Science.gov

Sample records for plasmids conferring kanamycin

  1. Novel plasmid conferring kanamycin and tetracycline resistance in turkey-derived Campylobacter jejuni strain 11601MD

    USDA-ARS?s Scientific Manuscript database

    In Campylobacter spp., resistance to the antibiotics kanamycin and tetracycline is frequently associated with plasmid-borne genes. However, relatively few plasmids of Campylobacter jejuni have been fully characterized to date. A novel plasmid (p11601MD; 44,095 bp.) harboring tet(O) was identified in...

  2. Characterization of Small ColE1-Like Plasmids Conferring Kanamycin Resistance in Salmonella enterica subsp. enterica serovars Typhimurium and Newport

    USDA-ARS?s Scientific Manuscript database

    Multi-antibiotic resistant (MR) Salmonella enterica serovars Typhimurium and Newport are an increasing concern in human and animal health. Many strains are known to carry antibiotic resistance determinants on multiple plasmids, yet detailed information is scarce. Three plasmids conferring kanamycin...

  3. Transformation of Thermoanaerobacterium sp. strain JW/SL-YS485 with plasmid pIKM1 conferring kanamycin resistance

    SciTech Connect

    Mai, V.; Lorenz, W.W.; Wiegel, J.

    1997-12-31

    The industrial application of thermophilic (eu)bacteria is hampered by the lack of genetic systems for these bacteria. We report here the first unequivocal transformation of a Gram-positive, thermophilic, anaerobic microorganism, Thermoanaerobacterium, with the kanamycin resistance-mediating plasmid pIKM1. The construct pIKM1 is based on the Escherichia coli-Clostridium acetobutylicum shuttle vector pIMP1 and contains the thermostable kanamycin cassette from S. faecalis plasmid pKD102. Using electrotransformation, plasmid pIKM1 mediated kanamycin resistance in Thermoanaerobacterium sp. strain JW/SL-YS485 up to 400 {mu}g ml{sup -1} at 48{degrees}C and 200 {mu}g ml{sup -1} at 60{degrees}C.

  4. Novel plasmid conferring kanamycin and tetracycline resistance in the turkey-derived Campylobacter jejuni strain 11601MD.

    PubMed

    Crespo, M D; Altermann, E; Olson, J; Miller, W G; Chandrashekhar, K; Kathariou, S

    2016-07-01

    In Campylobacter spp., resistance to the antimicrobials kanamycin and tetracycline is frequently associated with plasmid-borne genes. However, relatively few plasmids of Campylobacter jejuni have been fully characterized to date. A novel plasmid (p11601MD; 44,095nt) harboring tet(O) was identified in C. jejuni strain 11601MD, which was isolated from the jejunum of a turkey produced conventionally in North Carolina. Analysis of the p11601MD sequence revealed the presence of a high-GC content cassette with four genes that included tet(O) and a putative aminoglycoside transferase gene (aphA-3) highly similar to kanamycin resistance determinants. Several genes putatively involved in conjugative transfer were also identified on the plasmid. These findings will contribute to a better understanding of the distribution of potentially self-mobilizing plasmids harboring antibiotic resistance determinants in Campylobacter spp. from turkeys and other sources. Copyright © 2016 Elsevier Inc. All rights reserved.

  5. Characterization of small ColE1-like plasmids conferring kanamycin resistance in Salmonella enterica subsp. enterica serovars Typhimurium and Newport.

    PubMed

    Chen, Chin-Yi; Strobaugh, Terence P; Frye, Jonathan G

    2010-05-01

    Multi-antibiotic resistant (MR) Salmonella enterica serovars Typhimurium and Newport are an increasing concern in human and animal health. Many strains are known to carry antibiotic resistance determinants on multiple plasmids, yet detailed information has been scarce. Three plasmids conferring kanamycin (Kan) resistance were isolated and nucleotide sequences were determined. Two Kan(R) plasmids from Salmonella Newport strains, pSN11/00Kan and pSN02/01Kan, were found to be identical and were 5698bp in size. Plasmid pG7601Kan from Salmonella Typhimurium phage type U302 strain G7601 was 3208bp, and was the same as the previously reported pU302S from another U302 strain G8430. All three plasmids carried identical aph(3')-I genes. The plasmids were ColE1-like, containing RNA I/RNA II and the rom gene. Plasmids pSN11/00Kan and pSN02/01Kan also carried mobilization genes mobC and mobABD, similar to those of the pColK-K235 and pColD-157 plasmids from the colicinogenic Escherichia coli strains. All three plasmids were stable without kanamycin selection for approximately 100 generations.

  6. Typing and characterization of ColE1-like plasmids conferring kanamycin resistance in Salmonella enterica serotypes

    USDA-ARS?s Scientific Manuscript database

    Background: Multi-antibiotic resistant Salmonella enterica serotypes are increasing in prevalence and concern in human and animal health. Many strains carry resistance determinants on plasmids; current practices focus heavily on large plasmids and the role small plasmids play in resistance gene tra...

  7. Development of plasmid cloning vectors for Thermus thermophilus HB8: Expression of a heterologous, plasmid-borne kanamycin nucleotidyltransferase gene

    SciTech Connect

    Mather, M.W.; Fee, J.A. )

    1992-01-01

    While several thermus genes have been cloned and T. thermophilus has been shown to be transformable, molecular genetic studies of these thermophiles have been hampered by the absence of selectable cloning vectors. The authors have constructed a selectable plasmid by random insertion of a heterologous gene encoding a thermostable kanamycin nucleotidyltransferase activity into a cryptic, multicopy plasmid from T. thermophilus HB8. This plasmid should serve as a suitable starting point for the development of a gene expression system for T. thermophilus.

  8. Characterization of plasmid-mediated aphA-3 kanamycin resistance in Campylobacter jejuni.

    PubMed

    Gibreel, Amera; Sköld, Ola; Taylor, Diane E

    2004-01-01

    A total of 254 isolates of Campylobacter jejuni and three isolates of Campylobacter coli, isolated from Sweden, Canada, and Egypt, were screened for kanamycin resistance. Eight strains of C. jejuni contained large plasmids that carried the aphA-3 kanamycin-resistance marker. In six plasmids, the aphA-3 gene was located downstream of an apparent insertion sequence, designated IS607*, which showed a considerable similarity to IS607, characterized on the chromosome of some Helicobacter pylori strains. In contrast, the other plasmids carried the aphA-3 gene as a part of a resistance cluster. This included three resistance markers encoding 6'-adenylyltransferase (aadE), streptothricin acetyltransferase (sat), and 3'-aminoglycoside phosphotransferase type III (aphA-3). The genetic organization of this resistance cluster suggests that it has been acquired by C. jejuni from a Gram-positive organism. The IS607* element was also observed in kanamycin-susceptible strains of C. jejuni on plasmids mediating tetracycline resistance. The kanamycin-resistance phenotype transferred along with tetracycline resistance by conjugation from four representative C. jejuni strains to a recipient strain of C. jejuni. The kanamycin-resistance determinant (aphA-3) was stably transferred from one of the four C. jejuni strains to a recipient strain of Escherichia coli. However, the C. jejuni plasmid, which also carries the tetO gene, was not maintained in E. coli. Pulsed-field gel electrophoresis revealed the integration of approximately 50 kb of the plasmid into the chromosome of the E. coli recipient.

  9. An Arabidopsis thaliana ABC transporter that confers kanamycin resistance in transgenic plants does not endow resistance to Escherichia coli.

    PubMed

    Burris, Kellie; Mentewab, Ayalew; Ripp, Steven; Stewart, C Neal

    2008-03-01

    Concerns have been raised about potential horizontal gene transfer (HGT) of antibiotic resistance markers (ARMs) from transgenic plants to bacteria of medical and environmental importance. All ARMs used in transgenic plants have been bacterial in origin, but it has been recently shown that an Arabidopsis thaliana ABC transporter, Atwbc19, confers kanamycin resistance when overexpressed in transgenic plants. Atwbc19 was evaluated for its ability to transfer kanamycin resistance to Escherichia coli, a kanamycin-sensitive model bacterium, under simulated HGT, staged by subcloning Atwbc19 under the control of a bacterial promoter, genetically transforming to kanamycin-sensitive bacteria, and assessing if resistance was conferred as compared with bacteria harbouring nptII, the standard kanamycin resistance gene used to produce transgenic plants. NptII provided much greater resistance than Atwbc19 and was significantly different from the no-plasmid control at low concentrations. Atwbc19 was not significantly different from the no-plasmid control at higher concentrations. Even though HGT risks are considered low with nptII, Atwbc19 should have even lower risks, as its encoded protein is possibly mistargeted in bacteria.

  10. Prevalence of ColE1-like plasmids and kanamycin resistance genes in Salmonella enterica serovars.

    PubMed

    Chen, Chin-Yi; Lindsey, Rebecca L; Strobaugh, Terence P; Frye, Jonathan G; Meinersmann, Richard J

    2010-10-01

    Multi-antimicrobial-resistant Salmonella enterica strains frequently carry resistance genes on plasmids. Recent studies focus heavily on large conjugative plasmids, and the role that small plasmids play in resistance gene transfer is largely unknown. To expand our previous studies in assessing the prevalence of the isolates harboring ColE1-like plasmids carrying the aph gene responsible for kanamycin resistance (Kan(r)) phenotypes, 102 Kan(r) Salmonella isolates collected through the National Antimicrobial Resistance Monitoring System (NARMS) in 2005 were screened by PCR using ColE1 primer sets. Thirty isolates were found to be positive for ColE1-like replicon. Plasmids from 23 isolates were able to propagate in Escherichia coli and were subjected to further characterization. Restriction mapping revealed three major plasmid groups found in three or more isolates, with each group consisting of two to three subtypes. The aph genes from the Kan(r) Salmonella isolates were amplified by PCR, sequenced, and showed four different aph(3')-I genes. The distribution of the ColE1 plasmid groups in association with the aph gene, Salmonella serovar, and isolate source demonstrated a strong linkage of the plasmid with S. enterica serovar Typhimurium DT104. Due to their high copy number and mobility, the ColE1-like plasmids may play a critical role in transmission of antibiotic resistance genes among enteric pathogens, and these findings warrant a close monitoring of this plasmid incompatibility group.

  11. Mobilization properties of small ColE1-like plasmids carrying kanamycin resistance gene isolated from Salmonella enterica serotypes

    USDA-ARS?s Scientific Manuscript database

    Background: Previously we isolated and characterized various groups of small kanamycin resistance (KanR) ColE1-like plasmids from different serotypes of Salmonella enterica isolates. These plasmids all carried the aph(3)-I gene encoding the aminoglycoside phosphotransferase responsible for the kanam...

  12. Influence of tra genes of IncP and F plasmids on the mobilization of small Kanamycin resistance ColE1-Like plasmids in bacterial biofilms

    USDA-ARS?s Scientific Manuscript database

    Background: Horizontal gene transfer is a mechanism for movement of antibiotic resistance genes among bacteria. Some small kanamycin resistance (KanR) ColE1-like plasmids isolated from different serotypes of Salmonella enterica were shown to carry mobilization genes; although not self-transmissibl...

  13. Overexpression of the chromosomally encoded aminoglycoside acetyltransferase eis confers kanamycin resistance in Mycobacterium tuberculosis.

    PubMed

    Zaunbrecher, M Analise; Sikes, R David; Metchock, Beverly; Shinnick, Thomas M; Posey, James E

    2009-11-24

    The emergence of multidrug-resistant (MDR) tuberculosis (TB) highlights the urgent need to understand the mechanisms of resistance to the drugs used to treat this disease. The aminoglycosides kanamycin and amikacin are important bactericidal drugs used to treat MDR TB, and resistance to one or both of these drugs is a defining characteristic of extensively drug-resistant TB. We identified mutations in the -10 and -35 promoter region of the eis gene, which encodes a previously uncharacterized aminoglycoside acetyltransferase. These mutations led to a 20-180-fold increase in the amount of eis leaderless mRNA transcript, with a corresponding increase in protein expression. Importantly, these promoter mutations conferred resistance to kanamycin [5 microg/mL < minimum inhibitory concentration (MIC) kanamycin resistance harbored eis promoter mutations. These results have important clinical implications in that clinical isolates determined to be resistant to kanamycin may not be cross-resistant to amikacin, as is often assumed. Molecular detection of eis mutations should distinguish strains resistant to kanamycin and those resistant to kanamycin and amikacin. This may help avoid excluding a potentially effective drug from a treatment regimen for drug-resistant TB.

  14. Deletion formation mutations in plasmid expression vectors are unfavored by runaway amplification conditions and differentially selected under kanamycin stress.

    PubMed

    Oliveira, Pedro H; Prazeres, Duarte M F; Monteiro, Gabriel A

    2009-09-25

    Plasmid pCIneo is a ColE1-like mammalian expression vector also used as backbone for DNA vaccine development. We have recently shown that pCIneo spontaneously recombines due to the presence of two 28bp direct repeats. The persistence of low-frequency recombinants led us to evaluate the impact of environmental stresses typically found during plasmid production on plasmid copy number and recombination frequency. We observed an increase in pCIneo amplification (2.6-4.3-fold) in Escherichia coli cultures grown at 42 degrees C and also in minimal medium (at both 37 degrees C and 42 degrees C). These conditions fit to the smallest ratio between recombinant molecules and total plasmids. Conversely, increasing the dissolved oxygen tension from 20% to 40% in rich media did not have a significant impact on both plasmid copy number and recombination frequency, independently of the temperature used. We have also shown recently that the neomycin resistance (neo(r)) gene of pCIneo becomes actively transcribed as a result of recombination between the repeats. This prompted us to gain some insight into plasmid adaptation and competition by evaluating the impact of distinct concentrations of kanamycin on the differential selection of plasmid recombinant forms: monomer and heterodimers (1+2 and 1+3). We found the monomeric form to be predominantly recovered at lower concentrations of antibiotic whilst higher concentrations led to an increase in the percentage of the 1+2 form. The 1+3 heterodimeric form was invariably found at low percentages, independently of the concentration used.

  15. Overexpression of an Arabidopsis thaliana ABC transporter confers kanamycin resistance to transgenic plants.

    PubMed

    Mentewab, Ayalew; Stewart, C Neal

    2005-09-01

    Selectable markers of bacterial origin such as the neomycin phosphotransferase type II gene, which can confer kanamycin resistance to transgenic plants, represent an invaluable tool for plant engineering. However, since all currently used antibiotic-resistance genes are of bacterial origin, there have been concerns about horizontal gene transfer from transgenic plants back to bacteria, which may result in antibiotic resistance. Here we characterize a plant gene, Atwbc19, the gene that encodes an Arabidopsis thaliana ATP binding cassette (ABC) transporter and confers antibiotic resistance to transgenic plants. The mechanism of resistance is novel, and the levels of resistance achieved are comparable to those attained through expression of bacterial antibiotic-resistance genes in transgenic tobacco using the CaMV 35S promoter. Because ABC transporters are endogenous to plants, the use of Atwbc19 as a selectable marker in transgenic plants may provide a practical alternative to current bacterial marker genes in terms of the risk for horizontal transfer of resistance genes.

  16. Novel mutations conferring resistance to kanamycin in Mycobacterium tuberculosis clinical isolates from Northern India.

    PubMed

    Kaur, Simerpreet; Rana, Vibhuti; Singh, Pooja; Trivedi, Garima; Anand, Shashi; Kaur, Amanpreet; Gupta, Pawan; Jain, Amita; Sharma, Charu

    2016-01-01

    Twenty-nine Kanamycin resistant clinical isolates of Mycobacterium tuberculosis from Northern India were screened to evaluate genetic mutations in rrs gene, eis gene with its promoter, and whiB7 gene along with its 5'UTR. 14 strains (~48.0%) collectively exhibited mutations in rrs, eis or whiB7 target regions. While the highest frequency of mutations was found in rrs gene, eis and whiB7 loci displayed novel mutations. The novel mutations displayed by eis and whiB7 loci were found to be associated specifically with the Kanamycin resistance as none of the twenty nine Kanamycin sensitive strains harbor them. The inclusion of novel mutations of eis and whiB7 loci will be useful in improving the specificity of future diagnostics.

  17. Protein Diversity Confers Specificity in Plasmid Segregation

    PubMed Central

    Fothergill, Timothy J. G.; Barillà, Daniela; Hayes, Finbarr

    2005-01-01

    The ParG segregation protein (8.6 kDa) of multidrug resistance plasmid TP228 is a homodimeric DNA-binding factor. The ParG dimer consists of intertwined C-terminal domains that adopt a ribbon-helix-helix architecture and a pair of flexible, unstructured N-terminal tails. A variety of plasmids possess partition loci with similar organizations to that of TP228, but instead of ParG homologs, these plasmids specify a diversity of unrelated, but similarly sized, partition proteins. These include the proteobacterial pTAR, pVT745, and pB171 plasmids. The ParG analogs of these plasmids were characterized in parallel with the ParG homolog encoded by the pseudomonal plasmid pVS1. Like ParG, the four proteins are dimeric. No heterodimerization was detectable in vivo among the proteins nor with the prototypical ParG protein, suggesting that monomer-monomer interactions are specific among the five proteins. Nevertheless, as with ParG, the ParG analogs all possess significant amounts of unordered amino acid residues, potentially highlighting a common structural link among the proteins. Furthermore, the ParG analogs bind specifically to the DNA regions located upstream of their homologous parF-like genes. These nucleoprotein interactions are largely restricted to cognate protein-DNA pairs. The results reveal that the partition complexes of these and related plasmids have recruited disparate DNA-binding factors that provide a layer of specificity to the macromolecular interactions that mediate plasmid segregation. PMID:15805511

  18. Protein diversity confers specificity in plasmid segregation.

    PubMed

    Fothergill, Timothy J G; Barillà, Daniela; Hayes, Finbarr

    2005-04-01

    The ParG segregation protein (8.6 kDa) of multidrug resistance plasmid TP228 is a homodimeric DNA-binding factor. The ParG dimer consists of intertwined C-terminal domains that adopt a ribbon-helix-helix architecture and a pair of flexible, unstructured N-terminal tails. A variety of plasmids possess partition loci with similar organizations to that of TP228, but instead of ParG homologs, these plasmids specify a diversity of unrelated, but similarly sized, partition proteins. These include the proteobacterial pTAR, pVT745, and pB171 plasmids. The ParG analogs of these plasmids were characterized in parallel with the ParG homolog encoded by the pseudomonal plasmid pVS1. Like ParG, the four proteins are dimeric. No heterodimerization was detectable in vivo among the proteins nor with the prototypical ParG protein, suggesting that monomer-monomer interactions are specific among the five proteins. Nevertheless, as with ParG, the ParG analogs all possess significant amounts of unordered amino acid residues, potentially highlighting a common structural link among the proteins. Furthermore, the ParG analogs bind specifically to the DNA regions located upstream of their homologous parF-like genes. These nucleoprotein interactions are largely restricted to cognate protein-DNA pairs. The results reveal that the partition complexes of these and related plasmids have recruited disparate DNA-binding factors that provide a layer of specificity to the macromolecular interactions that mediate plasmid segregation.

  19. Decreased susceptibility to 4'-deoxy-6'-N-methylamikacin (BB-K311) conferred by a mutant plasmid in Escherichia coli.

    PubMed

    Perlin, M H; Lerner, S A

    1982-07-01

    Escherichia coli MP6 contains a plasmid that encodes aminoglycoside 3'-phosphotransferase II, which phosphorylates kanamycin and confers high-level kanamycin resistance, Amikacin is a minor substrate of this enzyme, but MP6 is susceptible to amikacin. Strain MP10 has a spontaneous mutation in the plasmid of MP6 that increases the aminoglycoside 3'-phosphotransferase II activity not only against kanamycin but also against amikacin. This mutation is also responsible for the appearance of resistance to amikacin in MP10. Resistance to 4'-deoxy-6'-N-methylamikacin (BB-K311) by enzymatic modification has not been reported previously. As with amikacin, MP6 was susceptible to BB-K311 and its aminoglycoside 3'-phosphotransferase II did not phosphorylate this amikacin derivative appreciably. We found that the plasmid-borne mutation in MP10, however, localized by being cloned with a 3.7-megadalton HindIII fragment containing the aminoglycoside 3'-phosphotransferase II gene, resulted in increased phosphorylation of BB-K311 and resistance to it. Thus, the mutation distinguishing MP6 and MP10 has increased the activity of an existing aminoglycoside-modifying enzyme and produced new bacterial resistance to two previously minor substrates of the enzyme.

  20. Characterization and distribution of ColE1-like kanamycin-resistance plasmids in Salmonella enterica from food animals

    USDA-ARS?s Scientific Manuscript database

    Background: Antimicrobial resistant foodborne pathogens cause public health concerns and multi-drug resistant (MDR) pathogens present difficulties when treatment is warranted. Large plasmids are responsible for the majority of the MDR and subsequently, the focus of most research. Previous studies sh...

  1. eis Promoter C14G and C15G Mutations Do Not Confer Kanamycin Resistance in Mycobacterium tuberculosis.

    PubMed

    Pholwat, Suporn; Stroup, Suzanne; Heysell, Scott; Ogarkov, Oleg; Zhdanova, Svetlana; Ramakrishnan, Girija; Houpt, Eric

    2016-12-01

    We studied the significance of particular eis mutations on Mycobacterium tuberculosis drug resistance using a specialized transduction strategy. Recombinant strains harboring eis promoter mutations C14T, C12T, and G10A exhibited kanamycin resistance with MICs of 40, 10, and 20 μg/ml, respectively, while recombinant strains harboring C14G and C15G mutations were kanamycin susceptible (MIC, 2.5 to 5 μg/ml). Each of the eis mutants tested remained amikacin susceptible (MIC, 0.5 to 4 μg/ml). The identification of specific eis mutations is needed for accurate genotypic susceptibility testing for kanamycin.

  2. Sequence analysis of a group of low molecular-weight plasmids carrying multiple IS903 elements flanking a kanamycin resistance aph gene in Salmonella enterica serovars

    USDA-ARS?s Scientific Manuscript database

    A group of low molecular-weight ColE1-like plasmids carrying the aph sequence type aph(ii), from three different Salmonella serovars were sequenced. These plasmids carry 2 or more copies of IS903 elements, with up to 21 bp sequence differences to one another, two of which flank the aph gene. This g...

  3. The plasmid-encoded regulator activates factors conferring lysozyme resistance on enteropathogenic Escherichia coli strains.

    PubMed

    Salinger, Nina; Kokona, Bashkim; Fairman, Robert; Okeke, Iruka N

    2009-01-01

    We demonstrate that enhanced lysozyme resistance of enteropathogenic Escherichia coli requires the plasmid-encoded regulator, Per, and is mediated by factors outside the locus for enterocyte effacement. EspC, a Per-activated serine protease autotransporter protein, conferred enhanced resistance on nonpathogenic E. coli, and a second Per-regulated, espC-independent lysozyme resistance mechanism was identified.

  4. The Plasmid-Encoded Regulator Activates Factors Conferring Lysozyme Resistance on Enteropathogenic Escherichia coli Strains▿

    PubMed Central

    Salinger, Nina; Kokona, Bashkim; Fairman, Robert; Okeke, Iruka N.

    2009-01-01

    We demonstrate that enhanced lysozyme resistance of enteropathogenic Escherichia coli requires the plasmid-encoded regulator, Per, and is mediated by factors outside the locus for enterocyte effacement. EspC, a Per-activated serine protease autotransporter protein, conferred enhanced resistance on nonpathogenic E. coli, and a second Per-regulated, espC-independent lysozyme resistance mechanism was identified. PMID:18997020

  5. Identification of dfrA14 in two distinct plasmids conferring trimethoprim resistance in Actinobacillus pleuropneumoniae.

    PubMed

    Bossé, Janine T; Li, Yanwen; Walker, Stephanie; Atherton, Tom; Fernandez Crespo, Roberto; Williamson, Susanna M; Rogers, Jon; Chaudhuri, Roy R; Weinert, Lucy A; Oshota, Olusegun; Holden, Matt T G; Maskell, Duncan J; Tucker, Alexander W; Wren, Brendan W; Rycroft, Andrew N; Langford, Paul R

    2015-08-01

    The objective of this study was to determine the distribution and genetic basis of trimethoprim resistance in Actinobacillus pleuropneumoniae isolates from pigs in England. Clinical isolates collected between 1998 and 2011 were tested for resistance to trimethoprim and sulphonamide. The genetic basis of trimethoprim resistance was determined by shotgun WGS analysis and the subsequent isolation and sequencing of plasmids. A total of 16 (out of 106) A. pleuropneumoniae isolates were resistant to both trimethoprim (MIC >32 mg/L) and sulfisoxazole (MIC ≥256 mg/L), and a further 32 were resistant only to sulfisoxazole (MIC ≥256 mg/L). Genome sequence data for the trimethoprim-resistant isolates revealed the presence of the dfrA14 dihydrofolate reductase gene. The distribution of plasmid sequences in multiple contigs suggested the presence of two distinct dfrA14-containing plasmids in different isolates, which was confirmed by plasmid isolation and sequencing. Both plasmids encoded mobilization genes, the sulphonamide resistance gene sul2, as well as dfrA14 inserted into strA, a streptomycin-resistance-associated gene, although the gene order differed between the two plasmids. One of the plasmids further encoded the strB streptomycin-resistance-associated gene. This is the first description of mobilizable plasmids conferring trimethoprim resistance in A. pleuropneumoniae and, to our knowledge, the first report of dfrA14 in any member of the Pasteurellaceae. The identification of dfrA14 conferring trimethoprim resistance in A. pleuropneumoniae isolates will facilitate PCR screens for resistance to this important antimicrobial. © The Author 2015. Published by Oxford University Press on behalf of the British Society for Antimicrobial Chemotherapy.

  6. Rv3168 phosphotransferase activity mediates kanamycin resistance in Mycobacterium tuberculosis.

    PubMed

    Ahn, Jae-Woo; Kim, Kyung-Jin

    2013-11-28

    Tuberculosis is a worldwide epidemic disease caused by Mycobacterium tuberculosis, with an estimated one-third of the human population currently affected. Treatment of this disease with aminoglycoside antibiotics has become less effective owing to antibiotic resistance. Recent determination of the crystal structure of the M. tuberculosis Rv3168 protein suggests a structure similar to that of Enterococcus faecalis APH(3')-IIIa, and that this protein may be an aminoglycoside phosphotransferase. To determine whether Rv3168 confers antibiotic resistance against kanamycin, we performed dose-response antibiotic resistance experiments using kanamycin. Expression of the Rv3168 protein in Escherichia coli conferred antibiotic resistance against 100 μM kanamycin, a concentration that effected cell growth arrest in the parental E. coli strain and an E. coli strain expressing the Rv3168(D249A) mutant, in which the catalytic Asp249 residue was mutated to alanine. Furthermore, we detected phosphotransferase activity of Rv3168 against kanamycin as a substrate. Moreover, docking simulation of kanamycin into the Rv3168 structure suggests that kanamycin fits well into the substrate binding pocket of the protein, and that the phosphorylation-hydroxyl-group of kanamycin was located at a position similar to that in E. faecalis APH(3')-IIIa. On the basis of these results, we suggest that the Rv3168 mediates kanamycin resistance in M. tuberculosis, likely through phosphotransferase targeting of kanamycin.

  7. Plasmid-conferred tetracycline resistance confers collateral cadmium sensitivity to E. coli cells

    SciTech Connect

    Griffith, J.K.; Buckingham, J.M.; Hanners, J.L.; Hildebrand, C.E.; Walters, R.A.

    1982-01-01

    E. coli HB101 cells transformed to tetracycline resistance with the plasmids pMB9 or pBR322 display a 10/sup 5/-10/sup 6/-fold lower plating efficiency on agar containing 440 ..mu..M CdCl/sub 2/ than nontransformed cells. When DNA is inserted into the BamH1 site of the plasmid tet gene, or when DNA spanning the BamH1 site is deleted, tetracycline resistance and cadmium hypersensitivity are both lost. In contrast, insertion of DNA into the ampicillin resistance gene does not affect cadmium hypersensitivity.

  8. Environmentally co-occurring mercury resistance plasmids are genetically and phenotypically diverse and confer variable context-dependent fitness effects.

    PubMed

    Hall, James P J; Harrison, Ellie; Lilley, Andrew K; Paterson, Steve; Spiers, Andrew J; Brockhurst, Michael A

    2015-12-01

    Plasmids are important mobile elements that can facilitate genetic exchange and local adaptation within microbial communities. We compared the sequences of four co-occurring pQBR family environmental mercury resistance plasmids and measured their effects on competitive fitness of a Pseudomonas fluorescens SBW25 host, which was isolated at the same field site. Fitness effects of carriage differed between plasmids and were strongly context dependent, varying with medium, plasmid status of competitor and levels of environmental mercury. The plasmids also varied widely in their rates of conjugation and segregational loss. We found that few of the plasmid-borne accessory genes could be ascribed functions, although we identified a putative chemotaxis operon, a type IV pilus-encoding cluster and a region encoding putative arylsulfatase enzymes, which were conserved across geographically distant isolates. One plasmid, pQBR55, conferred the ability to catabolize sucrose. Transposons, including the mercury resistance Tn5042, appeared to have been acquired by different pQBR plasmids by recombination, indicating an important role for horizontal gene transfer in the recent evolution of pQBR plasmids. Our findings demonstrate extensive genetic and phenotypic diversity among co-occurring members of a plasmid community and suggest a role for environmental heterogeneity in the maintenance of plasmid diversity.

  9. Environmentally co‐occurring mercury resistance plasmids are genetically and phenotypically diverse and confer variable context‐dependent fitness effects

    PubMed Central

    Harrison, Ellie; Lilley, Andrew K.; Paterson, Steve; Spiers, Andrew J.; Brockhurst, Michael A.

    2015-01-01

    Summary Plasmids are important mobile elements that can facilitate genetic exchange and local adaptation within microbial communities. We compared the sequences of four co‐occurring pQBR family environmental mercury resistance plasmids and measured their effects on competitive fitness of a P seudomonas fluorescens  SBW25 host, which was isolated at the same field site. Fitness effects of carriage differed between plasmids and were strongly context dependent, varying with medium, plasmid status of competitor and levels of environmental mercury. The plasmids also varied widely in their rates of conjugation and segregational loss. We found that few of the plasmid‐borne accessory genes could be ascribed functions, although we identified a putative chemotaxis operon, a type IV pilus‐encoding cluster and a region encoding putative arylsulfatase enzymes, which were conserved across geographically distant isolates. One plasmid, pQBR55, conferred the ability to catabolize sucrose. Transposons, including the mercury resistance Tn5042, appeared to have been acquired by different pQBR plasmids by recombination, indicating an important role for horizontal gene transfer in the recent evolution of pQBR plasmids. Our findings demonstrate extensive genetic and phenotypic diversity among co‐occurring members of a plasmid community and suggest a role for environmental heterogeneity in the maintenance of plasmid diversity. PMID:25969927

  10. Immunization with plasmid DNA encoding the hemagglutinin and the nucleoprotein confers robust protection against a lethal canine distemper virus challenge.

    PubMed

    Dahl, Lotte; Jensen, Trine Hammer; Gottschalck, Elisabeth; Karlskov-Mortensen, Peter; Jensen, Tove Dannemann; Nielsen, Line; Andersen, Mads Klindt; Buckland, Robin; Wild, T Fabian; Blixenkrone-Møller, Merete

    2004-09-09

    We have investigated the protective effect of immunization of a highly susceptible natural host of canine distemper virus (CDV) with DNA plasmids encoding the viral nucleoprotein (N) and hemagglutinin (H). The combined intradermal and intramuscular routes of immunization elicited high virus-neutralizing serum antibody titres in mink (Mustela vison). To mimic natural exposure, we also conducted challenge infection by horizontal transmission from infected contact animals. Other groups received a lethal challenge infection by administration to the mucosae of the respiratory tract and into the muscle. One of the mink vaccinated with N plasmid alone developed severe disease after challenge. In contrast, vaccination with the H plasmid together with the N plasmid conferred solid protection against disease and we were unable to detect CDV infection in PBMCs or in different tissues after challenge. Our findings show that DNA immunization by the combined intradermal and intramuscular routes can confer solid protective immunity against naturally transmitted morbillivirus infection and disease.

  11. Kanamycin-resistant alfalfa has a point mutation in the 16S plastid rRNA.

    PubMed

    Rosellini, D; LaFayette, P R; Barone, P; Veronesi, F; Parrott, W A

    2004-05-01

    Genes conferring resistance to kanamycin are frequently used to obtain transgenic plants as spontaneous resistance to kanamycin is not known to exist in higher plants. Nevertheless, mutations conferring kanamycin resistance have been identified in Chlamydomonas reinhardtii, raising the question as to why kanamycin-resistant mutants have not been found in higher plants. While attempting plastid transformation of alfalfa, we obtained non-transgenic but kanamycin-resistant somatic embryos following 2 months of culture in the presence of 50 mg l(-1) kanamycin. Sequencing of the plastid DNA region corresponding to the decoding site of the 16S rRNA in ten independent resistant events revealed an A to C transversion at position 1357 of the 16S plastid rDNA, the same site at which an A to G conversion confers kanamycin resistance to C. reinhardtii by reducing the ability of the antibiotic to bind to its target site. All plants derived from the resistant embryos through additional cycles of somatic embryogenesis in the absence of kanamycin retained the mutant phenotype, suggesting that the mutation was homoplastomic. Resistant plants produced 85% less biomass than controls; their leaves were chlorotic during early development and over time slowly turned green. The absence of kanamycin- resistant mutants in higher plants might be explained by the requirement for a regeneration system capable of resulting in homoplastomic individuals, or it may be the result of the detrimental effect of the mutation on the phenotype.

  12. Characterisation of a mobilisable plasmid conferring florfenicol and chloramphenicol resistance in Actinobacillus pleuropneumoniae.

    PubMed

    Bossé, Janine T; Li, Yanwen; Atherton, Tom G; Walker, Stephanie; Williamson, Susanna M; Rogers, Jon; Chaudhuri, Roy R; Weinert, Lucy A; Holden, Matthew T G; Maskell, Duncan J; Tucker, Alexander W; Wren, Brendan W; Rycroft, Andrew N; Langford, Paul R

    2015-08-05

    The complete nucleotide sequence of a 7.7kb mobilisable plasmid (pM3446F), isolated from a florfenicol resistant isolate of Actinobacillus pleuropneumoniae, showed extended similarity to plasmids found in other members of the Pasteurellaceae containing the floR gene as well as replication and mobilisation genes. Mobilisation into other Pasteurellaceae species confirmed that this plasmid can be transferred horizontally.

  13. Characterization of Mobile Staphylococcus equorum Plasmids Isolated from Fermented Seafood That Confer Lincomycin Resistance

    PubMed Central

    Lee, Jong-Hoon; Jeong, Do-Won

    2015-01-01

    The complete nucleotide sequences of lincomycin-resistance gene (lnuA)-containing plasmids in Staphylococcus equorum strains isolated from the high-salt-fermented seafood jeotgal were determined. These plasmids, designated pSELNU1–3, are 2638-bp long, have two polymorphic sites, and encode typical elements found in plasmids that replicate via a rolling-circle mechanism including the replication protein gene (rep), a double-stranded origin of replication, a single-stranded origin of replication, and counter-transcribed RNA sequence, as well as lnuA. Plasmid sequences exhibit over 83% identity to other Staphylococcus plasmids that harbor rep and lnuA genes. Further, three pairs of identified direct repeats may be involved in inter-plasmid recombination. One plasmid, pSELNU1, was successfully transferred to other Staphylococcus species, Enterococcus faecalis, and Tetragenococcus halophilus in vitro. Antibiotic susceptibility of the transconjugants was host-dependent, and transconjugants maintained a lincomycin resistance phenotype in the absence of selective pressure over 60 generations. PMID:26448648

  14. Characterization of Mobile Staphylococcus equorum Plasmids Isolated from Fermented Seafood That Confer Lincomycin Resistance.

    PubMed

    Lee, Jong-Hoon; Jeong, Do-Won

    2015-01-01

    The complete nucleotide sequences of lincomycin-resistance gene (lnuA)-containing plasmids in Staphylococcus equorum strains isolated from the high-salt-fermented seafood jeotgal were determined. These plasmids, designated pSELNU1-3, are 2638-bp long, have two polymorphic sites, and encode typical elements found in plasmids that replicate via a rolling-circle mechanism including the replication protein gene (rep), a double-stranded origin of replication, a single-stranded origin of replication, and counter-transcribed RNA sequence, as well as lnuA. Plasmid sequences exhibit over 83% identity to other Staphylococcus plasmids that harbor rep and lnuA genes. Further, three pairs of identified direct repeats may be involved in inter-plasmid recombination. One plasmid, pSELNU1, was successfully transferred to other Staphylococcus species, Enterococcus faecalis, and Tetragenococcus halophilus in vitro. Antibiotic susceptibility of the transconjugants was host-dependent, and transconjugants maintained a lincomycin resistance phenotype in the absence of selective pressure over 60 generations.

  15. IncA/C plasmids conferring high azithromycin resistance in vibrio cholera.

    PubMed

    Wang, Ruibai; Liu, Haican; Zhao, Xiuqin; Li, Jie; Wan, Kanglin

    2017-09-14

    Azithromycin (AZM) is a clinically important antibiotic to Vibrio cholerae especially for inhibiting colonization of V. cholerae in intestine and the treatment of severe cholera in children and pregnant women. One IncA/C plasmid was isolated from both of the high MIC AZM resistant V cholerae strains of the two mainly pathogenic serogroups, O1 and O139. In the 172 predicted ORFs, 16 genes were related to antibiotic resistance in which 5 were well-defined genes associated with macrolide resistance. The 5 macrolide resistant genes disturbed in two clusters, mphR-mrx-mph(K) and mel-mph2, flanking by insertion sequence (IS) and involving two kinds of mechanisms. The deletion of the complete region of the two clusters deceased the MIC of AZM from ≥64µg/ml to ≤ 0.5µg/ml. This IncA/C plasmid showed great ability to accumulate antibiotic resistant genes. Besides 11 genes to other antibiotics, five macrolide resistant genes with different function were gathered repeatedly through transposition on one plasmid. This genotype could not be simply explained by antibiotic stress applied on the host from the environment or treatment. These phosphorylase and transmembrane transports might be involved in the transport and metabolism of other non-antibiotic substances, enabling this kind of plasmid to propagate better in the host. Copyright © 2017. Published by Elsevier B.V.

  16. Plasmid-Encoded asp Operon Confers a Proton Motive Metabolic Cycle Catalyzed by an Aspartate-Alanine Exchange Reaction

    PubMed Central

    Abe, Keietsu; Ohnishi, Fumito; Yagi, Kyoko; Nakajima, Tasuku; Higuchi, Takeshi; Sano, Motoaki; Machida, Masayuki; Sarker, Rafiquel I.; Maloney, Peter C.

    2002-01-01

    Tetragenococcus halophila D10 catalyzes the decarboxylation of l-aspartate with nearly stoichiometric release of l-alanine and CO2. This trait is encoded on a 25-kb plasmid, pD1. We found in this plasmid a putative asp operon consisting of two genes, which we designated aspD and aspT, encoding an l-aspartate-β-decarboxylase (AspD) and an aspartate-alanine antiporter (AspT), respectively, and determined the nucleotide sequences. The sequence analysis revealed that the genes of the asp operon in pD1 were in the following order: promoter → aspD → aspT. The deduced amino acid sequence of AspD showed similarity to the sequences of two known l-aspartate-β-decarboxylases from Pseudomonas dacunhae and Alcaligenes faecalis. Hydropathy analyses suggested that the aspT gene product encodes a hydrophobic protein with multiple membrane-spanning regions. The operon was subcloned into the Escherichia coli expression vector pTrc99A, and the two genes were cotranscribed in the resulting plasmid, pTrcAsp. Expression of the asp operon in E. coli coincided with appearance of the capacity to catalyze the decarboxylation of aspartate to alanine. Histidine-tagged AspD (AspDHis) was also expressed in E. coli and purified from cell extracts. The purified AspDHis clearly exhibited activity of l-aspartate-β-decarboxylase. Recombinant AspT was solubilized from E. coli membranes and reconstituted in proteoliposomes. The reconstituted AspT catalyzed self-exchange of aspartate and electrogenic heterologous exchange of aspartate with alanine. Thus, the asp operon confers a proton motive metabolic cycle consisting of the electrogenic aspartate-alanine antiporter and the aspartate decarboxylase, which keeps intracellular levels of alanine, the countersubstrate for aspartate, high. PMID:12003930

  17. Plasmid-encoded asp operon confers a proton motive metabolic cycle catalyzed by an aspartate-alanine exchange reaction.

    PubMed

    Abe, Keietsu; Ohnishi, Fumito; Yagi, Kyoko; Nakajima, Tasuku; Higuchi, Takeshi; Sano, Motoaki; Machida, Masayuki; Sarker, Rafiquel I; Maloney, Peter C

    2002-06-01

    Tetragenococcus halophila D10 catalyzes the decarboxylation of L-aspartate with nearly stoichiometric release of L-alanine and CO(2). This trait is encoded on a 25-kb plasmid, pD1. We found in this plasmid a putative asp operon consisting of two genes, which we designated aspD and aspT, encoding an L-aspartate-beta-decarboxylase (AspD) and an aspartate-alanine antiporter (AspT), respectively, and determined the nucleotide sequences. The sequence analysis revealed that the genes of the asp operon in pD1 were in the following order: promoter --> aspD --> aspT. The deduced amino acid sequence of AspD showed similarity to the sequences of two known L-aspartate-beta-decarboxylases from Pseudomonas dacunhae and Alcaligenes faecalis. Hydropathy analyses suggested that the aspT gene product encodes a hydrophobic protein with multiple membrane-spanning regions. The operon was subcloned into the Escherichia coli expression vector pTrc99A, and the two genes were cotranscribed in the resulting plasmid, pTrcAsp. Expression of the asp operon in E. coli coincided with appearance of the capacity to catalyze the decarboxylation of aspartate to alanine. Histidine-tagged AspD (AspDHis) was also expressed in E. coli and purified from cell extracts. The purified AspDHis clearly exhibited activity of L-aspartate-beta-decarboxylase. Recombinant AspT was solubilized from E. coli membranes and reconstituted in proteoliposomes. The reconstituted AspT catalyzed self-exchange of aspartate and electrogenic heterologous exchange of aspartate with alanine. Thus, the asp operon confers a proton motive metabolic cycle consisting of the electrogenic aspartate-alanine antiporter and the aspartate decarboxylase, which keeps intracellular levels of alanine, the countersubstrate for aspartate, high.

  18. Novel ABC Transporter Gene, vga(C), Located on a Multiresistance Plasmid from a Porcine Methicillin-Resistant Staphylococcus aureus ST398 Strain ▿

    PubMed Central

    Kadlec, Kristina; Schwarz, Stefan

    2009-01-01

    A novel ABC transporter gene, vga(C), was identified on the 14,365-bp multiresistance plasmid pKKS825 in a porcine methicillin (meticillin)-resistant Staphylococcus aureus isolate of sequence type 398. The vga(C) gene encodes a 523-amino-acid protein which confers resistance not only to streptogramin A antibiotics but also to lincosamides and pleuromutilins. Plasmid pKKS825 also carries the resistance genes aadD, tet(L), and dfrK, which may enable the coselection of vga(C) under selective pressure by kanamycin/neomycin, tetracyclines, and trimethoprim. PMID:19470508

  19. Marker-free plasmids for gene therapeutic applications--lack of antibiotic resistance gene substantially improves the manufacturing process.

    PubMed

    Mairhofer, Jürgen; Cserjan-Puschmann, Monika; Striedner, Gerald; Nöbauer, Katharina; Razzazi-Fazeli, Ebrahim; Grabherr, Reingard

    2010-04-01

    Plasmid DNA is being considered as a promising alternative to traditional protein vaccines or viral delivery methods for gene therapeutic applications. DNA-based products are highly flexible, stable, are easily stored and can be manufactured on a large scale. Although, much safer than viral approaches, issues have been raised with regard to safety due to possible integration of plasmid DNA into cellular DNA or spread of antibiotic resistance genes to intestinal bacteria by horizontal gene transfer. Accordingly, there is interest in methods for the production of plasmid DNA that lacks the antibiotic resistance gene to further improve their safety profile. Here, we report for the first time the gram-scale manufacturing of a minimized plasmid that is devoid of any additional sequence elements on the plasmid backbone, and merely consists of the target expression cassette and the bacterial origin of replication. Three different host/vector combinations were cultivated in a fed-batch fermentation process, comparing the progenitor strain JM108 to modified strains JM108murselect, hosting a plasmid either containing the aminoglycoside phosphotransferase which provides kanamycin resistance, or a marker-free variant of the same plasmid. The metabolic load exerted by expression of the aminoglycoside phosphotransferase was monitored by measuring ppGpp- and cAMP-levels. Moreover, we revealed that JM108 is deficient of the Lon protease and thereby refined the genotype of JM108. The main consequences of Lon-deficiency with regard to plasmid DNA production are discussed herein. Additionally, we found that the expression of the aminoglycoside phosphotransferase, conferring resistance to kanamycin, was very high in plasmid DNA producing processes that actually inclusion bodies were formed. Thereby, a severe metabolic load on the host cell was imposed, detrimental for overall plasmid yield. Hence, deleting the antibiotic resistance gene from the vector backbone is not only beneficial

  20. Aptasensors for quantitative detection of kanamycin.

    PubMed

    Robati, Rezvan Yazdian; Arab, Atefeh; Ramezani, Mohammad; Langroodi, Fatemeh Alebooye; Abnous, Khalil; Taghdisi, Seyed Mohammad

    2016-08-15

    Up till now, various techniques have been developed to detect kanamycin in biological samples. However, due to some problems involved in these methods including time-consuming, expensive equipment and high consumption of reagents, new strategies for detection and quantitative determination of kanamycin are needed. Aptamer-based biosensors with unique recognition capability have attracted more attention of scientists because of its rapid response, high sensitivity and simple fabrication. Hence, we summarized optical and electrochemical kanamycin aptasensors and focuses on recent advances and modern techniques in aptasensor-based kanamycin detection techniques in order to provide readers with an inclusive understanding of its improvement and progress.

  1. Previously undescribed plasmids recovered from activated sludge confer tetracycline resistance and phenotypic changes to Acinetobacter oleivorans DR1.

    PubMed

    Hong, Hyerim; Ko, Hyeok-Jin; Choi, In-Geol; Park, Woojun

    2014-02-01

    We used culture-dependent and culture-independent methods to extract previously undescribed plasmids harboring tetracycline (TC) resistance genes from activated sludge. The extracted plasmids were transformed into naturally competent Acinetobacter oleivorans DR1 to recover a non-Escherichia coli-based plasmid. The transformed cells showed 80-100-fold higher TC resistance than the wild-type strain. Restriction length polymorphism performed using 30 transformed cells showed four different types of plasmids. Illumina-based whole sequencing of the four plasmids identified three previously unreported plasmids and one previously reported plasmid. All plasmids carried TC resistance-related genes (tetL, tetH), tetracycline transcriptional regulators (tetR), and mobilization-related genes. As per expression analysis, TC resistance genes were functional in the presence of TC. The recovered plasmids showed mosaic gene acquisition through horizontal gene transfer. Membrane fluidity, hydrophobicity, biofilm formation, motility, growth rate, sensitivity to stresses, and quorum sensing signals of the transformed cells were different from those of the wild-type cells. Plasmid-bearing cells seemed to have an energy burden for maintaining and expressing plasmid genes. Our data showed that acquisition of TC resistance through plasmid uptake is related to loss of biological fitness. Thus, cells acquiring antibiotic resistance plasmids can survive in the presence of antibiotics, but must pay ecological costs.

  2. High Throughput Analyses of Budding Yeast ARSs Reveal New DNA Elements Capable of Conferring Centromere-Independent Plasmid Propagation

    PubMed Central

    Hoggard, Timothy; Liachko, Ivan; Burt, Cassaundra; Meikle, Troy; Jiang, Katherine; Craciun, Gheorghe; Dunham, Maitreya J.; Fox, Catherine A.

    2016-01-01

    The ability of plasmids to propagate in Saccharomyces cerevisiae has been instrumental in defining eukaryotic chromosomal control elements. Stable propagation demands both plasmid replication, which requires a chromosomal replication origin (i.e., an ARS), and plasmid distribution to dividing cells, which requires either a chromosomal centromere for segregation or a plasmid-partitioning element. While our knowledge of yeast ARSs and centromeres is relatively advanced, we know less about chromosomal regions that can function as plasmid partitioning elements. The Rap1 protein-binding site (RAP1) present in transcriptional silencers and telomeres of budding yeast is a known plasmid-partitioning element that functions to anchor a plasmid to the inner nuclear membrane (INM), which in turn facilitates plasmid distribution to daughter cells. This Rap1-dependent INM-anchoring also has an important chromosomal role in higher-order chromosomal structures that enhance transcriptional silencing and telomere stability. Thus, plasmid partitioning can reflect fundamental features of chromosome structure and biology, yet a systematic screen for plasmid partitioning elements has not been reported. Here, we couple deep sequencing with competitive growth experiments of a plasmid library containing thousands of short ARS fragments to identify new plasmid partitioning elements. Competitive growth experiments were performed with libraries that differed only in terms of the presence or absence of a centromere. Comparisons of the behavior of ARS fragments in the two experiments allowed us to identify sequences that were likely to drive plasmid partitioning. In addition to the silencer RAP1 site, we identified 74 new putative plasmid-partitioning motifs predicted to act as binding sites for DNA binding proteins enriched for roles in negative regulation of gene expression and G2/M-phase associated biology. These data expand our knowledge of chromosomal elements that may function in plasmid

  3. High Throughput Analyses of Budding Yeast ARSs Reveal New DNA Elements Capable of Conferring Centromere-Independent Plasmid Propagation.

    PubMed

    Hoggard, Timothy; Liachko, Ivan; Burt, Cassaundra; Meikle, Troy; Jiang, Katherine; Craciun, Gheorghe; Dunham, Maitreya J; Fox, Catherine A

    2016-04-07

    The ability of plasmids to propagate in Saccharomyces cerevisiae has been instrumental in defining eukaryotic chromosomal control elements. Stable propagation demands both plasmid replication, which requires a chromosomal replication origin (i.e., an ARS), and plasmid distribution to dividing cells, which requires either a chromosomal centromere for segregation or a plasmid-partitioning element. While our knowledge of yeast ARSs and centromeres is relatively advanced, we know less about chromosomal regions that can function as plasmid partitioning elements. The Rap1 protein-binding site (RAP1) present in transcriptional silencers and telomeres of budding yeast is a known plasmid-partitioning element that functions to anchor a plasmid to the inner nuclear membrane (INM), which in turn facilitates plasmid distribution to daughter cells. This Rap1-dependent INM-anchoring also has an important chromosomal role in higher-order chromosomal structures that enhance transcriptional silencing and telomere stability. Thus, plasmid partitioning can reflect fundamental features of chromosome structure and biology, yet a systematic screen for plasmid partitioning elements has not been reported. Here, we couple deep sequencing with competitive growth experiments of a plasmid library containing thousands of short ARS fragments to identify new plasmid partitioning elements. Competitive growth experiments were performed with libraries that differed only in terms of the presence or absence of a centromere. Comparisons of the behavior of ARS fragments in the two experiments allowed us to identify sequences that were likely to drive plasmid partitioning. In addition to the silencer RAP1 site, we identified 74 new putative plasmid-partitioning motifs predicted to act as binding sites for DNA binding proteins enriched for roles in negative regulation of gene expression and G2/M-phase associated biology. These data expand our knowledge of chromosomal elements that may function in plasmid

  4. Engineering of a functional thermostable kanamycin resistance marker for use in Moorella thermoacetica ATCC39073.

    PubMed

    Iwasaki, Yuki; Kita, Akihisa; Sakai, Shinsuke; Takaoka, Kazue; Yano, Shinichi; Tajima, Takahisa; Kato, Junichi; Nishio, Naomichi; Murakami, Katsuji; Nakashimada, Yutaka

    2013-06-01

    A transformation system for Moorella thermoacetica ATCC39073 was developed using thermostable kanamycin resistant gene (kanR) derived from the plasmid pJH1 that Streptococcus faecalis harbored. When kanR with its native promoter was introduced into uracil auxotrophic mutant of M. thermoacetica ATCC39073 together with a gene to complement the uracil auxotrophy as a selection marker, it did not give kanamycin resistance due to poor transcription level of kanR. However, the use of glyceraldehyde-3-phosphate dehydrogenase promoter cloned from M. thermoacetica ATCC39073 significantly improved transcription level of kanR and resulted in the cell growth in the presence of more than 150 μg mL(-1) kanamycin. It was also demonstrated that kanR with G3PD promoter can be used as a selection marker for transformation of wild-type strain of M. thermoacetica ATCC39073.

  5. Broad host range plasmids.

    PubMed

    Jain, Aayushi; Srivastava, Preeti

    2013-11-01

    Plasmids are and will remain important cloning vehicles for biotechnology. They have also been associated with the spread of a number of diseases and therefore are a subject of environmental concern. With the advent of sequencing technologies, the database of plasmids is increasing. It will be of immense importance to identify the various bacterial hosts in which the plasmid can replicate. The present review article describes the features that confer broad host range to the plasmids, the molecular basis of plasmid host range evolution, and applications in recombinant DNA technology and environment.

  6. A novel multidrug resistance plasmid isolated from an Escherichia coli strain resistant to aminoglycosides.

    PubMed

    Sun, Hui; Li, Shasha; Xie, Zhijing; Yang, Fangfang; Sun, Yani; Zhu, Yanli; Zhao, Xiaomin; Jiang, Shijin

    2012-07-01

    Previous studies have reported several different plasmids that confer multidrug resistance (MDR) including resistance to aminoglycosides. In this study, we investigated the aminoglycoside resistance patterns for 224 Escherichia coli isolates from diseased chickens and ducks in China, characterized a novel MDR plasmid, and collected prevalence data on similar resistance plasmids. Antibiotic susceptibilities were determined using disc diffusion and the microdilution method. The plasmid pXZ was analysed by restriction fragment length polymorphism (RFLP) with EcoRI and SalI, and sequenced. The prevalence of similar resistance plasmids was assessed by multiplex PCR and by RFLP analysis. Among the 224 E. coli isolates, 189 (84.4%) were resistant to streptomycin, 125 (55.8%) were resistant to kanamycin, 116 (51.8%) were resistant to gentamicin, 106 (47.3%) were resistant to neomycin and 98 (43.8%) were resistant to amikacin. Among the 224 E. coli isolates, 17 contained a plasmid with the MDR-encoding region of pXZ, which showed high-level resistance to aminoglycosides (MICs of gentamicin and amikacin ≥ 512 mg/L). The plasmid pXZ was digested into five fragments by EcoRI and six fragments by SalI. The plasmid pXZ was a circular DNA molecule of 76635 bp with a 51.65% guanine + cytosine content and included four resistance genes (rmtB, fosA3, bla(TEM-1) and bla(CTX-M-24)). A novel MDR plasmid, pXZ, harbouring four resistance genes (rmtB, fosA3, bla(TEM-1) and bla(CTX-M)) was identified. To our knowledge, this is the first report of an aminoglycoside resistance plasmid harbouring the fosA3 gene.

  7. Identification of Novel Conjugative Plasmids with Multiple Copies of fosB that Confer High-Level Fosfomycin Resistance to Vancomycin-Resistant Enterococci.

    PubMed

    Sun, Lingyan; Zhang, Ping; Qu, Tingting; Chen, Yan; Hua, Xiaoting; Shi, Keren; Yu, Yunsong

    2017-01-01

    To further characterize the fosB-carrying plasmids of 19 vancomycin-resistant enterococci, the complete sequences of the fosB- and vanA-containing plasmids of Enterococcus faecium (pEMA120) and E. avium (pEA19081) were obtained by single-molecule, real-time sequencing. We found that these two plasmids are essentially identical (99.99% nucleotide sequence identity), which proved the possibility of interspecies transmission. Comparative analysis of the plasmids revealed that the backbone of pEMA120 is 99% similar to a conjugative fosB-negative E. faecium plasmid, pZB18. There is a traE disrupted in the transfer region of pEMA120, in comparison to pZB18 with an intact traE. The difference of their transfer frequencies between pEMA120 and pZB18 suggests this interruption of traE might affect conjugative transfer. Two copies of the fosB gene linked to a tnpA gene, forming an ISL3-like transposon, were found at separate locations within pEMA120, which had not been reported previously. These two fosB-carrying transposons were confirmed to form circular intermediates by inverse PCR. The hybridization of plasmid DNA digested by BsaI, having restriction site within the fosB sequence, demonstrated that the presence of multiple copies of fosB per plasmid is common. The total copy number of the fosB gene as revealed by qRT-PCR did not correlate with fosfomycin MICs or growth rates at sub-MICs of fosfomycin in different transconjugants. From susceptibility tests, the fosB gene, regardless of the copy number, conferred high fosfomycin MICs that ranged from 16384 to 65536 μg/ml. This first complete nucleotide sequence of a plasmid carrying two copies of fosB in VRE suggests that the fosB gene can transfer to multiple loci of plasmids by the ISL3 family transposase TnpA, possibly in the form of circular intermediates, leading to the dissemination of high fosfomycin resistance in VRE.

  8. Comparison of the Deoxyribonucleic Acid Molecular Weights and Homologies of Plasmids Conferring Linked Resistance to Streptomycin and Sulfonamides

    PubMed Central

    Barth, Peter T.; Grinter, Nigel J.

    1974-01-01

    Bacterial strains showing linked resistance to streptomycin (Sm) and sulfonamides (Su) were chosen representing a wide taxonomic and geographical range. Their SmSu resistances were transferred to Escherichia coli K-12 and then plasmid deoxyribonucleic acid (DNA) was isolated by ethidium bromide CsCl centrifugation. The plasmid DNA was examined by electron microscopy and analyzed by sedimentation through 5 to 20% neutral sucrose gradients. Plasmid DNA from strains having transmissible SmSu resistance consisted of two or three molecular species, one of which had a molecular mass of about 5.7 Mdal (106 daltons), the others varying between 20 to 60 Mdal. By using transformation or F′ mobilization, we isolated the SmSu-resistance determinant from any fellow resident plasmids in each strain and again isolated the plasmid DNA. Cosedimentation of each of these with a differently labeled reference plasmid DNA (R300B) showed 9 out of 12 of the plasmids to have a molecular mass not significantly different from the reference (5.7 Mdal); two others were 6.3 and 9.2 Mdal, but PB165 consisted of three plasmids of 7.4, 14.7, and 21.4 Mdal. Three separate isolations of the SmSu determinant from PB165 gave the same three plasmids, which we conclude may be monomer, dimer, and trimer, respectively. DNA-DNA hybridizations at 75 C demonstrated 80 to 93% homology between reference R300B DNA and each isolated SmSu plasmid DNA, except for the 9.2-Mdal plasmid which had 45% homology and PB165 which had 35%. All the SmSu plasmids were present as multiple copies (about 10) per chromosome. The conjugative plasmid of R300 (present as 1.3 copies per chromosome) has been shown to have negligible effect on the number of copies of its accompanying SmSu plasmid R300B. We conclude that the SmSu plasmids are closely related and probably have a common evolutionary origin. Images PMID:4616941

  9. 21 CFR 862.3520 - Kanamycin test system.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... 21 Food and Drugs 8 2010-04-01 2010-04-01 false Kanamycin test system. 862.3520 Section 862.3520....3520 Kanamycin test system. (a) Identification. A kanamycin test system is a device intended to measure kanamycin, an antibiotic drug, in plasma and serum. Measurements obtained by this device are used in the...

  10. 21 CFR 522.1204 - Kanamycin sulfate injection.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... 21 Food and Drugs 6 2010-04-01 2010-04-01 false Kanamycin sulfate injection. 522.1204 Section 522....1204 Kanamycin sulfate injection. (a) Specifications. Each milliliter of kanamycin sulfate injection veterinary contains either 50 or 200 milligrams of kanamycin. (b) Sponsor. See No. 000856 in § 510.600(c) of...

  11. 21 CFR 862.3520 - Kanamycin test system.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... 21 Food and Drugs 8 2011-04-01 2011-04-01 false Kanamycin test system. 862.3520 Section 862.3520....3520 Kanamycin test system. (a) Identification. A kanamycin test system is a device intended to measure kanamycin, an antibiotic drug, in plasma and serum. Measurements obtained by this device are used in the...

  12. 21 CFR 862.3520 - Kanamycin test system.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ... 21 Food and Drugs 8 2012-04-01 2012-04-01 false Kanamycin test system. 862.3520 Section 862.3520....3520 Kanamycin test system. (a) Identification. A kanamycin test system is a device intended to measure kanamycin, an antibiotic drug, in plasma and serum. Measurements obtained by this device are used in...

  13. 21 CFR 862.3520 - Kanamycin test system.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... 21 Food and Drugs 8 2013-04-01 2013-04-01 false Kanamycin test system. 862.3520 Section 862.3520....3520 Kanamycin test system. (a) Identification. A kanamycin test system is a device intended to measure kanamycin, an antibiotic drug, in plasma and serum. Measurements obtained by this device are used in...

  14. 21 CFR 522.1204 - Kanamycin sulfate injection.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... 21 Food and Drugs 6 2013-04-01 2013-04-01 false Kanamycin sulfate injection. 522.1204 Section 522....1204 Kanamycin sulfate injection. (a) Specifications. Each milliliter of kanamycin sulfate injection veterinary contains either 50 or 200 milligrams of kanamycin. (b) Sponsor. See No. 000856 in § 510.600(c)...

  15. 21 CFR 524.1204 - Kanamycin, amphomycin, and hydrocortisone ointment.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... 21 Food and Drugs 6 2014-04-01 2014-04-01 false Kanamycin, amphomycin, and hydrocortisone ointment... ANIMAL DRUGS § 524.1204 Kanamycin, amphomycin, and hydrocortisone ointment. (a) Specifications. Each gram of ointment contains 5 milligrams kanamycin activity as kanamycin sulfate, 5 milligrams of...

  16. 21 CFR 862.3520 - Kanamycin test system.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... 21 Food and Drugs 8 2014-04-01 2014-04-01 false Kanamycin test system. 862.3520 Section 862.3520....3520 Kanamycin test system. (a) Identification. A kanamycin test system is a device intended to measure kanamycin, an antibiotic drug, in plasma and serum. Measurements obtained by this device are used in...

  17. 21 CFR 522.1204 - Kanamycin.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... dogs and cats—(1) Amount. Administer by subcutaneous or intramuscular injection 5 mg per pound of body... of bacterial infections due to kanamycin sensitive organisms in dogs and cats. (3) Limitations...

  18. DNA sequence analysis of the composite plasmid pTC conferring virulence and antimicrobial resistance for porcine enterotoxigenic Escherichia coli.

    PubMed

    Fekete, Péter Z; Brzuszkiewicz, Elzbieta; Blum-Oehler, Gabriele; Olasz, Ferenc; Szabó, Mónika; Gottschalk, Gerhard; Hacker, Jörg; Nagy, Béla

    2012-01-01

    In this study the plasmid pTC, a 90 kb self-conjugative virulence plasmid of the porcine enterotoxigenic Escherichia coli (ETEC) strain EC2173 encoding the STa and STb heat-stable enterotoxins and tetracycline resistance, has been sequenced in two steps. As a result we identified five main distinct regions of pTC: (i) the maintenance region responsible for the extreme stability of the plasmid, (ii) the TSL (toxin-specific locus comprising the estA and estB genes) which is unique and characteristic for pTC, (iii) a Tn10 transposon, encoding tetracycline resistance, (iv) the tra (plasmid transfer) region, and (v) the colE1-like origin of replication. It is concluded that pTC is a self-transmissible composite plasmid harbouring antibiotic resistance and virulence genes. pTC belongs to a group of large conjugative E. coli plasmids represented by NR1 with a widespread tra backbone which might have evolved from a common ancestor. This is the first report of a completely sequenced animal ETEC virulence plasmid containing an antimicrobial resistance locus, thereby representing a selection advantage for spread of pathogenicity in the presence of antimicrobials leading to increased disease potential. Copyright © 2011. Published by Elsevier GmbH.

  19. Designing plasmid vectors.

    PubMed

    Tolmachov, Oleg

    2009-01-01

    Nonviral gene therapy vectors are commonly based on recombinant bacterial plasmids or their derivatives. The plasmids are propagated in bacteria, so, in addition to their therapeutic cargo, they necessarily contain a bacterial replication origin and a selection marker, usually a gene conferring antibiotic resistance. Structural and maintenance plasmid stability in bacteria is required for the plasmid DNA production and can be achieved by carefully choosing a combination of the therapeutic DNA sequences, replication origin, selection marker, and bacterial strain. The use of appropriate promoters, other regulatory elements, and mammalian maintenance devices ensures that the therapeutic gene or genes are adequately expressed in target human cells. Optimal immune response to the plasmid vectors can be modulated via inclusion or exclusion of DNA sequences containing immunostimulatory CpG sequence motifs. DNA fragments facilitating construction of plasmid vectors should also be considered for inclusion in the design of plasmid vectors. Techniques relying on site-specific or homologous recombination are preferred for construction of large plasmids (>15 kb), while digestion of DNA by restriction enzymes with subsequent ligation of the resulting DNA fragments continues to be the mainstream approach for generation of small- and medium-size plasmids. Rapid selection of a desired recombinant plasmid against a background of other plasmids continues to be a challenge. In this chapter, the emphasis is placed on efficient and flexible versions of DNA cloning protocols using selection of recombinant plasmids by restriction endonucleases directly in the ligation mixture.

  20. HPLC-ELSD determination of kanamycin B in the presence of kanamycin A in fermentation broth.

    PubMed

    Zhang, Yong; He, Hui-Min; Zhang, Jin; Liu, Feng-Jiao; Li, Chao; Wang, Bing-Wu; Qiao, Ren-Zhong

    2015-03-01

    A novel method for the direct determination of kanamycin B in the presence of kanamycin A in fermentation broth using high performance liquid chromatography with evaporative light scattering detector (HPLC-ELSD) was developed. An Agilent Technologies C18 column was utilized, evaporation temperature of 40°C and nitrogen pressure of 3.5 bar, the optimized mobile phase was water-acetonitrile (65:35, v/v), containing 11.6 mm heptafluorobutyric acid (isocratic elution with flow rate of 0.5 mL/min) with the gain 11. Kanamycin B was eluted at 5.6 min with an asymmetry factor of 1.827. The method showed good linearity over the concentration range of 0.05 to 0.80 mg/mL for the kanamycin B (r(2) = 0.9987). The intra-day and inter-day coefficients of variation obtained from kanamycin B were less than 4.3%. Mean recovery of kanamycin B from spiked fermentation broth was 95%. The developed method was applied to the determination of kanamycin B without any interference from other constituents in the fermentation broth. This method offers simple, rapid and quantitative detection of kanamycin B. Copyright © 2014 John Wiley & Sons, Ltd.

  1. The Presence of Conjugative Plasmid pLS20 Affects Global Transcription of Its Bacillus subtilis Host and Confers Beneficial Stress Resistance to Cells

    PubMed Central

    Rösch, Thomas C.; Golman, Wladislaw; Hucklesby, Laura; Gonzalez-Pastor, Jose E.

    2014-01-01

    Conjugation activity of plasmid pLS20 from Bacillus subtilis subsp. natto is induced when cells are diluted into fresh medium and diminishes as cells enter into stationary-phase growth. Transcriptional profiling shows that during mid-exponential growth, more than 5% of the host genes are affected in the presence of the plasmid, in contrast to the minor changes seen in freshly diluted and stationary-phase cells. Changes occurred in many metabolic pathways, although pLS20 does not confer any detectable burden on its host cell, as well as in membrane and cell wall-associated processes, in the large motility operon, and in several other cellular processes. In agreement with these changes, we found considerable alterations in motility and enzyme activity and increased resistance against several different forms of stress in cells containing the plasmid, revealing that the presence of pLS20 has a broad impact on the physiology of its host cell and increases its stress resistance in multiple aspects. Additionally, we found that the lack of chromosomal gene yueB, known to encode a phage receptor protein, which is upregulated in cells containing pLS20, strongly reduced conjugation efficiency, revealing that pLS20 not only increases fitness of its host but also employs host proteins for efficient transfer into a new cell. PMID:24334659

  2. Kanamycin ototoxicity in glutamate transporter knockout mice.

    PubMed

    Shimizu, Yoshitaka; Hakuba, Nobuhiro; Hyodo, Jun; Taniguchi, Masafumi; Gyo, Kiyofumi

    2005-06-03

    Glutamate-aspartate transporter (GLAST), a powerful glutamate uptake system, removes released glutamate from the synaptic cleft and facilitates the re-use of glutamate as a neurotransmitter recycling system. Aminoglycoside-induced hearing loss is mediated via a glutamate excitotoxic process. We investigated the effect of aminoglycoside ototoxicity in GLAST knockout mice using the recorded auditory brainstem response (ABR) and number of hair cells in the cochlea. Kanamycin (100 mg/mL) was injected directly into the posterior semicircular canal of mice. Before the kanamycin treatment, there was no difference in the ABR threshold average between the wild-type and knockout mice. Kanamycin injection aggravated the ABR threshold in the GLAST knockout mice compared with the wild-type mice, and the IHC degeneration was more severe in the GLAST knockout mice. These findings suggest that GLAST plays an important role in preventing the degeneration of inner hair cells in aminoglycoside ototoxicity.

  3. An Escherichia coli system for assay of F1p site-specific recombination on substrate plasmids.

    PubMed

    Snaith, M R; Kilby, N J; Murray, J A

    1996-11-21

    We have developed an Escherichia coli system for testing the behaviour of plasmids carrying target sites for the F1p site-specific recombinase. The E. coli strain BL-FLP is described, which carries a chromosomally integrated bacteriophage T7 RNA polymerase gene expressed from a lac promoter, and harbours the plasmid pMS40.pMS40 has the features: (i) it carries the FLP recombinase gene under the control of a bacteriophage T7 promoter, (ii) it confers kanamycin resistance, and (iii) it uses an R6K origin of replication; these two latter features make it compatible with most conventional cloning vectors. Substrate plasmids carrying F1p-recognition targets (FRT) are transformed into BL-FLP, and the consequences of F1p-mediated recombination can be analysed after subsequent extraction of plasmid DNA. We show that this system is capable of base-perfect F1p-mediated recombination on plasmid substrates. We also present a corrected sequence of the commonly used F1p substrate plasmid, pNEO beta GAL (O'Gorman et al. (1991) Science 251, 1351-1355).

  4. Combined treatment with the antibiotics kanamycin and streptomycin promotes the conjugation of Escherichia coli.

    PubMed

    Zhang, Peng-Yi; Xu, Pei-Pei; Xia, Zhi-Jie; Wang, Jing; Xiong, Juan; Li, Yue-Zhong

    2013-11-01

    It is widely accepted that antibiotics provide a critical selective pressure for the horizontal transfer of antibiotic resistance between bacterial species. This study demonstrated that a combination of low doses of kanamycin and streptomycin, which inhibited the growth of recipient and donor cells, respectively, had positive effects on the transmission of the conjugation plasmids pRK2013, pSU2007, and RP4 from Escherichia coli DH5α to HB101 at their minimum inhibitory concentrations (MICs). Administration of either antibiotic alone as well as other antibiotics in combination or alone did not have this effect. Two-dimensional electrophoresis revealed that 60 proteins were downregulated and 14 proteins were upregulated in the conjugation of E. coli DH5α (pRK2013) and HB101 in the presence of kanamycin and streptomycin. Of these proteins, 64 were subsequently identified by mass spectrometry. Two antibiotic-induced genes encoding oligopeptide-binding protein (OppA) and ribose-binding protein (RbsB) were further confirmed by quantitative real-time PCR. When these genes were deleted, the number of transconjugants decreased in the same fashion as when the cells were treated with kanamycin and streptomycin. These results indicate that the process of E. coli conjugation may be promoted by combination treatment with kanamycin and streptomycin and that two proteins potentially participated in this process.

  5. Multiple Antibiotic Resistance Plasmids Allow Scalable,
PCR-Mediated DNA Manipulation and Near-Zero Background Cloning.

    PubMed

    Arnak, Remigiusz; Altun, Burcin; Tosato, Valentina; Bruschi, Carlo V

    2016-09-01

    We have constructed two plasmids that can be used for cloning as templates for PCR- -based gene disruption, mutagenesis and the construction of DNA chromosome translocation cassettes. To our knowledge, these plasmids are the first vectors that confer resistance to ampicillin, kanamycin and hygromycin B in bacteria, and to geneticin (G418) and hygromycin B in Saccharomyces cerevisiae simultaneously. The option of simultaneously using up to three resistance markers provides a highly stringent control of recombinant selection and the almost complete elimination of background resistance, while unique restriction sites allow easy cloning of chosen genetic material. Moreover, we successfully used these new vectors as PCR templates for the induction of chromosome translocation in budding yeast by the bridge-induced translocation system. Cells in which translocation was induced carried chromosomal rearrangements as expected and exhibited resistance to both, G418 and hygromycin B. These features make our constructs very handy tools for many molecular biology applications.

  6. A Transmissible Plasmid-Borne Pathogenicity Island Confers Piscibactin Biosynthesis in the Fish Pathogen Photobacterium damselae subsp. piscicida

    PubMed Central

    Rivas, Amable J.; Balado, Miguel; Fuentes-Monteverde, Juan Carlos; Rodríguez, Jaime; Jiménez, Carlos; Lemos, Manuel L.; Waldor, Matthew K.

    2015-01-01

    The fish pathogen Photobacterium damselae subsp. piscicida produces the siderophore piscibactin. A gene cluster that resembles the Yersinia high-pathogenicity island (HPI) encodes piscibactin biosynthesis. Here, we report that this HPI-like cluster is part of a hitherto-uncharacterized 68-kb plasmid dubbed pPHDP70. This plasmid lacks homologs of genes that mediate conjugation, but we found that it could be transferred at low frequencies from P. damselae subsp. piscicida to a mollusk pathogenic Vibrio alginolyticus strain and to other Gram-negative bacteria, likely dependent on the conjugative functions of the coresident plasmid pPHDP60. Following its conjugative transfer, pPHDP70 restored the capacity of a vibrioferrin mutant of V. alginolyticus to grow under low-iron conditions, and piscibactin became detectable in its supernatant. Thus, pPHDP70 appears to harbor all the genes required for piscibactin biosynthesis and transport. P. damselae subsp. piscicida strains cured of pPHDP70 no longer produced piscibactin, had impaired growth under iron-limited conditions, and exhibited markedly decreased virulence in fish. Collectively, our findings highlight the importance of pPHDP70, with its capacity for piscibactin-mediated iron acquisition, in the virulence of P. damselae subsp. piscicida. Horizontal transmission of this plasmid-borne piscibactin synthesis gene cluster in the marine environment may facilitate the emergence of new pathogens. PMID:26092457

  7. Glycodiversification for the optimization of the kanamycin class aminoglycosides.

    PubMed

    Wang, Jinhua; Li, Jie; Chen, Hsiao-Nung; Chang, Huiwen; Tanifum, Christabel Tomla; Liu, Hsiu-Hsiang; Czyryca, Przemyslaw G; Chang, Cheng-Wei Tom

    2005-10-06

    In an effort to optimize the antibacterial activity of kanamycin class aminoglycoside antibiotics, we have accomplished the synthesis and antibacterial assay of new kanamycin B analogues. A rationale-based glycodiversification strategy was employed. The activity of the lead is comparable to that of commercially available kanamycin. These new members, however, were found to be inactive against aminoglycoside resistant bacteria. Molecular modeling was used to provide the explanation. Thus, a new strategy for structural modifications of kanamycin class aminoglycosides is suggested.

  8. 21 CFR 524.1200a - Kanamycin ophthalmic ointment.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... 21 Food and Drugs 6 2013-04-01 2013-04-01 false Kanamycin ophthalmic ointment. 524.1200a Section... § 524.1200a Kanamycin ophthalmic ointment. (a) Specifications. The drug, which is in a suitable and harmless ointment base, contains 3.5 milligrams of kanamycin activity (as the sulfate) per gram of...

  9. 21 CFR 524.1200a - Kanamycin ophthalmic ointment.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... 21 Food and Drugs 6 2010-04-01 2010-04-01 false Kanamycin ophthalmic ointment. 524.1200a Section... § 524.1200a Kanamycin ophthalmic ointment. (a) Specifications. The drug, which is in a suitable and harmless ointment base, contains 3.5 milligrams of kanamycin activity (as the sulfate) per gram of...

  10. 21 CFR 520.1204 - Kanamycin, bismuth subcarbonate, activated attapulgite.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... 21 Food and Drugs 6 2013-04-01 2013-04-01 false Kanamycin, bismuth subcarbonate, activated... § 520.1204 Kanamycin, bismuth subcarbonate, activated attapulgite. (a) Specifications—(1) Each 5 milliliters (mL) of suspension contains 100 milligrams (mg) kanamycin (as the sulfate), 250 mg...

  11. 21 CFR 524.1200b - Kanamycin ophthalmic aqueous solution.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... 21 Food and Drugs 6 2011-04-01 2011-04-01 false Kanamycin ophthalmic aqueous solution. 524.1200b... § 524.1200b Kanamycin ophthalmic aqueous solution. (a) Specifications. The drug, which is in an aqueous... kanamycin activity (as the sulfate) per milliliter of solution. (b) Sponsor. See No. 000856 in §...

  12. 21 CFR 524.1200b - Kanamycin ophthalmic aqueous solution.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... 21 Food and Drugs 6 2013-04-01 2013-04-01 false Kanamycin ophthalmic aqueous solution. 524.1200b... § 524.1200b Kanamycin ophthalmic aqueous solution. (a) Specifications. The drug, which is in an aqueous... kanamycin activity (as the sulfate) per milliliter of solution. (b) Sponsor. See No. 000856 in §...

  13. 21 CFR 524.1200a - Kanamycin ophthalmic ointment.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... 21 Food and Drugs 6 2011-04-01 2011-04-01 false Kanamycin ophthalmic ointment. 524.1200a Section... § 524.1200a Kanamycin ophthalmic ointment. (a) Specifications. The drug, which is in a suitable and harmless ointment base, contains 3.5 milligrams of kanamycin activity (as the sulfate) per gram of...

  14. 21 CFR 524.1200a - Kanamycin ophthalmic ointment.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ... 21 Food and Drugs 6 2012-04-01 2012-04-01 false Kanamycin ophthalmic ointment. 524.1200a Section... § 524.1200a Kanamycin ophthalmic ointment. (a) Specifications. The drug, which is in a suitable and harmless ointment base, contains 3.5 milligrams of kanamycin activity (as the sulfate) per gram of...

  15. 21 CFR 524.1200b - Kanamycin ophthalmic aqueous solution.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ... 21 Food and Drugs 6 2012-04-01 2012-04-01 false Kanamycin ophthalmic aqueous solution. 524.1200b... § 524.1200b Kanamycin ophthalmic aqueous solution. (a) Specifications. The drug, which is in an aqueous... kanamycin activity (as the sulfate) per milliliter of solution. (b) Sponsor. See No. 000856 in §...

  16. 21 CFR 520.1204 - Kanamycin, bismuth subcarbonate, activated attapulgite.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ... 21 Food and Drugs 6 2012-04-01 2012-04-01 false Kanamycin, bismuth subcarbonate, activated... § 520.1204 Kanamycin, bismuth subcarbonate, activated attapulgite. (a) Specifications—(1) Each 5 milliliters (mL) of suspension contains 100 milligrams (mg) kanamycin (as the sulfate), 250 mg...

  17. 21 CFR 520.1204 - Kanamycin, bismuth subcarbonate, activated attapulgite.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... 21 Food and Drugs 6 2014-04-01 2014-04-01 false Kanamycin, bismuth subcarbonate, activated... § 520.1204 Kanamycin, bismuth subcarbonate, activated attapulgite. (a) Specifications—(1) Each 5 milliliters (mL) of suspension contains 100 milligrams (mg) kanamycin (as the sulfate), 250 mg...

  18. 21 CFR 524.1200b - Kanamycin ophthalmic aqueous solution.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... 21 Food and Drugs 6 2010-04-01 2010-04-01 false Kanamycin ophthalmic aqueous solution. 524.1200b... § 524.1200b Kanamycin ophthalmic aqueous solution. (a) Specifications. The drug, which is in an aqueous... kanamycin activity (as the sulfate) per milliliter of solution. (b) Sponsor. See No. 000856 in §...

  19. Two versatile shuttle vectors for Thermus thermophilus-Escherichia coli containing multiple cloning sites, lacZα gene and kanamycin or hygromycin resistance marker.

    PubMed

    Fujita, Atsushi; Misumi, Yoshio; Koyama, Yoshinori

    2012-05-01

    Two versatile shuttle vectors for Thermus thermophilus and Escherichia coli were developed on the basis of the T. thermophilus cryptic plasmid pTT8 and E. coli vector pUC13. These shuttle vectors, pTRK1T and pTRH1T, carry a gene encoding a protein homologous to replication protein derived from pTT8, a replicon for E. coli, new multiple cloning sites and a lacZα gene from E. coli vector pUC13, and also have a gene encoding a thermostable protein that confers resistance to kanamycin or hygromycin, which can be used as a selection marker in T. thermophilus. These shuttle vectors are useful to develop enzymes and proteins of biotechnological interest. We also constructed a plasmid, pUC13T, which carries the same multiple cloning sites of pTRK1T and pTRH1T. These vectors should facilitate cloning procedures both in E. coli and T. thermophilus.

  20. Comparative analysis of combination kanamycin-furosemide versus kanamycin alone in the mouse cochlea.

    PubMed

    Hirose, Keiko; Sato, Eisuke

    2011-02-01

    Combinations of aminoglycosides and loop diuretics have been known to have a synergistic effect in ototoxic injury. Because murine hair cells are relatively resistant to ototoxicity compared to those of other mammals, investigators have turned to combination therapies to create ototoxic lesions in the mouse inner ear. In this paper, we perform a systematic comparison of hearing thresholds, hair cell damage and monocyte migration into the mouse cochlea after kanamycin versus combined kanamycin/furosemide and explore the pathophysiology of enhanced hair cell loss in aminoglycoside ototoxicity in the presence of loop diuretic. Combined kanamycin-furosemide resulted in elevation of threshold not only in the high frequencies, but across all frequencies with more extensive loss of outer hair cells when compared to kanamycin alone. The stria vascularis was severely atrophied and stellate cells in the spiral limbus were missing in kanamycin-furosemide exposed mice while these changes were not observed in mice receiving kanamycin alone. Monocytes and macrophages were recruited in large numbers to the spiral ligament and spiral ganglion in these mice. Combination therapy resulted in a greater number of macrophages in total, and many more macrophages were present further apically when compared to mice given kanamycin alone. Combined kanamycin-furosemide provides an effective method of addressing the relative resistance to ototoxicity that is observed in most mouse strains. As the mouse becomes increasingly more common in studies of hearing loss, and combination therapies gain popularity, recognition of the overall effects of combined aminoglycoside-loop diuretic therapy will be critical to interpretation of the interventions that follow.

  1. Characterization of chimeric plasmid cloning vehicles in Bacillus subtilis.

    PubMed

    Gryczan, T; Shivakumar, A G; Dubnau, D

    1980-01-01

    Restriction endonuclease cleavage maps of seven chimeric plasmids that may be used for molecular cloning in Bacillus subtilis are presented. These plasmids all carry multiple antibiotic resistance markers and were constructed by in vitro molecular cloning techniques. Several of the antibiotic resistance markers were shown to undergo insertional inactivation at specific restriction endonuclease sites. Kanamycin inactivation occurred at the BglII site of pUB110 derivatives, erythromycin inactivation occurred at the HpaI and BclI sites of pE194 derivatives, and streptomycin inactivation occurred at the HindIII site of pSA0501 derivatives. A stable mini-derivative of pBD12 was isolated and characterized. By using these plasmids, we identified proteins involved in plasmid-coded kanamycin and erythromycin resistance. The properties and uses of these chimeric plasmids in the further development of recombinant deoxyribonucleic acid technology in B. subtilis are discussed.

  2. A Highly Thermostable Kanamycin Resistance Marker Expands the Tool Kit for Genetic Manipulation of Caldicellulosiruptor bescii

    PubMed Central

    Lipscomb, Gina L.; Conway, Jonathan M.; Blumer-Schuette, Sara E.; Kelly, Robert M.

    2016-01-01

    engineering applications geared toward biofuel production. The current genetic system used with C. bescii is based upon only a single selection strategy, and this uses the gene involved in a primary biosynthetic pathway. There are many advantages with an additional genetic selection using an antibiotic. This presents a challenge for thermophilic microorganisms, as only a limited number of antibiotics are stable above 50°C, and a thermostable version of the enzyme conferring antibiotic resistance must be obtained. In this work, we have developed a selection system for C. bescii using the antibiotic kanamycin and have shown that, in combination with the biosynthetic gene marker, it can be used to efficiently delete genes in this organism. PMID:27208106

  3. A Highly Thermostable Kanamycin Resistance Marker Expands the Tool Kit for Genetic Manipulation of Caldicellulosiruptor bescii.

    PubMed

    Lipscomb, Gina L; Conway, Jonathan M; Blumer-Schuette, Sara E; Kelly, Robert M; Adams, Michael W W

    2016-07-15

    geared toward biofuel production. The current genetic system used with C. bescii is based upon only a single selection strategy, and this uses the gene involved in a primary biosynthetic pathway. There are many advantages with an additional genetic selection using an antibiotic. This presents a challenge for thermophilic microorganisms, as only a limited number of antibiotics are stable above 50°C, and a thermostable version of the enzyme conferring antibiotic resistance must be obtained. In this work, we have developed a selection system for C. bescii using the antibiotic kanamycin and have shown that, in combination with the biosynthetic gene marker, it can be used to efficiently delete genes in this organism. Copyright © 2016, American Society for Microbiology. All Rights Reserved.

  4. RCH51, a multiply antibiotic-resistant Acinetobacter baumannii ST103IP isolate, carries resistance genes in three plasmids, including a novel potentially conjugative plasmid carrying oxa235 in transposon Tn6252.

    PubMed

    Hamidian, Mohammad; Nigro, Steven J; Hartstein, Rebecca M; Hall, Ruth M

    2017-07-01

    To determine the identity and context of genes conferring antibiotic resistance in a sporadic multiply antibiotic-resistant Acinetobacter baumannii recovered at Royal Children's Hospital, Brisbane. The antibiotic resistance phenotype for 23 antibiotics was determined using disc diffusion or MIC determination. The whole-genome sequence of RCH51 was determined using the Illumina HiSeq platform. Antibiotic resistance determinants were identified using ResFinder. Plasmids were recovered by transformation. Isolate RCH51 belongs to the uncommon STs ST103 IP (7-3-2-1-7-1-4) and ST514 OX (1-52-29-28-18-114-7). It was found to be resistant to sulfamethoxazole, tetracycline, gentamicin, tobramycin and kanamycin and also exhibited reduced susceptibility to imipenem (MIC 2 mg/L) and meropenem (MIC 6 mg/L). RCH51 carries the oxa235 , sul2 , floR , aadB and tet39 resistance genes, all located on plasmids. The largest of the three plasmids, pRCH51-3, is 52 789 bp and carries oxa235 in the ISAba1-bounded transposon Tn 6252 , as well as sul2 and floR . pRCH51-3 represents a new A. baumannii plasmid family that is potentially conjugative as it contains several genes predicted to encode transfer functions. However, conjugation of pRCH51-3 was not detected. The aadB and tet39 resistance genes were each found in small plasmids identical to the known plasmids pRAY*-v1 and pRCH52-1, respectively. The resistance gene complement of RCH51 was found in three plasmids. pRCH51-3, which carries the oxa235 , sul2 and floR resistance genes, represents a new, potentially conjugative A. baumannii plasmid type.

  5. Iteron Plasmids.

    PubMed

    Konieczny, Igor; Bury, Katarzyna; Wawrzycka, Aleksandra; Wegrzyn, Katarzyna

    2014-12-01

    Iteron-containing plasmids are model systems for studying the metabolism of extrachromosomal genetic elements in bacterial cells. Here we describe the current knowledge and understanding of the structure of iteron-containing replicons, the structure of the iteron plasmid encoded replication initiation proteins, and the molecular mechanisms for iteron plasmid DNA replication initiation. We also discuss the current understanding of control mechanisms affecting the plasmid copy number and how host chaperone proteins and proteases can affect plasmid maintenance in bacterial cells.

  6. Antibiotic resistance of vibrio cholerae: special considerations of R-plasmids.

    PubMed

    Kuwahara, S

    1978-09-01

    Studies on the transmission of R plasmid by conjugation between enterobacteria and vibrio or related bacteria were reviewed. The majority of the reports confirmed successful transmission from enterobacteria to Vibrio cholerae and related species, although the transmission frequencies were extremely low and the transmitted R plasmid was very unstable except for thermosensitive kanamycin plasmid and usual R plasmid coexisting with P plasmid. Strains of V. cholerae and Aeromonas liquefaciens as well as A. salmonicida bearing R plasmid were detected in nature. R plasmid was relatively unstable in V. cholerae strains with which transmission of R plasmid to enterobacteria was confirmed. At present, only 3 R plasmids have been obtained from naturally occurring strains of V. cholerae. Although the 2 European plasmids belong to the C incompatibility group with 98 megadalton closed covalent circular DNA molecule, one plasmid belongs to the J group with more than 25 megadalton molecular weight, and no CCC of satelite DNA was detected in bacteria harboring this plasmid.

  7. Kanamycin activates caspase-1 in NC/Nga mice.

    PubMed

    Han, Na-Ra; Kim, Hyung-Min; Jeong, Hyun-Ja

    2011-08-01

    Abuse of antibiotics to treat children has been associated with an increased risk of the development of inflammatory diseases. The underlying mechanism behind this association still remains to be clarified. Here, we examined the mechanisms behind kanamycin-induced skin inflammation in NC/Nga mice. NC/Nga mice were orally administered kanamycin for 7 days consecutively. Blood, spleen and dorsal skin were taken 18 weeks after kanamycin treatment was stopped. Kanamycin significantly increased the allergic reaction. We also observed significant increases in caspase-1 mRNA and protein expression in the dorsal skin of the kanamycin-administered mice compared to the control mice. The increased enzymatic activity of caspase-1 in the dorsal skin of the kanamycin-administered mice increased the mRNA expressions of IL-1β and IL-18. The productions of IL-1β and IL-18 were also increased in the splenocytes obtained from kanamycin-administered mice. Kanamycin upregulated the TNF-α mRNA expression in the dorsal skin and the TNF-α production in stimulated splenocytes. The activation of nuclear factor-κB and degradation of IκBα were increased by kanamycin administration. Our findings suggest that the use of kanamycin during infancy may increase the potential for skin inflammatory reactions through the upregulation of caspase-1.

  8. Analysis of plasmids in nosocomial strains of multiple-antibiotic-resistant Staphylococcus aureus.

    PubMed Central

    Lyon, B R; May, J W; Skurray, R A

    1983-01-01

    Nosocomial infections caused by Staphylococcus aureus strains resistant to methicillin and multiple antibiotics have reached epidemic proportions in Melbourne, Australia, over the past 5 years. Plasmid analysis of representative clinical isolates demonstrated the presence of three classes of plasmid DNA in most strains. Resistance to gentamicin, kanamycin, and tobramycin was usually mediated by an 18-megadalton plasmid but could also be encoded by a related 22-megadalton plasmid. Two distinguishable plasmids of 3 megadaltons each endowed resistance to chloramphenicol, and the third class consisted of small plasmids, each approximately 1 megadalton in size, with no attributable function. An extensive array of resistance determinants, including some which have usually been associated with a plasmid locus, were found to exist on the chromosome. Evidence that resistance to gentamicin, kanamycin, and tobramycin is chromosomally encoded in some clinical isolates suggests that this determinant may have undergone genetic translocation onto the staphylococcal chromosome. Images PMID:6311086

  9. The Complete Nucleotide Sequence of the Carbapenem Resistance-Conferring Conjugative Plasmid pLD209 from a Pseudomonas putida Clinical Strain Reveals a Chimeric Design Formed by Modules Derived from Both Environmental and Clinical Bacteria

    PubMed Central

    Marchiaro, Patricia M.; Brambilla, Luciano; Morán-Barrio, Jorgelina; Revale, Santiago; Pasteran, Fernando; Vila, Alejandro J.; Viale, Alejandro M.

    2014-01-01

    The complete sequence of the carbapenem-resistance-conferring conjugative plasmid pLD209 from a Pseudomonas putida clinical strain is presented. pLD209 is formed by 3 well-defined regions: an adaptability module encompassing a Tn402-like class 1 integron of clinical origin containing blaVIM-2 and aacA4 gene cassettes, partitioning and transfer modules, and a replication module derived from plasmids of environmental bacteria. pLD209 is thus a mosaic of modules originating in both the clinical and environmental (nonclinical) microbiota. PMID:24395220

  10. Gene therapy with plasmids encoding IFN-β or IFN-α14 confers long-term resistance to HIV-1 in humanized mice

    PubMed Central

    Abraham, Sojan; Choi, Jang-Gi; Ortega, Nora M.; Zhang, Junli; Shankar, Premlata; Swamy, N. Manjunath

    2016-01-01

    Because endogenous interferon type I (IFN-I) produced by HIV-1 infection might complicate the analysis of therapeutically administered IFN-I, we tested different humanized mouse models for induction of IFN-I during HIV-1 infection. While HIV-1 induced high levels of IFN-α in BLT mice, IFN-I was undetectable following infection in the Hu-PBL mouse model, in which only T cells expand. We therefore tested the effect of treatment with Pegylated IFN-2 (pegasys), in Hu-PBL mice. Pegasys prevented CD4 T cell depletion and reduced the viral load for 10 days, but the effect waned thereafter. We next expressed IFN-I subsets (IFN-α2, −α6, −α8, −α14, and −β) in Hu-PBL mice by hydrodynamic injection of plasmids encoding them and 2 days later infected the mice with HIV-1. CD4 T cell depletion was prevented in all subtypes of IFN-I-expressing mice by day 10. However, at day 40 post-infection, protection was seen in IFN-β- and IFN-α14-expressing mice, but not the others. The viral load followed an inverse pattern and was highest in control mice and lowest in IFN-β- and IFN-α14-expressing mice until day 40 after infection. These results show that gene therapy with plasmids encoding IFN-β and −α14, but not the commonly used −α2, confers long-term suppression of HIV-1 replication. PMID:27729616

  11. Location and cloning of the ultraviolet-sensitizing function from the chromosomally associated IncJ group plasmid, R391

    SciTech Connect

    Pembroke, J.T.; Stevens, E.; Brandsma, J.A.; Van de Putte, P.

    1986-07-01

    The IncJ plasmid R391, which specifies a uv-sensitizing function, has been shown to be associated with chromosomal DNA. Deletions originating from Tn10 insertion into the kanamycin-resistance determinant of plasmid R391 gave rise to uv-resistant derivatives. This apparent linkage between the kanamycin-resistance determinant and the uv-sensitizing gene(s) was used to clone the uv-sensitizing function from plasmid R391 into pUR222. A recombinant plasmid containing both functions (KanR and Uvs+) was obtained. The uv-sensitizing function was mapped to a 4-kb EcoRI fragment.

  12. Erythromycin Resistance-Conferring Plasmid pRSB105, Isolated from a Sewage Treatment Plant, Harbors a New Macrolide Resistance Determinant, an Integron-Containing Tn402-Like Element, and a Large Region of Unknown Function▿

    PubMed Central

    Schlüter, A.; Szczepanowski, R.; Kurz, N.; Schneiker, S.; Krahn, I.; Pühler, A.

    2007-01-01

    The erythromycin resistance plasmid pRSB105 was previously isolated from an activated sludge bacterial community of a municipal wastewater treatment plant. Compilation of the complete pRSB105 nucleotide sequence revealed that the plasmid is 57,137 bp in size and has a mean G+C content of 56.66 mol%. The pRSB105 backbone is composed of two different replication and/or partitioning modules and a functional mobilization region encoding the mobilization genes mobCDE and mobBA. The first replicon (Rep1) is nearly identical to the corresponding replication module of the multiresistance plasmid pRSB101 isolated from an unknown activated sludge bacterium. Accordingly, pRSB101 and pRSB105 are sister plasmids belonging to a new plasmid family. The second replicon (Rep2) of pRSB105 was classified as a member of the IncP-6 group. While Rep1 confers replication ability only in γ-proteobacteria, Rep2 extents the host range of the plasmid since it is also functional in the β-proteobacterium Ralstonia eutropha. Plasmid pRSB105 harbors the macrolide resistance genes mel and mph, encoding, respectively, a predicted ABC-type efflux permease and a macrolide-2′-phosphotransferase. Erythromycin resistance is mainly attributed to mel, whereas mph contributes to erythromycin resistance to a lesser extent. The second resistance region, represented by an integron-containing Tn402-like element, includes a β-lactam (oxa10) and a trimethoprim (dfrB2) resistance gene cassette. In addition to antibiotic resistance modules, pRSB105 encodes a functional restriction/modification system and two nonresistance regions of unknown function. The presence of different mobile genetic elements that flank resistance and nonresistance modules on pRSB105 indicates that these elements were involved in acquisition of accessory plasmid modules. Comparative genomics of pRSB105 and related plasmids elucidated that pRSB105 evolved by integration of distinct modules from different plasmid sources, including

  13. Novel erm(T)-Carrying Multiresistance Plasmids from Porcine and Human Isolates of Methicillin-Resistant Staphylococcus aureus ST398 That Also Harbor Cadmium and Copper Resistance Determinants

    PubMed Central

    Gómez-Sanz, Elena; Kadlec, Kristina; Feßler, Andrea T.; Zarazaga, Myriam; Schwarz, Stefan

    2013-01-01

    This study describes three novel erm(T)-carrying multiresistance plasmids that also harbor cadmium and copper resistance determinants. The plasmids, designated pUR1902, pUR2940, and pUR2941, were obtained from porcine and human methicillin-resistant Staphylococcus aureus (MRSA) of the clonal lineage ST398. In addition to the macrolide-lincosamide-streptogramin B (MLSB) resistance gene erm(T), all three plasmids also carry the tetracycline resistance gene tet(L). Furthermore, plasmid pUR2940 harbors the trimethoprim resistance gene dfrK and the MLSB resistance gene erm(C), while plasmids pUR1902 and pUR2941 possess the kanamycin/neomycin resistance gene aadD. Sequence analysis of approximately 18.1 kb of the erm(T)-flanking region from pUR1902, 20.0 kb from pUR2940, and 20.8 kb from pUR2941 revealed the presence of several copies of the recently described insertion sequence ISSau10, which is probably involved in the evolution of the respective plasmids. All plasmids carried a functional cadmium resistance operon with the genes cadD and cadX, in addition to the multicopper oxidase gene mco and the ATPase copper transport gene copA, which are involved in copper resistance. The comparative analysis of S. aureus RN4220 and the three S. aureus RN4220 transformants carrying plasmid pUR1902, pUR2940, or pUR2941 revealed an 8-fold increase in CdSO4 and a 2-fold increase in CuSO4 MICs. The emergence of multidrug resistance plasmids that also carry heavy metal resistance genes is alarming and requires further surveillance. The colocalization of antimicrobial resistance genes and genes that confer resistance to heavy metals may facilitate their persistence, coselection, and dissemination. PMID:23629701

  14. Novel erm(T)-carrying multiresistance plasmids from porcine and human isolates of methicillin-resistant Staphylococcus aureus ST398 that also harbor cadmium and copper resistance determinants.

    PubMed

    Gómez-Sanz, Elena; Kadlec, Kristina; Feßler, Andrea T; Zarazaga, Myriam; Torres, Carmen; Schwarz, Stefan

    2013-07-01

    This study describes three novel erm(T)-carrying multiresistance plasmids that also harbor cadmium and copper resistance determinants. The plasmids, designated pUR1902, pUR2940, and pUR2941, were obtained from porcine and human methicillin-resistant Staphylococcus aureus (MRSA) of the clonal lineage ST398. In addition to the macrolide-lincosamide-streptogramin B (MLSB) resistance gene erm(T), all three plasmids also carry the tetracycline resistance gene tet(L). Furthermore, plasmid pUR2940 harbors the trimethoprim resistance gene dfrK and the MLSB resistance gene erm(C), while plasmids pUR1902 and pUR2941 possess the kanamycin/neomycin resistance gene aadD. Sequence analysis of approximately 18.1 kb of the erm(T)-flanking region from pUR1902, 20.0 kb from pUR2940, and 20.8 kb from pUR2941 revealed the presence of several copies of the recently described insertion sequence ISSau10, which is probably involved in the evolution of the respective plasmids. All plasmids carried a functional cadmium resistance operon with the genes cadD and cadX, in addition to the multicopper oxidase gene mco and the ATPase copper transport gene copA, which are involved in copper resistance. The comparative analysis of S. aureus RN4220 and the three S. aureus RN4220 transformants carrying plasmid pUR1902, pUR2940, or pUR2941 revealed an 8-fold increase in CdSO4 and a 2-fold increase in CuSO4 MICs. The emergence of multidrug resistance plasmids that also carry heavy metal resistance genes is alarming and requires further surveillance. The colocalization of antimicrobial resistance genes and genes that confer resistance to heavy metals may facilitate their persistence, coselection, and dissemination.

  15. Protein fusions with the kanamycin resistance gene from transposon Tn5.

    PubMed Central

    Reiss, B; Sprengel, R; Schaller, H

    1984-01-01

    The gene for the neomycin phosphotransferase II (NPT II) from transposon Tn5 was fused at the amino or carboxy terminus to foreign DNA sequences coding for 3-300 amino acids and the properties of the fused proteins were investigated. All amino-terminal fusions examined conferred kanamycin resistance to their host cell, but profound differences in their enzymatic activity and stability were detected. Short additions to the amino terminus of the NPT II resulted in highly enzymatically active fusion proteins whereas long amino-terminal fusions often had to be proteolytically degraded to release active proteins. Fusions at the carboxy-terminal end of the NPT II protein did not always induce kanamycin resistance and their enzymatic activity depended more stringently on the nature of the junction sequence. Images Fig. 4. PMID:6098471

  16. Synthetic neomycin-kanamycin phosphotransferase, type II coding sequence for gene targeting in mammalian cells.

    PubMed

    Jin, Seung-Gi; Mann, Jeffrey R

    2005-07-01

    The bacterial neomycin-kanamycin phosphotransferase, type II enzyme is encoded by the neo gene and confers resistance to aminoglycoside drugs such as neomycin and kanamycin-bacterial selection and G418-eukaryotic cell selection. Although widely used in gene targeting in mouse embryonic stem cells, the neo coding sequence contains numerous cryptic splice sites and has a high CpG content. At least the former can cause unwanted effects in cis at the targeted locus. We describe a synthetic sequence, sneo, which encodes the same protein as that encoded by neo. This synthetic sequence has no predicted splice sites in either strand, low CpG content, and increased mammalian codon usage. In mouse embryonic stem cells sneo expressability is similar to neo. The use of sneo in gene targeting experiments should substantially reduce the probability of unwanted effects in cis due to splicing, and perhaps CpG methylation, within the coding sequence of the selectable marker.

  17. The qacG gene on plasmid pST94 confers resistance to quaternary ammonium compounds in staphylococci isolated from the food industry.

    PubMed

    Heir, E; Sundheim, G; Holck, A L

    1999-03-01

    The 2.3 kb resistance plasmid pST94 revealed a new gene (qacG) encoding resistance to benzalkonium chloride (BC), a commonly used quaternary ammonium disinfectant, and the intercalating dye ethidium bromide (Eb) in staphylococci isolated from the food industry. The 107 amino acid QacG protein showing 69.2% identity to the staphylococcal multi-drug resistance protein Smr is a new member of the small multi-drug resistance (SMR) protein family. QacG conferred resistance via proton dependent efflux. An additional ORF on pST94 encoded a protein with extensive similarity to replication proteins of other Gram-positive bacteria. Gene constructs containing the qacG and smr gene region combined with the smr or qacG promoter, respectively, indicated that QacG is more efficient than Smr and that qacG has a weaker promoter. Resistant qacG-containing cells could be adapted to withstand higher concentrations of BC. Adapted qacG-containing cells showed increased resistance mainly to BC. In contrast, adaptation of sensitive cells showed cross-resistance development to a range of compounds. Induction of proton-dependent efflux was observed for BC-adapted staphylococci cells not containing qacG. The ability of sublethal concentrations of BC to develop cross-resistance and induce efflux mechanisms could be of practical significance; it should be considered before use of any new disinfectant and in the design of better disinfection procedures.

  18. Plasmid-related quinolone resistance determinants in epidemic Vibrio parahaemolyticus, uropathogenic Escherichia coli, and marine bacteria from an aquaculture area in Chile.

    PubMed

    Aedo, Sandra; Ivanova, Larisa; Tomova, Alexandra; Cabello, Felipe C

    2014-08-01

    Marine bacteria from aquaculture areas with industrial use of quinolones have the potential to pass quinolone resistance genes to animal and human pathogens. The VPA0095 gene, related to the quinolone resistance determinant qnrA, from clinical isolates of epidemic Vibrio parahaemolyticus conferred reduced susceptibility to quinolone after cloning into Escherichia coli K-12 either when acting alone or synergistically with DNA gyrase mutations. In addition, a plasmid-mediated quinolone resistance gene from marine bacteria, aac(6')-Ib-cr, was identical to aac(6')-Ib-cr from urinary tract isolates of E. coli, suggesting a recent flow of this gene between these bacteria isolated from different environments. aac(6')-Ib-cr from E. coli also conferred reduced susceptibility to quinolone and kanamycin when cloned into E. coli K-12.

  19. 21 CFR 520.1204 - Kanamycin, bismuth subcarbonate, activated attapulgite.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... milliliters (mL) of suspension contains 100 milligrams (mg) kanamycin (as the sulfate), 250 mg bismuth subcarbonate, and 500 mg activated attapulgite (aluminum magnesium silicate). (2) Each tablet contains 100 mg kanamycin (as the sulfate), 250 mg bismuth subcarbonate, and 500 mg activated attapulgite. (b) Sponsor....

  20. 21 CFR 520.1204 - Kanamycin, bismuth subcarbonate, activated attapulgite.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... milliliters (mL) of suspension contains 100 milligrams (mg) kanamycin (as the sulfate), 250 mg bismuth subcarbonate, and 500 mg activated attapulgite (aluminum magnesium silicate). (2) Each tablet contains 100 mg kanamycin (as the sulfate), 250 mg bismuth subcarbonate, and 500 mg activated attapulgite. (b) Sponsor....

  1. Na+/H+ antiport activity conferred by Bacillus subtilis tetA(L), a 5' truncation product of tetA(L), and related plasmid genes upon Escherichia coli.

    PubMed Central

    Cheng, J; Baldwin, K; Guffanti, A A; Krulwich, T A

    1996-01-01

    An Escherichia coli transformant expressing the Bacillus subtilis tetA(L) gene from a weak promoter was challenged by growth on medium with low, increasing tetracycline concentrations. Changes in the substrate preference ratios of the TetA(L)-mediated resistances and antiports were examined in view of recent findings suggesting that TetA(L) catalyzes efflux of Na+ in exchange for protons in addition to having the ability to catalyze metal-tetracycline/H+ antiport. After growth of the transformant on 1 microgram or more of tetracycline per ml for 12 to 15 h, the tetA(L) gene in the plasmid was found to be disrupted by an IS10 element 50 bp from the 5' end of the coding sequence. This disrupted recombinant plasmid, pKB1, conferred greater tetracycline resistance and higher levels of membrane metal-tetracycline/proton antiport than the original plasmid, pJTA1, but conferred lower NA+ resistance and Na+/H+ antiport levels than the original plasmid. The results indicate that the 5' end of the gene is necessary for optimal Na+/H+ antiport but that some such activity as well as robust tetracycline/H+ antiport persists in its absence. Two plasmid genes, tet(K) and qacA, were compared with tetA(L) vis-à-vis their abilities to enhance the Na+/H+ antiporter activity of everted vesicles from E. coli transformants. tet(K), which is more closely related to tetA(L), catalyzed 22Na+ uptake by energized vesicles, whereas the less closely related qacA gene did not. PMID:8849239

  2. 62-kb plasmids harboring rulAB homologues confer UV-tolerance and epiphytic fitness to Pseudomonas syringae pv. syringae mango isolates.

    PubMed

    Cazorla, F M; Codina, J C; Abad, C; Arrebola, E; Torés, J A; Murillo, J; Pérez-García, A; de Vicente, A

    2008-08-01

    The presence of genetic determinants homologous to rulAB genes for ultraviolet (UV) radiation resistance was determined in a collection of Pseudomonas syringae pv. syringae strains isolated from mango. The potential role of these plasmids in UV tolerance and ecological fitness in the mango phyllosphere was also evaluated. Nearly all of the 62-kb plasmids present in the P. syringae pv. syringae strains hybridized with a rulAB probe, but these 62-kb plasmids showed differences in restriction patterns. In vitro assays of tolerance to UV radiation of P. syringae pv. syringae strains showed a higher survival of the strains harboring the 62-kb plasmids compared to strains lacking plasmids when exposed to UVC or UVA+B fractions. Similar results were observed when transconjugants harboring the 62-kb plasmid were tested. Survival assays were carried out under field conditions, and a higher survival of P. syringae pv. syringae strains harboring 62-kb plasmids under direct solar radiation on the adaxial surface of leaves was also observed. When the assays were carried out in shady areas or on the abaxial surface of leaves, survival time was comparable for all the assayed strains, whether or not they contained a 62-kb plasmid hybridizing to rulAB. Our results indicate that P. syringae pv. syringae strains harboring 62-kb plasmids show an increase in ecological fitness when colonizing the mango phyllosphere.

  3. A novel kanamycin/G418 resistance marker for direct selection of transformants in Escherichia coli and different yeast species.

    PubMed

    Agaphonov, Michael; Romanova, Nina; Choi, Eui-Sung; Ter-Avanesyan, Michael

    2010-04-01

    We have developed a set of cloning vectors possessing a modified Tn903 kanamycin resistance gene that enables the selection of both kanamycin-resistant transformants in Escherichia coli and G418-resistant transformants in the yeasts Saccharomyces cerevisiae, Hansenula polymorpha and Pichia pastoris. Expression of this gene in yeast is controlled by the H. polymorpha glyceraldehyde-3-phosphate dehydrogenase promoter, while expression in E. coli is governed by an upstream E. coli lacZ promoter. Applicability of the vectors for gene disruption in H. polymorpha and S. cerevisiae was demonstrated by inactivation of the HpMAL1 and URA3 genes, respectively. One of the vectors possesses a H. polymorpha ARS allowing plasmid maintenance in an episomal state. The small size of the vectors (2-2.5 kb) makes them convenient for routine DNA cloning. In addition, we report a novel approach for construction of gene disruption cassettes.

  4. Plasmid-determined resistance to fosfomycin in Serratia marcescens.

    PubMed Central

    Mendoza, C; Garcia, J M; Llaneza, J; Mendez, F J; Hardisson, C; Ortiz, J M

    1980-01-01

    Multiple-antibiotic-resistant strains of Serratia marcescens isolated from hospitalized patients were examined for their ability to transfer antibiotic resistance to Escherichia coli by conjugation. Two different patterns of linked transferable resistance were found among the transconjugants. The first comprised resistance to carbenicillin, streptomycin, and fosfomycin; the second, and more common, pattern included resistance to carbenicillin, streptomycin, kanamycin, gentamicin, tetracycline, chloramphenicol, sulfonamide, and fosfomycin. The two types of transconjugant strains carried a single plasmid of either 57 or 97 megadaltons in size. Both of these plasmids are present in parental S. marcescens strains resistant to fosfomycin. The 57-megadalton plasmid was transformed into E. coli. Images PMID:7004337

  5. Plasmid Biopharmaceuticals.

    PubMed

    Prazeres, Duarte Miguel F; Monteiro, Gabriel A

    2014-12-01

    Plasmids are currently an indispensable molecular tool in life science research and a central asset for the modern biotechnology industry, supporting its mission to produce pharmaceutical proteins, antibodies, vaccines, industrial enzymes, and molecular diagnostics, to name a few key products. Furthermore, plasmids have gradually stepped up in the past 20 years as useful biopharmaceuticals in the context of gene therapy and DNA vaccination interventions. This review provides a concise coverage of the scientific progress that has been made since the emergence of what are called today plasmid biopharmaceuticals. The most relevant topics are discussed to provide researchers with an updated overview of the field. A brief outline of the initial breakthroughs and innovations is followed by a discussion of the motivation behind the medical uses of plasmids in the context of therapeutic and prophylactic interventions. The molecular characteristics and rationale underlying the design of plasmid vectors as gene transfer agents are described and a description of the most important methods used to deliver plasmid biopharmaceuticals in vivo (gene gun, electroporation, cationic lipids and polymers, and micro- and nanoparticles) is provided. The major safety issues (integration and autoimmunity) surrounding the use of plasmid biopharmaceuticals is discussed next. Aspects related to the large-scale manufacturing are also covered, and reference is made to the plasmid products that have received marketing authorization as of today.

  6. Mineral Nutrition of Streptomyces kanamyceticus for Kanamycin Formation

    PubMed Central

    Basak, Ketaki; Majumdar, S. K.

    1975-01-01

    Kanamycin production by Streptomyces kanamyceticus ATCC 12853 requires magnesium sulfate and potassium phosphate at concentrations of 0.4 and 1.0 g per liter, respectively. The optimal concentrations of Fe and Zn for production of kanamycin are 0.25 and 0.575 μg/ml, respectively, whereas Mo at 0.04 μg/ml allows maximal cellular growth and antibiotic synthesis. Mn and Ca are without any effect. Cu, Co, Ni, and V have inhibitory effect on growth of the organism as well as kanamycin formation. PMID:1190749

  7. Drug resistance, R plasmids and pigmentation of Serratia marcescens isolated in Taiwan.

    PubMed

    Ding, M J; Sung, S J

    1987-02-01

    The Serratia marcescens isolates used in this study were resistant to ampicillin, tetracycline or cephalothin, streptomycin, tobramycin, kanamycin, carbenicillin, chloramphenicol and gentamicin in descending order. Nalidixic acid was the most effective antibiotic against S. marcescens, followed by amikacin and sulfamethoxazole-trimethoprim. The non-pigmented plasmid-carrying isolates displayed higher resistance to some antimicrobial agents than did the pigmented isolates and plasmid-free white isolates. Nine out of 12 resistant markers were coded by plasmids in S. marcescens. The average number of resistant markers per strain was seven for plasmid-containing white isolates as compared to four for other S. marcescens groups. About 73% of S. marcescens contained plasmids. Thirty eight percent of plasmid-carrying S. marcescens spread their R plasmids to E. coli. Conjugative R plasmids were identified in six out of 17 strains of S. marcescens, which apparently contained a single plasmid.

  8. 21 CFR 522.1204 - Kanamycin sulfate injection.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ...) ANIMAL DRUGS, FEEDS, AND RELATED PRODUCTS IMPLANTATION OR INJECTABLE DOSAGE FORM NEW ANIMAL DRUGS § 522... kanamycin sensitive organisms in dogs and cats. (2) It is administered subcutaneously or intramuscularly at...

  9. 21 CFR 522.1204 - Kanamycin sulfate injection.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ...) ANIMAL DRUGS, FEEDS, AND RELATED PRODUCTS IMPLANTATION OR INJECTABLE DOSAGE FORM NEW ANIMAL DRUGS § 522... kanamycin sensitive organisms in dogs and cats. (2) It is administered subcutaneously or intramuscularly at...

  10. Radioenzymatic assays for aminoglycosides with kanamycin 6'- acetyltransferase

    SciTech Connect

    Weber, A.; Smith, A.L.; Opheim, K.E.

    1985-03-01

    To facilitate the rapid and accurate quantitation of parenterally administered aminoglycosides, the optimum conditions (pH, duration of incubation, and cofactor concentrations) were defined to permit radioenzymatic assays with kanamycin acetyltransferase. The accuracy in quantitating tobramycin, netilmicin, kanamycin, and amikacin at concentrations in the therapeutic range was greater than 90%, with a mean recovery of 102.8%. The mean of the interassay coefficient of variation was 7.8%. Typical standard curves at six different concentrations resulted in a correlation coefficient (r value) of greater than 0.99 for each aminoglycoside. The radioenzymatic assay correlates well with the bioassay (tobramycin and netilmicin) and radioimmunoassay (amikacin and kanamycin); the correlation coefficient is greater than 0.90 for all. The authors conclude that the radioenzymatic assay utilizing kanamycin 6'-acetyltransferase is feasible for all commercially available parenterally administered aminoglycosides.

  11. [Electrooptical parameters of kanamycin-treated E. coli cell suspensions].

    PubMed

    Guliĭ, O I; Markina, L N; Bunin, V D; Ignatov, V V; Ignatov, O V

    2008-01-01

    The effect of kanamycin on the electrophysical parameters of cell suspensions of Escherichia coli K-12 and pMMB33 was investigated. Incubation of the sensitive K-12 strain with kanamycin resulted in significant changes in the orientation spectra (OS) of the cell suspensions; these changes were not revealed in the case of the resistant pMMB33 strain. In the case of the sensitive K-12 strain incubated with different kanamycin concentrations, changes in the OS of the cell suspensions occurred within the 10-1000 kHz frequency range of the orienting electrical field. The most pronounced change in the electrooptical signal was observed at 10 microg/ml of kanamycin. Control experiments were carried out by standard plating on nutrient media. Thus, the OS changes of suspensions in the presence of antibiotics may be used as a test for microbial resistance to such antibiotics.

  12. Thermosensitive replication of a kanamycin resistance factor.

    PubMed

    Terawaki, Y; Takayasu, H; Akiba, T

    1967-09-01

    A strain of Proteus vulgaris isolated from the urinary tract of a patient with postoperative pyelonephritis and resistant to sulfonamide, streptomycin, tetracycline, and kanamycin (KM) was found to transfer only KM resistance by cell-to-cell conjugation. The genetic determinant controlling the transferable KM resistance was considered to be an R factor and was designated R (KM). Successive transfer of KM resistance was demonstrated also from Escherichia coli 20S0, which received the R (KM) factor, to other substrains of E. coli K-12 or Salmonella typhimurium LT-2. The transfer of the R (KM) factor was strongly affected by the temperature at which the mating culture was kept. The transfer frequency of R (KM) at 25 C was about 10(5) times higher than at 37 C. The R (KM) factor was spontaneously eliminated from the host bacterial cells when P. vulgaris was cultured at 42 C, but no elimination occurred at 25 C. This elimination of the R (KM) factor at elevated temperature was also observed when the R (KM) factor infected E. coli and S. typhimurium. On the other hand, a normal R factor could not be eliminated from the same E. coli host strain by cultivation at the higher temperature. We consider the thermosensitive transfer and the spontaneous elimination of the R (KM) factor at higher temperature to depend upon thermosensitive replication of the R (KM) factor.

  13. Genetic study of the pVM82 plasmid responsible for some pathogenic traits of Yersinia pseudotuberculosis

    SciTech Connect

    Il`ina, T.S.; Fil`kova, S.L.

    1995-07-01

    The large pVM82 plasmid isolated epidemic strains of Yersinia pseudotuberculosis includes the 25 MDa segment, which encodes a series of properties affecting the virulence of the bacterium. Insertion mutants of pVM82 containing transposition-defective Tn2507 with a kanamycin-resistance marker in different Hind III fragments of the 25 MDa segment were obtained. By recombination between two homologous pVM82 containing genetic markers in different parts, deletion derivatives of pVM82 plasmid and insertions of the plasmid segment, carrying a kanamycin-resistance marker, into a chromosome were obtained. Results were obtained suggesting the presence in the plasmid 25 MDa segment of a transposon-like structure capable of migrating from pVM82 plasmid onto a chromosome and from a chromosome and pVM82 onto pRP1.2 plasmid of a broad host range. 8 refs., 4 figs., 1 tab.

  14. Biofilms and the plasmid maintenance question.

    PubMed

    Imran, Mudassar; Jones, Don; Smith, Hal

    2005-02-01

    Can a conjugative plasmid encoding enhanced biofilm forming abilities for its bacterial host facilitate the persistence of the plasmid in a bacterial population despite conferring diminished growth rate and segregative plasmid loss on its bearers? We construct a mathematical model in a chemostat and in a plug flow environment to answer this question. Explicit conditions for an affirmative answer are derived. Numerical simulations support the conclusion.

  15. Isolation of VanB-type Enterococcus faecalis strains from nosocomial infections: first report of the isolation and identification of the pheromone-responsive plasmids pMG2200, Encoding VanB-type vancomycin resistance and a Bac41-type bacteriocin, and pMG2201, encoding erythromycin resistance and cytolysin (Hly/Bac).

    PubMed

    Zheng, Bo; Tomita, Haruyoshi; Inoue, Takako; Ike, Yasuyoshi

    2009-02-01

    Eighteen identical VanB-type Enterococcus faecalis isolates that were obtained from different hospitalized patients were examined for their drug resistance and plasmid DNAs. Of the 18 strains, 12 strains exhibited resistance to erythromycin (Em), gentamicin (Gm), kanamycin (Km), tetracycline (Tc), and vancomycin (Van) and produced cytolysin (Hly/Bac) and a bacteriocin (Bac) active against E. faecalis strains. Another six of the strains exhibited resistance to Gm, Km, Tc, and Van and produced a bacteriocin. Em and Van resistance was transferred individually to E. faecalis FA2-2 strains at a frequency of about 10(-4) per donor cell by broth mating. The Em-resistant transconjugants and the Van-resistant transconjugants harbored a 65.7-kbp plasmid and a 106-kbp plasmid, respectively. The 106-kbp and 65.7-kbp plasmids isolated from the representative E. faecalis NKH15 strains were designated pMG2200 and pMG2201, respectively. pMG2200 conferred vancomycin resistance and bacteriocin activity on the host strain and responded to the synthetic pheromone cCF10 for pCF10, while pMG2201 conferred erythromycin resistance and cytolysin activity on its host strain and responded to the synthetic pheromone cAD1 for pAD1. The complete DNA sequence of pMG2200 (106,527 bp) showed that the plasmid carried a Tn1549-like element encoding vanB2-type resistance and the Bac41-like bacteriocin genes of pheromone-responsive plasmid pYI14. The plasmid contained the regulatory region found in pheromone-responsive plasmids and encoded the genes prgX and prgQ, which are the key negative regulatory elements for plasmid pCF10. pMG2200 also encoded TraE1, a key positive regulator of plasmid pAD1, indicating that pMG2200 is a naturally occurring chimeric plasmid that has a resulting prgX-prgQ-traE1 genetic organization in the regulatory region of the pheromone response. The functional oriT region and the putative relaxase gene of pMG2200 were identified and found to differ from those of pCF10 and pAD1

  16. Yeast telomere repeat sequence (TRS) improves circular plasmid segregation, and TRS plasmid segregation involves the RAP1 gene product.

    PubMed Central

    Longtine, M S; Enomoto, S; Finstad, S L; Berman, J

    1992-01-01

    Telomere repeat sequences (TRSs) can dramatically improve the segregation of unstable circular autonomously replicating sequence (ARS) plasmids in Saccharomyces cerevisiae. Deletion analysis demonstrated that yeast TRSs, which conform to the general sequence (C(1-3)A)n, are able to stabilize circular ARS plasmids. A number of TRS clones of different primary sequence and C(1-3)A tract length confer the plasmid stabilization phenotype. TRS sequences do not appear to improve plasmid replication efficiency, as determined by plasmid copy number analysis and functional assays for ARS activity. Pedigree analysis confirms that TRS-containing plasmids are missegregated at low frequency and that missegregated TRS-containing plasmids, like ARS plasmids, are preferentially retained by the mother cell. Plasmids stabilized by TRSs have properties that distinguish them from centromere-containing plasmids and 2 microns-based recombinant plasmids. Linear ARS plasmids, which include two TRS tracts at their termini, segregate inefficiently, while circular plasmids with one or two TRS tracts segregate efficiently, suggesting that plasmid topology or TRS accessibility interferes with TRS segregation function on linear plasmids. In strains carrying the temperature-sensitive mutant alleles rap1grc4 and rap1-5, TRS plasmids are not stable at the semipermissive temperature, suggesting that RAP1 protein is involved in TRS plasmid stability. In Schizosaccharomyces pombe, an ARS plasmid was stabilized by the addition of S. pombe telomere sequence, suggesting that the ability to improve the segregation of ARS plasmids is a general property of telomere repeats. PMID:1569937

  17. Autotransmissible resident plasmid of Rhizobium meliloti.

    PubMed

    Bedmar, E J; Olivares, J

    1980-01-01

    A resident plasmid of wild-type strains of Rhizobium meliloti of 59.6 megadaltons has been shown to be transferred at a high frequency to "cured" strains of this bacterial species. This plasmid, named pEZ1, that confers phage-sensitivity to cells carrying it is also transmissible to Escherichia coli and from it to "cured" R. meliloti strains.

  18. Immunoassay Analysis of Kanamycin in Serum Using the Tobramycin Kit

    PubMed Central

    Dijkstra, J. A.; Voerman, A. J.; Greijdanus, B.; Touw, D. J.

    2016-01-01

    Kanamycin is one of the aminoglycosides used in the treatment of multidrug-resistant tuberculosis. Blood concentrations of kanamycin are predictive for the treatment efficacy and the occurrence of side effects, and dose adjustments can be needed to optimize therapy. However, an immunoassay method for the quantification of kanamycin is not commercially available. We modified the existing tobramycin immunoassay to analyze kanamycin. This modified method was tested in a concentration range of 0.3 to 80.0 mg/liter for inaccuracy and imprecision. In addition, the analytical results of the immunoassay method were compared to those obtained by a liquid chromatography-tandem mass spectrometry (LC-MS/MS) analytical method using Passing and Bablok regression. Within-day imprecision varied from 2.3 to 13.3%, and between-day imprecision ranged from 0.0 to 11.3%. The inaccuracy ranged from −5.2 to 7.6%. No significant cross-reactivity with other antimicrobials and antiviral agents was observed. The results of the modified immunoassay method were comparable with the LC-MS/MS analytical outcome. This new immunoassay method enables laboratories to perform therapeutic drug monitoring of kanamycin without the need for complex and expensive LC-MS/MS equipment. PMID:27185806

  19. Transformation of Acinetobacter sp. Strain BD413(pFG4ΔnptII) with Transgenic Plant DNA in Soil Microcosms and Effects of Kanamycin on Selection of Transformants

    PubMed Central

    Nielsen, Kaare M.; van Elsas, Jan D.; Smalla, Kornelia

    2000-01-01

    Here we show that horizontal transfer of DNA, extracted from transgenic sugar beets, to bacteria, based on homologous recombination, can occur in soil. Restoration of a 317-bp-deleted nptII gene in Acinetobacter sp. strain BD413(pFG4) cells incubated in sterile soil microcosms was detected after addition of nutrients and transgenic plant DNA encoding a functional nptII gene conferring bacterial kanamycin resistance. Selective effects of the addition of kanamycin on the population dynamics of Acinetobacter sp. cells in soil were found, and high concentrations of kanamycin reduced the CFU of Acinetobacter sp. cells from 109 CFU/g of soil to below detection. In contrast to a chromosomal nptII-encoded kanamycin resistance, the pFG4-generated resistance was found to be unstable over a 31-day incubation period in vitro. PMID:10698801

  20. Distribution of ColE1-like KAN-resistance plasmids in a population of Salmonella enterica from animal diagnostic samples

    USDA-ARS?s Scientific Manuscript database

    Background: Previous studies showed that some Salmonella isolates may harbor ColE1-like plasmids that carry a single aph gene responsible for kanamycin resistance (KAN-R). However the distribution of these plasmids is unknown. Methods: KAN-R Salmonella isolates (n=102) collected through the 2005 N...

  1. Plasmid-Encoded Iron Uptake Systems.

    PubMed

    Di Lorenzo, Manuela; Stork, Michiel

    2014-12-01

    Plasmids confer genetic information that benefits the bacterial cells containing them. In pathogenic bacteria, plasmids often harbor virulence determinants that enhance the pathogenicity of the bacterium. The ability to acquire iron in environments where it is limited, for instance the eukaryotic host, is a critical factor for bacterial growth. To acquire iron, bacteria have evolved specific iron uptake mechanisms. These systems are often chromosomally encoded, while those that are plasmid-encoded are rare. Two main plasmid types, ColV and pJM1, have been shown to harbor determinants that increase virulence by providing the cell with essential iron for growth. It is clear that these two plasmid groups evolved independently from each other since they do not share similarities either in the plasmid backbones or in the iron uptake systems they harbor. The siderophores aerobactin and salmochelin that are found on ColV plasmids fall in the hydroxamate and catechol group, respectively, whereas both functional groups are present in the anguibactin siderophore, the only iron uptake system found on pJM1-type plasmids. Besides siderophore-mediated iron uptake, ColV plasmids carry additional genes involved in iron metabolism. These systems include ABC transporters, hemolysins, and a hemoglobin protease. ColV- and pJM1-like plasmids have been shown to confer virulence to their bacterial host, and this trait can be completely ascribed to their encoded iron uptake systems.

  2. Discovery of parallel pathways of kanamycin biosynthesis allows antibiotic manipulation.

    PubMed

    Park, Je Won; Park, Sung Ryeol; Nepal, Keshav Kumar; Han, Ah Reum; Ban, Yeon Hee; Yoo, Young Ji; Kim, Eun Ji; Kim, Eui Min; Kim, Dooil; Sohng, Jae Kyung; Yoon, Yeo Joon

    2011-10-09

    Kanamycin is one of the most widely used antibiotics, yet its biosynthetic pathway remains unclear. Current proposals suggest that the kanamycin biosynthetic products are linearly related via single enzymatic transformations. To explore this system, we have reconstructed the entire biosynthetic pathway through the heterologous expression of combinations of putative biosynthetic genes from Streptomyces kanamyceticus in the non-aminoglycoside-producing Streptomyces venezuelae. Unexpectedly, we discovered that the biosynthetic pathway contains an early branch point, governed by the substrate promiscuity of a glycosyltransferase, that leads to the formation of two parallel pathways in which early intermediates are further modified. Glycosyltransferase exchange can alter flux through these two parallel pathways, and the addition of other biosynthetic enzymes can be used to synthesize known and new highly active antibiotics. These results complete our understanding of kanamycin biosynthesis and demonstrate the potential of pathway engineering for direct in vivo production of clinically useful antibiotics and more robust aminoglycosides.

  3. Reversible neurotoxicity of kanamycin on dorsal cochlear nucleus.

    PubMed

    Fan, Guo-Run; Yin, Ze-Deng; Sun, Yu; Chen, Sen; Zhang, Wen-Juan; Huang, Xiang; Kong, Wei-Jia; Zhang, Hong-Lian

    2013-03-28

    The time course of aminoglycoside neurotoxic effect on cochlear nucleus is still obscure. We examined dynamic pathological changes of dorsal cochlear nucleus (DCN) and investigated whether apoptosis or autophagy was upregulated in the neurotoxic course of kanamycin on DCN after kanamycin treatment. Rats were treated with kanamycin sulfate/kg/day at a dose of 500mg by subcutaneous injection for 10 days. Dynamic pathological changes, neuron density and neuron apoptosis of the DCN were examined at 1, 7, 14, 28, 56, 70 and 140 days after kanamycin treatment. The expressions of JNK1, DAPK2, Bcl-2, p-Bcl-2, Caspase-3, LC3B and Beclin-1 were also detected. Under transmission electron microscopy, the mitochondrial swelling and focal vacuoles as well as endoplasmic reticulum dilation were progressively aggravated from 1 day to 14 days, and gradually recovered from 28 days to 140 days. Meanwhile, both autophagosomes and autolysosomes were increased from 1 day to 56 days. Only few neurons were positive to the TUNEL staining. Moreover, neither the expressions of caspase-3 and DAPK2 nor neurons density of DCN changed significantly. LC3-II was drastically increased at 7 days. Beclin-1 was upgraded at 1 and 7 days. P-Bcl-2 increased at 1, 7, 14 and 28 days. JNK1 increased at 7 days, and Bcl-2 was downgraded at 140 days. LC3-B positive neurons were increased at 1, 7 and 14 days. These data demonstrated that the neurons damage of the DCN caused by kanamycin was reversible and autophagy was upregulated in the neurotoxic course of kanamycin on DCN through JNK1-mediated phosphorylation of Bcl-2 pathway.

  4. GFP plasmid-induced defects in Salmonella invasion depend on plasmid architecture, not protein expression.

    PubMed

    Clark, Leann; Martinez-Argudo, Isabel; Humphrey, Tom J; Jepson, Mark A

    2009-02-01

    We have investigated the impact of plasmids and GFP expression on invasion of cultured epithelial cells by Salmonella enterica Typhimurium strain SL1344. The invasiveness of SL1344 carrying plasmids derived from pBR322, encoding promoterless GFP or constitutively expressed rpsM-GFP, was compared under optimal growth conditions with that of SL1344(pBR322), unmodified SL1344 and a strain with chromosome-integrated rpsM-GFP. The strain carrying pBR322 exhibited normal invasion, but the presence of modified plasmids impaired invasiveness, and impairment was exacerbated by plasmid-encoded chloramphenicol resistance (CmR). Using a different antibiotic resistance marker, kanamycin (KmR), did not impair invasiveness. Despite the effect of plasmid-encoded CmR, the strain containing chromosomally encoded GFP, also carrying a CmR gene, was as invasive as the wild-type. To investigate the mechanism by which plasmid carriage decreases invasion, we monitored SPI-1 gene expression using prgH promoter activity as an index of SPI-1 activity. An SL1344 strain with a chromosome-integrated prgH::gfp reporter construct exhibited lower GFP expression during exponential phase when carrying plasmids incorporating CmR or gfp, mirroring invasion data. These data provide evidence that suppression of SPI-1 gene expression is a major factor in the loss of invasiveness associated with plasmid carriage. Our findings also indicate that some plasmids, especially those carrying CmR, should be used with caution, as virulence traits and gene expression may be affected by their presence. Integration of reporter proteins into the bacterial chromosome, however, appears to circumvent the adverse effects observed with plasmids.

  5. Broad-host-range plasmid pRK340 delivers Tn5 into the Legionella pneumophila chromosome.

    PubMed Central

    Keen, M G; Street, E D; Hoffman, P S

    1985-01-01

    Transposon Tn5 was introduced into Legionella pneumophila on plasmid pRK340, which is temperature sensitive for plasmid maintenance. The presence of plasmid DNA was confirmed by agarose gel electrophoresis and by conjugal transfer of the plasmid to Escherichia coli. Tn5 insertions were obtained by culturing L. pneumophila at the nonpermissive temperature (43 degrees C) on buffered charcoal-yeast extract agar containing kanamycin. Of the 260 kanamycin-resistant colonies picked, 220 failed to conjugate pRK340 to E. coli. Plasmid DNA was not visualized from eight randomly picked Tn5-containing strains, and Southern hybridizations indicated that Tn5, but not pRK340, inserted into multiple sites in the Legionella chromosome. In addition, the streptomycin resistance determinant on Tn5 was expressed in L. pneumophila. Images PMID:2987191

  6. Historical Events That Spawned the Field of Plasmid Biology.

    PubMed

    Kado, Clarence I

    2014-10-01

    This chapter revisits the historical development and outcome of studies focused on the transmissible, extrachromosomal genetic elements called plasmids. Early work on plasmids involved structural and genetic mapping of these molecules, followed by the development of an understanding of how plasmids replicate and segregate during cell division. The intriguing property of plasmid transmission between bacteria and between bacteria and higher cells has received considerable attention. The utilitarian aspects of plasmids are described, including examples of various plasmid vector systems. This chapter also discusses the functional attributes of plasmids needed for their persistence and survival in nature and in man-made environments. The term plasmid biology was first conceived at the Fallen Leaf Lake Conference on Promiscuous Plasmids, 1990, Lake Tahoe, California. The International Society for Plasmid Biology was established in 2004 (www.ISPB.org).

  7. Application of glycodiversification: expedient synthesis and antibacterial evaluation of a library of kanamycin B analogues.

    PubMed

    Li, Jie; Wang, Jinhua; Czyryca, Przemyslaw Greg; Chang, Huiwen; Orsak, Thomas W; Evanson, Richard; Chang, Cheng-Wei Tom

    2004-04-29

    [reaction: see text] The expedient synthesis of a library of kanamycin B analogues is reported. The revealed SAR will guide future designs in developing kanamycin-type aminoglycoside antibiotics against drug-resistant bacteria.

  8. Regeneration of Medicago truncatula from protoplasts isolated from kanamycin-sensitive and kanamycin-resistant plants.

    PubMed

    Rose, R J; Nolan, K E

    1995-03-01

    Medicago truncatula (barrel medic) is an annual legume of agricultural and biological interest. In this report regeneration from isolated mesophyll protoplasts is described. A specifically developed, highly regenerable seed line is essential for regeneration. Other critical requirements for regeneration are the starting plant material, the use of agarose droplets incubated in a shallow layer of liquid medium, and protoplast density. Plants are grown in controlled environment conditions. Protoplasts are purified using a Percoll-based flotation procedure, then embedded in 100 μl agarose droplets containing a basal medium plus 25 μM NAA and 4 μM BAP (the same medium as in the surrounding shallow liquid layer) to induce protoplast division. A protoplast density of 6-8×10(5) ml(-1) is required for maximum colony formation. M. truncatula plants previously transformed for kanamycin resistance yielded embryogenic callus and also regenerated plants. Protoplasts from other annual Medicago (M.intertexta and M.scutellata) species readily form calli by the procedure we have described.

  9. 21 CFR 524.1204 - Kanamycin sulfate, calcium amphomycin, and hydrocortisone acetate.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... 21 Food and Drugs 6 2011-04-01 2011-04-01 false Kanamycin sulfate, calcium amphomycin, and... DOSAGE FORM NEW ANIMAL DRUGS § 524.1204 Kanamycin sulfate, calcium amphomycin, and hydrocortisone acetate... or cream contains: 5.0 milligrams of kanamycin activity as the sulfate, 5.0 milligrams of...

  10. 21 CFR 524.1204 - Kanamycin sulfate, calcium amphomycin, and hydrocortisone acetate.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ... 21 Food and Drugs 6 2012-04-01 2012-04-01 false Kanamycin sulfate, calcium amphomycin, and... DOSAGE FORM NEW ANIMAL DRUGS § 524.1204 Kanamycin sulfate, calcium amphomycin, and hydrocortisone acetate... or cream contains: 5.0 milligrams of kanamycin activity as the sulfate, 5.0 milligrams of...

  11. 21 CFR 524.1204 - Kanamycin sulfate, calcium amphomycin, and hydrocortisone acetate.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... 21 Food and Drugs 6 2013-04-01 2013-04-01 false Kanamycin sulfate, calcium amphomycin, and... DOSAGE FORM NEW ANIMAL DRUGS § 524.1204 Kanamycin sulfate, calcium amphomycin, and hydrocortisone acetate... or cream contains: 5.0 milligrams of kanamycin activity as the sulfate, 5.0 milligrams of...

  12. High level of cross-resistance between kanamycin, amikacin, and capreomycin among Mycobacterium tuberculosis isolates from Georgia and a close relation with mutations in the rrs gene.

    PubMed

    Jugheli, Levan; Bzekalava, Nino; de Rijk, Pim; Fissette, Krista; Portaels, Françoise; Rigouts, Leen

    2009-12-01

    The aminoglycosides kanamycin and amikacin and the macrocyclic peptide capreomycin are key drugs for the treatment of multidrug-resistant tuberculosis (MDR-TB). The increasing rates of resistance to these drugs and the possible cross-resistance between them are concerns for MDR-TB therapy. Mutations in the 16S rRNA gene (rrs) have been associated with resistance to each of the drugs, and mutations of the tlyA gene, which encodes a putative rRNA methyltransferase, are thought to confer capreomycin resistance in Mycobacterium tuberculosis bacteria. Studies of possible cross-resistance have shown variable results. In this study, the MICs of these drugs for 145 clinical isolates from Georgia and the sequences of the rrs and tlyA genes of the isolates were determined. Of 78 kanamycin-resistant strains, 9 (11.5%) were susceptible to amikacin and 16 (20.5%) were susceptible to capreomycin. Four strains were resistant to capreomycin but were susceptible to the other drugs, whereas all amikacin-resistant isolates were resistant to kanamycin. Sequencing revealed six types of mutations in the rrs gene (A514C, C517T, A1401G, C1402T, C1443G, T1521C) but no mutations in the tlyA gene. The A514C, C517T, C1443G, and T1521C mutations showed no association with resistance to any of the drugs. The A1401G and C1402T mutations were observed in 65 kanamycin-resistant isolates and the 4 capreomycin-resistant isolates, respectively, whereas none of the susceptible isolates showed either of those mutations. The four mutants with the C1402T mutations showed high levels of resistance to capreomycin but no resistance to kanamycin and amikacin. Detection of the A1401G mutation appeared to be 100% specific for the detection of resistance to kanamycin and amikacin, while the sensitivities reached 85.9% and 94.2%, respectively.

  13. Cloning and over expression of non-coding RNA rprA in E.coli and its resistance to Kanamycin without osmotic shock.

    PubMed

    Sahni, Azita; Hajjari, Mohammadreza; Raheb, Jamshid; Foroughmand, Ali Mohammad; Asgari, Morteza

    2017-01-01

    Recent reports have indicated that small RNAs have key roles in the response of the E.coli to stress and also in the regulating of virulence factors. It seems that some small non-coding RNAs are involved in multidrug resistance. Previous studies have indicated that rprA can increase the tolerance to Kanamycin in RcsB-deficient Escherichia coli K-12 following osmotic shock. The current study aims to clone and over-express the non-coding RNA rprA in E.coli and investigate its effect on the bacterial resistance to Kanamycin without any osmotic shock. For this purpose, rprA gene was amplified by the PCR and then cloned into the PET-28a (+) vector. The recombinant plasmid was transformed into wild type E.coli BL21 (DE3). The over expression was induced by IPTG and confirmed by qRT-PCR. The resistance to the kanamycin was then measured in different times by spectrophotometry. The statistical analysis showed that the rprA can increase the resistance to Kanamycin in Ecoli K12. The interaction between rprA and rpoS was reviewed and analyzed by in silico methods. The results showed that the bacteria with over-expressed rprA were more resistant to Kanamycin. The present study is an important step to prove the role of non-coding RNA rprA in bacterial resistance. The data can be the basis for future works and can also help to develop and deliver next-generation antibiotics.

  14. Cloning and over expression of non-coding RNA rprA in E.coli and its resistance to Kanamycin without osmotic shock

    PubMed Central

    Sahni, Azita; Hajjari, Mohammadreza; Raheb, Jamshid; Foroughmand, Ali Mohammad; Asgari, Morteza

    2017-01-01

    Recent reports have indicated that small RNAs have key roles in the response of the E.coli to stress and also in the regulating of virulence factors. It seems that some small non-coding RNAs are involved in multidrug resistance. Previous studies have indicated that rprA can increase the tolerance to Kanamycin in RcsB-deficient Escherichia coli K-12 following osmotic shock. The current study aims to clone and over-express the non-coding RNA rprA in E.coli and investigate its effect on the bacterial resistance to Kanamycin without any osmotic shock. For this purpose, rprA gene was amplified by the PCR and then cloned into the PET-28a (+) vector. The recombinant plasmid was transformed into wild type E.coli BL21 (DE3). The over expression was induced by IPTG and confirmed by qRT-PCR. The resistance to the kanamycin was then measured in different times by spectrophotometry. The statistical analysis showed that the rprA can increase the resistance to Kanamycin in Ecoli K12. The interaction between rprA and rpoS was reviewed and analyzed by in silico methods. The results showed that the bacteria with over-expressed rprA were more resistant to Kanamycin. The present study is an important step to prove the role of non-coding RNA rprA in bacterial resistance. The data can be the basis for future works and can also help to develop and deliver next-generation antibiotics. PMID:28479746

  15. Novel blaROB-1-Bearing Plasmid Conferring Resistance to β-Lactams in Haemophilus parasuis Isolates from Healthy Weaning Pigs

    PubMed Central

    Moleres, Javier; Santos-López, Alfonso; Lázaro, Isidro; Labairu, Javier; Prat, Cristina; Ardanuy, Carmen; González-Zorn, Bruno

    2015-01-01

    Haemophilus parasuis, the causative agent of Glässer's disease, is one of the early colonizers of the nasal mucosa of piglets. It is prevalent in swine herds, and lesions associated with disease are fibrinous polyserositis and bronchopneumonia. Antibiotics are commonly used in disease control, and resistance to several antibiotics has been described in H. parasuis. Prediction of H. parasuis virulence is currently limited by our scarce understanding of its pathogenicity. Some genes have been associated with H. parasuis virulence, such as lsgB and group 1 vtaA, while biofilm growth has been associated with nonvirulent strains. In this study, 86 H. parasuis nasal isolates from farms that had not had a case of disease for more than 10 years were obtained by sampling piglets at weaning. Isolates were studied by enterobacterial repetitive intergenic consensus PCR and determination of the presence of lsgB and group 1 vtaA, biofilm formation, inflammatory cell response, and resistance to antibiotics. As part of the diversity encountered, a novel 2,661-bp plasmid, named pJMA-1, bearing the blaROB-1 β-lactamase was detected in eight colonizing strains. pJMA-1 was shown to share a backbone with other small plasmids described in the Pasteurellaceae, to be 100% stable, and to have a lower biological cost than the previously described plasmid pB1000. pJMA-1 was also found in nine H. parasuis nasal strains from a separate collection, but it was not detected in isolates from the lesions of animals with Glässer's disease or in nontypeable Haemophilus influenzae isolates. Altogether, we show that commensal H. parasuis isolates represent a reservoir of β-lactam resistance genes which can be transferred to pathogens or other bacteria. PMID:25747001

  16. Novel blaROB-1-bearing plasmid conferring resistance to β-lactams in Haemophilus parasuis isolates from healthy weaning pigs.

    PubMed

    Moleres, Javier; Santos-López, Alfonso; Lázaro, Isidro; Labairu, Javier; Prat, Cristina; Ardanuy, Carmen; González-Zorn, Bruno; Aragon, Virginia; Garmendia, Junkal

    2015-05-01

    Haemophilus parasuis, the causative agent of Glässer's disease, is one of the early colonizers of the nasal mucosa of piglets. It is prevalent in swine herds, and lesions associated with disease are fibrinous polyserositis and bronchopneumonia. Antibiotics are commonly used in disease control, and resistance to several antibiotics has been described in H. parasuis. Prediction of H. parasuis virulence is currently limited by our scarce understanding of its pathogenicity. Some genes have been associated with H. parasuis virulence, such as lsgB and group 1 vtaA, while biofilm growth has been associated with nonvirulent strains. In this study, 86 H. parasuis nasal isolates from farms that had not had a case of disease for more than 10 years were obtained by sampling piglets at weaning. Isolates were studied by enterobacterial repetitive intergenic consensus PCR and determination of the presence of lsgB and group 1 vtaA, biofilm formation, inflammatory cell response, and resistance to antibiotics. As part of the diversity encountered, a novel 2,661-bp plasmid, named pJMA-1, bearing the blaROB-1 β-lactamase was detected in eight colonizing strains. pJMA-1 was shown to share a backbone with other small plasmids described in the Pasteurellaceae, to be 100% stable, and to have a lower biological cost than the previously described plasmid pB1000. pJMA-1 was also found in nine H. parasuis nasal strains from a separate collection, but it was not detected in isolates from the lesions of animals with Glässer's disease or in nontypeable Haemophilus influenzae isolates. Altogether, we show that commensal H. parasuis isolates represent a reservoir of β-lactam resistance genes which can be transferred to pathogens or other bacteria. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

  17. Detection of the plasmid-mediated mcr-1 gene conferring colistin resistance in human and food isolates of Salmonella enterica and Escherichia coli in England and Wales.

    PubMed

    Doumith, Michel; Godbole, Gauri; Ashton, Philip; Larkin, Lesley; Dallman, Tim; Day, Martin; Day, Michaela; Muller-Pebody, Berit; Ellington, Matthew J; de Pinna, Elizabeth; Johnson, Alan P; Hopkins, Katie L; Woodford, Neil

    2016-08-01

    In response to the first report of transmissible colistin resistance mediated by the mcr-1 gene in Escherichia coli and Klebsiella spp. from animals and humans in China, we sought to determine its presence in Enterobacteriaceae isolated in the UK. The PHE archive of whole-genome sequences of isolates from surveillance collections, submissions to reference services and research projects was retrospectively analysed for the presence of mcr-1 using Genefinder. The genetic environment of the gene was also analysed. Rapid screening of the genomes of ∼24 000 Salmonella enterica, E. coli, Klebsiella spp., Enterobacter spp., Campylobacter spp. and Shigella spp. isolated from food or humans identified 15 mcr-1-positive isolates. These comprised: 10 human S. enterica isolates submitted between 2012 and 2015 (8 Salmonella Typhimurium, 1 Salmonella Paratyphi B var Java and 1 Salmonella Virchow) from 10 patients; 3 isolates of E. coli from 2 patients; and 2 isolates of Salmonella Paratyphi B var Java from poultry meat imported from the EU. The mcr-1 gene was located on diverse plasmids belonging to the IncHI2, IncI2 and IncX4 replicon types and its association with ISApl1 varied. Six mcr-1-positive S. enterica isolates were from patients who had recently travelled to Asia. Analysis of WGS data allowed rapid confirmation of the presence of the plasmid-mediated colistin resistance gene mcr-1 in diverse genetic environments and plasmids. It has been present in E. coli and Salmonella spp. harboured by humans in England and Wales since at least 2012. © Crown copyright 2016.

  18. In vivo and in vitro cloning and phenotype characterization of tellurite resistance determinant conferred by plasmid pTE53 of a clinical isolate of Escherichia coli.

    PubMed

    Burian, J; Tu, N; Kl'ucár, L; Guller, L; Lloyd-Jones, G; Stuchlík, S; Fejdi, P; Siekel, P; Turna, J

    1998-01-01

    A determinant encoding resistance against potassium tellurite (Te(r)) was discovered in a clinical isolate of Escherichia coli strain KL53. The strain formed typical black colonies on solid LB medium with tellurite. The determinant was located on a large conjugative plasmid designated pTE53. Electron-dense particles were observed in cells harboring pTE53 by electron microscopy. X-Ray identification analysis identified these deposits as elemental tellurium and X-ray diffraction analysis showed patterns typical of crystalline structures. Comparison with JCPDS 4-0554 (Joint Committee on Powder Diffraction Standards) reference data confirmed that these crystals were pure tellurium crystals. In common with other characterized Te(r) determinants, accumulation studies with radioactively labeled tellurite showed that reduced uptake of tellurite did not contribute to the resistance mechanism. Tellurite accumulation rates for E. coli strain AB1157 harboring pTE53 were twice higher than for the plasmid-free host strain. In addition, no efflux mechanism was detected. The potassium tellurite resistance determinant of plasmid pTE53 was cloned using both in vitro and in vivo techniques in low-copy-number vectors pACYC184 and mini-Mu derivative pPR46. Cloning of the functional Te(r) determinant into high-copy cloning vectors pTZ19R and mini-Mu derivatives pBEf and pJT2 was not successful. During in vivo cloning experiments, clones with unusual "white colony" phenotypes were found on solid LB with tellurite. All these clones were Mucts62 lysogens. Their tellurite resistance levels were in the same order as the wild type strains. Clones with the "white" phenotype had a 3.6 times lower content of tellurium than the tellurite-reducing strain. Transformation of a "white" mutant with a recombinant pACYC184 based Te(r) plasmid did not change the phenotype. However, when one clone was cured from Mucts62 the "white" phenotype reverted to the wild-type "black" phenotype. It was suggested

  19. Emergence of tetracycline resistance due to a multiple drug resistance plasmid in Vibrio cholerae O139.

    PubMed

    Yamamoto, T; Nair, G B; Takeda, Y

    1995-04-01

    Of the 173 clinical strains of Vibrio cholerae O139 isolated from India, Bangladesh, and Thailand tested, six strains from India were resistant to tetracycline, ampicillin, chloramphenicol, kanamycin, and gentamicin. These six strains harbored a self-transmissible plasmid that mediated resistance to tetracycline, ampicillin, chloramphenicol, kanamycin, gentamicin, sulfamethoxazole, trimethoprim, and O/129. The multiple drug resistance plasmids were 200 kb in size and belonged to the incompatibility group C. Although a majority of the O139 strains (94.8%) were highly resistant to streptomycin, sulfamethoxazole, trimethoprim, and O/129, the tetracycline-susceptible strains so far tested were plasmid-negative. The data suggest the existence of two distinct multiple antimicrobial agent resistance (MAR) patterns in V. cholerae O139.

  20. Gold nanoparticle-based colorimetric detection of kanamycin using a DNA aptamer.

    PubMed

    Song, Kyung-Mi; Cho, Minseon; Jo, Hunho; Min, Kyoungin; Jeon, Sung Ho; Kim, Taisun; Han, Min Su; Ku, Ja Kang; Ban, Changill

    2011-08-15

    A selective kanamycin-binding single-strand DNA (ssDNA) aptamer (TGGGGGTTGAGGCTAAGCCGA) was discovered through in vitro selection using affinity chromatography with kanamycin-immobilized sepharose beads. The selected aptamer has a high affinity for kanamycin and also for kanamycin derivatives such as kanamycin B and tobramycin. The dissociation constants (K(d) [kanamycin]=78.8 nM, K(d) [kanamycin B]=84.5 nM, and K(d) [tobramycin]=103 nM) of the new aptamer were determined by fluorescence intensity analysis using 5'-fluorescein amidite (FAM) modification. Using this aptamer, kanamycin was detected down to 25 nM by the gold nanoparticle-based colorimetric method. Because the designed colorimetric method is simple, easy, and visible to the naked eye, it has advantages that make it useful for the detection of kanamycin. Furthermore, the selected new aptamer has many potential applications as a bioprobe for the detection of kanamycin, kanamycin B, and tobramycin in pharmaceutical preparations and food products.

  1. Pheromone-responsive conjugative vancomycin resistance plasmids in Enterococcus faecalis isolates from humans and chicken feces.

    PubMed

    Lim, Suk-Kyung; Tanimoto, Koichi; Tomita, Haruyoshi; Ike, Yasuyoshi

    2006-10-01

    The drug resistances and plasmid contents of a total of 85 vancomycin-resistant enterococcus (VRE) strains that had been isolated in Korea were examined. Fifty-four of the strains originated from samples of chicken feces, and 31 were isolated from hospital patients in Korea. Enterococcus faecalis KV1 and KV2, which had been isolated from a patient and a sample of chicken feces, respectively, were found to carry the plasmids pSL1 and pSL2, respectively. The plasmids transferred resistances to vancomycin, gentamicin, kanamycin, streptomycin, and erythromycin to E. faecalis strains at a high frequency of about 10(-3) per donor cell during 4 hours of broth mating. E. faecalis strains containing each of the pSL plasmids formed clumps after 2 hours of incubation in broth containing E. faecalis FA2-2 culture filtrate (i.e., the E. faecalis sex pheromone), and the plasmid subsequently transferred to the recipient strain in a 10-min short mating in broth, indicating that the plasmids are responsive to E. faecalis pheromones. The pSL plasmids did not respond to any of synthetic pheromones for the previously characterized plasmids. The pheromone specific for pSL plasmids has been designated cSL1. Southern hybridization analysis showed that specific FspI fragments from each of the pSL plasmids hybridized with the aggregation substance gene (asa1) of the pheromone-responsive plasmid pAD1, indicating that the plasmids had a gene homologous to asa1. The restriction maps of the plasmids were identical, and the size of the plasmids was estimated to be 128.1 kb. The plasmids carried five drug resistance determinants for vanA, ermB, aph(3'), aph(6'), and aac(6')/aph(2'), which encode resistance to vancomycin, erythromycin, kanamycin, streptomycin, and gentamicin/kanamycin, respectively. Nucleotide sequence analyses of the drug resistance determinants and their flanking regions are described in this report. The results described provide evidence for the exchange of genetic information

  2. Isolation and screening of plasmids from the epilithon which mobilize recombinant plasmid pD10

    SciTech Connect

    Hill, K.E.; Weightman, A.J.; Fry, J.C. )

    1992-04-01

    This study examined the potential of bacteria from river epilithon to mobilize a recombinant catabolic plasmid, pD10, encoding 3-chlorobenzoate degradation and kanamycin resistance. Fifty-four mobilizing plasmids were exogenously isolated by triparental matings between strains of Pseudomonas putida and epilithic bacteria from the River Taff (South Wales, United Kingdom). Frequencies for mobilization ranged from 1.7 {times} 10{sup {minus}8} to 4.5 {times} 10{sup {minus}3} per recipient at 20C. The sizes of the mobilizing plasmids isolated ranged from 40 kb to over 200 kb, and 19 of 54 were found to encode mercury resistance. Plasmid-encoded resistance from 40 kb to over 200 kb, and 19 of 54 were found to encode mercury resistance. Plasmid-encoded resistance to tetracycline and streptomycin was also found but not resistance to UV light or various heavy metals. Eight plasmids of epilithic bacteria, analyzed by comparing restriction fragmentation patterns, showed significant differences between those isolated from different independent matings. Optimal temperatures for mobilization of pD10 were between 15 and 25C. Four mercury resistance plasmids were found to be broad host range, transferring mercury resistance and mobilizing pD10 readily to representative species of {beta}- and {gamma}-purple bacteria. In general, frequencies of pD10 mobilization by plasmids of epilithic bacteria were 2 to 3 orders of magnitude lower than conjugal transfer frequencies. Thus, there is a high potential for exchange of recombinant genes introduced into the epilithon by mobilization between a variety of bacterial species.

  3. blaCMY-2-positive IncA/C plasmids from Escherichia coli and Salmonella enterica are a distinct component of a larger lineage of plasmids.

    PubMed

    Call, Douglas R; Singer, Randall S; Meng, Da; Broschat, Shira L; Orfe, Lisa H; Anderson, Janet M; Herndon, David R; Kappmeyer, Lowell S; Daniels, Joshua B; Besser, Thomas E

    2010-02-01

    Large multidrug resistance plasmids of the A/C incompatibility complex (IncA/C) have been found in a diverse group of Gram-negative commensal and pathogenic bacteria. We present three completed sequences from IncA/C plasmids that originated from Escherichia coli (cattle) and Salmonella enterica serovar Newport (human) and that carry the cephamycinase gene blaCMY-2. These large plasmids (148 to 166 kbp) share extensive sequence identity and synteny. The most divergent plasmid, peH4H, has lost several conjugation-related genes and has gained a kanamycin resistance region. Two of the plasmids (pAM04528 and peH4H) harbor two copies of blaCMY-2, while the third plasmid (pAR060302) harbors a single copy of the gene. The majority of single-nucleotide polymorphisms comprise nonsynonymous mutations in floR. A comparative analysis of these plasmids with five other published IncA/C plasmids showed that the blaCMY-2 plasmids from E. coli and S. enterica are genetically distinct from those originating from Yersinia pestis and Photobacterium damselae and distal to one originating from Yersinia ruckeri. While the overall similarity of these plasmids supports the likelihood of recent movements among E. coli and S. enterica hosts, their greater divergence from Y. pestis or Y. ruckeri suggests less recent plasmid transfer among these pathogen groups.

  4. RNA-seq analysis of the effect of kanamycin and the ABC transporter AtWBC19 on Arabidopsis thaliana seedlings reveals changes in metal content.

    PubMed

    Mentewab, Ayalew; Matheson, Kinnari; Adebiyi, Morayo; Robinson, Shanice; Elston, Brianna

    2014-01-01

    Plants are exposed to antibiotics produced by soil microorganisms, but little is known about their responses at the transcriptional level. Likewise, few endogenous mechanisms of antibiotic resistance have been reported. The Arabidopsis thaliana ATP Binding Cassette (ABC) transporter AtWBC19 (ABCG19) is known to confer kanamycin resistance, but the exact mechanism of resistance is not well understood. Here we examined the transcriptomes of control seedlings and wbc19 mutant seedlings using RNA-seq analysis. Exposure to kanamycin indicated changes in the organization of the photosynthetic apparatus, metabolic fluxes and metal uptake. Elemental analysis showed a 60% and 80% reduction of iron uptake in control and wbc19 mutant seedlings respectively, upon exposure to kanamycin. The drop in iron content was accompanied by the upregulation of the gene encoding for FERRIC REDUCTION OXIDASE 6 (FRO6) in mutant seedlings but not by the differential expression of other transport genes known to be induced by iron deficiency. In addition, wbc19 mutants displayed a distinct expression profile in the absence of kanamycin. Most notably the expression of several zinc ion binding proteins, including ZINC TRANSPORTER 1 PRECURSOR (ZIP1) was increased, suggesting abnormal zinc uptake. Elemental analysis confirmed a 50% decrease of zinc content in wbc19 mutants. Thus, the antibiotic resistance gene WBC19 appears to also have a role in zinc uptake.

  5. RNA-Seq Analysis of the Effect of Kanamycin and the ABC Transporter AtWBC19 on Arabidopsis thaliana Seedlings Reveals Changes in Metal Content

    PubMed Central

    Mentewab, Ayalew; Matheson, Kinnari; Adebiyi, Morayo; Robinson, Shanice; Elston, Brianna

    2014-01-01

    Plants are exposed to antibiotics produced by soil microorganisms, but little is known about their responses at the transcriptional level. Likewise, few endogenous mechanisms of antibiotic resistance have been reported. The Arabidopsis thaliana ATP Binding Cassette (ABC) transporter AtWBC19 (ABCG19) is known to confer kanamycin resistance, but the exact mechanism of resistance is not well understood. Here we examined the transcriptomes of control seedlings and wbc19 mutant seedlings using RNA-seq analysis. Exposure to kanamycin indicated changes in the organization of the photosynthetic apparatus, metabolic fluxes and metal uptake. Elemental analysis showed a 60% and 80% reduction of iron uptake in control and wbc19 mutant seedlings respectively, upon exposure to kanamycin. The drop in iron content was accompanied by the upregulation of the gene encoding for FERRIC REDUCTION OXIDASE 6 (FRO6) in mutant seedlings but not by the differential expression of other transport genes known to be induced by iron deficiency. In addition, wbc19 mutants displayed a distinct expression profile in the absence of kanamycin. Most notably the expression of several zinc ion binding proteins, including ZINC TRANSPORTER 1 PRECURSOR (ZIP1) was increased, suggesting abnormal zinc uptake. Elemental analysis confirmed a 50% decrease of zinc content in wbc19 mutants. Thus, the antibiotic resistance gene WBC19 appears to also have a role in zinc uptake. PMID:25310285

  6. Kanamycin Resistance Cassette for Genetic Manipulation of Treponema denticola.

    PubMed

    Li, Yuebin; Ruby, John; Wu, Hui

    2015-07-01

    Treponema denticola has been recognized as an important oral pathogen of the "red complex" bacterial consortium that is associated with the pathogenesis of endodontal and periodontal diseases. However, little is known about the virulence of T. denticola due to its recalcitrant genetic system. The difficulty in genetically manipulating oral spirochetes is partially due to the lack of antibiotic resistance cassettes that are useful for gene complementation following allelic replacement mutagenesis. In this study, a kanamycin resistance cassette was identified and developed for the genetic manipulation of T. denticola ATCC 35405. Compared to the widely used ermF-ermAM cassette, the kanamycin cassette used in the transformation experiments gave rise to additional antibiotic-resistant T. denticola colonies. The kanamycin cassette is effective for allelic replacement mutagenesis as demonstrated by inactivation of two open reading frames of T. denticola, TDE1430 and TDE0911. In addition, the cassette is also functional in trans-chromosomal complementation. This was determined by functional rescue of a periplasmic flagellum (PF)-deficient mutant that had the flgE gene coding for PF hook protein inactivated. The integration of the full-length flgE gene into the genome of the flgE mutant rescued all of the defects associated with the flgE mutant that included the lack of PF filament and spirochetal motility. Taken together, we demonstrate that the kanamycin resistance gene is a suitable cassette for the genetic manipulation of T. denticola that will facilitate the characterization of virulence factors attributed to this important oral pathogen.

  7. Complete nucleotide sequence of plasmid pNA6 reveals the high plasticity of IncU family plasmids.

    PubMed

    Dang, Bingjun; Xu, Yan; Mao, Daqing; Luo, Yi

    2016-10-10

    Antibiotic resistance is a serious problem in health care and is of widespread public concern. Conjugative plasmids are the most important vectors in the dissemination of antibiotic resistance genes. In this study, we determined the complete sequence of plasmid pNA6, a plasmid which was isolated from the sediments of Haihe River. This plasmid confers reduced susceptibility to ampicillin, erythromycin and sulfamethoxazole. The complete sequence of plasmid pNA6 was 52,210bp in length with an average G+C content of 52.70%. Plasmid pNA6 belongs to the IncU group by sequence queries against the GenBank database. This plasmid has a typical IncU backbone and shows the highest similarities with plasmid RA3 and plasmid pFBAOT6. Plasmid pNA6 carries a class 1 integron consisting of aacA4, ereA and dfrA1 genes. Moreover, plasmid pNA6 also harbors a blaTEM-1-containing complex structure which inserted into the replication region and maintenance region. This insertion site has never been found on other IncU plasmids. The sequencing of plasmid pNA6 will add new sequence information to IncU family plasmids and enhance our understanding of the plasticity of IncU family plasmids.

  8. CHARACTERIZATION OF A 3.3-KB PLASMID OF ESCHERICHIA COLI O157:H7 AND EVALUATION OF STABILITY OF GENETICALLY ENGINEERED DERIVATIVES OF THIS PLASMID EXPRESSING GREEN FLUORESCENCE

    USDA-ARS?s Scientific Manuscript database

    Enterohemorrhagic Escherichia coli (EHEC) O157:H7 (strain 86-24) harbors a 3.3 kb, cryptic plasmid (pSP70) that does not encode a selectable phenotype. A transposon (Tn) encoding kanamycin resistance (Kan**r) was inserted by in vitro transposon mutagenesis at a random location on pSP70 to construct...

  9. Plasmids in diatom species.

    PubMed Central

    Hildebrand, M; Corey, D K; Ludwig, J R; Kukel, A; Feng, T Y; Volcani, B E

    1991-01-01

    We have discovered plasmids in 5 of 18 diatom species surveyed. In several species, more than one type of plasmid is present. Several of the plasmids show similarity by hybridization previously characterized plasmids in Cylindrotheca fusiformis (J. D. Jacobs et al., unpublished data). Additionally, there is similarity between the plasmids found in C. fusiformis and chloroplast DNA in three diatom species. These results add to the evidence that the plasmids have features of mobile genetic elements. Images PMID:1885558

  10. Plasmid incidence in bacteria from deep subsurface sediments

    SciTech Connect

    Fredrickson, J.K.; Hicks, R.J.; Li, S.W.; Brockman, F.J. )

    1988-12-01

    Bacteria were isolated from deep terrestrial subsurface sediments underlying the coastal plain of South Carolina. A total of 163 isolates from deep sediments, surface soil, and return drill muds were examined for plasmid DNA content and resistance to the antibiotics penicillin, ampicillin, carbenicillin, streptomycin, kanamycin, and tetracycline. MICs of Cu{sup 2+}, Cr{sup 3+}, and Hg{sup 2+} for each isolate were also determined. The overall frequency of plasmid occurrence in the subsurface bacteria was 33%. Resistance was most frequent to penicillin (70% of all isolates), ampicillin (49%), and carbenicillin (32%) and was concluded to be related to the concentrations of the individual antibiotics in the disks used for assaying resistance and to the production of low levels of {beta}-lactamase. The frequencies of resistance to penicillin and ampicillin were significantly greater for isolates bearing plasmids than for plasmidless isolates; however, resistance was not transferable to penicillin-sensitive Escherichia coli. Hybridization of subsurface bacterial plasmids and chromosomal DNA with a whole-TOL-plasmid (pWWO) probe revealed some homology of subsurface bacterial plasmid and chromosomal DNAs, indicating a potential for those bacterial to harbor catabolic genes on plasmids or chromosomes. The incidences of antibiotic resistance and MICs of metals for subsurface bacteria were significantly different from those drill mud bacteria, ruling out the possibility that bacteria from sediments were derived from drill muds.

  11. Characterization of aminoglycoside-modifying enzymes in enterobacteriaceae clinical strains and characterization of the plasmids implicated in their diffusion.

    PubMed

    Miró, Elisenda; Grünbaum, Federico; Gómez, Laura; Rivera, Alba; Mirelis, Beatriz; Coll, Pere; Navarro, Ferran

    2013-04-01

    A total of 788 clinical Enterobacteriaceae were collected to describe the aminoglycoside-modifying genes (AME genes) and to characterize the plasmids that carry these genes. Among the 788 strains collected, 330 (41.8%) were aminoglycoside-resistant: 264 Escherichia coli (80%), 33 Proteus mirabilis (10%), 10 Klebsiella pneumoniae (3%), six K. oxytoca (1.8%), five Enterobacter cloacae (1.5%), three Morganella morganii (0.9%), three Providencia stuartii (0.9%), two Salmonella enterica (0.6%), and one each Citrobacter freundii, C. koseri, Proteus vulgaris, and Shigella sonnei. The most affected aminoglycoside was streptomycin (92.7%), followed by kanamycin (26.3%), gentamicin (18%), tobramycin (16.9%), netilmicin (3.6%), and amikacin (1.5%). The AME genes found were aph(3″)-Ib (65.4%), ant(3″)-Ia (37.5%), aph(3')-Ia (13.9%), aac(3)-IIa (12.4%), aac(6')-Ib (4.2%), ant(2″)-Ia (3.6%), and aph(3')-IIa (1.2%). Thirty-four percent of the strains showed more than one enzyme. The most frequent association was ant(3″)-Ia plus aph(3″)-Ib (35 strains). From 66 selected AME genes, 24 were plasmid located: 12 aac(3)-IIa, six aph(3')-Ia, three ant(3″)-Ia, two ant(2″)-Ia, and one aac(6')-Ib. These genes were located in plasmids belonging to incompatibility groups F, FIA, FIB, or HI2. In conclusion, the AME genes involved in aminoglycoside-clinical resistance were aac(3)-IIa, aac(6')-Ib, and ant(2″)-Ia, genes that confer resistance to tobramycin, gentamicin, and amikacin.

  12. Small-plasmid-mediated antibiotic resistance is enhanced by increases in plasmid copy number and bacterial fitness.

    PubMed

    San Millan, Alvaro; Santos-Lopez, Alfonso; Ortega-Huedo, Rafael; Bernabe-Balas, Cristina; Kennedy, Sean P; Gonzalez-Zorn, Bruno

    2015-01-01

    Plasmids play a key role in the horizontal spread of antibiotic resistance determinants among bacterial pathogens. When an antibiotic resistance plasmid arrives in a new bacterial host, it produces a fitness cost, causing a competitive disadvantage for the plasmid-bearing bacterium in the absence of antibiotics. On the other hand, in the presence of antibiotics, the plasmid promotes the survival of the clone. The adaptations experienced by plasmid and bacterium in the presence of antibiotics during the first generations of coexistence will be crucial for the progress of the infection and the maintenance of plasmid-mediated resistance once the treatment is over. Here we developed a model system using the human pathogen Haemophilus influenzae carrying the small plasmid pB1000 conferring resistance to β-lactam antibiotics to investigate host and plasmid adaptations in the course of a simulated ampicillin therapy. Our results proved that plasmid-bearing clones compensated for the fitness disadvantage during the first 100 generations of plasmid-host adaptation. In addition, ampicillin treatment was associated with an increase in pB1000 copy number. The augmentation in both bacterial fitness and plasmid copy number gave rise to H. influenzae populations with higher ampicillin resistance levels. In conclusion, we show here that the modulations in bacterial fitness and plasmid copy number help a plasmid-bearing bacterium to adapt during antibiotic therapy, promoting both the survival of the host and the spread of the plasmid.

  13. Transformation of Azotobacter vinelandii with plasmid DNA.

    PubMed Central

    Glick, B R; Brooks, H E; Pasternak, J J

    1985-01-01

    Azotobacter vinelandii cells can be transformed at high frequencies with the broad-host-range plasmids pRK2501, RSF1010, and pGSS15, using a modification of the procedure developed by Page and von Tigerstrom (J. Bacteriol. 139:1058-1061, 1979) for chromosomal DNA-mediated transformation. The frequency of transformation per microgram of plasmid DNA per viable cell with pRK2501 and pGSS15 was about 5 X 10(-2) and 2 X 10(-2), respectively. With RSF1010, transformation frequencies ranged from 3 X 10(-4) to 4 X 10(-2). With each plasmid, the frequency of transformation was independent of the phase of the growth cycle. When concentrations of pRK2501 ranging from 0.1 to 51 micrograms of DNA were tested, the frequency of transformation was directly proportional to the amount of DNA. This linear response indicated that, although the uptake of plasmid DNA with this procedure may be inefficient, there is a high probability that once inside a cell the plasmid will be stably maintained. Cells that have been transformed with pRK2501 did not grow well on transforming medium which lacks iron and contains fixed nitrogen. However, on growth medium which contains iron and lacks fixed nitrogen, transformants produced distinctive colonies larger than those of nontransformed cells. Resistance to kanamycin due to transformation by pRK2501 was stably maintained for at least 10 successive generations in the absence of selective pressure. The present protocol should facilitate the molecular cloning of genes in Azotobacter spp. Images PMID:3980437

  14. Plasmid DNA manufacturing technology.

    PubMed

    Carnes, Aaron E; Williams, James A

    2007-01-01

    Today, plasmid DNA is becoming increasingly important as the next generation of biotechnology products (gene medicines and DNA vaccines) make their way into clinical trials, and eventually into the pharmaceutical marketplace. This review summarizes recent patents and patent applications relating to plasmid manufacturing, in the context of a comprehensive description of the plasmid manufacturing intellectual property landscape. Strategies for plasmid manufacturers to develop or in-license key plasmid manufacturing technologies are described with the endpoint of efficiently producing kg quantities of plasmid DNA of a quality that meets anticipated European and FDA quality specifications for commercial plasmid products.

  15. Transformation of heat-treated Clostridium acetobutylicum protoplasts with pUB110 plasmid DNA

    SciTech Connect

    Lin, Y.L.; Blaschek, H.P.

    1984-10-01

    Heat treatment of Clostridium acetobutylicum SA-1 protoplasts at 55/sup 0/C for 15 min before transformation resulted in expression in this microorganism of the kanamycin resistance determinant associated with plasmid pUB110. No heat treatment, or heat treatment at 65 or 44/sup 0/C for various time intervals, resulted in no kanamycin resistance transformants being recovered on selective kanamycin-containing regeneration medium. DNase plate assay indicated that treatment at 55/sup 0/C for 15 min completely inactivated the DNase activity associated with SA-1 protoplasts. Treatment of protoplasts at 65 or 55/sup 0/C for various periods under simulated transformation conditions had an inhibitory effect, although prolonged treatment at 55 or 44/sup 0/C appeared to stimulate DNase activity. Inactivation of protoplast-associated DNase activity by heat treatment at 55/sup 0/C for 15 min correlated with successful expression of kanamycin resistance and suggests that an extremely active, heat-sensitive, protoplast-associated DNase may be a factor in the polyethylene glycol-induced transformation of C. acetobutylicum SA-1 protoplasts. Plasmid pUB110 DNA was isolated from C. acetobutylicum SA-1 kanamycin-resistant (Km/sup r/) transformant cultures by a modification of the procedure used for C. perfringens plasmids. Detection of pUB110 DNA was possible only when diethyl pyrocarbonate was incorporated into isolation protocols to inactivate DNase activity. Restriction studies further verified the presence of pUB110 DNA in C. acetobutylicum SA-1 Km/sup r/ transformants. 36 references, 4 figures, 1 table.

  16. Plasmids of Azotobacter vinelandii.

    PubMed Central

    Maia, M; Sanchez, J M; Vela, G R

    1988-01-01

    Four laboratory strains and two isolates of Azotobacter vinelandii were found to contain plasmids. Twenty-five laboratory strains which could fix nitrogen did not have free, covalently closed circular plasmid DNA. The plasmids varied in size from 9 to 52 megadaltons, and each strain yielded only one plasmid. No discernible differences in ability to fix nitrogen were found between plasmid-bearing and cured cultures. PMID:3350795

  17. High-frequency transformation of Brevibacterium lactofermentum protoplasts by plasmid DNA.

    PubMed

    Santamaria, R I; Gil, J A; Martin, J F

    1985-04-01

    An efficient polyethylene glycol-assisted method for transformation of Brevibacterium lactofermentum protoplasts that uses plasmid vectors has been developed. Two small plasmids, pUL330 (5.2 kilobases) and pUL340 (5.8 kilobases), both containing the kanamycin resistance gene from transposon Tn5 and the replication origin of the natural plasmid pBL1 of B. lactofermentum, were selected as vectors. Supercoiled forms of the plasmids yielded a 100-fold higher transformation frequency than did linear forms. The optimal transformation frequency was achieved with 10 ng of DNA in 1 ml of transformation buffer. Higher concentrations of plasmid DNA resulted in a decrease in transformation frequency per microgram of DNA. Optimal transformation was obtained with 25 to 35% polyethylene glycol 6000. Under optimal conditions, 10(6) transformants per microgram of DNA were obtained.

  18. Isolation by genetic labeling of a new mycobacterial plasmid, pJAZ38, from Mycobacterium fortuitum.

    PubMed Central

    Gavigan, J A; Aínsa, J A; Pérez, E; Otal, I; Martín, C

    1997-01-01

    In a two-step mating experiment with recipient strains of Mycobacterium smegmatis, the Mycobacterium fortuitum cryptic plasmid pJAZ38 was isolated. Plasmid pJAZ38 was genetically labeled by cointegration formation mediated by the kanamycin-resistant mycobacterial transposon Tn611. The region responsible for replication of pJAZ38 was located and sequenced. This region showed homology with the Mycobacterium avium plasmid pLR7 and the Mycobacterium scrofulaceum plasmid pMSC262, a family of plasmids which have been found to be widespread throughout the mycobacteria. Further experiments showed pJAZ38 to be stably inherited in the absence of selection pressure and compatible with the most commonly used mycobacterial replicon, pAL5000. In contrast to pLR7 and pMSC262, pJAZ38 was able to replicate in M. smegmatis mc(2)155, making it a useful tool for mycobacterial genetics. PMID:9209023

  19. Plasmids from Euryarchaeota.

    PubMed

    Forterre, Patrick; Krupovic, Mart; Raymann, Kasie; Soler, Nicolas

    2014-12-01

    Many plasmids have been described in Euryarchaeota, one of the three major archaeal phyla, most of them in salt-loving haloarchaea and hyperthermophilic Thermococcales. These plasmids resemble bacterial plasmids in terms of size (from small plasmids encoding only one gene up to large megaplasmids) and replication mechanisms (rolling circle or theta). Some of them are related to viral genomes and form a more or less continuous sequence space including many integrated elements. Plasmids from Euryarchaeota have been useful for designing efficient genetic tools for these microorganisms. In addition, they have also been used to probe the topological state of plasmids in species with or without DNA gyrase and/or reverse gyrase. Plasmids from Euryarchaeota encode both DNA replication proteins recruited from their hosts and novel families of DNA replication proteins. Euryarchaeota form an interesting playground to test evolutionary hypotheses on the origin and evolution of viruses and plasmids, since a robust phylogeny is available for this phylum. Preliminary studies have shown that for different plasmid families, plasmids share a common gene pool and coevolve with their hosts. They are involved in gene transfer, mostly between plasmids and viruses present in closely related species, but rarely between cells from distantly related archaeal lineages. With few exceptions (e.g., plasmids carrying gas vesicle genes), most archaeal plasmids seem to be cryptic. Interestingly, plasmids and viral genomes have been detected in extracellular membrane vesicles produced by Thermococcales, suggesting that these vesicles could be involved in the transfer of viruses and plasmids between cells.

  20. Loss of plasmids containing cloned inserts coding for novobiocin resistance or novobiocin sensitivity in Haemophilus influenzae

    SciTech Connect

    Setlow, J.K.; Spikes, D.; Ledbetter, M.

    1984-06-01

    Plasmids pNov1 and pNov1s, coding for resistance and sensitivity to novobiocin, respectively, were readily lost from wild-type Haemophilus influenzae but retained in a strain lacking an inducible defective prophage. The plasmid loss could be partly or wholly eliminated by a low-copy-number mutation in the plasmid or by the presence of certain antibiotic resistance markers in the host chromosome. Release of both phage HP1c1, measured by plaque assay, and defective phage, measured by electron microscopy, was increased when the plasmids were present. The frequency of recombination between pNov1 and the chromosome, causing the plasmid to be converted to pNov1s, could under some circumstances be decreased from the normal 60 to 70% to below 10% by the presence of a kanamycin resistance marker in the chromosome. This suggested that a gene product coded for by the plasmid, the expression of which was affected by the kanamycin resistance marker, was responsible for the high recombination frequency. Evidence was obtained from in vitro experiments that the gene product was a gyrase.

  1. Biology of the staphylococcal conjugative multiresistance plasmid pSK41.

    PubMed

    Liu, Michael A; Kwong, Stephen M; Jensen, Slade O; Brzoska, Anthony J; Firth, Neville

    2013-07-01

    Plasmid pSK41 is a large, low-copy-number, conjugative plasmid from Staphylococcus aureus that is representative of a family of staphylococcal plasmids that confer multiple resistances to a wide range of antimicrobial agents. The plasmid consists of a conserved plasmid backbone containing the genes for plasmid housekeeping functions, which is punctuated by copies of IS257 that flank a Tn4001-hybrid structure and cointegrated plasmids that harbour resistance genes. This review summarises the current understanding of the biology of pSK41, focussing on the systems responsible for its replication, maintenance and transmission, and their regulation.

  2. Exposing Plasmids as the Achilles’ Heel of Drug-Resistant Bacteria

    PubMed Central

    Williams, Julia J.; Hergenrother, Paul J.

    2008-01-01

    Many multi-drug resistant bacterial pathogens harbor large plasmids that encode proteins conferring resistance to antibiotics. While the acquisition of these plasmids often enables bacteria to survive in the presence of antibiotics, it is possible that plasmids also represent a vulnerability that can be exploited in tailored antibacterial therapy. This review highlights three recently described strategies designed to specifically combat bacteria harboring such plasmids: Inhibition of plasmid conjugation, inhibition of plasmid replication, and exploitation of plasmid-encoded toxin-antitoxin systems. PMID:18625335

  3. Novel Plasmid-Borne Multidrug Resistance Gene Cluster Including lsa(E) from a Linezolid-Resistant Enterococcus faecium Isolate of Swine Origin

    PubMed Central

    Si, Hongbin; Zhang, Wan-Jiang; Chu, Shengbo; Wang, Xiu-Mei; Dai, Lei; Hua, Xin; Dong, Zhimin

    2015-01-01

    A novel nonconjugative plasmid of 28,489 bp from a porcine linezolid-resistant Enterococcus faecium isolate was completely sequenced. This plasmid harbored a novel type of multiresistance gene cluster that comprised the resistance genes lnu(B), lsa(E), spw, aadE, aphA3, and two copies of erm(B), which account for resistance to macrolides, lincosamides, streptogramins, pleuromutilins, streptomycin, spectinomycin, and kanamycin/neomycin. Structural comparisons suggested that this plasmid might have developed from other enterococcal plasmids by insertion element (IS)-mediated interplasmid recombination processes. PMID:26324271

  4. Plasmid diversity in neisseriae.

    PubMed

    van Passel, Mark W J; van der Ende, Arie; Bart, Aldert

    2006-08-01

    Horizontal gene transfer constitutes an important force in prokaryotic genome evolution, and it is well-known that plasmids are vehicles for DNA transfer. Chromosomal DNA is frequently exchanged between pathogenic and commensal neisseriae, but relatively little is known about plasmid diversity and prevalence among these nasopharyngeal inhabitants. We investigated the plasmid contents of 18 Neisseria lactamica isolates and 20 nasopharyngeal Neisseria meningitidis isolates. Of 18 N. lactamica strains, 9 harbored one or more plasmids, whereas only one N. meningitidis isolate contained a plasmid. Twelve plasmids were completely sequenced, while five plasmid sequences from the public databases were also included in the analyses. On the basis of nucleic acid sequences, mobilization, and replicase protein alignments, we distinguish six different plasmid groups (I to VI). Three plasmids from N. lactamica appeared to be highly similar on the nucleotide level to the meningococcal plasmids pJS-A (>99%) and pJS-B (>75%). The genetic organizations of two plasmids show a striking resemblance with that of the recently identified meningococcal disease-associated (MDA) phage, while four putative proteins encoded by these plasmids show 25% to 39% protein identity to those encoded by the MDA phage. The putative promoter of the gene encoding the replicase on these plasmids contains a polycytidine tract, suggesting that replication is subjected to phase variation. In conclusion, extensive plasmid diversity is encountered among commensal neisseriae. Members of three plasmid groups are found in both pathogenic and commensal neisseriae, indicating plasmid exchange between these species. Resemblance between plasmids and MDA phage may be indicative of dissemination of phage-related sequences among pathogenic and commensal neisseriae.

  5. 21 CFR 524.1200 - Kanamycin ophthalmic and topical dosage forms.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... 21 Food and Drugs 6 2011-04-01 2011-04-01 false Kanamycin ophthalmic and topical dosage forms. 524.1200 Section 524.1200 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN... ANIMAL DRUGS § 524.1200 Kanamycin ophthalmic and topical dosage forms. ...

  6. 21 CFR 524.1200 - Kanamycin ophthalmic and topical dosage forms.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... 21 Food and Drugs 6 2010-04-01 2010-04-01 false Kanamycin ophthalmic and topical dosage forms. 524.1200 Section 524.1200 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN... ANIMAL DRUGS § 524.1200 Kanamycin ophthalmic and topical dosage forms. ...

  7. 21 CFR 524.1200 - Kanamycin ophthalmic and topical dosage forms.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... 21 Food and Drugs 6 2013-04-01 2013-04-01 false Kanamycin ophthalmic and topical dosage forms. 524.1200 Section 524.1200 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN... ANIMAL DRUGS § 524.1200 Kanamycin ophthalmic and topical dosage forms....

  8. 21 CFR 524.1200 - Kanamycin ophthalmic and topical dosage forms.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ... 21 Food and Drugs 6 2012-04-01 2012-04-01 false Kanamycin ophthalmic and topical dosage forms. 524.1200 Section 524.1200 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN... ANIMAL DRUGS § 524.1200 Kanamycin ophthalmic and topical dosage forms....

  9. 21 CFR 524.1200 - Kanamycin ophthalmic and topical dosage forms.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... 21 Food and Drugs 6 2014-04-01 2014-04-01 false Kanamycin ophthalmic and topical dosage forms. 524.1200 Section 524.1200 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN... ANIMAL DRUGS § 524.1200 Kanamycin ophthalmic and topical dosage forms....

  10. Development of immunoassays for the detection of kanamycin in veterinary fields

    PubMed Central

    Jin, Yong; Jang, Jin-Wook; Han, Chang-Hoon

    2006-01-01

    Monoclonal antibody against kanamycin was prepared, and competitive direct ELISA and immunochromatographic assay were developed using the antibody to detect kanamycin in animal plasma and milk. The monoclonal antibody produced was identified to be IgG1, which has a kappa light chain. No cross-reactivity of the antibody was detected with other aminoglycosides, indicating that the monoclonal antibody was highly specific for kanamycin. Based on competitive direct ELISA, the detection limits of kanamycin were determined to be 1.1 ng/ml in PBS, 1.4 ng/ml in plasma, and 1.0 ng/ml in milk. The concentration of intramuscularly injected kanamycin was successfully monitored in rabbit plasma with competitive direct ELISA. Based on the colloidal gold-based immunochromatographic assay, the detection limits of kanamycin were estimated to be about 6-8 ng/ml in PBS, plasma, and milk. The immunochromatographic assay would be suitable for rapid and simple screening of kanamycin residues in veterinary medicine. Screened positives can be confirmed using a more sensitive laboratory method such as competitive direct ELISA. Therefore, the assays developed in this study could be used to complement each other as well as other laboratory findings. Moreover, instead of slaughtering the animals to obtain test samples, these methods could be applied to determine kanamycin concentration in the plasma of live animals. PMID:16645333

  11. Development of immunoassays for the detection of kanamycin in veterinary fields.

    PubMed

    Jin, Yong; Jang, Jin-Wook; Han, Chang-Hoon; Lee, Mun-Han

    2006-06-01

    Monoclonal antibody against kanamycin was prepared, and competitive direct ELISA and immunochromatographic assay were developed using the antibody to detect kanamycin in animal plasma and milk. The monoclonal antibody produced was identified to be IgG1, which has a kappa light chain. No cross-reactivity of the antibody was detected with other aminoglycosides, indicating that the monoclonal antibody was highly specific for kanamycin. Based on competitive direct ELISA, the detection limits of kanamycin were determined to be 1.1 ng/ml in PBS, 1.4 ng/ml in plasma, and 1.0 ng/ml in milk. The concentration of intramuscularly injected kanamycin was successfully monitored in rabbit plasma with competitive direct ELISA. Based on the colloidal gold-based immunochromatographic assay, the detection limits of kanamycin were estimated to be about 6-8 ng/ml in PBS, plasma, and milk. The immunochromatographic assay would be suitable for rapid and simple screening of kanamycin residues in veterinary medicine. Screened positives can be confirmed using a more sensitive laboratory method such as competitive direct ELISA. Therefore, the assays developed in this study could be used to complement each other as well as other laboratory findings. Moreover, instead of slaughtering the animals to obtain test samples, these methods could be applied to determine kanamycin concentration in the plasma of live animals.

  12. Discordant resistance to kanamycin and amikacin in drug-resistant Mycobacterium tuberculosis.

    PubMed

    Krüüner, Annika; Jureen, Pontus; Levina, Klavdia; Ghebremichael, Solomon; Hoffner, Sven

    2003-09-01

    It is generally thought that there is full cross-resistance in Mycobacterium tuberculosis between the aminoglycoside drugs kanamycin and amikacin. However, kanamycin resistance and amikacin susceptibility were seen in 43 of 79 (54%) multidrug-resistant Estonian isolates, indicating that there might be a need to test the resistance of M. tuberculosis isolates to both drugs.

  13. Fructose restores susceptibility of multidrug-resistant Edwardsiella tarda to kanamycin.

    PubMed

    Su, Yu-bin; Peng, Bo; Han, Yi; Li, Hui; Peng, Xuan-xian

    2015-03-06

    Edwardsiella tarda, the causative agent of Edwardsiellosis, imposes medical challenges in both the clinic and aquaculture. The emergence of multidrug resistant strains makes antibiotic treatment impractical. The identification of molecules that facilitate or promote antibiotic efficacy is in high demand. In the present study, we aimed to identify small molecules whose abundance is correlated with kanamycin resistance in E. tarda by gas chromatography-mass spectrometry. We found that the abundance of fructose was greatly suppressed in kanamycin-resistant strains. The incubation of kanamycin-resistant bacteria with exogenous fructose sensitized the bacteria to kanamycin. Moreover, the fructose also functioned in bacteria persisters and biofilm. The synergistic effects of fructose and kanamycin were validated in a mouse model. Furthermore, the mechanism relies on fructose in activating TCA cycle to produce NADH, which generates proton motive force to increase the uptake of the antibiotics. Therefore, we present a novel approach in fighting against multidrug resistant bacteria through exploration of antibiotic-suppressed molecules.

  14. Sensitivity to detergents and plasmid curing in Enterococcus faecalis.

    PubMed

    Keyhani, Jacqueline; Keyhani, Ezzatollah; Attar, Farnoosh; Haddadi, Azam

    2006-03-01

    This research reports the sensitivity of a clinical isolate of Enterococcus faecalis to sodium N-lauroylsarcosinate (sarkosyl) and sodium dodecyl sulfate (SDS), as well as the efficiency of these detergents in curing the strain. Compared to Escherichia coli, Enterococcus faecalis was very sensitive to both detergents, with minimum inhibitory concentrations (MIC) for the latter being 100 times lower than for Escherichia coli. The clinical isolate of Enterococcus faecalis used in this study exhibited plasmid-borne resistance to kanamycin (MIC 2 mg/ml) and tetracycline (MIC 50 mug/ml); 3% curing was observed after growth in the presence of sarkosyl but no curing was observed after growth in the presence of either SDS or acridine orange. In contrast, 35% curing of plasmid-bearing Escherichia coli was observed after growth in the presence of either SDS or acridine orange, but none was observed after growth in the presence of sarkosyl.

  15. A conjugative plasmid carrying the carbapenem resistance gene blaOXA-23 in AbaR4 in an extensively resistant GC1 Acinetobacter baumannii isolate

    PubMed Central

    Hamidian, Mohammad; Kenyon, Johanna J.; Holt, Kathryn E.; Pickard, Derek; Hall, Ruth M.

    2014-01-01

    Objectives To locate the acquired blaOXA-23 carbapenem resistance gene in an Australian A. baumannii global clone 1 (GC1) isolate. Methods The genome of the extensively antibiotic-resistant GC1 isolate A85 harbouring blaOXA-23 in Tn2006 was sequenced using Illumina HiSeq, and the reads were used to generate a de novo assembly. PCR was used to assemble relevant contigs. Sequences were compared with ones in GenBank. Conjugation experiments were conducted. Results The sporadic GC1 isolate A85, recovered in 2003, was extensively resistant, exhibiting resistance to imipenem, meropenem and ticarcillin/clavulanate, to cephalosporins and fluoroquinolones and to the older antibiotics gentamicin, kanamycin and neomycin, sulfamethoxazole, trimethoprim and tetracycline. Genes for resistance to older antibiotics are in the chromosome, in an AbaR3 resistance island. A second copy of the ampC gene in Tn6168 confers cephalosporin resistance and the gyrA and parC genes have mutations leading to fluoroquinolone resistance. An 86 335 bp repAci6 plasmid, pA85-3, carrying blaOXA-23 in Tn2006 in AbaR4, was shown to transfer imipenem, meropenem and ticarcillin/clavulanate resistance into a susceptible recipient. A85 also contains two small cryptic plasmids of 2.7 and 8.7 kb. A85 is sequence type ST126 (Oxford scheme) and carries a novel KL15 capsule locus and the OCL3 outer core locus. Conclusions A85 represents a new GC1 lineage identified by the novel capsule locus but retains AbaR3 carrying genes for resistance to older antibiotics. Resistance to imipenem, meropenem and ticarcillin/clavulanate has been introduced into A85 by pA85-3, a repAci6 conjugative plasmid carrying Tn2006 in AbaR4. PMID:24907141

  16. Sequence-Modified Antibiotic Resistance Genes Provide Sustained Plasmid-Mediated Transgene Expression in Mammals.

    PubMed

    Lu, Jiamiao; Zhang, Feijie; Fire, Andrew Z; Kay, Mark A

    2017-03-30

    Conventional plasmid vectors are incapable of achieving sustained levels of transgene expression in vivo even in quiescent mammalian tissues because the transgene expression cassette is silenced. Transcriptional silencing results from the presence of the bacterial plasmid backbone or virtually any DNA sequence of >1 kb in length placed outside of the expression cassette. Here, we show that transcriptional silencing can be substantially forestalled by increasing the An/Tn sequence composition in the plasmid bacterial backbone. Increasing numbers of An/Tn sequences increased sustained transcription of both backbone sequences and adjacent expression cassettes. In order to recapitulate these expression profiles in compact and portable plasmid DNA backbones, we engineered the standard kanamycin or ampicillin antibiotic resistance genes, optimizing the number of An/Tn sequence without altering the encoded amino acids. The resulting vector backbones yield sustained transgene expression from mouse liver, providing generic DNA vectors capable of sustained transgene expression without additional genes or mammalian regulatory elements.

  17. Bacteriophages limit the existence conditions for conjugative plasmids.

    PubMed

    Harrison, Ellie; Wood, A Jamie; Dytham, Calvin; Pitchford, Jonathan W; Truman, Julie; Spiers, Andrew; Paterson, Steve; Brockhurst, Michael A

    2015-06-02

    Bacteriophages are a major cause of bacterial mortality and impose strong selection on natural bacterial populations, yet their effects on the dynamics of conjugative plasmids have rarely been tested. We combined experimental evolution, mathematical modeling, and individual-based simulations to explain how the ecological and population genetics effects of bacteriophages upon bacteria interact to determine the dynamics of conjugative plasmids and their persistence. The ecological effects of bacteriophages on bacteria are predicted to limit the existence conditions for conjugative plasmids, preventing persistence under weak selection for plasmid accessory traits. Experiments showed that phages drove faster extinction of plasmids in environments where the plasmid conferred no benefit, but they also revealed more complex effects of phages on plasmid dynamics under these conditions, specifically, the temporary maintenance of plasmids at fixation followed by rapid loss. We hypothesized that the population genetic effects of bacteriophages, specifically, selection for phage resistance mutations, may have caused this. Further mathematical modeling and individual-based simulations supported our hypothesis, showing that conjugative plasmids may hitchhike with phage resistance mutations in the bacterial chromosome. Conjugative plasmids are infectious loops of DNA capable of transmitting DNA between bacterial cells and between species. Because plasmids often carry extra genes that allow bacteria to live in otherwise-inhospitable environments, their dynamics are central to understanding bacterial adaptive evolution. The plasmid-bacterium interaction has typically been studied in isolation, but in natural bacterial communities, bacteriophages, viruses that infect bacteria, are ubiquitous. Using experiments, mathematical models, and computer simulations we show that bacteriophages drive plasmid dynamics through their ecological and evolutionary effects on bacteria and ultimately

  18. Kanamycin detection based on the catalytic ability enhancement of gold nanoparticles.

    PubMed

    Wang, Chengke; Chen, Dan; Wang, Qingqing; Tan, Rong

    2017-05-15

    In this paper, we demonstrated that kanamycin could enhance the peroxidase-like activity of citrate-capped gold nanoparticles (AuNPs) through two steps: the attachment of kanamycin onto AuNPs through -NH2 (on kanamycin) and -COOH (on AuNPs) interactions; and the specifically interaction between glucoside on kanamycin and AuNPs which changes the surface property of AuNPs, and produced •OH radicals and Au(3+) in the solution, and catalyzed the chromogenic reactions between 3, 3', 5, 5'-tetramethylbenzidine (TMB) and H2O2. Based on this principle, a novel method for kanamycin detection has been developed. This method exhibited high sensitivity and selectivity, as low as 0.1nM kanamycin could be detected with a linear range from 0.1nM to 20nM and 20nM to 300nM, respectively. This method was also successfully applied for the detection of kanamycin content in milk and meat samples.

  19. Shifts in Host Range of a Promiscuous Plasmid through Parallel Evolution of its Replication Initiation Protein

    PubMed Central

    Sota, Masahiro; Yano, Hirokazu; Hughes, Julie; Daughdrill, Gary W.; Abdo, Zaid; Forney, Larry J.; Top, Eva M.

    2011-01-01

    The ability of bacterial plasmids to adapt to novel hosts and thereby shift their host range is key to their long-term persistence in bacterial communities. Promiscuous plasmids of the IncP-1 group can colonize a wide range of hosts, but it is not known if and how they can contract, shift or further expand their host range. To understand the evolutionary mechanisms of host range shifts of IncP-1 plasmids, an IncP-1β mini-replicon was experimentally evolved in four hosts wherein it was initially unstable. After 1000 generations in serial batch cultures under antibiotic selection for plasmid maintenance (kanamycin resistance), the stability of the mini-plasmid had dramatically improved in all coevolved hosts. However, only plasmids evolved in Shewanella oneidensis showed improved stability in the ancestor, indicating that adaptive mutations had occurred in the plasmid itself. Complete genome sequence analysis of nine independently evolved plasmids showed seven unique plasmid genotypes that had various kinds of single mutations at one locus, namely the N-terminal region of the replication initiation protein TrfA. Such parallel evolution indicates that this region was under strong selection. In five of the seven evolved plasmids these trfA mutations resulted in a significantly higher plasmid copy number. Evolved plasmids were found to be stable in four other naïve hosts, but could no longer replicate in Pseudomonas aeruginosa. This study demonstrates that plasmids can specialize to a novel host through trade-offs between improved stability in the new host and the ability to replicate in a previously permissive host. PMID:20520653

  20. Detection and Characterization of Conjugative Degradative Plasmids in Xenobiotic-Degrading Sphingomonas Strains

    PubMed Central

    Basta, Tamara; Keck, Andreas; Klein, Joachim; Stolz, Andreas

    2004-01-01

    A systematic survey for the presence of plasmids in 17 different xenobiotic-degrading Sphingomonas strains was performed. In almost all analyzed strains, two to five plasmids with sizes of about 50 to 500 kb were detected by using pulsed-field gel electrophoresis. A comparison of plasmid preparations untreated or treated with S1 nuclease suggested that, in general, Sphingomonas plasmids are circular. Hybridization experiments with labeled gene probes suggested that large plasmids are involved in the degradation of dibenzo-p-dioxin, dibenzofuran, and naphthalenesulfonates in S. wittichii RW1, Sphingomonas sp. HH69, and S. xenophaga BN6, respectively. The plasmids which are responsible for the degradation of naphthalene, biphenyl, and toluene by S. aromaticivorans F199 (pNL1) and of naphthalenesulfonates by S. xenophaga BN6 (pBN6) were site-specifically labeled with a kanamycin resistance cassette. The conjugative transfer of these labeled plasmids was attempted with various bacterial strains as putative recipient strains. Thus, a conjugative transfer of plasmid pBN6 from S. xenophaga BN6 to a cured mutant of strain BN6 and to Sphingomonas sp. SS3 was observed. The conjugation experiments with plasmid pNL1 suggested a broader host range of this plasmid, because it was transferred without any obvious structural changes to S. yanoikuyae B1, Sphingomonas sp. SS3, and S. herbicidovorans. In contrast, major plasmid rearrangements were observed in the transconjugants after the transfer of plasmid pNL1 to Sphingomonas sp. HH69 and of pBN6 to Sphingomonas sp. SS3. No indications for the transfer of a Sphingomonas plasmid to bacteria outside of the Sphingomonadaceae were obtained. PMID:15175300

  1. Detection and characterization of conjugative degradative plasmids in xenobiotic-degrading Sphingomonas strains.

    PubMed

    Basta, Tamara; Keck, Andreas; Klein, Joachim; Stolz, Andreas

    2004-06-01

    A systematic survey for the presence of plasmids in 17 different xenobiotic-degrading Sphingomonas strains was performed. In almost all analyzed strains, two to five plasmids with sizes of about 50 to 500 kb were detected by using pulsed-field gel electrophoresis. A comparison of plasmid preparations untreated or treated with S1 nuclease suggested that, in general, Sphingomonas plasmids are circular. Hybridization experiments with labeled gene probes suggested that large plasmids are involved in the degradation of dibenzo-p-dioxin, dibenzofuran, and naphthalenesulfonates in S. wittichii RW1, Sphingomonas sp. HH69, and S. xenophaga BN6, respectively. The plasmids which are responsible for the degradation of naphthalene, biphenyl, and toluene by S. aromaticivorans F199 (pNL1) and of naphthalenesulfonates by S. xenophaga BN6 (pBN6) were site-specifically labeled with a kanamycin resistance cassette. The conjugative transfer of these labeled plasmids was attempted with various bacterial strains as putative recipient strains. Thus, a conjugative transfer of plasmid pBN6 from S. xenophaga BN6 to a cured mutant of strain BN6 and to Sphingomonas sp. SS3 was observed. The conjugation experiments with plasmid pNL1 suggested a broader host range of this plasmid, because it was transferred without any obvious structural changes to S. yanoikuyae B1, Sphingomonas sp. SS3, and S. herbicidovorans. In contrast, major plasmid rearrangements were observed in the transconjugants after the transfer of plasmid pNL1 to Sphingomonas sp. HH69 and of pBN6 to Sphingomonas sp. SS3. No indications for the transfer of a Sphingomonas plasmid to bacteria outside of the Sphingomonadaceae were obtained.

  2. RmtC introduces G1405 methylation in 16S rRNA and confers high-level aminoglycoside resistance on Gram-positive microorganisms.

    PubMed

    Wachino, Jun-Ichi; Shibayama, Keigo; Kimura, Kouji; Yamane, Kunikazu; Suzuki, Satowa; Arakawa, Yoshichika

    2010-10-01

    Seven plasmid-mediated 16S rRNA methyltransferases (MTases), RmtA, RmtB, RmtC, RmtD, RmtE, ArmA, and NpmA, conferring aminoglycoside resistance have so far been found in Gram-negative pathogenic microorganisms. In the present study, by performing an RNase protection assay, primer extension, and HPLC, we confirmed that RmtC indeed methylates at the N7 position of nucleotide G1405 in 16S rRNA as found in ArmA and RmtB. RmtC has an MTase activity specific for the bacterial 30S ribosomal subunit consisting of 16S rRNA and several ribosomal proteins, but not for the naked 16S rRNA, as seen in ArmA, RmtB, and NpmA. All seven 16S rRNA MTases have been found exclusively in Gram-negative bacilli to date, and no plasmid-mediated 16S rRNA MTase has been reported in Gram-positive pathogenic microorganisms. Thus, we checked whether or not the RmtC could function in Gram-positive bacilli, and found that RmtC could indeed confer high-level resistance to gentamicin and kanamycin in Bacillus subtilis and Staphylococcus aureus. 16S rRNA MTases seemed to be functional to some extent in any bacterial species, regardless of the provenance of the 16S rRNA MTase gene responsible for aminoglycoside resistance.

  3. Transformation of Haemophilus influenzae by plasmid RSF0885

    SciTech Connect

    Notani, N.K.; Setlow, J.K.; McCarthy, D.; Clayton, N.L.

    1981-12-01

    Plasmid RSF0885, which conferred ampicillin resistance, transformed competent Haemophilus influenzae cells with low efficiency (maximun, less than 0.01%). As judged by competition experiments and uptake of radioactivity, plasmid RSF0885 deoxyribonucleic acid was taken up into competent H. influenzae cells several orders of magnitude less efficiently than H. influenzae chromosomal deoxyribonucleic acid. Plasmid RSF0885 transformed cells with even lower efficiency than could be accounted for by the low uptake. Transformation was not affected by rec-1 and rec-2 mutations in the recipient, and strains cured of the plasmid did not show increased transformation. Plasmid molecules cut once with a restriction enzyme that made blunt ends did not transform. Transformation was favored by the closed circular form of the plasmid.

  4. Audiological Evaluation of Patients Taking Kanamycin for Multidrug Resistant Tuberculosis

    PubMed Central

    Sharma, Vishal; Bhagat, Sanjeev; Verma, Bhimsain; Singh, Ravinder; Singh, Surinderpal

    2016-01-01

    Introduction: The incidence of multidrug resistant tuberculosis is increasing in developing countries. Aminoglycosides are an integral part of second-line drugs, however ototoxicity is a major limitation for their use. This study aims to determine the extent of hearing loss in patients taking one of the commonly prescribed drugs for Multidrug resistant tuberculosis (MDR-TB), Kanamycin, at a Government Medical College, Patiala, Punjab, India, which is a 1200 bed tertiary care hospital. Materials and Methods: A total of 100 patients (68 males and 32 females) with confirmed diagnosis of MDR-TB were included in this study conducted between January 2012 and February 2014. Subjects were between 15 to 60 years of age, with a mean age of 37.46 ± 10.1. Pure tone audiometry (PTA) was performed before the start of the therapy, as a baseline, and was repeated after 1 week and 6 weeks of Kanamycin use to assess hearing loss as an effect of therapy. Results: Of the 100 patients examined, ototoxicity was found in 18 subjects post therapy. Incidence of high frequency hearing loss was 2% at week 1, and 12% after 6 weeks of follow up. However, 4% of the cases developed flat loss at week 6. The hearing loss was bilateral in 13 patients and unilateral in 5 patients. Ototoxicity was more common in males (66.67%) compared to females (33.3%). Maximum cases were found in the age group of 36 to 45 years (36.8%), the majority being from a rural background (83.3%). The association with socioeconomic status (P=0.024) and co-morbid conditions like diabetes and hypertension (P=0.001) reached statistical significance. Conclusion: Lack of specific guidelines to monitor patients taking aminoglycosides makes ototoxicity a major adverse effect of their use in MDR-TB. More studies are mandated to study the risk factors associated with the development of ototoxicity and for the development of alternate drugs for the treatment of MDR-TB. PMID:27429949

  5. Degradative plasmids from sphingomonads.

    PubMed

    Stolz, Andreas

    2014-01-01

    Large plasmids ('megaplasmids') are commonly found in members of the Alphaproteobacterial family Sphingomonadaceae ('sphingomonads'). These plasmids contribute to the extraordinary catabolic flexibility of this group of organisms, which degrade a broad range of recalcitrant xenobiotic compounds. The genomes of several sphingomonads have been sequenced during the last years. In the course of these studies, also the sequences of several plasmids have been determined. The analysis of the published information and the sequences deposited in the public databases allowed a first classification of these plasmids into a restricted number of groups according to the proteins involved in the initiation of replication, plasmid partition and conjugation. The sequence comparisons demonstrated that the plasmids from sphingomonads encode for four main groups of replication initiation (Rep) proteins. These Rep proteins belong to the protein superfamilies RepA_C (Pfam 04796), Rep_3 (Pfam 01051), RPA (Pfam 10134) and HTH-36 (Pfam 13730). The 'degradative megaplasmids' pNL2, pCAR3, pSWIT02, pCHQ1, pISP0, and pISP1, which code for genes involved in the degradation of aromatic hydrocarbons, carbazole, dibenzo-p-dioxin and γ-hexachlorocyclohexane, carry Rep proteins which either belong to the RepA_C- (plasmids pNL2, pCAR3, pSWIT02), Rep-3- (plasmids pCHQ1, pISP0) or RPA-superfamily (pISP1). The classification of these 'degradative megaplasmids' into three groups is also supported by sequence comparisons of the proteins involved in plasmid partition (ParAB) and the organization of the three genes on the respective plasmids. All analysed 'degradative megaplasmids' carry genes, which might allow a conjugative transfer of the plasmids. Sequence comparisons of these genes suggest the presence of at least two types of transfer functions, which either are closer related to the tra- or vir-genes previously described for plasmids from other sources.

  6. A type 2 A/C2 plasmid carrying the aacC4 apramycin resistance gene and the erm(42) erythromycin resistance gene recovered from two Salmonella enterica serovars.

    PubMed

    Harmer, Christopher J; Holt, Kathryn E; Hall, Ruth M

    2015-04-01

    To determine the relationships between RepA/C2 plasmids carrying several antibiotic resistance genes found in isolates of Salmonella enterica serovars Ohio and Senftenberg from pigs. Illumina HiSeq was used to sequence seven S. enterica isolates. BLAST searches identified relevant A/C2 plasmid contigs and contigs were assembled using PCR. Two serovar Ohio isolates were ST329 and the five Senftenberg isolates were ST210. The A/C2 plasmids recovered from the seven isolates belong to type 2 and contain two resistance islands. Their backbones are closely related, differing by five or fewer SNPs. The sul2-containing resistance island ARI-B is 19.9 kb and also contains the kanamycin and neomycin resistance gene aphA1, the tetracycline resistance gene tetA(D) and an erythromycin resistance gene, erm(42), not previously seen in A/C2 plasmids. A second 30.3 kb resistance island, RI-119, is in a unique location in the A/C2 backbone 8.2 kb downstream of rhs. RI-119 contained genes conferring resistance to apramycin, netilmicin and tobramycin (aacC4), hygromycin (hph), sulphonamides (sul1) and spectinomycin and streptomycin (aadA2). In one of the seven plasmids, this resistance region contained two IS26-mediated deletions. A discrete 5.7 kb segment containing the aacC4 and hph genes and bounded by IS26 on one side and the inverted repeat of Tn5393 on the other was identified. The presence of almost identical A/C2 plasmids in two serovars indicates a common origin. Type 2 A/C2 plasmids continue to evolve via addition of new resistance regions such as RI-119 and evolution of existing ones. © The Author 2014. Published by Oxford University Press on behalf of the British Society for Antimicrobial Chemotherapy. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

  7. Synthesis and Bioactivities of Kanamycin B-Derived Cationic Amphiphiles.

    PubMed

    Fosso, Marina Y; Shrestha, Sanjib K; Green, Keith D; Garneau-Tsodikova, Sylvie

    2015-12-10

    Cationic amphiphiles derived from aminoglycosides (AGs) have been shown to exhibit enhanced antimicrobial activity. Through the attachment of hydrophobic residues such as linear alkyl chains on the AG backbone, interesting antibacterial and antifungal agents with a novel mechanism of action have been developed. Herein, we report the design and synthesis of seven kanamycin B (KANB) derivatives. Their antibacterial and antifungal activities, along with resistance/enzymatic, hemolytic, and cytotoxicity assays were also studied. Two of these compounds, with a C12 and C14 aliphatic chain attached at the 6″-position of KANB through a thioether linkage, exhibited good antibacterial and antifungal activity, were poorer substrates than KANB for several AG-modifying enzymes, and could delay the development of resistance in bacteria and fungi. Also, they were both relatively less hemolytic than the known membrane targeting antibiotic gramicidin and the known antifungal agent amphotericin B and were not toxic at their antifungal MIC values. Their oxidation to sulfones was also demonstrated to have no effect on their activities. Moreover, they both acted synergistically with posaconazole, an azole currently used in the treatment of human fungal infections.

  8. Aggregation of Kanamycin A: dimer formation with physiological cations.

    PubMed

    Dieterich, Johannes M; Gerstel, Ulrich; Schröder, Jens-Michael; Hartke, Bernd

    2011-12-01

    Global cluster geometry optimization has focused so far on clusters of atoms or of compact molecules. We are demonstrating here that present-day techniques also allow to globally optimize clusters of extended, flexible molecules, and that such studies have immediate relevance to experiment. For example, recent experimental findings point to production of larger clusters of an aminoglycoside closely related to Kanamycin A (KA), together with certain preferred physiological cations, by Pseudomonas aeruginosa. The present study provides first theoretical support for KA clustering, with a close examination of the monomer, the bare dimer, and dimers with sodium and potassium cations, employing global cluster structure optimization, in conjunction with force fields, semiempirical methods, DFT and ab-initio approaches. Interestingly, already at this stage the theoretical findings support the experimental observation that sodium cations are preferred over potassium cations in KA clusters, due to fundamentally different cationic embedding. Theoretically predicted NMR and IR spectra for these species indicate that it should be possible to experimentally detect the aggregation state and even the cationic embedding mode in such clusters.

  9. Deficient Sumoylation of Yeast 2-Micron Plasmid Proteins Rep1 and Rep2 Associated with Their Loss from the Plasmid-Partitioning Locus and Impaired Plasmid Inheritance

    PubMed Central

    Pinder, Jordan B.; McQuaid, Mary E.; Dobson, Melanie J.

    2013-01-01

    The 2-micron plasmid of the budding yeast Saccharomyces cerevisiae encodes copy-number amplification and partitioning systems that enable the plasmid to persist despite conferring no advantage to its host. Plasmid partitioning requires interaction of the plasmid Rep1 and Rep2 proteins with each other and with the plasmid-partitioning locus STB. Here we demonstrate that Rep1 stability is reduced in the absence of Rep2, and that both Rep proteins are sumoylated. Lysine-to-arginine substitutions in Rep1 and Rep2 that inhibited their sumoylation perturbed plasmid inheritance without affecting Rep protein stability or two-hybrid interaction between Rep1 and Rep2. One-hybrid and chromatin immunoprecipitation assays revealed that Rep1 was required for efficient retention of Rep2 at STB and that sumoylation-deficient mutants of Rep1 and Rep2 were impaired for association with STB. The normal co-localization of both Rep proteins with the punctate nuclear plasmid foci was also lost when Rep1 was sumoylation-deficient. The correlation of Rep protein sumoylation status with plasmid-partitioning locus association suggests a theme common to eukaryotic chromosome segregation proteins, sumoylated forms of which are found enriched at centromeres, and between the yeast 2-micron plasmid and viral episomes that depend on sumoylation of their maintenance proteins for persistence in their hosts. PMID:23555963

  10. Risk factors associated with kanamycin-resistant tuberculosis in a Beijing tuberculosis referral hospital.

    PubMed

    Yu, Hao Tian; Wang, Qi; Yang, Nan; Li, Hong Min; Liang, Jian Qin; Liu, Cui Hua

    2012-07-01

    The rapidly increasing number of multidrug-resistant tuberculosis (MDR-TB) cases worldwide underlines the necessity for the rational use of key second-line drugs such as kanamycin. In this study, we determined the prevalence of, and risk factors associated with, kanamycin-resistant tuberculosis (TB) in 309 Hospital, Beijing, China, with the aim of providing information for better case management in order to minimize further development of extensively drug-resistant TB (XDR-TB). Drug susceptibility testing results and clinical data were retrospectively analysed for hospitalized TB patients for whom such data were available in 309 Hospital for the period 1997-2009. Univariate and multivariate analyses were used to determine the risk factors associated with kanamycin-resistant TB. During 1997-2009, 553 (14.4 %) of 3843 tested Mycobacterium tuberculosis isolates from hospitalized TB patients were kanamycin-resistant. The increasing trend of resistance to kanamycin was reversed since 2000. The independent risk factors associated with kanamycin-resistant TB included living in urban areas [adjusted odds ratio (OR) = 1.89], being retreated for repeat cases (adjusted OR = 1.60), being smear-positive for acid-fast bacilli at admission to the hospital (adjusted OR = 1.39), having ofloxacin-resistant (adjusted OR = 1.61) or para-aminosalicylic acid-resistant TB (adjusted OR = 1.47), having MDR-TB (adjusted OR = 5.10), having MDR-TB plus ofloxacin resistance (adjusted OR = 4.27) and having poly-resistant TB (adjusted OR = 3.94). The remaining rate of kanamycin resistance is still high despite the reversal of the increasing trend during the past decade. Surveillance of kanamycin resistance, especially among high-risk populations, should be continued to closely monitor trends so that appropriate action can be taken.

  11. Plasmid-Mediated Antimicrobial Resistance in Staphylococci and Other Firmicutes.

    PubMed

    Schwarz, Stefan; Shen, Jianzhong; Wendlandt, Sarah; Fessler, Andrea T; Wang, Yang; Kadlec, Kristina; Wu, Cong-Ming

    2014-12-01

    In staphylococci and other Firmicutes, resistance to numerous classes of antimicrobial agents, which are commonly used in human and veterinary medicine, is mediated by genes that are associated with mobile genetic elements. The gene products of some of these antimicrobial resistance genes confer resistance to only specific members of a certain class of antimicrobial agents, whereas others confer resistance to the entire class or even to members of different classes of antimicrobial agents. The resistance mechanisms specified by the resistance genes fall into any of three major categories: active efflux, enzymatic inactivation, and modification/replacement/protection of the target sites of the antimicrobial agents. Among the mobile genetic elements that carry such resistance genes, plasmids play an important role as carriers of primarily plasmid-borne resistance genes, but also as vectors for nonconjugative and conjugative transposons that harbor resistance genes. Plasmids can be exchanged by horizontal gene transfer between members of the same species but also between bacteria belonging to different species and genera. Plasmids are highly flexible elements, and various mechanisms exist by which plasmids can recombine, form cointegrates, or become integrated in part or in toto into the chromosomal DNA or into other plasmids. As such, plasmids play a key role in the dissemination of antimicrobial resistance genes within the gene pool to which staphylococci and other Firmicutes have access. This chapter is intended to provide an overview of the current knowledge of plasmid-mediated antimicrobial resistance in staphylococci and other Firmicutes.

  12. Impact of kanamycin on melanogenesis and antioxidant enzymes activity in melanocytes--an in vitro study.

    PubMed

    Wrześniok, Dorota; Otręba, Michał; Beberok, Artur; Buszman, Ewa

    2013-12-01

    Aminoglycosides, broad spectrum aminoglycoside antibiotics, are used in various infections therapy due to their good antimicrobial characteristics. However, their adverse effects such as nephrotoxicity and auditory ototoxicity, as well as some toxic effects directed to pigmented tissues, complicate the use of these agents. This study was undertaken to investigate the effect of aminoglycoside antibiotic-kanamycin on viability, melanogenesis and antioxidant enzymes activity in cultured human normal melanocytes (HEMa-LP). It has been demonstrated that kanamycin induces concentration-dependent loss in melanocytes viability. The value of EC50 was found to be ~6.0 mM. Kanamycin suppressed melanin biosynthesis: antibiotic was shown to inhibit cellular tyrosinase activity and to reduce melanin content in normal human melanocytes. Significant changes in the cellular antioxidant enzymes: SOD, CAT and GPx were stated in melanocytes exposed to kanamycin. Moreover, it was observed that kanamycin caused depletion of antioxidant defense sytem. It is concluded that the inhibitory effect of kanamycin on melanogenesis and not sufficient antioxidant defense mechanism in melanocytes in vitro may explain the potential mechanisms of undesirable side effects of this drug directed to pigmented tissues in vivo.

  13. Polyethylene oxide (PEO)-hyaluronic acid (HA) nanofibers with kanamycin inhibits the growth of Listeria monocytogenes.

    PubMed

    Ahire, J J; Robertson, D D; van Reenen, A J; Dicks, L M T

    2017-02-01

    Listeria monocytogenes is well known to cause prosthetic joint infections in immunocompromised patients. In this study, polyethylene oxide (PEO) nanofibers, containing kanamycin and hyaluronic acid (HA), were prepared by electrospinning at a constant electric field of 10kV. PEO nanofibers spun with 0.2% (w/v) HA and 1% (w/v) kanamycin had a smooth, bead-free structure at 30-35% relative humidity. The average diameter of the nanofibers was 83±20nm. Attenuated total reflectance (ATR)-Fourier transform infrared (FTIR) spectroscopy indicated that kanamycin was successfully incorporated into PEO/HA matrix. The presence of kanamycin affects the thermal properties of PEO/HA nanofibers, as shown by differential scanning calorimetry (DSC) and thermogravimetric analyses (TGA). The kanamycin-PEO-HA nanofibers (1mg; 47±3μg kanamycin) inhibited the growth of L. monocytogenes EDGe by 62%, as compared with PEO-HA nanofibers, suggesting that it may be used to coat prosthetic implants to prevent secondary infections.

  14. Design, synthesis, and antibacterial activities of conformationally constrained kanamycin A derivatives.

    PubMed

    Zhang, Wenxuan; Chen, Ying; Liang, Qingzhao; Li, Hui; Jin, Hongwei; Zhang, Liangren; Meng, Xiangbao; Li, Zhongjun

    2013-01-18

    A series of conformationally constrained kanamycin A derivatives with a 2'-hydroxyl group in ring I and a 5-hydroxyl group in ring II tethered by carbon chains were designed and synthesized. Pivotal 5,2'-hydroxyl groups were exposed, and the kanamycin A intermediate was synthesized from 5, 2', 4″, 6″-di-O-benzylidene-protected tetraazidokanamycin A. Cyclic kanamycin A derivatives with intramolecular 8-, 9-, 10-, and 11-membered ethers were then prepared by cesium carbonate mediated Williamson ether synthesis or a ring-closing metathesis reaction. The kanamycin A derivatives were assayed against both susceptible and resistant bacterial strains. Although no derivative showed better antibacterial activities than kanamycin A, the antibacterial activities of these cyclic kanamycin A derivatives indeed varied with the length of the bridge. Moreover, different variations of activities were observed between the susceptible and resistant bacterial strains. More tightly constrained derivative 2 with a one-carbon bridge showed better activity than the others against susceptible strains, but it was much less effective for resistant bacterial strains than derivative 3 with a two-carbon bridge and derivative 6 with an unsaturated four-carbon bridge.

  15. Plasmids coding for drug resistance and localized adherence to HeLa cells in enteropathogenic Escherichia coli O55:H- and O55:H6.

    PubMed Central

    Laporta, M Z; Silva, M L; Scaletsky, I C; Trabulsi, L R

    1986-01-01

    Plasmids coding for drug resistance and localized adherence (LA) to HeLa cells were found in two enteropathogenic Escherichia coli strains belonging to serotypes O55:H- and O55:H6. Strain 49-81 HSJ (O55:H-) carries two plasmids, one coding for both ampicillin resistance (Apr) and LA (pMS49). Strain 71-82 HSJ (O55:H6) harbors only one plasmid, coding for resistance to sulfadiazine, chloramphenicol, kanamycin, ampicillin, and LA (pMS71). Plasmids pMS49 and pMS71 were transferred to E. coli K-12 711 and from this strain to E. coli K-12 J53. Curing with acridine orange of an Apr LA+ transconjugant showed that both characteristics were lost simultaneously. The plasmids have a molecular weight of approximately 55 X 10(6) and are the first naturally recombinant plasmids coding for adherence and drug resistance described in enteropathogenic E. coli. Images PMID:3510986

  16. Ultra-sensitive detection of kanamycin for food safety using a reduced graphene oxide-based fluorescent aptasensor

    PubMed Central

    Ha, Na-Reum; Jung, In-Pil; La, Im-Joung; Jung, Ho-Sup; Yoon, Moon-Young

    2017-01-01

    Overuse of antibiotics has caused serious problems, such as appearance of super bacteria, whose accumulation in the human body through the food chain is a concern. Kanamycin is a common antibiotic used to treat diverse infections; however, residual kanamycin can cause many side effects in humans. Thus, development of an ultra-sensitive, precise, and simple detection system for residual kanamycin in food products is urgently needed for food safety. In this study, we identified kanamycin-binding aptamers via a new screening method, and truncated variants were analyzed for optimization of the minimal sequence required for target binding. We found various aptamers with high binding affinity from 34.7 to 669 nanomolar Kdapp values with good specificity against kanamycin. Furthermore, we developed a reduced graphene oxide (RGO)-based fluorescent aptasensor for kanamycin detection. In this system, kanamycin was detected at a concentration as low as 1 pM (582.6 fg/mL). In addition, this method could detect kanamycin accurately in kanamycin-spiked blood serum and milk samples. Consequently, this simple, rapid, and sensitive kanamycin detection system with newly structural and functional analysis aptamer exhibits outstanding detection compared to previous methods and provides a new possibility for point of care testing and food safety. PMID:28054670

  17. Ultra-sensitive detection of kanamycin for food safety using a reduced graphene oxide-based fluorescent aptasensor.

    PubMed

    Ha, Na-Reum; Jung, In-Pil; La, Im-Joung; Jung, Ho-Sup; Yoon, Moon-Young

    2017-01-05

    Overuse of antibiotics has caused serious problems, such as appearance of super bacteria, whose accumulation in the human body through the food chain is a concern. Kanamycin is a common antibiotic used to treat diverse infections; however, residual kanamycin can cause many side effects in humans. Thus, development of an ultra-sensitive, precise, and simple detection system for residual kanamycin in food products is urgently needed for food safety. In this study, we identified kanamycin-binding aptamers via a new screening method, and truncated variants were analyzed for optimization of the minimal sequence required for target binding. We found various aptamers with high binding affinity from 34.7 to 669 nanomolar Kd(app) values with good specificity against kanamycin. Furthermore, we developed a reduced graphene oxide (RGO)-based fluorescent aptasensor for kanamycin detection. In this system, kanamycin was detected at a concentration as low as 1 pM (582.6 fg/mL). In addition, this method could detect kanamycin accurately in kanamycin-spiked blood serum and milk samples. Consequently, this simple, rapid, and sensitive kanamycin detection system with newly structural and functional analysis aptamer exhibits outstanding detection compared to previous methods and provides a new possibility for point of care testing and food safety.

  18. Ultra-sensitive detection of kanamycin for food safety using a reduced graphene oxide-based fluorescent aptasensor

    NASA Astrophysics Data System (ADS)

    Ha, Na-Reum; Jung, In-Pil; La, Im-Joung; Jung, Ho-Sup; Yoon, Moon-Young

    2017-01-01

    Overuse of antibiotics has caused serious problems, such as appearance of super bacteria, whose accumulation in the human body through the food chain is a concern. Kanamycin is a common antibiotic used to treat diverse infections; however, residual kanamycin can cause many side effects in humans. Thus, development of an ultra-sensitive, precise, and simple detection system for residual kanamycin in food products is urgently needed for food safety. In this study, we identified kanamycin-binding aptamers via a new screening method, and truncated variants were analyzed for optimization of the minimal sequence required for target binding. We found various aptamers with high binding affinity from 34.7 to 669 nanomolar Kdapp values with good specificity against kanamycin. Furthermore, we developed a reduced graphene oxide (RGO)-based fluorescent aptasensor for kanamycin detection. In this system, kanamycin was detected at a concentration as low as 1 pM (582.6 fg/mL). In addition, this method could detect kanamycin accurately in kanamycin-spiked blood serum and milk samples. Consequently, this simple, rapid, and sensitive kanamycin detection system with newly structural and functional analysis aptamer exhibits outstanding detection compared to previous methods and provides a new possibility for point of care testing and food safety.

  19. Molecular analysis of cross-resistance to capreomycin, kanamycin, amikacin, and viomycin in Mycobacterium tuberculosis.

    PubMed

    Maus, Courtney E; Plikaytis, Bonnie B; Shinnick, Thomas M

    2005-08-01

    Capreomycin, kanamycin, amikacin, and viomycin are drugs that are used to treat multidrug-resistant tuberculosis. Each inhibits translation, and cross-resistance to them is a concern during therapy. A recent study revealed that mutation of the tlyA gene, encoding a putative rRNA methyltransferase, confers capreomycin and viomycin resistance in Mycobacterium tuberculosis bacteria. Mutations in the 16S rRNA gene (rrs) have been associated with resistance to each of the drugs; however, reports of cross-resistance to the drugs have been variable. We investigated the role of rrs mutations in capreomycin resistance and examined the molecular basis of cross-resistance to the four drugs in M. tuberculosis laboratory-generated mutants and clinical isolates. Spontaneous mutants were generated to the drugs singularly and in combination by plating on medium containing one or two drugs. The frequencies of recovery of the mutants on single- and dual-drug plates were consistent with single-step mutations. The rrs genes of all mutants were sequenced, and the tlyA genes were sequenced for mutants selected on capreomycin, viomycin, or both; MICs of all four drugs were determined. Three rrs mutations (A1401G, C1402T, and G1484T) were found, and each was associated with a particular cross-resistance pattern. Similar mutations and cross-resistance patterns were found in drug-resistant clinical isolates. Overall, the data implicate rrs mutations as a molecular basis for resistance to each of the four drugs. Furthermore, the genotypic and phenotypic differences seen in the development of cross-resistance when M. tuberculosis bacteria were exposed to one or two drugs have implications for selection of treatment regimens.

  20. Plasmid Partition Mechanisms.

    PubMed

    Baxter, Jamie C; Funnell, Barbara E

    2014-12-01

    The stable maintenance of low-copy-number plasmids in bacteria is actively driven by partition mechanisms that are responsible for the positioning of plasmids inside the cell. Partition systems are ubiquitous in the microbial world and are encoded by many bacterial chromosomes as well as plasmids. These systems, although different in sequence and mechanism, typically consist of two proteins and a DNA partition site, or prokaryotic centromere, on the plasmid or chromosome. One protein binds site-specifically to the centromere to form a partition complex, and the other protein uses the energy of nucleotide binding and hydrolysis to transport the plasmid, via interactions with this partition complex inside the cell. For plasmids, this minimal cassette is sufficient to direct proper segregation in bacterial cells. There has been significant progress in the last several years in our understanding of partition mechanisms. Two general areas that have developed are (i) the structural biology of partition proteins and their interactions with DNA and (ii) the action and dynamics of the partition ATPases that drive the process. In addition, systems that use tubulin-like GTPases to partition plasmids have recently been identified. In this chapter, we concentrate on these recent developments and the molecular details of plasmid partition mechanisms.

  1. Yeast DNA plasmids.

    PubMed

    Gunge, N

    1983-01-01

    The study of yeast DNA plasmids has been initiated with the discovery of the 2-micron DNA in Saccharomyces cerevisiae. This multiple copy plasmid, organized into chromatin structure in vivo, probably exists in the nucleus and provides a good system to obtain information on eukaryotic DNA replication. Yeast transformation with the 2-micron DNA or artificially constructed chimeric plasmids had contributed significantly to the study of the molecular biology of yeast and eukaryotes, allowing the isolation and characterization of various genes, ars, centromeres, and telomeres, and also serving as a tool to study the expression of various heterologous genes. Encouraged by these fruitful results, new yeast plasmids have been screened among phylogenetically distant yeasts. The linear DNA plasmids (pGKl1 and pGKl2) from Kluyveromyces lactis are the first case of yeast plasmids associated with biological function (killer phenotype). This plasmid system would be ideal as a model to study the structure and function of eukaryotic linear chromosomes. The extracellular secretion of protein toxin suggests the plasmids to be an excellent candidate for a secretion vector. The importance of yeasts as suitable materials for the study of eukaryotic cell biology would be much enhanced by the advent of new transformation systems with diverse host yeasts of genetically and phylogenetically distinct properties.

  2. Mobility of plasmids.

    PubMed

    Smillie, Chris; Garcillán-Barcia, M Pilar; Francia, M Victoria; Rocha, Eduardo P C; de la Cruz, Fernando

    2010-09-01

    Plasmids are key vectors of horizontal gene transfer and essential genetic engineering tools. They code for genes involved in many aspects of microbial biology, including detoxication, virulence, ecological interactions, and antibiotic resistance. While many studies have decorticated the mechanisms of mobility in model plasmids, the identification and characterization of plasmid mobility from genome data are unexplored. By reviewing the available data and literature, we established a computational protocol to identify and classify conjugation and mobilization genetic modules in 1,730 plasmids. This allowed the accurate classification of proteobacterial conjugative or mobilizable systems in a combination of four mating pair formation and six relaxase families. The available evidence suggests that half of the plasmids are nonmobilizable and that half of the remaining plasmids are conjugative. Some conjugative systems are much more abundant than others and preferably associated with some clades or plasmid sizes. Most very large plasmids are nonmobilizable, with evidence of ongoing domestication into secondary chromosomes. The evolution of conjugation elements shows ancient divergence between mobility systems, with relaxases and type IV coupling proteins (T4CPs) often following separate paths from type IV secretion systems. Phylogenetic patterns of mobility proteins are consistent with the phylogeny of the host prokaryotes, suggesting that plasmid mobility is in general circumscribed within large clades. Our survey suggests the existence of unsuspected new relaxases in archaea and new conjugation systems in cyanobacteria and actinobacteria. Few genes, e.g., T4CPs, relaxases, and VirB4, are at the core of plasmid conjugation, and together with accessory genes, they have evolved into specific systems adapted to specific physiological and ecological contexts.

  3. Instability of multiple drug resistance plasmids in Salmonella typhimurium isolated from poultry.

    PubMed Central

    Brown, D. J.; Threlfall, E. J.; Rowe, B.

    1991-01-01

    Plasmids in five strains of Salmonella typhimurium resistant to ampicillin, chloramphenicol, gentamicin, neomycin/kanamycin, streptomycin, sulphonamides, tetracyclines and trimethoprim (ACGKSSuTTm), CGKSSuTTm, ACSSuT or CSSuT which had been isolated from poultry in the first 3 months of 1989 have been characterized and compared with plasmids in two strains of R-types ACGKSSuTTm and ASSuTTm isolated from two patients later in the year. With the exception of the human isolate of R-type ASSuTTm, all strains carried two non-conjugative plasmids, one coding for SSu and belonging to incompatibility group Q, and a second coding for multiple resistance and belonging to the FIme incompatibility group. The human isolate of R-type ASSuTTm did not carry the IncQ SSu plasmid but like the poultry isolates, carried a non-conjugative FIme plasmid. Restriction endonuclease digestion with the enzymes EcoR I, Pst I and Hind III demonstrated that the FIme plasmids from strains of different R-types showed a high degree of homology but exhibited numerous fragment size polymorphisms. The restriction digest fingerprint of plasmids in the human isolate of R-type ACGKSSuTTm was indistinguishable from a poultry isolate of the same R-type. Analysis of segregants of one of the poultry isolates of R-type ACGKSSuTTm demonstrated that resistance determinants could be rapidly lost from the FIme plasmid to give rise to a number of R-types and fingerprint patterns. Loss of tetracycline resistance from this plasmid appeared to be correlated with the integration of other plasmid-mediated resistances into the bacterial chromosome. Evidence is presented for the rapid loss of antimicrobial resistance determinants from a multiple resistance plasmid of the FIme incompatibility group in response to withdrawal of antibiotic selective pressure. Images Fig. 1 PMID:2019296

  4. Instability of multiple drug resistance plasmids in Salmonella typhimurium isolated from poultry.

    PubMed

    Brown, D J; Threlfall, E J; Rowe, B

    1991-04-01

    Plasmids in five strains of Salmonella typhimurium resistant to ampicillin, chloramphenicol, gentamicin, neomycin/kanamycin, streptomycin, sulphonamides, tetracyclines and trimethoprim (ACGKSSuTTm), CGKSSuTTm, ACSSuT or CSSuT which had been isolated from poultry in the first 3 months of 1989 have been characterized and compared with plasmids in two strains of R-types ACGKSSuTTm and ASSuTTm isolated from two patients later in the year. With the exception of the human isolate of R-type ASSuTTm, all strains carried two non-conjugative plasmids, one coding for SSu and belonging to incompatibility group Q, and a second coding for multiple resistance and belonging to the FIme incompatibility group. The human isolate of R-type ASSuTTm did not carry the IncQ SSu plasmid but like the poultry isolates, carried a non-conjugative FIme plasmid. Restriction endonuclease digestion with the enzymes EcoR I, Pst I and Hind III demonstrated that the FIme plasmids from strains of different R-types showed a high degree of homology but exhibited numerous fragment size polymorphisms. The restriction digest fingerprint of plasmids in the human isolate of R-type ACGKSSuTTm was indistinguishable from a poultry isolate of the same R-type. Analysis of segregants of one of the poultry isolates of R-type ACGKSSuTTm demonstrated that resistance determinants could be rapidly lost from the FIme plasmid to give rise to a number of R-types and fingerprint patterns. Loss of tetracycline resistance from this plasmid appeared to be correlated with the integration of other plasmid-mediated resistances into the bacterial chromosome. Evidence is presented for the rapid loss of antimicrobial resistance determinants from a multiple resistance plasmid of the FIme incompatibility group in response to withdrawal of antibiotic selective pressure.

  5. International Spread and Persistence of TEM-24 Is Caused by the Confluence of Highly Penetrating Enterobacteriaceae Clones and an IncA/C2 Plasmid Containing Tn1696::Tn1 and IS5075-Tn21▿

    PubMed Central

    Novais, Ângela; Baquero, Fernando; Machado, Elisabete; Cantón, Rafael; Peixe, Luísa; Coque, Teresa M.

    2010-01-01

    TEM-24 remains one of the most widespread TEM-type extended-spectrum β-lactamases (ESBLs) among Enterobacteriaceae. To analyze the reasons influencing its spread and persistence, a multilevel population genetics study was carried out on 28 representative TEM-24 producers from Belgium, France, Portugal, and Spain (13 Enterobacter aerogenes isolates, 6 Escherichia coli isolates, 6 Klebsiella pneumoniae isolates, 2 Proteus mirabilis isolates, and 1 Klebsiella oxytoca isolate, from 1998 to 2004). Clonal relatedness (XbaI pulsed-field gel electrophoresis [PFGE] and E. coli phylogroups) and antibiotic susceptibility were determined by standard procedures. Plasmid analysis included determination of the incompatibility group (by PCR, hybridization, and/or sequencing) and comparison of restriction fragment length polymorphism (RFLP) patterns. Characterization of genetic elements conferring antibiotic resistance included integrons (classes 1, 2, and 3) and transposons (Tn3, Tn21, and Tn402). Similar PFGE patterns were identified among E. aerogenes, K. pneumoniae, and P. mirabilis isolates, while E. coli strains were diverse (phylogenetic groups A, B2, and D). Highly related 180-kb IncA/C2 plasmids conferring resistance to kanamycin, tobramycin, chloramphenicol, trimethoprim, and sulfonamides were identified. Each plasmid contained defective In0-Tn402 (dfrA1-aadA1, aacA4, or aacA4-aacC1-orfE-aadA2-cmlA1) and In4-Tn402 (aacA4 or dfrA1-aadA1) variants. These integrons were located within Tn21, Tn1696, or hybrids of these transposons, with IS5075 interrupting their IRtnp and IRmer. In all cases, blaTEM-24 was part of an IS5075-ΔTn1 transposon within tnp1696, mimicking other genetic elements containing blaTEM-2 and blaTEM-3 variants. The international dissemination of TEM-24 is fuelled by an IncA/C2 plasmid acquired by different enterobacterial clones which seem to evolve by gaining diverse genetic elements. This work highlights the risks of a confluence between highly

  6. Multiresistant Plasmids from Pseudomonas aeruginosa Highly Resistant to Either or Both Gentamicin and Carbenicillin

    PubMed Central

    Kontomichalou, Polyxeni; Papachristou, Efstathia; Angelatou, Fevronia

    1976-01-01

    High-level resistance to gentamicin and carbenicillin was found in 30 and 10.7%, respectively, of Pseudomonas aeruginosa strains, especially in isolates from urine. In 23 out of 25 strains tested, these resistances were R mediated and linked to multiresistant plasmids, carrying genes for resistances to five other aminoglycosides, tobramycin, kanamycin, neomycin, streptomycin, and spectinomycin, and for resistances to chloramphenicol, tetracycline, sulfonamides, and mercury chloride. Carbenicillin resistance was unstable in Pseudomonas, and in its presence the multiresistant plasmids had a host range extended to the Enterobacteriaceae (group I plasmids). Otherwise they were transferable intragenerically only (group II plasmids). The extended host range plasmids were, as a rule, in fi− incompatibility class A–C. Segregants incompatible with both class A–C and P plasmids were detected. The β-lactamase specified by the carbenicillin marker was of the TEM-like type. Multiple linkages of resistance determinants to the aminoglycosides were concomitantly present in most of the plasmids. Results from the bioassay indicated the presence of at least two aminoglycoside-inactivating enzymes. PMID:820245

  7. Antimicrobial susceptibility, plasmid profiles and haemocin activities of Avibacterium paragallinarum strains.

    PubMed

    Hsu, Yuan-Man; Shieh, Happy K; Chen, Wei-Hao; Sun, Tsung-Yu; Shiang, Jia-Hsiang

    2007-10-06

    In this study, 18 Avibacterium paragallinarum isolates collected in Taiwan from 1990 to 2003 were serotyped and tested for resistance to antimicrobial agents. Serotyping revealed that 13 isolates were Page serovar A and 5 isolates were Page serovar C. More than 75% of the isolates were resistant to neomycin, streptomycin and erythromycin. The most common resistance pattern (15 isolates, 83.3%) was neomycin-streptomycin. Furthermore, 88.9% of the isolates were resistant to two or more antibiotics. About 72% of isolates contained plasmids (pYMH5 and/or pA14). Plasmid pYMH5 encoded functional streptomycin, sulfonamide, kanamycin and neomycin resistance genes and revealed significant homology to a broad host-range plasmid, pLS88. Plasmid pA14 encoded a putative MglA protein and RNase II, both of which might be associated with virulence. Furthermore, seven isolates showed haemocin activity. Plasmid pYMH5 is the first multidrug-resistance plasmid reported in A. paragallinarum and it may facilitate the spread of antibiotic-resistance genes between bacteria. The putative virulence plasmid pA14 and haemocin-like activity in A. paragallinarum indicate two possible mechanisms which might be responsible for the pathogenesis.

  8. Bacteriophages Limit the Existence Conditions for Conjugative Plasmids

    PubMed Central

    Wood, A. Jamie; Dytham, Calvin; Pitchford, Jonathan W.; Truman, Julie; Spiers, Andrew; Paterson, Steve; Brockhurst, Michael A.

    2015-01-01

    ABSTRACT Bacteriophages are a major cause of bacterial mortality and impose strong selection on natural bacterial populations, yet their effects on the dynamics of conjugative plasmids have rarely been tested. We combined experimental evolution, mathematical modeling, and individual-based simulations to explain how the ecological and population genetics effects of bacteriophages upon bacteria interact to determine the dynamics of conjugative plasmids and their persistence. The ecological effects of bacteriophages on bacteria are predicted to limit the existence conditions for conjugative plasmids, preventing persistence under weak selection for plasmid accessory traits. Experiments showed that phages drove faster extinction of plasmids in environments where the plasmid conferred no benefit, but they also revealed more complex effects of phages on plasmid dynamics under these conditions, specifically, the temporary maintenance of plasmids at fixation followed by rapid loss. We hypothesized that the population genetic effects of bacteriophages, specifically, selection for phage resistance mutations, may have caused this. Further mathematical modeling and individual-based simulations supported our hypothesis, showing that conjugative plasmids may hitchhike with phage resistance mutations in the bacterial chromosome. PMID:26037122

  9. The Agrobacterium Ti Plasmids.

    PubMed

    Christie, Peter J; Gordon, Jay E

    2014-12-01

    Agrobacterium tumefaciens is a plant pathogen with the capacity to deliver a segment of oncogenic DNA carried on a large plasmid called the tumor-inducing or Ti plasmid to susceptible plant cells. A. tumefaciens belongs to the class Alphaproteobacteria, whose members include other plant pathogens (Agrobacterium rhizogenes), plant and insect symbionts (Rhizobium spp. and Wolbachia spp., respectively), human pathogens (Brucella spp., Bartonella spp., Rickettsia spp.), and nonpathogens (Caulobacter crescentus, Rhodobacter sphaeroides). Many species of Alphaproteobacteria carry large plasmids ranging in size from ∼100 kb to nearly 2 Mb. These large replicons typically code for functions essential for cell physiology, pathogenesis, or symbiosis. Most of these elements rely on a conserved gene cassette termed repABC for replication and partitioning, and maintenance at only one or a few copies per cell. The subject of this review is the ∼200-kb Ti plasmids carried by infectious strains of A. tumefaciens. We will summarize the features of this plasmid as a representative of the repABC family of megaplasmids. We will also describe novel features of this plasmid that enable A. tumefaciens cells to incite tumor formation in plants, sense and respond to an array of plant host and bacterial signal molecules, and maintain and disseminate the plasmid among populations of agrobacteria. At the end of this review, we will describe how this natural genetic engineer has been adapted to spawn an entire industry of plant biotechnology and review its potential for use in future therapeutic applications of plant and nonplant species.

  10. Plasmid borne Carbapenem-Hydrolyzing Class D β-Lactamases (CHDLs) and AdeABC efflux pump conferring carbapenem-tigecycline resistance among Acinetobacter baumannii isolates harboring TnAbaRs.

    PubMed

    Savari, Mohammad; Ekrami, Alireza; Shoja, Saeed; Bahador, Abbas

    2017-03-01

    Here we studied the prevalence and mechanisms of simultaneous resistance to carbapenem and tigecycline and accumulation of resistance determinants reservoirs in genome of Acinetobacter baumannii (A. baumannii) clinical isolates. Susceptibility of the isolates were measured to 18 antimicrobial agents. Genetic diversity of the microbial population was determined using the International Clonal lineage typing (IC typing), multiple locus VNTR analysis (MLVA) and plasmid profiling methods. To detect the AbaRs, Carbapenem-Hydrolyzing Class D β-Lactamases (CHDLs) genes, AdeABC efflux pump genes and resistance determinants, PCR was used. Filter mating experiments were used to prove that if carbapenem resistance genes are located on conjugative plasmids or not. Among the A. baumannii clinical isolates, 40.8% were carbapenem-tigecycline resistant and in this population, 46.9% were belonging to IC I, IC II or IC III and 53.1% were IC variants. These isolates had fallen in 40 MLVA types and were harboring plasmids in multiple numbers and sizes. In this study, blaOXA-23-like was the most prevalent CHDL and conjugation analysis proved that the carbapenem resistance genes are located on conjugative plasmids. All efflux pump genes, except for adeC, were detected in all carbapenem-tigecycline resistant A. baumannii (CTRAb) isolates. Resistance determinants were distributed in both TnAbaRs and R plasmids with a shift toward the R plasmids. Emerging of carbapenem resistant A. baumannii (CRAB) with simultaneous resistance to the last line therapy including tigecycline represent emerging of extensively drug resistance (XDR) and pandrug resistance (PDR) phenotypes that would be a great threat to our public health system.

  11. Intradermal naked plasmid DNA immunization: mechanisms of action.

    PubMed

    Elnekave, Mazal; Furmanov, Karina; Hovav, Avi-Hai

    2011-08-01

    Plasmid DNA is a promising vaccine modality that is regularly examined in prime-boost immunization regimens. Recent advances in skin immunity increased our understanding of the sophisticated cutaneous immune network, which revived scientific interest in delivering vaccines to the skin. Intradermal administration of plasmid DNA via needle injection is a simple and inexpensive procedure that exposes the plasmid and its encoded antigen to the dermal immune surveillance system. This triggers unique mechanisms for eliciting local and systemic immunity that can confer protection against pathogens and tumors. Understanding the mechanisms of intradermal plasmid DNA immunization is essential for enhancing and modulating its immunogenicity. With regard to vaccination, this is of greater importance as this routine injection technique is highly desirable for worldwide immunization. This article will focus on the current understanding of the mechanisms involved in antigen expression and presentation during primary and secondary syringe and needle intradermal plasmid DNA immunization.

  12. The evolution of a conjugative plasmid and its ability to increase bacterial fitness

    PubMed Central

    Dionisio, F; Conceição, I.C; Marques, A.C.R; Fernandes, L; Gordo, I

    2005-01-01

    Conjugative plasmids are extra-chromosomal DNA elements that are capable of horizontal transmission and are found in many natural isolated bacteria. Although plasmids may carry beneficial genes to their bacterial host, they may also cause a fitness cost. In this work, we studied the evolution of the R1 plasmid and we found that, in spite of the R1 plasmid conferring an initial cost to its host, after 420 generations the cost disappeared in all five independent evolution experiments. In fact, in two of these five experiments evolved conjugative plasmids actually conferred a fitness advantage to their hosts. Furthermore, the relative fitness of the ancestral clone bearing one of the evolved plasmids is significantly higher than both the plasmid-free ancestral cells and the evolved cells carrying the evolved plasmid. Given that the R1 plasmid may spread among different species of enterobacteria, we wondered what the effect of the evolved plasmid would be inside Salmonella enterica cells. We found that the evolved plasmid is also able to dramatically increase the relative fitness of these cells. Our results suggest that even if general usage of antibiotics is halted, conjugative plasmids that have been selected with antibiotics in previous years can still persist among bacterial populations or even invade new strains. PMID:17148179

  13. Label-free detection of kanamycin based on a G-quadruplex DNA aptamer-based fluorescent intercalator displacement assay.

    PubMed

    Xing, Yun-Peng; Liu, Chun; Zhou, Xiao-Hong; Shi, Han-Chang

    2015-01-30

    This work was the first to report that the kanamycin-binding DNA aptamer (5'-TGG GGG TTG AGG CTA AGC CGA-3') can form stable parallel G-quadruplex DNA (G4-DNA) structures by themselves and that this phenomenon can be verified by nondenaturing polyacrylamide gel electrophoresis and circular dichroism spectroscopy. Based on these findings, we developed a novel label-free strategy for kanamycin detection based on the G4-DNA aptamer-based fluorescent intercalator displacement assay with thiazole orange (TO) as the fluorescence probe. In the proposed strategy, TO became strongly fluorescent upon binding to kanamycin-binding G4-DNA. However, the addition of kanamycin caused the displacement of TO from the G4-DNA-TO conjugate, thereby resulting in decreased fluorescent signal, which was inversely related to the kanamycin concentration. The detection limit of the proposed assay decreased to 59 nM with a linear working range of 0.1 μM to 20 μM for kanamycin. The cross-reactivity against six other antibiotics was negligible compared with the response to kanamycin. A satisfactory recovery of kanamycin in milk samples ranged from 80.1% to 98.0%, confirming the potential of this bioassay in the measurement of kanamycin in various applications. Our results also served as a good reference for developing similar fluorescent G4-DNA-based bioassays in the future.

  14. Label-free detection of kanamycin based on a G-quadruplex DNA aptamer-based fluorescent intercalator displacement assay

    NASA Astrophysics Data System (ADS)

    Xing, Yun-Peng; Liu, Chun; Zhou, Xiao-Hong; Shi, Han-Chang

    2015-01-01

    This work was the first to report that the kanamycin-binding DNA aptamer (5'-TGG GGG TTG AGG CTA AGC CGA-3') can form stable parallel G-quadruplex DNA (G4-DNA) structures by themselves and that this phenomenon can be verified by nondenaturing polyacrylamide gel electrophoresis and circular dichroism spectroscopy. Based on these findings, we developed a novel label-free strategy for kanamycin detection based on the G4-DNA aptamer-based fluorescent intercalator displacement assay with thiazole orange (TO) as the fluorescence probe. In the proposed strategy, TO became strongly fluorescent upon binding to kanamycin-binding G4-DNA. However, the addition of kanamycin caused the displacement of TO from the G4-DNA-TO conjugate, thereby resulting in decreased fluorescent signal, which was inversely related to the kanamycin concentration. The detection limit of the proposed assay decreased to 59 nM with a linear working range of 0.1 μM to 20 μM for kanamycin. The cross-reactivity against six other antibiotics was negligible compared with the response to kanamycin. A satisfactory recovery of kanamycin in milk samples ranged from 80.1% to 98.0%, confirming the potential of this bioassay in the measurement of kanamycin in various applications. Our results also served as a good reference for developing similar fluorescent G4-DNA-based bioassays in the future.

  15. Novel Synthesis of Kanamycin Conjugated Gold Nanoparticles with Potent Antibacterial Activity

    PubMed Central

    Payne, Jason N.; Waghwani, Hitesh K.; Connor, Michael G.; Hamilton, William; Tockstein, Sarah; Moolani, Harsh; Chavda, Fenil; Badwaik, Vivek; Lawrenz, Matthew B.; Dakshinamurthy, Rajalingam

    2016-01-01

    With a sharp increase in the cases of multi-drug resistant (MDR) bacteria all over the world, there is a huge demand to develop a new generation of antibiotic agents to fight them. As an alternative to the traditional drug discovery route, we have designed an effective antibacterial agent by modifying an existing commercial antibiotic, kanamycin, conjugated on the surface of gold nanoparticles (AuNPs). In this study, we report a single-step synthesis of kanamycin-capped AuNPs (Kan-AuNPs) utilizing the combined reducing and capping properties of kanamycin. While Kan-AuNPs have increased toxicity to a primate cell line (Vero 76), antibacterial assays showed dose-dependent broad spectrum activity of Kan-AuNPs against both Gram-positive and Gram-negative bacteria, including Kanamycin resistant bacteria. Further, a significant reduction in the minimum inhibitory concentration (MIC) of Kan-AuNPs was observed when compared to free kanamycin against all the bacterial strains tested. Mechanistic studies using transmission electron microscopy and fluorescence microscopy indicated that at least part of Kan-AuNPs increased efficacy may be through disrupting the bacterial envelope, resulting in the leakage of cytoplasmic content and the death of bacterial cells. Results of this study provide critical information about a novel method for the development of antibiotic capped AuNPs as potent next-generation antibacterial agents. PMID:27330535

  16. Label-free detection of kanamycin using aptamer-based cantilever array sensor.

    PubMed

    Bai, Xiaojing; Hou, Hui; Zhang, Bailin; Tang, Jilin

    2014-06-15

    A label-free detection method of kanamycin using aptamer-based cantilever array sensor was developed. The cantilever array was composed of sensing cantilevers and reference cantilevers. This configuration allowed direct detection of individual cantilever deflections and subsequent determination of differential deflection of sensing/reference cantilever pair. The sensing cantilevers were functionalized with kanamycin aptamer, which was used as receptor molecules while the reference cantilevers were modified with 6-mercapto-1-hexanol (MCH) to eliminate the influence of environmental disturbances. The kanamycin-aptamer interaction induced a change in cantilever surface stress, which caused a differential deflection between the sensing and reference cantilever pair. The surface stress change was linear with kanamycin concentration over the range of 100 μM-10mM with a correlation coefficient of 0.995. A detection limit of 50 μM was obtained, at a signal-to-noise ratio of 3. The sensor also showed good selectivity against other antibiotics such as neomycin, ribostamycin and chloramphenicol. The facile method for kanamycin detection may have great potential for investigating more other molecules.

  17. 17-DMAG induces Hsp70 and protects the auditory hair cells from kanamycin ototoxicity in vitro.

    PubMed

    Liu, Yun; Yu, Yang; Chu, Hanqi; Bing, Dan; Wang, Shaoli; Zhou, Liangqiang; Chen, Jin; Chen, Qingguo; Pan, Chunchen; Sun, Yanbo; Cui, Yonghua

    2015-02-19

    Heat shock protein 70 (Hsp70) has been known to be able to play a protective role in the cochlea. The aim of this study was to investigate whether geldanamycin hydrosoluble derivative 17-(dimethylaminoethylamino)-17-demethoxygeldanamycin (17-DMAG) has the ability to induce Hsp70 up-regulation to protect hair cells from kanamycin-induced ototoxicity in vitro. The organ of Corti (OC) explants were isolated from mice at postnatal day 3-5. Then, the explants were exposed to kanamycin with or without pre-incubation with 17-DMAG. The expression of Hsp70 was assessed by reverse transcription-quantitative polymerase chain reaction, ELISA, and immunofluorescent staining. The surviving hair cells were examined by phalloidin labeling and were counted. We found that Hsp70 expression in the explants after pre-incubation with 17-DMAG was significantly increased at both mRNA and protein levels. Immunofluorescent staining showed that Hsp70 was mainly located in the auditory hair cells. Compared with kanamycin group, the loss of hair cells was inhibited significantly in 17-DMAG+kanamycin group. Our study demonstrated that 17-DMAG induces Hsp70 in the hair cells, and has a significant protective effect against kanamycin ototoxicity in vitro. 17-DMAG has the possibility to be a safe and effective anti-ototoxic drug.

  18. Sustained Fos expression is observed in the developing brainstem auditory circuits of kanamycin-treated rats.

    PubMed

    Lee, Jae Ho; Kim, Hee Jung; Suh, Myung-Whan; Ahn, Seung Cheol

    2011-11-14

    It has been demonstrated that kanamycin treatment during early developmental period induces partial cochlear destruction and enhanced glutamatergic transmission at the medial nucleus of the trapezoid body (MNTB) - the lateral superior olive (LSO) synapses in the superior olivary complex (SOC). As c-fos was expected to be expressed in the SOC by kanamycin-induced cochlear damage, the expression of c-fos protein (Fos) was investigated using immunohistochemistry in kanamycin-treated rat pups. In the control rat pups less than postnatal (P) day 9 in age, Fos-like immunoreactivity (Fos-IR) was transiently observed in the MNTB and LSO on P6, but disappeared on P9, which reflects a physiologic process. In contrast, in kanamycin-treated rats, Fos-IR was consistently observed through P9. Because a significant increase in terminal uridine deoxynucleotidyl transferase-mediated 2'-deoxyuridine 5'-triphosphate-biotin nick-end labeling (TUNEL) and glial fibrillary acidic protein (GFAP) IR was not demonstrated in the MNTB and LSO of kanamycin-treated rats, the increased Fos-IR does not appear to indicate an ongoing pathologic process, but may be related to the increased activity caused by the disturbance in excitatory and inhibitory balance between brainstem auditory circuits.

  19. Structure-activity relationships for antibacterial to antifungal conversion of kanamycin to amphiphilic analogues.

    PubMed

    Fosso, Marina; AlFindee, Madher N; Zhang, Qian; Nziko, Vincent de Paul Nzuwah; Kawasaki, Yukie; Shrestha, Sanjib K; Bearss, Jeremiah; Gregory, Rylee; Takemoto, Jon Y; Chang, Cheng-Wei Tom

    2015-05-01

    Novel fungicides are urgently needed. It was recently reported that the attachment of an octyl group at the O-4″ position of kanamycin B converts this antibacterial aminoglycoside into a novel antifungal agent. To elucidate the structure-activity relationship (SAR) for this phenomenon, a lead compound FG03 with a hydroxyl group replacing the 3″-NH2 group of kanamycin B was synthesized. FG03's antifungal activity and synthetic scheme inspired the synthesis of a library of kanamycin B analogues alkylated at various hydroxyl groups. SAR studies of the library revealed that for antifungal activity the O-4″ position is the optimal site for attaching a linear alkyl chain and that the 3″-NH2 and 6″-OH groups of the kanamycin B parent molecule are not essential for antifungal activity. The discovery of lead compound, FG03, is an example of reviving clinically obsolete drugs like kanamycin by simple chemical modification and an alternative strategy for discovering novel antimicrobials.

  20. Structure-activity relationships among the kanamycin aminoglycosides: role of ring I hydroxyl and amino groups.

    PubMed

    Salian, Sumantha; Matt, Tanja; Akbergenov, Rashid; Harish, Shinde; Meyer, Martin; Duscha, Stefan; Shcherbakov, Dmitri; Bernet, Bruno B; Vasella, Andrea; Westhof, Eric; Böttger, Erik C

    2012-12-01

    The kanamycins form an important subgroup of the 4,6-disubstituted 2-deoxystreptamine aminoglycoside antibiotics, comprising kanamycin A, kanamycin B, tobramycin, and dibekacin. These compounds interfere with protein synthesis by targeting the ribosomal decoding A site, and they differ in the numbers and locations of amino and hydroxy groups of the glucopyranosyl moiety (ring I). We synthesized kanamycin analogues characterized by subtle variations of the 2' and 6' substituents of ring I. The functional activities of the kanamycins and the synthesized analogues were investigated (i) in cell-free translation assays on wild-type and mutant bacterial ribosomes to study drug-target interaction, (ii) in MIC assays to assess antibacterial activity, and (iii) in rabbit reticulocyte translation assays to determine activity on eukaryotic ribosomes. Position 2' forms an intramolecular H bond with O5 of ring II, helping the relative orientations of the two rings with respect to each other. This bond becomes critical for drug activity when a 6'-OH substituent is present.

  1. An ultrasensitive homogeneous aptasensor for kanamycin based on upconversion fluorescence resonance energy transfer.

    PubMed

    Li, Hui; Sun, De-en; Liu, Yajie; Liu, Zhihong

    2014-05-15

    We developed an ultrasensitive fluorescence resonance energy transfer (FRET) aptasensor for kanamycin detection, using upconversion nanoparticles (UCNPs) as the energy donor and graphene as the energy acceptor. Oleic acid modified upconversion nanoparticles were synthesized through a hydrothermal process followed by a ligand exchange with hexanedioic acid. The kanamycin aptamer (5'-NH2-AGATGGGGGTTGAGGCTAAGCCGA-3') was tagged to UCNPs through an EDC-NHS protocol. The π-π stacking interaction between the aptamer and graphene brought UCNPs and graphene in close proximity and hence initiated the FRET process resulting in quenching of UCNPs fluorescence. The addition of kanamycin to the UCNPs-aptamer-graphene complex caused the fluorescence recovery because of the blocking of the energy transfer, which was induced by the conformation change of aptamer into a hairpin structure. A linear calibration was obtained between the fluorescence intensity and the logarithm of kanamycin concentration in the range from 0.01 nM to 3 nM in aqueous buffer solution, with a detection limit of 9 pM. The aptasensor was also applicable in diluted human serum sample with a linear range from 0.03 nM to 3 nM and a detection limit of 18 pM. The aptasensor showed good specificity towards kanamycin without being disturbed by other antibiotics. The ultrahigh sensitivity and pronounced robustness in complicated sample matrix suggested promising prospect of the aptasensor in practical applications.

  2. Novel Synthesis of Kanamycin Conjugated Gold Nanoparticles with Potent Antibacterial Activity.

    PubMed

    Payne, Jason N; Waghwani, Hitesh K; Connor, Michael G; Hamilton, William; Tockstein, Sarah; Moolani, Harsh; Chavda, Fenil; Badwaik, Vivek; Lawrenz, Matthew B; Dakshinamurthy, Rajalingam

    2016-01-01

    With a sharp increase in the cases of multi-drug resistant (MDR) bacteria all over the world, there is a huge demand to develop a new generation of antibiotic agents to fight them. As an alternative to the traditional drug discovery route, we have designed an effective antibacterial agent by modifying an existing commercial antibiotic, kanamycin, conjugated on the surface of gold nanoparticles (AuNPs). In this study, we report a single-step synthesis of kanamycin-capped AuNPs (Kan-AuNPs) utilizing the combined reducing and capping properties of kanamycin. While Kan-AuNPs have increased toxicity to a primate cell line (Vero 76), antibacterial assays showed dose-dependent broad spectrum activity of Kan-AuNPs against both Gram-positive and Gram-negative bacteria, including Kanamycin resistant bacteria. Further, a significant reduction in the minimum inhibitory concentration (MIC) of Kan-AuNPs was observed when compared to free kanamycin against all the bacterial strains tested. Mechanistic studies using transmission electron microscopy and fluorescence microscopy indicated that at least part of Kan-AuNPs increased efficacy may be through disrupting the bacterial envelope, resulting in the leakage of cytoplasmic content and the death of bacterial cells. Results of this study provide critical information about a novel method for the development of antibiotic capped AuNPs as potent next-generation antibacterial agents.

  3. Chlamydial plasmids and bacteriophages.

    PubMed

    Pawlikowska-Warych, Małgorzata; Śliwa-Dominiak, Joanna; Deptuła, Wiesław

    2015-01-01

    Chlamydia are absolute pathogens of humans and animals; despite being rather well recognised, they are still open for discovery. One such discovery is the occurrence of extrachromosomal carriers of genetic information. In prokaryotes, such carriers include plasmids and bacteriophages, which are present only among some Chlamydia species. Plasmids were found exclusively in Chlamydia (C.) trachomatis, C. psittaci, C. pneumoniae, C. suis, C. felis, C. muridarum and C. caviae. In prokaryotic organisms, plasmids usually code for genes that facilitate survival of the bacteria in the environment (although they are not essential). In chlamydia, their role has not been definitely recognised, apart from the fact that they participate in the synthesis of glycogen and encode proteins responsible for their virulence. Furthermore, in C. suis it was evidenced that the plasmid is integrated in a genomic island and contains the tetracycline-resistance gene. Bacteriophages specific for chlamydia (chlamydiaphages) were detected only in six species: C. psittaci, C. abortus, C. felis, C. caviae C. pecorum and C. pneumoniae. These chlamydiaphages cause inhibition of the developmental cycle, and delay transformation of reticulate bodies (RBs) into elementary bodies (EBs), thus reducing the possibility of infecting other cells in time. Plasmids and bacteriophages can be used in the diagnostics of chlamydioses; although especially in the case of plasmids, they are already used for detection of chlamydial infections. In addition, bacteriophages could be used as therapeutic agents to replace antibiotics, potentially addressing the problem of increasing antibiotic-resistance among chlamydia.

  4. Autonomous assembly of synthetic oligonucleotides built from an expanded DNA alphabet. Total synthesis of a gene encoding kanamycin resistance

    PubMed Central

    Merritt, Kristen K; Bradley, Kevin M; Hutter, Daniel; Matsuura, Mariko F; Rowold, Diane J

    2014-01-01

    Summary Background: Many synthetic biologists seek to increase the degree of autonomy in the assembly of long DNA (L-DNA) constructs from short synthetic DNA fragments, which are today quite inexpensive because of automated solid-phase synthesis. However, the low information density of DNA built from just four nucleotide “letters”, the presence of strong (G:C) and weak (A:T) nucleobase pairs, the non-canonical folded structures that compete with Watson–Crick pairing, and other features intrinsic to natural DNA, generally prevent the autonomous assembly of short single-stranded oligonucleotides greater than a dozen or so. Results: We describe a new strategy to autonomously assemble L-DNA constructs from fragments of synthetic single-stranded DNA. This strategy uses an artificially expanded genetic information system (AEGIS) that adds nucleotides to the four (G, A, C, and T) found in standard DNA by shuffling hydrogen-bonding units on the nucleobases, all while retaining the overall Watson–Crick base-pairing geometry. The added information density allows larger numbers of synthetic fragments to self-assemble without off-target hybridization, hairpin formation, and non-canonical folding interactions. The AEGIS pairs are then converted into standard pairs to produce a fully natural L-DNA product. Here, we report the autonomous assembly of a gene encoding kanamycin resistance using this strategy. Synthetic fragments were built from a six-letter alphabet having two AEGIS components, 5-methyl-2’-deoxyisocytidine and 2’-deoxyisoguanosine (respectively S and B), at their overlapping ends. Gaps in the overlapped assembly were then filled in using DNA polymerases, and the nicks were sealed by ligase. The S:B pairs in the ligated construct were then converted to T:A pairs during PCR amplification. When cloned into a plasmid, the product was shown to make Escherichia coli resistant to kanamycin. A parallel study that attempted to assemble similarly sized genes with

  5. Complete nucleotide sequence of pH11, an IncHI2 plasmid conferring multi-antibiotic resistance and multi-heavy metal resistance genes in a clinical Klebsiella pneumoniae isolate.

    PubMed

    Zhai, Yao; He, Zilong; Kang, Yu; Yu, Haiying; Wang, Jianfeng; Du, Pengcheng; Zhang, Zhao; Hu, Songnian; Gao, Zhancheng

    2016-07-01

    The complete 284,628bp sequence of pH11, an IncHI2 plasmid, was determined through single-molecule, real-time (SMRT) sequencing. Harbored by a clinical Klebsiella pneumoniae strain H11, and isolated in Beijing, this plasmid contains multiple antibiotic resistance genes, including catA2, aac(6')-Ib, strB, strA, dfrA19, blaTEM-1, blaSHV-12, sul1, qacE delta 1, ereA, arr2, and aac3. The aac(6')-Ib is carried by a class I integron. Plasmid pH11 also carries several genes associated with resistance to heavy metals, such as tellurium, mercury, cobalt, zinc, nickel, copper, lead and cadmium. This plasmid exhibits numerous characteristics, including HipBA and RelBE toxin-antitoxin systems, two major transfer (Tra) regions closely related to those of Salmonella enterica serovar plasmid pRH-R27, a type II restriction modification system (EcoRII R-M system), several methyltransferases and methylases and genes encoding Hha and StpA. These characteristics suggest that pH11 may adapt to various hosts and environments. Multiple insertion sequence elements, transposases, recombinases, resolvases and integrases are scattered throughout pH11. The presence of these genes may indicate that horizontal gene transfer occurs frequently in pH11 and thus may facilitate the dissemination of antimicrobial resistance determinants. Our data suggest that pH11 is a chimera gradually assembled through the integration of different horizontally acquired DNA segments via transposition or homologous recombination.

  6. Plasmid partitioning systems of conjugative plasmids from Clostridium perfringens.

    PubMed

    Adams, Vicki; Watts, Thomas D; Bulach, Dieter M; Lyras, Dena; Rood, Julian I

    2015-07-01

    Many pathogenic strains of Clostridium perfringens carry several highly similar toxin or antibiotic resistance plasmids that have 35 to 40 kb of very closely related syntenous sequences, including regions that carry the genes encoding conjugative transfer, plasmid replication and plasmid maintenance functions. Key questions are how are these closely related plasmids stably maintained in the same cell and what is the basis for plasmid incompatibility in C. perfringens. Comparative analysis of the Rep proteins encoded by these plasmids suggested that this protein was not the basis for plasmid incompatibility since plasmids carried in a single strain often encoded an almost identical Rep protein. These plasmids all carried a similar, but not identical, parMRC plasmid partitioning locus. Phylogenetic analysis of the deduced ParM proteins revealed that these proteins could be divided into ten separate groups. Importantly, in every strain that carried more than one of these plasmids, the respective ParM proteins were from different phylogenetic groups. Similar observations were made from the analysis of phylogenetic trees of the ParR proteins and the parC loci. These findings provide evidence that the basis for plasmid incompatibility in the conjugative toxin and resistance plasmid family from C. perfringens resides in subtle differences in the parMRC plasmid partitioning loci carried by these plasmids.

  7. [Research progress of acute kanamycin sulfate-induced deafness in guinea pig].

    PubMed

    Yin, Zedeng; Kng, Weijia

    2012-05-01

    To present a summary of current knowledge regarding acute kanamycin sulfate-induced deafness in guinea pig, by reviewing the published literature. Animal model of acute deafness induced by a single dose of kanamycin sulfate in combination with ethacrynic acid or furosemide in guinea pig was usually used to investigate the mechanism of cochlear cell degeneration. There were different time sequences of cell degeneration of spiral ganglion cell and hair cell in different studies. The findings may result from different doses, order of two drugs administration or time point chosen. There remains scope for further research in chronic kanamycin-induced deafness, which more replicates the type of exposure to people than acute deafness.

  8. Construction of kanamycin B overproducing strain by genetic engineering of Streptomyces tenebrarius.

    PubMed

    Ni, Xianpu; Li, Dan; Yang, Lihua; Huang, Tingjiao; Li, Hao; Xia, Huanzhang

    2011-02-01

    Genetic engineering as an important approach to strain optimization has received wide recognition. Recent advances in the studies on the biosynthetic pathways and gene clusters of Streptomyces make stain optimization by genetic alteration possible. Kanamycin B is a key intermediate in the manufacture of the important medicines dibekacin and arbekacin, which belong to a class of antibiotics known as the aminoglycosides. Kanamycin could be prepared by carbamoylkanamycin B hydrolysis. However, carbamoylkanamycin B production in Streptomyces tenebrarius H6 is very low. Therefore, we tried to obtain high kanamycin B-producing strains that produced kanamycin B as a main component. In our work, aprD3 and aprD4 were clarified to be responsible for deoxygenation in apramycin and tobramycin biosynthesis. Based on this information, genes aprD3, aprQ (deduced apramycin biosynthetic gene), and aprD4 were disrupted to optimize the production of carbamoylkanamycin B. Compared with wild-type strain, mutant strain SPU313 (ΔaprD3, ΔaprQ, and ΔaprD4) produced carbamoylkanamycin B as a single antibiotic, whose production increased approximately fivefold. To construct a strain producing kanamycin B instead of carbamoylkanamycin B, the carbamoyl-transfer gene tacA was inactivated in strain SPU313. Mutant strain SPU314 (ΔaprD3, ΔaprQ, ΔaprD4, and ΔtacA) specifically produced kanamycin B, which was proven by LC-MS. This work demonstrated careful genetic engineering could significantly improve production and eliminate undesired products.

  9. Macrophage-specific Mycobacterium tuberculosis genes: identification by green fluorescent protein and kanamycin resistance selection.

    PubMed

    Srivastava, Vikas; Rouanet, Carine; Srivastava, Ranjana; Ramalingam, B; Locht, Camille; Srivastava, Brahm S

    2007-03-01

    Mycobacterium tuberculosis survives and multiplies inside macrophages of its host by modulating the expression of several genes essential for in vivo survival. An in vivo expression system has been developed, based on green fluorescent protein and kanamycin resistance, to identify M. tuberculosis genes which appear to be up-regulated in infected macrophages. A promoter-trap shuttle vector, pLL192, was constructed, containing a streptomycin resistance gene as selection marker and an artificial bicistronic operon composed of the promoterless green fluorescent protein (gfp) gene, followed by the kanamycin resistance gene. A unique BamHI site upstream of the gfp gene allowed for insertion of promoter libraries. The vector was validated by the use of known regulated or constitutive M. tuberculosis promoters. In addition, an M. tuberculosis genomic DNA library was inserted into pLL192 and then introduced into Mycobacterium bovis BCG. The recombinant BCG cells were then used to infect the J774A.1 murine macrophage-like cell line in the presence of kanamycin. Several recombinant BCG cells were thereby selected that were resistant to kanamycin within infected macrophages, but were sensitive to kanamycin when grown in vitro. The kanamycin resistance phenotype was paralleled by the fluorescence phenotype. After nucleotide sequencing, the corresponding genes were identified as mce1A, PE_PGRS63(RV3097c), Rv2232, Rv1026, Rv1635c, viuB, Rv2231(cobC) and Rv0997. Real-time PCR analysis using RNA isolated at various time points from M. tuberculosis and M. bovis BCG grown in vitro and within macrophages, confirmed the up-regulation of these genes. The level of up-regulation varied from 2- to 40-fold in macrophages compared to growth in vitro.

  10. Amelioration of the cost of conjugative plasmid carriage in Eschericha coli K12.

    PubMed Central

    Dahlberg, Cecilia; Chao, Lin

    2003-01-01

    Although plasmids can provide beneficial functions to their host bacteria, they might confer a physiological or energetic cost. This study examines how natural selection may reduce the cost of carrying conjugative plasmids with drug-resistance markers in the absence of antibiotic selection. We studied two plasmids, R1 and RP4, both of which carry multiple drug resistance genes and were shown to impose an initial fitness cost on Escherichia coli. To determine if and how the cost could be reduced, we subjected plasmid-containing bacteria to 1100 generations of evolution in batch cultures. Analysis of the evolved populations revealed that plasmid loss never occurred, but that the cost was reduced through genetic changes in both the plasmids and the bacteria. Changes in the plasmids were inferred by the demonstration that evolved plasmids no longer imposed a cost on their hosts when transferred to a plasmid-free clone of the ancestral E. coli. Changes in the bacteria were shown by the lowered cost when the ancestral plasmids were introduced into evolved bacteria that had been cured of their (evolved) plasmids. Additionally, changes in the bacteria were inferred because conjugative transfer rates of evolved R1 plasmids were lower in the evolved host than in the ancestral host. Our results suggest that once a conjugative bacterial plasmid has invaded a bacterial population it will remain even if the original selection is discontinued. PMID:14704155

  11. Kanamycin resistance in plants: an unexpected trait controlled by a potentially multifaceted gene.

    PubMed

    Rommens, Caius M

    2006-07-01

    Ayalew Mentewab and C. Neal Stewart Jr recently showed that an Arabidopsis kanamycin resistance gene encodes an ATP binding cassette (ABC) transporter. This Atwbc19 protein is hypothesized to prevent ribosome inactivation by translocating kanamycin into the vacuole. Because ABC transporters often recognize multiple exogenous substrates, overexpression of Atwbc19 can result in the accumulation of unexpected compounds in transgenic plants. Another potential safety issue associated with this gene is horizontal gene transfer. Thus, commercial applications are likely to be limited to methods that allow removal of the selectable marker from the transgenic plant genome.

  12. Plasmids encoding therapeutic agents

    DOEpatents

    Keener, William K.

    2007-08-07

    Plasmids encoding anti-HIV and anti-anthrax therapeutic agents are disclosed. Plasmid pWKK-500 encodes a fusion protein containing DP178 as a targeting moiety, the ricin A chain, an HIV protease cleavable linker, and a truncated ricin B chain. N-terminal extensions of the fusion protein include the maltose binding protein and a Factor Xa protease site. C-terminal extensions include a hydrophobic linker, an L domain motif peptide, a KDEL ER retention signal, another Factor Xa protease site, an out-of-frame buforin II coding sequence, the lacZ.alpha. peptide, and a polyhistidine tag. More than twenty derivatives of plasmid pWKK-500 are described. Plasmids pWKK-700 and pWKK-800 are similar to pWKK-500 wherein the DP178-encoding sequence is substituted by RANTES- and SDF-1-encoding sequences, respectively. Plasmid pWKK-900 is similar to pWKK-500 wherein the HIV protease cleavable linker is substituted by a lethal factor (LF) peptide-cleavable linker.

  13. Two different erm(C)-carrying plasmids in the same methicillin-resistant Staphylococcus aureus CC398 isolate from a broiler farm.

    PubMed

    Wendlandt, Sarah; Kadlec, Kristina; Feßler, Andrea T; van Duijkeren, Engeline; Schwarz, Stefan

    2014-07-16

    During a study on plasmid-borne antimicrobial resistance among methicillin-resistant Staphylococcus aureus (MRSA) isolates from broiler farms, an MRSA isolate was identified which carried multiple plasmids. This MRSA isolate belonged to CC398 and exhibited spa type t3015 and dru type dt11a. Plasmid profiling revealed the presence of one large and two small plasmids. The resistance genes tet(L) (tetracycline resistance), dfrK (trimethoprim resistance) and aadD (kanamycin/neomycin resistance) were located on the large plasmid. Both small plasmids, designated pSWS371 and pSWS372, carried only an erm(C) gene for macrolide/lincosamide resistance. Sequence analysis revealed that the 2458-bp plasmid pSWS371 carried only a repL gene for plasmid replication in addition to the erm(C) gene. In contrast, the 3882-bp plasmid pSWS372 harbored - in addition to the erm(C) gene - three more genes: a repF gene for plasmid replication, a cop-6 gene for a small protein potentially involved in copy number control of the plasmid and a novel pre/mob gene for a protein involved in plasmid recombination and mobilization. The erm(C) genes of both small plasmids exhibited constitutive erm(C) gene expression and analysis of the respective translational attenuators identified deletions of 16 bp and 74 bp which explain the constitutive expression. The simultaneous presence of two small plasmids that carry the same resistance gene in the same MRSA isolate is a rare observation. The fact that both plasmids belong to different incompatibility groups as specified by the different rep genes, repL and repF, explains why they can stably coexist in the same bacterial cell. Copyright © 2014 Elsevier B.V. All rights reserved.

  14. Phytoplasma plasmid DNA extraction.

    PubMed

    Andersen, Mark T; Liefting, Lia W

    2013-01-01

    Phytoplasma plasmids have generally been detected from DNA extracted from plants and insects using methods designed for the purification of total phytoplasma DNA. Methods include extraction from tissues that are high in phytoplasma titre, such as the phloem of plants, with the use of CsCl-bisbenzimide gradients that exploit the low G+C content of phytoplasma DNA. Many of the methods employed for phytoplasma purification have been described elsewhere in this book. Here we describe in detail two methods that are specifically aimed at isolating plasmid DNA.

  15. Photoelectrochemical aptasensing of kanamycin using visible light-activated carbon nitride and graphene oxide nanocomposites.

    PubMed

    Li, Ruizhen; Liu, Yong; Cheng, Ling; Yang, Changzhu; Zhang, Jingdong

    2014-10-07

    Photoactive material and recognition element are two crucial factors which determine the sensitivity and selectivity of the photoelectrochemical (PEC) sensor. Herein we developed a novel PEC aptamer sensor for the specific detection of kanamycin using water-dispersible graphite-like carbon nitride (w-g-C3N4) as visible light-active material and aptamer as the biorecognition element. While a suitable amount of graphene oxide (GO) was doped in w-g-C3N4, the visible light photocurrent response was enhanced, which was beneficial to the construction of PEC sensor. On the other hand, the large specific surface area and π-conjugated structure of GO/w-g-C3N4 provided an excellent platform for immobilizing the kanamycin-binding DNA aptamer on the surface of the sensor via π-π stacking interaction. On such a sensor, the capture of kanamycin molecules by aptamer resulted in increased photocurrent. The PEC response of the sensor was found to be linearly proportional to the concentration of kanamycin in the range from 1 nM to 230 nM with a detection limit (3S/N) of 0.2 nM. Moreover, the proposed sensor displayed high selectivity, good reproducibility, and high stability, demonstrating the successful combination of GO/w-g-C3N4 with aptamer in fabricating high performance PEC sensors.

  16. Susceptibility of coagulase-negative staphylococci to a kanamycin and cefalexin combination.

    PubMed

    Silley, P; Goby, L; Pillar, C M

    2012-06-01

    A combination of kanamycin and cefalexin was licensed in Europe in 2008 to treat bovine clinical mastitis. Preliminary broth and disk clinical breakpoints for this antibiotic combination have been proposed for Staphylococcus aureus, Streptococcus dysgalactiae, Streptococcus uberis, and Escherichia coli. This study indicates that these proposed breakpoints also hold for coagulase-negative staphylococci (CNS), a group of bacteria frequently isolated in milk samples from cows with clinical mastitis. The data show that clinical bovine mastitis isolates of CNS from Europe have a high degree of susceptibility to the kanamycin/cefalexin combination, with minimal resistance to either agent alone. The use of the available kanamycin and cefalexin combination disk for testing the susceptibility of bovine mastitis isolates of Staph. aureus, Strep. uberis, Strep. dysgalactiae, and E. coli is also reliable for use in the testing of CNS, as disk results correlated with broth minimum inhibitory concentrations. The study reports, for the first time, the approved Clinical Laboratory Standards Institute quality control ranges for the kanamycin/cefalexin combination and wild-type cutoff values for major bacterial pathogens implicated in bovine mastitis.

  17. Aptamer-mediated 'turn-off/turn-on' nanozyme activity of gold nanoparticles for kanamycin detection.

    PubMed

    Sharma, Tarun Kumar; Ramanathan, Rajesh; Weerathunge, Pabudi; Mohammadtaheri, Mahsa; Daima, Hemant Kumar; Shukla, Ravi; Bansal, Vipul

    2014-12-28

    A new ultrafast and highly sensitive 'turn-off/turn-on' biosensing approach that combines the intrinsic peroxidase-like activity of gold nanoparticles (GNPs) with the high affinity and specificity of a ssDNA aptamer is presented for the efficient detection of a model small molecule kanamycin.

  18. [Antitoxic properties of pantothenic acid derivatives, precursors of coenzyme A biosynthesis, with regard to kanamycin].

    PubMed

    Moĭseenok, A G; Dorofeev, B F; Sheĭbak, V M; Khomich, T I

    1984-11-01

    The effect of calcium pantothenate (CPN)B 4'-phospho-CPN (PCP), pantetheine (PT) and calcium S-sulfopantetheine (SPN) on acute toxicity of kanamycin sulfate was studied on albino mice. The above derivatives of pantothenic acid except PT lowered the antibiotic toxicity. The coefficient of the antitoxic effect (LD50/ED50) of SPN and PCP was 1.3-1.4 times higher than that of CPN. The combined use of kanamycin (1/5 of the LD50) with CPN, PCP or PT (30 mg/kg bw was equivalent to CPN) for 15 days prevented the increase in the total content of CoA and in the content of the fraction of free CoA and the precursors of its biosynthesis participating in the reaction of N-acetylation in the liver and brain. The contents of these substances were within the normal during the whole experiment. A certain increase in the activity of pantothenate kinase in the liver cytosol due to the use of kanamycin was eliminated by the simultaneous use of PCP and PT. The vitamin-containing compounds PCP and SPN were recommended for the clinical trials as agents preventing complications of kanamycin therapy.

  19. Serum resistance encoded by colicin V plasmids in Escherichia coli and its relationship to the plasmid transfer system.

    PubMed Central

    Nilius, A M; Savage, D C

    1984-01-01

    Eight colicin V plasmids were conjugated into a plasmidless Escherichia coli (K-12) strain that was susceptible to the bactericidal effects of normal rabbit serum. The resulting colicin V-positive strains were examined for their capacity to resist the lethal effects of serum. Serum resistance was assessed as growth of the bacterial strain in medium containing 5% normal rabbit serum inoculated from a culture in the early exponential phase. Only three of the eight colicin V plasmids were found to confer the serum resistance phenotype on the host strain. Derepression of the transfer system was associated with serum resistance in two of the plasmids. Two other derepressed plasmids did not confer serum resistance on the host bacterium. Therefore, such derepression alone was insufficient to produce serum resistance. The factor(s) encoded by colicin V plasmids and responsible for the serum resistance of the bacterial strains bearing the plasmids was shown to be a property associated with the cell and not an extracellular factor excreted into the growth medium. PMID:6365788

  20. Plasmid and clonal interference during post horizontal gene transfer evolution.

    PubMed

    Bedhomme, S; Perez Pantoja, D; Bravo, I G

    2017-04-01

    Plasmids are nucleic acid molecules that can drive their own replication in a living cell. They can be transmitted horizontally and can thrive in the host cell to high-copy numbers. Plasmid replication and gene expression consume cellular resources and cells carrying plasmids incur fitness costs. But many plasmids carry genes that can be beneficial under certain conditions, allowing the cell to endure in the presence of antibiotics, toxins, competitors or parasites. Horizontal transfer of plasmid-encoded genes can thus instantaneously confer differential adaptation to local or transient selection conditions. This conflict between cellular fitness and plasmid spread sets the scene for multilevel selection processes. We have engineered a system to study the short-term evolutionary impact of different synonymous versions of a plasmid-encoded antibiotic resistance gene. Applying experimental evolution under different selection conditions and deep sequencing allowed us to show rapid local adaptation to the presence of antibiotic and to the specific version of the resistance gene transferred. We describe the presence of clonal interference at two different levels: at the within-cell level, because a single cell can carry several plasmids, and at the between-cell level, because a bacterial population may contain several clones carrying different plasmids and displaying different fitness in the presence/absence of antibiotic. Understanding the within-cell and between-cell dynamics of plasmids after horizontal gene transfer is essential to unravel the dense network of mobile elements underlying the worldwide threat to public health of antibiotic resistance. © 2017 John Wiley & Sons Ltd.

  1. Plasmid Detection, Characterization, and Ecology.

    PubMed

    Smalla, Kornelia; Jechalke, Sven; Top, Eva M

    2015-02-01

    Plasmids are important vehicles for rapid adaptation of bacterial populations to changing environmental conditions. It is thought that to reduce the cost of plasmid carriage, only a fraction of a local population carries plasmids or is permissive to plasmid uptake. Plasmids provide various accessory traits which might be beneficial under particular conditions. The genetic variation generated by plasmid carriage within populations ensures the robustness toward environmental changes. Plasmid-mediated gene transfer plays an important role not only in the mobilization and dissemination of antibiotic resistance genes but also in the spread of degradative pathways and pathogenicity determinants of pathogens. Here we summarize the state-of-the-art methods to study the occurrence, abundance, and diversity of plasmids in environmental bacteria. Increasingly, cultivation-independent total-community DNA-based methods are being used to characterize and quantify the diversity and abundance of plasmids in relation to various biotic and abiotic factors. An improved understanding of the ecology of plasmids and their hosts is crucial in the development of intervention strategies for antibiotic-resistance-gene spread. We discuss the potentials and limitations of methods used to determine the host range of plasmids, as the ecology of plasmids is tightly linked to their hosts. The recent advances in sequencing technologies provide an enormous potential for plasmid classification, diversity, and evolution studies, but numerous challenges still exist.

  2. Plasmid interference for curing antibiotic resistance plasmids in vivo.

    PubMed

    Kamruzzaman, Muhammad; Shoma, Shereen; Thomas, Christopher M; Partridge, Sally R; Iredell, Jonathan R

    2017-01-01

    Antibiotic resistance increases the likelihood of death from infection by common pathogens such as Escherichia coli and Klebsiella pneumoniae in developed and developing countries alike. Most important modern antibiotic resistance genes spread between such species on self-transmissible (conjugative) plasmids. These plasmids are traditionally grouped on the basis of replicon incompatibility (Inc), which prevents coexistence of related plasmids in the same cell. These plasmids also use post-segregational killing ('addiction') systems, which poison any bacterial cells that lose the addictive plasmid, to guarantee their own survival. This study demonstrates that plasmid incompatibilities and addiction systems can be exploited to achieve the safe and complete eradication of antibiotic resistance from bacteria in vitro and in the mouse gut. Conjugative 'interference plasmids' were constructed by specifically deleting toxin and antibiotic resistance genes from target plasmids. These interference plasmids efficiently cured the corresponding antibiotic resistant target plasmid from different Enterobacteriaceae in vitro and restored antibiotic susceptibility in vivo to all bacterial populations into which plasmid-mediated resistance had spread. This approach might allow eradication of emergent or established populations of resistance plasmids in individuals at risk of severe sepsis, enabling subsequent use of less toxic and/or more effective antibiotics than would otherwise be possible, if sepsis develops. The generalisability of this approach and its potential applications in bioremediation of animal and environmental microbiomes should now be systematically explored.

  3. Mechanisms of plasmid segregation: have multicopy plasmids been overlooked?

    PubMed

    Million-Weaver, Samuel; Camps, Manel

    2014-09-01

    Plasmids are self-replicating pieces of DNA typically bearing non-essential genes. Given that plasmids represent a metabolic burden to the host, mechanisms ensuring plasmid transmission to daughter cells are critical for their stable maintenance in the population. Here we review these mechanisms, focusing on two active partition strategies common to low-copy plasmids: par systems type I and type II. Both involve three components: an adaptor protein, a motor protein, and a centromere, which is a sequence area in the plasmid that is recognized by the adaptor protein. The centromere-bound adaptor nucleates polymerization of the motor, leading to filament formation, which can pull plasmids apart (par I) or push them towards opposite poles of the cell (par II). No such active partition mechanisms are known to occur in high copy number plasmids. In this case, vertical transmission is generally considered stochastic, due to the random distribution of plasmids in the cytoplasm. We discuss conceptual and experimental lines of evidence questioning the random distribution model and posit the existence of a mechanism for segregation in high copy number plasmids that moves plasmids to cell poles to facilitate transmission to daughter cells. This mechanism would involve chromosomally-encoded proteins and the plasmid origin of replication. Modulation of this proposed mechanism of segregation could provide new ways to enhance plasmid stability in the context of recombinant gene expression, which is limiting for large-scale protein production and for bioremediation.

  4. Protonation of kanamycin A: detailing of thermodynamics and protonation sites assignment.

    PubMed

    Fuentes-Martínez, Yanet; Godoy-Alcántar, Carolina; Medrano, Felipe; Dikiy, Alexander; Yatsimirsky, Anatoly K

    2010-08-01

    Protonation of an aminoglycoside antibiotic kanamycin A sulfate was studied by potentiometric titrations at variable ionic strength, sulfate concentration and temperature. From these results the association constants of differently protonated forms of kanamycin A with sulfate and enthalpy changes for protonation of each amino group were determined. The protonation of all amino groups of kanamycin A is exothermic, but the protonation enthalpy does not correlate with basicity as in a case of simple polyamines. The sites of stepwise protonation of kanamycin A have been assigned by analysis of (1)H-(13)C-HSQC spectra at variable pH in D(2)O. Plots of chemical shifts for each H and C atom of kanamycin A vs. pH were fitted to the theoretical equation relating them to pK(a) values of ionogenic groups and it was observed that changes in chemical shifts of all atoms in ring C were controlled by ionization of a single amino group with pK(a) 7.98, in ring B by ionization of two amino groups with pK(a) 6.61 and 8.54, but in ring A all atoms felt ionization of one group with pK(a) 9.19 and some atoms felt ionization of a second group with pK(a) 6.51, which therefore should belong to amino group at C3 in ring B positioned closer to the ring A while higher pK(a) 8.54 can be assigned to the group at C1. This resolves the previously existed uncertainty in assignment of protonation sites in rings B and C.

  5. Bicarbonate enhances the in vitro antibiotic activity of kanamycin in Escherichia coli.

    PubMed

    Gutiérrez-Huante, M; Martínez, H; Bustamante, V H; Puente, J L; Sánchez, J

    2015-05-01

    Growth of enteropathogenic Escherichia coli E2348/69 was inhibited by bicarbonate in a dose-dependent manner, showing approximately 5% growth reduction at 5 mmol l(-1) while kanamycin at 3·12 μg ml(-1) inhibited growth by 15%, yet when kanamycin and bicarbonate were combined at these concentrations, inhibition increased to 80%. Unexpectedly, at bicarbonate concentrations >20 mmol l(-1) enhancement of the antibiotic activity virtually disappeared, i.e. there was a paradoxical Eagle-like effect. How bicarbonate acts is unclear, but neutral or alkaline pH also enhanced the activity of kanamycin. However, several differences indicated a separate effect of bicarbonate. First, bicarbonate inhibited growth more than the corresponding increments in pH. Second, at low concentration, the antibiotic enhancing effect of bicarbonate was stronger than the effect of pH alone. Third, 5 mmol l(-1) bicarbonate significantly enhanced the activity of kanamycin while the corresponding pH had no effect. Fourth, the Eagle-like effect was exclusive of bicarbonate because changes in pH did not induce an analogous behaviour. Notwithstanding the mechanism, the enhancing effect of bicarbonate was indubitable. Consequently, it seems worthwhile to explore further its potential to improve the efficacy of aminoglycosides and maybe even other antibiotics. Bicarbonate at a low concentration enhanced the in vitro antibiotic activity of kanamycin and gentamicin. Even though the action mechanism of bicarbonate is hitherto unknown, it seems worthwhile to explore further its capacity to improve the efficacy of aminoglycosides. Clearly, the well-known harmful side-effects of aminoglycosides are a concern. However, it has recently been shown in a fish model that bicarbonate may protect ciliary cells against the damage caused by aminoglycosides. So, it seems possible that bicarbonate could help reduce aminoglycoside dosage at the same time that it might help lessen the damage to auditory ciliary cells in

  6. Chemotherapy of Bacterial Plasmids

    DTIC Science & Technology

    1979-01-29

    multiresistance to chemotherapeutic drugs, mediated drug resistance are the emergence of strains determined by R-plasmids, causes treatment failures of Haemophilus ... influenzae , resistant to ampicillin [8] of hospital infections, foremost in patients with a or chloramphenicol [9] and of Neisseria gonorrhoeae

  7. Plasmids of Legionella Species.

    DTIC Science & Technology

    1982-06-18

    these organisms could support the replication of other plasmids. In recent years, there have been epidemics of typhoid fever in Vietnam and Mexico due...and M. Pollack. 1973. Chloram- phenicol-resistant typhoid fever in Vietnam associated with R factor. Lancet ii:983-985. IA I~ ! l -- +t.-t, lo. re

  8. Extremely sensitive sandwich assay of kanamycin using surface-enhanced Raman scattering of 2-mercaptobenzothiazole labeled gold@silver nanoparticles.

    PubMed

    Zengin, Adem; Tamer, Ugur; Caykara, Tuncer

    2014-03-19

    Herein, we report the development of extremely sensitive sandwich assay of kanamycin using a combination of anti-kanamycin functionalized hybrid magnetic (Fe3O4) nanoparticles (MNPs) and 2-mercaptobenzothiazole labeled Au-core@Ag-shell nanoparticles as the recognition and surface-enhanced Raman scattering (SERS) substrate, respectively. The hybrid MNPs were first prepared via surface-mediated RAFT polymerization of N-acryloyl-L-glutamic acid in the presence of 2-(butylsulfanylcarbonylthiolsulfanyl) propionic acid-modified MNPs as a RAFT agent and then biofunctionalized with anti-kanamycin, which are both specific for kanamycin and can be collected via a simple magnet. After separating kanamycin from the sample matrix, they were sandwiched with the SERS substrate. According to our experimental results, the limit of detection (LOD) was determined to be 2pg mL(-1), this value being about 3-7 times more than sensitive than the LOD of previously reported results, which can be explained by the higher SERS activity of silver coated gold nanoparticles. The analysis time took less than 10min, including washing and optical detection steps. Furthermore, the sandwich assay was evaluated for investigating the kanamycin specificity on neomycin, gentamycin and streptomycin and detecting kanamycin in artificially contaminated milk.

  9. Time sequence of auditory nerve and spiral ganglion cell degeneration following chronic kanamycin-induced deafness in the guinea pig.

    PubMed

    Kong, W J; Yin, Z D; Fan, G R; Li, D; Huang, X

    2010-05-17

    We investigated the time sequence of morphological changes of the spiral ganglion cell (SGC) and auditory nerve (AN) following chronic kanamycin-induced deafness. Guinea pigs were treated with kanamycin by subcutaneous injection at 500 mg/kg per day for 7 days. Histological changes in hair cells, SGCs, Schwann cells and the area of the cross-sectional of the AN with vestibular ganglion (VG) in the internal acoustic meatus were quantified at 1, 7, 14, 28, 56 and 70 days after kanamycin treatment. Outer hair cells decreased at 7 and 14 days. Loss of inner hair cells occurred at 14 and 28 days. The cross-sectional area of the AN with VG increased at 1 day and decreased shortly following loss of SGCs and Schwann cells at 7, 14 and 28 days after deafening. There was a similar time course of morphological changes in the overall cochlea and the basal turn. Thus, the effects of kanamycin on hair cells, spiral ganglion and Schwann cells are progressive. Early degeneration of SGC and Schwann cell mainly results from the direct toxic effect of kanamycin. However, multiple factors such as loss of hair cell, degeneration of Schwann cell and the progressive damage of kanamycin, may participate in the late degeneration process of SGCs. The molecular mechanism of the degeneration of SGC and Schwann cell should be investigated in the future. Moreover, there is a different time sequence of cell degeneration between acute and chronic deafness by kanamycin.

  10. Plasmid interference for curing antibiotic resistance plasmids in vivo

    PubMed Central

    Kamruzzaman, Muhammad; Shoma, Shereen; Thomas, Christopher M.; Partridge, Sally R.

    2017-01-01

    Antibiotic resistance increases the likelihood of death from infection by common pathogens such as Escherichia coli and Klebsiella pneumoniae in developed and developing countries alike. Most important modern antibiotic resistance genes spread between such species on self-transmissible (conjugative) plasmids. These plasmids are traditionally grouped on the basis of replicon incompatibility (Inc), which prevents coexistence of related plasmids in the same cell. These plasmids also use post-segregational killing (‘addiction’) systems, which poison any bacterial cells that lose the addictive plasmid, to guarantee their own survival. This study demonstrates that plasmid incompatibilities and addiction systems can be exploited to achieve the safe and complete eradication of antibiotic resistance from bacteria in vitro and in the mouse gut. Conjugative ‘interference plasmids’ were constructed by specifically deleting toxin and antibiotic resistance genes from target plasmids. These interference plasmids efficiently cured the corresponding antibiotic resistant target plasmid from different Enterobacteriaceae in vitro and restored antibiotic susceptibility in vivo to all bacterial populations into which plasmid-mediated resistance had spread. This approach might allow eradication of emergent or established populations of resistance plasmids in individuals at risk of severe sepsis, enabling subsequent use of less toxic and/or more effective antibiotics than would otherwise be possible, if sepsis develops. The generalisability of this approach and its potential applications in bioremediation of animal and environmental microbiomes should now be systematically explored. PMID:28245276

  11. Non-invasive determination of conjugative transfer of plasmids bearing antibiotic-resistance genes in biofilm-bound bacteria: effects of substrate loading and antibiotic selection

    PubMed Central

    Ma, Hongyan; Bryers, James D.

    2012-01-01

    Biofilms cause much of all human microbial infections. Attempts to eradicate biofilm-based infections rely on disinfectants and antibiotics. Unfortunately, biofilm bacteria are significantly less responsive to antibiotic stressors than their planktonic counterparts. Sublethal doses of antibiotics can actually enhance biofilm formation. Here, we have developed a non-invasive microscopic image analyses to quantify plasmid conjugation within a developing biofilm. Corroborating destructive samples were analyzed by a cultivation-independent flow cytometry analysis and a selective plate count method to cultivate transconjugants. Increases in substrate loading altered biofilm 3-D architecture and subsequently affected the frequency of plasmid conjugation (decreases at least two times) in the absence of any antibiotic selective pressure. More importantly, donor populations in biofilms exposed to a sublethal dose of kanamycin exhibited enhanced transfer efficiency of plasmids containing the kanamycin resistance gene, up to tenfold. However, when stressed with a different antibiotic, imipenem, transfer of plasmids containing the kanR+ gene was not enhanced. These preliminary results suggest biofilm bacteria “sense” antibiotics to which they are resistant, which enhances the spread of that resistance. Confocal scanning microscopy coupled with our non-invasive image analysis was able to estimate plasmid conjugative transfer efficiency either averaged over the entire biofilm landscape or locally with individual biofilm clusters. PMID:22669634

  12. Heterologous expression of the kanamycin biosynthetic gene cluster (pSKC2) in Streptomyces venezuelae YJ003.

    PubMed

    Thapa, Laxmi Prasad; Oh, Tae-Jin; Lee, Hei Chan; Liou, Kwangkyoung; Park, Je Won; Yoon, Yeo Joon; Sohng, Jae Kyung

    2007-10-01

    The pSKC2 cosmid, which has 32 kb and 28 open-reading frames, was isolated from Streptomyces kanamyceticus ATCC12853 as the gene cluster of kanamycin. This gene cluster includes the minimal biosynthetic genes of kanamycin with the resistance and regulatory genes. It was heterologously expressed in Streptomyces venezuelae YJ003, which has the advantage of fast growth, good efficiency of the transformation host, and rapid production of the aminoglycosides antibiotic. The isolated compound was analyzed by electrospray ionization-mass spectrometry, liquid chromatography-mass spectrometry, high-performance liquid chromatography, and tandem mass spectrometry and shows a molecular weight of 485 as kanamycin A.

  13. Plasmid-mediated fitness advantage of Acinetobacter baylyi in sulfadiazine-polluted soil.

    PubMed

    Jechalke, Sven; Kopmann, Christoph; Richter, Mona; Moenickes, Sylvia; Heuer, Holger; Smalla, Kornelia

    2013-11-01

    LowGC-type plasmids conferring resistance to sulfonamides have been frequently isolated from manure and manured soil. However, knowledge on the dynamics of plasmid-carrying populations in soil and their response to the presence of sulfonamides is scarce. Here, we investigated effects of the sulfonamide resistance conferring plasmid pHHV216 on the fitness of Acinetobacter baylyi BD413 in soil after application of manure with or without the sulfonamide antibiotic sulfadiazine (SDZ). The persistence of A. baylyi BD413 pHHV216 in competition to its plasmid-free variant was followed in soil microcosms. CFU counts showed a decrease in A. baylyi BD413 in manured soils over the experimental period of 32 days by about 0.5 log units. The proportion of the plasmid-carrying populations decreased from 50 to < 40% in the absence of SDZ, while the proportion of plasmid-carrying BD413 increased from 50 to about 65% with SDZ added. The data suggest that SDZ introduced via manure into soil was bioaccessible, providing a fitness advantage for the plasmid-carrying population of BD413 in soil, while the plasmid conferred a fitness disadvantage when selective pressure by SDZ was absent. In future, this method may be used as a tool for the assessment of bioavailability of antibiotics in soil.

  14. Narrow- and Broad-Host-Range Symbiotic Plasmids of Rhizobium spp. Strains That Nodulate Phaseolus vulgaris

    PubMed Central

    Brom, Susana; Martinez, Esperanza; Dávila, Guillermo; Palacios, Rafael

    1988-01-01

    Agrobacterium transconjugants containing symbiotic plasmids from different Rhizobium spp. strains that nodulate Phaseolus vulgaris were obtained. All transconjugants conserved the parental nodulation host range. Symbiotic (Sym) plasmids of Rhizobium strains isolated originally from P. vulgaris nodules, which had a broad nodulation host range, and single-copy nitrogenase genes conferred a Fix+ phenotype to the Agrobacterium transconjugants. A Fix− phenotype was obtained with Sym plasmids of strains isolated from P. vulgaris nodules that had a narrow host range and reiterated nif genes, as well as with Sym plasmids of strains isolated from other legumes that presented single nif genes and a broad nodulation host range. This indicates that different types of Sym plasmids can confer the ability to establish an effective symbiosis with P. vulgaris. Images PMID:16347637

  15. Chromosomal gene capture mediated by the Pseudomonas putida TOL catabolic plasmid.

    PubMed Central

    Ramos-González, M I; Ramos-Díaz, M A; Ramos, J L

    1994-01-01

    The Pseudomonas putida TOL plasmid pWW0 is able to mediate chromosomal mobilization in the canonical unidirectional way, i.e., from donor to recipient cells, and bidirectionally, i.e., donor-->recipient-->donor (retrotransfer). Transconjugants are recipient cells that have received DNA from donor cells, whereas retrotransconjugants are donor bacteria that have received DNA from a recipient. The TOL plasmid pWW0 is able to directly mobilize and retromobilize a kanamycin resistance marker integrated into the chromosome of other P. putida strains, a process that appears to involve a single conjugational event. The rate of retrotransfer (as well as of direct transfer) of the chromosomal marker is influenced by the location of the kanamycin marker on the chromosome and ranges from 10(-3) to less than 10(-8) retrotransconjugants per donor (transconjugants per recipient). The mobilized DNA is incorporated into the chromosome of the retrotransconjugants (transconjugants) in a process that seems to occur through recombination of highly homologous flanking regions. No interspecific mobilization of the chromosomal marker in matings involving P. putida and the closely related Pseudomonas fluorescens, which belongs to rRNA group I, was observed. Images PMID:8045894

  16. Remarkable stability of an instability-prone lentiviral vector plasmid in Escherichia coli Stbl3.

    PubMed

    Al-Allaf, Faisal A; Tolmachov, Oleg E; Zambetti, Lia Paola; Tchetchelnitski, Viktoria; Mehmet, Huseyin

    2013-02-01

    Large-scale production of plasmid DNA to prepare therapeutic gene vectors or DNA-based vaccines requires a suitable bacterial host, which can stably maintain the plasmid DNA during industrial cultivation. Plasmid loss during bacterial cell divisions and structural changes in the plasmid DNA can dramatically reduce the yield of the desired recombinant plasmid DNA. While generating an HIV-based gene vector containing a bicistronic expression cassette 5'-Olig2cDNA-IRES-dsRed2-3', we encountered plasmid DNA instability, which occurred in homologous recombination deficient recA1 Escherichia coli strain Stbl2 specifically during large-scale bacterial cultivation. Unexpectedly, the new recombinant plasmid was structurally changed or completely lost in 0.5 L liquid cultures but not in the preceding 5 mL cultures. Neither the employment of an array of alternative recA1 E. coli plasmid hosts, nor the lowering of the culture incubation temperature prevented the instability. However, after the introduction of this instability-prone plasmid into the recA13E. coli strain Stbl3, the transformed bacteria grew without being overrun by plasmid-free cells, reduction in the plasmid DNA yield or structural changes in plasmid DNA. Thus, E. coli strain Stbl3 conferred structural and maintenance stability to the otherwise instability-prone lentivirus-based recombinant plasmid, suggesting that this strain can be used for the faithful maintenance of similar stability-compromised plasmids in large-scale bacterial cultivations. In contrast to Stbl2, which is derived wholly from the wild type isolate E. coli K12, E. coli Stbl3 is a hybrid strain of mixed E. coli K12 and E. coli B parentage. Therefore, we speculate that genetic determinants for the benevolent properties of E. coli Stbl3 for safe plasmid propagation originate from its E. coli B ancestor.

  17. MAPLE fabrication of thin films based on kanamycin functionalized magnetite nanoparticles with anti-pathogenic properties

    NASA Astrophysics Data System (ADS)

    Grumezescu, Valentina; Andronescu, Ecaterina; Holban, Alina Maria; Mogoantă, Laurenţiu; Mogoşanu, George Dan; Grumezescu, Alexandru Mihai; Stănculescu, Anca; Socol, Gabriel; Iordache, Florin; Maniu, Horia; Chifiriuc, Mariana Carmen

    2015-05-01

    In this study we aimed to evaluate the biocompatibility and antimicrobial activity of kanamycin functionalized 5 nm-magnetite (Fe3O4@KAN) nanoparticles thin films deposited by Matrix Assisted Pulsed Laser Evaporation (MAPLE) technique. A laser deposition regime was established in order to stoichiometrically transfer Fe3O4@KAN thin films on silicone and glass substrates. Morphological and physico-chemical properties of powders and coatings were characterized by XRD, TEM, SEM, AFM and IR microscopy (IRM). Our nanostructured thin films have proved efficiency in the prevention of microbial adhesion and mature biofilms development as a result of antibiotic release in its active form. Furthermore, kanamycin functionalized nanostructures exhibit a good biocompatibility, both in vivo and in vitro, demonstrating their potential for implants application. This is the first study reporting the assessment of the in vivo biocompatibility of a magnetite-antimicrobial thin films produced by MAPLE technique.

  18. Detection of Tn5-like sequences in kanamycin-resistant stream bacteria and environmental DNA

    SciTech Connect

    Leff, L.G.; McArthur, J.V. ); Dana, J.R.; Shimkets, L.J. )

    1993-02-01

    This study investigates the occurrence of kanamycin and neomycin resistance in the culturable portion of the bacterial assemblage of a South Carolina stream. The constitutively expressed nptII gene was used to determine resistance. Spartial differences in the relative abundances of nptII taken from different locations and habitats in the stream were investigated. Results suggest that multiple probes will probably be necessary to assess kanamycin resistance potential of stream bacteria. At the largest patial scale there are not significant difference among the sites in abundances of nptII genes, though there were some differences in habitats. The authors conclude DNA hybridization appears to be a useful technique for assessing the abundance of genes in mixtures of nonculturable organisms.

  19. Efficient plastid transformation in tobacco using the aphA-6 gene and kanamycin selection.

    PubMed

    Huang, F-C; Klaus, S M J; Herz, S; Zou, Z; Koop, H-U; Golds, T J

    2002-09-01

    Here we report on the development of a new dominant selection marker for plastid transformation in higher plants using the aminoglycoside phosphotransferase gene aphA-6 from Acinetobacter baumannii. Vectors containing chimeric aphA-6 gene constructs were introduced into the tobacco chloroplast using particle bombardment of alginate-embedded protoplast-derived micro colonies or polyethylene glycol (PEG)-mediated DNA uptake. Targeted insertion into the plastome was achieved via homologous recombination, and plastid transformants were recovered on the basis of their resistance to kanamycin. Variations in kanamycin resistance in transplastomic lines were observed depending on the 5' and 3' regulatory elements associated with the aphA-6 coding region. Transplastomic plants were fertile and showed maternal inheritance of the transplastome in the progeny.

  20. Plasmids Imparting Sulfonamide Resistance in Escherichia coli: Implications for Persistence▿

    PubMed Central

    Bean, David C.; Livermore, David M.; Hall, Lucinda M. C.

    2009-01-01

    Sulfonamide resistance remains prevalent among clinical isolates of Escherichia coli in the United Kingdom, despite a dramatic (>97%) national decline in the rate of prescription of sulfonamides in the 1990s. To investigate potential mechanisms accounting for this persistence, we characterized plasmids carrying sul2, the most prevalent determinant of sulfonamide resistance. Among 33 conjugative and 5 nonconjugative plasmids carrying sul2, resistance to other antimicrobial agents was common, but the spectrum of resistance profiles was diverse: 82%, 74%, and 45% carried resistance to ampicillin, streptomycin, and trimethoprim, respectively. Resistance to mercury was carried by 33% of the plasmids, but none conferred significant resistance to silver or to any of three disinfectants tested. The potential virulence genes iutA (aerobactin system) and traT (serum survival) were carried by 21% and 36% of the plasmids, respectively. The 33 conjugative plasmids belonged to five different incompatibility groups, FIB, B/O, I1, K/B, and P (42%, 33%, 9%, 3% and 3%, respectively), with 3 plasmids being unassigned, and to 19 similarity groups on the basis of their restriction profiles. The sequences flanking sul2 were diverse and suggested more than one mechanism of genetic mobility. The five nonconjugative plasmids were all related to p9123 (pBP1), which was previously found to confer a fitness advantage on its host. We propose that the persistence of sul2, despite the reduced rate of prescription of sulfonamides, is due to a combination of coselection by antibiotics still in common use, a lack of a selective disadvantage in sul2 carriage, and the genetic mobility of sul2. PMID:19075061

  1. Draft Genome Sequence of Amikacin- and Kanamycin-Resistant Mycobacterium tuberculosis MT433 without rrs and eis Mutations.

    PubMed

    Sowajassatakul, Angkanang; Coker, Olabisi O; Prammananan, Therdsak; Chaiprasert, Angkana; Phunpruch, Saranya

    2015-11-19

    We announce the draft genome sequence of amikacin- and kanamycin-resistant Mycobacterium tuberculosis MT433, which has been previously described as the strain carrying an unknown resistance mechanism.

  2. Functional characterization of KanP, a methyltransferase from the kanamycin biosynthetic gene cluster of Streptomyces kanamyceticus.

    PubMed

    Nepal, Keshav Kumar; Yoo, Jin Cheol; Sohng, Jae Kyung

    2010-09-20

    KanP, a putative methyltransferase, is located in the kanamycin biosynthetic gene cluster of Streptomyces kanamyceticus ATCC12853. Amino acid sequence analysis of KanP revealed the presence of S-adenosyl-L-methionine binding motifs, which are present in other O-methyltransferases. The kanP gene was expressed in Escherichia coli BL21 (DE3) to generate the E. coli KANP recombinant strain. The conversion of external quercetin to methylated quercetin in the culture extract of E. coli KANP proved the function of kanP as S-adenosyl-L-methionine-dependent methyltransferase. This is the first report concerning the identification of an O-methyltransferase gene from the kanamycin gene cluster. The resistant activity assay and RT-PCR analysis demonstrated the leeway for obtaining methylated kanamycin derivatives from the wild-type strain of kanamycin producer.

  3. Label-free immunosensor for the detection of kanamycin using Ag@Fe₃O₄ nanoparticles and thionine mixed graphene sheet.

    PubMed

    Yu, Shujun; Wei, Qin; Du, Bin; Wu, Dan; Li, He; Yan, Liangguo; Ma, Hongmin; Zhang, Yong

    2013-10-15

    A highly sensitive label-free immunosensor for the detection of kanamycin had been developed using silver hybridized mesoporous ferroferric oxide nanoparticles (Ag@Fe₃O₄ NPs) and thionine mixed graphene sheet (TH-GS). TH was used as an electron transfer mediator. The electrical signal was greatly improved in the presence of GS due to its good electron-transfer ability. With the advantages of large specific surface area and excellent electrical conductivity, Ag@Fe₃O₄ NPs could immobilize more antibodies of kanamycin and promote the electron transfer. Cyclic voltammetry and square wave voltammetry were used to characterize the recognition of kanamycin. The proposed immunosensor showed good performances such as low detection limit (15 pg mL⁻¹), wide linear range (from 0.050 to 16 ng mL⁻¹), short analysis time (3 min), high stability, and good selectivity in the detection of kanamycin. The immunosensor was evaluated for pork meat sample, receiving satisfactory results.

  4. Management of gonococcal ophthalmia neonatorum with single-dose kanamycin and ocular irrigation with saline.

    PubMed

    Latif, A; Mason, P; Marowa, E; Paraiwa, E; Dhamu, F; Tambo, J; Gwanzura, L; Mapeta, D; Jongeling, G

    1988-01-01

    Two hundred nineteen neonates with gonococcal ophthalmia neonatorum, including 40 infected with penicillinase-producing strains, were treated as outpatients with a single intramuscular injection of 100 mg of kanamycin and hourly ocular irrigation with saline. Neisseria gonorrhoeae was isolated from three (1.4%) of the 212 babies attending for follow-up, and post-gonococcal conjunctivitis developed in 22 (10.4%) of those who returned for follow-up.

  5. Covalently linked kanamycin - Ciprofloxacin hybrid antibiotics as a tool to fight bacterial resistance.

    PubMed

    Shavit, Michal; Pokrovskaya, Varvara; Belakhov, Valery; Baasov, Timor

    2017-03-16

    To address the growing problem of antibiotic resistance, a set of 12 hybrid compounds that covalently link fluoroquinolone (ciprofloxacin) and aminoglycoside (kanamycin A) antibiotics were synthesized, and their activity was determined against both Gram-negative and Gram-positive bacteria, including resistant strains. The hybrids were antagonistic relative to the ciprofloxacin, but were substantially more potent than the parent kanamycin against Gram-negative bacteria, and overcame most dominant resistance mechanisms to aminoglycosides. Selected hybrids were 42-640 fold poorer inhibitors of bacterial protein synthesis than the parent kanamycin, while they displayed similar inhibitory activity to that of ciprofloxacin against DNA gyrase and topoisomerase IV enzymes. The hybrids showed significant delay of resistance development in both E. coli and B. subtilis in comparison to that of component drugs alone or their 1:1 mixture. More generally, the data suggest that an antagonistic combination of aminoglycoside-fluoroquinolone hybrids can lead to new compounds that slowdown/prevent the emergence of resistance.

  6. A novel strategy for obtaining kanamycin resistance in Arabidopsis thaliana by silencing an endogenous gene encoding a putative chloroplast transporter.

    PubMed

    Aufsatz, Werner; Nehlin, Lilian; Voronin, Viktor; Schmidt, Agnes; Matzke, Antonius J M; Matzke, Marjori

    2009-02-01

    The use of bacterial antibiotic resistance markers in transgenic plants raises concerns about horizontal gene transfer to soil bacteria. We report here that kanamycin resistance in Arabidopsis thaliana can be achieved by silencing an endogenous gene encoding a putative chloroplast transporter, which presumably imports kanamycin into chloroplasts to interfere with ribosomal RNA. Homologs of the transporter exist in other plant species, suggesting this strategy may be generally useful for selecting transformed plant cells.

  7. Characterization and Comparative Overview of Complete Sequences of the First Plasmids of Pandoraea across Clinical and Non-clinical Strains

    PubMed Central

    Yong, Delicia; Tee, Kok Keng; Yin, Wai-Fong; Chan, Kok-Gan

    2016-01-01

    To date, information on plasmid analysis in Pandoraea spp. is scarce. To address the gap of knowledge on this, the complete sequences of eight plasmids from Pandoraea spp. namely Pandoraea faecigallinarum DSM 23572T (pPF72-1, pPF72-2), Pandoraea oxalativorans DSM 23570T (pPO70-1, pPO70-2, pPO70-3, pPO70-4), Pandoraea vervacti NS15 (pPV15) and Pandoraea apista DSM 16535T (pPA35) were studied for the first time in this study. The information on plasmid sequences in Pandoraea spp. is useful as the sequences did not match any known plasmid sequence deposited in public databases. Replication genes were not identified in some plasmids, a situation that has led to the possibility of host interaction involvement. Some plasmids were also void of par genes and intriguingly, repA gene was also not discovered in these plasmids. This further leads to the hypothesis of host-plasmid interaction. Plasmid stabilization/stability protein-encoding genes were observed in some plasmids but were not established for participating in plasmid segregation. Toxin-antitoxin systems MazEF, VapBC, RelBE, YgiT-MqsR, HigBA, and ParDE were identified across the plasmids and their presence would improve plasmid maintenance. Conjugation genes were identified portraying the conjugation ability amongst Pandoraea plasmids. Additionally, we found a shared region amongst some of the plasmids that consists of conjugation genes. The identification of genes involved in replication, segregation, toxin-antitoxin systems and conjugation, would aid the design of drugs to prevent the survival or transmission of plasmids carrying pathogenic properties. Additionally, genes conferring virulence and antibiotic resistance were identified amongst the plasmids. The observed features in the plasmids shed light on the Pandoraea spp. as opportunistic pathogens. PMID:27790203

  8. Plasmid copy number noise in monoclonal populations of bacteria

    NASA Astrophysics Data System (ADS)

    Wong Ng, Jérôme; Chatenay, Didier; Robert, Jérôme; Poirier, Michael Guy

    2010-01-01

    Plasmids are extra chromosomal DNA that can confer to their hosts’ supplementary characteristics such as antibiotic resistance. Plasmids code for their copy number through their own replication frequency. Even though the biochemical networks underlying the plasmid copy number (PCN) regulation processes have been studied and modeled, no measurement of the heterogeneity in PCN within a whole population has been done. We have developed a fluorescent-based measurement system, which enables determination of the mean and noise in PCN within a monoclonal population of bacteria. Two different fluorescent protein reporters were inserted: one on the chromosome and the other on the plasmid. The fluorescence of these bacteria was measured with a microfluidic flow cytometry device. We show that our measurements are consistent with known plasmid characteristics. We find that the partitioning system lowers the PCN mean and standard deviation. Finally, bacterial populations were allowed to grow without selective pressure. In this case, we were able to determine the plasmid loss rate and growth inhibition effect.

  9. Drug resistance and broad geographical distribution of identical R plasmids of Pasteurella piscicida isolated from cultured yellowtail in Japan.

    PubMed

    Kim, E H; Aoki, T

    1993-01-01

    An MIC test of 12 chemotherapeutic agents performed on 175 strains of Pasteurella piscicida collected from cultured yellowtail (Seriola quinqueradiata) in different areas of Japan from 1989 to 1991 revealed 152 strains (87%) with resistance to combinations of ampicillin (AP), chloramphenicol (CP), kanamycin (KM), nalidixic acid (NA), sulfamonomethoxine (SA), tetracycline (TC), and/or trimethoprim (TMP). The remaining 23 strains were sensitive to all the drugs tested: AP, cefazolin, CP, florfenicol (FF), furazolidone, KM, NA, novobiocin, SA, streptomycin, TC, and TMP. FF showed the most effective antibacterial activity against P. piscicida with MICs ranging from 0.004 to 0.6 microgram/ml. One hundred and forty-nine of the 152 resistant strains carried transferable R plasmids encoding one of the Cp Km Sa Tc, Km Sa Tc, Km Sa, and Sa resistance. The most common resistance marker of transferable R plasmids identified in P. piscicida was Km Sa Tc. R plasmids encoding three different resistant markers were very similar on the basis of their digestion patterns with restriction endonucleases. There was homology among the DNAs of nine transferable R plasmids selected. Our findings suggest that multiple drug resistant strains of P. piscicida carrying transferable R plasmids with the same DNA structure are common in yellowtail farms and that the R plasmid has been retained within the P. piscicida population without change in their DNA structure according to geography and year.

  10. Diverse Broad-Host-Range Plasmids from Freshwater Carry Few Accessory Genes

    PubMed Central

    Sen, Diya; Yano, Hirokazu; Bauer, Matthew L.; Rogers, Linda M.; Van der Auwera, Geraldine A.

    2013-01-01

    Broad-host-range self-transferable plasmids are known to facilitate bacterial adaptation by spreading genes between phylogenetically distinct hosts. These plasmids typically have a conserved backbone region and a variable accessory region that encodes host-beneficial traits. We do not know, however, how well plasmids that do not encode accessory functions can survive in nature. The goal of this study was to characterize the backbone and accessory gene content of plasmids that were captured from freshwater sources without selecting for a particular phenotype or cultivating their host. To do this, triparental matings were used such that the only required phenotype was the plasmid's ability to mobilize a nonconjugative plasmid. Based on complete genome sequences of 10 plasmids, only 5 carried identifiable accessory gene regions, and none carried antibiotic resistance genes. The plasmids belong to four known incompatibility groups (IncN, IncP-1, IncU, and IncW) and two potentially new groups. Eight of the plasmids were shown to have a broad host range, being able to transfer into alpha-, beta-, and gammaproteobacteria. Because of the absence of antibiotic resistance genes, we resampled one of the sites and compared the proportion of captured plasmids that conferred antibiotic resistance to their hosts with the proportion of such plasmids captured from the effluent of a local wastewater treatment plant. Few of the captured plasmids from either site encoded antibiotic resistance. A high diversity of plasmids that encode no or unknown accessory functions is thus readily found in freshwater habitats. The question remains how the plasmids persist in these microbial communities. PMID:24096417

  11. Molecular and phenotypic characterization of multidrug-resistant Mycobacterium tuberculosis isolates resistant to kanamycin, amikacin, and capreomycin in China.

    PubMed

    Zhang, Z; Liu, M; Wang, Y; Pang, Y; Kam, K M; Zhao, Y

    2014-11-01

    Although second-line anti-tuberculosis (TB) injectable drugs have been widely used to improve treatment outcomes of multidrug-resistant TB (MDR-TB), little is known about the prevalence and mechanism of second-line injectable drug resistance among MDR Mycobacterium tuberculosis isolates in China. Here, we found that 12.7 % (20/158) of isolates showed resistance to at least one second-line injectable drug among 158 MDR isolates. At the same time, there were 16 (10.1 %) strains resistant to kanamycin (KAN), 9 (5.7 %) to amikacin (AMK), and 12 (7.6 %) to capreomycin (CAP). In addition, our data revealed no significant difference in the drug resistance patterns for Beijing versus non-Beijing genotype strains (p > 0.05). The most frequently observed mutation was A-to-G substitution at position 1401 of the rrs gene, conferring high-level resistance to KAN and AMK, but had varying minimum inhibitory concentrations (MICs) for CAP. The mutations in the eis promoter and tlyA gene were responsible for low-level resistance to CAP. 83.3 % of A1401G substitutions in the rrs gene was observed in Beijing genotype strains, while the difference was not significant (p = 0.157). Our data demonstrated that the hot-spot regions localized in the rrs gene serve as excellent markers for AMK, but is not a sensitive marker for KAN and CAP. In addition, the cross-resistance patterns and MICs differed among different genetic mutation types, which challenge the practice in China of generalizing resistance to AMK and CAP based on the resistance to KAN alone. Our findings suggested that the individualized drug susceptibility to three major second-line injectable drugs is essential in order to generate more effective treatment regimens for MDR patients.

  12. Toxin Plasmids of Clostridium perfringens

    PubMed Central

    Li, Jihong; Adams, Vicki; Bannam, Trudi L.; Miyamoto, Kazuaki; Garcia, Jorge P.; Uzal, Francisco A.; Rood, Julian I.

    2013-01-01

    SUMMARY In both humans and animals, Clostridium perfringens is an important cause of histotoxic infections and diseases originating in the intestines, such as enteritis and enterotoxemia. The virulence of this Gram-positive, anaerobic bacterium is heavily dependent upon its prolific toxin-producing ability. Many of the ∼16 toxins produced by C. perfringens are encoded by large plasmids that range in size from ∼45 kb to ∼140 kb. These plasmid-encoded toxins are often closely associated with mobile elements. A C. perfringens strain can carry up to three different toxin plasmids, with a single plasmid carrying up to three distinct toxin genes. Molecular Koch's postulate analyses have established the importance of several plasmid-encoded toxins when C. perfringens disease strains cause enteritis or enterotoxemias. Many toxin plasmids are closely related, suggesting a common evolutionary origin. In particular, most toxin plasmids and some antibiotic resistance plasmids of C. perfringens share an ∼35-kb region containing a Tn916-related conjugation locus named tcp (transfer of clostridial plasmids). This tcp locus can mediate highly efficient conjugative transfer of these toxin or resistance plasmids. For example, conjugative transfer of a toxin plasmid from an infecting strain to C. perfringens normal intestinal flora strains may help to amplify and prolong an infection. Therefore, the presence of toxin genes on conjugative plasmids, particularly in association with insertion sequences that may mobilize these toxin genes, likely provides C. perfringens with considerable virulence plasticity and adaptability when it causes diseases originating in the gastrointestinal tract. PMID:23699255

  13. Peaceful coexistence amongst Borrelia plasmids: getting by with a little help from their friends?

    PubMed

    Chaconas, George; Norris, Steven J

    2013-09-01

    Borrelia species comprise a unique genus of bacterial pathogens. These organisms contain a segmented genome with up to two dozen plasmids ranging in size from 5 kb up to about 200 kb. The plasmids have also been referred to as mini-chromosomes or essential genetic elements, as some of them carry information important for infection of vertebrates or for survival in the tick vector. Most of the plasmids are linear with covalently closed hairpin telomeres and these linear plasmids are in a constant state of genetic rearrangement. The mechanisms of plasmid replication, maintenance and partitioning remain largely obscure and are complicated by a long doubling time, the requirement for expensive media and inefficient genetic manipulation. A set of five parologous protein families (PFs) are believed to confer the ability for autonomous replication and plasmid maintenance. The number of plasmids also complicates analyses because of the possibility that PFs from one plasmid may sometimes function in trans on other plasmids. Two papers in the last year have moved the field forward and their combined data suggest that trans complementation amongst Borrelia plasmids may sometimes occur.

  14. Conjugative Plasmids of Neisseria gonorrhoeae

    PubMed Central

    Pachulec, Emilia; van der Does, Chris

    2010-01-01

    Many clinical isolates of the human pathogen Neisseria gonorrhoeae contain conjugative plasmids. The host range of these plasmids is limited to Neisseria species, but presence of a tetracycline (tetM) determinant inserted in several of these plasmids is an important cause of the rapid spread of tetracycline resistance. Previously plasmids with different backbones (Dutch and American type backbones) and with and without different tetM determinants (Dutch and American type tetM determinants) have been identified. Within the isolates tested, all plasmids with American or Dutch type tetM determinants contained a Dutch type plasmid backbone. This demonstrated that tetM determinants should not be used to differentiate between conjugal plasmid backbones. The nucleotide sequences of conjugative plasmids with Dutch type plasmid backbones either not containing the tetM determinant (pEP5233) or containing Dutch (pEP5289) or American (pEP5050) type tetM determinants were determined. Analysis of the backbone sequences showed that they belong to a novel IncP1 subfamily divergent from the IncP1α, β, γ, δ and ε subfamilies. The tetM determinants were inserted in a genetic load region found in all these plasmids. Insertion was accompanied by the insertion of a gene with an unknown function, and rearrangement of a toxin/antitoxin gene cluster. The genetic load region contains two toxin/antitoxins of the Zeta/Epsilon toxin/antitoxin family previously only found in Gram positive organisms and the virulence associated protein D of the VapD/VapX toxin/antitoxin family. Remarkably, presence of VapX of pJD1, a small cryptic neisserial plasmid, in the acceptor strain strongly increased the conjugation efficiency, suggesting that it functions as an antitoxin for the conjugative plasmid. The presence of the toxin and antitoxin on different plasmids might explain why the host range of this IncP1 plasmid is limited to Neisseria species. The isolated plasmids conjugated efficiently between

  15. IncM Plasmid R1215 Is the Source of Chromosomally Located Regions Containing Multiple Antibiotic Resistance Genes in the Globally Disseminated Acinetobacter baumannii GC1 and GC2 Clones

    PubMed Central

    Blackwell, Grace A.

    2016-01-01

    ABSTRACT Clear similarities between antibiotic resistance islands in the chromosomes of extensively antibiotic-resistant isolates from the two dominant, globally distributed Acinetobacter baumannii clones, GC1 and GC2, suggest a common origin. A close relative of the likely progenitor of both of these regions was found in R1215, a conjugative IncM plasmid from a Serratia marcescens strain isolated prior to 1980. The 37.8-kb resistance region in R1215 lies within the mucB gene and includes aacC1, aadA1, aphA1b, blaTEM, catA1, sul1, and tetA(A), genes that confer resistance to gentamicin, streptomycin and spectinomycin, kanamycin and neomycin, ampicillin, chloramphenicol, sulfamethoxazole, and tetracycline, respectively. The backbone of this region is derived from Tn1721 and is interrupted by a hybrid Tn2670 (Tn21)-Tn1696-type transposon, Tn6020, and an incomplete Tn1. After minor rearrangements, this R1215 resistance island can generate AbGRI2-0*, the predicted earliest form of the IS26-bounded AbGRI2-type resistance island of GC2 isolates, and to the multiple antibiotic resistance region (MARR) of AbaR0, the precursor of this region in AbaR-type resistance islands in the GC1 group. A 29.9-kb circle excised by IS26 has been inserted into the A. baumannii chromosome to generate AbGRI2-0*. To create the MARR of AbaR0, a different circular form, again generated by IS26 from an R1215 resistance region variant, has been opened at a different point by recombination with a copy of the sul1 gene already present in the AbaR precursor. Recent IncM plasmids related to R1215 have a variant resistance island containing a blaSHV gene in the same location. IMPORTANCE Two lineages of extensively antibiotic-resistant A. baumannii currently plaguing modern medicine each acquired resistance to all of the original antibiotics (ampicillin, tetracycline, kanamycin, and sulfonamides) by the end of the 1970s and then became resistant to antibiotics from newer families after they were

  16. Drug resistance, plasmids, biotypes and susceptibility to bacteriophages of Salmonella isolated from poultry in Canada.

    PubMed

    Poppe, C; McFadden, K A; Demczuk, W H

    1996-07-01

    Salmonella isolates from 295 layer and 294 broiler flocks in Canada were examined to determine resistance to antimicrobial agents, plasmid profiles, biochemical properties, and susceptibility to polyvalent bacteriophages. Except for the high number of strains resistant to spectinomycin (97.8%), the frequency of drug resistance of Salmonella isolates from layer flocks was low. None of 457 isolates from layer flocks was resistant to amikacin or ciprofloxacin, and less than 2% of the strains were resistant to cephalothin, chloramphenicol, cotrimoxazole, gentamicin, kanamycin, neomycin, nitrofurantoin, and/or polymyxin B. About 3% of the strains were resistant to ampicillin, carbenicillin and/or tetracycline, whereas 8% of the strains were resistant to sulfisoxazole. Salmonella anatum var. O15+ and S. typhimurium var. copenhagen strains were resistant to multiple antimicrobial agents. None of 1159 Salmonella strains from broiler flocks was resistant to amikacin, cephalothin, ciprofloxacin or polymyxin B, less than 1% of the strains were resistant to chloramphenicol, 2% were resistant to ampicillin, carbenicillin and/or chloramphenicol; 5-7% were resistant to the aminoglycosides gentamicin, kanamycin and/or neomycin; 6% were resistant to nitrofurantoin; 10% to tetracycline; 14% to sulfisoxazole; and 99% to spectinomycin. A high percentage of S. binza, S. anatum var. O15+, S. schwarzengrund and S. heidelberg strains were resistant to antimicrobial agents. Some of the single or multiple resistances were encoded by conjugative plasmids or by plasmids that were thermosensitive for transfer. Eight percent of S. heidelberg strains did not produce hydrogen sulfide. Ninety-seven percent of the Salmonella strains were susceptible to the lytic effect of polyvalent bacteriophages.

  17. Plasmid Rolling-Circle Replication.

    PubMed

    Ruiz-Masó, J A; MachóN, C; Bordanaba-Ruiseco, L; Espinosa, M; Coll, M; Del Solar, G

    2015-02-01

    Plasmids are DNA entities that undergo controlled replication independent of the chromosomal DNA, a crucial step that guarantees the prevalence of the plasmid in its host. DNA replication has to cope with the incapacity of the DNA polymerases to start de novo DNA synthesis, and different replication mechanisms offer diverse solutions to this problem. Rolling-circle replication (RCR) is a mechanism adopted by certain plasmids, among other genetic elements, that represents one of the simplest initiation strategies, that is, the nicking by a replication initiator protein on one parental strand to generate the primer for leading-strand initiation and a single priming site for lagging-strand synthesis. All RCR plasmid genomes consist of a number of basic elements: leading strand initiation and control, lagging strand origin, phenotypic determinants, and mobilization, generally in that order of frequency. RCR has been mainly characterized in Gram-positive bacterial plasmids, although it has also been described in Gram-negative bacterial or archaeal plasmids. Here we aim to provide an overview of the RCR plasmids' lifestyle, with emphasis on their characteristic traits, promiscuity, stability, utility as vectors, etc. While RCR is one of the best-characterized plasmid replication mechanisms, there are still many questions left unanswered, which will be pointed out along the way in this review.

  18. Mechanisms of Theta Plasmid Replication.

    PubMed

    Lilly, Joshua; Camps, Manel

    2015-02-01

    Plasmids are autonomously replicating pieces of DNA. This article discusses theta plasmid replication, which is a class of circular plasmid replication that includes ColE1-like origins of replication popular with expression vectors. All modalities of theta plasmid replication initiate synthesis with the leading strand at a predetermined site and complete replication through recruitment of the host's replisome, which extends the leading strand continuously while synthesizing the lagging strand discontinuously. There are clear differences between different modalities of theta plasmid replication in mechanisms of DNA duplex melting and in priming of leading- and lagging-strand synthesis. In some replicons duplex melting depends on transcription, while other replicons rely on plasmid-encoded trans-acting proteins (Reps); primers for leading-strand synthesis can be generated through processing of a transcript or in other replicons by the action of host- or plasmid-encoded primases. None of these processes require DNA breaks. The frequency of replication initiation is tightly regulated to facilitate establishment in permissive hosts and to achieve a steady state. The last section of the article reviews how plasmid copy number is sensed and how this feedback modulates the frequency of replication.

  19. Phenotypic plasticity in bacterial plasmids.

    PubMed Central

    Turner, Paul E

    2004-01-01

    Plasmid pB15 was previously shown to evolve increased horizontal (infectious) transfer at the expense of reduced vertical (intergenerational) transfer and vice versa, a key trade-off assumed in theories of parasite virulence. Whereas the models predict that susceptible host abundance should determine which mode of transfer is selectively favored, host density failed to mediate the trade-off in pB15. One possibility is that the plasmid's transfer deviates from the assumption that horizontal spread (conjugation) occurs in direct proportion to cell density. I tested this hypothesis using Escherichia coli/pB15 associations in laboratory serial culture. Contrary to most models of plasmid transfer kinetics, my data show that pB15 invades static (nonshaking) bacterial cultures only at intermediate densities. The results can be explained by phenotypic plasticity in traits governing plasmid transfer. As cells become more numerous, the plasmid's conjugative transfer unexpectedly declines, while the trade-off between transmission routes causes vertical transfer to increase. Thus, at intermediate densities the plasmid's horizontal transfer can offset selection against plasmid-bearing cells, but at high densities pB15 conjugates so poorly that it cannot invade. I discuss adaptive vs. nonadaptive causes for the phenotypic plasticity, as well as potential mechanisms that may lead to complex transfer dynamics of plasmids in liquid environments. PMID:15166133

  20. Plasmid acquisition in microgravity

    NASA Technical Reports Server (NTRS)

    Juergensmeyer, Margaret A.; Juergensmeyer, Elizabeth A.; Guikema, James A.

    1995-01-01

    In microgravity, bacteria often show an increased resistance to antibiotics. Bacteria can develop resistance to an antibiotic after transformation, the acquisition of DNA, usually in the form of a plasmid containing a gene for resistance to one or more antibiotics. In order to study the capacity of bacteria to become resistant to antibiotics in microgravity, we have modified the standard protocol for transformation of Escherichia coli for use in the NASA-flight-certified hardware package, The Fluid Processing Apparatus (FPA). Here we report on the ability of E. coli to remain competent for long periods of time at temperatures that are readily available on the Space Shuttle, and present some preliminary flight results.

  1. Plasmid acquisition in microgravity

    NASA Technical Reports Server (NTRS)

    Juergensmeyer, Margaret A.; Juergensmeyer, Elizabeth A.; Guikema, James A.

    1995-01-01

    In microgravity, bacteria often show an increased resistance to antibiotics. Bacteria can develop resistance to an antibiotic after transformation, the acquisition of DNA, usually in the form of a plasmid containing a gene for resistance to one or more antibiotics. In order to study the capacity of bacteria to become resistant to antibiotics in microgravity, we have modified the standard protocol for transformation of Escherichia coli for use in the NASA-flight-certified hardware package, The Fluid Processing Apparatus (FPA). Here we report on the ability of E. coli to remain competent for long periods of time at temperatures that are readily available on the Space Shuttle, and present some preliminary flight results.

  2. Conjugation efficiency depends on intra and intercellular interactions between distinct plasmids: Plasmids promote the immigration of other plasmids but repress co-colonizing plasmids.

    PubMed

    Gama, João Alves; Zilhão, Rita; Dionisio, Francisco

    2017-08-24

    Conjugative plasmids encode the genes responsible for the synthesis of conjugative pili and plasmid transfer. Expression of the conjugative machinery (including conjugative pili) may be costly to bacteria, not only due to the energetic/metabolic cost associated with their expression but also because they serve as receptors for certain viruses. Consequently, the presence of two plasmids in the same cell may be disadvantageous to each plasmid, because they may impose a higher fitness cost on the host. Therefore, plasmids may encode mechanisms to cope with co-resident plasmids. Moreover, it is possible that the transfer rate of a plasmid is affected by the presence of a distinct plasmid in the recipient cell. In this work, we measured transfer rates of twelve natural plasmids belonging to seven incompatibility groups in three situations, namely when: (i) donor cells contain a plasmid and recipient cells are plasmid-free; (ii) donor cells contain two unrelated plasmids and recipient cells are plasmid-free; and (iii) half of the cells contain a given plasmid and the other half contain another, unrelated, plasmid. In the third situation, recipient cells of a plasmid are the donor cells of the other plasmid. We show that there are more negative interactions (reduction of a plasmid's conjugative efficiency) between plasmids if they reside in the same cell than if they reside in different cells. However, if plasmids interacted intercellularly, the transfer rate of one of the plasmids was often higher (when the unrelated conjugative plasmid was present in the recipient cell) than if the recipient cell was plasmid-free - a positive effect. Experimental data retrieved from the study of mutant plasmids not expressing conjugative pili on the cell surface suggest that positive effects result from a higher efficiency of mating pair formation. Overall, our results suggest that negative interactions are significantly more frequent when plasmids occupy the same cell. Such

  3. Variants of the gentamicin and tobramycin resistance plasmid pRAY are widely distributed in Acinetobacter.

    PubMed

    Hamidian, Mohammad; Nigro, Steven J; Hall, Ruth M

    2012-12-01

    To determine the cause of resistance to the aminoglycosides gentamicin and tobramycin in Acinetobacter isolates and the location of the resistance genes. Australian Acinetobacter baumannii isolates were screened for resistance to aminoglycosides. PCR followed by restriction digestion of amplicons was used to detect genes and plasmids. Plasmids were isolated and examined by restriction digestion. Plasmid DNA sequences were determined and bioinformatic analysis was used to identify features. The sequence of the bla(OXA-Ab) gene and multilocus sequence typing were used to determine strain types. Isolates that exhibited resistance to gentamicin, kanamycin and tobramycin were of diverse strain types. These isolates all carried the aadB gene cassette, and in all but one the cassette was in a 6 kb plasmid similar to pRAY. The three plasmid sequences determined revealed multiple frame-shift differences in the available pRAY sequence that altered the reading frames. In pRAY*, mobA and mobC mobilization genes were identified, but no potential replication initiation protein was found. pRAY*-v1 differed from pRAY* by 66 single-base differences, and pRAY*-v2 included two insertion sequences, ISAba22, located upstream of the aadB gene cassette, and IS18-like, within ISAba22. The plasmid pRAY* and variants are widely distributed in Acinetobacter spp. and are the most common cause of resistance to gentamicin and tobramycin. Mobilization genes should assist in the dissemination of pRAY* and its variants.

  4. Cross-resistance of Mycobacterium tuberculosis isolates among streptomycin, kanamycin and amikacin.

    PubMed

    Sugawara, I; Zhang, J; Li, C

    2009-06-01

    Seventy-four streptomycin (SM)-resistant M. tuberculosis clinical isolates were subjected to cross-resistance drug testing against two major aminoglycosides, kanamycin (KM) and amikacin (AMK). Among them, 15 clinical isolates (20.3%) were resistant to both KM and AMK. Fifteen (80%) of 19 KM-resistant isolates were AMK-resistant. Fifteen SM, KM, and AMK resistant isolates harbored rrs mutation, but only two had rrs and rpsL double mutations. Low-level SM resistance was associated with rpsL mutation, whereas high-level SM resistance was linked to rrs mutation.

  5. Limited sampling strategies for therapeutic drug monitoring of amikacin and kanamycin in patients with multidrug-resistant tuberculosis.

    PubMed

    Dijkstra, J A; van Altena, R; Akkerman, O W; de Lange, W C M; Proost, J H; van der Werf, T S; Kosterink, J G W; Alffenaar, J W C

    2015-09-01

    Amikacin and kanamycin are considered important and effective drugs in the treatment of multidrug-resistant tuberculosis (MDR-TB). Unfortunately, the incidence of toxicity is high and is related to elevated drug exposure. In order to achieve a balance between efficacy and toxicity, a population pharmacokinetic (PPK) model may help to optimise drug exposure. Patients with MDR-TB who had received amikacin or kanamycin as part of their treatment and who had routinely received therapeutic drug monitoring were evaluated. A PPK model was developed and subsequently validated. Using this model, a limited sampling model was developed. Eleven patients receiving amikacin and nine patients receiving kanamycin were included in this study. The median observed 24-h area under the concentration-time curve (AUC0-24h) was 77.2 mg h/L [interquartile range (IQR) 64.7-96.2 mg h/L] for amikacin and 64.1 mg h/L (IQR 55.6-92.1 mg h/L) for kanamycin. The PPK model was developed and validated using n-1 cross-validation. A robust population model was developed that is suitable for predicting the AUC0-24h of amikacin and kanamycin. This model, in combination with the limited sampling strategy developed, can be used in daily routine to guide dosing but also to assess AUC0-24h in phase 3 studies.

  6. Label-free detection of kanamycin based on the aptamer-functionalized conducting polymer/gold nanocomposite.

    PubMed

    Zhu, Ye; Chandra, Pranjal; Song, Kyung-Mi; Ban, Changill; Shim, Yoon-Bo

    2012-01-01

    Highly sensitive label-free detection of kanamycin is achieved with an aptamer sensor based on a conducting polymer/gold self-assembled nanocomposite. The sensor probe is fabricated by covalently immobilizing an in vitro selected DNA aptamer for kanamycin onto gold nanoparticle (AuNP)-comprised conducting polymer, poly-[2, 5-di-(2-thienyl)-1H-pyrrole-1-(p-benzoic acid)] (poly-DPB). The self-assembling of DPB on AuNP is investigated by TEM and UV-vis spectroscopy and the modification of the aptamer sensor is characterized using XPS and electrochemical impedance spectroscopy. The probe is applied to detect kanamycin by using voltammetric techniques. The sensor shows a pair of redox peaks around 0.26/ 0.08 V (vs. Ag/AgCl) for kanamycin captured by the aptamer-immobilized probe. The parameters that can affect the response, such as aptamer concentration, incubation time, temperature, and pH are optimized. The calibration plot shows a linear range from 0.05 μM to 9.0 μM kanamycin with a detection limit of 9.4±0.4 nM. The proposed aptamer sensor is examined with a real sample.

  7. Selection of a multidrug resistance plasmid by sublethal levels of antibiotics and heavy metals.

    PubMed

    Gullberg, Erik; Albrecht, Lisa M; Karlsson, Christoffer; Sandegren, Linus; Andersson, Dan I

    2014-10-07

    How sublethal levels of antibiotics and heavy metals select for clinically important multidrug resistance plasmids is largely unknown. Carriage of plasmids generally confers substantial fitness costs, implying that for the plasmid-carrying bacteria to be maintained in the population, the plasmid cost needs to be balanced by a selective pressure conferred by, for example, antibiotics or heavy metals. We studied the effects of low levels of antibiotics and heavy metals on the selective maintenance of a 220-kbp extended-spectrum β-lactamase (ESBL) plasmid identified in a hospital outbreak of Klebsiella pneumoniae and Escherichia coli. The concentrations of antibiotics and heavy metals required to maintain plasmid-carrying bacteria, the minimal selective concentrations (MSCs), were in all cases below (almost up to 140-fold) the MIC of the plasmid-free susceptible bacteria. This finding indicates that the very low antibiotic and heavy metal levels found in polluted environments and in treated humans and animals might be sufficiently high to maintain multiresistance plasmids. When resistance genes were moved from the plasmid to the chromosome, the MSC decreased, showing that MSC for a specific resistance conditionally depends on genetic context. This finding suggests that a cost-free resistance could be maintained in a population by an infinitesimally low concentration of antibiotic. By studying the effect of combinations of several compounds, it was observed that for certain combinations of drugs each new compound added lowered the minimal selective concentration of the others. This combination effect could be a significant factor in the selection of multidrug resistance plasmids/bacterial clones in complex multidrug environments. Importance: Antibiotic resistance is in many pathogenic bacteria caused by genes that are carried on large conjugative plasmids. These plasmids typically contain multiple antibiotic resistance genes as well as genes that confer resistance to

  8. Characterization of a Large Antibiotic Resistance Plasmid Found in Enteropathogenic Escherichia coli Strain B171 and Its Relatedness to Plasmids of Diverse E. coli and Shigella Strains.

    PubMed

    Hazen, Tracy H; Michalski, Jane; Nagaraj, Sushma; Okeke, Iruka N; Rasko, David A

    2017-09-01

    Enteropathogenic Escherichia coli (EPEC) is a leading cause of severe infantile diarrhea in developing countries. Previous research has focused on the diversity of the EPEC virulence plasmid, whereas less is known regarding the genetic content and distribution of antibiotic resistance plasmids carried by EPEC. A previous study demonstrated that in addition to the virulence plasmid, reference EPEC strain B171 harbors a second, larger plasmid that confers antibiotic resistance. To further understand the genetic diversity and dissemination of antibiotic resistance plasmids among EPEC strains, we describe the complete sequence of an antibiotic resistance plasmid from EPEC strain B171. The resistance plasmid, pB171_90, has a completed sequence length of 90,229 bp, a GC content of 54.55%, and carries protein-encoding genes involved in conjugative transfer, resistance to tetracycline (tetA), sulfonamides (sulI), and mercury, as well as several virulence-associated genes, including the transcriptional regulator hha and the putative calcium sequestration inhibitor (csi). In silico detection of the pB171_90 genes among 4,798 publicly available E. coli genome assemblies indicates that the unique genes of pB171_90 (csi and traI) are primarily restricted to genomes identified as EPEC or enterotoxigenic E. coli However, conserved regions of the pB171_90 plasmid containing genes involved in replication, stability, and antibiotic resistance were identified among diverse E. coli pathotypes. Interestingly, pB171_90 also exhibited significant similarity with a sequenced plasmid from Shigella dysenteriae type I. Our findings demonstrate the mosaic nature of EPEC antibiotic resistance plasmids and highlight the need for additional sequence-based characterization of antibiotic resistance plasmids harbored by pathogenic E. coli. Copyright © 2017 American Society for Microbiology.

  9. Plasmid-Borne Antimicrobial Resistance of Staphylococcus aureus Isolated in a Hospital in Lisbon, Portugal.

    PubMed

    Costa, Sofia Santos; Palma, Cláudia; Kadlec, Kristina; Fessler, Andrea T; Viveiros, Miguel; Melo-Cristino, José; Schwarz, Stefan; Couto, Isabel

    2016-12-01

    Plasmids play a key role in the genetic plasticity and survival of Staphylococcus aureus in challenging environments. Although many S. aureus plasmids have been described, still few studies portray the plasmid content of a given S. aureus population. The aim of this work was to characterize the plasmids carried by a collection of 53 S. aureus isolates collected in a large hospital in Lisbon, Portugal, and investigate their role in conferring resistance to several antimicrobial agents. Plasmids were present in 44 out of the 53 isolates and were grouped into eleven AccI restriction profiles. Plasmid curing of representative strains and comparison of antimicrobial susceptibility profiles between pairs of isogenic strains proved to be a valuable guidance tool in the identification of plasmid-located resistance genes. The plasmids harbored several resistance genes, namely blaZ (resistance to β-lactams), erm(C) (resistance to macrolides, lincosamides, and streptogramin B), cadA (resistance to cadmium and zinc), cadD (resistance to cadmium), and qacA and smr (resistance to biocides and dyes). This study demonstrates the impact of plasmids on the resistance properties of S. aureus, highlighting their role in the dissemination of antibiotic, heavy metal, and biocide resistance genes, and survival of this major pathogen in the hospital environment.

  10. Fosfomycin resistance plasmids do not affect fosfomycin transport into Escherichia coli.

    PubMed Central

    León, J; García-Lobo, J M; Ortiz, J M

    1982-01-01

    Escherichia coli cells carrying fosfomycin resistance plasmids were able to take up fosfomycin from the medium to the same extent as plasmid-free bacteria. The antibiotic entered the plasmid-harboring cells by means of the glpT and uhp transport systems, as is the case with susceptible bacteria. Active fosfomycin could be detected in soluble extracts of cells which had previously been incubated in the presence of the antibiotic. Furthermore, fosfomycin resistance plasmids did not confer on E. coli cells resistance to the novel antibiotic FR-31564, which is incorporated by the same transport systems as fosfomycin. We conclude that, in contrast to chromosomal resistance mutants, altered transport does not play a role in the plasmid-encoded fosfomycin resistance mechanism. PMID:7044304

  11. Effect of chromosomal homology on plasmid transfer and transformation in Streptococcus pneumoniae

    SciTech Connect

    Lacks, S.A.; Stassi, D.L.; Lopez, P.; Espinosa, M.; Greenberg, B.

    1982-01-01

    The obvious rarity of simultanaeous uptake of two recombinant plasmids bearing the same chromosomal segment militated against the likelihood of cloning such segments by the conventional approach. However, it was possible to clone chromosomal genes in S. pneumoniae, and clones of two well-studied pneumococcal genes, malM, which codes for the amylomaltase essential for maltose utilization, and sul-d, which confers sulfonamide resistance, were obtained. The availability of recombinant plasmids carrying DNA segments homologous to the chromosome allowed investigation of the effects of such homology on plasmid establishment. In addition to facilitation of plasmid establishment, evidence was obtained for a subsequent process, in which alleles were equilibrated between the chromosome and the plasmid pool.

  12. Exogenous alanine and/or glucose plus kanamycin kills antibiotic-resistant bacteria.

    PubMed

    Peng, Bo; Su, Yu-Bin; Li, Hui; Han, Yi; Guo, Chang; Tian, Yao-Mei; Peng, Xuan-Xian

    2015-02-03

    Multidrug-resistant bacteria are an increasingly serious threat to human and animal health. However, novel drugs that can manage infections by multidrug-resistant bacteria have proved elusive. Here we show that glucose and alanine abundances are greatly suppressed in kanamycin-resistant Edwardsiella tarda by GC-MS-based metabolomics. Exogenous alanine or glucose restores susceptibility of multidrug-resistant E. tarda to killing by kanamycin, demonstrating an approach to killing multidrug-resistant bacteria. The mechanism underlying this approach is that exogenous glucose or alanine promotes the TCA cycle by substrate activation, which in turn increases production of NADH and proton motive force and stimulates uptake of antibiotic. Similar results are obtained with other Gram-negative bacteria (Vibrio parahaemolyticus, Klebsiella pneumoniae, Pseudomonas aeruginosa) and Gram-positive bacterium (Staphylococcus aureus), and the results are also reproduced in a mouse model for urinary tract infection. This study establishes a functional metabolomics-based strategy to manage infection by antibiotic-resistant bacteria. Copyright © 2015 Elsevier Inc. All rights reserved.

  13. Stable Agrobacterium-mediated transformation of maritime pine based on kanamycin selection.

    PubMed

    Alvarez, José M; Ordás, Ricardo J

    2013-01-01

    An efficient transformation protocol based on kanamycin selection was developed for Agrobacterium-mediated transformation of maritime pine embryonal masses. The binary vector pBINUbiGUSint, which contained neomycin phosphotransferase II (nptII) as a selectable marker gene and β -glucuronidase (uidA) as a reporter gene, was used for transformation studies. Different factors, such as embryogenic line, bacterial strain, bacterial concentration, and coculture duration, were examined and optimized. For selection of transformants, 15 mgL(-1) kanamycin was used. The highest transformation efficiency (11.4 events per gram of fresh mass) was achieved when a vigorously growing embryonal mass (embryogenic line L01) was cocultivated with Agrobacterium strain AGL1 at the optical density (OD(600 nm)) of 0.3 for 72 h. Evidence of the stable transgene integration was obtained by polymerase chain reaction for the nptII and uidA genes and expression of the uidA gene. Maturation capacity of the transgenic lines was negatively affected by the transformation process. Induction of axillary shoots by preculturing the embryos with benzyladenine allowed overcoming the low maturation rates of some transformed lines. The transgenic embryos were germinated and the axillar shoots were rooted. Transgenic plants were transferred to potting substrate showing normal growth.

  14. Stable Agrobacterium-Mediated Transformation of Maritime Pine Based on Kanamycin Selection

    PubMed Central

    Alvarez, José M.; Ordás, Ricardo J.

    2013-01-01

    An efficient transformation protocol based on kanamycin selection was developed for Agrobacterium-mediated transformation of maritime pine embryonal masses. The binary vector pBINUbiGUSint, which contained neomycin phosphotransferase II (nptII) as a selectable marker gene and β-glucuronidase (uidA) as a reporter gene, was used for transformation studies. Different factors, such as embryogenic line, bacterial strain, bacterial concentration, and coculture duration, were examined and optimized. For selection of transformants, 15 mgL−1 kanamycin was used. The highest transformation efficiency (11.4 events per gram of fresh mass) was achieved when a vigorously growing embryonal mass (embryogenic line L01) was cocultivated with Agrobacterium strain AGL1 at the optical density (OD600 nm) of 0.3 for 72 h. Evidence of the stable transgene integration was obtained by polymerase chain reaction for the nptII and uidA genes and expression of the uidA gene. Maturation capacity of the transgenic lines was negatively affected by the transformation process. Induction of axillary shoots by preculturing the embryos with benzyladenine allowed overcoming the low maturation rates of some transformed lines. The transgenic embryos were germinated and the axillar shoots were rooted. Transgenic plants were transferred to potting substrate showing normal growth. PMID:24376383

  15. Adaptive gene profiling of Mycobacterium tuberculosis during sub-lethal kanamycin exposure.

    PubMed

    Habib, Zeshan; Xu, Weize; Jamal, Muhammad; Rehman, Khaista; Chen, Xi; Dai, Jinxia; Fu, Zhen Fang; Cao, Gang

    2017-09-28

    Resistance to anti-tuberculosis drugs is a formidable obstacle to effective tuberculosis (TB) treatment and prevention globally. New forms of multidrug, extensive drug and total drug resistance Mycobacterium tuberculosis (Mtb) causing a serious threat to human as well as animal's population. Mtb shows diverse adaptability under stress conditions especially antibiotic treatment, however underlying physiological mechanism remained elusive. In present study, we investigated Mtb's response and adaptation with reference to gene expression during sub-lethal kanamycin exposure. Mtb were cultured under sub-lethal drug and control conditions, where half were sub-cultured every 3-days to observe serial adaptation under same conditions and the remaining were subjected to RNA-seq. We identified 98 up-regulated and 198 down-regulated responsive genes compared to control through differential analysis, of which Ra1750 and Ra3160 were the most responsive genes. In adaptive analysis, we found Ra1750, Ra3160, Ra3161, Ra3893 and Ra2492 up-regulation at early stage and gradually showed low expression levels at the later stages of drug exposure. The adaptive expression of Ra1750, Ra3160 and Ra3161 were further confirmed by real time qPCR. These results suggested that these genes contributed in Mtb's physiological adaptation during sub-lethal kanamycin exposure. Our findings may aid to edify these potential targets for drug development against drug resistance tuberculosis. Copyright © 2017. Published by Elsevier Ltd.

  16. Role of Plasmids in Lactobacillus brevis BSO 464 Hop Tolerance and Beer Spoilage

    PubMed Central

    Bergsveinson, Jordyn; Baecker, Nina; Pittet, Vanessa

    2014-01-01

    Specific isolates of lactic acid bacteria (LAB) can grow in the harsh beer environment, thus posing a threat to brew quality and the economic success of breweries worldwide. Plasmid-localized genes, such as horA, horC, and hitA, have been suggested to confer hop tolerance, a trait required for LAB survival in beer. The presence and expression of these genes among LAB, however, do not universally correlate with the ability to grow in beer. Genome sequencing of the virulent beer spoilage organism Lactobacillus brevis BSO 464 revealed the presence of eight plasmids, with plasmids 1, 2, and 3 containing horA, horC, and hitA, respectively. To investigate the roles that these and the other five plasmids play in L. brevis BSO 464 growth in beer, plasmid curing with novobiocin was used to derive 10 plasmid variants. Multiplex PCRs were utilized to determine the presence or absence of each plasmid, and how plasmid loss affected hop tolerance and growth in degassed (noncarbonated) beer was assessed. Loss of three of the eight plasmids was found to affect hop tolerance and growth in beer. Loss of plasmid 2 (horC and 28 other genes) had the most dramatic effect, with loss of plasmid 4 (120 genes) and plasmid 8 (47 genes) having significant, but smaller, impacts. These results support the contention that genes on mobile genetic elements are essential for bacterial growth in beer and that beer spoilage ability is not dependent solely on the three previously described hop tolerance genes or on the chromosome of a beer spoilage LAB isolate. PMID:25501474

  17. Role of plasmids in Lactobacillus brevis BSO 464 hop tolerance and beer spoilage.

    PubMed

    Bergsveinson, Jordyn; Baecker, Nina; Pittet, Vanessa; Ziola, Barry

    2015-02-01

    Specific isolates of lactic acid bacteria (LAB) can grow in the harsh beer environment, thus posing a threat to brew quality and the economic success of breweries worldwide. Plasmid-localized genes, such as horA, horC, and hitA, have been suggested to confer hop tolerance, a trait required for LAB survival in beer. The presence and expression of these genes among LAB, however, do not universally correlate with the ability to grow in beer. Genome sequencing of the virulent beer spoilage organism Lactobacillus brevis BSO 464 revealed the presence of eight plasmids, with plasmids 1, 2, and 3 containing horA, horC, and hitA, respectively. To investigate the roles that these and the other five plasmids play in L. brevis BSO 464 growth in beer, plasmid curing with novobiocin was used to derive 10 plasmid variants. Multiplex PCRs were utilized to determine the presence or absence of each plasmid, and how plasmid loss affected hop tolerance and growth in degassed (noncarbonated) beer was assessed. Loss of three of the eight plasmids was found to affect hop tolerance and growth in beer. Loss of plasmid 2 (horC and 28 other genes) had the most dramatic effect, with loss of plasmid 4 (120 genes) and plasmid 8 (47 genes) having significant, but smaller, impacts. These results support the contention that genes on mobile genetic elements are essential for bacterial growth in beer and that beer spoilage ability is not dependent solely on the three previously described hop tolerance genes or on the chromosome of a beer spoilage LAB isolate.

  18. Comparative study on the antibiotic susceptibility and plasmid profiles of Vibrio alginolyticus strains isolated from four Tunisian marine biotopes.

    PubMed

    Lajnef, Rim; Snoussi, Mejdi; Romalde, Jesús López; Nozha, Cohen; Hassen, Abdennaceur

    2012-12-01

    The antibiotic resistance patterns and the plasmids profiles of the predominant etiological agent responsible for vibriosis in Tunisia, V. alginolyticus were studied to contribute to control their spread in some Mediterranean aquaculture farms and seawater. The sixty-nine V. alginolyticus strains isolated from different marine Tunisian biotopes (bathing waters, aquaculture and conchylicole farms and a river connected to the seawater during the cold seasons) were multi-drug resistant with high resistance rate to ampicillin, kanamycin, doxycyclin, erythromycin, imipinem, and nalidixic acid. The multiple resistance index ranged from 0.3 to 0.7 for the isolates of Khenis, from 0.5 to 0.8 for those of Menzel Jmil, from 0.5 to 0.75 (Hergla) and from 0.3 to 0.7 for the isolates of Oued Soltane. The high value of antibiotic resistance index was recorded for the V. alginolyticus population isolated from the fish farm in Hergla (ARI = 0.672) followed by the population isolated from the conchylicole station of Menzel Jmil (ARI = 0.645). The results obtained by the MIC tests confirmed the resistance of the V. alginolyticus to ampicillin, erythromycin, kanamycin, cefotaxime, streptomycin and trimethoprim. Plasmids were found in 79.48 % of the strains analyzed and 30 different plasmid profiles were observed. The strains had a high difference in the size of plasmids varying between 0.5 and 45 kb. Our study reveals that the antibiotic-resistant bacteria are widespread in the aquaculture and conchylicole farm relatively to others strains isolated from seawater.

  19. Time course of neuronal and synaptic plasticity in dorsal cochlear nucleus of guinea pig following chronic kanamycin-induced deafness.

    PubMed

    Kong, W J; Yin, Z D; Fan, G R; Yang, Y; Huang, X

    2010-04-30

    We investigated the time course of the plasticity in fusiform cell (FC) and at auditory nerve (AN) synapse on FC (AN/FC synapse) following chronic kanamycin-induced deafness. Guinea pigs were treated with kanamycin sulfate by subcutaneous injection at dose of 500 mg/kg/day for 7 days. Ultrastructural changes in FC and AN/FC synapse were observed, and local insulin-like growth factor 1 (IGF-1) mRNA was quantified using quantitative real time PCR at 1, 7, 14, 28, 70 and 140 days after kanamycin treatment. The average threshold was 46.46+/-3.45, 80.63+/-5.95 and 103.95+/-6.59 dB SPL respectively at 1, 7 and 14 days, and the threshold was statistically unchanged at 28, 70 and 140 days in comparison with the 14 day group. Mitochondrial swelling in FC and at AN/FC synapse was progressive at 7, 14 and 28 days. Moreover, the thickness of the postsynaptic densities increased at 1, 7 and 14 days. Finally, there was a persistent upregulation in local IGF-1 mRNA at 7, 14, 28 and 70 days. These changes in the ultrastructure of AN/FC synapse and FC, and upregulation of local IGF-1 mRNA were no longer present at 140 days. Our results indicate that the effects of kanamycin on the ultrastructure of FC and AN/FC synapse are progressive. However, FC and AN/FC synapse are capable of reviving and remodeling after kanamycin-induced lesion and incomplete deafferentation. Additionally, local IGF-1 might play a role in the lesion- and deafness-induced plasticity in FC and at AN/FC synapse following chronic kanamycin-induced deafness.

  20. pA506, a Conjugative Plasmid of the Plant Epiphyte Pseudomonas fluorescens A506

    PubMed Central

    Stockwell, Virginia O.; Davis, Edward W.; Carey, Alyssa; Shaffer, Brenda T.; Mavrodi, Dmitri V.; Hassan, Karl A.; Hockett, Kevin; Thomashow, Linda S.; Paulsen, Ian T.

    2013-01-01

    Conjugative plasmids are known to facilitate the acquisition and dispersal of genes contributing to the fitness of Pseudomonas spp. Here, we report the characterization of pA506, the 57-kb conjugative plasmid of Pseudomonas fluorescens A506, a plant epiphyte used in the United States for the biological control of fire blight disease of pear and apple. Twenty-nine of the 67 open reading frames (ORFs) of pA506 have putative functions in conjugation, including a type IV secretion system related to that of MOBP6 family plasmids and a gene cluster for type IV pili. We demonstrate that pA506 is self-transmissible via conjugation between A506 and strains of Pseudomonas spp. or the Enterobacteriaceae. The origin of vegetative replication (oriV) of pA506 is typical of those in pPT23A family plasmids, which are present in many pathovars of Pseudomonas syringae, but pA506 lacks repA, a defining locus for pPT23A plasmids, and has a novel partitioning region. We selected a plasmid-cured derivative of A506 and compared it to the wild type to identify plasmid-encoded phenotypes. pA506 conferred UV resistance, presumably due to the plasmid-borne rulAB genes, but did not influence epiphytic fitness of A506 on pear or apple blossoms in the field. pA506 does not appear to confer resistance to antibiotics or other toxic elements. Based on the conjugative nature of pA506 and the large number of its genes that are shared with plasmids from diverse groups of environmental bacteria, the plasmid is likely to serve as a vehicle for genetic exchange between A506 and its coinhabitants on plant surfaces. PMID:23811504

  1. Selection of a Multidrug Resistance Plasmid by Sublethal Levels of Antibiotics and Heavy Metals

    PubMed Central

    Gullberg, Erik; Albrecht, Lisa M.; Karlsson, Christoffer; Sandegren, Linus

    2014-01-01

    ABSTRACT How sublethal levels of antibiotics and heavy metals select for clinically important multidrug resistance plasmids is largely unknown. Carriage of plasmids generally confers substantial fitness costs, implying that for the plasmid-carrying bacteria to be maintained in the population, the plasmid cost needs to be balanced by a selective pressure conferred by, for example, antibiotics or heavy metals. We studied the effects of low levels of antibiotics and heavy metals on the selective maintenance of a 220-kbp extended-spectrum β-lactamase (ESBL) plasmid identified in a hospital outbreak of Klebsiella pneumoniae and Escherichia coli. The concentrations of antibiotics and heavy metals required to maintain plasmid-carrying bacteria, the minimal selective concentrations (MSCs), were in all cases below (almost up to 140-fold) the MIC of the plasmid-free susceptible bacteria. This finding indicates that the very low antibiotic and heavy metal levels found in polluted environments and in treated humans and animals might be sufficiently high to maintain multiresistance plasmids. When resistance genes were moved from the plasmid to the chromosome, the MSC decreased, showing that MSC for a specific resistance conditionally depends on genetic context. This finding suggests that a cost-free resistance could be maintained in a population by an infinitesimally low concentration of antibiotic. By studying the effect of combinations of several compounds, it was observed that for certain combinations of drugs each new compound added lowered the minimal selective concentration of the others. This combination effect could be a significant factor in the selection of multidrug resistance plasmids/bacterial clones in complex multidrug environments. PMID:25293762

  2. Modification of kanamycin-esculin-azide agar to improve selectivity in the enumeration of fecal streptococci from water samples.

    PubMed Central

    Audicana, A; Perales, I; Borrego, J J

    1995-01-01

    Kanamycin-esculin-azide agar was modified by increasing the concentration of sodium azide to 0.4 g liter-1 and replacing kanamycin sulfate with 5 mg of oxolinic acid liter-1. The modification, named oxolinic acid-esculin-azide (OAA) agar, was compared with Slanetz-Bartley and KF agars by using drinking water and seawater samples. The OAA agar showed higher specificity, selectivity, and recovery efficiencies than those obtained by using the other media. In addition, no confirmation of typical colonies was needed when OAA agar was used, which significantly shortens the time of sample processing and increases the accuracy of the method. PMID:8534085

  3. Plasmid-borne macrolide resistance in Micrococcus luteus.

    PubMed

    Liebl, Wolfgang; Kloos, Wesley E; Ludwig, Wolfgang

    2002-08-01

    A plasmid designated pMEC2 which confers resistance to erythromycin, other macrolides, and lincomycin was detected in Micrococcus luteus strain MAW843 isolated from human skin. Curing of this approximately 4.2 kb plasmid from the host organism resulted in erythromycin sensitivity of the strain. Introduction of pMEC2 into a different M. luteus strain conferred erythromycin resistance upon this strain. Macrolide resistance in M. luteus MAW843 was an inducible trait. Induction occurred at subinhibitory erythromycin concentrations of about 0.02-0.05 micro g ml(-1). Erythromycin and oleandomycin were inducers, while spiramycin and tylosin exerted no significant inducer properties. With heterologous expression experiments in Corynebacterium glutamicum, using hybrid plasmid constructs and deletion derivatives thereof, it was possible to narrow down the location of the plasmid-borne erythromycin-resistance determinant to a region of about 1.8 kb of pMEC2. Sequence analysis of the genetic determinant, designated erm(36), identified an ORF putatively encoding a 281-residue protein with similarity to 23S rRNA adenine N(6)-methyltransferases. erm(36) was most related (about 52-54% identity) to erythromycin-resistance proteins found in high-G+C Gram-positive bacteria, including the (opportunistic) pathogenic corynebacteria Corynebacterium jeikeium, C. striatum, C. diphtheriae and Propionibacterium acnes. This is believed to be the first report of a plasmid-borne, inducible antibiotic resistance in micrococci. The possible role of non-pathogenic, saprophytic micrococci bearing antibiotic-resistance genes in the spreading of these determinants is discussed.

  4. Plasmid-mediated resistance to lincomycin by inactivation in Staphylococcus haemolyticus.

    PubMed Central

    Leclercq, R; Carlier, C; Duval, J; Courvalin, P

    1985-01-01

    Staphylococcus haemolyticus BM4610 was resistant to high levels of lincomycin and susceptible to macrolides, clindamycin, and streptogramins. This resistance phenotype, not previously reported for a human clinical isolate, was due to inactivation of the antibiotic. The gene conferring resistance to lincomycin in strain BM4610 was carried by a 2.5-kilobase plasmid, pIP855, which was cloned in Escherichia coli. Plasmid pIP855 caused inactivation of both lincomycin and clindamycin in S. haemolyticus and in E. coli but conferred detectable resistance to lincomycin only in S. haemolyticus and to clindamycin only in E. coli. Images PMID:3907492

  5. Plasmid-mediated quinolone resistance

    PubMed Central

    Jacoby, George A.; Strahilevitz, Jacob; Hooper, David C.

    2014-01-01

    Summary Three mechanisms for plasmid-mediated quinolone resistance (PMQR) have been discovered since 1998. Plasmid genes qnrA, qnrB, qnrC, qnrD, qnrS, and qnrVC code for proteins of the pentapeptide repeat family that protects DNA gyrase and topoisomerase IV from quinolone inhibition. The qnr genes appear to have been acquired from chromosomal genes in aquatic bacteria, are usually associated with mobilizing or transposable elements on plasmids, and are often incorporated into sul1-type integrons. The second plasmid-mediated mechanism involves acetylation of quinolones with an appropriate amino nitrogen target by a variant of the common aminoglycoside acetyltransferase AAC(6′)-Ib. The third mechanism is enhanced efflux produced by plasmid genes for pumps QepAB and OqxAB. PMQR has been found in clinical and environmental isolates around the world and appears to be spreading. The plasmid-mediated mechanisms provide only low-level resistance that by itself does not exceed the clinical breakpoint for susceptibility but nonetheless facilitates selection of higher-level resistance and makes infection by pathogens containing PMQR harder to treat. PMID:25584197

  6. Plasmid-mediated quinolone resistance.

    PubMed

    Jacoby, George A; Strahilevitz, Jacob; Hooper, David C

    2014-10-01

    Three mechanisms for plasmid-mediated quinolone resistance (PMQR) have been discovered since 1998. Plasmid genes qnrA, qnrB, qnrC, qnrD, qnrS, and qnrVC code for proteins of the pentapeptide repeat family that protects DNA gyrase and topoisomerase IV from quinolone inhibition. The qnr genes appear to have been acquired from chromosomal genes in aquatic bacteria, are usually associated with mobilizing or transposable elements on plasmids, and are often incorporated into sul1-type integrons. The second plasmid-mediated mechanism involves acetylation of quinolones with an appropriate amino nitrogen target by a variant of the common aminoglycoside acetyltransferase AAC(6')-Ib. The third mechanism is enhanced efflux produced by plasmid genes for pumps QepAB and OqxAB. PMQR has been found in clinical and environmental isolates around the world and appears to be spreading. The plasmid-mediated mechanisms provide only low-level resistance that by itself does not exceed the clinical breakpoint for susceptibility but nonetheless facilitates selection of higher-level resistance and makes infection by pathogens containing PMQR harder to treat.

  7. Glutamate co-transmission from developing medial nucleus of the trapezoid body - Lateral superior olive synapses is cochlear dependent in kanamycin-treated rats

    SciTech Connect

    Lee, Jae Ho; Pradhan, Jonu; Maskey, Dhiraj; Park, Ki Sup; Hong, Sung Hwa; Suh, Myung-Whan; Kim, Myeung Ju; Ahn, Seung Cheol

    2011-02-11

    Research highlights: {yields} Glutamate co-transmission is enhanced in kanamycin-treated rats. {yields} VGLUT3 expression is increased in kanamycin-treated rats. {yields} GlyR expression is decreased in kanamycin-treated rats. {yields} GlyR, VGLUT3 expression patterns are asymmetric in unilaterally cochlear ablated rat. -- Abstract: Cochlear dependency of glutamate co-transmission at the medial nucleus of the trapezoid body (MNTB) - the lateral superior olive (LSO) synapses was investigated using developing rats treated with high dose kanamycin. Rats were treated with kanamycin from postnatal day (P) 3 to P8. A scanning electron microscopic study on P9 demonstrated partial cochlear hair cell damage. A whole cell voltage clamp experiment demonstrated the increased glutamatergic portion of postsynaptic currents (PSCs) elicited by MNTB stimulation in P9-P11 kanamycin-treated rats. The enhanced VGLUT3 immunoreactivities (IRs) in kanamycin-treated rats and asymmetric VGLUT3 IRs in the LSO of unilaterally cochlear ablated rats supported the electrophysiologic data. Taken together, it is concluded that glutamate co-transmission is cochlear-dependent and enhanced glutamate co-transmission in kanamycin-treated rats is induced by partial cochlear damage.

  8. Chemical adjuvants for plasmid DNA vaccines.

    PubMed

    Greenland, John R; Letvin, Norman L

    2007-05-10

    Plasmid DNA vaccines are a promising modality for immunization against a variety of human pathogens. Immunization via multiple routes with plasmid DNA can elicit potent cellular immune responses, and these immunogens can be administered repeatedly without inducing anti-vector immunity. Nonetheless, the immunogenicity of plasmid DNA vaccines has been limited by problems associated with delivery. A number of adjuvants have been designed to improve plasmid DNA immunogenicity, either by directly stimulating the immune system or by enhancing plasmid DNA expression. Chemical adjuvants for enhancing plasmid DNA expression include liposomes, polymers, and microparticles, all of which have shown promise for enhancing the expression and immunogenicity of plasmid DNA vaccines in animal models. Micro- and nanoparticles have not been shown to enhance immune responses to plasmid DNA vaccines. However, formulation of plasmid DNA with some non-particulate polymeric adjuvants has led to a statistically significant enhancement of immune responses. Further development of these technologies will significantly improve the utility of plasmid DNA vaccination.

  9. Glutamate co-transmission from developing medial nucleus of the trapezoid body--lateral superior olive synapses is cochlear dependent in kanamycin-treated rats.

    PubMed

    Lee, Jae Ho; Pradhan, Jonu; Maskey, Dhiraj; Park, Ki Sup; Hong, Sung Hwa; Suh, Myung-Whan; Kim, Myeung Ju; Ahn, Seung Cheol

    2011-02-11

    Cochlear dependency of glutamate co-transmission at the medial nucleus of the trapezoid body (MNTB)--the lateral superior olive (LSO) synapses was investigated using developing rats treated with high dose kanamycin. Rats were treated with kanamycin from postnatal day (P) 3 to P8. A scanning electron microscopic study on P9 demonstrated partial cochlear hair cell damage. A whole cell voltage clamp experiment demonstrated the increased glutamatergic portion of postsynaptic currents (PSCs) elicited by MNTB stimulation in P9-P11 kanamycin-treated rats. The enhanced VGLUT3 immunoreactivities (IRs) in kanamycin-treated rats and asymmetric VGLUT3 IRs in the LSO of unilaterally cochlear ablated rats supported the electrophysiologic data. Taken together, it is concluded that glutamate co-transmission is cochlear-dependent and enhanced glutamate co-transmission in kanamycin-treated rats is induced by partial cochlear damage.

  10. Recombination between plasmids of incompatibility groups P-1 and P-2.

    PubMed Central

    Jacoby, G A; Jacob, A E; Hedges, R W

    1976-01-01

    R plasmids of incompatibility group P-2 are readily transmissible between Pseudomonas strains, but not to Escherichia coli or other enterobacteria, whereas those of group P-1 have a broad host range. Pseudomonas aeruginosa donor strains carrying both a P-1 plasmid (RP1, RP4, or R751) and a P-2 plasmid (pMG1, pMG2, pMG5, or RPL11) were mated with E. coli K-12, and selection was imposed for resistance markers on the P-2 plasmids. Transconjugants were obtained at a low frequency, in which P-2 markers were expressed and were serially transmissible in E. coli together with P-1 markers. These plasmids had P-1 incompatibility properties, conferred susceptibility to phages active on P-1 carrying strains, and behaved on sucrose gradient centrifugation as unimolecular species of higher molecular weights than the P-1 parent. Recombinant plasmid formation was independent of a functional Rec gene in both donor and recipient and, with R751, had a preferred site leading to loss of trimethoprim resistance. Interaction between insertion sequences may be involved. Thus, plasmids of group P-2 can recombine with R factors of another group quite separate in compatibility properties, host range, and pilus type. Formation of such recombinants provides one pathway by which the genetic diversity of plasmids may have evolved. PMID:821925

  11. Characterization and comparative analysis of antibiotic resistance plasmids isolated from a wastewater treatment plant.

    PubMed

    Rahube, Teddie O; Viana, Laia S; Koraimann, Günther; Yost, Christopher K

    2014-01-01

    A wastewater treatment plant (WWTP) is an environment high in nutrient concentration with diverse bacterial populations and can provide an ideal environment for the proliferation of mobile elements such as plasmids. WWTPs have also been identified as reservoirs for antibiotic resistance genes that are associated with human pathogens. The objectives of this study were to isolate and characterize self-transmissible or mobilizable resistance plasmids associated with effluent from WWTP. An enrichment culture approach designed to capture plasmids conferring resistance to high concentrations of erythromycin was used to capture plasmids from an urban WWTP servicing a population of ca. 210,000. DNA sequencing of the plasmids revealed diversity of plasmids represented by incompatibility groups IncU, col-E, IncFII and IncP-1β. Genes coding resistance to clinically relevant antibiotics (macrolide, tetracycline, beta-lactam, trimethoprim, chloramphenicol, sulphonamide), quaternary ammonium compounds and heavy metals were co-located on these plasmids, often within transposable and integrative mobile elements. Several of the plasmids were self-transmissible or mobilizable and could be maintained in the absence of antibiotic selection. The IncFII plasmid pEFC36a showed the highest degree of sequence identity to plasmid R1 which has been isolated in England more than 50 years ago from a patient suffering from a Salmonella infection. Functional conservation of key regulatory features of this F-like conjugation module were demonstrated by the finding that the conjugation frequency of pEFC36a could be stimulated by the positive regulator of plasmid R1 DNA transfer genes, TraJ.

  12. Molecular and Population Analyses of a Recombination Event in the Catabolic Plasmid pJP4

    PubMed Central

    Larraín-Linton, Juanita; De la Iglesia, Rodrigo; Melo, Francisco; González, Bernardo

    2006-01-01

    Cupriavidus necator JMP134(pJP4) harbors a catabolic plasmid, pJP4, which confers the ability to grow on chloroaromatic compounds. Repeated growth on 3-chlorobenzoate (3-CB) results in selection of a recombinant strain, which degrades 3-CB better but no longer grows on 2,4-dichlorophenoxyacetate (2,4-D). We have previously proposed that this phenotype is due to a double homologous recombination event between inverted repeats of the multicopies of this plasmid within the cell. One recombinant form of this plasmid (pJP4-F3) explains this phenotype, since it harbors two copies of the chlorocatechol degradation tfd gene clusters, which are essential to grow on 3-CB, but has lost the tfdA gene, encoding the first step in degradation of 2,4-D. The other recombinant plasmid (pJP4-FM) should harbor two copies of the tfdA gene but no copies of the tfd gene clusters. A molecular analysis using a multiplex PCR approach to distinguish the wild-type plasmid pJP4 from its two recombinant forms, was carried out. Expected PCR products confirming this recombination model were found and sequenced. Few recombinant plasmid forms in cultures grown in several carbon sources were detected. Kinetic studies indicated that cells containing the recombinant plasmid pJP4-FM were not selectable by sole carbon source growth pressure, whereas those cells harboring recombinant plasmid pJP4-F3 were selected upon growth on 3-CB. After 12 days of repeated growth on 3-CB, the complete plasmid population in C. necator JMP134 apparently corresponds to this form. However, wild-type plasmid forms could be recovered after growing this culture on 2,4-D, indicating that different plasmid forms can be found in C. necator JMP134 at the population level. PMID:16980481

  13. Molecular and population analyses of a recombination event in the catabolic plasmid pJP4.

    PubMed

    Larraín-Linton, Juanita; De la Iglesia, Rodrigo; Melo, Francisco; González, Bernardo

    2006-10-01

    Cupriavidus necator JMP134(pJP4) harbors a catabolic plasmid, pJP4, which confers the ability to grow on chloroaromatic compounds. Repeated growth on 3-chlorobenzoate (3-CB) results in selection of a recombinant strain, which degrades 3-CB better but no longer grows on 2,4-dichlorophenoxyacetate (2,4-D). We have previously proposed that this phenotype is due to a double homologous recombination event between inverted repeats of the multicopies of this plasmid within the cell. One recombinant form of this plasmid (pJP4-F3) explains this phenotype, since it harbors two copies of the chlorocatechol degradation tfd gene clusters, which are essential to grow on 3-CB, but has lost the tfdA gene, encoding the first step in degradation of 2,4-D. The other recombinant plasmid (pJP4-FM) should harbor two copies of the tfdA gene but no copies of the tfd gene clusters. A molecular analysis using a multiplex PCR approach to distinguish the wild-type plasmid pJP4 from its two recombinant forms, was carried out. Expected PCR products confirming this recombination model were found and sequenced. Few recombinant plasmid forms in cultures grown in several carbon sources were detected. Kinetic studies indicated that cells containing the recombinant plasmid pJP4-FM were not selectable by sole carbon source growth pressure, whereas those cells harboring recombinant plasmid pJP4-F3 were selected upon growth on 3-CB. After 12 days of repeated growth on 3-CB, the complete plasmid population in C. necator JMP134 apparently corresponds to this form. However, wild-type plasmid forms could be recovered after growing this culture on 2,4-D, indicating that different plasmid forms can be found in C. necator JMP134 at the population level.

  14. The 2 micron plasmid of Saccharomyces cerevisiae: a miniaturized selfish genome with optimized functional competence.

    PubMed

    Chan, Keng-Ming; Liu, Yen-Ting; Ma, Chien-Hui; Jayaram, Makkuni; Sau, Soumitra

    2013-07-01

    The 2 micron plasmid of Saccharomyces cerevisiae is a relatively small multi-copy selfish DNA element that resides in the yeast nucleus at a copy number of 40-60 per haploid cell. The plasmid is able to persist in host populations with almost chromosome-like stability with the help of a partitioning system and a copy number control system. The first part of this article describes the properties of the partitioning system comprising two plasmid coded proteins, Rep1 and Rep2, and a partitioning locus STB. Current evidence supports a model in which the Rep-STB system couples plasmid segregation to chromosome segregation by promoting the physical association of plasmid molecules with chromosomes. In the second part, the focus is on the Flp site-specific recombination system housed by the plasmid, which plays a critical role in maintaining steady state plasmid copy number. The Flp system corrects any decrease in plasmid population by promoting plasmid amplification via a recombination induced rolling circle replication mechanism. Appropriate plasmid amplification, without runaway increase in copy number, is ensured by positive and negative regulation of FLP gene expression by plasmid coded proteins and by the control of Flp level/activity through post-translational modification of Flp by the cellular sumoylation system. The Flp system has been successfully utilized to understand mechanisms of site-specific recombination and to bring about directed genetic alterations for addressing fundamental problems in biology and for accomplishing bio-engineering objectives. A particularly interesting, and perhaps less well known and underappreciated, application of Flp in revealing unique DNA topologies required to confer functional competence to DNA-protein machines is discussed.

  15. Pseudothrombocytopenia observed with ethylene diamine tetra acetate and citrate anticoagulants, resolved using 37°C incubation and Kanamycin.

    PubMed

    Kamath, Vandana; Sarda, Parimal; Chacko, Mary Purna; Sitaram, Usha

    2013-01-01

    Pseudothrombocytopenia (PTP) is defined by falsely low platelet counts on automated analyzers caused by in vitro phenomena including large platelet aggregates in blood samples. Diagnosis and resolution of PTP is crucial as it can lead to unwarranted interventions. We discuss a case of PTP in a pre-surgical setting, which was resolved using 37°C incubation and Kanamycin.

  16. The effect of some boron derivatives on kanamycin resistance and survival of E. coli and P. aeruginosa in lake water.

    PubMed

    Darcan, Cihan; Kahyaoğlu, Mustafa

    2012-08-01

    To study MIC value of 7 boron derivatives namely [Boric acid (H(3)BO(3)), Anhydrous Borax (Na(2)B(4)O(7)), Sodium Borate (NaBO(2)), Diammonium Tetraborate (NH(4))(2)B(4)O(7), Sodium Perborate (NaBO(3)), Boron Trioxide (B(2)O(3)), Potassium Tetraborate (K(2)B(4)O(7))] on E. coli and P. aeruginosa and their effects on survival of bacteria in lake water and resistance against kanamycin antibiotic. MIC values of Boron derivatives and antibiotic were studied by broth microdilution method. The effect of boron derivatives on survival of bacteria in lake water were also determined with plate count. Sodium perborate was determined as the most effective substance among the studied substances. Effectiveness increased as temperature increased. E. coli was more affected from P. aeruginosa in 8 mg/mL sodium perborate concentration in lake water. Moreover, it was determined that MIC value of kanamycin antibiotic decreased 200 times by especially treating P. aeruginosa with sodium perborate in lake water. However, it can be stated that this change in resistance did not arise from microorganisms. Sodium perborate solution can be used supportedly in kanamycin antibiotic applications for P. aeruginosa. Future studies are necessary to explore the relation between sodium perborate and kanamycin which is effective on P. aeruginosa in lake water. Copyright © 2012 The Editorial Board of Biomedical and Environmental Sciences. Published by Elsevier B.V. All rights reserved.

  17. In Vitro Activity of Netilmicin Compared with Gentamicin, Tobramycin, Amikacin, and Kanamycin

    PubMed Central

    Eickhoff, Theodore C.; Ehret, Josephine M.

    1977-01-01

    The in vitro activity of netilmicin was compared with that of gentamicin, tobramycin, amikacin, and kanamycin against 636 strains of bacteria recently isolated from clinical sources. Gentamicin was the most active antibiotic, but netilmicin and tobramycin closely paralleled it. Netilmicin was generally four-to eightfold less active than gentamicin against Serratia and group A streptococci, and was twofold less active against Pseudomonas aeruginosa. When effects of inoculum size and concentration of divalent cations in the media were evaluated, netilmicin was shown to be similar to gentamicin in vitro. Minimum inhibitory concentrations for P. aeruginosa were increased as much as 18-fold when the Mg2+ and Ca2+ concentrations were increased to physiological levels in Mueller-Hinton broth. PMID:879733

  18. Sulfonamide-Based Inhibitors of Aminoglycoside Acetyltransferase Eis Abolish Resistance to Kanamycin in Mycobacterium tuberculosis.

    PubMed

    Garzan, Atefeh; Willby, Melisa J; Green, Keith D; Gajadeera, Chathurada S; Hou, Caixia; Tsodikov, Oleg V; Posey, James E; Garneau-Tsodikova, Sylvie

    2016-12-08

    A two-drug combination therapy where one drug targets an offending cell and the other targets a resistance mechanism to the first drug is a time-tested, yet underexploited approach to combat or prevent drug resistance. By high-throughput screening, we identified a sulfonamide scaffold that served as a pharmacophore to generate inhibitors of Mycobacterium tuberculosis acetyltransferase Eis, whose upregulation causes resistance to the aminoglycoside (AG) antibiotic kanamycin A (KAN) in Mycobacterium tuberculosis. Rational systematic derivatization of this scaffold to maximize Eis inhibition and abolish the Eis-mediated KAN resistance of M. tuberculosis yielded several highly potent agents. A crystal structure of Eis in complex with one of the most potent inhibitors revealed that the inhibitor bound Eis in the AG-binding pocket held by a conformationally malleable region of Eis (residues 28-37) bearing key hydrophobic residues. These Eis inhibitors are promising leads for preclinical development of innovative AG combination therapies against resistant TB.

  19. Julian Davies and the discovery of kanamycin resistance transposon Tn5.

    PubMed

    Berg, Douglas E

    2016-10-12

    This paper recounts some of my fond memories of a collaboration between Julian Davies and myself that started in 1974 in Geneva and that led to our serendipitous discovery of the bacterial kanamycin resistance transposon Tn5, and aspects of the lasting positive impact of our interaction and discovery on me and the community. Tn5 was one of the first antibiotic resistance transposons to be found. Its analysis over the ensuing decades provided valuable insights into mechanisms and control of transposition, and led to its use as a much-valued tool in diverse areas of molecular genetics, as also will be discussed here.The Journal of Antibiotics advance online publication, 12 October 2016; doi:10.1038/ja.2016.120.

  20. Potent Inhibitors of Acetyltransferase Eis Overcome Kanamycin Resistance in Mycobacterium tuberculosis.

    PubMed

    Willby, Melisa J; Green, Keith D; Gajadeera, Chathurada S; Hou, Caixia; Tsodikov, Oleg V; Posey, James E; Garneau-Tsodikova, Sylvie

    2016-06-17

    A major cause of tuberculosis (TB) resistance to the aminoglycoside kanamycin (KAN) is the Mycobacterium tuberculosis (Mtb) acetyltransferase Eis. Upregulation of this enzyme is responsible for inactivation of KAN through acetylation of its amino groups. A 123 000-compound high-throughput screen (HTS) yielded several small-molecule Eis inhibitors that share an isothiazole S,S-dioxide heterocyclic core. These were investigated for their structure-activity relationships. Crystal structures of Eis in complex with two potent inhibitors show that these molecules are bound in the conformationally adaptable aminoglycoside binding site of the enzyme, thereby obstructing binding of KAN for acetylation. Importantly, we demonstrate that several Eis inhibitors, when used in combination with KAN against resistant Mtb, efficiently overcome KAN resistance. This approach paves the way toward development of novel combination therapies against aminoglycoside-resistant TB.

  1. Nestin expression and reactive phenomena in the mouse cochlea after kanamycin ototoxicity.

    PubMed

    Martone, Tiziana; Giordano, Pamela; Dagna, Federico; Carulli, Daniela; Albera, Roberto; Rossi, Ferdinando

    2014-06-01

    Following injury to the adult mammalian cochlea, hair cells cannot be spontaneously replaced. Nonetheless, the postnatal cochlea contains progenitor cells, distinguished by the expression of nestin, which are able to proliferate and form neurospheres in vitro. Such resident progenitors might be endowed with reparative potential. However, to date little is known about their behaviour in situ following hair cell injury. Using adult mice and ex vivo cochlear cultures, we sought to determine whether: (i) resident cochlear progenitors respond to kanamycin ototoxicity and compensate for it; and (ii) the reparative potential of cochlear progenitors can be stimulated by the addition of growth factors. Morphological changes of cochlear tissue, expression of nestin mRNA and protein and cell proliferation were investigated in these models. Our observations show that ototoxic injury has modest effects on nestin expression and cell proliferation. On the other hand, the addition of growth factors to the injured cochlear explants induced the appearance of nestin-positive cells in the supporting cell area of the organ of Corti. The vast majority of nestin-expressing cells, however, were not proliferating. Growth factors also had a robust stimulatory effect on axonal sprouting and the proliferative response, which was more pronounced in injured cochleae. On the whole, our findings indicate that nestin expression after kanamycin ototoxicity is related to tissue reactivity rather than activation of resident progenitors attempting to replace the lost receptors. In addition, administration of growth factors significantly enhances tissue remodelling, suggesting that cochlear repair may be promoted by the exogenous application of regeneration-promoting substances.

  2. Synergy of Penicillin-Netilmicin Combinations Against Enterococci Including Strains Highly Resistant to Streptomycin or Kanamycin

    PubMed Central

    Sanders, Christine C.

    1977-01-01

    The in vitro activity of combinations of penicillin and netilimicin was determined against 20 clinical isolates of enterococci and compared with that obtained in simultaneous tests with penicillin/sisomicin, penicillin/streptomycin, and penicillin/kanamycin. Synergy between the two drugs in each combination was determined by the use of quantitative kill curves and was defined as a killing by the combination at least 100-fold greater than that produced by the most effective drug alone. Penicillin/netilmicin and penicillin/sisomicin combinations were found to be synergistic against the majority of isolates tested, including strains resistant to penicillin/streptomycin or penicillin/kanamycin combinations. This synergy with penicillin could be demonstrated at a concentration of ≤7 μg/ml for either netilmicin or sisomicin. Studies on the kinetics of killing produced by these combinations showed the rate and extent of killing to be directly dependent upon the organism's relative susceptibility to the aminoglycoside alone and the aminoglycoside concentration in the combination. Results also indicated that the interaction between penicillin and netilmicin was true synergy; i.e., rapid and complete killing was produced by combinations containing each drug at concentrations insufficient to produce any killing alone, and the killing observed could not be produced by either drug alone at a concentration equivalent to the total drug concentration in the combination. The potential clinical application of this synergistic interaction should be investigated further, especially in view of recent reports showing netilmicin to be considerably less toxic than gentamicin in experimental animals. PMID:242509

  3. Molecular detection of drug resistance to ofloxacin and kanamycin in Mycobacterium tuberculosis by using multiplex allele-specific PCR.

    PubMed

    Kumari, Richa; Banerjee, Tuhina; Anupurba, Shampa

    2017-04-09

    Drug resistance in tuberculosis (TB) is the biggest global health challenge as it hinders the tuberculosis control program and makes the disease more worsen. Molecular methods interrupt the spread of drug resistance by facilitating the appropriate anti- tuberculosis therapy at correct time through rapid diagnosis of multi drug resistant (MDR) and extensively drug resistant tuberculosis (XDR-TB). In this study we standardized and evaluated the diagnostic utility of multiplex allele specific PCR (MAS-PCR) targeting gyrA D94G and rrs A1401G mutations for detection of resistance against two key drugs (ofloxacin and kanamycin) of second line anti tuberculosis treatment. MAS-PCR assays targeting gyrA D94G and rrs A1401G for ofloxacin (OFL) and kanamycin (KAN) resistance respectively were carried out on 150 multidrug resistant isolates of Mycobacterium tuberculosis. The results were compared with phenotypic drug susceptibility test against ofloxacin and kanamycin by using proportion method on MGIT 960. Of 150 MDR isolates 50 were resistant to both ofloxacin and kanamycin, 36 were resistant to ofloxacin only, 8 were resistant to kanamycin only and 56 were susceptible to both the drugs. MAS-PCR correctly identified gyrA D94G and rrs A1401G mutations in phenotypically resistant isolates with a specificity of 100%. The sensitivity of MAS-PCR was 88.66%, 93.55% and 86% for OFL, KAN and XDR-TB respectively. There was no mutation detected at gyrA D94G region of 12.86% (11 of 86) OFL resistant isolates while 6.89% (4 of 58) of KAN resistant isolates did not carry rrs A1401G substitution. MAS-PCR proves to be a rapid tool for detection of drug resistance which could also be used as an initial marker for screening of XDR-TB. Copyright © 2017 The Authors. Published by Elsevier Ltd.. All rights reserved.

  4. Targeting biofilms and persisters of ESKAPE pathogens with P14KanS, a kanamycin peptide conjugate.

    PubMed

    Mohamed, Mohamed F; Brezden, Anna; Mohammad, Haroon; Chmielewski, Jean; Seleem, Mohamed N

    2017-04-01

    The worldwide emergence of antibiotic resistance represents a serious medical threat. The ability of these resistant pathogens to form biofilms that are highly tolerant to antibiotics further aggravates the situation and leads to recurring infections. Thus, new therapeutic approaches that adopt novel mechanisms of action are urgently needed. To address this significant problem, we conjugated the antibiotic kanamycin with a novel antimicrobial peptide (P14LRR) to develop a kanamycin peptide conjugate (P14KanS). Antibacterial activities were evaluated in vitro and in vivo using a Caenorhabditis elegans model. Additionally, the mechanism of action, antibiofilm activity and anti-inflammatory effect of P14KanS were investigated. P14KanS exhibited potent antimicrobial activity against ESKAPE pathogens. P14KanS demonstrated a ≥128-fold improvement in MIC relative to kanamycin against kanamycin-resistant strains. Mechanistic studies confirmed that P14KanS exerts its antibacterial effect by selectively disrupting the bacterial cell membrane. Unlike many antibiotics, P14KanS demonstrated rapid bactericidal activity against stationary phases of both Gram-positive and Gram-negative pathogens. Moreover, P14KanS was superior in disrupting adherent bacterial biofilms and in killing intracellular pathogens as compared to conventional antibiotics. Furthermore, P14KanS demonstrated potent anti-inflammatory activity via the suppression of LPS-induced proinflammatory cytokines. Finally, P14KanS protected C. elegans from lethal infections of both Gram-positive and Gram-negative pathogens. The potent in vitro and in vivo activity of P14KanS warrants further investigation as a potential therapeutic agent for bacterial infections. This study demonstrates that equipping kanamycin with an antimicrobial peptide is a promising method to tackle bacterial biofilms and address bacterial resistance to aminoglycosides. Copyright © 2017 Elsevier B.V. All rights reserved.

  5. Plasmid-linked nif and “nod” genes in fast-growing rhizobia that nodulate Glycine max, Psophocarpus tetragonolobus, and Vigna unguiculata

    PubMed Central

    Broughton, William J.; Heycke, Nina; Z.A., Heiner Meyer; Pankhurst, Clive E.

    1984-01-01

    Forty-nine fast-growing Rhizobium strains from the nodules of 26 different tropical legume genera were screened to find isolates that would (i) nodulate, e.g., winged beans, so producing large nodules for RNA and protein isolation; (ii) also nodulate various small-seeded legumes, thus allowing screening of large numbers of mutants; and (iii) harbor plasmids containing nif structural genes as well as other functions involved in nodulation. On the basis of six different criteria, this rhizobial group appeared intermediate between classical fast- and slow-growing organisms, yet all contained plasmids. Plasmid numbers varied from one to five. Hybridizations between DNA prepared from nifDH and the putatative “nod” region of R. meliloti and these plasmids bound to nitrocellulose filters suggested that nif-nod genes are linked on a single sym plasmid. A broad-host-range strain containing a single sym plasmid was chosen for further study. Its plasmid, pMPIK3030a, was isolated on cesium chloride gradients and cloned in the cosmid pJB8, and the overlapping fragments were mapped by homology with the nif and nod regions of R. meliloti. As the wild-type plasmid pMPIK3030a was not self-transmissible, confirmation that the nod genes detected by homology were responsible for nodulation was obtained by introducing the mobilization functions of RP4 (together with Tn5) and selecting transconjugants resistant to kanamycin and neomycin. Transconjugants (obtained at a frequency of about 10-6 per recipient) in Agrobacterium tumefaciens cured of the Ti plasmid produced ineffective nodules on Vigna unguiculata, those in nonnodulating (Nod-) R. meliloti were partially effective, while those in Nod-R. leguminosarum were often fully effective. Images PMID:16593465

  6. Processing of Nonconjugative Resistance Plasmids by Conjugation Nicking Enzyme of Staphylococci

    PubMed Central

    Pollet, Rebecca M.; Ingle, James D.; Hymes, Jeff P.; Eakes, Thomas C.; Eto, Karina Yui; Kwong, Stephen M.; Ramsay, Joshua P.; Firth, Neville

    2016-01-01

    ABSTRACT Antimicrobial resistance in Staphylococcus aureus presents an increasing threat to human health. This resistance is often encoded on mobile plasmids, such as pSK41; however, the mechanism of transfer of these plasmids is not well understood. In this study, we first examine key protein-DNA interactions formed by the relaxase enzyme, NES, which initiates and terminates the transfer of the multidrug resistance plasmid pSK41. Two loops on the NES protein, hairpin loops 1 and 2, form extensive contacts with the DNA hairpin formed at the oriT region of pSK41, and here we establish that these contacts are essential for proper DNA cleavage and religation by the full 665-residue NES protein in vitro. Second, pSK156 and pCA347 are nonconjugative Staphylococcus aureus plasmids that contain sequences similar to the oriT region of pSK41 but differ in the sequence predicted to form a DNA hairpin. We show that pSK41-encoded NES is able to bind, cleave, and religate the oriT sequences of these nonconjugative plasmids in vitro. Although pSK41 could mobilize a coresident plasmid harboring its cognate oriT, it was unable to mobilize plasmids containing the pSK156 and pCA347 variant oriT mimics, suggesting that an accessory protein like that previously shown to confer specificity in the pWBG749 system may also be involved in transmission of plasmids containing a pSK41-like oriT. These data indicate that the conjugative relaxase in trans mechanism recently described for the pWBG749 family of plasmids also applies to the pSK41 family of plasmids, further heightening the potential significance of this mechanism in the horizontal transfer of staphylococcal plasmids. IMPORTANCE Understanding the mechanism of antimicrobial resistance transfer in bacteria such as Staphylococcus aureus is an important step toward potentially slowing the spread of antimicrobial-resistant infections. This work establishes protein-DNA interactions essential for the transfer of the Staphylococcus aureus

  7. Processing of Nonconjugative Resistance Plasmids by Conjugation Nicking Enzyme of Staphylococci.

    PubMed

    Pollet, Rebecca M; Ingle, James D; Hymes, Jeff P; Eakes, Thomas C; Eto, Karina Yui; Kwong, Stephen M; Ramsay, Joshua P; Firth, Neville; Redinbo, Matthew R

    2016-01-04

    Antimicrobial resistance in Staphylococcus aureus presents an increasing threat to human health. This resistance is often encoded on mobile plasmids, such as pSK41; however, the mechanism of transfer of these plasmids is not well understood. In this study, we first examine key protein-DNA interactions formed by the relaxase enzyme, NES, which initiates and terminates the transfer of the multidrug resistance plasmid pSK41. Two loops on the NES protein, hairpin loops 1 and 2, form extensive contacts with the DNA hairpin formed at the oriT region of pSK41, and here we establish that these contacts are essential for proper DNA cleavage and religation by the full 665-residue NES protein in vitro. Second, pSK156 and pCA347 are nonconjugative Staphylococcus aureus plasmids that contain sequences similar to the oriT region of pSK41 but differ in the sequence predicted to form a DNA hairpin. We show that pSK41-encoded NES is able to bind, cleave, and religate the oriT sequences of these nonconjugative plasmids in vitro. Although pSK41 could mobilize a coresident plasmid harboring its cognate oriT, it was unable to mobilize plasmids containing the pSK156 and pCA347 variant oriT mimics, suggesting that an accessory protein like that previously shown to confer specificity in the pWBG749 system may also be involved in transmission of plasmids containing a pSK41-like oriT. These data indicate that the conjugative relaxase in trans mechanism recently described for the pWBG749 family of plasmids also applies to the pSK41 family of plasmids, further heightening the potential significance of this mechanism in the horizontal transfer of staphylococcal plasmids. Understanding the mechanism of antimicrobial resistance transfer in bacteria such as Staphylococcus aureus is an important step toward potentially slowing the spread of antimicrobial-resistant infections. This work establishes protein-DNA interactions essential for the transfer of the Staphylococcus aureus multiresistance

  8. Xylella fastidiosa plasmid-encoded PemK toxin is an endoribonuclease.

    USDA-ARS?s Scientific Manuscript database

    Stable inheritance of pXF-RIV11 in Xylella fastidiosa is conferred by the pemI/pemK plasmid addiction system. PemK serves as a toxin inhibiting bacterial growth; PemI is the corresponding antitoxin that blocks activity of PemK toxin by direct binding. PemK toxin and PemI antitoxin were over-expre...

  9. Development and characterization of a transdermal patch and an emulgel containing kanamycin intended to be used in the treatment of mycetoma caused by Actinomadura madurae.

    PubMed

    López-Cervantes, Miriam; Escobar-Chávez, José Juan; Casas-Alancaster, Norma; Quintanar-Guerrero, David; Ganem-Quintanar, Adriana

    2009-12-01

    Mycetoma is a chronic, degenerative, and incapacitating infection of the skin and subcutaneous tissue. This study focuses on developing a kanamycin-based auxiliary system intended to be used in the treatment of mycetoma caused by Actinomadura madurae. Transdermal patches (with two different formulations: one with free kanamycin [K] and the other one with kanamycin adsorbed in silica [K-SG]) and an emulgel were developed. Both patches were prepared by the casting-evaporation technique. To characterize them, differential scanning calorimetry, bioadhesion, post-moisture detachment, strength and rupture distance, gas exchange, water uptake, and dissolution studies were carried out. The emulgel (containing 0.57% of kanamycin) was prepared from an oil-in-water emulsion, which was then incorporated to a gel. the patches with the best characteristics contained 22.9% of silica and 14.6% of kanamycin. Dissolution studies indicated that 8.8% of kanamycin released from K and 3.2% from K-SG at 24h. The emulgel containing 0.57% of kanamycin showed good technological characteristics for its application to the skin (viscosity, 44.9 +/- 1.4 poises; pH, 6.9 +/- 0.4; and penetrability, 52.7 +/- 5.1). The optimal patches were those containing 15.9% of freely dispersed kanamycin (K) and 14.6% of kanamycin adsorbed in silica (K-SG), which corresponds to the batch 2-0.8. The assessments performed to both pharmaceutical forms (patches and emulgel) show that they have the adequate technological characteristics for being used as an auxiliary in the treatment of actinomycetoma caused by A. madurae.

  10. Homology of cryptic plasmid of Neisseria gonorrhoeae with plasmids from Neisseria meningitidis and Neisseria lactamica.

    PubMed

    Ison, C A; Bellinger, C M; Walker, J

    1986-10-01

    DNA probe hybridisation was used to examine the relation between the cryptic plasmid from Neisseria gonorrhoeae and plasmids carried by pharyngeal isolates of Neisseria meningitidis and Neisseria lactamica. The complete gonococcal cryptic plasmid and HinfI derived digestion fragments subcloned into Escherichia coli were used to probe Southern blots of plasmid extracts. Homology was found to a plasmid of approximate molecular weight 4.5 kilobase pairs (Kb) but not to plasmids of less than 3.2 Kb or 6.5 Kb. Eleven of 16 strains of N meningitidis and two of six strains of N lactamica carried plasmids that showed strong hybridisation with the 4.2 Kb gonococcal plasmid. Hybridisation of plasmids from non-gonococcal species of neisseria with the gonococcal cryptic plasmid indicates that caution should be taken when using the cryptic plasmid as a diagnostic probe for gonorrhoea.

  11. Co-resident plasmids travel together.

    PubMed

    Gama, João Alves; Zilhão, Rita; Dionisio, Francisco

    2017-08-24

    Conjugative plasmids encode genes that enable them to transfer, by conjugation, from a given host cell to another cell. Conjugative transfer, despite being an important feature of conjugative plasmids, is not constitutive for most plasmids, the reason being that genes involved in horizontal transfer are mostly repressed. Only upon their transient de-repression are plasmids able to transfer horizontally. If host cells harbour multiple plasmids, their simultaneous transfer depends on simultaneous transient de-repression of all plasmids. If de-repression of different plasmids was random and independent events, simultaneous de-repression should be a rare event because the probability of simultaneous de-repression would be the product of the probabilities of de-repression of each plasmid. Some previous observations support this hypothesis, while others show that co-transfer of plasmids is more frequent than this reasoning indicates. Here, we show that co-transfer of multiple plasmids mainly results from non-independent events: the probability that all plasmids within a cell become de-repressed is much higher than if de-repression of plasmids genes were independent. We found a simple model for the probability of co-transfer: the plasmid having the lowest conjugation rates is the one who limits co-transfer. In this sense, cells receiving the plasmid with the lower transfer rate also receive the other plasmid. If de-repression happens simultaneously on co-resident plasmids, common cues may stimulate de-repression of distinct plasmids. Copyright © 2017 Elsevier Inc. All rights reserved.

  12. Construction of small plasmid vectors for use in genetic improvement of the extremely acidophilic Acidithiobacillus caldus.

    PubMed

    Meng, Jianzhou; Wang, Huiyan; Liu, Xiangmei; Lin, Jianqun; Pang, Xin; Lin, Jianqiang

    2013-10-01

    The genetic improvement of biomining bacteria including Acidithiobacillus caldus could facilitate the bioleaching process of sulfur-containing minerals. However, the available vectors for use in A. caldus are very scanty and limited to relatively large broad-host-range IncQ plasmids. In this study, a set of small, mobilizable plasmid vectors (pBBR1MCS-6, pMSD1 and pMSD2) were constructed based on plasmid pBBR1MCS-2, which does not belong to the IncQ, IncW, or IncP groups. The function of the tac promoter on 5.8-kb pMSD2 was determined by inserting a kanamycin-resistant reporter gene. The resulting recombinant pMSD2-Km was successfully transferred by conjugation into A. caldus MTH-04 with transfer frequency of 1.38±0.64×10(-5). The stability and plasmid copy number of pMSD2-Km in A. caldus MTH-04 were 75±2.7% and 5-6 copies per cell, respectively. By inserting an arsABC operon into pMSD2, an arsenic-resistant recombinant pMSD2-As was constructed and transferred into A. caldus MTH-04 by conjugation. The arsenic tolerance of A. caldus MTH-04 containing pMSD2-As was obviously increased up to 45mM of NaAsO2. These vectors could be applied in genetic improvement of A. caldus as well as other bioleaching bacteria.

  13. p518, a small floR plasmid from a South American isolate of Actinobacillus pleuropneumoniae.

    PubMed

    da Silva, Giarlã Cunha; Rossi, Ciro César; Santana, Mateus Ferreira; Langford, Paul R; Bossé, Janine T; Bazzolli, Denise Mara Soares

    2017-05-01

    A small (3.9kb) plasmid (p518), conferring resistance to florfenicol (MIC >8μg/mL) and chloramphenicol (MIC >8μg/mL) was isolated from an Actinobacillus pleuropneumoniae clinical isolate from Southeastern Brazil. To date, this is the smallest florfenicol resistance plasmid isolated from a member of the Pasteurellaceae. The complete nucleotide of this plasmid revealed a unique gene arrangement compared to previously reported florfenicol resistance plasmids found in other members of the Pasteurellaceae. In addition to the floR gene and a lysR gene, common to various florfenicol resistance plasmids, p518 also encodes strA and a partial strB sequence. An origin of replication (oriV) similar to that in the broad host range plasmid, pLS88, was identified in p518, and transformation into Escherichia coli MFDpir confirmed the ability to replicate in other species. Mobilisation genes appear to have been lost, with only a partial mobC sequence remaining, and attempts to transfer p518 from a conjugal donor strain (E. coli MFDpir) were not successful, suggesting this plasmid is not mobilisable. Similarly, attempts to transfer p518 into a competent A. pleuropneumoniae strain, MIDG2331, by natural transformation were also not successful. These results suggest that p518 may be only transferred by vertical descent. Copyright © 2017 The Authors. Published by Elsevier B.V. All rights reserved.

  14. Persistence of Antibiotic Resistance Plasmids in Biofilms

    DTIC Science & Technology

    2014-10-01

    useful in the care of patients with combat-related wound infections. 15. SUBJECT TERMS Antibiotic resistance, plasmid, biofilm, coevolution , bacteria...Antibiotic!resistance,!plasmid,!biofilm,! coevolution ,!bacteria,!wound!infections! ! ! ! 3! 3. OVERALL PROJECT SUMMARY: The! successful! persistence

  15. Segregation of the mutator property of plasmid R46 from its ultraviolet-protecting property.

    PubMed

    Mortelmans, K E; Stocker, B A

    1979-01-02

    Plasmid R46 (an R factor conferring resistance to ampicillin, sulfonamides, streptomycin and tetracycline) reduces the bactericidal effect of UV irradiation but increases its mutagenic effect (reversion of hisG46), and raises the frequency of spontaneous reversion (mutator effect). Putative deletion mutants of R46 were obtained by transduction of the plasmid, then two successive conjugal transfers. Plasmids of five of six deletion classes, each with a different combination of drug resistance traits, retained conjugative ability and the UV-protecting, mutagenesis-enhancing and mutator effects of R46. (pKM101, used in the Ames system to enhance responsiveness to chemical mutagens, is one such mutant of R46.) Plasmids of a sixth class, represented by pKM115, conferred resistance only to streptomycin and were non-conjugative. All of several such plasmids (of independent origin) had a much stronger mutator effect than did R46, but lacked UV-protecting ability and did not enhance the mutagenic effect of UV irradiation. We infer that R46 possesses: (i) a gene, uvp, which increases capacity for error-prone repair of UV-damaged DNA, and thus causes both UV protection and enhancement of UV mutagenesis; (ii) gene(s) whose action in the absence of gene uvp greatly increases the frequency of spontaneous reversion of hisG46. A plasmid of another incompatibility group, pLS51, has UV-protecting and mutagenesis-enhancing effect but lacks the mutator property; introduction of pLS51 into a clone of hisG46 carrying a pKM115-type plasmid greatly reduced its spontaneous reversion rate, as expected if pLS51 also has a uvp gene able to modulate the mutator effect of R46-derived gene(s) in the pKM115-type plasmid.

  16. Factors That Affect Transfer of the IncI1 β-Lactam Resistance Plasmid pESBL-283 between E. coli Strains

    PubMed Central

    Händel, Nadine; Otte, Sarah; Jonker, Martijs; Brul, Stanley; ter Kuile, Benno H.

    2015-01-01

    The spread of antibiotic resistant bacteria worldwide presents a major health threat to human health care that results in therapy failure and increasing costs. The transfer of resistance conferring plasmids by conjugation is a major route by which resistance genes disseminate at the intra- and interspecies level. High similarities between resistance genes identified in foodborne and hospital-acquired pathogens suggest transmission of resistance conferring and transferrable mobile elements through the food chain, either as part of intact strains, or through transfer of plasmids from foodborne to human strains. To study the factors that affect the rate of plasmid transfer, the transmission of an extended-spectrum β-lactamase (ESBL) plasmid from a foodborne Escherichia coli strain to the β-lactam sensitive E. coli MG1655 strain was documented as a function of simulated environmental factors. The foodborne E. coli isolate used as donor carried a CTX-M-1 harboring IncI1 plasmid that confers resistance to β-lactam antibiotics. Cell density, energy availability and growth rate were identified as factors that affect plasmid transfer efficiency. Transfer rates were highest in the absence of the antibiotic, with almost every acceptor cell picking up the plasmid. Raising the antibiotic concentrations above the minimum inhibitory concentration (MIC) resulted in reduced transfer rates, but also selected for the plasmid carrying donor and recombinant strains. Based on the mutational pattern of transconjugant cells, a common mechanism is proposed which compensates for fitness costs due to plasmid carriage by reducing other cell functions. Reducing potential fitness costs due to maintenance and expression of the plasmid could contribute to persistence of resistance genes in the environment even without antibiotic pressure. Taken together, the results identify factors that drive the spread and persistence of resistance conferring plasmids in natural isolates and shows how these

  17. Genomic and Functional Characterization of qnr-Encoding Plasmids from Municipal Wastewater Biosolid Klebsiella pneumoniae Isolates

    PubMed Central

    Kaplan, Ella; Sela, Noa; Doron-Faigenboim, Adi; Navon-Venezia, Shiri; Jurkevitch, Edouard; Cytryn, Eddie

    2015-01-01

    Municipal wastewater treatment facilities are considered to be “hotspots” for antibiotic resistance, since they conjoin high densities of environmental and fecal bacteria with selective pressure in the form of sub-therapeutic concentrations of antibiotics. Discharged effluents and biosolids from these facilities can disseminate antibiotic resistant genes to terrestrial and aquatic environments, potentially contributing to the increasing global trend in antibiotic resistance. This phenomenon is especially pertinent when resistance genes are associated with mobile genetic elements such as conjugative plasmids, which can be transferred between bacterial phyla. Fluoroquinolones are among the most abundant antibiotic compounds detected in wastewater treatment facilities, especially in biosolids, where due to their hydrophobic properties they accumulate to concentrations that may exceed 40 mg/L. Although fluoroquinolone resistance is traditionally associated with mutations in the gyrA/topoisomerase IV genes, there is increasing evidence of plasmid-mediated quinolone resistance, which is primarily encoded on qnr genes. In this study, we sequenced seven qnr-harboring plasmids from a diverse collection of Klebsiella strains, isolated from dewatered biosolids from a large wastewater treatment facility in Israel. One of the plasmids, termed pKPSH-11XL was a large (185.4 kbp), multi-drug resistance, IncF-type plasmid that harbored qnrB and 10 additional antibiotic resistance genes that conferred resistance to five different antibiotic families. It was highly similar to the pKPN3-like plasmid family that has been detected in multidrug resistant clinical Klebsiella isolates. In contrast, the six additional plasmids were much smaller (7–9 Kbp) and harbored a qnrS -type gene. These plasmids were highly similar to each other and closely resembled pGNB2, a plasmid isolated from a German wastewater treatment facility. Comparative genome analyses of pKPSH-11XL and other pKPN3

  18. Production of Plasmid DNA as Pharmaceutical.

    PubMed

    Schmeer, Marco; Schleef, Martin

    2015-01-01

    Pharmaceutical applications of plasmid DNA require certain quality standards, depending on the intended use of the plasmids. That is, for direct gene transfer into human, GMP Grade is mandatory, however, for GMP production of for example viral vectors (AAV or mRNA etc.), the plasmid DNA used has not to be produced under GMP necessarily. Here we summarize important features of producing plasmid DNA, ensuring the required quality for the intended (pharmaceutical) application.

  19. Salmonella Typhimurium ST213 is associated with two types of IncA/C plasmids carrying multiple resistance determinants

    PubMed Central

    2011-01-01

    Background Salmonella Typhimurium ST213 was first detected in the Mexican Typhimurium population in 2001. It is associated with a multi-drug resistance phenotype and a plasmid-borne blaCMY-2 gene conferring resistance to extended-spectrum cephalosporins. The objective of the current study was to examine the association between the ST213 genotype and blaCMY-2 plasmids. Results The blaCMY-2 gene was carried by an IncA/C plasmid. ST213 strains lacking the blaCMY-2 gene carried a different IncA/C plasmid. PCR analysis of seven DNA regions distributed throughout the plasmids showed that these IncA/C plasmids were related, but the presence and absence of DNA stretches produced two divergent types I and II. A class 1 integron (dfrA12, orfF and aadA2) was detected in most of the type I plasmids. Type I contained all the plasmids carrying the blaCMY-2 gene and a subset of plasmids lacking blaCMY-2. Type II included all of the remaining blaCMY-2-negative plasmids. A sequence comparison of the seven DNA regions showed that both types were closely related to IncA/C plasmids found in Escherichia, Salmonella, Yersinia, Photobacterium, Vibrio and Aeromonas. Analysis of our Typhimurium strains showed that the region containing the blaCMY-2 gene is inserted between traA and traC as a single copy, like in the E. coli plasmid pAR060302. The floR allele was identical to that of Newport pSN254, suggesting a mosaic pattern of ancestry with plasmids from other Salmonella serovars and E. coli. Only one of the tested strains was able to conjugate the IncA/C plasmid at very low frequencies (10-7 to 10-9). The lack of conjugation ability of our IncA/C plasmids agrees with the clonal dissemination trend suggested by the chromosomal backgrounds and plasmid pattern associations. Conclusions The ecological success of the newly emerging Typhimurium ST213 genotype in Mexico may be related to the carriage of IncA/C plasmids. We conclude that types I and II of IncA/C plasmids originated from a

  20. Salmonella Typhimurium ST213 is associated with two types of IncA/C plasmids carrying multiple resistance determinants.

    PubMed

    Wiesner, Magdalena; Calva, Edmundo; Fernández-Mora, Marcos; Cevallos, Miguel A; Campos, Freddy; Zaidi, Mussaret B; Silva, Claudia

    2011-01-11

    Salmonella Typhimurium ST213 was first detected in the Mexican Typhimurium population in 2001. It is associated with a multi-drug resistance phenotype and a plasmid-borne blaCMY-2 gene conferring resistance to extended-spectrum cephalosporins. The objective of the current study was to examine the association between the ST213 genotype and blaCMY-2 plasmids. The blaCMY-2 gene was carried by an IncA/C plasmid. ST213 strains lacking the blaCMY-2 gene carried a different IncA/C plasmid. PCR analysis of seven DNA regions distributed throughout the plasmids showed that these IncA/C plasmids were related, but the presence and absence of DNA stretches produced two divergent types I and II. A class 1 integron (dfrA12, orfF and aadA2) was detected in most of the type I plasmids. Type I contained all the plasmids carrying the blaCMY-2 gene and a subset of plasmids lacking blaCMY-2. Type II included all of the remaining blaCMY-2-negative plasmids. A sequence comparison of the seven DNA regions showed that both types were closely related to IncA/C plasmids found in Escherichia, Salmonella, Yersinia, Photobacterium, Vibrio and Aeromonas. Analysis of our Typhimurium strains showed that the region containing the blaCMY-2 gene is inserted between traA and traC as a single copy, like in the E. coli plasmid pAR060302. The floR allele was identical to that of Newport pSN254, suggesting a mosaic pattern of ancestry with plasmids from other Salmonella serovars and E. coli. Only one of the tested strains was able to conjugate the IncA/C plasmid at very low frequencies (10-7 to 10-9). The lack of conjugation ability of our IncA/C plasmids agrees with the clonal dissemination trend suggested by the chromosomal backgrounds and plasmid pattern associations. The ecological success of the newly emerging Typhimurium ST213 genotype in Mexico may be related to the carriage of IncA/C plasmids. We conclude that types I and II of IncA/C plasmids originated from a common ancestor and that the

  1. Building mosaics of therapeutic plasmid gene vectors.

    PubMed

    Tolmachov, Oleg E

    2011-12-01

    Plasmids are circular or linear DNA molecules propagated extra-chromosomally in bacteria. Evolution shaped plasmids are inherently mosaic structures with individual functional units represented by distinct segments in the plasmid genome. The patchwork of plasmid genetic modules is a convenient template and a model for the generation of artificial plasmids used as vehicles for gene delivery into human cells. Plasmid gene vectors are an important tool in gene therapy and in basic biomedical research, where these vectors offer efficient transgene expression in many settings in vitro and in vivo. Plasmid vectors can be attached to nuclear directing ligands or transferred by electroporation as naked DNA to deliver the payload genes to the nuclei of the target cells. Transgene expression silencing by plasmid sequences of bacterial origin and immune stimulation by bacterial unmethylated CpG motifs can be avoided by the generation of plasmid-based minimized DNA vectors, such as minicircles. Systems of efficient site-specific integration into human chromosomes and stable episomal maintenance in human cells are being developed for further reduction of the chances for transgene silencing. The successful generation of plasmid vectors is governed by a number of vector design rules, some of which are common to all gene vectors, while others are specific to plasmid vectors. This review is focused both on the guiding principles and on the technical know-how of plasmid gene vector design.

  2. Prevalence and significance of plasmid maintenance functions in the virulence plasmids of pathogenic bacteria.

    PubMed

    Sengupta, Manjistha; Austin, Stuart

    2011-07-01

    Virulence functions of pathogenic bacteria are often encoded on large extrachromosomal plasmids. These plasmids are maintained at low copy number to reduce the metabolic burden on their host. Low-copy-number plasmids risk loss during cell division. This is countered by plasmid-encoded systems that ensure that each cell receives at least one plasmid copy. Plasmid replication and recombination can produce plasmid multimers that hinder plasmid segregation. These are removed by multimer resolution systems. Equitable distribution of the resulting monomers to daughter cells is ensured by plasmid partition systems that actively segregate plasmid copies to daughter cells in a process akin to mitosis in higher organisms. Any plasmid-free cells that still arise due to occasional failures of replication, multimer resolution, or partition are eliminated by plasmid-encoded postsegregational killing systems. Here we argue that all of these three systems are essential for the stable maintenance of large low-copy-number plasmids. Thus, they should be found on all large virulence plasmids. Where available, well-annotated sequences of virulence plasmids confirm this. Indeed, virulence plasmids often appear to contain more than one example conforming to each of the three system classes. Since these systems are essential for virulence, they can be regarded as ubiquitous virulence factors. As such, they should be informative in the search for new antibacterial agents and drug targets.

  3. Entire sequence of the colonization factor coli surface antigen 6-encoding plasmid pCss165 from an enterotoxigenic Escherichia coli clinical isolate.

    PubMed

    Wajima, Takeaki; Sabui, Subrata; Kano, Shigeyuki; Ramamurthy, Thandavarayan; Chatterjee, Nabendu Sekhar; Hamabata, Takashi

    2013-11-01

    Coli surface antigen 6 (CS6) is one of the most prevalent colonization factors among enterotoxigenic Escherichia coli (ETEC) isolated in developing countries. Although it is known that CS6 is encoded by a plasmid, there are no reports on the sequence analysis of the CS6-encoding plasmid or genes exhibiting similar behavior to CS6. Here, we report the isolation of the CS6-encoding plasmid, pCss165Kan, from 4266 ΔcssB::kanamycin (Km) and its complete nucleotide sequence. This plasmid consisted of 165,311bp and 222 predicted coding sequences. Remarkably, there were many insertion sequence (IS) elements, which comprised 24.4% of the entire sequence. Virulence-associated genes such as heat-stable enterotoxin, homologues of ATP-binding cassette transporter in enteroaggregative E. coli (EAEC), and ETEC autotransporter A were also present, although the ETEC autotransporter A gene was disrupted by the integration of IS629. We found that 2 transcriptional regulators belonging to the AraC family were not involved in CS6 expression. Interestingly, pCss165 had conjugative transfer genes, as well as 3 toxin-antitoxin systems that potentially exclude other plasmid-free host bacteria. These genes might be involved in the prevalence of CS6 among ETEC isolates.

  4. Amikacin, kanamycin and tobramycin binding to melanin in the presence of Ca(2+) and Mg(2+) ions.

    PubMed

    Wrześniok, Dorota; Buszman, Ewa; Miernik-Biela, Ewa

    2012-01-01

    The aim of the presented work was to examine the interaction of amikacin, kanamycin and tobramycin with melanin in the presence of Ca(2+ )and Mg(2+) ions. It has been demonstrated that the analyzed aminoglycosides form complexes with melanin in the presence of metal ions and the amount of drugs bound to the polymer increases with increasing initial antibiotics concentration. It has been also shown that two classes of binding sites participate in the formation of amikacin, kanamycin and tobramycin complexes with melanin containing Ca(2+) or Mg(2+) ions: high affinity binding sites (n1) with the association constant K1 approximately 10(4)-10(5)M(-1) and low affinity binding sites (n2) with K2 approximately 10(3)M(-1). It has been demonstrated that calcium and magnesium significantly decrease the number of total binding sites (ntot) as compared with aminoglycoside-melanin complexes obtained in the absence of metal ions.

  5. Successful treatment of recurrent Helicobacter fennelliae bacteraemia by selective digestive decontamination with kanamycin in a lung cancer patient receiving chemotherapy

    PubMed Central

    Nagamatsu, Maki; Tomida, Junko; Kawamura, Yoshiaki; Yamamoto, Kei; Mawatari, Momoko; Kutsuna, Satoshi; Takeshita, Nozomi; Hayakawa, Kayoko; Kanagawa, Shuzo; Mezaki, Kazuhisa; Hashimoto, Masao; Ishii, Satoru; Ohmagari, Norio

    2016-01-01

    Introduction: Helicobacter fennelliae is an enterohepatic Helicobacter species causing bacteraemia in immunocompromised hosts. Only a few cases of recurrent H. fennelliae bacteraemia have been reported in Japan and there are no guidelines regarding antimicrobial treatment for H. fennelliae infection. Case presentation: H. fennelliae bacteraemia was observed in a patient receiving platinum-based chemotherapy for lung cancer. To prevent recurrence, the patient received antibiotic therapy with cefepime, amoxicillin and doxycycline for 6 weeks, which is similar to the therapy for Helicobacter cinaedi bacteraemia. Bacteraemia recurred despite the long-term antibiotic therapy. We hypothesized that the H. fennelliae bacteraemia originated from endogenous infection in the intestinal tract due to the long-term damage of the enteric mucosa by platinum-based drugs and performed selective digestive decontamination (SDD) with kanamycin. Bacteraemia did not recur after SDD. Conclusion: Our observations indicate that clinicians should be aware of possible recurrent H. fennelliae bacteraemia, which could be effectively prevented by SDD with kanamycin. PMID:28348791

  6. Frequency of Resistance to Kanamycin, Tobramycin, Netilmicin, and Amikacin in Gentamicin-Resistant Gram-Negative Bacteria

    PubMed Central

    Seligman, Stephen J.

    1978-01-01

    In vitro evaluation of 66 epidemiologically distinct, gentamicin-resistant, gram-negative isolates from four hospitals revealed that 92% were kanamycin resistant, 44% were netilmicin resistant, 41% were tobramycin resistant, and 6% were amikacin resistant. Combined resistance to gentamicin, tobramycin, and netilmicin occurred in 30% of the strains. Although the resistance percentage to amikacin was the lowest of the three newer agents, two strains were resistant to all of the aminoglycosides tested. PMID:626492

  7. The Effect of Kanamycin and Tetracycline on Growth and Photosynthetic Activity of Two Chlorophyte Algae.

    PubMed

    Bashir, Khawaja Muhammad Imran; Cho, Man-Gi

    2016-01-01

    Antibiotics are routinely used in microalgae culture screening, stock culture maintenance, and genetic transformation. By studying the effect of antibiotics on microalgae growth, we can estimate the least value to inhibit growth of undesired pathogens in algal culture. We studied the effect of kanamycin and tetracycline on the growth and photosynthetic activity of two chlorophyte microalgae, Dictyosphaerium pulchellum and Micractinium pusillum. We measured CFU mL(-1) on agar plates, optical density, fluorescence yields, and photosynthetic inhibition. Our results showed a significant effect of kan and tet on the tested microalgae species except tet, which showed a minor effect on M. pusillum. Both antibiotics are believed to interact with the protein synthesis machinery; hence, the inhibitory effect of the tested antibiotics was further confirmed by isolation and quantification of the whole cell protein. A significant reduction in protein quantity was observed at concentrations more than 5 mg L(-1), except M. pusillum, which showed only a slight reduction in protein quantity even at the maximum tested concentration of tet (30 mg L(-1)). This study can further aid in aquaculture industry, for the maintenance of the microalgae stock cultures and it can also help the microalgae genetic engineers in the construction of molecular markers.

  8. Systemic lipopolysaccharide induces cochlear inflammation and exacerbates the synergistic ototoxicity of kanamycin and furosemide.

    PubMed

    Hirose, Keiko; Li, Song-Zhe; Ohlemiller, Kevin K; Ransohoff, Richard M

    2014-08-01

    Aminoglycoside antibiotics are highly effective agents against gram-negative bacterial infections, but they cause adverse effects on hearing and balance dysfunction as a result of toxicity to hair cells of the cochlea and vestibular organs. While ototoxicity has been comprehensively studied, the contributions of the immune system, which controls the host response to infection, have not been studied in antibiotic ototoxicity. Recently, it has been shown that an inflammatory response is induced by hair cell injury. In this study, we found that lipopolysaccharide (LPS), an important component of bacterial endotoxin, when given in combination with kanamycin and furosemide, augmented the inflammatory response to hair cell injury and exacerbated hearing loss and hair cell injury. LPS injected into the peritoneum of experimental mice induced a brisk cochlear inflammatory response with recruitment of mononuclear phagocytes into the spiral ligament, even in the absence of ototoxic agents. While LPS alone did not affect hearing, animals that received LPS prior to ototoxic agents had worse hearing loss compared to those that did not receive LPS pretreatment. The poorer hearing outcome in LPS-treated mice did not correlate to changes in endocochlear potential. However, LPS-treated mice demonstrated an increased number of CCR2(+) inflammatory monocytes in the inner ear when compared with mice treated with ototoxic agents alone. We conclude that LPS and its associated inflammatory response are harmful to the inner ear when coupled with ototoxic medications and that the immune system may contribute to the final hearing outcome in subjects treated with ototoxic agents.

  9. Subinhibitory concentration of kanamycin induces the Pseudomonas aeruginosa type VI secretion system.

    PubMed

    Jones, Cerith; Allsopp, Luke; Horlick, Jack; Kulasekara, Hemantha; Filloux, Alain

    2013-01-01

    Pseudomonas aeruginosa is a Gram-negative bacterium found in natural environments including plants, soils and warm moist surfaces. This organism is also in the top ten of nosocomial pathogens, and prevalent in cystic fibrosis (CF) lung infections. The ability of P. aeruginosa to colonize a wide variety of environments in a lasting manner is associated with the formation of a resistant biofilm and the capacity to efficiently outcompete other microorganisms. Here we demonstrate that sub-inhibitory concentration of kanamycin not only induces biofilm formation but also induces expression of the type VI secretion genes in the H1-T6SS cluster. The H1-T6SS is known for its role in toxin production and bacterial competition. We show that the antibiotic induction of the H1-T6SS only occurs when a functional Gac/Rsm pathway is present. These observations may contribute to understand how P. aeruginosa responds to antibiotic producing competitors. It also suggests that improper antibiotic therapy may enhance P. aeruginosa colonization, including in the airways of CF patients.

  10. Subinhibitory Concentration of Kanamycin Induces the Pseudomonas aeruginosa type VI Secretion System

    PubMed Central

    Jones, Cerith; Allsopp, Luke; Horlick, Jack; Kulasekara, Hemantha; Filloux, Alain

    2013-01-01

    Pseudomonas aeruginosa is a Gram-negative bacterium found in natural environments including plants, soils and warm moist surfaces. This organism is also in the top ten of nosocomial pathogens, and prevalent in cystic fibrosis (CF) lung infections. The ability of P. aeruginosa to colonize a wide variety of environments in a lasting manner is associated with the formation of a resistant biofilm and the capacity to efficiently outcompete other microorganisms. Here we demonstrate that sub-inhibitory concentration of kanamycin not only induces biofilm formation but also induces expression of the type VI secretion genes in the H1-T6SS cluster. The H1-T6SS is known for its role in toxin production and bacterial competition. We show that the antibiotic induction of the H1-T6SS only occurs when a functional Gac/Rsm pathway is present. These observations may contribute to understand how P. aeruginosa responds to antibiotic producing competitors. It also suggests that improper antibiotic therapy may enhance P. aeruginosa colonization, including in the airways of CF patients. PMID:24260549

  11. M. tuberculosis ferritin (Rv3841): Potential involvement in Amikacin (AK) & Kanamycin (KM) resistance.

    PubMed

    Sharma, Divakar; Lata, Manju; Faheem, Mohammad; Khan, Asad Ullah; Joshi, Beenu; Venkatesan, Krishnamurthy; Shukla, Sangeeta; Bisht, Deepa

    2016-09-16

    Tuberculosis is an infectious disease, caused by one of the most successful human pathogen, Mycobacterium tuberculosis. Aminoglycosides, Amikacin (AK) & Kanamycin (KM) are commonly used to treat drug resistant tuberculosis. They target the protein synthesis machinery by interacting with several steps of translation. Several explanations have been proposed to explain the mechanism of aminoglycoside resistance but still our information is inadequate. Iron storing/interacting proteins were found to be overexpressed in aminoglycosides resistant isolates. Iron assimilation and utilization in M. tuberculosis plays a crucial role in growth, virulence and latency. To establish the relationship of ferritin with AK & KM resistance ferritin (Rv3841/bfrB) was cloned, expressed and antimicrobial drug susceptibility testing (DST) was carried out. Rv3841/bfrB gene was cloned and expressed in E. coli BL21 using pQE2 expression vector. Etest results for DST against AK & KM showed that the minimum inhibitory concentration (MIC) of ferritin recombinant cells was changed. Recombinants showed two fold changes in MIC with AK and three fold with KM E-strips. Overexpression of ferritin reflect the MIC shift which might be playing a critical role in the survival of mycobacteria by inhibiting/modulating the effects of AK & KM. String analysis also suggests that ferritin interacted with few proteins which are directly and indirectly involved in M. tuberculosis growth, Iron assimilation, virulence, resistance, stresses and latency.

  12. Origin and Evolution of Rickettsial Plasmids

    PubMed Central

    El Karkouri, Khalid; Pontarotti, Pierre; Raoult, Didier; Fournier, Pierre-Edouard

    2016-01-01

    Background Rickettsia species are strictly intracellular bacteria that have undergone a reductive genomic evolution. Despite their allopatric lifestyle, almost half of the 26 currently validated Rickettsia species have plasmids. In order to study the origin, evolutionary history and putative roles of rickettsial plasmids, we investigated the evolutionary processes that have shaped 20 plasmids belonging to 11 species, using comparative genomics and phylogenetic analysis between rickettsial, microbial and non-microbial genomes. Results Plasmids were differentially present among Rickettsia species. The 11 species had 1 to 4 plasmid (s) with a size ranging from 12 kb to 83 kb. We reconstructed pRICO, the last common ancestor of the current rickettsial plasmids. pRICO was vertically inherited mainly from Rickettsia/Orientia chromosomes and diverged vertically into a single or multiple plasmid(s) in each species. These plasmids also underwent a reductive evolution by progressive gene loss, similar to that observed in rickettsial chromosomes, possibly leading to cryptic plasmids or complete plasmid loss. Moreover, rickettsial plasmids exhibited ORFans, recent gene duplications and evidence of horizontal gene transfer events with rickettsial and non-rickettsial genomes mainly from the α/γ-proteobacteria lineages. Genes related to maintenance and plasticity of plasmids, and to adaptation and resistance to stress mostly evolved under vertical and/or horizontal processes. Those involved in nucleotide/carbohydrate transport and metabolism were under the influence of vertical evolution only, whereas genes involved in cell wall/membrane/envelope biogenesis, cycle control, amino acid/lipid/coenzyme and secondary metabolites biosynthesis, transport and metabolism underwent mainly horizontal transfer events. Conclusion Rickettsial plasmids had a complex evolution, starting with a vertical inheritance followed by a reductive evolution associated with increased complexity via

  13. Origin and Evolution of Rickettsial Plasmids.

    PubMed

    El Karkouri, Khalid; Pontarotti, Pierre; Raoult, Didier; Fournier, Pierre-Edouard

    2016-01-01

    Rickettsia species are strictly intracellular bacteria that have undergone a reductive genomic evolution. Despite their allopatric lifestyle, almost half of the 26 currently validated Rickettsia species have plasmids. In order to study the origin, evolutionary history and putative roles of rickettsial plasmids, we investigated the evolutionary processes that have shaped 20 plasmids belonging to 11 species, using comparative genomics and phylogenetic analysis between rickettsial, microbial and non-microbial genomes. Plasmids were differentially present among Rickettsia species. The 11 species had 1 to 4 plasmid (s) with a size ranging from 12 kb to 83 kb. We reconstructed pRICO, the last common ancestor of the current rickettsial plasmids. pRICO was vertically inherited mainly from Rickettsia/Orientia chromosomes and diverged vertically into a single or multiple plasmid(s) in each species. These plasmids also underwent a reductive evolution by progressive gene loss, similar to that observed in rickettsial chromosomes, possibly leading to cryptic plasmids or complete plasmid loss. Moreover, rickettsial plasmids exhibited ORFans, recent gene duplications and evidence of horizontal gene transfer events with rickettsial and non-rickettsial genomes mainly from the α/γ-proteobacteria lineages. Genes related to maintenance and plasticity of plasmids, and to adaptation and resistance to stress mostly evolved under vertical and/or horizontal processes. Those involved in nucleotide/carbohydrate transport and metabolism were under the influence of vertical evolution only, whereas genes involved in cell wall/membrane/envelope biogenesis, cycle control, amino acid/lipid/coenzyme and secondary metabolites biosynthesis, transport and metabolism underwent mainly horizontal transfer events. Rickettsial plasmids had a complex evolution, starting with a vertical inheritance followed by a reductive evolution associated with increased complexity via horizontal gene transfer as well as

  14. Plasmid diversity in Vibrio vulnificus biotypes.

    PubMed

    Roig, Francisco J; Amaro, Carmen

    2009-02-01

    Vibrio vulnificus is a heterogeneous bacterial species that can be virulent for humans and fish. Virulence in fish seems to rely on a recently described plasmid that can be transmitted between strains, aided by a conjugative plasmid. The main objective of this work was to analyse the plasmid content of a wide collection of strains from the three biotypes of the species, as well as to identify putative conjugative and virulence plasmids by means of Southern hybridization with specific probes and sequence analysis of selected gene markers. We found 28 different plasmid profiles in a total of 112 strains, which were relatively biotype- or serovar-specific. Biotype 1 lacked high-molecular-mass plasmids, with the exception of a putative conjugative plasmid of 48 kb that was present in 42.8% of clinical and environmental strains isolated worldwide. All biotype 2 strains possessed the virulence plasmid, whose molecular mass ranged between 68 and 70 kb, and 89.65% of these strains also had a putative conjugative plasmid with a molecular size of 52-56 kb. Finally, a 48 kb putative conjugative plasmid was present in all biotype 3 strains. Data from partial sequencing of traD, traI and the whole vep07 (a recently described plasmid-borne virulence gene) from a selection of strains suggest that the plasmids of 48-56 kb probably belong to the same family of F-plasmids as pYJ016 and that the gene vep07 is absolutely essential for fish virulence. Additional cryptic plasmids of low molecular mass were present in the three biotypes. In conclusion, plasmids are widespread among V. vulnificus species and could contribute substantially to genetic plasticity of the species.

  15. Amikacin in Newborn Infants: Comparative Pharmacology with Kanamycin and Clinical Efficacy in 45 Neonates with Bacterial Diseases

    PubMed Central

    Howard, Jorge B.; McCracken, George H.; Trujillo, Hugo; Mohs, Edgar

    1976-01-01

    The pharmacokinetic properties of amikacin (BBK8) were similar to those of kanamycin in newborn infants. Peak serum concentrations of both drugs were in the range of 15 to 25 μg/ml with the exception of kanamycin in babies weighing greater than 2,000 g at birth where peak levels were 12.5 to 15 μg/ml. Volumes of distribution, plasma clearances, and serum half-life values were comparable for the two drugs. The clinical and bacteriological responses to amikacin therapy were assessed in 45 neonates with bacterial diseases. A case fatality rate of 26% was observed in infants with septicemia and/or meningitis, whereas no deaths occurred among 22 infants with urinary tract and mucocutaneous infections. Cultures from infected sites were sterile within 72 h of initiating amikacin therapy in 47% of the infants, continued positive for greater than 72 h in 31%, and were not reevaluated during therapy in 22%. The clinical response was judged to be satisfactory in 92% of the surviving infants. The efficacy of amikacin was comparable to that of kanamycin or gentamicin in neonatal bacterial diseases. PMID:984762

  16. Production of monoclonal antibody and development of enzyme-linked immunosorbent assay for kanamycin in biological matrices.

    PubMed

    Watanabe, H; Satake, A; Kido, Y; Tsuji, A

    1999-11-01

    Monoclonal antibodies (MAbs) against kanamycin were prepared by using a kanamycin-bovine gamma-globulin conjugate for the immunization of mice. Splenocytes from BALB/c immunized mice were fused with P3X63Ag8U.1 myeloma cells. This resulted in two hybridoma cell lines. Fifty per cent inhibition concentrations (IC50) for the MAbs were 2 and 5 ng ml-1. One MAb (IC50 = 2 ng ml-1) was named #22 and was used to develop quantitative assays for kanamycin by means of an enzyme-linked immunosorbent assay (ELISA). The detection limit was 0.2 ng ml-1 and the standard deviations were 0.2-4.4% for intra-assay and 0.6-4.7% for inter-assay, respectively. The detection limits using peroxidase were 4 ppb in cattle milk, cattle plasma, cattle urine, swine plasma, swine urine and chicken plasma. Using the MAb #22 produced, a rapid test kit based on an immunochromatographic method was developed. The detection limits using the kit were 50 ppb in cattle milk, cattle plasma, cattle urine and chicken plasma.

  17. Infrared Spectroscopy Coupled with a Dispersion Model for Quantifying the Real-Time Dynamics of Kanamycin Resistance in Artificial Microbiota.

    PubMed

    Jin, Naifu; Paraskevaidi, Maria; Semple, Kirk T; Martin, Francis L; Zhang, Dayi

    2017-09-19

    Overusage of antibiotics leads to the widespread induction of antibiotic-resistance genes (ARGs). Developing an approach to allow real-time monitoring and fast prediction of ARGs dynamics in clinical or environmental samples has become an urgent matter. Vibrational spectroscopy is potentially an ideal technique toward the characterization of the microbial composition of microbiota as it is nondestructive, high-throughput, and label-free. Herein, we employed attenuated total reflection Fourier transform infrared (ATR-FT-IR) spectroscopy and developed a spectrochemical tool to quantify the static and dynamic composition of kanamycin resistance in artificial microbiota to evaluate microbial antibiotic resistance. Second-order differentiation was introduced in identifying the spectral biomarkers, and principal component analysis followed by linear discriminant analysis (PCA-LDA) was used for the multivariate analysis of the entire spectral features employed. The calculated results of the mathematical dispersion model coupled with PCA-LDA showed high similarity to the designed microbiota structure, with no significant difference (P > 0.05) in the static treatments. Moreover, our model successfully predicted the dynamics of kanamycin resistance within artificial microbiota under kanamycin pressures. This work lends new insights into the potential role of spectrochemical analyses in investigating the existence and trends of antibiotic resistance in microbiota.

  18. Antimicrobial Resistance and Plasmid Profile of Bacterial Strains Isolated from the Urbanized Eltsovka-1 River (Russia).

    PubMed

    Lobova, Tatiana I; Yemelyanova, Elena; Andreeva, Irina S; Puchkova, Larisa I; Repin, Vladimir Ye

    2015-08-01

    Antimicrobial resistance and plasmid profile of Gram-positive and Gram-negative bacterial strains isolated from the urbanized Eltsovka-1 River (Russia) were investigated. Sequencing of the 16S rRNA of of G+ strains showed 99-100% identity to that of Bacillus aerophilus, Bacillus altitudinis, Bacillus amyloliquefaciens, Bacillus anthrancis, Bacillus barbaricus, Bacillus cereus, Bacillus flexus, Bacillus indriensis, Bacillus stratosphericus, Bacillus subtilis subsp. subtilis, Bacillus thuringiensis, Streptomyces albidoflavus, Streptomyces albus, Streptomyces exfoliatus, Streptomyces odorifer, and Streptomyces sampsonii. Sequencing of the 16S rRNA of G-strains was similar in 99-100% to that of Aeromonas bestiarum, Aeromonas encheleia, Aeromonas hydrophila, A. hydrophila subsp. anaerogenes, A. hydrophila subsp. dhakensis, Aeromonas media, Aeromonas molluscorum, Aeromonas popoffii, Aeromonas salmonicida subsp. masoucida, A. salmonicida subsp. pectinolytica, A. salmonicida subsp. salmonicida, Aeromonas punctata, Aeromonas sobria, and Shewanella putrefaciens. The highest percentage (88.4%) of strains was resistant to polymyxin B followed by 69% to lincomycin, 61.5% to benzilpenicillin, 57.7% to ampicillin, and 50% to carbenicillin. A low level of resistance (4%) was found to kanamycin (8%), to streptomycin (11.5%), to neomycin and tetracycline, and (15%) to erythromycin. No resistance was found to gentamycin, monomycin, and chloroamphenicol. The majority (80.7%) of strains was multidrug-resistant. Ninety-two percent of all strains carried plasmid DNA of various sizes.

  19. Coincident plasmids and antimicrobial resistance in marine bacteria isolated from polluted and unpolluted Atlantic Ocean Samples

    SciTech Connect

    Baya, A.M.; Brayton, P.R.; Brown, V.L.; Grimes, D.J.; Russek-Cohen, E.; Colwell, R.R.

    1986-06-01

    Sewage effluent and outfall confluence samples were collected at the Barceloneta Regional Treatment Plant in Barceloneta, Puerto Rico; outfall confluence samples at Ocean City, Md., were also collected. Samples from uncontaminated open ocean areas served as clean-water controls. Bacteria were enriched in marine broth 2216 amended with 1 ..mu..g of one of a set of chemical selected for study per ml: nitrobenzene, dibutyl phthalate, m-cresol, o-cresol, 4-nitroaniline, bis(tributyltin) oxide, and quinone. MICs of the chemicals were determined individually for all isolates. Bacterial isolates were evaluated for resistance to nine different antibiotics and for the presence of plasmid DNA. Treated sewage was found to contain large numbers of bacteria simultaneously possessing antibiotic resistance, chemical resistance, and multiple bands of plasmic DNA. Bacteria resistant to penicillin, erythromycin, nalidixic acid, ampicillin, m-cresol, quinone, and bis(tributyltin) oxide were detected in nearly all samples, but only sewage outfall confluence samples yielded bacterial isolates that were resistant to streptomycin. Bacteria resistant to a combination of antibiotics, including kanamycin, chloramphenicol, gentamicin, and tetracycline, were isolated only from sewage effluent samples. It is concluded that bacterial isolates derived from toxic chemical wastes more frequently contain plasmid DNA and demonstrate antimicrobial resistance than do bacterial isolates from domestic sewage-impacted waters or from uncontaminated open ocean sites.

  20. Origin-of-transfer sequences facilitate mobilisation of non-conjugative antimicrobial-resistance plasmids in Staphylococcus aureus

    PubMed Central

    O'Brien, Frances G.; Yui Eto, Karina; Murphy, Riley J. T.; Fairhurst, Heather M.; Coombs, Geoffrey W.; Grubb, Warren B.; Ramsay, Joshua P.

    2015-01-01

    Staphylococcus aureus is a common cause of hospital, community and livestock-associated infections and is increasingly resistant to multiple antimicrobials. A significant proportion of antimicrobial-resistance genes are plasmid-borne, but only a minority of S. aureus plasmids encode proteins required for conjugative transfer or Mob relaxase proteins required for mobilisation. The pWBG749 family of S. aureus conjugative plasmids can facilitate the horizontal transfer of diverse antimicrobial-resistance plasmids that lack Mob genes. Here we reveal that these mobilisable plasmids carry copies of the pWBG749 origin-of-transfer (oriT) sequence and that these oriT sequences facilitate mobilisation by pWBG749. Sequences resembling the pWBG749 oriT were identified on half of all sequenced S. aureus plasmids, including the most prevalent large antimicrobial-resistance/virulence-gene plasmids, pIB485, pMW2 and pUSA300HOUMR. oriT sequences formed five subfamilies with distinct inverted-repeat-2 (IR2) sequences. pWBG749-family plasmids encoding each IR2 were identified and pWBG749 mobilisation was found to be specific for plasmids carrying matching IR2 sequences. Specificity of mobilisation was conferred by a putative ribbon-helix-helix-protein gene smpO. Several plasmids carried 2–3 oriT variants and pWBG749-mediated recombination occurred between distinct oriT sites during mobilisation. These observations suggest this relaxase-in trans mechanism of mobilisation by pWBG749-family plasmids is a common mechanism of plasmid dissemination in S. aureus. PMID:26243776

  1. Studies on Saccharomyces cerevisiae carrying the plasmid pCYG4 related with ammonia assimilation. Batch experiments.

    PubMed

    Lima Filho, J L; Ledingham, W M

    1988-10-01

    Batch culture experiments of three different strains of Saccharomyces cerevisiae have been carried out. The first strain was transformed by a plasmid pCYG4, which carries the glutamate dehydrogenase (NADP-GDH, E.C. 1.4.14) gene conferring an 11-fold increase in activity. The second was transformed by the same plasmid, but without NADP-GDH, and the third was the wild type. The specific growth rates of the two recombinant DNA strains were below that of the wild type, which can be related to extra plasmid protein production.

  2. Conference Planning.

    ERIC Educational Resources Information Center

    Burke, W. Warner, Ed.; Beckhard, Richard, Ed.

    This book, written to instruct in the use of a conference as a medium of social intercourse, is divided into four sections. Section I, which contains five articles, deals with factors to be considered in planning a conference. Specific techniques one can employ to improve a conference and several different techniques for evaluating the…

  3. Molecular Epidemiology of KPC-Producing Escherichia coli: Occurrence of ST131-fimH30 Subclone Harboring pKpQIL-Like IncFIIk Plasmid

    PubMed Central

    O'Hara, Jessica A.; Hu, Fupin; Ahn, Chulsoo; Nelson, Jeremy; Rivera, Jesabel I.; Pasculle, Anthony W.

    2014-01-01

    Of 20 Klebsiella pneumoniae carbapenemase (KPC)-producing Escherichia coli isolates identified at hospitals in western Pennsylvania, 60% belonged to the epidemic ST131-fimH30 subclone. IncFIIk was the most common replicon type for the blaKPC-carrying plasmids (n = 8). All IncFIIk plasmids possessed a scaffold similar to that of pKpQIL, and seven of them were borne by ST131-fimH30 isolates. IncN plasmids conferred resistance to trimethoprim-sulfamethoxazole, and IncA/C plasmids conferred resistance to gentamicin. Three blaKPC-carrying plasmids (IncA/C and IncN) possessed blaSHV-7/12 and qnrA1 or qnrS1. PMID:24820082

  4. Plasmid curing of Oenococcus oeni.

    PubMed

    Mesas, Juan M; Rodríguez, M Carmen; Alegre, M Teresa

    2004-01-01

    Two strains of Oenococcus oeni, RS1 (which carries the plasmid pRS1) and RS2 (which carries the plasmids pRS2 and pRS3), were grown in the presence of different curing agents and at different temperatures. Sublethal temperature together with acriflavine generated all possible types of cured strains, i.e., lacking pRS1 (from strain RS1), and lacking pRS2, pRS3, or both (from strain RS2). Sublethal temperature together with acridine orange only generated cured strains lacking pRS3. These results suggest that acriflavine is a better curing agent than acridine orange for O. oeni, and that pRS3 is the most sensitive to these curing agents. We also observed spontaneous loss of pRS2 or both pRS2 and pRS3 by electroporation. The ability to cure O. oeni strains of plasmids provides a critical new tool for the genetic analysis and engineering of this commercially important bacterium.

  5. The mechanism of plasmid curing in bacteria.

    PubMed

    Spengler, Gabriella; Molnár, Annamária; Schelz, Zsuzsanna; Amaral, Leonard; Sharples, Derek; Molnár, Joseph

    2006-07-01

    Bacterial plasmids have a major impact on metabolic function. Lactose fermentation of E. coli or hemolysin B transporter expressed by the plasmids that carry these respective genes could be readily obviated by heterocyclic compounds that readily bind to plasmid DNA. These compounds could also reverse the resistance to antibiotics of E. coli, Enterobacter, Proteus, Staphylococcus and Yersinia strains by eliminating plasmids. However, the frequency and extent of this effect was significantly less than might have been expected based on a complex interaction with plasmid DNA. The effects of heterocyclic compounds on the plasmids responsible for the virulence of Yersinia and A. tumefaciens, or on nodulation, nitrogen fixation of Rhizobia accounted for the elimination of 0.1 to 1.0 % of plasmids present in the populations studied. Bacterial plasmids can be eliminated from bacterial species grown as pure or mixed bacterial cultures in the presence of sub-inhibitory concentrations of non-mutagenic heterocyclic compounds. The antiplasmid action of the compounds depends on the chemical structure of amphiphillic compounds having a planar ring system with substitution in the L-molecular region. A symmetrical pi-electron conjugation at the highest occupied molecular orbitals favours the antiplasmid effect. The antiplasmid effect of heterocyclic compounds is expressed differentially in accordance with the structural form of the DNA to which they bind. In this manner "extrachromosomal" plasmid DNA that exists in a superhelical state binds more compound than its linear or open-circular form; and least to the chromosomal DNA of the bacterium, that carries the plasmid. It can also be noted that these compounds are not mutagenic and their antiplasmid effects correlate with the energy of HOMO-orbitals. Plasmid elimination is considered also to take place in ecosystems containing numerous bacterial species. This opens up a new perspective in rational drug design against bacterial

  6. Plasmid Diversity and Adaptation Analyzed by Massive Sequencing of Escherichia coli Plasmids.

    PubMed

    de Toro, María; Garcilláon-Barcia, M Pilar; De La Cruz, Fernando

    2014-12-01

    Whole-genome sequencing is revolutionizing the analysis of bacterial genomes. It leads to a massive increase in the amount of available data to be analyzed. Bacterial genomes are usually composed of one main chromosome and a number of accessory chromosomes, called plasmids. A recently developed methodology called PLACNET (for plasmid constellation networks) allows the reconstruction of the plasmids of a given genome. Thus, it opens an avenue for plasmidome analysis on a global scale. This work reviews our knowledge of the genetic determinants for plasmid propagation (conjugation and related functions), their diversity, and their prevalence in the variety of plasmids found by whole-genome sequencing. It focuses on the results obtained from a collection of 255 Escherichia coli plasmids reconstructed by PLACNET. The plasmids found in E. coli represent a nonaleatory subset of the plasmids found in proteobacteria. Potential reasons for the prevalence of some specific plasmid groups will be discussed and, more importantly, additional questions will be posed.

  7. Plasmidic Extended-Spectrum β-Lactamases in Vibrio cholerae O1 El Tor Isolates in Argentina†

    PubMed Central

    Petroni, Alejandro; Corso, Alejandra; Melano, Roberto; Cacace, María Luisa; Bru, Ana María; Rossi, Alicia; Galas, Marcelo

    2002-01-01

    Since 1992 there have been seven major outbreaks of cholera in Argentina. Susceptibility analysis of 1,947 isolates (40% of reported cases) of Vibrio cholerae O1 biotype El Tor suggested the presence of extended-spectrum β-lactamases (ESBLs) in 28 isolates. Because of their different susceptibility profiles, V. cholerae isolates M1502, M1516, M1573, and M3030 (all of which are of the Ogawa serotype) were selected for the present study. By susceptibility analysis, isoelectric focusing, and PCR-based restriction fragment length polymorphism analysis, CTX-M-type enzymes were identified in three isolates, whereas a PER-2-type enzyme, in addition to a TEM-1-like enzyme, was identified in the other isolate. The presence of these ESBLs in V. cholerae isolates resulted in MICs well below those commonly observed for members of the family Enterobacteriaceae. Genes that encode both ESBLs were transferred to Escherichia coli by conjugation, together with all determinants of resistance to non-β-lactam antibiotics (gentamicin, kanamycin, and sulfamethoxazole for all isolates; amikacin and streptomycin for three isolates; trimethoprim, tetracycline, and chloramphenicol for two isolates). Plasmid profile analysis and Southern blotting revealed the presence of single plasmids of about 150 kb in the four V. cholerae isolates and their respective transconjugants and revealed that the plasmids harbored genes encoding CTX-M-type or PER-2-type ESBLs. These results strongly suggest the broad spread of these ESBLs among genera belong to families other than the Enterobacteriaceae. PMID:11959583

  8. Evolution of Regions Containing Antibiotic Resistance Genes in FII-2-FIB-1 ColV-Colla Virulence Plasmids.

    PubMed

    Moran, Robert A; Hall, Ruth M

    2017-09-18

    Three ColV virulence plasmids carrying antibiotic resistance genes were assembled from draft genome sequences of commensal ST95, ST131, and ST2705 Escherichia coli isolates from healthy Australians. Plasmids pCERC4, pCERC5, and pCERC9 include almost identical backbones containing FII-2 and FIB-1 replicons and the conserved ColV virulence region with an additional ColIa determinant. Only pCERC5 includes a complete, uninterrupted F-like transfer region and was able to conjugate. pCERC5 and pCERC9 contain Tn1721, carrying the tet(A) tetracycline resistance determinant in the same location, with Tn2 (blaTEM; ampicillin resistance) interrupting the Tn1721 in pCERC5. pCERC4 has a Tn1721/Tn21 hybrid transposon carrying dfrA5 (trimethoprim resistance) and sul1 (sulfamethoxazole resistance) in a class 1 integron. Four FII-2:FIB-1 ColV-ColIa plasmids in the GenBank nucleotide database have a related transposon in the same position, but an IS26 has reshaped the resistance gene region, deleting 2,069 bp of the integron 3'-CS, including sul1, and serving as a target for IS26 translocatable units containing blaTEM, sul2 and strAB (streptomycin resistance), or aphA1 (kanamycin/neomycin resistance). Another ColV-ColIa plasmid containing a related resistance gene region has lost the FII replicon and acquired a unique transfer region via recombination within the resistance region and at oriT. Eighteen further complete ColV plasmid sequences in GenBank contained FIB-1, but the FII replicons were of three types, FII-24, FII-18, and a variant of FII-36.

  9. Ototoxic destruction by co-administration of kanamycin and ethacrynic acid in rats.

    PubMed

    Liu, Hong; Ding, Da-lian; Jiang, Hai-yan; Wu, Xue-wen; Salvi, Richard; Sun, Hong

    2011-10-01

    It is well known that ethacrynic acid (EA) can potentiate the ototoxicity of aminoglycoside antibiotics (AmAn) such as kanamycin (KM), if they were applied at the same time. Currently, to create the model of EA-KM-induced cochlear lesion in rats, adult rats received a single injection of EA (75 mg/kg, intravenous injection), or followed immediately by KM (500 mg/kg, intramuscular injection). The hearing function was assessed by auditory brainstem response (ABR) measurement in response to click and/or tone bursts at 4, 8, 12, 16, 20, 24, and 32 kHz. The static microcirculation status in the stria vascularis after a single EA injection was evaluated with eosin staining. The pathological changes in cochlear and vestibular hair cells were also quantified after co-administration of EA and KM. After a single EA injection, blood flow in vessels supplying the stria vascularis rapidly diminished. However, the blood supply to the cochlear lateral wall partially recovered 5 h after EA treatment. Threshold changes in ABR were basically parallel to the microcirculation changes in stria vascularis after single EA treatment. Importantly, disposable co-administration of EA and KM resulted in a permanent hearing loss and severe damage to the cochlear hair cells, but spared the vestibular hair cells. Since the cochlear lateral wall is the important part of the blood-cochlea barrier, EA-induced anoxic damage to the epithelium of stria vascularis may enhance the entry of KM to the cochlea. Thus, experimental animal model of selective cochlear damage with normal vestibular systems can be reliably created through co-administration of EA and KM.

  10. Ototoxic destruction by co-administration of kanamycin and ethacrynic acid in rats*

    PubMed Central

    Liu, Hong; Ding, Da-lian; Jiang, Hai-yan; Wu, Xue-wen; Salvi, Richard; Sun, Hong

    2011-01-01

    It is well known that ethacrynic acid (EA) can potentiate the ototoxicity of aminoglycoside antibiotics (AmAn) such as kanamycin (KM), if they were applied at the same time. Currently, to create the model of EA-KM-induced cochlear lesion in rats, adult rats received a single injection of EA (75 mg/kg, intravenous injection), or followed immediately by KM (500 mg/kg, intramuscular injection). The hearing function was assessed by auditory brainstem response (ABR) measurement in response to click and/or tone bursts at 4, 8, 12, 16, 20, 24, and 32 kHz. The static microcirculation status in the stria vascularis after a single EA injection was evaluated with eosin staining. The pathological changes in cochlear and vestibular hair cells were also quantified after co-administration of EA and KM. After a single EA injection, blood flow in vessels supplying the stria vascularis rapidly diminished. However, the blood supply to the cochlear lateral wall partially recovered 5 h after EA treatment. Threshold changes in ABR were basically parallel to the microcirculation changes in stria vascularis after single EA treatment. Importantly, disposable co-administration of EA and KM resulted in a permanent hearing loss and severe damage to the cochlear hair cells, but spared the vestibular hair cells. Since the cochlear lateral wall is the important part of the blood-cochlea barrier, EA-induced anoxic damage to the epithelium of stria vascularis may enhance the entry of KM to the cochlea. Thus, experimental animal model of selective cochlear damage with normal vestibular systems can be reliably created through co-administration of EA and KM. PMID:21960349

  11. Virulence Plasmids of Spore-Forming Bacteria.

    PubMed

    Adams, Vicki; Li, Jihong; Wisniewski, Jessica A; Uzal, Francisco A; Moore, Robert J; McClane, Bruce A; Rood, Julian I

    2014-12-01

    Plasmid-encoded virulence factors are important in the pathogenesis of diseases caused by spore-forming bacteria. Unlike many other bacteria, the most common virulence factors encoded by plasmids in Clostridium and Bacillus species are protein toxins. Clostridium perfringens causes several histotoxic and enterotoxin diseases in both humans and animals and produces a broad range of toxins, including many pore-forming toxins such as C. perfringens enterotoxin, epsilon-toxin, beta-toxin, and NetB. Genetic studies have led to the determination of the role of these toxins in disease pathogenesis. The genes for these toxins are generally carried on large conjugative plasmids that have common core replication, maintenance, and conjugation regions. There is considerable functional information available about the unique tcp conjugation locus carried by these plasmids, but less is known about plasmid maintenance. The latter is intriguing because many C. perfringens isolates stably maintain up to four different, but closely related, toxin plasmids. Toxin genes may also be plasmid-encoded in the neurotoxic clostridia. The tetanus toxin gene is located on a plasmid in Clostridium tetani, but the botulinum toxin genes may be chromosomal, plasmid-determined, or located on bacteriophages in Clostridium botulinum. In Bacillus anthracis it is well established that virulence is plasmid determined, with anthrax toxin genes located on pXO1 and capsule genes on a separate plasmid, pXO2. Orthologs of these plasmids are also found in other members of the Bacillus cereus group such as B. cereus and Bacillus thuringiensis. In B. thuringiensis these plasmids may carry genes encoding one or more insecticidal toxins.

  12. IncP-1β Plasmids Are Important Carriers of Fitness Traits for Variovorax Species in the Mycosphere--Two Novel Plasmids, pHB44 and pBS64, with Differential Effects Unveiled.

    PubMed

    Zhang, Miaozhi; Warmink, Jan; Pereira E Silva, Michele C; Brons, Jolanda; Smalla, Kornelia; van Elsas, Jan Dirk

    2015-07-01

    The Laccaria proxima mycosphere strongly selects Variovorax paradoxus cells. Fifteen independent V. paradoxus strains, isolated from mycospheres sampled at two occasions, were investigated with respect to the occurrence of plasmids of sizes <60-100 kb. Two V. paradoxus strains, HB44 and BS64, were found to contain such plasmids, which were coined pHB44 and pBS64. Replicon typing using a suite of plasmid-specific PCR systems indicated that both plasmids belong to the IncP-1β group. Also, both were able to mobilize selectable IncQ group plasmids into Escherichia coli as well as Pseudomonas fluorescens. Moreover, they showed stable replication in these organisms, confirming their broad host range. Strain BS64 was cured of pBS64 and plasmid pHB44 was subsequently moved into this cured strain by making use of the IncQ group tracer plasmid pSUP104, which was then removed at elevated temperature. Thus, both plasmids could be screened for their ability to confer a phenotype upon strain BS64. No evidence for the presence of genes for xenobiotic degradation and/or antibiotic or heavy metal resistances was found for either of the two plasmids. Remarkably, both could stimulate the production of biofilm material by strain BS64. Also, the population densities of pBS64-containing strain BS64 were temporarily raised in liquid as well as soil systems (versus the plasmid-cured strain), both in the presence of the fungal host Lyophyllum sp. strain Karsten. Strikingly, plasmid pHB44 significantly enhanced the fitness of strain BS64 in soil containing Lyophyllum sp. strain Karsten, but decreased its fitness in soil supplemented with extra FeCl3. The effect was noted both in separate (no inter-strain competition) and joint (competition) inoculations.

  13. Noncanonical SMC protein in Mycobacterium smegmatis restricts maintenance of Mycobacterium fortuitum plasmids.

    PubMed

    Panas, Michael W; Jain, Paras; Yang, Hui; Mitra, Shimontini; Biswas, Debasis; Wattam, Alice Rebecca; Letvin, Norman L; Jacobs, William R

    2014-09-16

    Research on tuberculosis and leprosy was revolutionized by the development of a plasmid transformation system in the fast-growing surrogate, Mycobacterium smegmatis. This transformation system was made possible by the successful isolation of a M. smegmatis mutant strain mc(2)155, whose efficient plasmid transformation (ept) phenotype supported the replication of Mycobacterium fortuitum pAL5000 plasmids. In this report, we identified the EptC gene, the loss of which confers the ept phenotype. EptC shares significant amino acid sequence homology and domain structure with the MukB protein of Escherichia coli, a structural maintenance of chromosomes (SMC) protein. Surprisingly, M. smegmatis has three paralogs of SMC proteins: EptC and MSMEG_0370 both share homology with Gram-negative bacterial MukB; and MSMEG_2423 shares homology with Gram-positive bacterial SMCs, including the single SMC protein predicted for Mycobacterium tuberculosis and Mycobacterium leprae. Purified EptC was shown to bind ssDNA and stabilize negative supercoils in plasmid DNA. Moreover, an EptC-mCherry fusion protein was constructed and shown to bind to DNA in live mycobacteria, and to prevent segregation of plasmid DNA to daughter cells. To our knowledge, this is the first report of impaired plasmid maintenance caused by a SMC homolog, which has been canonically known to assist the segregation of genetic materials.

  14. Genomics of high molecular weight plasmids isolated from an on-farm biopurification system.

    PubMed

    Martini, María C; Wibberg, Daniel; Lozano, Mauricio; Torres Tejerizo, Gonzalo; Albicoro, Francisco J; Jaenicke, Sebastian; van Elsas, Jan Dirk; Petroni, Alejandro; Garcillán-Barcia, M Pilar; de la Cruz, Fernando; Schlüter, Andreas; Pühler, Alfred; Pistorio, Mariano; Lagares, Antonio; Del Papa, María F

    2016-06-20

    The use of biopurification systems (BPS) constitutes an efficient strategy to eliminate pesticides from polluted wastewaters from farm activities. BPS environments contain a high microbial density and diversity facilitating the exchange of information among bacteria, mediated by mobile genetic elements (MGEs), which play a key role in bacterial adaptation and evolution in such environments. Here we sequenced and characterized high-molecular-weight plasmids from a bacterial collection of an on-farm BPS. The high-throughput-sequencing of the plasmid pool yielded a total of several Mb sequence information. Assembly of the sequence data resulted in six complete replicons. Using in silico analyses we identified plasmid replication genes whose encoding proteins represent 13 different Pfam families, as well as proteins involved in plasmid conjugation, indicating a large diversity of plasmid replicons and suggesting the occurrence of horizontal gene transfer (HGT) events within the habitat analyzed. In addition, genes conferring resistance to 10 classes of antimicrobial compounds and those encoding enzymes potentially involved in pesticide and aromatic hydrocarbon degradation were found. Global analysis of the plasmid pool suggest that the analyzed BPS represents a key environment for further studies addressing the dissemination of MGEs carrying catabolic genes and pathway assembly regarding degradation capabilities.

  15. Genomics of high molecular weight plasmids isolated from an on-farm biopurification system

    PubMed Central

    Martini, María C.; Wibberg, Daniel; Lozano, Mauricio; Torres Tejerizo, Gonzalo; Albicoro, Francisco J.; Jaenicke, Sebastian; van Elsas, Jan Dirk; Petroni, Alejandro; Garcillán-Barcia, M. Pilar; de la Cruz, Fernando; Schlüter, Andreas; Pühler, Alfred; Pistorio, Mariano; Lagares, Antonio; Del Papa, María F.

    2016-01-01

    The use of biopurification systems (BPS) constitutes an efficient strategy to eliminate pesticides from polluted wastewaters from farm activities. BPS environments contain a high microbial density and diversity facilitating the exchange of information among bacteria, mediated by mobile genetic elements (MGEs), which play a key role in bacterial adaptation and evolution in such environments. Here we sequenced and characterized high-molecular-weight plasmids from a bacterial collection of an on-farm BPS. The high-throughput-sequencing of the plasmid pool yielded a total of several Mb sequence information. Assembly of the sequence data resulted in six complete replicons. Using in silico analyses we identified plasmid replication genes whose encoding proteins represent 13 different Pfam families, as well as proteins involved in plasmid conjugation, indicating a large diversity of plasmid replicons and suggesting the occurrence of horizontal gene transfer (HGT) events within the habitat analyzed. In addition, genes conferring resistance to 10 classes of antimicrobial compounds and those encoding enzymes potentially involved in pesticide and aromatic hydrocarbon degradation were found. Global analysis of the plasmid pool suggest that the analyzed BPS represents a key environment for further studies addressing the dissemination of MGEs carrying catabolic genes and pathway assembly regarding degradation capabilities. PMID:27321040

  16. Homologous recombination between plasmids in mammalian cells can be enhanced by treatment of input DNA.

    PubMed Central

    Kucherlapati, R S; Eves, E M; Song, K Y; Morse, B S; Smithies, O

    1984-01-01

    We have used the eukaryotic-prokaryotic shuttle vector pSV2Neo to demonstrate that cultured mammalian somatic cells have the enzymatic machinery to mediate homologous recombination and that the frequency of this recombination can be enhanced by pretreatment of the input DNA. Two nonoverlapping deletion mutants of pSV2Neo were constructed, each affecting the bacterial aminoglycoside 3'-phosphorylase gene (the neo gene), which confers resistance to aminoglycoside antibiotics on bacteria and resistance to the antibiotic G418 on mammalian cells. Mammalian cells transfected with either deletion plasmid alone yield no G418 -resistant colonies. Cells cotransfected with both deletion plasmids yield G418 -resistant colonies with high frequency. We show that these resistant colonies result from recombination involving homologous crossing-over or gene conversion between the deletion plasmids by rescuing from the resistant cells both types of reciprocal recombinant, full-length plasmids, and doubly deleted plasmids. Cutting one of the input plasmids to generate a double-stranded gap in the neo gene considerably enhances the frequency of homologous recombination within the gene. This suggests that targeting exogenous DNA to specific sites in mammalian chromosomes could be facilitated by suitable pretreatment of the DNA. Images PMID:6328502

  17. p39R861-4, A Type 2 A/C2 Plasmid Carrying a Segment from the A/C1 Plasmid RA1.

    PubMed

    Anantham, Sashindran; Harmer, Christopher J; Hall, Ruth M

    2015-12-01

    The largest plasmid in the strain 39R861, which is used as a plasmid size standard, was recovered by conjugation and sequenced to determine its exact size. Plasmid p39R861-4 transferred at high frequency. Although reported to be the A/C1 plasmid RA1, p39R861-4 is a 155794-bp Type 2 A/C2 plasmid, in which a 39-kb segment, derived from RA1 that includes a relative of the RA1 resistance island, replaces 26.5 kb of the Type 2 backbone. p39R861-4 includes a single copy of IS10 and two resistance islands with a CR2-sul2 region in each of them. The 84 kb of backbone between the resistance islands is inverted relative to other known A/C plasmids and this inversion has arisen through recombination between the CR2-sul2 regions that are inversely oriented. The two resistance islands present before this inversion occurred were one related to but longer than that found in RA1, and one that is a form of the ARI-B island and identical to ARI-B in the A/C2 plasmid R55. They contain genes conferring resistance to tetracycline (tetA(D)), sulfonamides (sul2), and florfenicol and chloramphenicol (floR). The tet(D) determinant is flanked by two IS26 in a transposon-like structure named Tntet(D). Both resistance islands contain remnants of the two ends of the integrative element GIsul2, consistent with the sul2 gene being mobilized by GIsul2 rather than by CR2.

  18. Microwave effects on plasmid DNA.

    PubMed

    Sagripanti, J L; Swicord, M L; Davis, C C

    1987-05-01

    The exposure of purified plasmid DNA to microwave radiation at nonthermal levels in the frequency range from 2.00 to 8.75 GHz produces single- and double-strand breaks that are detected by agarose gel electrophoresis. Microwave-induced damage to DNA depends on the presence of small amounts of copper. This effect is dependent upon both the microwave power and the duration of the exposure. Cuprous, but not cupric, ions were able to mimic the effects produced by microwaves on DNA.

  19. A Plasmid in Legionella pneumophila

    DTIC Science & Technology

    1980-09-01

    13). which they were isolated and the number of the isolate The Legionnaires disease bacterium, L. pneu. from that city. The following 16... Legionnaires disease bacterium. .1. (un. Micro. biol. 8:320-:t25. appears reasonable that this organism could sup- 1:l. Fraser, D5. W., and J. F. McI~ade. 1979...INFECTION AND IMMUNITY, Sept. 1980, p. 1(92-1095 Vol. 29, No. :1 0I 9-9567/A)/- 1092/14$02.00/0. A Plasmid in Legionella pneumophila_ ( (/’ )GREGORY

  20. Microwave effects on plasmid DNA

    SciTech Connect

    Sagripanti, J.L.; Swicord, M.L.; Davis, C.C.

    1987-05-01

    The exposure of purified plasmid DNA to microwave radiation at nonthermal levels in the frequency range from 2.00 to 8.75 GHz produces single- and double-strand breaks that are detected by agarose gel electrophoresis. Microwave-induced damage to DNA depends on the presence of small amounts of copper. This effect is dependent upon both the microwave power and the duration of the exposure. Cuprous, but not cupric, ions were able to mimic the effects produced by microwaves on DNA.

  1. The aminoglycoside antibiotic kanamycin damages DNA bases in Escherichia coli: caffeine potentiates the DNA-damaging effects of kanamycin while suppressing cell killing by ciprofloxacin in Escherichia coli and Bacillus anthracis.

    PubMed

    Kang, Tina Manzhu; Yuan, Jessica; Nguyen, Angelyn; Becket, Elinne; Yang, Hanjing; Miller, Jeffrey H

    2012-06-01

    The distribution of mutants in the Keio collection of Escherichia coli gene knockout mutants that display increased sensitivity to the aminoglycosides kanamycin and neomycin indicates that damaged bases resulting from antibiotic action can lead to cell death. Strains lacking one of a number of glycosylases (e.g., AlkA, YzaB, Ogt, KsgA) or other specific repair proteins (AlkB, PhrB, SmbC) are more sensitive to these antibiotics. Mutants lacking AlkB display the strongest sensitivity among the glycosylase- or direct lesion removal-deficient strains. This perhaps suggests the involvement of ethenoadenine adducts, resulting from reactive oxygen species and lipid peroxidation, since AlkB removes this lesion. Other sensitivities displayed by mutants lacking UvrA, polymerase V (Pol V), or components of double-strand break repair indicate that kanamycin results in damaged base pairs that need to be removed or replicated past in order to avoid double-strand breaks that saturate the cellular repair capacity. Caffeine enhances the sensitivities of these repair-deficient strains to kanamycin and neomycin. The gene knockout mutants that display increased sensitivity to caffeine (dnaQ, holC, holD, and priA knockout mutants) indicate that caffeine blocks DNA replication, ultimately leading to double-strand breaks that require recombinational repair by functions encoded by recA, recB, and recC, among others. Additionally, caffeine partially protects cells of both Escherichia coli and Bacillus anthracis from killing by the widely used fluoroquinolone antibiotic ciprofloxacin.

  2. Survey of plasmids in various mycoplasmas.

    PubMed Central

    Harasawa, R.; Barile, M. F.

    1983-01-01

    Thirty-three strains representing 15 distinct Mycoplasma, Acholeplasma, and Spiroplasma species were examined for the presence of plasmid DNA by agarose gel electrophoresis. The electrophoretic patterns of the DNAs of three strains, Mycoplasma sp. strain 747, Spiroplasma mirum strain SMCA, and M. hominis strain 1257, suggested the presence of a plasmid with molecular weights of approximately 70, 10, and 9 megadaltons, respectively. The functions of these plasmids are currently unknown. Images FIG. 1 PMID:6679154

  3. Plasmid-encoded trimethoprim resistance in staphylococci.

    PubMed Central

    Archer, G L; Coughter, J P; Johnston, J L

    1986-01-01

    High-level (greater than 1,000 micrograms/ml) resistance to the antimicrobial agent trimethoprim was found in 17 of 101 (17%) coagulase-negative staphylococci and 5 of 51 (10%) Staphylococcus aureus from a number of different hospitals in the United States. Resistance was plasmid encoded and could be transferred by conjugation in 4 of the 17 (24%) Tpr coagulase-negative staphylococci and 3 of the 5 (60%) Tpr S. aureus. A 1.2-kilobase segment of plasmid DNA from one of the plasmids (pG01) was cloned on a high-copy-number vector in Escherichia coli and expressed high-level Tpr (MIC, 1,025 micrograms/ml) in the gram-negative host. In situ filter hybridization demonstrated homology between the cloned Tpr gene probe and plasmid DNA from each conjugative Tpr plasmid, a single nonconjugative plasmid from a United States Staphylococcus epidermidis isolate, a nonconjugative plasmid from an Australian methicillin-resistant S. aureus isolate, and chromosomal DNA from three Tpr S. epidermidis isolates that did not contain any plasmid DNA that was homologous with the probe. No homology was seen between the probe and staphylococcal plasmids not mediating Tpr, plasmid DNA from 12 Tpr S. epidermidis isolates not transferring Tpr by conjugation, or plasmid-encoded Tpr genes derived from gram-negative bacteria. Plasmid-encoded Tpr appears to be a relatively new gene in staphylococci and, because it can be transferred by conjugation, could become more prevalent in nonsocomial isolates. Images PMID:3729338

  4. TEM-1-encoding small plasmids impose dissimilar fitness costs on Haemophilus influenzae and Haemophilus parainfluenzae.

    PubMed

    Søndergaard, Annette; Lund, Marianne; Nørskov-Lauritsen, Niels

    2015-12-01

    Only two beta-lactamases, TEM-1 and ROB-1, have been observed in Haemophilus influenzae, while four different TEM but no ROB enzymes have been found in Haemophilus parainfluenzae. In order to investigate the mechanisms behind the dissemination of small beta-lactamase-encoding plasmids in H. influenzae and H. parainfluenzae, we assessed the fitness cost of three TEM-1- (pPN223, pA1209, pA1606), one TEM-15- (pSF3) and one ROB-1-bearing (pB1000) plasmid when expressed in either bacterial species. All plasmids were stable in H. influenzae and H. parainfluenzae except pB1000, which showed on average (sample mean) 76% curing in H. parainfluenzae after 5  days of subculture. Competition assays between isogenic strains with and without plasmid showed no competitive disadvantage of pPN223 and pA1606 in H. influenzae, or of pA1209 in H. parainfluenzae. In contrast, pSF3 and pB1000 were associated with significant competitive disadvantages in both species. Some of the competitive disadvantages may be related to differences in plasmid copy number and mRNA expression of the beta-lactamase genes, as revealed by quantitative PCR analysis. In conclusion, plasmids encoding TEM beta-lactamases isolated from H. influenzae and H. parainfluenzae can be stably transferred between species. The fast curing of pB1000 in H. parainfluenzae observed in this study correlates to the fact that ROB-1 has never been reported for this species. TEM-1-encoding plasmids are associated with the lowest level of fitness cost, but different TEM-1 plasmids confer different levels of fitness cost on the two hosts.

  5. IncI1 Plasmid Carrying Extended-Spectrum-β-Lactamase Gene blaCTX-M-1 in Salmonella enterica Isolates from Poultry and Humans in France, 2003 to 2008 ▿

    PubMed Central

    Cloeckaert, Axel; Praud, Karine; Lefevre, Martine; Doublet, Benoît; Pardos, Maria; Granier, Sophie A.; Brisabois, Anne; Weill, François-Xavier

    2010-01-01

    We report the dissemination of a conjugative IncI1 plasmid carrying blaCTX-M-1, conferring resistance to extended-spectrum cephalosporins, in Salmonella enterica isolates from poultry and humans in France from 2003 to 2008. By IncI1 plasmid subtyping, this plasmid was shown to be genetically related to that found in Escherichia coli isolates from healthy poultry in France. PMID:20643895

  6. Plasmid transfer systems in the rhizobia.

    PubMed

    Ding, Hao; Hynes, Michael F

    2009-08-01

    Rhizobia are agriculturally important bacteria that can form nitrogen-fixing nodules on the roots of leguminous plants. Agricultural application of rhizobial inoculants can play an important role in increasing leguminous crop yields. In temperate rhizobia, genes involved in nodulation and nitrogen fixation are usually located on one or more large plasmids (pSyms) or on symbiotic islands. In addition, other large plasmids of rhizobia carry genes that are beneficial for survival and competition of rhizobia in the rhizosphere. Conjugative transfer of these large plasmids thus plays an important role in the evolution of rhizobia. Therefore, understanding the mechanism of conjugative transfer of large rhizobial plasmids provides foundations for maintaining, monitoring, and predicting the behaviour of these plasmids during field release events. In this minireview, we summarize two types of known rhizobial conjugative plasmids, including quorum sensing regulated plasmids and RctA-repressed plasmids. We provide evidence for the existence of a third type of conjugative plasmid, including pRleVF39c in Rhizobium leguminosarum bv. viciae strain VF39SM, and we provide a comparison of the different types of conjugation genes found in members of the rhizobia that have had their genomes sequenced so far.

  7. pLS101 plasmid vector

    DOEpatents

    Lacks, S.A.; Balganesh, T.S.

    1985-02-19

    Disclosed is recombinant plasmid pLS101, consisting essentially of a 2.0 Kb ma1M gene fragment ligated to a 4.4 Kb Tcr DNA fragment, which is particularly useful for transforming Gram-positive bacteria. This plasmid contains at least four restriction sites suitable for inserting exogeneous gene sequences. Also disclosed is a method for plasmid isolation by penicillin selection, as well as processes for enrichment of recombinant plasmids in Gram-positive bacterial systems. 5 figs., 2 tabs.

  8. pLS010 plasmid vector

    DOEpatents

    Lacks, Sanford A.; Balganesh, Tanjore S.

    1988-01-01

    Disclosed is recombinant plasmid pLS101, consisting essentially of a 2.0 Kb malM gene fragment ligated to a 4.4 Kb T.sub.c r DNA fragment, which is particularly useful for transforming Gram-positive bacteria. This plasmid contains at least four restriction sites suitable for inserting exogeneous gene sequences. Also disclosed is a method for plasmid isolation by penicillin selection, as well as processes for enrichment of recombinant plasmids in Gram-positive bacterial systems.

  9. Combined administration of kanamycin and furosemide does not result in loss of vestibular function in Guinea pigs.

    PubMed

    Bremer, Hendrik G; de Groot, John C M J; Versnel, Huib; Klis, Sjaak F L

    2012-01-01

    Aminoglycoside antibiotics are known to damage the vestibular and auditory sensory epithelia. Although loop diuretics enhance the cochleotoxic effect of aminoglycosides, it is not known whether concomitant administration of an aminoglycoside and a loop diuretic affects the vestibular system. The aim of our study was to investigate the effect of co-administration of kanamycin and furosemide upon the otolith organs and to compare it to the known vestibulotoxic effect of gentamicin. Five guinea pigs were injected with a single dose of both kanamycin (400 mg/kg, s.c.) and furosemide (100 mg/kg, i.v.), 5 animals received gentamicin (100 mg/kg, i.p.) for 10 days, and 5 untreated animals served as controls. After 7 days, vestibular function was assessed by measuring vestibular short-latency evoked potentials (VsEPs) to linear acceleration stimuli and cochlear function by auditory brainstem responses (ABRs) to clicks. Hair cell densities were determined in phalloidin-stained whole mounts of the utricles and saccules, and in midmodiolar sections of resin-embedded cochleae. Co-administration of kanamycin and furosemide had no significant effect on VsEPs and hair cell densities in the utricles and saccules were not reduced. ABR thresholds were increased to a great extent (by ∼60 dB), and histologically a severe loss of cochlear hair cells was observed. The effect of gentamicin, both on vestibular and cochlear function, was just the opposite. VsEP thresholds to horizontal stimulation were elevated and suprathreshold amplitudes showed a decrease, whereas cochlear function was not reduced. With this protocol, we have a tool to selectively induce cochlear or vestibular damage, which may be of interest to researchers and clinicians alike.

  10. Diagnosis of Drug Resistance to Fluoroquinolones, Amikacin, Capreomycin, Kanamycin and Ethambutol with Genotype MTBDRsl Assay: a Meta-Analysis.

    PubMed

    Mao, Xiaolu; Ke, Zunqiong; Shi, Xiaoyan; Liu, Shuiyi; Tang, Beibei; Wang, Jin; Huang, Hao

    2015-01-01

    The Genotype MTBDRsl is a new-generation PCR-based line-probe assay for rapid identification of the resistance to the second-line antituberculosis drugs with a single strip. The aim of this meta-analysis was to evaluate the performance of Genotype MTBDRsl in detecting drug resistance to fluoroquinolones, amikacin, capreomycin, kanamycin and ethambutol in comparison with the phenotypic drug susceptibility test. We searched Pubmed, Embase and the Cochrane Library and calculated the sensitivity, the specificity, the positive likelihood ratio (PLR), negative likelihood ratio (NLR), diagnostic odds ratio (DOR), corresponding 95% confidence interval (CI), and the area under the summary receiver operating characteristic (SROC) curves (AUC), and tested heterogeneity in accuracy estimates with the Spearman correlation coefficient and Chi-square. The summarized sensitivity (95% CI), specificity (95% CI), and AUC (standard error) were 0.869 (0.847-0.890), 0.973 (0.965-0.979) and 0.9690 (0.0188) for fluoroquinolones, 0.868 (0.829-0.900), 0.998 (0.994-0.999) and 0.9944 (0.0050) for amikacin, 0.879 (0.838-0.914), 0.970 (0.958-0.978) and 0.9791 (0.0120) for capreomycin, 0.501 (0.461-0.541), 0.991 (0.983-0.996) and 0.9814 (0.0114) for kanamycin and 0.686 (0.663-0.709), 0.871 (0.852-0.888) and 0.7349 (0.0639) for ethambutol, respectively. The genotype MTBDRsl demonstrate excellent accuracy for detecting drug resistance to fluoroquinolones, amikacin, and capreomycin, but it may not be an appropriate choice for detection of kanamycin and ethambutol. © 2015 by the Association of Clinical Scientists, Inc.

  11. Synergy with rifampin and kanamycin enhances potency, kill kinetics, and selectivity of de novo-designed antimicrobial peptides.

    PubMed

    Anantharaman, Aparna; Rizvi, Meryam Sardar; Sahal, Dinkar

    2010-05-01

    By choosing membranes as targets of action, antibacterial peptides offer the promise of providing antibiotics to which bacteria would not become resistant. However, there is a need to increase their potency against bacteria along with achieving a reduction in toxicity to host cells. Here, we report that three de novo-designed antibacterial peptides (DeltaFm, DeltaFmscr, and Ud) with poor to moderate antibacterial potencies and kill kinetics improved significantly in all of these aspects when synergized with rifampin and kanamycin against Escherichia coli. (DeltaFm and DeltaFmscr [a scrambled-sequence version of DeltaFm] are isomeric, monomeric decapeptides containing the nonproteinogenic amino acid alpha,beta-didehydrophenylalanine [DeltaF] in their sequences. Ud is a lysine-branched dimeric peptide containing the helicogenic amino acid alpha-aminoisobutyric acid [Aib].) In synergy with rifampin, the MIC of DeltaFmscr showed a 34-fold decrease (67.9 microg/ml alone, compared to 2 microg/ml in combination). A 20-fold improvement in the minimum bactericidal concentration of Ud was observed when the peptide was used in combination with rifampin (369.9 microg/ml alone, compared to 18.5 microg/ml in combination). Synergy with kanamycin resulted in an enhancement in kill kinetics for DeltaFmscr (no killing until 60 min for DeltaFmscr alone, versus 50% and 90% killing within 20 min and 60 min, respectively, in combination with kanamycin). Combination of the dendrimeric peptide DeltaFq (a K-K2 dendrimer for which the sequence of DeltaFm constitutes each of the four branches) (MIC, 21.3 microg/ml) with kanamycin (MIC, 2.1 microg/ml) not only lowered the MIC of each by 4-fold but also improved the therapeutic potential of this highly hemolytic (37% hemolysis alone, compared to 4% hemolysis in combination) and cytotoxic (70% toxicity at 10x MIC alone, versus 30% toxicity in combination) peptide. Thus, synergy between peptide and nonpeptide antibiotics has the potential to

  12. Decreased Immunoreactivities of the Chloride Transporters, KCC2 and NKCC1, in the Lateral Superior Olive Neurons of Kanamycin-treated Rats

    PubMed Central

    Suh, Myung-Whan

    2012-01-01

    Objectives From our previous study about the weak expressions of potassium-chloride (KCC2) and sodium-potassium-2 chloride (NKCC1) co-transporters in the lateral superior olive (LSO) in circling mice, we hypothesized that partially damaged cochlea of circling mice might be a cause of the weak expressions of KCC2 or NKCC1. To test this possibility, we reproduced the altered expressions of KCC2 and NKCC1 in the LSO of rats, whose cochleae were partially destroyed with kanamycin. Methods Rat pups were treated with kanamycin from postnatal (P)3 to P8 (700 mg/kg, subcutaneous injection, twice a day) and sacrificed for immunohistochemical analysis, scanning electron microscope (SEM) and auditory brain stem response. Results The SEM study revealed partially missing hair cells in P9 rats treated with kanamycin, and the hearing threshold was elevated to 63.8±2.5 dB SPL (4 ears) at P16. Both KCC2 and NKCC1 immunoreactivities were more prominent in control rats on P16. On 9 paired slices, the mean densities of NKCC1 immunoreactivities were 118.0±1.0 (control) and 112.2±1.2 (kanamycin treated), whereas those of KCC2 were 115.7±1.5 (control) and 112.0±0.8 (kanamycin treated). Conclusion We concluded that weak expressions of KCC2 and NKCC1 in circling mice were due to partial destruction of cochleae. PMID:22977707

  13. Improved methods in Agrobacterium-mediated transformation of almond using positive (mannose/pmi) or negative (kanamycin resistance) selection-based protocols.

    PubMed

    Ramesh, Sunita A; Kaiser, Brent N; Franks, Tricia; Collins, Graham; Sedgley, Margaret

    2006-08-01

    A protocol for Agrobacterium-mediated transformation with either kanamycin or mannose selection was developed for leaf explants of the cultivar Prunus dulcis cv. Ne Plus Ultra. Regenerating shoots were selected on medium containing 15 muM kanamycin (negative selection), while in the positive selection strategy, shoots were selected on 2.5 g/l mannose supplemented with 15 g/l sucrose. Transformation efficiencies based on PCR analysis of individual putative transformed shoots from independent lines relative to the initial numbers of leaf explants tested were 5.6% for kanamycin/nptII and 6.8% for mannose/pmi selection, respectively. Southern blot analysis on six randomly chosen PCR-positive shoots confirmed the presence of the nptII transgene in each, and five randomly chosen lines identified to contain the pmi transgene by PCR showed positive hybridisation to a pmi DNA probe. The positive (mannose/pmi) and the negative (kanamycin) selection protocols used in this study have greatly improved transformation efficiency in almond, which were confirmed with PCR and Southern blot. This study also demonstrates that in almond the mannose/pmi selection protocol is appropriate and can result in higher transformation efficiencies over that of kanamycin/nptII selection protocols.

  14. Microbial Evolution: Towards Resolving the Plasmid Paradox.

    PubMed

    MacLean, R Craig; San Millan, Alvaro

    2015-08-31

    Plasmids play a key role in bacterial evolution by providing bacteria with new and important functions, such as antibiotic resistance. New research shows how bacterial regulatory evolution can stabilize bacteria-plasmid associations and catalyze evolutionary innovation. Copyright © 2015 Elsevier Ltd. All rights reserved.

  15. Enhancement of bacterial competitive fitness by apramycin resistance plasmids from non-pathogenic Escherichia coli.

    PubMed

    Yates, C M; Shaw, D J; Roe, A J; Woolhouse, M E J; Amyes, S G B

    2006-09-22

    The study of antibiotic resistance has in the past focused on organisms that are pathogenic to humans or animals. However, the development of resistance in commensal organisms is of concern because of possible transfer of resistance genes to zoonotic pathogens. Conjugative plasmids are genetic elements capable of such transfer and are traditionally thought to engender a fitness burden on host bacteria. In this study, conjugative apramycin resistance plasmids isolated from newborn calves were characterized. Calves were raised on a farm that had not used apramycin or related aminoglycoside antibiotics for at least 20 months prior to sampling. Of three apramycin resistance plasmids, one was capable of transfer at very high rates and two were found to confer fitness advantages on new Escherichia coli hosts. This is the first identification of natural plasmids isolated from commensal organisms that are able to confer a fitness advantage on a new host. This work indicates that reservoirs of antibiotic resistance genes in commensal organisms might not decrease if antibiotic usage is halted.

  16. Transformation of Bacillus polymyxa with plasmid DNA.

    PubMed Central

    Mallonee, D H; Speckman, R A

    1989-01-01

    A plasmid transformation system was developed for Bacillus polymyxa ATCC 12321 and derivatives of this strain. The method utilizes a penicillin-treated-cell technique to facilitate uptake of the plasmid DNA. Low-frequency transformation (10(-6) per recipient cell) of plasmids pC194, pBD64, and pBC16 was accomplished with this method. Selection for the transformants was accomplished on both hypertonic and nonhypertonic selective media, with the highest rates of recovery occurring on a peptone-glucose-yeast extract medium containing 0.25 M sucrose. Several additional plasmids were shown to be capable of transferring their antibiotic resistance phenotypes to B. polymyxa through the use of a protoplast transformation procedure which allowed for a more efficient transfer of the plasmid DNA. However, cell walls could not be regenerated on the transformed protoplasts, and the transformants could not be subcultured from the original selective media. Images PMID:2604393

  17. The ABCs of plasmid replication and segregation.

    PubMed

    Pinto, Uelinton M; Pappas, Katherine M; Winans, Stephen C

    2012-11-01

    To ensure faithful transmission of low-copy plasmids to daughter cells, these plasmids must replicate once per cell cycle and distribute the replicated DNA to the nascent daughter cells. RepABC family plasmids are found exclusively in alphaproteobacteria and carry a combined replication and partitioning locus, the repABC cassette, which is also found on secondary chromosomes in this group. RepC and a replication origin are essential for plasmid replication, and RepA, RepB and the partitioning sites distribute the replicons to predivisional cells. Here, we review our current understanding of the transcriptional and post-transcriptional regulation of the Rep proteins and of their functions in plasmid replication and partitioning.

  18. In vivo cloning strategy for Rhizobium plasmids.

    PubMed

    Hernández-Lucas, I; Mavingui, P; Finan, T; Chain, P; Martínez-Romero, E

    2002-10-01

    We have developed a simple system to clone indigenous Rhizobium plasmids into E. coli. The strategy consists of three matings: the first is to insert Tn5 in the plasmid to be cloned, the second incorporates the integrative vector into the inserted Tn5 in the native Rhizobium plasmid, and the last mating transfers the target plasmid directly into E. coli. This mating-based system was successfully used to clone plasmids of Rhizobium species with sizes ranging from 150 to 270 kb. In addition, a 500-kb fragment of a 600-kb megaplasmid was also cloned. This strategy could be used for cloning indigenous replicons of other gram-negative bacteria into a different host.

  19. Large-scale preparation of plasmid DNA.

    PubMed

    Heilig, J S; Elbing, K L; Brent, R

    2001-05-01

    Although the need for large quantities of plasmid DNA has diminished as techniques for manipulating small quantities of DNA have improved, occasionally large amounts of high-quality plasmid DNA are desired. This unit describes the preparation of milligram quantities of highly purified plasmid DNA. The first part of the unit describes three methods for preparing crude lysates enriched in plasmid DNA from bacterial cells grown in liquid culture: alkaline lysis, boiling, and Triton lysis. The second part describes four methods for purifying plasmid DNA in such lysates away from contaminating RNA and protein: CsCl/ethidium bromide density gradient centrifugation, polyethylene glycol (PEG) precipitation, anion-exchange chromatography, and size-exclusion chromatography.

  20. A kanamycin sensor based on an electrosynthesized molecularly imprinted poly-o-phenylenediamine film on a single-walled carbon nanohorn modified glassy carbon electrode.

    PubMed

    Han, Shuang; Li, Bingqian; Song, Ze; Pan, Sihao; Zhang, Zhichao; Yao, Hui; Zhu, Shuyun; Xu, Guobao

    2016-12-19

    A single-walled carbon nanohorn (SWCNH) has been used to construct a molecularly imprinted electrochemical sensor for the first time. Kanamycin, a widely used aminoglycoside antibiotic, is used as a representative analyte to test the detection strategy. The kanamycin sensor was constructed by the electropolymerization of a molecularly imprinted poly-o-phenylenediamine film on a SWCNH modified glassy carbon electrode. The sensor was investigated in the presence or absence of kanamycin by cyclic voltammetry to verify the changes in the redox peak currents of K3Fe(CN)6. The sensor exhibits a linear range of 0.1-50 μM with a detection limit of 0.1 μM. It also shows high recognition ability, indicating that the SWCNH-based molecularly imprinted sensor is promising.

  1. The Complete Sequence and Comparative Analysis of a Multidrug-Resistance and Virulence Multireplicon IncFII Plasmid pEC302/04 from an Extraintestinal Pathogenic Escherichia coli EC302/04 Indicate Extensive Diversity of IncFII Plasmids

    PubMed Central

    Ho, Wing Sze; Yap, Kien-Pong; Yeo, Chew Chieng; Rajasekaram, Ganeswrie; Thong, Kwai Lin

    2016-01-01

    Extraintestinal pathogenic Escherichia coli (ExPEC) that causes extraintestinal infections often harbor plasmids encoding fitness traits such as resistance and virulence determinants that are of clinical importance. We determined the complete nucleotide sequence of plasmid pEC302/04 from a multidrug-resistant E. coli EC302/04 which was isolated from the tracheal aspirate of a patient in Malaysia. In addition, we also performed comparative sequence analyses of 18 related IncFIIA plasmids to determine the phylogenetic relationship and diversity of these plasmids. The 140,232 bp pEC302/04 is a multireplicon plasmid that bears three replication systems (FII, FIA, and FIB) with subtype of F2:A1:B1. The plasmid is self-transmissible with a complete transfer region. pEC302/04 also carries antibiotic resistance genes such as blaTEM−1 and a class I integron containing sul1, cml and aadA resistance genes, conferring multidrug resistance (MDR) to its host, E. coli EC302/04. Besides, two iron acquisition systems (SitABCD and IutA-IucABCD) which are the conserved virulence determinants of ExPEC-colicin V or B and M (ColV/ColBM)-producing plasmids were identified in pEC302/04. Multiple toxin-antitoxin (TA)-based addiction systems (i.e., PemI/PemK, VagC/VagD, CcdA/CcdB, and Hok/Sok) and a plasmid partitioning system, ParAB, and PsiAB, which are important for plasmid maintenance were also found. Comparative plasmid analysis revealed only one conserved gene, the repA1 as the core genome, showing that there is an extensive diversity among the IncFIIA plasmids. The phylogenetic relationship of 18 IncF plasmids based on the core regions revealed that ColV/ColBM-plasmids and non-ColV/ColBM plasmids were separated into two distinct groups. These plasmids, which carry highly diverse genetic contents, are also mosaic in nature. The atypical combination of genetic materials, i.e., the MDR- and ColV/ColBM-plasmid-virulence encoding regions in a single ExPEC plasmid is rare but of clinical

  2. Dual Targeting of Intracellular Pathogenic Bacteria with a Cleavable Conjugate of Kanamycin and an Antibacterial Cell-Penetrating Peptide.

    PubMed

    Brezden, Anna; Mohamed, Mohamed F; Nepal, Manish; Harwood, John S; Kuriakose, Jerrin; Seleem, Mohamed N; Chmielewski, Jean

    2016-08-31

    Bacterial infection caused by intracellular pathogens, such as Mycobacterium, Salmonella, and Brucella, is a burgeoning global health epidemic that necessitates urgent action. However, the therapeutic value of a number of antibiotics, including aminoglycosides, against intracellular pathogenic bacteria is compromised due to their inability to traverse eukaryotic membranes. For this significant problem to be addressed, a cleavable conjugate of the antibiotic kanamycin and a nonmembrane lytic, broad-spectrum antimicrobial peptide with efficient mammalian cell penetration, P14LRR, was prepared. This approach allows kanamycin to enter mammalian cells as a conjugate linked via a tether that breaks down in the reducing environment within cells. Potent antimicrobial activity of the P14KanS conjugate was demonstrated in vitro, and this reducible conjugate effectively cleared intracellular pathogenic bacteria within macrophages more potently than that of a conjugate lacking the disulfide moiety. Notably, successful clearance of Mycobacterium tuberculosis within macrophages was observed with the dual antibiotic conjugate, and Salmonella levels were significantly reduced in an in vivo Caenorhabditis elegans model.

  3. Crystallization and preliminary X-ray diffraction analysis of kanamycin-binding β-lactamase in complex with its ligand.

    PubMed

    Van de Water, Karen; Soror, Sameh H; Wohlkonig, Alexandre; van Nuland, Nico A J; Volkov, Alexander N

    2011-06-01

    TEM-1 β-lactamase is a highly efficient enzyme that is involved in bacterial resistance against β-lactam antibiotics such as penicillin. It is also a robust scaffold protein which can be engineered by molecular-evolution techniques to bind a variety of targets. One such β-lactamase variant (BlaKr) has been constructed to bind kanamycin (kan) and other aminoglycoside antibiotics, which are neither substrates nor ligands of native β-lactamases. In addition to recognizing kan, BlaKr activity is up-regulated by its binding via an activation mechanism which is not yet understood at the molecular level. In order to fill this gap, determination of the structure of the BlaKr-kan complex was embarked upon. A crystallization condition for BlaKr-kan was identified using high-throughput screening, and crystal growth was further optimized using streak-seeding and hanging-drop methods. The crystals belonged to the orthorhombic space group P2(1)2(1)2(1), with unit-cell parameters a = 47.01, b = 72.33, c = 74.62 Å, and diffracted to 1.67 Å resolution using synchrotron radiation. The X-ray structure of BlaKr with its ligand kanamycin should provide the molecular-level details necessary for understanding the activation mechanism of the engineered enzyme.

  4. Involvement of calpain-I and microRNA34 in kanamycin-induced apoptosis of inner ear cells.

    PubMed

    Yu, Li; Tang, Hao; Jiang, Xiao Hua; Tsang, Lai Ling; Chung, Yiu Wa; Chan, Hsiao Chang

    2010-12-01

    Inner ear cells, including hair cells, spiral ganglion cells, stria vascularis cells and supporting cells on the basilar membrane, play a major role in transducing hearing signals and regulating inner ear homoeostasis. However, their functions are often damaged by antibiotic-induced ototoxicity. Apoptosis is probably involved in inner ear cell injury following aminoglycoside treatment. Calpain, a calcium-dependent protease, is essential for mediating and promoting cell death. We have therefore investigated the involvement of calpain in the molecular mechanism underlying ototoxicity induced by the antibiotic kanamycin in mice. Kanamycin (750 mg/kg) mainly induced cell death of cochlear cells, including stria vascularis cells, supporting cells and spiral ganglion cells, but not hair cells within the organ of Corti. Cell death due to apoptosis occurred in a time-dependent manner with concomitant up-regulation of calpain expression. Furthermore, the expression levels of two microRNAs, mir34a and mir34c, were altered in a dose-dependent manner in cochlear cells. These novel findings demonstrated the involvement of both calpain and microRNAs in antibiotic-induced ototoxicity.

  5. Conference Resolution

    NASA Astrophysics Data System (ADS)

    2009-04-01

    Since the first IUPAP International Conference on Women in Physics (Paris, March 2002) and the Second Conference (Rio de Janeiro, May 2005), progress has continued in most countries and world regions to attract girls to physics and advance women into leadership roles, and many working groups have formed. The Third Conference (Seoul, October 2008), with 283 attendees from 57 countries, was dedicated to celebrating the physics achievements of women throughout the world, networking toward new international collaborations, building each participant's capacity for career success, and aiding the formation of active regional working groups to advance women in physics. Despite the progress, women remain a small minority of the physics community in most countries.

  6. Transferable antibiotic resistance plasmids from biogas plant digestates often belong to the IncP-1ε subgroup.

    PubMed

    Wolters, Birgit; Kyselková, Martina; Krögerrecklenfort, Ellen; Kreuzig, Robert; Smalla, Kornelia

    2014-01-01

    Manure is known to contain residues of antibiotics administered to farm animals as well as bacteria carrying antibiotic resistance genes (ARGs). These genes are often located on mobile genetic elements. In biogas plants (BGPs), organic substrates such as manure and plant material are mixed and fermented in order to provide energy, and resulting digestates are used for soil fertilization. The fate of plasmid carrying bacteria from manure during the fermentation process is unknown. The present study focused on transferable antibiotic resistance plasmids from digestates of seven BGPs, using manure as a co-substrate, and their phenotypic and genotypic characterization. Plasmids conferring resistance to either tetracycline or sulfadiazine were captured by means of exogenous plasmid isolation from digestates into Pseudomonas putida KT2442 and Escherichia coli CV601 recipients, at transfer frequencies ranging from 10(-5) to 10(-7). Transconjugants (n = 101) were screened by PCR-Southern blot hybridization and real-time PCR for the presence of IncP-1, IncP-1ε, IncW, IncN, IncP-7, IncP-9, LowGC, and IncQ plasmids. While 61 plasmids remained unassigned, 40 plasmids belonged to the IncP-1ε subgroup. All these IncP-1ε plasmids were shown to harbor the genes tet(A), sul1, qacEΔ1, intI1, and integron gene cassette amplicons of different size. Further analysis of 16 representative IncP-1ε plasmids showed that they conferred six different multiple antibiotic resistance patterns and their diversity seemed to be driven by the gene cassette arrays. IncP-1ε plasmids displaying similar restriction and antibiotic resistance patterns were captured from different BGPs, suggesting that they may be typical of this environment. Our study showed that BGP digestates are a potential source of transferable antibiotic resistance plasmids, and in particular the broad host range IncP-1ε plasmids might contribute to the spread of ARGs when digestates are used as fertilizer.

  7. Transferable antibiotic resistance plasmids from biogas plant digestates often belong to the IncP-1ε subgroup

    PubMed Central

    Wolters, Birgit; Kyselková, Martina; Krögerrecklenfort, Ellen; Kreuzig, Robert; Smalla, Kornelia

    2015-01-01

    Manure is known to contain residues of antibiotics administered to farm animals as well as bacteria carrying antibiotic resistance genes (ARGs). These genes are often located on mobile genetic elements. In biogas plants (BGPs), organic substrates such as manure and plant material are mixed and fermented in order to provide energy, and resulting digestates are used for soil fertilization. The fate of plasmid carrying bacteria from manure during the fermentation process is unknown. The present study focused on transferable antibiotic resistance plasmids from digestates of seven BGPs, using manure as a co-substrate, and their phenotypic and genotypic characterization. Plasmids conferring resistance to either tetracycline or sulfadiazine were captured by means of exogenous plasmid isolation from digestates into Pseudomonas putida KT2442 and Escherichia coli CV601 recipients, at transfer frequencies ranging from 10-5 to 10-7. Transconjugants (n = 101) were screened by PCR-Southern blot hybridization and real-time PCR for the presence of IncP-1, IncP-1ε, IncW, IncN, IncP-7, IncP-9, LowGC, and IncQ plasmids. While 61 plasmids remained unassigned, 40 plasmids belonged to the IncP-1ε subgroup. All these IncP-1ε plasmids were shown to harbor the genes tet(A), sul1, qacEΔ1, intI1, and integron gene cassette amplicons of different size. Further analysis of 16 representative IncP-1ε plasmids showed that they conferred six different multiple antibiotic resistance patterns and their diversity seemed to be driven by the gene cassette arrays. IncP-1ε plasmids displaying similar restriction and antibiotic resistance patterns were captured from different BGPs, suggesting that they may be typical of this environment. Our study showed that BGP digestates are a potential source of transferable antibiotic resistance plasmids, and in particular the broad host range IncP-1ε plasmids might contribute to the spread of ARGs when digestates are used as fertilizer. PMID:25653641

  8. Effect of Mutations on the Binding of Kanamycin-B to RNA Hairpins Derived from the Mycobacterium tuberculosis Ribosomal A-Site.

    PubMed

    Truitt, Amber R; Choi, Bok-Eum; Li, Jenny; Soto, Ana Maria

    2015-12-29

    Kanamycin is an aminoglycoside antibiotic used in the treatment of drug-resistant tuberculosis. Mutations at the rRNA A-site have been associated with kanamycin resistance in Mycobacterium tuberculosis clinical isolates. Understanding the effect of these mutations on the conformation of the M. tuberculosis A-site is critical for understanding the mechanisms of antibiotic resistance in M. tuberculosis. In this work, we have studied RNA hairpins derived from the M. tuberculosis A-site, the wild type and three mutants at the following positions (M. tuberculosis/Escherichia coli numbering): A1400/1408 → G, C1401/1409 → U, and the double mutant G1483/1491 C1401/1409 → UA. Specifically, we used circular dichroism, ultraviolet spectroscopy, and fluorescence spectroscopy to characterize the conformation, stability, and binding affinity of kanamycin-B and other aminoglycoside antibiotics for these RNA hairpins. Our results show that the mutations affect the conformation of the decoding site, with the mutations at position 1401/1409 resulting in significant destabilizations. Interestingly, the mutants bind paromomycin with weaker affinity than the wild type, but they bind kanamycin-B with similar affinity than the wild type. The results suggest that the presence of mutations does not prevent kanamycin-B from binding. Instead, kanamycin may promote different interactions with a third partner in the mutants compared to the wild type. Furthermore, our results with longer and shorter hairpins suggest that the region of the A-site that varies among organisms may have modulating effects on the binding and interactions of the A-site.

  9. Identification of regions essential for extrachromosomal replication and maintenance of an endogenous plasmid in Dictyostelium.

    PubMed Central

    Ahern, K G; Howard, P K; Firtel, R A

    1988-01-01

    Initial experiments with the endogenous 12.3 kb Dictyostelium discoideum plasmid Ddp1 led to the generation of a large shuttle vector, Ddp1-20. In addition to Ddp1, this vector contains pBR322 and a gene fusion that confers G418 resistance in Dictyostelium cells. We have shown that Ddp1-20 replicates extrachromosomally in Dictyostelium cells and can be grown in Escherichia coli cells (1). We have now examined deletions within this vector to identify the elements essential for extrachromosomal replication and stable maintenance of the plasmid. We find that a 2.2 kb fragment is sufficient to confer stable, extrachromosomal replication with a reduction in copy number from about 40 to approximately 10-15 copies per cell. Vectors containing additional Ddp1 sequences have a higher copy number. The 2.2 kb region contains none of the complete, previously identified transcription units on Ddp1 expressed during vegetative growth or development. These results suggest that gene products expressed by Ddp1 are not essential for replication, stability, or partitioning of the plasmid between daughter cells. Vectors carrying only the 2.2 kb fragment plus the gene fusion conferring G418 resistance transform Dictyostelium cells with high efficiency using either calcium phosphate mediated transformation or electroporation. Finally, we have examined the relative levels of expression of actin promoters driving neoR genes when in extrachromosomal or integrating vectors. Images PMID:3405751

  10. Plasmid Conjugation from Proteobacteria as Evidence for the Origin of Xenologous Genes in Cyanobacteria

    PubMed Central

    Encinas, David; Garcillán-Barcia, M. Pilar; Santos-Merino, María; Delaye, Luis; Moya, Andrés

    2014-01-01

    Comparative genomics have shown that 5% of Synechococcus elongatus PCC 7942 genes are of probable proteobacterial origin. To investigate the role of interphylum conjugation in cyanobacterial gene acquisition, we tested the ability of a set of prototype proteobacterial conjugative plasmids (RP4, pKM101, R388, R64, and F) to transfer DNA from Escherichia coli to S. elongatus. A series of BioBrick-compatible, mobilizable shuttle vectors was developed. These vectors were based on the putative origin of replication of the Synechococcus resident plasmid pANL. Not only broad-host-range plasmids, such as RP4 and R388, but also narrower-host-range plasmids, such as pKM101, all encoding MPFT-type IV secretion systems, were able to transfer plasmid DNA from E. coli to S. elongatus by conjugation. Neither MPFF nor MPFI could be used as interphylum DNA delivery agents. Reciprocally, pANL-derived cointegrates could be introduced in E. coli by electroporation, where they conferred a functional phenotype. These results suggest the existence of potentially ample channels of gene flow between proteobacteria and cyanobacteria and point to MPFT-based interphylum conjugation as a potential mechanism to explain the proteobacterial origin of a majority of S. elongatus xenologous genes. PMID:24509315

  11. [Gene cloning, selection of plasmids and application of Fasciola hepatica cathepsin L1 gene].

    PubMed

    Kuk, Salih; Erensoy, Ahmet

    2008-01-01

    Gene cloning refers to the process by which a fragment of DNA is transferred from one organism to a vector. A vector is an agent that can carry a DNA fragment into a host cell. Commonly used vectors include plasmids, lambda phage, cosmid and yeast artificial chromosome (YAC). Plasmid vectors that have been extensively used in genetic engineering are derived from natural plasmids. These contain a genetic marker conferring a phenotype that can be selected for or against and a polylinker or multiple cloning site (MCS), which is a short region containing several commonly used restriction sites allowing the insertion of DNA fragments at this location easily. There are several plasmids and gene cloning kits available nowadays commercially. These kits contain an advanced positive selection system for the highest efficiency cloning of PCR products generated with any DNA polymerase. The kits offer cloning efficiencies of up to 100% positive clones, eliminating the need for tedious colony screening. We consider that researchers should choose the most suitable plasmids and cloning kits for gene cloning in view of factors such as time consumption, cost and individual laboratory options.

  12. Autonomously replicating plasmids carrying the AMA1 region in Penicillium chrysogenum.

    PubMed

    Fierro, F; Kosalková, K; Gutiérrez, S; Martin, J F

    1996-04-01

    Plasmid vectors containing the AMA1 sequence transformed with high efficiency and replicated autonomously in Penicillium chrysogenum. The efficiency of transformation of P. chrysogenum was related to the length of the AMA1 fragment used for constructing the different autonomously replicating plasmids. One of the two palindromic inverted repeats of AMA1 (the 2.2-kb SalI-HindIII fragment) is sufficient to confer autonomous replication and a high transformation efficiency. Deletion of the 0.6-kb central fragment located between the inverted repeats did not affect either the ability of the plasmids to replicate autonomously or the efficiency of transformation, but did alter the mitotic stability and the plasmid copy number. Deletion of any fragment of the 2.2-kb repeat caused the loss of the ability to replicate autonomously and reduced the transformation efficiency. Most of the transformants retained the original plasmid configuration, as multimers and without reorganization, after several rounds of autonomous replication. The AMA1 region works as an origin of replication in P. chrysogenum and A. nidulans but not apparently in Acremonium chrysogenum.

  13. Swapping single-stranded DNA sequence specificities of relaxases from conjugative plasmids F and R100

    PubMed Central

    Harley, Matthew J.; Schildbach, Joel F.

    2003-01-01

    Conjugative plasmid transfer is an important mechanism for diversifying prokaryotic genomes and disseminating antibiotic resistance. Relaxases are conjugative plasmid-encoded proteins essential for plasmid transfer. Relaxases bind and cleave one plasmid strand site- and sequence-specifically before transfer of the cleaved strand. TraI36, a domain of F plasmid TraI that contains relaxase activity, binds a plasmid sequence in single-stranded form with subnanomolar KD and high sequence specificity. Despite 91% amino acid sequence identity, TraI36 domains from plasmids F and R100 discriminate between binding sites. The binding sites differ by 2 of 11 bases, but both proteins bind their cognate site with three orders of magnitude higher affinity than the other site. To identify specificity determinants, we generated variants having R100 amino acids in the F TraI36 background. Although most retain F specificity, the Q193R/R201Q variant binds the R100 site with 10-fold greater affinity than the F site. The reverse switch (R193Q/Q201R) in R100 TraI36 confers a wild-type F specificity on the variant. Nonadditivity of individual amino acid and base contributions to recognition suggests that the specificity difference derives from multiple interactions. The F TraI36 crystal structure shows positions 193 and 201 form opposite sides of a pocket within the binding cleft, suggesting binding involves knob-into-hole interactions. Specificity is presumably modulated by altering the composition of the pocket. Our results demonstrate that F-like relaxases can switch between highly sequence-specific recognition of different sequences with minimal amino acid substitution. PMID:14504391

  14. The immunogenicity of viral haemorragic septicaemia rhabdovirus (VHSV) DNA vaccines can depend on plasmid regulatory sequences.

    PubMed

    Chico, V; Ortega-Villaizan, M; Falco, A; Tafalla, C; Perez, L; Coll, J M; Estepa, A

    2009-03-18

    A plasmid DNA encoding the viral hemorrhagic septicaemia virus (VHSV)-G glycoprotein under the control of 5' sequences (enhancer/promoter sequence plus both non-coding 1st exon and 1st intron sequences) from carp beta-actin gene (pAE6-G(VHSV)) was compared to the vaccine plasmid usually described the gene expression is regulated by the human cytomegalovirus (CMV) immediate-early promoter (pMCV1.4-G(VHSV)). We observed that these two plasmids produced a markedly different profile in the level and time of expression of the encoded-antigen, and this may have a direct effect upon the intensity and suitability of the in vivo immune response. Thus, fish genetic immunisation assays were carried out to study the immune response of both plasmids. A significantly enhanced specific-antibody response against the viral glycoprotein was found in the fish immunised with pAE6-G(VHSV). However, the protective efficacy against VHSV challenge conferred by both plasmids was similar. Later analysis of the transcription profile of a set of representative immune-related genes in the DNA immunized fish suggested that depending on the plasmid-related regulatory sequences controlling its expression, the plasmid might activate distinct patterns of the immune system. All together, the results from this study mainly point out that the selection of a determinate encoded-antigen/vector combination for genetic immunisation is of extraordinary importance in designing optimised DNA vaccines that, when required for inducing protective immune response, could elicit responses biased to antigen-specific antibodies or cytotoxic T cells generation.

  15. Caprolactam-silica network, a strong potentiator of the antimicrobial activity of kanamycin against gram-positive and gram-negative bacterial strains.

    PubMed

    Voicu, Georgeta; Grumezescu, Valentina; Andronescu, Ecaterina; Grumezescu, Alexandru Mihai; Ficai, Anton; Ficai, Denisa; Ghitulica, Cristina Daniela; Gheorghe, Irina; Chifiriuc, Mariana Carmen

    2013-03-25

    Here, we report the fabrication of a novel ε-caprolactam-silica (ε-SiO2) network and assessed its biocompatibility and ability to improve the antimicrobial activity of kanamycin. The results of the quantitative antimicrobial assay demonstrate that the obtained ε-SiO2 network has efficiently improved the kanamycin activity on Staphylococcus aureus ATCC 25923 and Escherichia coli ATCC 25922 strains, with a significant decrease of the minimum inhibitory concentration. The ε-SiO2 network could be feasibly obtained and represents an alternative for the design of new antibiotic drug carriers or delivery systems to control bacterial infections.

  16. 35S Promoter Methylation in Kanamycin-Resistant Kalanchoe (Kalanchoe pinnata L.) Plants Expressing the Antimicrobial Peptide Cecropin P1 Transgene.

    PubMed

    Shevchuk, T V; Zakharchenko, N S; Tarlachkov, S V; Furs, O V; Dyachenko, O V; Buryanov, Y I

    2016-09-01

    Transgenic kalanchoe plants (Kalanchoe pinnata L.) expressing the antimicrobial peptide cecropin P1 gene (cecP1) under the control of the 35S cauliflower mosaic virus 35S RNA promoter and the selective neomycin phosphotransferase II (nptII) gene under the control of the nopaline synthase gene promoter were studied. The 35S promoter methylation and the cecropin P1 biosynthesis levels were compared in plants growing on media with and without kanamycin. The low level of active 35S promoter methylation further decreases upon cultivation on kanamycin-containing medium, while cecropin P1 synthesis increases.

  17. Complete Nucleotide Sequence of IncP-1β Plasmid pDTC28 Reveals a Non-Functional Variant of the blaGES-Type Gene

    PubMed Central

    Dang, Bingjun; Mao, Daqing; Luo, Yi

    2016-01-01

    Plasmid pDTC28 was isolated from the sediments of Haihe River using E. coli CV601 (gfp-tagged) as recipient and indigenous bacteria from the sediment as donors. This plasmid confers reduced susceptibility to tetracycline and sulfamethoxazole. The complete sequence of plasmid pDTC28 was 61,503 bp in length with an average G+C content of 64.09%. Plasmid pDTC28 belongs to the IncP-1β group by phylogenetic analysis. The backbones of plasmid pDTC28 and other IncP-1β plasmids are very classical and conserved, whereas the accessory regions of these plasmids are diverse. A blaGES-5-like gene was found on the accessory region, and this blaGES-5-like gene contained 18 silent mutations and 7 missense mutations compared with the blaGES-5 gene. The mutations resulted in 7 amino acid substitutions in GES-5 carbapenemase, causing the loss of function of the blaGES-5-like gene on plasmid pDTC28 against carbapenems and even β-lactams. The enzyme produced by the blaGES-5-like gene cassette may be a new variant of GES-type enzymes. Thus, the plasmid sequenced in this study will expand our understanding of GES-type β-lactamases and provide insights into the genetic platforms used for the dissemination of GES-type genes. PMID:27152950

  18. Complete Nucleotide Sequence of pGA45, a 140,698-bp IncFIIY Plasmid Encoding blaIMI-3-Mediated Carbapenem Resistance, from River Sediment

    PubMed Central

    Dang, Bingjun; Mao, Daqing; Luo, Yi

    2016-01-01

    Plasmid pGA45 was isolated from the sediments of Haihe River using Escherichia coli CV601 (gfp-tagged) as recipients and indigenous bacteria from sediment as donors. This plasmid confers reduced susceptibility to imipenem which belongs to carbapenem group. Plasmid pGA45 was fully sequenced on an Illumina HiSeq 2000 sequencing system. The complete sequence of plasmid pGA45 was 140,698 bp in length with an average G + C content of 52.03%. Sequence analysis shows that pGA45 belongs to IncFIIY group and harbors a backbone region which shares high homology and gene synteny to several other IncF plasmids including pNDM1_EC14653, pYDC644, pNDM-Ec1GN574, pRJF866, pKOX_NDM1, and pP10164-NDM. In addition to the backbone region, plasmid pGA45 harbors two notable features including one blaIMI-3-containing region and one type VI secretion system region. The blaIMI-3-containing region is responsible for bacteria carbapenem resistance and the type VI secretion system region is probably involved in bacteria virulence, respectively. Plasmid pGA45 represents the first complete nucleotide sequence of the blaIMI-harboring plasmid from environment sample and the sequencing of this plasmid provided insight into the architecture used for the dissemination of blaIMI carbapenemase genes. PMID:26941718

  19. PemK toxin encoded by the Xylella fastidiosa IncP-1 plasmid pXF-RIV11 is a ribonuclease

    USDA-ARS?s Scientific Manuscript database

    Stable inheritance of the IncP-1 plasmid pXF-RIV11 in Xylella fastidiosa is conferred by the pemI/pemK plasmid addiction system. PemK serves as a toxin inhibiting bacterial growth; PemI is the corresponding antitoxin that blocks activity of PemK toxin by direct binding. Here, PemK toxin and PemI ant...

  20. Biomedical Conferences

    NASA Technical Reports Server (NTRS)

    1976-01-01

    As a result of Biomedical Conferences, Vivo Metric Systems Co. has produced cardiac electrodes based on NASA technology. Frequently in science, one highly specialized discipline is unaware of relevant advances made in other areas. In an attempt to familiarize researchers in a variety of disciplines with medical problems and needs, NASA has sponsored conferences that bring together university scientists, practicing physicians and manufacturers of medical instruments.

  1. Rolling-circle replication of bacterial plasmids.

    PubMed Central

    Khan, S A

    1997-01-01

    Many bacterial plasmids replicate by a rolling-circle (RC) mechanism. Their replication properties have many similarities to as well as significant differences from those of single-stranded DNA (ssDNA) coliphages, which also replicate by an RC mechanism. Studies on a large number of RC plasmids have revealed that they fall into several families based on homology in their initiator proteins and leading-strand origins. The leading-strand origins contain distinct sequences that are required for binding and nicking by the Rep proteins. Leading-strand origins also contain domains that are required for the initiation and termination of replication. RC plasmids generate ssDNA intermediates during replication, since their lagging-strand synthesis does not usually initiate until the leading strand has been almost fully synthesized. The leading- and lagging-strand origins are distinct, and the displaced leading-strand DNA is converted to the double-stranded form by using solely the host proteins. The Rep proteins encoded by RC plasmids contain specific domains that are involved in their origin binding and nicking activities. The replication and copy number of RC plasmids, in general, are regulated at the level of synthesis of their Rep proteins, which are usually rate limiting for replication. Some RC Rep proteins are known to be inactivated after supporting one round of replication. A number of in vitro replication systems have been developed for RC plasmids and have provided insight into the mechanism of plasmid RC replication. PMID:9409148

  2. The last step of kanamycin biosynthesis: unique deamination reaction catalyzed by the α-ketoglutarate-dependent nonheme iron dioxygenase KanJ and the NADPH-dependent reductase KanK.

    PubMed

    Sucipto, Hilda; Kudo, Fumitaka; Eguchi, Tadashi

    2012-04-02

    Mystery solved: using heterologous expression, the activities of two enzymes exclusively belonging to the kanamycin biosynthetic pathway have been identified in vitro. A distinctive reaction mechanism to produce kanamycin is proposed and the previously unknown catalytic deamination activity of KanJ dioxygenase is uncovered.

  3. Evaluating metabolic stress and plasmid stability in plasmid DNA production by Escherichia coli.

    PubMed

    Silva, Filomena; Queiroz, João A; Domingues, Fernanda C

    2012-01-01

    In the context of recombinant DNA technology, the development of feasible and high-yielding plasmid DNA production processes has regained attention as more evidence for its efficacy as vectors for gene therapy and DNA vaccination arise. When producing plasmid DNA in Escherichia coli, a number of biological restraints, triggered by plasmid maintenance and replication as well as culture conditions are responsible for limiting final biomass and product yields. This termed "metabolic burden" can also cause detrimental effects on plasmid stability and quality, since the cell machinery is no longer capable of maintaining an active metabolism towards plasmid synthesis and the stress responses elicited by plasmid maintenance can also cause increased plasmid instability. The optimization of plasmid DNA production bioprocesses is still hindered by the lack of information on the host metabolic responses as well as information on plasmid instability. Therefore, systematic and on-line approaches are required not only to characterise this "metabolic burden" and plasmid stability but also for the design of appropriate metabolic engineering and culture strategies. The monitoring tools described to date rapidly evolve from laborious, off-line and at-line monitoring to online monitoring, at a time-scale that enables researchers to solve these bioprocessing problems as they occur. This review highlights major E. coli biological alterations caused by plasmid maintenance and replication, possible causes for plasmid instability and discusses the ability of currently employed bioprocess monitoring techniques to provide information in order to circumvent metabolic burden and plasmid instability, pointing out the possible evolution of these methods towards online bioprocess monitoring.

  4. Persistence of Antibiotic Resistance Plasmids in Biofilms

    DTIC Science & Technology

    2013-10-01

    TERMS Antibiotic resistance, plasmid, biofilm, coevolution , bacteria, wound infections. 16. SECURITY CLASSIFICATION OF: 17. LIMITATION OF...suitable  candidate   for  plasmid  persistence  tests  in  biofilms  and  for   coevolution  experiments.   Plasmid   pB10...under   antibiotic  selection.   Coevolution  experiment:  methods   Prior  to  commencing  the  evolution  experiments,  we

  5. Choosing and using Schizosaccharomyces pombe plasmids.

    PubMed

    Siam, Rania; Dolan, William P; Forsburg, Susan L

    2004-07-01

    A wide range of plasmids has been developed for molecular studies in the fission yeast Schizosaccharomyces pombe. This includes general purpose episomes, expression vectors, epitope tagging plasmids, and integration vectors. This review describes the typical features of S. pombe vectors, including replication origins, positive and negative selection markers, and constitutive and inducible promoter systems. We will also discuss vectors with epitope tags and how these can be used to modify episomal or endogenous gene sequences. Considerations for choosing and using a plasmid are presented and specialized methods are described.

  6. A novel suicide shuttle plasmid for Streptococcus suis serotype 2 and Streptococcus equi ssp. zooepidemicus gene mutation

    PubMed Central

    Liu, Rui; Zhang, Ping; Su, Yiqi; Lin, Huixing; Zhang, Hui; Yu, Lei; Ma, Zhe; Fan, Hongjie

    2016-01-01

    The mariner-based Himar1 system has been utilized for creating mutant libraries of many Gram-positive bacteria. Streptococcus suis serotype 2 (SS2) and Streptococcus equi ssp. zooepidemicus (SEZ) are primary pathogens of swine that threaten the swine industry in China. To provide a forward-genetics technology for finding virulent phenotype-related genes in these two pathogens, we constructed a novel temperature-sensitive suicide shuttle plasmid, pMar4s, which contains the Himar1 system transposon, TnYLB-1, and the Himar1 C9 transposase from pMarA and the repTAs temperature-sensitive fragment from pSET4s. The kanamycin (Kan) resistance gene was in the TnYLB-1 transposon. Temperature sensitivity and Kan resistance allowed the selection of mutant strains and construction of the mutant library. The SS2 and SEZ mutant libraries were successfully constructed using the pMar4s plasmid. Inverse-Polymerase Chain Reaction (Inverse-PCR) results revealed large variability in transposon insertion sites and that the library could be used for phenotype alteration screening. The thiamine biosynthesis gene apbE was screened for its influence on SS2 anti-phagocytosis; likewise, the sagF gene was identified to be a hemolytic activity-related gene in SEZ. pMar4s was suitable for mutant library construction, providing more information regarding SS2 and SEZ virulence factors and illustrating the pathogenesis of swine streptococcosis. PMID:27256117

  7. Identification of a thermophilic plasmid origin and its cloning within a new Thermus-E. coli shuttle vector.

    PubMed

    Wayne, J; Xu, S Y

    1997-08-22

    A pUC19-based vector has been generated for selecting functional thermophilic origins (oris) of Thermus ssp. Once combined with thermophilic DNA, the vector can be amplified in ampicillin resistant (Ap(R)) E. coli, prior to transformation and kanamycin (Km) selection in Thermus thermophilus. The Km(R) Thermus transformants replicate any newly-formed shuttle vectors via introduced thermophilic oris. Using this "ori-selecting" vector, three novel thermophilic oris were cloned from randomly digested Thermus cryptic plasmid DNA. These shuttle vectors are useful for genetic analyses, as well as protein engineering within thermophiles. The smallest ori-containing sequence of 4.2 kb has been subcloned, sequenced, and further refined to 2.3 kb. A significant ORF of 341 amino acids (aa), with a Thermus promoter and RBS, is found within the thermophilic ori. Deleting part of this ORF abolishes the shuttle vector's ability to replicate in T. thermophilus. Therefore, we postulate that this ORF encodes a replication protein (Rep) necessary for thermophilic plasmid replication. The thermophilic ori also contains two sequences which resemble DnaA boxes.

  8. Comparative genomics of multidrug resistance-encoding IncA/C plasmids from commensal and pathogenic Escherichia coli from multiple animal sources.

    PubMed

    Fernández-Alarcón, Claudia; Singer, Randall S; Johnson, Timothy J

    2011-01-01

    Incompatibility group A/C (IncA/C) plasmids have received recent attention for their broad host range and ability to confer resistance to multiple antimicrobial agents. Due to the potential spread of multidrug resistance (MDR) phenotypes from foodborne pathogens to human pathogens, the dissemination of these plasmids represents a public health risk. In this study, four animal-source IncA/C plasmids isolated from Escherichia coli were sequenced and analyzed, including isolates from commercial dairy cows, pigs and turkeys in the U.S. and Chile. These plasmids were initially selected because they either contained the floR and tetA genes encoding for florfenicol and tetracycline resistance, respectively, and/or the bla(CMY-2) gene encoding for extended spectrum β-lactamase resistance. Overall, sequence analysis revealed that each of the four plasmids retained a remarkably stable and conserved backbone sequence, with differences observed primarily within their accessory regions, which presumably have evolved via horizontal gene transfer events involving multiple modules. Comparison of these plasmids with other available IncA/C plasmid sequences further defined the core and accessory elements of these plasmids in E. coli and Salmonella. Our results suggest that the bla(CMY-2) plasmid lineage appears to have derived from an ancestral IncA/C plasmid type harboring floR-tetAR-strAB and Tn21-like accessory modules. Evidence is mounting that IncA/C plasmids are widespread among enteric bacteria of production animals and these emergent plasmids have flexibility in their acquisition of MDR-encoding modules, necessitating further study to understand the evolutionary mechanisms involved in their dissemination and stability in bacterial populations.

  9. Processing of Nonconjugative Resistance Plasmids by Conjugation Nicking Enzyme of Staphylococci

    SciTech Connect

    Pollet, Rebecca M.; Ingle, James D.; Hymes, Jeff P.; Eakes, Thomas C.; Eto, Karina Yui; Kwong, Stephen M.; Ramsay, Joshua P.; Firth, Neville; Redinbo, Matthew R.; Christie, P. J.

    2016-01-04

    Antimicrobial resistance inStaphylococcus aureuspresents an increasing threat to human health. This resistance is often encoded on mobile plasmids, such as pSK41; however, the mechanism of transfer of these plasmids is not well understood. In this study, we first examine key protein-DNA interactions formed by the relaxase enzyme, NES, which initiates and terminates the transfer of the multidrug resistance plasmid pSK41. Two loops on the NES protein, hairpin loops 1 and 2, form extensive contacts with the DNA hairpin formed at theoriTregion of pSK41, and here we establish that these contacts are essential for proper DNA cleavage and religation by the full 665-residue NES proteinin vitro. Second, pSK156 and pCA347 are nonconjugativeStaphylococcus aureusplasmids that contain sequences similar to theoriTregion of pSK41 but differ in the sequence predicted to form a DNA hairpin. We show that pSK41-encoded NES is able to bind, cleave, and religate theoriTsequences of these nonconjugative plasmidsin vitro. Although pSK41 could mobilize a coresident plasmid harboring its cognateoriT, it was unable to mobilize plasmids containing the pSK156 and pCA347 variantoriTmimics, suggesting that an accessory protein like that previously shown to confer specificity in the pWBG749 system may also be involved in transmission of plasmids containing a pSK41-likeoriT. These data indicate that the conjugative relaxase intransmechanism recently described for the pWBG749 family of plasmids also applies to the pSK41 family of plasmids, further heightening the potential significance of this mechanism in the horizontal transfer of staphylococcal plasmids.

    IMPORTANCEUnderstanding the mechanism of

  10. Topological Behavior of Plasmid DNA

    PubMed Central

    Higgins, N. Patrick; Vologodskii, Alexander V.

    2015-01-01

    The discovery of the B-form structure of DNA by Watson and Crick led to an explosion of research on nucleic acids in the fields of biochemistry, biophysics, and genetics. Powerful techniques were developed to reveal a myriad of different structural conformations that change B-DNA as it is transcribed, replicated, and recombined and as sister chromosomes are moved into new daughter cell compartments during cell division. This article links the original discoveries of superhelical structure and molecular topology to non-B form DNA structure and contemporary biochemical and biophysical techniques. The emphasis is on the power of plasmids for studying DNA structure and function. The conditions that trigger the formation of alternative DNA structures such as left-handed Z-DNA, inter- and intra-molecular triplexes, triple-stranded DNA, and linked catenanes and hemicatenanes are explained. The DNA dynamics and topological issues are detailed for stalled replication forks and for torsional and structural changes on DNA in front of and behind a transcription complex and a replisome. The complex and interconnected roles of topoisomerases and abundant small nucleoid association proteins are explained. And methods are described for comparing in vivo and in vitro reactions to probe and understand the temporal pathways of DNA and chromosome chemistry that occur inside living cells. PMID:26104708

  11. Topological Behavior of Plasmid DNA.

    PubMed

    Higgins, N Patrick; Vologodskii, Alexander V

    2015-04-01

    The discovery of the B-form structure of DNA by Watson and Crick led to an explosion of research on nucleic acids in the fields of biochemistry, biophysics, and genetics. Powerful techniques were developed to reveal a myriad of different structural conformations that change B-DNA as it is transcribed, replicated, and recombined and as sister chromosomes are moved into new daughter cell compartments during cell division. This article links the original discoveries of superhelical structure and molecular topology to non-B form DNA structure and contemporary biochemical and biophysical techniques. The emphasis is on the power of plasmids for studying DNA structure and function. The conditions that trigger the formation of alternative DNA structures such as left-handed Z-DNA, inter- and intra-molecular triplexes, triple-stranded DNA, and linked catenanes and hemicatenanes are explained. The DNA dynamics and topological issues are detailed for stalled replication forks and for torsional and structural changes on DNA in front of and behind a transcription complex and a replisome. The complex and interconnected roles of topoisomerases and abundant small nucleoid association proteins are explained. And methods are described for comparing in vivo and in vitro reactions to probe and understand the temporal pathways of DNA and chromosome chemistry that occur inside living cells.

  12. Plasmids as Tools for Containment.

    PubMed

    García, José L; Díaz, Eduardo

    2014-10-01

    Active containment systems are a major tool for reducing the uncertainty associated with the introduction of monocultures, genetically engineered or not, into target habitats for a large number of biotechnological applications (e.g., bioremediation, bioleaching, biopesticides, biofuels, biotransformations, live vaccines, etc.). While biological containment reduces the survival of the introduced organism outside the target habitat and/or upon completion of the projected task, gene containment strategies reduce the lateral spread of the key genetic determinants to indigenous microorganisms. In fundamental research, suicide circuits become relevant tools to address the role of gene transfer, mainly plasmid transfer, in evolution and how this transfer contributes to genome plasticity and to the rapid adaptation of microbial communities to environmental changes. Many lethal functions and regulatory circuits have been used and combined to design efficient containment systems. As many new genomes are being sequenced, novel lethal genes and regulatory elements are available, e.g., new toxin-antitoxin modules, and they could be used to increase further the current containment efficiencies and to expand containment to other organisms. Although the current containment systems can increase the predictability of genetically modified organisms in the environment, containment will never be absolute, due to the existence of mutations that lead to the appearance of surviving subpopulations. In this sense, orthogonal systems (xenobiology) appear to be the solution for setting a functional genetic firewall that will allow absolute containment of recombinant organisms.

  13. Characterization of a transferable bcrABC and cadAC genes-harboring plasmid in Listeria monocytogenes strain isolated from food products of animal origin.

    PubMed

    Xu, Dongyang; Nie, Qing; Wang, Wenyan; Shi, Lei; Yan, He

    2016-01-18

    In this study, we characterized a bcrABC cassette and its genetic environment harbored by a plasmid in Listeria monocytogenes (L. monocytogenes) 11GZL18, a strain isolated from raw meat in 2011. The bcrABC cassette and its genetic environment were characterized, with a total of 33,727 nt nucleotide sequence obtained. The nucleotide sequences of the bcrABC cassette in strain 11GZL18 exhibited 100% identity to that on plasmid pLM80, which is harbored by L. monocytogenes strain H7550 and H7858, and the neighboring 21,678 nt nucleotide sequence of bcrABC cassette showed 99% identity with plasmid pLM80. The plasmid curing experiment demonstrated the role of the plasmid in conferring benzalkonium chloride (BC) and cadmium (Cd) tolerance in this strain. The bcrABC cassette and cadAC genes from the L. monocytogenes 11GZL18 were harbored by plasmid, functional and transmissible, and led to the acquired tolerance in Gram-negative Escherichia coli (E. coli) DH5α by chemical and natural transformation. Besides, the efflux pump activity that is conferring tolerance to BC and Cd was observed in strain 11GZL18, while not in a plasmid-cured strain 11GZL18-C, confirming that efflux pumps play a role in plasmid-mediated tolerance to BC and Cd in L. monocytogenes 11GZL18. In this study we characterized the genetic organization of a novel BC and Cd tolerance determinants-harboring plasmid in a L. monocytogenes strain isolated from raw meat of animal origin, and demonstrated the potential horizontal transferability of this bcrABC cassette-harboring plasmid to E. coli. The findings will further improve our understanding of the adaptations of this organism to disinfectants such as BC and may contribute to elucidating possible dissemination of BC tolerance in foodborne L. monocytogenes.

  14. Mechanisms Involved in Acquisition of blaNDM Genes by IncA/C2 and IncFIIY Plasmids.

    PubMed

    Wailan, Alexander M; Sidjabat, Hanna E; Yam, Wan Keat; Alikhan, Nabil-Fareed; Petty, Nicola K; Sartor, Anna L; Williamson, Deborah A; Forde, Brian M; Schembri, Mark A; Beatson, Scott A; Paterson, David L; Walsh, Timothy R; Partridge, Sally R

    2016-07-01

    blaNDM genes confer carbapenem resistance and have been identified on transferable plasmids belonging to different incompatibility (Inc) groups. Here we present the complete sequences of four plasmids carrying a blaNDM gene, pKP1-NDM-1, pEC2-NDM-3, pECL3-NDM-1, and pEC4-NDM-6, from four clinical samples originating from four different patients. Different plasmids carry segments that align to different parts of the blaNDM region found on Acinetobacter plasmids. pKP1-NDM-1 and pEC2-NDM-3, from Klebsiella pneumoniae and Escherichia coli, respectively, were identified as type 1 IncA/C2 plasmids with almost identical backbones. Different regions carrying blaNDM are inserted in different locations in the antibiotic resistance island known as ARI-A, and ISCR1 may have been involved in the acquisition of blaNDM-3 by pEC2-NDM-3. pECL3-NDM-1 and pEC4-NDM-6, from Enterobacter cloacae and E. coli, respectively, have similar IncFIIY backbones, but different regions carrying blaNDM are found in different locations. Tn3-derived inverted-repeat transposable elements (TIME) appear to have been involved in the acquisition of blaNDM-6 by pEC4-NDM-6 and the rmtC 16S rRNA methylase gene by IncFIIY plasmids. Characterization of these plasmids further demonstrates that even very closely related plasmids may have acquired blaNDM genes by different mechanisms. These findings also illustrate the complex relationships between antimicrobial resistance genes, transposable elements, and plasmids and provide insights into the possible routes for transmission of blaNDM genes among species of the Enterobacteriaceae family.

  15. pRMH760, a precursor of A/C₂ plasmids carrying blaCMY and blaNDM genes.

    PubMed

    Harmer, Christopher J; Hall, Ruth M

    2014-10-01

    To investigate the evolution of plasmids in the repA/C2 group carrying genes conferring resistance to cephalosporins (bla(CMY)) or to carbapenems (bla(NDM)) and cephalosporins (bla(CMY)), the sequence of plasmid pRMH760 that lacks the β-lactamase genes was determined and compared to all available A/C2 plasmid sequences. pRMH760 is 170.6 kb and carries several antibiotic resistance genes in a 45.1 kb complex transposon structure located upstream of the rhs gene. In plasmid pR148, the closest relative of pRMH760, the antibiotic resistance island is in the same position but the resistance genes differ. pRMH760 also contains a deletion in the rhs gene. Sequenced A/C2 plasmids containing bla(CMY) or bla(CMY) and bla(NDM) have backbones closely related to the pRMH760/pR148 backbone, and they include resistance islands in the same location, indicating that they arose from a plasmid related to pRMH760/pR148. However, the gene content of this resistance island differs in each case, and the island family was designated ARI-A. The bla(NDM) gene is within ARI-A. The ISEcp1-bla(CMY) fragment is located elsewhere and is always in the same location, consistent with a single acquisition event. Plasmids containing only bla(CMY) carry a second resistance island, designated ARI-B, which includes the sul2 gene and a variable set of further resistance genes. Nine A/C2 plasmids that were not of this type (type 1) were found to have a similar backbone that can be simply distinguished by the presence of two exchanged regions and two insertions. Antibiotic resistance islands in type 2 plasmids are in different locations and have different structures.

  16. Mechanisms Involved in Acquisition of blaNDM Genes by IncA/C2 and IncFIIY Plasmids

    PubMed Central

    Sidjabat, Hanna E.; Yam, Wan Keat; Alikhan, Nabil-Fareed; Petty, Nicola K.; Sartor, Anna L.; Williamson, Deborah A.; Forde, Brian M.; Beatson, Scott A.; Paterson, David L.; Walsh, Timothy R.

    2016-01-01

    blaNDM genes confer carbapenem resistance and have been identified on transferable plasmids belonging to different incompatibility (Inc) groups. Here we present the complete sequences of four plasmids carrying a blaNDM gene, pKP1-NDM-1, pEC2-NDM-3, pECL3-NDM-1, and pEC4-NDM-6, from four clinical samples originating from four different patients. Different plasmids carry segments that align to different parts of the blaNDM region found on Acinetobacter plasmids. pKP1-NDM-1 and pEC2-NDM-3, from Klebsiella pneumoniae and Escherichia coli, respectively, were identified as type 1 IncA/C2 plasmids with almost identical backbones. Different regions carrying blaNDM are inserted in different locations in the antibiotic resistance island known as ARI-A, and ISCR1 may have been involved in the acquisition of blaNDM-3 by pEC2-NDM-3. pECL3-NDM-1 and pEC4-NDM-6, from Enterobacter cloacae and E. coli, respectively, have similar IncFIIY backbones, but different regions carrying blaNDM are found in different locations. Tn3-derived inverted-repeat transposable elements (TIME) appear to have been involved in the acquisition of blaNDM-6 by pEC4-NDM-6 and the rmtC 16S rRNA methylase gene by IncFIIY plasmids. Characterization of these plasmids further demonstrates that even very closely related plasmids may have acquired blaNDM genes by different mechanisms. These findings also illustrate the complex relationships between antimicrobial resistance genes, transposable elements, and plasmids and provide insights into the possible routes for transmission of blaNDM genes among species of the Enterobacteriaceae family. PMID:27114281

  17. Conjugative transfer of an IncA/C plasmid-borne blaCMY-2 gene through genetic re-arrangements with an IncX1 plasmid.

    PubMed

    Wiesner, Magdalena; Fernández-Mora, Marcos; Cevallos, Miguel A; Zavala-Alvarado, Crispín; Zaidi, Mussaret B; Calva, Edmundo; Silva, Claudia

    2013-11-21

    Our observation that in the Mexican Salmonella Typhimurium population none of the ST19 and ST213 strains harbored both the Salmonella virulence plasmid (pSTV) and the prevalent IncA/C plasmid (pA/C) led us to hypothesize that restriction to horizontal transfer of these plasmids existed. We designed a conjugation scheme using ST213 strain YU39 as donor of the blaCMY-2 gene (conferring resistance to ceftriaxone; CRO) carried by pA/C, and two E. coli lab strains (DH5α and HB101) and two Typhimurium ST19 strains (SO1 and LT2) carrying pSTV as recipients. The aim of this study was to determine if the genetic background of the different recipient strains affected the transfer frequencies of pA/C. YU39 was able to transfer CRO resistance, via a novel conjugative mechanism, to all the recipient strains although at low frequencies (10-7 to 10-10). The presence of pSTV in the recipients had little effect on the conjugation frequency. The analysis of the transconjugants showed that three different phenomena were occurring associated to the transfer of blaCMY-2: 1) the co-integration of pA/C and pX1; 2) the transposition of the CMY region from pA/C to pX1; or 3) the rearrangement of pA/C. In addition, the co-lateral mobilization of a small (5 kb) ColE1-like plasmid was observed. The transconjugant plasmids involving pX1 re-arrangements (either via co-integration or ISEcp1-mediated transposition) obtained the capacity to conjugate at very high levels, similar to those found for pX1 (10-1). Two versions of the region containing blaCMY-2 were found to transpose to pX1: the large version was inserted into an intergenic region located where the "genetic load" operons are frequently inserted into pX1, while the short version was inserted into the stbDE operon involved in plasmid addiction system. This is the first study to report the acquisition of an extended spectrum cephalosporin (ESC)-resistance gene by an IncX1 plasmid. We showed that the transfer of the YU39 blaCMY-2 gene

  18. Isolation and physical characterization of streptomycete plasmids.

    PubMed

    Pernodet, J L; Guerineau, M

    1981-01-01

    Covalently closed circular DNA was isolated from a strain of Streptomyces coelicolor ATCC 10147 and from a strain of Streptomyces coelicolor subspecies flavus ATCC 19894, using two different methods. The two plasmids were of uniform monomer size: 8.9 kb for pS 10147, the plasmid from S. coelicolor ATCC 10147, and around 125 kb for the plasmid from S. coelicolor ATCC 19894. A restriction enzyme map was constructed for pS 10147, using seven enzymes. Four of the enzymes, (BamHI, Bgl,II, PvuII, and XhoI) cut pS 10147 once while PstI made two cuts. The GC content of this plasmid was calculated to be 72%. The possible utilisation of pS 10147 as a cloning vector in Streptomyces is discussed.

  19. Capacitively coupled contactless conductivity detection as an alternative detection mode in CE for the analysis of kanamycin sulphate and its related substances.

    PubMed

    El-Attug, Mohamed N; Adams, Erwin; Hoogmartens, Jos; Van Schepdael, Ann

    2011-09-01

    A method was developed to determine simultaneously kanamycin, its related substances and sulphate in kanamycin sulphate using capacitively coupled contactless conductivity detection. Kanamycin is an aminoglycoside antibiotic that lacks a strong UV-absorbing chromophore. Due to its physicochemical properties, CE in combination with capacitively coupled contactless conductivity detection was chosen. The separation method uses a BGE composed of 40 mM 2-(N-morpholino)ethanesulphonic acid monohydrate and 40 mM L-histidine, pH 6.35. A 0.6 mM N-cetyltrimethyl ammonium bromide (CTAB) solution was added as electroosmotic flow modifier in a concentration below the critical micellar concentration (CMC). Ammonium acetate 50 mg/L was used as internal standard. In total, 30 kV was applied in reverse polarity on a fused-silica capillary (65/41 cm; 75 μm id). The optimized separation was obtained in less than 6 min with good linearity (R(2)=0.9999) for kanamycin. It shows a good precision expressed as RSD on the relative peak areas equal to 0.3 and 1.1% for intra-day and inter-day precision, respectively. The LOD and LOQ are 0.7 and 2.3 mg/L, respectively. Similarly, for sulphate, a good linearity (R(2)=0.9996) and precision (RSD 0.4 and 0.6% for intra-day and inter-day, respectively) were obtained.

  20. Photoelectrochemical aptasensor for the sensitive and selective detection of kanamycin based on Au nanoparticle functionalized self-doped TiO2 nanotube arrays.

    PubMed

    Xin, Yanmei; Li, Zhenzhen; Zhang, Zhonghai

    2015-11-04

    In this communication, a new photoelectrochemical aptasensor with Au nanoparticle functionalized self-doped TiO2 nanotube arrays (Au/SD-TiO2 NTs) as the core sensing unit and aptamers as the recognition unit was set up to accomplish the sensitive and selective detection of kanamycin with the lowest detection limit of 0.1 nM.

  1. Outer membrane proteomics of kanamycin-resistant Escherichia coli identified MipA as a novel antibiotic resistance-related protein.

    PubMed

    Li, Hui; Zhang, Dan-feng; Lin, Xiang-min; Peng, Xuan-xian

    2015-06-01

    Antibiotic-resistant bacteria are a great threat to human health and food safety and there is an urgent need to understand the mechanisms of resistance for combating these bacteria. In the current study, comparative proteomic methodologies were applied to identify Escherichia coli K-12 outer membrane (OM) proteins related to kanamycin resistance. Mass spectrometry and western blotting results revealed that OM proteins TolC, Tsx and OstA were up-regulated, whereas MipA, OmpA, FadL and OmpW were down-regulated in kanamycin-resistant E. coli K-12 strain. Genetic deletion of tolC (ΔtolC-Km) led to a 2-fold decrease in the minimum inhibitory concentration (MIC) of kanamycin and deletion of mipA (ΔmipA-Km) resulted in a 4-fold increase in the MIC of kanamycin. Changes in the MICs for genetically modified strains could be completely recovered by gene complementation. Compared with the wild-type strain, the survival capability of ΔompA-Km was significantly increased and that of Δtsx-Km was significantly decreased. We further evaluated the role and expression of MipA in response to four other antibiotics including nalidixic acid, streptomycin, chloramphenicol and aureomycin, which suggested that MipA was a novel OM protein related to antibiotic resistance.

  2. An aptamer-based signal-on bio-assay for sensitive and selective detection of Kanamycin A by using gold nanoparticles.

    PubMed

    Chen, Jing; Li, Zhaohui; Ge, Jia; Yang, Ran; Zhang, Lin; Qu, Ling-Bo; Wang, Hong-Qi; Zhang, Ling

    2015-07-01

    In this study, a simple and sensitive aptamer-based fluorescence method for the detection of Kanamycin A by using gold nanoparticles (AuNPs) has been developed. In this assay, AuNPs were utilized as DNA nanocarrier as well as efficient fluorescence quencher. In the absence of Kanamycin A, dye-labeled aptamer could be adsorbed onto the surface of AuNPs and the fluorescence signal was quenched. In the presence of Kanamycin A, the specific binding between dye-labeled aptamer and its target induced the formation of rigid structure, which led to dye-labeled aptamer releasing from the surface of AuNPs and the fluorescence intensity was recovered consequently. Under optimum conditions, calibration modeling showed that the analytical linear range covered from 0.8nM to 350nM and the detection limit of 0.3nM was realized successfully. This proposed bio-assay also showed high selectivity over other antibiotics. Meanwhile, this strategy was further used to determine the concentrations of Kanamycin A in milk sample with satisfying results.

  3. Tuning the regioselectivity of the Staudinger reaction for the facile synthesis of kanamycin and neomycin class antibiotics with N-1 modification.

    PubMed

    Li, Jie; Chen, Hsiao-Nung; Chang, Huiwen; Wang, Jinhua; Chang, Cheng-Wei Tom

    2005-07-07

    [reaction: see text] A novel method for achieving the desired regioselective reduction of the N-1 azido group on a tetraazidoneamine has been developed that leads to the synthesis of both kanamycin and neomycin class antibiotics bearing N-1 modification. Both classes of aminoglycosides are active against aminoglycoside-resistant bacteria carrying APH(3')-I and AAC(6')/APH(2'').

  4. Pre-XDR & XDR in MDR and Ofloxacin and Kanamycin resistance in non-MDR Mycobacterium tuberculosis isolates.

    PubMed

    Jain, Amita; Dixit, Pratima; Prasad, Rajendra

    2012-09-01

    Resistance to second line anti tubercular drugs is a cause of serious concern. The present study reports the prevalence of Ofloxacin (OFX) and Kanamycin (KM) resistance in Mycobacterium tuberculosis isolates from cases of pulmonary tuberculosis, who received anti tubercular treatment for >4 weeks in past. Of total 438 enrolled patients, 361 were culture positive for M. tuberculosis, of which, 95 (26.3%) were OFX resistant & 49 (13.5%) were KM resistant. Total 130 isolates were Multidrug resistant, of which, 55 (42.3%) were resistant to either OFX or KM (Pre-XDR) & 11 (8.5%) were resistant to both KM & OFX (XDR). Resistance to quinolones & aminoglycosides should be routinely assessed in areas endemic for tuberculosis.

  5. Selective modification of the 3''-amino group of kanamycin prevents significant loss of activity in resistant bacterial strains.

    PubMed

    Santana, Andrés G; Zárate, Sandra G; Asensio, Juan Luis; Revuelta, Julia; Bastida, Agatha

    2016-01-14

    Aminoglycosides are highly potent, wide-spectrum bactericidals. N-1 modification of aminoglycosides has thus far been the best approach to regain bactericidal efficiency of this class of antibiotics against resistant bacterial strains. In the present study we have evaluated the effect that both, the number of modifications and their distribution on the aminoglycoside amino groups (N-1, N-3, N-6' and N-3''), have on the antibiotic activity. The modification of N-3'' in the antibiotic kanamycin A is the key towards the design of new aminoglycoside antibiotics. This derivative maintains the antibiotic activity against aminoglycoside acetyl-transferase- and nucleotidyl-transferase-expressing strains, which are two of the most prevalent modifying enzymes found in aminoglycoside resistant bacteria.

  6. Colorimetric detection of kanamycin based on analyte-protected silver nanoparticles and aptamer-selective sensing mechanism.

    PubMed

    Xu, Yuanyuan; Han, Tian; Li, Xiaqing; Sun, Linghao; Zhang, Yujuan; Zhang, Yuanshu

    2015-09-03

    In this work, a novel colorimetric detection method for kanamycin (Kana), a widely used aminoglycoside antibiotic, has been developed using unmodified silver nanoparticles (AgNPs) as sensing probe. The method is designed based on the finding that the analyte (Kana) can protect AgNPs against salt-induced aggregation, and nucleic acid aptamers can decrease the risk of false positives through an aptamer-selective sensing mechanism. By use of the proposed method, selective quantification of Kana can be achieved over the concentration range from 0.05 to 0.6 μg mL(-1) within 20 min. The detection limit is estimated to be 2.6 ng mL(-1), which is much lower than the allowed maximum residue limit. Further studies also demonstrate the applicability of the proposed method in milk samples, revealing that the method may possess enormous potential for practical detection of Kana in the future.

  7. Sulfonamide-Based Inhibitors of Aminoglycoside Acetyltransferase Eis Abolish Resistance to Kanamycin in Mycobacterium tuberculosis

    SciTech Connect

    Garzan, Atefeh; Willby, Melisa J.; Green, Keith D.; Gajadeera, Chathurada S.; Hou, Caixia; Tsodikov, Oleg V.; Posey, James E.; Garneau-Tsodikova, Sylvie

    2016-12-08

    A two-drug combination therapy where one drug targets an offending cell and the other targets a resistance mechanism to the first drug is a time-tested, yet underexploited approach to combat or prevent drug resistance. By high-throughput screening, we identified a sulfonamide scaffold that served as a pharmacophore to generate inhibitors of Mycobacterium tuberculosis acetyltransferase Eis, whose upregulation causes resistance to the aminoglycoside (AG) antibiotic kanamycin A (KAN) in Mycobacterium tuberculosis. Rational systematic derivatization of this scaffold to maximize Eis inhibition and abolish the Eis-mediated KAN resistance of M. tuberculosis yielded several highly potent agents. A crystal structure of Eis in complex with one of the most potent inhibitors revealed that the inhibitor bound Eis in the AG-binding pocket held by a conformationally malleable region of Eis (residues 28–37) bearing key hydrophobic residues. These Eis inhibitors are promising leads for preclinical development of innovative AG combination therapies against resistant TB.

  8. Plasmid Replication Control by Antisense RNAs.

    PubMed

    Brantl, Sabine

    2014-08-01

    Plasmids are selfish genetic elements that normally constitute a burden for the bacterial host cell. This burden is expected to favor plasmid loss. Therefore, plasmids have evolved mechanisms to control their replication and ensure their stable maintenance. Replication control can be either mediated by iterons or by antisense RNAs. Antisense RNAs work through a negative control circuit. They are constitutively synthesized and metabolically unstable. They act both as a measuring device and a regulator, and regulation occurs by inhibition. Increased plasmid copy numbers lead to increasing antisense-RNA concentrations, which, in turn, result in the inhibition of a function essential for replication. On the other hand, decreased plasmid copy numbers entail decreasing concentrations of the inhibiting antisense RNA, thereby increasing the replication frequency. Inhibition is achieved by a variety of mechanisms, which are discussed in detail. The most trivial case is the inhibition of translation of an essential replication initiator protein (Rep) by blockage of the rep-ribosome binding site. Alternatively, ribosome binding to a leader peptide mRNA whose translation is required for efficient Rep translation can be prevented by antisense-RNA binding. In 2004, translational attenuation was discovered. Antisense-RNA-mediated transcriptional attenuation is another mechanism that has, so far, only been detected in plasmids of Gram-positive bacteria. ColE1, a plasmid that does not need a plasmid-encoded replication initiator protein, uses the inhibition of primer formation. In other cases, antisense RNAs inhibit the formation of an activator pseudoknot that is required for efficient Rep translation.

  9. Marine Diatom Plasmids and their Biotechnological Applications

    DTIC Science & Technology

    1992-02-27

    plasmid is homologous to the Tn21-type transposable elements. The element carries an open reading frame encoding a DNA invertase gene. Sequence comparisons...of regions upstream and downstream of the invertase gene indicate that the diatom plasmid is most similar to the Staphylococcus aureus transposon...the highly prokaryotic nature (i.e., codon usage bias, promoter sequences, etc.) of the invertase gene we have sequenced, we have tentatively

  10. Polynucleotide sequence relationships among Ent plasmids and the relationship between Ent and other plasmids.

    PubMed Central

    So, M; Crosa, J H; Falkow, S

    1975-01-01

    Deoxyribonucleic acid-deoxyribonucleic acid hybridization studies reveal that the plasmids coding for the production of heat stable and heat labile enteroxtoxins of Escherichia coli, regardless of their origin, have a majority of their polynucleotide sequences in common, but are not related in any significant way to those plasmids coding for the synthesis of only ST toxin. The heat stable and heat labile plasmids also share a significant degree of their polynucleotide sequences with plasmids of the FI and FII incompatibility groups, but not with R factors belonging to the I, N, W, P, or X incompatibility groups. PMID:1090570

  11. Proteomic analysis of the sarcosine-insoluble outer membrane fraction of Pseudomonas aeruginosa responding to ampicilin, kanamycin, and tetracycline resistance.

    PubMed

    Peng, Xuanxian; Xu, Changxin; Ren, Haixia; Lin, Xiangmin; Wu, Lina; Wang, Sanying

    2005-01-01

    Nosocomial wound infections by antibiotic-resistant Pseudomonas aeruginosa strains have increasing importance in hospitals. Outer membrane proteins of the bacterium have strong influence on its resistance to antibiotics. In the current study, a parallel proteomic approach was applied to analysis of sarcosine-insoluble outer membrane fraction of P. aeruginosa responding to ampicilin, kanamycin and tetracycline resistances. Eleven differential proteins with 15 spots were determined and then identified by MALDI-TOF/MS, in which four with increased OprF, MexA, OmpH, and decreased hypothetical protein (NCBI No. 15599856), six with increased OprF, OmpH, hypothetical protein (NCBI No. 15599183) and decreased OprG, MexA, conserved hypothetical protein (NCBI No. 15600371), and eight with increased OprF, MexA, OprL, probable Omp (NCBI No. 15599856), probable secretion protein (NCBI No. 15600167), OprD and decreased OprG, conserved hypothetical protein (NCBI No. 15600371) responded to ampicilin, kanamycin, and tetracycline resistances, respectively. With the exception of OprF, the other differential proteins did not show the same behaviors against the three antibiotic resistances. Compared with our previous report on E. coli Omps responding to ampicilin and tetracycline resistances, which was only a protein difference in quality between the two antibiotics, P. aeruginosa showed significant diversity against the three antibiotics. Our findings might provide valuable data for an understanding of antibiotic-resistant difference between different species of bacteria. Meanwhile, these proteins shared by different bacteria or a bacterium against different antibiotics may provide universal targets for the development of new drugs that control antibiotic-resistant bacteria.

  12. Recombination-dependent concatemeric plasmid replication.

    PubMed Central

    Viret, J F; Bravo, A; Alonso, J C

    1991-01-01

    The replication of covalently closed circular supercoiled (form I) DNA in prokaryotes is generally controlled at the initiation level by a rate-limiting effector. Once initiated, replication proceeds via one of two possible modes (theta or sigma replication) which do not rely on functions involved in DNA repair and general recombination. Recently, a novel plasmid replication mode, leading to the accumulation of linear multigenome-length plasmid concatemers in both gram-positive and gram-negative bacteria, has been described. Unlike form I DNA replication, an intermediate recombination step is most probably involved in the initiation of concatemeric plasmid DNA replication. On the basis of structural and functional studies, we infer that recombination-dependent plasmid replication shares important features with phage late replication modes and, in several aspects, parallels the synthesis of plasmid concatemers in phage-infected cells. The characterization of the concatemeric plasmid replication mode has allowed new insights into the mechanisms of DNA replication and recombination in prokaryotes. PMID:1779931

  13. Plasmid fermentation process for DNA immunization applications.

    PubMed

    Carnes, Aaron E; Williams, James A

    2014-01-01

    Plasmid DNA for immunization applications must be of the highest purity and quality. The ability of downstream purification to efficiently produce a pure final product is directly influenced by the performance of the upstream fermentation process. While several clinical manufacturing facilities already have validated fermentation processes in place to manufacture plasmid DNA for use in humans, a simple and inexpensive laboratory-scale fermentation process can be valuable for in-house production of plasmid DNA for use in animal efficacy studies. This chapter describes a simple fed-batch fermentation process for producing bacterial cell paste enriched with high-quality plasmid DNA. A constant feeding strategy results in a medium cell density culture with continuously increasing plasmid amplification towards the end of the process. Cell banking and seed culture preparation protocols, which can dramatically influence final product yield and quality, are also described. These protocols are suitable for production of research-grade plasmid DNA at the 100 mg-to-1.5 g scale from a typical 10 L laboratory benchtop fermentor.

  14. Plasmid-mediated mineralization of 4-chlorobiphenyl.

    PubMed Central

    Shields, M S; Hooper, S W; Sayler, G S

    1985-01-01

    Strains of Alcaligenes and Acinetobacter spp. were isolated from a mixed culture already proven to be proficient at complete mineralization of monohalogenated biphenyls. These strains were shown to harbor a 35 X 10(6)-dalton plasmid mediating a complete pathway for 4-chlorobiphenyl (4CB) oxidation. Subsequent plasmid curing of these bacteria resulted in the abolishment of the 4CB mineralization phenotype and loss of even early 4CB metabolism by Acinetobacter spp. Reestablishment of the Alcaligenes plasmid, denoted pSS50, in the cured Acinetobacter spp. via filter surface mating resulted in the restoration of 4CB mineralization abilities. 4CB mineralization, however, proved to be an unstable characteristic in some subcultured strains. Such loss was not found to coincide with any detectable alteration in plasmid size. Cultures capable of complete mineralization, as well as those limited to partial metabolism of 4CB, produced 4-chlorobenzoate as a metabolite. Demonstration of mineralization of a purified 14C-labeled chlorobenzoate showed it to be a true intermediate in 4CB mineralization. Unlike the mineralization capability, the ability to produce a metabolite has proven to be stable on subculture. These results indicate the occurrence of a novel plasmid, or evolved catabolic plasmid, that mediates the complete mineralization of 4CB. Images PMID:2993249

  15. Multiple plasmid interference - Pledging allegiance to my enemy's enemy.

    PubMed

    Gama, João Alves; Zilhão, Rita; Dionisio, Francisco

    2017-08-24

    As shown in the previous article, two distinct conjugative plasmids sometimes interact within bacterial cells, implicating changes of transfer rates. In most cases of interactions within bacteria, the transfer of one of the plasmids decreases. Less frequently, the transfer rate of one of the plasmids increases. Here we analyse what happens if three distinct conjugative plasmids colonize the same bacterial cell. Our aim is to understand how interactions between two plasmids affect the transfer rate of the third plasmid. After showing that plasmids interact in 59 out of 84 possible interactions we show that, with some exceptions, if the transfer rate of a plasmid decreases in the presence of a second plasmid, a decrease is also observed in the presence of a third plasmid. Moreover, if the conjugation rate of a plasmid increases in the presence of another, an increase is also observed if there is a third plasmid in the cell. Both types of interactions are mostly independent of the third plasmid's identity, even if sometimes the third plasmid quantitatively distorts the interaction of the other two plasmids. There is a bias towards negative intensifying interactions, which provide good news concerning the spread conjugative plasmids encoding antibiotic-resistance genes and virulence factors. Copyright © 2017 Elsevier Inc. All rights reserved.

  16. [Progress in endogenous plasmid curing of bacteria--a review].

    PubMed

    Feng, Jun; Zhang, Wei; Song, Cunjiang

    2013-11-04

    To investigate the functions of the bacteria endogenous plasmid, which include bacterial drug resistance, symbiosis, capsular formation and heavy metal resistance, the endogenous plasmid needs to be cured first. We reviewed physical, chemical and molecular biological methods of endogenous plasmid curing, clarified the curing principles. The prospective of research on plasmid curing was also discussed, based on our own studies.

  17. Auxotrophic markers pyrF and proC can replace antibiotic markers on protein production plasmids in high-cell-density Pseudomonas fluorescens fermentation.

    PubMed

    Schneider, Jane C; Jenings, Annika F; Mun, Deborah M; McGovern, Patricia M; Chew, Lawrence C

    2005-01-01

    The use of antibiotic-resistance genes as selectable markers in transgenic organisms is coming under increased scrutiny, for fear that they may spread to human pathogens, thereby reducing the effectiveness of antibiotic therapy. A current Pseudomonas fluorescens protein expression system uses a tetracycline resistance gene (tetR/tetA) to maintain an expression plasmid under control of a repressible promoter and a kanamycin resistance gene (kanR) to maintain a plasmid carrying a repressor gene. We investigated using auxotrophic markers to replace these two antibiotic resistance genes: pyrF (encoding orotidine-5'-phosphate decarboxylase) in place of tetR/tetA and proC (encoding pyrroline-5-carboxylate reductase) in place of kanR, complementing their respective precise chromosomal deletions created by allele exchange using a suicide vector carrying pyrF as a counterselectable marker. The resulting strains, devoid of antibiotic-resistance genes, were shown to achieve high productivity of nitrilase and thermostable alpha-amylase equal to that of the former antibiotic-resistant production host. The production plasmids were stable. The pyrF (uracil-dependent) background of the production host strain also allows us to sequentially alter the genome to incorporate other desired genomic changes, deletions, or insertions using 5'-fluoroorotic acid counterselection, restoring the selectable marker after each step.

  18. An Invertron-Like Linear Plasmid Mediates Intracellular Survival and Virulence in Bovine Isolates of Rhodococcus equi

    PubMed Central

    Valero-Rello, Ana; Hapeshi, Alexia; Anastasi, Elisa; Alvarez, Sonsiray; Scortti, Mariela; Meijer, Wim G.; MacArthur, Iain

    2015-01-01

    We report a novel host-associated virulence plasmid in Rhodococcus equi, pVAPN, carried by bovine isolates of this facultative intracellular pathogenic actinomycete. Surprisingly, pVAPN is a 120-kb invertron-like linear replicon unrelated to the circular virulence plasmids associated with equine (pVAPA) and porcine (pVAPB variant) R. equi isolates. pVAPN is similar to the linear plasmid pNSL1 from Rhodococcus sp. NS1 and harbors six new vap multigene family members (vapN to vapS) in a vap pathogenicity locus presumably acquired via en bloc mobilization from a direct predecessor of equine pVAPA. Loss of pVAPN rendered R. equi avirulent in macrophages and mice. Mating experiments using an in vivo transconjugant selection strategy demonstrated that pVAPN transfer is sufficient to confer virulence to a plasmid-cured R. equi recipient. Phylogenetic analyses assigned the vap multigene family complement from pVAPN, pVAPA, and pVAPB to seven monophyletic clades, each containing plasmid type-specific allelic variants of a precursor vap gene carried by the nearest vap island ancestor. Deletion of vapN, the predicted “bovine-type” allelic counterpart of vapA, essential for virulence in pVAPA, abrogated pVAPN-mediated intramacrophage proliferation and virulence in mice. Our findings support a model in which R. equi virulence is conferred by host-adapted plasmids. Their central role is mediating intracellular proliferation in macrophages, promoted by a key vap determinant present in the common ancestor of the plasmid-specific vap islands, with host tropism as a secondary trait selected during coevolution with specific animal species. PMID:25895973

  19. An Invertron-Like Linear Plasmid Mediates Intracellular Survival and Virulence in Bovine Isolates of Rhodococcus equi.

    PubMed

    Valero-Rello, Ana; Hapeshi, Alexia; Anastasi, Elisa; Alvarez, Sonsiray; Scortti, Mariela; Meijer, Wim G; MacArthur, Iain; Vázquez-Boland, José A

    2015-07-01

    We report a novel host-associated virulence plasmid in Rhodococcus equi, pVAPN, carried by bovine isolates of this facultative intracellular pathogenic actinomycete. Surprisingly, pVAPN is a 120-kb invertron-like linear replicon unrelated to the circular virulence plasmids associated with equine (pVAPA) and porcine (pVAPB variant) R. equi isolates. pVAPN is similar to the linear plasmid pNSL1 from Rhodococcus sp. NS1 and harbors six new vap multigene family members (vapN to vapS) in a vap pathogenicity locus presumably acquired via en bloc mobilization from a direct predecessor of equine pVAPA. Loss of pVAPN rendered R. equi avirulent in macrophages and mice. Mating experiments using an in vivo transconjugant selection strategy demonstrated that pVAPN transfer is sufficient to confer virulence to a plasmid-cured R. equi recipient. Phylogenetic analyses assigned the vap multigene family complement from pVAPN, pVAPA, and pVAPB to seven monophyletic clades, each containing plasmid type-specific allelic variants of a precursor vap gene carried by the nearest vap island ancestor. Deletion of vapN, the predicted "bovine-type" allelic counterpart of vapA, essential for virulence in pVAPA, abrogated pVAPN-mediated intramacrophage proliferation and virulence in mice. Our findings support a model in which R. equi virulence is conferred by host-adapted plasmids. Their central role is mediating intracellular proliferation in macrophages, promoted by a key vap determinant present in the common ancestor of the plasmid-specific vap islands, with host tropism as a secondary trait selected during coevolution with specific animal species. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

  20. The master activator of IncA/C conjugative plasmids stimulates genomic islands and multidrug resistance dissemination.

    PubMed

    Carraro, Nicolas; Matteau, Dominick; Luo, Peng; Rodrigue, Sébastien; Burrus, Vincent

    2014-10-01

    Dissemination of antibiotic resistance genes occurs mostly by conjugation, which mediates DNA transfer between cells in direct contact. Conjugative plasmids of the IncA/C incompatibility group have become a substantial threat due to their broad host-range, the extended spectrum of antimicrobial resistance they confer, their prevalence in enteric bacteria and their very efficient spread by conjugation. However, their biology remains largely unexplored. Using the IncA/C conjugative plasmid pVCR94ΔX as a prototype, we have investigated the regulatory circuitry that governs IncA/C plasmids dissemination and found that the transcriptional activator complex AcaCD is essential for the expression of plasmid transfer genes. Using chromatin immunoprecipitation coupled with exonuclease digestion (ChIP-exo) and RNA sequencing (RNA-seq) approaches, we have identified the sequences recognized by AcaCD and characterized the AcaCD regulon. Data mining using the DNA motif recognized by AcaCD revealed potential AcaCD-binding sites upstream of genes involved in the intracellular mobility functions (recombination directionality factor and mobilization genes) in two widespread classes of genomic islands (GIs) phylogenetically unrelated to IncA/C plasmids. The first class, SGI1, confers and propagates multidrug resistance in Salmonella enterica and Proteus mirabilis, whereas MGIVmi1 in Vibrio mimicus belongs to a previously uncharacterized class of GIs. We have demonstrated that through expression of AcaCD, IncA/C plasmids specifically trigger the excision and mobilization of the GIs at high frequencies. This study provides new evidence of the considerable impact of IncA/C plasmids on bacterial genome plasticity through their own mobility and the mobilization of genomic islands.

  1. The Master Activator of IncA/C Conjugative Plasmids Stimulates Genomic Islands and Multidrug Resistance Dissemination

    PubMed Central

    Luo, Peng; Rodrigue, Sébastien; Burrus, Vincent

    2014-01-01

    Dissemination of antibiotic resistance genes occurs mostly by conjugation, which mediates DNA transfer between cells in direct contact. Conjugative plasmids of the IncA/C incompatibility group have become a substantial threat due to their broad host-range, the extended spectrum of antimicrobial resistance they confer, their prevalence in enteric bacteria and their very efficient spread by conjugation. However, their biology remains largely unexplored. Using the IncA/C conjugative plasmid pVCR94ΔX as a prototype, we have investigated the regulatory circuitry that governs IncA/C plasmids dissemination and found that the transcriptional activator complex AcaCD is essential for the expression of plasmid transfer genes. Using chromatin immunoprecipitation coupled with exonuclease digestion (ChIP-exo) and RNA sequencing (RNA-seq) approaches, we have identified the sequences recognized by AcaCD and characterized the AcaCD regulon. Data mining using the DNA motif recognized by AcaCD revealed potential AcaCD-binding sites upstream of genes involved in the intracellular mobility functions (recombination directionality factor and mobilization genes) in two widespread classes of genomic islands (GIs) phylogenetically unrelated to IncA/C plasmids. The first class, SGI1, confers and propagates multidrug resistance in Salmonella enterica and Proteus mirabilis, whereas MGIVmi1 in Vibrio mimicus belongs to a previously uncharacterized class of GIs. We have demonstrated that through expression of AcaCD, IncA/C plasmids specifically trigger the excision and mobilization of the GIs at high frequencies. This study provides new evidence of the considerable impact of IncA/C plasmids on bacterial genome plasticity through their own mobility and the mobilization of genomic islands. PMID:25340549

  2. Conference reports

    NASA Astrophysics Data System (ADS)

    Dongpei, Chen; Yulong, Ma

    1994-12-01

    The Ultrasonic Electronics Branch Society of the China Acoustics Society, and the Electronics Countermeasure Branch Society of the China Electronics Society held and All-China Applications Conference of Ultrasonic Electronics Devices in Electronic Countermeasures, Radar and Military Communication Technology. A total of 66 papers was received by the conference with contents relating to surface acoustic wave devices, high-frequency acoustic wave devices, acousto-optical devices, applications of devices in radar, applications of devices in electronic countermeasures, and applications of devices in military communication systems.

  3. Clostridium perfringens type A-E toxin plasmids.

    PubMed

    Freedman, John C; Theoret, James R; Wisniewski, Jessica A; Uzal, Francisco A; Rood, Julian I; McClane, Bruce A

    2015-05-01

    Clostridium perfringens relies upon plasmid-encoded toxin genes to cause intestinal infections. These toxin genes are associated with insertion sequences that may facilitate their mobilization and transfer, giving rise to new toxin plasmids with common backbones. Most toxin plasmids carry a transfer of clostridial plasmids locus mediating conjugation, which likely explains the presence of similar toxin plasmids in otherwise unrelated C. perfringens strains. The association of many toxin genes with insertion sequences and conjugative plasmids provides virulence flexibility when causing intestinal infections. However, incompatibility issues apparently limit the number of toxin plasmids maintained by a single cell.

  4. Clostridium perfringens type A–E toxin plasmids

    PubMed Central

    Freedman, John C.; Theoret, James R.; Wisniewski, Jessica A.; Uzal, Francisco A.; Rood, Julian I.; McClane, Bruce A.

    2014-01-01

    Clostridium perfringens relies upon plasmid-encoded toxin genes to cause intestinal infections. These toxin genes are associated with insertion sequences that may facilitate their mobilization and transfer, giving rise to new toxin plasmids with common backbones. Most toxin plasmids carry a transfer of clostridial plasmids locus mediating conjugation, which likely explains the presence of similar toxin plasmids in otherwise unrelated C. perfringens strains. The association of many toxin genes with insertion sequences and conjugative plasmids provides virulence flexibility when causing intestinal infections. However, incompatibility issues apparently limit the number of toxin plasmids maintained by a single cell. PMID:25283728

  5. Evaluating the in vitro susceptibility of bovine mastitis pathogens to a combination of kanamycin and cefalexin: Recommendations for a disk diffusion test.

    PubMed

    Pillar, C M; Goby, L; Draghi, D; Grover, P; Thornsberry, C

    2009-12-01

    Cows suffering from bovine mastitis have markedly reduced milk production because of inflammation within the udder subsequent to infection and damage from bacterial toxins. Antibiotic treatment is commonly used as a preventative and therapeutic measure for bovine mastitis. The most common pathogens include Staphylococcus aureus, various streptococci (Streptococcus dysgalactiae, Streptococcus uberis), and coliforms (Escherichia coli), which can be contracted from other infected cows or from the environment. A combination of kanamycin and cefalexin (1:1.5 wt/wt) is currently used therapeutically in Europe for the treatment of bovine mastitis, although standardized methods for the in vitro determination of the susceptibility of target pathogens have not been developed. This study evaluates the appropriate broth microdilution testing criteria for kanamycin and cefalexin administered in combination and reports the development of a disk diffusion test. At a ratio of kanamycin:cefalexin relevant to that observed in milk postadministration (10:1 wt/wt), the minimum inhibitory concentrations were determined against 307 isolates of target mastitis pathogens (staphylococci, streptococci, and E. coli). Based on achievable concentrations in milk and the resulting distribution of minimum inhibitory concentrations, preliminary broth breakpoints for kanamycin/cefalexin (10:1 fixed ratio) of or=32/3.2 microg/mL resistant were applied to evaluated staphylococci, streptococci, and E. coli. Parallel testing by disk diffusion and resulting error-rate bounded analysis using a combined disk concentration of 30 microg of kanamycin and 15 microg of cefalexin resulted in the establishment of preliminary disk interpretive breakpoints of >or=20 mm susceptible, 18 to 19 mm intermediate, and

  6. Properties of the arsenate reductase of plasmid R773.

    PubMed

    Gladysheva, T B; Oden, K L; Rosen, B P

    1994-06-14

    Resistance to toxic oxyanions in Escherichia coli is conferred by the ars operon carried on plasmid R773. The gene products of this operon catalyze extrusion of antimonials and arsenicals from cells of E. coli, thus providing resistance to those toxic oxyanions. In addition, resistance to arsenate is conferred by the product of the arsC gene. In this report, purified ArsC protein was shown to catalyze reduction of arsenate to arsenite. The enzymatic activity of the ArsC protein required glutaredoxin as a source of reducing equivalents. Other reductants, including glutathione and thioredoxin, were not effective electron donors. A spectrophotometric assay was devised in which arsenate reduction was coupled to NADPH oxidation. The results obtained with the coupled assay corresponded to those found by direct reduction of radioactive arsenate to arsenite. The only substrate of the reaction was arsenate (Km = 8 mM); other oxyanions including phosphate, sulfate, and antimonate were not reduced. Phosphate and sulfate were weak inhibitors, while the product, arsenite, was a stronger inhibitor (Ki = 0.1 mM). Arsenate reductase activity exhibited a pH optimum of 6.3-6.8. These results indicate that the ArsC protein is a novel reductase, and elucidation of its enzymatic mechanism should be of interest.

  7. Plasmid-encoding extended-spectrum β-lactamase CTX-M-55 in a clinical Shigella sonnei strain, China.

    PubMed

    Qu, Fen; Ying, Zhe; Zhang, Chuanling; Chen, Zhenhong; Chen, Suming; Cui, Enbo; Bao, Chunmei; Yang, Huiying; Wang, Jie; Liu, Changting; Mao, Yuanli; Zhou, Dongsheng

    2014-01-01

    To characterize a clinical Shigella sonnei strain harboring a conjugatable blaCTX-M-55-borne plasmid. S. sonnei strain #1081 was isolated from a dysentery patient in China. A CTX-M-55-encoding plasmid harbored in this strain was transformed to Escherichia coli, and then its complete nucleotide sequence was determined by next generation sequencing. The MIC values of bacterial strains were tested by using Vitec(®) 2 (Biomerieux, Marcy l'Etoile, France). Strain #1081 conferred the resistance to multiple beta-lactam antibiotics. blaCTX-M-55 was the only known antibiotic resistance gene and located in a 3090-bp ISEcp1-blaCTX-M-55-orf477 transposition unit carried by a conjugatable plasmid p1081-CTXM in #1081. The ISEcp1-mediated transposition provided a sole promoter, which was located adjacently upstream of the inverted repeat right element of ISEcp1, to drive the expression of CTX-M-55. Plasmid p1081-CTXM was a close variant of the IncI2-type plasmid pHN1122-1 that was harbored in a faecal E. coli strain recovered from a dog in China, indicating the potential transfer of CTX-M-55-encoding plasmids from faecal flora E. coli to human pathogen S. sonnei.

  8. Identification of bacterial plasmids based on mobility and plasmid population biology.

    PubMed

    Garcillán-Barcia, Maria Pilar; Alvarado, Andrés; de la Cruz, Fernando

    2011-09-01

    Plasmids contain a backbone of core genes that remains relatively stable for long evolutionary periods, making sense to speak about plasmid species. The identification and characterization of the core genes of a plasmid species has a special relevance in the study of its epidemiology and modes of transmission. Besides, this knowledge will help to unveil the main routes that genes, for example antibiotic resistance (AbR) genes, use to travel from environmental reservoirs to human pathogens. Global dissemination of multiple antibiotic resistances and virulence traits by plasmids is an increasing threat for the treatment of many bacterial infectious diseases. To follow the dissemination of virulence and AbR genes, we need to identify the causative plasmids and follow their path from reservoirs to pathogens. In this review, we discuss how the existing diversity in plasmid genetic structures gives rise to a large diversity in propagation strategies. We would like to propose that, using an identification methodology based on plasmid mobility types, we can follow the propagation routes of most plasmids in Gammaproteobacteria, as well as their cargo genes, in complex ecosystems. Once the dissemination routes are known, designing antidissemination drugs and testing their efficacy will become feasible. We discuss in this review how the existing diversity in plasmid genetic structures gives rise to a large diversity in propagation strategies. We would like to propose that, by using an identification methodology based on plasmid mobility types, we can follow the propagation routes of most plasmids in ?-proteobacteria, as well as their cargo genes, in complex ecosystems.

  9. A novel type 1/2 hybrid IncC plasmid carrying fifteen antimicrobial resistance genes recovered from Proteus mirabilis in China.

    PubMed

    Lei, Chang-Wei; Kong, Ling-Han; Ma, Su-Zhen; Liu, Bi-Hui; Chen, Yan-Peng; Zhang, An-Yun; Wang, Hong-Ning

    2017-07-27

    IncC plasmids are of great concern as vehicles of broad-spectrum cephalosporins and carbapenems resistance genes blaCMY and blaNDM. The aim of this study was to sequence and characterize a multidrug resistance (MDR) IncC plasmid (pPm14C18) recovered from Proteus mirabilis. pPm14C18 was identified in a CMY-2-producing P. mirabilis isolate from chicken in China in 2014, and could be transferred to Escherichia coli conferring an MDR phenotype. Whole genome sequencing confirmed pPm14C18 was a novel type 1/2 hybrid IncC plasmid 165,992bp in size, containing fifteen antimicrobial resistance genes. It harboured a novel MDR mosaic region comprised of a hybrid Tn21tnp-pDUmer, in which blaCTX-M-65, dfrA32 and ereA were firstly reported in IncC plasmid. Phylogenetic relationship reconstruction based on the nucleotide sequences of the 52 IncC backbones showed all type 1 IncC plasmids were clustered into one clade, and then merged with pPm14C18 and finally with the type 2 IncC plasmids and another type 1/2 hybrid IncC plasmid pYR1. The MDR IncC plasmids in P. mirabilis of animal origin might threaten public health, which should be drawn more attention. Copyright © 2017 Elsevier Inc. All rights reserved.

  10. Conference Summary

    ERIC Educational Resources Information Center

    Doherty, Cait

    2009-01-01

    This article summarizes an original conference, organised by the Child Care Research Forum (http://www.qub.ac.uk/sites/ccrf/), which brought together experts from all over Northern Ireland to showcase some of the wealth of research with children and young people that is going on in the country today. Developed around the six high-level outcomes of…

  11. The conference

    Treesearch

    Gordon M. Heisler; Lee P. Herrington

    1977-01-01

    This is a report on the Conference on Metropolitan Physical Environment, held in August 1975 at Syracuse, N.Y., where some 160 scientists and planners met to discuss the use of vegetation, space, and structures to improve the amenities for people who live in metropolitan areas.

  12. Conference Space

    ERIC Educational Resources Information Center

    Tillett, Wade

    2016-01-01

    The following is an exploration of the spatial configurations (and their implications) within a typical panel session at an academic conference. The presenter initially takes up different roles and hyperbolically describes some possible messages that the spatial arrangement sends. Eventually, the presenter engages the audience members in atypical…

  13. Conference Space

    ERIC Educational Resources Information Center

    Tillett, Wade

    2016-01-01

    The following is an exploration of the spatial configurations (and their implications) within a typical panel session at an academic conference. The presenter initially takes up different roles and hyperbolically describes some possible messages that the spatial arrangement sends. Eventually, the presenter engages the audience members in atypical…

  14. Changing plasmid types responsible for extended spectrum cephalosporin resistance in Escherichia coli O157:H7 in the United States, 1996-2009.

    PubMed

    Folster, J P; Pecic, G; Stroika, S; Rickert, R; Whichard, J

    2014-06-01

    Escherichia coli O157 is a major cause of foodborne illness. Plasmids are genetic elements that mobilize antimicrobial resistance determinants including blaCMY β-lactamases that confer resistance to extended-spectrum cephalosporins (ESC). ESCs are important for treating a variety of infections. IncA/C plasmids are found among diverse sources, including cattle, the principal source of E. coli O157 infections in humans. IncI1 plasmids are common among E. coli and Salmonella from poultry and other avian sources. To broaden our understanding of reservoirs of blaCMY, we determined the types of plasmids carrying blaCMY among E. coli O157. From 1996 to 2009, 3742 E. coli O157 isolates were tested. Eleven (0.29%) were ceftriaxone resistant and had a blaCMY-2-containing plasmid. All four isolates submitted before 2001 and a single 2001 isolate had blaCMY encoded on IncA/C plasmids, while all five isolates submitted after 2001 and a single 2001 isolate had blaCMY carried on IncI1 plasmids. The IncI1 plasmids were ST2, ST20, and ST23. We conclude that cephalosporin resistance among E. coli O157:H7 is due to plasmid-encoded blaCMY genes and that plasmid types appear to have shifted from IncA/C to IncI1. This shift suggests either a change in plasmid type among animal reservoirs or that the organism has expanded into avian reservoirs. More analysis of human, retail meat, and food animal isolates is necessary to broaden our understanding of the antimicrobial resistance determinants of ESC resistance among E. coli O157.

  15. Changing plasmid types responsible for extended-spectrum cephalosporin resistance in Escherichia coli O157:H7 in the USA, 1996-2009.

    PubMed

    Folster, J P; Pecic, G; Stroika, S; Rickert, R; Whichard, J M

    2014-06-01

    Escherichia coli O157 is a major cause of food-borne illness. Plasmids are genetic elements that mobilise antimicrobial resistance determinants, including blaCMY β-lactamases that confer resistance to extended-spectrum cephalosporins (ESCs). ESCs are important for treating a variety of infections. IncA/C plasmids are found among diverse sources, including cattle, the principal source of E. coli O157 infections in humans. IncI1 plasmids are common among E. coli and Salmonella from poultry and other avian sources. To broaden our understanding of the reservoirs of blaCMY, the types of plasmids carrying blaCMY among E. coli O157 were determined. From 1996 to 2009, 3742 E. coli O157 isolates were tested. Eleven isolates (0.29%) were ceftriaxone-resistant and had a blaCMY-2-containing plasmid. All four isolates submitted before 2001 as well as a single 2001 isolate had blaCMY encoded on IncA/C plasmids, whilst all five isolates submitted after 2001 and a single 2001 isolate had blaCMY carried on IncI1 plasmids. The IncI1 plasmids were ST2, ST20 and ST23. We conclude that cephalosporin resistance among E. coli O157:H7 is due to plasmid-encoded blaCMY genes and that plasmid types appear to have shifted from IncA/C to IncI1. This shift suggests either a change in plasmid type among animal reservoirs or that the organism has expanded into avian reservoirs. More analysis of human, retail meat and food animal isolates is necessary to broaden our understanding of the antimicrobial resistance determinants of ESC resistance among E. coli O157. Published by Elsevier Ltd.

  16. N15: the linear phage-plasmid.

    PubMed

    Ravin, Nikolai V

    2011-03-01

    The lambdoid phage N15 of Escherichia coli is very unusual among temperate phages in that its prophage is not integrated into chromosome but is a linear plasmid molecule with covalently closed ends. Upon infection the phage DNA circularises via cohesive ends, then phage-encoded enzyme, protelomerase, cuts at an inverted repeat site and forms hairpin ends (telomeres) of the linear plasmid prophage. Replication of the N15 prophage is initiated at an internally located ori site and proceeds bidirectionally resulting in formation of duplicated telomeres. Then the N15 protelomerase cuts duplicated telomeres generating two linear plasmid molecules with hairpin telomeres. Stable inheritance of the plasmid prophage is ensured by partitioning operon similar to the F factor sop operon. Unlike F sop, the N15 centromere consists of four inverted repeats dispersed in the genome. The multiplicity and dispersion of centromeres are required for efficient partitioning of a linear plasmid. The centromeres are located in N15 genome regions involved in phage replication and control of lysogeny, and binding of partition proteins at these sites regulates these processes. Two N15-related lambdoid Siphoviridae phages, φKO2 in Klebsiella oxytoca and pY54 in Yersinia enterocolitica, also lysogenize their hosts as linear plasmids, as well as Myoviridae marine phages VP882 and VP58.5 in Vibrio parahaemolyticus and ΦHAP-1 in Halomonas aquamarina. The genomes of all these phages contain similar protelomerase genes, lysogeny modules and replication genes, as well as plasmid-partitioning genes, suggesting that these phages may belong to a group diverged from a common ancestor.

  17. Bovine papillomavirus vector that propagates as a plasmid in both mouse and bacterial cells.

    PubMed

    DiMaio, D; Treisman, R; Maniatis, T

    1982-07-01

    We report the construction of a bovine papillomavirus (BPV)-derived recombinant plasmid that propagates as an extrachromosomal element in both mouse and bacterial cells. Plasmids composed of a subgenomic transforming fragment of BPV DNA, a deletion derivative of pBR322, and a 7.6-kilobase fragment of DNA from the human beta-globin gene cluster efficiently induce focus formation on mouse C127 cells. BPV-beta-globin hybrids are maintained in the transformed cells as plasmids with a copy number of about 10-30 per cell. Plasmids indistinguishable from the input DNA have been recovered by transformation of bacteria with low molecular weight DNA from transformed mouse cells. The human beta-globin gene linked to BPV DNA is transcribed from its own promoter at a high level in these cells. The expression of BPV-linked cellular genes in conjunction with the ability to shuttle DNA between bacteria and mammalian cells may provide a rapid means of analyzing and recovering genes that confer an identifiable phenotype upon mammalian cells.

  18. Pervasive Sign Epistasis between Conjugative Plasmids and Drug-Resistance Chromosomal Mutations

    PubMed Central

    Carvalho, Luís M.; Reis, Ana M.; Gordo, Isabel; Trindade, Sandra; Dionisio, Francisco

    2011-01-01

    Multidrug-resistant bacteria arise mostly by the accumulation of plasmids and chromosomal mutations. Typically, these resistant determinants are costly to the bacterial cell. Yet, recently, it has been found that, in Escherichia coli bacterial cells, a mutation conferring resistance to an antibiotic can be advantageous to the bacterial cell if another antibiotic-resistance mutation is already present, a phenomenon called sign epistasis. Here we study the interaction between antibiotic-resistance chromosomal mutations and conjugative (i.e., self-transmissible) plasmids and find many cases of sign epistasis (40%)—including one of reciprocal sign epistasis where the strain carrying both resistance determinants is fitter than the two strains carrying only one of the determinants. This implies that the acquisition of an additional resistance plasmid or of a resistance mutation often increases the fitness of a bacterial strain already resistant to antibiotics. We further show that there is an overall antagonistic interaction between mutations and plasmids (52%). These results further complicate expectations of resistance reversal by interdiction of antibiotic use. PMID:21829372

  19. Pervasive sign epistasis between conjugative plasmids and drug-resistance chromosomal mutations.

    PubMed

    Silva, Rui F; Mendonça, Sílvia C M; Carvalho, Luís M; Reis, Ana M; Gordo, Isabel; Trindade, Sandra; Dionisio, Francisco

    2011-07-01

    Multidrug-resistant bacteria arise mostly by the accumulation of plasmids and chromosomal mutations. Typically, these resistant determinants are costly to the bacterial cell. Yet, recently, it has been found that, in Escherichia coli bacterial cells, a mutation conferring resistance to an antibiotic can be advantageous to the bacterial cell if another antibiotic-resistance mutation is already present, a phenomenon called sign epistasis. Here we study the interaction between antibiotic-resistance chromosomal mutations and conjugative (i.e., self-transmissible) plasmids and find many cases of sign epistasis (40%)--including one of reciprocal sign epistasis where the strain carrying both resistance determinants is fitter than the two strains carrying only one of the determinants. This implies that the acquisition of an additional resistance plasmid or of a resistance mutation often increases the fitness of a bacterial strain already resistant to antibiotics. We further show that there is an overall antagonistic interaction between mutations and plasmids (52%). These results further complicate expectations of resistance reversal by interdiction of antibiotic use.

  20. Multiple keys for a single lock: the unusual structural plasticity of the nucleotidyltransferase (4')/kanamycin complex.

    PubMed

    Matesanz, Ruth; Diaz, José Fernando; Corzana, Francisco; Santana, Andrés G; Bastida, Agatha; Asensio, Juan Luis

    2012-03-05

    The most common mode of bacterial resistance to aminoglycoside antibiotics is the enzyme-catalysed chemical modification of the drug. Over the last two decades, significant efforts in medicinal chemistry have been focused on the design of non- inactivable antibiotics. Unfortunately, this strategy has met with limited success on account of the remarkably wide substrate specificity of aminoglycoside-modifying enzymes. To understand the mechanisms behind substrate promiscuity, we have performed a comprehensive experimental and theoretical analysis of the molecular-recognition processes that lead to antibiotic inactivation by Staphylococcus aureus nucleotidyltransferase 4'(ANT(4')), a clinically relevant protein. According to our results, the ability of this enzyme to inactivate structurally diverse polycationic molecules relies on three specific features of the catalytic region. First, the dominant role of electrostatics in aminoglycoside recognition, in combination with the significant extension of the enzyme anionic regions, confers to the protein/antibiotic complex a highly dynamic character. The motion deduced for the bound antibiotic seem to be essential for the enzyme action and probably provide a mechanism to explore alternative drug inactivation modes. Second, the nucleotide recognition is exclusively mediated by the inorganic fragment. In fact, even inorganic triphosphate can be employed as a substrate. Third, ANT(4') seems to be equipped with a duplicated basic catalyst that is able to promote drug inactivation through different reactive geometries. This particular combination of features explains the enzyme versatility and renders the design of non-inactivable derivatives a challenging task.

  1. Electrotransformation of Yersinia ruckeri by plasmid DNA.

    PubMed

    Cutrín, J M; Conchas, R F; Barja, J L; Toranzo, A E

    1994-01-01

    Yersinia ruckeri, a fish pathogenic bacterium in aquaculture, was used to evaluate the electroporation as a new transformation method for this species. DNA used for the electrotransformation were plasmids of molecular mass ranging from 2.3 kb to 33 kb, and diverse replicons. To optimize this method we used Y. ruckeri 11.29 strain (from serotype 02) and pSU2718 DNA. The best transformation efficiency (6.0 x 10(5) transformants/micrograms DNA) was obtained with 12.5 kV/cm, 25 microF, 400 omega and 2 hours of incubation after pulse. When these conditions were applied to other strains belonging to different serotypes and other plasmids, we obtained transformants in all strains assayed, but only when using low molecular weight plasmids. Plasmid vectors and resident plasmid were not modified in host strains after electrotransformation. In studies of conformation we confirmed that only circular DNA was able for transformation. The utilization of this technique for direct cloning in Y. ruckeri makes possible further studies on recombinant DNA.

  2. Requirements for Borrelia burgdorferi plasmid maintenance.

    PubMed

    Tilly, Kit; Checroun, Claire; Rosa, Patricia A

    2012-07-01

    Borrelia burgdorferi has multiple linear and circular plasmids that are faithfully replicated and partitioned as the bacterium grows and divides. The low copy number of these replicons implies that active partitioning contributes to plasmid stability. Analyzing the requirements for plasmid replication and partition in B. burgdorferi is complicated by the complexity of the genome and the possibility that products may act in trans. Consequently, we have studied the replication-partition region (bbb10-13) of the B. burgdorferi 26kb circular plasmid (cp26) in Escherichia coli, by fusion with a partition-defective miniF plasmid. Our analysis demonstrated that bbb10, bbb11, and bbb13 are required for stable miniF maintenance, whereas bbb12 is dispensable. To validate these results, we attempted to inactivate two of these genes in B. burgdorferi. bbb12 mutants were obtained at a typical frequency, suggesting that the bbb12 product is dispensable for cp26 maintenance as well. We could not directly measure cp26 stability in the bbb12 mutant, because cp26 carries essential genes, and bacteria that have lost cp26 are inviable. Conversely, we were unable to inactivate bbb10 on cp26 of B. burgdorferi. Our results suggest that bbb12 is dispensable for cp26 maintenance, whereas bbb10, bbb11, and bbb13 play crucial roles in that process. Published by Elsevier Inc.

  3. Proteolysis in plasmid DNA stable maintenance in bacterial cells.

    PubMed

    Karlowicz, Anna; Wegrzyn, Katarzyna; Dubiel, Andrzej; Ropelewska, Malgorzata; Konieczny, Igor

    2016-07-01

    Plasmids, as extrachromosomal genetic elements, need to work out strategies that promote independent replication and stable maintenance in host bacterial cells. Their maintenance depends on constant formation and dissociation of nucleoprotein complexes formed on plasmid DNA. Plasmid replication initiation proteins (Rep) form specific complexes on direct repeats (iterons) localized within the plasmid replication origin. Formation of these complexes along with a strict control of Rep protein cellular concentration, quaternary structure, and activity, is essential for plasmid maintenance. Another important mechanism for maintenance of low-copy-number plasmids are the toxin-antitoxin (TA) post-segregational killing (psk) systems, which prevent plasmid loss from the bacterial cell population. In this mini review we discuss the importance of nucleoprotein complex processing by energy-dependent host proteases in plasmid DNA replication and plasmid type II toxin-antitoxin psk systems, and draw attention to the elusive role of DNA in this process.

  4. Persistence of a pKPN3-like CTX-M-15-encoding IncFIIK plasmid in a Klebsiella pneumonia ST17 host during two years of intestinal colonization.

    PubMed

    Löhr, Iren Høyland; Hülter, Nils; Bernhoff, Eva; Johnsen, Pål Jarle; Sundsfjord, Arnfinn; Naseer, Umaer

    2015-01-01

    To characterize the CTX-M-15-encoding plasmid in a Klebsiella pneumoniae ST17 strain, responsible for an outbreak at a Norwegian neonatal intensive care unit and subsequent colonization of affected children for up to two years. To identify plasmid-mediated features relevant for the outbreak dynamics, and to investigate the plasmids capability of horizontal transfer, its segregational stability and plasmid-mediated fitness costs. Plasmid profiling was performed by S1-nuclease PFGE, PCR-based replicon typing and Southern blot-hybridization. The complete sequence of the CTX-M-15-encoding plasmid was obtained by 454 sequencing. Plasmid self-transferability was investigated by broth- and filter mating, segregational stability was explored by serial passage, and plasmid-conferred fitness costs were examined in pairwise head-to-head competitions and by growth rate comparisons. CTX-M-15 was encoded by a ~180 kb IncFIIK plasmid in K. pneumoniae ST17. S1-nuclease PFGE profiles of the first and the last CTX-M-15-producing K. pneumoniae isolates, recovered from the four children colonized the longest, suggested that the plasmid was stably maintained during intestinal carriage of up to two years. The DNA sequence of the pKPN3-like plasmid, pKp848CTX, uncovered a Tn3-like antibiotic resistance region and multiple heavy metal- and thermoresistance determinants. Plasmid pKp848CTX could not be transferred to Escherichia coli in vitro and we found no evidence to support horizontal plasmid transfer in vivo. Segregational plasmid loss ranging from 0.83% to 17.5% was demonstrated in evolved populations in vitro, but only minor fitness costs were associated with plasmid-carriage. Plasmid pKp848CTX encodes phenotypic traits, which may have had an impact on the fitness and survival of the K. pneumoniae ST17 strain in the outbreak setting. The antibiotic resistance plasmid pKp848CTX was stably maintained during two years of intestinal colonization, conferring negligible fitness cost to its

  5. Diversity and Homogeneity among Small Plasmids of Aeromonas salmonicida subsp. salmonicida Linked with Geographical Origin

    PubMed Central

    Attéré, Sabrina A.; Vincent, Antony T.; Trudel, Mélanie V.; Chanut, Romain; Charette, Steve J.

    2015-01-01

    Furunculosis, which is caused by Aeromonas salmonicida subsp. salmonicida, is a major salmonid disease in fish farms worldwide. Several plasmids found in this bacterium confer phenotypes such drug resistance and virulence. Small plasmids (pAsa1, pAsa2, pAsa3, and pAsal1) related to ColE1- and ColE2-type replicons are usually present in its normal plasmidome. In the present study, with the objective to investigate if these plasmids display particularities related to the origin of the isolates bearing them, a total of 153 isolates, including 78 new and 75 previously described, were analyzed for the presence of small plasmids by PCR and DNA restriction fragment profiling. A geographical dichotomy between Canadian and European isolates for their propensity to do not have pAsa3 or pAsal1 was found. In addition, the genotyping analysis led to the identification of two European isolates harboring an unusual pAsal1. An investigation by next-generation sequencing (NGS) of these two isolates shed light on two pAsal1 variants (pAsal1C and pAsal1D). As with pAsal1B, another pAsal1 variant previously described, these two new variants bore a second insertion sequence (ISAS5) in addition to the usual ISAS11. The characterization of these variants suggested that they could predominate over the wild-type pAsal1 in stressful conditions such as growth at temperatures of 25°C and above. To obtain a comprehensive portrait of the mutational pressure on small plasmids, 26 isolates whose DNA had been sequenced by NGS were investigated. pAsa3 and pAsal1 were more prone to mutations than pAsa1 and pAsa2, especially in the mobA gene, which encodes a relaxase and a primase. Lastly, the average copy number of each plasmid per cell was assessed using raw sequencing data. A clear trend with respect to the relative proportion per cell of each plasmid was identified. Our large-scale study revealed a geographical dichotomy in small plasmid repertoire in addition to a clear trend for pAsa3 and p

  6. Electrotransfer of Plasmid Vector DNA into Muscle

    NASA Astrophysics Data System (ADS)

    Miyazaki, Satsuki; Miyazaki, Jun-Ichi

    Wolff et al. (1990) first reported that plasmid DNA injected into skeletal muscle is taken up by muscle cells and the genes in the plasmid are expressed for more than two months thereafter, although the transfected DNA does not usually undergo chromosomal integration (Wolff et al., 1991, 1992). However, the relatively low expression levels attained by this method have hampered its applications for uses other than as a DNA vaccine (Davis et al., 1995). There are a number of reports analyzing the conditions that affect the efficiency of gene transfer by intramuscular DNA injection and assessing the fine structures of expression plasmid vectors that may affect expression levels (Davis et al., 1993; Liang et al., 1996; Norman et al., 1997). Furthermore, various attempts were done to improve the efficiency of gene transfer by intramus cular DNA injection. Consequently, regenerating muscle was shown to produce 80-fold or more protein than did normal muscle, following injection of an expression plas-mid. Muscle regeneration was induced by treatment with cardiotoxin or bupivacaine (Wells, 1993; Vitadello et al., 1994). We previously demonstrated that by combining a strong promoter and bupivacaine pretreatment intramuscular injection of an IL-5 expression plasmid results in IL-5 production in muscle at a level sufficient to induce marked proliferation of eosinophils in the bone marrow and eosinophil infiltration of various organs (Tokui et al., 1997). It was also reported that a single intramuscular injection of an erythropoietin expression plasmid produced physiologically significant elevations in serum erythropoietin levels and increased hematocrits in adult mice (Tripathy et al., 1996). Hematocrits in these animals remained elevated at >60% for at least 90 days after a single injection. However, improvements to this method have not been sufficient to extend its applications including clinical use.

  7. Transfer of mupirocin resistance from Staphylococcus haemolyticus clinical strains to Staphylococcus aureus through conjugative and mobilizable plasmids.

    PubMed

    Rossi, Ciro C; Ferreira, Natália C; Coelho, Marcus L V; Schuenck, Ricardo P; Bastos, Maria do Carmo de F; Giambiagi-deMarval, Marcia

    2016-07-01

    Coagulase-negative staphylococci are thought to act as reservoirs of antibiotic resistance genes that can be transferred to Staphylococcus aureus, thus hindering the combat of this bacterium. In this work, we analyzed the presence of plasmids conferring resistance to the antibiotic mupirocin-widely used to treat and prevent S. aureus infections in hospital environments-in nosocomial S. haemolyticus strains. About 12% of the 75 strains tested were resistant to mupirocin, and this phenotype was correlated with the presence of plasmids. These plasmids were shown to be diverse, being either conjugative or mobilizable, and capable of transferring mupirocin resistance to S. aureus Our findings reinforce that S. haemolyticus, historically and mistakenly considered as a less important pathogen, is a reservoir of resistance genes which can be transferred to other bacteria, such as S. aureus, emphasizing the necessity of more effective strategies to detect and combat this emergent opportunistic pathogen.

  8. Plasmid vectors and molecular building blocks for the development of genetic manipulation tools for Trypanosoma cruzi.

    PubMed

    Bouvier, León A; Cámara, María de los Milagros; Canepa, Gaspar E; Miranda, Mariana R; Pereira, Claudio A

    2013-01-01

    The post genomic era revealed the need for developing better performing, easier to use and more sophisticated genetic manipulation tools for the study of Trypanosoma cruzi, the etiological agent of Chagas disease. In this work a series of plasmids that allow genetic manipulation of this protozoan parasite were developed. First of all we focused on useful tools to establish selection strategies for different strains and which can be employed as expression vectors. On the other