Sample records for plasmids conferring kanamycin

  1. Novel plasmid conferring kanamycin and tetracycline resistance in turkey-derived Campylobacter jejuni strain 11601MD

    Technology Transfer Automated Retrieval System (TEKTRAN)

    In Campylobacter spp., resistance to the antibiotics kanamycin and tetracycline is frequently associated with plasmid-borne genes. However, relatively few plasmids of Campylobacter jejuni have been fully characterized to date. A novel plasmid (p11601MD; 44,095 bp.) harboring tet(O) was identified in...

  2. Characterization of Small ColE1-Like Plasmids Conferring Kanamycin Resistance in Salmonella enterica subsp. enterica serovars Typhimurium and Newport

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Multi-antibiotic resistant (MR) Salmonella enterica serovars Typhimurium and Newport are an increasing concern in human and animal health. Many strains are known to carry antibiotic resistance determinants on multiple plasmids, yet detailed information is scarce. Three plasmids conferring kanamycin...

  3. Transformation of Thermoanaerobacterium sp. strain JW/SL-YS485 with plasmid pIKM1 conferring kanamycin resistance

    SciTech Connect

    Mai, V.; Lorenz, W.W.; Wiegel, J.


    The industrial application of thermophilic (eu)bacteria is hampered by the lack of genetic systems for these bacteria. We report here the first unequivocal transformation of a Gram-positive, thermophilic, anaerobic microorganism, Thermoanaerobacterium, with the kanamycin resistance-mediating plasmid pIKM1. The construct pIKM1 is based on the Escherichia coli-Clostridium acetobutylicum shuttle vector pIMP1 and contains the thermostable kanamycin cassette from S. faecalis plasmid pKD102. Using electrotransformation, plasmid pIKM1 mediated kanamycin resistance in Thermoanaerobacterium sp. strain JW/SL-YS485 up to 400 {mu}g ml{sup -1} at 48{degrees}C and 200 {mu}g ml{sup -1} at 60{degrees}C.

  4. Novel plasmid conferring kanamycin and tetracycline resistance in the turkey-derived Campylobacter jejuni strain 11601MD.


    Crespo, M D; Altermann, E; Olson, J; Miller, W G; Chandrashekhar, K; Kathariou, S


    In Campylobacter spp., resistance to the antimicrobials kanamycin and tetracycline is frequently associated with plasmid-borne genes. However, relatively few plasmids of Campylobacter jejuni have been fully characterized to date. A novel plasmid (p11601MD; 44,095nt) harboring tet(O) was identified in C. jejuni strain 11601MD, which was isolated from the jejunum of a turkey produced conventionally in North Carolina. Analysis of the p11601MD sequence revealed the presence of a high-GC content cassette with four genes that included tet(O) and a putative aminoglycoside transferase gene (aphA-3) highly similar to kanamycin resistance determinants. Several genes putatively involved in conjugative transfer were also identified on the plasmid. These findings will contribute to a better understanding of the distribution of potentially self-mobilizing plasmids harboring antibiotic resistance determinants in Campylobacter spp. from turkeys and other sources.

  5. Characterization of small ColE1-like plasmids conferring kanamycin resistance in Salmonella enterica subsp. enterica serovars Typhimurium and Newport.


    Chen, Chin-Yi; Strobaugh, Terence P; Frye, Jonathan G


    Multi-antibiotic resistant (MR) Salmonella enterica serovars Typhimurium and Newport are an increasing concern in human and animal health. Many strains are known to carry antibiotic resistance determinants on multiple plasmids, yet detailed information has been scarce. Three plasmids conferring kanamycin (Kan) resistance were isolated and nucleotide sequences were determined. Two Kan(R) plasmids from Salmonella Newport strains, pSN11/00Kan and pSN02/01Kan, were found to be identical and were 5698bp in size. Plasmid pG7601Kan from Salmonella Typhimurium phage type U302 strain G7601 was 3208bp, and was the same as the previously reported pU302S from another U302 strain G8430. All three plasmids carried identical aph(3')-I genes. The plasmids were ColE1-like, containing RNA I/RNA II and the rom gene. Plasmids pSN11/00Kan and pSN02/01Kan also carried mobilization genes mobC and mobABD, similar to those of the pColK-K235 and pColD-157 plasmids from the colicinogenic Escherichia coli strains. All three plasmids were stable without kanamycin selection for approximately 100 generations.

  6. Typing and characterization of ColE1-like plasmids conferring kanamycin resistance in Salmonella enterica serotypes

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Background: Multi-antibiotic resistant Salmonella enterica serotypes are increasing in prevalence and concern in human and animal health. Many strains carry resistance determinants on plasmids; current practices focus heavily on large plasmids and the role small plasmids play in resistance gene tra...

  7. Development of plasmid cloning vectors for Thermus thermophilus HB8: Expression of a heterologous, plasmid-borne kanamycin nucleotidyltransferase gene

    SciTech Connect

    Mather, M.W.; Fee, J.A. )


    While several thermus genes have been cloned and T. thermophilus has been shown to be transformable, molecular genetic studies of these thermophiles have been hampered by the absence of selectable cloning vectors. The authors have constructed a selectable plasmid by random insertion of a heterologous gene encoding a thermostable kanamycin nucleotidyltransferase activity into a cryptic, multicopy plasmid from T. thermophilus HB8. This plasmid should serve as a suitable starting point for the development of a gene expression system for T. thermophilus.

  8. An Arabidopsis thaliana ABC transporter that confers kanamycin resistance in transgenic plants does not endow resistance to Escherichia coli.


    Burris, Kellie; Mentewab, Ayalew; Ripp, Steven; Stewart, C Neal


    Concerns have been raised about potential horizontal gene transfer (HGT) of antibiotic resistance markers (ARMs) from transgenic plants to bacteria of medical and environmental importance. All ARMs used in transgenic plants have been bacterial in origin, but it has been recently shown that an Arabidopsis thaliana ABC transporter, Atwbc19, confers kanamycin resistance when overexpressed in transgenic plants. Atwbc19 was evaluated for its ability to transfer kanamycin resistance to Escherichia coli, a kanamycin-sensitive model bacterium, under simulated HGT, staged by subcloning Atwbc19 under the control of a bacterial promoter, genetically transforming to kanamycin-sensitive bacteria, and assessing if resistance was conferred as compared with bacteria harbouring nptII, the standard kanamycin resistance gene used to produce transgenic plants. NptII provided much greater resistance than Atwbc19 and was significantly different from the no-plasmid control at low concentrations. Atwbc19 was not significantly different from the no-plasmid control at higher concentrations. Even though HGT risks are considered low with nptII, Atwbc19 should have even lower risks, as its encoded protein is possibly mistargeted in bacteria.

  9. Characterization of plasmid-mediated aphA-3 kanamycin resistance in Campylobacter jejuni.


    Gibreel, Amera; Sköld, Ola; Taylor, Diane E


    A total of 254 isolates of Campylobacter jejuni and three isolates of Campylobacter coli, isolated from Sweden, Canada, and Egypt, were screened for kanamycin resistance. Eight strains of C. jejuni contained large plasmids that carried the aphA-3 kanamycin-resistance marker. In six plasmids, the aphA-3 gene was located downstream of an apparent insertion sequence, designated IS607*, which showed a considerable similarity to IS607, characterized on the chromosome of some Helicobacter pylori strains. In contrast, the other plasmids carried the aphA-3 gene as a part of a resistance cluster. This included three resistance markers encoding 6'-adenylyltransferase (aadE), streptothricin acetyltransferase (sat), and 3'-aminoglycoside phosphotransferase type III (aphA-3). The genetic organization of this resistance cluster suggests that it has been acquired by C. jejuni from a Gram-positive organism. The IS607* element was also observed in kanamycin-susceptible strains of C. jejuni on plasmids mediating tetracycline resistance. The kanamycin-resistance phenotype transferred along with tetracycline resistance by conjugation from four representative C. jejuni strains to a recipient strain of C. jejuni. The kanamycin-resistance determinant (aphA-3) was stably transferred from one of the four C. jejuni strains to a recipient strain of Escherichia coli. However, the C. jejuni plasmid, which also carries the tetO gene, was not maintained in E. coli. Pulsed-field gel electrophoresis revealed the integration of approximately 50 kb of the plasmid into the chromosome of the E. coli recipient.

  10. Prevalence of ColE1-like plasmids and kanamycin resistance genes in Salmonella enterica serovars.


    Chen, Chin-Yi; Lindsey, Rebecca L; Strobaugh, Terence P; Frye, Jonathan G; Meinersmann, Richard J


    Multi-antimicrobial-resistant Salmonella enterica strains frequently carry resistance genes on plasmids. Recent studies focus heavily on large conjugative plasmids, and the role that small plasmids play in resistance gene transfer is largely unknown. To expand our previous studies in assessing the prevalence of the isolates harboring ColE1-like plasmids carrying the aph gene responsible for kanamycin resistance (Kan(r)) phenotypes, 102 Kan(r) Salmonella isolates collected through the National Antimicrobial Resistance Monitoring System (NARMS) in 2005 were screened by PCR using ColE1 primer sets. Thirty isolates were found to be positive for ColE1-like replicon. Plasmids from 23 isolates were able to propagate in Escherichia coli and were subjected to further characterization. Restriction mapping revealed three major plasmid groups found in three or more isolates, with each group consisting of two to three subtypes. The aph genes from the Kan(r) Salmonella isolates were amplified by PCR, sequenced, and showed four different aph(3')-I genes. The distribution of the ColE1 plasmid groups in association with the aph gene, Salmonella serovar, and isolate source demonstrated a strong linkage of the plasmid with S. enterica serovar Typhimurium DT104. Due to their high copy number and mobility, the ColE1-like plasmids may play a critical role in transmission of antibiotic resistance genes among enteric pathogens, and these findings warrant a close monitoring of this plasmid incompatibility group.

  11. Mobilization properties of small ColE1-like plasmids carrying kanamycin resistance gene isolated from Salmonella enterica serotypes

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Background: Previously we isolated and characterized various groups of small kanamycin resistance (KanR) ColE1-like plasmids from different serotypes of Salmonella enterica isolates. These plasmids all carried the aph(3)-I gene encoding the aminoglycoside phosphotransferase responsible for the kanam...

  12. Overexpression of the chromosomally encoded aminoglycoside acetyltransferase eis confers kanamycin resistance in Mycobacterium tuberculosis.


    Zaunbrecher, M Analise; Sikes, R David; Metchock, Beverly; Shinnick, Thomas M; Posey, James E


    The emergence of multidrug-resistant (MDR) tuberculosis (TB) highlights the urgent need to understand the mechanisms of resistance to the drugs used to treat this disease. The aminoglycosides kanamycin and amikacin are important bactericidal drugs used to treat MDR TB, and resistance to one or both of these drugs is a defining characteristic of extensively drug-resistant TB. We identified mutations in the -10 and -35 promoter region of the eis gene, which encodes a previously uncharacterized aminoglycoside acetyltransferase. These mutations led to a 20-180-fold increase in the amount of eis leaderless mRNA transcript, with a corresponding increase in protein expression. Importantly, these promoter mutations conferred resistance to kanamycin [5 microg/mL < minimum inhibitory concentration (MIC) kanamycin resistance harbored eis promoter mutations. These results have important clinical implications in that clinical isolates determined to be resistant to kanamycin may not be cross-resistant to amikacin, as is often assumed. Molecular detection of eis mutations should distinguish strains resistant to kanamycin and those resistant to kanamycin and amikacin. This may help avoid excluding a potentially effective drug from a treatment regimen for drug-resistant TB.

  13. Deletion formation mutations in plasmid expression vectors are unfavored by runaway amplification conditions and differentially selected under kanamycin stress.


    Oliveira, Pedro H; Prazeres, Duarte M F; Monteiro, Gabriel A


    Plasmid pCIneo is a ColE1-like mammalian expression vector also used as backbone for DNA vaccine development. We have recently shown that pCIneo spontaneously recombines due to the presence of two 28bp direct repeats. The persistence of low-frequency recombinants led us to evaluate the impact of environmental stresses typically found during plasmid production on plasmid copy number and recombination frequency. We observed an increase in pCIneo amplification (2.6-4.3-fold) in Escherichia coli cultures grown at 42 degrees C and also in minimal medium (at both 37 degrees C and 42 degrees C). These conditions fit to the smallest ratio between recombinant molecules and total plasmids. Conversely, increasing the dissolved oxygen tension from 20% to 40% in rich media did not have a significant impact on both plasmid copy number and recombination frequency, independently of the temperature used. We have also shown recently that the neomycin resistance (neo(r)) gene of pCIneo becomes actively transcribed as a result of recombination between the repeats. This prompted us to gain some insight into plasmid adaptation and competition by evaluating the impact of distinct concentrations of kanamycin on the differential selection of plasmid recombinant forms: monomer and heterodimers (1+2 and 1+3). We found the monomeric form to be predominantly recovered at lower concentrations of antibiotic whilst higher concentrations led to an increase in the percentage of the 1+2 form. The 1+3 heterodimeric form was invariably found at low percentages, independently of the concentration used.

  14. Overexpression of an Arabidopsis thaliana ABC transporter confers kanamycin resistance to transgenic plants.


    Mentewab, Ayalew; Stewart, C Neal


    Selectable markers of bacterial origin such as the neomycin phosphotransferase type II gene, which can confer kanamycin resistance to transgenic plants, represent an invaluable tool for plant engineering. However, since all currently used antibiotic-resistance genes are of bacterial origin, there have been concerns about horizontal gene transfer from transgenic plants back to bacteria, which may result in antibiotic resistance. Here we characterize a plant gene, Atwbc19, the gene that encodes an Arabidopsis thaliana ATP binding cassette (ABC) transporter and confers antibiotic resistance to transgenic plants. The mechanism of resistance is novel, and the levels of resistance achieved are comparable to those attained through expression of bacterial antibiotic-resistance genes in transgenic tobacco using the CaMV 35S promoter. Because ABC transporters are endogenous to plants, the use of Atwbc19 as a selectable marker in transgenic plants may provide a practical alternative to current bacterial marker genes in terms of the risk for horizontal transfer of resistance genes.

  15. Protein Diversity Confers Specificity in Plasmid Segregation

    PubMed Central

    Fothergill, Timothy J. G.; Barillà, Daniela; Hayes, Finbarr


    The ParG segregation protein (8.6 kDa) of multidrug resistance plasmid TP228 is a homodimeric DNA-binding factor. The ParG dimer consists of intertwined C-terminal domains that adopt a ribbon-helix-helix architecture and a pair of flexible, unstructured N-terminal tails. A variety of plasmids possess partition loci with similar organizations to that of TP228, but instead of ParG homologs, these plasmids specify a diversity of unrelated, but similarly sized, partition proteins. These include the proteobacterial pTAR, pVT745, and pB171 plasmids. The ParG analogs of these plasmids were characterized in parallel with the ParG homolog encoded by the pseudomonal plasmid pVS1. Like ParG, the four proteins are dimeric. No heterodimerization was detectable in vivo among the proteins nor with the prototypical ParG protein, suggesting that monomer-monomer interactions are specific among the five proteins. Nevertheless, as with ParG, the ParG analogs all possess significant amounts of unordered amino acid residues, potentially highlighting a common structural link among the proteins. Furthermore, the ParG analogs bind specifically to the DNA regions located upstream of their homologous parF-like genes. These nucleoprotein interactions are largely restricted to cognate protein-DNA pairs. The results reveal that the partition complexes of these and related plasmids have recruited disparate DNA-binding factors that provide a layer of specificity to the macromolecular interactions that mediate plasmid segregation. PMID:15805511

  16. Protein diversity confers specificity in plasmid segregation.


    Fothergill, Timothy J G; Barillà, Daniela; Hayes, Finbarr


    The ParG segregation protein (8.6 kDa) of multidrug resistance plasmid TP228 is a homodimeric DNA-binding factor. The ParG dimer consists of intertwined C-terminal domains that adopt a ribbon-helix-helix architecture and a pair of flexible, unstructured N-terminal tails. A variety of plasmids possess partition loci with similar organizations to that of TP228, but instead of ParG homologs, these plasmids specify a diversity of unrelated, but similarly sized, partition proteins. These include the proteobacterial pTAR, pVT745, and pB171 plasmids. The ParG analogs of these plasmids were characterized in parallel with the ParG homolog encoded by the pseudomonal plasmid pVS1. Like ParG, the four proteins are dimeric. No heterodimerization was detectable in vivo among the proteins nor with the prototypical ParG protein, suggesting that monomer-monomer interactions are specific among the five proteins. Nevertheless, as with ParG, the ParG analogs all possess significant amounts of unordered amino acid residues, potentially highlighting a common structural link among the proteins. Furthermore, the ParG analogs bind specifically to the DNA regions located upstream of their homologous parF-like genes. These nucleoprotein interactions are largely restricted to cognate protein-DNA pairs. The results reveal that the partition complexes of these and related plasmids have recruited disparate DNA-binding factors that provide a layer of specificity to the macromolecular interactions that mediate plasmid segregation.

  17. Novel mutations conferring resistance to kanamycin in Mycobacterium tuberculosis clinical isolates from Northern India.


    Kaur, Simerpreet; Rana, Vibhuti; Singh, Pooja; Trivedi, Garima; Anand, Shashi; Kaur, Amanpreet; Gupta, Pawan; Jain, Amita; Sharma, Charu


    Twenty-nine Kanamycin resistant clinical isolates of Mycobacterium tuberculosis from Northern India were screened to evaluate genetic mutations in rrs gene, eis gene with its promoter, and whiB7 gene along with its 5'UTR. 14 strains (~48.0%) collectively exhibited mutations in rrs, eis or whiB7 target regions. While the highest frequency of mutations was found in rrs gene, eis and whiB7 loci displayed novel mutations. The novel mutations displayed by eis and whiB7 loci were found to be associated specifically with the Kanamycin resistance as none of the twenty nine Kanamycin sensitive strains harbor them. The inclusion of novel mutations of eis and whiB7 loci will be useful in improving the specificity of future diagnostics.

  18. Decreased susceptibility to 4'-deoxy-6'-N-methylamikacin (BB-K311) conferred by a mutant plasmid in Escherichia coli.


    Perlin, M H; Lerner, S A


    Escherichia coli MP6 contains a plasmid that encodes aminoglycoside 3'-phosphotransferase II, which phosphorylates kanamycin and confers high-level kanamycin resistance, Amikacin is a minor substrate of this enzyme, but MP6 is susceptible to amikacin. Strain MP10 has a spontaneous mutation in the plasmid of MP6 that increases the aminoglycoside 3'-phosphotransferase II activity not only against kanamycin but also against amikacin. This mutation is also responsible for the appearance of resistance to amikacin in MP10. Resistance to 4'-deoxy-6'-N-methylamikacin (BB-K311) by enzymatic modification has not been reported previously. As with amikacin, MP6 was susceptible to BB-K311 and its aminoglycoside 3'-phosphotransferase II did not phosphorylate this amikacin derivative appreciably. We found that the plasmid-borne mutation in MP10, however, localized by being cloned with a 3.7-megadalton HindIII fragment containing the aminoglycoside 3'-phosphotransferase II gene, resulted in increased phosphorylation of BB-K311 and resistance to it. Thus, the mutation distinguishing MP6 and MP10 has increased the activity of an existing aminoglycoside-modifying enzyme and produced new bacterial resistance to two previously minor substrates of the enzyme.

  19. Characterization and distribution of ColE1-like kanamycin-resistance plasmids in Salmonella enterica from food animals

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Background: Antimicrobial resistant foodborne pathogens cause public health concerns and multi-drug resistant (MDR) pathogens present difficulties when treatment is warranted. Large plasmids are responsible for the majority of the MDR and subsequently, the focus of most research. Previous studies sh...

  20. eis Promoter C14G and C15G Mutations Do Not Confer Kanamycin Resistance in Mycobacterium tuberculosis.


    Pholwat, Suporn; Stroup, Suzanne; Heysell, Scott; Ogarkov, Oleg; Zhdanova, Svetlana; Ramakrishnan, Girija; Houpt, Eric


    We studied the significance of particular eis mutations on Mycobacterium tuberculosis drug resistance using a specialized transduction strategy. Recombinant strains harboring eis promoter mutations C14T, C12T, and G10A exhibited kanamycin resistance with MICs of 40, 10, and 20 μg/ml, respectively, while recombinant strains harboring C14G and C15G mutations were kanamycin susceptible (MIC, 2.5 to 5 μg/ml). Each of the eis mutants tested remained amikacin susceptible (MIC, 0.5 to 4 μg/ml). The identification of specific eis mutations is needed for accurate genotypic susceptibility testing for kanamycin.

  1. Sequence analysis of a group of low molecular-weight plasmids carrying multiple IS903 elements flanking a kanamycin resistance aph gene in Salmonella enterica serovars

    Technology Transfer Automated Retrieval System (TEKTRAN)

    A group of low molecular-weight ColE1-like plasmids carrying the aph sequence type aph(ii), from three different Salmonella serovars were sequenced. These plasmids carry 2 or more copies of IS903 elements, with up to 21 bp sequence differences to one another, two of which flank the aph gene. This g...

  2. Rv3168 phosphotransferase activity mediates kanamycin resistance in Mycobacterium tuberculosis.


    Ahn, Jae-Woo; Kim, Kyung-Jin


    Tuberculosis is a worldwide epidemic disease caused by Mycobacterium tuberculosis, with an estimated one-third of the human population currently affected. Treatment of this disease with aminoglycoside antibiotics has become less effective owing to antibiotic resistance. Recent determination of the crystal structure of the M. tuberculosis Rv3168 protein suggests a structure similar to that of Enterococcus faecalis APH(3')-IIIa, and that this protein may be an aminoglycoside phosphotransferase. To determine whether Rv3168 confers antibiotic resistance against kanamycin, we performed dose-response antibiotic resistance experiments using kanamycin. Expression of the Rv3168 protein in Escherichia coli conferred antibiotic resistance against 100 μM kanamycin, a concentration that effected cell growth arrest in the parental E. coli strain and an E. coli strain expressing the Rv3168(D249A) mutant, in which the catalytic Asp249 residue was mutated to alanine. Furthermore, we detected phosphotransferase activity of Rv3168 against kanamycin as a substrate. Moreover, docking simulation of kanamycin into the Rv3168 structure suggests that kanamycin fits well into the substrate binding pocket of the protein, and that the phosphorylation-hydroxyl-group of kanamycin was located at a position similar to that in E. faecalis APH(3')-IIIa. On the basis of these results, we suggest that the Rv3168 mediates kanamycin resistance in M. tuberculosis, likely through phosphotransferase targeting of kanamycin.

  3. Environmentally co-occurring mercury resistance plasmids are genetically and phenotypically diverse and confer variable context-dependent fitness effects.


    Hall, James P J; Harrison, Ellie; Lilley, Andrew K; Paterson, Steve; Spiers, Andrew J; Brockhurst, Michael A


    Plasmids are important mobile elements that can facilitate genetic exchange and local adaptation within microbial communities. We compared the sequences of four co-occurring pQBR family environmental mercury resistance plasmids and measured their effects on competitive fitness of a Pseudomonas fluorescens SBW25 host, which was isolated at the same field site. Fitness effects of carriage differed between plasmids and were strongly context dependent, varying with medium, plasmid status of competitor and levels of environmental mercury. The plasmids also varied widely in their rates of conjugation and segregational loss. We found that few of the plasmid-borne accessory genes could be ascribed functions, although we identified a putative chemotaxis operon, a type IV pilus-encoding cluster and a region encoding putative arylsulfatase enzymes, which were conserved across geographically distant isolates. One plasmid, pQBR55, conferred the ability to catabolize sucrose. Transposons, including the mercury resistance Tn5042, appeared to have been acquired by different pQBR plasmids by recombination, indicating an important role for horizontal gene transfer in the recent evolution of pQBR plasmids. Our findings demonstrate extensive genetic and phenotypic diversity among co-occurring members of a plasmid community and suggest a role for environmental heterogeneity in the maintenance of plasmid diversity.

  4. Immunization with plasmid DNA encoding the hemagglutinin and the nucleoprotein confers robust protection against a lethal canine distemper virus challenge.


    Dahl, Lotte; Jensen, Trine Hammer; Gottschalck, Elisabeth; Karlskov-Mortensen, Peter; Jensen, Tove Dannemann; Nielsen, Line; Andersen, Mads Klindt; Buckland, Robin; Wild, T Fabian; Blixenkrone-Møller, Merete


    We have investigated the protective effect of immunization of a highly susceptible natural host of canine distemper virus (CDV) with DNA plasmids encoding the viral nucleoprotein (N) and hemagglutinin (H). The combined intradermal and intramuscular routes of immunization elicited high virus-neutralizing serum antibody titres in mink (Mustela vison). To mimic natural exposure, we also conducted challenge infection by horizontal transmission from infected contact animals. Other groups received a lethal challenge infection by administration to the mucosae of the respiratory tract and into the muscle. One of the mink vaccinated with N plasmid alone developed severe disease after challenge. In contrast, vaccination with the H plasmid together with the N plasmid conferred solid protection against disease and we were unable to detect CDV infection in PBMCs or in different tissues after challenge. Our findings show that DNA immunization by the combined intradermal and intramuscular routes can confer solid protective immunity against naturally transmitted morbillivirus infection and disease.

  5. Characterisation of a mobilisable plasmid conferring florfenicol and chloramphenicol resistance in Actinobacillus pleuropneumoniae.


    Bossé, Janine T; Li, Yanwen; Atherton, Tom G; Walker, Stephanie; Williamson, Susanna M; Rogers, Jon; Chaudhuri, Roy R; Weinert, Lucy A; Holden, Matthew T G; Maskell, Duncan J; Tucker, Alexander W; Wren, Brendan W; Rycroft, Andrew N; Langford, Paul R


    The complete nucleotide sequence of a 7.7kb mobilisable plasmid (pM3446F), isolated from a florfenicol resistant isolate of Actinobacillus pleuropneumoniae, showed extended similarity to plasmids found in other members of the Pasteurellaceae containing the floR gene as well as replication and mobilisation genes. Mobilisation into other Pasteurellaceae species confirmed that this plasmid can be transferred horizontally.

  6. Kanamycin-resistant alfalfa has a point mutation in the 16S plastid rRNA.


    Rosellini, D; LaFayette, P R; Barone, P; Veronesi, F; Parrott, W A


    Genes conferring resistance to kanamycin are frequently used to obtain transgenic plants as spontaneous resistance to kanamycin is not known to exist in higher plants. Nevertheless, mutations conferring kanamycin resistance have been identified in Chlamydomonas reinhardtii, raising the question as to why kanamycin-resistant mutants have not been found in higher plants. While attempting plastid transformation of alfalfa, we obtained non-transgenic but kanamycin-resistant somatic embryos following 2 months of culture in the presence of 50 mg l(-1) kanamycin. Sequencing of the plastid DNA region corresponding to the decoding site of the 16S rRNA in ten independent resistant events revealed an A to C transversion at position 1357 of the 16S plastid rDNA, the same site at which an A to G conversion confers kanamycin resistance to C. reinhardtii by reducing the ability of the antibiotic to bind to its target site. All plants derived from the resistant embryos through additional cycles of somatic embryogenesis in the absence of kanamycin retained the mutant phenotype, suggesting that the mutation was homoplastomic. Resistant plants produced 85% less biomass than controls; their leaves were chlorotic during early development and over time slowly turned green. The absence of kanamycin- resistant mutants in higher plants might be explained by the requirement for a regeneration system capable of resulting in homoplastomic individuals, or it may be the result of the detrimental effect of the mutation on the phenotype.

  7. Characterization of Mobile Staphylococcus equorum Plasmids Isolated from Fermented Seafood That Confer Lincomycin Resistance

    PubMed Central

    Lee, Jong-Hoon; Jeong, Do-Won


    The complete nucleotide sequences of lincomycin-resistance gene (lnuA)-containing plasmids in Staphylococcus equorum strains isolated from the high-salt-fermented seafood jeotgal were determined. These plasmids, designated pSELNU1–3, are 2638-bp long, have two polymorphic sites, and encode typical elements found in plasmids that replicate via a rolling-circle mechanism including the replication protein gene (rep), a double-stranded origin of replication, a single-stranded origin of replication, and counter-transcribed RNA sequence, as well as lnuA. Plasmid sequences exhibit over 83% identity to other Staphylococcus plasmids that harbor rep and lnuA genes. Further, three pairs of identified direct repeats may be involved in inter-plasmid recombination. One plasmid, pSELNU1, was successfully transferred to other Staphylococcus species, Enterococcus faecalis, and Tetragenococcus halophilus in vitro. Antibiotic susceptibility of the transconjugants was host-dependent, and transconjugants maintained a lincomycin resistance phenotype in the absence of selective pressure over 60 generations. PMID:26448648

  8. Plasmid-Encoded asp Operon Confers a Proton Motive Metabolic Cycle Catalyzed by an Aspartate-Alanine Exchange Reaction

    PubMed Central

    Abe, Keietsu; Ohnishi, Fumito; Yagi, Kyoko; Nakajima, Tasuku; Higuchi, Takeshi; Sano, Motoaki; Machida, Masayuki; Sarker, Rafiquel I.; Maloney, Peter C.


    Tetragenococcus halophila D10 catalyzes the decarboxylation of l-aspartate with nearly stoichiometric release of l-alanine and CO2. This trait is encoded on a 25-kb plasmid, pD1. We found in this plasmid a putative asp operon consisting of two genes, which we designated aspD and aspT, encoding an l-aspartate-β-decarboxylase (AspD) and an aspartate-alanine antiporter (AspT), respectively, and determined the nucleotide sequences. The sequence analysis revealed that the genes of the asp operon in pD1 were in the following order: promoter → aspD → aspT. The deduced amino acid sequence of AspD showed similarity to the sequences of two known l-aspartate-β-decarboxylases from Pseudomonas dacunhae and Alcaligenes faecalis. Hydropathy analyses suggested that the aspT gene product encodes a hydrophobic protein with multiple membrane-spanning regions. The operon was subcloned into the Escherichia coli expression vector pTrc99A, and the two genes were cotranscribed in the resulting plasmid, pTrcAsp. Expression of the asp operon in E. coli coincided with appearance of the capacity to catalyze the decarboxylation of aspartate to alanine. Histidine-tagged AspD (AspDHis) was also expressed in E. coli and purified from cell extracts. The purified AspDHis clearly exhibited activity of l-aspartate-β-decarboxylase. Recombinant AspT was solubilized from E. coli membranes and reconstituted in proteoliposomes. The reconstituted AspT catalyzed self-exchange of aspartate and electrogenic heterologous exchange of aspartate with alanine. Thus, the asp operon confers a proton motive metabolic cycle consisting of the electrogenic aspartate-alanine antiporter and the aspartate decarboxylase, which keeps intracellular levels of alanine, the countersubstrate for aspartate, high. PMID:12003930

  9. Plasmid-encoded asp operon confers a proton motive metabolic cycle catalyzed by an aspartate-alanine exchange reaction.


    Abe, Keietsu; Ohnishi, Fumito; Yagi, Kyoko; Nakajima, Tasuku; Higuchi, Takeshi; Sano, Motoaki; Machida, Masayuki; Sarker, Rafiquel I; Maloney, Peter C


    Tetragenococcus halophila D10 catalyzes the decarboxylation of L-aspartate with nearly stoichiometric release of L-alanine and CO(2). This trait is encoded on a 25-kb plasmid, pD1. We found in this plasmid a putative asp operon consisting of two genes, which we designated aspD and aspT, encoding an L-aspartate-beta-decarboxylase (AspD) and an aspartate-alanine antiporter (AspT), respectively, and determined the nucleotide sequences. The sequence analysis revealed that the genes of the asp operon in pD1 were in the following order: promoter --> aspD --> aspT. The deduced amino acid sequence of AspD showed similarity to the sequences of two known L-aspartate-beta-decarboxylases from Pseudomonas dacunhae and Alcaligenes faecalis. Hydropathy analyses suggested that the aspT gene product encodes a hydrophobic protein with multiple membrane-spanning regions. The operon was subcloned into the Escherichia coli expression vector pTrc99A, and the two genes were cotranscribed in the resulting plasmid, pTrcAsp. Expression of the asp operon in E. coli coincided with appearance of the capacity to catalyze the decarboxylation of aspartate to alanine. Histidine-tagged AspD (AspDHis) was also expressed in E. coli and purified from cell extracts. The purified AspDHis clearly exhibited activity of L-aspartate-beta-decarboxylase. Recombinant AspT was solubilized from E. coli membranes and reconstituted in proteoliposomes. The reconstituted AspT catalyzed self-exchange of aspartate and electrogenic heterologous exchange of aspartate with alanine. Thus, the asp operon confers a proton motive metabolic cycle consisting of the electrogenic aspartate-alanine antiporter and the aspartate decarboxylase, which keeps intracellular levels of alanine, the countersubstrate for aspartate, high.

  10. 21 CFR 522.1204 - Kanamycin.

    Code of Federal Regulations, 2014 CFR


    ... 21 Food and Drugs 6 2014-04-01 2014-04-01 false Kanamycin. 522.1204 Section 522.1204 Food and..., FEEDS, AND RELATED PRODUCTS IMPLANTATION OR INJECTABLE DOSAGE FORM NEW ANIMAL DRUGS § 522.1204 Kanamycin. (a) Specifications. Each milliliter of solution contains 50 or 200 milligrams (mg) of kanamycin...

  11. Previously undescribed plasmids recovered from activated sludge confer tetracycline resistance and phenotypic changes to Acinetobacter oleivorans DR1.


    Hong, Hyerim; Ko, Hyeok-Jin; Choi, In-Geol; Park, Woojun


    We used culture-dependent and culture-independent methods to extract previously undescribed plasmids harboring tetracycline (TC) resistance genes from activated sludge. The extracted plasmids were transformed into naturally competent Acinetobacter oleivorans DR1 to recover a non-Escherichia coli-based plasmid. The transformed cells showed 80-100-fold higher TC resistance than the wild-type strain. Restriction length polymorphism performed using 30 transformed cells showed four different types of plasmids. Illumina-based whole sequencing of the four plasmids identified three previously unreported plasmids and one previously reported plasmid. All plasmids carried TC resistance-related genes (tetL, tetH), tetracycline transcriptional regulators (tetR), and mobilization-related genes. As per expression analysis, TC resistance genes were functional in the presence of TC. The recovered plasmids showed mosaic gene acquisition through horizontal gene transfer. Membrane fluidity, hydrophobicity, biofilm formation, motility, growth rate, sensitivity to stresses, and quorum sensing signals of the transformed cells were different from those of the wild-type cells. Plasmid-bearing cells seemed to have an energy burden for maintaining and expressing plasmid genes. Our data showed that acquisition of TC resistance through plasmid uptake is related to loss of biological fitness. Thus, cells acquiring antibiotic resistance plasmids can survive in the presence of antibiotics, but must pay ecological costs.

  12. High Throughput Analyses of Budding Yeast ARSs Reveal New DNA Elements Capable of Conferring Centromere-Independent Plasmid Propagation.


    Hoggard, Timothy; Liachko, Ivan; Burt, Cassaundra; Meikle, Troy; Jiang, Katherine; Craciun, Gheorghe; Dunham, Maitreya J; Fox, Catherine A


    The ability of plasmids to propagate in Saccharomyces cerevisiae has been instrumental in defining eukaryotic chromosomal control elements. Stable propagation demands both plasmid replication, which requires a chromosomal replication origin (i.e., an ARS), and plasmid distribution to dividing cells, which requires either a chromosomal centromere for segregation or a plasmid-partitioning element. While our knowledge of yeast ARSs and centromeres is relatively advanced, we know less about chromosomal regions that can function as plasmid partitioning elements. The Rap1 protein-binding site (RAP1) present in transcriptional silencers and telomeres of budding yeast is a known plasmid-partitioning element that functions to anchor a plasmid to the inner nuclear membrane (INM), which in turn facilitates plasmid distribution to daughter cells. This Rap1-dependent INM-anchoring also has an important chromosomal role in higher-order chromosomal structures that enhance transcriptional silencing and telomere stability. Thus, plasmid partitioning can reflect fundamental features of chromosome structure and biology, yet a systematic screen for plasmid partitioning elements has not been reported. Here, we couple deep sequencing with competitive growth experiments of a plasmid library containing thousands of short ARS fragments to identify new plasmid partitioning elements. Competitive growth experiments were performed with libraries that differed only in terms of the presence or absence of a centromere. Comparisons of the behavior of ARS fragments in the two experiments allowed us to identify sequences that were likely to drive plasmid partitioning. In addition to the silencer RAP1 site, we identified 74 new putative plasmid-partitioning motifs predicted to act as binding sites for DNA binding proteins enriched for roles in negative regulation of gene expression and G2/M-phase associated biology. These data expand our knowledge of chromosomal elements that may function in plasmid

  13. Aptasensors for quantitative detection of kanamycin.


    Robati, Rezvan Yazdian; Arab, Atefeh; Ramezani, Mohammad; Langroodi, Fatemeh Alebooye; Abnous, Khalil; Taghdisi, Seyed Mohammad


    Up till now, various techniques have been developed to detect kanamycin in biological samples. However, due to some problems involved in these methods including time-consuming, expensive equipment and high consumption of reagents, new strategies for detection and quantitative determination of kanamycin are needed. Aptamer-based biosensors with unique recognition capability have attracted more attention of scientists because of its rapid response, high sensitivity and simple fabrication. Hence, we summarized optical and electrochemical kanamycin aptasensors and focuses on recent advances and modern techniques in aptasensor-based kanamycin detection techniques in order to provide readers with an inclusive understanding of its improvement and progress.

  14. Broad host range plasmids.


    Jain, Aayushi; Srivastava, Preeti


    Plasmids are and will remain important cloning vehicles for biotechnology. They have also been associated with the spread of a number of diseases and therefore are a subject of environmental concern. With the advent of sequencing technologies, the database of plasmids is increasing. It will be of immense importance to identify the various bacterial hosts in which the plasmid can replicate. The present review article describes the features that confer broad host range to the plasmids, the molecular basis of plasmid host range evolution, and applications in recombinant DNA technology and environment.

  15. Engineering of a functional thermostable kanamycin resistance marker for use in Moorella thermoacetica ATCC39073.


    Iwasaki, Yuki; Kita, Akihisa; Sakai, Shinsuke; Takaoka, Kazue; Yano, Shinichi; Tajima, Takahisa; Kato, Junichi; Nishio, Naomichi; Murakami, Katsuji; Nakashimada, Yutaka


    A transformation system for Moorella thermoacetica ATCC39073 was developed using thermostable kanamycin resistant gene (kanR) derived from the plasmid pJH1 that Streptococcus faecalis harbored. When kanR with its native promoter was introduced into uracil auxotrophic mutant of M. thermoacetica ATCC39073 together with a gene to complement the uracil auxotrophy as a selection marker, it did not give kanamycin resistance due to poor transcription level of kanR. However, the use of glyceraldehyde-3-phosphate dehydrogenase promoter cloned from M. thermoacetica ATCC39073 significantly improved transcription level of kanR and resulted in the cell growth in the presence of more than 150 μg mL(-1) kanamycin. It was also demonstrated that kanR with G3PD promoter can be used as a selection marker for transformation of wild-type strain of M. thermoacetica ATCC39073.

  16. Designing plasmid vectors.


    Tolmachov, Oleg


    Nonviral gene therapy vectors are commonly based on recombinant bacterial plasmids or their derivatives. The plasmids are propagated in bacteria, so, in addition to their therapeutic cargo, they necessarily contain a bacterial replication origin and a selection marker, usually a gene conferring antibiotic resistance. Structural and maintenance plasmid stability in bacteria is required for the plasmid DNA production and can be achieved by carefully choosing a combination of the therapeutic DNA sequences, replication origin, selection marker, and bacterial strain. The use of appropriate promoters, other regulatory elements, and mammalian maintenance devices ensures that the therapeutic gene or genes are adequately expressed in target human cells. Optimal immune response to the plasmid vectors can be modulated via inclusion or exclusion of DNA sequences containing immunostimulatory CpG sequence motifs. DNA fragments facilitating construction of plasmid vectors should also be considered for inclusion in the design of plasmid vectors. Techniques relying on site-specific or homologous recombination are preferred for construction of large plasmids (>15 kb), while digestion of DNA by restriction enzymes with subsequent ligation of the resulting DNA fragments continues to be the mainstream approach for generation of small- and medium-size plasmids. Rapid selection of a desired recombinant plasmid against a background of other plasmids continues to be a challenge. In this chapter, the emphasis is placed on efficient and flexible versions of DNA cloning protocols using selection of recombinant plasmids by restriction endonucleases directly in the ligation mixture.

  17. 21 CFR 522.1204 - Kanamycin sulfate injection.

    Code of Federal Regulations, 2012 CFR


    ... 21 Food and Drugs 6 2012-04-01 2012-04-01 false Kanamycin sulfate injection. 522.1204 Section 522....1204 Kanamycin sulfate injection. (a) Specifications. Each milliliter of kanamycin sulfate injection veterinary contains either 50 or 200 milligrams of kanamycin. (b) Sponsor. See No. 000856 in § 510.600(c)...

  18. 21 CFR 862.3520 - Kanamycin test system.

    Code of Federal Regulations, 2012 CFR


    ... 21 Food and Drugs 8 2012-04-01 2012-04-01 false Kanamycin test system. 862.3520 Section 862.3520....3520 Kanamycin test system. (a) Identification. A kanamycin test system is a device intended to measure kanamycin, an antibiotic drug, in plasma and serum. Measurements obtained by this device are used in...

  19. 21 CFR 862.3520 - Kanamycin test system.

    Code of Federal Regulations, 2013 CFR


    ... 21 Food and Drugs 8 2013-04-01 2013-04-01 false Kanamycin test system. 862.3520 Section 862.3520....3520 Kanamycin test system. (a) Identification. A kanamycin test system is a device intended to measure kanamycin, an antibiotic drug, in plasma and serum. Measurements obtained by this device are used in...

  20. 21 CFR 522.1204 - Kanamycin sulfate injection.

    Code of Federal Regulations, 2013 CFR


    ... 21 Food and Drugs 6 2013-04-01 2013-04-01 false Kanamycin sulfate injection. 522.1204 Section 522....1204 Kanamycin sulfate injection. (a) Specifications. Each milliliter of kanamycin sulfate injection veterinary contains either 50 or 200 milligrams of kanamycin. (b) Sponsor. See No. 000856 in § 510.600(c)...

  1. 21 CFR 524.1204 - Kanamycin, amphomycin, and hydrocortisone ointment.

    Code of Federal Regulations, 2014 CFR


    ... 21 Food and Drugs 6 2014-04-01 2014-04-01 false Kanamycin, amphomycin, and hydrocortisone ointment... ANIMAL DRUGS § 524.1204 Kanamycin, amphomycin, and hydrocortisone ointment. (a) Specifications. Each gram of ointment contains 5 milligrams kanamycin activity as kanamycin sulfate, 5 milligrams of...

  2. 21 CFR 522.1204 - Kanamycin sulfate injection.

    Code of Federal Regulations, 2011 CFR


    ... 21 Food and Drugs 6 2011-04-01 2011-04-01 false Kanamycin sulfate injection. 522.1204 Section 522....1204 Kanamycin sulfate injection. (a) Specifications. Each milliliter of kanamycin sulfate injection veterinary contains either 50 or 200 milligrams of kanamycin. (b) Sponsor. See No. 000856 in § 510.600(c)...

  3. 21 CFR 522.1204 - Kanamycin sulfate injection.

    Code of Federal Regulations, 2010 CFR


    ... 21 Food and Drugs 6 2010-04-01 2010-04-01 false Kanamycin sulfate injection. 522.1204 Section 522....1204 Kanamycin sulfate injection. (a) Specifications. Each milliliter of kanamycin sulfate injection veterinary contains either 50 or 200 milligrams of kanamycin. (b) Sponsor. See No. 000856 in § 510.600(c)...

  4. 21 CFR 862.3520 - Kanamycin test system.

    Code of Federal Regulations, 2011 CFR


    ... 21 Food and Drugs 8 2011-04-01 2011-04-01 false Kanamycin test system. 862.3520 Section 862.3520....3520 Kanamycin test system. (a) Identification. A kanamycin test system is a device intended to measure kanamycin, an antibiotic drug, in plasma and serum. Measurements obtained by this device are used in...

  5. 21 CFR 862.3520 - Kanamycin test system.

    Code of Federal Regulations, 2014 CFR


    ... 21 Food and Drugs 8 2014-04-01 2014-04-01 false Kanamycin test system. 862.3520 Section 862.3520....3520 Kanamycin test system. (a) Identification. A kanamycin test system is a device intended to measure kanamycin, an antibiotic drug, in plasma and serum. Measurements obtained by this device are used in...

  6. 21 CFR 862.3520 - Kanamycin test system.

    Code of Federal Regulations, 2010 CFR


    ... 21 Food and Drugs 8 2010-04-01 2010-04-01 false Kanamycin test system. 862.3520 Section 862.3520....3520 Kanamycin test system. (a) Identification. A kanamycin test system is a device intended to measure kanamycin, an antibiotic drug, in plasma and serum. Measurements obtained by this device are used in...

  7. An Escherichia coli system for assay of F1p site-specific recombination on substrate plasmids.


    Snaith, M R; Kilby, N J; Murray, J A


    We have developed an Escherichia coli system for testing the behaviour of plasmids carrying target sites for the F1p site-specific recombinase. The E. coli strain BL-FLP is described, which carries a chromosomally integrated bacteriophage T7 RNA polymerase gene expressed from a lac promoter, and harbours the plasmid pMS40.pMS40 has the features: (i) it carries the FLP recombinase gene under the control of a bacteriophage T7 promoter, (ii) it confers kanamycin resistance, and (iii) it uses an R6K origin of replication; these two latter features make it compatible with most conventional cloning vectors. Substrate plasmids carrying F1p-recognition targets (FRT) are transformed into BL-FLP, and the consequences of F1p-mediated recombination can be analysed after subsequent extraction of plasmid DNA. We show that this system is capable of base-perfect F1p-mediated recombination on plasmid substrates. We also present a corrected sequence of the commonly used F1p substrate plasmid, pNEO beta GAL (O'Gorman et al. (1991) Science 251, 1351-1355).

  8. HPLC-ELSD determination of kanamycin B in the presence of kanamycin A in fermentation broth.


    Zhang, Yong; He, Hui-Min; Zhang, Jin; Liu, Feng-Jiao; Li, Chao; Wang, Bing-Wu; Qiao, Ren-Zhong


    A novel method for the direct determination of kanamycin B in the presence of kanamycin A in fermentation broth using high performance liquid chromatography with evaporative light scattering detector (HPLC-ELSD) was developed. An Agilent Technologies C18 column was utilized, evaporation temperature of 40°C and nitrogen pressure of 3.5 bar, the optimized mobile phase was water-acetonitrile (65:35, v/v), containing 11.6 mm heptafluorobutyric acid (isocratic elution with flow rate of 0.5 mL/min) with the gain 11. Kanamycin B was eluted at 5.6 min with an asymmetry factor of 1.827. The method showed good linearity over the concentration range of 0.05 to 0.80 mg/mL for the kanamycin B (r(2) = 0.9987). The intra-day and inter-day coefficients of variation obtained from kanamycin B were less than 4.3%. Mean recovery of kanamycin B from spiked fermentation broth was 95%. The developed method was applied to the determination of kanamycin B without any interference from other constituents in the fermentation broth. This method offers simple, rapid and quantitative detection of kanamycin B.

  9. A Transmissible Plasmid-Borne Pathogenicity Island Confers Piscibactin Biosynthesis in the Fish Pathogen Photobacterium damselae subsp. piscicida

    PubMed Central

    Rivas, Amable J.; Balado, Miguel; Fuentes-Monteverde, Juan Carlos; Rodríguez, Jaime; Jiménez, Carlos; Lemos, Manuel L.; Waldor, Matthew K.


    The fish pathogen Photobacterium damselae subsp. piscicida produces the siderophore piscibactin. A gene cluster that resembles the Yersinia high-pathogenicity island (HPI) encodes piscibactin biosynthesis. Here, we report that this HPI-like cluster is part of a hitherto-uncharacterized 68-kb plasmid dubbed pPHDP70. This plasmid lacks homologs of genes that mediate conjugation, but we found that it could be transferred at low frequencies from P. damselae subsp. piscicida to a mollusk pathogenic Vibrio alginolyticus strain and to other Gram-negative bacteria, likely dependent on the conjugative functions of the coresident plasmid pPHDP60. Following its conjugative transfer, pPHDP70 restored the capacity of a vibrioferrin mutant of V. alginolyticus to grow under low-iron conditions, and piscibactin became detectable in its supernatant. Thus, pPHDP70 appears to harbor all the genes required for piscibactin biosynthesis and transport. P. damselae subsp. piscicida strains cured of pPHDP70 no longer produced piscibactin, had impaired growth under iron-limited conditions, and exhibited markedly decreased virulence in fish. Collectively, our findings highlight the importance of pPHDP70, with its capacity for piscibactin-mediated iron acquisition, in the virulence of P. damselae subsp. piscicida. Horizontal transmission of this plasmid-borne piscibactin synthesis gene cluster in the marine environment may facilitate the emergence of new pathogens. PMID:26092457

  10. Kanamycin ototoxicity in glutamate transporter knockout mice.


    Shimizu, Yoshitaka; Hakuba, Nobuhiro; Hyodo, Jun; Taniguchi, Masafumi; Gyo, Kiyofumi


    Glutamate-aspartate transporter (GLAST), a powerful glutamate uptake system, removes released glutamate from the synaptic cleft and facilitates the re-use of glutamate as a neurotransmitter recycling system. Aminoglycoside-induced hearing loss is mediated via a glutamate excitotoxic process. We investigated the effect of aminoglycoside ototoxicity in GLAST knockout mice using the recorded auditory brainstem response (ABR) and number of hair cells in the cochlea. Kanamycin (100 mg/mL) was injected directly into the posterior semicircular canal of mice. Before the kanamycin treatment, there was no difference in the ABR threshold average between the wild-type and knockout mice. Kanamycin injection aggravated the ABR threshold in the GLAST knockout mice compared with the wild-type mice, and the IHC degeneration was more severe in the GLAST knockout mice. These findings suggest that GLAST plays an important role in preventing the degeneration of inner hair cells in aminoglycoside ototoxicity.

  11. Combined treatment with the antibiotics kanamycin and streptomycin promotes the conjugation of Escherichia coli.


    Zhang, Peng-Yi; Xu, Pei-Pei; Xia, Zhi-Jie; Wang, Jing; Xiong, Juan; Li, Yue-Zhong


    It is widely accepted that antibiotics provide a critical selective pressure for the horizontal transfer of antibiotic resistance between bacterial species. This study demonstrated that a combination of low doses of kanamycin and streptomycin, which inhibited the growth of recipient and donor cells, respectively, had positive effects on the transmission of the conjugation plasmids pRK2013, pSU2007, and RP4 from Escherichia coli DH5α to HB101 at their minimum inhibitory concentrations (MICs). Administration of either antibiotic alone as well as other antibiotics in combination or alone did not have this effect. Two-dimensional electrophoresis revealed that 60 proteins were downregulated and 14 proteins were upregulated in the conjugation of E. coli DH5α (pRK2013) and HB101 in the presence of kanamycin and streptomycin. Of these proteins, 64 were subsequently identified by mass spectrometry. Two antibiotic-induced genes encoding oligopeptide-binding protein (OppA) and ribose-binding protein (RbsB) were further confirmed by quantitative real-time PCR. When these genes were deleted, the number of transconjugants decreased in the same fashion as when the cells were treated with kanamycin and streptomycin. These results indicate that the process of E. coli conjugation may be promoted by combination treatment with kanamycin and streptomycin and that two proteins potentially participated in this process.

  12. Two versatile shuttle vectors for Thermus thermophilus-Escherichia coli containing multiple cloning sites, lacZα gene and kanamycin or hygromycin resistance marker.


    Fujita, Atsushi; Misumi, Yoshio; Koyama, Yoshinori


    Two versatile shuttle vectors for Thermus thermophilus and Escherichia coli were developed on the basis of the T. thermophilus cryptic plasmid pTT8 and E. coli vector pUC13. These shuttle vectors, pTRK1T and pTRH1T, carry a gene encoding a protein homologous to replication protein derived from pTT8, a replicon for E. coli, new multiple cloning sites and a lacZα gene from E. coli vector pUC13, and also have a gene encoding a thermostable protein that confers resistance to kanamycin or hygromycin, which can be used as a selection marker in T. thermophilus. These shuttle vectors are useful to develop enzymes and proteins of biotechnological interest. We also constructed a plasmid, pUC13T, which carries the same multiple cloning sites of pTRK1T and pTRH1T. These vectors should facilitate cloning procedures both in E. coli and T. thermophilus.

  13. Characterization of chimeric plasmid cloning vehicles in Bacillus subtilis.


    Gryczan, T; Shivakumar, A G; Dubnau, D


    Restriction endonuclease cleavage maps of seven chimeric plasmids that may be used for molecular cloning in Bacillus subtilis are presented. These plasmids all carry multiple antibiotic resistance markers and were constructed by in vitro molecular cloning techniques. Several of the antibiotic resistance markers were shown to undergo insertional inactivation at specific restriction endonuclease sites. Kanamycin inactivation occurred at the BglII site of pUB110 derivatives, erythromycin inactivation occurred at the HpaI and BclI sites of pE194 derivatives, and streptomycin inactivation occurred at the HindIII site of pSA0501 derivatives. A stable mini-derivative of pBD12 was isolated and characterized. By using these plasmids, we identified proteins involved in plasmid-coded kanamycin and erythromycin resistance. The properties and uses of these chimeric plasmids in the further development of recombinant deoxyribonucleic acid technology in B. subtilis are discussed.

  14. Glycodiversification for the optimization of the kanamycin class aminoglycosides.


    Wang, Jinhua; Li, Jie; Chen, Hsiao-Nung; Chang, Huiwen; Tanifum, Christabel Tomla; Liu, Hsiu-Hsiang; Czyryca, Przemyslaw G; Chang, Cheng-Wei Tom


    In an effort to optimize the antibacterial activity of kanamycin class aminoglycoside antibiotics, we have accomplished the synthesis and antibacterial assay of new kanamycin B analogues. A rationale-based glycodiversification strategy was employed. The activity of the lead is comparable to that of commercially available kanamycin. These new members, however, were found to be inactive against aminoglycoside resistant bacteria. Molecular modeling was used to provide the explanation. Thus, a new strategy for structural modifications of kanamycin class aminoglycosides is suggested.

  15. 21 CFR 524.1200a - Kanamycin ophthalmic ointment.

    Code of Federal Regulations, 2013 CFR


    ... 21 Food and Drugs 6 2013-04-01 2013-04-01 false Kanamycin ophthalmic ointment. 524.1200a Section... § 524.1200a Kanamycin ophthalmic ointment. (a) Specifications. The drug, which is in a suitable and harmless ointment base, contains 3.5 milligrams of kanamycin activity (as the sulfate) per gram of...

  16. 21 CFR 524.1200a - Kanamycin ophthalmic ointment.

    Code of Federal Regulations, 2010 CFR


    ... 21 Food and Drugs 6 2010-04-01 2010-04-01 false Kanamycin ophthalmic ointment. 524.1200a Section... § 524.1200a Kanamycin ophthalmic ointment. (a) Specifications. The drug, which is in a suitable and harmless ointment base, contains 3.5 milligrams of kanamycin activity (as the sulfate) per gram of...

  17. 21 CFR 520.1204 - Kanamycin, bismuth subcarbonate, activated attapulgite.

    Code of Federal Regulations, 2013 CFR


    ... 21 Food and Drugs 6 2013-04-01 2013-04-01 false Kanamycin, bismuth subcarbonate, activated... § 520.1204 Kanamycin, bismuth subcarbonate, activated attapulgite. (a) Specifications—(1) Each 5 milliliters (mL) of suspension contains 100 milligrams (mg) kanamycin (as the sulfate), 250 mg...

  18. 21 CFR 524.1200b - Kanamycin ophthalmic aqueous solution.

    Code of Federal Regulations, 2011 CFR


    ... 21 Food and Drugs 6 2011-04-01 2011-04-01 false Kanamycin ophthalmic aqueous solution. 524.1200b... § 524.1200b Kanamycin ophthalmic aqueous solution. (a) Specifications. The drug, which is in an aqueous... kanamycin activity (as the sulfate) per milliliter of solution. (b) Sponsor. See No. 000856 in §...

  19. 21 CFR 524.1200b - Kanamycin ophthalmic aqueous solution.

    Code of Federal Regulations, 2013 CFR


    ... 21 Food and Drugs 6 2013-04-01 2013-04-01 false Kanamycin ophthalmic aqueous solution. 524.1200b... § 524.1200b Kanamycin ophthalmic aqueous solution. (a) Specifications. The drug, which is in an aqueous... kanamycin activity (as the sulfate) per milliliter of solution. (b) Sponsor. See No. 000856 in §...

  20. 21 CFR 524.1200a - Kanamycin ophthalmic ointment.

    Code of Federal Regulations, 2011 CFR


    ... 21 Food and Drugs 6 2011-04-01 2011-04-01 false Kanamycin ophthalmic ointment. 524.1200a Section... § 524.1200a Kanamycin ophthalmic ointment. (a) Specifications. The drug, which is in a suitable and harmless ointment base, contains 3.5 milligrams of kanamycin activity (as the sulfate) per gram of...

  1. 21 CFR 524.1200a - Kanamycin ophthalmic ointment.

    Code of Federal Regulations, 2012 CFR


    ... 21 Food and Drugs 6 2012-04-01 2012-04-01 false Kanamycin ophthalmic ointment. 524.1200a Section... § 524.1200a Kanamycin ophthalmic ointment. (a) Specifications. The drug, which is in a suitable and harmless ointment base, contains 3.5 milligrams of kanamycin activity (as the sulfate) per gram of...

  2. 21 CFR 524.1200b - Kanamycin ophthalmic aqueous solution.

    Code of Federal Regulations, 2012 CFR


    ... 21 Food and Drugs 6 2012-04-01 2012-04-01 false Kanamycin ophthalmic aqueous solution. 524.1200b... § 524.1200b Kanamycin ophthalmic aqueous solution. (a) Specifications. The drug, which is in an aqueous... kanamycin activity (as the sulfate) per milliliter of solution. (b) Sponsor. See No. 000856 in §...

  3. 21 CFR 520.1204 - Kanamycin, bismuth subcarbonate, activated attapulgite.

    Code of Federal Regulations, 2012 CFR


    ... 21 Food and Drugs 6 2012-04-01 2012-04-01 false Kanamycin, bismuth subcarbonate, activated... § 520.1204 Kanamycin, bismuth subcarbonate, activated attapulgite. (a) Specifications—(1) Each 5 milliliters (mL) of suspension contains 100 milligrams (mg) kanamycin (as the sulfate), 250 mg...

  4. 21 CFR 520.1204 - Kanamycin, bismuth subcarbonate, activated attapulgite.

    Code of Federal Regulations, 2014 CFR


    ... 21 Food and Drugs 6 2014-04-01 2014-04-01 false Kanamycin, bismuth subcarbonate, activated... § 520.1204 Kanamycin, bismuth subcarbonate, activated attapulgite. (a) Specifications—(1) Each 5 milliliters (mL) of suspension contains 100 milligrams (mg) kanamycin (as the sulfate), 250 mg...

  5. 21 CFR 524.1200b - Kanamycin ophthalmic aqueous solution.

    Code of Federal Regulations, 2010 CFR


    ... 21 Food and Drugs 6 2010-04-01 2010-04-01 false Kanamycin ophthalmic aqueous solution. 524.1200b... § 524.1200b Kanamycin ophthalmic aqueous solution. (a) Specifications. The drug, which is in an aqueous... kanamycin activity (as the sulfate) per milliliter of solution. (b) Sponsor. See No. 000856 in §...

  6. Comparative analysis of combination kanamycin-furosemide versus kanamycin alone in the mouse cochlea.


    Hirose, Keiko; Sato, Eisuke


    Combinations of aminoglycosides and loop diuretics have been known to have a synergistic effect in ototoxic injury. Because murine hair cells are relatively resistant to ototoxicity compared to those of other mammals, investigators have turned to combination therapies to create ototoxic lesions in the mouse inner ear. In this paper, we perform a systematic comparison of hearing thresholds, hair cell damage and monocyte migration into the mouse cochlea after kanamycin versus combined kanamycin/furosemide and explore the pathophysiology of enhanced hair cell loss in aminoglycoside ototoxicity in the presence of loop diuretic. Combined kanamycin-furosemide resulted in elevation of threshold not only in the high frequencies, but across all frequencies with more extensive loss of outer hair cells when compared to kanamycin alone. The stria vascularis was severely atrophied and stellate cells in the spiral limbus were missing in kanamycin-furosemide exposed mice while these changes were not observed in mice receiving kanamycin alone. Monocytes and macrophages were recruited in large numbers to the spiral ligament and spiral ganglion in these mice. Combination therapy resulted in a greater number of macrophages in total, and many more macrophages were present further apically when compared to mice given kanamycin alone. Combined kanamycin-furosemide provides an effective method of addressing the relative resistance to ototoxicity that is observed in most mouse strains. As the mouse becomes increasingly more common in studies of hearing loss, and combination therapies gain popularity, recognition of the overall effects of combined aminoglycoside-loop diuretic therapy will be critical to interpretation of the interventions that follow.

  7. Iteron Plasmids.


    Konieczny, Igor; Bury, Katarzyna; Wawrzycka, Aleksandra; Wegrzyn, Katarzyna


    Iteron-containing plasmids are model systems for studying the metabolism of extrachromosomal genetic elements in bacterial cells. Here we describe the current knowledge and understanding of the structure of iteron-containing replicons, the structure of the iteron plasmid encoded replication initiation proteins, and the molecular mechanisms for iteron plasmid DNA replication initiation. We also discuss the current understanding of control mechanisms affecting the plasmid copy number and how host chaperone proteins and proteases can affect plasmid maintenance in bacterial cells.

  8. A Highly Thermostable Kanamycin Resistance Marker Expands the Tool Kit for Genetic Manipulation of Caldicellulosiruptor bescii

    PubMed Central

    Lipscomb, Gina L.; Conway, Jonathan M.; Blumer-Schuette, Sara E.; Kelly, Robert M.


    engineering applications geared toward biofuel production. The current genetic system used with C. bescii is based upon only a single selection strategy, and this uses the gene involved in a primary biosynthetic pathway. There are many advantages with an additional genetic selection using an antibiotic. This presents a challenge for thermophilic microorganisms, as only a limited number of antibiotics are stable above 50°C, and a thermostable version of the enzyme conferring antibiotic resistance must be obtained. In this work, we have developed a selection system for C. bescii using the antibiotic kanamycin and have shown that, in combination with the biosynthetic gene marker, it can be used to efficiently delete genes in this organism. PMID:27208106

  9. Antibiotic resistance of vibrio cholerae: special considerations of R-plasmids.


    Kuwahara, S


    Studies on the transmission of R plasmid by conjugation between enterobacteria and vibrio or related bacteria were reviewed. The majority of the reports confirmed successful transmission from enterobacteria to Vibrio cholerae and related species, although the transmission frequencies were extremely low and the transmitted R plasmid was very unstable except for thermosensitive kanamycin plasmid and usual R plasmid coexisting with P plasmid. Strains of V. cholerae and Aeromonas liquefaciens as well as A. salmonicida bearing R plasmid were detected in nature. R plasmid was relatively unstable in V. cholerae strains with which transmission of R plasmid to enterobacteria was confirmed. At present, only 3 R plasmids have been obtained from naturally occurring strains of V. cholerae. Although the 2 European plasmids belong to the C incompatibility group with 98 megadalton closed covalent circular DNA molecule, one plasmid belongs to the J group with more than 25 megadalton molecular weight, and no CCC of satelite DNA was detected in bacteria harboring this plasmid.

  10. The Complete Nucleotide Sequence of the Carbapenem Resistance-Conferring Conjugative Plasmid pLD209 from a Pseudomonas putida Clinical Strain Reveals a Chimeric Design Formed by Modules Derived from Both Environmental and Clinical Bacteria

    PubMed Central

    Marchiaro, Patricia M.; Brambilla, Luciano; Morán-Barrio, Jorgelina; Revale, Santiago; Pasteran, Fernando; Vila, Alejandro J.; Viale, Alejandro M.


    The complete sequence of the carbapenem-resistance-conferring conjugative plasmid pLD209 from a Pseudomonas putida clinical strain is presented. pLD209 is formed by 3 well-defined regions: an adaptability module encompassing a Tn402-like class 1 integron of clinical origin containing blaVIM-2 and aacA4 gene cassettes, partitioning and transfer modules, and a replication module derived from plasmids of environmental bacteria. pLD209 is thus a mosaic of modules originating in both the clinical and environmental (nonclinical) microbiota. PMID:24395220

  11. Gene therapy with plasmids encoding IFN-β or IFN-α14 confers long-term resistance to HIV-1 in humanized mice

    PubMed Central

    Abraham, Sojan; Choi, Jang-Gi; Ortega, Nora M.; Zhang, Junli; Shankar, Premlata; Swamy, N. Manjunath


    Because endogenous interferon type I (IFN-I) produced by HIV-1 infection might complicate the analysis of therapeutically administered IFN-I, we tested different humanized mouse models for induction of IFN-I during HIV-1 infection. While HIV-1 induced high levels of IFN-α in BLT mice, IFN-I was undetectable following infection in the Hu-PBL mouse model, in which only T cells expand. We therefore tested the effect of treatment with Pegylated IFN-2 (pegasys), in Hu-PBL mice. Pegasys prevented CD4 T cell depletion and reduced the viral load for 10 days, but the effect waned thereafter. We next expressed IFN-I subsets (IFN-α2, −α6, −α8, −α14, and −β) in Hu-PBL mice by hydrodynamic injection of plasmids encoding them and 2 days later infected the mice with HIV-1. CD4 T cell depletion was prevented in all subtypes of IFN-I-expressing mice by day 10. However, at day 40 post-infection, protection was seen in IFN-β- and IFN-α14-expressing mice, but not the others. The viral load followed an inverse pattern and was highest in control mice and lowest in IFN-β- and IFN-α14-expressing mice until day 40 after infection. These results show that gene therapy with plasmids encoding IFN-β and −α14, but not the commonly used −α2, confers long-term suppression of HIV-1 replication. PMID:27729616

  12. Analysis of plasmids in nosocomial strains of multiple-antibiotic-resistant Staphylococcus aureus.

    PubMed Central

    Lyon, B R; May, J W; Skurray, R A


    Nosocomial infections caused by Staphylococcus aureus strains resistant to methicillin and multiple antibiotics have reached epidemic proportions in Melbourne, Australia, over the past 5 years. Plasmid analysis of representative clinical isolates demonstrated the presence of three classes of plasmid DNA in most strains. Resistance to gentamicin, kanamycin, and tobramycin was usually mediated by an 18-megadalton plasmid but could also be encoded by a related 22-megadalton plasmid. Two distinguishable plasmids of 3 megadaltons each endowed resistance to chloramphenicol, and the third class consisted of small plasmids, each approximately 1 megadalton in size, with no attributable function. An extensive array of resistance determinants, including some which have usually been associated with a plasmid locus, were found to exist on the chromosome. Evidence that resistance to gentamicin, kanamycin, and tobramycin is chromosomally encoded in some clinical isolates suggests that this determinant may have undergone genetic translocation onto the staphylococcal chromosome. Images PMID:6311086

  13. Erythromycin Resistance-Conferring Plasmid pRSB105, Isolated from a Sewage Treatment Plant, Harbors a New Macrolide Resistance Determinant, an Integron-Containing Tn402-Like Element, and a Large Region of Unknown Function▿

    PubMed Central

    Schlüter, A.; Szczepanowski, R.; Kurz, N.; Schneiker, S.; Krahn, I.; Pühler, A.


    The erythromycin resistance plasmid pRSB105 was previously isolated from an activated sludge bacterial community of a municipal wastewater treatment plant. Compilation of the complete pRSB105 nucleotide sequence revealed that the plasmid is 57,137 bp in size and has a mean G+C content of 56.66 mol%. The pRSB105 backbone is composed of two different replication and/or partitioning modules and a functional mobilization region encoding the mobilization genes mobCDE and mobBA. The first replicon (Rep1) is nearly identical to the corresponding replication module of the multiresistance plasmid pRSB101 isolated from an unknown activated sludge bacterium. Accordingly, pRSB101 and pRSB105 are sister plasmids belonging to a new plasmid family. The second replicon (Rep2) of pRSB105 was classified as a member of the IncP-6 group. While Rep1 confers replication ability only in γ-proteobacteria, Rep2 extents the host range of the plasmid since it is also functional in the β-proteobacterium Ralstonia eutropha. Plasmid pRSB105 harbors the macrolide resistance genes mel and mph, encoding, respectively, a predicted ABC-type efflux permease and a macrolide-2′-phosphotransferase. Erythromycin resistance is mainly attributed to mel, whereas mph contributes to erythromycin resistance to a lesser extent. The second resistance region, represented by an integron-containing Tn402-like element, includes a β-lactam (oxa10) and a trimethoprim (dfrB2) resistance gene cassette. In addition to antibiotic resistance modules, pRSB105 encodes a functional restriction/modification system and two nonresistance regions of unknown function. The presence of different mobile genetic elements that flank resistance and nonresistance modules on pRSB105 indicates that these elements were involved in acquisition of accessory plasmid modules. Comparative genomics of pRSB105 and related plasmids elucidated that pRSB105 evolved by integration of distinct modules from different plasmid sources, including

  14. Location and cloning of the ultraviolet-sensitizing function from the chromosomally associated IncJ group plasmid, R391

    SciTech Connect

    Pembroke, J.T.; Stevens, E.; Brandsma, J.A.; Van de Putte, P.


    The IncJ plasmid R391, which specifies a uv-sensitizing function, has been shown to be associated with chromosomal DNA. Deletions originating from Tn10 insertion into the kanamycin-resistance determinant of plasmid R391 gave rise to uv-resistant derivatives. This apparent linkage between the kanamycin-resistance determinant and the uv-sensitizing gene(s) was used to clone the uv-sensitizing function from plasmid R391 into pUR222. A recombinant plasmid containing both functions (KanR and Uvs+) was obtained. The uv-sensitizing function was mapped to a 4-kb EcoRI fragment.

  15. Novel erm(T)-Carrying Multiresistance Plasmids from Porcine and Human Isolates of Methicillin-Resistant Staphylococcus aureus ST398 That Also Harbor Cadmium and Copper Resistance Determinants

    PubMed Central

    Gómez-Sanz, Elena; Kadlec, Kristina; Feßler, Andrea T.; Zarazaga, Myriam; Schwarz, Stefan


    This study describes three novel erm(T)-carrying multiresistance plasmids that also harbor cadmium and copper resistance determinants. The plasmids, designated pUR1902, pUR2940, and pUR2941, were obtained from porcine and human methicillin-resistant Staphylococcus aureus (MRSA) of the clonal lineage ST398. In addition to the macrolide-lincosamide-streptogramin B (MLSB) resistance gene erm(T), all three plasmids also carry the tetracycline resistance gene tet(L). Furthermore, plasmid pUR2940 harbors the trimethoprim resistance gene dfrK and the MLSB resistance gene erm(C), while plasmids pUR1902 and pUR2941 possess the kanamycin/neomycin resistance gene aadD. Sequence analysis of approximately 18.1 kb of the erm(T)-flanking region from pUR1902, 20.0 kb from pUR2940, and 20.8 kb from pUR2941 revealed the presence of several copies of the recently described insertion sequence ISSau10, which is probably involved in the evolution of the respective plasmids. All plasmids carried a functional cadmium resistance operon with the genes cadD and cadX, in addition to the multicopper oxidase gene mco and the ATPase copper transport gene copA, which are involved in copper resistance. The comparative analysis of S. aureus RN4220 and the three S. aureus RN4220 transformants carrying plasmid pUR1902, pUR2940, or pUR2941 revealed an 8-fold increase in CdSO4 and a 2-fold increase in CuSO4 MICs. The emergence of multidrug resistance plasmids that also carry heavy metal resistance genes is alarming and requires further surveillance. The colocalization of antimicrobial resistance genes and genes that confer resistance to heavy metals may facilitate their persistence, coselection, and dissemination. PMID:23629701

  16. Novel erm(T)-carrying multiresistance plasmids from porcine and human isolates of methicillin-resistant Staphylococcus aureus ST398 that also harbor cadmium and copper resistance determinants.


    Gómez-Sanz, Elena; Kadlec, Kristina; Feßler, Andrea T; Zarazaga, Myriam; Torres, Carmen; Schwarz, Stefan


    This study describes three novel erm(T)-carrying multiresistance plasmids that also harbor cadmium and copper resistance determinants. The plasmids, designated pUR1902, pUR2940, and pUR2941, were obtained from porcine and human methicillin-resistant Staphylococcus aureus (MRSA) of the clonal lineage ST398. In addition to the macrolide-lincosamide-streptogramin B (MLSB) resistance gene erm(T), all three plasmids also carry the tetracycline resistance gene tet(L). Furthermore, plasmid pUR2940 harbors the trimethoprim resistance gene dfrK and the MLSB resistance gene erm(C), while plasmids pUR1902 and pUR2941 possess the kanamycin/neomycin resistance gene aadD. Sequence analysis of approximately 18.1 kb of the erm(T)-flanking region from pUR1902, 20.0 kb from pUR2940, and 20.8 kb from pUR2941 revealed the presence of several copies of the recently described insertion sequence ISSau10, which is probably involved in the evolution of the respective plasmids. All plasmids carried a functional cadmium resistance operon with the genes cadD and cadX, in addition to the multicopper oxidase gene mco and the ATPase copper transport gene copA, which are involved in copper resistance. The comparative analysis of S. aureus RN4220 and the three S. aureus RN4220 transformants carrying plasmid pUR1902, pUR2940, or pUR2941 revealed an 8-fold increase in CdSO4 and a 2-fold increase in CuSO4 MICs. The emergence of multidrug resistance plasmids that also carry heavy metal resistance genes is alarming and requires further surveillance. The colocalization of antimicrobial resistance genes and genes that confer resistance to heavy metals may facilitate their persistence, coselection, and dissemination.

  17. Kanamycin activates caspase-1 in NC/Nga mice.


    Han, Na-Ra; Kim, Hyung-Min; Jeong, Hyun-Ja


    Abuse of antibiotics to treat children has been associated with an increased risk of the development of inflammatory diseases. The underlying mechanism behind this association still remains to be clarified. Here, we examined the mechanisms behind kanamycin-induced skin inflammation in NC/Nga mice. NC/Nga mice were orally administered kanamycin for 7 days consecutively. Blood, spleen and dorsal skin were taken 18 weeks after kanamycin treatment was stopped. Kanamycin significantly increased the allergic reaction. We also observed significant increases in caspase-1 mRNA and protein expression in the dorsal skin of the kanamycin-administered mice compared to the control mice. The increased enzymatic activity of caspase-1 in the dorsal skin of the kanamycin-administered mice increased the mRNA expressions of IL-1β and IL-18. The productions of IL-1β and IL-18 were also increased in the splenocytes obtained from kanamycin-administered mice. Kanamycin upregulated the TNF-α mRNA expression in the dorsal skin and the TNF-α production in stimulated splenocytes. The activation of nuclear factor-κB and degradation of IκBα were increased by kanamycin administration. Our findings suggest that the use of kanamycin during infancy may increase the potential for skin inflammatory reactions through the upregulation of caspase-1.

  18. The qacG gene on plasmid pST94 confers resistance to quaternary ammonium compounds in staphylococci isolated from the food industry.


    Heir, E; Sundheim, G; Holck, A L


    The 2.3 kb resistance plasmid pST94 revealed a new gene (qacG) encoding resistance to benzalkonium chloride (BC), a commonly used quaternary ammonium disinfectant, and the intercalating dye ethidium bromide (Eb) in staphylococci isolated from the food industry. The 107 amino acid QacG protein showing 69.2% identity to the staphylococcal multi-drug resistance protein Smr is a new member of the small multi-drug resistance (SMR) protein family. QacG conferred resistance via proton dependent efflux. An additional ORF on pST94 encoded a protein with extensive similarity to replication proteins of other Gram-positive bacteria. Gene constructs containing the qacG and smr gene region combined with the smr or qacG promoter, respectively, indicated that QacG is more efficient than Smr and that qacG has a weaker promoter. Resistant qacG-containing cells could be adapted to withstand higher concentrations of BC. Adapted qacG-containing cells showed increased resistance mainly to BC. In contrast, adaptation of sensitive cells showed cross-resistance development to a range of compounds. Induction of proton-dependent efflux was observed for BC-adapted staphylococci cells not containing qacG. The ability of sublethal concentrations of BC to develop cross-resistance and induce efflux mechanisms could be of practical significance; it should be considered before use of any new disinfectant and in the design of better disinfection procedures.

  19. Plasmid-related quinolone resistance determinants in epidemic Vibrio parahaemolyticus, uropathogenic Escherichia coli, and marine bacteria from an aquaculture area in Chile.


    Aedo, Sandra; Ivanova, Larisa; Tomova, Alexandra; Cabello, Felipe C


    Marine bacteria from aquaculture areas with industrial use of quinolones have the potential to pass quinolone resistance genes to animal and human pathogens. The VPA0095 gene, related to the quinolone resistance determinant qnrA, from clinical isolates of epidemic Vibrio parahaemolyticus conferred reduced susceptibility to quinolone after cloning into Escherichia coli K-12 either when acting alone or synergistically with DNA gyrase mutations. In addition, a plasmid-mediated quinolone resistance gene from marine bacteria, aac(6')-Ib-cr, was identical to aac(6')-Ib-cr from urinary tract isolates of E. coli, suggesting a recent flow of this gene between these bacteria isolated from different environments. aac(6')-Ib-cr from E. coli also conferred reduced susceptibility to quinolone and kanamycin when cloned into E. coli K-12.

  20. Synthetic neomycin-kanamycin phosphotransferase, type II coding sequence for gene targeting in mammalian cells.


    Jin, Seung-Gi; Mann, Jeffrey R


    The bacterial neomycin-kanamycin phosphotransferase, type II enzyme is encoded by the neo gene and confers resistance to aminoglycoside drugs such as neomycin and kanamycin-bacterial selection and G418-eukaryotic cell selection. Although widely used in gene targeting in mouse embryonic stem cells, the neo coding sequence contains numerous cryptic splice sites and has a high CpG content. At least the former can cause unwanted effects in cis at the targeted locus. We describe a synthetic sequence, sneo, which encodes the same protein as that encoded by neo. This synthetic sequence has no predicted splice sites in either strand, low CpG content, and increased mammalian codon usage. In mouse embryonic stem cells sneo expressability is similar to neo. The use of sneo in gene targeting experiments should substantially reduce the probability of unwanted effects in cis due to splicing, and perhaps CpG methylation, within the coding sequence of the selectable marker.

  1. Na+/H+ antiport activity conferred by Bacillus subtilis tetA(L), a 5' truncation product of tetA(L), and related plasmid genes upon Escherichia coli.

    PubMed Central

    Cheng, J; Baldwin, K; Guffanti, A A; Krulwich, T A


    An Escherichia coli transformant expressing the Bacillus subtilis tetA(L) gene from a weak promoter was challenged by growth on medium with low, increasing tetracycline concentrations. Changes in the substrate preference ratios of the TetA(L)-mediated resistances and antiports were examined in view of recent findings suggesting that TetA(L) catalyzes efflux of Na+ in exchange for protons in addition to having the ability to catalyze metal-tetracycline/H+ antiport. After growth of the transformant on 1 microgram or more of tetracycline per ml for 12 to 15 h, the tetA(L) gene in the plasmid was found to be disrupted by an IS10 element 50 bp from the 5' end of the coding sequence. This disrupted recombinant plasmid, pKB1, conferred greater tetracycline resistance and higher levels of membrane metal-tetracycline/proton antiport than the original plasmid, pJTA1, but conferred lower NA+ resistance and Na+/H+ antiport levels than the original plasmid. The results indicate that the 5' end of the gene is necessary for optimal Na+/H+ antiport but that some such activity as well as robust tetracycline/H+ antiport persists in its absence. Two plasmid genes, tet(K) and qacA, were compared with tetA(L) vis-à-vis their abilities to enhance the Na+/H+ antiporter activity of everted vesicles from E. coli transformants. tet(K), which is more closely related to tetA(L), catalyzed 22Na+ uptake by energized vesicles, whereas the less closely related qacA gene did not. PMID:8849239

  2. 21 CFR 520.1204 - Kanamycin, bismuth subcarbonate, activated attapulgite.

    Code of Federal Regulations, 2011 CFR


    ... milliliters (mL) of suspension contains 100 milligrams (mg) kanamycin (as the sulfate), 250 mg bismuth subcarbonate, and 500 mg activated attapulgite (aluminum magnesium silicate). (2) Each tablet contains 100 mg kanamycin (as the sulfate), 250 mg bismuth subcarbonate, and 500 mg activated attapulgite. (b) Sponsor....

  3. 21 CFR 520.1204 - Kanamycin, bismuth subcarbonate, activated attapulgite.

    Code of Federal Regulations, 2010 CFR


    ... milliliters (mL) of suspension contains 100 milligrams (mg) kanamycin (as the sulfate), 250 mg bismuth subcarbonate, and 500 mg activated attapulgite (aluminum magnesium silicate). (2) Each tablet contains 100 mg kanamycin (as the sulfate), 250 mg bismuth subcarbonate, and 500 mg activated attapulgite. (b) Sponsor....

  4. Plasmid-determined resistance to fosfomycin in Serratia marcescens.

    PubMed Central

    Mendoza, C; Garcia, J M; Llaneza, J; Mendez, F J; Hardisson, C; Ortiz, J M


    Multiple-antibiotic-resistant strains of Serratia marcescens isolated from hospitalized patients were examined for their ability to transfer antibiotic resistance to Escherichia coli by conjugation. Two different patterns of linked transferable resistance were found among the transconjugants. The first comprised resistance to carbenicillin, streptomycin, and fosfomycin; the second, and more common, pattern included resistance to carbenicillin, streptomycin, kanamycin, gentamicin, tetracycline, chloramphenicol, sulfonamide, and fosfomycin. The two types of transconjugant strains carried a single plasmid of either 57 or 97 megadaltons in size. Both of these plasmids are present in parental S. marcescens strains resistant to fosfomycin. The 57-megadalton plasmid was transformed into E. coli. Images PMID:7004337

  5. Plasmid Biopharmaceuticals.


    Prazeres, Duarte Miguel F; Monteiro, Gabriel A


    Plasmids are currently an indispensable molecular tool in life science research and a central asset for the modern biotechnology industry, supporting its mission to produce pharmaceutical proteins, antibodies, vaccines, industrial enzymes, and molecular diagnostics, to name a few key products. Furthermore, plasmids have gradually stepped up in the past 20 years as useful biopharmaceuticals in the context of gene therapy and DNA vaccination interventions. This review provides a concise coverage of the scientific progress that has been made since the emergence of what are called today plasmid biopharmaceuticals. The most relevant topics are discussed to provide researchers with an updated overview of the field. A brief outline of the initial breakthroughs and innovations is followed by a discussion of the motivation behind the medical uses of plasmids in the context of therapeutic and prophylactic interventions. The molecular characteristics and rationale underlying the design of plasmid vectors as gene transfer agents are described and a description of the most important methods used to deliver plasmid biopharmaceuticals in vivo (gene gun, electroporation, cationic lipids and polymers, and micro- and nanoparticles) is provided. The major safety issues (integration and autoimmunity) surrounding the use of plasmid biopharmaceuticals is discussed next. Aspects related to the large-scale manufacturing are also covered, and reference is made to the plasmid products that have received marketing authorization as of today.

  6. A novel kanamycin/G418 resistance marker for direct selection of transformants in Escherichia coli and different yeast species.


    Agaphonov, Michael; Romanova, Nina; Choi, Eui-Sung; Ter-Avanesyan, Michael


    We have developed a set of cloning vectors possessing a modified Tn903 kanamycin resistance gene that enables the selection of both kanamycin-resistant transformants in Escherichia coli and G418-resistant transformants in the yeasts Saccharomyces cerevisiae, Hansenula polymorpha and Pichia pastoris. Expression of this gene in yeast is controlled by the H. polymorpha glyceraldehyde-3-phosphate dehydrogenase promoter, while expression in E. coli is governed by an upstream E. coli lacZ promoter. Applicability of the vectors for gene disruption in H. polymorpha and S. cerevisiae was demonstrated by inactivation of the HpMAL1 and URA3 genes, respectively. One of the vectors possesses a H. polymorpha ARS allowing plasmid maintenance in an episomal state. The small size of the vectors (2-2.5 kb) makes them convenient for routine DNA cloning. In addition, we report a novel approach for construction of gene disruption cassettes.

  7. Genetic study of the pVM82 plasmid responsible for some pathogenic traits of Yersinia pseudotuberculosis

    SciTech Connect

    Il`ina, T.S.; Fil`kova, S.L.


    The large pVM82 plasmid isolated epidemic strains of Yersinia pseudotuberculosis includes the 25 MDa segment, which encodes a series of properties affecting the virulence of the bacterium. Insertion mutants of pVM82 containing transposition-defective Tn2507 with a kanamycin-resistance marker in different Hind III fragments of the 25 MDa segment were obtained. By recombination between two homologous pVM82 containing genetic markers in different parts, deletion derivatives of pVM82 plasmid and insertions of the plasmid segment, carrying a kanamycin-resistance marker, into a chromosome were obtained. Results were obtained suggesting the presence in the plasmid 25 MDa segment of a transposon-like structure capable of migrating from pVM82 plasmid onto a chromosome and from a chromosome and pVM82 onto pRP1.2 plasmid of a broad host range. 8 refs., 4 figs., 1 tab.

  8. Radioenzymatic assays for aminoglycosides with kanamycin 6'- acetyltransferase

    SciTech Connect

    Weber, A.; Smith, A.L.; Opheim, K.E.


    To facilitate the rapid and accurate quantitation of parenterally administered aminoglycosides, the optimum conditions (pH, duration of incubation, and cofactor concentrations) were defined to permit radioenzymatic assays with kanamycin acetyltransferase. The accuracy in quantitating tobramycin, netilmicin, kanamycin, and amikacin at concentrations in the therapeutic range was greater than 90%, with a mean recovery of 102.8%. The mean of the interassay coefficient of variation was 7.8%. Typical standard curves at six different concentrations resulted in a correlation coefficient (r value) of greater than 0.99 for each aminoglycoside. The radioenzymatic assay correlates well with the bioassay (tobramycin and netilmicin) and radioimmunoassay (amikacin and kanamycin); the correlation coefficient is greater than 0.90 for all. The authors conclude that the radioenzymatic assay utilizing kanamycin 6'-acetyltransferase is feasible for all commercially available parenterally administered aminoglycosides.

  9. [Electrooptical parameters of kanamycin-treated E. coli cell suspensions].


    Guliĭ, O I; Markina, L N; Bunin, V D; Ignatov, V V; Ignatov, O V


    The effect of kanamycin on the electrophysical parameters of cell suspensions of Escherichia coli K-12 and pMMB33 was investigated. Incubation of the sensitive K-12 strain with kanamycin resulted in significant changes in the orientation spectra (OS) of the cell suspensions; these changes were not revealed in the case of the resistant pMMB33 strain. In the case of the sensitive K-12 strain incubated with different kanamycin concentrations, changes in the OS of the cell suspensions occurred within the 10-1000 kHz frequency range of the orienting electrical field. The most pronounced change in the electrooptical signal was observed at 10 microg/ml of kanamycin. Control experiments were carried out by standard plating on nutrient media. Thus, the OS changes of suspensions in the presence of antibiotics may be used as a test for microbial resistance to such antibiotics.

  10. Thermosensitive replication of a kanamycin resistance factor.


    Terawaki, Y; Takayasu, H; Akiba, T


    A strain of Proteus vulgaris isolated from the urinary tract of a patient with postoperative pyelonephritis and resistant to sulfonamide, streptomycin, tetracycline, and kanamycin (KM) was found to transfer only KM resistance by cell-to-cell conjugation. The genetic determinant controlling the transferable KM resistance was considered to be an R factor and was designated R (KM). Successive transfer of KM resistance was demonstrated also from Escherichia coli 20S0, which received the R (KM) factor, to other substrains of E. coli K-12 or Salmonella typhimurium LT-2. The transfer of the R (KM) factor was strongly affected by the temperature at which the mating culture was kept. The transfer frequency of R (KM) at 25 C was about 10(5) times higher than at 37 C. The R (KM) factor was spontaneously eliminated from the host bacterial cells when P. vulgaris was cultured at 42 C, but no elimination occurred at 25 C. This elimination of the R (KM) factor at elevated temperature was also observed when the R (KM) factor infected E. coli and S. typhimurium. On the other hand, a normal R factor could not be eliminated from the same E. coli host strain by cultivation at the higher temperature. We consider the thermosensitive transfer and the spontaneous elimination of the R (KM) factor at higher temperature to depend upon thermosensitive replication of the R (KM) factor.

  11. Biofilms and the plasmid maintenance question.


    Imran, Mudassar; Jones, Don; Smith, Hal


    Can a conjugative plasmid encoding enhanced biofilm forming abilities for its bacterial host facilitate the persistence of the plasmid in a bacterial population despite conferring diminished growth rate and segregative plasmid loss on its bearers? We construct a mathematical model in a chemostat and in a plug flow environment to answer this question. Explicit conditions for an affirmative answer are derived. Numerical simulations support the conclusion.

  12. Isolation of VanB-type Enterococcus faecalis strains from nosocomial infections: first report of the isolation and identification of the pheromone-responsive plasmids pMG2200, Encoding VanB-type vancomycin resistance and a Bac41-type bacteriocin, and pMG2201, encoding erythromycin resistance and cytolysin (Hly/Bac).


    Zheng, Bo; Tomita, Haruyoshi; Inoue, Takako; Ike, Yasuyoshi


    Eighteen identical VanB-type Enterococcus faecalis isolates that were obtained from different hospitalized patients were examined for their drug resistance and plasmid DNAs. Of the 18 strains, 12 strains exhibited resistance to erythromycin (Em), gentamicin (Gm), kanamycin (Km), tetracycline (Tc), and vancomycin (Van) and produced cytolysin (Hly/Bac) and a bacteriocin (Bac) active against E. faecalis strains. Another six of the strains exhibited resistance to Gm, Km, Tc, and Van and produced a bacteriocin. Em and Van resistance was transferred individually to E. faecalis FA2-2 strains at a frequency of about 10(-4) per donor cell by broth mating. The Em-resistant transconjugants and the Van-resistant transconjugants harbored a 65.7-kbp plasmid and a 106-kbp plasmid, respectively. The 106-kbp and 65.7-kbp plasmids isolated from the representative E. faecalis NKH15 strains were designated pMG2200 and pMG2201, respectively. pMG2200 conferred vancomycin resistance and bacteriocin activity on the host strain and responded to the synthetic pheromone cCF10 for pCF10, while pMG2201 conferred erythromycin resistance and cytolysin activity on its host strain and responded to the synthetic pheromone cAD1 for pAD1. The complete DNA sequence of pMG2200 (106,527 bp) showed that the plasmid carried a Tn1549-like element encoding vanB2-type resistance and the Bac41-like bacteriocin genes of pheromone-responsive plasmid pYI14. The plasmid contained the regulatory region found in pheromone-responsive plasmids and encoded the genes prgX and prgQ, which are the key negative regulatory elements for plasmid pCF10. pMG2200 also encoded TraE1, a key positive regulator of plasmid pAD1, indicating that pMG2200 is a naturally occurring chimeric plasmid that has a resulting prgX-prgQ-traE1 genetic organization in the regulatory region of the pheromone response. The functional oriT region and the putative relaxase gene of pMG2200 were identified and found to differ from those of pCF10 and pAD1

  13. Yeast telomere repeat sequence (TRS) improves circular plasmid segregation, and TRS plasmid segregation involves the RAP1 gene product.

    PubMed Central

    Longtine, M S; Enomoto, S; Finstad, S L; Berman, J


    Telomere repeat sequences (TRSs) can dramatically improve the segregation of unstable circular autonomously replicating sequence (ARS) plasmids in Saccharomyces cerevisiae. Deletion analysis demonstrated that yeast TRSs, which conform to the general sequence (C(1-3)A)n, are able to stabilize circular ARS plasmids. A number of TRS clones of different primary sequence and C(1-3)A tract length confer the plasmid stabilization phenotype. TRS sequences do not appear to improve plasmid replication efficiency, as determined by plasmid copy number analysis and functional assays for ARS activity. Pedigree analysis confirms that TRS-containing plasmids are missegregated at low frequency and that missegregated TRS-containing plasmids, like ARS plasmids, are preferentially retained by the mother cell. Plasmids stabilized by TRSs have properties that distinguish them from centromere-containing plasmids and 2 microns-based recombinant plasmids. Linear ARS plasmids, which include two TRS tracts at their termini, segregate inefficiently, while circular plasmids with one or two TRS tracts segregate efficiently, suggesting that plasmid topology or TRS accessibility interferes with TRS segregation function on linear plasmids. In strains carrying the temperature-sensitive mutant alleles rap1grc4 and rap1-5, TRS plasmids are not stable at the semipermissive temperature, suggesting that RAP1 protein is involved in TRS plasmid stability. In Schizosaccharomyces pombe, an ARS plasmid was stabilized by the addition of S. pombe telomere sequence, suggesting that the ability to improve the segregation of ARS plasmids is a general property of telomere repeats. PMID:1569937

  14. Autotransmissible resident plasmid of Rhizobium meliloti.


    Bedmar, E J; Olivares, J


    A resident plasmid of wild-type strains of Rhizobium meliloti of 59.6 megadaltons has been shown to be transferred at a high frequency to "cured" strains of this bacterial species. This plasmid, named pEZ1, that confers phage-sensitivity to cells carrying it is also transmissible to Escherichia coli and from it to "cured" R. meliloti strains.

  15. Plasmid-Encoded Iron Uptake Systems.


    Di Lorenzo, Manuela; Stork, Michiel


    Plasmids confer genetic information that benefits the bacterial cells containing them. In pathogenic bacteria, plasmids often harbor virulence determinants that enhance the pathogenicity of the bacterium. The ability to acquire iron in environments where it is limited, for instance the eukaryotic host, is a critical factor for bacterial growth. To acquire iron, bacteria have evolved specific iron uptake mechanisms. These systems are often chromosomally encoded, while those that are plasmid-encoded are rare. Two main plasmid types, ColV and pJM1, have been shown to harbor determinants that increase virulence by providing the cell with essential iron for growth. It is clear that these two plasmid groups evolved independently from each other since they do not share similarities either in the plasmid backbones or in the iron uptake systems they harbor. The siderophores aerobactin and salmochelin that are found on ColV plasmids fall in the hydroxamate and catechol group, respectively, whereas both functional groups are present in the anguibactin siderophore, the only iron uptake system found on pJM1-type plasmids. Besides siderophore-mediated iron uptake, ColV plasmids carry additional genes involved in iron metabolism. These systems include ABC transporters, hemolysins, and a hemoglobin protease. ColV- and pJM1-like plasmids have been shown to confer virulence to their bacterial host, and this trait can be completely ascribed to their encoded iron uptake systems.

  16. Distribution of ColE1-like KAN-resistance plasmids in a population of Salmonella enterica from animal diagnostic samples

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Background: Previous studies showed that some Salmonella isolates may harbor ColE1-like plasmids that carry a single aph gene responsible for kanamycin resistance (KAN-R). However the distribution of these plasmids is unknown. Methods: KAN-R Salmonella isolates (n=102) collected through the 2005 N...

  17. GFP plasmid-induced defects in Salmonella invasion depend on plasmid architecture, not protein expression.


    Clark, Leann; Martinez-Argudo, Isabel; Humphrey, Tom J; Jepson, Mark A


    We have investigated the impact of plasmids and GFP expression on invasion of cultured epithelial cells by Salmonella enterica Typhimurium strain SL1344. The invasiveness of SL1344 carrying plasmids derived from pBR322, encoding promoterless GFP or constitutively expressed rpsM-GFP, was compared under optimal growth conditions with that of SL1344(pBR322), unmodified SL1344 and a strain with chromosome-integrated rpsM-GFP. The strain carrying pBR322 exhibited normal invasion, but the presence of modified plasmids impaired invasiveness, and impairment was exacerbated by plasmid-encoded chloramphenicol resistance (CmR). Using a different antibiotic resistance marker, kanamycin (KmR), did not impair invasiveness. Despite the effect of plasmid-encoded CmR, the strain containing chromosomally encoded GFP, also carrying a CmR gene, was as invasive as the wild-type. To investigate the mechanism by which plasmid carriage decreases invasion, we monitored SPI-1 gene expression using prgH promoter activity as an index of SPI-1 activity. An SL1344 strain with a chromosome-integrated prgH::gfp reporter construct exhibited lower GFP expression during exponential phase when carrying plasmids incorporating CmR or gfp, mirroring invasion data. These data provide evidence that suppression of SPI-1 gene expression is a major factor in the loss of invasiveness associated with plasmid carriage. Our findings also indicate that some plasmids, especially those carrying CmR, should be used with caution, as virulence traits and gene expression may be affected by their presence. Integration of reporter proteins into the bacterial chromosome, however, appears to circumvent the adverse effects observed with plasmids.

  18. Broad-host-range plasmid pRK340 delivers Tn5 into the Legionella pneumophila chromosome.

    PubMed Central

    Keen, M G; Street, E D; Hoffman, P S


    Transposon Tn5 was introduced into Legionella pneumophila on plasmid pRK340, which is temperature sensitive for plasmid maintenance. The presence of plasmid DNA was confirmed by agarose gel electrophoresis and by conjugal transfer of the plasmid to Escherichia coli. Tn5 insertions were obtained by culturing L. pneumophila at the nonpermissive temperature (43 degrees C) on buffered charcoal-yeast extract agar containing kanamycin. Of the 260 kanamycin-resistant colonies picked, 220 failed to conjugate pRK340 to E. coli. Plasmid DNA was not visualized from eight randomly picked Tn5-containing strains, and Southern hybridizations indicated that Tn5, but not pRK340, inserted into multiple sites in the Legionella chromosome. In addition, the streptomycin resistance determinant on Tn5 was expressed in L. pneumophila. Images PMID:2987191

  19. Historical Events That Spawned the Field of Plasmid Biology.


    Kado, Clarence I


    This chapter revisits the historical development and outcome of studies focused on the transmissible, extrachromosomal genetic elements called plasmids. Early work on plasmids involved structural and genetic mapping of these molecules, followed by the development of an understanding of how plasmids replicate and segregate during cell division. The intriguing property of plasmid transmission between bacteria and between bacteria and higher cells has received considerable attention. The utilitarian aspects of plasmids are described, including examples of various plasmid vector systems. This chapter also discusses the functional attributes of plasmids needed for their persistence and survival in nature and in man-made environments. The term plasmid biology was first conceived at the Fallen Leaf Lake Conference on Promiscuous Plasmids, 1990, Lake Tahoe, California. The International Society for Plasmid Biology was established in 2004 (

  20. Immunoassay Analysis of Kanamycin in Serum Using the Tobramycin Kit

    PubMed Central

    Dijkstra, J. A.; Voerman, A. J.; Greijdanus, B.; Touw, D. J.


    Kanamycin is one of the aminoglycosides used in the treatment of multidrug-resistant tuberculosis. Blood concentrations of kanamycin are predictive for the treatment efficacy and the occurrence of side effects, and dose adjustments can be needed to optimize therapy. However, an immunoassay method for the quantification of kanamycin is not commercially available. We modified the existing tobramycin immunoassay to analyze kanamycin. This modified method was tested in a concentration range of 0.3 to 80.0 mg/liter for inaccuracy and imprecision. In addition, the analytical results of the immunoassay method were compared to those obtained by a liquid chromatography-tandem mass spectrometry (LC-MS/MS) analytical method using Passing and Bablok regression. Within-day imprecision varied from 2.3 to 13.3%, and between-day imprecision ranged from 0.0 to 11.3%. The inaccuracy ranged from −5.2 to 7.6%. No significant cross-reactivity with other antimicrobials and antiviral agents was observed. The results of the modified immunoassay method were comparable with the LC-MS/MS analytical outcome. This new immunoassay method enables laboratories to perform therapeutic drug monitoring of kanamycin without the need for complex and expensive LC-MS/MS equipment. PMID:27185806

  1. Discovery of parallel pathways of kanamycin biosynthesis allows antibiotic manipulation.


    Park, Je Won; Park, Sung Ryeol; Nepal, Keshav Kumar; Han, Ah Reum; Ban, Yeon Hee; Yoo, Young Ji; Kim, Eun Ji; Kim, Eui Min; Kim, Dooil; Sohng, Jae Kyung; Yoon, Yeo Joon


    Kanamycin is one of the most widely used antibiotics, yet its biosynthetic pathway remains unclear. Current proposals suggest that the kanamycin biosynthetic products are linearly related via single enzymatic transformations. To explore this system, we have reconstructed the entire biosynthetic pathway through the heterologous expression of combinations of putative biosynthetic genes from Streptomyces kanamyceticus in the non-aminoglycoside-producing Streptomyces venezuelae. Unexpectedly, we discovered that the biosynthetic pathway contains an early branch point, governed by the substrate promiscuity of a glycosyltransferase, that leads to the formation of two parallel pathways in which early intermediates are further modified. Glycosyltransferase exchange can alter flux through these two parallel pathways, and the addition of other biosynthetic enzymes can be used to synthesize known and new highly active antibiotics. These results complete our understanding of kanamycin biosynthesis and demonstrate the potential of pathway engineering for direct in vivo production of clinically useful antibiotics and more robust aminoglycosides.

  2. Reversible neurotoxicity of kanamycin on dorsal cochlear nucleus.


    Fan, Guo-Run; Yin, Ze-Deng; Sun, Yu; Chen, Sen; Zhang, Wen-Juan; Huang, Xiang; Kong, Wei-Jia; Zhang, Hong-Lian


    The time course of aminoglycoside neurotoxic effect on cochlear nucleus is still obscure. We examined dynamic pathological changes of dorsal cochlear nucleus (DCN) and investigated whether apoptosis or autophagy was upregulated in the neurotoxic course of kanamycin on DCN after kanamycin treatment. Rats were treated with kanamycin sulfate/kg/day at a dose of 500mg by subcutaneous injection for 10 days. Dynamic pathological changes, neuron density and neuron apoptosis of the DCN were examined at 1, 7, 14, 28, 56, 70 and 140 days after kanamycin treatment. The expressions of JNK1, DAPK2, Bcl-2, p-Bcl-2, Caspase-3, LC3B and Beclin-1 were also detected. Under transmission electron microscopy, the mitochondrial swelling and focal vacuoles as well as endoplasmic reticulum dilation were progressively aggravated from 1 day to 14 days, and gradually recovered from 28 days to 140 days. Meanwhile, both autophagosomes and autolysosomes were increased from 1 day to 56 days. Only few neurons were positive to the TUNEL staining. Moreover, neither the expressions of caspase-3 and DAPK2 nor neurons density of DCN changed significantly. LC3-II was drastically increased at 7 days. Beclin-1 was upgraded at 1 and 7 days. P-Bcl-2 increased at 1, 7, 14 and 28 days. JNK1 increased at 7 days, and Bcl-2 was downgraded at 140 days. LC3-B positive neurons were increased at 1, 7 and 14 days. These data demonstrated that the neurons damage of the DCN caused by kanamycin was reversible and autophagy was upregulated in the neurotoxic course of kanamycin on DCN through JNK1-mediated phosphorylation of Bcl-2 pathway.

  3. Application of glycodiversification: expedient synthesis and antibacterial evaluation of a library of kanamycin B analogues.


    Li, Jie; Wang, Jinhua; Czyryca, Przemyslaw Greg; Chang, Huiwen; Orsak, Thomas W; Evanson, Richard; Chang, Cheng-Wei Tom


    [reaction: see text] The expedient synthesis of a library of kanamycin B analogues is reported. The revealed SAR will guide future designs in developing kanamycin-type aminoglycoside antibiotics against drug-resistant bacteria.

  4. Novel blaROB-1-Bearing Plasmid Conferring Resistance to β-Lactams in Haemophilus parasuis Isolates from Healthy Weaning Pigs

    PubMed Central

    Moleres, Javier; Santos-López, Alfonso; Lázaro, Isidro; Labairu, Javier; Prat, Cristina; Ardanuy, Carmen; González-Zorn, Bruno


    Haemophilus parasuis, the causative agent of Glässer's disease, is one of the early colonizers of the nasal mucosa of piglets. It is prevalent in swine herds, and lesions associated with disease are fibrinous polyserositis and bronchopneumonia. Antibiotics are commonly used in disease control, and resistance to several antibiotics has been described in H. parasuis. Prediction of H. parasuis virulence is currently limited by our scarce understanding of its pathogenicity. Some genes have been associated with H. parasuis virulence, such as lsgB and group 1 vtaA, while biofilm growth has been associated with nonvirulent strains. In this study, 86 H. parasuis nasal isolates from farms that had not had a case of disease for more than 10 years were obtained by sampling piglets at weaning. Isolates were studied by enterobacterial repetitive intergenic consensus PCR and determination of the presence of lsgB and group 1 vtaA, biofilm formation, inflammatory cell response, and resistance to antibiotics. As part of the diversity encountered, a novel 2,661-bp plasmid, named pJMA-1, bearing the blaROB-1 β-lactamase was detected in eight colonizing strains. pJMA-1 was shown to share a backbone with other small plasmids described in the Pasteurellaceae, to be 100% stable, and to have a lower biological cost than the previously described plasmid pB1000. pJMA-1 was also found in nine H. parasuis nasal strains from a separate collection, but it was not detected in isolates from the lesions of animals with Glässer's disease or in nontypeable Haemophilus influenzae isolates. Altogether, we show that commensal H. parasuis isolates represent a reservoir of β-lactam resistance genes which can be transferred to pathogens or other bacteria. PMID:25747001

  5. In vivo and in vitro cloning and phenotype characterization of tellurite resistance determinant conferred by plasmid pTE53 of a clinical isolate of Escherichia coli.


    Burian, J; Tu, N; Kl'ucár, L; Guller, L; Lloyd-Jones, G; Stuchlík, S; Fejdi, P; Siekel, P; Turna, J


    A determinant encoding resistance against potassium tellurite (Te(r)) was discovered in a clinical isolate of Escherichia coli strain KL53. The strain formed typical black colonies on solid LB medium with tellurite. The determinant was located on a large conjugative plasmid designated pTE53. Electron-dense particles were observed in cells harboring pTE53 by electron microscopy. X-Ray identification analysis identified these deposits as elemental tellurium and X-ray diffraction analysis showed patterns typical of crystalline structures. Comparison with JCPDS 4-0554 (Joint Committee on Powder Diffraction Standards) reference data confirmed that these crystals were pure tellurium crystals. In common with other characterized Te(r) determinants, accumulation studies with radioactively labeled tellurite showed that reduced uptake of tellurite did not contribute to the resistance mechanism. Tellurite accumulation rates for E. coli strain AB1157 harboring pTE53 were twice higher than for the plasmid-free host strain. In addition, no efflux mechanism was detected. The potassium tellurite resistance determinant of plasmid pTE53 was cloned using both in vitro and in vivo techniques in low-copy-number vectors pACYC184 and mini-Mu derivative pPR46. Cloning of the functional Te(r) determinant into high-copy cloning vectors pTZ19R and mini-Mu derivatives pBEf and pJT2 was not successful. During in vivo cloning experiments, clones with unusual "white colony" phenotypes were found on solid LB with tellurite. All these clones were Mucts62 lysogens. Their tellurite resistance levels were in the same order as the wild type strains. Clones with the "white" phenotype had a 3.6 times lower content of tellurium than the tellurite-reducing strain. Transformation of a "white" mutant with a recombinant pACYC184 based Te(r) plasmid did not change the phenotype. However, when one clone was cured from Mucts62 the "white" phenotype reverted to the wild-type "black" phenotype. It was suggested

  6. High level of cross-resistance between kanamycin, amikacin, and capreomycin among Mycobacterium tuberculosis isolates from Georgia and a close relation with mutations in the rrs gene.


    Jugheli, Levan; Bzekalava, Nino; de Rijk, Pim; Fissette, Krista; Portaels, Françoise; Rigouts, Leen


    The aminoglycosides kanamycin and amikacin and the macrocyclic peptide capreomycin are key drugs for the treatment of multidrug-resistant tuberculosis (MDR-TB). The increasing rates of resistance to these drugs and the possible cross-resistance between them are concerns for MDR-TB therapy. Mutations in the 16S rRNA gene (rrs) have been associated with resistance to each of the drugs, and mutations of the tlyA gene, which encodes a putative rRNA methyltransferase, are thought to confer capreomycin resistance in Mycobacterium tuberculosis bacteria. Studies of possible cross-resistance have shown variable results. In this study, the MICs of these drugs for 145 clinical isolates from Georgia and the sequences of the rrs and tlyA genes of the isolates were determined. Of 78 kanamycin-resistant strains, 9 (11.5%) were susceptible to amikacin and 16 (20.5%) were susceptible to capreomycin. Four strains were resistant to capreomycin but were susceptible to the other drugs, whereas all amikacin-resistant isolates were resistant to kanamycin. Sequencing revealed six types of mutations in the rrs gene (A514C, C517T, A1401G, C1402T, C1443G, T1521C) but no mutations in the tlyA gene. The A514C, C517T, C1443G, and T1521C mutations showed no association with resistance to any of the drugs. The A1401G and C1402T mutations were observed in 65 kanamycin-resistant isolates and the 4 capreomycin-resistant isolates, respectively, whereas none of the susceptible isolates showed either of those mutations. The four mutants with the C1402T mutations showed high levels of resistance to capreomycin but no resistance to kanamycin and amikacin. Detection of the A1401G mutation appeared to be 100% specific for the detection of resistance to kanamycin and amikacin, while the sensitivities reached 85.9% and 94.2%, respectively.

  7. 21 CFR 524.1204 - Kanamycin sulfate, calcium amphomycin, and hydrocortisone acetate.

    Code of Federal Regulations, 2011 CFR


    ... 21 Food and Drugs 6 2011-04-01 2011-04-01 false Kanamycin sulfate, calcium amphomycin, and... DOSAGE FORM NEW ANIMAL DRUGS § 524.1204 Kanamycin sulfate, calcium amphomycin, and hydrocortisone acetate... or cream contains: 5.0 milligrams of kanamycin activity as the sulfate, 5.0 milligrams of...

  8. 21 CFR 524.1204 - Kanamycin sulfate, calcium amphomycin, and hydrocortisone acetate.

    Code of Federal Regulations, 2012 CFR


    ... 21 Food and Drugs 6 2012-04-01 2012-04-01 false Kanamycin sulfate, calcium amphomycin, and... DOSAGE FORM NEW ANIMAL DRUGS § 524.1204 Kanamycin sulfate, calcium amphomycin, and hydrocortisone acetate... or cream contains: 5.0 milligrams of kanamycin activity as the sulfate, 5.0 milligrams of...

  9. 21 CFR 524.1204 - Kanamycin sulfate, calcium amphomycin, and hydrocortisone acetate.

    Code of Federal Regulations, 2013 CFR


    ... 21 Food and Drugs 6 2013-04-01 2013-04-01 false Kanamycin sulfate, calcium amphomycin, and... DOSAGE FORM NEW ANIMAL DRUGS § 524.1204 Kanamycin sulfate, calcium amphomycin, and hydrocortisone acetate... or cream contains: 5.0 milligrams of kanamycin activity as the sulfate, 5.0 milligrams of...

  10. Emergence of tetracycline resistance due to a multiple drug resistance plasmid in Vibrio cholerae O139.


    Yamamoto, T; Nair, G B; Takeda, Y


    Of the 173 clinical strains of Vibrio cholerae O139 isolated from India, Bangladesh, and Thailand tested, six strains from India were resistant to tetracycline, ampicillin, chloramphenicol, kanamycin, and gentamicin. These six strains harbored a self-transmissible plasmid that mediated resistance to tetracycline, ampicillin, chloramphenicol, kanamycin, gentamicin, sulfamethoxazole, trimethoprim, and O/129. The multiple drug resistance plasmids were 200 kb in size and belonged to the incompatibility group C. Although a majority of the O139 strains (94.8%) were highly resistant to streptomycin, sulfamethoxazole, trimethoprim, and O/129, the tetracycline-susceptible strains so far tested were plasmid-negative. The data suggest the existence of two distinct multiple antimicrobial agent resistance (MAR) patterns in V. cholerae O139.

  11. Pheromone-responsive conjugative vancomycin resistance plasmids in Enterococcus faecalis isolates from humans and chicken feces.


    Lim, Suk-Kyung; Tanimoto, Koichi; Tomita, Haruyoshi; Ike, Yasuyoshi


    The drug resistances and plasmid contents of a total of 85 vancomycin-resistant enterococcus (VRE) strains that had been isolated in Korea were examined. Fifty-four of the strains originated from samples of chicken feces, and 31 were isolated from hospital patients in Korea. Enterococcus faecalis KV1 and KV2, which had been isolated from a patient and a sample of chicken feces, respectively, were found to carry the plasmids pSL1 and pSL2, respectively. The plasmids transferred resistances to vancomycin, gentamicin, kanamycin, streptomycin, and erythromycin to E. faecalis strains at a high frequency of about 10(-3) per donor cell during 4 hours of broth mating. E. faecalis strains containing each of the pSL plasmids formed clumps after 2 hours of incubation in broth containing E. faecalis FA2-2 culture filtrate (i.e., the E. faecalis sex pheromone), and the plasmid subsequently transferred to the recipient strain in a 10-min short mating in broth, indicating that the plasmids are responsive to E. faecalis pheromones. The pSL plasmids did not respond to any of synthetic pheromones for the previously characterized plasmids. The pheromone specific for pSL plasmids has been designated cSL1. Southern hybridization analysis showed that specific FspI fragments from each of the pSL plasmids hybridized with the aggregation substance gene (asa1) of the pheromone-responsive plasmid pAD1, indicating that the plasmids had a gene homologous to asa1. The restriction maps of the plasmids were identical, and the size of the plasmids was estimated to be 128.1 kb. The plasmids carried five drug resistance determinants for vanA, ermB, aph(3'), aph(6'), and aac(6')/aph(2'), which encode resistance to vancomycin, erythromycin, kanamycin, streptomycin, and gentamicin/kanamycin, respectively. Nucleotide sequence analyses of the drug resistance determinants and their flanking regions are described in this report. The results described provide evidence for the exchange of genetic information

  12. Isolation and screening of plasmids from the epilithon which mobilize recombinant plasmid pD10

    SciTech Connect

    Hill, K.E.; Weightman, A.J.; Fry, J.C. )


    This study examined the potential of bacteria from river epilithon to mobilize a recombinant catabolic plasmid, pD10, encoding 3-chlorobenzoate degradation and kanamycin resistance. Fifty-four mobilizing plasmids were exogenously isolated by triparental matings between strains of Pseudomonas putida and epilithic bacteria from the River Taff (South Wales, United Kingdom). Frequencies for mobilization ranged from 1.7 {times} 10{sup {minus}8} to 4.5 {times} 10{sup {minus}3} per recipient at 20C. The sizes of the mobilizing plasmids isolated ranged from 40 kb to over 200 kb, and 19 of 54 were found to encode mercury resistance. Plasmid-encoded resistance from 40 kb to over 200 kb, and 19 of 54 were found to encode mercury resistance. Plasmid-encoded resistance to tetracycline and streptomycin was also found but not resistance to UV light or various heavy metals. Eight plasmids of epilithic bacteria, analyzed by comparing restriction fragmentation patterns, showed significant differences between those isolated from different independent matings. Optimal temperatures for mobilization of pD10 were between 15 and 25C. Four mercury resistance plasmids were found to be broad host range, transferring mercury resistance and mobilizing pD10 readily to representative species of {beta}- and {gamma}-purple bacteria. In general, frequencies of pD10 mobilization by plasmids of epilithic bacteria were 2 to 3 orders of magnitude lower than conjugal transfer frequencies. Thus, there is a high potential for exchange of recombinant genes introduced into the epilithon by mobilization between a variety of bacterial species.

  13. Regeneration of Medicago truncatula from protoplasts isolated from kanamycin-sensitive and kanamycin-resistant plants.


    Rose, R J; Nolan, K E


    Medicago truncatula (barrel medic) is an annual legume of agricultural and biological interest. In this report regeneration from isolated mesophyll protoplasts is described. A specifically developed, highly regenerable seed line is essential for regeneration. Other critical requirements for regeneration are the starting plant material, the use of agarose droplets incubated in a shallow layer of liquid medium, and protoplast density. Plants are grown in controlled environment conditions. Protoplasts are purified using a Percoll-based flotation procedure, then embedded in 100 μl agarose droplets containing a basal medium plus 25 μM NAA and 4 μM BAP (the same medium as in the surrounding shallow liquid layer) to induce protoplast division. A protoplast density of 6-8×10(5) ml(-1) is required for maximum colony formation. M. truncatula plants previously transformed for kanamycin resistance yielded embryogenic callus and also regenerated plants. Protoplasts from other annual Medicago (M.intertexta and M.scutellata) species readily form calli by the procedure we have described.

  14. blaCMY-2-positive IncA/C plasmids from Escherichia coli and Salmonella enterica are a distinct component of a larger lineage of plasmids.


    Call, Douglas R; Singer, Randall S; Meng, Da; Broschat, Shira L; Orfe, Lisa H; Anderson, Janet M; Herndon, David R; Kappmeyer, Lowell S; Daniels, Joshua B; Besser, Thomas E


    Large multidrug resistance plasmids of the A/C incompatibility complex (IncA/C) have been found in a diverse group of Gram-negative commensal and pathogenic bacteria. We present three completed sequences from IncA/C plasmids that originated from Escherichia coli (cattle) and Salmonella enterica serovar Newport (human) and that carry the cephamycinase gene blaCMY-2. These large plasmids (148 to 166 kbp) share extensive sequence identity and synteny. The most divergent plasmid, peH4H, has lost several conjugation-related genes and has gained a kanamycin resistance region. Two of the plasmids (pAM04528 and peH4H) harbor two copies of blaCMY-2, while the third plasmid (pAR060302) harbors a single copy of the gene. The majority of single-nucleotide polymorphisms comprise nonsynonymous mutations in floR. A comparative analysis of these plasmids with five other published IncA/C plasmids showed that the blaCMY-2 plasmids from E. coli and S. enterica are genetically distinct from those originating from Yersinia pestis and Photobacterium damselae and distal to one originating from Yersinia ruckeri. While the overall similarity of these plasmids supports the likelihood of recent movements among E. coli and S. enterica hosts, their greater divergence from Y. pestis or Y. ruckeri suggests less recent plasmid transfer among these pathogen groups.

  15. Complete nucleotide sequence of plasmid pNA6 reveals the high plasticity of IncU family plasmids.


    Dang, Bingjun; Xu, Yan; Mao, Daqing; Luo, Yi


    Antibiotic resistance is a serious problem in health care and is of widespread public concern. Conjugative plasmids are the most important vectors in the dissemination of antibiotic resistance genes. In this study, we determined the complete sequence of plasmid pNA6, a plasmid which was isolated from the sediments of Haihe River. This plasmid confers reduced susceptibility to ampicillin, erythromycin and sulfamethoxazole. The complete sequence of plasmid pNA6 was 52,210bp in length with an average G+C content of 52.70%. Plasmid pNA6 belongs to the IncU group by sequence queries against the GenBank database. This plasmid has a typical IncU backbone and shows the highest similarities with plasmid RA3 and plasmid pFBAOT6. Plasmid pNA6 carries a class 1 integron consisting of aacA4, ereA and dfrA1 genes. Moreover, plasmid pNA6 also harbors a blaTEM-1-containing complex structure which inserted into the replication region and maintenance region. This insertion site has never been found on other IncU plasmids. The sequencing of plasmid pNA6 will add new sequence information to IncU family plasmids and enhance our understanding of the plasticity of IncU family plasmids.


    Technology Transfer Automated Retrieval System (TEKTRAN)

    Enterohemorrhagic Escherichia coli (EHEC) O157:H7 (strain 86-24) harbors a 3.3 kb, cryptic plasmid (pSP70) that does not encode a selectable phenotype. A transposon (Tn) encoding kanamycin resistance (Kan**r) was inserted by in vitro transposon mutagenesis at a random location on pSP70 to construct...

  17. Plasmids in diatom species.

    PubMed Central

    Hildebrand, M; Corey, D K; Ludwig, J R; Kukel, A; Feng, T Y; Volcani, B E


    We have discovered plasmids in 5 of 18 diatom species surveyed. In several species, more than one type of plasmid is present. Several of the plasmids show similarity by hybridization previously characterized plasmids in Cylindrotheca fusiformis (J. D. Jacobs et al., unpublished data). Additionally, there is similarity between the plasmids found in C. fusiformis and chloroplast DNA in three diatom species. These results add to the evidence that the plasmids have features of mobile genetic elements. Images PMID:1885558

  18. Gold nanoparticle-based colorimetric detection of kanamycin using a DNA aptamer.


    Song, Kyung-Mi; Cho, Minseon; Jo, Hunho; Min, Kyoungin; Jeon, Sung Ho; Kim, Taisun; Han, Min Su; Ku, Ja Kang; Ban, Changill


    A selective kanamycin-binding single-strand DNA (ssDNA) aptamer (TGGGGGTTGAGGCTAAGCCGA) was discovered through in vitro selection using affinity chromatography with kanamycin-immobilized sepharose beads. The selected aptamer has a high affinity for kanamycin and also for kanamycin derivatives such as kanamycin B and tobramycin. The dissociation constants (K(d) [kanamycin]=78.8 nM, K(d) [kanamycin B]=84.5 nM, and K(d) [tobramycin]=103 nM) of the new aptamer were determined by fluorescence intensity analysis using 5'-fluorescein amidite (FAM) modification. Using this aptamer, kanamycin was detected down to 25 nM by the gold nanoparticle-based colorimetric method. Because the designed colorimetric method is simple, easy, and visible to the naked eye, it has advantages that make it useful for the detection of kanamycin. Furthermore, the selected new aptamer has many potential applications as a bioprobe for the detection of kanamycin, kanamycin B, and tobramycin in pharmaceutical preparations and food products.

  19. Plasmid incidence in bacteria from deep subsurface sediments

    SciTech Connect

    Fredrickson, J.K.; Hicks, R.J.; Li, S.W.; Brockman, F.J. )


    Bacteria were isolated from deep terrestrial subsurface sediments underlying the coastal plain of South Carolina. A total of 163 isolates from deep sediments, surface soil, and return drill muds were examined for plasmid DNA content and resistance to the antibiotics penicillin, ampicillin, carbenicillin, streptomycin, kanamycin, and tetracycline. MICs of Cu{sup 2+}, Cr{sup 3+}, and Hg{sup 2+} for each isolate were also determined. The overall frequency of plasmid occurrence in the subsurface bacteria was 33%. Resistance was most frequent to penicillin (70% of all isolates), ampicillin (49%), and carbenicillin (32%) and was concluded to be related to the concentrations of the individual antibiotics in the disks used for assaying resistance and to the production of low levels of {beta}-lactamase. The frequencies of resistance to penicillin and ampicillin were significantly greater for isolates bearing plasmids than for plasmidless isolates; however, resistance was not transferable to penicillin-sensitive Escherichia coli. Hybridization of subsurface bacterial plasmids and chromosomal DNA with a whole-TOL-plasmid (pWWO) probe revealed some homology of subsurface bacterial plasmid and chromosomal DNAs, indicating a potential for those bacterial to harbor catabolic genes on plasmids or chromosomes. The incidences of antibiotic resistance and MICs of metals for subsurface bacteria were significantly different from those drill mud bacteria, ruling out the possibility that bacteria from sediments were derived from drill muds.

  20. RNA-Seq Analysis of the Effect of Kanamycin and the ABC Transporter AtWBC19 on Arabidopsis thaliana Seedlings Reveals Changes in Metal Content

    PubMed Central

    Mentewab, Ayalew; Matheson, Kinnari; Adebiyi, Morayo; Robinson, Shanice; Elston, Brianna


    Plants are exposed to antibiotics produced by soil microorganisms, but little is known about their responses at the transcriptional level. Likewise, few endogenous mechanisms of antibiotic resistance have been reported. The Arabidopsis thaliana ATP Binding Cassette (ABC) transporter AtWBC19 (ABCG19) is known to confer kanamycin resistance, but the exact mechanism of resistance is not well understood. Here we examined the transcriptomes of control seedlings and wbc19 mutant seedlings using RNA-seq analysis. Exposure to kanamycin indicated changes in the organization of the photosynthetic apparatus, metabolic fluxes and metal uptake. Elemental analysis showed a 60% and 80% reduction of iron uptake in control and wbc19 mutant seedlings respectively, upon exposure to kanamycin. The drop in iron content was accompanied by the upregulation of the gene encoding for FERRIC REDUCTION OXIDASE 6 (FRO6) in mutant seedlings but not by the differential expression of other transport genes known to be induced by iron deficiency. In addition, wbc19 mutants displayed a distinct expression profile in the absence of kanamycin. Most notably the expression of several zinc ion binding proteins, including ZINC TRANSPORTER 1 PRECURSOR (ZIP1) was increased, suggesting abnormal zinc uptake. Elemental analysis confirmed a 50% decrease of zinc content in wbc19 mutants. Thus, the antibiotic resistance gene WBC19 appears to also have a role in zinc uptake. PMID:25310285

  1. RNA-seq analysis of the effect of kanamycin and the ABC transporter AtWBC19 on Arabidopsis thaliana seedlings reveals changes in metal content.


    Mentewab, Ayalew; Matheson, Kinnari; Adebiyi, Morayo; Robinson, Shanice; Elston, Brianna


    Plants are exposed to antibiotics produced by soil microorganisms, but little is known about their responses at the transcriptional level. Likewise, few endogenous mechanisms of antibiotic resistance have been reported. The Arabidopsis thaliana ATP Binding Cassette (ABC) transporter AtWBC19 (ABCG19) is known to confer kanamycin resistance, but the exact mechanism of resistance is not well understood. Here we examined the transcriptomes of control seedlings and wbc19 mutant seedlings using RNA-seq analysis. Exposure to kanamycin indicated changes in the organization of the photosynthetic apparatus, metabolic fluxes and metal uptake. Elemental analysis showed a 60% and 80% reduction of iron uptake in control and wbc19 mutant seedlings respectively, upon exposure to kanamycin. The drop in iron content was accompanied by the upregulation of the gene encoding for FERRIC REDUCTION OXIDASE 6 (FRO6) in mutant seedlings but not by the differential expression of other transport genes known to be induced by iron deficiency. In addition, wbc19 mutants displayed a distinct expression profile in the absence of kanamycin. Most notably the expression of several zinc ion binding proteins, including ZINC TRANSPORTER 1 PRECURSOR (ZIP1) was increased, suggesting abnormal zinc uptake. Elemental analysis confirmed a 50% decrease of zinc content in wbc19 mutants. Thus, the antibiotic resistance gene WBC19 appears to also have a role in zinc uptake.

  2. Characterization of aminoglycoside-modifying enzymes in enterobacteriaceae clinical strains and characterization of the plasmids implicated in their diffusion.


    Miró, Elisenda; Grünbaum, Federico; Gómez, Laura; Rivera, Alba; Mirelis, Beatriz; Coll, Pere; Navarro, Ferran


    A total of 788 clinical Enterobacteriaceae were collected to describe the aminoglycoside-modifying genes (AME genes) and to characterize the plasmids that carry these genes. Among the 788 strains collected, 330 (41.8%) were aminoglycoside-resistant: 264 Escherichia coli (80%), 33 Proteus mirabilis (10%), 10 Klebsiella pneumoniae (3%), six K. oxytoca (1.8%), five Enterobacter cloacae (1.5%), three Morganella morganii (0.9%), three Providencia stuartii (0.9%), two Salmonella enterica (0.6%), and one each Citrobacter freundii, C. koseri, Proteus vulgaris, and Shigella sonnei. The most affected aminoglycoside was streptomycin (92.7%), followed by kanamycin (26.3%), gentamicin (18%), tobramycin (16.9%), netilmicin (3.6%), and amikacin (1.5%). The AME genes found were aph(3″)-Ib (65.4%), ant(3″)-Ia (37.5%), aph(3')-Ia (13.9%), aac(3)-IIa (12.4%), aac(6')-Ib (4.2%), ant(2″)-Ia (3.6%), and aph(3')-IIa (1.2%). Thirty-four percent of the strains showed more than one enzyme. The most frequent association was ant(3″)-Ia plus aph(3″)-Ib (35 strains). From 66 selected AME genes, 24 were plasmid located: 12 aac(3)-IIa, six aph(3')-Ia, three ant(3″)-Ia, two ant(2″)-Ia, and one aac(6')-Ib. These genes were located in plasmids belonging to incompatibility groups F, FIA, FIB, or HI2. In conclusion, the AME genes involved in aminoglycoside-clinical resistance were aac(3)-IIa, aac(6')-Ib, and ant(2″)-Ia, genes that confer resistance to tobramycin, gentamicin, and amikacin.

  3. Small-plasmid-mediated antibiotic resistance is enhanced by increases in plasmid copy number and bacterial fitness.


    San Millan, Alvaro; Santos-Lopez, Alfonso; Ortega-Huedo, Rafael; Bernabe-Balas, Cristina; Kennedy, Sean P; Gonzalez-Zorn, Bruno


    Plasmids play a key role in the horizontal spread of antibiotic resistance determinants among bacterial pathogens. When an antibiotic resistance plasmid arrives in a new bacterial host, it produces a fitness cost, causing a competitive disadvantage for the plasmid-bearing bacterium in the absence of antibiotics. On the other hand, in the presence of antibiotics, the plasmid promotes the survival of the clone. The adaptations experienced by plasmid and bacterium in the presence of antibiotics during the first generations of coexistence will be crucial for the progress of the infection and the maintenance of plasmid-mediated resistance once the treatment is over. Here we developed a model system using the human pathogen Haemophilus influenzae carrying the small plasmid pB1000 conferring resistance to β-lactam antibiotics to investigate host and plasmid adaptations in the course of a simulated ampicillin therapy. Our results proved that plasmid-bearing clones compensated for the fitness disadvantage during the first 100 generations of plasmid-host adaptation. In addition, ampicillin treatment was associated with an increase in pB1000 copy number. The augmentation in both bacterial fitness and plasmid copy number gave rise to H. influenzae populations with higher ampicillin resistance levels. In conclusion, we show here that the modulations in bacterial fitness and plasmid copy number help a plasmid-bearing bacterium to adapt during antibiotic therapy, promoting both the survival of the host and the spread of the plasmid.

  4. Kanamycin Resistance Cassette for Genetic Manipulation of Treponema denticola.


    Li, Yuebin; Ruby, John; Wu, Hui


    Treponema denticola has been recognized as an important oral pathogen of the "red complex" bacterial consortium that is associated with the pathogenesis of endodontal and periodontal diseases. However, little is known about the virulence of T. denticola due to its recalcitrant genetic system. The difficulty in genetically manipulating oral spirochetes is partially due to the lack of antibiotic resistance cassettes that are useful for gene complementation following allelic replacement mutagenesis. In this study, a kanamycin resistance cassette was identified and developed for the genetic manipulation of T. denticola ATCC 35405. Compared to the widely used ermF-ermAM cassette, the kanamycin cassette used in the transformation experiments gave rise to additional antibiotic-resistant T. denticola colonies. The kanamycin cassette is effective for allelic replacement mutagenesis as demonstrated by inactivation of two open reading frames of T. denticola, TDE1430 and TDE0911. In addition, the cassette is also functional in trans-chromosomal complementation. This was determined by functional rescue of a periplasmic flagellum (PF)-deficient mutant that had the flgE gene coding for PF hook protein inactivated. The integration of the full-length flgE gene into the genome of the flgE mutant rescued all of the defects associated with the flgE mutant that included the lack of PF filament and spirochetal motility. Taken together, we demonstrate that the kanamycin resistance gene is a suitable cassette for the genetic manipulation of T. denticola that will facilitate the characterization of virulence factors attributed to this important oral pathogen.

  5. Plasmid DNA manufacturing technology.


    Carnes, Aaron E; Williams, James A


    Today, plasmid DNA is becoming increasingly important as the next generation of biotechnology products (gene medicines and DNA vaccines) make their way into clinical trials, and eventually into the pharmaceutical marketplace. This review summarizes recent patents and patent applications relating to plasmid manufacturing, in the context of a comprehensive description of the plasmid manufacturing intellectual property landscape. Strategies for plasmid manufacturers to develop or in-license key plasmid manufacturing technologies are described with the endpoint of efficiently producing kg quantities of plasmid DNA of a quality that meets anticipated European and FDA quality specifications for commercial plasmid products.

  6. Transformation of heat-treated Clostridium acetobutylicum protoplasts with pUB110 plasmid DNA

    SciTech Connect

    Lin, Y.L.; Blaschek, H.P.


    Heat treatment of Clostridium acetobutylicum SA-1 protoplasts at 55/sup 0/C for 15 min before transformation resulted in expression in this microorganism of the kanamycin resistance determinant associated with plasmid pUB110. No heat treatment, or heat treatment at 65 or 44/sup 0/C for various time intervals, resulted in no kanamycin resistance transformants being recovered on selective kanamycin-containing regeneration medium. DNase plate assay indicated that treatment at 55/sup 0/C for 15 min completely inactivated the DNase activity associated with SA-1 protoplasts. Treatment of protoplasts at 65 or 55/sup 0/C for various periods under simulated transformation conditions had an inhibitory effect, although prolonged treatment at 55 or 44/sup 0/C appeared to stimulate DNase activity. Inactivation of protoplast-associated DNase activity by heat treatment at 55/sup 0/C for 15 min correlated with successful expression of kanamycin resistance and suggests that an extremely active, heat-sensitive, protoplast-associated DNase may be a factor in the polyethylene glycol-induced transformation of C. acetobutylicum SA-1 protoplasts. Plasmid pUB110 DNA was isolated from C. acetobutylicum SA-1 kanamycin-resistant (Km/sup r/) transformant cultures by a modification of the procedure used for C. perfringens plasmids. Detection of pUB110 DNA was possible only when diethyl pyrocarbonate was incorporated into isolation protocols to inactivate DNase activity. Restriction studies further verified the presence of pUB110 DNA in C. acetobutylicum SA-1 Km/sup r/ transformants. 36 references, 4 figures, 1 table.

  7. Isolation by genetic labeling of a new mycobacterial plasmid, pJAZ38, from Mycobacterium fortuitum.

    PubMed Central

    Gavigan, J A; Aínsa, J A; Pérez, E; Otal, I; Martín, C


    In a two-step mating experiment with recipient strains of Mycobacterium smegmatis, the Mycobacterium fortuitum cryptic plasmid pJAZ38 was isolated. Plasmid pJAZ38 was genetically labeled by cointegration formation mediated by the kanamycin-resistant mycobacterial transposon Tn611. The region responsible for replication of pJAZ38 was located and sequenced. This region showed homology with the Mycobacterium avium plasmid pLR7 and the Mycobacterium scrofulaceum plasmid pMSC262, a family of plasmids which have been found to be widespread throughout the mycobacteria. Further experiments showed pJAZ38 to be stably inherited in the absence of selection pressure and compatible with the most commonly used mycobacterial replicon, pAL5000. In contrast to pLR7 and pMSC262, pJAZ38 was able to replicate in M. smegmatis mc(2)155, making it a useful tool for mycobacterial genetics. PMID:9209023

  8. High-frequency transformation of Brevibacterium lactofermentum protoplasts by plasmid DNA.


    Santamaria, R I; Gil, J A; Martin, J F


    An efficient polyethylene glycol-assisted method for transformation of Brevibacterium lactofermentum protoplasts that uses plasmid vectors has been developed. Two small plasmids, pUL330 (5.2 kilobases) and pUL340 (5.8 kilobases), both containing the kanamycin resistance gene from transposon Tn5 and the replication origin of the natural plasmid pBL1 of B. lactofermentum, were selected as vectors. Supercoiled forms of the plasmids yielded a 100-fold higher transformation frequency than did linear forms. The optimal transformation frequency was achieved with 10 ng of DNA in 1 ml of transformation buffer. Higher concentrations of plasmid DNA resulted in a decrease in transformation frequency per microgram of DNA. Optimal transformation was obtained with 25 to 35% polyethylene glycol 6000. Under optimal conditions, 10(6) transformants per microgram of DNA were obtained.

  9. Plasmids from Euryarchaeota.


    Forterre, Patrick; Krupovic, Mart; Raymann, Kasie; Soler, Nicolas


    Many plasmids have been described in Euryarchaeota, one of the three major archaeal phyla, most of them in salt-loving haloarchaea and hyperthermophilic Thermococcales. These plasmids resemble bacterial plasmids in terms of size (from small plasmids encoding only one gene up to large megaplasmids) and replication mechanisms (rolling circle or theta). Some of them are related to viral genomes and form a more or less continuous sequence space including many integrated elements. Plasmids from Euryarchaeota have been useful for designing efficient genetic tools for these microorganisms. In addition, they have also been used to probe the topological state of plasmids in species with or without DNA gyrase and/or reverse gyrase. Plasmids from Euryarchaeota encode both DNA replication proteins recruited from their hosts and novel families of DNA replication proteins. Euryarchaeota form an interesting playground to test evolutionary hypotheses on the origin and evolution of viruses and plasmids, since a robust phylogeny is available for this phylum. Preliminary studies have shown that for different plasmid families, plasmids share a common gene pool and coevolve with their hosts. They are involved in gene transfer, mostly between plasmids and viruses present in closely related species, but rarely between cells from distantly related archaeal lineages. With few exceptions (e.g., plasmids carrying gas vesicle genes), most archaeal plasmids seem to be cryptic. Interestingly, plasmids and viral genomes have been detected in extracellular membrane vesicles produced by Thermococcales, suggesting that these vesicles could be involved in the transfer of viruses and plasmids between cells.

  10. Loss of plasmids containing cloned inserts coding for novobiocin resistance or novobiocin sensitivity in Haemophilus influenzae

    SciTech Connect

    Setlow, J.K.; Spikes, D.; Ledbetter, M.


    Plasmids pNov1 and pNov1s, coding for resistance and sensitivity to novobiocin, respectively, were readily lost from wild-type Haemophilus influenzae but retained in a strain lacking an inducible defective prophage. The plasmid loss could be partly or wholly eliminated by a low-copy-number mutation in the plasmid or by the presence of certain antibiotic resistance markers in the host chromosome. Release of both phage HP1c1, measured by plaque assay, and defective phage, measured by electron microscopy, was increased when the plasmids were present. The frequency of recombination between pNov1 and the chromosome, causing the plasmid to be converted to pNov1s, could under some circumstances be decreased from the normal 60 to 70% to below 10% by the presence of a kanamycin resistance marker in the chromosome. This suggested that a gene product coded for by the plasmid, the expression of which was affected by the kanamycin resistance marker, was responsible for the high recombination frequency. Evidence was obtained from in vitro experiments that the gene product was a gyrase.

  11. Biology of the staphylococcal conjugative multiresistance plasmid pSK41.


    Liu, Michael A; Kwong, Stephen M; Jensen, Slade O; Brzoska, Anthony J; Firth, Neville


    Plasmid pSK41 is a large, low-copy-number, conjugative plasmid from Staphylococcus aureus that is representative of a family of staphylococcal plasmids that confer multiple resistances to a wide range of antimicrobial agents. The plasmid consists of a conserved plasmid backbone containing the genes for plasmid housekeeping functions, which is punctuated by copies of IS257 that flank a Tn4001-hybrid structure and cointegrated plasmids that harbour resistance genes. This review summarises the current understanding of the biology of pSK41, focussing on the systems responsible for its replication, maintenance and transmission, and their regulation.

  12. Exposing Plasmids as the Achilles’ Heel of Drug-Resistant Bacteria

    PubMed Central

    Williams, Julia J.; Hergenrother, Paul J.


    Many multi-drug resistant bacterial pathogens harbor large plasmids that encode proteins conferring resistance to antibiotics. While the acquisition of these plasmids often enables bacteria to survive in the presence of antibiotics, it is possible that plasmids also represent a vulnerability that can be exploited in tailored antibacterial therapy. This review highlights three recently described strategies designed to specifically combat bacteria harboring such plasmids: Inhibition of plasmid conjugation, inhibition of plasmid replication, and exploitation of plasmid-encoded toxin-antitoxin systems. PMID:18625335

  13. Novel Plasmid-Borne Multidrug Resistance Gene Cluster Including lsa(E) from a Linezolid-Resistant Enterococcus faecium Isolate of Swine Origin

    PubMed Central

    Si, Hongbin; Zhang, Wan-Jiang; Chu, Shengbo; Wang, Xiu-Mei; Dai, Lei; Hua, Xin; Dong, Zhimin


    A novel nonconjugative plasmid of 28,489 bp from a porcine linezolid-resistant Enterococcus faecium isolate was completely sequenced. This plasmid harbored a novel type of multiresistance gene cluster that comprised the resistance genes lnu(B), lsa(E), spw, aadE, aphA3, and two copies of erm(B), which account for resistance to macrolides, lincosamides, streptogramins, pleuromutilins, streptomycin, spectinomycin, and kanamycin/neomycin. Structural comparisons suggested that this plasmid might have developed from other enterococcal plasmids by insertion element (IS)-mediated interplasmid recombination processes. PMID:26324271

  14. Plasmid diversity in neisseriae.


    van Passel, Mark W J; van der Ende, Arie; Bart, Aldert


    Horizontal gene transfer constitutes an important force in prokaryotic genome evolution, and it is well-known that plasmids are vehicles for DNA transfer. Chromosomal DNA is frequently exchanged between pathogenic and commensal neisseriae, but relatively little is known about plasmid diversity and prevalence among these nasopharyngeal inhabitants. We investigated the plasmid contents of 18 Neisseria lactamica isolates and 20 nasopharyngeal Neisseria meningitidis isolates. Of 18 N. lactamica strains, 9 harbored one or more plasmids, whereas only one N. meningitidis isolate contained a plasmid. Twelve plasmids were completely sequenced, while five plasmid sequences from the public databases were also included in the analyses. On the basis of nucleic acid sequences, mobilization, and replicase protein alignments, we distinguish six different plasmid groups (I to VI). Three plasmids from N. lactamica appeared to be highly similar on the nucleotide level to the meningococcal plasmids pJS-A (>99%) and pJS-B (>75%). The genetic organizations of two plasmids show a striking resemblance with that of the recently identified meningococcal disease-associated (MDA) phage, while four putative proteins encoded by these plasmids show 25% to 39% protein identity to those encoded by the MDA phage. The putative promoter of the gene encoding the replicase on these plasmids contains a polycytidine tract, suggesting that replication is subjected to phase variation. In conclusion, extensive plasmid diversity is encountered among commensal neisseriae. Members of three plasmid groups are found in both pathogenic and commensal neisseriae, indicating plasmid exchange between these species. Resemblance between plasmids and MDA phage may be indicative of dissemination of phage-related sequences among pathogenic and commensal neisseriae.

  15. 21 CFR 524.1200 - Kanamycin ophthalmic and topical dosage forms.

    Code of Federal Regulations, 2013 CFR


    ... 21 Food and Drugs 6 2013-04-01 2013-04-01 false Kanamycin ophthalmic and topical dosage forms. 524.1200 Section 524.1200 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN... ANIMAL DRUGS § 524.1200 Kanamycin ophthalmic and topical dosage forms....

  16. 21 CFR 524.1200 - Kanamycin ophthalmic and topical dosage forms.

    Code of Federal Regulations, 2011 CFR


    ... 21 Food and Drugs 6 2011-04-01 2011-04-01 false Kanamycin ophthalmic and topical dosage forms. 524.1200 Section 524.1200 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN... ANIMAL DRUGS § 524.1200 Kanamycin ophthalmic and topical dosage forms....

  17. 21 CFR 524.1200 - Kanamycin ophthalmic and topical dosage forms.

    Code of Federal Regulations, 2010 CFR


    ... 21 Food and Drugs 6 2010-04-01 2010-04-01 false Kanamycin ophthalmic and topical dosage forms. 524.1200 Section 524.1200 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN... ANIMAL DRUGS § 524.1200 Kanamycin ophthalmic and topical dosage forms....

  18. 21 CFR 524.1200 - Kanamycin ophthalmic and topical dosage forms.

    Code of Federal Regulations, 2012 CFR


    ... 21 Food and Drugs 6 2012-04-01 2012-04-01 false Kanamycin ophthalmic and topical dosage forms. 524.1200 Section 524.1200 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN... ANIMAL DRUGS § 524.1200 Kanamycin ophthalmic and topical dosage forms....

  19. 21 CFR 524.1200 - Kanamycin ophthalmic and topical dosage forms.

    Code of Federal Regulations, 2014 CFR


    ... 21 Food and Drugs 6 2014-04-01 2014-04-01 false Kanamycin ophthalmic and topical dosage forms. 524.1200 Section 524.1200 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN... ANIMAL DRUGS § 524.1200 Kanamycin ophthalmic and topical dosage forms....

  20. Discordant resistance to kanamycin and amikacin in drug-resistant Mycobacterium tuberculosis.


    Krüüner, Annika; Jureen, Pontus; Levina, Klavdia; Ghebremichael, Solomon; Hoffner, Sven


    It is generally thought that there is full cross-resistance in Mycobacterium tuberculosis between the aminoglycoside drugs kanamycin and amikacin. However, kanamycin resistance and amikacin susceptibility were seen in 43 of 79 (54%) multidrug-resistant Estonian isolates, indicating that there might be a need to test the resistance of M. tuberculosis isolates to both drugs.

  1. RmtC introduces G1405 methylation in 16S rRNA and confers high-level aminoglycoside resistance on Gram-positive microorganisms.


    Wachino, Jun-Ichi; Shibayama, Keigo; Kimura, Kouji; Yamane, Kunikazu; Suzuki, Satowa; Arakawa, Yoshichika


    Seven plasmid-mediated 16S rRNA methyltransferases (MTases), RmtA, RmtB, RmtC, RmtD, RmtE, ArmA, and NpmA, conferring aminoglycoside resistance have so far been found in Gram-negative pathogenic microorganisms. In the present study, by performing an RNase protection assay, primer extension, and HPLC, we confirmed that RmtC indeed methylates at the N7 position of nucleotide G1405 in 16S rRNA as found in ArmA and RmtB. RmtC has an MTase activity specific for the bacterial 30S ribosomal subunit consisting of 16S rRNA and several ribosomal proteins, but not for the naked 16S rRNA, as seen in ArmA, RmtB, and NpmA. All seven 16S rRNA MTases have been found exclusively in Gram-negative bacilli to date, and no plasmid-mediated 16S rRNA MTase has been reported in Gram-positive pathogenic microorganisms. Thus, we checked whether or not the RmtC could function in Gram-positive bacilli, and found that RmtC could indeed confer high-level resistance to gentamicin and kanamycin in Bacillus subtilis and Staphylococcus aureus. 16S rRNA MTases seemed to be functional to some extent in any bacterial species, regardless of the provenance of the 16S rRNA MTase gene responsible for aminoglycoside resistance.

  2. Fructose restores susceptibility of multidrug-resistant Edwardsiella tarda to kanamycin.


    Su, Yu-bin; Peng, Bo; Han, Yi; Li, Hui; Peng, Xuan-xian


    Edwardsiella tarda, the causative agent of Edwardsiellosis, imposes medical challenges in both the clinic and aquaculture. The emergence of multidrug resistant strains makes antibiotic treatment impractical. The identification of molecules that facilitate or promote antibiotic efficacy is in high demand. In the present study, we aimed to identify small molecules whose abundance is correlated with kanamycin resistance in E. tarda by gas chromatography-mass spectrometry. We found that the abundance of fructose was greatly suppressed in kanamycin-resistant strains. The incubation of kanamycin-resistant bacteria with exogenous fructose sensitized the bacteria to kanamycin. Moreover, the fructose also functioned in bacteria persisters and biofilm. The synergistic effects of fructose and kanamycin were validated in a mouse model. Furthermore, the mechanism relies on fructose in activating TCA cycle to produce NADH, which generates proton motive force to increase the uptake of the antibiotics. Therefore, we present a novel approach in fighting against multidrug resistant bacteria through exploration of antibiotic-suppressed molecules.

  3. Sequence-Modified Antibiotic Resistance Genes Provide Sustained Plasmid-Mediated Transgene Expression in Mammals.


    Lu, Jiamiao; Zhang, Feijie; Fire, Andrew Z; Kay, Mark A


    Conventional plasmid vectors are incapable of achieving sustained levels of transgene expression in vivo even in quiescent mammalian tissues because the transgene expression cassette is silenced. Transcriptional silencing results from the presence of the bacterial plasmid backbone or virtually any DNA sequence of >1 kb in length placed outside of the expression cassette. Here, we show that transcriptional silencing can be substantially forestalled by increasing the An/Tn sequence composition in the plasmid bacterial backbone. Increasing numbers of An/Tn sequences increased sustained transcription of both backbone sequences and adjacent expression cassettes. In order to recapitulate these expression profiles in compact and portable plasmid DNA backbones, we engineered the standard kanamycin or ampicillin antibiotic resistance genes, optimizing the number of An/Tn sequence without altering the encoded amino acids. The resulting vector backbones yield sustained transgene expression from mouse liver, providing generic DNA vectors capable of sustained transgene expression without additional genes or mammalian regulatory elements.

  4. Detection and Characterization of Conjugative Degradative Plasmids in Xenobiotic-Degrading Sphingomonas Strains

    PubMed Central

    Basta, Tamara; Keck, Andreas; Klein, Joachim; Stolz, Andreas


    A systematic survey for the presence of plasmids in 17 different xenobiotic-degrading Sphingomonas strains was performed. In almost all analyzed strains, two to five plasmids with sizes of about 50 to 500 kb were detected by using pulsed-field gel electrophoresis. A comparison of plasmid preparations untreated or treated with S1 nuclease suggested that, in general, Sphingomonas plasmids are circular. Hybridization experiments with labeled gene probes suggested that large plasmids are involved in the degradation of dibenzo-p-dioxin, dibenzofuran, and naphthalenesulfonates in S. wittichii RW1, Sphingomonas sp. HH69, and S. xenophaga BN6, respectively. The plasmids which are responsible for the degradation of naphthalene, biphenyl, and toluene by S. aromaticivorans F199 (pNL1) and of naphthalenesulfonates by S. xenophaga BN6 (pBN6) were site-specifically labeled with a kanamycin resistance cassette. The conjugative transfer of these labeled plasmids was attempted with various bacterial strains as putative recipient strains. Thus, a conjugative transfer of plasmid pBN6 from S. xenophaga BN6 to a cured mutant of strain BN6 and to Sphingomonas sp. SS3 was observed. The conjugation experiments with plasmid pNL1 suggested a broader host range of this plasmid, because it was transferred without any obvious structural changes to S. yanoikuyae B1, Sphingomonas sp. SS3, and S. herbicidovorans. In contrast, major plasmid rearrangements were observed in the transconjugants after the transfer of plasmid pNL1 to Sphingomonas sp. HH69 and of pBN6 to Sphingomonas sp. SS3. No indications for the transfer of a Sphingomonas plasmid to bacteria outside of the Sphingomonadaceae were obtained. PMID:15175300

  5. Detection and characterization of conjugative degradative plasmids in xenobiotic-degrading Sphingomonas strains.


    Basta, Tamara; Keck, Andreas; Klein, Joachim; Stolz, Andreas


    A systematic survey for the presence of plasmids in 17 different xenobiotic-degrading Sphingomonas strains was performed. In almost all analyzed strains, two to five plasmids with sizes of about 50 to 500 kb were detected by using pulsed-field gel electrophoresis. A comparison of plasmid preparations untreated or treated with S1 nuclease suggested that, in general, Sphingomonas plasmids are circular. Hybridization experiments with labeled gene probes suggested that large plasmids are involved in the degradation of dibenzo-p-dioxin, dibenzofuran, and naphthalenesulfonates in S. wittichii RW1, Sphingomonas sp. HH69, and S. xenophaga BN6, respectively. The plasmids which are responsible for the degradation of naphthalene, biphenyl, and toluene by S. aromaticivorans F199 (pNL1) and of naphthalenesulfonates by S. xenophaga BN6 (pBN6) were site-specifically labeled with a kanamycin resistance cassette. The conjugative transfer of these labeled plasmids was attempted with various bacterial strains as putative recipient strains. Thus, a conjugative transfer of plasmid pBN6 from S. xenophaga BN6 to a cured mutant of strain BN6 and to Sphingomonas sp. SS3 was observed. The conjugation experiments with plasmid pNL1 suggested a broader host range of this plasmid, because it was transferred without any obvious structural changes to S. yanoikuyae B1, Sphingomonas sp. SS3, and S. herbicidovorans. In contrast, major plasmid rearrangements were observed in the transconjugants after the transfer of plasmid pNL1 to Sphingomonas sp. HH69 and of pBN6 to Sphingomonas sp. SS3. No indications for the transfer of a Sphingomonas plasmid to bacteria outside of the Sphingomonadaceae were obtained.

  6. Kanamycin detection based on the catalytic ability enhancement of gold nanoparticles.


    Wang, Chengke; Chen, Dan; Wang, Qingqing; Tan, Rong


    In this paper, we demonstrated that kanamycin could enhance the peroxidase-like activity of citrate-capped gold nanoparticles (AuNPs) through two steps: the attachment of kanamycin onto AuNPs through -NH2 (on kanamycin) and -COOH (on AuNPs) interactions; and the specifically interaction between glucoside on kanamycin and AuNPs which changes the surface property of AuNPs, and produced •OH radicals and Au(3+) in the solution, and catalyzed the chromogenic reactions between 3, 3', 5, 5'-tetramethylbenzidine (TMB) and H2O2. Based on this principle, a novel method for kanamycin detection has been developed. This method exhibited high sensitivity and selectivity, as low as 0.1nM kanamycin could be detected with a linear range from 0.1nM to 20nM and 20nM to 300nM, respectively. This method was also successfully applied for the detection of kanamycin content in milk and meat samples.

  7. Plasmid and clonal interference during post horizontal gene transfer evolution.


    Bedhomme, S; Perez Pantoja, D; Bravo, I G


    Plasmids are nucleic acid molecules that can drive their own replication in a living cell. They can be transmitted horizontally and can thrive in the host cell to high-copy numbers. Plasmid replication and gene expression consume cellular resources and cells carrying plasmids incur fitness costs. But many plasmids carry genes that can be beneficial under certain conditions, allowing the cell to endure in the presence of antibiotics, toxins, competitors or parasites. Horizontal transfer of plasmid-encoded genes can thus instantaneously confer differential adaptation to local or transient selection conditions. This conflict between cellular fitness and plasmid spread sets the scene for multilevel selection processes. We have engineered a system to study the short-term evolutionary impact of different synonymous versions of a plasmid-encoded antibiotic resistance gene. Applying experimental evolution under different selection conditions and deep sequencing allowed us to show rapid local adaptation to the presence of antibiotic and to the specific version of the resistance gene transferred. We describe the presence of clonal interference at two different levels: at the within-cell level, because a single cell can carry several plasmids, and at the between-cell level, because a bacterial population may contain several clones carrying different plasmids and displaying different fitness in the presence/absence of antibiotic. Understanding the within-cell and between-cell dynamics of plasmids after horizontal gene transfer is essential to unravel the dense network of mobile elements underlying the worldwide threat to public health of antibiotic resistance.

  8. Degradative plasmids from sphingomonads.


    Stolz, Andreas


    Large plasmids ('megaplasmids') are commonly found in members of the Alphaproteobacterial family Sphingomonadaceae ('sphingomonads'). These plasmids contribute to the extraordinary catabolic flexibility of this group of organisms, which degrade a broad range of recalcitrant xenobiotic compounds. The genomes of several sphingomonads have been sequenced during the last years. In the course of these studies, also the sequences of several plasmids have been determined. The analysis of the published information and the sequences deposited in the public databases allowed a first classification of these plasmids into a restricted number of groups according to the proteins involved in the initiation of replication, plasmid partition and conjugation. The sequence comparisons demonstrated that the plasmids from sphingomonads encode for four main groups of replication initiation (Rep) proteins. These Rep proteins belong to the protein superfamilies RepA_C (Pfam 04796), Rep_3 (Pfam 01051), RPA (Pfam 10134) and HTH-36 (Pfam 13730). The 'degradative megaplasmids' pNL2, pCAR3, pSWIT02, pCHQ1, pISP0, and pISP1, which code for genes involved in the degradation of aromatic hydrocarbons, carbazole, dibenzo-p-dioxin and γ-hexachlorocyclohexane, carry Rep proteins which either belong to the RepA_C- (plasmids pNL2, pCAR3, pSWIT02), Rep-3- (plasmids pCHQ1, pISP0) or RPA-superfamily (pISP1). The classification of these 'degradative megaplasmids' into three groups is also supported by sequence comparisons of the proteins involved in plasmid partition (ParAB) and the organization of the three genes on the respective plasmids. All analysed 'degradative megaplasmids' carry genes, which might allow a conjugative transfer of the plasmids. Sequence comparisons of these genes suggest the presence of at least two types of transfer functions, which either are closer related to the tra- or vir-genes previously described for plasmids from other sources.

  9. Plasmid-Mediated Antimicrobial Resistance in Staphylococci and Other Firmicutes.


    Schwarz, Stefan; Shen, Jianzhong; Wendlandt, Sarah; Fessler, Andrea T; Wang, Yang; Kadlec, Kristina; Wu, Cong-Ming


    In staphylococci and other Firmicutes, resistance to numerous classes of antimicrobial agents, which are commonly used in human and veterinary medicine, is mediated by genes that are associated with mobile genetic elements. The gene products of some of these antimicrobial resistance genes confer resistance to only specific members of a certain class of antimicrobial agents, whereas others confer resistance to the entire class or even to members of different classes of antimicrobial agents. The resistance mechanisms specified by the resistance genes fall into any of three major categories: active efflux, enzymatic inactivation, and modification/replacement/protection of the target sites of the antimicrobial agents. Among the mobile genetic elements that carry such resistance genes, plasmids play an important role as carriers of primarily plasmid-borne resistance genes, but also as vectors for nonconjugative and conjugative transposons that harbor resistance genes. Plasmids can be exchanged by horizontal gene transfer between members of the same species but also between bacteria belonging to different species and genera. Plasmids are highly flexible elements, and various mechanisms exist by which plasmids can recombine, form cointegrates, or become integrated in part or in toto into the chromosomal DNA or into other plasmids. As such, plasmids play a key role in the dissemination of antimicrobial resistance genes within the gene pool to which staphylococci and other Firmicutes have access. This chapter is intended to provide an overview of the current knowledge of plasmid-mediated antimicrobial resistance in staphylococci and other Firmicutes.

  10. Plasmids coding for drug resistance and localized adherence to HeLa cells in enteropathogenic Escherichia coli O55:H- and O55:H6.

    PubMed Central

    Laporta, M Z; Silva, M L; Scaletsky, I C; Trabulsi, L R


    Plasmids coding for drug resistance and localized adherence (LA) to HeLa cells were found in two enteropathogenic Escherichia coli strains belonging to serotypes O55:H- and O55:H6. Strain 49-81 HSJ (O55:H-) carries two plasmids, one coding for both ampicillin resistance (Apr) and LA (pMS49). Strain 71-82 HSJ (O55:H6) harbors only one plasmid, coding for resistance to sulfadiazine, chloramphenicol, kanamycin, ampicillin, and LA (pMS71). Plasmids pMS49 and pMS71 were transferred to E. coli K-12 711 and from this strain to E. coli K-12 J53. Curing with acridine orange of an Apr LA+ transconjugant showed that both characteristics were lost simultaneously. The plasmids have a molecular weight of approximately 55 X 10(6) and are the first naturally recombinant plasmids coding for adherence and drug resistance described in enteropathogenic E. coli. Images PMID:3510986

  11. Audiological Evaluation of Patients Taking Kanamycin for Multidrug Resistant Tuberculosis

    PubMed Central

    Sharma, Vishal; Bhagat, Sanjeev; Verma, Bhimsain; Singh, Ravinder; Singh, Surinderpal


    Introduction: The incidence of multidrug resistant tuberculosis is increasing in developing countries. Aminoglycosides are an integral part of second-line drugs, however ototoxicity is a major limitation for their use. This study aims to determine the extent of hearing loss in patients taking one of the commonly prescribed drugs for Multidrug resistant tuberculosis (MDR-TB), Kanamycin, at a Government Medical College, Patiala, Punjab, India, which is a 1200 bed tertiary care hospital. Materials and Methods: A total of 100 patients (68 males and 32 females) with confirmed diagnosis of MDR-TB were included in this study conducted between January 2012 and February 2014. Subjects were between 15 to 60 years of age, with a mean age of 37.46 ± 10.1. Pure tone audiometry (PTA) was performed before the start of the therapy, as a baseline, and was repeated after 1 week and 6 weeks of Kanamycin use to assess hearing loss as an effect of therapy. Results: Of the 100 patients examined, ototoxicity was found in 18 subjects post therapy. Incidence of high frequency hearing loss was 2% at week 1, and 12% after 6 weeks of follow up. However, 4% of the cases developed flat loss at week 6. The hearing loss was bilateral in 13 patients and unilateral in 5 patients. Ototoxicity was more common in males (66.67%) compared to females (33.3%). Maximum cases were found in the age group of 36 to 45 years (36.8%), the majority being from a rural background (83.3%). The association with socioeconomic status (P=0.024) and co-morbid conditions like diabetes and hypertension (P=0.001) reached statistical significance. Conclusion: Lack of specific guidelines to monitor patients taking aminoglycosides makes ototoxicity a major adverse effect of their use in MDR-TB. More studies are mandated to study the risk factors associated with the development of ototoxicity and for the development of alternate drugs for the treatment of MDR-TB. PMID:27429949

  12. Plasmid Partition Mechanisms.


    Baxter, Jamie C; Funnell, Barbara E


    The stable maintenance of low-copy-number plasmids in bacteria is actively driven by partition mechanisms that are responsible for the positioning of plasmids inside the cell. Partition systems are ubiquitous in the microbial world and are encoded by many bacterial chromosomes as well as plasmids. These systems, although different in sequence and mechanism, typically consist of two proteins and a DNA partition site, or prokaryotic centromere, on the plasmid or chromosome. One protein binds site-specifically to the centromere to form a partition complex, and the other protein uses the energy of nucleotide binding and hydrolysis to transport the plasmid, via interactions with this partition complex inside the cell. For plasmids, this minimal cassette is sufficient to direct proper segregation in bacterial cells. There has been significant progress in the last several years in our understanding of partition mechanisms. Two general areas that have developed are (i) the structural biology of partition proteins and their interactions with DNA and (ii) the action and dynamics of the partition ATPases that drive the process. In addition, systems that use tubulin-like GTPases to partition plasmids have recently been identified. In this chapter, we concentrate on these recent developments and the molecular details of plasmid partition mechanisms.

  13. Yeast DNA plasmids.


    Gunge, N


    The study of yeast DNA plasmids has been initiated with the discovery of the 2-micron DNA in Saccharomyces cerevisiae. This multiple copy plasmid, organized into chromatin structure in vivo, probably exists in the nucleus and provides a good system to obtain information on eukaryotic DNA replication. Yeast transformation with the 2-micron DNA or artificially constructed chimeric plasmids had contributed significantly to the study of the molecular biology of yeast and eukaryotes, allowing the isolation and characterization of various genes, ars, centromeres, and telomeres, and also serving as a tool to study the expression of various heterologous genes. Encouraged by these fruitful results, new yeast plasmids have been screened among phylogenetically distant yeasts. The linear DNA plasmids (pGKl1 and pGKl2) from Kluyveromyces lactis are the first case of yeast plasmids associated with biological function (killer phenotype). This plasmid system would be ideal as a model to study the structure and function of eukaryotic linear chromosomes. The extracellular secretion of protein toxin suggests the plasmids to be an excellent candidate for a secretion vector. The importance of yeasts as suitable materials for the study of eukaryotic cell biology would be much enhanced by the advent of new transformation systems with diverse host yeasts of genetically and phylogenetically distinct properties.

  14. International Spread and Persistence of TEM-24 Is Caused by the Confluence of Highly Penetrating Enterobacteriaceae Clones and an IncA/C2 Plasmid Containing Tn1696::Tn1 and IS5075-Tn21▿

    PubMed Central

    Novais, Ângela; Baquero, Fernando; Machado, Elisabete; Cantón, Rafael; Peixe, Luísa; Coque, Teresa M.


    TEM-24 remains one of the most widespread TEM-type extended-spectrum β-lactamases (ESBLs) among Enterobacteriaceae. To analyze the reasons influencing its spread and persistence, a multilevel population genetics study was carried out on 28 representative TEM-24 producers from Belgium, France, Portugal, and Spain (13 Enterobacter aerogenes isolates, 6 Escherichia coli isolates, 6 Klebsiella pneumoniae isolates, 2 Proteus mirabilis isolates, and 1 Klebsiella oxytoca isolate, from 1998 to 2004). Clonal relatedness (XbaI pulsed-field gel electrophoresis [PFGE] and E. coli phylogroups) and antibiotic susceptibility were determined by standard procedures. Plasmid analysis included determination of the incompatibility group (by PCR, hybridization, and/or sequencing) and comparison of restriction fragment length polymorphism (RFLP) patterns. Characterization of genetic elements conferring antibiotic resistance included integrons (classes 1, 2, and 3) and transposons (Tn3, Tn21, and Tn402). Similar PFGE patterns were identified among E. aerogenes, K. pneumoniae, and P. mirabilis isolates, while E. coli strains were diverse (phylogenetic groups A, B2, and D). Highly related 180-kb IncA/C2 plasmids conferring resistance to kanamycin, tobramycin, chloramphenicol, trimethoprim, and sulfonamides were identified. Each plasmid contained defective In0-Tn402 (dfrA1-aadA1, aacA4, or aacA4-aacC1-orfE-aadA2-cmlA1) and In4-Tn402 (aacA4 or dfrA1-aadA1) variants. These integrons were located within Tn21, Tn1696, or hybrids of these transposons, with IS5075 interrupting their IRtnp and IRmer. In all cases, blaTEM-24 was part of an IS5075-ΔTn1 transposon within tnp1696, mimicking other genetic elements containing blaTEM-2 and blaTEM-3 variants. The international dissemination of TEM-24 is fuelled by an IncA/C2 plasmid acquired by different enterobacterial clones which seem to evolve by gaining diverse genetic elements. This work highlights the risks of a confluence between highly

  15. 21 CFR 524.1204 - Kanamycin sulfate, calcium amphomycin, and hydrocortisone acetate.

    Code of Federal Regulations, 2010 CFR


    ... HEALTH AND HUMAN SERVICES (CONTINUED) ANIMAL DRUGS, FEEDS, AND RELATED PRODUCTS OPHTHALMIC AND TOPICAL DOSAGE FORM NEW ANIMAL DRUGS § 524.1204 Kanamycin sulfate, calcium amphomycin, and hydrocortisone acetate... antibiotics: Acute otitis externa, furunculosis, folliculitis, pruritus, anal gland infections,...

  16. Mobility of plasmids.


    Smillie, Chris; Garcillán-Barcia, M Pilar; Francia, M Victoria; Rocha, Eduardo P C; de la Cruz, Fernando


    Plasmids are key vectors of horizontal gene transfer and essential genetic engineering tools. They code for genes involved in many aspects of microbial biology, including detoxication, virulence, ecological interactions, and antibiotic resistance. While many studies have decorticated the mechanisms of mobility in model plasmids, the identification and characterization of plasmid mobility from genome data are unexplored. By reviewing the available data and literature, we established a computational protocol to identify and classify conjugation and mobilization genetic modules in 1,730 plasmids. This allowed the accurate classification of proteobacterial conjugative or mobilizable systems in a combination of four mating pair formation and six relaxase families. The available evidence suggests that half of the plasmids are nonmobilizable and that half of the remaining plasmids are conjugative. Some conjugative systems are much more abundant than others and preferably associated with some clades or plasmid sizes. Most very large plasmids are nonmobilizable, with evidence of ongoing domestication into secondary chromosomes. The evolution of conjugation elements shows ancient divergence between mobility systems, with relaxases and type IV coupling proteins (T4CPs) often following separate paths from type IV secretion systems. Phylogenetic patterns of mobility proteins are consistent with the phylogeny of the host prokaryotes, suggesting that plasmid mobility is in general circumscribed within large clades. Our survey suggests the existence of unsuspected new relaxases in archaea and new conjugation systems in cyanobacteria and actinobacteria. Few genes, e.g., T4CPs, relaxases, and VirB4, are at the core of plasmid conjugation, and together with accessory genes, they have evolved into specific systems adapted to specific physiological and ecological contexts.

  17. Risk factors associated with kanamycin-resistant tuberculosis in a Beijing tuberculosis referral hospital.


    Yu, Hao Tian; Wang, Qi; Yang, Nan; Li, Hong Min; Liang, Jian Qin; Liu, Cui Hua


    The rapidly increasing number of multidrug-resistant tuberculosis (MDR-TB) cases worldwide underlines the necessity for the rational use of key second-line drugs such as kanamycin. In this study, we determined the prevalence of, and risk factors associated with, kanamycin-resistant tuberculosis (TB) in 309 Hospital, Beijing, China, with the aim of providing information for better case management in order to minimize further development of extensively drug-resistant TB (XDR-TB). Drug susceptibility testing results and clinical data were retrospectively analysed for hospitalized TB patients for whom such data were available in 309 Hospital for the period 1997-2009. Univariate and multivariate analyses were used to determine the risk factors associated with kanamycin-resistant TB. During 1997-2009, 553 (14.4 %) of 3843 tested Mycobacterium tuberculosis isolates from hospitalized TB patients were kanamycin-resistant. The increasing trend of resistance to kanamycin was reversed since 2000. The independent risk factors associated with kanamycin-resistant TB included living in urban areas [adjusted odds ratio (OR) = 1.89], being retreated for repeat cases (adjusted OR = 1.60), being smear-positive for acid-fast bacilli at admission to the hospital (adjusted OR = 1.39), having ofloxacin-resistant (adjusted OR = 1.61) or para-aminosalicylic acid-resistant TB (adjusted OR = 1.47), having MDR-TB (adjusted OR = 5.10), having MDR-TB plus ofloxacin resistance (adjusted OR = 4.27) and having poly-resistant TB (adjusted OR = 3.94). The remaining rate of kanamycin resistance is still high despite the reversal of the increasing trend during the past decade. Surveillance of kanamycin resistance, especially among high-risk populations, should be continued to closely monitor trends so that appropriate action can be taken.

  18. Synthesis and Bioactivities of Kanamycin B-Derived Cationic Amphiphiles.


    Fosso, Marina Y; Shrestha, Sanjib K; Green, Keith D; Garneau-Tsodikova, Sylvie


    Cationic amphiphiles derived from aminoglycosides (AGs) have been shown to exhibit enhanced antimicrobial activity. Through the attachment of hydrophobic residues such as linear alkyl chains on the AG backbone, interesting antibacterial and antifungal agents with a novel mechanism of action have been developed. Herein, we report the design and synthesis of seven kanamycin B (KANB) derivatives. Their antibacterial and antifungal activities, along with resistance/enzymatic, hemolytic, and cytotoxicity assays were also studied. Two of these compounds, with a C12 and C14 aliphatic chain attached at the 6″-position of KANB through a thioether linkage, exhibited good antibacterial and antifungal activity, were poorer substrates than KANB for several AG-modifying enzymes, and could delay the development of resistance in bacteria and fungi. Also, they were both relatively less hemolytic than the known membrane targeting antibiotic gramicidin and the known antifungal agent amphotericin B and were not toxic at their antifungal MIC values. Their oxidation to sulfones was also demonstrated to have no effect on their activities. Moreover, they both acted synergistically with posaconazole, an azole currently used in the treatment of human fungal infections.

  19. Aggregation of Kanamycin A: dimer formation with physiological cations.


    Dieterich, Johannes M; Gerstel, Ulrich; Schröder, Jens-Michael; Hartke, Bernd


    Global cluster geometry optimization has focused so far on clusters of atoms or of compact molecules. We are demonstrating here that present-day techniques also allow to globally optimize clusters of extended, flexible molecules, and that such studies have immediate relevance to experiment. For example, recent experimental findings point to production of larger clusters of an aminoglycoside closely related to Kanamycin A (KA), together with certain preferred physiological cations, by Pseudomonas aeruginosa. The present study provides first theoretical support for KA clustering, with a close examination of the monomer, the bare dimer, and dimers with sodium and potassium cations, employing global cluster structure optimization, in conjunction with force fields, semiempirical methods, DFT and ab-initio approaches. Interestingly, already at this stage the theoretical findings support the experimental observation that sodium cations are preferred over potassium cations in KA clusters, due to fundamentally different cationic embedding. Theoretically predicted NMR and IR spectra for these species indicate that it should be possible to experimentally detect the aggregation state and even the cationic embedding mode in such clusters.

  20. Bacteriophages Limit the Existence Conditions for Conjugative Plasmids

    PubMed Central

    Wood, A. Jamie; Dytham, Calvin; Pitchford, Jonathan W.; Truman, Julie; Spiers, Andrew; Paterson, Steve; Brockhurst, Michael A.


    ABSTRACT Bacteriophages are a major cause of bacterial mortality and impose strong selection on natural bacterial populations, yet their effects on the dynamics of conjugative plasmids have rarely been tested. We combined experimental evolution, mathematical modeling, and individual-based simulations to explain how the ecological and population genetics effects of bacteriophages upon bacteria interact to determine the dynamics of conjugative plasmids and their persistence. The ecological effects of bacteriophages on bacteria are predicted to limit the existence conditions for conjugative plasmids, preventing persistence under weak selection for plasmid accessory traits. Experiments showed that phages drove faster extinction of plasmids in environments where the plasmid conferred no benefit, but they also revealed more complex effects of phages on plasmid dynamics under these conditions, specifically, the temporary maintenance of plasmids at fixation followed by rapid loss. We hypothesized that the population genetic effects of bacteriophages, specifically, selection for phage resistance mutations, may have caused this. Further mathematical modeling and individual-based simulations supported our hypothesis, showing that conjugative plasmids may hitchhike with phage resistance mutations in the bacterial chromosome. PMID:26037122

  1. Multiresistant Plasmids from Pseudomonas aeruginosa Highly Resistant to Either or Both Gentamicin and Carbenicillin

    PubMed Central

    Kontomichalou, Polyxeni; Papachristou, Efstathia; Angelatou, Fevronia


    High-level resistance to gentamicin and carbenicillin was found in 30 and 10.7%, respectively, of Pseudomonas aeruginosa strains, especially in isolates from urine. In 23 out of 25 strains tested, these resistances were R mediated and linked to multiresistant plasmids, carrying genes for resistances to five other aminoglycosides, tobramycin, kanamycin, neomycin, streptomycin, and spectinomycin, and for resistances to chloramphenicol, tetracycline, sulfonamides, and mercury chloride. Carbenicillin resistance was unstable in Pseudomonas, and in its presence the multiresistant plasmids had a host range extended to the Enterobacteriaceae (group I plasmids). Otherwise they were transferable intragenerically only (group II plasmids). The extended host range plasmids were, as a rule, in fi− incompatibility class A–C. Segregants incompatible with both class A–C and P plasmids were detected. The β-lactamase specified by the carbenicillin marker was of the TEM-like type. Multiple linkages of resistance determinants to the aminoglycosides were concomitantly present in most of the plasmids. Results from the bioassay indicated the presence of at least two aminoglycoside-inactivating enzymes. PMID:820245

  2. Polyethylene oxide (PEO)-hyaluronic acid (HA) nanofibers with kanamycin inhibits the growth of Listeria monocytogenes.


    Ahire, J J; Robertson, D D; van Reenen, A J; Dicks, L M T


    Listeria monocytogenes is well known to cause prosthetic joint infections in immunocompromised patients. In this study, polyethylene oxide (PEO) nanofibers, containing kanamycin and hyaluronic acid (HA), were prepared by electrospinning at a constant electric field of 10kV. PEO nanofibers spun with 0.2% (w/v) HA and 1% (w/v) kanamycin had a smooth, bead-free structure at 30-35% relative humidity. The average diameter of the nanofibers was 83±20nm. Attenuated total reflectance (ATR)-Fourier transform infrared (FTIR) spectroscopy indicated that kanamycin was successfully incorporated into PEO/HA matrix. The presence of kanamycin affects the thermal properties of PEO/HA nanofibers, as shown by differential scanning calorimetry (DSC) and thermogravimetric analyses (TGA). The kanamycin-PEO-HA nanofibers (1mg; 47±3μg kanamycin) inhibited the growth of L. monocytogenes EDGe by 62%, as compared with PEO-HA nanofibers, suggesting that it may be used to coat prosthetic implants to prevent secondary infections.

  3. Design, synthesis, and antibacterial activities of conformationally constrained kanamycin A derivatives.


    Zhang, Wenxuan; Chen, Ying; Liang, Qingzhao; Li, Hui; Jin, Hongwei; Zhang, Liangren; Meng, Xiangbao; Li, Zhongjun


    A series of conformationally constrained kanamycin A derivatives with a 2'-hydroxyl group in ring I and a 5-hydroxyl group in ring II tethered by carbon chains were designed and synthesized. Pivotal 5,2'-hydroxyl groups were exposed, and the kanamycin A intermediate was synthesized from 5, 2', 4″, 6″-di-O-benzylidene-protected tetraazidokanamycin A. Cyclic kanamycin A derivatives with intramolecular 8-, 9-, 10-, and 11-membered ethers were then prepared by cesium carbonate mediated Williamson ether synthesis or a ring-closing metathesis reaction. The kanamycin A derivatives were assayed against both susceptible and resistant bacterial strains. Although no derivative showed better antibacterial activities than kanamycin A, the antibacterial activities of these cyclic kanamycin A derivatives indeed varied with the length of the bridge. Moreover, different variations of activities were observed between the susceptible and resistant bacterial strains. More tightly constrained derivative 2 with a one-carbon bridge showed better activity than the others against susceptible strains, but it was much less effective for resistant bacterial strains than derivative 3 with a two-carbon bridge and derivative 6 with an unsaturated four-carbon bridge.

  4. Impact of kanamycin on melanogenesis and antioxidant enzymes activity in melanocytes--an in vitro study.


    Wrześniok, Dorota; Otręba, Michał; Beberok, Artur; Buszman, Ewa


    Aminoglycosides, broad spectrum aminoglycoside antibiotics, are used in various infections therapy due to their good antimicrobial characteristics. However, their adverse effects such as nephrotoxicity and auditory ototoxicity, as well as some toxic effects directed to pigmented tissues, complicate the use of these agents. This study was undertaken to investigate the effect of aminoglycoside antibiotic-kanamycin on viability, melanogenesis and antioxidant enzymes activity in cultured human normal melanocytes (HEMa-LP). It has been demonstrated that kanamycin induces concentration-dependent loss in melanocytes viability. The value of EC50 was found to be ~6.0 mM. Kanamycin suppressed melanin biosynthesis: antibiotic was shown to inhibit cellular tyrosinase activity and to reduce melanin content in normal human melanocytes. Significant changes in the cellular antioxidant enzymes: SOD, CAT and GPx were stated in melanocytes exposed to kanamycin. Moreover, it was observed that kanamycin caused depletion of antioxidant defense sytem. It is concluded that the inhibitory effect of kanamycin on melanogenesis and not sufficient antioxidant defense mechanism in melanocytes in vitro may explain the potential mechanisms of undesirable side effects of this drug directed to pigmented tissues in vivo.

  5. Plasmid borne Carbapenem-Hydrolyzing Class D β-Lactamases (CHDLs) and AdeABC efflux pump conferring carbapenem-tigecycline resistance among Acinetobacter baumannii isolates harboring TnAbaRs.


    Savari, Mohammad; Ekrami, Alireza; Shoja, Saeed; Bahador, Abbas


    Here we studied the prevalence and mechanisms of simultaneous resistance to carbapenem and tigecycline and accumulation of resistance determinants reservoirs in genome of Acinetobacter baumannii (A. baumannii) clinical isolates. Susceptibility of the isolates were measured to 18 antimicrobial agents. Genetic diversity of the microbial population was determined using the International Clonal lineage typing (IC typing), multiple locus VNTR analysis (MLVA) and plasmid profiling methods. To detect the AbaRs, Carbapenem-Hydrolyzing Class D β-Lactamases (CHDLs) genes, AdeABC efflux pump genes and resistance determinants, PCR was used. Filter mating experiments were used to prove that if carbapenem resistance genes are located on conjugative plasmids or not. Among the A. baumannii clinical isolates, 40.8% were carbapenem-tigecycline resistant and in this population, 46.9% were belonging to IC I, IC II or IC III and 53.1% were IC variants. These isolates had fallen in 40 MLVA types and were harboring plasmids in multiple numbers and sizes. In this study, blaOXA-23-like was the most prevalent CHDL and conjugation analysis proved that the carbapenem resistance genes are located on conjugative plasmids. All efflux pump genes, except for adeC, were detected in all carbapenem-tigecycline resistant A. baumannii (CTRAb) isolates. Resistance determinants were distributed in both TnAbaRs and R plasmids with a shift toward the R plasmids. Emerging of carbapenem resistant A. baumannii (CRAB) with simultaneous resistance to the last line therapy including tigecycline represent emerging of extensively drug resistance (XDR) and pandrug resistance (PDR) phenotypes that would be a great threat to our public health system.

  6. Intradermal naked plasmid DNA immunization: mechanisms of action.


    Elnekave, Mazal; Furmanov, Karina; Hovav, Avi-Hai


    Plasmid DNA is a promising vaccine modality that is regularly examined in prime-boost immunization regimens. Recent advances in skin immunity increased our understanding of the sophisticated cutaneous immune network, which revived scientific interest in delivering vaccines to the skin. Intradermal administration of plasmid DNA via needle injection is a simple and inexpensive procedure that exposes the plasmid and its encoded antigen to the dermal immune surveillance system. This triggers unique mechanisms for eliciting local and systemic immunity that can confer protection against pathogens and tumors. Understanding the mechanisms of intradermal plasmid DNA immunization is essential for enhancing and modulating its immunogenicity. With regard to vaccination, this is of greater importance as this routine injection technique is highly desirable for worldwide immunization. This article will focus on the current understanding of the mechanisms involved in antigen expression and presentation during primary and secondary syringe and needle intradermal plasmid DNA immunization.

  7. Ultra-sensitive detection of kanamycin for food safety using a reduced graphene oxide-based fluorescent aptasensor

    NASA Astrophysics Data System (ADS)

    Ha, Na-Reum; Jung, In-Pil; La, Im-Joung; Jung, Ho-Sup; Yoon, Moon-Young


    Overuse of antibiotics has caused serious problems, such as appearance of super bacteria, whose accumulation in the human body through the food chain is a concern. Kanamycin is a common antibiotic used to treat diverse infections; however, residual kanamycin can cause many side effects in humans. Thus, development of an ultra-sensitive, precise, and simple detection system for residual kanamycin in food products is urgently needed for food safety. In this study, we identified kanamycin-binding aptamers via a new screening method, and truncated variants were analyzed for optimization of the minimal sequence required for target binding. We found various aptamers with high binding affinity from 34.7 to 669 nanomolar Kdapp values with good specificity against kanamycin. Furthermore, we developed a reduced graphene oxide (RGO)-based fluorescent aptasensor for kanamycin detection. In this system, kanamycin was detected at a concentration as low as 1 pM (582.6 fg/mL). In addition, this method could detect kanamycin accurately in kanamycin-spiked blood serum and milk samples. Consequently, this simple, rapid, and sensitive kanamycin detection system with newly structural and functional analysis aptamer exhibits outstanding detection compared to previous methods and provides a new possibility for point of care testing and food safety.

  8. Ultra-sensitive detection of kanamycin for food safety using a reduced graphene oxide-based fluorescent aptasensor

    PubMed Central

    Ha, Na-Reum; Jung, In-Pil; La, Im-Joung; Jung, Ho-Sup; Yoon, Moon-Young


    Overuse of antibiotics has caused serious problems, such as appearance of super bacteria, whose accumulation in the human body through the food chain is a concern. Kanamycin is a common antibiotic used to treat diverse infections; however, residual kanamycin can cause many side effects in humans. Thus, development of an ultra-sensitive, precise, and simple detection system for residual kanamycin in food products is urgently needed for food safety. In this study, we identified kanamycin-binding aptamers via a new screening method, and truncated variants were analyzed for optimization of the minimal sequence required for target binding. We found various aptamers with high binding affinity from 34.7 to 669 nanomolar Kdapp values with good specificity against kanamycin. Furthermore, we developed a reduced graphene oxide (RGO)-based fluorescent aptasensor for kanamycin detection. In this system, kanamycin was detected at a concentration as low as 1 pM (582.6 fg/mL). In addition, this method could detect kanamycin accurately in kanamycin-spiked blood serum and milk samples. Consequently, this simple, rapid, and sensitive kanamycin detection system with newly structural and functional analysis aptamer exhibits outstanding detection compared to previous methods and provides a new possibility for point of care testing and food safety. PMID:28054670

  9. The Agrobacterium Ti Plasmids.


    Christie, Peter J; Gordon, Jay E


    Agrobacterium tumefaciens is a plant pathogen with the capacity to deliver a segment of oncogenic DNA carried on a large plasmid called the tumor-inducing or Ti plasmid to susceptible plant cells. A. tumefaciens belongs to the class Alphaproteobacteria, whose members include other plant pathogens (Agrobacterium rhizogenes), plant and insect symbionts (Rhizobium spp. and Wolbachia spp., respectively), human pathogens (Brucella spp., Bartonella spp., Rickettsia spp.), and nonpathogens (Caulobacter crescentus, Rhodobacter sphaeroides). Many species of Alphaproteobacteria carry large plasmids ranging in size from ∼100 kb to nearly 2 Mb. These large replicons typically code for functions essential for cell physiology, pathogenesis, or symbiosis. Most of these elements rely on a conserved gene cassette termed repABC for replication and partitioning, and maintenance at only one or a few copies per cell. The subject of this review is the ∼200-kb Ti plasmids carried by infectious strains of A. tumefaciens. We will summarize the features of this plasmid as a representative of the repABC family of megaplasmids. We will also describe novel features of this plasmid that enable A. tumefaciens cells to incite tumor formation in plants, sense and respond to an array of plant host and bacterial signal molecules, and maintain and disseminate the plasmid among populations of agrobacteria. At the end of this review, we will describe how this natural genetic engineer has been adapted to spawn an entire industry of plant biotechnology and review its potential for use in future therapeutic applications of plant and nonplant species.

  10. Molecular analysis of cross-resistance to capreomycin, kanamycin, amikacin, and viomycin in Mycobacterium tuberculosis.


    Maus, Courtney E; Plikaytis, Bonnie B; Shinnick, Thomas M


    Capreomycin, kanamycin, amikacin, and viomycin are drugs that are used to treat multidrug-resistant tuberculosis. Each inhibits translation, and cross-resistance to them is a concern during therapy. A recent study revealed that mutation of the tlyA gene, encoding a putative rRNA methyltransferase, confers capreomycin and viomycin resistance in Mycobacterium tuberculosis bacteria. Mutations in the 16S rRNA gene (rrs) have been associated with resistance to each of the drugs; however, reports of cross-resistance to the drugs have been variable. We investigated the role of rrs mutations in capreomycin resistance and examined the molecular basis of cross-resistance to the four drugs in M. tuberculosis laboratory-generated mutants and clinical isolates. Spontaneous mutants were generated to the drugs singularly and in combination by plating on medium containing one or two drugs. The frequencies of recovery of the mutants on single- and dual-drug plates were consistent with single-step mutations. The rrs genes of all mutants were sequenced, and the tlyA genes were sequenced for mutants selected on capreomycin, viomycin, or both; MICs of all four drugs were determined. Three rrs mutations (A1401G, C1402T, and G1484T) were found, and each was associated with a particular cross-resistance pattern. Similar mutations and cross-resistance patterns were found in drug-resistant clinical isolates. Overall, the data implicate rrs mutations as a molecular basis for resistance to each of the four drugs. Furthermore, the genotypic and phenotypic differences seen in the development of cross-resistance when M. tuberculosis bacteria were exposed to one or two drugs have implications for selection of treatment regimens.

  11. Complete nucleotide sequence of pH11, an IncHI2 plasmid conferring multi-antibiotic resistance and multi-heavy metal resistance genes in a clinical Klebsiella pneumoniae isolate.


    Zhai, Yao; He, Zilong; Kang, Yu; Yu, Haiying; Wang, Jianfeng; Du, Pengcheng; Zhang, Zhao; Hu, Songnian; Gao, Zhancheng


    The complete 284,628bp sequence of pH11, an IncHI2 plasmid, was determined through single-molecule, real-time (SMRT) sequencing. Harbored by a clinical Klebsiella pneumoniae strain H11, and isolated in Beijing, this plasmid contains multiple antibiotic resistance genes, including catA2, aac(6')-Ib, strB, strA, dfrA19, blaTEM-1, blaSHV-12, sul1, qacE delta 1, ereA, arr2, and aac3. The aac(6')-Ib is carried by a class I integron. Plasmid pH11 also carries several genes associated with resistance to heavy metals, such as tellurium, mercury, cobalt, zinc, nickel, copper, lead and cadmium. This plasmid exhibits numerous characteristics, including HipBA and RelBE toxin-antitoxin systems, two major transfer (Tra) regions closely related to those of Salmonella enterica serovar plasmid pRH-R27, a type II restriction modification system (EcoRII R-M system), several methyltransferases and methylases and genes encoding Hha and StpA. These characteristics suggest that pH11 may adapt to various hosts and environments. Multiple insertion sequence elements, transposases, recombinases, resolvases and integrases are scattered throughout pH11. The presence of these genes may indicate that horizontal gene transfer occurs frequently in pH11 and thus may facilitate the dissemination of antimicrobial resistance determinants. Our data suggest that pH11 is a chimera gradually assembled through the integration of different horizontally acquired DNA segments via transposition or homologous recombination.

  12. Chlamydial plasmids and bacteriophages.


    Pawlikowska-Warych, Małgorzata; Śliwa-Dominiak, Joanna; Deptuła, Wiesław


    Chlamydia are absolute pathogens of humans and animals; despite being rather well recognised, they are still open for discovery. One such discovery is the occurrence of extrachromosomal carriers of genetic information. In prokaryotes, such carriers include plasmids and bacteriophages, which are present only among some Chlamydia species. Plasmids were found exclusively in Chlamydia (C.) trachomatis, C. psittaci, C. pneumoniae, C. suis, C. felis, C. muridarum and C. caviae. In prokaryotic organisms, plasmids usually code for genes that facilitate survival of the bacteria in the environment (although they are not essential). In chlamydia, their role has not been definitely recognised, apart from the fact that they participate in the synthesis of glycogen and encode proteins responsible for their virulence. Furthermore, in C. suis it was evidenced that the plasmid is integrated in a genomic island and contains the tetracycline-resistance gene. Bacteriophages specific for chlamydia (chlamydiaphages) were detected only in six species: C. psittaci, C. abortus, C. felis, C. caviae C. pecorum and C. pneumoniae. These chlamydiaphages cause inhibition of the developmental cycle, and delay transformation of reticulate bodies (RBs) into elementary bodies (EBs), thus reducing the possibility of infecting other cells in time. Plasmids and bacteriophages can be used in the diagnostics of chlamydioses; although especially in the case of plasmids, they are already used for detection of chlamydial infections. In addition, bacteriophages could be used as therapeutic agents to replace antibiotics, potentially addressing the problem of increasing antibiotic-resistance among chlamydia.

  13. Plasmid partitioning systems of conjugative plasmids from Clostridium perfringens.


    Adams, Vicki; Watts, Thomas D; Bulach, Dieter M; Lyras, Dena; Rood, Julian I


    Many pathogenic strains of Clostridium perfringens carry several highly similar toxin or antibiotic resistance plasmids that have 35 to 40 kb of very closely related syntenous sequences, including regions that carry the genes encoding conjugative transfer, plasmid replication and plasmid maintenance functions. Key questions are how are these closely related plasmids stably maintained in the same cell and what is the basis for plasmid incompatibility in C. perfringens. Comparative analysis of the Rep proteins encoded by these plasmids suggested that this protein was not the basis for plasmid incompatibility since plasmids carried in a single strain often encoded an almost identical Rep protein. These plasmids all carried a similar, but not identical, parMRC plasmid partitioning locus. Phylogenetic analysis of the deduced ParM proteins revealed that these proteins could be divided into ten separate groups. Importantly, in every strain that carried more than one of these plasmids, the respective ParM proteins were from different phylogenetic groups. Similar observations were made from the analysis of phylogenetic trees of the ParR proteins and the parC loci. These findings provide evidence that the basis for plasmid incompatibility in the conjugative toxin and resistance plasmid family from C. perfringens resides in subtle differences in the parMRC plasmid partitioning loci carried by these plasmids.

  14. Label-free detection of kanamycin based on a G-quadruplex DNA aptamer-based fluorescent intercalator displacement assay

    NASA Astrophysics Data System (ADS)

    Xing, Yun-Peng; Liu, Chun; Zhou, Xiao-Hong; Shi, Han-Chang


    This work was the first to report that the kanamycin-binding DNA aptamer (5'-TGG GGG TTG AGG CTA AGC CGA-3') can form stable parallel G-quadruplex DNA (G4-DNA) structures by themselves and that this phenomenon can be verified by nondenaturing polyacrylamide gel electrophoresis and circular dichroism spectroscopy. Based on these findings, we developed a novel label-free strategy for kanamycin detection based on the G4-DNA aptamer-based fluorescent intercalator displacement assay with thiazole orange (TO) as the fluorescence probe. In the proposed strategy, TO became strongly fluorescent upon binding to kanamycin-binding G4-DNA. However, the addition of kanamycin caused the displacement of TO from the G4-DNA-TO conjugate, thereby resulting in decreased fluorescent signal, which was inversely related to the kanamycin concentration. The detection limit of the proposed assay decreased to 59 nM with a linear working range of 0.1 μM to 20 μM for kanamycin. The cross-reactivity against six other antibiotics was negligible compared with the response to kanamycin. A satisfactory recovery of kanamycin in milk samples ranged from 80.1% to 98.0%, confirming the potential of this bioassay in the measurement of kanamycin in various applications. Our results also served as a good reference for developing similar fluorescent G4-DNA-based bioassays in the future.

  15. Label-free detection of kanamycin based on a G-quadruplex DNA aptamer-based fluorescent intercalator displacement assay.


    Xing, Yun-Peng; Liu, Chun; Zhou, Xiao-Hong; Shi, Han-Chang


    This work was the first to report that the kanamycin-binding DNA aptamer (5'-TGG GGG TTG AGG CTA AGC CGA-3') can form stable parallel G-quadruplex DNA (G4-DNA) structures by themselves and that this phenomenon can be verified by nondenaturing polyacrylamide gel electrophoresis and circular dichroism spectroscopy. Based on these findings, we developed a novel label-free strategy for kanamycin detection based on the G4-DNA aptamer-based fluorescent intercalator displacement assay with thiazole orange (TO) as the fluorescence probe. In the proposed strategy, TO became strongly fluorescent upon binding to kanamycin-binding G4-DNA. However, the addition of kanamycin caused the displacement of TO from the G4-DNA-TO conjugate, thereby resulting in decreased fluorescent signal, which was inversely related to the kanamycin concentration. The detection limit of the proposed assay decreased to 59 nM with a linear working range of 0.1 μM to 20 μM for kanamycin. The cross-reactivity against six other antibiotics was negligible compared with the response to kanamycin. A satisfactory recovery of kanamycin in milk samples ranged from 80.1% to 98.0%, confirming the potential of this bioassay in the measurement of kanamycin in various applications. Our results also served as a good reference for developing similar fluorescent G4-DNA-based bioassays in the future.

  16. Label-free detection of kanamycin using aptamer-based cantilever array sensor.


    Bai, Xiaojing; Hou, Hui; Zhang, Bailin; Tang, Jilin


    A label-free detection method of kanamycin using aptamer-based cantilever array sensor was developed. The cantilever array was composed of sensing cantilevers and reference cantilevers. This configuration allowed direct detection of individual cantilever deflections and subsequent determination of differential deflection of sensing/reference cantilever pair. The sensing cantilevers were functionalized with kanamycin aptamer, which was used as receptor molecules while the reference cantilevers were modified with 6-mercapto-1-hexanol (MCH) to eliminate the influence of environmental disturbances. The kanamycin-aptamer interaction induced a change in cantilever surface stress, which caused a differential deflection between the sensing and reference cantilever pair. The surface stress change was linear with kanamycin concentration over the range of 100 μM-10mM with a correlation coefficient of 0.995. A detection limit of 50 μM was obtained, at a signal-to-noise ratio of 3. The sensor also showed good selectivity against other antibiotics such as neomycin, ribostamycin and chloramphenicol. The facile method for kanamycin detection may have great potential for investigating more other molecules.

  17. 17-DMAG induces Hsp70 and protects the auditory hair cells from kanamycin ototoxicity in vitro.


    Liu, Yun; Yu, Yang; Chu, Hanqi; Bing, Dan; Wang, Shaoli; Zhou, Liangqiang; Chen, Jin; Chen, Qingguo; Pan, Chunchen; Sun, Yanbo; Cui, Yonghua


    Heat shock protein 70 (Hsp70) has been known to be able to play a protective role in the cochlea. The aim of this study was to investigate whether geldanamycin hydrosoluble derivative 17-(dimethylaminoethylamino)-17-demethoxygeldanamycin (17-DMAG) has the ability to induce Hsp70 up-regulation to protect hair cells from kanamycin-induced ototoxicity in vitro. The organ of Corti (OC) explants were isolated from mice at postnatal day 3-5. Then, the explants were exposed to kanamycin with or without pre-incubation with 17-DMAG. The expression of Hsp70 was assessed by reverse transcription-quantitative polymerase chain reaction, ELISA, and immunofluorescent staining. The surviving hair cells were examined by phalloidin labeling and were counted. We found that Hsp70 expression in the explants after pre-incubation with 17-DMAG was significantly increased at both mRNA and protein levels. Immunofluorescent staining showed that Hsp70 was mainly located in the auditory hair cells. Compared with kanamycin group, the loss of hair cells was inhibited significantly in 17-DMAG+kanamycin group. Our study demonstrated that 17-DMAG induces Hsp70 in the hair cells, and has a significant protective effect against kanamycin ototoxicity in vitro. 17-DMAG has the possibility to be a safe and effective anti-ototoxic drug.

  18. Sustained Fos expression is observed in the developing brainstem auditory circuits of kanamycin-treated rats.


    Lee, Jae Ho; Kim, Hee Jung; Suh, Myung-Whan; Ahn, Seung Cheol


    It has been demonstrated that kanamycin treatment during early developmental period induces partial cochlear destruction and enhanced glutamatergic transmission at the medial nucleus of the trapezoid body (MNTB) - the lateral superior olive (LSO) synapses in the superior olivary complex (SOC). As c-fos was expected to be expressed in the SOC by kanamycin-induced cochlear damage, the expression of c-fos protein (Fos) was investigated using immunohistochemistry in kanamycin-treated rat pups. In the control rat pups less than postnatal (P) day 9 in age, Fos-like immunoreactivity (Fos-IR) was transiently observed in the MNTB and LSO on P6, but disappeared on P9, which reflects a physiologic process. In contrast, in kanamycin-treated rats, Fos-IR was consistently observed through P9. Because a significant increase in terminal uridine deoxynucleotidyl transferase-mediated 2'-deoxyuridine 5'-triphosphate-biotin nick-end labeling (TUNEL) and glial fibrillary acidic protein (GFAP) IR was not demonstrated in the MNTB and LSO of kanamycin-treated rats, the increased Fos-IR does not appear to indicate an ongoing pathologic process, but may be related to the increased activity caused by the disturbance in excitatory and inhibitory balance between brainstem auditory circuits.

  19. Structure-activity relationships for antibacterial to antifungal conversion of kanamycin to amphiphilic analogues.


    Fosso, Marina; AlFindee, Madher N; Zhang, Qian; Nziko, Vincent de Paul Nzuwah; Kawasaki, Yukie; Shrestha, Sanjib K; Bearss, Jeremiah; Gregory, Rylee; Takemoto, Jon Y; Chang, Cheng-Wei Tom


    Novel fungicides are urgently needed. It was recently reported that the attachment of an octyl group at the O-4″ position of kanamycin B converts this antibacterial aminoglycoside into a novel antifungal agent. To elucidate the structure-activity relationship (SAR) for this phenomenon, a lead compound FG03 with a hydroxyl group replacing the 3″-NH2 group of kanamycin B was synthesized. FG03's antifungal activity and synthetic scheme inspired the synthesis of a library of kanamycin B analogues alkylated at various hydroxyl groups. SAR studies of the library revealed that for antifungal activity the O-4″ position is the optimal site for attaching a linear alkyl chain and that the 3″-NH2 and 6″-OH groups of the kanamycin B parent molecule are not essential for antifungal activity. The discovery of lead compound, FG03, is an example of reviving clinically obsolete drugs like kanamycin by simple chemical modification and an alternative strategy for discovering novel antimicrobials.

  20. Structure-activity relationships among the kanamycin aminoglycosides: role of ring I hydroxyl and amino groups.


    Salian, Sumantha; Matt, Tanja; Akbergenov, Rashid; Harish, Shinde; Meyer, Martin; Duscha, Stefan; Shcherbakov, Dmitri; Bernet, Bruno B; Vasella, Andrea; Westhof, Eric; Böttger, Erik C


    The kanamycins form an important subgroup of the 4,6-disubstituted 2-deoxystreptamine aminoglycoside antibiotics, comprising kanamycin A, kanamycin B, tobramycin, and dibekacin. These compounds interfere with protein synthesis by targeting the ribosomal decoding A site, and they differ in the numbers and locations of amino and hydroxy groups of the glucopyranosyl moiety (ring I). We synthesized kanamycin analogues characterized by subtle variations of the 2' and 6' substituents of ring I. The functional activities of the kanamycins and the synthesized analogues were investigated (i) in cell-free translation assays on wild-type and mutant bacterial ribosomes to study drug-target interaction, (ii) in MIC assays to assess antibacterial activity, and (iii) in rabbit reticulocyte translation assays to determine activity on eukaryotic ribosomes. Position 2' forms an intramolecular H bond with O5 of ring II, helping the relative orientations of the two rings with respect to each other. This bond becomes critical for drug activity when a 6'-OH substituent is present.

  1. An ultrasensitive homogeneous aptasensor for kanamycin based on upconversion fluorescence resonance energy transfer.


    Li, Hui; Sun, De-en; Liu, Yajie; Liu, Zhihong


    We developed an ultrasensitive fluorescence resonance energy transfer (FRET) aptasensor for kanamycin detection, using upconversion nanoparticles (UCNPs) as the energy donor and graphene as the energy acceptor. Oleic acid modified upconversion nanoparticles were synthesized through a hydrothermal process followed by a ligand exchange with hexanedioic acid. The kanamycin aptamer (5'-NH2-AGATGGGGGTTGAGGCTAAGCCGA-3') was tagged to UCNPs through an EDC-NHS protocol. The π-π stacking interaction between the aptamer and graphene brought UCNPs and graphene in close proximity and hence initiated the FRET process resulting in quenching of UCNPs fluorescence. The addition of kanamycin to the UCNPs-aptamer-graphene complex caused the fluorescence recovery because of the blocking of the energy transfer, which was induced by the conformation change of aptamer into a hairpin structure. A linear calibration was obtained between the fluorescence intensity and the logarithm of kanamycin concentration in the range from 0.01 nM to 3 nM in aqueous buffer solution, with a detection limit of 9 pM. The aptasensor was also applicable in diluted human serum sample with a linear range from 0.03 nM to 3 nM and a detection limit of 18 pM. The aptasensor showed good specificity towards kanamycin without being disturbed by other antibiotics. The ultrahigh sensitivity and pronounced robustness in complicated sample matrix suggested promising prospect of the aptasensor in practical applications.

  2. Novel Synthesis of Kanamycin Conjugated Gold Nanoparticles with Potent Antibacterial Activity

    PubMed Central

    Payne, Jason N.; Waghwani, Hitesh K.; Connor, Michael G.; Hamilton, William; Tockstein, Sarah; Moolani, Harsh; Chavda, Fenil; Badwaik, Vivek; Lawrenz, Matthew B.; Dakshinamurthy, Rajalingam


    With a sharp increase in the cases of multi-drug resistant (MDR) bacteria all over the world, there is a huge demand to develop a new generation of antibiotic agents to fight them. As an alternative to the traditional drug discovery route, we have designed an effective antibacterial agent by modifying an existing commercial antibiotic, kanamycin, conjugated on the surface of gold nanoparticles (AuNPs). In this study, we report a single-step synthesis of kanamycin-capped AuNPs (Kan-AuNPs) utilizing the combined reducing and capping properties of kanamycin. While Kan-AuNPs have increased toxicity to a primate cell line (Vero 76), antibacterial assays showed dose-dependent broad spectrum activity of Kan-AuNPs against both Gram-positive and Gram-negative bacteria, including Kanamycin resistant bacteria. Further, a significant reduction in the minimum inhibitory concentration (MIC) of Kan-AuNPs was observed when compared to free kanamycin against all the bacterial strains tested. Mechanistic studies using transmission electron microscopy and fluorescence microscopy indicated that at least part of Kan-AuNPs increased efficacy may be through disrupting the bacterial envelope, resulting in the leakage of cytoplasmic content and the death of bacterial cells. Results of this study provide critical information about a novel method for the development of antibiotic capped AuNPs as potent next-generation antibacterial agents. PMID:27330535

  3. Novel Synthesis of Kanamycin Conjugated Gold Nanoparticles with Potent Antibacterial Activity.


    Payne, Jason N; Waghwani, Hitesh K; Connor, Michael G; Hamilton, William; Tockstein, Sarah; Moolani, Harsh; Chavda, Fenil; Badwaik, Vivek; Lawrenz, Matthew B; Dakshinamurthy, Rajalingam


    With a sharp increase in the cases of multi-drug resistant (MDR) bacteria all over the world, there is a huge demand to develop a new generation of antibiotic agents to fight them. As an alternative to the traditional drug discovery route, we have designed an effective antibacterial agent by modifying an existing commercial antibiotic, kanamycin, conjugated on the surface of gold nanoparticles (AuNPs). In this study, we report a single-step synthesis of kanamycin-capped AuNPs (Kan-AuNPs) utilizing the combined reducing and capping properties of kanamycin. While Kan-AuNPs have increased toxicity to a primate cell line (Vero 76), antibacterial assays showed dose-dependent broad spectrum activity of Kan-AuNPs against both Gram-positive and Gram-negative bacteria, including Kanamycin resistant bacteria. Further, a significant reduction in the minimum inhibitory concentration (MIC) of Kan-AuNPs was observed when compared to free kanamycin against all the bacterial strains tested. Mechanistic studies using transmission electron microscopy and fluorescence microscopy indicated that at least part of Kan-AuNPs increased efficacy may be through disrupting the bacterial envelope, resulting in the leakage of cytoplasmic content and the death of bacterial cells. Results of this study provide critical information about a novel method for the development of antibiotic capped AuNPs as potent next-generation antibacterial agents.

  4. Plasmids encoding therapeutic agents


    Keener, William K.


    Plasmids encoding anti-HIV and anti-anthrax therapeutic agents are disclosed. Plasmid pWKK-500 encodes a fusion protein containing DP178 as a targeting moiety, the ricin A chain, an HIV protease cleavable linker, and a truncated ricin B chain. N-terminal extensions of the fusion protein include the maltose binding protein and a Factor Xa protease site. C-terminal extensions include a hydrophobic linker, an L domain motif peptide, a KDEL ER retention signal, another Factor Xa protease site, an out-of-frame buforin II coding sequence, the lacZ.alpha. peptide, and a polyhistidine tag. More than twenty derivatives of plasmid pWKK-500 are described. Plasmids pWKK-700 and pWKK-800 are similar to pWKK-500 wherein the DP178-encoding sequence is substituted by RANTES- and SDF-1-encoding sequences, respectively. Plasmid pWKK-900 is similar to pWKK-500 wherein the HIV protease cleavable linker is substituted by a lethal factor (LF) peptide-cleavable linker.

  5. Characterization of a Plasmid-Encoded Type IV Secretion System in Campylobacter jejuni 81-176

    DTIC Science & Technology


    jejuni 81-176, pTet, is a conjugative R factor encoding tetracycline resistance (Batchelor et al., 2004), and is likely related to the tetO...chloramphenicol per ml, 25 µg of kanamycin per ml, 20 µg of streptomycin per ml, 20 µg of tetracycline per ml, and 10 µg of trimethoprim per ml. Plasmids...shows the qualitative results from a yeast 2- hybrid screen using Cjp5/VirB11 as both bait and prey. Colonies were subcloned on 54 minimal

  6. [Research progress of acute kanamycin sulfate-induced deafness in guinea pig].


    Yin, Zedeng; Kng, Weijia


    To present a summary of current knowledge regarding acute kanamycin sulfate-induced deafness in guinea pig, by reviewing the published literature. Animal model of acute deafness induced by a single dose of kanamycin sulfate in combination with ethacrynic acid or furosemide in guinea pig was usually used to investigate the mechanism of cochlear cell degeneration. There were different time sequences of cell degeneration of spiral ganglion cell and hair cell in different studies. The findings may result from different doses, order of two drugs administration or time point chosen. There remains scope for further research in chronic kanamycin-induced deafness, which more replicates the type of exposure to people than acute deafness.

  7. Construction of kanamycin B overproducing strain by genetic engineering of Streptomyces tenebrarius.


    Ni, Xianpu; Li, Dan; Yang, Lihua; Huang, Tingjiao; Li, Hao; Xia, Huanzhang


    Genetic engineering as an important approach to strain optimization has received wide recognition. Recent advances in the studies on the biosynthetic pathways and gene clusters of Streptomyces make stain optimization by genetic alteration possible. Kanamycin B is a key intermediate in the manufacture of the important medicines dibekacin and arbekacin, which belong to a class of antibiotics known as the aminoglycosides. Kanamycin could be prepared by carbamoylkanamycin B hydrolysis. However, carbamoylkanamycin B production in Streptomyces tenebrarius H6 is very low. Therefore, we tried to obtain high kanamycin B-producing strains that produced kanamycin B as a main component. In our work, aprD3 and aprD4 were clarified to be responsible for deoxygenation in apramycin and tobramycin biosynthesis. Based on this information, genes aprD3, aprQ (deduced apramycin biosynthetic gene), and aprD4 were disrupted to optimize the production of carbamoylkanamycin B. Compared with wild-type strain, mutant strain SPU313 (ΔaprD3, ΔaprQ, and ΔaprD4) produced carbamoylkanamycin B as a single antibiotic, whose production increased approximately fivefold. To construct a strain producing kanamycin B instead of carbamoylkanamycin B, the carbamoyl-transfer gene tacA was inactivated in strain SPU313. Mutant strain SPU314 (ΔaprD3, ΔaprQ, ΔaprD4, and ΔtacA) specifically produced kanamycin B, which was proven by LC-MS. This work demonstrated careful genetic engineering could significantly improve production and eliminate undesired products.

  8. Macrophage-specific Mycobacterium tuberculosis genes: identification by green fluorescent protein and kanamycin resistance selection.


    Srivastava, Vikas; Rouanet, Carine; Srivastava, Ranjana; Ramalingam, B; Locht, Camille; Srivastava, Brahm S


    Mycobacterium tuberculosis survives and multiplies inside macrophages of its host by modulating the expression of several genes essential for in vivo survival. An in vivo expression system has been developed, based on green fluorescent protein and kanamycin resistance, to identify M. tuberculosis genes which appear to be up-regulated in infected macrophages. A promoter-trap shuttle vector, pLL192, was constructed, containing a streptomycin resistance gene as selection marker and an artificial bicistronic operon composed of the promoterless green fluorescent protein (gfp) gene, followed by the kanamycin resistance gene. A unique BamHI site upstream of the gfp gene allowed for insertion of promoter libraries. The vector was validated by the use of known regulated or constitutive M. tuberculosis promoters. In addition, an M. tuberculosis genomic DNA library was inserted into pLL192 and then introduced into Mycobacterium bovis BCG. The recombinant BCG cells were then used to infect the J774A.1 murine macrophage-like cell line in the presence of kanamycin. Several recombinant BCG cells were thereby selected that were resistant to kanamycin within infected macrophages, but were sensitive to kanamycin when grown in vitro. The kanamycin resistance phenotype was paralleled by the fluorescence phenotype. After nucleotide sequencing, the corresponding genes were identified as mce1A, PE_PGRS63(RV3097c), Rv2232, Rv1026, Rv1635c, viuB, Rv2231(cobC) and Rv0997. Real-time PCR analysis using RNA isolated at various time points from M. tuberculosis and M. bovis BCG grown in vitro and within macrophages, confirmed the up-regulation of these genes. The level of up-regulation varied from 2- to 40-fold in macrophages compared to growth in vitro.

  9. Serum resistance encoded by colicin V plasmids in Escherichia coli and its relationship to the plasmid transfer system.

    PubMed Central

    Nilius, A M; Savage, D C


    Eight colicin V plasmids were conjugated into a plasmidless Escherichia coli (K-12) strain that was susceptible to the bactericidal effects of normal rabbit serum. The resulting colicin V-positive strains were examined for their capacity to resist the lethal effects of serum. Serum resistance was assessed as growth of the bacterial strain in medium containing 5% normal rabbit serum inoculated from a culture in the early exponential phase. Only three of the eight colicin V plasmids were found to confer the serum resistance phenotype on the host strain. Derepression of the transfer system was associated with serum resistance in two of the plasmids. Two other derepressed plasmids did not confer serum resistance on the host bacterium. Therefore, such derepression alone was insufficient to produce serum resistance. The factor(s) encoded by colicin V plasmids and responsible for the serum resistance of the bacterial strains bearing the plasmids was shown to be a property associated with the cell and not an extracellular factor excreted into the growth medium. PMID:6365788

  10. Phytoplasma plasmid DNA extraction.


    Andersen, Mark T; Liefting, Lia W


    Phytoplasma plasmids have generally been detected from DNA extracted from plants and insects using methods designed for the purification of total phytoplasma DNA. Methods include extraction from tissues that are high in phytoplasma titre, such as the phloem of plants, with the use of CsCl-bisbenzimide gradients that exploit the low G+C content of phytoplasma DNA. Many of the methods employed for phytoplasma purification have been described elsewhere in this book. Here we describe in detail two methods that are specifically aimed at isolating plasmid DNA.

  11. Kanamycin resistance in plants: an unexpected trait controlled by a potentially multifaceted gene.


    Rommens, Caius M


    Ayalew Mentewab and C. Neal Stewart Jr recently showed that an Arabidopsis kanamycin resistance gene encodes an ATP binding cassette (ABC) transporter. This Atwbc19 protein is hypothesized to prevent ribosome inactivation by translocating kanamycin into the vacuole. Because ABC transporters often recognize multiple exogenous substrates, overexpression of Atwbc19 can result in the accumulation of unexpected compounds in transgenic plants. Another potential safety issue associated with this gene is horizontal gene transfer. Thus, commercial applications are likely to be limited to methods that allow removal of the selectable marker from the transgenic plant genome.

  12. Plasmid Detection, Characterization, and Ecology.


    Smalla, Kornelia; Jechalke, Sven; Top, Eva M


    Plasmids are important vehicles for rapid adaptation of bacterial populations to changing environmental conditions. It is thought that to reduce the cost of plasmid carriage, only a fraction of a local population carries plasmids or is permissive to plasmid uptake. Plasmids provide various accessory traits which might be beneficial under particular conditions. The genetic variation generated by plasmid carriage within populations ensures the robustness toward environmental changes. Plasmid-mediated gene transfer plays an important role not only in the mobilization and dissemination of antibiotic resistance genes but also in the spread of degradative pathways and pathogenicity determinants of pathogens. Here we summarize the state-of-the-art methods to study the occurrence, abundance, and diversity of plasmids in environmental bacteria. Increasingly, cultivation-independent total-community DNA-based methods are being used to characterize and quantify the diversity and abundance of plasmids in relation to various biotic and abiotic factors. An improved understanding of the ecology of plasmids and their hosts is crucial in the development of intervention strategies for antibiotic-resistance-gene spread. We discuss the potentials and limitations of methods used to determine the host range of plasmids, as the ecology of plasmids is tightly linked to their hosts. The recent advances in sequencing technologies provide an enormous potential for plasmid classification, diversity, and evolution studies, but numerous challenges still exist.

  13. Mechanisms of plasmid segregation: have multicopy plasmids been overlooked?


    Million-Weaver, Samuel; Camps, Manel


    Plasmids are self-replicating pieces of DNA typically bearing non-essential genes. Given that plasmids represent a metabolic burden to the host, mechanisms ensuring plasmid transmission to daughter cells are critical for their stable maintenance in the population. Here we review these mechanisms, focusing on two active partition strategies common to low-copy plasmids: par systems type I and type II. Both involve three components: an adaptor protein, a motor protein, and a centromere, which is a sequence area in the plasmid that is recognized by the adaptor protein. The centromere-bound adaptor nucleates polymerization of the motor, leading to filament formation, which can pull plasmids apart (par I) or push them towards opposite poles of the cell (par II). No such active partition mechanisms are known to occur in high copy number plasmids. In this case, vertical transmission is generally considered stochastic, due to the random distribution of plasmids in the cytoplasm. We discuss conceptual and experimental lines of evidence questioning the random distribution model and posit the existence of a mechanism for segregation in high copy number plasmids that moves plasmids to cell poles to facilitate transmission to daughter cells. This mechanism would involve chromosomally-encoded proteins and the plasmid origin of replication. Modulation of this proposed mechanism of segregation could provide new ways to enhance plasmid stability in the context of recombinant gene expression, which is limiting for large-scale protein production and for bioremediation.

  14. Plasmid interference for curing antibiotic resistance plasmids in vivo.


    Kamruzzaman, Muhammad; Shoma, Shereen; Thomas, Christopher M; Partridge, Sally R; Iredell, Jonathan R


    Antibiotic resistance increases the likelihood of death from infection by common pathogens such as Escherichia coli and Klebsiella pneumoniae in developed and developing countries alike. Most important modern antibiotic resistance genes spread between such species on self-transmissible (conjugative) plasmids. These plasmids are traditionally grouped on the basis of replicon incompatibility (Inc), which prevents coexistence of related plasmids in the same cell. These plasmids also use post-segregational killing ('addiction') systems, which poison any bacterial cells that lose the addictive plasmid, to guarantee their own survival. This study demonstrates that plasmid incompatibilities and addiction systems can be exploited to achieve the safe and complete eradication of antibiotic resistance from bacteria in vitro and in the mouse gut. Conjugative 'interference plasmids' were constructed by specifically deleting toxin and antibiotic resistance genes from target plasmids. These interference plasmids efficiently cured the corresponding antibiotic resistant target plasmid from different Enterobacteriaceae in vitro and restored antibiotic susceptibility in vivo to all bacterial populations into which plasmid-mediated resistance had spread. This approach might allow eradication of emergent or established populations of resistance plasmids in individuals at risk of severe sepsis, enabling subsequent use of less toxic and/or more effective antibiotics than would otherwise be possible, if sepsis develops. The generalisability of this approach and its potential applications in bioremediation of animal and environmental microbiomes should now be systematically explored.

  15. Chemotherapy of Bacterial Plasmids

    DTIC Science & Technology


    multiresistance to chemotherapeutic drugs, mediated drug resistance are the emergence of strains determined by R-plasmids, causes treatment failures of Haemophilus ... influenzae , resistant to ampicillin [8] of hospital infections, foremost in patients with a or chloramphenicol [9] and of Neisseria gonorrhoeae

  16. [Antitoxic properties of pantothenic acid derivatives, precursors of coenzyme A biosynthesis, with regard to kanamycin].


    Moĭseenok, A G; Dorofeev, B F; Sheĭbak, V M; Khomich, T I


    The effect of calcium pantothenate (CPN)B 4'-phospho-CPN (PCP), pantetheine (PT) and calcium S-sulfopantetheine (SPN) on acute toxicity of kanamycin sulfate was studied on albino mice. The above derivatives of pantothenic acid except PT lowered the antibiotic toxicity. The coefficient of the antitoxic effect (LD50/ED50) of SPN and PCP was 1.3-1.4 times higher than that of CPN. The combined use of kanamycin (1/5 of the LD50) with CPN, PCP or PT (30 mg/kg bw was equivalent to CPN) for 15 days prevented the increase in the total content of CoA and in the content of the fraction of free CoA and the precursors of its biosynthesis participating in the reaction of N-acetylation in the liver and brain. The contents of these substances were within the normal during the whole experiment. A certain increase in the activity of pantothenate kinase in the liver cytosol due to the use of kanamycin was eliminated by the simultaneous use of PCP and PT. The vitamin-containing compounds PCP and SPN were recommended for the clinical trials as agents preventing complications of kanamycin therapy.

  17. Photoelectrochemical aptasensing of kanamycin using visible light-activated carbon nitride and graphene oxide nanocomposites.


    Li, Ruizhen; Liu, Yong; Cheng, Ling; Yang, Changzhu; Zhang, Jingdong


    Photoactive material and recognition element are two crucial factors which determine the sensitivity and selectivity of the photoelectrochemical (PEC) sensor. Herein we developed a novel PEC aptamer sensor for the specific detection of kanamycin using water-dispersible graphite-like carbon nitride (w-g-C3N4) as visible light-active material and aptamer as the biorecognition element. While a suitable amount of graphene oxide (GO) was doped in w-g-C3N4, the visible light photocurrent response was enhanced, which was beneficial to the construction of PEC sensor. On the other hand, the large specific surface area and π-conjugated structure of GO/w-g-C3N4 provided an excellent platform for immobilizing the kanamycin-binding DNA aptamer on the surface of the sensor via π-π stacking interaction. On such a sensor, the capture of kanamycin molecules by aptamer resulted in increased photocurrent. The PEC response of the sensor was found to be linearly proportional to the concentration of kanamycin in the range from 1 nM to 230 nM with a detection limit (3S/N) of 0.2 nM. Moreover, the proposed sensor displayed high selectivity, good reproducibility, and high stability, demonstrating the successful combination of GO/w-g-C3N4 with aptamer in fabricating high performance PEC sensors.

  18. Susceptibility of coagulase-negative staphylococci to a kanamycin and cefalexin combination.


    Silley, P; Goby, L; Pillar, C M


    A combination of kanamycin and cefalexin was licensed in Europe in 2008 to treat bovine clinical mastitis. Preliminary broth and disk clinical breakpoints for this antibiotic combination have been proposed for Staphylococcus aureus, Streptococcus dysgalactiae, Streptococcus uberis, and Escherichia coli. This study indicates that these proposed breakpoints also hold for coagulase-negative staphylococci (CNS), a group of bacteria frequently isolated in milk samples from cows with clinical mastitis. The data show that clinical bovine mastitis isolates of CNS from Europe have a high degree of susceptibility to the kanamycin/cefalexin combination, with minimal resistance to either agent alone. The use of the available kanamycin and cefalexin combination disk for testing the susceptibility of bovine mastitis isolates of Staph. aureus, Strep. uberis, Strep. dysgalactiae, and E. coli is also reliable for use in the testing of CNS, as disk results correlated with broth minimum inhibitory concentrations. The study reports, for the first time, the approved Clinical Laboratory Standards Institute quality control ranges for the kanamycin/cefalexin combination and wild-type cutoff values for major bacterial pathogens implicated in bovine mastitis.

  19. Aptamer-mediated 'turn-off/turn-on' nanozyme activity of gold nanoparticles for kanamycin detection.


    Sharma, Tarun Kumar; Ramanathan, Rajesh; Weerathunge, Pabudi; Mohammadtaheri, Mahsa; Daima, Hemant Kumar; Shukla, Ravi; Bansal, Vipul


    A new ultrafast and highly sensitive 'turn-off/turn-on' biosensing approach that combines the intrinsic peroxidase-like activity of gold nanoparticles (GNPs) with the high affinity and specificity of a ssDNA aptamer is presented for the efficient detection of a model small molecule kanamycin.

  20. Plasmid interference for curing antibiotic resistance plasmids in vivo

    PubMed Central

    Kamruzzaman, Muhammad; Shoma, Shereen; Thomas, Christopher M.; Partridge, Sally R.


    Antibiotic resistance increases the likelihood of death from infection by common pathogens such as Escherichia coli and Klebsiella pneumoniae in developed and developing countries alike. Most important modern antibiotic resistance genes spread between such species on self-transmissible (conjugative) plasmids. These plasmids are traditionally grouped on the basis of replicon incompatibility (Inc), which prevents coexistence of related plasmids in the same cell. These plasmids also use post-segregational killing (‘addiction’) systems, which poison any bacterial cells that lose the addictive plasmid, to guarantee their own survival. This study demonstrates that plasmid incompatibilities and addiction systems can be exploited to achieve the safe and complete eradication of antibiotic resistance from bacteria in vitro and in the mouse gut. Conjugative ‘interference plasmids’ were constructed by specifically deleting toxin and antibiotic resistance genes from target plasmids. These interference plasmids efficiently cured the corresponding antibiotic resistant target plasmid from different Enterobacteriaceae in vitro and restored antibiotic susceptibility in vivo to all bacterial populations into which plasmid-mediated resistance had spread. This approach might allow eradication of emergent or established populations of resistance plasmids in individuals at risk of severe sepsis, enabling subsequent use of less toxic and/or more effective antibiotics than would otherwise be possible, if sepsis develops. The generalisability of this approach and its potential applications in bioremediation of animal and environmental microbiomes should now be systematically explored. PMID:28245276

  1. Plasmid-mediated fitness advantage of Acinetobacter baylyi in sulfadiazine-polluted soil.


    Jechalke, Sven; Kopmann, Christoph; Richter, Mona; Moenickes, Sylvia; Heuer, Holger; Smalla, Kornelia


    LowGC-type plasmids conferring resistance to sulfonamides have been frequently isolated from manure and manured soil. However, knowledge on the dynamics of plasmid-carrying populations in soil and their response to the presence of sulfonamides is scarce. Here, we investigated effects of the sulfonamide resistance conferring plasmid pHHV216 on the fitness of Acinetobacter baylyi BD413 in soil after application of manure with or without the sulfonamide antibiotic sulfadiazine (SDZ). The persistence of A. baylyi BD413 pHHV216 in competition to its plasmid-free variant was followed in soil microcosms. CFU counts showed a decrease in A. baylyi BD413 in manured soils over the experimental period of 32 days by about 0.5 log units. The proportion of the plasmid-carrying populations decreased from 50 to < 40% in the absence of SDZ, while the proportion of plasmid-carrying BD413 increased from 50 to about 65% with SDZ added. The data suggest that SDZ introduced via manure into soil was bioaccessible, providing a fitness advantage for the plasmid-carrying population of BD413 in soil, while the plasmid conferred a fitness disadvantage when selective pressure by SDZ was absent. In future, this method may be used as a tool for the assessment of bioavailability of antibiotics in soil.

  2. Narrow- and Broad-Host-Range Symbiotic Plasmids of Rhizobium spp. Strains That Nodulate Phaseolus vulgaris

    PubMed Central

    Brom, Susana; Martinez, Esperanza; Dávila, Guillermo; Palacios, Rafael


    Agrobacterium transconjugants containing symbiotic plasmids from different Rhizobium spp. strains that nodulate Phaseolus vulgaris were obtained. All transconjugants conserved the parental nodulation host range. Symbiotic (Sym) plasmids of Rhizobium strains isolated originally from P. vulgaris nodules, which had a broad nodulation host range, and single-copy nitrogenase genes conferred a Fix+ phenotype to the Agrobacterium transconjugants. A Fix− phenotype was obtained with Sym plasmids of strains isolated from P. vulgaris nodules that had a narrow host range and reiterated nif genes, as well as with Sym plasmids of strains isolated from other legumes that presented single nif genes and a broad nodulation host range. This indicates that different types of Sym plasmids can confer the ability to establish an effective symbiosis with P. vulgaris. Images PMID:16347637

  3. Protonation of kanamycin A: detailing of thermodynamics and protonation sites assignment.


    Fuentes-Martínez, Yanet; Godoy-Alcántar, Carolina; Medrano, Felipe; Dikiy, Alexander; Yatsimirsky, Anatoly K


    Protonation of an aminoglycoside antibiotic kanamycin A sulfate was studied by potentiometric titrations at variable ionic strength, sulfate concentration and temperature. From these results the association constants of differently protonated forms of kanamycin A with sulfate and enthalpy changes for protonation of each amino group were determined. The protonation of all amino groups of kanamycin A is exothermic, but the protonation enthalpy does not correlate with basicity as in a case of simple polyamines. The sites of stepwise protonation of kanamycin A have been assigned by analysis of (1)H-(13)C-HSQC spectra at variable pH in D(2)O. Plots of chemical shifts for each H and C atom of kanamycin A vs. pH were fitted to the theoretical equation relating them to pK(a) values of ionogenic groups and it was observed that changes in chemical shifts of all atoms in ring C were controlled by ionization of a single amino group with pK(a) 7.98, in ring B by ionization of two amino groups with pK(a) 6.61 and 8.54, but in ring A all atoms felt ionization of one group with pK(a) 9.19 and some atoms felt ionization of a second group with pK(a) 6.51, which therefore should belong to amino group at C3 in ring B positioned closer to the ring A while higher pK(a) 8.54 can be assigned to the group at C1. This resolves the previously existed uncertainty in assignment of protonation sites in rings B and C.

  4. Remarkable stability of an instability-prone lentiviral vector plasmid in Escherichia coli Stbl3.


    Al-Allaf, Faisal A; Tolmachov, Oleg E; Zambetti, Lia Paola; Tchetchelnitski, Viktoria; Mehmet, Huseyin


    Large-scale production of plasmid DNA to prepare therapeutic gene vectors or DNA-based vaccines requires a suitable bacterial host, which can stably maintain the plasmid DNA during industrial cultivation. Plasmid loss during bacterial cell divisions and structural changes in the plasmid DNA can dramatically reduce the yield of the desired recombinant plasmid DNA. While generating an HIV-based gene vector containing a bicistronic expression cassette 5'-Olig2cDNA-IRES-dsRed2-3', we encountered plasmid DNA instability, which occurred in homologous recombination deficient recA1 Escherichia coli strain Stbl2 specifically during large-scale bacterial cultivation. Unexpectedly, the new recombinant plasmid was structurally changed or completely lost in 0.5 L liquid cultures but not in the preceding 5 mL cultures. Neither the employment of an array of alternative recA1 E. coli plasmid hosts, nor the lowering of the culture incubation temperature prevented the instability. However, after the introduction of this instability-prone plasmid into the recA13E. coli strain Stbl3, the transformed bacteria grew without being overrun by plasmid-free cells, reduction in the plasmid DNA yield or structural changes in plasmid DNA. Thus, E. coli strain Stbl3 conferred structural and maintenance stability to the otherwise instability-prone lentivirus-based recombinant plasmid, suggesting that this strain can be used for the faithful maintenance of similar stability-compromised plasmids in large-scale bacterial cultivations. In contrast to Stbl2, which is derived wholly from the wild type isolate E. coli K12, E. coli Stbl3 is a hybrid strain of mixed E. coli K12 and E. coli B parentage. Therefore, we speculate that genetic determinants for the benevolent properties of E. coli Stbl3 for safe plasmid propagation originate from its E. coli B ancestor.

  5. Extremely sensitive sandwich assay of kanamycin using surface-enhanced Raman scattering of 2-mercaptobenzothiazole labeled gold@silver nanoparticles.


    Zengin, Adem; Tamer, Ugur; Caykara, Tuncer


    Herein, we report the development of extremely sensitive sandwich assay of kanamycin using a combination of anti-kanamycin functionalized hybrid magnetic (Fe3O4) nanoparticles (MNPs) and 2-mercaptobenzothiazole labeled Au-core@Ag-shell nanoparticles as the recognition and surface-enhanced Raman scattering (SERS) substrate, respectively. The hybrid MNPs were first prepared via surface-mediated RAFT polymerization of N-acryloyl-L-glutamic acid in the presence of 2-(butylsulfanylcarbonylthiolsulfanyl) propionic acid-modified MNPs as a RAFT agent and then biofunctionalized with anti-kanamycin, which are both specific for kanamycin and can be collected via a simple magnet. After separating kanamycin from the sample matrix, they were sandwiched with the SERS substrate. According to our experimental results, the limit of detection (LOD) was determined to be 2pg mL(-1), this value being about 3-7 times more than sensitive than the LOD of previously reported results, which can be explained by the higher SERS activity of silver coated gold nanoparticles. The analysis time took less than 10min, including washing and optical detection steps. Furthermore, the sandwich assay was evaluated for investigating the kanamycin specificity on neomycin, gentamycin and streptomycin and detecting kanamycin in artificially contaminated milk.

  6. Time sequence of auditory nerve and spiral ganglion cell degeneration following chronic kanamycin-induced deafness in the guinea pig.


    Kong, W J; Yin, Z D; Fan, G R; Li, D; Huang, X


    We investigated the time sequence of morphological changes of the spiral ganglion cell (SGC) and auditory nerve (AN) following chronic kanamycin-induced deafness. Guinea pigs were treated with kanamycin by subcutaneous injection at 500 mg/kg per day for 7 days. Histological changes in hair cells, SGCs, Schwann cells and the area of the cross-sectional of the AN with vestibular ganglion (VG) in the internal acoustic meatus were quantified at 1, 7, 14, 28, 56 and 70 days after kanamycin treatment. Outer hair cells decreased at 7 and 14 days. Loss of inner hair cells occurred at 14 and 28 days. The cross-sectional area of the AN with VG increased at 1 day and decreased shortly following loss of SGCs and Schwann cells at 7, 14 and 28 days after deafening. There was a similar time course of morphological changes in the overall cochlea and the basal turn. Thus, the effects of kanamycin on hair cells, spiral ganglion and Schwann cells are progressive. Early degeneration of SGC and Schwann cell mainly results from the direct toxic effect of kanamycin. However, multiple factors such as loss of hair cell, degeneration of Schwann cell and the progressive damage of kanamycin, may participate in the late degeneration process of SGCs. The molecular mechanism of the degeneration of SGC and Schwann cell should be investigated in the future. Moreover, there is a different time sequence of cell degeneration between acute and chronic deafness by kanamycin.

  7. Characterization and Comparative Overview of Complete Sequences of the First Plasmids of Pandoraea across Clinical and Non-clinical Strains

    PubMed Central

    Yong, Delicia; Tee, Kok Keng; Yin, Wai-Fong; Chan, Kok-Gan


    To date, information on plasmid analysis in Pandoraea spp. is scarce. To address the gap of knowledge on this, the complete sequences of eight plasmids from Pandoraea spp. namely Pandoraea faecigallinarum DSM 23572T (pPF72-1, pPF72-2), Pandoraea oxalativorans DSM 23570T (pPO70-1, pPO70-2, pPO70-3, pPO70-4), Pandoraea vervacti NS15 (pPV15) and Pandoraea apista DSM 16535T (pPA35) were studied for the first time in this study. The information on plasmid sequences in Pandoraea spp. is useful as the sequences did not match any known plasmid sequence deposited in public databases. Replication genes were not identified in some plasmids, a situation that has led to the possibility of host interaction involvement. Some plasmids were also void of par genes and intriguingly, repA gene was also not discovered in these plasmids. This further leads to the hypothesis of host-plasmid interaction. Plasmid stabilization/stability protein-encoding genes were observed in some plasmids but were not established for participating in plasmid segregation. Toxin-antitoxin systems MazEF, VapBC, RelBE, YgiT-MqsR, HigBA, and ParDE were identified across the plasmids and their presence would improve plasmid maintenance. Conjugation genes were identified portraying the conjugation ability amongst Pandoraea plasmids. Additionally, we found a shared region amongst some of the plasmids that consists of conjugation genes. The identification of genes involved in replication, segregation, toxin-antitoxin systems and conjugation, would aid the design of drugs to prevent the survival or transmission of plasmids carrying pathogenic properties. Additionally, genes conferring virulence and antibiotic resistance were identified amongst the plasmids. The observed features in the plasmids shed light on the Pandoraea spp. as opportunistic pathogens. PMID:27790203

  8. Heterologous expression of the kanamycin biosynthetic gene cluster (pSKC2) in Streptomyces venezuelae YJ003.


    Thapa, Laxmi Prasad; Oh, Tae-Jin; Lee, Hei Chan; Liou, Kwangkyoung; Park, Je Won; Yoon, Yeo Joon; Sohng, Jae Kyung


    The pSKC2 cosmid, which has 32 kb and 28 open-reading frames, was isolated from Streptomyces kanamyceticus ATCC12853 as the gene cluster of kanamycin. This gene cluster includes the minimal biosynthetic genes of kanamycin with the resistance and regulatory genes. It was heterologously expressed in Streptomyces venezuelae YJ003, which has the advantage of fast growth, good efficiency of the transformation host, and rapid production of the aminoglycosides antibiotic. The isolated compound was analyzed by electrospray ionization-mass spectrometry, liquid chromatography-mass spectrometry, high-performance liquid chromatography, and tandem mass spectrometry and shows a molecular weight of 485 as kanamycin A.

  9. Plasmid copy number noise in monoclonal populations of bacteria

    NASA Astrophysics Data System (ADS)

    Wong Ng, Jérôme; Chatenay, Didier; Robert, Jérôme; Poirier, Michael Guy


    Plasmids are extra chromosomal DNA that can confer to their hosts’ supplementary characteristics such as antibiotic resistance. Plasmids code for their copy number through their own replication frequency. Even though the biochemical networks underlying the plasmid copy number (PCN) regulation processes have been studied and modeled, no measurement of the heterogeneity in PCN within a whole population has been done. We have developed a fluorescent-based measurement system, which enables determination of the mean and noise in PCN within a monoclonal population of bacteria. Two different fluorescent protein reporters were inserted: one on the chromosome and the other on the plasmid. The fluorescence of these bacteria was measured with a microfluidic flow cytometry device. We show that our measurements are consistent with known plasmid characteristics. We find that the partitioning system lowers the PCN mean and standard deviation. Finally, bacterial populations were allowed to grow without selective pressure. In this case, we were able to determine the plasmid loss rate and growth inhibition effect.

  10. Peaceful coexistence amongst Borrelia plasmids: getting by with a little help from their friends?


    Chaconas, George; Norris, Steven J


    Borrelia species comprise a unique genus of bacterial pathogens. These organisms contain a segmented genome with up to two dozen plasmids ranging in size from 5 kb up to about 200 kb. The plasmids have also been referred to as mini-chromosomes or essential genetic elements, as some of them carry information important for infection of vertebrates or for survival in the tick vector. Most of the plasmids are linear with covalently closed hairpin telomeres and these linear plasmids are in a constant state of genetic rearrangement. The mechanisms of plasmid replication, maintenance and partitioning remain largely obscure and are complicated by a long doubling time, the requirement for expensive media and inefficient genetic manipulation. A set of five parologous protein families (PFs) are believed to confer the ability for autonomous replication and plasmid maintenance. The number of plasmids also complicates analyses because of the possibility that PFs from one plasmid may sometimes function in trans on other plasmids. Two papers in the last year have moved the field forward and their combined data suggest that trans complementation amongst Borrelia plasmids may sometimes occur.

  11. Toxin Plasmids of Clostridium perfringens

    PubMed Central

    Li, Jihong; Adams, Vicki; Bannam, Trudi L.; Miyamoto, Kazuaki; Garcia, Jorge P.; Uzal, Francisco A.; Rood, Julian I.


    SUMMARY In both humans and animals, Clostridium perfringens is an important cause of histotoxic infections and diseases originating in the intestines, such as enteritis and enterotoxemia. The virulence of this Gram-positive, anaerobic bacterium is heavily dependent upon its prolific toxin-producing ability. Many of the ∼16 toxins produced by C. perfringens are encoded by large plasmids that range in size from ∼45 kb to ∼140 kb. These plasmid-encoded toxins are often closely associated with mobile elements. A C. perfringens strain can carry up to three different toxin plasmids, with a single plasmid carrying up to three distinct toxin genes. Molecular Koch's postulate analyses have established the importance of several plasmid-encoded toxins when C. perfringens disease strains cause enteritis or enterotoxemias. Many toxin plasmids are closely related, suggesting a common evolutionary origin. In particular, most toxin plasmids and some antibiotic resistance plasmids of C. perfringens share an ∼35-kb region containing a Tn916-related conjugation locus named tcp (transfer of clostridial plasmids). This tcp locus can mediate highly efficient conjugative transfer of these toxin or resistance plasmids. For example, conjugative transfer of a toxin plasmid from an infecting strain to C. perfringens normal intestinal flora strains may help to amplify and prolong an infection. Therefore, the presence of toxin genes on conjugative plasmids, particularly in association with insertion sequences that may mobilize these toxin genes, likely provides C. perfringens with considerable virulence plasticity and adaptability when it causes diseases originating in the gastrointestinal tract. PMID:23699255

  12. Detection of Tn5-like sequences in kanamycin-resistant stream bacteria and environmental DNA

    SciTech Connect

    Leff, L.G.; McArthur, J.V. ); Dana, J.R.; Shimkets, L.J. )


    This study investigates the occurrence of kanamycin and neomycin resistance in the culturable portion of the bacterial assemblage of a South Carolina stream. The constitutively expressed nptII gene was used to determine resistance. Spartial differences in the relative abundances of nptII taken from different locations and habitats in the stream were investigated. Results suggest that multiple probes will probably be necessary to assess kanamycin resistance potential of stream bacteria. At the largest patial scale there are not significant difference among the sites in abundances of nptII genes, though there were some differences in habitats. The authors conclude DNA hybridization appears to be a useful technique for assessing the abundance of genes in mixtures of nonculturable organisms.

  13. MAPLE fabrication of thin films based on kanamycin functionalized magnetite nanoparticles with anti-pathogenic properties

    NASA Astrophysics Data System (ADS)

    Grumezescu, Valentina; Andronescu, Ecaterina; Holban, Alina Maria; Mogoantă, Laurenţiu; Mogoşanu, George Dan; Grumezescu, Alexandru Mihai; Stănculescu, Anca; Socol, Gabriel; Iordache, Florin; Maniu, Horia; Chifiriuc, Mariana Carmen


    In this study we aimed to evaluate the biocompatibility and antimicrobial activity of kanamycin functionalized 5 nm-magnetite (Fe3O4@KAN) nanoparticles thin films deposited by Matrix Assisted Pulsed Laser Evaporation (MAPLE) technique. A laser deposition regime was established in order to stoichiometrically transfer Fe3O4@KAN thin films on silicone and glass substrates. Morphological and physico-chemical properties of powders and coatings were characterized by XRD, TEM, SEM, AFM and IR microscopy (IRM). Our nanostructured thin films have proved efficiency in the prevention of microbial adhesion and mature biofilms development as a result of antibiotic release in its active form. Furthermore, kanamycin functionalized nanostructures exhibit a good biocompatibility, both in vivo and in vitro, demonstrating their potential for implants application. This is the first study reporting the assessment of the in vivo biocompatibility of a magnetite-antimicrobial thin films produced by MAPLE technique.

  14. Efficient plastid transformation in tobacco using the aphA-6 gene and kanamycin selection.


    Huang, F-C; Klaus, S M J; Herz, S; Zou, Z; Koop, H-U; Golds, T J


    Here we report on the development of a new dominant selection marker for plastid transformation in higher plants using the aminoglycoside phosphotransferase gene aphA-6 from Acinetobacter baumannii. Vectors containing chimeric aphA-6 gene constructs were introduced into the tobacco chloroplast using particle bombardment of alginate-embedded protoplast-derived micro colonies or polyethylene glycol (PEG)-mediated DNA uptake. Targeted insertion into the plastome was achieved via homologous recombination, and plastid transformants were recovered on the basis of their resistance to kanamycin. Variations in kanamycin resistance in transplastomic lines were observed depending on the 5' and 3' regulatory elements associated with the aphA-6 coding region. Transplastomic plants were fertile and showed maternal inheritance of the transplastome in the progeny.

  15. Functional characterization of KanP, a methyltransferase from the kanamycin biosynthetic gene cluster of Streptomyces kanamyceticus.


    Nepal, Keshav Kumar; Yoo, Jin Cheol; Sohng, Jae Kyung


    KanP, a putative methyltransferase, is located in the kanamycin biosynthetic gene cluster of Streptomyces kanamyceticus ATCC12853. Amino acid sequence analysis of KanP revealed the presence of S-adenosyl-L-methionine binding motifs, which are present in other O-methyltransferases. The kanP gene was expressed in Escherichia coli BL21 (DE3) to generate the E. coli KANP recombinant strain. The conversion of external quercetin to methylated quercetin in the culture extract of E. coli KANP proved the function of kanP as S-adenosyl-L-methionine-dependent methyltransferase. This is the first report concerning the identification of an O-methyltransferase gene from the kanamycin gene cluster. The resistant activity assay and RT-PCR analysis demonstrated the leeway for obtaining methylated kanamycin derivatives from the wild-type strain of kanamycin producer.

  16. Label-free immunosensor for the detection of kanamycin using Ag@Fe₃O₄ nanoparticles and thionine mixed graphene sheet.


    Yu, Shujun; Wei, Qin; Du, Bin; Wu, Dan; Li, He; Yan, Liangguo; Ma, Hongmin; Zhang, Yong


    A highly sensitive label-free immunosensor for the detection of kanamycin had been developed using silver hybridized mesoporous ferroferric oxide nanoparticles (Ag@Fe₃O₄ NPs) and thionine mixed graphene sheet (TH-GS). TH was used as an electron transfer mediator. The electrical signal was greatly improved in the presence of GS due to its good electron-transfer ability. With the advantages of large specific surface area and excellent electrical conductivity, Ag@Fe₃O₄ NPs could immobilize more antibodies of kanamycin and promote the electron transfer. Cyclic voltammetry and square wave voltammetry were used to characterize the recognition of kanamycin. The proposed immunosensor showed good performances such as low detection limit (15 pg mL⁻¹), wide linear range (from 0.050 to 16 ng mL⁻¹), short analysis time (3 min), high stability, and good selectivity in the detection of kanamycin. The immunosensor was evaluated for pork meat sample, receiving satisfactory results.

  17. Draft Genome Sequence of Amikacin- and Kanamycin-Resistant Mycobacterium tuberculosis MT433 without rrs and eis Mutations.


    Sowajassatakul, Angkanang; Coker, Olabisi O; Prammananan, Therdsak; Chaiprasert, Angkana; Phunpruch, Saranya


    We announce the draft genome sequence of amikacin- and kanamycin-resistant Mycobacterium tuberculosis MT433, which has been previously described as the strain carrying an unknown resistance mechanism.

  18. A novel strategy for obtaining kanamycin resistance in Arabidopsis thaliana by silencing an endogenous gene encoding a putative chloroplast transporter.


    Aufsatz, Werner; Nehlin, Lilian; Voronin, Viktor; Schmidt, Agnes; Matzke, Antonius J M; Matzke, Marjori


    The use of bacterial antibiotic resistance markers in transgenic plants raises concerns about horizontal gene transfer to soil bacteria. We report here that kanamycin resistance in Arabidopsis thaliana can be achieved by silencing an endogenous gene encoding a putative chloroplast transporter, which presumably imports kanamycin into chloroplasts to interfere with ribosomal RNA. Homologs of the transporter exist in other plant species, suggesting this strategy may be generally useful for selecting transformed plant cells.

  19. Covalently linked kanamycin - Ciprofloxacin hybrid antibiotics as a tool to fight bacterial resistance.


    Shavit, Michal; Pokrovskaya, Varvara; Belakhov, Valery; Baasov, Timor


    To address the growing problem of antibiotic resistance, a set of 12 hybrid compounds that covalently link fluoroquinolone (ciprofloxacin) and aminoglycoside (kanamycin A) antibiotics were synthesized, and their activity was determined against both Gram-negative and Gram-positive bacteria, including resistant strains. The hybrids were antagonistic relative to the ciprofloxacin, but were substantially more potent than the parent kanamycin against Gram-negative bacteria, and overcame most dominant resistance mechanisms to aminoglycosides. Selected hybrids were 42-640 fold poorer inhibitors of bacterial protein synthesis than the parent kanamycin, while they displayed similar inhibitory activity to that of ciprofloxacin against DNA gyrase and topoisomerase IV enzymes. The hybrids showed significant delay of resistance development in both E. coli and B. subtilis in comparison to that of component drugs alone or their 1:1 mixture. More generally, the data suggest that an antagonistic combination of aminoglycoside-fluoroquinolone hybrids can lead to new compounds that slowdown/prevent the emergence of resistance.

  20. IncM Plasmid R1215 Is the Source of Chromosomally Located Regions Containing Multiple Antibiotic Resistance Genes in the Globally Disseminated Acinetobacter baumannii GC1 and GC2 Clones

    PubMed Central

    Blackwell, Grace A.


    ABSTRACT Clear similarities between antibiotic resistance islands in the chromosomes of extensively antibiotic-resistant isolates from the two dominant, globally distributed Acinetobacter baumannii clones, GC1 and GC2, suggest a common origin. A close relative of the likely progenitor of both of these regions was found in R1215, a conjugative IncM plasmid from a Serratia marcescens strain isolated prior to 1980. The 37.8-kb resistance region in R1215 lies within the mucB gene and includes aacC1, aadA1, aphA1b, blaTEM, catA1, sul1, and tetA(A), genes that confer resistance to gentamicin, streptomycin and spectinomycin, kanamycin and neomycin, ampicillin, chloramphenicol, sulfamethoxazole, and tetracycline, respectively. The backbone of this region is derived from Tn1721 and is interrupted by a hybrid Tn2670 (Tn21)-Tn1696-type transposon, Tn6020, and an incomplete Tn1. After minor rearrangements, this R1215 resistance island can generate AbGRI2-0*, the predicted earliest form of the IS26-bounded AbGRI2-type resistance island of GC2 isolates, and to the multiple antibiotic resistance region (MARR) of AbaR0, the precursor of this region in AbaR-type resistance islands in the GC1 group. A 29.9-kb circle excised by IS26 has been inserted into the A. baumannii chromosome to generate AbGRI2-0*. To create the MARR of AbaR0, a different circular form, again generated by IS26 from an R1215 resistance region variant, has been opened at a different point by recombination with a copy of the sul1 gene already present in the AbaR precursor. Recent IncM plasmids related to R1215 have a variant resistance island containing a blaSHV gene in the same location. IMPORTANCE Two lineages of extensively antibiotic-resistant A. baumannii currently plaguing modern medicine each acquired resistance to all of the original antibiotics (ampicillin, tetracycline, kanamycin, and sulfonamides) by the end of the 1970s and then became resistant to antibiotics from newer families after they were

  1. Conjugative Plasmids of Neisseria gonorrhoeae

    PubMed Central

    Pachulec, Emilia; van der Does, Chris


    Many clinical isolates of the human pathogen Neisseria gonorrhoeae contain conjugative plasmids. The host range of these plasmids is limited to Neisseria species, but presence of a tetracycline (tetM) determinant inserted in several of these plasmids is an important cause of the rapid spread of tetracycline resistance. Previously plasmids with different backbones (Dutch and American type backbones) and with and without different tetM determinants (Dutch and American type tetM determinants) have been identified. Within the isolates tested, all plasmids with American or Dutch type tetM determinants contained a Dutch type plasmid backbone. This demonstrated that tetM determinants should not be used to differentiate between conjugal plasmid backbones. The nucleotide sequences of conjugative plasmids with Dutch type plasmid backbones either not containing the tetM determinant (pEP5233) or containing Dutch (pEP5289) or American (pEP5050) type tetM determinants were determined. Analysis of the backbone sequences showed that they belong to a novel IncP1 subfamily divergent from the IncP1α, β, γ, δ and ε subfamilies. The tetM determinants were inserted in a genetic load region found in all these plasmids. Insertion was accompanied by the insertion of a gene with an unknown function, and rearrangement of a toxin/antitoxin gene cluster. The genetic load region contains two toxin/antitoxins of the Zeta/Epsilon toxin/antitoxin family previously only found in Gram positive organisms and the virulence associated protein D of the VapD/VapX toxin/antitoxin family. Remarkably, presence of VapX of pJD1, a small cryptic neisserial plasmid, in the acceptor strain strongly increased the conjugation efficiency, suggesting that it functions as an antitoxin for the conjugative plasmid. The presence of the toxin and antitoxin on different plasmids might explain why the host range of this IncP1 plasmid is limited to Neisseria species. The isolated plasmids conjugated efficiently between

  2. Molecular and phenotypic characterization of multidrug-resistant Mycobacterium tuberculosis isolates resistant to kanamycin, amikacin, and capreomycin in China.


    Zhang, Z; Liu, M; Wang, Y; Pang, Y; Kam, K M; Zhao, Y


    Although second-line anti-tuberculosis (TB) injectable drugs have been widely used to improve treatment outcomes of multidrug-resistant TB (MDR-TB), little is known about the prevalence and mechanism of second-line injectable drug resistance among MDR Mycobacterium tuberculosis isolates in China. Here, we found that 12.7 % (20/158) of isolates showed resistance to at least one second-line injectable drug among 158 MDR isolates. At the same time, there were 16 (10.1 %) strains resistant to kanamycin (KAN), 9 (5.7 %) to amikacin (AMK), and 12 (7.6 %) to capreomycin (CAP). In addition, our data revealed no significant difference in the drug resistance patterns for Beijing versus non-Beijing genotype strains (p > 0.05). The most frequently observed mutation was A-to-G substitution at position 1401 of the rrs gene, conferring high-level resistance to KAN and AMK, but had varying minimum inhibitory concentrations (MICs) for CAP. The mutations in the eis promoter and tlyA gene were responsible for low-level resistance to CAP. 83.3 % of A1401G substitutions in the rrs gene was observed in Beijing genotype strains, while the difference was not significant (p = 0.157). Our data demonstrated that the hot-spot regions localized in the rrs gene serve as excellent markers for AMK, but is not a sensitive marker for KAN and CAP. In addition, the cross-resistance patterns and MICs differed among different genetic mutation types, which challenge the practice in China of generalizing resistance to AMK and CAP based on the resistance to KAN alone. Our findings suggested that the individualized drug susceptibility to three major second-line injectable drugs is essential in order to generate more effective treatment regimens for MDR patients.

  3. Plasmid Rolling-Circle Replication.


    Ruiz-Masó, J A; MachóN, C; Bordanaba-Ruiseco, L; Espinosa, M; Coll, M; Del Solar, G


    Plasmids are DNA entities that undergo controlled replication independent of the chromosomal DNA, a crucial step that guarantees the prevalence of the plasmid in its host. DNA replication has to cope with the incapacity of the DNA polymerases to start de novo DNA synthesis, and different replication mechanisms offer diverse solutions to this problem. Rolling-circle replication (RCR) is a mechanism adopted by certain plasmids, among other genetic elements, that represents one of the simplest initiation strategies, that is, the nicking by a replication initiator protein on one parental strand to generate the primer for leading-strand initiation and a single priming site for lagging-strand synthesis. All RCR plasmid genomes consist of a number of basic elements: leading strand initiation and control, lagging strand origin, phenotypic determinants, and mobilization, generally in that order of frequency. RCR has been mainly characterized in Gram-positive bacterial plasmids, although it has also been described in Gram-negative bacterial or archaeal plasmids. Here we aim to provide an overview of the RCR plasmids' lifestyle, with emphasis on their characteristic traits, promiscuity, stability, utility as vectors, etc. While RCR is one of the best-characterized plasmid replication mechanisms, there are still many questions left unanswered, which will be pointed out along the way in this review.

  4. Mechanisms of Theta Plasmid Replication.


    Lilly, Joshua; Camps, Manel


    Plasmids are autonomously replicating pieces of DNA. This article discusses theta plasmid replication, which is a class of circular plasmid replication that includes ColE1-like origins of replication popular with expression vectors. All modalities of theta plasmid replication initiate synthesis with the leading strand at a predetermined site and complete replication through recruitment of the host's replisome, which extends the leading strand continuously while synthesizing the lagging strand discontinuously. There are clear differences between different modalities of theta plasmid replication in mechanisms of DNA duplex melting and in priming of leading- and lagging-strand synthesis. In some replicons duplex melting depends on transcription, while other replicons rely on plasmid-encoded trans-acting proteins (Reps); primers for leading-strand synthesis can be generated through processing of a transcript or in other replicons by the action of host- or plasmid-encoded primases. None of these processes require DNA breaks. The frequency of replication initiation is tightly regulated to facilitate establishment in permissive hosts and to achieve a steady state. The last section of the article reviews how plasmid copy number is sensed and how this feedback modulates the frequency of replication.

  5. Phenotypic plasticity in bacterial plasmids.

    PubMed Central

    Turner, Paul E


    Plasmid pB15 was previously shown to evolve increased horizontal (infectious) transfer at the expense of reduced vertical (intergenerational) transfer and vice versa, a key trade-off assumed in theories of parasite virulence. Whereas the models predict that susceptible host abundance should determine which mode of transfer is selectively favored, host density failed to mediate the trade-off in pB15. One possibility is that the plasmid's transfer deviates from the assumption that horizontal spread (conjugation) occurs in direct proportion to cell density. I tested this hypothesis using Escherichia coli/pB15 associations in laboratory serial culture. Contrary to most models of plasmid transfer kinetics, my data show that pB15 invades static (nonshaking) bacterial cultures only at intermediate densities. The results can be explained by phenotypic plasticity in traits governing plasmid transfer. As cells become more numerous, the plasmid's conjugative transfer unexpectedly declines, while the trade-off between transmission routes causes vertical transfer to increase. Thus, at intermediate densities the plasmid's horizontal transfer can offset selection against plasmid-bearing cells, but at high densities pB15 conjugates so poorly that it cannot invade. I discuss adaptive vs. nonadaptive causes for the phenotypic plasticity, as well as potential mechanisms that may lead to complex transfer dynamics of plasmids in liquid environments. PMID:15166133

  6. Plasmid acquisition in microgravity

    NASA Technical Reports Server (NTRS)

    Juergensmeyer, Margaret A.; Juergensmeyer, Elizabeth A.; Guikema, James A.


    In microgravity, bacteria often show an increased resistance to antibiotics. Bacteria can develop resistance to an antibiotic after transformation, the acquisition of DNA, usually in the form of a plasmid containing a gene for resistance to one or more antibiotics. In order to study the capacity of bacteria to become resistant to antibiotics in microgravity, we have modified the standard protocol for transformation of Escherichia coli for use in the NASA-flight-certified hardware package, The Fluid Processing Apparatus (FPA). Here we report on the ability of E. coli to remain competent for long periods of time at temperatures that are readily available on the Space Shuttle, and present some preliminary flight results.

  7. Selection of a multidrug resistance plasmid by sublethal levels of antibiotics and heavy metals.


    Gullberg, Erik; Albrecht, Lisa M; Karlsson, Christoffer; Sandegren, Linus; Andersson, Dan I


    How sublethal levels of antibiotics and heavy metals select for clinically important multidrug resistance plasmids is largely unknown. Carriage of plasmids generally confers substantial fitness costs, implying that for the plasmid-carrying bacteria to be maintained in the population, the plasmid cost needs to be balanced by a selective pressure conferred by, for example, antibiotics or heavy metals. We studied the effects of low levels of antibiotics and heavy metals on the selective maintenance of a 220-kbp extended-spectrum β-lactamase (ESBL) plasmid identified in a hospital outbreak of Klebsiella pneumoniae and Escherichia coli. The concentrations of antibiotics and heavy metals required to maintain plasmid-carrying bacteria, the minimal selective concentrations (MSCs), were in all cases below (almost up to 140-fold) the MIC of the plasmid-free susceptible bacteria. This finding indicates that the very low antibiotic and heavy metal levels found in polluted environments and in treated humans and animals might be sufficiently high to maintain multiresistance plasmids. When resistance genes were moved from the plasmid to the chromosome, the MSC decreased, showing that MSC for a specific resistance conditionally depends on genetic context. This finding suggests that a cost-free resistance could be maintained in a population by an infinitesimally low concentration of antibiotic. By studying the effect of combinations of several compounds, it was observed that for certain combinations of drugs each new compound added lowered the minimal selective concentration of the others. This combination effect could be a significant factor in the selection of multidrug resistance plasmids/bacterial clones in complex multidrug environments. Importance: Antibiotic resistance is in many pathogenic bacteria caused by genes that are carried on large conjugative plasmids. These plasmids typically contain multiple antibiotic resistance genes as well as genes that confer resistance to

  8. Plasmid-Borne Antimicrobial Resistance of Staphylococcus aureus Isolated in a Hospital in Lisbon, Portugal.


    Costa, Sofia Santos; Palma, Cláudia; Kadlec, Kristina; Fessler, Andrea T; Viveiros, Miguel; Melo-Cristino, José; Schwarz, Stefan; Couto, Isabel


    Plasmids play a key role in the genetic plasticity and survival of Staphylococcus aureus in challenging environments. Although many S. aureus plasmids have been described, still few studies portray the plasmid content of a given S. aureus population. The aim of this work was to characterize the plasmids carried by a collection of 53 S. aureus isolates collected in a large hospital in Lisbon, Portugal, and investigate their role in conferring resistance to several antimicrobial agents. Plasmids were present in 44 out of the 53 isolates and were grouped into eleven AccI restriction profiles. Plasmid curing of representative strains and comparison of antimicrobial susceptibility profiles between pairs of isogenic strains proved to be a valuable guidance tool in the identification of plasmid-located resistance genes. The plasmids harbored several resistance genes, namely blaZ (resistance to β-lactams), erm(C) (resistance to macrolides, lincosamides, and streptogramin B), cadA (resistance to cadmium and zinc), cadD (resistance to cadmium), and qacA and smr (resistance to biocides and dyes). This study demonstrates the impact of plasmids on the resistance properties of S. aureus, highlighting their role in the dissemination of antibiotic, heavy metal, and biocide resistance genes, and survival of this major pathogen in the hospital environment.

  9. Fosfomycin resistance plasmids do not affect fosfomycin transport into Escherichia coli.

    PubMed Central

    León, J; García-Lobo, J M; Ortiz, J M


    Escherichia coli cells carrying fosfomycin resistance plasmids were able to take up fosfomycin from the medium to the same extent as plasmid-free bacteria. The antibiotic entered the plasmid-harboring cells by means of the glpT and uhp transport systems, as is the case with susceptible bacteria. Active fosfomycin could be detected in soluble extracts of cells which had previously been incubated in the presence of the antibiotic. Furthermore, fosfomycin resistance plasmids did not confer on E. coli cells resistance to the novel antibiotic FR-31564, which is incorporated by the same transport systems as fosfomycin. We conclude that, in contrast to chromosomal resistance mutants, altered transport does not play a role in the plasmid-encoded fosfomycin resistance mechanism. PMID:7044304

  10. Effect of chromosomal homology on plasmid transfer and transformation in Streptococcus pneumoniae

    SciTech Connect

    Lacks, S.A.; Stassi, D.L.; Lopez, P.; Espinosa, M.; Greenberg, B.


    The obvious rarity of simultanaeous uptake of two recombinant plasmids bearing the same chromosomal segment militated against the likelihood of cloning such segments by the conventional approach. However, it was possible to clone chromosomal genes in S. pneumoniae, and clones of two well-studied pneumococcal genes, malM, which codes for the amylomaltase essential for maltose utilization, and sul-d, which confers sulfonamide resistance, were obtained. The availability of recombinant plasmids carrying DNA segments homologous to the chromosome allowed investigation of the effects of such homology on plasmid establishment. In addition to facilitation of plasmid establishment, evidence was obtained for a subsequent process, in which alleles were equilibrated between the chromosome and the plasmid pool.

  11. Role of Plasmids in Lactobacillus brevis BSO 464 Hop Tolerance and Beer Spoilage

    PubMed Central

    Bergsveinson, Jordyn; Baecker, Nina; Pittet, Vanessa


    Specific isolates of lactic acid bacteria (LAB) can grow in the harsh beer environment, thus posing a threat to brew quality and the economic success of breweries worldwide. Plasmid-localized genes, such as horA, horC, and hitA, have been suggested to confer hop tolerance, a trait required for LAB survival in beer. The presence and expression of these genes among LAB, however, do not universally correlate with the ability to grow in beer. Genome sequencing of the virulent beer spoilage organism Lactobacillus brevis BSO 464 revealed the presence of eight plasmids, with plasmids 1, 2, and 3 containing horA, horC, and hitA, respectively. To investigate the roles that these and the other five plasmids play in L. brevis BSO 464 growth in beer, plasmid curing with novobiocin was used to derive 10 plasmid variants. Multiplex PCRs were utilized to determine the presence or absence of each plasmid, and how plasmid loss affected hop tolerance and growth in degassed (noncarbonated) beer was assessed. Loss of three of the eight plasmids was found to affect hop tolerance and growth in beer. Loss of plasmid 2 (horC and 28 other genes) had the most dramatic effect, with loss of plasmid 4 (120 genes) and plasmid 8 (47 genes) having significant, but smaller, impacts. These results support the contention that genes on mobile genetic elements are essential for bacterial growth in beer and that beer spoilage ability is not dependent solely on the three previously described hop tolerance genes or on the chromosome of a beer spoilage LAB isolate. PMID:25501474

  12. Role of plasmids in Lactobacillus brevis BSO 464 hop tolerance and beer spoilage.


    Bergsveinson, Jordyn; Baecker, Nina; Pittet, Vanessa; Ziola, Barry


    Specific isolates of lactic acid bacteria (LAB) can grow in the harsh beer environment, thus posing a threat to brew quality and the economic success of breweries worldwide. Plasmid-localized genes, such as horA, horC, and hitA, have been suggested to confer hop tolerance, a trait required for LAB survival in beer. The presence and expression of these genes among LAB, however, do not universally correlate with the ability to grow in beer. Genome sequencing of the virulent beer spoilage organism Lactobacillus brevis BSO 464 revealed the presence of eight plasmids, with plasmids 1, 2, and 3 containing horA, horC, and hitA, respectively. To investigate the roles that these and the other five plasmids play in L. brevis BSO 464 growth in beer, plasmid curing with novobiocin was used to derive 10 plasmid variants. Multiplex PCRs were utilized to determine the presence or absence of each plasmid, and how plasmid loss affected hop tolerance and growth in degassed (noncarbonated) beer was assessed. Loss of three of the eight plasmids was found to affect hop tolerance and growth in beer. Loss of plasmid 2 (horC and 28 other genes) had the most dramatic effect, with loss of plasmid 4 (120 genes) and plasmid 8 (47 genes) having significant, but smaller, impacts. These results support the contention that genes on mobile genetic elements are essential for bacterial growth in beer and that beer spoilage ability is not dependent solely on the three previously described hop tolerance genes or on the chromosome of a beer spoilage LAB isolate.

  13. pA506, a Conjugative Plasmid of the Plant Epiphyte Pseudomonas fluorescens A506

    PubMed Central

    Stockwell, Virginia O.; Davis, Edward W.; Carey, Alyssa; Shaffer, Brenda T.; Mavrodi, Dmitri V.; Hassan, Karl A.; Hockett, Kevin; Thomashow, Linda S.; Paulsen, Ian T.


    Conjugative plasmids are known to facilitate the acquisition and dispersal of genes contributing to the fitness of Pseudomonas spp. Here, we report the characterization of pA506, the 57-kb conjugative plasmid of Pseudomonas fluorescens A506, a plant epiphyte used in the United States for the biological control of fire blight disease of pear and apple. Twenty-nine of the 67 open reading frames (ORFs) of pA506 have putative functions in conjugation, including a type IV secretion system related to that of MOBP6 family plasmids and a gene cluster for type IV pili. We demonstrate that pA506 is self-transmissible via conjugation between A506 and strains of Pseudomonas spp. or the Enterobacteriaceae. The origin of vegetative replication (oriV) of pA506 is typical of those in pPT23A family plasmids, which are present in many pathovars of Pseudomonas syringae, but pA506 lacks repA, a defining locus for pPT23A plasmids, and has a novel partitioning region. We selected a plasmid-cured derivative of A506 and compared it to the wild type to identify plasmid-encoded phenotypes. pA506 conferred UV resistance, presumably due to the plasmid-borne rulAB genes, but did not influence epiphytic fitness of A506 on pear or apple blossoms in the field. pA506 does not appear to confer resistance to antibiotics or other toxic elements. Based on the conjugative nature of pA506 and the large number of its genes that are shared with plasmids from diverse groups of environmental bacteria, the plasmid is likely to serve as a vehicle for genetic exchange between A506 and its coinhabitants on plant surfaces. PMID:23811504

  14. Selection of a Multidrug Resistance Plasmid by Sublethal Levels of Antibiotics and Heavy Metals

    PubMed Central

    Gullberg, Erik; Albrecht, Lisa M.; Karlsson, Christoffer; Sandegren, Linus


    ABSTRACT How sublethal levels of antibiotics and heavy metals select for clinically important multidrug resistance plasmids is largely unknown. Carriage of plasmids generally confers substantial fitness costs, implying that for the plasmid-carrying bacteria to be maintained in the population, the plasmid cost needs to be balanced by a selective pressure conferred by, for example, antibiotics or heavy metals. We studied the effects of low levels of antibiotics and heavy metals on the selective maintenance of a 220-kbp extended-spectrum β-lactamase (ESBL) plasmid identified in a hospital outbreak of Klebsiella pneumoniae and Escherichia coli. The concentrations of antibiotics and heavy metals required to maintain plasmid-carrying bacteria, the minimal selective concentrations (MSCs), were in all cases below (almost up to 140-fold) the MIC of the plasmid-free susceptible bacteria. This finding indicates that the very low antibiotic and heavy metal levels found in polluted environments and in treated humans and animals might be sufficiently high to maintain multiresistance plasmids. When resistance genes were moved from the plasmid to the chromosome, the MSC decreased, showing that MSC for a specific resistance conditionally depends on genetic context. This finding suggests that a cost-free resistance could be maintained in a population by an infinitesimally low concentration of antibiotic. By studying the effect of combinations of several compounds, it was observed that for certain combinations of drugs each new compound added lowered the minimal selective concentration of the others. This combination effect could be a significant factor in the selection of multidrug resistance plasmids/bacterial clones in complex multidrug environments. PMID:25293762

  15. Comparative study on the antibiotic susceptibility and plasmid profiles of Vibrio alginolyticus strains isolated from four Tunisian marine biotopes.


    Lajnef, Rim; Snoussi, Mejdi; Romalde, Jesús López; Nozha, Cohen; Hassen, Abdennaceur


    The antibiotic resistance patterns and the plasmids profiles of the predominant etiological agent responsible for vibriosis in Tunisia, V. alginolyticus were studied to contribute to control their spread in some Mediterranean aquaculture farms and seawater. The sixty-nine V. alginolyticus strains isolated from different marine Tunisian biotopes (bathing waters, aquaculture and conchylicole farms and a river connected to the seawater during the cold seasons) were multi-drug resistant with high resistance rate to ampicillin, kanamycin, doxycyclin, erythromycin, imipinem, and nalidixic acid. The multiple resistance index ranged from 0.3 to 0.7 for the isolates of Khenis, from 0.5 to 0.8 for those of Menzel Jmil, from 0.5 to 0.75 (Hergla) and from 0.3 to 0.7 for the isolates of Oued Soltane. The high value of antibiotic resistance index was recorded for the V. alginolyticus population isolated from the fish farm in Hergla (ARI = 0.672) followed by the population isolated from the conchylicole station of Menzel Jmil (ARI = 0.645). The results obtained by the MIC tests confirmed the resistance of the V. alginolyticus to ampicillin, erythromycin, kanamycin, cefotaxime, streptomycin and trimethoprim. Plasmids were found in 79.48 % of the strains analyzed and 30 different plasmid profiles were observed. The strains had a high difference in the size of plasmids varying between 0.5 and 45 kb. Our study reveals that the antibiotic-resistant bacteria are widespread in the aquaculture and conchylicole farm relatively to others strains isolated from seawater.

  16. Limited sampling strategies for therapeutic drug monitoring of amikacin and kanamycin in patients with multidrug-resistant tuberculosis.


    Dijkstra, J A; van Altena, R; Akkerman, O W; de Lange, W C M; Proost, J H; van der Werf, T S; Kosterink, J G W; Alffenaar, J W C


    Amikacin and kanamycin are considered important and effective drugs in the treatment of multidrug-resistant tuberculosis (MDR-TB). Unfortunately, the incidence of toxicity is high and is related to elevated drug exposure. In order to achieve a balance between efficacy and toxicity, a population pharmacokinetic (PPK) model may help to optimise drug exposure. Patients with MDR-TB who had received amikacin or kanamycin as part of their treatment and who had routinely received therapeutic drug monitoring were evaluated. A PPK model was developed and subsequently validated. Using this model, a limited sampling model was developed. Eleven patients receiving amikacin and nine patients receiving kanamycin were included in this study. The median observed 24-h area under the concentration-time curve (AUC0-24h) was 77.2 mg h/L [interquartile range (IQR) 64.7-96.2 mg h/L] for amikacin and 64.1 mg h/L (IQR 55.6-92.1 mg h/L) for kanamycin. The PPK model was developed and validated using n-1 cross-validation. A robust population model was developed that is suitable for predicting the AUC0-24h of amikacin and kanamycin. This model, in combination with the limited sampling strategy developed, can be used in daily routine to guide dosing but also to assess AUC0-24h in phase 3 studies.

  17. Label-free detection of kanamycin based on the aptamer-functionalized conducting polymer/gold nanocomposite.


    Zhu, Ye; Chandra, Pranjal; Song, Kyung-Mi; Ban, Changill; Shim, Yoon-Bo


    Highly sensitive label-free detection of kanamycin is achieved with an aptamer sensor based on a conducting polymer/gold self-assembled nanocomposite. The sensor probe is fabricated by covalently immobilizing an in vitro selected DNA aptamer for kanamycin onto gold nanoparticle (AuNP)-comprised conducting polymer, poly-[2, 5-di-(2-thienyl)-1H-pyrrole-1-(p-benzoic acid)] (poly-DPB). The self-assembling of DPB on AuNP is investigated by TEM and UV-vis spectroscopy and the modification of the aptamer sensor is characterized using XPS and electrochemical impedance spectroscopy. The probe is applied to detect kanamycin by using voltammetric techniques. The sensor shows a pair of redox peaks around 0.26/ 0.08 V (vs. Ag/AgCl) for kanamycin captured by the aptamer-immobilized probe. The parameters that can affect the response, such as aptamer concentration, incubation time, temperature, and pH are optimized. The calibration plot shows a linear range from 0.05 μM to 9.0 μM kanamycin with a detection limit of 9.4±0.4 nM. The proposed aptamer sensor is examined with a real sample.

  18. Some physiological characteristics of neomycin and kanamycin-resistant strains of Staphylococcus aureus

    PubMed Central

    Jacobs, S. I.; Willis, A. T.


    Five hundred and fifty-two strains of Staphylococcus aureus of hospital origin were resistant to penicillin, streptomycin, and tetracycline. Of these, 298 were also resistant to neomycin and kanamycin, and this resistance was related to pigment production on glycerol monoacetate agar, the production of β-lysin, the absence of fibrinolytic and proteolytic activity, and to phage susceptibility. The use of physiological markers, the inadequacy of phage typing, and the possible reasons for the emergence of neomycin-resistant staphylococci are discussed. PMID:14227429

  19. Cross-resistance of Mycobacterium tuberculosis isolates among streptomycin, kanamycin and amikacin.


    Sugawara, I; Zhang, J; Li, C


    Seventy-four streptomycin (SM)-resistant M. tuberculosis clinical isolates were subjected to cross-resistance drug testing against two major aminoglycosides, kanamycin (KM) and amikacin (AMK). Among them, 15 clinical isolates (20.3%) were resistant to both KM and AMK. Fifteen (80%) of 19 KM-resistant isolates were AMK-resistant. Fifteen SM, KM, and AMK resistant isolates harbored rrs mutation, but only two had rrs and rpsL double mutations. Low-level SM resistance was associated with rpsL mutation, whereas high-level SM resistance was linked to rrs mutation.

  20. Plasmid-mediated quinolone resistance.


    Jacoby, George A; Strahilevitz, Jacob; Hooper, David C


    Three mechanisms for plasmid-mediated quinolone resistance (PMQR) have been discovered since 1998. Plasmid genes qnrA, qnrB, qnrC, qnrD, qnrS, and qnrVC code for proteins of the pentapeptide repeat family that protects DNA gyrase and topoisomerase IV from quinolone inhibition. The qnr genes appear to have been acquired from chromosomal genes in aquatic bacteria, are usually associated with mobilizing or transposable elements on plasmids, and are often incorporated into sul1-type integrons. The second plasmid-mediated mechanism involves acetylation of quinolones with an appropriate amino nitrogen target by a variant of the common aminoglycoside acetyltransferase AAC(6')-Ib. The third mechanism is enhanced efflux produced by plasmid genes for pumps QepAB and OqxAB. PMQR has been found in clinical and environmental isolates around the world and appears to be spreading. The plasmid-mediated mechanisms provide only low-level resistance that by itself does not exceed the clinical breakpoint for susceptibility but nonetheless facilitates selection of higher-level resistance and makes infection by pathogens containing PMQR harder to treat.

  1. Plasmid-mediated quinolone resistance

    PubMed Central

    Jacoby, George A.; Strahilevitz, Jacob; Hooper, David C.


    Summary Three mechanisms for plasmid-mediated quinolone resistance (PMQR) have been discovered since 1998. Plasmid genes qnrA, qnrB, qnrC, qnrD, qnrS, and qnrVC code for proteins of the pentapeptide repeat family that protects DNA gyrase and topoisomerase IV from quinolone inhibition. The qnr genes appear to have been acquired from chromosomal genes in aquatic bacteria, are usually associated with mobilizing or transposable elements on plasmids, and are often incorporated into sul1-type integrons. The second plasmid-mediated mechanism involves acetylation of quinolones with an appropriate amino nitrogen target by a variant of the common aminoglycoside acetyltransferase AAC(6′)-Ib. The third mechanism is enhanced efflux produced by plasmid genes for pumps QepAB and OqxAB. PMQR has been found in clinical and environmental isolates around the world and appears to be spreading. The plasmid-mediated mechanisms provide only low-level resistance that by itself does not exceed the clinical breakpoint for susceptibility but nonetheless facilitates selection of higher-level resistance and makes infection by pathogens containing PMQR harder to treat. PMID:25584197

  2. Chemical adjuvants for plasmid DNA vaccines.


    Greenland, John R; Letvin, Norman L


    Plasmid DNA vaccines are a promising modality for immunization against a variety of human pathogens. Immunization via multiple routes with plasmid DNA can elicit potent cellular immune responses, and these immunogens can be administered repeatedly without inducing anti-vector immunity. Nonetheless, the immunogenicity of plasmid DNA vaccines has been limited by problems associated with delivery. A number of adjuvants have been designed to improve plasmid DNA immunogenicity, either by directly stimulating the immune system or by enhancing plasmid DNA expression. Chemical adjuvants for enhancing plasmid DNA expression include liposomes, polymers, and microparticles, all of which have shown promise for enhancing the expression and immunogenicity of plasmid DNA vaccines in animal models. Micro- and nanoparticles have not been shown to enhance immune responses to plasmid DNA vaccines. However, formulation of plasmid DNA with some non-particulate polymeric adjuvants has led to a statistically significant enhancement of immune responses. Further development of these technologies will significantly improve the utility of plasmid DNA vaccination.

  3. Recombination between plasmids of incompatibility groups P-1 and P-2.

    PubMed Central

    Jacoby, G A; Jacob, A E; Hedges, R W


    R plasmids of incompatibility group P-2 are readily transmissible between Pseudomonas strains, but not to Escherichia coli or other enterobacteria, whereas those of group P-1 have a broad host range. Pseudomonas aeruginosa donor strains carrying both a P-1 plasmid (RP1, RP4, or R751) and a P-2 plasmid (pMG1, pMG2, pMG5, or RPL11) were mated with E. coli K-12, and selection was imposed for resistance markers on the P-2 plasmids. Transconjugants were obtained at a low frequency, in which P-2 markers were expressed and were serially transmissible in E. coli together with P-1 markers. These plasmids had P-1 incompatibility properties, conferred susceptibility to phages active on P-1 carrying strains, and behaved on sucrose gradient centrifugation as unimolecular species of higher molecular weights than the P-1 parent. Recombinant plasmid formation was independent of a functional Rec gene in both donor and recipient and, with R751, had a preferred site leading to loss of trimethoprim resistance. Interaction between insertion sequences may be involved. Thus, plasmids of group P-2 can recombine with R factors of another group quite separate in compatibility properties, host range, and pilus type. Formation of such recombinants provides one pathway by which the genetic diversity of plasmids may have evolved. PMID:821925

  4. Stable Agrobacterium-mediated transformation of maritime pine based on kanamycin selection.


    Alvarez, José M; Ordás, Ricardo J


    An efficient transformation protocol based on kanamycin selection was developed for Agrobacterium-mediated transformation of maritime pine embryonal masses. The binary vector pBINUbiGUSint, which contained neomycin phosphotransferase II (nptII) as a selectable marker gene and β -glucuronidase (uidA) as a reporter gene, was used for transformation studies. Different factors, such as embryogenic line, bacterial strain, bacterial concentration, and coculture duration, were examined and optimized. For selection of transformants, 15 mgL(-1) kanamycin was used. The highest transformation efficiency (11.4 events per gram of fresh mass) was achieved when a vigorously growing embryonal mass (embryogenic line L01) was cocultivated with Agrobacterium strain AGL1 at the optical density (OD(600 nm)) of 0.3 for 72 h. Evidence of the stable transgene integration was obtained by polymerase chain reaction for the nptII and uidA genes and expression of the uidA gene. Maturation capacity of the transgenic lines was negatively affected by the transformation process. Induction of axillary shoots by preculturing the embryos with benzyladenine allowed overcoming the low maturation rates of some transformed lines. The transgenic embryos were germinated and the axillar shoots were rooted. Transgenic plants were transferred to potting substrate showing normal growth.

  5. Exogenous alanine and/or glucose plus kanamycin kills antibiotic-resistant bacteria.


    Peng, Bo; Su, Yu-Bin; Li, Hui; Han, Yi; Guo, Chang; Tian, Yao-Mei; Peng, Xuan-Xian


    Multidrug-resistant bacteria are an increasingly serious threat to human and animal health. However, novel drugs that can manage infections by multidrug-resistant bacteria have proved elusive. Here we show that glucose and alanine abundances are greatly suppressed in kanamycin-resistant Edwardsiella tarda by GC-MS-based metabolomics. Exogenous alanine or glucose restores susceptibility of multidrug-resistant E. tarda to killing by kanamycin, demonstrating an approach to killing multidrug-resistant bacteria. The mechanism underlying this approach is that exogenous glucose or alanine promotes the TCA cycle by substrate activation, which in turn increases production of NADH and proton motive force and stimulates uptake of antibiotic. Similar results are obtained with other Gram-negative bacteria (Vibrio parahaemolyticus, Klebsiella pneumoniae, Pseudomonas aeruginosa) and Gram-positive bacterium (Staphylococcus aureus), and the results are also reproduced in a mouse model for urinary tract infection. This study establishes a functional metabolomics-based strategy to manage infection by antibiotic-resistant bacteria.

  6. Stable Agrobacterium-Mediated Transformation of Maritime Pine Based on Kanamycin Selection

    PubMed Central

    Alvarez, José M.; Ordás, Ricardo J.


    An efficient transformation protocol based on kanamycin selection was developed for Agrobacterium-mediated transformation of maritime pine embryonal masses. The binary vector pBINUbiGUSint, which contained neomycin phosphotransferase II (nptII) as a selectable marker gene and β-glucuronidase (uidA) as a reporter gene, was used for transformation studies. Different factors, such as embryogenic line, bacterial strain, bacterial concentration, and coculture duration, were examined and optimized. For selection of transformants, 15 mgL−1 kanamycin was used. The highest transformation efficiency (11.4 events per gram of fresh mass) was achieved when a vigorously growing embryonal mass (embryogenic line L01) was cocultivated with Agrobacterium strain AGL1 at the optical density (OD600 nm) of 0.3 for 72 h. Evidence of the stable transgene integration was obtained by polymerase chain reaction for the nptII and uidA genes and expression of the uidA gene. Maturation capacity of the transgenic lines was negatively affected by the transformation process. Induction of axillary shoots by preculturing the embryos with benzyladenine allowed overcoming the low maturation rates of some transformed lines. The transgenic embryos were germinated and the axillar shoots were rooted. Transgenic plants were transferred to potting substrate showing normal growth. PMID:24376383

  7. Time course of neuronal and synaptic plasticity in dorsal cochlear nucleus of guinea pig following chronic kanamycin-induced deafness.


    Kong, W J; Yin, Z D; Fan, G R; Yang, Y; Huang, X


    We investigated the time course of the plasticity in fusiform cell (FC) and at auditory nerve (AN) synapse on FC (AN/FC synapse) following chronic kanamycin-induced deafness. Guinea pigs were treated with kanamycin sulfate by subcutaneous injection at dose of 500 mg/kg/day for 7 days. Ultrastructural changes in FC and AN/FC synapse were observed, and local insulin-like growth factor 1 (IGF-1) mRNA was quantified using quantitative real time PCR at 1, 7, 14, 28, 70 and 140 days after kanamycin treatment. The average threshold was 46.46+/-3.45, 80.63+/-5.95 and 103.95+/-6.59 dB SPL respectively at 1, 7 and 14 days, and the threshold was statistically unchanged at 28, 70 and 140 days in comparison with the 14 day group. Mitochondrial swelling in FC and at AN/FC synapse was progressive at 7, 14 and 28 days. Moreover, the thickness of the postsynaptic densities increased at 1, 7 and 14 days. Finally, there was a persistent upregulation in local IGF-1 mRNA at 7, 14, 28 and 70 days. These changes in the ultrastructure of AN/FC synapse and FC, and upregulation of local IGF-1 mRNA were no longer present at 140 days. Our results indicate that the effects of kanamycin on the ultrastructure of FC and AN/FC synapse are progressive. However, FC and AN/FC synapse are capable of reviving and remodeling after kanamycin-induced lesion and incomplete deafferentation. Additionally, local IGF-1 might play a role in the lesion- and deafness-induced plasticity in FC and at AN/FC synapse following chronic kanamycin-induced deafness.

  8. The 2 micron plasmid of Saccharomyces cerevisiae: a miniaturized selfish genome with optimized functional competence.


    Chan, Keng-Ming; Liu, Yen-Ting; Ma, Chien-Hui; Jayaram, Makkuni; Sau, Soumitra


    The 2 micron plasmid of Saccharomyces cerevisiae is a relatively small multi-copy selfish DNA element that resides in the yeast nucleus at a copy number of 40-60 per haploid cell. The plasmid is able to persist in host populations with almost chromosome-like stability with the help of a partitioning system and a copy number control system. The first part of this article describes the properties of the partitioning system comprising two plasmid coded proteins, Rep1 and Rep2, and a partitioning locus STB. Current evidence supports a model in which the Rep-STB system couples plasmid segregation to chromosome segregation by promoting the physical association of plasmid molecules with chromosomes. In the second part, the focus is on the Flp site-specific recombination system housed by the plasmid, which plays a critical role in maintaining steady state plasmid copy number. The Flp system corrects any decrease in plasmid population by promoting plasmid amplification via a recombination induced rolling circle replication mechanism. Appropriate plasmid amplification, without runaway increase in copy number, is ensured by positive and negative regulation of FLP gene expression by plasmid coded proteins and by the control of Flp level/activity through post-translational modification of Flp by the cellular sumoylation system. The Flp system has been successfully utilized to understand mechanisms of site-specific recombination and to bring about directed genetic alterations for addressing fundamental problems in biology and for accomplishing bio-engineering objectives. A particularly interesting, and perhaps less well known and underappreciated, application of Flp in revealing unique DNA topologies required to confer functional competence to DNA-protein machines is discussed.

  9. Molecular and population analyses of a recombination event in the catabolic plasmid pJP4.


    Larraín-Linton, Juanita; De la Iglesia, Rodrigo; Melo, Francisco; González, Bernardo


    Cupriavidus necator JMP134(pJP4) harbors a catabolic plasmid, pJP4, which confers the ability to grow on chloroaromatic compounds. Repeated growth on 3-chlorobenzoate (3-CB) results in selection of a recombinant strain, which degrades 3-CB better but no longer grows on 2,4-dichlorophenoxyacetate (2,4-D). We have previously proposed that this phenotype is due to a double homologous recombination event between inverted repeats of the multicopies of this plasmid within the cell. One recombinant form of this plasmid (pJP4-F3) explains this phenotype, since it harbors two copies of the chlorocatechol degradation tfd gene clusters, which are essential to grow on 3-CB, but has lost the tfdA gene, encoding the first step in degradation of 2,4-D. The other recombinant plasmid (pJP4-FM) should harbor two copies of the tfdA gene but no copies of the tfd gene clusters. A molecular analysis using a multiplex PCR approach to distinguish the wild-type plasmid pJP4 from its two recombinant forms, was carried out. Expected PCR products confirming this recombination model were found and sequenced. Few recombinant plasmid forms in cultures grown in several carbon sources were detected. Kinetic studies indicated that cells containing the recombinant plasmid pJP4-FM were not selectable by sole carbon source growth pressure, whereas those cells harboring recombinant plasmid pJP4-F3 were selected upon growth on 3-CB. After 12 days of repeated growth on 3-CB, the complete plasmid population in C. necator JMP134 apparently corresponds to this form. However, wild-type plasmid forms could be recovered after growing this culture on 2,4-D, indicating that different plasmid forms can be found in C. necator JMP134 at the population level.

  10. Characterization and comparative analysis of antibiotic resistance plasmids isolated from a wastewater treatment plant.


    Rahube, Teddie O; Viana, Laia S; Koraimann, Günther; Yost, Christopher K


    A wastewater treatment plant (WWTP) is an environment high in nutrient concentration with diverse bacterial populations and can provide an ideal environment for the proliferation of mobile elements such as plasmids. WWTPs have also been identified as reservoirs for antibiotic resistance genes that are associated with human pathogens. The objectives of this study were to isolate and characterize self-transmissible or mobilizable resistance plasmids associated with effluent from WWTP. An enrichment culture approach designed to capture plasmids conferring resistance to high concentrations of erythromycin was used to capture plasmids from an urban WWTP servicing a population of ca. 210,000. DNA sequencing of the plasmids revealed diversity of plasmids represented by incompatibility groups IncU, col-E, IncFII and IncP-1β. Genes coding resistance to clinically relevant antibiotics (macrolide, tetracycline, beta-lactam, trimethoprim, chloramphenicol, sulphonamide), quaternary ammonium compounds and heavy metals were co-located on these plasmids, often within transposable and integrative mobile elements. Several of the plasmids were self-transmissible or mobilizable and could be maintained in the absence of antibiotic selection. The IncFII plasmid pEFC36a showed the highest degree of sequence identity to plasmid R1 which has been isolated in England more than 50 years ago from a patient suffering from a Salmonella infection. Functional conservation of key regulatory features of this F-like conjugation module were demonstrated by the finding that the conjugation frequency of pEFC36a could be stimulated by the positive regulator of plasmid R1 DNA transfer genes, TraJ.

  11. Modification of kanamycin-esculin-azide agar to improve selectivity in the enumeration of fecal streptococci from water samples.

    PubMed Central

    Audicana, A; Perales, I; Borrego, J J


    Kanamycin-esculin-azide agar was modified by increasing the concentration of sodium azide to 0.4 g liter-1 and replacing kanamycin sulfate with 5 mg of oxolinic acid liter-1. The modification, named oxolinic acid-esculin-azide (OAA) agar, was compared with Slanetz-Bartley and KF agars by using drinking water and seawater samples. The OAA agar showed higher specificity, selectivity, and recovery efficiencies than those obtained by using the other media. In addition, no confirmation of typical colonies was needed when OAA agar was used, which significantly shortens the time of sample processing and increases the accuracy of the method. PMID:8534085

  12. Glutamate co-transmission from developing medial nucleus of the trapezoid body - Lateral superior olive synapses is cochlear dependent in kanamycin-treated rats

    SciTech Connect

    Lee, Jae Ho; Pradhan, Jonu; Maskey, Dhiraj; Park, Ki Sup; Hong, Sung Hwa; Suh, Myung-Whan; Kim, Myeung Ju; Ahn, Seung Cheol


    Research highlights: {yields} Glutamate co-transmission is enhanced in kanamycin-treated rats. {yields} VGLUT3 expression is increased in kanamycin-treated rats. {yields} GlyR expression is decreased in kanamycin-treated rats. {yields} GlyR, VGLUT3 expression patterns are asymmetric in unilaterally cochlear ablated rat. -- Abstract: Cochlear dependency of glutamate co-transmission at the medial nucleus of the trapezoid body (MNTB) - the lateral superior olive (LSO) synapses was investigated using developing rats treated with high dose kanamycin. Rats were treated with kanamycin from postnatal day (P) 3 to P8. A scanning electron microscopic study on P9 demonstrated partial cochlear hair cell damage. A whole cell voltage clamp experiment demonstrated the increased glutamatergic portion of postsynaptic currents (PSCs) elicited by MNTB stimulation in P9-P11 kanamycin-treated rats. The enhanced VGLUT3 immunoreactivities (IRs) in kanamycin-treated rats and asymmetric VGLUT3 IRs in the LSO of unilaterally cochlear ablated rats supported the electrophysiologic data. Taken together, it is concluded that glutamate co-transmission is cochlear-dependent and enhanced glutamate co-transmission in kanamycin-treated rats is induced by partial cochlear damage.

  13. Glutamate co-transmission from developing medial nucleus of the trapezoid body--lateral superior olive synapses is cochlear dependent in kanamycin-treated rats.


    Lee, Jae Ho; Pradhan, Jonu; Maskey, Dhiraj; Park, Ki Sup; Hong, Sung Hwa; Suh, Myung-Whan; Kim, Myeung Ju; Ahn, Seung Cheol


    Cochlear dependency of glutamate co-transmission at the medial nucleus of the trapezoid body (MNTB)--the lateral superior olive (LSO) synapses was investigated using developing rats treated with high dose kanamycin. Rats were treated with kanamycin from postnatal day (P) 3 to P8. A scanning electron microscopic study on P9 demonstrated partial cochlear hair cell damage. A whole cell voltage clamp experiment demonstrated the increased glutamatergic portion of postsynaptic currents (PSCs) elicited by MNTB stimulation in P9-P11 kanamycin-treated rats. The enhanced VGLUT3 immunoreactivities (IRs) in kanamycin-treated rats and asymmetric VGLUT3 IRs in the LSO of unilaterally cochlear ablated rats supported the electrophysiologic data. Taken together, it is concluded that glutamate co-transmission is cochlear-dependent and enhanced glutamate co-transmission in kanamycin-treated rats is induced by partial cochlear damage.

  14. Plasmid-linked nif and “nod” genes in fast-growing rhizobia that nodulate Glycine max, Psophocarpus tetragonolobus, and Vigna unguiculata

    PubMed Central

    Broughton, William J.; Heycke, Nina; Z.A., Heiner Meyer; Pankhurst, Clive E.


    Forty-nine fast-growing Rhizobium strains from the nodules of 26 different tropical legume genera were screened to find isolates that would (i) nodulate, e.g., winged beans, so producing large nodules for RNA and protein isolation; (ii) also nodulate various small-seeded legumes, thus allowing screening of large numbers of mutants; and (iii) harbor plasmids containing nif structural genes as well as other functions involved in nodulation. On the basis of six different criteria, this rhizobial group appeared intermediate between classical fast- and slow-growing organisms, yet all contained plasmids. Plasmid numbers varied from one to five. Hybridizations between DNA prepared from nifDH and the putatative “nod” region of R. meliloti and these plasmids bound to nitrocellulose filters suggested that nif-nod genes are linked on a single sym plasmid. A broad-host-range strain containing a single sym plasmid was chosen for further study. Its plasmid, pMPIK3030a, was isolated on cesium chloride gradients and cloned in the cosmid pJB8, and the overlapping fragments were mapped by homology with the nif and nod regions of R. meliloti. As the wild-type plasmid pMPIK3030a was not self-transmissible, confirmation that the nod genes detected by homology were responsible for nodulation was obtained by introducing the mobilization functions of RP4 (together with Tn5) and selecting transconjugants resistant to kanamycin and neomycin. Transconjugants (obtained at a frequency of about 10-6 per recipient) in Agrobacterium tumefaciens cured of the Ti plasmid produced ineffective nodules on Vigna unguiculata, those in nonnodulating (Nod-) R. meliloti were partially effective, while those in Nod-R. leguminosarum were often fully effective. Images PMID:16593465

  15. Xylella fastidiosa plasmid-encoded PemK toxin is an endoribonuclease.

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Stable inheritance of pXF-RIV11 in Xylella fastidiosa is conferred by the pemI/pemK plasmid addiction system. PemK serves as a toxin inhibiting bacterial growth; PemI is the corresponding antitoxin that blocks activity of PemK toxin by direct binding. PemK toxin and PemI antitoxin were over-expre...

  16. Pseudothrombocytopenia observed with ethylene diamine tetra acetate and citrate anticoagulants, resolved using 37°C incubation and Kanamycin.


    Kamath, Vandana; Sarda, Parimal; Chacko, Mary Purna; Sitaram, Usha


    Pseudothrombocytopenia (PTP) is defined by falsely low platelet counts on automated analyzers caused by in vitro phenomena including large platelet aggregates in blood samples. Diagnosis and resolution of PTP is crucial as it can lead to unwarranted interventions. We discuss a case of PTP in a pre-surgical setting, which was resolved using 37°C incubation and Kanamycin.

  17. Sulfonamide-Based Inhibitors of Aminoglycoside Acetyltransferase Eis Abolish Resistance to Kanamycin in Mycobacterium tuberculosis.


    Garzan, Atefeh; Willby, Melisa J; Green, Keith D; Gajadeera, Chathurada S; Hou, Caixia; Tsodikov, Oleg V; Posey, James E; Garneau-Tsodikova, Sylvie


    A two-drug combination therapy where one drug targets an offending cell and the other targets a resistance mechanism to the first drug is a time-tested, yet underexploited approach to combat or prevent drug resistance. By high-throughput screening, we identified a sulfonamide scaffold that served as a pharmacophore to generate inhibitors of Mycobacterium tuberculosis acetyltransferase Eis, whose upregulation causes resistance to the aminoglycoside (AG) antibiotic kanamycin A (KAN) in Mycobacterium tuberculosis. Rational systematic derivatization of this scaffold to maximize Eis inhibition and abolish the Eis-mediated KAN resistance of M. tuberculosis yielded several highly potent agents. A crystal structure of Eis in complex with one of the most potent inhibitors revealed that the inhibitor bound Eis in the AG-binding pocket held by a conformationally malleable region of Eis (residues 28-37) bearing key hydrophobic residues. These Eis inhibitors are promising leads for preclinical development of innovative AG combination therapies against resistant TB.

  18. Julian Davies and the discovery of kanamycin resistance transposon Tn5.


    Berg, Douglas E


    This paper recounts some of my fond memories of a collaboration between Julian Davies and myself that started in 1974 in Geneva and that led to our serendipitous discovery of the bacterial kanamycin resistance transposon Tn5, and aspects of the lasting positive impact of our interaction and discovery on me and the community. Tn5 was one of the first antibiotic resistance transposons to be found. Its analysis over the ensuing decades provided valuable insights into mechanisms and control of transposition, and led to its use as a much-valued tool in diverse areas of molecular genetics, as also will be discussed here.The Journal of Antibiotics advance online publication, 12 October 2016; doi:10.1038/ja.2016.120.

  19. Potent Inhibitors of Acetyltransferase Eis Overcome Kanamycin Resistance in Mycobacterium tuberculosis.


    Willby, Melisa J; Green, Keith D; Gajadeera, Chathurada S; Hou, Caixia; Tsodikov, Oleg V; Posey, James E; Garneau-Tsodikova, Sylvie


    A major cause of tuberculosis (TB) resistance to the aminoglycoside kanamycin (KAN) is the Mycobacterium tuberculosis (Mtb) acetyltransferase Eis. Upregulation of this enzyme is responsible for inactivation of KAN through acetylation of its amino groups. A 123 000-compound high-throughput screen (HTS) yielded several small-molecule Eis inhibitors that share an isothiazole S,S-dioxide heterocyclic core. These were investigated for their structure-activity relationships. Crystal structures of Eis in complex with two potent inhibitors show that these molecules are bound in the conformationally adaptable aminoglycoside binding site of the enzyme, thereby obstructing binding of KAN for acetylation. Importantly, we demonstrate that several Eis inhibitors, when used in combination with KAN against resistant Mtb, efficiently overcome KAN resistance. This approach paves the way toward development of novel combination therapies against aminoglycoside-resistant TB.

  20. Homology of cryptic plasmid of Neisseria gonorrhoeae with plasmids from Neisseria meningitidis and Neisseria lactamica.


    Ison, C A; Bellinger, C M; Walker, J


    DNA probe hybridisation was used to examine the relation between the cryptic plasmid from Neisseria gonorrhoeae and plasmids carried by pharyngeal isolates of Neisseria meningitidis and Neisseria lactamica. The complete gonococcal cryptic plasmid and HinfI derived digestion fragments subcloned into Escherichia coli were used to probe Southern blots of plasmid extracts. Homology was found to a plasmid of approximate molecular weight 4.5 kilobase pairs (Kb) but not to plasmids of less than 3.2 Kb or 6.5 Kb. Eleven of 16 strains of N meningitidis and two of six strains of N lactamica carried plasmids that showed strong hybridisation with the 4.2 Kb gonococcal plasmid. Hybridisation of plasmids from non-gonococcal species of neisseria with the gonococcal cryptic plasmid indicates that caution should be taken when using the cryptic plasmid as a diagnostic probe for gonorrhoea.

  1. Synergy of Penicillin-Netilmicin Combinations Against Enterococci Including Strains Highly Resistant to Streptomycin or Kanamycin

    PubMed Central

    Sanders, Christine C.


    The in vitro activity of combinations of penicillin and netilimicin was determined against 20 clinical isolates of enterococci and compared with that obtained in simultaneous tests with penicillin/sisomicin, penicillin/streptomycin, and penicillin/kanamycin. Synergy between the two drugs in each combination was determined by the use of quantitative kill curves and was defined as a killing by the combination at least 100-fold greater than that produced by the most effective drug alone. Penicillin/netilmicin and penicillin/sisomicin combinations were found to be synergistic against the majority of isolates tested, including strains resistant to penicillin/streptomycin or penicillin/kanamycin combinations. This synergy with penicillin could be demonstrated at a concentration of ≤7 μg/ml for either netilmicin or sisomicin. Studies on the kinetics of killing produced by these combinations showed the rate and extent of killing to be directly dependent upon the organism's relative susceptibility to the aminoglycoside alone and the aminoglycoside concentration in the combination. Results also indicated that the interaction between penicillin and netilmicin was true synergy; i.e., rapid and complete killing was produced by combinations containing each drug at concentrations insufficient to produce any killing alone, and the killing observed could not be produced by either drug alone at a concentration equivalent to the total drug concentration in the combination. The potential clinical application of this synergistic interaction should be investigated further, especially in view of recent reports showing netilmicin to be considerably less toxic than gentamicin in experimental animals. PMID:242509

  2. Nestin expression and reactive phenomena in the mouse cochlea after kanamycin ototoxicity.


    Martone, Tiziana; Giordano, Pamela; Dagna, Federico; Carulli, Daniela; Albera, Roberto; Rossi, Ferdinando


    Following injury to the adult mammalian cochlea, hair cells cannot be spontaneously replaced. Nonetheless, the postnatal cochlea contains progenitor cells, distinguished by the expression of nestin, which are able to proliferate and form neurospheres in vitro. Such resident progenitors might be endowed with reparative potential. However, to date little is known about their behaviour in situ following hair cell injury. Using adult mice and ex vivo cochlear cultures, we sought to determine whether: (i) resident cochlear progenitors respond to kanamycin ototoxicity and compensate for it; and (ii) the reparative potential of cochlear progenitors can be stimulated by the addition of growth factors. Morphological changes of cochlear tissue, expression of nestin mRNA and protein and cell proliferation were investigated in these models. Our observations show that ototoxic injury has modest effects on nestin expression and cell proliferation. On the other hand, the addition of growth factors to the injured cochlear explants induced the appearance of nestin-positive cells in the supporting cell area of the organ of Corti. The vast majority of nestin-expressing cells, however, were not proliferating. Growth factors also had a robust stimulatory effect on axonal sprouting and the proliferative response, which was more pronounced in injured cochleae. On the whole, our findings indicate that nestin expression after kanamycin ototoxicity is related to tissue reactivity rather than activation of resident progenitors attempting to replace the lost receptors. In addition, administration of growth factors significantly enhances tissue remodelling, suggesting that cochlear repair may be promoted by the exogenous application of regeneration-promoting substances.

  3. Factors That Affect Transfer of the IncI1 β-Lactam Resistance Plasmid pESBL-283 between E. coli Strains

    PubMed Central

    Händel, Nadine; Otte, Sarah; Jonker, Martijs; Brul, Stanley; ter Kuile, Benno H.


    The spread of antibiotic resistant bacteria worldwide presents a major health threat to human health care that results in therapy failure and increasing costs. The transfer of resistance conferring plasmids by conjugation is a major route by which resistance genes disseminate at the intra- and interspecies level. High similarities between resistance genes identified in foodborne and hospital-acquired pathogens suggest transmission of resistance conferring and transferrable mobile elements through the food chain, either as part of intact strains, or through transfer of plasmids from foodborne to human strains. To study the factors that affect the rate of plasmid transfer, the transmission of an extended-spectrum β-lactamase (ESBL) plasmid from a foodborne Escherichia coli strain to the β-lactam sensitive E. coli MG1655 strain was documented as a function of simulated environmental factors. The foodborne E. coli isolate used as donor carried a CTX-M-1 harboring IncI1 plasmid that confers resistance to β-lactam antibiotics. Cell density, energy availability and growth rate were identified as factors that affect plasmid transfer efficiency. Transfer rates were highest in the absence of the antibiotic, with almost every acceptor cell picking up the plasmid. Raising the antibiotic concentrations above the minimum inhibitory concentration (MIC) resulted in reduced transfer rates, but also selected for the plasmid carrying donor and recombinant strains. Based on the mutational pattern of transconjugant cells, a common mechanism is proposed which compensates for fitness costs due to plasmid carriage by reducing other cell functions. Reducing potential fitness costs due to maintenance and expression of the plasmid could contribute to persistence of resistance genes in the environment even without antibiotic pressure. Taken together, the results identify factors that drive the spread and persistence of resistance conferring plasmids in natural isolates and shows how these

  4. Construction of small plasmid vectors for use in genetic improvement of the extremely acidophilic Acidithiobacillus caldus.


    Meng, Jianzhou; Wang, Huiyan; Liu, Xiangmei; Lin, Jianqun; Pang, Xin; Lin, Jianqiang


    The genetic improvement of biomining bacteria including Acidithiobacillus caldus could facilitate the bioleaching process of sulfur-containing minerals. However, the available vectors for use in A. caldus are very scanty and limited to relatively large broad-host-range IncQ plasmids. In this study, a set of small, mobilizable plasmid vectors (pBBR1MCS-6, pMSD1 and pMSD2) were constructed based on plasmid pBBR1MCS-2, which does not belong to the IncQ, IncW, or IncP groups. The function of the tac promoter on 5.8-kb pMSD2 was determined by inserting a kanamycin-resistant reporter gene. The resulting recombinant pMSD2-Km was successfully transferred by conjugation into A. caldus MTH-04 with transfer frequency of 1.38±0.64×10(-5). The stability and plasmid copy number of pMSD2-Km in A. caldus MTH-04 were 75±2.7% and 5-6 copies per cell, respectively. By inserting an arsABC operon into pMSD2, an arsenic-resistant recombinant pMSD2-As was constructed and transferred into A. caldus MTH-04 by conjugation. The arsenic tolerance of A. caldus MTH-04 containing pMSD2-As was obviously increased up to 45mM of NaAsO2. These vectors could be applied in genetic improvement of A. caldus as well as other bioleaching bacteria.

  5. Genomic and Functional Characterization of qnr-Encoding Plasmids from Municipal Wastewater Biosolid Klebsiella pneumoniae Isolates

    PubMed Central

    Kaplan, Ella; Sela, Noa; Doron-Faigenboim, Adi; Navon-Venezia, Shiri; Jurkevitch, Edouard; Cytryn, Eddie


    Municipal wastewater treatment facilities are considered to be “hotspots” for antibiotic resistance, since they conjoin high densities of environmental and fecal bacteria with selective pressure in the form of sub-therapeutic concentrations of antibiotics. Discharged effluents and biosolids from these facilities can disseminate antibiotic resistant genes to terrestrial and aquatic environments, potentially contributing to the increasing global trend in antibiotic resistance. This phenomenon is especially pertinent when resistance genes are associated with mobile genetic elements such as conjugative plasmids, which can be transferred between bacterial phyla. Fluoroquinolones are among the most abundant antibiotic compounds detected in wastewater treatment facilities, especially in biosolids, where due to their hydrophobic properties they accumulate to concentrations that may exceed 40 mg/L. Although fluoroquinolone resistance is traditionally associated with mutations in the gyrA/topoisomerase IV genes, there is increasing evidence of plasmid-mediated quinolone resistance, which is primarily encoded on qnr genes. In this study, we sequenced seven qnr-harboring plasmids from a diverse collection of Klebsiella strains, isolated from dewatered biosolids from a large wastewater treatment facility in Israel. One of the plasmids, termed pKPSH-11XL was a large (185.4 kbp), multi-drug resistance, IncF-type plasmid that harbored qnrB and 10 additional antibiotic resistance genes that conferred resistance to five different antibiotic families. It was highly similar to the pKPN3-like plasmid family that has been detected in multidrug resistant clinical Klebsiella isolates. In contrast, the six additional plasmids were much smaller (7–9 Kbp) and harbored a qnrS -type gene. These plasmids were highly similar to each other and closely resembled pGNB2, a plasmid isolated from a German wastewater treatment facility. Comparative genome analyses of pKPSH-11XL and other pKPN3

  6. Production of Plasmid DNA as Pharmaceutical.


    Schmeer, Marco; Schleef, Martin


    Pharmaceutical applications of plasmid DNA require certain quality standards, depending on the intended use of the plasmids. That is, for direct gene transfer into human, GMP Grade is mandatory, however, for GMP production of for example viral vectors (AAV or mRNA etc.), the plasmid DNA used has not to be produced under GMP necessarily. Here we summarize important features of producing plasmid DNA, ensuring the required quality for the intended (pharmaceutical) application.

  7. Prevalence and significance of plasmid maintenance functions in the virulence plasmids of pathogenic bacteria.


    Sengupta, Manjistha; Austin, Stuart


    Virulence functions of pathogenic bacteria are often encoded on large extrachromosomal plasmids. These plasmids are maintained at low copy number to reduce the metabolic burden on their host. Low-copy-number plasmids risk loss during cell division. This is countered by plasmid-encoded systems that ensure that each cell receives at least one plasmid copy. Plasmid replication and recombination can produce plasmid multimers that hinder plasmid segregation. These are removed by multimer resolution systems. Equitable distribution of the resulting monomers to daughter cells is ensured by plasmid partition systems that actively segregate plasmid copies to daughter cells in a process akin to mitosis in higher organisms. Any plasmid-free cells that still arise due to occasional failures of replication, multimer resolution, or partition are eliminated by plasmid-encoded postsegregational killing systems. Here we argue that all of these three systems are essential for the stable maintenance of large low-copy-number plasmids. Thus, they should be found on all large virulence plasmids. Where available, well-annotated sequences of virulence plasmids confirm this. Indeed, virulence plasmids often appear to contain more than one example conforming to each of the three system classes. Since these systems are essential for virulence, they can be regarded as ubiquitous virulence factors. As such, they should be informative in the search for new antibacterial agents and drug targets.

  8. Building mosaics of therapeutic plasmid gene vectors.


    Tolmachov, Oleg E


    Plasmids are circular or linear DNA molecules propagated extra-chromosomally in bacteria. Evolution shaped plasmids are inherently mosaic structures with individual functional units represented by distinct segments in the plasmid genome. The patchwork of plasmid genetic modules is a convenient template and a model for the generation of artificial plasmids used as vehicles for gene delivery into human cells. Plasmid gene vectors are an important tool in gene therapy and in basic biomedical research, where these vectors offer efficient transgene expression in many settings in vitro and in vivo. Plasmid vectors can be attached to nuclear directing ligands or transferred by electroporation as naked DNA to deliver the payload genes to the nuclei of the target cells. Transgene expression silencing by plasmid sequences of bacterial origin and immune stimulation by bacterial unmethylated CpG motifs can be avoided by the generation of plasmid-based minimized DNA vectors, such as minicircles. Systems of efficient site-specific integration into human chromosomes and stable episomal maintenance in human cells are being developed for further reduction of the chances for transgene silencing. The successful generation of plasmid vectors is governed by a number of vector design rules, some of which are common to all gene vectors, while others are specific to plasmid vectors. This review is focused both on the guiding principles and on the technical know-how of plasmid gene vector design.

  9. Entire sequence of the colonization factor coli surface antigen 6-encoding plasmid pCss165 from an enterotoxigenic Escherichia coli clinical isolate.


    Wajima, Takeaki; Sabui, Subrata; Kano, Shigeyuki; Ramamurthy, Thandavarayan; Chatterjee, Nabendu Sekhar; Hamabata, Takashi


    Coli surface antigen 6 (CS6) is one of the most prevalent colonization factors among enterotoxigenic Escherichia coli (ETEC) isolated in developing countries. Although it is known that CS6 is encoded by a plasmid, there are no reports on the sequence analysis of the CS6-encoding plasmid or genes exhibiting similar behavior to CS6. Here, we report the isolation of the CS6-encoding plasmid, pCss165Kan, from 4266 ΔcssB::kanamycin (Km) and its complete nucleotide sequence. This plasmid consisted of 165,311bp and 222 predicted coding sequences. Remarkably, there were many insertion sequence (IS) elements, which comprised 24.4% of the entire sequence. Virulence-associated genes such as heat-stable enterotoxin, homologues of ATP-binding cassette transporter in enteroaggregative E. coli (EAEC), and ETEC autotransporter A were also present, although the ETEC autotransporter A gene was disrupted by the integration of IS629. We found that 2 transcriptional regulators belonging to the AraC family were not involved in CS6 expression. Interestingly, pCss165 had conjugative transfer genes, as well as 3 toxin-antitoxin systems that potentially exclude other plasmid-free host bacteria. These genes might be involved in the prevalence of CS6 among ETEC isolates.

  10. Studies on Saccharomyces cerevisiae carrying the plasmid pCYG4 related with ammonia assimilation. Batch experiments.


    Lima Filho, J L; Ledingham, W M


    Batch culture experiments of three different strains of Saccharomyces cerevisiae have been carried out. The first strain was transformed by a plasmid pCYG4, which carries the glutamate dehydrogenase (NADP-GDH, E.C. 1.4.14) gene conferring an 11-fold increase in activity. The second was transformed by the same plasmid, but without NADP-GDH, and the third was the wild type. The specific growth rates of the two recombinant DNA strains were below that of the wild type, which can be related to extra plasmid protein production.

  11. Molecular Epidemiology of KPC-Producing Escherichia coli: Occurrence of ST131-fimH30 Subclone Harboring pKpQIL-Like IncFIIk Plasmid

    PubMed Central

    O'Hara, Jessica A.; Hu, Fupin; Ahn, Chulsoo; Nelson, Jeremy; Rivera, Jesabel I.; Pasculle, Anthony W.


    Of 20 Klebsiella pneumoniae carbapenemase (KPC)-producing Escherichia coli isolates identified at hospitals in western Pennsylvania, 60% belonged to the epidemic ST131-fimH30 subclone. IncFIIk was the most common replicon type for the blaKPC-carrying plasmids (n = 8). All IncFIIk plasmids possessed a scaffold similar to that of pKpQIL, and seven of them were borne by ST131-fimH30 isolates. IncN plasmids conferred resistance to trimethoprim-sulfamethoxazole, and IncA/C plasmids conferred resistance to gentamicin. Three blaKPC-carrying plasmids (IncA/C and IncN) possessed blaSHV-7/12 and qnrA1 or qnrS1. PMID:24820082

  12. Origin-of-transfer sequences facilitate mobilisation of non-conjugative antimicrobial-resistance plasmids in Staphylococcus aureus

    PubMed Central

    O'Brien, Frances G.; Yui Eto, Karina; Murphy, Riley J. T.; Fairhurst, Heather M.; Coombs, Geoffrey W.; Grubb, Warren B.; Ramsay, Joshua P.


    Staphylococcus aureus is a common cause of hospital, community and livestock-associated infections and is increasingly resistant to multiple antimicrobials. A significant proportion of antimicrobial-resistance genes are plasmid-borne, but only a minority of S. aureus plasmids encode proteins required for conjugative transfer or Mob relaxase proteins required for mobilisation. The pWBG749 family of S. aureus conjugative plasmids can facilitate the horizontal transfer of diverse antimicrobial-resistance plasmids that lack Mob genes. Here we reveal that these mobilisable plasmids carry copies of the pWBG749 origin-of-transfer (oriT) sequence and that these oriT sequences facilitate mobilisation by pWBG749. Sequences resembling the pWBG749 oriT were identified on half of all sequenced S. aureus plasmids, including the most prevalent large antimicrobial-resistance/virulence-gene plasmids, pIB485, pMW2 and pUSA300HOUMR. oriT sequences formed five subfamilies with distinct inverted-repeat-2 (IR2) sequences. pWBG749-family plasmids encoding each IR2 were identified and pWBG749 mobilisation was found to be specific for plasmids carrying matching IR2 sequences. Specificity of mobilisation was conferred by a putative ribbon-helix-helix-protein gene smpO. Several plasmids carried 2–3 oriT variants and pWBG749-mediated recombination occurred between distinct oriT sites during mobilisation. These observations suggest this relaxase-in trans mechanism of mobilisation by pWBG749-family plasmids is a common mechanism of plasmid dissemination in S. aureus. PMID:26243776

  13. Plasmid diversity in Vibrio vulnificus biotypes.


    Roig, Francisco J; Amaro, Carmen


    Vibrio vulnificus is a heterogeneous bacterial species that can be virulent for humans and fish. Virulence in fish seems to rely on a recently described plasmid that can be transmitted between strains, aided by a conjugative plasmid. The main objective of this work was to analyse the plasmid content of a wide collection of strains from the three biotypes of the species, as well as to identify putative conjugative and virulence plasmids by means of Southern hybridization with specific probes and sequence analysis of selected gene markers. We found 28 different plasmid profiles in a total of 112 strains, which were relatively biotype- or serovar-specific. Biotype 1 lacked high-molecular-mass plasmids, with the exception of a putative conjugative plasmid of 48 kb that was present in 42.8% of clinical and environmental strains isolated worldwide. All biotype 2 strains possessed the virulence plasmid, whose molecular mass ranged between 68 and 70 kb, and 89.65% of these strains also had a putative conjugative plasmid with a molecular size of 52-56 kb. Finally, a 48 kb putative conjugative plasmid was present in all biotype 3 strains. Data from partial sequencing of traD, traI and the whole vep07 (a recently described plasmid-borne virulence gene) from a selection of strains suggest that the plasmids of 48-56 kb probably belong to the same family of F-plasmids as pYJ016 and that the gene vep07 is absolutely essential for fish virulence. Additional cryptic plasmids of low molecular mass were present in the three biotypes. In conclusion, plasmids are widespread among V. vulnificus species and could contribute substantially to genetic plasticity of the species.

  14. Origin and Evolution of Rickettsial Plasmids

    PubMed Central

    El Karkouri, Khalid; Pontarotti, Pierre; Raoult, Didier; Fournier, Pierre-Edouard


    Background Rickettsia species are strictly intracellular bacteria that have undergone a reductive genomic evolution. Despite their allopatric lifestyle, almost half of the 26 currently validated Rickettsia species have plasmids. In order to study the origin, evolutionary history and putative roles of rickettsial plasmids, we investigated the evolutionary processes that have shaped 20 plasmids belonging to 11 species, using comparative genomics and phylogenetic analysis between rickettsial, microbial and non-microbial genomes. Results Plasmids were differentially present among Rickettsia species. The 11 species had 1 to 4 plasmid (s) with a size ranging from 12 kb to 83 kb. We reconstructed pRICO, the last common ancestor of the current rickettsial plasmids. pRICO was vertically inherited mainly from Rickettsia/Orientia chromosomes and diverged vertically into a single or multiple plasmid(s) in each species. These plasmids also underwent a reductive evolution by progressive gene loss, similar to that observed in rickettsial chromosomes, possibly leading to cryptic plasmids or complete plasmid loss. Moreover, rickettsial plasmids exhibited ORFans, recent gene duplications and evidence of horizontal gene transfer events with rickettsial and non-rickettsial genomes mainly from the α/γ-proteobacteria lineages. Genes related to maintenance and plasticity of plasmids, and to adaptation and resistance to stress mostly evolved under vertical and/or horizontal processes. Those involved in nucleotide/carbohydrate transport and metabolism were under the influence of vertical evolution only, whereas genes involved in cell wall/membrane/envelope biogenesis, cycle control, amino acid/lipid/coenzyme and secondary metabolites biosynthesis, transport and metabolism underwent mainly horizontal transfer events. Conclusion Rickettsial plasmids had a complex evolution, starting with a vertical inheritance followed by a reductive evolution associated with increased complexity via

  15. Antimicrobial Resistance and Plasmid Profile of Bacterial Strains Isolated from the Urbanized Eltsovka-1 River (Russia).


    Lobova, Tatiana I; Yemelyanova, Elena; Andreeva, Irina S; Puchkova, Larisa I; Repin, Vladimir Ye


    Antimicrobial resistance and plasmid profile of Gram-positive and Gram-negative bacterial strains isolated from the urbanized Eltsovka-1 River (Russia) were investigated. Sequencing of the 16S rRNA of of G+ strains showed 99-100% identity to that of Bacillus aerophilus, Bacillus altitudinis, Bacillus amyloliquefaciens, Bacillus anthrancis, Bacillus barbaricus, Bacillus cereus, Bacillus flexus, Bacillus indriensis, Bacillus stratosphericus, Bacillus subtilis subsp. subtilis, Bacillus thuringiensis, Streptomyces albidoflavus, Streptomyces albus, Streptomyces exfoliatus, Streptomyces odorifer, and Streptomyces sampsonii. Sequencing of the 16S rRNA of G-strains was similar in 99-100% to that of Aeromonas bestiarum, Aeromonas encheleia, Aeromonas hydrophila, A. hydrophila subsp. anaerogenes, A. hydrophila subsp. dhakensis, Aeromonas media, Aeromonas molluscorum, Aeromonas popoffii, Aeromonas salmonicida subsp. masoucida, A. salmonicida subsp. pectinolytica, A. salmonicida subsp. salmonicida, Aeromonas punctata, Aeromonas sobria, and Shewanella putrefaciens. The highest percentage (88.4%) of strains was resistant to polymyxin B followed by 69% to lincomycin, 61.5% to benzilpenicillin, 57.7% to ampicillin, and 50% to carbenicillin. A low level of resistance (4%) was found to kanamycin (8%), to streptomycin (11.5%), to neomycin and tetracycline, and (15%) to erythromycin. No resistance was found to gentamycin, monomycin, and chloroamphenicol. The majority (80.7%) of strains was multidrug-resistant. Ninety-two percent of all strains carried plasmid DNA of various sizes.

  16. Coincident plasmids and antimicrobial resistance in marine bacteria isolated from polluted and unpolluted Atlantic Ocean Samples

    SciTech Connect

    Baya, A.M.; Brayton, P.R.; Brown, V.L.; Grimes, D.J.; Russek-Cohen, E.; Colwell, R.R.


    Sewage effluent and outfall confluence samples were collected at the Barceloneta Regional Treatment Plant in Barceloneta, Puerto Rico; outfall confluence samples at Ocean City, Md., were also collected. Samples from uncontaminated open ocean areas served as clean-water controls. Bacteria were enriched in marine broth 2216 amended with 1 of one of a set of chemical selected for study per ml: nitrobenzene, dibutyl phthalate, m-cresol, o-cresol, 4-nitroaniline, bis(tributyltin) oxide, and quinone. MICs of the chemicals were determined individually for all isolates. Bacterial isolates were evaluated for resistance to nine different antibiotics and for the presence of plasmid DNA. Treated sewage was found to contain large numbers of bacteria simultaneously possessing antibiotic resistance, chemical resistance, and multiple bands of plasmic DNA. Bacteria resistant to penicillin, erythromycin, nalidixic acid, ampicillin, m-cresol, quinone, and bis(tributyltin) oxide were detected in nearly all samples, but only sewage outfall confluence samples yielded bacterial isolates that were resistant to streptomycin. Bacteria resistant to a combination of antibiotics, including kanamycin, chloramphenicol, gentamicin, and tetracycline, were isolated only from sewage effluent samples. It is concluded that bacterial isolates derived from toxic chemical wastes more frequently contain plasmid DNA and demonstrate antimicrobial resistance than do bacterial isolates from domestic sewage-impacted waters or from uncontaminated open ocean sites.

  17. Plasmid curing of Oenococcus oeni.


    Mesas, Juan M; Rodríguez, M Carmen; Alegre, M Teresa


    Two strains of Oenococcus oeni, RS1 (which carries the plasmid pRS1) and RS2 (which carries the plasmids pRS2 and pRS3), were grown in the presence of different curing agents and at different temperatures. Sublethal temperature together with acriflavine generated all possible types of cured strains, i.e., lacking pRS1 (from strain RS1), and lacking pRS2, pRS3, or both (from strain RS2). Sublethal temperature together with acridine orange only generated cured strains lacking pRS3. These results suggest that acriflavine is a better curing agent than acridine orange for O. oeni, and that pRS3 is the most sensitive to these curing agents. We also observed spontaneous loss of pRS2 or both pRS2 and pRS3 by electroporation. The ability to cure O. oeni strains of plasmids provides a critical new tool for the genetic analysis and engineering of this commercially important bacterium.

  18. The mechanism of plasmid curing in bacteria.


    Spengler, Gabriella; Molnár, Annamária; Schelz, Zsuzsanna; Amaral, Leonard; Sharples, Derek; Molnár, Joseph


    Bacterial plasmids have a major impact on metabolic function. Lactose fermentation of E. coli or hemolysin B transporter expressed by the plasmids that carry these respective genes could be readily obviated by heterocyclic compounds that readily bind to plasmid DNA. These compounds could also reverse the resistance to antibiotics of E. coli, Enterobacter, Proteus, Staphylococcus and Yersinia strains by eliminating plasmids. However, the frequency and extent of this effect was significantly less than might have been expected based on a complex interaction with plasmid DNA. The effects of heterocyclic compounds on the plasmids responsible for the virulence of Yersinia and A. tumefaciens, or on nodulation, nitrogen fixation of Rhizobia accounted for the elimination of 0.1 to 1.0 % of plasmids present in the populations studied. Bacterial plasmids can be eliminated from bacterial species grown as pure or mixed bacterial cultures in the presence of sub-inhibitory concentrations of non-mutagenic heterocyclic compounds. The antiplasmid action of the compounds depends on the chemical structure of amphiphillic compounds having a planar ring system with substitution in the L-molecular region. A symmetrical pi-electron conjugation at the highest occupied molecular orbitals favours the antiplasmid effect. The antiplasmid effect of heterocyclic compounds is expressed differentially in accordance with the structural form of the DNA to which they bind. In this manner "extrachromosomal" plasmid DNA that exists in a superhelical state binds more compound than its linear or open-circular form; and least to the chromosomal DNA of the bacterium, that carries the plasmid. It can also be noted that these compounds are not mutagenic and their antiplasmid effects correlate with the energy of HOMO-orbitals. Plasmid elimination is considered also to take place in ecosystems containing numerous bacterial species. This opens up a new perspective in rational drug design against bacterial

  19. Amikacin, kanamycin and tobramycin binding to melanin in the presence of Ca(2+) and Mg(2+) ions.


    Wrześniok, Dorota; Buszman, Ewa; Miernik-Biela, Ewa


    The aim of the presented work was to examine the interaction of amikacin, kanamycin and tobramycin with melanin in the presence of Ca(2+ )and Mg(2+) ions. It has been demonstrated that the analyzed aminoglycosides form complexes with melanin in the presence of metal ions and the amount of drugs bound to the polymer increases with increasing initial antibiotics concentration. It has been also shown that two classes of binding sites participate in the formation of amikacin, kanamycin and tobramycin complexes with melanin containing Ca(2+) or Mg(2+) ions: high affinity binding sites (n1) with the association constant K1 approximately 10(4)-10(5)M(-1) and low affinity binding sites (n2) with K2 approximately 10(3)M(-1). It has been demonstrated that calcium and magnesium significantly decrease the number of total binding sites (ntot) as compared with aminoglycoside-melanin complexes obtained in the absence of metal ions.

  20. Successful treatment of recurrent Helicobacter fennelliae bacteraemia by selective digestive decontamination with kanamycin in a lung cancer patient receiving chemotherapy

    PubMed Central

    Nagamatsu, Maki; Tomida, Junko; Kawamura, Yoshiaki; Yamamoto, Kei; Mawatari, Momoko; Kutsuna, Satoshi; Takeshita, Nozomi; Hayakawa, Kayoko; Kanagawa, Shuzo; Mezaki, Kazuhisa; Hashimoto, Masao; Ishii, Satoru; Ohmagari, Norio


    Introduction: Helicobacter fennelliae is an enterohepatic Helicobacter species causing bacteraemia in immunocompromised hosts. Only a few cases of recurrent H. fennelliae bacteraemia have been reported in Japan and there are no guidelines regarding antimicrobial treatment for H. fennelliae infection. Case presentation: H. fennelliae bacteraemia was observed in a patient receiving platinum-based chemotherapy for lung cancer. To prevent recurrence, the patient received antibiotic therapy with cefepime, amoxicillin and doxycycline for 6 weeks, which is similar to the therapy for Helicobacter cinaedi bacteraemia. Bacteraemia recurred despite the long-term antibiotic therapy. We hypothesized that the H. fennelliae bacteraemia originated from endogenous infection in the intestinal tract due to the long-term damage of the enteric mucosa by platinum-based drugs and performed selective digestive decontamination (SDD) with kanamycin. Bacteraemia did not recur after SDD. Conclusion: Our observations indicate that clinicians should be aware of possible recurrent H. fennelliae bacteraemia, which could be effectively prevented by SDD with kanamycin. PMID:28348791

  1. Plasmid Diversity and Adaptation Analyzed by Massive Sequencing of Escherichia coli Plasmids.


    de Toro, María; Garcilláon-Barcia, M Pilar; De La Cruz, Fernando


    Whole-genome sequencing is revolutionizing the analysis of bacterial genomes. It leads to a massive increase in the amount of available data to be analyzed. Bacterial genomes are usually composed of one main chromosome and a number of accessory chromosomes, called plasmids. A recently developed methodology called PLACNET (for plasmid constellation networks) allows the reconstruction of the plasmids of a given genome. Thus, it opens an avenue for plasmidome analysis on a global scale. This work reviews our knowledge of the genetic determinants for plasmid propagation (conjugation and related functions), their diversity, and their prevalence in the variety of plasmids found by whole-genome sequencing. It focuses on the results obtained from a collection of 255 Escherichia coli plasmids reconstructed by PLACNET. The plasmids found in E. coli represent a nonaleatory subset of the plasmids found in proteobacteria. Potential reasons for the prevalence of some specific plasmid groups will be discussed and, more importantly, additional questions will be posed.

  2. Frequency of Resistance to Kanamycin, Tobramycin, Netilmicin, and Amikacin in Gentamicin-Resistant Gram-Negative Bacteria

    PubMed Central

    Seligman, Stephen J.


    In vitro evaluation of 66 epidemiologically distinct, gentamicin-resistant, gram-negative isolates from four hospitals revealed that 92% were kanamycin resistant, 44% were netilmicin resistant, 41% were tobramycin resistant, and 6% were amikacin resistant. Combined resistance to gentamicin, tobramycin, and netilmicin occurred in 30% of the strains. Although the resistance percentage to amikacin was the lowest of the three newer agents, two strains were resistant to all of the aminoglycosides tested. PMID:626492

  3. IncP-1β Plasmids Are Important Carriers of Fitness Traits for Variovorax Species in the Mycosphere--Two Novel Plasmids, pHB44 and pBS64, with Differential Effects Unveiled.


    Zhang, Miaozhi; Warmink, Jan; Pereira E Silva, Michele C; Brons, Jolanda; Smalla, Kornelia; van Elsas, Jan Dirk


    The Laccaria proxima mycosphere strongly selects Variovorax paradoxus cells. Fifteen independent V. paradoxus strains, isolated from mycospheres sampled at two occasions, were investigated with respect to the occurrence of plasmids of sizes <60-100 kb. Two V. paradoxus strains, HB44 and BS64, were found to contain such plasmids, which were coined pHB44 and pBS64. Replicon typing using a suite of plasmid-specific PCR systems indicated that both plasmids belong to the IncP-1β group. Also, both were able to mobilize selectable IncQ group plasmids into Escherichia coli as well as Pseudomonas fluorescens. Moreover, they showed stable replication in these organisms, confirming their broad host range. Strain BS64 was cured of pBS64 and plasmid pHB44 was subsequently moved into this cured strain by making use of the IncQ group tracer plasmid pSUP104, which was then removed at elevated temperature. Thus, both plasmids could be screened for their ability to confer a phenotype upon strain BS64. No evidence for the presence of genes for xenobiotic degradation and/or antibiotic or heavy metal resistances was found for either of the two plasmids. Remarkably, both could stimulate the production of biofilm material by strain BS64. Also, the population densities of pBS64-containing strain BS64 were temporarily raised in liquid as well as soil systems (versus the plasmid-cured strain), both in the presence of the fungal host Lyophyllum sp. strain Karsten. Strikingly, plasmid pHB44 significantly enhanced the fitness of strain BS64 in soil containing Lyophyllum sp. strain Karsten, but decreased its fitness in soil supplemented with extra FeCl3. The effect was noted both in separate (no inter-strain competition) and joint (competition) inoculations.

  4. Noncanonical SMC protein in Mycobacterium smegmatis restricts maintenance of Mycobacterium fortuitum plasmids.


    Panas, Michael W; Jain, Paras; Yang, Hui; Mitra, Shimontini; Biswas, Debasis; Wattam, Alice Rebecca; Letvin, Norman L; Jacobs, William R


    Research on tuberculosis and leprosy was revolutionized by the development of a plasmid transformation system in the fast-growing surrogate, Mycobacterium smegmatis. This transformation system was made possible by the successful isolation of a M. smegmatis mutant strain mc(2)155, whose efficient plasmid transformation (ept) phenotype supported the replication of Mycobacterium fortuitum pAL5000 plasmids. In this report, we identified the EptC gene, the loss of which confers the ept phenotype. EptC shares significant amino acid sequence homology and domain structure with the MukB protein of Escherichia coli, a structural maintenance of chromosomes (SMC) protein. Surprisingly, M. smegmatis has three paralogs of SMC proteins: EptC and MSMEG_0370 both share homology with Gram-negative bacterial MukB; and MSMEG_2423 shares homology with Gram-positive bacterial SMCs, including the single SMC protein predicted for Mycobacterium tuberculosis and Mycobacterium leprae. Purified EptC was shown to bind ssDNA and stabilize negative supercoils in plasmid DNA. Moreover, an EptC-mCherry fusion protein was constructed and shown to bind to DNA in live mycobacteria, and to prevent segregation of plasmid DNA to daughter cells. To our knowledge, this is the first report of impaired plasmid maintenance caused by a SMC homolog, which has been canonically known to assist the segregation of genetic materials.

  5. Genomics of high molecular weight plasmids isolated from an on-farm biopurification system.


    Martini, María C; Wibberg, Daniel; Lozano, Mauricio; Torres Tejerizo, Gonzalo; Albicoro, Francisco J; Jaenicke, Sebastian; van Elsas, Jan Dirk; Petroni, Alejandro; Garcillán-Barcia, M Pilar; de la Cruz, Fernando; Schlüter, Andreas; Pühler, Alfred; Pistorio, Mariano; Lagares, Antonio; Del Papa, María F


    The use of biopurification systems (BPS) constitutes an efficient strategy to eliminate pesticides from polluted wastewaters from farm activities. BPS environments contain a high microbial density and diversity facilitating the exchange of information among bacteria, mediated by mobile genetic elements (MGEs), which play a key role in bacterial adaptation and evolution in such environments. Here we sequenced and characterized high-molecular-weight plasmids from a bacterial collection of an on-farm BPS. The high-throughput-sequencing of the plasmid pool yielded a total of several Mb sequence information. Assembly of the sequence data resulted in six complete replicons. Using in silico analyses we identified plasmid replication genes whose encoding proteins represent 13 different Pfam families, as well as proteins involved in plasmid conjugation, indicating a large diversity of plasmid replicons and suggesting the occurrence of horizontal gene transfer (HGT) events within the habitat analyzed. In addition, genes conferring resistance to 10 classes of antimicrobial compounds and those encoding enzymes potentially involved in pesticide and aromatic hydrocarbon degradation were found. Global analysis of the plasmid pool suggest that the analyzed BPS represents a key environment for further studies addressing the dissemination of MGEs carrying catabolic genes and pathway assembly regarding degradation capabilities.

  6. Genomics of high molecular weight plasmids isolated from an on-farm biopurification system

    PubMed Central

    Martini, María C.; Wibberg, Daniel; Lozano, Mauricio; Torres Tejerizo, Gonzalo; Albicoro, Francisco J.; Jaenicke, Sebastian; van Elsas, Jan Dirk; Petroni, Alejandro; Garcillán-Barcia, M. Pilar; de la Cruz, Fernando; Schlüter, Andreas; Pühler, Alfred; Pistorio, Mariano; Lagares, Antonio; Del Papa, María F.


    The use of biopurification systems (BPS) constitutes an efficient strategy to eliminate pesticides from polluted wastewaters from farm activities. BPS environments contain a high microbial density and diversity facilitating the exchange of information among bacteria, mediated by mobile genetic elements (MGEs), which play a key role in bacterial adaptation and evolution in such environments. Here we sequenced and characterized high-molecular-weight plasmids from a bacterial collection of an on-farm BPS. The high-throughput-sequencing of the plasmid pool yielded a total of several Mb sequence information. Assembly of the sequence data resulted in six complete replicons. Using in silico analyses we identified plasmid replication genes whose encoding proteins represent 13 different Pfam families, as well as proteins involved in plasmid conjugation, indicating a large diversity of plasmid replicons and suggesting the occurrence of horizontal gene transfer (HGT) events within the habitat analyzed. In addition, genes conferring resistance to 10 classes of antimicrobial compounds and those encoding enzymes potentially involved in pesticide and aromatic hydrocarbon degradation were found. Global analysis of the plasmid pool suggest that the analyzed BPS represents a key environment for further studies addressing the dissemination of MGEs carrying catabolic genes and pathway assembly regarding degradation capabilities. PMID:27321040

  7. The Effect of Kanamycin and Tetracycline on Growth and Photosynthetic Activity of Two Chlorophyte Algae.


    Bashir, Khawaja Muhammad Imran; Cho, Man-Gi


    Antibiotics are routinely used in microalgae culture screening, stock culture maintenance, and genetic transformation. By studying the effect of antibiotics on microalgae growth, we can estimate the least value to inhibit growth of undesired pathogens in algal culture. We studied the effect of kanamycin and tetracycline on the growth and photosynthetic activity of two chlorophyte microalgae, Dictyosphaerium pulchellum and Micractinium pusillum. We measured CFU mL(-1) on agar plates, optical density, fluorescence yields, and photosynthetic inhibition. Our results showed a significant effect of kan and tet on the tested microalgae species except tet, which showed a minor effect on M. pusillum. Both antibiotics are believed to interact with the protein synthesis machinery; hence, the inhibitory effect of the tested antibiotics was further confirmed by isolation and quantification of the whole cell protein. A significant reduction in protein quantity was observed at concentrations more than 5 mg L(-1), except M. pusillum, which showed only a slight reduction in protein quantity even at the maximum tested concentration of tet (30 mg L(-1)). This study can further aid in aquaculture industry, for the maintenance of the microalgae stock cultures and it can also help the microalgae genetic engineers in the construction of molecular markers.

  8. Systemic lipopolysaccharide induces cochlear inflammation and exacerbates the synergistic ototoxicity of kanamycin and furosemide.


    Hirose, Keiko; Li, Song-Zhe; Ohlemiller, Kevin K; Ransohoff, Richard M


    Aminoglycoside antibiotics are highly effective agents against gram-negative bacterial infections, but they cause adverse effects on hearing and balance dysfunction as a result of toxicity to hair cells of the cochlea and vestibular organs. While ototoxicity has been comprehensively studied, the contributions of the immune system, which controls the host response to infection, have not been studied in antibiotic ototoxicity. Recently, it has been shown that an inflammatory response is induced by hair cell injury. In this study, we found that lipopolysaccharide (LPS), an important component of bacterial endotoxin, when given in combination with kanamycin and furosemide, augmented the inflammatory response to hair cell injury and exacerbated hearing loss and hair cell injury. LPS injected into the peritoneum of experimental mice induced a brisk cochlear inflammatory response with recruitment of mononuclear phagocytes into the spiral ligament, even in the absence of ototoxic agents. While LPS alone did not affect hearing, animals that received LPS prior to ototoxic agents had worse hearing loss compared to those that did not receive LPS pretreatment. The poorer hearing outcome in LPS-treated mice did not correlate to changes in endocochlear potential. However, LPS-treated mice demonstrated an increased number of CCR2(+) inflammatory monocytes in the inner ear when compared with mice treated with ototoxic agents alone. We conclude that LPS and its associated inflammatory response are harmful to the inner ear when coupled with ototoxic medications and that the immune system may contribute to the final hearing outcome in subjects treated with ototoxic agents.

  9. Subinhibitory concentration of kanamycin induces the Pseudomonas aeruginosa type VI secretion system.


    Jones, Cerith; Allsopp, Luke; Horlick, Jack; Kulasekara, Hemantha; Filloux, Alain


    Pseudomonas aeruginosa is a Gram-negative bacterium found in natural environments including plants, soils and warm moist surfaces. This organism is also in the top ten of nosocomial pathogens, and prevalent in cystic fibrosis (CF) lung infections. The ability of P. aeruginosa to colonize a wide variety of environments in a lasting manner is associated with the formation of a resistant biofilm and the capacity to efficiently outcompete other microorganisms. Here we demonstrate that sub-inhibitory concentration of kanamycin not only induces biofilm formation but also induces expression of the type VI secretion genes in the H1-T6SS cluster. The H1-T6SS is known for its role in toxin production and bacterial competition. We show that the antibiotic induction of the H1-T6SS only occurs when a functional Gac/Rsm pathway is present. These observations may contribute to understand how P. aeruginosa responds to antibiotic producing competitors. It also suggests that improper antibiotic therapy may enhance P. aeruginosa colonization, including in the airways of CF patients.

  10. M. tuberculosis ferritin (Rv3841): Potential involvement in Amikacin (AK) & Kanamycin (KM) resistance.


    Sharma, Divakar; Lata, Manju; Faheem, Mohammad; Khan, Asad Ullah; Joshi, Beenu; Venkatesan, Krishnamurthy; Shukla, Sangeeta; Bisht, Deepa


    Tuberculosis is an infectious disease, caused by one of the most successful human pathogen, Mycobacterium tuberculosis. Aminoglycosides, Amikacin (AK) & Kanamycin (KM) are commonly used to treat drug resistant tuberculosis. They target the protein synthesis machinery by interacting with several steps of translation. Several explanations have been proposed to explain the mechanism of aminoglycoside resistance but still our information is inadequate. Iron storing/interacting proteins were found to be overexpressed in aminoglycosides resistant isolates. Iron assimilation and utilization in M. tuberculosis plays a crucial role in growth, virulence and latency. To establish the relationship of ferritin with AK & KM resistance ferritin (Rv3841/bfrB) was cloned, expressed and antimicrobial drug susceptibility testing (DST) was carried out. Rv3841/bfrB gene was cloned and expressed in E. coli BL21 using pQE2 expression vector. Etest results for DST against AK & KM showed that the minimum inhibitory concentration (MIC) of ferritin recombinant cells was changed. Recombinants showed two fold changes in MIC with AK and three fold with KM E-strips. Overexpression of ferritin reflect the MIC shift which might be playing a critical role in the survival of mycobacteria by inhibiting/modulating the effects of AK & KM. String analysis also suggests that ferritin interacted with few proteins which are directly and indirectly involved in M. tuberculosis growth, Iron assimilation, virulence, resistance, stresses and latency.

  11. Amikacin in Newborn Infants: Comparative Pharmacology with Kanamycin and Clinical Efficacy in 45 Neonates with Bacterial Diseases

    PubMed Central

    Howard, Jorge B.; McCracken, George H.; Trujillo, Hugo; Mohs, Edgar


    The pharmacokinetic properties of amikacin (BBK8) were similar to those of kanamycin in newborn infants. Peak serum concentrations of both drugs were in the range of 15 to 25 μg/ml with the exception of kanamycin in babies weighing greater than 2,000 g at birth where peak levels were 12.5 to 15 μg/ml. Volumes of distribution, plasma clearances, and serum half-life values were comparable for the two drugs. The clinical and bacteriological responses to amikacin therapy were assessed in 45 neonates with bacterial diseases. A case fatality rate of 26% was observed in infants with septicemia and/or meningitis, whereas no deaths occurred among 22 infants with urinary tract and mucocutaneous infections. Cultures from infected sites were sterile within 72 h of initiating amikacin therapy in 47% of the infants, continued positive for greater than 72 h in 31%, and were not reevaluated during therapy in 22%. The clinical response was judged to be satisfactory in 92% of the surviving infants. The efficacy of amikacin was comparable to that of kanamycin or gentamicin in neonatal bacterial diseases. PMID:984762

  12. Virulence Plasmids of Spore-Forming Bacteria.


    Adams, Vicki; Li, Jihong; Wisniewski, Jessica A; Uzal, Francisco A; Moore, Robert J; McClane, Bruce A; Rood, Julian I


    Plasmid-encoded virulence factors are important in the pathogenesis of diseases caused by spore-forming bacteria. Unlike many other bacteria, the most common virulence factors encoded by plasmids in Clostridium and Bacillus species are protein toxins. Clostridium perfringens causes several histotoxic and enterotoxin diseases in both humans and animals and produces a broad range of toxins, including many pore-forming toxins such as C. perfringens enterotoxin, epsilon-toxin, beta-toxin, and NetB. Genetic studies have led to the determination of the role of these toxins in disease pathogenesis. The genes for these toxins are generally carried on large conjugative plasmids that have common core replication, maintenance, and conjugation regions. There is considerable functional information available about the unique tcp conjugation locus carried by these plasmids, but less is known about plasmid maintenance. The latter is intriguing because many C. perfringens isolates stably maintain up to four different, but closely related, toxin plasmids. Toxin genes may also be plasmid-encoded in the neurotoxic clostridia. The tetanus toxin gene is located on a plasmid in Clostridium tetani, but the botulinum toxin genes may be chromosomal, plasmid-determined, or located on bacteriophages in Clostridium botulinum. In Bacillus anthracis it is well established that virulence is plasmid determined, with anthrax toxin genes located on pXO1 and capsule genes on a separate plasmid, pXO2. Orthologs of these plasmids are also found in other members of the Bacillus cereus group such as B. cereus and Bacillus thuringiensis. In B. thuringiensis these plasmids may carry genes encoding one or more insecticidal toxins.

  13. A Plasmid in Legionella pneumophila

    DTIC Science & Technology


    13). which they were isolated and the number of the isolate The Legionnaires disease bacterium, L. pneu. from that city. The following 16... Legionnaires disease bacterium. .1. (un. Micro. biol. 8:320-:t25. appears reasonable that this organism could sup- 1:l. Fraser, D5. W., and J. F. McI~ade. 1979...INFECTION AND IMMUNITY, Sept. 1980, p. 1(92-1095 Vol. 29, No. :1 0I 9-9567/A)/- 1092/14$02.00/0. A Plasmid in Legionella pneumophila_ ( (/’ )GREGORY

  14. Microwave effects on plasmid DNA.


    Sagripanti, J L; Swicord, M L; Davis, C C


    The exposure of purified plasmid DNA to microwave radiation at nonthermal levels in the frequency range from 2.00 to 8.75 GHz produces single- and double-strand breaks that are detected by agarose gel electrophoresis. Microwave-induced damage to DNA depends on the presence of small amounts of copper. This effect is dependent upon both the microwave power and the duration of the exposure. Cuprous, but not cupric, ions were able to mimic the effects produced by microwaves on DNA.

  15. Microwave effects on plasmid DNA

    SciTech Connect

    Sagripanti, J.L.; Swicord, M.L.; Davis, C.C.


    The exposure of purified plasmid DNA to microwave radiation at nonthermal levels in the frequency range from 2.00 to 8.75 GHz produces single- and double-strand breaks that are detected by agarose gel electrophoresis. Microwave-induced damage to DNA depends on the presence of small amounts of copper. This effect is dependent upon both the microwave power and the duration of the exposure. Cuprous, but not cupric, ions were able to mimic the effects produced by microwaves on DNA.

  16. IncI1 Plasmid Carrying Extended-Spectrum-β-Lactamase Gene blaCTX-M-1 in Salmonella enterica Isolates from Poultry and Humans in France, 2003 to 2008 ▿

    PubMed Central

    Cloeckaert, Axel; Praud, Karine; Lefevre, Martine; Doublet, Benoît; Pardos, Maria; Granier, Sophie A.; Brisabois, Anne; Weill, François-Xavier


    We report the dissemination of a conjugative IncI1 plasmid carrying blaCTX-M-1, conferring resistance to extended-spectrum cephalosporins, in Salmonella enterica isolates from poultry and humans in France from 2003 to 2008. By IncI1 plasmid subtyping, this plasmid was shown to be genetically related to that found in Escherichia coli isolates from healthy poultry in France. PMID:20643895

  17. TEM-1-encoding small plasmids impose dissimilar fitness costs on Haemophilus influenzae and Haemophilus parainfluenzae.


    Søndergaard, Annette; Lund, Marianne; Nørskov-Lauritsen, Niels


    Only two beta-lactamases, TEM-1 and ROB-1, have been observed in Haemophilus influenzae, while four different TEM but no ROB enzymes have been found in Haemophilus parainfluenzae. In order to investigate the mechanisms behind the dissemination of small beta-lactamase-encoding plasmids in H. influenzae and H. parainfluenzae, we assessed the fitness cost of three TEM-1- (pPN223, pA1209, pA1606), one TEM-15- (pSF3) and one ROB-1-bearing (pB1000) plasmid when expressed in either bacterial species. All plasmids were stable in H. influenzae and H. parainfluenzae except pB1000, which showed on average (sample mean) 76% curing in H. parainfluenzae after 5  days of subculture. Competition assays between isogenic strains with and without plasmid showed no competitive disadvantage of pPN223 and pA1606 in H. influenzae, or of pA1209 in H. parainfluenzae. In contrast, pSF3 and pB1000 were associated with significant competitive disadvantages in both species. Some of the competitive disadvantages may be related to differences in plasmid copy number and mRNA expression of the beta-lactamase genes, as revealed by quantitative PCR analysis. In conclusion, plasmids encoding TEM beta-lactamases isolated from H. influenzae and H. parainfluenzae can be stably transferred between species. The fast curing of pB1000 in H. parainfluenzae observed in this study correlates to the fact that ROB-1 has never been reported for this species. TEM-1-encoding plasmids are associated with the lowest level of fitness cost, but different TEM-1 plasmids confer different levels of fitness cost on the two hosts.

  18. Survey of plasmids in various mycoplasmas.

    PubMed Central

    Harasawa, R.; Barile, M. F.


    Thirty-three strains representing 15 distinct Mycoplasma, Acholeplasma, and Spiroplasma species were examined for the presence of plasmid DNA by agarose gel electrophoresis. The electrophoretic patterns of the DNAs of three strains, Mycoplasma sp. strain 747, Spiroplasma mirum strain SMCA, and M. hominis strain 1257, suggested the presence of a plasmid with molecular weights of approximately 70, 10, and 9 megadaltons, respectively. The functions of these plasmids are currently unknown. Images FIG. 1 PMID:6679154

  19. Plasmid-encoded trimethoprim resistance in staphylococci.

    PubMed Central

    Archer, G L; Coughter, J P; Johnston, J L


    High-level (greater than 1,000 micrograms/ml) resistance to the antimicrobial agent trimethoprim was found in 17 of 101 (17%) coagulase-negative staphylococci and 5 of 51 (10%) Staphylococcus aureus from a number of different hospitals in the United States. Resistance was plasmid encoded and could be transferred by conjugation in 4 of the 17 (24%) Tpr coagulase-negative staphylococci and 3 of the 5 (60%) Tpr S. aureus. A 1.2-kilobase segment of plasmid DNA from one of the plasmids (pG01) was cloned on a high-copy-number vector in Escherichia coli and expressed high-level Tpr (MIC, 1,025 micrograms/ml) in the gram-negative host. In situ filter hybridization demonstrated homology between the cloned Tpr gene probe and plasmid DNA from each conjugative Tpr plasmid, a single nonconjugative plasmid from a United States Staphylococcus epidermidis isolate, a nonconjugative plasmid from an Australian methicillin-resistant S. aureus isolate, and chromosomal DNA from three Tpr S. epidermidis isolates that did not contain any plasmid DNA that was homologous with the probe. No homology was seen between the probe and staphylococcal plasmids not mediating Tpr, plasmid DNA from 12 Tpr S. epidermidis isolates not transferring Tpr by conjugation, or plasmid-encoded Tpr genes derived from gram-negative bacteria. Plasmid-encoded Tpr appears to be a relatively new gene in staphylococci and, because it can be transferred by conjugation, could become more prevalent in nonsocomial isolates. Images PMID:3729338

  20. pLS101 plasmid vector


    Lacks, S.A.; Balganesh, T.S.


    Disclosed is recombinant plasmid pLS101, consisting essentially of a 2.0 Kb ma1M gene fragment ligated to a 4.4 Kb Tcr DNA fragment, which is particularly useful for transforming Gram-positive bacteria. This plasmid contains at least four restriction sites suitable for inserting exogeneous gene sequences. Also disclosed is a method for plasmid isolation by penicillin selection, as well as processes for enrichment of recombinant plasmids in Gram-positive bacterial systems. 5 figs., 2 tabs.

  1. pLS010 plasmid vector

    SciTech Connect

    Lacks, Sanford A.; Balganesh, Tanjore S.


    Disclosed is recombinant plasmid pLS101, consisting essentially of a 2.0 Kb malM gene fragment ligated to a 4.4 Kb T.sub.c r DNA fragment, which is particularly useful for transforming Gram-positive bacteria. This plasmid contains at least four restriction sites suitable for inserting exogeneous gene sequences. Also disclosed is a method for plasmid isolation by penicillin selection, as well as processes for enrichment of recombinant plasmids in Gram-positive bacterial systems.

  2. Persistence of Antibiotic Resistance Plasmids in Biofilms

    DTIC Science & Technology


    model  broad-­‐host-­‐range  MDR  plasmids  pRGM1  and... model   plasmids,   the   IncU   plasmid   pRGM1   and   the   IncP-­‐1   plasmid   pB10,   with   mini-­‐Tn5-­‐PA1-­‐ 04/03...we  have  focused  on  this   strain   as   our   main   model   host   (from   here   on   often  

  3. Plasmid transfer systems in the rhizobia.


    Ding, Hao; Hynes, Michael F


    Rhizobia are agriculturally important bacteria that can form nitrogen-fixing nodules on the roots of leguminous plants. Agricultural application of rhizobial inoculants can play an important role in increasing leguminous crop yields. In temperate rhizobia, genes involved in nodulation and nitrogen fixation are usually located on one or more large plasmids (pSyms) or on symbiotic islands. In addition, other large plasmids of rhizobia carry genes that are beneficial for survival and competition of rhizobia in the rhizosphere. Conjugative transfer of these large plasmids thus plays an important role in the evolution of rhizobia. Therefore, understanding the mechanism of conjugative transfer of large rhizobial plasmids provides foundations for maintaining, monitoring, and predicting the behaviour of these plasmids during field release events. In this minireview, we summarize two types of known rhizobial conjugative plasmids, including quorum sensing regulated plasmids and RctA-repressed plasmids. We provide evidence for the existence of a third type of conjugative plasmid, including pRleVF39c in Rhizobium leguminosarum bv. viciae strain VF39SM, and we provide a comparison of the different types of conjugation genes found in members of the rhizobia that have had their genomes sequenced so far.

  4. Ototoxic destruction by co-administration of kanamycin and ethacrynic acid in rats.


    Liu, Hong; Ding, Da-lian; Jiang, Hai-yan; Wu, Xue-wen; Salvi, Richard; Sun, Hong


    It is well known that ethacrynic acid (EA) can potentiate the ototoxicity of aminoglycoside antibiotics (AmAn) such as kanamycin (KM), if they were applied at the same time. Currently, to create the model of EA-KM-induced cochlear lesion in rats, adult rats received a single injection of EA (75 mg/kg, intravenous injection), or followed immediately by KM (500 mg/kg, intramuscular injection). The hearing function was assessed by auditory brainstem response (ABR) measurement in response to click and/or tone bursts at 4, 8, 12, 16, 20, 24, and 32 kHz. The static microcirculation status in the stria vascularis after a single EA injection was evaluated with eosin staining. The pathological changes in cochlear and vestibular hair cells were also quantified after co-administration of EA and KM. After a single EA injection, blood flow in vessels supplying the stria vascularis rapidly diminished. However, the blood supply to the cochlear lateral wall partially recovered 5 h after EA treatment. Threshold changes in ABR were basically parallel to the microcirculation changes in stria vascularis after single EA treatment. Importantly, disposable co-administration of EA and KM resulted in a permanent hearing loss and severe damage to the cochlear hair cells, but spared the vestibular hair cells. Since the cochlear lateral wall is the important part of the blood-cochlea barrier, EA-induced anoxic damage to the epithelium of stria vascularis may enhance the entry of KM to the cochlea. Thus, experimental animal model of selective cochlear damage with normal vestibular systems can be reliably created through co-administration of EA and KM.

  5. Conference Resolution

    NASA Astrophysics Data System (ADS)


    Since the first IUPAP International Conference on Women in Physics (Paris, March 2002) and the Second Conference (Rio de Janeiro, May 2005), progress has continued in most countries and world regions to attract girls to physics and advance women into leadership roles, and many working groups have formed. The Third Conference (Seoul, October 2008), with 283 attendees from 57 countries, was dedicated to celebrating the physics achievements of women throughout the world, networking toward new international collaborations, building each participant's capacity for career success, and aiding the formation of active regional working groups to advance women in physics. Despite the progress, women remain a small minority of the physics community in most countries.

  6. Enhancement of bacterial competitive fitness by apramycin resistance plasmids from non-pathogenic Escherichia coli.


    Yates, C M; Shaw, D J; Roe, A J; Woolhouse, M E J; Amyes, S G B


    The study of antibiotic resistance has in the past focused on organisms that are pathogenic to humans or animals. However, the development of resistance in commensal organisms is of concern because of possible transfer of resistance genes to zoonotic pathogens. Conjugative plasmids are genetic elements capable of such transfer and are traditionally thought to engender a fitness burden on host bacteria. In this study, conjugative apramycin resistance plasmids isolated from newborn calves were characterized. Calves were raised on a farm that had not used apramycin or related aminoglycoside antibiotics for at least 20 months prior to sampling. Of three apramycin resistance plasmids, one was capable of transfer at very high rates and two were found to confer fitness advantages on new Escherichia coli hosts. This is the first identification of natural plasmids isolated from commensal organisms that are able to confer a fitness advantage on a new host. This work indicates that reservoirs of antibiotic resistance genes in commensal organisms might not decrease if antibiotic usage is halted.

  7. The aminoglycoside antibiotic kanamycin damages DNA bases in Escherichia coli: caffeine potentiates the DNA-damaging effects of kanamycin while suppressing cell killing by ciprofloxacin in Escherichia coli and Bacillus anthracis.


    Kang, Tina Manzhu; Yuan, Jessica; Nguyen, Angelyn; Becket, Elinne; Yang, Hanjing; Miller, Jeffrey H


    The distribution of mutants in the Keio collection of Escherichia coli gene knockout mutants that display increased sensitivity to the aminoglycosides kanamycin and neomycin indicates that damaged bases resulting from antibiotic action can lead to cell death. Strains lacking one of a number of glycosylases (e.g., AlkA, YzaB, Ogt, KsgA) or other specific repair proteins (AlkB, PhrB, SmbC) are more sensitive to these antibiotics. Mutants lacking AlkB display the strongest sensitivity among the glycosylase- or direct lesion removal-deficient strains. This perhaps suggests the involvement of ethenoadenine adducts, resulting from reactive oxygen species and lipid peroxidation, since AlkB removes this lesion. Other sensitivities displayed by mutants lacking UvrA, polymerase V (Pol V), or components of double-strand break repair indicate that kanamycin results in damaged base pairs that need to be removed or replicated past in order to avoid double-strand breaks that saturate the cellular repair capacity. Caffeine enhances the sensitivities of these repair-deficient strains to kanamycin and neomycin. The gene knockout mutants that display increased sensitivity to caffeine (dnaQ, holC, holD, and priA knockout mutants) indicate that caffeine blocks DNA replication, ultimately leading to double-strand breaks that require recombinational repair by functions encoded by recA, recB, and recC, among others. Additionally, caffeine partially protects cells of both Escherichia coli and Bacillus anthracis from killing by the widely used fluoroquinolone antibiotic ciprofloxacin.

  8. Large-scale preparation of plasmid DNA.


    Heilig, J S; Elbing, K L; Brent, R


    Although the need for large quantities of plasmid DNA has diminished as techniques for manipulating small quantities of DNA have improved, occasionally large amounts of high-quality plasmid DNA are desired. This unit describes the preparation of milligram quantities of highly purified plasmid DNA. The first part of the unit describes three methods for preparing crude lysates enriched in plasmid DNA from bacterial cells grown in liquid culture: alkaline lysis, boiling, and Triton lysis. The second part describes four methods for purifying plasmid DNA in such lysates away from contaminating RNA and protein: CsCl/ethidium bromide density gradient centrifugation, polyethylene glycol (PEG) precipitation, anion-exchange chromatography, and size-exclusion chromatography.

  9. The ABCs of plasmid replication and segregation.


    Pinto, Uelinton M; Pappas, Katherine M; Winans, Stephen C


    To ensure faithful transmission of low-copy plasmids to daughter cells, these plasmids must replicate once per cell cycle and distribute the replicated DNA to the nascent daughter cells. RepABC family plasmids are found exclusively in alphaproteobacteria and carry a combined replication and partitioning locus, the repABC cassette, which is also found on secondary chromosomes in this group. RepC and a replication origin are essential for plasmid replication, and RepA, RepB and the partitioning sites distribute the replicons to predivisional cells. Here, we review our current understanding of the transcriptional and post-transcriptional regulation of the Rep proteins and of their functions in plasmid replication and partitioning.

  10. Identification of regions essential for extrachromosomal replication and maintenance of an endogenous plasmid in Dictyostelium.

    PubMed Central

    Ahern, K G; Howard, P K; Firtel, R A


    Initial experiments with the endogenous 12.3 kb Dictyostelium discoideum plasmid Ddp1 led to the generation of a large shuttle vector, Ddp1-20. In addition to Ddp1, this vector contains pBR322 and a gene fusion that confers G418 resistance in Dictyostelium cells. We have shown that Ddp1-20 replicates extrachromosomally in Dictyostelium cells and can be grown in Escherichia coli cells (1). We have now examined deletions within this vector to identify the elements essential for extrachromosomal replication and stable maintenance of the plasmid. We find that a 2.2 kb fragment is sufficient to confer stable, extrachromosomal replication with a reduction in copy number from about 40 to approximately 10-15 copies per cell. Vectors containing additional Ddp1 sequences have a higher copy number. The 2.2 kb region contains none of the complete, previously identified transcription units on Ddp1 expressed during vegetative growth or development. These results suggest that gene products expressed by Ddp1 are not essential for replication, stability, or partitioning of the plasmid between daughter cells. Vectors carrying only the 2.2 kb fragment plus the gene fusion conferring G418 resistance transform Dictyostelium cells with high efficiency using either calcium phosphate mediated transformation or electroporation. Finally, we have examined the relative levels of expression of actin promoters driving neoR genes when in extrachromosomal or integrating vectors. Images PMID:3405751

  11. Combined administration of kanamycin and furosemide does not result in loss of vestibular function in Guinea pigs.


    Bremer, Hendrik G; de Groot, John C M J; Versnel, Huib; Klis, Sjaak F L


    Aminoglycoside antibiotics are known to damage the vestibular and auditory sensory epithelia. Although loop diuretics enhance the cochleotoxic effect of aminoglycosides, it is not known whether concomitant administration of an aminoglycoside and a loop diuretic affects the vestibular system. The aim of our study was to investigate the effect of co-administration of kanamycin and furosemide upon the otolith organs and to compare it to the known vestibulotoxic effect of gentamicin. Five guinea pigs were injected with a single dose of both kanamycin (400 mg/kg, s.c.) and furosemide (100 mg/kg, i.v.), 5 animals received gentamicin (100 mg/kg, i.p.) for 10 days, and 5 untreated animals served as controls. After 7 days, vestibular function was assessed by measuring vestibular short-latency evoked potentials (VsEPs) to linear acceleration stimuli and cochlear function by auditory brainstem responses (ABRs) to clicks. Hair cell densities were determined in phalloidin-stained whole mounts of the utricles and saccules, and in midmodiolar sections of resin-embedded cochleae. Co-administration of kanamycin and furosemide had no significant effect on VsEPs and hair cell densities in the utricles and saccules were not reduced. ABR thresholds were increased to a great extent (by ∼60 dB), and histologically a severe loss of cochlear hair cells was observed. The effect of gentamicin, both on vestibular and cochlear function, was just the opposite. VsEP thresholds to horizontal stimulation were elevated and suprathreshold amplitudes showed a decrease, whereas cochlear function was not reduced. With this protocol, we have a tool to selectively induce cochlear or vestibular damage, which may be of interest to researchers and clinicians alike.

  12. Plasmid Conjugation from Proteobacteria as Evidence for the Origin of Xenologous Genes in Cyanobacteria

    PubMed Central

    Encinas, David; Garcillán-Barcia, M. Pilar; Santos-Merino, María; Delaye, Luis; Moya, Andrés


    Comparative genomics have shown that 5% of Synechococcus elongatus PCC 7942 genes are of probable proteobacterial origin. To investigate the role of interphylum conjugation in cyanobacterial gene acquisition, we tested the ability of a set of prototype proteobacterial conjugative plasmids (RP4, pKM101, R388, R64, and F) to transfer DNA from Escherichia coli to S. elongatus. A series of BioBrick-compatible, mobilizable shuttle vectors was developed. These vectors were based on the putative origin of replication of the Synechococcus resident plasmid pANL. Not only broad-host-range plasmids, such as RP4 and R388, but also narrower-host-range plasmids, such as pKM101, all encoding MPFT-type IV secretion systems, were able to transfer plasmid DNA from E. coli to S. elongatus by conjugation. Neither MPFF nor MPFI could be used as interphylum DNA delivery agents. Reciprocally, pANL-derived cointegrates could be introduced in E. coli by electroporation, where they conferred a functional phenotype. These results suggest the existence of potentially ample channels of gene flow between proteobacteria and cyanobacteria and point to MPFT-based interphylum conjugation as a potential mechanism to explain the proteobacterial origin of a majority of S. elongatus xenologous genes. PMID:24509315

  13. Autonomously replicating plasmids carrying the AMA1 region in Penicillium chrysogenum.


    Fierro, F; Kosalková, K; Gutiérrez, S; Martin, J F


    Plasmid vectors containing the AMA1 sequence transformed with high efficiency and replicated autonomously in Penicillium chrysogenum. The efficiency of transformation of P. chrysogenum was related to the length of the AMA1 fragment used for constructing the different autonomously replicating plasmids. One of the two palindromic inverted repeats of AMA1 (the 2.2-kb SalI-HindIII fragment) is sufficient to confer autonomous replication and a high transformation efficiency. Deletion of the 0.6-kb central fragment located between the inverted repeats did not affect either the ability of the plasmids to replicate autonomously or the efficiency of transformation, but did alter the mitotic stability and the plasmid copy number. Deletion of any fragment of the 2.2-kb repeat caused the loss of the ability to replicate autonomously and reduced the transformation efficiency. Most of the transformants retained the original plasmid configuration, as multimers and without reorganization, after several rounds of autonomous replication. The AMA1 region works as an origin of replication in P. chrysogenum and A. nidulans but not apparently in Acremonium chrysogenum.

  14. Decreased Immunoreactivities of the Chloride Transporters, KCC2 and NKCC1, in the Lateral Superior Olive Neurons of Kanamycin-treated Rats

    PubMed Central

    Suh, Myung-Whan


    Objectives From our previous study about the weak expressions of potassium-chloride (KCC2) and sodium-potassium-2 chloride (NKCC1) co-transporters in the lateral superior olive (LSO) in circling mice, we hypothesized that partially damaged cochlea of circling mice might be a cause of the weak expressions of KCC2 or NKCC1. To test this possibility, we reproduced the altered expressions of KCC2 and NKCC1 in the LSO of rats, whose cochleae were partially destroyed with kanamycin. Methods Rat pups were treated with kanamycin from postnatal (P)3 to P8 (700 mg/kg, subcutaneous injection, twice a day) and sacrificed for immunohistochemical analysis, scanning electron microscope (SEM) and auditory brain stem response. Results The SEM study revealed partially missing hair cells in P9 rats treated with kanamycin, and the hearing threshold was elevated to 63.8±2.5 dB SPL (4 ears) at P16. Both KCC2 and NKCC1 immunoreactivities were more prominent in control rats on P16. On 9 paired slices, the mean densities of NKCC1 immunoreactivities were 118.0±1.0 (control) and 112.2±1.2 (kanamycin treated), whereas those of KCC2 were 115.7±1.5 (control) and 112.0±0.8 (kanamycin treated). Conclusion We concluded that weak expressions of KCC2 and NKCC1 in circling mice were due to partial destruction of cochleae. PMID:22977707

  15. Improved methods in Agrobacterium-mediated transformation of almond using positive (mannose/pmi) or negative (kanamycin resistance) selection-based protocols.


    Ramesh, Sunita A; Kaiser, Brent N; Franks, Tricia; Collins, Graham; Sedgley, Margaret


    A protocol for Agrobacterium-mediated transformation with either kanamycin or mannose selection was developed for leaf explants of the cultivar Prunus dulcis cv. Ne Plus Ultra. Regenerating shoots were selected on medium containing 15 muM kanamycin (negative selection), while in the positive selection strategy, shoots were selected on 2.5 g/l mannose supplemented with 15 g/l sucrose. Transformation efficiencies based on PCR analysis of individual putative transformed shoots from independent lines relative to the initial numbers of leaf explants tested were 5.6% for kanamycin/nptII and 6.8% for mannose/pmi selection, respectively. Southern blot analysis on six randomly chosen PCR-positive shoots confirmed the presence of the nptII transgene in each, and five randomly chosen lines identified to contain the pmi transgene by PCR showed positive hybridisation to a pmi DNA probe. The positive (mannose/pmi) and the negative (kanamycin) selection protocols used in this study have greatly improved transformation efficiency in almond, which were confirmed with PCR and Southern blot. This study also demonstrates that in almond the mannose/pmi selection protocol is appropriate and can result in higher transformation efficiencies over that of kanamycin/nptII selection protocols.

  16. Synergy with rifampin and kanamycin enhances potency, kill kinetics, and selectivity of de novo-designed antimicrobial peptides.


    Anantharaman, Aparna; Rizvi, Meryam Sardar; Sahal, Dinkar


    By choosing membranes as targets of action, antibacterial peptides offer the promise of providing antibiotics to which bacteria would not become resistant. However, there is a need to increase their potency against bacteria along with achieving a reduction in toxicity to host cells. Here, we report that three de novo-designed antibacterial peptides (DeltaFm, DeltaFmscr, and Ud) with poor to moderate antibacterial potencies and kill kinetics improved significantly in all of these aspects when synergized with rifampin and kanamycin against Escherichia coli. (DeltaFm and DeltaFmscr [a scrambled-sequence version of DeltaFm] are isomeric, monomeric decapeptides containing the nonproteinogenic amino acid alpha,beta-didehydrophenylalanine [DeltaF] in their sequences. Ud is a lysine-branched dimeric peptide containing the helicogenic amino acid alpha-aminoisobutyric acid [Aib].) In synergy with rifampin, the MIC of DeltaFmscr showed a 34-fold decrease (67.9 microg/ml alone, compared to 2 microg/ml in combination). A 20-fold improvement in the minimum bactericidal concentration of Ud was observed when the peptide was used in combination with rifampin (369.9 microg/ml alone, compared to 18.5 microg/ml in combination). Synergy with kanamycin resulted in an enhancement in kill kinetics for DeltaFmscr (no killing until 60 min for DeltaFmscr alone, versus 50% and 90% killing within 20 min and 60 min, respectively, in combination with kanamycin). Combination of the dendrimeric peptide DeltaFq (a K-K2 dendrimer for which the sequence of DeltaFm constitutes each of the four branches) (MIC, 21.3 microg/ml) with kanamycin (MIC, 2.1 microg/ml) not only lowered the MIC of each by 4-fold but also improved the therapeutic potential of this highly hemolytic (37% hemolysis alone, compared to 4% hemolysis in combination) and cytotoxic (70% toxicity at 10x MIC alone, versus 30% toxicity in combination) peptide. Thus, synergy between peptide and nonpeptide antibiotics has the potential to

  17. Swapping single-stranded DNA sequence specificities of relaxases from conjugative plasmids F and R100

    PubMed Central

    Harley, Matthew J.; Schildbach, Joel F.


    Conjugative plasmid transfer is an important mechanism for diversifying prokaryotic genomes and disseminating antibiotic resistance. Relaxases are conjugative plasmid-encoded proteins essential for plasmid transfer. Relaxases bind and cleave one plasmid strand site- and sequence-specifically before transfer of the cleaved strand. TraI36, a domain of F plasmid TraI that contains relaxase activity, binds a plasmid sequence in single-stranded form with subnanomolar KD and high sequence specificity. Despite 91% amino acid sequence identity, TraI36 domains from plasmids F and R100 discriminate between binding sites. The binding sites differ by 2 of 11 bases, but both proteins bind their cognate site with three orders of magnitude higher affinity than the other site. To identify specificity determinants, we generated variants having R100 amino acids in the F TraI36 background. Although most retain F specificity, the Q193R/R201Q variant binds the R100 site with 10-fold greater affinity than the F site. The reverse switch (R193Q/Q201R) in R100 TraI36 confers a wild-type F specificity on the variant. Nonadditivity of individual amino acid and base contributions to recognition suggests that the specificity difference derives from multiple interactions. The F TraI36 crystal structure shows positions 193 and 201 form opposite sides of a pocket within the binding cleft, suggesting binding involves knob-into-hole interactions. Specificity is presumably modulated by altering the composition of the pocket. Our results demonstrate that F-like relaxases can switch between highly sequence-specific recognition of different sequences with minimal amino acid substitution. PMID:14504391

  18. The immunogenicity of viral haemorragic septicaemia rhabdovirus (VHSV) DNA vaccines can depend on plasmid regulatory sequences.


    Chico, V; Ortega-Villaizan, M; Falco, A; Tafalla, C; Perez, L; Coll, J M; Estepa, A


    A plasmid DNA encoding the viral hemorrhagic septicaemia virus (VHSV)-G glycoprotein under the control of 5' sequences (enhancer/promoter sequence plus both non-coding 1st exon and 1st intron sequences) from carp beta-actin gene (pAE6-G(VHSV)) was compared to the vaccine plasmid usually described the gene expression is regulated by the human cytomegalovirus (CMV) immediate-early promoter (pMCV1.4-G(VHSV)). We observed that these two plasmids produced a markedly different profile in the level and time of expression of the encoded-antigen, and this may have a direct effect upon the intensity and suitability of the in vivo immune response. Thus, fish genetic immunisation assays were carried out to study the immune response of both plasmids. A significantly enhanced specific-antibody response against the viral glycoprotein was found in the fish immunised with pAE6-G(VHSV). However, the protective efficacy against VHSV challenge conferred by both plasmids was similar. Later analysis of the transcription profile of a set of representative immune-related genes in the DNA immunized fish suggested that depending on the plasmid-related regulatory sequences controlling its expression, the plasmid might activate distinct patterns of the immune system. All together, the results from this study mainly point out that the selection of a determinate encoded-antigen/vector combination for genetic immunisation is of extraordinary importance in designing optimised DNA vaccines that, when required for inducing protective immune response, could elicit responses biased to antigen-specific antibodies or cytotoxic T cells generation.

  19. PemK toxin encoded by the Xylella fastidiosa IncP-1 plasmid pXF-RIV11 is a ribonuclease

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Stable inheritance of the IncP-1 plasmid pXF-RIV11 in Xylella fastidiosa is conferred by the pemI/pemK plasmid addiction system. PemK serves as a toxin inhibiting bacterial growth; PemI is the corresponding antitoxin that blocks activity of PemK toxin by direct binding. Here, PemK toxin and PemI ant...

  20. Complete Nucleotide Sequence of pGA45, a 140,698-bp IncFIIY Plasmid Encoding blaIMI-3-Mediated Carbapenem Resistance, from River Sediment

    PubMed Central

    Dang, Bingjun; Mao, Daqing; Luo, Yi


    Plasmid pGA45 was isolated from the sediments of Haihe River using Escherichia coli CV601 (gfp-tagged) as recipients and indigenous bacteria from sediment as donors. This plasmid confers reduced susceptibility to imipenem which belongs to carbapenem group. Plasmid pGA45 was fully sequenced on an Illumina HiSeq 2000 sequencing system. The complete sequence of plasmid pGA45 was 140,698 bp in length with an average G + C content of 52.03%. Sequence analysis shows that pGA45 belongs to IncFIIY group and harbors a backbone region which shares high homology and gene synteny to several other IncF plasmids including pNDM1_EC14653, pYDC644, pNDM-Ec1GN574, pRJF866, pKOX_NDM1, and pP10164-NDM. In addition to the backbone region, plasmid pGA45 harbors two notable features including one blaIMI-3-containing region and one type VI secretion system region. The blaIMI-3-containing region is responsible for bacteria carbapenem resistance and the type VI secretion system region is probably involved in bacteria virulence, respectively. Plasmid pGA45 represents the first complete nucleotide sequence of the blaIMI-harboring plasmid from environment sample and the sequencing of this plasmid provided insight into the architecture used for the dissemination of blaIMI carbapenemase genes. PMID:26941718

  1. Complete Nucleotide Sequence of IncP-1β Plasmid pDTC28 Reveals a Non-Functional Variant of the blaGES-Type Gene

    PubMed Central

    Dang, Bingjun; Mao, Daqing; Luo, Yi


    Plasmid pDTC28 was isolated from the sediments of Haihe River using E. coli CV601 (gfp-tagged) as recipient and indigenous bacteria from the sediment as donors. This plasmid confers reduced susceptibility to tetracycline and sulfamethoxazole. The complete sequence of plasmid pDTC28 was 61,503 bp in length with an average G+C content of 64.09%. Plasmid pDTC28 belongs to the IncP-1β group by phylogenetic analysis. The backbones of plasmid pDTC28 and other IncP-1β plasmids are very classical and conserved, whereas the accessory regions of these plasmids are diverse. A blaGES-5-like gene was found on the accessory region, and this blaGES-5-like gene contained 18 silent mutations and 7 missense mutations compared with the blaGES-5 gene. The mutations resulted in 7 amino acid substitutions in GES-5 carbapenemase, causing the loss of function of the blaGES-5-like gene on plasmid pDTC28 against carbapenems and even β-lactams. The enzyme produced by the blaGES-5-like gene cassette may be a new variant of GES-type enzymes. Thus, the plasmid sequenced in this study will expand our understanding of GES-type β-lactamases and provide insights into the genetic platforms used for the dissemination of GES-type genes. PMID:27152950

  2. Rolling-circle replication of bacterial plasmids.

    PubMed Central

    Khan, S A


    Many bacterial plasmids replicate by a rolling-circle (RC) mechanism. Their replication properties have many similarities to as well as significant differences from those of single-stranded DNA (ssDNA) coliphages, which also replicate by an RC mechanism. Studies on a large number of RC plasmids have revealed that they fall into several families based on homology in their initiator proteins and leading-strand origins. The leading-strand origins contain distinct sequences that are required for binding and nicking by the Rep proteins. Leading-strand origins also contain domains that are required for the initiation and termination of replication. RC plasmids generate ssDNA intermediates during replication, since their lagging-strand synthesis does not usually initiate until the leading strand has been almost fully synthesized. The leading- and lagging-strand origins are distinct, and the displaced leading-strand DNA is converted to the double-stranded form by using solely the host proteins. The Rep proteins encoded by RC plasmids contain specific domains that are involved in their origin binding and nicking activities. The replication and copy number of RC plasmids, in general, are regulated at the level of synthesis of their Rep proteins, which are usually rate limiting for replication. Some RC Rep proteins are known to be inactivated after supporting one round of replication. A number of in vitro replication systems have been developed for RC plasmids and have provided insight into the mechanism of plasmid RC replication. PMID:9409148

  3. Evaluating metabolic stress and plasmid stability in plasmid DNA production by Escherichia coli.


    Silva, Filomena; Queiroz, João A; Domingues, Fernanda C


    In the context of recombinant DNA technology, the development of feasible and high-yielding plasmid DNA production processes has regained attention as more evidence for its efficacy as vectors for gene therapy and DNA vaccination arise. When producing plasmid DNA in Escherichia coli, a number of biological restraints, triggered by plasmid maintenance and replication as well as culture conditions are responsible for limiting final biomass and product yields. This termed "metabolic burden" can also cause detrimental effects on plasmid stability and quality, since the cell machinery is no longer capable of maintaining an active metabolism towards plasmid synthesis and the stress responses elicited by plasmid maintenance can also cause increased plasmid instability. The optimization of plasmid DNA production bioprocesses is still hindered by the lack of information on the host metabolic responses as well as information on plasmid instability. Therefore, systematic and on-line approaches are required not only to characterise this "metabolic burden" and plasmid stability but also for the design of appropriate metabolic engineering and culture strategies. The monitoring tools described to date rapidly evolve from laborious, off-line and at-line monitoring to online monitoring, at a time-scale that enables researchers to solve these bioprocessing problems as they occur. This review highlights major E. coli biological alterations caused by plasmid maintenance and replication, possible causes for plasmid instability and discusses the ability of currently employed bioprocess monitoring techniques to provide information in order to circumvent metabolic burden and plasmid instability, pointing out the possible evolution of these methods towards online bioprocess monitoring.

  4. A kanamycin sensor based on an electrosynthesized molecularly imprinted poly-o-phenylenediamine film on a single-walled carbon nanohorn modified glassy carbon electrode.


    Han, Shuang; Li, Bingqian; Song, Ze; Pan, Sihao; Zhang, Zhichao; Yao, Hui; Zhu, Shuyun; Xu, Guobao


    A single-walled carbon nanohorn (SWCNH) has been used to construct a molecularly imprinted electrochemical sensor for the first time. Kanamycin, a widely used aminoglycoside antibiotic, is used as a representative analyte to test the detection strategy. The kanamycin sensor was constructed by the electropolymerization of a molecularly imprinted poly-o-phenylenediamine film on a SWCNH modified glassy carbon electrode. The sensor was investigated in the presence or absence of kanamycin by cyclic voltammetry to verify the changes in the redox peak currents of K3Fe(CN)6. The sensor exhibits a linear range of 0.1-50 μM with a detection limit of 0.1 μM. It also shows high recognition ability, indicating that the SWCNH-based molecularly imprinted sensor is promising.

  5. Comparative genomics of multidrug resistance-encoding IncA/C plasmids from commensal and pathogenic Escherichia coli from multiple animal sources.


    Fernández-Alarcón, Claudia; Singer, Randall S; Johnson, Timothy J


    Incompatibility group A/C (IncA/C) plasmids have received recent attention for their broad host range and ability to confer resistance to multiple antimicrobial agents. Due to the potential spread of multidrug resistance (MDR) phenotypes from foodborne pathogens to human pathogens, the dissemination of these plasmids represents a public health risk. In this study, four animal-source IncA/C plasmids isolated from Escherichia coli were sequenced and analyzed, including isolates from commercial dairy cows, pigs and turkeys in the U.S. and Chile. These plasmids were initially selected because they either contained the floR and tetA genes encoding for florfenicol and tetracycline resistance, respectively, and/or the bla(CMY-2) gene encoding for extended spectrum β-lactamase resistance. Overall, sequence analysis revealed that each of the four plasmids retained a remarkably stable and conserved backbone sequence, with differences observed primarily within their accessory regions, which presumably have evolved via horizontal gene transfer events involving multiple modules. Comparison of these plasmids with other available IncA/C plasmid sequences further defined the core and accessory elements of these plasmids in E. coli and Salmonella. Our results suggest that the bla(CMY-2) plasmid lineage appears to have derived from an ancestral IncA/C plasmid type harboring floR-tetAR-strAB and Tn21-like accessory modules. Evidence is mounting that IncA/C plasmids are widespread among enteric bacteria of production animals and these emergent plasmids have flexibility in their acquisition of MDR-encoding modules, necessitating further study to understand the evolutionary mechanisms involved in their dissemination and stability in bacterial populations.

  6. Choosing and using Schizosaccharomyces pombe plasmids.


    Siam, Rania; Dolan, William P; Forsburg, Susan L


    A wide range of plasmids has been developed for molecular studies in the fission yeast Schizosaccharomyces pombe. This includes general purpose episomes, expression vectors, epitope tagging plasmids, and integration vectors. This review describes the typical features of S. pombe vectors, including replication origins, positive and negative selection markers, and constitutive and inducible promoter systems. We will also discuss vectors with epitope tags and how these can be used to modify episomal or endogenous gene sequences. Considerations for choosing and using a plasmid are presented and specialized methods are described.

  7. Processing of Nonconjugative Resistance Plasmids by Conjugation Nicking Enzyme of Staphylococci

    SciTech Connect

    Pollet, Rebecca M.; Ingle, James D.; Hymes, Jeff P.; Eakes, Thomas C.; Eto, Karina Yui; Kwong, Stephen M.; Ramsay, Joshua P.; Firth, Neville; Redinbo, Matthew R.; Christie, P. J.


    Antimicrobial resistance inStaphylococcus aureuspresents an increasing threat to human health. This resistance is often encoded on mobile plasmids, such as pSK41; however, the mechanism of transfer of these plasmids is not well understood. In this study, we first examine key protein-DNA interactions formed by the relaxase enzyme, NES, which initiates and terminates the transfer of the multidrug resistance plasmid pSK41. Two loops on the NES protein, hairpin loops 1 and 2, form extensive contacts with the DNA hairpin formed at theoriTregion of pSK41, and here we establish that these contacts are essential for proper DNA cleavage and religation by the full 665-residue NES proteinin vitro. Second, pSK156 and pCA347 are nonconjugativeStaphylococcus aureusplasmids that contain sequences similar to theoriTregion of pSK41 but differ in the sequence predicted to form a DNA hairpin. We show that pSK41-encoded NES is able to bind, cleave, and religate theoriTsequences of these nonconjugative plasmidsin vitro. Although pSK41 could mobilize a coresident plasmid harboring its cognateoriT, it was unable to mobilize plasmids containing the pSK156 and pCA347 variantoriTmimics, suggesting that an accessory protein like that previously shown to confer specificity in the pWBG749 system may also be involved in transmission of plasmids containing a pSK41-likeoriT. These data indicate that the conjugative relaxase intransmechanism recently described for the pWBG749 family of plasmids also applies to the pSK41 family of plasmids, further heightening the potential significance of this mechanism in the horizontal transfer of staphylococcal plasmids.

    IMPORTANCEUnderstanding the mechanism of

  8. Characterization of a transferable bcrABC and cadAC genes-harboring plasmid in Listeria monocytogenes strain isolated from food products of animal origin.


    Xu, Dongyang; Nie, Qing; Wang, Wenyan; Shi, Lei; Yan, He


    In this study, we characterized a bcrABC cassette and its genetic environment harbored by a plasmid in Listeria monocytogenes (L. monocytogenes) 11GZL18, a strain isolated from raw meat in 2011. The bcrABC cassette and its genetic environment were characterized, with a total of 33,727 nt nucleotide sequence obtained. The nucleotide sequences of the bcrABC cassette in strain 11GZL18 exhibited 100% identity to that on plasmid pLM80, which is harbored by L. monocytogenes strain H7550 and H7858, and the neighboring 21,678 nt nucleotide sequence of bcrABC cassette showed 99% identity with plasmid pLM80. The plasmid curing experiment demonstrated the role of the plasmid in conferring benzalkonium chloride (BC) and cadmium (Cd) tolerance in this strain. The bcrABC cassette and cadAC genes from the L. monocytogenes 11GZL18 were harbored by plasmid, functional and transmissible, and led to the acquired tolerance in Gram-negative Escherichia coli (E. coli) DH5α by chemical and natural transformation. Besides, the efflux pump activity that is conferring tolerance to BC and Cd was observed in strain 11GZL18, while not in a plasmid-cured strain 11GZL18-C, confirming that efflux pumps play a role in plasmid-mediated tolerance to BC and Cd in L. monocytogenes 11GZL18. In this study we characterized the genetic organization of a novel BC and Cd tolerance determinants-harboring plasmid in a L. monocytogenes strain isolated from raw meat of animal origin, and demonstrated the potential horizontal transferability of this bcrABC cassette-harboring plasmid to E. coli. The findings will further improve our understanding of the adaptations of this organism to disinfectants such as BC and may contribute to elucidating possible dissemination of BC tolerance in foodborne L. monocytogenes.

  9. Crystallization and preliminary X-ray diffraction analysis of kanamycin-binding β-lactamase in complex with its ligand.


    Van de Water, Karen; Soror, Sameh H; Wohlkonig, Alexandre; van Nuland, Nico A J; Volkov, Alexander N


    TEM-1 β-lactamase is a highly efficient enzyme that is involved in bacterial resistance against β-lactam antibiotics such as penicillin. It is also a robust scaffold protein which can be engineered by molecular-evolution techniques to bind a variety of targets. One such β-lactamase variant (BlaKr) has been constructed to bind kanamycin (kan) and other aminoglycoside antibiotics, which are neither substrates nor ligands of native β-lactamases. In addition to recognizing kan, BlaKr activity is up-regulated by its binding via an activation mechanism which is not yet understood at the molecular level. In order to fill this gap, determination of the structure of the BlaKr-kan complex was embarked upon. A crystallization condition for BlaKr-kan was identified using high-throughput screening, and crystal growth was further optimized using streak-seeding and hanging-drop methods. The crystals belonged to the orthorhombic space group P2(1)2(1)2(1), with unit-cell parameters a = 47.01, b = 72.33, c = 74.62 Å, and diffracted to 1.67 Å resolution using synchrotron radiation. The X-ray structure of BlaKr with its ligand kanamycin should provide the molecular-level details necessary for understanding the activation mechanism of the engineered enzyme.

  10. Involvement of calpain-I and microRNA34 in kanamycin-induced apoptosis of inner ear cells.


    Yu, Li; Tang, Hao; Jiang, Xiao Hua; Tsang, Lai Ling; Chung, Yiu Wa; Chan, Hsiao Chang


    Inner ear cells, including hair cells, spiral ganglion cells, stria vascularis cells and supporting cells on the basilar membrane, play a major role in transducing hearing signals and regulating inner ear homoeostasis. However, their functions are often damaged by antibiotic-induced ototoxicity. Apoptosis is probably involved in inner ear cell injury following aminoglycoside treatment. Calpain, a calcium-dependent protease, is essential for mediating and promoting cell death. We have therefore investigated the involvement of calpain in the molecular mechanism underlying ototoxicity induced by the antibiotic kanamycin in mice. Kanamycin (750 mg/kg) mainly induced cell death of cochlear cells, including stria vascularis cells, supporting cells and spiral ganglion cells, but not hair cells within the organ of Corti. Cell death due to apoptosis occurred in a time-dependent manner with concomitant up-regulation of calpain expression. Furthermore, the expression levels of two microRNAs, mir34a and mir34c, were altered in a dose-dependent manner in cochlear cells. These novel findings demonstrated the involvement of both calpain and microRNAs in antibiotic-induced ototoxicity.

  11. Mechanisms Involved in Acquisition of blaNDM Genes by IncA/C2 and IncFIIY Plasmids

    PubMed Central

    Sidjabat, Hanna E.; Yam, Wan Keat; Alikhan, Nabil-Fareed; Petty, Nicola K.; Sartor, Anna L.; Williamson, Deborah A.; Forde, Brian M.; Beatson, Scott A.; Paterson, David L.; Walsh, Timothy R.


    blaNDM genes confer carbapenem resistance and have been identified on transferable plasmids belonging to different incompatibility (Inc) groups. Here we present the complete sequences of four plasmids carrying a blaNDM gene, pKP1-NDM-1, pEC2-NDM-3, pECL3-NDM-1, and pEC4-NDM-6, from four clinical samples originating from four different patients. Different plasmids carry segments that align to different parts of the blaNDM region found on Acinetobacter plasmids. pKP1-NDM-1 and pEC2-NDM-3, from Klebsiella pneumoniae and Escherichia coli, respectively, were identified as type 1 IncA/C2 plasmids with almost identical backbones. Different regions carrying blaNDM are inserted in different locations in the antibiotic resistance island known as ARI-A, and ISCR1 may have been involved in the acquisition of blaNDM-3 by pEC2-NDM-3. pECL3-NDM-1 and pEC4-NDM-6, from Enterobacter cloacae and E. coli, respectively, have similar IncFIIY backbones, but different regions carrying blaNDM are found in different locations. Tn3-derived inverted-repeat transposable elements (TIME) appear to have been involved in the acquisition of blaNDM-6 by pEC4-NDM-6 and the rmtC 16S rRNA methylase gene by IncFIIY plasmids. Characterization of these plasmids further demonstrates that even very closely related plasmids may have acquired blaNDM genes by different mechanisms. These findings also illustrate the complex relationships between antimicrobial resistance genes, transposable elements, and plasmids and provide insights into the possible routes for transmission of blaNDM genes among species of the Enterobacteriaceae family. PMID:27114281

  12. Mechanisms Involved in Acquisition of blaNDM Genes by IncA/C2 and IncFIIY Plasmids.


    Wailan, Alexander M; Sidjabat, Hanna E; Yam, Wan Keat; Alikhan, Nabil-Fareed; Petty, Nicola K; Sartor, Anna L; Williamson, Deborah A; Forde, Brian M; Schembri, Mark A; Beatson, Scott A; Paterson, David L; Walsh, Timothy R; Partridge, Sally R


    blaNDM genes confer carbapenem resistance and have been identified on transferable plasmids belonging to different incompatibility (Inc) groups. Here we present the complete sequences of four plasmids carrying a blaNDM gene, pKP1-NDM-1, pEC2-NDM-3, pECL3-NDM-1, and pEC4-NDM-6, from four clinical samples originating from four different patients. Different plasmids carry segments that align to different parts of the blaNDM region found on Acinetobacter plasmids. pKP1-NDM-1 and pEC2-NDM-3, from Klebsiella pneumoniae and Escherichia coli, respectively, were identified as type 1 IncA/C2 plasmids with almost identical backbones. Different regions carrying blaNDM are inserted in different locations in the antibiotic resistance island known as ARI-A, and ISCR1 may have been involved in the acquisition of blaNDM-3 by pEC2-NDM-3. pECL3-NDM-1 and pEC4-NDM-6, from Enterobacter cloacae and E. coli, respectively, have similar IncFIIY backbones, but different regions carrying blaNDM are found in different locations. Tn3-derived inverted-repeat transposable elements (TIME) appear to have been involved in the acquisition of blaNDM-6 by pEC4-NDM-6 and the rmtC 16S rRNA methylase gene by IncFIIY plasmids. Characterization of these plasmids further demonstrates that even very closely related plasmids may have acquired blaNDM genes by different mechanisms. These findings also illustrate the complex relationships between antimicrobial resistance genes, transposable elements, and plasmids and provide insights into the possible routes for transmission of blaNDM genes among species of the Enterobacteriaceae family.

  13. pRMH760, a precursor of A/C₂ plasmids carrying blaCMY and blaNDM genes.


    Harmer, Christopher J; Hall, Ruth M


    To investigate the evolution of plasmids in the repA/C2 group carrying genes conferring resistance to cephalosporins (bla(CMY)) or to carbapenems (bla(NDM)) and cephalosporins (bla(CMY)), the sequence of plasmid pRMH760 that lacks the β-lactamase genes was determined and compared to all available A/C2 plasmid sequences. pRMH760 is 170.6 kb and carries several antibiotic resistance genes in a 45.1 kb complex transposon structure located upstream of the rhs gene. In plasmid pR148, the closest relative of pRMH760, the antibiotic resistance island is in the same position but the resistance genes differ. pRMH760 also contains a deletion in the rhs gene. Sequenced A/C2 plasmids containing bla(CMY) or bla(CMY) and bla(NDM) have backbones closely related to the pRMH760/pR148 backbone, and they include resistance islands in the same location, indicating that they arose from a plasmid related to pRMH760/pR148. However, the gene content of this resistance island differs in each case, and the island family was designated ARI-A. The bla(NDM) gene is within ARI-A. The ISEcp1-bla(CMY) fragment is located elsewhere and is always in the same location, consistent with a single acquisition event. Plasmids containing only bla(CMY) carry a second resistance island, designated ARI-B, which includes the sul2 gene and a variable set of further resistance genes. Nine A/C2 plasmids that were not of this type (type 1) were found to have a similar backbone that can be simply distinguished by the presence of two exchanged regions and two insertions. Antibiotic resistance islands in type 2 plasmids are in different locations and have different structures.

  14. Effect of Mutations on the Binding of Kanamycin-B to RNA Hairpins Derived from the Mycobacterium tuberculosis Ribosomal A-Site.


    Truitt, Amber R; Choi, Bok-Eum; Li, Jenny; Soto, Ana Maria


    Kanamycin is an aminoglycoside antibiotic used in the treatment of drug-resistant tuberculosis. Mutations at the rRNA A-site have been associated with kanamycin resistance in Mycobacterium tuberculosis clinical isolates. Understanding the effect of these mutations on the conformation of the M. tuberculosis A-site is critical for understanding the mechanisms of antibiotic resistance in M. tuberculosis. In this work, we have studied RNA hairpins derived from the M. tuberculosis A-site, the wild type and three mutants at the following positions (M. tuberculosis/Escherichia coli numbering): A1400/1408 → G, C1401/1409 → U, and the double mutant G1483/1491 C1401/1409 → UA. Specifically, we used circular dichroism, ultraviolet spectroscopy, and fluorescence spectroscopy to characterize the conformation, stability, and binding affinity of kanamycin-B and other aminoglycoside antibiotics for these RNA hairpins. Our results show that the mutations affect the conformation of the decoding site, with the mutations at position 1401/1409 resulting in significant destabilizations. Interestingly, the mutants bind paromomycin with weaker affinity than the wild type, but they bind kanamycin-B with similar affinity than the wild type. The results suggest that the presence of mutations does not prevent kanamycin-B from binding. Instead, kanamycin may promote different interactions with a third partner in the mutants compared to the wild type. Furthermore, our results with longer and shorter hairpins suggest that the region of the A-site that varies among organisms may have modulating effects on the binding and interactions of the A-site.

  15. A novel suicide shuttle plasmid for Streptococcus suis serotype 2 and Streptococcus equi ssp. zooepidemicus gene mutation

    PubMed Central

    Liu, Rui; Zhang, Ping; Su, Yiqi; Lin, Huixing; Zhang, Hui; Yu, Lei; Ma, Zhe; Fan, Hongjie


    The mariner-based Himar1 system has been utilized for creating mutant libraries of many Gram-positive bacteria. Streptococcus suis serotype 2 (SS2) and Streptococcus equi ssp. zooepidemicus (SEZ) are primary pathogens of swine that threaten the swine industry in China. To provide a forward-genetics technology for finding virulent phenotype-related genes in these two pathogens, we constructed a novel temperature-sensitive suicide shuttle plasmid, pMar4s, which contains the Himar1 system transposon, TnYLB-1, and the Himar1 C9 transposase from pMarA and the repTAs temperature-sensitive fragment from pSET4s. The kanamycin (Kan) resistance gene was in the TnYLB-1 transposon. Temperature sensitivity and Kan resistance allowed the selection of mutant strains and construction of the mutant library. The SS2 and SEZ mutant libraries were successfully constructed using the pMar4s plasmid. Inverse-Polymerase Chain Reaction (Inverse-PCR) results revealed large variability in transposon insertion sites and that the library could be used for phenotype alteration screening. The thiamine biosynthesis gene apbE was screened for its influence on SS2 anti-phagocytosis; likewise, the sagF gene was identified to be a hemolytic activity-related gene in SEZ. pMar4s was suitable for mutant library construction, providing more information regarding SS2 and SEZ virulence factors and illustrating the pathogenesis of swine streptococcosis. PMID:27256117

  16. Identification of a thermophilic plasmid origin and its cloning within a new Thermus-E. coli shuttle vector.


    Wayne, J; Xu, S Y


    A pUC19-based vector has been generated for selecting functional thermophilic origins (oris) of Thermus ssp. Once combined with thermophilic DNA, the vector can be amplified in ampicillin resistant (Ap(R)) E. coli, prior to transformation and kanamycin (Km) selection in Thermus thermophilus. The Km(R) Thermus transformants replicate any newly-formed shuttle vectors via introduced thermophilic oris. Using this "ori-selecting" vector, three novel thermophilic oris were cloned from randomly digested Thermus cryptic plasmid DNA. These shuttle vectors are useful for genetic analyses, as well as protein engineering within thermophiles. The smallest ori-containing sequence of 4.2 kb has been subcloned, sequenced, and further refined to 2.3 kb. A significant ORF of 341 amino acids (aa), with a Thermus promoter and RBS, is found within the thermophilic ori. Deleting part of this ORF abolishes the shuttle vector's ability to replicate in T. thermophilus. Therefore, we postulate that this ORF encodes a replication protein (Rep) necessary for thermophilic plasmid replication. The thermophilic ori also contains two sequences which resemble DnaA boxes.

  17. Topological Behavior of Plasmid DNA.


    Higgins, N Patrick; Vologodskii, Alexander V


    The discovery of the B-form structure of DNA by Watson and Crick led to an explosion of research on nucleic acids in the fields of biochemistry, biophysics, and genetics. Powerful techniques were developed to reveal a myriad of different structural conformations that change B-DNA as it is transcribed, replicated, and recombined and as sister chromosomes are moved into new daughter cell compartments during cell division. This article links the original discoveries of superhelical structure and molecular topology to non-B form DNA structure and contemporary biochemical and biophysical techniques. The emphasis is on the power of plasmids for studying DNA structure and function. The conditions that trigger the formation of alternative DNA structures such as left-handed Z-DNA, inter- and intra-molecular triplexes, triple-stranded DNA, and linked catenanes and hemicatenanes are explained. The DNA dynamics and topological issues are detailed for stalled replication forks and for torsional and structural changes on DNA in front of and behind a transcription complex and a replisome. The complex and interconnected roles of topoisomerases and abundant small nucleoid association proteins are explained. And methods are described for comparing in vivo and in vitro reactions to probe and understand the temporal pathways of DNA and chromosome chemistry that occur inside living cells.

  18. Plasmids as Tools for Containment.


    García, José L; Díaz, Eduardo


    Active containment systems are a major tool for reducing the uncertainty associated with the introduction of monocultures, genetically engineered or not, into target habitats for a large number of biotechnological applications (e.g., bioremediation, bioleaching, biopesticides, biofuels, biotransformations, live vaccines, etc.). While biological containment reduces the survival of the introduced organism outside the target habitat and/or upon completion of the projected task, gene containment strategies reduce the lateral spread of the key genetic determinants to indigenous microorganisms. In fundamental research, suicide circuits become relevant tools to address the role of gene transfer, mainly plasmid transfer, in evolution and how this transfer contributes to genome plasticity and to the rapid adaptation of microbial communities to environmental changes. Many lethal functions and regulatory circuits have been used and combined to design efficient containment systems. As many new genomes are being sequenced, novel lethal genes and regulatory elements are available, e.g., new toxin-antitoxin modules, and they could be used to increase further the current containment efficiencies and to expand containment to other organisms. Although the current containment systems can increase the predictability of genetically modified organisms in the environment, containment will never be absolute, due to the existence of mutations that lead to the appearance of surviving subpopulations. In this sense, orthogonal systems (xenobiology) appear to be the solution for setting a functional genetic firewall that will allow absolute containment of recombinant organisms.

  19. Caprolactam-silica network, a strong potentiator of the antimicrobial activity of kanamycin against gram-positive and gram-negative bacterial strains.


    Voicu, Georgeta; Grumezescu, Valentina; Andronescu, Ecaterina; Grumezescu, Alexandru Mihai; Ficai, Anton; Ficai, Denisa; Ghitulica, Cristina Daniela; Gheorghe, Irina; Chifiriuc, Mariana Carmen


    Here, we report the fabrication of a novel ε-caprolactam-silica (ε-SiO2) network and assessed its biocompatibility and ability to improve the antimicrobial activity of kanamycin. The results of the quantitative antimicrobial assay demonstrate that the obtained ε-SiO2 network has efficiently improved the kanamycin activity on Staphylococcus aureus ATCC 25923 and Escherichia coli ATCC 25922 strains, with a significant decrease of the minimum inhibitory concentration. The ε-SiO2 network could be feasibly obtained and represents an alternative for the design of new antibiotic drug carriers or delivery systems to control bacterial infections.

  20. 35S Promoter Methylation in Kanamycin-Resistant Kalanchoe (Kalanchoe pinnata L.) Plants Expressing the Antimicrobial Peptide Cecropin P1 Transgene.


    Shevchuk, T V; Zakharchenko, N S; Tarlachkov, S V; Furs, O V; Dyachenko, O V; Buryanov, Y I


    Transgenic kalanchoe plants (Kalanchoe pinnata L.) expressing the antimicrobial peptide cecropin P1 gene (cecP1) under the control of the 35S cauliflower mosaic virus 35S RNA promoter and the selective neomycin phosphotransferase II (nptII) gene under the control of the nopaline synthase gene promoter were studied. The 35S promoter methylation and the cecropin P1 biosynthesis levels were compared in plants growing on media with and without kanamycin. The low level of active 35S promoter methylation further decreases upon cultivation on kanamycin-containing medium, while cecropin P1 synthesis increases.

  1. Isolation and physical characterization of streptomycete plasmids.


    Pernodet, J L; Guerineau, M


    Covalently closed circular DNA was isolated from a strain of Streptomyces coelicolor ATCC 10147 and from a strain of Streptomyces coelicolor subspecies flavus ATCC 19894, using two different methods. The two plasmids were of uniform monomer size: 8.9 kb for pS 10147, the plasmid from S. coelicolor ATCC 10147, and around 125 kb for the plasmid from S. coelicolor ATCC 19894. A restriction enzyme map was constructed for pS 10147, using seven enzymes. Four of the enzymes, (BamHI, Bgl,II, PvuII, and XhoI) cut pS 10147 once while PstI made two cuts. The GC content of this plasmid was calculated to be 72%. The possible utilisation of pS 10147 as a cloning vector in Streptomyces is discussed.

  2. The last step of kanamycin biosynthesis: unique deamination reaction catalyzed by the α-ketoglutarate-dependent nonheme iron dioxygenase KanJ and the NADPH-dependent reductase KanK.


    Sucipto, Hilda; Kudo, Fumitaka; Eguchi, Tadashi


    Mystery solved: using heterologous expression, the activities of two enzymes exclusively belonging to the kanamycin biosynthetic pathway have been identified in vitro. A distinctive reaction mechanism to produce kanamycin is proposed and the previously unknown catalytic deamination activity of KanJ dioxygenase is uncovered.

  3. Marine Diatom Plasmids and their Biotechnological Applications

    DTIC Science & Technology


    plasmid is homologous to the Tn21-type transposable elements. The element carries an open reading frame encoding a DNA invertase gene. Sequence comparisons...of regions upstream and downstream of the invertase gene indicate that the diatom plasmid is most similar to the Staphylococcus aureus transposon...the highly prokaryotic nature (i.e., codon usage bias, promoter sequences, etc.) of the invertase gene we have sequenced, we have tentatively

  4. Plasmid Replication Control by Antisense RNAs.


    Brantl, Sabine


    Plasmids are selfish genetic elements that normally constitute a burden for the bacterial host cell. This burden is expected to favor plasmid loss. Therefore, plasmids have evolved mechanisms to control their replication and ensure their stable maintenance. Replication control can be either mediated by iterons or by antisense RNAs. Antisense RNAs work through a negative control circuit. They are constitutively synthesized and metabolically unstable. They act both as a measuring device and a regulator, and regulation occurs by inhibition. Increased plasmid copy numbers lead to increasing antisense-RNA concentrations, which, in turn, result in the inhibition of a function essential for replication. On the other hand, decreased plasmid copy numbers entail decreasing concentrations of the inhibiting antisense RNA, thereby increasing the replication frequency. Inhibition is achieved by a variety of mechanisms, which are discussed in detail. The most trivial case is the inhibition of translation of an essential replication initiator protein (Rep) by blockage of the rep-ribosome binding site. Alternatively, ribosome binding to a leader peptide mRNA whose translation is required for efficient Rep translation can be prevented by antisense-RNA binding. In 2004, translational attenuation was discovered. Antisense-RNA-mediated transcriptional attenuation is another mechanism that has, so far, only been detected in plasmids of Gram-positive bacteria. ColE1, a plasmid that does not need a plasmid-encoded replication initiator protein, uses the inhibition of primer formation. In other cases, antisense RNAs inhibit the formation of an activator pseudoknot that is required for efficient Rep translation.

  5. The Master Activator of IncA/C Conjugative Plasmids Stimulates Genomic Islands and Multidrug Resistance Dissemination

    PubMed Central

    Luo, Peng; Rodrigue, Sébastien; Burrus, Vincent


    Dissemination of antibiotic resistance genes occurs mostly by conjugation, which mediates DNA transfer between cells in direct contact. Conjugative plasmids of the IncA/C incompatibility group have become a substantial threat due to their broad host-range, the extended spectrum of antimicrobial resistance they confer, their prevalence in enteric bacteria and their very efficient spread by conjugation. However, their biology remains largely unexplored. Using the IncA/C conjugative plasmid pVCR94ΔX as a prototype, we have investigated the regulatory circuitry that governs IncA/C plasmids dissemination and found that the transcriptional activator complex AcaCD is essential for the expression of plasmid transfer genes. Using chromatin immunoprecipitation coupled with exonuclease digestion (ChIP-exo) and RNA sequencing (RNA-seq) approaches, we have identified the sequences recognized by AcaCD and characterized the AcaCD regulon. Data mining using the DNA motif recognized by AcaCD revealed potential AcaCD-binding sites upstream of genes involved in the intracellular mobility functions (recombination directionality factor and mobilization genes) in two widespread classes of genomic islands (GIs) phylogenetically unrelated to IncA/C plasmids. The first class, SGI1, confers and propagates multidrug resistance in Salmonella enterica and Proteus mirabilis, whereas MGIVmi1 in Vibrio mimicus belongs to a previously uncharacterized class of GIs. We have demonstrated that through expression of AcaCD, IncA/C plasmids specifically trigger the excision and mobilization of the GIs at high frequencies. This study provides new evidence of the considerable impact of IncA/C plasmids on bacterial genome plasticity through their own mobility and the mobilization of genomic islands. PMID:25340549

  6. The master activator of IncA/C conjugative plasmids stimulates genomic islands and multidrug resistance dissemination.


    Carraro, Nicolas; Matteau, Dominick; Luo, Peng; Rodrigue, Sébastien; Burrus, Vincent


    Dissemination of antibiotic resistance genes occurs mostly by conjugation, which mediates DNA transfer between cells in direct contact. Conjugative plasmids of the IncA/C incompatibility group have become a substantial threat due to their broad host-range, the extended spectrum of antimicrobial resistance they confer, their prevalence in enteric bacteria and their very efficient spread by conjugation. However, their biology remains largely unexplored. Using the IncA/C conjugative plasmid pVCR94ΔX as a prototype, we have investigated the regulatory circuitry that governs IncA/C plasmids dissemination and found that the transcriptional activator complex AcaCD is essential for the expression of plasmid transfer genes. Using chromatin immunoprecipitation coupled with exonuclease digestion (ChIP-exo) and RNA sequencing (RNA-seq) approaches, we have identified the sequences recognized by AcaCD and characterized the AcaCD regulon. Data mining using the DNA motif recognized by AcaCD revealed potential AcaCD-binding sites upstream of genes involved in the intracellular mobility functions (recombination directionality factor and mobilization genes) in two widespread classes of genomic islands (GIs) phylogenetically unrelated to IncA/C plasmids. The first class, SGI1, confers and propagates multidrug resistance in Salmonella enterica and Proteus mirabilis, whereas MGIVmi1 in Vibrio mimicus belongs to a previously uncharacterized class of GIs. We have demonstrated that through expression of AcaCD, IncA/C plasmids specifically trigger the excision and mobilization of the GIs at high frequencies. This study provides new evidence of the considerable impact of IncA/C plasmids on bacterial genome plasticity through their own mobility and the mobilization of genomic islands.

  7. An Invertron-Like Linear Plasmid Mediates Intracellular Survival and Virulence in Bovine Isolates of Rhodococcus equi

    PubMed Central

    Valero-Rello, Ana; Hapeshi, Alexia; Anastasi, Elisa; Alvarez, Sonsiray; Scortti, Mariela; Meijer, Wim G.; MacArthur, Iain


    We report a novel host-associated virulence plasmid in Rhodococcus equi, pVAPN, carried by bovine isolates of this facultative intracellular pathogenic actinomycete. Surprisingly, pVAPN is a 120-kb invertron-like linear replicon unrelated to the circular virulence plasmids associated with equine (pVAPA) and porcine (pVAPB variant) R. equi isolates. pVAPN is similar to the linear plasmid pNSL1 from Rhodococcus sp. NS1 and harbors six new vap multigene family members (vapN to vapS) in a vap pathogenicity locus presumably acquired via en bloc mobilization from a direct predecessor of equine pVAPA. Loss of pVAPN rendered R. equi avirulent in macrophages and mice. Mating experiments using an in vivo transconjugant selection strategy demonstrated that pVAPN transfer is sufficient to confer virulence to a plasmid-cured R. equi recipient. Phylogenetic analyses assigned the vap multigene family complement from pVAPN, pVAPA, and pVAPB to seven monophyletic clades, each containing plasmid type-specific allelic variants of a precursor vap gene carried by the nearest vap island ancestor. Deletion of vapN, the predicted “bovine-type” allelic counterpart of vapA, essential for virulence in pVAPA, abrogated pVAPN-mediated intramacrophage proliferation and virulence in mice. Our findings support a model in which R. equi virulence is conferred by host-adapted plasmids. Their central role is mediating intracellular proliferation in macrophages, promoted by a key vap determinant present in the common ancestor of the plasmid-specific vap islands, with host tropism as a secondary trait selected during coevolution with specific animal species. PMID:25895973

  8. Polynucleotide sequence relationships among Ent plasmids and the relationship between Ent and other plasmids.

    PubMed Central

    So, M; Crosa, J H; Falkow, S


    Deoxyribonucleic acid-deoxyribonucleic acid hybridization studies reveal that the plasmids coding for the production of heat stable and heat labile enteroxtoxins of Escherichia coli, regardless of their origin, have a majority of their polynucleotide sequences in common, but are not related in any significant way to those plasmids coding for the synthesis of only ST toxin. The heat stable and heat labile plasmids also share a significant degree of their polynucleotide sequences with plasmids of the FI and FII incompatibility groups, but not with R factors belonging to the I, N, W, P, or X incompatibility groups. PMID:1090570

  9. Conference Space

    ERIC Educational Resources Information Center

    Tillett, Wade


    The following is an exploration of the spatial configurations (and their implications) within a typical panel session at an academic conference. The presenter initially takes up different roles and hyperbolically describes some possible messages that the spatial arrangement sends. Eventually, the presenter engages the audience members in atypical…

  10. Recombination-dependent concatemeric plasmid replication.

    PubMed Central

    Viret, J F; Bravo, A; Alonso, J C


    The replication of covalently closed circular supercoiled (form I) DNA in prokaryotes is generally controlled at the initiation level by a rate-limiting effector. Once initiated, replication proceeds via one of two possible modes (theta or sigma replication) which do not rely on functions involved in DNA repair and general recombination. Recently, a novel plasmid replication mode, leading to the accumulation of linear multigenome-length plasmid concatemers in both gram-positive and gram-negative bacteria, has been described. Unlike form I DNA replication, an intermediate recombination step is most probably involved in the initiation of concatemeric plasmid DNA replication. On the basis of structural and functional studies, we infer that recombination-dependent plasmid replication shares important features with phage late replication modes and, in several aspects, parallels the synthesis of plasmid concatemers in phage-infected cells. The characterization of the concatemeric plasmid replication mode has allowed new insights into the mechanisms of DNA replication and recombination in prokaryotes. PMID:1779931

  11. Plasmid-mediated mineralization of 4-chlorobiphenyl.

    PubMed Central

    Shields, M S; Hooper, S W; Sayler, G S


    Strains of Alcaligenes and Acinetobacter spp. were isolated from a mixed culture already proven to be proficient at complete mineralization of monohalogenated biphenyls. These strains were shown to harbor a 35 X 10(6)-dalton plasmid mediating a complete pathway for 4-chlorobiphenyl (4CB) oxidation. Subsequent plasmid curing of these bacteria resulted in the abolishment of the 4CB mineralization phenotype and loss of even early 4CB metabolism by Acinetobacter spp. Reestablishment of the Alcaligenes plasmid, denoted pSS50, in the cured Acinetobacter spp. via filter surface mating resulted in the restoration of 4CB mineralization abilities. 4CB mineralization, however, proved to be an unstable characteristic in some subcultured strains. Such loss was not found to coincide with any detectable alteration in plasmid size. Cultures capable of complete mineralization, as well as those limited to partial metabolism of 4CB, produced 4-chlorobenzoate as a metabolite. Demonstration of mineralization of a purified 14C-labeled chlorobenzoate showed it to be a true intermediate in 4CB mineralization. Unlike the mineralization capability, the ability to produce a metabolite has proven to be stable on subculture. These results indicate the occurrence of a novel plasmid, or evolved catabolic plasmid, that mediates the complete mineralization of 4CB. Images PMID:2993249

  12. [Progress in endogenous plasmid curing of bacteria--a review].


    Feng, Jun; Zhang, Wei; Song, Cunjiang


    To investigate the functions of the bacteria endogenous plasmid, which include bacterial drug resistance, symbiosis, capsular formation and heavy metal resistance, the endogenous plasmid needs to be cured first. We reviewed physical, chemical and molecular biological methods of endogenous plasmid curing, clarified the curing principles. The prospective of research on plasmid curing was also discussed, based on our own studies.

  13. Auxotrophic markers pyrF and proC can replace antibiotic markers on protein production plasmids in high-cell-density Pseudomonas fluorescens fermentation.


    Schneider, Jane C; Jenings, Annika F; Mun, Deborah M; McGovern, Patricia M; Chew, Lawrence C


    The use of antibiotic-resistance genes as selectable markers in transgenic organisms is coming under increased scrutiny, for fear that they may spread to human pathogens, thereby reducing the effectiveness of antibiotic therapy. A current Pseudomonas fluorescens protein expression system uses a tetracycline resistance gene (tetR/tetA) to maintain an expression plasmid under control of a repressible promoter and a kanamycin resistance gene (kanR) to maintain a plasmid carrying a repressor gene. We investigated using auxotrophic markers to replace these two antibiotic resistance genes: pyrF (encoding orotidine-5'-phosphate decarboxylase) in place of tetR/tetA and proC (encoding pyrroline-5-carboxylate reductase) in place of kanR, complementing their respective precise chromosomal deletions created by allele exchange using a suicide vector carrying pyrF as a counterselectable marker. The resulting strains, devoid of antibiotic-resistance genes, were shown to achieve high productivity of nitrilase and thermostable alpha-amylase equal to that of the former antibiotic-resistant production host. The production plasmids were stable. The pyrF (uracil-dependent) background of the production host strain also allows us to sequentially alter the genome to incorporate other desired genomic changes, deletions, or insertions using 5'-fluoroorotic acid counterselection, restoring the selectable marker after each step.

  14. Properties of the arsenate reductase of plasmid R773.


    Gladysheva, T B; Oden, K L; Rosen, B P


    Resistance to toxic oxyanions in Escherichia coli is conferred by the ars operon carried on plasmid R773. The gene products of this operon catalyze extrusion of antimonials and arsenicals from cells of E. coli, thus providing resistance to those toxic oxyanions. In addition, resistance to arsenate is conferred by the product of the arsC gene. In this report, purified ArsC protein was shown to catalyze reduction of arsenate to arsenite. The enzymatic activity of the ArsC protein required glutaredoxin as a source of reducing equivalents. Other reductants, including glutathione and thioredoxin, were not effective electron donors. A spectrophotometric assay was devised in which arsenate reduction was coupled to NADPH oxidation. The results obtained with the coupled assay corresponded to those found by direct reduction of radioactive arsenate to arsenite. The only substrate of the reaction was arsenate (Km = 8 mM); other oxyanions including phosphate, sulfate, and antimonate were not reduced. Phosphate and sulfate were weak inhibitors, while the product, arsenite, was a stronger inhibitor (Ki = 0.1 mM). Arsenate reductase activity exhibited a pH optimum of 6.3-6.8. These results indicate that the ArsC protein is a novel reductase, and elucidation of its enzymatic mechanism should be of interest.

  15. Clostridium perfringens type A-E toxin plasmids.


    Freedman, John C; Theoret, James R; Wisniewski, Jessica A; Uzal, Francisco A; Rood, Julian I; McClane, Bruce A


    Clostridium perfringens relies upon plasmid-encoded toxin genes to cause intestinal infections. These toxin genes are associated with insertion sequences that may facilitate their mobilization and transfer, giving rise to new toxin plasmids with common backbones. Most toxin plasmids carry a transfer of clostridial plasmids locus mediating conjugation, which likely explains the presence of similar toxin plasmids in otherwise unrelated C. perfringens strains. The association of many toxin genes with insertion sequences and conjugative plasmids provides virulence flexibility when causing intestinal infections. However, incompatibility issues apparently limit the number of toxin plasmids maintained by a single cell.

  16. Clostridium perfringens type A–E toxin plasmids

    PubMed Central

    Freedman, John C.; Theoret, James R.; Wisniewski, Jessica A.; Uzal, Francisco A.; Rood, Julian I.; McClane, Bruce A.


    Clostridium perfringens relies upon plasmid-encoded toxin genes to cause intestinal infections. These toxin genes are associated with insertion sequences that may facilitate their mobilization and transfer, giving rise to new toxin plasmids with common backbones. Most toxin plasmids carry a transfer of clostridial plasmids locus mediating conjugation, which likely explains the presence of similar toxin plasmids in otherwise unrelated C. perfringens strains. The association of many toxin genes with insertion sequences and conjugative plasmids provides virulence flexibility when causing intestinal infections. However, incompatibility issues apparently limit the number of toxin plasmids maintained by a single cell. PMID:25283728

  17. Identification of bacterial plasmids based on mobility and plasmid population biology.


    Garcillán-Barcia, Maria Pilar; Alvarado, Andrés; de la Cruz, Fernando


    Plasmids contain a backbone of core genes that remains relatively stable for long evolutionary periods, making sense to speak about plasmid species. The identification and characterization of the core genes of a plasmid species has a special relevance in the study of its epidemiology and modes of transmission. Besides, this knowledge will help to unveil the main routes that genes, for example antibiotic resistance (AbR) genes, use to travel from environmental reservoirs to human pathogens. Global dissemination of multiple antibiotic resistances and virulence traits by plasmids is an increasing threat for the treatment of many bacterial infectious diseases. To follow the dissemination of virulence and AbR genes, we need to identify the causative plasmids and follow their path from reservoirs to pathogens. In this review, we discuss how the existing diversity in plasmid genetic structures gives rise to a large diversity in propagation strategies. We would like to propose that, using an identification methodology based on plasmid mobility types, we can follow the propagation routes of most plasmids in Gammaproteobacteria, as well as their cargo genes, in complex ecosystems. Once the dissemination routes are known, designing antidissemination drugs and testing their efficacy will become feasible. We discuss in this review how the existing diversity in plasmid genetic structures gives rise to a large diversity in propagation strategies. We would like to propose that, by using an identification methodology based on plasmid mobility types, we can follow the propagation routes of most plasmids in ?-proteobacteria, as well as their cargo genes, in complex ecosystems.

  18. N15: the linear phage-plasmid.


    Ravin, Nikolai V


    The lambdoid phage N15 of Escherichia coli is very unusual among temperate phages in that its prophage is not integrated into chromosome but is a linear plasmid molecule with covalently closed ends. Upon infection the phage DNA circularises via cohesive ends, then phage-encoded enzyme, protelomerase, cuts at an inverted repeat site and forms hairpin ends (telomeres) of the linear plasmid prophage. Replication of the N15 prophage is initiated at an internally located ori site and proceeds bidirectionally resulting in formation of duplicated telomeres. Then the N15 protelomerase cuts duplicated telomeres generating two linear plasmid molecules with hairpin telomeres. Stable inheritance of the plasmid prophage is ensured by partitioning operon similar to the F factor sop operon. Unlike F sop, the N15 centromere consists of four inverted repeats dispersed in the genome. The multiplicity and dispersion of centromeres are required for efficient partitioning of a linear plasmid. The centromeres are located in N15 genome regions involved in phage replication and control of lysogeny, and binding of partition proteins at these sites regulates these processes. Two N15-related lambdoid Siphoviridae phages, φKO2 in Klebsiella oxytoca and pY54 in Yersinia enterocolitica, also lysogenize their hosts as linear plasmids, as well as Myoviridae marine phages VP882 and VP58.5 in Vibrio parahaemolyticus and ΦHAP-1 in Halomonas aquamarina. The genomes of all these phages contain similar protelomerase genes, lysogeny modules and replication genes, as well as plasmid-partitioning genes, suggesting that these phages may belong to a group diverged from a common ancestor.

  19. Capacitively coupled contactless conductivity detection as an alternative detection mode in CE for the analysis of kanamycin sulphate and its related substances.


    El-Attug, Mohamed N; Adams, Erwin; Hoogmartens, Jos; Van Schepdael, Ann


    A method was developed to determine simultaneously kanamycin, its related substances and sulphate in kanamycin sulphate using capacitively coupled contactless conductivity detection. Kanamycin is an aminoglycoside antibiotic that lacks a strong UV-absorbing chromophore. Due to its physicochemical properties, CE in combination with capacitively coupled contactless conductivity detection was chosen. The separation method uses a BGE composed of 40 mM 2-(N-morpholino)ethanesulphonic acid monohydrate and 40 mM L-histidine, pH 6.35. A 0.6 mM N-cetyltrimethyl ammonium bromide (CTAB) solution was added as electroosmotic flow modifier in a concentration below the critical micellar concentration (CMC). Ammonium acetate 50 mg/L was used as internal standard. In total, 30 kV was applied in reverse polarity on a fused-silica capillary (65/41 cm; 75 μm id). The optimized separation was obtained in less than 6 min with good linearity (R(2)=0.9999) for kanamycin. It shows a good precision expressed as RSD on the relative peak areas equal to 0.3 and 1.1% for intra-day and inter-day precision, respectively. The LOD and LOQ are 0.7 and 2.3 mg/L, respectively. Similarly, for sulphate, a good linearity (R(2)=0.9996) and precision (RSD 0.4 and 0.6% for intra-day and inter-day, respectively) were obtained.

  20. Photoelectrochemical aptasensor for the sensitive and selective detection of kanamycin based on Au nanoparticle functionalized self-doped TiO2 nanotube arrays.


    Xin, Yanmei; Li, Zhenzhen; Zhang, Zhonghai


    In this communication, a new photoelectrochemical aptasensor with Au nanoparticle functionalized self-doped TiO2 nanotube arrays (Au/SD-TiO2 NTs) as the core sensing unit and aptamers as the recognition unit was set up to accomplish the sensitive and selective detection of kanamycin with the lowest detection limit of 0.1 nM.

  1. Outer membrane proteomics of kanamycin-resistant Escherichia coli identified MipA as a novel antibiotic resistance-related protein.


    Li, Hui; Zhang, Dan-feng; Lin, Xiang-min; Peng, Xuan-xian


    Antibiotic-resistant bacteria are a great threat to human health and food safety and there is an urgent need to understand the mechanisms of resistance for combating these bacteria. In the current study, comparative proteomic methodologies were applied to identify Escherichia coli K-12 outer membrane (OM) proteins related to kanamycin resistance. Mass spectrometry and western blotting results revealed that OM proteins TolC, Tsx and OstA were up-regulated, whereas MipA, OmpA, FadL and OmpW were down-regulated in kanamycin-resistant E. coli K-12 strain. Genetic deletion of tolC (ΔtolC-Km) led to a 2-fold decrease in the minimum inhibitory concentration (MIC) of kanamycin and deletion of mipA (ΔmipA-Km) resulted in a 4-fold increase in the MIC of kanamycin. Changes in the MICs for genetically modified strains could be completely recovered by gene complementation. Compared with the wild-type strain, the survival capability of ΔompA-Km was significantly increased and that of Δtsx-Km was significantly decreased. We further evaluated the role and expression of MipA in response to four other antibiotics including nalidixic acid, streptomycin, chloramphenicol and aureomycin, which suggested that MipA was a novel OM protein related to antibiotic resistance.

  2. An aptamer-based signal-on bio-assay for sensitive and selective detection of Kanamycin A by using gold nanoparticles.


    Chen, Jing; Li, Zhaohui; Ge, Jia; Yang, Ran; Zhang, Lin; Qu, Ling-Bo; Wang, Hong-Qi; Zhang, Ling


    In this study, a simple and sensitive aptamer-based fluorescence method for the detection of Kanamycin A by using gold nanoparticles (AuNPs) has been developed. In this assay, AuNPs were utilized as DNA nanocarrier as well as efficient fluorescence quencher. In the absence of Kanamycin A, dye-labeled aptamer could be adsorbed onto the surface of AuNPs and the fluorescence signal was quenched. In the presence of Kanamycin A, the specific binding between dye-labeled aptamer and its target induced the formation of rigid structure, which led to dye-labeled aptamer releasing from the surface of AuNPs and the fluorescence intensity was recovered consequently. Under optimum conditions, calibration modeling showed that the analytical linear range covered from 0.8nM to 350nM and the detection limit of 0.3nM was realized successfully. This proposed bio-assay also showed high selectivity over other antibiotics. Meanwhile, this strategy was further used to determine the concentrations of Kanamycin A in milk sample with satisfying results.

  3. Tuning the regioselectivity of the Staudinger reaction for the facile synthesis of kanamycin and neomycin class antibiotics with N-1 modification.


    Li, Jie; Chen, Hsiao-Nung; Chang, Huiwen; Wang, Jinhua; Chang, Cheng-Wei Tom


    [reaction: see text] A novel method for achieving the desired regioselective reduction of the N-1 azido group on a tetraazidoneamine has been developed that leads to the synthesis of both kanamycin and neomycin class antibiotics bearing N-1 modification. Both classes of aminoglycosides are active against aminoglycoside-resistant bacteria carrying APH(3')-I and AAC(6')/APH(2'').

  4. Pre-XDR & XDR in MDR and Ofloxacin and Kanamycin resistance in non-MDR Mycobacterium tuberculosis isolates.


    Jain, Amita; Dixit, Pratima; Prasad, Rajendra


    Resistance to second line anti tubercular drugs is a cause of serious concern. The present study reports the prevalence of Ofloxacin (OFX) and Kanamycin (KM) resistance in Mycobacterium tuberculosis isolates from cases of pulmonary tuberculosis, who received anti tubercular treatment for >4 weeks in past. Of total 438 enrolled patients, 361 were culture positive for M. tuberculosis, of which, 95 (26.3%) were OFX resistant & 49 (13.5%) were KM resistant. Total 130 isolates were Multidrug resistant, of which, 55 (42.3%) were resistant to either OFX or KM (Pre-XDR) & 11 (8.5%) were resistant to both KM & OFX (XDR). Resistance to quinolones & aminoglycosides should be routinely assessed in areas endemic for tuberculosis.

  5. Selective modification of the 3''-amino group of kanamycin prevents significant loss of activity in resistant bacterial strains.


    Santana, Andrés G; Zárate, Sandra G; Asensio, Juan Luis; Revuelta, Julia; Bastida, Agatha


    Aminoglycosides are highly potent, wide-spectrum bactericidals. N-1 modification of aminoglycosides has thus far been the best approach to regain bactericidal efficiency of this class of antibiotics against resistant bacterial strains. In the present study we have evaluated the effect that both, the number of modifications and their distribution on the aminoglycoside amino groups (N-1, N-3, N-6' and N-3''), have on the antibiotic activity. The modification of N-3'' in the antibiotic kanamycin A is the key towards the design of new aminoglycoside antibiotics. This derivative maintains the antibiotic activity against aminoglycoside acetyl-transferase- and nucleotidyl-transferase-expressing strains, which are two of the most prevalent modifying enzymes found in aminoglycoside resistant bacteria.

  6. Colorimetric detection of kanamycin based on analyte-protected silver nanoparticles and aptamer-selective sensing mechanism.


    Xu, Yuanyuan; Han, Tian; Li, Xiaqing; Sun, Linghao; Zhang, Yujuan; Zhang, Yuanshu


    In this work, a novel colorimetric detection method for kanamycin (Kana), a widely used aminoglycoside antibiotic, has been developed using unmodified silver nanoparticles (AgNPs) as sensing probe. The method is designed based on the finding that the analyte (Kana) can protect AgNPs against salt-induced aggregation, and nucleic acid aptamers can decrease the risk of false positives through an aptamer-selective sensing mechanism. By use of the proposed method, selective quantification of Kana can be achieved over the concentration range from 0.05 to 0.6 μg mL(-1) within 20 min. The detection limit is estimated to be 2.6 ng mL(-1), which is much lower than the allowed maximum residue limit. Further studies also demonstrate the applicability of the proposed method in milk samples, revealing that the method may possess enormous potential for practical detection of Kana in the future.

  7. Sulfonamide-Based Inhibitors of Aminoglycoside Acetyltransferase Eis Abolish Resistance to Kanamycin in Mycobacterium tuberculosis

    SciTech Connect

    Garzan, Atefeh; Willby, Melisa J.; Green, Keith D.; Gajadeera, Chathurada S.; Hou, Caixia; Tsodikov, Oleg V.; Posey, James E.; Garneau-Tsodikova, Sylvie


    A two-drug combination therapy where one drug targets an offending cell and the other targets a resistance mechanism to the first drug is a time-tested, yet underexploited approach to combat or prevent drug resistance. By high-throughput screening, we identified a sulfonamide scaffold that served as a pharmacophore to generate inhibitors of Mycobacterium tuberculosis acetyltransferase Eis, whose upregulation causes resistance to the aminoglycoside (AG) antibiotic kanamycin A (KAN) in Mycobacterium tuberculosis. Rational systematic derivatization of this scaffold to maximize Eis inhibition and abolish the Eis-mediated KAN resistance of M. tuberculosis yielded several highly potent agents. A crystal structure of Eis in complex with one of the most potent inhibitors revealed that the inhibitor bound Eis in the AG-binding pocket held by a conformationally malleable region of Eis (residues 28–37) bearing key hydrophobic residues. These Eis inhibitors are promising leads for preclinical development of innovative AG combination therapies against resistant TB.

  8. Bovine papillomavirus vector that propagates as a plasmid in both mouse and bacterial cells.


    DiMaio, D; Treisman, R; Maniatis, T


    We report the construction of a bovine papillomavirus (BPV)-derived recombinant plasmid that propagates as an extrachromosomal element in both mouse and bacterial cells. Plasmids composed of a subgenomic transforming fragment of BPV DNA, a deletion derivative of pBR322, and a 7.6-kilobase fragment of DNA from the human beta-globin gene cluster efficiently induce focus formation on mouse C127 cells. BPV-beta-globin hybrids are maintained in the transformed cells as plasmids with a copy number of about 10-30 per cell. Plasmids indistinguishable from the input DNA have been recovered by transformation of bacteria with low molecular weight DNA from transformed mouse cells. The human beta-globin gene linked to BPV DNA is transcribed from its own promoter at a high level in these cells. The expression of BPV-linked cellular genes in conjunction with the ability to shuttle DNA between bacteria and mammalian cells may provide a rapid means of analyzing and recovering genes that confer an identifiable phenotype upon mammalian cells.

  9. Proteomic analysis of the sarcosine-insoluble outer membrane fraction of Pseudomonas aeruginosa responding to ampicilin, kanamycin, and tetracycline resistance.


    Peng, Xuanxian; Xu, Changxin; Ren, Haixia; Lin, Xiangmin; Wu, Lina; Wang, Sanying


    Nosocomial wound infections by antibiotic-resistant Pseudomonas aeruginosa strains have increasing importance in hospitals. Outer membrane proteins of the bacterium have strong influence on its resistance to antibiotics. In the current study, a parallel proteomic approach was applied to analysis of sarcosine-insoluble outer membrane fraction of P. aeruginosa responding to ampicilin, kanamycin and tetracycline resistances. Eleven differential proteins with 15 spots were determined and then identified by MALDI-TOF/MS, in which four with increased OprF, MexA, OmpH, and decreased hypothetical protein (NCBI No. 15599856), six with increased OprF, OmpH, hypothetical protein (NCBI No. 15599183) and decreased OprG, MexA, conserved hypothetical protein (NCBI No. 15600371), and eight with increased OprF, MexA, OprL, probable Omp (NCBI No. 15599856), probable secretion protein (NCBI No. 15600167), OprD and decreased OprG, conserved hypothetical protein (NCBI No. 15600371) responded to ampicilin, kanamycin, and tetracycline resistances, respectively. With the exception of OprF, the other differential proteins did not show the same behaviors against the three antibiotic resistances. Compared with our previous report on E. coli Omps responding to ampicilin and tetracycline resistances, which was only a protein difference in quality between the two antibiotics, P. aeruginosa showed significant diversity against the three antibiotics. Our findings might provide valuable data for an understanding of antibiotic-resistant difference between different species of bacteria. Meanwhile, these proteins shared by different bacteria or a bacterium against different antibiotics may provide universal targets for the development of new drugs that control antibiotic-resistant bacteria.

  10. Electrotransformation of Yersinia ruckeri by plasmid DNA.


    Cutrín, J M; Conchas, R F; Barja, J L; Toranzo, A E


    Yersinia ruckeri, a fish pathogenic bacterium in aquaculture, was used to evaluate the electroporation as a new transformation method for this species. DNA used for the electrotransformation were plasmids of molecular mass ranging from 2.3 kb to 33 kb, and diverse replicons. To optimize this method we used Y. ruckeri 11.29 strain (from serotype 02) and pSU2718 DNA. The best transformation efficiency (6.0 x 10(5) transformants/micrograms DNA) was obtained with 12.5 kV/cm, 25 microF, 400 omega and 2 hours of incubation after pulse. When these conditions were applied to other strains belonging to different serotypes and other plasmids, we obtained transformants in all strains assayed, but only when using low molecular weight plasmids. Plasmid vectors and resident plasmid were not modified in host strains after electrotransformation. In studies of conformation we confirmed that only circular DNA was able for transformation. The utilization of this technique for direct cloning in Y. ruckeri makes possible further studies on recombinant DNA.

  11. Evaluating the in vitro susceptibility of bovine mastitis pathogens to a combination of kanamycin and cefalexin: Recommendations for a disk diffusion test.


    Pillar, C M; Goby, L; Draghi, D; Grover, P; Thornsberry, C


    Cows suffering from bovine mastitis have markedly reduced milk production because of inflammation within the udder subsequent to infection and damage from bacterial toxins. Antibiotic treatment is commonly used as a preventative and therapeutic measure for bovine mastitis. The most common pathogens include Staphylococcus aureus, various streptococci (Streptococcus dysgalactiae, Streptococcus uberis), and coliforms (Escherichia coli), which can be contracted from other infected cows or from the environment. A combination of kanamycin and cefalexin (1:1.5 wt/wt) is currently used therapeutically in Europe for the treatment of bovine mastitis, although standardized methods for the in vitro determination of the susceptibility of target pathogens have not been developed. This study evaluates the appropriate broth microdilution testing criteria for kanamycin and cefalexin administered in combination and reports the development of a disk diffusion test. At a ratio of kanamycin:cefalexin relevant to that observed in milk postadministration (10:1 wt/wt), the minimum inhibitory concentrations were determined against 307 isolates of target mastitis pathogens (staphylococci, streptococci, and E. coli). Based on achievable concentrations in milk and the resulting distribution of minimum inhibitory concentrations, preliminary broth breakpoints for kanamycin/cefalexin (10:1 fixed ratio) of or=32/3.2 microg/mL resistant were applied to evaluated staphylococci, streptococci, and E. coli. Parallel testing by disk diffusion and resulting error-rate bounded analysis using a combined disk concentration of 30 microg of kanamycin and 15 microg of cefalexin resulted in the establishment of preliminary disk interpretive breakpoints of >or=20 mm susceptible, 18 to 19 mm intermediate, and

  12. Proteolysis in plasmid DNA stable maintenance in bacterial cells.


    Karlowicz, Anna; Wegrzyn, Katarzyna; Dubiel, Andrzej; Ropelewska, Malgorzata; Konieczny, Igor


    Plasmids, as extrachromosomal genetic elements, need to work out strategies that promote independent replication and stable maintenance in host bacterial cells. Their maintenance depends on constant formation and dissociation of nucleoprotein complexes formed on plasmid DNA. Plasmid replication initiation proteins (Rep) form specific complexes on direct repeats (iterons) localized within the plasmid replication origin. Formation of these complexes along with a strict control of Rep protein cellular concentration, quaternary structure, and activity, is essential for plasmid maintenance. Another important mechanism for maintenance of low-copy-number plasmids are the toxin-antitoxin (TA) post-segregational killing (psk) systems, which prevent plasmid loss from the bacterial cell population. In this mini review we discuss the importance of nucleoprotein complex processing by energy-dependent host proteases in plasmid DNA replication and plasmid type II toxin-antitoxin psk systems, and draw attention to the elusive role of DNA in this process.

  13. Transfer of mupirocin resistance from Staphylococcus haemolyticus clinical strains to Staphylococcus aureus through conjugative and mobilizable plasmids.


    Rossi, Ciro C; Ferreira, Natália C; Coelho, Marcus L V; Schuenck, Ricardo P; Bastos, Maria do Carmo de F; Giambiagi-deMarval, Marcia


    Coagulase-negative staphylococci are thought to act as reservoirs of antibiotic resistance genes that can be transferred to Staphylococcus aureus, thus hindering the combat of this bacterium. In this work, we analyzed the presence of plasmids conferring resistance to the antibiotic mupirocin-widely used to treat and prevent S. aureus infections in hospital environments-in nosocomial S. haemolyticus strains. About 12% of the 75 strains tested were resistant to mupirocin, and this phenotype was correlated with the presence of plasmids. These plasmids were shown to be diverse, being either conjugative or mobilizable, and capable of transferring mupirocin resistance to S. aureus Our findings reinforce that S. haemolyticus, historically and mistakenly considered as a less important pathogen, is a reservoir of resistance genes which can be transferred to other bacteria, such as S. aureus, emphasizing the necessity of more effective strategies to detect and combat this emergent opportunistic pathogen.

  14. Diversity and Homogeneity among Small Plasmids of Aeromonas salmonicida subsp. salmonicida Linked with Geographical Origin

    PubMed Central

    Attéré, Sabrina A.; Vincent, Antony T.; Trudel, Mélanie V.; Chanut, Romain; Charette, Steve J.


    Furunculosis, which is caused by Aeromonas salmonicida subsp. salmonicida, is a major salmonid disease in fish farms worldwide. Several plasmids found in this bacterium confer phenotypes such drug resistance and virulence. Small plasmids (pAsa1, pAsa2, pAsa3, and pAsal1) related to ColE1- and ColE2-type replicons are usually present in its normal plasmidome. In the present study, with the objective to investigate if these plasmids display particularities related to the origin of the isolates bearing them, a total of 153 isolates, including 78 new and 75 previously described, were analyzed for the presence of small plasmids by PCR and DNA restriction fragment profiling. A geographical dichotomy between Canadian and European isolates for their propensity to do not have pAsa3 or pAsal1 was found. In addition, the genotyping analysis led to the identification of two European isolates harboring an unusual pAsal1. An investigation by next-generation sequencing (NGS) of these two isolates shed light on two pAsal1 variants (pAsal1C and pAsal1D). As with pAsal1B, another pAsal1 variant previously described, these two new variants bore a second insertion sequence (ISAS5) in addition to the usual ISAS11. The characterization of these variants suggested that they could predominate over the wild-type pAsal1 in stressful conditions such as growth at temperatures of 25°C and above. To obtain a comprehensive portrait of the mutational pressure on small plasmids, 26 isolates whose DNA had been sequenced by NGS were investigated. pAsa3 and pAsal1 were more prone to mutations than pAsa1 and pAsa2, especially in the mobA gene, which encodes a relaxase and a primase. Lastly, the average copy number of each plasmid per cell was assessed using raw sequencing data. A clear trend with respect to the relative proportion per cell of each plasmid was identified. Our large-scale study revealed a geographical dichotomy in small plasmid repertoire in addition to a clear trend for pAsa3 and p

  15. Plasmid vectors and molecular building blocks for the development of genetic manipulation tools for Trypanosoma cruzi.


    Bouvier, León A; Cámara, María de los Milagros; Canepa, Gaspar E; Miranda, Mariana R; Pereira, Claudio A


    The post genomic era revealed the need for developing better performing, easier to use and more sophisticated genetic manipulation tools for the study of Trypanosoma cruzi, the etiological agent of Chagas disease. In this work a series of plasmids that allow genetic manipulation of this protozoan parasite were developed. First of all we focused on useful tools to establish selection strategies for different strains and which can be employed as expression vectors. On the other hand molecular building blocks in the form of diverse selectable markers, modifiable fluorescent protein and epitope-tag coding sequences were produced. Both types of modules were harboured in backbone molecules conceived to offer multiple construction and sub-cloning strategies. These can be used to confer new properties to already available genetic manipulation tools or as starting points for whole novel designs. The performance of each plasmid and building block was determined independently. For illustration purposes, some simple direct practical applications were conducted.

  16. Electrotransfer of Plasmid Vector DNA into Muscle

    NASA Astrophysics Data System (ADS)

    Miyazaki, Satsuki; Miyazaki, Jun-Ichi

    Wolff et al. (1990) first reported that plasmid DNA injected into skeletal muscle is taken up by muscle cells and the genes in the plasmid are expressed for more than two months thereafter, although the transfected DNA does not usually undergo chromosomal integration (Wolff et al., 1991, 1992). However, the relatively low expression levels attained by this method have hampered its applications for uses other than as a DNA vaccine (Davis et al., 1995). There are a number of reports analyzing the conditions that affect the efficiency of gene transfer by intramuscular DNA injection and assessing the fine structures of expression plasmid vectors that may affect expression levels (Davis et al., 1993; Liang et al., 1996; Norman et al., 1997). Furthermore, various attempts were done to improve the efficiency of gene transfer by intramus cular DNA injection. Consequently, regenerating muscle was shown to produce 80-fold or more protein than did normal muscle, following injection of an expression plas-mid. Muscle regeneration was induced by treatment with cardiotoxin or bupivacaine (Wells, 1993; Vitadello et al., 1994). We previously demonstrated that by combining a strong promoter and bupivacaine pretreatment intramuscular injection of an IL-5 expression plasmid results in IL-5 production in muscle at a level sufficient to induce marked proliferation of eosinophils in the bone marrow and eosinophil infiltration of various organs (Tokui et al., 1997). It was also reported that a single intramuscular injection of an erythropoietin expression plasmid produced physiologically significant elevations in serum erythropoietin levels and increased hematocrits in adult mice (Tripathy et al., 1996). Hematocrits in these animals remained elevated at >60% for at least 90 days after a single injection. However, improvements to this method have not been sufficient to extend its applications including clinical use.

  17. Plasmid-borne florfenicol and ceftiofur resistance encoded by the floR and blaCMY-2 genes in Escherichia coli isolates from diseased cattle in France.


    Meunier, Danièle; Jouy, Eric; Lazizzera, Corinne; Doublet, Benoît; Kobisch, Marylène; Cloeckaert, Axel; Madec, Jean-Yves


    This study was designed to determine the genetic basis of florfenicol and ceftiofur resistance in Escherichia coli isolates recovered from French cattle. In these isolates, ceftiofur resistance was conferred by bla(CMY-2) located on three distinct conjugative plasmids on a specific DNA fragment, ISEcp1-bla(CMY-2)-blc- sugE. Two of the plasmids also carried the floR gene conferring resistance to florfenicol. The floR gene was shown to be associated with the insertion sequence ISCR2. Mobile elements appear to contribute to the mobilization of floR and bla(CMY-2) genes in E. coli. The presence of bla(CMY-2) and floR on the same plasmid highlights the potential risk for a co-selection of the bla(CMY-2) gene through the use of florfenicol in food animal production.

  18. Mutation detection in plasmid-based biopharmaceuticals.


    Oliveira, Pedro H; Prather, Kristala L J; Prazeres, Duarte M F; Monteiro, Gabriel A


    As the number of applications involving therapeutic plasmid DNA (pDNA) increases worldwide, there is a growing concern over maintaining rigorous quality control through a panel of high-quality assays. For this reason, efficient, cost-effective and sensitive technologies enabling the identification of genetic variants and unwanted side products are needed to successfully establish the identity and stability of a plasmid-based biopharmaceutical. This review highlights several bioinformatic tools for ab initio detection of potentially unstable DNA regions, as well as techniques used for mutation detection in nucleic acids, with particular emphasis on pDNA.

  19. Plasmid IL-12 electroporation in melanoma

    PubMed Central

    Cha, Edward; Daud, Adil


    Intratumoral gene electroporation uses electric charges to facilitate entry of plasmid DNA into cells in a reproducible and highly efficient manner, especially to accessible sites such as cutaneous and subcutaneous melanomas. Effective for locally treated disease, electroporation of plasmid DNA encoding interleukin-12 can also induce responses in untreated distant disease, suggesting that adaptive immune responses are being elicited that can target melanoma-associated antigens. In vivo electroporation with immunomodulatory cytokine DNA is a promising approach that can trigger systemic anti-tumor immune responses without the systemic toxicity associated with intravenous cytokine delivery and potentially offer complete long-term tumor regression. PMID:23151447

  20. Plasmid-mediated susceptibility to intestinal microbial antagonisms in Escherichia coli.


    Andremont, A; Gerbaud, G; Tancrède, C; Courvalin, P


    Self-transferable plasmid pIP1100 confers to Escherichia coli an unusually high level of resistance (1 to 2 mg/ml) to erythromycin by production of an erythromycin esterase. The effect of pIP1100 on the destiny of E. coli strains in the intestines of gnotobiotic mice was studied. In germfree mice, pIP1100 was efficiently transferred to a plasmid-free E. coli recipient. Intestinal counts of the donor, the recipient, and the transconjugants were greater than 8.5 log CFU/g of feces. When erythromycin was added to the diet of the mice, counts of the plasmid-bearing strains were only slightly lowered and partial inactivation of erythromycin was observed in the feces. Transfer of pIP1100 also occurred in human-flora-associated mice. In this model all the E. coli strains were subject to microbial antagonisms caused by the anaerobic components of the flora. However, strains harboring pIP1100 were strongly inhibited (less than 2.5 log CFU/g of feces), whereas their plasmid-free counterparts persisted at much higher population levels (greater than 5.2 log CFU/g of feces). The ecological disadvantage conferred by pIP1100 to E. coli when a complex human flora was concomitantly present in the intestine of the mice persisted during erythromycin administration. These results provide an explanation for the low incidence of isolation of highly erythromycin-resistant E. coli strains despite the extensive use of the antibiotic.

  1. Conferences revisited

    NASA Astrophysics Data System (ADS)

    Radcliffe, Jonathan


    Way back in the mid-1990s, as a young PhD student, I wrote a Lateral Thoughts article about my first experience of an academic conference (Physics World 1994 October p80). It was a peach of a trip - most of the lab decamped to Grenoble for a week of great weather, beautiful scenery and, of course, the physics. A whole new community was there for me to see in action, and the internationality of it all helped us to forget about England's non-appearance in the 1994 World Cup finals.

  2. Plasmid Introduction in Metal-Stressed, Subsurface-Derived Microcosms: Plasmid Fate and Community Response

    PubMed Central

    Smets, Barth F.; Morrow, Jayne B.; Arango Pinedo, Catalina


    The nonconjugal IncQ plasmids pMOL187 and pMOL222, which contain the metal resistance-encoding genes czc and ncc, were introduced by using Escherichia coli as a transitory delivery strain into microcosms containing subsurface-derived parent materials. The microcosms were semicontinuously dosed with an artificial groundwater to set a low-carbon flux and a target metal stress (0, 10, 100, and 1,000 μM CdCl2), permitting long-term community monitoring. The broad-host-range IncPα plasmid RP4 was also transitorily introduced into a subset of microcosms. No novel community phenotype was detected after plasmid delivery, due to the high background resistances to Cd and Ni. At fixed Cd doses, however, small but consistent increases in Cdr or Nir density were measured due to the introduction of a single pMOL plasmid, and this effect was enhanced by the joint introduction of RP4; the effects were most significant at the highest Cd doses. The pMOL plasmids introduced could, however, be monitored via czc- and ncc-targeted infinite-dilution PCR (ID-PCR) methods, because these genes were absent from the indigenous community: long-term presence of czc (after 14 or 27 weeks) was contingent on the joint introduction of RP4, although RP4 cointroduction was not yet required to ensure retention of ncc after 8 weeks. Plasmids isolated from Nir transconjugants further confirmed the presence and retention of a pMOL222-sized plasmid. ID-PCR targeting the RP4-specific trafA gene revealed retention of RP4 for at least 8 weeks. Our findings confirm plasmid transfer and long-term retention in low-carbon-flux, metal-stressed subsurface communities but indicate that the subsurface community examined has limited mobilization potential for the IncQ plasmids employed. PMID:12839785

  3. Maintenance of a Pseudomonas fluorescens plasmid in heterologous hosts: metabolic burden as a more reliable variable to predict plasmid instability.


    Chandrasekaran, S; Lalithakumari, D


    The stability of a large, multiresistance plasmid, pSCL of P. fluorescens CAS102 was studied in Pseudomonas putida and E. coli under various non-stress conditions. Both the strains lost the plasmid within 25 days when repeatedly subcultured in LB broth without any antibiotic. The transformants survived in sterile soil and water without any marked reduction in the viability. In sterile soil, P. putida lost 93% and E. coli, 98% of their plasmid containing population in 30 days, while in sterile water the plasmid loss was 92.5% and 97% respectively. The two variables, viz. the efficiency of plasmid-partitioning during cell division and measurement of relative specific growth rates of plasmid-plus and plasmid-minus cells which are used to predict plasmid instability cannot be used to predict plasmid loss during starvation. The utility of a third variable, viz. the metabolic burden due to plasmid maintenance in predicting plasmid instability in different hosts is discussed. The rate of plasmid loss was found to be comparatively faster in E. coli than in P. putida. The biosynthetic burden due to plasmid maintenance was also more in E. coli than in P. putida when compared to the plasmid-plus and plasmid-minus cells of the two strains which was evident from the increased nutrient uptake rates (glucose, O2, and amino acid) and increased protein content of the plasmid-plus cells of E. coli. From the results, a correlation could be found between the degree of metabolic burden and the rate of plasmid loss. The reliability of metabolic burden, to predict plasmid instability versus the relative specific growth rates is discussed.

  4. Multiple keys for a single lock: the unusual structural plasticity of the nucleotidyltransferase (4')/kanamycin complex.


    Matesanz, Ruth; Diaz, José Fernando; Corzana, Francisco; Santana, Andrés G; Bastida, Agatha; Asensio, Juan Luis


    The most common mode of bacterial resistance to aminoglycoside antibiotics is the enzyme-catalysed chemical modification of the drug. Over the last two decades, significant efforts in medicinal chemistry have been focused on the design of non- inactivable antibiotics. Unfortunately, this strategy has met with limited success on account of the remarkably wide substrate specificity of aminoglycoside-modifying enzymes. To understand the mechanisms behind substrate promiscuity, we have performed a comprehensive experimental and theoretical analysis of the molecular-recognition processes that lead to antibiotic inactivation by Staphylococcus aureus nucleotidyltransferase 4'(ANT(4')), a clinically relevant protein. According to our results, the ability of this enzyme to inactivate structurally diverse polycationic molecules relies on three specific features of the catalytic region. First, the dominant role of electrostatics in aminoglycoside recognition, in combination with the significant extension of the enzyme anionic regions, confers to the protein/antibiotic complex a highly dynamic character. The motion deduced for the bound antibiotic seem to be essential for the enzyme action and probably provide a mechanism to explore alternative drug inactivation modes. Second, the nucleotide recognition is exclusively mediated by the inorganic fragment. In fact, even inorganic triphosphate can be employed as a substrate. Third, ANT(4') seems to be equipped with a duplicated basic catalyst that is able to promote drug inactivation through different reactive geometries. This particular combination of features explains the enzyme versatility and renders the design of non-inactivable derivatives a challenging task.

  5. Plasmid-determined resistance to serum bactericidal activity: a major outer membrane protein, the traT gene product, is responsible for plasmid-specified serum resistance in Escherichia coli.

    PubMed Central

    Moll, A; Manning, P A; Timmis, K N


    Resistance to the bactericidal activity of serum appears to be an important virulence property of invasive bacteria. The conjugative multiple-antibiotic-resistance plasmid R6-5 was found to confer upon Escherichia coli host bacteria increased resistance against rabbit serum. Gene-cloning techniques were used to localize the serum resistance determinant of R6-5 to a segment of the plasmid that encodes conjugal transfer functions, and a pACYC184 hybrid plasmid, designated pKT107, that contains this segment was constructed. The generation and analysis of deletion and insertion mutant derivatives of the pKT107 plasmid that no longer specify serum resistance permitted precise localization of the serum-resistance cistron on the R6-5 map and demonstrated that this locus is coincident with that of traT, one of the two surface exclusion genes of R6-5. Examination of the proteins synthesized in E. coli minicells of pKT107 and its serum-sensitive mutant derivative plasmids confirmed that the serum-resistance gene product of R6-5 is the traT protein and showed that this protein is a major structural component (about 21,000 copies per cell) of the bacterial outer membrane. Images Fig. 3 Fig. 4 Fig. 5 Fig. 6 PMID:6995306

  6. Plasmid Replicons from Pseudomonas Are Natural Chimeras of Functional, Exchangeable Modules

    PubMed Central

    Bardaji, Leire; Añorga, Maite; Ruiz-Masó, José A.; del Solar, Gloria; Murillo, Jesús


    Plasmids are a main factor for the evolution of bacteria through horizontal gene exchange, including the dissemination of pathogenicity genes, resistance to antibiotics and degradation of pollutants. Their capacity to duplicate is dependent on their replication determinants (replicon), which also define their bacterial host range and the inability to coexist with related replicons. We characterize a second replicon from the virulence plasmid pPsv48C, from Pseudomonas syringae pv. savastanoi, which appears to be a natural chimera between the gene encoding a newly described replication protein and a putative replication control region present in the widespread family of PFP virulence plasmids. We present extensive evidence of this type of chimerism in structurally similar replicons from species of Pseudomonas, including environmental bacteria as well as plant, animal and human pathogens. We establish that these replicons consist of two functional modules corresponding to putative control (REx-C module) and replication (REx-R module) regions. These modules are functionally separable, do not show specificity for each other, and are dynamically exchanged among replicons of four distinct plasmid families. Only the REx-C module displays strong incompatibility, which is overcome by a few nucleotide changes clustered in a stem-and-loop structure of a putative antisense RNA. Additionally, a REx-C module from pPsv48C conferred replication ability to a non-replicative chromosomal DNA region containing features associated to replicons. Thus, the organization of plasmid replicons as independent and exchangeable functional modules is likely facilitating rapid replicon evolution, fostering their diversification and survival, besides allowing the potential co-option of appropriate genes into novel replicons and the artificial construction of new replicon specificities. PMID:28243228

  7. Plasmid Replicons from Pseudomonas Are Natural Chimeras of Functional, Exchangeable Modules.


    Bardaji, Leire; Añorga, Maite; Ruiz-Masó, José A; Del Solar, Gloria; Murillo, Jesús


    Plasmids are a main factor for the evolution of bacteria through horizontal gene exchange, including the dissemination of pathogenicity genes, resistance to antibiotics and degradation of pollutants. Their capacity to duplicate is dependent on their replication determinants (replicon), which also define their bacterial host range and the inability to coexist with related replicons. We characterize a second replicon from the virulence plasmid pPsv48C, from Pseudomonas syringae pv. savastanoi, which appears to be a natural chimera between the gene encoding a newly described replication protein and a putative replication control region present in the widespread family of PFP virulence plasmids. We present extensive evidence of this type of chimerism in structurally similar replicons from species of Pseudomonas, including environmental bacteria as well as plant, animal and human pathogens. We establish that these replicons consist of two functional modules corresponding to putative control (REx-C module) and replication (REx-R module) regions. These modules are functionally separable, do not show specificity for each other, and are dynamically exchanged among replicons of four distinct plasmid families. Only the REx-C module displays strong incompatibility, which is overcome by a few nucleotide changes clustered in a stem-and-loop structure of a putative antisense RNA. Additionally, a REx-C module from pPsv48C conferred replication ability to a non-replicative chromosomal DNA region containing features associated to replicons. Thus, the organization of plasmid replicons as independent and exchangeable functional modules is likely facilitating rapid replicon evolution, fostering their diversification and survival, besides allowing the potential co-option of appropriate genes into novel replicons and the artificial construction of new replicon specificities.

  8. Complete sequence of a plasmid from a bovine methicillin-resistant Staphylococcus aureus harbouring a novel ica-like gene cluster in addition to antimicrobial and heavy metal resistance genes.


    Feßler, Andrea T; Zhao, Qin; Schoenfelder, Sonja; Kadlec, Kristina; Brenner Michael, Geovana; Wang, Yang; Ziebuhr, Wilma; Shen, Jianzhong; Schwarz, Stefan


    The multiresistance plasmid pAFS11, obtained from a bovine methicillin-resistant Staphylococcus aureus (MRSA) isolate, was completely sequenced and analysed for its structure and organisation. Moreover, the susceptibility to the heavy metals cadmium and copper was determined by broth macrodilution. The 49,189-bp plasmid harboured the apramycin resistance gene apmA, two copies of the macrolide/lincosamide/streptogramin B resistance gene erm(B) (both located on remnants of a truncated transposon Tn917), the kanamycin/neomycin resistance gene aadD, the tetracycline resistance gene tet(L) and the trimethoprim resistance gene dfrK. The latter three genes were part of a 7,284-bp segment which was bracketed by two copies of IS431. In addition, the cadmium resistance operon cadDX as well as the copper resistance genes copA and mco were located on the plasmid and mediated a reduced susceptibility to cadmium and copper. Moreover, a complete novel ica-like gene cluster of so far unknown genetic origin was detected on this plasmid. The ica-like gene cluster comprised four different genes whose products showed 64.4-76.9% homology to the Ica proteins known to be involved in biofilm formation of the S. aureus strains Mu50, Mu3 and N315. However, 96.2-99.4% homology was seen to proteins from S. sciuri NS1 indicating an S. sciuri origin. The finding of five different antibiotic resistance genes co-located on a plasmid with heavy metal resistance genes and an ica-like gene cluster is alarming. With the acquisition of this plasmid, antimicrobial multiresistance, heavy metal resistances and potential virulence properties may be co-selected and spread via a single horizontal gene transfer event.

  9. Horizontal Gene Transfer of a ColV Plasmid Has Resulted in a Dominant Avian Clonal Type of Salmonella enterica Serovar Kentucky

    PubMed Central

    Johnson, Timothy J.; Thorsness, Jessica L.; Anderson, Cole P.; Lynne, Aaron M.; Foley, Steven L.; Han, Jing; Fricke, W. Florian; McDermott, Patrick F.; White, David G.; Khatri, Mahesh; Stell, Adam L.; Flores, Cristian; Singer, Randall S.


    Salmonella enterica continues to be a significant cause of foodborne gastrointestinal illness in humans. A wide variety of Salmonella serovars have been isolated from production birds and from retail poultry meat. Recently, though, S. enterica subsp. enterica serovar Kentucky has emerged as one of the prominent Salmonella serovars isolated from broiler chickens. Recent work suggests that its emergence apparently coincides with its acquisition of a ColV virulence plasmid. In the present study, we examined 902 Salmonella isolates belonging to 59 different serovars for the presence of this plasmid. Of the serovars examined, the ColV plasmid was found only among isolates belonging to the serovars Kentucky (72.9%), Typhimurium (15.0%) and Heidelberg (1.7%). We demonstrated that a single PFGE clonal type of S. Kentucky harbors this plasmid, and acquisition of this plasmid by S. Kentucky significantly increased its ability to colonize the chicken cecum and cause extraintestinal disease. Comparison of the completed sequences of three ColV plasmids from S. Kentucky isolated from different geographical locales, timepoints and sources revealed a nearly identical genetic structure with few single nucleotide changes or insertions/deletions. Overall, it appears that the ColV plasmid was recently acquired by a single clonal type S. Kentucky and confers to its host enhanced colonization and fitness capabilities. Thus, the potential for horizontal gene transfer of virulence and fitness factors to Salmonella from other enteric bacteria exists in poultry, representing a potential human health hazard. PMID:21203520

  10. Analysis of pMA67, a predicted rolling-circle replicating, mobilizable, tetracycline-resistance plasmid from the honey bee pathogen, Paenibacillus larvae.


    Murray, K Daniel; Aronstein, Katherine A; de León, Jesse H


    This work characterizes a recently discovered natural tetracycline-resistance plasmid called pMA67 from Paenibacillus larvae--a Gram-positive bacterial pathogen of honey bees. We provide evidence that pMA67 replicates by the rolling-circle mechanism, and sequence comparisons place it in the pMV158 family of rolling-circle replicons. The plasmid contains predicted rep, cop, and rnaII genes for control of replication initiating at a predicted double-strand origin. The plasmid has an ssoT single-strand origin, which is efficient enough to allow only very small amounts of the single-stranded DNA intermediate to accumulate. The overall efficiency of replication is sufficient to render the plasmid segregationally stable without selection in P. larvae and in Bacillus megaterium, but not in Escherichia coli. The plasmid is expected to be mobilizable due to the presence of a mob gene and an oriT site. The plasmid contains a tetL gene, whose predicted amino acid sequence implies a relatively ancient divergence from all previously known plasmid-encoded tetL genes. We confirm that the tetL gene alone is sufficient for conferring resistance to tetracyclines. Sequence comparisons, mostly with the well-characterized pMV158, allow us to predict promoters, DNA and RNA secondary structures, DNA and protein motifs, and other elements.

  11. Molecular delivery of plasmids for genetic vaccination.


    Mazid, Romiza; Tan, Melvin X; Danquah, Michael K


    Plasmid vaccination is a smart gene delivery application mostly achieved through the utilisation of viral or copolymeric systems as surrogated carriers in micro or nano formulations. A common polymeric protocol for plasmid vaccine formulation, which as somewhat been successful, is via the complexation of the DNA molecules with a cationic polymer, and encapsulating in a vehicular carrier polymer. Even though plasmid vaccination research has not witnessed the much anticipated success, due a number of cellular and physicochemical reasons, application of copolymeric carriers with tight functionalities is a promising strategy to optimally deliver the DNA molecules; in view of the available chemistries and physical properties that could be tuned to enable enhanced targeted delivery, uptake and specific transfection. This also enables the targeting of specific epitopes and antigen presenting cells for the treatment of many pathogenic infections and cancer. This paper provides a brief critical review of the current state of plasmid vaccines formulation and molecular delivery with analysis of performance data obtained from clinical trials.

  12. Diversity, biology and evolution of IncQ-family plasmids.


    Loftie-Eaton, Wesley; Rawlings, Douglas E


    Plasmids of IncQ-family are distinguished by having a unique strand-displacement mechanism of replication that is capable of functioning in a wide variety of bacterial hosts. In addition, these plasmids are highly mobilizable and therefore very promiscuous. Common features of the replicons have been used to identify IncQ-family plasmids in DNA sequence databases and in this way several unstudied plasmids have been compared to more well-studied IncQ plasmids. We propose that IncQ plasmids can be divided into four subgroups based on a number of mutually supportive criteria. The most important of these are the amino acid sequences of their three essential replication proteins and the observation that the replicon of each subgroup has become fused to four different lineages of mobilization genes. This review of IncQ-family plasmid diversity has highlighted several events in the evolution of these plasmids and raised several questions for further research.

  13. A novel method of plasmid isolation using laundry detergent.


    Yadav, P; Yadav, A; Garg, V; Datta, T K; Goswami, S L; De, S


    Since the discovery of plasmid, various methods have been developed to isolate plasmid DNA. All the methods have one common and important target of isolating plasmid DNA of high quality and quantity in less time. These methods are not completely safe because of use of toxic chemicals compounds. The developed protocol for plasmid extraction is based on the alkaline lysis method of plasmid preparation (extraction atpH 8.0) with slight modifications. Cell lysis reagent sodium dodecyl sulfate is replaced by lipase enzyme present in laundry detergent. A good plasmid preparation can be made, which is well suited for subsequent molecular biology applications. By taking safety measures on count, contaminants like, RNA and protein can be completely avoided with maximized plasmid yield. The resultant plasmid quality and quantity can be well comparable to other prevalent methods.

  14. Antibiotic resistance and R-plasmids in food chain Salmonella: evidence of plasmid relatedness.

    PubMed Central

    Bezanson, G S; Pauzé, M; Lior, H


    A large number of strains (1,783) belonging to 15 Salmonella serovars isolated, in Canada, from the three major links of the human food chain were screened for multiple antibiotic resistance and the presence of R-plasmids. Multiresistant strains occurred among animal feed, livestock, and human isolates at frequencies of 4, 22, and 14%, respectively. Conjugation analysis revealed that 58% of the isolates from feeds, 87% of those from livestock, and 89% of the human strains carried all or part of their resistance determinants extrachromosomally on R-plasmids. Conjugative plasmids representing nine different incompatibility groups were detected, with the Inc I alpha group being predominant. Within the limits of the parameters measured, certain of these plasmids show a degree of relatedness suggestive of a common ancestry. PMID:7013704

  15. Endogenous mutagenesis in recombinant sulfolobus plasmids.


    Sakofsky, Cynthia J; Grogan, Dennis W


    Low rates of replication errors in chromosomal genes of Sulfolobus spp. demonstrate that these extreme thermoacidophiles can maintain genome integrity in environments with high temperature and low pH. In contrast to this genetic stability, we observed unusually frequent mutation of the β-D-glycosidase gene (lacS) of a shuttle plasmid (pJlacS) propagated in Sulfolobus acidocaldarius. The resulting Lac(-) mutants also grew faster than the Lac(+) parent, thereby amplifying the impact of the frequent lacS mutations on the population. We developed a mutant accumulation assay and corrections for the effects of copy number and differential growth for this system; the resulting measurements and calculations yielded a corrected rate of 5.1 × 10(-4) mutational events at the lacS gene per plasmid replication. Analysis of independent lacS mutants revealed three types of mutations: (i) G · C-to-A · T transitions, (ii) slipped-strand events, and (iii) deletions. These mutations were frequent in plasmid-borne lacS expressed at a high level but not in single-copy lacS in the chromosome or at lower levels of expression in a plasmid. Substitution mutations arose at only two of 12 potential priming sites of the DNA primase of the pRN1 replicon, but nearly all these mutations created nonsense (chain termination) codons. The spontaneous mutation rate of plasmid-borne lacS was 175-fold higher under high-expression than under low-expression conditions. The results suggest that important DNA repair or replication fidelity functions are impaired or overwhelmed in pJlacS, with results analogous to those of the "transcription-associated mutagenesis" seen in bacteria and eukaryotes.

  16. Antibiotic multiresistance plasmid pRSB101 isolated from a wastewater treatment plant is related to plasmids residing in phytopathogenic bacteria and carries eight different resistance determinants including a multidrug transport system.


    Szczepanowski, Rafael; Krahn, Irene; Linke, Burkhard; Goesmann, Alexander; Pühler, Alfred; Schlüter, Andreas


    Ten different antibiotic resistance plasmids conferring high-level erythromycin resistance were isolated from an activated sludge bacterial community of a wastewater treatment plant by applying a transformation-based approach. One of these plasmids, designated pRSB101, mediates resistance to tetracycline, erythromycin, roxythromycin, sulfonamides, cephalosporins, spectinomycin, streptomycin, trimethoprim, nalidixic acid and low concentrations of norfloxacin. Plasmid pRSB101 was completely sequenced and annotated. Its size is 47 829 bp. Conserved synteny exists between the pRSB101 replication/partition (rep/par) module and the pXAC33-replicon from the phytopathogen Xanthomonas axonopodis pv. citri. The second pRSB101 backbone module encodes a three-Mob-protein type mobilization (mob) system with homology to that of IncQ-like plasmids. Plasmid pRSB101 is mobilizable with the help of the IncP-1alpha plasmid RP4 providing transfer functions in trans. A 20 kb resistance region on pRSB101 is located within an integron-containing Tn402-like transposon. The variable region of the class 1 integron carries the genes dhfr1 for a dihydrofolate reductase, aadA2 for a spectinomycin/streptomycin adenylyltransferase and bla(TLA-2) for a so far unknown Ambler class A extended spectrum beta-lactamase. The integron-specific 3'-segment (qacEDelta1-sul1-orf5Delta) is connected to a macrolide resistance operon consisting of the genes mph(A) (macrolide 2'-phosphotransferase I), mrx (hydrophobic protein of unknown function) and mphR(A) (regulatory protein). Finally, a putative mobile element with the tetracycline resistance genes tetA (tetracycline efflux pump) and tetR was identified upstream of the Tn402-specific transposase gene tniA. The second 'genetic load' region on pRSB101 harbours four distinct mobile genetic elements, another integron belonging to a new class and footprints of two more transposable elements. A tripartite multidrug (MDR) transporter consisting of an ATP

  17. Photoreactivation of Ultraviolet-Irradiated, Plasmid-Bearing and Plasmid-Free Strains of Bacillus anthracis

    DTIC Science & Technology


    NUMBER __ vation Bacillus anthracis) ś 7. AUTHOR(’a) B.KusnShD . CONTRACT OR GRANT NUMBER(a) PERFORMING ORGANIZATION NAME AND ADDRESS 10. PROGRAM ELEMENT... Bacillus anthracis, anthrax, photoreactivation, DNA repair, plasmid A6SSTACT (Cinvt ass,.yme eEb ir "mease wy f dentif by block nlmbaw) Iee. he...effects of toxin- a’nd capsule-encoding plasmids on the kinetics of UIV inactivation of various strains of Bacillus anthracis were investigated. :Z

  18. Complete dissociation and reassembly behavior as studied by using poly(ethylene glycol)-block-poly(glutamate sodium) and kanamycin A.


    Wen, Hao; Pan, Wei; Zhou, Jihan; Li, Zhibo; Liang, Dehai


    Kanamycin A, an amino modified sugar, can interact with poly(ethylene glycol)-block-poly(glutamate sodium) (PEG114-PGlu64) via electrostatic interactions (with PGlu) and hydrogen bonding (with PEG). The interplay of these two forces determines the assembly process and the resulting structure. In deionized water, kanamycin A and PEG114-PGlu64 form a spherical structure at [+]/[-] = 3.5. This structure dissociates instantly and completely in the presence of 30 mM NaCl. However, a new structure is reassembled in about 2 hours. A similar phenomenon is observed when the buffer pH is increased from 7.8 to 8.3. We attribute the distinct dissociation/reassembly process to the reestablishment of the balance between electrostatic interactions and hydrogen bonding. The dissociation/reassembly process in response to environmental changes offers a novel approach to release the loaded cargo in a controlled manner.

  19. Plasmid DNA gene therapy by electroporation: principles and recent advances.


    Murakami, Tatsufumi; Sunada, Yoshihide


    Simple plasmid DNA injection is a safe and feasible gene transfer method, but it confers low transfection efficiency and transgene expression. This non-viral gene transfer method is enhanced by physical delivery methods, such as electroporation and the use of a gene gun. In vivo electroporation has been rapidly developed over the last two decades to deliver DNA to various tissues or organs. It is generally considered that membrane permeabilization and DNA electrophoresis play important roles in electro-gene transfer. Skeletal muscle is a well characterized target tissue for electroporation, because it is accessible and allows for long-lasting gene expression ( > one year). Skin is also a target tissue because of its accessibility and immunogenicity. Numerous studies have been performed using in vivo electroporation in animal models of disease. Clinical trials of DNA vaccines and immunotherapy for cancer treatment using in vivo electroporation have been initiated in patients with melanoma and prostate cancer. Furthermore, electroporation has been applied to DNA vaccines for infectious diseases to enhance immunogenicity, and the relevant clinical trials have been initiated. The gene gun approach is also being applied for the delivery of DNA vaccines against infectious diseases to the skin. Here, we review recent advances in the mechanism of in vivo electroporation, and summarize the findings of recent preclinical and clinical studies using this technology.

  20. Complete nucleotide sequence of Klebsiella pneumoniae multidrug resistance plasmid pKP048, carrying blaKPC-2, blaDHA-1, qnrB4, and armA.


    Jiang, Yan; Yu, Dongliang; Wei, Zeqing; Shen, Ping; Zhou, Zhihui; Yu, Yunsong


    The Klebsiella pneumoniae multidrug resistance plasmid pKP048 was completely sequenced. This plasmid carries several important resistance determinants, such as bla(KPC-2), bla(DHA-1), qnrB4, and armA, which confer resistance to carbapenems, cephalosporins, fluoroquinolones, and aminoglycosides, respectively. Analysis of the finished 151,188-bp sequence data revealed 163 putative genes, 108 of which were assigned functions such as replication, stable inheritance, antibiotic resistance, a mobile element, conjugal transfer, and a restriction-modification system, showing the strong phylogenetic mosaicism and plasticity of the plasmid.

  1. Comparative study of kanamycin sulphate microparticles and nanoparticles for intramuscular administration: preparation in vitro release and preliminary in vivo evaluation.


    Mustafa, Sanaul; Devi, V Kusum; Pai, Roopa S


    Kanamycin sulphate (KS) is a Mycobacterium tuberculosis protein synthesis inhibitor. KS is polycationic, a property responsible for KS poor oral absorption half-life (2.5 h) and rapid renal clearance, which results in serious nephrotoxicity/ototoxicity. The current study aimed to develop KS-loaded PLGA vitamin-E-TPGS microparticles (MPs) and nanoparticles (NPs) to reduce the dosing frequency and dose-related adverse effect. In vitro release was sustained up to 10 days for KS PLGA-TPGS MPs and 13 days for KS PLGA-TPGS NPs in phosphate-buffered saline (PBS) pH 7.4. The in vivo pharmacokinetic test in Wistar rats showed that the AUC0-∞ of KS PLGA-TPGS NPs (280.58 μg/mL*min) was about 1.62-fold higher than that of KS PLGA-TPGS MPs (172.30 μg/mL*min). Further, in vivo protein-binding assay ascribed 1.20-fold increase in the uptake of KS PLGA-TPGS NPs through the alveolar macrophage (AM). The studies, therefore, could provide another useful tool for successful development of KS MPs and NPs.

  2. Conformational Response of 30S-bound IF3 to A-Site Binders Streptomycin and Kanamycin

    PubMed Central

    Chulluncuy, Roberto; Espiche, Carlos; Nakamoto, Jose Alberto; Fabbretti, Attilio; Milón, Pohl


    Aminoglycoside antibiotics are widely used to treat infectious diseases. Among them, streptomycin and kanamycin (and derivatives) are of importance to battle multidrug-resistant (MDR) Mycobacterium tuberculosis. Both drugs bind the small ribosomal subunit (30S) and inhibit protein synthesis. Genetic, structural, and biochemical studies indicate that local and long-range conformational rearrangements of the 30S subunit account for this inhibition. Here, we use intramolecular FRET between the C- and N-terminus domains of the flexible IF3 to monitor real-time perturbations of their binding sites on the 30S platform. Steady and pre-steady state binding experiments show that both aminoglycosides bring IF3 domains apart, promoting an elongated state of the factor. Binding of Initiation Factor IF1 triggers closure of IF3 bound to the 30S complex, while both aminoglycosides revert the IF1-dependent conformation. Our results uncover dynamic perturbations across the 30S subunit, from the A-site to the platform, and suggest that both aminoglycosides could interfere with prokaryotic translation initiation by modulating the interaction between IF3 domains with the 30S platform. PMID:27983590

  3. Synthesis, characterization and in vitro evaluation of amphiphilic ion pairs of erythromycin and kanamycin antibiotics with liposaccharides.


    Pignatello, Rosario; Simerska, Pavla; Leonardi, Antonio; Abdelrahim, Adel S; Petronio, Giulio Petronio; Fuochi, Virginia; Furneri, Pio Maria; Ruozi, Barbara; Toth, Istvan


    The hydrophilic ion paring strategy (HIP) is a method explored to improve the cell/tissue uptake of poorly adsorbed drugs and to optimize their physico-chemical characteristics. In this context, we here describe the synthesis of some ion pairs of two model cationic antibiotics, erythromycin (ERY) and kanamycin A (KAN), with liposaccharides having different levels of lipophilicity and charge. The formation of drug-liposaccharide complexes was confirmed by Fourier transform infrared spectroscopy (FT-IR), differential scanning calorimetry (DSC) and powder X-ray diffraction (PXRD) analysis. The effect of the amphiphilic liposaccharide moieties on the antimicrobial activity of ERY and KAN was assessed by measuring the minimal inhibitory concentration (MIC) of the compounds against a panel of bacterial strains that were susceptible or resistant to the parent antibiotics. The ion pairing did not depress the in vitro antibiotic activity, although no lowering of MIC values was registered. The experimental findings would motivate the future investigation of this ion pairing strategy in drug design, for instance allowing improvement of the encapsulation efficiency of hydrophilic antibiotics in lipid-based nanocarriers, or changing their in vivo biodistribution and pharmacokinetic profile.

  4. Immunosensor based on magnetic relaxation switch and biotin-streptavidin system for the detection of Kanamycin in milk.


    Chen, Yi Ping; Zou, Ming qiang; Qi, Cai; Xie, Meng-Xia; Wang, Da-Ning; Wang, Yan-Fei; Xue, Qiang; Li, Jin-Feng; Chen, Yan


    A rapid, sensitive, and simple immunosensor was developed for the detection of Kanamycin (KM) in milk. This immunosensor is based on magnetic relaxation switch (MRS) assay and biotin-streptavidin system (B-SA system). The target analyte (KM) competed with those on the surface of the superparamagnetic iron oxide (SPIO) nanoparticles and hence affected the formation of SPIO aggregates. The dispersed and aggregated states of SPIO can modulate the spin-spin relaxation time (T(2)) of the neighboring water molecule. T(2) was then changed as an effect of the target analyte. The B-SA system was used to amplify the SPIO binding, thus enhance the sensitivity. The detection working was 1.5 to 25.2ng mL(-1) and limit of detection (LOD) was determined to be 0.1ng mL(-1). The LOD of the immunosensor decreased tenfold, and its analysis time (45min) was much shorter than that of enzyme-linked immunosorbent assay (6h to 8h). The average recoveries of the KM at various spiking levels ranged from 80.2% to 85.6% with a relative standard deviation (RSD) below 4.0%. The results showed that the MRS immunosensor was a promising platform for the determination of small molecular residues because of its high sensitivity, specificity, homogeneity, and speed.

  5. Molecular recognition of 6'-N-5-hexynoate kanamycin A and RNA 1x1 internal loops containing CA mismatches.


    Tran, Tuan; Disney, Matthew D


    In our previous study to identify the RNA internal loops that bind an aminoglycoside derivative, we determined that 6'-N-5-hexynoate kanamycin A prefers to bind 1x1 nucleotide internal loops containing C·A mismatches. In this present study, the molecular recognition between a variety of RNAs that are mutated around the C·A loop and the ligand was investigated. Studies show that both loop nucleotides and loop closing pairs affect binding affinity. Most interestingly, it was shown that there is a correlation between the thermodynamic stability of the C·A internal loops and ligand affinity. Specifically, C·A loops that had relatively high or low stability bound the ligand most weakly whereas loops with intermediate stability bound the ligand most tightly. In contrast, there is no correlation between the likelihood that a loop forms a C-A(+) pair at lower pH and ligand affinity. It was also found that a 1x1 nucleotide C·A loop that bound to the ligand with the highest affinity is identical to the consensus site in RNAs that are edited by adenosine deaminases acting on RNA type 2 (ADAR2). These studies provide a detailed investigation of factors affecting small molecule recognition of internal loops containing C·A mismatches, which are present in a variety of RNAs that cause disease.

  6. Conformational Response of 30S-bound IF3 to A-Site Binders Streptomycin and Kanamycin.


    Chulluncuy, Roberto; Espiche, Carlos; Nakamoto, Jose Alberto; Fabbretti, Attilio; Milón, Pohl


    Aminoglycoside antibiotics are widely used to treat infectious diseases. Among them, streptomycin and kanamycin (and derivatives) are of importance to battle multidrug-resistant (MDR) Mycobacterium tuberculosis. Both drugs bind the small ribosomal subunit (30S) and inhibit protein synthesis. Genetic, structural, and biochemical studies indicate that local and long-range conformational rearrangements of the 30S subunit account for this inhibition. Here, we use intramolecular FRET between the C- and N-terminus domains of the flexible IF3 to monitor real-time perturbations of their binding sites on the 30S platform. Steady and pre-steady state binding experiments show that both aminoglycosides bring IF3 domains apart, promoting an elongated state of the factor. Binding of Initiation Factor IF1 triggers closure of IF3 bound to the 30S complex, while both aminoglycosides revert the IF1-dependent conformation. Our results uncover dynamic perturbations across the 30S subunit, from the A-site to the platform, and suggest that both aminoglycosides could interfere with prokaryotic translation initiation by modulating the interaction between IF3 domains with the 30S platform.

  7. The combination effect of Korean red ginseng saponins with kanamycin and cefotaxime against methicillin-resistant Staphylococcus aureus.


    Sung, Woo Sang; Lee, Dong Gun


    Korean red ginseng saponins (ginsenosides) have been reported as having various biological properties, but the combinational effects with commercial antibiotics and the mode of action of ginsenosides remain mostly unknown. In this study, saponins were isolated from Korean red ginseng, and the antibacterial effects of ginsenosides were investigated. Ginsenosides showed antibacterial activities toward pathogenic Gram-positive and Gram-negative bacteria. To elucidate the antibacterial mode of action of ginsenosides, we measured the release of the fluorescent marker calcein from negatively charged PC/PG (1 : 1, w/w) liposomes, which mimic bacterial membranes. The results suggest that ginsenosides may exert antibacterial activity by disrupting the cell membrane. To estimate the general combination effects of ginsenosides and commercial antibiotics, such as kanamycin and cefotaxime, on antibacterial activity against methicillin-resistant Staphylococcus aureus (MRSA) strains that were clinically isolated from an infected patient, the fraction inhibitory concentration (FIC) indexes were determined by a checkerboard study. The FIC indexes showed synergistic or additive effects between the ginsenosides and antibiotics tested.

  8. A novel signal amplification strategy of an electrochemical aptasensor for kanamycin, based on thionine functionalized graphene and hierarchical nanoporous PtCu.


    Qin, Xiaoli; Yin, Yan; Yu, Huijing; Guo, Wenjuan; Pei, Meishan


    An ultrasensitive electrochemical aptasensor for the quantitative detection of kanamycin antibiotic was fabricated based on a novel signal amplification strategy. This aptasensor was developed using thionine functionalized graphene (GR-TH) and hierarchical nanoporous (HNP) PtCu alloy as biosensing substrates for the first time. HNP-PtCu alloy with controllable bimodal ligament/pore distributions was successfully prepared by two-step dealloying of a well-designed PtCuAl precursor alloy combined with an annealing operation. GR-TH composite was synthesized by one-step reduction of graphene oxide (GO) in TH solution. Greatly amplified sensitivity was achieved by using GR-TH/HNP-PtCu composite owing to its large specific surface and good electron-transfer ability. Under the optimized conditions, the proposed aptasensor exhibited a high sensitivity and a wider linearity to kanamycin in the range 5 × 10(-7)-5 × 10(-2) μgmL(-1) with a low detection limit of 0.42 pgmL(-1). This aptasensor also displayed a satisfying electrochemical performance with good stability, selectivity and reproducibility. The as-prepared aptasensor was successfully used for the determination of kanamycin in animal derived food.

  9. Gold nanorod-covered kanamycin-loaded hollow SiO2 (HSKAu(rod)) nanocapsules for drug delivery and photothermal therapy on bacteria.


    Hu, Bo; Zhang, Li-Pei; Chen, Xu-Wei; Wang, Jian-Hua


    A hybrid bactericidal material, gold nanorod-covered kanamycin-loaded hollow SiO(2) (HSKAu(rod)) nanocapsules, is constructed. The hybrid material combines the features of a chemical drug with photothermal physical sterilization which decreases the dosage of broad-spectrum antibiotic and the physical damage of biological systems. Hollow SiO(2) nanocapsules are used as carriers for drug delivery. The nanocapsules load a model drug, kanamycin, and are covered with gold nanorods to avoid drug leakage and realize photothermal treatment. The sterilizing effect on the bacterial strain is investigated by incubating E. coli BL21 with the hybrid nanocapsules and irradiating under near-infrared light (NIR) for 20 min. A bactericidal effect, i.e., a sterilizing rate of 53.47%, is achieved for the HSKAu(rod) nanocapsules under NIR irradiation, with respect to a net sum sterilizing rate of 34.49% for the individual components of the HSKAu(rod) nanocapsules, e.g., carrier nanocapsules, chemical sterilization of kanamycin and physical sterilization due to the gold nanorods under NIR irradiation. It is demonstrated that the combination of chemical drug and physical sterilization results in an obvious synergistic effect and makes the sterilization more effective. This novel hybrid has great potential as an adjuvant therapeutic alternative material for sterilization or even for the control of disease.

  10. Gold nanorod-covered kanamycin-loaded hollow SiO2 (HSKAurod) nanocapsules for drug delivery and photothermal therapy on bacteria

    NASA Astrophysics Data System (ADS)

    Hu, Bo; Zhang, Li-Pei; Chen, Xu-Wei; Wang, Jian-Hua


    A hybrid bactericidal material, gold nanorod-covered kanamycin-loaded hollow SiO2 (HSKAurod) nanocapsules, is constructed. The hybrid material combines the features of a chemical drug with photothermal physical sterilization which decreases the dosage of broad-spectrum antibiotic and the physical damage of biological systems. Hollow SiO2 nanocapsules are used as carriers for drug delivery. The nanocapsules load a model drug, kanamycin, and are covered with gold nanorods to avoid drug leakage and realize photothermal treatment. The sterilizing effect on the bacterial strain is investigated by incubating E. coli BL21 with the hybrid nanocapsules and irradiating under near-infrared light (NIR) for 20 min. A bactericidal effect, i.e., a sterilizing rate of 53.47%, is achieved for the HSKAurod nanocapsules under NIR irradiation, with respect to a net sum sterilizing rate of 34.49% for the individual components of the HSKAurod nanocapsules, e.g., carrier nanocapsules, chemical sterilization of kanamycin and physical sterilization due to the gold nanorods under NIR irradiation. It is demonstrated that the combination of chemical drug and physical sterilization results in an obvious synergistic effect and makes the sterilization more effective. This novel hybrid has great potential as an adjuvant therapeutic alternative material for sterilization or even for the control of disease.

  11. Bacteriophage selection against a plasmid-encoded sex apparatus leads to the loss of antibiotic-resistance plasmids.


    Jalasvuori, Matti; Friman, Ville-Petri; Nieminen, Anne; Bamford, Jaana K H; Buckling, Angus


    Antibiotic-resistance genes are often carried by conjugative plasmids, which spread within and between bacterial species. It has long been recognized that some viruses of bacteria (bacteriophage; phage) have evolved to infect and kill plasmid-harbouring cells. This raises a question: can phages cause the loss of plasmid-associated antibiotic resistance by selecting for plasmid-free bacteria, or can bacteria or plasmids evolve resistance to phages in other ways? Here, we show that multiple antibiotic-resistance genes containing plasmids are stably maintained in both Escherichia coli and Salmonella enterica in the absence of phages, while plasmid-dependent phage PRD1 causes a dramatic reduction in the frequency of antibiotic-resistant bacteria. The loss of antibiotic resistance in cells initially harbouring RP4 plasmid was shown to result from evolution of phage resistance where bacterial cells expelled their plasmid (and hence the suitable receptor for phages). Phages also selected for a low frequency of plasmid-containing, phage-resistant bacteria, presumably as a result of modification of the plasmid-encoded receptor. However, these double-resistant mutants had a growth cost compared with phage-resistant but antibiotic-susceptible mutants and were unable to conjugate. These results suggest that bacteriophages could play a significant role in restricting the spread of plasmid-encoded antibiotic resistance.

  12. Dissemination of plasmid-encoded AmpC β-lactamases in antimicrobial resistant Salmonella serotypes originating from humans, pigs and the swine environment.


    Keelara, Shivaramu; Thakur, Siddhartha


    The aim of this study was to characterize and determine the inter-serovar exchange of AmpC β-lactamase conferring plasmids isolated from humans, pigs and the swine environment. Plasmids isolated from a total of 21 antimicrobial resistant (AMR) Salmonella isolates representing human clinical cases (n=6), pigs (n=6) and the swine farm environment (n=9) were characterized by replicon typing and restriction digestion, inter-serovar transferability by conjugation, and presence of AmpC β-lactamase enzyme encoding gene blaCMY-2 by southern hybridization. Based on replicon typing, the majority (17/21, 81%) of the plasmids belonged to the I1-Iγ Inc group and were between 70 and 103kb. The potential for inter-serovar plasmid transfer was further confirmed by the PCR detection of AMR genes on the plasmids isolated from trans-conjugants. Plasmids from Salmonella serovars Anatum, Ouakam, Johannesburg and Typhimurium isolated from the same cohort of pigs and their environment and S. Heidelberg from a single human clinical isolate had identical plasmids based on digestion with multiple restriction enzymes (EcoRI, HindIII and PstI) and southern blotting. We demonstrated likely horizontal inter-serovar exchange of plasmid-encoding AmpC β-lactamases resistance among MDR Salmonella serotypes isolated from pigs, swine farm environment and clinical human cases. This study provides valuable information on the role of the swine farm environment and by extension other livestock farm environments, as a potential reservoir of resistant bacterial strains that potentially transmit resistance determinants to livestock, in this case, swine, humans and possibly other hosts by horizontal exchange of plasmids.

  13. Plasmids of Distinct IncK Lineages Show Compatible Phenotypes

    PubMed Central

    Rozwandowicz, Marta; Brouwer, Michael S. M.; Zomer, Aldert L.; Bossers, Alex; Harders, Frank; Mevius, Dik J.; Wagenaar, Jaap A.


    ABSTRACT IncK plasmids are some of the main carriers of blaCTX-M-14 and blaCMY-2 genes and show high similarity to other plasmids belonging to the I complex, including IncB/O plasmids. Here, we studied the phylogenetic relationship of 37 newly sequenced IncK and IncB/O plasmids. We show that IncK plasmids can be divided into two compatible lineages named IncK1 and IncK2. PMID:28052854

  14. Plasmid flux in Escherichia coli ST131 sublineages, analyzed by plasmid constellation network (PLACNET), a new method for plasmid reconstruction from whole genome sequences.


    Lanza, Val F; de Toro, María; Garcillán-Barcia, M Pilar; Mora, Azucena; Blanco, Jorge; Coque, Teresa M; de la Cruz, Fernando


    Bacterial whole genome sequence (WGS) methods are rapidly overtaking classical sequence analysis. Many bacterial sequencing projects focus on mobilome changes, since macroevolutionary events, such as the acquisition or loss of mobile genetic elements, mainly plasmids, play essential roles in adaptive evolution. Existing WGS analysis protocols do not assort contigs between plasmids and the main chromosome, thus hampering full analysis of plasmid sequences. We developed a method (called plasmid constellation networks or PLACNET) that identifies, visualizes and analyzes plasmids in WGS projects by creating a network of contig interactions, thus allowing comprehensive plasmid analysis within WGS datasets. The workflow of the method is based on three types of data: assembly information (including scaffold links and coverage), comparison to reference sequences and plasmid-diagnostic sequence features. The resulting network is pruned by expert analysis, to eliminate confounding data, and implemented in a Cytoscape-based graphic representation. To demonstrate PLACNET sensitivity and efficacy, the plasmidome of the Escherichia coli lineage ST131 was analyzed. ST131 is a globally spread clonal group of extraintestinal pathogenic E. coli (ExPEC), comprising different sublineages with ability to acquire and spread antibiotic resistance and virulence genes via plasmids. Results show that plasmids flux in the evolution of this lineage, which is wide open for plasmid exchange. MOBF12/IncF plasmids were pervasive, adding just by themselves more than 350 protein families to the ST131 pangenome. Nearly 50% of the most frequent γ-proteobacterial plasmid groups were found to be present in our limited sample of ten analyzed ST131 genomes, which represent the main ST131 sublineages.

  15. Plasmid Flux in Escherichia coli ST131 Sublineages, Analyzed by Plasmid Constellation Network (PLACNET), a New Method for Plasmid Reconstruction from Whole Genome Sequences

    PubMed Central

    Garcillán-Barcia, M. Pilar; Mora, Azucena; Blanco, Jorge; Coque, Teresa M.; de la Cruz, Fernando


    Bacterial whole genome sequence (WGS) methods are rapidly overtaking classical sequence analysis. Many bacterial sequencing projects focus on mobilome changes, since macroevolutionary events, such as the acquisition or loss of mobile genetic elements, mainly plasmids, play essential roles in adaptive evolution. Existing WGS analysis protocols do not assort contigs between plasmids and the main chromosome, thus hampering full analysis of plasmid sequences. We developed a method (called plasmid constellation networks or PLACNET) that identifies, visualizes and analyzes plasmids in WGS projects by creating a network of contig interactions, thus allowing comprehensive plasmid analysis within WGS datasets. The workflow of the method is based on three types of data: assembly information (including scaffold links and coverage), comparison to reference sequences and plasmid-diagnostic sequence features. The resulting network is pruned by expert analysis, to eliminate confounding data, and implemented in a Cytoscape-based graphic representation. To demonstrate PLACNET sensitivity and efficacy, the plasmidome of the Escherichia coli lineage ST131 was analyzed. ST131 is a globally spread clonal group of extraintestinal pathogenic E. coli (ExPEC), comprising different sublineages with ability to acquire and spread antibiotic resistance and virulence genes via plasmids. Results show that plasmids flux in the evolution of this lineage, which is wide open for plasmid exchange. MOBF12/IncF plasmids were pervasive, adding just by themselves more than 350 protein families to the ST131 pangenome. Nearly 50% of the most frequent γ–proteobacterial plasmid groups were found to be present in our limited sample of ten analyzed ST131 genomes, which represent the main ST131 sublineages. PMID:25522143

  16. Comparative genetic organization of incompatibility group P degradative plasmids.

    PubMed Central

    Burlage, R S; Bemis, L A; Layton, A C; Sayler, G S; Larimer, F


    Plasmids that encode genes for the degradation of recalcitrant compounds are often examined only for characteristics of the degradative pathways and ignore regions that are necessary for plasmid replication, incompatibility, and conjugation. If these characteristics were known, then the mobility of the catabolic genes between species could be predicted and different catabolic pathways might be combined to alter substrate range. Two catabolic plasmids, pSS50 and pSS60, isolated from chlorobiphenyl-degrading strains and a 3-chlorobenzoate-degrading plasmid, pBR60, were compared with the previously described IncP group (Pseudomonas group P-1) plasmids pJP4 and R751. All three of the former plasmids were also members of the IncP group, although pBR60 is apparently more distantly related. DNA probes specific for known genetic loci were used to determine the order of homologous loci on the plasmids. In all of these plasmids the order is invariant, demonstrating the conservation of this "backbone" region. In addition, all five plasmids display at least some homology with the mercury resistance transposon, Tn501, which has been suggested to be characteristic of the beta subgroup of the IncP plasmids. Plasmids pSS50 and pSS60 have been mapped in detail, and repeat sequences that surround the suspected degradation genes are described. Images PMID:2254257

  17. Plasmids of ’Legionella’ Species

    DTIC Science & Technology


    reports of cytotoxin and 8-lactamase production and the virulent to avirulent conversion of Legionella pneumophila through serial passage on...strains of L. pneumophila and 12 strains representing four other species of Legionella were screened for the presence of plasmid DNA’ by a variety of lysing...several well-established methods. Table 1. Legionella -like Strains Legionella pneumophila Legionella bozemanii OLDA WIGA, MI-15 Legionella micdadei

  18. Plasmid Stabilization to Insure Gene Expression

    DTIC Science & Technology


    suspended colony was used to initiate growth), independent growth rate measurements and a simple mathematical model, the kinetics of the loss of the LacZ...thermophilic anaerobe, C. thermocellum, an organism which degrades cellulose and hemicellulose at high temperature and carries out a direct fermentation... Kinetics of loss of a recombinant plasmid in Bacillus subtilis. Biotechnol. Bioeng. 37: 927-935. Shoham, Y., E. Israeli, A. L. Sonenshein and A. L

  19. Transition of deletion mutants of the composite resistance plasmid NR1 in Escherichia coli and Salmonella typhimurium.

    PubMed Central

    Huffman, G A; Rownd, R H


    Derivatives of the composite R plasmid NR1 from which a portion of the resistance determinants (r-determinants) component had been deleted were found to undergo amplification of the remaining r-determinants region in Escherichia coli and Salmonella typhimurium. The wild-type NR1 plasmid does not amplify in these genera, although all of these plasmids undergo amplification in Proteus mirabilis. The deletion mutants retained the mercuric ion resistance operon (mer) but conferred a much lower level of sulfonamide resistance than NR1. The remaining r-determinants region, which is bounded by direct repeats of the insertion element IS1, formed multiple tandem duplications in E. coli, S. typhimurium, and P. mirabilis after subculturing the host cells in medium containing high concentrations of sulfonamide. Gene amplification was characterized by restriction endonuclease analysis, analytical buoyant density centrifugation, DNA-DNA hybridization, and sedimentation in sucrose gradients. The tandem repeats remained attached to the resistance transfer factor component of the plasmid in at least part of the plasmid population; autonomous tandem repeats of r-determinants were probably also present. Amplification did not occur in host recA mutants. Amplified strains subcultured in drug-free medium lost the amplified r-determinants. By using a strain temperature sensitive for the recA gene, it was possible to obtain gene amplification at the permissive temperature. Loss of r-determinants took place at the permissive temperature, but not at the nonpermissive temperature. The termini of the deletions of several independent mutants which conferred low sulfonamide resistance were found to be located within the adjacent streptomycin-spectinomycin resistance gene. Images PMID:6086573

  20. Asbestos fibers mediate transformation of monkey cells by exogenous plasmid DNA

    SciTech Connect

    Appel, J.D.; Fasy, T.M.; Kohtz, D.S.; Kohtz, J.D.; Johnson, E.M. )


    The authors have tested the ability of chrysotile asbestos fibers to introduce plasmid DNA into monkey COS-7 cells and the ability of this DNA to function in both replication and gene expression. Chrysotile fibers are at least as effective as calcium phosphate in standard transfection assays at optimal ratios of asbestos to DNA. After transfection with chrysotile, a minor percentage of introduced plasmid DNA bearing a simian virus 40 origin of replication replicates after 24 hr. Fragmentation of entering DNA is more prominent with asbestos than with calcium phosphate, and after 72 hr most DNA introduced by asbestos is associated with chromosomal DNA. Cells transfected with plasmid p11-4, bearing the p53 protooncogene, express this gene. Cells transfected with pSV2-neo express a gene conferring resistance of antibiotic G418, allowing isolation of colonies of transformed cells after 18 days. The introduction of exogenous DNA into eukaryotic cells could cause mutations in several ways and thus contribute to asbestos-induced oncogenesis.

  1. Cloning and expression of plasmid genes encoding resistances to chromate and cobalt in Alcaligenes eutrophus.

    PubMed Central

    Nies, A; Nies, D H; Silver, S


    Resistances to chromate and cobalt were cloned on a 30-kilobase-pair (kb) DNA region from the large Alcaligenes eutrophus plasmid pMOL28 into the broad-host-range mobilizable cosmid vector pVK102. A restriction nuclease map of the 30-kb region was generated. The resistances expressed from the hybrid plasmids after transfer back into A. eutrophus were inducible and conferred the same degree of resistance as the parent plasmid pMOL28. Resistances were expressed in metal-sensitive Alcaligenes strains and related bacteria but not in Escherichia coli. Resistance to chromate was further localized on a 2.6-kb EcoRI fragment, and resistance to cobalt was localized on an adjoining 8.5-kb PstI-EcoRI fragment. When the 2.6-kb EcoRI fragment was expressed in E. coli under the control of a bacteriophage T7 promoter, three polypeptides with molecular masses of 31,500, 21,000, and 14,500 daltons were visible on autoradiograms. The 31,500- and 21,000-dalton polypeptides were membrane bound; the 14,500-dalton polypeptide was soluble. Images PMID:2549011

  2. Metal chelate affinity precipitation of RNA and purification of plasmid DNA

    NASA Technical Reports Server (NTRS)

    Balan, Sindhu; Murphy, Jason; Galaev, Igor; Kumar, Ashok; Fox, George E.; Mattiasson, Bo; Willson, Richard C.


    The affinity of metal chelates for amino acids, such as histidine, is widely used in purifying proteins, most notably through six-histidine 'tails'. We have found that metal affinity interactions can also be applied to separation of single-stranded nucleic acids through interactions involving exposed purines. Here we describe a metal affinity precipitation method to resolve RNA from linear and plasmid DNA. A copper-charged copolymer of N-isopropyl acrylamide (NIPAM) and vinyl imidazole (VI) is used to purify plasmid from an alkaline lysate of E. coli. The NIPAM units confer reversible solubility on the copolymer while the imidazole chelates metal ions in a manner accessible to interaction with soluble ligands. RNA was separated from the plasmid by precipitation along with the polymer in the presence of 800 mM NaCl. Bound RNA could be recovered by elution with imidazole and separated from copolymer by a second precipitation step. RNA binding showed a strong dependence on temperature and on the type of buffer used.

  3. The Influence of Biofilms in the Biology of Plasmids.


    Cook, Laura C C; Dunny, Gary M


    The field of plasmid biology has historically focused on bacteria growing in liquid culture. Surface-attached communities of bacterial biofilms have recently been understood to be the normal environment of bacteria in the natural world. Thus, studies examining plasmid replication, maintenance, and transfer in biofilms are essential for a true understanding of bacterial plasmid biology. This article reviews the current knowledge of the interplay between bacterial biofilms and plasmids, focusing on the role of plasmids in biofilm development and the role of biofilms in plasmid maintenance, copy-number control, and transfer. The studies examined herein highlight the importance of biofilms as an important ecological niche in which bacterial plasmids play an essential role.

  4. Genetic characterization of plasmid-mediated quinolone resistance gene qnrS2 in Pseudoalteromonas and Shewanella isolates from seawater.


    Zhao, Jing-Yi; Zhao, Shu-Mei; Mu, Xiao-Dong; Xiao, Zijun


    Three qnrS2-containing isolates of Pseudoalteromonas and Shewanella were collected from the seawater samples of Qingdao in China during 2014. They displayed resistance to ampicillin, ciprofloxacin, kanamycin, nalidixic acid and sulfamethoxazole. The qnrS2 genes were identified in the chromosomes of Pseudoalteromonas strain E8 and S16, and in a 140-kb plasmid in Shewanella strain S14, respectively. In addition, two copies of qnrS2 were identified in the strain E8. Sequence analyses revealed that there was an identical DNA segment located in the downstream of qnrS2 in strain S14 and E8, coding for a TetR transcriptional regulator, two putative integrases and a hypothetical protein. However, different genetic structures were identified in the upstream sequences: the terB gene associated with tellurite resistance in the strain S14, and a putative integron with dfrA6 and aadA13 gene cassettes or the Tn7-related gene complex tnsABC in the strain E8. In Pseudoalteromonas strain S16, qnrS2 was bracketed by the endonuclease I and III genes, and the electron transport complex rsxCDGE was located in the upstream sequences. This is the first report of two copies of the qnrS2 gene existing in one bacterial chromosome, and also the first identification of qnrS2 in Shewanella.

  5. Specific targeted integration of kanamycin resistance-associated nonselectable DNA in the genome of the yeast Saccharomyces cerevisiae.


    Waghmare, Sanjeev K; Caputo, Valentina; Radovic, Slobodanka; Bruschi, Carlo V


    Sophisticated genome manipulation requires the possibility to modify any intergenic or intragenic DNA sequence at will, without leaving large amounts of undesired vector DNA at the site of alteration. To this end, a series of vectors was developed from a previous gene knockout plasmid system to integrate nonselectable foreign DNA at any desired genomic location in yeast, with a minimum amount of residual plasmid DNA. These vectors have two mutated Flp recognition targets (FRT) sequences flanking the KanMX4 gene and multiple sites for subcloning the DNA fragment to be integrated. The selectable marker can be recycled by Flp site-specific excision between the identical FRTs, thereby allowing the integration of further DNA fragments. With this system, the NLS-tetR-GFP and DsRed genes were successfully integrated at the thr1 locus, and the RVB1 gene was tagged at the C-terminus with the V5-epitope-6-histidine tag. This plasmid system provides for a new molecular tool to integrate any DNA fragment at any genome location in [cir+] yeast strains. Moreover, the system can be extrapolated to other eukaryotic cells in which the FLP/FRT system functions efficiently.

  6. Modeling sRNA-Regulated Plasmid Maintenance

    PubMed Central

    Klumpp, Stefan


    We study a theoretical model for the toxin-antitoxin (hok/sok) mechanism for plasmid maintenance in bacteria. Toxin-antitoxin systems enforce the maintenance of a plasmid through post-segregational killing of cells that have lost the plasmid. Key to their function is the tight regulation of expression of a protein toxin by an sRNA antitoxin. Here, we focus on the nonlinear nature of the regulatory circuit dynamics of the toxin-antitoxin mechanism. The mechanism relies on a transient increase in protein concentration rather than on the steady state of the genetic circuit. Through a systematic analysis of the parameter dependence of this transient increase, we confirm some known design features of this system and identify new ones: for an efficient toxin-antitoxin mechanism, the synthesis rate of the toxin’s mRNA template should be lower that of the sRNA antitoxin, the mRNA template should be more stable than the sRNA antitoxin, and the mRNA-sRNA complex should be more stable than the sRNA antitoxin. Moreover, a short half-life of the protein toxin is also beneficial to the function of the toxin-antitoxin system. In addition, we study a therapeutic scenario in which a competitor mRNA is introduced to sequester the sRNA antitoxin, causing the toxic protein to be expressed. PMID:28085919

  7. Plasmid R6K replication control.


    Rakowski, Sheryl A; Filutowicz, Marcin


    The focus of this minireview is the replication control of the 39.9-kb plasmid R6K and its derivatives. Historically, this plasmid was thought to have a narrow host range but more recent findings indicate that its derivatives can replicate in a variety of enteric and non-enteric bacterial species (Wild et al., 2004). In the four-plus decades since it was first described, R6K has proven to be an excellent model for studies of plasmid DNA replication. In part this is because of its similarities to other systems in which replication is activated and regulated by Rep protein and iteron-containing DNA. However its apparent idiosynchracies have also added to its significance (e.g., independent and co-dependent replication origins, and Rep dimers that stably bind iterons). Here, we survey the current state of knowledge regarding R6K replication and place individual regulatory elements into a proposed homeostatic model with implications for the biological significance of R6K and its multiple origins of replication.

  8. Conjugative transfer of an IncA/C plasmid-borne blaCMY-2 gene through genetic re-arrangements with an IncX1 plasmid

    PubMed Central


    Background Our observation that in the Mexican Salmonella Typhimurium population none of the ST19 and ST213 strains harbored both the Salmonella virulence plasmid (pSTV) and the prevalent IncA/C plasmid (pA/C) led us to hypothesize that restriction to horizontal transfer of these plasmids existed. We designed a conjugation scheme using ST213 strain YU39 as donor of the blaCMY-2 gene (conferring resistance to ceftriaxone; CRO) carried by pA/C, and two E. coli lab strains (DH5α and HB101) and two Typhimurium ST19 strains (SO1 and LT2) carrying pSTV as recipients. The aim of this study was to determine if the genetic background of the different recipient strains affected the transfer frequencies of pA/C. Results YU39 was able to transfer CRO resistance, via a novel conjugative mechanism, to all the recipient strains although at low frequencies (10-7 to 10-10). The presence of pSTV in the recipients had little effect on the conjugation frequency. The analysis of the transconjugants showed that three different phenomena were occurring associated to the transfer of blaCMY-2: 1) the co-integration of pA/C and pX1; 2) the transposition of the CMY region from pA/C to pX1; or 3) the rearrangement of pA/C. In addition, the co-lateral mobilization of a small (5 kb) ColE1-like plasmid was observed. The transconjugant plasmids involving pX1 re-arrangements (either via co-integration or ISEcp1-mediated transposition) obtained the capacity to conjugate at very high levels, similar to those found for pX1 (10-1). Two versions of the region containing blaCMY-2 were found to transpose to pX1: the large version was inserted into an intergenic region located where the “genetic load” operons are frequently inserted into pX1, while the short version was inserted into the stbDE operon involved in plasmid addiction system. This is the first study to report the acquisition of an extended spectrum cephalosporin (ESC)-resistance gene by an IncX1 plasmid. Conclusions We showed that the

  9. Plasmid-Encoded Tetracycline Efflux Pump Protein Alters Bacterial Stress Responses and Ecological Fitness of Acinetobacter oleivorans

    PubMed Central

    Hong, Hyerim; Jung, Jaejoon; Park, Woojun


    Acquisition of the extracellular tetracycline (TC) resistance plasmid pAST2 affected host gene expression and phenotype in the oil-degrading soil bacterium, Acinetobacter oleivorans DR1. Whole-transcriptome profiling of DR1 cells harboring pAST2 revealed that all the plasmid genes were highly expressed under TC conditions, and the expression levels of many host chromosomal genes were modulated by the presence of pAST2. The host energy burden imposed by replication of pAST2 led to (i) lowered ATP concentrations, (ii) downregulated expression of many genes involved in cellular growth, and (iii) reduced growth rate. Interestingly, some phenotypes were restored by deleting the plasmid-encoded efflux pump gene tetH, suggesting that the membrane integrity changes resulting from the incorporation of efflux pump proteins also resulted in altered host response under the tested conditions. Alteration of membrane integrity by tetH deletion was shown by measuring permeability of fluorescent probe and membrane hydrophobicity. The presence of the plasmid conferred peroxide and superoxide resistance to cells, but only peroxide resistance was diminished by tetH gene deletion, suggesting that the plasmid-encoded membrane-bound efflux pump protein provided peroxide resistance. The downregulation of fimbriae-related genes presumably led to reduced swimming motility, but this phenotype was recovered by tetH gene deletion. Our data suggest that not only the plasmid replication burden, but also its encoded efflux pump protein altered host chromosomal gene expression and phenotype, which also alters the ecological fitness of the host in the environment. PMID:25229538

  10. Identification of pOENI-1 and related plasmids in Oenococcus oeni strains performing the malolactic fermentation in wine.


    Favier, Marion; Bilhère, Eric; Lonvaud-Funel, Aline; Moine, Virginie; Lucas, Patrick M


    Plasmids in lactic acid bacteria occasionally confer adaptive advantages improving the growth and behaviour of their host cells. They are often associated to starter cultures used in the food industry and could be a signature of their superiority. Oenococcus oeni is the main lactic acid bacteria species encountered in wine. It performs the malolactic fermentation that occurs in most wines after alcoholic fermentation and contributes to their quality and stability. Industrial O. oeni starters may be used to better control malolactic fermentation. Starters are selected empirically by virtue of their fermentation kinetics and capacity to survive in wine. This study was initiated with the aim to determine whether O. oeni contains plasmids of technological interest. Screening of 11 starters and 33 laboratory strains revealed two closely related plasmids, named pOENI-1 (18.3-kb) and pOENI-1v2 (21.9-kb). Sequence analyses indicate that they use the theta mode of replication, carry genes of maintenance and replication and two genes possibly involved in wine adaptation encoding a predicted sulphite exporter (tauE) and a NADH:flavin oxidoreductase of the old yellow enzyme family (oye). Interestingly, pOENI-1 and pOENI-1v2 were detected only in four strains, but this included three industrial starters. PCR screenings also revealed that tauE is present in six of the 11 starters, being probably inserted in the chromosome of some strains. Microvinification assays performed using strains with and without plasmids did not disclose significant differences of survival in wine or fermentation kinetics. However, analyses of 95 wines at different phases of winemaking showed that strains carrying the plasmids or the genes tauE and oye were predominant during spontaneous malolactic fermentation. Taken together, the results revealed a family of related plasmids associated with industrial starters and indigenous strains performing spontaneous malolactic fermentation that possibly

  11. Identification of pOENI-1 and Related Plasmids in Oenococcus oeni Strains Performing the Malolactic Fermentation in Wine

    PubMed Central

    Favier, Marion; Bilhère, Eric; Lonvaud-Funel, Aline; Moine, Virginie; Lucas, Patrick M.


    Plasmids in lactic acid bacteria occasionally confer adaptive advantages improving the growth and behaviour of their host cells. They are often associated to starter cultures used in the food industry and could be a signature of their superiority. Oenococcus oeni is the main lactic acid bacteria species encountered in wine. It performs the malolactic fermentation that occurs in most wines after alcoholic fermentation and contributes to their quality and stability. Industrial O. oeni starters may be used to better control malolactic fermentation. Starters are selected empirically by virtue of their fermentation kinetics and capacity to survive in wine. This study was initiated with the aim to determine whether O. oeni contains plasmids of technological interest. Screening of 11 starters and 33 laboratory strains revealed two closely related plasmids, named pOENI-1 (18.3-kb) and pOENI-1v2 (21.9-kb). Sequence analyses indicate that they use the theta mode of replication, carry genes of maintenance and replication and two genes possibly involved in wine adaptation encoding a predicted sulphite exporter (tauE) and a NADH:flavin oxidoreductase of the old yellow enzyme family (oye). Interestingly, pOENI-1 and pOENI-1v2 were detected only in four strains, but this included three industrial starters. PCR screenings also revealed that tauE is present in six of the 11 starters, being probably inserted in the chromosome of some strains. Microvinification assays performed using strains with and without plasmids did not disclose significant differences of survival in wine or fermentation kinetics. However, analyses of 95 wines at different phases of winemaking showed that strains carrying the plasmids or the genes tauE and oye were predominant during spontaneous malolactic fermentation. Taken together, the results revealed a family of related plasmids associated with industrial starters and indigenous strains performing spontaneous malolactic fermentation that possibly

  12. Detection of plasmid-borne extended-spectrum β-lactamase (ESBL) genes in Escherichia coli isolates from bovine mastitis.


    Freitag, Christin; Michael, Geovana Brenner; Kadlec, Kristina; Hassel, Melanie; Schwarz, Stefan


    Extended-spectrum β-lactamase (ESBL)-producing isolates have been increasingly reported during recent years. The aims of this study were to characterize ESBL-producing Escherichia coli from bovine mastitis as well as their ESBL gene-carrying plasmids. A culture collection of E. coli isolated from bovine quarter milk samples (2009-2013), was screened for ESBL production using ESBL selective agar plates. Putative ESBL producers (n=16) were investigated by phenotypic confirmatory tests and were characterized by the detection/sequencing of ESBL genes, XbaI macrorestriction analysis, multilocus sequence typing (MLST), phylotyping and antimicrobial susceptibility testing. ESBL gene-carrying plasmids were investigated by transfer experiments, PCRs for the detection of co-located antimicrobial resistance genes, PCR-based replicon typing and S1-nuclease pulsed-field gel electrophoresis. Twelve ESBL-producing isolates were found. They showed eleven different XbaI patterns and were distributed among eight MLST types [ST10 (n=3), ST117 (n=2), ST361 (n=1), ST362 (n=1), ST540 (n=1), ST1431 (n=2), ST1508 (n=1), and the novel ST5447 (n=1)] and the phylogenetic groups A (n=6), B1 (n=2), B2 (n=1) and D (n=3). ESBL genes blaCTX-M-1 (n=5), blaCTX-M-2 (n=2), blaCTX-M-14 and blaCTX-M-15 (n=4) were found on conjugative plasmids (35-225kb) of diverse incompatibility groups (e.g. IncF, IncI1 or HI2+P). Co-located resistance to sulfonamides, tetracycline, trimethoprim, and chloramphenicol/florfenicol was detected on five ESBL gene-carrying plasmids, but seven plasmids conferred solely resistance to β-lactam antibiotics. The presence of additional resistance genes on the ESBL gene-carrying plasmids suggests that co-selection of ESBL genes may occur even in the absence of β-lactam antibiotics.

  13. Successful treatment of a LifeSite Hemodialysis Access System pocket infection with large-volume kanamycin solution irrigation.


    Ross, John R


    Bridge devices-dialysis catheters and subcutaneous access devices-play a critical role in increasing the placement of arteriovenous (AV) fistulas by providing hemodialysis vascular access while AV fistulas mature. The LifeSite Hemodialysis Access System (Vasca Inc, Tewskburg, MA), a fully implantable, subcutaneous dual valve access system, has been shown to have lower complication rates, higher blood flow rates, and better long-term device survival than conventional tunneled hemodialysis catheters, indicating it may better meet the requirements for optimally bridging to a fistula. This case study of a 48-year-old black man undergoing chronic hemodialysis for renal failure because of insulin-dependent diabetes describes a simple approach for resolving localized pocket infections associated with the LifeSite System by drip irrigation of the valves and tissue pockets with an antibiotic solution. Eight weeks after implantation of the LifeSite System, the patient exhibited symptoms of infection of the lateral LifeSite valve tissue pocket, which on culture was shown to be caused by Staphylococcus aureus. Flushing the LifeSite valve and tissue pocket with a large volume of kanamycin solution, in conjunction with intravenous vancomycin and routine irrigation of the valve with isopropyl alcohol, resolved the infection after 1 treatment. The LifeSite System successfully bridged the patient to a transposed basilic vein fistula created through a 2-stage surgical procedure. The LifeSite System provided uninterrupted access for hemodialysis over a period of 6 months while the fistula matured. The LifeSite System should allow surgeons to attempt fistula construction in more patients, including diabetics, access-challenged patients, and patients with small vessels, who may benefit from a nontraditional surgical approach toward fistula creation.

  14. Plasmid accumulation reduces life span in Saccharomyces cerevisiae.


    Falcón, Alaric A; Aris, John P


    Aging in the yeast Saccharomyces cerevisiae is under the control of multiple pathways. The production and accumulation of extrachromosomal rDNA circles (ERCs) is one pathway that has been proposed to bring about aging in yeast. To test this proposal, we have developed a plasmid-based model system to study the role of DNA episomes in reduction of yeast life span. Recombinant plasmids containing different replication origins, cis-acting partitioning elements, and selectable marker genes were constructed and analyzed for their effects on yeast replicative life span. Plasmids containing the ARS1 replication origin reduce life span to the greatest extent of the plasmids analyzed. This reduction in life span is partially suppressed by a CEN4 centromeric element on ARS1 plasmids. Plasmids containing a replication origin from the endogenous yeast 2 mu circle also reduce life span, but to a lesser extent than ARS1 plasmids. Consistent with this, ARS1 and 2 mu origin plasmids accumulate in approximately 7-generation-old cells, but ARS1/CEN4 plasmids do not. Importantly, ARS1 plasmids accumulate to higher levels in old cells than 2 mu origin plasmids, suggesting a correlation between plasmid accumulation and life span reduction. Reduction in life span is neither an indirect effect of increased ERC levels nor the result of stochastic cessation of growth. The presence of a fully functional 9.1-kb rDNA repeat on plasmids is not required for, and does not augment, reduction in life span. These findings support the view that accumulation of DNA episomes, including episomes such as ERCs, cause cell senescence in yeast.

  15. The Complete Sequences and Ecological Roles of Two IncP-1β Plasmids, pHB44 and pBS64, Isolated from the Mycosphere of Laccaria proxima.


    Zhang, Miaozhi; Brons, Jolanda K; van Elsas, Jan Dirk


    Two novel plasmids, coined pHB44 and pBS64, were recently found in Variovorax paradoxus strains HB44 and BS64 isolated from the mycosphere of Laccaria proxima, on two different sampling occasions. We here describe the full sequences of pHB44 and pBS64 and establish their evolutionary placement and ecological function. Both plasmids, unique for mycospheric V. paradoxus, were around 58 kb in size. They possessed, in a very similar fashion, three main plasmid backbone regions, which were predicted to be involved in plasmid replication, central control of maintenance, and conjugational transfer. Phylogenetic inference on the basis of seven selected and concatenated plasmid backbone genes provided solid evidence for the placement of the two plasmids in the IncP-1β1 group, with the recently isolated IncP-1β1 plasmid pMBUI8 as the closest relative. A comparative analysis of the sequences present in each of the recombinational hot spots (RHS) I to III across plasmids pHB44, pBS64, and pMBUI8 revealed the insertions found in plasmids pHB44 and pBS64 to be different from those of pMBUI8. Whereas, in the former two plasmids, RHS I and III were devoid of any major inserts, their RHS II regions contained inserts of 15,043 (pHB44) and 16,406 kb (pBS64), against about 9,3 kb for pMBUI8. Interestingly, these regions were highly similar across plasmids pHB44 and pBS64, and differed from that of pMBUI8. Closer inspection revealed the insert in the former plasmids to contain, next to transposases, an "mmf" gene cassette previously reported to encode metal "responsiveness" in the PromA plasmid pMOL98. Whereas the plasmid pHB44 RHS II contained the canonical mmf sequence, that in pBS64 contained, in addition, a "two-gene duplicated region" flanking the mmf C2 gene. In vitro experiments on the growth and survival of strains with or without plasmid pHB44 suggested this plasmid was involved in the binding and import of Fe(3+) as well as V(3+) ions into the host cells, thus yielding a

  16. Osa Protein Constitutes a Strong Oncogenic Suppression System That Can Block vir-Dependent Transfer of IncQ Plasmids between Agrobacterium Cells and the Establishment of IncQ Plasmids in Plant Cells

    PubMed Central

    Lee, Lan-Ying; Gelvin, Stanton B.


    The osa (oncogenic suppressive activity) gene of the IncW group plasmid pSa is sufficient to suppress tumorigenesis by Agrobacterium tumefaciens. osa confers oncogenic suppression by inhibiting VirE2 protein export. This result is similar, but not identical, to that of oncogenic suppression by the IncQ plasmid RSF1010. We conducted a series of experiments to compare oncogenic suppression by these two systems. Agrobacterium strains harboring plasmids containing osa are more able to effect oncogenic suppression than are similar strains containing various RSF1010 derivatives. When osa is present within a donor Agrobacterium strain that also carries a derivative of RSF1010, the transfer of RSF1010 derivatives to recipient bacteria and their establishment in plants are blocked. Oncogenic suppression is still effected when the osa gene is integrated into the Agrobacterium chromosome, suggesting that it is the osa gene product that is active in suppression and that suppression does not require a protein-nucleic acid intermediate like that described for IncQ plasmids. Extracellular complementation experiments with tobacco leaf disks indicated that Osa blocks stable transfer of RSF1010 to plant cells by inhibiting transfer of VirE2, which is essential for the transfer of RSF1010 into plant cells, and not by inhibiting the actual transfer of RSF1010 itself. Our results suggest that Osa and RSF1010 cause oncogenic suppression by using different mechanisms. PMID:15489437

  17. Functional activity of plasmid DNA after entry into the atmosphere of earth investigated by a new biomarker stability assay for ballistic spaceflight experiments.


    Thiel, Cora S; Tauber, Svantje; Schütte, Andreas; Schmitz, Burkhard; Nuesse, Harald; Moeller, Ralf; Ullrich, Oliver


    Sounding rockets represent an excellent platform for testing the influence of space conditions during the passage of Earth's atmosphere and re-entry on biological, physical and chemical experiments for astrobiological purposes. We designed a robust functionality biomarker assay to analyze the biological effects of suborbital spaceflights prevailing during ballistic rocket flights. During the TEXUS-49 rocket mission in March 2011, artificial plasmid DNA carrying a fluorescent marker (enhanced green fluorescent protein: EGFP) and an antibiotic resistance cassette (kanamycin/neomycin) was attached on different positions of rocket exterior; (i) circular every 90 degree on the outer surface concentrical of the payload, (ii) in the grooves of screw heads located in between the surface application sites, and (iii) on the surface of the bottom side of the payload. Temperature measurements showed two major peaks at 118 and 130 °C during the 780 seconds lasting flight on the inside of the recovery module, while outer gas temperatures of more than 1000 °C were estimated on the sample application locations. Directly after retrieval and return transport of the payload, the plasmid DNA samples were recovered. Subsequent analyses showed that DNA could be recovered from all application sites with a maximum of 53% in the grooves of the screw heads. We could further show that up to 35% of DNA retained its full biological function, i.e., mediating antibiotic resistance in bacteria and fluorescent marker expression in eukaryotic cells. These experiments show that our plasmid DNA biomarker assay is suitable to characterize the environmental conditions affecting DNA during an atmospheric transit and the re-entry and constitute the first report of the stability of DNA during hypervelocity atmospheric transit indicating that sounding rocket flights can be used to model the high-speed atmospheric entry of organics-laden artificial meteorites.

  18. Functional Activity of Plasmid DNA after Entry into the Atmosphere of Earth Investigated by a New Biomarker Stability Assay for Ballistic Spaceflight Experiments

    PubMed Central

    Thiel, Cora S.; Tauber, Svantje; Schütte, Andreas; Schmitz, Burkhard; Nuesse, Harald; Moeller, Ralf; Ullrich, Oliver


    Sounding rockets represent an excellent platform for testing the influence of space conditions during the passage of Earth's atmosphere and re-entry on biological, physical and chemical experiments for astrobiological purposes. We designed a robust functionality biomarker assay to analyze the biological effects of suborbital spaceflights prevailing during ballistic rocket flights. During the TEXUS-49 rocket mission in March 2011, artificial plasmid DNA carrying a fluorescent marker (enhanced green fluorescent protein: EGFP) and an antibiotic resistance cassette (kanamycin/neomycin) was attached on different positions of rocket exterior; (i) circular every 90 degree on the outer surface concentrical of the payload, (ii) in the grooves of screw heads located in between the surface application sites, and (iii) on the surface of the bottom side of the payload. Temperature measurements showed two major peaks at 118 and 130°C during the 780 seconds lasting flight on the inside of the recovery module, while outer gas temperatures of more than 1000°C were estimated on the sample application locations. Directly after retrieval and return transport of the payload, the plasmid DNA samples were recovered. Subsequent analyses showed that DNA could be recovered from all application sites with a maximum of 53% in the grooves of the screw heads. We could further show that up to 35% of DNA retained its full biological function, i.e., mediating antibiotic resistance in bacteria and fluorescent marker expression in eukariotic cells. These experiments show that our plasmid DNA biomarker assay is suitable to characterize the environmental conditions affecting DNA during an atmospheric transit and the re-entry and constitute the first report of the stability of DNA during hypervelocity atmospheric transit indicating that sounding rocket flights can be used to model the high-speed atmospheric entry of organics-laden artificial meteorites. PMID:25426925

  19. Structures of replication initiation proteins from staphylococcal antibiotic resistance plasmids reveal protein asymmetry and flexibility are necessary for replication

    PubMed Central

    Carr, Stephen B.; Phillips, Simon E.V.; Thomas, Christopher D.


    Antibiotic resistance in pathogenic bacteria is a continual threat to human health, often residing in extrachromosomal plasmid DNA. Plasmids of the pT181 family are widespread and confer various antibiotic resistances to Staphylococcus aureus. They replicate via a rolling circle mechanism that requires a multi-functional, plasmid-encoded replication protein to initiate replication, recruit a helicase to the site of initiation and terminate replication after DNA synthesis is complete. We present the first atomic resolution structures of three such replication proteins that reveal distinct, functionally relevant conformations. The proteins possess a unique active site and have been shown to contain a catalytically essential metal ion that is bound in a manner distinct from that of any other rolling circle replication proteins. These structures are the first examples of the Rep_trans Pfam family providing insights into the replication of numerous antibiotic resistance plasmids from Gram-positive bacteria, Gram-negative phage and the mobilisation of DNA by conjugative transposons. PMID:26792891

  20. Therapeutic option of plasmid-DNA based gene transfer.


    Taniyama, Yoshiaki; Azuma, Junya; Kunugiza, Yasuo; Iekushi, Kazuma; Rakugi, Hiromi; Morishita, Ryuichi


    Gene therapy offers a novel approach for the prevention and treatment of a variety of diseases, but it is not yet a common method in clinical cases because of various problems. Viral vectors show high efficiency of gene transfer, but they have some problems with toxicity and immunity. On the other hand, plasmid deoxyribonucleic acid (DNA)-based gene transfer is very safe, but its efficiency is relatively low. Especially, plasmid DNA gene therapy is used for cardiovascular disease because plasmid DNA transfer is possible for cardiac or skeletal muscle. Clinical angiogenic gene therapy using plasmid DNA gene transfer has been attempted in patients with peripheral artery disease, but a phase III clinical trial did not show sufficient efficiency. In this situation, more efficient plasmid DNA gene transfer is needed all over the world. This review focuses on plasmid DNA gene transfer and its enhancement, including ultrasound with microbubbles, electroporation, hydrodynamic method, gene gun, jet injection, cationic lipids and cationic polymers.

  1. Identification and sequence homology relationships of plasmids from various micrococci

    SciTech Connect

    Mathis, J.N.


    Plasmids have been found in strains of the following Micrococcus species M. nishinomiyaensis (9/22), M. luteus (8/47), and M. agilis (1/5). No plasmids were detected in strains of M. lylae (0/16) or M. sedentarius (0/20). Thirty-eight antibiotics and 23 inorganic salts were screened in an attempt to determine plasmid function. None of these antibiotics and inorganic salts were found to be associated with the presence or absence of plasmid DNA within these strains. Minimum inhibitory concentration experiments and curing experiments in which phenotypic change occurred without plasmid loss are the basis for this conclusion. Hydrocarbon biosynthesis parameters in certain Micrococcus strains previously analyzed were also shown not to be clearly associated to the presence or absence of plasmid DNA.

  2. Community-wide plasmid gene mobilization and selection

    PubMed Central

    Sentchilo, Vladimir; Mayer, Antonia P; Guy, Lionel; Miyazaki, Ryo; Green Tringe, Susannah; Barry, Kerrie; Malfatti, Stephanie; Goessmann, Alexander; Robinson-Rechavi, Marc; van der Meer, Jan R


    Plasmids have long been recognized as an important driver of DNA exchange and genetic innovation in prokaryotes. The success of plasmids has been attributed to their independent replication from the host's chromosome and their frequent self-transfer. It is thought that plasmids accumulate, rearrange and distribute nonessential genes, which may provide an advantage for host proliferation under selective conditions. In order to test this hypothesis independently of biases from culture selection, we study the plasmid metagenome from microbial communities in two activated sludge systems, one of which receives mostly household and the other chemical industry wastewater. We find that plasmids from activated sludge microbial communities carry among the largest proportion of unknown gene pools so far detected in metagenomic DNA, confirming their presumed role of DNA innovators. At a system level both plasmid metagenomes were dominated by functions associated with replication and transposition, and contained a wide variety of antibiotic and heavy metal resistances. Plasmid families were very different in the two metagenomes and grouped in deep-branching new families compared with known plasmid replicons. A number of abundant plasmid replicons could be completely assembled directly from the metagenome, providing insight in plasmid composition without culturing bias. Functionally, the two metagenomes strongly differed in several ways, including a greater abundance of genes for carbohydrate metabolism in the industrial and of general defense factors in the household activated sludge plasmid metagenome. This suggests that plasmids not only contribute to the adaptation of single individual prokaryotic species, but of the prokaryotic community as a whole under local selective conditions. PMID:23407308

  3. Drug resistance plasmids in Lactobacillus acidophilus and Lactobacillus reuteri.

    PubMed Central

    Vescovo, M; Morelli, L; Bottazzi, V


    Sixteen strains of Lactobacillus reuteri and 20 strains of Lactobacillus acidophilus were tested for resistance to 22 antibiotics by using commercially available sensitivity disks. Evidence suggesting linkage of these resistances to plasmids was obtained by "curing" experiments with acridine dyes and high growth temperatures. Examination of plasmid patterns of agarose gel electrophoresis provided further evidence of loss in plasmid DNA under curing conditions in some of the strains examined. Images PMID:6798933

  4. Large Linear Plasmids of Borrelia Species That Cause Relapsing Fever

    PubMed Central

    Porcella, Stephen F.; Raffel, Sandra J.; Schwan, Tom G.; Barbour, Alan G.


    Borrelia species of relapsing fever (RF) and Lyme disease (LD) lineages have linear chromosomes and both linear and circular plasmids. Unique to RF species, and little characterized to date, are large linear plasmids of ∼160 kb, or ∼10% of the genome. By a combination of Sanger and next-generation methods, we determined the sequences of large linear plasmids of two New World species: Borrelia hermsii, to completion of its 174-kb length, and B. turicatae, partially to 114 kb of its 150 kb. These sequences were then compared to corresponding sequences of the Old World species B. duttonii and B. recurrentis and to plasmid sequences of LD Borrelia species. The large plasmids were largely colinear, except for their left ends, about 27 kb of which was inverted in New World species. Approximately 60% of the B. hermsii lp174 plasmid sequence was repetitive for 6 types of sequence, and half of its open reading frames encoded hypothetical proteins not discernibly similar to proteins in the database. The central ∼25 kb of all 4 linear plasmids was syntenic for orthologous genes for plasmid maintenance or partitioning in Borrelia species. Of all the sequenced linear and circular plasmids in Borrelia species, the large plasmid's putative partition/replication genes were most similar to those of the 54-kb linear plasmids of LD species. Further evidence for shared ancestry was the observation that two of the hypothetical proteins were predicted to be structurally similar to the LD species' CspA proteins, which are encoded on the 54-kb plasmids. PMID:23749977

  5. Large linear plasmids of Borrelia species that cause relapsing fever.


    Miller, Shelley Campeau; Porcella, Stephen F; Raffel, Sandra J; Schwan, Tom G; Barbour, Alan G


    Borrelia species of relapsing fever (RF) and Lyme disease (LD) lineages have linear chromosomes and both linear and circular plasmids. Unique to RF species, and little characterized to date, are large linear plasmids of ∼160 kb, or ∼10% of the genome. By a combination of Sanger and next-generation methods, we determined the sequences of large linear plasmids of two New World species: Borrelia hermsii, to completion of its 174-kb length, and B. turicatae, partially to 114 kb of its 150 kb. These sequences were then compared to corresponding sequences of the Old World species B. duttonii and B. recurrentis and to plasmid sequences of LD Borrelia species. The large plasmids were largely colinear, except for their left ends, about 27 kb of which was inverted in New World species. Approximately 60% of the B. hermsii lp174 plasmid sequence was repetitive for 6 types of sequence, and half of its open reading frames encoded hypothetical proteins not discernibly similar to proteins in the database. The central ∼25 kb of all 4 linear plasmids was syntenic for orthologous genes for plasmid maintenance or partitioning in Borrelia species. Of all the sequenced linear and circular plasmids in Borrelia species, the large plasmid's putative partition/replication genes were most similar to those of the 54-kb linear plasmids of LD species. Further evidence for shared ancestry was the observation that two of the hypothetical proteins were predicted to be structurally similar to the LD species' CspA proteins, which are encoded on the 54-kb plasmids.

  6. Photonic plasmid stability of transformed Salmonella typhimurium: A comparison of three unique plasmids

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Acquiring a highly stable photonic plasmid in transformed Salmonella typhimurium for use in biophotonic studies of bacterial tracking in vivo is critical to experimental paradigm development. The objective of this study was to determine stability of transformed Salmonella typhimurium (S. typh-lux) u...

  7. Photonic Plasmid Stability of Transformed Salmonella Typhimurium: A Comparison of Three Unique Plasmids

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Background: Acquiring a highly stable photonic plasmid in transformed Salmonella Typhimurium for use in biophotonic studies of bacterial tracking in vivo is critical to experimental paradigm development. The objective of this study was to determine stability of transformed Salmonella Typhimurium (S....

  8. Ornamental fish as a source of plasmid-mediated quinolone resistance genes and antibiotic resistance plasmids.


    Dobiasova, Hana; Kutilova, Iva; Piackova, Veronika; Vesely, Tomas; Cizek, Alois; Dolejska, Monika


    Growing ornamental fish industry is associated with public health concerns including extensive antibiotic use accompanied by increasing antibiotic resistance. The aim of this study was to analyze Aeromonas isolates from imported tropical ornamental fish and coldwater koi carps bred in the Czech Republic to assess the potential risk of ornamental fish as a source of plasmid-mediated quinolone resistance genes (PMQR) and antibiotic resistance plasmids. A collection of Aeromonas spp. with reduced susceptibility to ciprofloxacin (MIC ≥ 0.05 mg/L) was selected for the detection of PMQR genes. Isolates harbouring PMQR genes were further analyzed for the additional antibiotic resistance, integron content, clonality, biofilm production and transferability of PMQR genes by conjugation and transformation. Comparative analysis of plasmids carrying PMQR genes was performed. Fifteen (19%, n=80) isolates from koi carps and 18 (24%, n=76) isolates from imported ornamental fish were positive for qnrS2, aac(6')-Ib-cr or qnrB17 genes. PMQR-positive isolates from imported ornamental fish showed higher MIC levels to quinolones, multiresistance and diverse content of antibiotic resistance genes and integrons compared to the isolates from the carps. Related IncU plasmids harbouring qnrS2 and aac(6')-Ib-cr genes were found in Aeromonas spp. from imported ornamental fish and koi carps from various geographical areas. Ornamental fish may represent a potential source of multiresistant bacteria and mobile genetic elements for the environment and for humans.

  9. Conference Abstracts: AEDS '82.

    ERIC Educational Resources Information Center

    Journal of Computers in Mathematics and Science Teaching, 1982


    Abstracts from nine selected papers presented at the 1982 Association for Educational Data Systems (AEDS) conference are provided. Copies of conference proceedings may be obtained for fifteen dollars from the Association. (MP)

  10. Why is entry exclusion an essential feature of conjugative plasmids?


    Garcillán-Barcia, M Pilar; de la Cruz, Fernando


    Entry exclusion is a property of plasmids by which the cells that contain them become bad recipients in additional conjugation rounds. This work reviews entry exclusion essential features and analyzes the mechanisms of action of the best studied systems. We searched for homologs of the proteins responsible for experimentally known exclusion systems. Results were used to classify exclusion systems in families of related elements. We arrive to the conclusion that all conjugative plasmids contain at least one entry exclusion gene. Although entry exclusion genes seem to be part of the plasmid conjugative machinery, they are systematically absent in phylogenetically related type IV protein exporting machines involved in virulence for plants and animals. We infer from this fact that entry exclusion is an essential feature of conjugative plasmid biology. Mathematical models suggest that plasmids expressing entry exclusion selectively eliminate plasmids lacking it, reinforcing its essential character and suggesting that entry exclusion plays a direct role in plasmid survival. Other experimental results confirm that entry exclusion is essential for the stability of a conjugative plasmid. We suggest that entry exclusion limits the damage of lethal zygosis (bacterial death produced by excessive rounds of conjugation). Additionally, it avoids competition in a host among identical plasmid backbones. Conversely, the lack of entry exclusion in conjugative transposons can be understood as a means of generating rapid evolutionary change.

  11. [Isolation of the R'his plasmids of Vibrio cholerae].


    Rusina, O Iu; Tiganova, I G; Aleshkin, G I; Andreeva, I V; Skavronskaia, A G


    V. cholerae strain VT5104 capable of donor activity in conjugation has been constructed by the genetic technique based on plasmid RP4::Mucts62 integration into V. cholerae chromosome due to plasmid homology with Mucts62 inserted into the chromosome. The gene for histidine synthesis has been mobilized and transferred into the recipient cells from VT5104 donor. The conjugants obtained are able to efficiently transfer his+ gene included into the plasmid structure in conjugation with eltor recipient. Thus, the constructed strain VT5104 generates R' plasmids carrying V. cholerae chromosomal genes.

  12. Physical and genetic analysis of the ColD plasmid.


    Frey, J; Ghersa, P; Palacios, P G; Belet, M


    The plasmid ColD-CA23, a high-copy-number plasmid of 5.12 kilobases, encodes colicin D, a protein of approximately 87,000 daltons which inhibits bacterial protein synthesis. Colicin D production is under the control of the Escherichia coli SOS regulatory system and is released to the growth medium via the action of the lysis gene product(s). A detailed map of the ColD plasmid was established for 10 restriction enzymes. Using in vitro insertional omega mutagenesis and in vivo insertional Tn5 mutagenesis, we localized the regions of the plasmid responsible for colicin D activity (cda), for mitomycin C-induced lysis (cdl), and for colicin D immunity (cdi). These genes were all located contiguously on a 2,400-base-pair fragment similar to a large number of other Col plasmids (A, E1, E2, E3, E8, N, and CloDF). The ColD plasmid was mobilizable by conjugative transfer by helper plasmids of the IncFII incompatibility group, but not by plasmids belonging to the groups IncI-alpha or IncP. The location of the mobilization functions was determined by deletion analysis. The plasmid needs a segment of 400 base pairs, which is located between the mob genes and the gene for autolysis, for its replication.

  13. Physical and genetic analysis of the ColD plasmid.

    PubMed Central

    Frey, J; Ghersa, P; Palacios, P G; Belet, M


    The plasmid ColD-CA23, a high-copy-number plasmid of 5.12 kilobases, encodes colicin D, a protein of approximately 87,000 daltons which inhibits bacterial protein synthesis. Colicin D production is under the control of the Escherichia coli SOS regulatory system and is released to the growth medium via the action of the lysis gene product(s). A detailed map of the ColD plasmid was established for 10 restriction enzymes. Using in vitro insertional omega mutagenesis and in vivo insertional Tn5 mutagenesis, we localized the regions of the plasmid responsible for colicin D activity (cda), for mitomycin C-induced lysis (cdl), and for colicin D immunity (cdi). These genes were all located contiguously on a 2,400-base-pair fragment similar to a large number of other Col plasmids (A, E1, E2, E3, E8, N, and CloDF). The ColD plasmid was mobilizable by conjugative transfer by helper plasmids of the IncFII incompatibility group, but not by plasmids belonging to the groups IncI-alpha or IncP. The location of the mobilization functions was determined by deletion analysis. The plasmid needs a segment of 400 base pairs, which is located between the mob genes and the gene for autolysis, for its replication. Images PMID:3007432

  14. Plasmid genes required for microcin B17 production.

    PubMed Central

    San Millán, J L; Kolter, R; Moreno, F


    The production of the antibiotic substance microcin B17 (Mcc) is determined by a 3.5-kilobase DNA fragment from plasmid pMccB17. Several Mcc- mutations on plasmid pMccB17 were obtained by both transposon insertion and nitrosoguanidine mutagenesis. Plasmids carrying these mutations were tested for their ability to complement Mcc- insertion or deletion mutations on pMM102 (pMM102 is a pBR322 derivative carrying the region encoding microcin B17). Results from these experiments indicate that at least four plasmid genes are required for microcin production. PMID:2993228

  15. Plasmid DNA hydrogels for biomedical applications.


    Costa, Diana; Valente, Artur J M; Miguel, M Graça; Queiroz, João


    In the last few years, our research group has focused on the design and development of plasmid DNA (pDNA) based systems as devices to be used therapeutically in the biomedical field. Biocompatible macro and micro plasmid DNA gels were prepared by a cross-linking reaction. For the first time, the pDNA gels have been investigated with respect to their swelling in aqueous solution containing different additives. Furthermore, we clarified the fundamental and basic aspects of the solute release mechanism from pDNA hydrogels and the significance of this information is enormous as a basic tool for the formulation of pDNA carriers for drug/gene delivery applications. The co-delivery of a specific gene and anticancer drugs, combining chemical and gene therapies in the treatment of cancer was the main challenge of our research. Significant progresses have been made with a new p53 encoding pDNA microgel that is suitable for the loading and release of pDNA and doxorubicin. This represents a strong valuable finding in the strategic development of systems to improve cancer cure through the synergetic effect of chemical and gene therapy.

  16. Studies on Saccharomyces cerevisiae under carbon-limiting growth transformed with plasmid pCYG4 that carries the gene for NADP-GDH.


    Lima Filho, J L; Ledingham, W M


    The gene (GDH1) coding for the NADP-linked glutamate dehydrogenase system (NADP-GDH) has been cloned from Saccharomyces cerevisiae strain. Cells being transformed by the NADP-GDH gene on a 2 micron bared vector (pCYG4) plasmid confering 11-fold higher level on expressed GDH activity over the wild-type cells. The behavior of these cells was investigated under chemostatic growth with a carbon rate-limiting nutrient. Specific growth rates of cells carrying plasmid pCYG4 were found to be slightly slower than wild type cells. Furthermore, the NADP-GDH activity increases proportionally with the dilution rate. In addition, oscillations in the NADP-GDH activity, especially at a dilution rate up to 0.15/h, are probably consequential on the appearance of a changing mixed population (cells with and without plasmids).

  17. The General Conference Mennonites.

    ERIC Educational Resources Information Center

    Ediger, Marlow

    General Conference Mennonites and Old Order Amish are compared and contrasted in the areas of physical appearance, religious beliefs, formal education, methods of farming, and home settings. General Conference Mennonites and Amish differ in physical appearance and especially in dress. The General Conference Mennonite men and women dress the same…

  18. EDITORIAL: Conference program

    NASA Astrophysics Data System (ADS)


    Some of the papers and talks given at the conference have not been published in this volume of Journal of Physics: Conference Series. The attached PDF file lists the full conference program and indicates (with an asterisk) those papers or talks which are not present in this volume.

  19. Youth Conference Handbook.

    ERIC Educational Resources Information Center

    Brown, Brenda H.

    This handbook is designed to provide practical aid to those who have charge of the planning and organization of a youth conference, Defined as a conference to provide practical information as well as information about possible responsibilities, risks, and consequences of actions, related to the chosen conference topic. Suggestions are given for…

  20. Parent Conferences. Beginnings Workshop.

    ERIC Educational Resources Information Center

    Duffy, Roslyn; And Others


    Presents six workshop sessions on parent conferences: (1) "Parents' Perspectives on Conferencing" (R. Duffy); (2) "Three Way Conferences" (G. Zeller); (3) "Conferencing with Parents of Infants" (K. Albrecht); (4) "Conferencing with Parents of School-Agers" (L. G. Miller); (5) "Cross Cultural Conferences" (J. Gonzalez-Mena); and (6) "Working with…

  1. Complete nucleotide sequence and analysis of two conjugative broad host range plasmids from a marine microbial biofilm.


    Norberg, Peter; Bergström, Maria; Hermansson, Malte


    The complete nucleotide sequence of plasmids pMCBF1 and pMCBF6 was determined and analyzed. pMCBF1 and pMCBF6 form a novel clade within the IncP-1 plasmid family designated IncP-1 ς. The plasmids were exogenously isolated earlier from a marine biofilm. pMCBF1 (62 689 base pairs; bp) and pMCBF6 (66 729 bp) have identical backbones, but differ in their mercury resistance transposons. pMCBF1 carries Tn5053 and pMCBF6 carries Tn5058. Both are flanked by 5 bp direct repeats, typical of replicative transposition. Both insertions are in the vicinity of a resolvase gene in the backbone, supporting the idea that both transposons are "res-site hunters" that preferably insert close to and use external resolvase functions. The similarity of the backbones indicates recent insertion of the two transposons and the ongoing dynamics of plasmid evolution in marine biofilms. Both plasmids also carry the insertion sequence ISPst1, albeit without flanking repeats. ISPs1is located in an unusual site within the control region of the plasmid. In contrast to most known IncP-1 plasmids the pMCBF1/pMCBF6 backbone has no insert between the replication initiation gene (trfA) and the vegetative replication origin (oriV). One pMCBF1/pMCBF6 block of about 2.5 kilo bases (kb) has no similarity with known sequences in the databases. Furthermore, insertion of three genes with similarity to the multidrug efflux pump operon mexEF and a gene from the NodT family of the tripartite multi-drug resistance-nodulation-division (RND) system in Pseudomonas aeruginosa was found. They do not seem to confer antibiotic resistance to the hosts of pMCBF1/pMCBF6, but the presence of RND on promiscuous plasmids may have serious implications for the spread of antibiotic multi-resistance.

  2. Plasmids in different strains of Streptomyces ambofaciens: free and integrated form of plasmid pSAM2.


    Pernodet, J L; Simonet, J M; Guérineau, M


    Five strains of Streptomyces ambofaciens were examined for their plasmid content. Among these strains, four belong to the same lineage (strains B) and the other was isolated independently (strain A). A large plasmid (ca. 80 kb), called pSAM1 in this paper and already described, was present in all B strains, and absent in strain A. A second plasmid, not described before, was found as covalently closed circular DNA in two of the four B strains. This plasmid with a size of 11.1 kb was called pSAM2. A restriction map for 14 enzymes was established. Hybridization experiments showed that a unique sequence homologous to this plasmid is integrated in a larger replicon, which is not pSAM1 and is probably the chromosome, in all B strains and not in strain A. It seems probable that the integrated sequence is the origin of the free plasmid found in two strains of the B family. It is noteworthy that the integrated form and the free plasmid may be found together. Transformation experiments proved that pSAM2 may be maintained autonomously in S. ambofaciens strain A and in S. lividans. pSAM2 is a self-transmissible plasmid, able to elicit the lethal zygosis reaction. pSAM2 was compared to the plasmids SLP1, pIJ110 and pIJ408, which all come from integrated sequences in three Streptomyces species and are found as autonomous plasmids after transfer to S. lividans. If pSAM2 resembles these plasmids in its origin, it does not appear to be related directly to them. Concerning their plasmid content, the two isolates of S. ambofaciens are very different.(ABSTRACT TRUNCATED AT 250 WORDS)

  3. Uptake of ammonia by Saccharomyces cerevisiae carrying the plasmid pCYG4 related with ammonia assimilation.


    Lima Filho, J L; Ledingham, W M


    Batch culture experiments involving ammonia uptake in Saccharomyces cerevisiae BC55 pCYG4 have been carried out. This strain carries the plasmid pCYG4 that directs substantial overproduction of NADP-GDH, conferring an 11-fold increase in activity. The wild type cells had a specific growth rate greater than BC55 pCYG4. The ammonia uptake was practically the same until 15 h of growth. However, the amount of ammonia hydroxide added during growth (60 h) was two and half times greater in the BC55 pCYG4 than wild type cells. The results suggest that the presence of the plasmid pCYG4 can increase the amount of ammonia taken by the cells, but not the amount of biomass.

  4. Restriction endonuclease analysis of the lactose plasmid in Streptococcus lactis ML3 and two recombinant lactose plasmids.


    Walsh, P M; McKay, L L


    We investigated the molecular relationship between the 60-megadalton (Mdal) recombinant lactose plasmids in ML 3 x LM2301 lactose-positive (Lac+) transconjugants and the genetic material of Streptococcus lactis ML3. Lactose metabolism is linked to the 33-Mdal plasmid pSK08 in ML3, and the recipient LM2301 is cured of plasmid DNA. The plasmids were analyzed with a series of restriction enzymes. We found that the 60-Mdal plasmids of Lac+ transconjugants contained pSK08 DNA, but were not simply dimers of pSK08. The 60-Mdal plasmids contained a segment of DNA not apparent in pSK08. The restriction patterns of the 60-Mdal plasmid in a Lac+ nonclumping transconjugant and that in a Lac+ clumping transconjugant were different. This suggested that there was a molecular differences between these two recombinant plasmids. We conclude that the segment of DNA in the 60-Mdal plasmids that was not present in pSK08 was the proposed transfer factor responsible for cell aggregation and high-frequency conjugation.

  5. Plasmid pGA1 from Corynebacterium glutamicum codes for a gene product that positively influences plasmid copy number.

    PubMed Central

    Nesvera, J; Pátek, M; Hochmannová, J; Abrhámová, Z; Becvárová, V; Jelínkova, M; Vohradský, J


    The complete nucleotide sequence (4,826 bp) of the cryptic plasmid pGA1 from Corynebacterium glutamicum was determined. DNA sequence analysis revealed four putative coding regions (open reading frame A [ORFA], ORFA2, ORFB, and ORFC). ORFC was identified as a rep gene coding for an initiator of plasmid replication (Rep) according to the high level of homology of its deduced amino acid sequence with the Rep proteins of plasmids pSR1 (from C. glutamicum) and pNG2 (from Corynebacterium diphtheriae). This function was confirmed by deletion mapping of the minimal replicon of pGA1 (1.7 kb) which contains only ORFC. Deletion derivatives of pGA1 devoid of ORFA exhibited significant decreases in the copy number in C. glutamicum cells and displayed segregational instability. Introduction of ORFA in trans into the cells harboring these deletion plasmids dramatically increased their copy number and segregational stability. The ORFA gene product thus positively influences plasmid copy number. This is the first report on such activity associated with a nonintegrating bacterial plasmid. The related plasmids pGA1, pSR1, and pNG2 lacking significant homology with any other plasmid seem to be representatives of a new group of plasmids replicating in the rolling-circle mode. PMID:9045809

  6. Development of pVCR94ΔX from Vibrio cholerae, a prototype for studying multidrug resistant IncA/C conjugative plasmids.


    Carraro, Nicolas; Sauvé, Maxime; Matteau, Dominick; Lauzon, Guillaume; Rodrigue, Sébastien; Burrus, Vincent


    Antibiotic resistance has grown steadily in Vibrio cholerae over the last few decades to become a major threat in countries affected by cholera. Multi-drug resistance (MDR) spreads among clinical and environmental V. cholerae strains by lateral gene transfer often mediated by integrative and conjugative elements (ICEs) of the SXT/R391 family. However, in a few reported but seemingly isolated cases, MDR in V. cholerae was shown to be associated with other self-transmissible genetic elements such as conjugative plasmids. IncA/C conjugative plasmids are often found associated with MDR in isolates of Enterobacteriaceae. To date, IncA/C plasmids have not been commonly found in V. cholerae or other species of Vibrio. Here we present a detailed analysis of pVCR94ΔX derived from pVCR94, a novel IncA/C conjugative plasmid identified in a V. cholerae clinical strain isolated during the 1994 Rwandan cholera outbreak. pVCR94 was found to confer resistance to sulfamethoxazole, trimethoprim, ampicillin, streptomycin, tetracycline, and chloramphenicol and to transfer at very high frequency. Sequence analysis revealed its mosaic nature as well as high similarity of the core genes responsible for transfer and maintenance with other IncA/C plasmids and ICEs of the SXT/R391 family. Although IncA/C plasmids are considered a major threat in antibiotics resistance, their basic biology has received little attention, mostly because of the difficulty to genetically manipulate these MDR conferring elements. Therefore, we developed a convenient derivative from pVCR94, pVCR94Δ X, a 120.5-kb conjugative plasmid which only codes for sulfamethoxazole resistance. Using pVCR94Δ X, we identified the origin of transfer (oriT) and discovered an essential gene for transfer, both located within the shared backbone, allowing for an annotation update of all IncA/C plasmids. pVCR94Δ X may be a useful model that will provide new insights on the basic biology of IncA/C conjugative plasmids.

  7. Development of pVCR94ΔX from Vibrio cholerae, a prototype for studying multidrug resistant IncA/C conjugative plasmids

    PubMed Central

    Carraro, Nicolas; Sauvé, Maxime; Matteau, Dominick; Lauzon, Guillaume; Rodrigue, Sébastien; Burrus, Vincent


    Antibiotic resistance has grown steadily in Vibrio cholerae over the last few decades to become a major threat in countries affected by cholera. Multi-drug resistance (MDR) spreads among clinical and environmental V. cholerae strains by lateral gene transfer often mediated by integrative and conjugative elements (ICEs) of the SXT/R391 family. However, in a few reported but seemingly isolated cases, MDR in V. cholerae was shown to be associated with other self-transmissible genetic elements such as conjugative plasmids. IncA/C conjugative plasmids are often found associated with MDR in isolates of Enterobacteriaceae. To date, IncA/C plasmids have not been commonly found in V. cholerae or other species of Vibrio. Here we present a detailed analysis of pVCR94ΔX derived from pVCR94, a novel IncA/C conjugative plasmid identified in a V. cholerae clinical strain isolated during the 1994 Rwandan cholera outbreak. pVCR94 was found to confer resistance to sulfamethoxazole, trimethoprim, ampicillin, streptomycin, tetracycline, and chloramphenicol and to transfer at very high frequency. Sequence analysis revealed its mosaic nature as well as high similarity of the core genes responsible for transfer and maintenance with other IncA/C plasmids and ICEs of the SXT/R391 family. Although IncA/C plasmids are considered a major threat in antibiotics resistance, their basic biology has received little attention, mostly because of the difficulty to genetically manipulate these MDR conferring elements. Therefore, we developed a convenient derivative from pVCR94, pVCR94Δ X, a 120.5-kb conjugative plasmid which only codes for sulfamethoxazole resistance. Using pVCR94Δ X, we identified the origin of transfer (oriT) and discovered an essential gene for transfer, both located within the shared backbone, allowing for an annotation update of all IncA/C plasmids. pVCR94Δ X may be a useful model that will provide new insights on the basic biology of IncA/C conjugative plasmids. PMID

  8. Comparative genomics of an IncA/C multidrug resistance plasmid from Escherichia coli and Klebsiella isolates from intensive care unit patients and the utility of whole-genome sequencing in health care settings.


    Hazen, Tracy H; Zhao, LiCheng; Boutin, Mallory A; Stancil, Angela; Robinson, Gwen; Harris, Anthony D; Rasko, David A; Johnson, J Kristie


    The IncA/C plasmids have been implicated for their role in the dissemination of β-lactamases, including gene variants that confer resistance to expanded-spectrum cephalosporins, which are often the treatment of last resort against multidrug-resistant, hospital-associated pathogens. A bla(FOX-5) gene was detected in 14 Escherichia coli and 16 Klebsiella isolates that were cultured from perianal swabs of patients admitted to an intensive care unit (ICU) of the University of Maryland Medical Center (UMMC) in Baltimore, MD, over a span of 3 years. Four of the FOX-encoding isolates were obtained from subsequent samples of patients that were initially negative for an AmpC β-lactamase upon admission to the ICU, suggesting that the AmpC β-lactamase-encoding plasmid was acquired while the patient was in the ICU. The genomes of five E. coli isolates and six Klebsiella isolates containing bla(FOX-5) were selected for sequencing based on their plasmid profiles. An ∼ 167-kb IncA/C plasmid encoding the FOX-5 β-lactamase, a CARB-2 β-lactamase, additional antimicrobial resistance genes, and heavy metal resistance genes was identified. Another FOX-5-encoding IncA/C plasmid that was nearly identical except for a variable region associated with the resistance genes was also identified. To our knowledge, these plasmids represent the first FOX-5-encoding plasmids sequenced. We used comparative genomics to describe the genetic diversity of a plasmid encoding a FOX-5 β-lactamase relative to the whole-genome diversity of 11 E. coli and Klebsiella isolates that carry this plasmid. Our findings demonstrate the utility of whole-genome sequencing for tracking of plasmid and antibiotic resistance gene distribution in health care settings.

  9. An oligonucleotide microarray to characterize multidrug resistant plasmids

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Bacteria plasmids are fragments of extra-chromosomal double stranded deoxyribonucleic acid (DNA) that can contain a variety of genes beneficial to the host organism like antibiotic drug resistance. Many of the Enterobacteriaceae carry multiple drug resistance (MDR) genes on large plasmids of replic...

  10. Plasmid-encoded copper resistance and precipitation by Mycobacterium scrofulaceum.

    PubMed Central

    Erardi, F X; Failla, M L; Falkinham, J O


    A copper-tolerant Mycobacterium scrofulaceum strain was able to remove copper from culture medium by sulfate-dependent precipitation as copper sulfide. Such precipitation of copper sulfide was not observed in a derivative that lacks a 173-kilobase plasmid. In addition, the plasmid-carrying strain has a sulfate-independent copper resistance mechanism. PMID:3662522

  11. Identification of IncA/C Plasmid Replication and Maintenance Genes and Development of a Plasmid Multilocus Sequence Typing Scheme.


    Hancock, Steven J; Phan, Minh-Duy; Peters, Kate M; Forde, Brian M; Chong, Teik Min; Yin, Wai-Fong; Chan, Kok-Gan; Paterson, David L; Walsh, Timothy R; Beatson, Scott A; Schembri, Mark A


    Plasmids of incompatibility group A/C (IncA/C) are becoming increasingly prevalent within pathogenic Enterobacteriaceae They are associated with the dissemination of multiple clinically relevant resistance genes, including blaCMY and blaNDM Current typing methods for IncA/C plasmids offer limited resolution. In this study, we present the complete sequence of a blaNDM-1-positive IncA/C plasmid, pMS6198A, isolated from a multidrug-resistant uropathogenic Escherichia coli strain. Hypersaturated transposon mutagenesis, coupled with transposon-directed insertion site sequencing (TraDIS), was employed to identify conserved genetic elements required for replication and maintenance of pMS6198A. Our analysis of TraDIS data identified roles for the replicon, including repA, a toxin-antitoxin system; two putative partitioning genes, parAB; and a putative gene, 053 Construction of mini-IncA/C plasmids and examination of their stability within E. coli confirmed that the region encompassing 053 contributes to the stable maintenance of IncA/C plasmids. Subsequently, the four major maintenance genes (repA, parAB, and 053) were used to construct a new plasmid multilocus sequence typing (PMLST) scheme for IncA/C plasmids. Application of this scheme to a database of 82 IncA/C plasmids identified 11 unique sequence types (STs), with two dominant STs. The majority of blaNDM-positive plasmids examined (15/17; 88%) fall into ST1, suggesting acquisition and subsequent expansion of this blaNDM-containing plasmid lineage. The IncA/C PMLST scheme represents a standardized tool to identify, track, and analyze the dissemination of important IncA/C plasmid lineages, particularly in the context of epidemiological studies.

  12. Manipulating yeast genome using plasmid vectors.


    Stearns, T; Ma, H; Botstein, D


    The vectors and techniques described here enable one to manipulate the yeast genome to meet specific needs. Genes can be cloned, and the clone used to delete the wild-type gene from the chromosome, or replace it with mutant versions. Mutants derived by classical methods, such as mutagenesis of whole cells, or by reversion of a phenotype, can be cloned and analyzed in vitro. Yeast genes and foreign genes can either be inserted into autonomously replicating plasmid vectors that are reasonably stable or integrated into a yeast chromosome where they are maintained at one copy per genome. The combination of these techniques with the characterized promoter systems available in yeast make it possible to express almost any gene in yeast. Once this is achieved, the entire repertoire of yeast genetics is available to probe the function of the gene, or to engineer the expression in useful ways.

  13. Aptasensor based on the synergistic contributions of chitosan-gold nanoparticles, graphene-gold nanoparticles and multi-walled carbon nanotubes-cobalt phthalocyanine nanocomposites for kanamycin detection.


    Sun, Xia; Li, Falan; Shen, Guanghui; Huang, Jiadong; Wang, Xiangyou


    An electrochemical aptasensor was developed for the detection of kanamycin based on the synergistic contributions of chitosan-gold nanoparticles (CS-AuNPs), graphene-gold nanoparticles (GR-AuNPs) and multi-walled carbon nanotubes-cobalt phthalocyanine (MWCNTs-CoPc) nanocomposites. The aptasensor was prepared by sequentially dripping CS-AuNPs, GR-AuNPs and MWCNTs-CoPc nanocomposites onto a gold electrode (GE) surface. During the above process, these nanomaterials showed a remarkable synergistic effect towards the aptasensor. CS-AuNPs, GR-AuNPs and MWCNTs-CoPc as the nanocomposites mediator improved electron relay during the entire electron transfer process and the aptasensor response speed. The electrochemical properties of the modified processes were characterized by cyclic voltammetry (CV). The morphologies of the nanocomposites were characterized by scanning electron microscopy (SEM). The experimental conditions such as the concentration of the aptamer, the time, temperature and the pH were optimized. Based on the synergistic contributions of CS-AuNPs, GR-AuNPs and MWCNTs-CoPc nanocomposites, the proposed aptasensor displayed high sensitivity, high specificity, a low detection limit (5.8 × 10(-9) M) (S/N = 3) and excellent stability. It was successfully applied to the detection of kanamycin in real milk spiked samples.

  14. A novel electrochemical aptasensor for ultrasensitive detection of kanamycin based on MWCNTs-HMIMPF6 and nanoporous PtTi alloy.


    Guo, Wenjuan; Sun, Na; Qin, Xiaoli; Pei, Meishan; Wang, Luyan


    A novel aptasensor based on a novel composite film consisting of multi-walled carbon nanotubes (MWCNTs), ionic liquid (IL) of 1-hexyl-3-methylimidazolium hexafluorophosphate (HMIMPF6), and nanoporous PtTi (NP-PtTi) alloy was constructed for ultrasensitive detection of kanamycin. The NP-PtTi alloy was successfully fabricated by a simple dealloying of PtTiAl source alloy in HCl solution. The NP-PtTi alloy has uniform interconnected network structure with specific surface area and was used to immobilize aptamer. After modified with the composite material, current signal was amplified obviously, which attributed to the larger specific surface area and excellent electrical conductivity of NP-PtTi and MWCNTs. A number of factors affecting the activity of the aptasensor have been discussed and optimized. Under the optimized conditions, the proposed aptasensor provided a linear range of 0.05-100 ng mL(-1) with a low detection limit of 3.7 pg mL(-1). This aptasensor displayed high sensitivity, stability and reproducibility. In addition, the as-prepared aptasensor was successfully used for the determination of kanamycin in a real sample.

  15. Plasmid addiction systems: perspectives and applications in biotechnology.


    Kroll, Jens; Klinter, Stefan; Schneider, Cornelia; Voss, Isabella; Steinbüchel, Alexander


    Biotechnical production processes often operate with plasmid-based expression systems in well-established prokaryotic and eukaryotic hosts such as Escherichia coli or Saccharomyces cerevisiae, respectively. Genetically engineered organisms produce important chemicals, biopolymers, biofuels and high-value proteins like insulin. In those bioprocesses plasmids in recombinant hosts have an essential impact on productivity. Plasmid-free cells lead to losses in the entire product recovery and decrease the profitability of the whole process. Use of antibiotics in industrial fermentations is not an applicable option to maintain plasmid stability. Especially in pharmaceutical or GMP-based fermentation processes, deployed antibiotics must be inactivated and removed. Several plasmid addiction systems (PAS) were described in the literature. However, not every system has reached a full applicable state. This review compares most known addiction systems and is focusing on biotechnical applications.

  16. Marker-free plasmids for biotechnological applications - implications and perspectives.


    Oliveira, Pedro H; Mairhofer, Juergen


    Nonviral gene therapy and DNA vaccines have become the first promising approaches to treat, cure, or ultimately prevent disease by providing genetic information encoded on a plasmid. Since 1989, more than 1800 clinical trials have been approved worldwide, and approximately 20% of them are using plasmid DNA (pDNA) as a vector system. Although much safer than viral approaches, DNA vectors generally do encode antibiotic resistance genes in the plasmid backbone. These antibiotic resistance markers constitute a possible safety risk, and they are associated with structural plasmid instabilities and decreased gene delivery efficiency. These drawbacks have initiated the development of various antibiotic marker-free selection approaches. We provide an overview on the potential implications of marker-free plasmids and perspectives for their successful biotechnological use in the future.

  17. IncP-1β plasmids of Comamonas sp. and Delftia sp. strains isolated from a wastewater treatment plant mediate resistance to and decolorization of the triphenylmethane dye crystal violet.


    Stolze, Yvonne; Eikmeyer, Felix; Wibberg, Daniel; Brandis, Gerrit; Karsten, Christina; Krahn, Irene; Schneiker-Bekel, Susanne; Viehöver, Prisca; Barsch, Aiko; Keck, Matthias; Top, Eva M; Niehaus, Karsten; Schlüter, Andreas


    The application of toxic triphenylmethane dyes such as crystal violet (CV) in various industrial processes leads to large amounts of dye-contaminated sludges that need to be detoxified. Specific bacteria residing in wastewater treatment plants (WWTPs) are able to degrade triphenylmethane dyes. The objective of this work was to gain insights into the genetic background of bacterial strains capable of CV degradation. Three bacterial strains isolated from a municipal WWTP harboured IncP-1β plasmids mediating resistance to and decolorization of CV. These isolates were assigned to the genera Comamonas and Delftia. The CV-resistance plasmid pKV29 from Delftia sp. KV29 was completely sequenced. In addition, nucleotide sequences of the accessory regions involved in conferring CV resistance were determined for plasmids pKV11 and pKV36 from the other two isolates. Plasmid pKV29 contains typical IncP-1β backbone modules that are highly similar to those of previously sequenced IncP-1β plasmids that confer antibiotic resistance, degradative capabilities or mercury resistance. The accessory regions located between the conjugative transfer (tra) and mating pair formation modules (trb) of all three plasmids analysed share common modules and include a triphenylmethane reductase gene, tmr, that is responsible for decolorization of CV. Moreover, these accessory regions encode other enzymes that are dispensable for CV degradation and hence are involved in so-far-unknown metabolic pathways. Analysis of plasmid-mediated degradation of CV in Escherichia coli by ultra-high-performance liquid chromatography-electrospray ionization-quadrupole-time-of-flight MS revealed that leuco crystal violet was the first degradation product. Michler's ketone and 4-dimethylaminobenzaldehyde appeared as secondary degradation metabolites. Enzymes encoded in the E. coli chromosome seem to be responsible for cleavage of leuco crystal violet. Plasmid-mediated degradation of triphenylmethane dyes such as CV

  18. Complex nature of enterococcal pheromone-responsive plasmids.


    Wardal, Ewa; Sadowy, Ewa; Hryniewicz, Waleria


    Pheromone-responsive plasmids constitute a unique group of approximately 20 plasmids identified, as yet, only among enterococcal species. Several of their representatives, e.g. pAD1, pCF10, pPD1 and pAM373 have been extensively studied. These plasmids possess a sophisticated conjugation mechanism based on response to sex pheromones--small peptides produced by plasmid-free recipient cells. Detailed analysis of regulation and function of the pheromone response process revealed its great complexity and dual role--in plasmid conjugation and modulation of enterococcal virulence. Among other functional modules identified in pheromone plasmids, the stabilization/partition systems play a crucial role in stable maintenance of the plasmid molecule in host bacteria. Among them, the par locus of pAD1 is one of the exceptional RNA addiction systems. Pheromone-responsive plasmids contribute also to enterococcal phenotype being an important vehicle of antibiotic resistance in this genus. Both types of acquired vancomycin resistance determinants, vanA and vanB, as well many other resistant phenotypes, were found to be located on these plasmids. They also encode two basic agents of enterococcal virulence, i.e. aggregation substance (AS) and cytolysin. AS participates in mating-pair formation during conjugation but can also facilitate the adherence ofenterococci to human tissues during infection. The second protein, cytolysin, displays hemolytic activity and helps to invade eukaryotic cells. There are still many aspects of the nature of pheromone plasmids that remain unclear and more detailed studies are needed to understand their uniqueness and complexity.

  19. The qacC Gene Has Recently Spread between Rolling Circle Plasmids of Staphylococcus, Indicative of a Novel Gene Transfer Mechanism

    PubMed Central

    Wassenaar, Trudy M.; Ussery, David W.; Ingmer, Hanne


    Resistance of Staphylococcus species to quaternary ammonium compounds, frequently used as disinfectants and biocides, can be attributed to qac genes. Most qac gene products belong to the Small Multidrug Resistant (SMR) protein family, and are often encoded by rolling-circle (RC) replicating plasmids. Four classes of SMR-type qac gene families have been described in Staphylococcus species: qacC, qacG, qacJ, and qacH. Within their class, these genes are highly conserved, but qacC genes are extremely conserved, although they are found in variable plasmid backgrounds. The lower degree of sequence identity of these plasmids compared to the strict nucleotide conservation of their qacC means that this gene has recently spread. In the absence of insertion sequences or other genetic elements explaining the mobility, we sought for an explanation of mobilization by sequence comparison. Publically available sequences of qac genes, their flanking genes and the replication gene that is invariably present in RC-plasmids were compared to reconstruct the evolutionary history of these plasmids and to explain the recent spread of qacC. Here we propose a new model that explains how qacC is mobilized and transferred to acceptor RC-plasmids without assistance of other genes, by means of its location in between the Double Strand replication Origin (DSO) and the Single-Strand replication Origin (SSO). The proposed mobilization model of this DSO-qacC-SSO element represents a novel mechanism of gene mobilization in RC-plasmids, which has also been employed by other genes, such as lnuA (conferring lincomycin resistance). The proposed gene mobility has aided to the wide spread of clinically relevant resistance genes in Staphylococcus populations. PMID:27729906

  20. Parameters controlling interbacterial plasmid spreading in a gnotoxenic chicken gut system: influence of plasmid and bacterial mutations.

    PubMed Central

    Sansonetti, P; Lafont, J P; Jaffé-Brachet, A; Guillot, J F; Chaslus-Dancla, E


    Conjugative transfer of R plasmids R64 and R64drd-11 has been compared in vitro and in vivo without selective pressure by antibiotics in a simplified experimental system; the ecosystem was the bowel of germfree chickens, with the host bacteria almost isogenic, and the plasmids differing only in their conjugative transfer frequency. The spread of repressed and derepressed (drd) R plasmids in recipient bacterial populations was very extensive. The repressed phenotype had only a transient effect during the first 4 h. The level of implantation of the donor bacterial population seems to be of minor importance. Only with a poor recipient (con strain) could the spread of R plasmids be reduced and a steady state with a predominantly sensitive bacterial population be established. It is suggested that this steady state results from an equilibrium between the frequencies of R plasmid transfer and loss. PMID:6999980

  1. 10 CFR 501.32 - Conferences (other than prepetition conferences).

    Code of Federal Regulations, 2010 CFR


    ... 10 Energy 4 2010-01-01 2010-01-01 false Conferences (other than prepetition conferences). 501.32... SANCTIONS Written Comments, Public Hearings and Conferences During Administrative Proceedings § 501.32 Conferences (other than prepetition conferences). (a) At any time following commencement of a...

  2. 47 CFR 1.248 - Prehearing conferences; hearing conferences.

    Code of Federal Regulations, 2010 CFR


    ... 47 Telecommunication 1 2010-10-01 2010-10-01 false Prehearing conferences; hearing conferences. 1... Hearing Proceedings Prehearing Procedures § 1.248 Prehearing conferences; hearing conferences. (a) The... to appear at a specified time and place for a conference prior to a hearing, or to submit...

  3. PCR-based typing of IncC plasmids.


    Harmer, Christopher J; Hall, Ruth M

    IncC (A/C2) plasmids are known to play an important role in the spread of multiple antibiotic resistance determinants, including extended-spectrum β-lactamases and carbapenamases, amongst Gram negative bacterial populations. The ability to identify and track these plasmids is valuable in epidemiological and clinical studies. A recent comparative analysis of the backbones of sequenced IncC plasmids identified two distinct lineages, type 1 and type 2, with different evolutionary histories. Here, a simple PCR method to rapidly assign plasmids to one of these lineages by detecting variable regions in the backbone was developed. This PCR scheme uses two primer pairs to assign the plasmid to a lineage, and an additional two PCRs can be used to detect the i1 and i2 insertions, which are only found in type 2. PCRs were also developed to detect the presence or absence of the sul2-containing ARI-B island, which is found in some plasmids belonging to both type 1 and type 2, and the ARI-A island found in most type 1 plasmids. The PCR strategy was validated using sequenced type 1 plasmids pRMH760 and pDGO100, and the type 2 plasmid pSRC119-A/C, and a collection of non-IncC plasmids in Escherichia coli, Salmonella enterica, and Klebsiella pneumoniae backgrounds. An IncC plasmid detected in an antibiotic susceptible commensal E. coli isolate was examined and found to be a type 1, lacking any antibiotic resistance islands and missing a large backbone segment. Examination of pIP40a, an IncC plasmid isolated in Paris in 1969, by PCR revealed that it belongs to type 1 but lacks ARI-A. However, it includes both ends of the integrative element GIsul2, whereas only remnants of one end of this element are found in more recently isolated IncC plasmids. The sequence of pIP40a was determined and confirmed the assignment to type 1 and revealed the presence of a complete copy of GIsul2.

  4. Dynamics of a Class 1 Integron Located on Plasmid or Chromosome in Two Aeromonas spp. Strains

    PubMed Central

    Pérez-Valdespino, Abigail; Lazarini-Martínez, Alfredo; Rivera-González, Alejandro X.; García-Hernández, Normand; Curiel-Quesada, Everardo


    Integrons are non-mobile bacterial genetic elements that carry different cassettes conferring antibiotic resistance. Cassettes can excise or integrate by action of an integron-encoded integrase, enabling bacteria to face environmental challenges. In this work, the functionality and dynamics of two integrons carrying the same cassette arrangement (dfrA12–orfF–aadA2), but located on plasmid or chromosome in two different strains were studied. In order to demonstrate the functionality of the Class 1 integrase, circular cassette integration intermediaries were PCR amplified by PCR using extrachromosomal DNA extracted from bacteria grown in the presence or absence of cassette-encoded antibiotics. Circular aadA2 and dfrA12–orfF–aadA2 cassettes were detected in cultures grown either in the presence or absence of antibiotics in both strains. No dfrA12–orfF circular intermediates could be detected under any culture conditions. These results show that both integrons are functional. However, these elements show different dynamics and functionality since the presence of streptomycin led to detectable gene rearrangements in the variable region only in the strain with the plasmid-born integron. In addition, complete integration products were demonstrated using a receptor molecule carrying an empty integron. In this case, integration products were observed in both strains even in the absence of antibiotics, but they were more evident in the strain with the plasmid-located integron when streptomycin was present in the culture medium. This suggests that integrons in the two strains respond differently to streptomycin even though DNA sequences upstream the intI1 gene, including the lexA boxes of both integrons are identical. PMID:27733851

  5. Identifying stabilizers of plasmid DNA for pharmaceutical use.


    Zeng, Yuhong; Ramsey, Joshua D; King, Robert; Leviten, Michael; Mcguire, Ruth; Volkin, David B; Joshi, Sangeeta B; Middaugh, C Russell


    To better address the need for developing stable formulations of plasmid DNA-based biopharmaceuticals, 37 compounds from a generally regarded as safe library were examined for their potential use as stabilizers. A plasmid DNA-based therapeutic vaccine, BHT-DNA, was used as a model system. Initial studies were performed to compare the biophysical properties of BHT-DNA plasmid from bulk drug substance and finished drug product. An agarose gel electrophoresis-based assay was then employed in excipient compatibility studies for the drug product by monitoring supercoiled plasmid DNA content in various formulations. After incubation at 40 °C for 30 days, eight out of the 37 excipients tested were able to better retain the supercoil content compared to the control. Sodium citrate appeared to be the most effective stabilizer and its protective capability plateaued at an ionic strength of about 0.4. Several other excipients including malic acid, ethanol, and Pluronic F-68 were also identified as promising stabilizers for BHT-DNA plasmid DNA. Additionally, compounds, including ferrous chloride, ascorbic acid, human serum albumin, and PEG 1000, which significantly destabilized the supercoiled plasmid DNA were identified. These data may also be applicable to other plasmid DNA-based pharmaceuticals for storage stability improvement, due to chemical and structural similarities of these macromolecules.

  6. Tubular cationized pullulan hydrogels as local reservoirs for plasmid DNA.


    San Juan, Aurélie; Ducrocq, Grégory; Hlawaty, Hanna; Bataille, Isabelle; Guénin, Erwann; Letourneur, Didier; Feldman, Laurent J


    In the present study, we measured the ability of various cationized pullulan tubular hydrogels to retain plasmid DNA, and tested the ability of retained plasmid DNA to transfect vascular smooth muscle cells (VSMCs). Cationized pullulans were obtained by grafting at different charge densities ethylamine (EA) or diethylaminoethylamine (DEAE) on the pullulan backbone. Polymers were characterized by elemental analysis, acid-base titration, size exclusion chromatography, Fourier-transform infrared spectroscopy, and proton nuclear magnetic resonance. The complexation of cationized pullulans in solution with plasmid DNA was evidenced by fluorescence quenching with PicoGreen. Cationized pullulans were then chemically crosslinked with phosphorus oxychloride to obtain tubular cationized pullulan hydrogels. Native pullulan tubes did not retain loaded plasmid DNA. In contrast, the ability of cationized pullulan tubes to retain plasmid DNA was dependent on both the amine content and the type of amine. The functional integrity of plasmid DNA in cationized pullulan tubes was demonstrated by in vitro transfection of VSMCs. Hence, cationized pullulan hydrogels can be designed as tubular structures with high affinity for plasmid DNA, which may provide new biomaterials to enhance the efficiency of local arterial gene transfer strategies.

  7. Plasmid carriage can limit bacteria-phage coevolution.


    Harrison, Ellie; Truman, Julie; Wright, Rosanna; Spiers, Andrew J; Paterson, Steve; Brockhurst, Michael A


    Coevolution with bacteriophages is a major selective force shaping bacterial populations and communities. A variety of both environmental and genetic factors has been shown to influence the mode and tempo of bacteria-phage coevolution. Here, we test the effects that carriage of a large conjugative plasmid, pQBR103, had on antagonistic coevolution between the bacterium Pseudomonas fluorescens and its phage, SBW25ϕ2. Plasmid carriage limited bacteria-phage coevolution; bacteria evolved lower phage-resistance and phages evolved lower infectivity in plasmid-carrying compared with plasmid-free populations. These differences were not explained by effects of plasmid carriage on the costs of phage resistance mutations. Surprisingly, in the presence of phages, plasmid carriage resulted in the evolution of high frequencies of mucoid bacterial colonies. Mucoidy can provide weak partial resistance against SBW25ϕ2, which may have limited selection for qualitative resistance mutations in our experiments. Taken together, our results suggest that plasmids can have evolutionary consequences for bacteria that go beyond the direct phenotypic effects of their accessory gene cargo.

  8. Plasmid-associated sensitivity of Bacillus thuringiensis to UV light

    SciTech Connect

    Benoit, T.G.; Wilson, G.R.; Bull, D.L.; Aronson, A.I. )


    Spores and vegetative cells of Bacillus thuringiensis were more sensitive to UV light than were spores or cells of plasmid-cured B. thuringiensis strains or of the closely related Bacillus cereus. Introduction of B. thuringiensis plasmids into B. cereus by cell mating increased the UV sensitivity of the cells and spores. Protoxins encoded by one or more B. thuringiensis plasmids were not involved in spore sensitivity, since a B. thuringiensis strain conditional for protoxin accumulation was equally sensitive at the permissive and nonpermissive temperatures. In addition, introduction of either a cloned protoxin gene, the cloning vector, or another plasmid not containing a protoxin gene into a plasmid-cured strain of B. thuringiensis all increased the UV sensitivity of the spores. Although the variety of small, acid-soluble proteins was the same in the spores of all strains examined, the quantity of dipicolinic acid was about twice as high in the plasmid-containing strains, and this may account for the differences in UV sensitivity of the spores. The cells of some strains harboring only B. thuringiensis plasmids were much more sensitive than cells of any of the other strains, and the differences were much greater than observed with spores.

  9. Plasmid-mediated mineralization of naphthalene, phenanthrene, and anthracene.

    PubMed Central

    Sanseverino, J; Applegate, B M; King, J M; Sayler, G S


    The well-characterized plasmid-encoded naphthalene degradation pathway in Pseudomonas putida PpG7(NAH7) was used to investigate the role of the NAH plasmid-encoded pathway in mineralizing phenanthrene and anthracene. Three Pseudomonas strains, designated 5R, DFC49, and DFC50, were recovered from a polynuclear aromatic hydrocarbon-degrading inoculum developed from a manufactured gas plant soil slurry reactor. Plasmids pKA1, pKA2, and pKA3, approximately 100 kb in size, were isolated from these strains and characterized. These plasmids have homologous regions of upper and lower NAH7 plasmid catabolic genes. By conjugation experiments, these plasmids, including NAH7, have been shown to encode the genotype for mineralization of [9-14C]phenanthrene and [U-14C]anthracene, as well as [1-14C]naphthalene. One strain, Pseudomonas fluorescens 5RL, which has the complete lower pathway inactivated by transposon insertion in nahG, accumulated a metabolite from phenanthrene and anthracene degradation. This is the first direct evidence to indicate that the NAH plasmid-encoded catabolic genes are involved in degradation of polynuclear aromatic hydrocarbons other than naphthalene. Images PMID:8328809

  10. General method for plasmid construction using homologous recombination.


    Raymond, C K; Pownder, T A; Sexson, S L


    We describe a general method for plasmid assembly that uses yeast and extends beyond yeast-specific research applications. This technology exploits the homologous recombination, double-stranded break repair pathway in Saccharomyces cerevisiae to join DNA fragments. Synthetic, double-stranded "recombination linkers" were used to "subclone" a DNA fragment into a plasmid with > 80% efficiency. Quantitative data on the influence of DNA concentration and overlap length on the efficiency of recombination are presented. Using a simple procedure, plasmids were shuttled from yeast into E. coli for subsequent screening and large-scale plasmid preps. This simple method for plasmid construction has several advantages. (i) It bypasses the need for extensive PCR amplification and for purification, modification and/or ligation techniques routinely used for plasmid constructions. (ii) The method does not rely on available restriction sites, thus fragment and vector DNA can be joined within any DNA sequence. This enables the use of multifunctional cloning vectors for protein expression in mammalian cells, other yeast species, E. coli and other expression systems as discussed. (iii) Finally, the technology exploits yeast strains, plasmids and microbial techniques that are inexpensive and readily available.

  11. Analysis of chromosomal integration and deletions of yeast plasmids.

    PubMed Central

    Cameron, J R; Philippsen, P; Davis, R W


    Plasmid DNAs from six strains of Saccharomyces cerevisiae were compared. Three different plasmids were found, designated Scp 1, Scp 2 and Scp 3, with monomer lengths of 6.19, 6.06 and 5.97 kilobases as referenced to sequenced phiX174 DNA. DNA from each of the plasmids was inserted into a lambda vector DNA. Hybrid phage containing inserted DNA of the desired size were enriched by genetic selection and their DNAs analysed by rapid techniques. All three plasmids share the same organization, two unique sequences separated by two inverted repeats, and share basically the same DNA sequences. Scp 2 and Scp 3 differ from Scp 1 by missing a unique HpaI site and by having small overlapping deletions in the same region. The HpaI site in Scp 1 is, therefore, in a nonessential region and suitable for insertion of foreign DNA in the potential use of the yeast plasmid as a vector. Hybridization of labelled cloned plasmid DNA to restriction fragments of linear yeast DNA separated on agarose gels showed that the plasmid DNA was not stably integrated into the yeast chromosomal DNA. Images PMID:331256

  12. Development of a microfluidic chip-based plasmid miniprep.


    Northrup, Victoria A; Backhouse, Christopher J; Glerum, D Moira


    Plasmids are the workhorse of contemporary molecular biology, serving as vectors in the multitude of molecular cloning approaches now available. Plasmid minipreps are a routine and essential means of extracting plasmid DNA from bacteria, such as Escherichia coli, for identification, characterization, and further manipulation. Although there have been many approaches described and miniprep kits are commercially available, traditional minipreps typically require more than 16h, including the time needed for bacterial cell culture. Here we describe the development of a microfluidic chip (MFC)-based miniprep that uses on-chip lysis and trapping of large DNA in agarose to differentially separate plasmid DNA from the bacterial chromosome. Our approach greatly decreases both the time required for the miniprep itself and the time required for growth of the bacterial cultures because our on-chip miniprep uses 10(5) times fewer E. coli cells. Because the quality of the isolated plasmid is comparable to that obtained using conventional miniprep protocols, this approach allows growth of E. coli and isolation of plasmid within hours, thereby making it ideal for rapid screening approaches. This MFC-based miniprep, coupled with recently demonstrated on-chip transfection capabilities, lays the groundwork for seamless manipulation of plasmids on MFC platforms.

  13. An updated view of plasmid conjugation and mobilization in Staphylococcus

    PubMed Central

    Ramsay, Joshua P.; Kwong, Stephen M.; Murphy, Riley J. T.; Yui Eto, Karina; Price, Karina J.; Nguyen, Quang T.; O'Brien, Frances G.; Grubb, Warren B.; Coombs, Geoffrey W.; Firth, Neville


    ABSTRACT The horizontal gene transfer facilitated by mobile genetic elements impacts almost all areas of bacterial evolution, including the accretion and dissemination of antimicrobial-resistance genes in the human and animal pathogen Staphylococcus aureus. Genome surveys of staphylococcal plasmids have revealed an unexpected paucity of conjugation and mobilization loci, perhaps suggesting that conjugation plays only a minor role in the evolution of this genus. In this letter we present the DNA sequences of historically documented staphylococcal conjugative plasmids and highlight that at least 3 distinct and widely distributed families of conjugative plasmids currently contribute to the dissemination of antimicrobial resistance in Staphylococcus. We also review the recently documented “relaxase-in trans” mechanism of conjugative mobilization facilitated by conjugative plasmids pWBG749 and pSK41, and discuss how this may facilitate the horizontal transmission of around 90% of plasmids that were previously considered non-mobilizable. Finally, we enumerate unique sequenced S. aureus plasmids with a potential mechanism of mobilization and predict that at least 80% of all non-conjugative S. aureus plasmids are mobilizable by at least one mechanism. We suggest that a greater research focus on the molecular biology of conjugation is essential if we are to recognize gene-transfer mechanisms from our increasingly in silico analyses. PMID:27583185

  14. F'-plasmid transfer from Escherichia coli to Pseudomonas fluorescens.

    PubMed Central

    Mergeay, M; Gerits, J


    Various F' plasmids of Escherichia coli K-12 could be transferred into mutants of the soil strain 6.2, classified herein as a Pseudomonas fluorescens biotype IV. This strain was previously found to receive Flac plasmid (N. Datta and R.W. Hedges, J. Gen Microbiol. 70:453-460, 1972). ilv, leu, met, arg, and his auxotrophs were complemented by plasmids carrying isofunctional genes; trp mutants were not complemented or were very poorly complemented. The frequency of transfer was 10(-5). Subsequent transfer into other P. fluorescens recipients was of the same order of magnitude. Some transconjugants were unable to act as donors, and these did not lose the received information if subcultured on nonselective media. Use of F' plasmids helped to discriminate metabolic blocks in P. fluorescens. In particular, metA, metB, and argH mutants were so distinguished. In addition, F131 plasmid carrying the his operon and a supD mutation could partially relieve the auxotrophy of thr, ilv, and metA13 mutants, suggesting functional expression of E. coli tRNA in P. fluorescens. In P. fluorescens metA Rifr mutants carrying the F110 plasmid, which carried the E. coli metA gene and the E. coli rifs allele, sensitivity to rifampin was found to be dominant at least temporarily over resistance. This suggests interaction of E. coli and P. fluorescens subunits of RNA polymerase. his mutations were also complemented by composite P plasmids containing the his-nif region of Klebsiella pneumoniae (plasmids FN68 and RP41). nif expression could be detected by acetylene reduction in some his+ transconjugants. The frequency of transfer of these P plasmids was 5 X 10(-4). PMID:97267

  15. 76 FR 64083 - Reliability Technical Conference; Notice of Technical Conference

    Federal Register 2010, 2011, 2012, 2013, 2014


    ... From the Federal Register Online via the Government Publishing Office DEPARTMENT OF ENERGY Federal Energy Regulatory Commission Reliability Technical Conference; Notice of Technical Conference Take notice that the Federal Energy Regulatory Commission will hold a Technical Conference on Tuesday, November...

  16. [Epidemiologic study of 2 S. typhimurium outbreaks using plasmid fingerprints].


    Baumgartner, A; Breer, C; Schopfer, K


    An outbreak of salmonellosis in an old people's home is reported. The infectious agent, S. typhi-murium, was isolated not only from several inmates but also from sick cows of the farm belonging to the home, in animal feed, from employees of the local butcher's shop, and finally in sludge from the local sewage plant. Plasmid analysis provided evidence of a common origin for the isolated S. typhi-murium strains. The incriminated strains harboured, together with two low-molecular-weight plasmids, a plasmid of approximately 50 Mdal, which was also demonstrated in some other S. typhi-murium strains isolated from clinical cases in the area around St. Gallen.

  17. A nonalkaline method for isolating sequencing-ready plasmids.


    Paul, Bonnie; Cloninger, Cheri; Felton, Marilyn; Khachatoorian, Ronik; Metzenberg, Stan


    We describe a simple method of isolating plasmid DNA directly from Escherichia coli culture medium by addition of lithium acetate and Sodium dodecyl sulphate, followed by centrifugation and alcohol precipitation. The plasmid is sufficiently pure that it can be used in many enzyme-based reactions, including DNA sequencing and restriction analysis. Chromosomal DNA contamination is significantly reduced by pretreatment of the culture with DNase I, suggesting that much of the contaminant is associated with permeable dead cells. Chromosomal DNA contaminant can also be selectively denatured without damage to the supercoiled plasmid by alkaline denaturation in an arginine buffer or heat treatment in the presence of urea or N,N-dimethylformamide.

  18. Influenza Plasmid DNA Vaccines: Progress and Prospects.


    Bicho, Diana; Queiroz, João António; Tomaz, Cândida Teixeira


    Current influenza vaccines have long been used to fight flu infectious; however, recent advances highlight the importance of produce new alternatives. Even though traditional influenza vaccines are safe and usually effective, they need to be uploaded every year to anticipate circulating flu viruses. This limitation together with the use of embryonated chicken eggs as the substrate for vaccine production, is time-consuming and could involve potential biohazards in growth of new virus strains. Plasmid DNA produced by prokaryote microorganisms and encoding foreign proteins had emerged as a promising therapeutic tool. This technology allows the expression of a gene of interest by eukaryotic cells in order to induce protective immune responses against the pathogen of interest. In this review, we discuss the strategies to choose the best DNA vaccine to be applied in the treatment and prevention of influenza. Specifically, we give an update of influenza DNA vaccines developments, all involved techniques, their main characteristics, applicability and technical features to obtain the best option against influenza infections.

  19. Functional analysis of a bacitracin resistance determinant located on ICECp1, a novel Tn916-like element from a conjugative plasmid in Clostridium perfringens.


    Han, Xiaoyan; Du, Xiang-Dang; Southey, Luke; Bulach, Dieter M; Seemann, Torsten; Yan, Xu-Xia; Bannam, Trudi L; Rood, Julian I


    Bacitracins are mixtures of structurally related cyclic polypeptides with antibiotic properties. They act by interfering with the biosynthesis of the bacterial cell wall. In this study, we analyzed an avian necrotic enteritis strain of Clostridium perfringens that was resistant to bacitracin and produced NetB toxin. We identified a bacitracin resistance locus that resembled a bacitracin resistance determinant from Enterococcus faecalis. It contained the structural genes bcrABD and a putative regulatory gene, bcrR. Mutagenesis studies provided evidence that both bcrA and bcrB are essential for bacitracin resistance, and that evidence was supported by the results of experiments in which the introduction of both the bcrA and bcrB genes into a bacitracin-susceptible C. perfringens strain was required to confer bacitracin resistance. The wild-type strain was shown to contain at least three large, putatively conjugative plasmids, and the bcrRABD locus was localized to an 89.7-kb plasmid, pJIR4150. This plasmid was experimentally shown to be conjugative and was sequenced. The sequence revealed that it also carries a tpeL toxin gene and is related to the pCW3 family of conjugative antibiotic resistance and toxin plasmids from C. perfringens. The bcr genes were located on a genetic element, ICECp1, which is related to the Tn916 family of integrative conjugative elements (ICEs). ICECp1 appears to be the first Tn916-like element shown to confer bacitracin resistance. In summary, we identified in a toxin-producing C. perfringens strain a novel mobile bacitracin resistance element which was experimentally shown to be essential for bacitracin resistance and is carried by a putative ICE located on a conjugative plasmid.

  20. Gene regulation of plasmid- and chromosome-determined inorganic ion transport in bacteria.

    PubMed Central

    Silver, S; Walderhaug, M


    Regulation of chromosomally determined nutrient cation and anion uptake systems shows important similarities to regulation of plasmid-determined toxic ion resistance systems that mediate the outward transport of deleterious ions. Chromosomally determined transport systems result in accumulation of K+, Mg2+, Fe3+, Mn2+, PO4(3-), SO4(2-), and additional trace nutrients, while bacterial plasmids harbor highly specific resistance systems for AsO2-, AsO4(3-), CrO4(2-), Cd2+, Co2+, Cu2+, Hg2+, Ni2+, SbO2-, TeO3(2-), Zn2+, and other toxic ions. To study the regulation of these systems, we need to define both the trans-acting regulatory proteins and the cis-acting target operator DNA regions for the proteins. The regulation of gene expression for K+ and PO4(3-) transport systems involves two-component sensor-effector pairs of proteins. The first protein responds to an extracellular ionic (or related) signal and then transmits the signal to an intracellular DNA-binding protein. Regulation of Fe3+ transport utilizes the single iron-binding and DNA-binding protein Fur. The MerR regulatory protein for mercury resistance both repress