Science.gov

Sample records for plasmids conferring kanamycin

  1. Novel plasmid conferring kanamycin and tetracycline resistance in turkey-derived Campylobacter jejuni strain 11601MD

    Technology Transfer Automated Retrieval System (TEKTRAN)

    In Campylobacter spp., resistance to the antibiotics kanamycin and tetracycline is frequently associated with plasmid-borne genes. However, relatively few plasmids of Campylobacter jejuni have been fully characterized to date. A novel plasmid (p11601MD; 44,095 bp.) harboring tet(O) was identified in...

  2. Transformation of Thermoanaerobacterium sp. strain JW/SL-YS485 with plasmid pIKM1 conferring kanamycin resistance

    SciTech Connect

    Mai, V.; Lorenz, W.W.; Wiegel, J.

    1997-12-31

    The industrial application of thermophilic (eu)bacteria is hampered by the lack of genetic systems for these bacteria. We report here the first unequivocal transformation of a Gram-positive, thermophilic, anaerobic microorganism, Thermoanaerobacterium, with the kanamycin resistance-mediating plasmid pIKM1. The construct pIKM1 is based on the Escherichia coli-Clostridium acetobutylicum shuttle vector pIMP1 and contains the thermostable kanamycin cassette from S. faecalis plasmid pKD102. Using electrotransformation, plasmid pIKM1 mediated kanamycin resistance in Thermoanaerobacterium sp. strain JW/SL-YS485 up to 400 {mu}g ml{sup -1} at 48{degrees}C and 200 {mu}g ml{sup -1} at 60{degrees}C.

  3. Mobilization properties of small ColE1-like plasmids carrying kanamycin resistance gene isolated from Salmonella enterica serotypes

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Background: Previously we isolated and characterized various groups of small kanamycin resistance (KanR) ColE1-like plasmids from different serotypes of Salmonella enterica isolates. These plasmids all carried the aph(3)-I gene encoding the aminoglycoside phosphotransferase responsible for the kanam...

  4. Characterization and distribution of ColE1-like kanamycin-resistance plasmids in Salmonella enterica from food animals

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Background: Antimicrobial resistant foodborne pathogens cause public health concerns and multi-drug resistant (MDR) pathogens present difficulties when treatment is warranted. Large plasmids are responsible for the majority of the MDR and subsequently, the focus of most research. Previous studies sh...

  5. Protein diversity confers specificity in plasmid segregation.

    PubMed

    Fothergill, Timothy J G; Barillà, Daniela; Hayes, Finbarr

    2005-04-01

    The ParG segregation protein (8.6 kDa) of multidrug resistance plasmid TP228 is a homodimeric DNA-binding factor. The ParG dimer consists of intertwined C-terminal domains that adopt a ribbon-helix-helix architecture and a pair of flexible, unstructured N-terminal tails. A variety of plasmids possess partition loci with similar organizations to that of TP228, but instead of ParG homologs, these plasmids specify a diversity of unrelated, but similarly sized, partition proteins. These include the proteobacterial pTAR, pVT745, and pB171 plasmids. The ParG analogs of these plasmids were characterized in parallel with the ParG homolog encoded by the pseudomonal plasmid pVS1. Like ParG, the four proteins are dimeric. No heterodimerization was detectable in vivo among the proteins nor with the prototypical ParG protein, suggesting that monomer-monomer interactions are specific among the five proteins. Nevertheless, as with ParG, the ParG analogs all possess significant amounts of unordered amino acid residues, potentially highlighting a common structural link among the proteins. Furthermore, the ParG analogs bind specifically to the DNA regions located upstream of their homologous parF-like genes. These nucleoprotein interactions are largely restricted to cognate protein-DNA pairs. The results reveal that the partition complexes of these and related plasmids have recruited disparate DNA-binding factors that provide a layer of specificity to the macromolecular interactions that mediate plasmid segregation. PMID:15805511

  6. Diversified mcr-1-Harbouring Plasmid Reservoirs Confer Resistance to Colistin in Human Gut Microbiota

    PubMed Central

    Ye, Huiyan; Li, Yihui; Li, Zhencui; Gao, Rongsui; Zhang, Han; Wen, Ronghui; Gao, George F.; Hu, Qinghua

    2016-01-01

    ABSTRACT Colistin is an ultimate line of refuge against multidrug-resistant Gram-negative pathogens. Very recently, the emergence of plasmid-mediated mcr-1 colistin resistance has become a great challenge to global public health, raising the possibility that dissemination of the mcr-1 gene is underestimated and diversified. Here, we report three cases of plasmid-carried MCR-1 colistin resistance in isolates from gut microbiota of diarrhea patients. Structural and functional analyses determined that the colistin resistance is conferred purely by the single mcr-1 gene. Genetic and sequence mapping revealed that mcr-1-harbouring plasmid reservoirs are present in diversity. Together, the data represent the first evidence of diversity in mcr-1-harbouring plasmid reservoirs of human gut microbiota. PMID:27048797

  7. Draft genome sequences of two Aeromonas salmonicida subsp. salmonicida isolates harboring plasmids conferring antibiotic resistance.

    PubMed

    Vincent, Antony T; Tanaka, Katherine H; Trudel, Melanie V; Frenette, Michel; Derome, Nicolas; Charette, Steve J

    2015-02-01

    The bacterium Aeromonas salmonicida is the etiological agent of furunculosis, a widespread fish disease causing important economic losses to the fish farming industry. Antibiotic treatments in fish farms may be challenging given the existence of multidrug-resistant isolates of this bacterium. Here, we report the draft genome sequences of the 2004-05MF26 and 2009-144K3 isolates, which harbor plasmids conferring antibiotic resistance. Both isolates also carry the large plasmid pAsa5, which is known to encode a type three secretion system (TTSS) and the pAsal1 plasmid which has the aopP gene producing a TTSS effector. These two isolates are good representatives of the plasmid diversity in A. salmonicida subsp. salmonicida. PMID:25724776

  8. Environmentally co-occurring mercury resistance plasmids are genetically and phenotypically diverse and confer variable context-dependent fitness effects.

    PubMed

    Hall, James P J; Harrison, Ellie; Lilley, Andrew K; Paterson, Steve; Spiers, Andrew J; Brockhurst, Michael A

    2015-12-01

    Plasmids are important mobile elements that can facilitate genetic exchange and local adaptation within microbial communities. We compared the sequences of four co-occurring pQBR family environmental mercury resistance plasmids and measured their effects on competitive fitness of a Pseudomonas fluorescens SBW25 host, which was isolated at the same field site. Fitness effects of carriage differed between plasmids and were strongly context dependent, varying with medium, plasmid status of competitor and levels of environmental mercury. The plasmids also varied widely in their rates of conjugation and segregational loss. We found that few of the plasmid-borne accessory genes could be ascribed functions, although we identified a putative chemotaxis operon, a type IV pilus-encoding cluster and a region encoding putative arylsulfatase enzymes, which were conserved across geographically distant isolates. One plasmid, pQBR55, conferred the ability to catabolize sucrose. Transposons, including the mercury resistance Tn5042, appeared to have been acquired by different pQBR plasmids by recombination, indicating an important role for horizontal gene transfer in the recent evolution of pQBR plasmids. Our findings demonstrate extensive genetic and phenotypic diversity among co-occurring members of a plasmid community and suggest a role for environmental heterogeneity in the maintenance of plasmid diversity.

  9. Plasmid-Encoded Metallo-β-Lactamase (IMP-6) Conferring Resistance to Carbapenems, Especially Meropenem

    PubMed Central

    Yano, Hisakazu; Kuga, Akio; Okamoto, Ryoichi; Kitasato, Hidero; Kobayashi, Toshimitsu; Inoue, Matsuhisa

    2001-01-01

    In 1996, Serratia marcescens KU3838 was isolated from the urine of a patient with a urinary tract infection at a hospital in northern Japan and was found to contain the plasmid pKU501. Previously, we determined that pKU501 carries blaIMP and the genes for TEM-1-type β-lactamases as well as producing both types of β-lactamases (H. Yano, A. Kuga, K. Irinoda, R. Okamoto, T. Kobayashi, and M. Inoue, J. Antibiot. 52:1135–1139, 1999). pKU502 is a recombinant plasmid that contains a 1.5-kb DNA fragment, including the metallo-β-lactamase gene, and is obtained by PCR amplification of pKU501. The sequence of the metallo-β-lactamase gene in pKU502 was determined and revealed that this metallo-β-lactamase gene differed from the gene encoding IMP-1 by one point mutation, leading to one amino acid substitution: 640-A in the base sequence of the IMP-1 gene was replaced by G, and Ser-196 was replaced by Gly in the mature enzyme. This enzyme was designated IMP-6. The strains that produced IMP-6 were resistant to carbapenems. The MICs of panipenem and especially meropenem were higher than the MIC of imipenem for these strains. The kcat/Km value of IMP-6 was about sevenfold higher against meropenem than against imipenem, although the MIC of meropenem for KU1917, which produced IMP-1, was lower than that of imipenem, and the MIC of panipenem was equal to that of imipenem. These results support the hypothesis that IMP-6 has extended substrate profiles against carbapenems. However, the activity of IMP-6 was very low against penicillin G and piperacillin. These results suggest that IMP-6 acquired high activity against carbapenems, especially meropenem, via the point mutation but in the process lost activity against penicillins. Although IMP-6 has reduced activity against penicillins due to this point mutation, pKU501 confers resistance to a variety of antimicrobial agents because it also produces TEM-1-type enzyme. PMID:11302793

  10. Characterisation of a mobilisable plasmid conferring florfenicol and chloramphenicol resistance in Actinobacillus pleuropneumoniae.

    PubMed

    Bossé, Janine T; Li, Yanwen; Atherton, Tom G; Walker, Stephanie; Williamson, Susanna M; Rogers, Jon; Chaudhuri, Roy R; Weinert, Lucy A; Holden, Matthew T G; Maskell, Duncan J; Tucker, Alexander W; Wren, Brendan W; Rycroft, Andrew N; Langford, Paul R

    2015-08-01

    The complete nucleotide sequence of a 7.7kb mobilisable plasmid (pM3446F), isolated from a florfenicol resistant isolate of Actinobacillus pleuropneumoniae, showed extended similarity to plasmids found in other members of the Pasteurellaceae containing the floR gene as well as replication and mobilisation genes. Mobilisation into other Pasteurellaceae species confirmed that this plasmid can be transferred horizontally. PMID:26049592

  11. Characterisation of a mobilisable plasmid conferring florfenicol and chloramphenicol resistance in Actinobacillus pleuropneumoniae

    PubMed Central

    Bossé, Janine T; Li, Yanwen; Atherton, Tom G; Walker, Stephanie; Williamson, Susanna M; Rogers, Jon; Chaudhuri, Roy R; Weinert, Lucy A; Holden, Matthew TG; Maskell, Duncan J; Tucker, Alexander W; Wren, Brendan W; Rycroft, Andrew N; Langford, Paul R

    2015-01-01

    The complete nucleotide sequence of a 7.7 kb mobilisable plasmid (pM3446F), isolated from a florfenicol resistant isolate of Actinobacillus pleuropneumoniae, showed extended similarity to plasmids found in other members of the Pasteurellaceae containing the floR gene as well as replication and mobilisation genes. Mobilisation into other Pasteurellaceae species confirmed that this plasmid can be transferred horizontally. PMID:26049592

  12. Association of tellurium resistance and bacteriophage inhibition conferred by R plasmids.

    PubMed Central

    Taylor, D E; Summers, A O

    1979-01-01

    Concomitant resistance to tellurium compounds (Ter) and inhibition of coli-phage development (Phi) are properties mediated by many H2 incompatibility group R plasmids which have been isolated from diverse bacterial and geographic sources. Ter plasmids from tellurium-resistant bacteria that were isolated from sewage and industrial wastes also mediated phage inhibition. Of these Ter plasmids, three from Citrobacter freundii belonged to the H incompatibility group, whereas three from Klebsiella pneumoniae did not. Images PMID:374351

  13. Characterization of Mobile Staphylococcus equorum Plasmids Isolated from Fermented Seafood That Confer Lincomycin Resistance

    PubMed Central

    Lee, Jong-Hoon; Jeong, Do-Won

    2015-01-01

    The complete nucleotide sequences of lincomycin-resistance gene (lnuA)-containing plasmids in Staphylococcus equorum strains isolated from the high-salt-fermented seafood jeotgal were determined. These plasmids, designated pSELNU1–3, are 2638-bp long, have two polymorphic sites, and encode typical elements found in plasmids that replicate via a rolling-circle mechanism including the replication protein gene (rep), a double-stranded origin of replication, a single-stranded origin of replication, and counter-transcribed RNA sequence, as well as lnuA. Plasmid sequences exhibit over 83% identity to other Staphylococcus plasmids that harbor rep and lnuA genes. Further, three pairs of identified direct repeats may be involved in inter-plasmid recombination. One plasmid, pSELNU1, was successfully transferred to other Staphylococcus species, Enterococcus faecalis, and Tetragenococcus halophilus in vitro. Antibiotic susceptibility of the transconjugants was host-dependent, and transconjugants maintained a lincomycin resistance phenotype in the absence of selective pressure over 60 generations. PMID:26448648

  14. Characterization of Mobile Staphylococcus equorum Plasmids Isolated from Fermented Seafood That Confer Lincomycin Resistance.

    PubMed

    Lee, Jong-Hoon; Jeong, Do-Won

    2015-01-01

    The complete nucleotide sequences of lincomycin-resistance gene (lnuA)-containing plasmids in Staphylococcus equorum strains isolated from the high-salt-fermented seafood jeotgal were determined. These plasmids, designated pSELNU1-3, are 2638-bp long, have two polymorphic sites, and encode typical elements found in plasmids that replicate via a rolling-circle mechanism including the replication protein gene (rep), a double-stranded origin of replication, a single-stranded origin of replication, and counter-transcribed RNA sequence, as well as lnuA. Plasmid sequences exhibit over 83% identity to other Staphylococcus plasmids that harbor rep and lnuA genes. Further, three pairs of identified direct repeats may be involved in inter-plasmid recombination. One plasmid, pSELNU1, was successfully transferred to other Staphylococcus species, Enterococcus faecalis, and Tetragenococcus halophilus in vitro. Antibiotic susceptibility of the transconjugants was host-dependent, and transconjugants maintained a lincomycin resistance phenotype in the absence of selective pressure over 60 generations.

  15. 21 CFR 522.1204 - Kanamycin.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... kanamycin sulfate. (b) Sponsor. See No. 054771 in § 510.600(c) of this chapter. (c) Conditions of use in dogs and cats—(1) Amount. Administer by subcutaneous or intramuscular injection 5 mg per pound of body... of bacterial infections due to kanamycin sensitive organisms in dogs and cats. (3)...

  16. Demonstration of plasmid-mediated drug resistance in Mycobacterium abscessus.

    PubMed

    Matsumoto, Cristianne Kayoko; Bispo, Paulo José Martins; Santin, Katiane; Nogueira, Christiane Lourenço; Leão, Sylvia Cardoso

    2014-05-01

    Plasmid-mediated kanamycin resistance was detected in a strain of Mycobacterium abscessus subsp. bolletii responsible for a nationwide epidemic of surgical infections in Brazil. The plasmid did not influence susceptibility to tobramycin, streptomycin, trimethoprim-sulfamethoxazole, clarithromycin, or ciprofloxacin. Plasmid-mediated drug resistance has not been described so far in mycobacteria. PMID:24574286

  17. Previously undescribed plasmids recovered from activated sludge confer tetracycline resistance and phenotypic changes to Acinetobacter oleivorans DR1.

    PubMed

    Hong, Hyerim; Ko, Hyeok-Jin; Choi, In-Geol; Park, Woojun

    2014-02-01

    We used culture-dependent and culture-independent methods to extract previously undescribed plasmids harboring tetracycline (TC) resistance genes from activated sludge. The extracted plasmids were transformed into naturally competent Acinetobacter oleivorans DR1 to recover a non-Escherichia coli-based plasmid. The transformed cells showed 80-100-fold higher TC resistance than the wild-type strain. Restriction length polymorphism performed using 30 transformed cells showed four different types of plasmids. Illumina-based whole sequencing of the four plasmids identified three previously unreported plasmids and one previously reported plasmid. All plasmids carried TC resistance-related genes (tetL, tetH), tetracycline transcriptional regulators (tetR), and mobilization-related genes. As per expression analysis, TC resistance genes were functional in the presence of TC. The recovered plasmids showed mosaic gene acquisition through horizontal gene transfer. Membrane fluidity, hydrophobicity, biofilm formation, motility, growth rate, sensitivity to stresses, and quorum sensing signals of the transformed cells were different from those of the wild-type cells. Plasmid-bearing cells seemed to have an energy burden for maintaining and expressing plasmid genes. Our data showed that acquisition of TC resistance through plasmid uptake is related to loss of biological fitness. Thus, cells acquiring antibiotic resistance plasmids can survive in the presence of antibiotics, but must pay ecological costs.

  18. 21 CFR 522.1204 - Kanamycin sulfate injection.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ... veterinary contains either 50 or 200 milligrams of kanamycin. (b) Sponsor. See No. 000856 in § 510.600(c) of... kanamycin sensitive organisms in dogs and cats. (2) It is administered subcutaneously or intramuscularly...

  19. 21 CFR 522.1204 - Kanamycin sulfate injection.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... veterinary contains either 50 or 200 milligrams of kanamycin. (b) Sponsor. See No. 000856 in § 510.600(c) of... kanamycin sensitive organisms in dogs and cats. (2) It is administered subcutaneously or intramuscularly...

  20. High Throughput Analyses of Budding Yeast ARSs Reveal New DNA Elements Capable of Conferring Centromere-Independent Plasmid Propagation

    PubMed Central

    Hoggard, Timothy; Liachko, Ivan; Burt, Cassaundra; Meikle, Troy; Jiang, Katherine; Craciun, Gheorghe; Dunham, Maitreya J.; Fox, Catherine A.

    2016-01-01

    The ability of plasmids to propagate in Saccharomyces cerevisiae has been instrumental in defining eukaryotic chromosomal control elements. Stable propagation demands both plasmid replication, which requires a chromosomal replication origin (i.e., an ARS), and plasmid distribution to dividing cells, which requires either a chromosomal centromere for segregation or a plasmid-partitioning element. While our knowledge of yeast ARSs and centromeres is relatively advanced, we know less about chromosomal regions that can function as plasmid partitioning elements. The Rap1 protein-binding site (RAP1) present in transcriptional silencers and telomeres of budding yeast is a known plasmid-partitioning element that functions to anchor a plasmid to the inner nuclear membrane (INM), which in turn facilitates plasmid distribution to daughter cells. This Rap1-dependent INM-anchoring also has an important chromosomal role in higher-order chromosomal structures that enhance transcriptional silencing and telomere stability. Thus, plasmid partitioning can reflect fundamental features of chromosome structure and biology, yet a systematic screen for plasmid partitioning elements has not been reported. Here, we couple deep sequencing with competitive growth experiments of a plasmid library containing thousands of short ARS fragments to identify new plasmid partitioning elements. Competitive growth experiments were performed with libraries that differed only in terms of the presence or absence of a centromere. Comparisons of the behavior of ARS fragments in the two experiments allowed us to identify sequences that were likely to drive plasmid partitioning. In addition to the silencer RAP1 site, we identified 74 new putative plasmid-partitioning motifs predicted to act as binding sites for DNA binding proteins enriched for roles in negative regulation of gene expression and G2/M-phase associated biology. These data expand our knowledge of chromosomal elements that may function in plasmid

  1. 21 CFR 520.1204 - Kanamycin, bismuth subcarbonate, activated attapulgite.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... 21 Food and Drugs 6 2014-04-01 2014-04-01 false Kanamycin, bismuth subcarbonate, activated... § 520.1204 Kanamycin, bismuth subcarbonate, activated attapulgite. (a) Specifications—(1) Each 5 milliliters (mL) of suspension contains 100 milligrams (mg) kanamycin (as the sulfate), 250 mg...

  2. 21 CFR 520.1204 - Kanamycin, bismuth subcarbonate, activated attapulgite.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ... 21 Food and Drugs 6 2012-04-01 2012-04-01 false Kanamycin, bismuth subcarbonate, activated... § 520.1204 Kanamycin, bismuth subcarbonate, activated attapulgite. (a) Specifications—(1) Each 5 milliliters (mL) of suspension contains 100 milligrams (mg) kanamycin (as the sulfate), 250 mg...

  3. 21 CFR 520.1204 - Kanamycin, bismuth subcarbonate, activated attapulgite.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... 21 Food and Drugs 6 2013-04-01 2013-04-01 false Kanamycin, bismuth subcarbonate, activated... § 520.1204 Kanamycin, bismuth subcarbonate, activated attapulgite. (a) Specifications—(1) Each 5 milliliters (mL) of suspension contains 100 milligrams (mg) kanamycin (as the sulfate), 250 mg...

  4. Prevalence of transposons encoding kanamycin, ampicillin and trimethoprim resistance in isolates from urinary tract infections detected using DNA probes.

    PubMed

    Chang, S F; Chang, L L; Chow, T Y; Wu, W J; Chang, J C

    1992-03-01

    Drug resistant Gram-negative bacteria causing urinary tract infections were collected. Kanamycin, ampicillin or trimethoprim-resistant strains were analyzed separately for the presence of Tn5, Tn3, or Tn7 by colony hybridization. Of these isolates, kanamycin-resistant transposons were present in 38.2% of 60 kanamycin-resistant isolates. A 3.3 kb fragment containing SacI-BamHI transposase of Tn3 and 42.6% showed a positive reaction in 129 ampicillin-resistant clinical isolates. Among the 75 trimethoprim-resistant isolates studied, 52% were shown to contain Tn7 when probed with a 1 kb BamHI fragment of Tn7. Results from Southern hybridizations demonstrated that these antibiotic resistant genes had been born on plasmids in some clinical isolates.

  5. Conjugative IncF and IncI1 plasmids with tet(A) and class 1 integron conferring multidrug resistance in F18(+) porcine enterotoxigenic E. coli.

    PubMed

    Szmolka, Ama; Lestár, Barbara; Pászti, Judit; Fekete, Péter; Nagy, Béla

    2015-12-01

    Enterotoxigenic E. coli (ETEC) bacteria frequently cause watery diarrhoea in newborn and weaned pigs. Plasmids carrying genes of different enterotoxins and fimbrial adhesins, as well as plasmids conferring antimicrobial resistance are of prime importance in the epidemiology and pathogenesis of ETEC. Recent studies have revealed the significance of the porcine ETEC plasmid pTC, carrying tetracycline resistance gene tet(B) with enterotoxin genes. In contrast, the role of tet(A) plasmids in transferring resistance of porcine ETEC is less understood. The objective of the present study was to provide a comparative analysis of antimicrobial resistance and virulence gene profiles of porcine post-weaning ETEC strains representing pork-producing areas in Central Europe and in the USA, with special attention to plasmids carrying the tet(A) gene. Antimicrobial resistance phenotypes and genotypes of 87 porcine ETEC strains isolated from cases of post-weaning diarrhoea in Austria, the Czech Republic, Hungary and the Midwest USA was determined by disk diffusion and by PCR. Central European strains carrying tet(A) or tet(B) were further subjected to molecular characterisation of their tet plasmids. Results indicated that > 90% of the ETEC strains shared a common multidrug resistant (MDR) pattern of sulphamethoxazole (91%), tetracycline (84%) and streptomycin (80%) resistance. Tetracycline resistance was most frequently determined by the tet(B) gene (38%), while tet(A) was identified in 26% of all isolates with wide ranges for both tet gene types between some countries and with class 1 integrons and resistance genes co-transferred by conjugation. The virulence gene profiles included enterotoxin genes (lt, sta and/or stb), as well as adhesin genes (k88/f4, f18). Characterisation of two representative tet(A) plasmids of porcine F18(+) ETEC from Central Europe revealed that the IncF plasmid (pES11732) of the Czech strain (~120 kb) carried tet(A) in association with catA1 for

  6. Conjugative IncF and IncI1 plasmids with tet(A) and class 1 integron conferring multidrug resistance in F18(+) porcine enterotoxigenic E. coli.

    PubMed

    Szmolka, Ama; Lestár, Barbara; Pászti, Judit; Fekete, Péter; Nagy, Béla

    2015-12-01

    Enterotoxigenic E. coli (ETEC) bacteria frequently cause watery diarrhoea in newborn and weaned pigs. Plasmids carrying genes of different enterotoxins and fimbrial adhesins, as well as plasmids conferring antimicrobial resistance are of prime importance in the epidemiology and pathogenesis of ETEC. Recent studies have revealed the significance of the porcine ETEC plasmid pTC, carrying tetracycline resistance gene tet(B) with enterotoxin genes. In contrast, the role of tet(A) plasmids in transferring resistance of porcine ETEC is less understood. The objective of the present study was to provide a comparative analysis of antimicrobial resistance and virulence gene profiles of porcine post-weaning ETEC strains representing pork-producing areas in Central Europe and in the USA, with special attention to plasmids carrying the tet(A) gene. Antimicrobial resistance phenotypes and genotypes of 87 porcine ETEC strains isolated from cases of post-weaning diarrhoea in Austria, the Czech Republic, Hungary and the Midwest USA was determined by disk diffusion and by PCR. Central European strains carrying tet(A) or tet(B) were further subjected to molecular characterisation of their tet plasmids. Results indicated that > 90% of the ETEC strains shared a common multidrug resistant (MDR) pattern of sulphamethoxazole (91%), tetracycline (84%) and streptomycin (80%) resistance. Tetracycline resistance was most frequently determined by the tet(B) gene (38%), while tet(A) was identified in 26% of all isolates with wide ranges for both tet gene types between some countries and with class 1 integrons and resistance genes co-transferred by conjugation. The virulence gene profiles included enterotoxin genes (lt, sta and/or stb), as well as adhesin genes (k88/f4, f18). Characterisation of two representative tet(A) plasmids of porcine F18(+) ETEC from Central Europe revealed that the IncF plasmid (pES11732) of the Czech strain (~120 kb) carried tet(A) in association with catA1 for

  7. A DNA polymerase V homologue encoded by TOL plasmid pWW0 confers evolutionary fitness on Pseudomonas putida under conditions of environmental stress.

    PubMed

    Tark, Mariliis; Tover, Andres; Tarassova, Kairi; Tegova, Radi; Kivi, Gaily; Hõrak, Rita; Kivisaar, Maia

    2005-08-01

    Plasmids in conjunction with other mobile elements such as transposons are major players in the genetic adaptation of bacteria in response to changes in environment. Here we show that a large catabolic TOL plasmid, pWW0, from Pseudomonas putida carries genes (rulAB genes) encoding an error-prone DNA polymerase Pol V homologue which increase the survival of bacteria under conditions of accumulation of DNA damage. A study of population dynamics in stationary phase revealed that the presence of pWW0-derived rulAB genes in the bacterial genome allows the expression of a strong growth advantage in stationary phase (GASP) phenotype of P. putida. When rulAB-carrying cells from an 8-day-old culture were mixed with Pol V-negative cells from a 1-day-old culture, cells derived from the aged culture out-competed cells from the nonaged culture and overtook the whole culture. At the same time, bacteria from an aged culture lacking the rulAB genes were only partially able to out-compete cells from a fresh overnight culture of the parental P. putida strain. Thus, in addition to conferring resistance to DNA damage, the plasmid-encoded Pol V genes significantly increase the evolutionary fitness of bacteria during prolonged nutritional starvation of a P. putida population. The results of our study indicate that RecA is involved in the control of expression of the pWW0-encoded Pol V. PMID:16030214

  8. 21 CFR 522.1204 - Kanamycin sulfate injection.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... 21 Food and Drugs 6 2010-04-01 2010-04-01 false Kanamycin sulfate injection. 522.1204 Section 522.1204 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED... kanamycin sensitive organisms in dogs and cats. (2) It is administered subcutaneously or intramuscularly...

  9. 21 CFR 522.1204 - Kanamycin sulfate injection.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... 21 Food and Drugs 6 2011-04-01 2011-04-01 false Kanamycin sulfate injection. 522.1204 Section 522.1204 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED... kanamycin sensitive organisms in dogs and cats. (2) It is administered subcutaneously or intramuscularly...

  10. Novel plasmid-mediated beta-lactamase (MIR-1) conferring resistance to oxyimino- and alpha-methoxy beta-lactams in clinical isolates of Klebsiella pneumoniae.

    PubMed

    Papanicolaou, G A; Medeiros, A A; Jacoby, G A

    1990-11-01

    Klebsiella pneumoniae isolates from 11 patients at the Miriam Hospital were identified as resistant to cefoxitin and ceftibuten as well as to aztreonam, cefotaxime, and ceftazidime. Resistance could be transferred by conjugation or transformation with plasmid DNA into Escherichia coli and was due to the production of a beta-lactamase with an isoelectric point of 8.4 named MIR-1. In E. coli, MIR-1 conferred resistance to aztreonam, cefotaxime, ceftazidime, ceftibuten, ceftriaxone, and such alpha-methoxy beta-lactams as cefmetazole, cefotetan, cefoxitin, and moxalactam. In vitro, MIR-1 hydrolyzed cephalothin and cephaloridine much more rapidly than it did penicillin G, ampicillin, or carbenicillin. Cefotaxime was hydrolyzed at 10% the rate of cephaloridine. Cefoxitin inactivation could only be detected by a microbiological test. The inhibition profile of MIR-1 was similar to that of chromosomally mediated class I beta-lactamases. Potassium clavulanate had little effect on cefoxitin or cefibuten resistance and was a poor inhibitor of MIR-1 activity. Cefoxitin or imipenem did not induce MIR-1. The gene determining MIR-1 was cloned on a 1.4-kb AccI-PstI fragment. Under stringent conditions, probes for TEM-1 and SHV-1 genes and the E. coli ampC gene failed to hybridize with the MIR-1 gene. However, a provisional sequence of 150 bp of the MIR-1 gene proved to be 90% identical to the sequence of ampC from Enterobacter cloacae but only 71% identical to that of E. coli, thus explaining the lack of hybridization to the E. coli ampC probe. Plasmid profiles of the 11 K. pneumoniae clinical isolates were not identical, but each contained a plasmid from 40 to 60 kb that hybridized with the cloned MIR-1 gene. Both transfer-proficient and transfer-deficient MIR-1 plasmids belonged to the N incompatibility group. Thus, the resistance of these K. pneumoniae strains was the result of plasmid acquisition of a class I beta-lactamase, a new resistance determinant that expands the kinds

  11. Novel plasmid-mediated beta-lactamase (MIR-1) conferring resistance to oxyimino- and alpha-methoxy beta-lactams in clinical isolates of Klebsiella pneumoniae.

    PubMed Central

    Papanicolaou, G A; Medeiros, A A; Jacoby, G A

    1990-01-01

    Klebsiella pneumoniae isolates from 11 patients at the Miriam Hospital were identified as resistant to cefoxitin and ceftibuten as well as to aztreonam, cefotaxime, and ceftazidime. Resistance could be transferred by conjugation or transformation with plasmid DNA into Escherichia coli and was due to the production of a beta-lactamase with an isoelectric point of 8.4 named MIR-1. In E. coli, MIR-1 conferred resistance to aztreonam, cefotaxime, ceftazidime, ceftibuten, ceftriaxone, and such alpha-methoxy beta-lactams as cefmetazole, cefotetan, cefoxitin, and moxalactam. In vitro, MIR-1 hydrolyzed cephalothin and cephaloridine much more rapidly than it did penicillin G, ampicillin, or carbenicillin. Cefotaxime was hydrolyzed at 10% the rate of cephaloridine. Cefoxitin inactivation could only be detected by a microbiological test. The inhibition profile of MIR-1 was similar to that of chromosomally mediated class I beta-lactamases. Potassium clavulanate had little effect on cefoxitin or cefibuten resistance and was a poor inhibitor of MIR-1 activity. Cefoxitin or imipenem did not induce MIR-1. The gene determining MIR-1 was cloned on a 1.4-kb AccI-PstI fragment. Under stringent conditions, probes for TEM-1 and SHV-1 genes and the E. coli ampC gene failed to hybridize with the MIR-1 gene. However, a provisional sequence of 150 bp of the MIR-1 gene proved to be 90% identical to the sequence of ampC from Enterobacter cloacae but only 71% identical to that of E. coli, thus explaining the lack of hybridization to the E. coli ampC probe. Plasmid profiles of the 11 K. pneumoniae clinical isolates were not identical, but each contained a plasmid from 40 to 60 kb that hybridized with the cloned MIR-1 gene. Both transfer-proficient and transfer-deficient MIR-1 plasmids belonged to the N incompatibility group. Thus, the resistance of these K. pneumoniae strains was the result of plasmid acquisition of a class I beta-lactamase, a new resistance determinant that expands the kinds

  12. Plasmid-mediated AmpC-type beta-lactamase isolated from Klebsiella pneumoniae confers resistance to broad-spectrum beta-lactams, including moxalactam.

    PubMed Central

    Horii, T; Arakawa, Y; Ohta, M; Ichiyama, S; Wacharotayankun, R; Kato, N

    1993-01-01

    Klebsiella pneumoniae NU2936 was isolated from a patient and was found to produce a plasmid-encoded beta-lactamase (MOX-1) which conferred resistance to broad spectrum beta-lactams, including moxalactam, flomoxef, ceftizoxime, cefotaxime, and ceftazidime. Resistance could be transferred from K. pneumoniae NU2936 to Escherichia coli CSH2 by conjugation with a transfer frequency of 5 x 10(-7). The structural gene of MOX-1 (blaMOX-1) was cloned and expressed in E. coli HB101. The MIC of moxalactam for E. coli HB101 producing MOX-1 was > 512 micrograms/ml. The apparent molecular mass and pI of this enzyme were calculated to be 38 kDa and 8.9, respectively. Hg2+ and Cu2+ failed to block enzyme activity, and the presence of EDTA in the reaction buffer did not reduce the enzyme activity. However, clavulanate and cloxacillin, serine beta-lactamase inhibitors, inhibited the enzyme activity competitively (Kis = 5.60 and 0.35 microM, respectively). The kinetic study of MOX-1 suggested that it effectively hydrolyzed broad-spectrum beta-lactams. A hybridization study confirmed that blaMOX-1 is encoded on a large resident plasmid (pRMOX1; 180 kb) of strain NU2936. By deletion analysis, the functional region was localized within a 1.2-kb region of the plasmid. By amino acid sequencing, 18 of 33 amino acid residues at the N terminus of MOX-1 were found to be identical to those of Pseudomonas aeruginosa AmpC. These findings suggest that MOX-1 is a plasmid-mediated AmpC-type beta-lactamase that provides enteric bacteria resistance to broad-spectrum beta-lactams, including moxalactam. Images PMID:8517725

  13. High genetic homology between plasmids of human and animal origins conferring resistance to the aminoglycosides gentamicin and apramycin.

    PubMed Central

    Chaslus-Dancla, E; Pohl, P; Meurisse, M; Marin, M; Lafont, J P

    1991-01-01

    Escherichia coli and Salmonella strains resistant to gentamicin and apramycin were isolated from cattle in France and Belgium and from patients in hospitals. Homology between plasmids of both human and animal origins encoding aminoglycoside 3-N-acetyltransferase was revealed by digestion with several restriction endonucleases and confirmed by hybridization with different replicon-specific probes. Images PMID:2039212

  14. A Transmissible Plasmid-Borne Pathogenicity Island Confers Piscibactin Biosynthesis in the Fish Pathogen Photobacterium damselae subsp. piscicida

    PubMed Central

    Rivas, Amable J.; Balado, Miguel; Fuentes-Monteverde, Juan Carlos; Rodríguez, Jaime; Jiménez, Carlos; Lemos, Manuel L.; Waldor, Matthew K.

    2015-01-01

    The fish pathogen Photobacterium damselae subsp. piscicida produces the siderophore piscibactin. A gene cluster that resembles the Yersinia high-pathogenicity island (HPI) encodes piscibactin biosynthesis. Here, we report that this HPI-like cluster is part of a hitherto-uncharacterized 68-kb plasmid dubbed pPHDP70. This plasmid lacks homologs of genes that mediate conjugation, but we found that it could be transferred at low frequencies from P. damselae subsp. piscicida to a mollusk pathogenic Vibrio alginolyticus strain and to other Gram-negative bacteria, likely dependent on the conjugative functions of the coresident plasmid pPHDP60. Following its conjugative transfer, pPHDP70 restored the capacity of a vibrioferrin mutant of V. alginolyticus to grow under low-iron conditions, and piscibactin became detectable in its supernatant. Thus, pPHDP70 appears to harbor all the genes required for piscibactin biosynthesis and transport. P. damselae subsp. piscicida strains cured of pPHDP70 no longer produced piscibactin, had impaired growth under iron-limited conditions, and exhibited markedly decreased virulence in fish. Collectively, our findings highlight the importance of pPHDP70, with its capacity for piscibactin-mediated iron acquisition, in the virulence of P. damselae subsp. piscicida. Horizontal transmission of this plasmid-borne piscibactin synthesis gene cluster in the marine environment may facilitate the emergence of new pathogens. PMID:26092457

  15. Complete nucleotide sequence analysis of plasmids in strains of Staphylococcus aureus clone USA300 reveals a high level of identity among isolates with closely related core genome sequences.

    PubMed

    Kennedy, Adam D; Porcella, Stephen F; Martens, Craig; Whitney, Adeline R; Braughton, Kevin R; Chen, Liang; Craig, Carly T; Tenover, Fred C; Kreiswirth, Barry N; Musser, James M; DeLeo, Frank R

    2010-12-01

    A community-associated methicillin-resistant Staphylococcus aureus (CA-MRSA) strain known as pulsed-field type USA300 (USA300) is epidemic in the United States. Previous comparative whole-genome sequencing studies demonstrated that there has been recent clonal emergence of a subset of USA300 isolates, which comprise the epidemic clone. Although the core genomes of these isolates are closely related, the level of diversity among USA300 plasmids was not resolved. Inasmuch as these plasmids might contribute to significant gene diversity among otherwise closely related USA300 isolates, we performed de novo sequencing of endogenous plasmids from 10 previously characterized USA300 clinical isolates obtained from different geographic locations in the United States. All isolates tested contained small (2- to 3-kb) and/or large (27- to 30-kb) plasmids. The large plasmids encoded heavy metal and/or antimicrobial resistance elements, including those that confer resistance to cadmium, bacitracin, macrolides, penicillin, kanamycin, and streptothricin, although all isolates were sensitive to minocycline, doxycycline, trimethoprim-sulfamethoxazole, vancomycin, teicoplanin, and linezolid. One of the USA300 isolates contained an archaic plasmid that encoded staphylococcal enterotoxins R, J, and P. Notably, the large plasmids (27 to 28 kb) from 8 USA300 isolates--those that comprise the epidemic USA300 clone--were virtually identical (99% identity) and similar to a large plasmid from strain USA300_TCH1516 (a previously sequenced USA300 strain from Houston, TX). These plasmids are largely divergent from the 37-kb plasmid of FPR3757, the first sequenced USA300 strain. The high level of plasmid sequence identity among the majority of closely related USA300 isolates is consistent with the recent clonal emergence hypothesis for USA300.

  16. [Labelling of nif-plasmid pEA9 from Enterobacter agglomerans 339].

    PubMed

    Liu, Cheng-jun; Klingmüller, Walter

    2002-07-01

    The authors describe the in vivo labelling of the plasmid pEA9 in Enterobacter agglomerans 339 with a kanamycin resistance gene. For labelling purposes the donor plasmid pST5 was constructed. This plasmid contains the nif ENX region from pEA9,in which a kanamycin resistance gene is cloned.pST5 was transformed into E.a.339 and subsequently cured from the host. Curing was achieved with AP medium. Fourty strains that had lost pST5,but retained the kanamycin resistance, could be isolated. It showed that none of these clones contained co-integrates of pST5 and pEA9. This is evident that in all clones the kanamycin resistance gene was integrated into pEA9 by homologous recombination.

  17. Heterologous production of paromamine in Streptomyces lividans TK24 using kanamycin biosynthetic genes from Streptomyces kanamyceticus ATCC12853.

    PubMed

    Nepal, Keshav Kumar; Oh, Tae-Jin; Sohng, Jae Kyung

    2009-05-31

    The 2-deoxystreptamine and paromamine are two key intermediates in kanamycin biosynthesis. In the present study, pSK-2 and pSK-7 recombinant plasmids were constructed with two combinations of genes: kanABK and kanABKF and kacA respectively from kanamycin producer Streptomyces kanamyceticus ATCC12853. These plasmids were heterologously expressed into Streptomyces lividans TK24 independently and generated two recombinant strains named S. lividans Sk-2/SL and S. lividans SK-7/SL, respectively. ESI/ MS and ESI-LC/MS analysis of the metabolite from S. lividans SK-2/SL showed that the compound had a molecular mass of 163 [M + H]+, which corresponds to that of 2-deoxystreptamine. ESI/MS and MS/MS analysis of metabolites from S. lividans SK-7/SL demonstrated the production of paromamine with a molecular mass of 324 [M + H]+. In this study, we report the production of paromamine in a heterologous host for the first time. This study will evoke to explore complete biosynthetic pathways of kanamycin and related aminoglycoside antibiotics.

  18. 21 CFR 524.1200b - Kanamycin ophthalmic aqueous solution.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... to kanamycin sensitive bacteria. It is used in treating conditions such as conjunctivities..., removal of foreign bodies, and intraocular surgery. Instill a few drops into the affected eye every...

  19. Antibiotic resistance of vibrio cholerae: special considerations of R-plasmids.

    PubMed

    Kuwahara, S

    1978-09-01

    Studies on the transmission of R plasmid by conjugation between enterobacteria and vibrio or related bacteria were reviewed. The majority of the reports confirmed successful transmission from enterobacteria to Vibrio cholerae and related species, although the transmission frequencies were extremely low and the transmitted R plasmid was very unstable except for thermosensitive kanamycin plasmid and usual R plasmid coexisting with P plasmid. Strains of V. cholerae and Aeromonas liquefaciens as well as A. salmonicida bearing R plasmid were detected in nature. R plasmid was relatively unstable in V. cholerae strains with which transmission of R plasmid to enterobacteria was confirmed. At present, only 3 R plasmids have been obtained from naturally occurring strains of V. cholerae. Although the 2 European plasmids belong to the C incompatibility group with 98 megadalton closed covalent circular DNA molecule, one plasmid belongs to the J group with more than 25 megadalton molecular weight, and no CCC of satelite DNA was detected in bacteria harboring this plasmid.

  20. Novel erm(T)-carrying multiresistance plasmids from porcine and human isolates of methicillin-resistant Staphylococcus aureus ST398 that also harbor cadmium and copper resistance determinants.

    PubMed

    Gómez-Sanz, Elena; Kadlec, Kristina; Feßler, Andrea T; Zarazaga, Myriam; Torres, Carmen; Schwarz, Stefan

    2013-07-01

    This study describes three novel erm(T)-carrying multiresistance plasmids that also harbor cadmium and copper resistance determinants. The plasmids, designated pUR1902, pUR2940, and pUR2941, were obtained from porcine and human methicillin-resistant Staphylococcus aureus (MRSA) of the clonal lineage ST398. In addition to the macrolide-lincosamide-streptogramin B (MLSB) resistance gene erm(T), all three plasmids also carry the tetracycline resistance gene tet(L). Furthermore, plasmid pUR2940 harbors the trimethoprim resistance gene dfrK and the MLSB resistance gene erm(C), while plasmids pUR1902 and pUR2941 possess the kanamycin/neomycin resistance gene aadD. Sequence analysis of approximately 18.1 kb of the erm(T)-flanking region from pUR1902, 20.0 kb from pUR2940, and 20.8 kb from pUR2941 revealed the presence of several copies of the recently described insertion sequence ISSau10, which is probably involved in the evolution of the respective plasmids. All plasmids carried a functional cadmium resistance operon with the genes cadD and cadX, in addition to the multicopper oxidase gene mco and the ATPase copper transport gene copA, which are involved in copper resistance. The comparative analysis of S. aureus RN4220 and the three S. aureus RN4220 transformants carrying plasmid pUR1902, pUR2940, or pUR2941 revealed an 8-fold increase in CdSO4 and a 2-fold increase in CuSO4 MICs. The emergence of multidrug resistance plasmids that also carry heavy metal resistance genes is alarming and requires further surveillance. The colocalization of antimicrobial resistance genes and genes that confer resistance to heavy metals may facilitate their persistence, coselection, and dissemination.

  1. Characterization of the replicon from plasmid pAC1 from Acetobacter pasteurianus.

    PubMed

    Grones, J; Králová, A; Turna, J

    1993-02-26

    A panel of recombinant plasmids pACK5 and pACT7 was prepared by introducing kanamycin and tetracycline resistance into the partially split plasmid pAC1 which contained replicon isolated from Acetobacter pasteurianus. The replicon in plasmid pAC1 is compatible with the ColE1 replicon. Compared to pBR322, the plasmid had more than 30 copies per chromosome in Escherichia coli cells. Plasmids were transformed into E. coli DH1, Acetobacter pasteurianus 3614, Acetobacter aceti 3620, Shigella, Citrobacter, and Brevibacterium flavum cells, and the stability of plasmid DNA was tested after cultivation in nonselective conditions.

  2. Plasmid-related quinolone resistance determinants in epidemic Vibrio parahaemolyticus, uropathogenic Escherichia coli, and marine bacteria from an aquaculture area in Chile.

    PubMed

    Aedo, Sandra; Ivanova, Larisa; Tomova, Alexandra; Cabello, Felipe C

    2014-08-01

    Marine bacteria from aquaculture areas with industrial use of quinolones have the potential to pass quinolone resistance genes to animal and human pathogens. The VPA0095 gene, related to the quinolone resistance determinant qnrA, from clinical isolates of epidemic Vibrio parahaemolyticus conferred reduced susceptibility to quinolone after cloning into Escherichia coli K-12 either when acting alone or synergistically with DNA gyrase mutations. In addition, a plasmid-mediated quinolone resistance gene from marine bacteria, aac(6')-Ib-cr, was identical to aac(6')-Ib-cr from urinary tract isolates of E. coli, suggesting a recent flow of this gene between these bacteria isolated from different environments. aac(6')-Ib-cr from E. coli also conferred reduced susceptibility to quinolone and kanamycin when cloned into E. coli K-12.

  3. 21 CFR 524.1200a - Kanamycin ophthalmic ointment.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... for use in dogs in various eye infections due to kanamycin sensitive bacteria. It is used treating... the affected eye three or four times daily or more frequently if deemed advisable. Treatment should be continued for at least 48 hours after the eye appears normal. For use only by or on the order of a...

  4. 21 CFR 862.3520 - Kanamycin test system.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... 21 Food and Drugs 8 2010-04-01 2010-04-01 false Kanamycin test system. 862.3520 Section 862.3520 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) MEDICAL DEVICES CLINICAL CHEMISTRY AND CLINICAL TOXICOLOGY DEVICES Clinical Toxicology Test Systems §...

  5. 21 CFR 862.3520 - Kanamycin test system.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... 21 Food and Drugs 8 2011-04-01 2011-04-01 false Kanamycin test system. 862.3520 Section 862.3520 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) MEDICAL DEVICES CLINICAL CHEMISTRY AND CLINICAL TOXICOLOGY DEVICES Clinical Toxicology Test Systems §...

  6. Crystal structure, conformation, and absolute configuration of kanamycin A.

    PubMed

    Puius, Yoram A; Stievater, Todd H; Srikrishnan, Thamarapu

    2006-12-11

    Kanamycin, an antibiotic complex produced by Streptomyces kanamycetius isolated from Japanese soil, was described by Okami and Umezawa as early as 1957 and consists of three components: Kanamycin A (the major component), B, and C. The disulfate salt of kanamycin A [4-O-(6-amino-6-deoxy-alpha-d-glucopyranosyl)-6-O-(3-amino-3-deoxy-alpha-d-glucopyranosyl)-2-deoxystreptamine] is a broad-spectrum antibiotic that is used to treat gonorrhea, salmonella, tuberculosis, and many other diseases. Crystals of kanamycin A monosulfate monohydrate obtained from water are triclinic, space group P1, with a=7.2294(14), b=12.4922(15), c=7.1168(9), alpha=94.74(1), beta=89.16(1), gamma=91.59(1), V=640.2(2)A(3), micro(CuKalpha)=18.4cm(-1), FW 600.6, D(calc)=1.558g/cm(3), CAD-4 diffractometric data (2693 reflections, 25543sigma(I)), structure by shelx-86 and refined by full-matrix least squares to a final R value of 0.038. The wrong conformer had an R value of 0.043. Both of the d-glucose moieties are attached to the deoxystreptamine by alpha linkages. This absolute configuration agrees with the earlier determination by both chemical and X-ray methods with photographic data. The (phi,psi) values for the glycosidic linkages are 101.6 degrees , -121.1 degrees , 106.3 degrees , and -140.4 degrees , respectively. Kanamycin interacts with the ribosomal S12 protein to stabilize the codon-anticodon binding between mRNA and the aminoacyl tRNA and inhibits the elongation of peptide chains through a series of reactions resulting in the prevention of ribosomes from moving along mRNA.

  7. Plasmid Biopharmaceuticals.

    PubMed

    Prazeres, Duarte Miguel F; Monteiro, Gabriel A

    2014-12-01

    Plasmids are currently an indispensable molecular tool in life science research and a central asset for the modern biotechnology industry, supporting its mission to produce pharmaceutical proteins, antibodies, vaccines, industrial enzymes, and molecular diagnostics, to name a few key products. Furthermore, plasmids have gradually stepped up in the past 20 years as useful biopharmaceuticals in the context of gene therapy and DNA vaccination interventions. This review provides a concise coverage of the scientific progress that has been made since the emergence of what are called today plasmid biopharmaceuticals. The most relevant topics are discussed to provide researchers with an updated overview of the field. A brief outline of the initial breakthroughs and innovations is followed by a discussion of the motivation behind the medical uses of plasmids in the context of therapeutic and prophylactic interventions. The molecular characteristics and rationale underlying the design of plasmid vectors as gene transfer agents are described and a description of the most important methods used to deliver plasmid biopharmaceuticals in vivo (gene gun, electroporation, cationic lipids and polymers, and micro- and nanoparticles) is provided. The major safety issues (integration and autoimmunity) surrounding the use of plasmid biopharmaceuticals is discussed next. Aspects related to the large-scale manufacturing are also covered, and reference is made to the plasmid products that have received marketing authorization as of today.

  8. The IncF plasmid pRSB225 isolated from a municipal wastewater treatment plant's on-site preflooder combining antibiotic resistance and putative virulence functions is highly related to virulence plasmids identified in pathogenic E. coli isolates.

    PubMed

    Wibberg, Daniel; Szczepanowski, Rafael; Eikmeyer, Felix; Pühler, Alfred; Schlüter, Andreas

    2013-03-01

    The IncF antibiotic resistance and virulence plasmid pRSB225, isolated from an unknown bacterium released with the purified wastewater from a municipal sewage treatment plant into the environment has been analysed at the genomic level by pyrosequencing. The 164,550bp plasmid comprises 210 coding sequences (cds). It is composed of three replicons (RepFIA, RepFIB, and RepFII) and encodes further plasmid-specific functions for stable maintenance and inheritance and conjugative plasmid transfer. The plasmid is self-transmissible and shows a narrow host range limited to the family Enterobacteriaceae. The accessory modules of the plasmid mainly comprise genes conferring resistance to ampicillin (bla(TEM-1b)), chloramphenicol (catA1), erythromycin (mphA), kanamycin and neomycin (aphA1), streptomycin (strAB), sulphonamides (sul2), tetracycline (tetA(B)) and trimethoprim (dfrA14), as well as mercuric ions (mer genes). In addition, putative virulence-associated genes coding for iron uptake (iutA/iucABCD, sitABCD, and a putative high-affinity Fe²⁺ uptake system) and for a toxin/antitoxin system (vagCD) were identified on the plasmid. All antibiotic and heavy metal resistance genes are located either on class 1 (Tn10-remnant, Tn4352B) and class 2 transposons (Tn2-remnant, Tn21, Tn402-remnant) or a class 1 integron, whereas almost all putative virulence genes are associated with IS elements (IS1, IS26), indicating that transposition and/or recombination events were responsible for acquisition of the accessory pRSB225 modules. Particular modules of plasmid pRSB225 are related to corresponding segments of different virulence plasmids harboured by pathogenic Escherichia coli strains. Moreover, pRSB225 modules were also detected in entero-aggregative-haemorrhagic E. coli (EAHEC) draft genome sequences suggesting that IncF plasmids related to pRSB225 mediated gene transfer into pathogenic E. coli derivatives. PMID:23212116

  9. Kanamycin Resistance Cassette for Genetic Manipulation of Treponema denticola.

    PubMed

    Li, Yuebin; Ruby, John; Wu, Hui

    2015-07-01

    Treponema denticola has been recognized as an important oral pathogen of the "red complex" bacterial consortium that is associated with the pathogenesis of endodontal and periodontal diseases. However, little is known about the virulence of T. denticola due to its recalcitrant genetic system. The difficulty in genetically manipulating oral spirochetes is partially due to the lack of antibiotic resistance cassettes that are useful for gene complementation following allelic replacement mutagenesis. In this study, a kanamycin resistance cassette was identified and developed for the genetic manipulation of T. denticola ATCC 35405. Compared to the widely used ermF-ermAM cassette, the kanamycin cassette used in the transformation experiments gave rise to additional antibiotic-resistant T. denticola colonies. The kanamycin cassette is effective for allelic replacement mutagenesis as demonstrated by inactivation of two open reading frames of T. denticola, TDE1430 and TDE0911. In addition, the cassette is also functional in trans-chromosomal complementation. This was determined by functional rescue of a periplasmic flagellum (PF)-deficient mutant that had the flgE gene coding for PF hook protein inactivated. The integration of the full-length flgE gene into the genome of the flgE mutant rescued all of the defects associated with the flgE mutant that included the lack of PF filament and spirochetal motility. Taken together, we demonstrate that the kanamycin resistance gene is a suitable cassette for the genetic manipulation of T. denticola that will facilitate the characterization of virulence factors attributed to this important oral pathogen.

  10. Genetic study of the pVM82 plasmid responsible for some pathogenic traits of Yersinia pseudotuberculosis

    SciTech Connect

    Il`ina, T.S.; Fil`kova, S.L.

    1995-07-01

    The large pVM82 plasmid isolated epidemic strains of Yersinia pseudotuberculosis includes the 25 MDa segment, which encodes a series of properties affecting the virulence of the bacterium. Insertion mutants of pVM82 containing transposition-defective Tn2507 with a kanamycin-resistance marker in different Hind III fragments of the 25 MDa segment were obtained. By recombination between two homologous pVM82 containing genetic markers in different parts, deletion derivatives of pVM82 plasmid and insertions of the plasmid segment, carrying a kanamycin-resistance marker, into a chromosome were obtained. Results were obtained suggesting the presence in the plasmid 25 MDa segment of a transposon-like structure capable of migrating from pVM82 plasmid onto a chromosome and from a chromosome and pVM82 onto pRP1.2 plasmid of a broad host range. 8 refs., 4 figs., 1 tab.

  11. Gold nanoparticle-based colorimetric detection of kanamycin using a DNA aptamer.

    PubMed

    Song, Kyung-Mi; Cho, Minseon; Jo, Hunho; Min, Kyoungin; Jeon, Sung Ho; Kim, Taisun; Han, Min Su; Ku, Ja Kang; Ban, Changill

    2011-08-15

    A selective kanamycin-binding single-strand DNA (ssDNA) aptamer (TGGGGGTTGAGGCTAAGCCGA) was discovered through in vitro selection using affinity chromatography with kanamycin-immobilized sepharose beads. The selected aptamer has a high affinity for kanamycin and also for kanamycin derivatives such as kanamycin B and tobramycin. The dissociation constants (K(d) [kanamycin]=78.8 nM, K(d) [kanamycin B]=84.5 nM, and K(d) [tobramycin]=103 nM) of the new aptamer were determined by fluorescence intensity analysis using 5'-fluorescein amidite (FAM) modification. Using this aptamer, kanamycin was detected down to 25 nM by the gold nanoparticle-based colorimetric method. Because the designed colorimetric method is simple, easy, and visible to the naked eye, it has advantages that make it useful for the detection of kanamycin. Furthermore, the selected new aptamer has many potential applications as a bioprobe for the detection of kanamycin, kanamycin B, and tobramycin in pharmaceutical preparations and food products. PMID:21530479

  12. Exposing plasmids as the Achilles' heel of drug-resistant bacteria.

    PubMed

    Williams, Julia J; Hergenrother, Paul J

    2008-08-01

    Many multidrug-resistant bacterial pathogens harbor large plasmids that encode proteins conferring resistance to antibiotics. Although the acquisition of these plasmids often enables bacteria to survive in the presence of antibiotics, it is possible that plasmids also represent a vulnerability that can be exploited in tailored antibacterial therapy. This review highlights three recently described strategies designed to specifically combat bacteria harboring such plasmids: inhibition of plasmid conjugation, inhibition of plasmid replication, and exploitation of plasmid-encoded toxin-antitoxin systems.

  13. Isolation and screening of plasmids from the epilithon which mobilize recombinant plasmid pD10.

    PubMed Central

    Hill, K E; Weightman, A J; Fry, J C

    1992-01-01

    This study examined the potential of bacteria from river epilithon to mobilize a recombinant catabolic plasmid, pD10, encoding 3-chlorobenzoate degradation and kanamycin resistance. Fifty-four mobilizing plasmids were exogenously isolated by triparental matings between strains of Pseudomonas putida and epilithic bacteria from the River Taff (South Wales, United Kingdom). Frequencies for mobilization ranged from 1.7 x 10(-8) to 4.5 x 10(-3) per recipient at 20 degrees C. The sizes of the mobilizing plasmids isolated ranged from 40 kb to over 200 kb, and 19 of 54 were found to encode mercury resistance. Plasmid-encoded resistance to tetracycline and streptomycin was also found but not resistance to UV light or various heavy metals. Eight plasmids of epilithic bacteria, analyzed by comparing restriction fragmentation patterns, showed significant differences between those isolated from different independent matings. Optimal temperatures for mobilization of pD10 were between 15 and 25 degrees C. Four mercury resistance plasmids were found to be broad host range, transferring mercury resistance and mobilizing pD10 readily to representative species of beta- and gamma-purple bacteria. In general, frequencies of pD10 mobilization by plasmids of epilithic bacteria were 2 to 3 orders of magnitude lower than conjugal transfer frequencies. Thus, there is a high potential for exchange of recombinant genes introduced into the epilithon by mobilization between a variety of bacterial species. Images PMID:1599248

  14. Characterization of a multiple antibiotic resistance plasmid from Haemophilus ducreyi.

    PubMed Central

    Willson, P J; Albritton, W L; Slaney, L; Setlow, J K

    1989-01-01

    Plasmid pLS88 from a clinical isolate of Haemophilus ducreyi encoded resistance determinants for sulfonamides and streptomycin related to those of RSF1010 and for kanamycin related to Tn903 but lacked the inverted repeats of the transposon. Its host range included Haemophilus influenzae, Actinobacillus pleuropneumoniae, and Escherichia coli; and it was compatible with pDM2 and RSF1010. Images PMID:2684012

  15. Scar formation in mice deafened with kanamycin and furosemide.

    PubMed

    Żak, Magdalena; van der Linden, Cynthia A; Bezdjian, Aren; Hendriksen, Ferry G; Klis, Sjaak F L; Grolman, Wilko

    2016-08-01

    In mammals, hair cell loss is irreversible and leads to hearing loss. To develop and test the functioning of different strategies aiming at hair cell regeneration, animal models of sensorineural hearing loss are essential. Although cochleae of these animals should lack hair cells, supporting cells should be preserved forming an environment for the regenerated hair cells. In this study, we investigated how ototoxic treatment with kanamycin and furosemide changes the structure of cochlear sensory epithelium in mice. The study also compared different tissue preparation protocols for scanning electron microscopy (SEM). Cochleae were collected from deafened and nondeafened mice and further processed for plastic mid modiolar sections and SEM. For comparing SEM protocols, cochleae from nondeafened mice were processed using three protocols: osmium-thiocarbohydrazide-osmium (OTO), tannic acid-arginine-osmium, and the conventional method with gold-coating. The OTO method demonstrated optimal cochlear tissue preservation. Histological investigation of cochleae of deafened mice revealed that the supporting cells enlarged and ultimately replaced the lost hair cells forming types 1 and 2 phalangeal scars in a base towards apex gradient. The type 3 epithelial scar, flattened epithelium, has not been seen in analysed cochleae. The study concluded that mice deafened with kanamycin and furosemide formed scars containing supporting cells, which renders this mouse model suitable for testing various hair cell regeneration approaches. Microsc. Res. Tech. 79:766-772, 2016. © 2016 Wiley Periodicals, Inc. PMID:27311812

  16. Scar formation in mice deafened with kanamycin and furosemide.

    PubMed

    Żak, Magdalena; van der Linden, Cynthia A; Bezdjian, Aren; Hendriksen, Ferry G; Klis, Sjaak F L; Grolman, Wilko

    2016-08-01

    In mammals, hair cell loss is irreversible and leads to hearing loss. To develop and test the functioning of different strategies aiming at hair cell regeneration, animal models of sensorineural hearing loss are essential. Although cochleae of these animals should lack hair cells, supporting cells should be preserved forming an environment for the regenerated hair cells. In this study, we investigated how ototoxic treatment with kanamycin and furosemide changes the structure of cochlear sensory epithelium in mice. The study also compared different tissue preparation protocols for scanning electron microscopy (SEM). Cochleae were collected from deafened and nondeafened mice and further processed for plastic mid modiolar sections and SEM. For comparing SEM protocols, cochleae from nondeafened mice were processed using three protocols: osmium-thiocarbohydrazide-osmium (OTO), tannic acid-arginine-osmium, and the conventional method with gold-coating. The OTO method demonstrated optimal cochlear tissue preservation. Histological investigation of cochleae of deafened mice revealed that the supporting cells enlarged and ultimately replaced the lost hair cells forming types 1 and 2 phalangeal scars in a base towards apex gradient. The type 3 epithelial scar, flattened epithelium, has not been seen in analysed cochleae. The study concluded that mice deafened with kanamycin and furosemide formed scars containing supporting cells, which renders this mouse model suitable for testing various hair cell regeneration approaches. Microsc. Res. Tech. 79:766-772, 2016. © 2016 Wiley Periodicals, Inc.

  17. Liposome-mediated transformation of tobacco mesophyll protoplasts by an Escherichia coli plasmid.

    PubMed Central

    Deshayes, A; Herrera-Estrella, L; Caboche, M

    1985-01-01

    An Escherichia coli plasmid, pLGV23neo, carrying a kanamycin resistance gene expressed in plant cells, was encapsulated into negatively charged liposomes prepared by the reverse phase evaporation technique. These liposomes were induced to fuse with tobacco mesophyll protoplasts by polyethyleneglycol treatment. Kanamycin-resistant clones were reproducibly isolated from transfected cultures at an average frequency of 4 X 10(-5). Plants regenerated from these resistant colonies were confirmed to be transformed according to three criteria. Protoplasts isolated from their leaves were resistant to 100 micrograms/ml kanamycin. The enzyme aminoglycoside 3'-phosphotransferase II encoded by the plasmid pLGV23neo was detected in leaf extracts. Approximately 3-5 copies of the gene encoding for kanamycin resistance were inserted in the genome of at least one of the studied transformants. The restriction pattern of inserted DNA was best explained by assuming a tandem integration of the pPLGV23neo sequences, implying an homologous recombination event between these sequences during transformation. Kanamycin resistance was transmitted as a single dominant nuclear marker to the progeny of resistant plants after selfing or cross-pollination with the wild-type. Images Fig. 3. Fig. 4. Fig. 5. Fig. 6. Fig. 7. PMID:3905385

  18. Historical Events That Spawned the Field of Plasmid Biology.

    PubMed

    Kado, Clarence I

    2014-10-01

    This chapter revisits the historical development and outcome of studies focused on the transmissible, extrachromosomal genetic elements called plasmids. Early work on plasmids involved structural and genetic mapping of these molecules, followed by the development of an understanding of how plasmids replicate and segregate during cell division. The intriguing property of plasmid transmission between bacteria and between bacteria and higher cells has received considerable attention. The utilitarian aspects of plasmids are described, including examples of various plasmid vector systems. This chapter also discusses the functional attributes of plasmids needed for their persistence and survival in nature and in man-made environments. The term plasmid biology was first conceived at the Fallen Leaf Lake Conference on Promiscuous Plasmids, 1990, Lake Tahoe, California. The International Society for Plasmid Biology was established in 2004 (www.ISPB.org).

  19. Historical Events That Spawned the Field of Plasmid Biology.

    PubMed

    Kado, Clarence I

    2014-10-01

    This chapter revisits the historical development and outcome of studies focused on the transmissible, extrachromosomal genetic elements called plasmids. Early work on plasmids involved structural and genetic mapping of these molecules, followed by the development of an understanding of how plasmids replicate and segregate during cell division. The intriguing property of plasmid transmission between bacteria and between bacteria and higher cells has received considerable attention. The utilitarian aspects of plasmids are described, including examples of various plasmid vector systems. This chapter also discusses the functional attributes of plasmids needed for their persistence and survival in nature and in man-made environments. The term plasmid biology was first conceived at the Fallen Leaf Lake Conference on Promiscuous Plasmids, 1990, Lake Tahoe, California. The International Society for Plasmid Biology was established in 2004 (www.ISPB.org). PMID:26104369

  20. Novel, plasmid-encoded, TEM-derived extended-spectrum beta-lactamase in Klebsiella pneumoniae conferring higher resistance to aztreonam than to extended-spectrum cephalosporins.

    PubMed Central

    Arlet, G; Rouveau, M; Fournier, G; Lagrange, P H; Philippon, A

    1993-01-01

    A clinical isolate of Klebsiella pneumoniae was more resistant to aztreonam than to cefotaxime and ceftazidime. It produced a clavulanate-susceptible beta-lactamase with an isoelectric point of 6.3 which readily hydrolyzed penicillins, cefotaxime, and ceftazidime, but which hydrolyzed aztreonam poorly. The enzyme was encoded by a gene on a 15-kb plasmid; the gene hybridized with an intragenic DNA probe of blaTEM. Images PMID:8239625

  1. Vaccination with Plasmid DNA Encoding TSA/LmSTI1 Leishmanial Fusion Proteins Confers Protection against Leishmania major Infection in Susceptible BALB/c Mice

    PubMed Central

    Campos-Neto, A.; Webb, J. R.; Greeson, K.; Coler, R. N.; Skeiky, Y. A. W.; Reed, S. G.

    2002-01-01

    We have recently shown that a cocktail containing two leishmanial recombinant antigens (LmSTI1 and TSA) and interleukin-12 (IL-12) as an adjuvant induces solid protection in both a murine and a nonhuman primate model of cutaneous leishmaniasis. However, because IL-12 is difficult to prepare, is expensive, and does not have the stability required for a vaccine product, we have investigated the possibility of using DNA as an alternative means of inducing protective immunity. Here, we present evidence that the antigens TSA and LmSTI1 delivered in a plasmid DNA format either as single genes or in a tandem digene construct induce equally solid protection against Leishmania major infection in susceptible BALB/c mice. Immunization of mice with either TSA DNA or LmSTI1 DNA induced specific CD4+-T-cell responses of the Th1 phenotype without a requirement for specific adjuvant. CD8 responses, as measured by cytotoxic-T-lymphocyte activity, were generated after immunization with TSA DNA but not LmSTI1 DNA. Interestingly, vaccination of mice with TSA DNA consistently induced protection to a much greater extent than LmSTI1 DNA, thus supporting the notion that CD8 responses might be an important accessory arm of the immune response for acquired resistance against leishmaniasis. Moreover, the protection induced by DNA immunization was specific for infection with Leishmania, i.e., the immunization had no effect on the course of infection of the mice challenged with an unrelated intracellular pathogen such as Mycobacterium tuberculosis. Conversely, immunization of BALB/c mice with a plasmid DNA that is protective against challenge with M. tuberculosis had no effect on the course of infection of these mice with L. major. Together, these results indicate that the protection observed with the leishmanial DNA is mediated by acquired specific immune response rather than by the activation of nonspecific innate immune mechanisms. In addition, a plasmid DNA containing a fusion construct of

  2. Fructose restores susceptibility of multidrug-resistant Edwardsiella tarda to kanamycin.

    PubMed

    Su, Yu-bin; Peng, Bo; Han, Yi; Li, Hui; Peng, Xuan-xian

    2015-03-01

    Edwardsiella tarda, the causative agent of Edwardsiellosis, imposes medical challenges in both the clinic and aquaculture. The emergence of multidrug resistant strains makes antibiotic treatment impractical. The identification of molecules that facilitate or promote antibiotic efficacy is in high demand. In the present study, we aimed to identify small molecules whose abundance is correlated with kanamycin resistance in E. tarda by gas chromatography-mass spectrometry. We found that the abundance of fructose was greatly suppressed in kanamycin-resistant strains. The incubation of kanamycin-resistant bacteria with exogenous fructose sensitized the bacteria to kanamycin. Moreover, the fructose also functioned in bacteria persisters and biofilm. The synergistic effects of fructose and kanamycin were validated in a mouse model. Furthermore, the mechanism relies on fructose in activating TCA cycle to produce NADH, which generates proton motive force to increase the uptake of the antibiotics. Therefore, we present a novel approach in fighting against multidrug resistant bacteria through exploration of antibiotic-suppressed molecules.

  3. Novel blaROB-1-Bearing Plasmid Conferring Resistance to β-Lactams in Haemophilus parasuis Isolates from Healthy Weaning Pigs

    PubMed Central

    Moleres, Javier; Santos-López, Alfonso; Lázaro, Isidro; Labairu, Javier; Prat, Cristina; Ardanuy, Carmen; González-Zorn, Bruno

    2015-01-01

    Haemophilus parasuis, the causative agent of Glässer's disease, is one of the early colonizers of the nasal mucosa of piglets. It is prevalent in swine herds, and lesions associated with disease are fibrinous polyserositis and bronchopneumonia. Antibiotics are commonly used in disease control, and resistance to several antibiotics has been described in H. parasuis. Prediction of H. parasuis virulence is currently limited by our scarce understanding of its pathogenicity. Some genes have been associated with H. parasuis virulence, such as lsgB and group 1 vtaA, while biofilm growth has been associated with nonvirulent strains. In this study, 86 H. parasuis nasal isolates from farms that had not had a case of disease for more than 10 years were obtained by sampling piglets at weaning. Isolates were studied by enterobacterial repetitive intergenic consensus PCR and determination of the presence of lsgB and group 1 vtaA, biofilm formation, inflammatory cell response, and resistance to antibiotics. As part of the diversity encountered, a novel 2,661-bp plasmid, named pJMA-1, bearing the blaROB-1 β-lactamase was detected in eight colonizing strains. pJMA-1 was shown to share a backbone with other small plasmids described in the Pasteurellaceae, to be 100% stable, and to have a lower biological cost than the previously described plasmid pB1000. pJMA-1 was also found in nine H. parasuis nasal strains from a separate collection, but it was not detected in isolates from the lesions of animals with Glässer's disease or in nontypeable Haemophilus influenzae isolates. Altogether, we show that commensal H. parasuis isolates represent a reservoir of β-lactam resistance genes which can be transferred to pathogens or other bacteria. PMID:25747001

  4. Underexpression of Ap from R-Plasmids in Fast-Growing Rhizobium Species

    PubMed Central

    Sikka, Virendra K.; Kumar, Sushil

    1984-01-01

    The presence of the plasmid RP1 in the cells of Rhizobium leguminosarum strains Rld1, 300, and 248, R. phaseoli 1233, R. trifolii strains T1 and 6661, and R. meliloti 4013 was found to appreciably increase bacterial resistance toward kanamycin and tetracycline but not toward ampicillin. The presence of 16 other R-plasmids in R. leguminosarum was also found to either not increase or only marginally increase bacterial resistance toward ampicillin. It appears now that underexpression of the plasmid-specified ampicillin function is common to most fast- and slow-growing rhizobia. PMID:16346686

  5. Audiological Evaluation of Patients Taking Kanamycin for Multidrug Resistant Tuberculosis

    PubMed Central

    Sharma, Vishal; Bhagat, Sanjeev; Verma, Bhimsain; Singh, Ravinder; Singh, Surinderpal

    2016-01-01

    Introduction: The incidence of multidrug resistant tuberculosis is increasing in developing countries. Aminoglycosides are an integral part of second-line drugs, however ototoxicity is a major limitation for their use. This study aims to determine the extent of hearing loss in patients taking one of the commonly prescribed drugs for Multidrug resistant tuberculosis (MDR-TB), Kanamycin, at a Government Medical College, Patiala, Punjab, India, which is a 1200 bed tertiary care hospital. Materials and Methods: A total of 100 patients (68 males and 32 females) with confirmed diagnosis of MDR-TB were included in this study conducted between January 2012 and February 2014. Subjects were between 15 to 60 years of age, with a mean age of 37.46 ± 10.1. Pure tone audiometry (PTA) was performed before the start of the therapy, as a baseline, and was repeated after 1 week and 6 weeks of Kanamycin use to assess hearing loss as an effect of therapy. Results: Of the 100 patients examined, ototoxicity was found in 18 subjects post therapy. Incidence of high frequency hearing loss was 2% at week 1, and 12% after 6 weeks of follow up. However, 4% of the cases developed flat loss at week 6. The hearing loss was bilateral in 13 patients and unilateral in 5 patients. Ototoxicity was more common in males (66.67%) compared to females (33.3%). Maximum cases were found in the age group of 36 to 45 years (36.8%), the majority being from a rural background (83.3%). The association with socioeconomic status (P=0.024) and co-morbid conditions like diabetes and hypertension (P=0.001) reached statistical significance. Conclusion: Lack of specific guidelines to monitor patients taking aminoglycosides makes ototoxicity a major adverse effect of their use in MDR-TB. More studies are mandated to study the risk factors associated with the development of ototoxicity and for the development of alternate drugs for the treatment of MDR-TB. PMID:27429949

  6. Engineering and characterization of a symbiotic selection-marker-free vector-host system for therapeutic plasmid production.

    PubMed

    Shi, Xinchang; Wang, Junzhi

    2015-09-01

    The present study aimed to develop a symbiotic selection-marker-free plasmid and host system that would allow successful plasmid maintenance and amplification for use in gene therapy. Initially, the chromosomal aspartate‑semialdehyde dehydrogenase (asd) gene was disrupted in DH10B Escherichia coli using Red recombinase‑mediated homologous recombination. This method required the use of linear DNA fragments carrying kan‑kil genes, and/or homologous extensions to the targeted locus. The resultant auxotrophic cell wall‑deficient strain (DH10BΔasd) was evaluated as a symbiotic host for amplification of the marker‑free plasmid, allowing it to supply ASD activity. In order to construct the plasmid, an asd expression cassette was inserted, under the control of the nirB promoter, into a eukaryotic expression vector, and its kanamycin resistance gene was subsequently removed. The symbiotic plasmid and host system was assessed for numerous plasmid production and stability parameters, including structure, yield, plasmid‑retention rate, and bacterial storability, under various conditions. The presence of the plasmid was subsequently confirmed by growth test, restriction enzyme mapping, and sequencing. The plasmid yield and copy number produced in the symbiotic cells, in the absence of antibiotic selection, were shown to be similar to those produced under kanamycin selection, in the cells containing the precursor plasmid and kanamycin resistance gene. Furthermore, the results of the present study demonstrated that when inoculated with <1% inoculant volume, >98% of the cells in the culture retained the plasmid regardless of the number of passages. The strain was stable when stored at ‑70˚C, with negligible viability loss over 12 months. The constructed plasmid is stable and has potential in future gene therapy, while much work is still required.

  7. Kanamycin and bumetanide ototoxicity: anatomical, physiological and behavioral correlates.

    PubMed

    Santi, P A; Ruggero, M A; Nelson, D A; Turner, C W

    1982-08-01

    Severe hair-cell degeneration and cochlear dysfunction was observed in chinchillas examined at 60 days (or longer) after administration of a single injection of 150 mg/kg kanamycin, followed 2 h later by a single injection of 20 mg/kg bumetanide. Outer hair cells in the cochlear base were most severely affected. While inner and outer hair-cell loss was common, some animals showed large regions along the basilar membrane where almost all inner hair cells were present and almost all outer hair cells were absent. Wherever areas of complete degeneration of the organ of Corti occurred, a small, diffuse population of nerve fibers within the spiral lamina was always present. Single-unit tuning curves correlated best with anatomical observations, compared with the other functional measures of auditory sensitivity that were obtained (behavioral audiogram and compound action potential thresholds). Results indicated that behavioral detection of auditory stimuli is relatively independent of innervation density as long as a few inner hair cells are present. Thus, the cross-fiber threshold envelope of the single-unit tuning curves appeared very similar to the behavioral audiogram. PMID:7118731

  8. Plasmid incidence in bacteria from deep subsurface sediments.

    PubMed

    Fredrickson, J K; Hicks, R J; Li, S W; Brockman, F J

    1988-12-01

    Bacteria were isolated from deep terrestrial subsurface sediments underlying the coastal plain of South Carolina. A total of 163 isolates from deep sediments, surface soil, and return drill muds were examined for plasmid DNA content and resistance to the antibiotics penicillin, ampicillin, carbenicillin, streptomycin, kanamycin, and tetracycline. MICs of Cu, Cr, and Hg for each isolate were also determined. The overall frequency of plasmid occurrence in the subsurface bacteria was 33%. Resistance was most frequent to penicillin (70% of all isolates), ampicillin (49%), and carbenicillin (32%) and was concluded to be related to the concentrations of the individual antibiotics in the disks used for assaying resistance and to the production of low levels of beta-lactamase. The frequencies of resistance to penicillin and ampicillin were significantly greater for isolates bearing plasmids than for plasmidless isolates; however, resistance was not transferable to penicillin-sensitive Escherichia coli. Hybridization of subsurface bacterial plasmids and chromosomal DNA with a whole-TOL-plasmid (pWWO) probe revealed some homology of subsurface bacterial plasmid and chromosomal DNAs, indicating a potential for those bacteria to harbor catabolic genes on plasmids or chromosomes. The incidences of antibiotic resistance and MICs of metals for subsurface bacteria were significantly different from those for drill mud bacteria, ruling out the possibility that bacteria from sediments were derived from drill muds. PMID:16347789

  9. Plasmid incidence in bacteria from deep subsurface sediments

    SciTech Connect

    Fredrickson, J.K.; Hicks, R.J.; Li, S.W.; Brockman, F.J. )

    1988-12-01

    Bacteria were isolated from deep terrestrial subsurface sediments underlying the coastal plain of South Carolina. A total of 163 isolates from deep sediments, surface soil, and return drill muds were examined for plasmid DNA content and resistance to the antibiotics penicillin, ampicillin, carbenicillin, streptomycin, kanamycin, and tetracycline. MICs of Cu{sup 2+}, Cr{sup 3+}, and Hg{sup 2+} for each isolate were also determined. The overall frequency of plasmid occurrence in the subsurface bacteria was 33%. Resistance was most frequent to penicillin (70% of all isolates), ampicillin (49%), and carbenicillin (32%) and was concluded to be related to the concentrations of the individual antibiotics in the disks used for assaying resistance and to the production of low levels of {beta}-lactamase. The frequencies of resistance to penicillin and ampicillin were significantly greater for isolates bearing plasmids than for plasmidless isolates; however, resistance was not transferable to penicillin-sensitive Escherichia coli. Hybridization of subsurface bacterial plasmids and chromosomal DNA with a whole-TOL-plasmid (pWWO) probe revealed some homology of subsurface bacterial plasmid and chromosomal DNAs, indicating a potential for those bacterial to harbor catabolic genes on plasmids or chromosomes. The incidences of antibiotic resistance and MICs of metals for subsurface bacteria were significantly different from those drill mud bacteria, ruling out the possibility that bacteria from sediments were derived from drill muds.

  10. Investigation of plasmid-induced growth defect in Pseudomonas putida.

    PubMed

    Mi, Jia; Sydow, Anne; Schempp, Florence; Becher, Daniela; Schewe, Hendrik; Schrader, Jens; Buchhaupt, Markus

    2016-08-10

    Genetic engineering in bacteria mainly relies on the use of plasmids. But despite their pervasive use for physiological studies as well as for the design and optimization of industrially used production strains, only limited information about plasmid induced growth defects is available for different replicons and organisms. Here, we present the identification and characterization of such a phenomenon for Pseudomonas putida transformants carrying the pBBR1-derived plasmid pMiS1. We identified the kanamycin resistance gene and the transcription factor encoding rhaR gene to be causal for the growth defect in P. putida. In contrast, this effect was not observed in Escherichia coli. The plasmid-induced growth defect was eliminated after introduction of a mutation in the plasmid-encoded rep gene, thus enabling construction of the non-toxic variant pMiS4. GFP reporters construct analyses and qPCR experiments revealed a distinctly lowered plasmid copy number for pMiS4, which is probably the reason for alleviation of the growth defect by this mutation. Our work expands the knowledge about plasmid-induced growth defects and provides a useful low-copy pBBR1 replicon variant. PMID:27287537

  11. Risk factors associated with kanamycin-resistant tuberculosis in a Beijing tuberculosis referral hospital.

    PubMed

    Yu, Hao Tian; Wang, Qi; Yang, Nan; Li, Hong Min; Liang, Jian Qin; Liu, Cui Hua

    2012-07-01

    The rapidly increasing number of multidrug-resistant tuberculosis (MDR-TB) cases worldwide underlines the necessity for the rational use of key second-line drugs such as kanamycin. In this study, we determined the prevalence of, and risk factors associated with, kanamycin-resistant tuberculosis (TB) in 309 Hospital, Beijing, China, with the aim of providing information for better case management in order to minimize further development of extensively drug-resistant TB (XDR-TB). Drug susceptibility testing results and clinical data were retrospectively analysed for hospitalized TB patients for whom such data were available in 309 Hospital for the period 1997-2009. Univariate and multivariate analyses were used to determine the risk factors associated with kanamycin-resistant TB. During 1997-2009, 553 (14.4 %) of 3843 tested Mycobacterium tuberculosis isolates from hospitalized TB patients were kanamycin-resistant. The increasing trend of resistance to kanamycin was reversed since 2000. The independent risk factors associated with kanamycin-resistant TB included living in urban areas [adjusted odds ratio (OR) = 1.89], being retreated for repeat cases (adjusted OR = 1.60), being smear-positive for acid-fast bacilli at admission to the hospital (adjusted OR = 1.39), having ofloxacin-resistant (adjusted OR = 1.61) or para-aminosalicylic acid-resistant TB (adjusted OR = 1.47), having MDR-TB (adjusted OR = 5.10), having MDR-TB plus ofloxacin resistance (adjusted OR = 4.27) and having poly-resistant TB (adjusted OR = 3.94). The remaining rate of kanamycin resistance is still high despite the reversal of the increasing trend during the past decade. Surveillance of kanamycin resistance, especially among high-risk populations, should be continued to closely monitor trends so that appropriate action can be taken.

  12. Stable transformation of tobacco by electroporation: evidence for plasmid concatenation.

    PubMed Central

    Riggs, C D; Bates, G W

    1986-01-01

    Electroporation (electric field-mediated DNA transfer) of tobacco protoplasts in the presence of the linearized plasmid pMON200 has led to the formation of transgenic plants. Defined electric shocks were delivered by capacitive discharges with readily available, low-cost electrical components. This transformation procedure is simple and efficient and may suggest a quick method for determining the appropriate electric fields for new cell systems. An optimal transformation frequency of 2.2 X 10(-4) (based on the number of cells subjected to the shock) was obtained with a single 2000-V/cm, 250-microseconds-duration capacitive discharge. Calli transformed to kanamycin resistance have been regenerated into whole plants. Southern blots of DNA from the transgenic plants demonstrate the integration of the selectable marker gene (neomycin phosphotransferase) at single or multiple genomic sites. In some cases, the plasmid appears to be integrated intact; in others, it is rearranged. The blots also provide evidence of plasmid recircularization and/or the formation of head-to-head and head-to-tail concatemers in most of the plants analyzed. Although some plants apparently have multiple integration sites, analysis of progeny obtained by self-fertilization of the transgenic plants indicates that the kanamycin-resistance marker is inherited as a single dominant gene. Images PMID:3016708

  13. Analysis of replication region of the cryptic plasmid pAG20 from Acetobacter aceti 3620.

    PubMed

    Kretová, Miroslava; Szemes, Tomás; Laco, Juraj; Gronesová, Paulína; Grones, Jozef

    2005-03-01

    The DNA sequence of small cryptic plasmid pAG20 in Acetobacter aceti was determined at 3064 bp with 51.6% GC pairs. The plasmid encoded a 186 amino acid protein which is important for plasmid replication in Gram-negative bacteria except Escherichia coli. Two 21 bp large direct repeat sequence 1 and two 13 bp direct repeat sequence 2 were determined in the regulation region upstream from gene encoded Rep protein. Vector pAG24 with kanamycin gene and two deletion derivatives pAG25 and pAG26 without rep gene from plasmid pAG20 were constructed. Plasmid pAG24 was replicated in a broad host range like E. coli, Acetobacter pasteurianus, A. aceti, Comanomonas spp., Serratia marcescens, and Shigella spp.

  14. High-frequency transformation of Brevibacterium lactofermentum protoplasts by plasmid DNA.

    PubMed Central

    Santamaria, R I; Gil, J A; Martin, J F

    1985-01-01

    An efficient polyethylene glycol-assisted method for transformation of Brevibacterium lactofermentum protoplasts that uses plasmid vectors has been developed. Two small plasmids, pUL330 (5.2 kilobases) and pUL340 (5.8 kilobases), both containing the kanamycin resistance gene from transposon Tn5 and the replication origin of the natural plasmid pBL1 of B. lactofermentum, were selected as vectors. Supercoiled forms of the plasmids yielded a 100-fold higher transformation frequency than did linear forms. The optimal transformation frequency was achieved with 10 ng of DNA in 1 ml of transformation buffer. Higher concentrations of plasmid DNA resulted in a decrease in transformation frequency per microgram of DNA. Optimal transformation was obtained with 25 to 35% polyethylene glycol 6000. Under optimal conditions, 10(6) transformants per microgram of DNA were obtained. PMID:3980445

  15. Plasmids from Euryarchaeota.

    PubMed

    Forterre, Patrick; Krupovic, Mart; Raymann, Kasie; Soler, Nicolas

    2014-12-01

    Many plasmids have been described in Euryarchaeota, one of the three major archaeal phyla, most of them in salt-loving haloarchaea and hyperthermophilic Thermococcales. These plasmids resemble bacterial plasmids in terms of size (from small plasmids encoding only one gene up to large megaplasmids) and replication mechanisms (rolling circle or theta). Some of them are related to viral genomes and form a more or less continuous sequence space including many integrated elements. Plasmids from Euryarchaeota have been useful for designing efficient genetic tools for these microorganisms. In addition, they have also been used to probe the topological state of plasmids in species with or without DNA gyrase and/or reverse gyrase. Plasmids from Euryarchaeota encode both DNA replication proteins recruited from their hosts and novel families of DNA replication proteins. Euryarchaeota form an interesting playground to test evolutionary hypotheses on the origin and evolution of viruses and plasmids, since a robust phylogeny is available for this phylum. Preliminary studies have shown that for different plasmid families, plasmids share a common gene pool and coevolve with their hosts. They are involved in gene transfer, mostly between plasmids and viruses present in closely related species, but rarely between cells from distantly related archaeal lineages. With few exceptions (e.g., plasmids carrying gas vesicle genes), most archaeal plasmids seem to be cryptic. Interestingly, plasmids and viral genomes have been detected in extracellular membrane vesicles produced by Thermococcales, suggesting that these vesicles could be involved in the transfer of viruses and plasmids between cells.

  16. Direct electrochemical detection of kanamycin based on peroxidase-like activity of gold nanoparticles.

    PubMed

    Wang, Chunshuai; Liu, Chang; Luo, Jibao; Tian, Yaping; Zhou, Nandi

    2016-09-14

    An enzyme-free, ultrasensitive electrochemical detection of kanamycin residue was achieved based on mimetic peroxidase activity of gold nanoparticles (AuNPs) and target-induced replacement of the aptamer. AuNPs which were synthesized using tyrosine as a reducing and capping agent, exhibited mimetic peroxidase activity. In the presence of kanamycin-specific aptamer, however, the single-stranded DNA (ssDNA) adsorbed on the surface of AuNPs via the interaction between the bases of ssDNA and AuNPs, and therefore blocked the catalytic site of AuNPs, and inhibited their peroxidase activity. While in the presence of target kanamycin, it bound with the adsorbed aptamer on AuNPs with high affinity, exposed the surface of AuNPs and recovered the peroxidase activity. Then AuNPs catalyzed the reaction between H2O2 and reduced thionine to produce oxidized thionine. The latter exhibited a distinct reduction peak on gold electrode in differential pulse voltammetry (DPV), and could be utilized to quantify the concentration of kanamycin. Under the optimized conditions, the proposed electrochemical assay showed an extremely high sensitivity towards kanamycin, with a linear relationship between the peak current and the concentration of kanamycin in the range of 0.1-60 nM, and a detection limit of 0.06 nM. Moreover, the established approach was successfully applied in the detection of kanamycin in honey samples. Therefore, the proposed electrochemical assay has great potential in the fields of food quality control and environmental monitoring. PMID:27566341

  17. Novel Synthesis of Kanamycin Conjugated Gold Nanoparticles with Potent Antibacterial Activity

    PubMed Central

    Payne, Jason N.; Waghwani, Hitesh K.; Connor, Michael G.; Hamilton, William; Tockstein, Sarah; Moolani, Harsh; Chavda, Fenil; Badwaik, Vivek; Lawrenz, Matthew B.; Dakshinamurthy, Rajalingam

    2016-01-01

    With a sharp increase in the cases of multi-drug resistant (MDR) bacteria all over the world, there is a huge demand to develop a new generation of antibiotic agents to fight them. As an alternative to the traditional drug discovery route, we have designed an effective antibacterial agent by modifying an existing commercial antibiotic, kanamycin, conjugated on the surface of gold nanoparticles (AuNPs). In this study, we report a single-step synthesis of kanamycin-capped AuNPs (Kan-AuNPs) utilizing the combined reducing and capping properties of kanamycin. While Kan-AuNPs have increased toxicity to a primate cell line (Vero 76), antibacterial assays showed dose-dependent broad spectrum activity of Kan-AuNPs against both Gram-positive and Gram-negative bacteria, including Kanamycin resistant bacteria. Further, a significant reduction in the minimum inhibitory concentration (MIC) of Kan-AuNPs was observed when compared to free kanamycin against all the bacterial strains tested. Mechanistic studies using transmission electron microscopy and fluorescence microscopy indicated that at least part of Kan-AuNPs increased efficacy may be through disrupting the bacterial envelope, resulting in the leakage of cytoplasmic content and the death of bacterial cells. Results of this study provide critical information about a novel method for the development of antibiotic capped AuNPs as potent next-generation antibacterial agents. PMID:27330535

  18. TraG from RP4 and TraG and VirD4 from Ti Plasmids Confer Relaxosome Specificity to the Conjugal Transfer System of pTiC58

    PubMed Central

    Hamilton, Claire M.; Lee, Hyewon; Li, Pei-Li; Cook, David M.; Piper, Kevin R.; von Bodman, Susanne Beck; Lanka, Erich; Ream, Walt; Farrand, Stephen K.

    2000-01-01

    Plasmid conjugation systems are composed of two components, the DNA transfer and replication system, or Dtr, and the mating pair formation system, or Mpf. During conjugal transfer an essential factor, called the coupling protein, is thought to interface the Dtr, in the form of the relaxosome, with the Mpf, in the form of the mating bridge. These proteins, such as TraG from the IncP1 plasmid RP4 (TraGRP4) and TraG and VirD4 from the conjugal transfer and T-DNA transfer systems of Ti plasmids, are believed to dictate specificity of the interactions that can occur between different Dtr and Mpf components. The Ti plasmids of Agrobacterium tumefaciens do not mobilize vectors containing the oriT of RP4, but these IncP1 plasmid derivatives lack the trans-acting Dtr functions and TraGRP4. A. tumefaciens donors transferred a chimeric plasmid that contains the oriT and Dtr genes of RP4 and the Mpf genes of pTiC58, indicating that the Ti plasmid mating bridge can interact with the RP4 relaxosome. However, the Ti plasmid did not mobilize transfer from an IncQ relaxosome. The Ti plasmid did mobilize such plasmids if TraGRP4 was expressed in the donors. Mutations in traGRP4 with defined effects on the RP4 transfer system exhibited similar phenotypes for Ti plasmid-mediated mobilization of the IncQ vector. When provided with VirD4, the tra system of pTiC58 mobilized plasmids from the IncQ relaxosome. However, neither TraGRP4 nor VirD4 restored transfer to a traG mutant of the Ti plasmid. VirD4 also failed to complement a traGRP4 mutant for transfer from the RP4 relaxosome or for RP4-mediated mobilization from the IncQ relaxosome. TraGRP4-mediated mobilization of the IncQ plasmid by pTiC58 did not inhibit Ti plasmid transfer, suggesting that the relaxosomes of the two plasmids do not compete for the same mating bridge. We conclude that TraGRP4 and VirD4 couples the IncQ but not the Ti plasmid relaxosome to the Ti plasmid mating bridge. However, VirD4 cannot couple the IncP1 or the

  19. Label-free detection of kanamycin based on a G-quadruplex DNA aptamer-based fluorescent intercalator displacement assay.

    PubMed

    Xing, Yun-Peng; Liu, Chun; Zhou, Xiao-Hong; Shi, Han-Chang

    2015-01-01

    This work was the first to report that the kanamycin-binding DNA aptamer (5'-TGG GGG TTG AGG CTA AGC CGA-3') can form stable parallel G-quadruplex DNA (G4-DNA) structures by themselves and that this phenomenon can be verified by nondenaturing polyacrylamide gel electrophoresis and circular dichroism spectroscopy. Based on these findings, we developed a novel label-free strategy for kanamycin detection based on the G4-DNA aptamer-based fluorescent intercalator displacement assay with thiazole orange (TO) as the fluorescence probe. In the proposed strategy, TO became strongly fluorescent upon binding to kanamycin-binding G4-DNA. However, the addition of kanamycin caused the displacement of TO from the G4-DNA-TO conjugate, thereby resulting in decreased fluorescent signal, which was inversely related to the kanamycin concentration. The detection limit of the proposed assay decreased to 59 nM with a linear working range of 0.1 μM to 20 μM for kanamycin. The cross-reactivity against six other antibiotics was negligible compared with the response to kanamycin. A satisfactory recovery of kanamycin in milk samples ranged from 80.1% to 98.0%, confirming the potential of this bioassay in the measurement of kanamycin in various applications. Our results also served as a good reference for developing similar fluorescent G4-DNA-based bioassays in the future. PMID:25634469

  20. Label-free detection of kanamycin based on a G-quadruplex DNA aptamer-based fluorescent intercalator displacement assay

    NASA Astrophysics Data System (ADS)

    Xing, Yun-Peng; Liu, Chun; Zhou, Xiao-Hong; Shi, Han-Chang

    2015-01-01

    This work was the first to report that the kanamycin-binding DNA aptamer (5'-TGG GGG TTG AGG CTA AGC CGA-3') can form stable parallel G-quadruplex DNA (G4-DNA) structures by themselves and that this phenomenon can be verified by nondenaturing polyacrylamide gel electrophoresis and circular dichroism spectroscopy. Based on these findings, we developed a novel label-free strategy for kanamycin detection based on the G4-DNA aptamer-based fluorescent intercalator displacement assay with thiazole orange (TO) as the fluorescence probe. In the proposed strategy, TO became strongly fluorescent upon binding to kanamycin-binding G4-DNA. However, the addition of kanamycin caused the displacement of TO from the G4-DNA-TO conjugate, thereby resulting in decreased fluorescent signal, which was inversely related to the kanamycin concentration. The detection limit of the proposed assay decreased to 59 nM with a linear working range of 0.1 μM to 20 μM for kanamycin. The cross-reactivity against six other antibiotics was negligible compared with the response to kanamycin. A satisfactory recovery of kanamycin in milk samples ranged from 80.1% to 98.0%, confirming the potential of this bioassay in the measurement of kanamycin in various applications. Our results also served as a good reference for developing similar fluorescent G4-DNA-based bioassays in the future.

  1. Label-free detection of kanamycin based on a G-quadruplex DNA aptamer-based fluorescent intercalator displacement assay

    PubMed Central

    Xing, Yun-Peng; Liu, Chun; Zhou, Xiao-Hong; Shi, Han-Chang

    2015-01-01

    This work was the first to report that the kanamycin-binding DNA aptamer (5′-TGG GGG TTG AGG CTA AGC CGA-3′) can form stable parallel G-quadruplex DNA (G4-DNA) structures by themselves and that this phenomenon can be verified by nondenaturing polyacrylamide gel electrophoresis and circular dichroism spectroscopy. Based on these findings, we developed a novel label-free strategy for kanamycin detection based on the G4-DNA aptamer-based fluorescent intercalator displacement assay with thiazole orange (TO) as the fluorescence probe. In the proposed strategy, TO became strongly fluorescent upon binding to kanamycin-binding G4-DNA. However, the addition of kanamycin caused the displacement of TO from the G4-DNA–TO conjugate, thereby resulting in decreased fluorescent signal, which was inversely related to the kanamycin concentration. The detection limit of the proposed assay decreased to 59 nM with a linear working range of 0.1 μM to 20 μM for kanamycin. The cross-reactivity against six other antibiotics was negligible compared with the response to kanamycin. A satisfactory recovery of kanamycin in milk samples ranged from 80.1% to 98.0%, confirming the potential of this bioassay in the measurement of kanamycin in various applications. Our results also served as a good reference for developing similar fluorescent G4-DNA-based bioassays in the future. PMID:25634469

  2. Expression Plasmids for Use in Candida glabrata

    PubMed Central

    Zordan, Rebecca E.; Ren, Yuxia; Pan, Shih-Jung; Rotondo, Giuseppe; Peñas, Alejandro De Las; Iluore, Joseph; Cormack, Brendan P.

    2013-01-01

    We describe a series of CEN/ARS episomal plasmids containing different Candida glabrata promoters, allowing for a range of constitutive or regulated expression of proteins in C. glabrata. The set of promoters includes three constitutive promoters (EGD2pr, HHT2pr, PDC1pr), two macrophage/phagocytosis-induced promoters (ACO2pr, LYS21pr), and one nutritionally regulated promoter (MET3pr). Each promoter was cloned into two plasmid backbones that differ in their selectable marker, URA3, or the dominant-selectable NAT1 gene, which confers resistance to the drug nourseothricin. Expression from the 12 resulting plasmids was assessed using GFP as a reporter and flow cytometry or quantitative reverse-transcription polymerase chain reaction to assess expression levels. Together this set of plasmids expands the toolkit of expression vectors available for use with C. glabrata. PMID:23934995

  3. [Antitoxic properties of pantothenic acid derivatives, precursors of coenzyme A biosynthesis, with regard to kanamycin].

    PubMed

    Moĭseenok, A G; Dorofeev, B F; Sheĭbak, V M; Khomich, T I

    1984-11-01

    The effect of calcium pantothenate (CPN)B 4'-phospho-CPN (PCP), pantetheine (PT) and calcium S-sulfopantetheine (SPN) on acute toxicity of kanamycin sulfate was studied on albino mice. The above derivatives of pantothenic acid except PT lowered the antibiotic toxicity. The coefficient of the antitoxic effect (LD50/ED50) of SPN and PCP was 1.3-1.4 times higher than that of CPN. The combined use of kanamycin (1/5 of the LD50) with CPN, PCP or PT (30 mg/kg bw was equivalent to CPN) for 15 days prevented the increase in the total content of CoA and in the content of the fraction of free CoA and the precursors of its biosynthesis participating in the reaction of N-acetylation in the liver and brain. The contents of these substances were within the normal during the whole experiment. A certain increase in the activity of pantothenate kinase in the liver cytosol due to the use of kanamycin was eliminated by the simultaneous use of PCP and PT. The vitamin-containing compounds PCP and SPN were recommended for the clinical trials as agents preventing complications of kanamycin therapy. PMID:6524887

  4. Degradative plasmids from sphingomonads.

    PubMed

    Stolz, Andreas

    2014-01-01

    Large plasmids ('megaplasmids') are commonly found in members of the Alphaproteobacterial family Sphingomonadaceae ('sphingomonads'). These plasmids contribute to the extraordinary catabolic flexibility of this group of organisms, which degrade a broad range of recalcitrant xenobiotic compounds. The genomes of several sphingomonads have been sequenced during the last years. In the course of these studies, also the sequences of several plasmids have been determined. The analysis of the published information and the sequences deposited in the public databases allowed a first classification of these plasmids into a restricted number of groups according to the proteins involved in the initiation of replication, plasmid partition and conjugation. The sequence comparisons demonstrated that the plasmids from sphingomonads encode for four main groups of replication initiation (Rep) proteins. These Rep proteins belong to the protein superfamilies RepA_C (Pfam 04796), Rep_3 (Pfam 01051), RPA (Pfam 10134) and HTH-36 (Pfam 13730). The 'degradative megaplasmids' pNL2, pCAR3, pSWIT02, pCHQ1, pISP0, and pISP1, which code for genes involved in the degradation of aromatic hydrocarbons, carbazole, dibenzo-p-dioxin and γ-hexachlorocyclohexane, carry Rep proteins which either belong to the RepA_C- (plasmids pNL2, pCAR3, pSWIT02), Rep-3- (plasmids pCHQ1, pISP0) or RPA-superfamily (pISP1). The classification of these 'degradative megaplasmids' into three groups is also supported by sequence comparisons of the proteins involved in plasmid partition (ParAB) and the organization of the three genes on the respective plasmids. All analysed 'degradative megaplasmids' carry genes, which might allow a conjugative transfer of the plasmids. Sequence comparisons of these genes suggest the presence of at least two types of transfer functions, which either are closer related to the tra- or vir-genes previously described for plasmids from other sources.

  5. Plasmid-Mediated Antimicrobial Resistance in Staphylococci and Other Firmicutes.

    PubMed

    Schwarz, Stefan; Shen, Jianzhong; Wendlandt, Sarah; Fessler, Andrea T; Wang, Yang; Kadlec, Kristina; Wu, Cong-Ming

    2014-12-01

    In staphylococci and other Firmicutes, resistance to numerous classes of antimicrobial agents, which are commonly used in human and veterinary medicine, is mediated by genes that are associated with mobile genetic elements. The gene products of some of these antimicrobial resistance genes confer resistance to only specific members of a certain class of antimicrobial agents, whereas others confer resistance to the entire class or even to members of different classes of antimicrobial agents. The resistance mechanisms specified by the resistance genes fall into any of three major categories: active efflux, enzymatic inactivation, and modification/replacement/protection of the target sites of the antimicrobial agents. Among the mobile genetic elements that carry such resistance genes, plasmids play an important role as carriers of primarily plasmid-borne resistance genes, but also as vectors for nonconjugative and conjugative transposons that harbor resistance genes. Plasmids can be exchanged by horizontal gene transfer between members of the same species but also between bacteria belonging to different species and genera. Plasmids are highly flexible elements, and various mechanisms exist by which plasmids can recombine, form cointegrates, or become integrated in part or in toto into the chromosomal DNA or into other plasmids. As such, plasmids play a key role in the dissemination of antimicrobial resistance genes within the gene pool to which staphylococci and other Firmicutes have access. This chapter is intended to provide an overview of the current knowledge of plasmid-mediated antimicrobial resistance in staphylococci and other Firmicutes.

  6. SPP1-mediated plasmid transduction.

    PubMed Central

    Canosi, U; Lüder, G; Trautner, T A

    1982-01-01

    The virulent Bacillus subtilis phage SPP1 transduces plasmid DNA. Plasmid-transducing phages contain only plasmid DNA. Such DNA represents a concatemer of monomeric plasmid molecules with the molecular weight of mature SPP1 DNA. Biological parameters of plasmid transduction are described. Images PMID:6292508

  7. International Spread and Persistence of TEM-24 Is Caused by the Confluence of Highly Penetrating Enterobacteriaceae Clones and an IncA/C2 Plasmid Containing Tn1696::Tn1 and IS5075-Tn21▿

    PubMed Central

    Novais, Ângela; Baquero, Fernando; Machado, Elisabete; Cantón, Rafael; Peixe, Luísa; Coque, Teresa M.

    2010-01-01

    TEM-24 remains one of the most widespread TEM-type extended-spectrum β-lactamases (ESBLs) among Enterobacteriaceae. To analyze the reasons influencing its spread and persistence, a multilevel population genetics study was carried out on 28 representative TEM-24 producers from Belgium, France, Portugal, and Spain (13 Enterobacter aerogenes isolates, 6 Escherichia coli isolates, 6 Klebsiella pneumoniae isolates, 2 Proteus mirabilis isolates, and 1 Klebsiella oxytoca isolate, from 1998 to 2004). Clonal relatedness (XbaI pulsed-field gel electrophoresis [PFGE] and E. coli phylogroups) and antibiotic susceptibility were determined by standard procedures. Plasmid analysis included determination of the incompatibility group (by PCR, hybridization, and/or sequencing) and comparison of restriction fragment length polymorphism (RFLP) patterns. Characterization of genetic elements conferring antibiotic resistance included integrons (classes 1, 2, and 3) and transposons (Tn3, Tn21, and Tn402). Similar PFGE patterns were identified among E. aerogenes, K. pneumoniae, and P. mirabilis isolates, while E. coli strains were diverse (phylogenetic groups A, B2, and D). Highly related 180-kb IncA/C2 plasmids conferring resistance to kanamycin, tobramycin, chloramphenicol, trimethoprim, and sulfonamides were identified. Each plasmid contained defective In0-Tn402 (dfrA1-aadA1, aacA4, or aacA4-aacC1-orfE-aadA2-cmlA1) and In4-Tn402 (aacA4 or dfrA1-aadA1) variants. These integrons were located within Tn21, Tn1696, or hybrids of these transposons, with IS5075 interrupting their IRtnp and IRmer. In all cases, blaTEM-24 was part of an IS5075-ΔTn1 transposon within tnp1696, mimicking other genetic elements containing blaTEM-2 and blaTEM-3 variants. The international dissemination of TEM-24 is fuelled by an IncA/C2 plasmid acquired by different enterobacterial clones which seem to evolve by gaining diverse genetic elements. This work highlights the risks of a confluence between highly

  8. MAPLE fabrication of thin films based on kanamycin functionalized magnetite nanoparticles with anti-pathogenic properties

    NASA Astrophysics Data System (ADS)

    Grumezescu, Valentina; Andronescu, Ecaterina; Holban, Alina Maria; Mogoantă, Laurenţiu; Mogoşanu, George Dan; Grumezescu, Alexandru Mihai; Stănculescu, Anca; Socol, Gabriel; Iordache, Florin; Maniu, Horia; Chifiriuc, Mariana Carmen

    2015-05-01

    In this study we aimed to evaluate the biocompatibility and antimicrobial activity of kanamycin functionalized 5 nm-magnetite (Fe3O4@KAN) nanoparticles thin films deposited by Matrix Assisted Pulsed Laser Evaporation (MAPLE) technique. A laser deposition regime was established in order to stoichiometrically transfer Fe3O4@KAN thin films on silicone and glass substrates. Morphological and physico-chemical properties of powders and coatings were characterized by XRD, TEM, SEM, AFM and IR microscopy (IRM). Our nanostructured thin films have proved efficiency in the prevention of microbial adhesion and mature biofilms development as a result of antibiotic release in its active form. Furthermore, kanamycin functionalized nanostructures exhibit a good biocompatibility, both in vivo and in vitro, demonstrating their potential for implants application. This is the first study reporting the assessment of the in vivo biocompatibility of a magnetite-antimicrobial thin films produced by MAPLE technique.

  9. [Evolutionary engineering in Salmonella: emergence of hybrid virulence-resistance plasmids in non-typhoid serotypes].

    PubMed

    Mendoza, María Del Carmen; Herrero, Ana; Rodicio, María Rosario

    2009-01-01

    An example of evolutive engineering in bacterial pathogens is the emergence of hybrid virulence-resistance (VR) plasmids in Salmonella enterica, resulting from an association between antimicrobial resistance determinants and specific virulence plasmids of the S. typhimurium and S. choleraesuis serotypes. VR plasmids all possess the spv (Salmonella plasmid virulence) operon, which is involved in systemic infection; however, they differ in the presence of other virulence determinants and in the resistance gene profile. VR plasmids of S. typhimurium have been found in Europe, and show resistance regions with different levels of complexity that can include class 1 integrons and various transposons. VR plasmids of S. choleraesuis, detected in strains isolated in Taiwan, only confer resistance to ampicillin and sulfonamides. Both serotypes are zoonotic and the presence of hybrid VR plasmids may confer an adaptive advantage under certain conditions, resulting in bacterial strains that are more difficult to treat and have a higher epidemic potential.

  10. Functional characterization of KanP, a methyltransferase from the kanamycin biosynthetic gene cluster of Streptomyces kanamyceticus.

    PubMed

    Nepal, Keshav Kumar; Yoo, Jin Cheol; Sohng, Jae Kyung

    2010-09-20

    KanP, a putative methyltransferase, is located in the kanamycin biosynthetic gene cluster of Streptomyces kanamyceticus ATCC12853. Amino acid sequence analysis of KanP revealed the presence of S-adenosyl-L-methionine binding motifs, which are present in other O-methyltransferases. The kanP gene was expressed in Escherichia coli BL21 (DE3) to generate the E. coli KANP recombinant strain. The conversion of external quercetin to methylated quercetin in the culture extract of E. coli KANP proved the function of kanP as S-adenosyl-L-methionine-dependent methyltransferase. This is the first report concerning the identification of an O-methyltransferase gene from the kanamycin gene cluster. The resistant activity assay and RT-PCR analysis demonstrated the leeway for obtaining methylated kanamycin derivatives from the wild-type strain of kanamycin producer. PMID:20015628

  11. Bacteriophages Limit the Existence Conditions for Conjugative Plasmids

    PubMed Central

    Wood, A. Jamie; Dytham, Calvin; Pitchford, Jonathan W.; Truman, Julie; Spiers, Andrew; Paterson, Steve; Brockhurst, Michael A.

    2015-01-01

    ABSTRACT Bacteriophages are a major cause of bacterial mortality and impose strong selection on natural bacterial populations, yet their effects on the dynamics of conjugative plasmids have rarely been tested. We combined experimental evolution, mathematical modeling, and individual-based simulations to explain how the ecological and population genetics effects of bacteriophages upon bacteria interact to determine the dynamics of conjugative plasmids and their persistence. The ecological effects of bacteriophages on bacteria are predicted to limit the existence conditions for conjugative plasmids, preventing persistence under weak selection for plasmid accessory traits. Experiments showed that phages drove faster extinction of plasmids in environments where the plasmid conferred no benefit, but they also revealed more complex effects of phages on plasmid dynamics under these conditions, specifically, the temporary maintenance of plasmids at fixation followed by rapid loss. We hypothesized that the population genetic effects of bacteriophages, specifically, selection for phage resistance mutations, may have caused this. Further mathematical modeling and individual-based simulations supported our hypothesis, showing that conjugative plasmids may hitchhike with phage resistance mutations in the bacterial chromosome. PMID:26037122

  12. Conjugal transfer of broad-host-range incompatibility group P and Q plasmids from Escherichia coli to Actinobacillus actinomycetemcomitans.

    PubMed Central

    Goncharoff, P; Yip, J K; Wang, H; Schreiner, H C; Pai, J A; Furgang, D; Stevens, R H; Figurski, D H; Fine, D H

    1993-01-01

    The first example of conjugal transfer of DNA from Escherichia coli to the periodontal pathogen Actinobacillus actinomycetemcomitans is presented. Derivatives of the incompatibility group P (IncP) plasmid RK2 successfully transferred from an E. coli donor to an A. actinomycetemcomitans recipient. The resulting A. actinomycetemcomitans transconjugants transferred the plasmids back to E. coli recipients. The IncP transfer functions were also used in trans to mobilize the IncQ plasmid pBK1 from E. coli to A. actinomycetemcomitans. The IncP and IncQ plasmids both transferred into A. actinomycetemcomitans at high frequencies (0.3 to 0.5 transconjugants per donor) and showed no gross deletions, insertions, or rearrangements. Determinations of MICs of various antibiotics for the A. actinomycetemcomitans transconjugant strains demonstrated the expression of ampicillin, chloramphenicol, and kanamycin resistance determinants. Images PMID:8335386

  13. Complete nucleotide sequence of pH11, an IncHI2 plasmid conferring multi-antibiotic resistance and multi-heavy metal resistance genes in a clinical Klebsiella pneumoniae isolate.

    PubMed

    Zhai, Yao; He, Zilong; Kang, Yu; Yu, Haiying; Wang, Jianfeng; Du, Pengcheng; Zhang, Zhao; Hu, Songnian; Gao, Zhancheng

    2016-07-01

    The complete 284,628bp sequence of pH11, an IncHI2 plasmid, was determined through single-molecule, real-time (SMRT) sequencing. Harbored by a clinical Klebsiella pneumoniae strain H11, and isolated in Beijing, this plasmid contains multiple antibiotic resistance genes, including catA2, aac(6')-Ib, strB, strA, dfrA19, blaTEM-1, blaSHV-12, sul1, qacE delta 1, ereA, arr2, and aac3. The aac(6')-Ib is carried by a class I integron. Plasmid pH11 also carries several genes associated with resistance to heavy metals, such as tellurium, mercury, cobalt, zinc, nickel, copper, lead and cadmium. This plasmid exhibits numerous characteristics, including HipBA and RelBE toxin-antitoxin systems, two major transfer (Tra) regions closely related to those of Salmonella enterica serovar plasmid pRH-R27, a type II restriction modification system (EcoRII R-M system), several methyltransferases and methylases and genes encoding Hha and StpA. These characteristics suggest that pH11 may adapt to various hosts and environments. Multiple insertion sequence elements, transposases, recombinases, resolvases and integrases are scattered throughout pH11. The presence of these genes may indicate that horizontal gene transfer occurs frequently in pH11 and thus may facilitate the dissemination of antimicrobial resistance determinants. Our data suggest that pH11 is a chimera gradually assembled through the integration of different horizontally acquired DNA segments via transposition or homologous recombination. PMID:27101788

  14. Chlamydial plasmids and bacteriophages.

    PubMed

    Pawlikowska-Warych, Małgorzata; Śliwa-Dominiak, Joanna; Deptuła, Wiesław

    2015-01-01

    Chlamydia are absolute pathogens of humans and animals; despite being rather well recognised, they are still open for discovery. One such discovery is the occurrence of extrachromosomal carriers of genetic information. In prokaryotes, such carriers include plasmids and bacteriophages, which are present only among some Chlamydia species. Plasmids were found exclusively in Chlamydia (C.) trachomatis, C. psittaci, C. pneumoniae, C. suis, C. felis, C. muridarum and C. caviae. In prokaryotic organisms, plasmids usually code for genes that facilitate survival of the bacteria in the environment (although they are not essential). In chlamydia, their role has not been definitely recognised, apart from the fact that they participate in the synthesis of glycogen and encode proteins responsible for their virulence. Furthermore, in C. suis it was evidenced that the plasmid is integrated in a genomic island and contains the tetracycline-resistance gene. Bacteriophages specific for chlamydia (chlamydiaphages) were detected only in six species: C. psittaci, C. abortus, C. felis, C. caviae C. pecorum and C. pneumoniae. These chlamydiaphages cause inhibition of the developmental cycle, and delay transformation of reticulate bodies (RBs) into elementary bodies (EBs), thus reducing the possibility of infecting other cells in time. Plasmids and bacteriophages can be used in the diagnostics of chlamydioses; although especially in the case of plasmids, they are already used for detection of chlamydial infections. In addition, bacteriophages could be used as therapeutic agents to replace antibiotics, potentially addressing the problem of increasing antibiotic-resistance among chlamydia.

  15. Natural plasmids of filamentous fungi.

    PubMed Central

    Griffiths, A J

    1995-01-01

    Among eukaryotes, plasmids have been found in fungi and plants but not in animals. Most plasmids are mitochondrial. In filamentous fungi, plasmids are commonly encountered in isolates from natural populations. Individual populations may show a predominance of one type, but some plasmids have a global distribution, often crossing species boundaries. Surveys have shown that strains can contain more than one type of plasmid and that different types appear to be distributed independently. In crosses, plasmids are generally inherited maternally. Horizontal transmission is by cell contact. Circular plasmids are common only in Neurospora spp., but linear plasmids have been found in many fungi. Circular plasmids have one open reading frame (ORF) coding for a DNA polymerase or a reverse transcriptase. Linear plasmids generally have two ORFs, coding for presumptive DNA and RNA polymerases with amino acid motifs showing homology to viral polymerases. Plasmids often attain a high copy number, in excess of that of mitochondrial DNA. Linear plasmids have a protein attached to their 5' end, and this is presumed to act as a replication primer. Most plasmids are neutral passengers, but several linear plasmids integrate into mitochondrial DNA, causing death of the host culture. Inferred amino acid sequences of linear plasmid ORFs have been used to plot phylogenetic trees, which show a fair concordance with conventional trees. The circular Neurospora plasmids have replication systems that seem to be evolutionary intermediates between the RNA and the DNA worlds. PMID:8531891

  16. Plasmid partitioning systems of conjugative plasmids from Clostridium perfringens.

    PubMed

    Adams, Vicki; Watts, Thomas D; Bulach, Dieter M; Lyras, Dena; Rood, Julian I

    2015-07-01

    Many pathogenic strains of Clostridium perfringens carry several highly similar toxin or antibiotic resistance plasmids that have 35 to 40 kb of very closely related syntenous sequences, including regions that carry the genes encoding conjugative transfer, plasmid replication and plasmid maintenance functions. Key questions are how are these closely related plasmids stably maintained in the same cell and what is the basis for plasmid incompatibility in C. perfringens. Comparative analysis of the Rep proteins encoded by these plasmids suggested that this protein was not the basis for plasmid incompatibility since plasmids carried in a single strain often encoded an almost identical Rep protein. These plasmids all carried a similar, but not identical, parMRC plasmid partitioning locus. Phylogenetic analysis of the deduced ParM proteins revealed that these proteins could be divided into ten separate groups. Importantly, in every strain that carried more than one of these plasmids, the respective ParM proteins were from different phylogenetic groups. Similar observations were made from the analysis of phylogenetic trees of the ParR proteins and the parC loci. These findings provide evidence that the basis for plasmid incompatibility in the conjugative toxin and resistance plasmid family from C. perfringens resides in subtle differences in the parMRC plasmid partitioning loci carried by these plasmids.

  17. Heavy metals resistant plasmid-mediated utilization of solar by Pseudomonas aeruginosa AA301.

    PubMed

    Abo-Amer, Aly E; Mohamed, Rehab M

    2006-01-01

    Solar-degrading bacteria, Pseudomonas aeruginosa strains, were isolated from Egyptian soil by Mineral Salt Medium (MSM) supplemented with Solar (motor fuel) from different oil-contaminated sites in Sohag province. The strain AA301 of Pseudomonas aeruginosa showed appreciable growth in MSM medium containing high concentrations of Solar ranging from 0.5 to 3% (v/v), with optimum concentration at 1.5%. Solar was used as a sole carbon source and a source of energy by the bacterium. The ability to degrade Solar was found to be associated with a single 60-kb plasmid designated pSOL15. The plasmid-cured variant, which was obtained by culturing in LB broth with kanamycin, lost the plasmid indicative the ability to degrade Solar must depend on this plasmid. The wild type isolate, Pseudomonas aeruginosa AA301 and transformant strain, have maximum growth (OD600 = approximately 2) on Solar, however the plasmid-cured variant did not have any significant growth on Solar. Moreover, resistance to a wide range of heavy metals such as Mn2+, Hg2+, Mg2+, Cd2+, Zn2+, and Ni2+ was also 60-kb plasmid-mediated. Therefore, the strain AA301 could be good candidate for remediation of some heavy metals and oil hydrocarbons in heavily polluted sites.

  18. Amelioration of the cost of conjugative plasmid carriage in Eschericha coli K12.

    PubMed Central

    Dahlberg, Cecilia; Chao, Lin

    2003-01-01

    Although plasmids can provide beneficial functions to their host bacteria, they might confer a physiological or energetic cost. This study examines how natural selection may reduce the cost of carrying conjugative plasmids with drug-resistance markers in the absence of antibiotic selection. We studied two plasmids, R1 and RP4, both of which carry multiple drug resistance genes and were shown to impose an initial fitness cost on Escherichia coli. To determine if and how the cost could be reduced, we subjected plasmid-containing bacteria to 1100 generations of evolution in batch cultures. Analysis of the evolved populations revealed that plasmid loss never occurred, but that the cost was reduced through genetic changes in both the plasmids and the bacteria. Changes in the plasmids were inferred by the demonstration that evolved plasmids no longer imposed a cost on their hosts when transferred to a plasmid-free clone of the ancestral E. coli. Changes in the bacteria were shown by the lowered cost when the ancestral plasmids were introduced into evolved bacteria that had been cured of their (evolved) plasmids. Additionally, changes in the bacteria were inferred because conjugative transfer rates of evolved R1 plasmids were lower in the evolved host than in the ancestral host. Our results suggest that once a conjugative bacterial plasmid has invaded a bacterial population it will remain even if the original selection is discontinued. PMID:14704155

  19. Two different erm(C)-carrying plasmids in the same methicillin-resistant Staphylococcus aureus CC398 isolate from a broiler farm.

    PubMed

    Wendlandt, Sarah; Kadlec, Kristina; Feßler, Andrea T; van Duijkeren, Engeline; Schwarz, Stefan

    2014-07-16

    During a study on plasmid-borne antimicrobial resistance among methicillin-resistant Staphylococcus aureus (MRSA) isolates from broiler farms, an MRSA isolate was identified which carried multiple plasmids. This MRSA isolate belonged to CC398 and exhibited spa type t3015 and dru type dt11a. Plasmid profiling revealed the presence of one large and two small plasmids. The resistance genes tet(L) (tetracycline resistance), dfrK (trimethoprim resistance) and aadD (kanamycin/neomycin resistance) were located on the large plasmid. Both small plasmids, designated pSWS371 and pSWS372, carried only an erm(C) gene for macrolide/lincosamide resistance. Sequence analysis revealed that the 2458-bp plasmid pSWS371 carried only a repL gene for plasmid replication in addition to the erm(C) gene. In contrast, the 3882-bp plasmid pSWS372 harbored - in addition to the erm(C) gene - three more genes: a repF gene for plasmid replication, a cop-6 gene for a small protein potentially involved in copy number control of the plasmid and a novel pre/mob gene for a protein involved in plasmid recombination and mobilization. The erm(C) genes of both small plasmids exhibited constitutive erm(C) gene expression and analysis of the respective translational attenuators identified deletions of 16 bp and 74 bp which explain the constitutive expression. The simultaneous presence of two small plasmids that carry the same resistance gene in the same MRSA isolate is a rare observation. The fact that both plasmids belong to different incompatibility groups as specified by the different rep genes, repL and repF, explains why they can stably coexist in the same bacterial cell.

  20. Plasmids encoding therapeutic agents

    DOEpatents

    Keener, William K.

    2007-08-07

    Plasmids encoding anti-HIV and anti-anthrax therapeutic agents are disclosed. Plasmid pWKK-500 encodes a fusion protein containing DP178 as a targeting moiety, the ricin A chain, an HIV protease cleavable linker, and a truncated ricin B chain. N-terminal extensions of the fusion protein include the maltose binding protein and a Factor Xa protease site. C-terminal extensions include a hydrophobic linker, an L domain motif peptide, a KDEL ER retention signal, another Factor Xa protease site, an out-of-frame buforin II coding sequence, the lacZ.alpha. peptide, and a polyhistidine tag. More than twenty derivatives of plasmid pWKK-500 are described. Plasmids pWKK-700 and pWKK-800 are similar to pWKK-500 wherein the DP178-encoding sequence is substituted by RANTES- and SDF-1-encoding sequences, respectively. Plasmid pWKK-900 is similar to pWKK-500 wherein the HIV protease cleavable linker is substituted by a lethal factor (LF) peptide-cleavable linker.

  1. Stable Agrobacterium-Mediated Transformation of Maritime Pine Based on Kanamycin Selection

    PubMed Central

    Alvarez, José M.; Ordás, Ricardo J.

    2013-01-01

    An efficient transformation protocol based on kanamycin selection was developed for Agrobacterium-mediated transformation of maritime pine embryonal masses. The binary vector pBINUbiGUSint, which contained neomycin phosphotransferase II (nptII) as a selectable marker gene and β-glucuronidase (uidA) as a reporter gene, was used for transformation studies. Different factors, such as embryogenic line, bacterial strain, bacterial concentration, and coculture duration, were examined and optimized. For selection of transformants, 15 mgL−1 kanamycin was used. The highest transformation efficiency (11.4 events per gram of fresh mass) was achieved when a vigorously growing embryonal mass (embryogenic line L01) was cocultivated with Agrobacterium strain AGL1 at the optical density (OD600 nm) of 0.3 for 72 h. Evidence of the stable transgene integration was obtained by polymerase chain reaction for the nptII and uidA genes and expression of the uidA gene. Maturation capacity of the transgenic lines was negatively affected by the transformation process. Induction of axillary shoots by preculturing the embryos with benzyladenine allowed overcoming the low maturation rates of some transformed lines. The transgenic embryos were germinated and the axillar shoots were rooted. Transgenic plants were transferred to potting substrate showing normal growth. PMID:24376383

  2. Exogenous alanine and/or glucose plus kanamycin kills antibiotic-resistant bacteria.

    PubMed

    Peng, Bo; Su, Yu-Bin; Li, Hui; Han, Yi; Guo, Chang; Tian, Yao-Mei; Peng, Xuan-Xian

    2015-02-01

    Multidrug-resistant bacteria are an increasingly serious threat to human and animal health. However, novel drugs that can manage infections by multidrug-resistant bacteria have proved elusive. Here we show that glucose and alanine abundances are greatly suppressed in kanamycin-resistant Edwardsiella tarda by GC-MS-based metabolomics. Exogenous alanine or glucose restores susceptibility of multidrug-resistant E. tarda to killing by kanamycin, demonstrating an approach to killing multidrug-resistant bacteria. The mechanism underlying this approach is that exogenous glucose or alanine promotes the TCA cycle by substrate activation, which in turn increases production of NADH and proton motive force and stimulates uptake of antibiotic. Similar results are obtained with other Gram-negative bacteria (Vibrio parahaemolyticus, Klebsiella pneumoniae, Pseudomonas aeruginosa) and Gram-positive bacterium (Staphylococcus aureus), and the results are also reproduced in a mouse model for urinary tract infection. This study establishes a functional metabolomics-based strategy to manage infection by antibiotic-resistant bacteria.

  3. Ultrastructural correlates of selective outer hair cell destruction following kanamycin intoxication in the chinchilla.

    PubMed

    Ryan, A F; Woolf, N K; Bone, R C

    1980-12-01

    Kanamycin ototoxicity, combined with behavioral audiometry to evaluate threshold shifts, was used to destroy outer hair cells (OHCs) in the basal cochlea of the chincilla while leaving the inner hair cell (IHC) population largely intact. After survival times of four weeks to one year, transmission electron microscopy was employed to determine the condition of surviving hair cells and neural elements. Throughout the region of OHC loss, IHCs and their innervation were normal in appearance if their adjacent supporting cells were undamaged. When IHC supporting cells, specifically the inner pillar cells, were damaged or absent, damage to IHCs was commonly observed. Such supporting cell-related damage included extrusion of the cuticular plate from the surface of the reticular lamina, encapsulation and/or fusion of stereocilia, and gross distortion of hair cell shape. When the outer supporting cells of the organ of Corti were undamaged following OHC loss, outer spiral fibers were found to have survived in near-normal numbers in the region from 0.5-1.0 mm basal to the basal most surviving OHC, but suffered progressive attrition toward the basal end of the cochlea. It is concluded that kanamycin-induced OHC loss can occur without concommitant IHC damage or outer spiral fiber loss. PMID:7451380

  4. Stable Agrobacterium-mediated transformation of maritime pine based on kanamycin selection.

    PubMed

    Alvarez, José M; Ordás, Ricardo J

    2013-01-01

    An efficient transformation protocol based on kanamycin selection was developed for Agrobacterium-mediated transformation of maritime pine embryonal masses. The binary vector pBINUbiGUSint, which contained neomycin phosphotransferase II (nptII) as a selectable marker gene and β -glucuronidase (uidA) as a reporter gene, was used for transformation studies. Different factors, such as embryogenic line, bacterial strain, bacterial concentration, and coculture duration, were examined and optimized. For selection of transformants, 15 mgL(-1) kanamycin was used. The highest transformation efficiency (11.4 events per gram of fresh mass) was achieved when a vigorously growing embryonal mass (embryogenic line L01) was cocultivated with Agrobacterium strain AGL1 at the optical density (OD(600 nm)) of 0.3 for 72 h. Evidence of the stable transgene integration was obtained by polymerase chain reaction for the nptII and uidA genes and expression of the uidA gene. Maturation capacity of the transgenic lines was negatively affected by the transformation process. Induction of axillary shoots by preculturing the embryos with benzyladenine allowed overcoming the low maturation rates of some transformed lines. The transgenic embryos were germinated and the axillar shoots were rooted. Transgenic plants were transferred to potting substrate showing normal growth.

  5. Mechanisms of plasmid segregation: have multicopy plasmids been overlooked?

    PubMed

    Million-Weaver, Samuel; Camps, Manel

    2014-09-01

    Plasmids are self-replicating pieces of DNA typically bearing non-essential genes. Given that plasmids represent a metabolic burden to the host, mechanisms ensuring plasmid transmission to daughter cells are critical for their stable maintenance in the population. Here we review these mechanisms, focusing on two active partition strategies common to low-copy plasmids: par systems type I and type II. Both involve three components: an adaptor protein, a motor protein, and a centromere, which is a sequence area in the plasmid that is recognized by the adaptor protein. The centromere-bound adaptor nucleates polymerization of the motor, leading to filament formation, which can pull plasmids apart (par I) or push them towards opposite poles of the cell (par II). No such active partition mechanisms are known to occur in high copy number plasmids. In this case, vertical transmission is generally considered stochastic, due to the random distribution of plasmids in the cytoplasm. We discuss conceptual and experimental lines of evidence questioning the random distribution model and posit the existence of a mechanism for segregation in high copy number plasmids that moves plasmids to cell poles to facilitate transmission to daughter cells. This mechanism would involve chromosomally-encoded proteins and the plasmid origin of replication. Modulation of this proposed mechanism of segregation could provide new ways to enhance plasmid stability in the context of recombinant gene expression, which is limiting for large-scale protein production and for bioremediation.

  6. Genetic transformation of Brassica nigra by agrobacterium based vector and direct plasmid uptake.

    PubMed

    Gupta, V; Lakshmi Sita, G; Shaila, M S; Jagannathan, V

    1993-05-01

    Genetic transformation systems have been established for Brassica nigra (cv. IC 257) by using an Agrobacterium binary vector as well as by direct DNA uptake of a plasmid vector. Both the type of vectors carried nptII gene and gus gene. For Agrobacterium mediated transformation, hypocotyl tissue explants were used, and up to 33% of the explants produced calli on selection medium. All of these expressed B-glucuronidase gene on histochemical staining. Protoplasts isolated from hypocotyl tissues of seedlings could be transformed with a plasmid vector by FEG mediated uptake of vector DNA. A number of fertile kanamycin resistant plants were obtained using both the methods, and their transformed nature was confirmed by Southern blot analysis and histochemical staining for GUS. Backcrossed and selfed progenies of these transformed plants showed the presence of npt and gus genes. PMID:24197344

  7. Non-invasive determination of conjugative transfer of plasmids bearing antibiotic-resistance genes in biofilm-bound bacteria: effects of substrate loading and antibiotic selection.

    PubMed

    Ma, Hongyan; Bryers, James D

    2013-01-01

    Biofilms cause much of all human microbial infections. Attempts to eradicate biofilm-based infections rely on disinfectants and antibiotics. Unfortunately, biofilm bacteria are significantly less responsive to antibiotic stressors than their planktonic counterparts. Sublethal doses of antibiotics can actually enhance biofilm formation. Here, we have developed a non-invasive microscopic image analyses to quantify plasmid conjugation within a developing biofilm. Corroborating destructive samples were analyzed by a cultivation-independent flow cytometry analysis and a selective plate count method to cultivate transconjugants. Increases in substrate loading altered biofilm 3-D architecture and subsequently affected the frequency of plasmid conjugation (decreases at least two times) in the absence of any antibiotic selective pressure. More importantly, donor populations in biofilms exposed to a sublethal dose of kanamycin exhibited enhanced transfer efficiency of plasmids containing the kanamycin resistance gene, up to tenfold. However, when stressed with a different antibiotic, imipenem, transfer of plasmids containing the kan(R+) gene was not enhanced. These preliminary results suggest biofilm bacteria "sense" antibiotics to which they are resistant, which enhances the spread of that resistance. Confocal scanning microscopy coupled with our non-invasive image analysis was able to estimate plasmid conjugative transfer efficiency either averaged over the entire biofilm landscape or locally with individual biofilm clusters.

  8. Toxin plasmids of Clostridium perfringens.

    PubMed

    Li, Jihong; Adams, Vicki; Bannam, Trudi L; Miyamoto, Kazuaki; Garcia, Jorge P; Uzal, Francisco A; Rood, Julian I; McClane, Bruce A

    2013-06-01

    In both humans and animals, Clostridium perfringens is an important cause of histotoxic infections and diseases originating in the intestines, such as enteritis and enterotoxemia. The virulence of this Gram-positive, anaerobic bacterium is heavily dependent upon its prolific toxin-producing ability. Many of the ∼16 toxins produced by C. perfringens are encoded by large plasmids that range in size from ∼45 kb to ∼140 kb. These plasmid-encoded toxins are often closely associated with mobile elements. A C. perfringens strain can carry up to three different toxin plasmids, with a single plasmid carrying up to three distinct toxin genes. Molecular Koch's postulate analyses have established the importance of several plasmid-encoded toxins when C. perfringens disease strains cause enteritis or enterotoxemias. Many toxin plasmids are closely related, suggesting a common evolutionary origin. In particular, most toxin plasmids and some antibiotic resistance plasmids of C. perfringens share an ∼35-kb region containing a Tn916-related conjugation locus named tcp (transfer of clostridial plasmids). This tcp locus can mediate highly efficient conjugative transfer of these toxin or resistance plasmids. For example, conjugative transfer of a toxin plasmid from an infecting strain to C. perfringens normal intestinal flora strains may help to amplify and prolong an infection. Therefore, the presence of toxin genes on conjugative plasmids, particularly in association with insertion sequences that may mobilize these toxin genes, likely provides C. perfringens with considerable virulence plasticity and adaptability when it causes diseases originating in the gastrointestinal tract.

  9. Synergy of Penicillin-Netilmicin Combinations Against Enterococci Including Strains Highly Resistant to Streptomycin or Kanamycin

    PubMed Central

    Sanders, Christine C.

    1977-01-01

    The in vitro activity of combinations of penicillin and netilimicin was determined against 20 clinical isolates of enterococci and compared with that obtained in simultaneous tests with penicillin/sisomicin, penicillin/streptomycin, and penicillin/kanamycin. Synergy between the two drugs in each combination was determined by the use of quantitative kill curves and was defined as a killing by the combination at least 100-fold greater than that produced by the most effective drug alone. Penicillin/netilmicin and penicillin/sisomicin combinations were found to be synergistic against the majority of isolates tested, including strains resistant to penicillin/streptomycin or penicillin/kanamycin combinations. This synergy with penicillin could be demonstrated at a concentration of ≤7 μg/ml for either netilmicin or sisomicin. Studies on the kinetics of killing produced by these combinations showed the rate and extent of killing to be directly dependent upon the organism's relative susceptibility to the aminoglycoside alone and the aminoglycoside concentration in the combination. Results also indicated that the interaction between penicillin and netilmicin was true synergy; i.e., rapid and complete killing was produced by combinations containing each drug at concentrations insufficient to produce any killing alone, and the killing observed could not be produced by either drug alone at a concentration equivalent to the total drug concentration in the combination. The potential clinical application of this synergistic interaction should be investigated further, especially in view of recent reports showing netilmicin to be considerably less toxic than gentamicin in experimental animals. PMID:242509

  10. Glutamate co-transmission from developing medial nucleus of the trapezoid body - Lateral superior olive synapses is cochlear dependent in kanamycin-treated rats

    SciTech Connect

    Lee, Jae Ho; Pradhan, Jonu; Maskey, Dhiraj; Park, Ki Sup; Hong, Sung Hwa; Suh, Myung-Whan; Kim, Myeung Ju; Ahn, Seung Cheol

    2011-02-11

    Research highlights: {yields} Glutamate co-transmission is enhanced in kanamycin-treated rats. {yields} VGLUT3 expression is increased in kanamycin-treated rats. {yields} GlyR expression is decreased in kanamycin-treated rats. {yields} GlyR, VGLUT3 expression patterns are asymmetric in unilaterally cochlear ablated rat. -- Abstract: Cochlear dependency of glutamate co-transmission at the medial nucleus of the trapezoid body (MNTB) - the lateral superior olive (LSO) synapses was investigated using developing rats treated with high dose kanamycin. Rats were treated with kanamycin from postnatal day (P) 3 to P8. A scanning electron microscopic study on P9 demonstrated partial cochlear hair cell damage. A whole cell voltage clamp experiment demonstrated the increased glutamatergic portion of postsynaptic currents (PSCs) elicited by MNTB stimulation in P9-P11 kanamycin-treated rats. The enhanced VGLUT3 immunoreactivities (IRs) in kanamycin-treated rats and asymmetric VGLUT3 IRs in the LSO of unilaterally cochlear ablated rats supported the electrophysiologic data. Taken together, it is concluded that glutamate co-transmission is cochlear-dependent and enhanced glutamate co-transmission in kanamycin-treated rats is induced by partial cochlear damage.

  11. Selective Conditions for a Multidrug Resistance Plasmid Depend on the Sociality of Antibiotic Resistance.

    PubMed

    Bottery, Michael J; Wood, A Jamie; Brockhurst, Michael A

    2016-04-01

    Multidrug resistance (MDR) plasmids frequently carry antibiotic resistance genes conferring qualitatively different mechanisms of resistance. We show here that the antibiotic concentrations selecting for the RK2 plasmid inEscherichia colidepend upon the sociality of the drug resistance: the selection for selfish drug resistance (efflux pump) occurred at very low drug concentrations, just 1.3% of the MIC of the plasmid-free antibiotic-sensitive strain, whereas selection for cooperative drug resistance (modifying enzyme) occurred at drug concentrations exceeding the MIC of the plasmid-free strain. PMID:26787694

  12. Selective Conditions for a Multidrug Resistance Plasmid Depend on the Sociality of Antibiotic Resistance

    PubMed Central

    Wood, A. Jamie; Brockhurst, Michael A.

    2016-01-01

    Multidrug resistance (MDR) plasmids frequently carry antibiotic resistance genes conferring qualitatively different mechanisms of resistance. We show here that the antibiotic concentrations selecting for the RK2 plasmid in Escherichia coli depend upon the sociality of the drug resistance: the selection for selfish drug resistance (efflux pump) occurred at very low drug concentrations, just 1.3% of the MIC of the plasmid-free antibiotic-sensitive strain, whereas selection for cooperative drug resistance (modifying enzyme) occurred at drug concentrations exceeding the MIC of the plasmid-free strain. PMID:26787694

  13. Narrow- and Broad-Host-Range Symbiotic Plasmids of Rhizobium spp. Strains That Nodulate Phaseolus vulgaris

    PubMed Central

    Brom, Susana; Martinez, Esperanza; Dávila, Guillermo; Palacios, Rafael

    1988-01-01

    Agrobacterium transconjugants containing symbiotic plasmids from different Rhizobium spp. strains that nodulate Phaseolus vulgaris were obtained. All transconjugants conserved the parental nodulation host range. Symbiotic (Sym) plasmids of Rhizobium strains isolated originally from P. vulgaris nodules, which had a broad nodulation host range, and single-copy nitrogenase genes conferred a Fix+ phenotype to the Agrobacterium transconjugants. A Fix− phenotype was obtained with Sym plasmids of strains isolated from P. vulgaris nodules that had a narrow host range and reiterated nif genes, as well as with Sym plasmids of strains isolated from other legumes that presented single nif genes and a broad nodulation host range. This indicates that different types of Sym plasmids can confer the ability to establish an effective symbiosis with P. vulgaris. Images PMID:16347637

  14. Characterization and Comparative Overview of Complete Sequences of the First Plasmids of Pandoraea across Clinical and Non-clinical Strains

    PubMed Central

    Yong, Delicia; Tee, Kok Keng; Yin, Wai-Fong; Chan, Kok-Gan

    2016-01-01

    To date, information on plasmid analysis in Pandoraea spp. is scarce. To address the gap of knowledge on this, the complete sequences of eight plasmids from Pandoraea spp. namely Pandoraea faecigallinarum DSM 23572T (pPF72-1, pPF72-2), Pandoraea oxalativorans DSM 23570T (pPO70-1, pPO70-2, pPO70-3, pPO70-4), Pandoraea vervacti NS15 (pPV15) and Pandoraea apista DSM 16535T (pPA35) were studied for the first time in this study. The information on plasmid sequences in Pandoraea spp. is useful as the sequences did not match any known plasmid sequence deposited in public databases. Replication genes were not identified in some plasmids, a situation that has led to the possibility of host interaction involvement. Some plasmids were also void of par genes and intriguingly, repA gene was also not discovered in these plasmids. This further leads to the hypothesis of host-plasmid interaction. Plasmid stabilization/stability protein-encoding genes were observed in some plasmids but were not established for participating in plasmid segregation. Toxin-antitoxin systems MazEF, VapBC, RelBE, YgiT-MqsR, HigBA, and ParDE were identified across the plasmids and their presence would improve plasmid maintenance. Conjugation genes were identified portraying the conjugation ability amongst Pandoraea plasmids. Additionally, we found a shared region amongst some of the plasmids that consists of conjugation genes. The identification of genes involved in replication, segregation, toxin-antitoxin systems and conjugation, would aid the design of drugs to prevent the survival or transmission of plasmids carrying pathogenic properties. Additionally, genes conferring virulence and antibiotic resistance were identified amongst the plasmids. The observed features in the plasmids shed light on the Pandoraea spp. as opportunistic pathogens. PMID:27790203

  15. Stable transformation of a mosquito cell line results in extraordinarily high copy numbers of the plasmid.

    PubMed Central

    Monroe, T J; Muhlmann-Diaz, M C; Kovach, M J; Carlson, J O; Bedford, J S; Beaty, B J

    1992-01-01

    Stable incorporation of high copy numbers (greater than 10,000 per cell) of a plasmid vector containing a gene conferring resistance to the antibiotic hygromycin was achieved in a cell line derived from the Aedes albopictus mosquito. Plasmid sequences were readily observed by ethidium bromide staining of cellular DNA after restriction endonuclease digestion and agarose gel electrophoresis. The plasmid was demonstrated by in situ hybridization to be present in large arrays integrated in metaphase chromosomes and in minute and double-minute replicating elements. In one subclone, approximately 60,000 copies of the plasmid were organized in a large array that resembles a chromosome, morphologically and in the segregation of its chromatids during anaphase. The original as well as modified versions of the plasmid were rescued by transformation of Escherichia coli using total cellular DNA. Southern blot analyses of recovered plasmids indicate the presence of mosquito-derived sequences. Images PMID:1631052

  16. Plasmid copy number noise in monoclonal populations of bacteria

    NASA Astrophysics Data System (ADS)

    Wong Ng, Jérôme; Chatenay, Didier; Robert, Jérôme; Poirier, Michael Guy

    2010-01-01

    Plasmids are extra chromosomal DNA that can confer to their hosts’ supplementary characteristics such as antibiotic resistance. Plasmids code for their copy number through their own replication frequency. Even though the biochemical networks underlying the plasmid copy number (PCN) regulation processes have been studied and modeled, no measurement of the heterogeneity in PCN within a whole population has been done. We have developed a fluorescent-based measurement system, which enables determination of the mean and noise in PCN within a monoclonal population of bacteria. Two different fluorescent protein reporters were inserted: one on the chromosome and the other on the plasmid. The fluorescence of these bacteria was measured with a microfluidic flow cytometry device. We show that our measurements are consistent with known plasmid characteristics. We find that the partitioning system lowers the PCN mean and standard deviation. Finally, bacterial populations were allowed to grow without selective pressure. In this case, we were able to determine the plasmid loss rate and growth inhibition effect.

  17. Partition locus-based classification of selected plasmids in Klebsiella pneumoniae, Escherichia coli and Salmonella enterica spp.: an additional tool.

    PubMed

    Bousquet, A; Henquet, S; Compain, F; Genel, N; Arlet, G; Decré, D

    2015-03-01

    The dissemination of antimicrobial resistance genes in Enterobacteriaceae has been largely attributed to plasmids, circular DNA molecules capable of autonomous replication. Whereas high-copy-number plasmids primarily rely on passive diffusion for plasmid maintenance, low-copy-number plasmids utilize so-called partition (par) systems. Plasmid partition relies on three structures, i.e. a centromere like DNA site, a centromere-binding protein and an ATPase or a GTPase motor protein for plasmid positioning. Identification and classification of plasmids is essential for tracing plasmids conferring drug resistance. PCR-based replicon typing is currently the standard method for plasmid identification but there are new classification schemes, especially the relaxase gene typing (PRaseT). Here we developed a multiplex PCR set targeting par loci found on the plasmids most frequently encountered in Enterobacteriaceae. This method, called "plasmid partition gene typing" (PAR-T), was validated with 136 transconjugants or transformants harboring various replicon types. The method was tested with 30 multidrug-resistant clinical isolates including Escherichia coli, Klebsiella pneumoniae and Salmonella enterica subsp. enterica carrying 1-4 replicons; all replicons were tested in parallel with PRaseT for comparison. Six multiplex PCRs and one simplex PCR including 18 pairs of primers recognized plasmids of groups IncA/C, FIA, FIB, FIC, FIIk, FII, HI1, HI2, I1, L/M, N, X. Our set of multiplex PCRs showed high specificity for the classification of resistance plasmids except for IncX replicons.

  18. A new plasmid-encoded proteic killer gene system: cloning, sequencing, and analyzing hig locus of plasmid Rts1.

    PubMed

    Tian, Q B; Ohnishi, M; Tabuchi, A; Terawaki, Y

    1996-03-18

    A new proteic killer gene system, hig, was identified on the plasmid Rts1. The hig locus consisting of a higA and higB is directly related to the temperature sensitive host cell growth conferred by Rts1. We proved that higB encoding presumably a 92-amino-acid polypeptide inhibited segregation of plasmid free cells, and higA encoding a 104-amino-acid polypeptide suppressed the higB function both in cis and in trans.

  19. Diverse broad-host-range plasmids from freshwater carry few accessory genes.

    PubMed

    Brown, Celeste J; Sen, Diya; Yano, Hirokazu; Bauer, Matthew L; Rogers, Linda M; Van der Auwera, Geraldine A; Top, Eva M

    2013-12-01

    Broad-host-range self-transferable plasmids are known to facilitate bacterial adaptation by spreading genes between phylogenetically distinct hosts. These plasmids typically have a conserved backbone region and a variable accessory region that encodes host-beneficial traits. We do not know, however, how well plasmids that do not encode accessory functions can survive in nature. The goal of this study was to characterize the backbone and accessory gene content of plasmids that were captured from freshwater sources without selecting for a particular phenotype or cultivating their host. To do this, triparental matings were used such that the only required phenotype was the plasmid's ability to mobilize a nonconjugative plasmid. Based on complete genome sequences of 10 plasmids, only 5 carried identifiable accessory gene regions, and none carried antibiotic resistance genes. The plasmids belong to four known incompatibility groups (IncN, IncP-1, IncU, and IncW) and two potentially new groups. Eight of the plasmids were shown to have a broad host range, being able to transfer into alpha-, beta-, and gammaproteobacteria. Because of the absence of antibiotic resistance genes, we resampled one of the sites and compared the proportion of captured plasmids that conferred antibiotic resistance to their hosts with the proportion of such plasmids captured from the effluent of a local wastewater treatment plant. Few of the captured plasmids from either site encoded antibiotic resistance. A high diversity of plasmids that encode no or unknown accessory functions is thus readily found in freshwater habitats. The question remains how the plasmids persist in these microbial communities.

  20. Piggery manure used for soil fertilization is a reservoir for transferable antibiotic resistance plasmids.

    PubMed

    Binh, Chu Thi Thanh; Heuer, Holger; Kaupenjohann, Martin; Smalla, Kornelia

    2008-10-01

    In this study, the prevalence and types of transferable antibiotic resistance plasmids in piggery manure were investigated. Samples from manure storage tanks of 15 farms in Germany were analysed, representing diverse sizes of herds, meat or piglet production. Antibiotic resistance plasmids from manure bacteria were captured in gfp-tagged rifampicin-resistant Escherichia coli and characterized. The occurrence of plasmid types was also detected in total community DNA by PCR and hybridization. A total of 228 transconjugants were captured from 15 manures using selective media supplemented with amoxicillin, sulfadiazine or tetracycline. The restriction patterns of 81 plasmids representing different antibiotic resistance patterns or different samples clustered into seven groups. Replicon probing revealed that 28 of the plasmids belonged to IncN, one to IncW, 13 to IncP-1 and 19 to the recently discovered pHHV216-like plasmids. The amoxicillin resistance gene bla-TEM was detected on 44 plasmids, and sulphonamide resistance genes sul1, sul2 and/or sul3 on 68 plasmids. Hybridization of replicon-specific sequences amplified from community DNA revealed that IncP-1 and pHHV216-like plasmids were detected in all manures, while IncN and IncW ones were less frequent. This study showed that 'field-scale' piggery manure is a reservoir of broad-host range plasmids conferring multiple antibiotic resistance genes. PMID:18557938

  1. Peaceful coexistence amongst Borrelia plasmids: getting by with a little help from their friends?

    PubMed

    Chaconas, George; Norris, Steven J

    2013-09-01

    Borrelia species comprise a unique genus of bacterial pathogens. These organisms contain a segmented genome with up to two dozen plasmids ranging in size from 5 kb up to about 200 kb. The plasmids have also been referred to as mini-chromosomes or essential genetic elements, as some of them carry information important for infection of vertebrates or for survival in the tick vector. Most of the plasmids are linear with covalently closed hairpin telomeres and these linear plasmids are in a constant state of genetic rearrangement. The mechanisms of plasmid replication, maintenance and partitioning remain largely obscure and are complicated by a long doubling time, the requirement for expensive media and inefficient genetic manipulation. A set of five parologous protein families (PFs) are believed to confer the ability for autonomous replication and plasmid maintenance. The number of plasmids also complicates analyses because of the possibility that PFs from one plasmid may sometimes function in trans on other plasmids. Two papers in the last year have moved the field forward and their combined data suggest that trans complementation amongst Borrelia plasmids may sometimes occur.

  2. The genetic basis of plasmid tropism between Chlamydia trachomatis and Chlamydia muridarum.

    PubMed

    Wang, Yibing; Cutcliffe, Lesley T; Skilton, Rachel J; Ramsey, Kyle H; Thomson, Nicholas R; Clarke, Ian N

    2014-10-01

    The development of genetic transformation technology for Chlamydia trachomatis using its endogenous plasmid has recently been described. Chlamydia muridarum cannot be transformed by the C. trachomatis plasmid, indicating a barrier between chlamydial species. To determine which regions of the plasmid conferred the species specificity, we used the novel approach of transforming wild-type C. muridarum carrying the endogenous plasmid pNigg and forced recombination with the C. trachomatis vector pGFP::SW2 which carries the complete C. trachomatis plasmid (pSW2). Penicillin and chloramphenicol-resistant transformants expressing the green fluorescent protein were selected. Recovery of plasmids from these transformants showed they were recombinants. The differences between the pSW2 and pNigg allowed identification of the recombination breakpoints and showed that pGFP::SW2 had exchanged a ~ 1 kbp region with pNigg covering CDS 2. The recombinant plasmid (pSW2NiggCDS2) is maintained under antibiotic selection when transformed into plasmid-cured C. muridarum. The ability to select for recombinants in C. muridarum shows that the barrier is not at transformation, but at the level of plasmid replication or maintenance. Our studies show that CDS 2, together with adjoining sequences, is the main determinant of plasmid tropism. PMID:24700815

  3. The genetic basis of plasmid tropism between Chlamydia trachomatis and Chlamydia muridarum

    PubMed Central

    Wang, Yibing; Cutcliffe, Lesley T; Skilton, Rachel J; Ramsey, Kyle H; Thomson, Nicholas R; Clarke, Ian N

    2014-01-01

    The development of genetic transformation technology for Chlamydia trachomatis using its endogenous plasmid has recently been described. Chlamydia muridarum cannot be transformed by the C. trachomatis plasmid, indicating a barrier between chlamydial species. To determine which regions of the plasmid conferred the species specificity, we used the novel approach of transforming wild-type C. muridarum carrying the endogenous plasmid pNigg and forced recombination with the C. trachomatis vector pGFP::SW2 which carries the complete C. trachomatis plasmid (pSW2). Penicillin and chloramphenicol-resistant transformants expressing the green fluorescent protein were selected. Recovery of plasmids from these transformants showed they were recombinants. The differences between the pSW2 and pNigg allowed identification of the recombination breakpoints and showed that pGFP::SW2 had exchanged a ∼ 1 kbp region with pNigg covering CDS 2. The recombinant plasmid (pSW2NiggCDS2) is maintained under antibiotic selection when transformed into plasmid-cured C. muridarum. The ability to select for recombinants in C. muridarum shows that the barrier is not at transformation, but at the level of plasmid replication or maintenance. Our studies show that CDS 2, together with adjoining sequences, is the main determinant of plasmid tropism. PMID:24700815

  4. Toxin Plasmids of Clostridium perfringens

    PubMed Central

    Li, Jihong; Adams, Vicki; Bannam, Trudi L.; Miyamoto, Kazuaki; Garcia, Jorge P.; Uzal, Francisco A.; Rood, Julian I.

    2013-01-01

    SUMMARY In both humans and animals, Clostridium perfringens is an important cause of histotoxic infections and diseases originating in the intestines, such as enteritis and enterotoxemia. The virulence of this Gram-positive, anaerobic bacterium is heavily dependent upon its prolific toxin-producing ability. Many of the ∼16 toxins produced by C. perfringens are encoded by large plasmids that range in size from ∼45 kb to ∼140 kb. These plasmid-encoded toxins are often closely associated with mobile elements. A C. perfringens strain can carry up to three different toxin plasmids, with a single plasmid carrying up to three distinct toxin genes. Molecular Koch's postulate analyses have established the importance of several plasmid-encoded toxins when C. perfringens disease strains cause enteritis or enterotoxemias. Many toxin plasmids are closely related, suggesting a common evolutionary origin. In particular, most toxin plasmids and some antibiotic resistance plasmids of C. perfringens share an ∼35-kb region containing a Tn916-related conjugation locus named tcp (transfer of clostridial plasmids). This tcp locus can mediate highly efficient conjugative transfer of these toxin or resistance plasmids. For example, conjugative transfer of a toxin plasmid from an infecting strain to C. perfringens normal intestinal flora strains may help to amplify and prolong an infection. Therefore, the presence of toxin genes on conjugative plasmids, particularly in association with insertion sequences that may mobilize these toxin genes, likely provides C. perfringens with considerable virulence plasticity and adaptability when it causes diseases originating in the gastrointestinal tract. PMID:23699255

  5. IncM Plasmid R1215 Is the Source of Chromosomally Located Regions Containing Multiple Antibiotic Resistance Genes in the Globally Disseminated Acinetobacter baumannii GC1 and GC2 Clones

    PubMed Central

    Blackwell, Grace A.

    2016-01-01

    ABSTRACT Clear similarities between antibiotic resistance islands in the chromosomes of extensively antibiotic-resistant isolates from the two dominant, globally distributed Acinetobacter baumannii clones, GC1 and GC2, suggest a common origin. A close relative of the likely progenitor of both of these regions was found in R1215, a conjugative IncM plasmid from a Serratia marcescens strain isolated prior to 1980. The 37.8-kb resistance region in R1215 lies within the mucB gene and includes aacC1, aadA1, aphA1b, blaTEM, catA1, sul1, and tetA(A), genes that confer resistance to gentamicin, streptomycin and spectinomycin, kanamycin and neomycin, ampicillin, chloramphenicol, sulfamethoxazole, and tetracycline, respectively. The backbone of this region is derived from Tn1721 and is interrupted by a hybrid Tn2670 (Tn21)-Tn1696-type transposon, Tn6020, and an incomplete Tn1. After minor rearrangements, this R1215 resistance island can generate AbGRI2-0*, the predicted earliest form of the IS26-bounded AbGRI2-type resistance island of GC2 isolates, and to the multiple antibiotic resistance region (MARR) of AbaR0, the precursor of this region in AbaR-type resistance islands in the GC1 group. A 29.9-kb circle excised by IS26 has been inserted into the A. baumannii chromosome to generate AbGRI2-0*. To create the MARR of AbaR0, a different circular form, again generated by IS26 from an R1215 resistance region variant, has been opened at a different point by recombination with a copy of the sul1 gene already present in the AbaR precursor. Recent IncM plasmids related to R1215 have a variant resistance island containing a blaSHV gene in the same location. IMPORTANCE Two lineages of extensively antibiotic-resistant A. baumannii currently plaguing modern medicine each acquired resistance to all of the original antibiotics (ampicillin, tetracycline, kanamycin, and sulfonamides) by the end of the 1970s and then became resistant to antibiotics from newer families after they were

  6. Systemic lipopolysaccharide induces cochlear inflammation and exacerbates the synergistic ototoxicity of kanamycin and furosemide.

    PubMed

    Hirose, Keiko; Li, Song-Zhe; Ohlemiller, Kevin K; Ransohoff, Richard M

    2014-08-01

    Aminoglycoside antibiotics are highly effective agents against gram-negative bacterial infections, but they cause adverse effects on hearing and balance dysfunction as a result of toxicity to hair cells of the cochlea and vestibular organs. While ototoxicity has been comprehensively studied, the contributions of the immune system, which controls the host response to infection, have not been studied in antibiotic ototoxicity. Recently, it has been shown that an inflammatory response is induced by hair cell injury. In this study, we found that lipopolysaccharide (LPS), an important component of bacterial endotoxin, when given in combination with kanamycin and furosemide, augmented the inflammatory response to hair cell injury and exacerbated hearing loss and hair cell injury. LPS injected into the peritoneum of experimental mice induced a brisk cochlear inflammatory response with recruitment of mononuclear phagocytes into the spiral ligament, even in the absence of ototoxic agents. While LPS alone did not affect hearing, animals that received LPS prior to ototoxic agents had worse hearing loss compared to those that did not receive LPS pretreatment. The poorer hearing outcome in LPS-treated mice did not correlate to changes in endocochlear potential. However, LPS-treated mice demonstrated an increased number of CCR2(+) inflammatory monocytes in the inner ear when compared with mice treated with ototoxic agents alone. We conclude that LPS and its associated inflammatory response are harmful to the inner ear when coupled with ototoxic medications and that the immune system may contribute to the final hearing outcome in subjects treated with ototoxic agents.

  7. M. tuberculosis ferritin (Rv3841): Potential involvement in Amikacin (AK) & Kanamycin (KM) resistance.

    PubMed

    Sharma, Divakar; Lata, Manju; Faheem, Mohammad; Khan, Asad Ullah; Joshi, Beenu; Venkatesan, Krishnamurthy; Shukla, Sangeeta; Bisht, Deepa

    2016-09-16

    Tuberculosis is an infectious disease, caused by one of the most successful human pathogen, Mycobacterium tuberculosis. Aminoglycosides, Amikacin (AK) & Kanamycin (KM) are commonly used to treat drug resistant tuberculosis. They target the protein synthesis machinery by interacting with several steps of translation. Several explanations have been proposed to explain the mechanism of aminoglycoside resistance but still our information is inadequate. Iron storing/interacting proteins were found to be overexpressed in aminoglycosides resistant isolates. Iron assimilation and utilization in M. tuberculosis plays a crucial role in growth, virulence and latency. To establish the relationship of ferritin with AK & KM resistance ferritin (Rv3841/bfrB) was cloned, expressed and antimicrobial drug susceptibility testing (DST) was carried out. Rv3841/bfrB gene was cloned and expressed in E. coli BL21 using pQE2 expression vector. Etest results for DST against AK & KM showed that the minimum inhibitory concentration (MIC) of ferritin recombinant cells was changed. Recombinants showed two fold changes in MIC with AK and three fold with KM E-strips. Overexpression of ferritin reflect the MIC shift which might be playing a critical role in the survival of mycobacteria by inhibiting/modulating the effects of AK & KM. String analysis also suggests that ferritin interacted with few proteins which are directly and indirectly involved in M. tuberculosis growth, Iron assimilation, virulence, resistance, stresses and latency. PMID:27521892

  8. The Effect of Kanamycin and Tetracycline on Growth and Photosynthetic Activity of Two Chlorophyte Algae

    PubMed Central

    2016-01-01

    Antibiotics are routinely used in microalgae culture screening, stock culture maintenance, and genetic transformation. By studying the effect of antibiotics on microalgae growth, we can estimate the least value to inhibit growth of undesired pathogens in algal culture. We studied the effect of kanamycin and tetracycline on the growth and photosynthetic activity of two chlorophyte microalgae, Dictyosphaerium pulchellum and Micractinium pusillum. We measured CFU mL−1 on agar plates, optical density, fluorescence yields, and photosynthetic inhibition. Our results showed a significant effect of kan and tet on the tested microalgae species except tet, which showed a minor effect on M. pusillum. Both antibiotics are believed to interact with the protein synthesis machinery; hence, the inhibitory effect of the tested antibiotics was further confirmed by isolation and quantification of the whole cell protein. A significant reduction in protein quantity was observed at concentrations more than 5 mg L−1, except M. pusillum, which showed only a slight reduction in protein quantity even at the maximum tested concentration of tet (30 mg L−1). This study can further aid in aquaculture industry, for the maintenance of the microalgae stock cultures and it can also help the microalgae genetic engineers in the construction of molecular markers. PMID:27747232

  9. Amplification of the entire kanamycin biosynthetic gene cluster during empirical strain improvement of Streptomyces kanamyceticus.

    PubMed

    Yanai, Koji; Murakami, Takeshi; Bibb, Mervyn

    2006-06-20

    Streptomyces kanamyceticus 12-6 is a derivative of the wild-type strain developed for industrial kanamycin (Km) production. Southern analysis and DNA sequencing revealed amplification of a large genomic segment including the entire Km biosynthetic gene cluster in the chromosome of strain 12-6. At 145 kb, the amplifiable unit of DNA (AUD) is the largest AUD reported in Streptomyces. Striking repetitive DNA sequences belonging to the clustered regularly interspaced short palindromic repeats family were found in the AUD and may play a role in its amplification. Strain 12-6 contains a mixture of different chromosomes with varying numbers of AUDs, sometimes exceeding 36 copies and producing an amplified region >5.7 Mb. The level of Km production depended on the copy number of the Km biosynthetic gene cluster, suggesting that DNA amplification occurred during strain improvement as a consequence of selection for increased Km resistance. Amplification of DNA segments including entire antibiotic biosynthetic gene clusters might be a common mechanism leading to increased antibiotic production in industrial strains.

  10. Characterization of a plasmid-specified pathway for catabolism of isopropylbenzene in Pseudomonas putida RE204.

    PubMed Central

    Eaton, R W; Timmis, K N

    1986-01-01

    A Pseudomonas putida strain designated RE204, able to utilize isopropylbenzene as the sole carbon and energy source, was isolated. Tn5 transposon mutagenesis by means of the suicide transposon donor plasmid pLG221 yielded mutant derivatives defective in isopropylbenzene metabolism. These were characterized by the identification of the products which they accumulated when grown in the presence of isopropylbenzene and by the assay of enzyme activities in cell extracts. Based on the results obtained, the following metabolic pathway is proposed: isopropylbenzene----2,3-dihydro -2,3-dihydroxyisopropylbenzene----3-isopropylcatechol----2 -hydroxy-6-oxo-7-methylocta-2,4-dienoate----isobutyrate + 2-oxopent-4-enoate----amphibolic intermediates. Plasmid DNA was isolated from strain RE204 and mutant derivatives and characterized by restriction enzyme cleavage analysis. Isopropylbenzene-negative isolates carried a Tn5 insert within a 15-kilobase region of a 105-kilobase plasmid designated pRE4. DNA fragments of pRE4 carrying genes encoding isopropylbenzene catabolic enzymes were cloned in Escherichia coli with various plasmid vectors; clones were identified by (i) selection for Tn5-encoded kanamycin resistance in the case of Tn5 mutant plasmids, (ii) screening for isopropylbenzene dioxygenase-catalyzed oxidation of indole to indigo, and (iii) use of a Tn5-carrying restriction fragment, derived from a pRE4::Tn5 mutant plasmid, as a probe for clones carrying wild-type restriction fragments. These clones were subsequently used to generate a transposon insertion and restriction enzyme cleavage map of the isopropylbenzene metabolic region of pRE4. Images PMID:3019995

  11. Curing vector for IncI1 plasmids and its use to provide evidence for a metabolic burden of IncI1 CTX-M-1 plasmid pIFM3791 on Klebsiella pneumoniae.

    PubMed

    Freire Martín, Irene; Thomas, Christopher M; Laing, Emma; AbuOun, Manal; La Ragione, Roberto M; Woodward, Martin J

    2016-07-01

    Using a sequence-based approach we previously identified an IncI1 CTX-M-1 plasmid, pIFM3791, on a single pig farm in the UK that was harboured by Klebsiella pneumoniae, Escherichia coli and Salmonella enterica serotype 4,5,12:i:-. To test the hypothesis that the plasmid had spread rapidly into these differing host bacteria we wished to assess whether the plasmid conferred a fitness advantage. To do this an IncI1 curing vector was constructed and used to displace the IncI1 CTX-M-1 plasmids from K. pneumoniae strain B3791 and several other unrelated IncI1-harbouring strains indicating the potential wider application of the curing vector. The IncI1 CTX-M-1 plasmid was reintroduced by conjugation into the cured K. pneumoniae strain and also a naturally IncI1 plasmid free S. enterica serotype 4,5,12:i:-, S348/11. Original, cured and complemented strains were tested for metabolic competence using Biolog technology and in competitive growth, association to mammalian cells and biofilm formation experiments. The plasmid-cured K. pneumoniae strain grew more rapidly than either the original plasmid-carrying strain or plasmid-complemented strains in competition experiments. Additionally, the plasmid-cured strain was significantly better at respiring with l-sorbose as a carbon source and putrescine, γ-amino-n-butyric acid, l-alanine and l-proline as nitrogen sources. By contrast, no differences in phenotype were found when comparing plasmid-harbouring and plasmid-free S. enterica S348/11. In conclusion, the IncI1 curing vector successfully displaced multiple IncI plasmids. The IncI1 CTX-M1 plasmid conferred a growth disadvantage upon K. pneumoniae, possibly by imposing a metabolic burden, the mechanism of which remains to be determined. PMID:27166141

  12. Curing vector for IncI1 plasmids and its use to provide evidence for a metabolic burden of IncI1 CTX-M-1 plasmid pIFM3791 on Klebsiella pneumoniae.

    PubMed

    Freire Martín, Irene; Thomas, Christopher M; Laing, Emma; AbuOun, Manal; La Ragione, Roberto M; Woodward, Martin J

    2016-07-01

    Using a sequence-based approach we previously identified an IncI1 CTX-M-1 plasmid, pIFM3791, on a single pig farm in the UK that was harboured by Klebsiella pneumoniae, Escherichia coli and Salmonella enterica serotype 4,5,12:i:-. To test the hypothesis that the plasmid had spread rapidly into these differing host bacteria we wished to assess whether the plasmid conferred a fitness advantage. To do this an IncI1 curing vector was constructed and used to displace the IncI1 CTX-M-1 plasmids from K. pneumoniae strain B3791 and several other unrelated IncI1-harbouring strains indicating the potential wider application of the curing vector. The IncI1 CTX-M-1 plasmid was reintroduced by conjugation into the cured K. pneumoniae strain and also a naturally IncI1 plasmid free S. enterica serotype 4,5,12:i:-, S348/11. Original, cured and complemented strains were tested for metabolic competence using Biolog technology and in competitive growth, association to mammalian cells and biofilm formation experiments. The plasmid-cured K. pneumoniae strain grew more rapidly than either the original plasmid-carrying strain or plasmid-complemented strains in competition experiments. Additionally, the plasmid-cured strain was significantly better at respiring with l-sorbose as a carbon source and putrescine, γ-amino-n-butyric acid, l-alanine and l-proline as nitrogen sources. By contrast, no differences in phenotype were found when comparing plasmid-harbouring and plasmid-free S. enterica S348/11. In conclusion, the IncI1 curing vector successfully displaced multiple IncI plasmids. The IncI1 CTX-M1 plasmid conferred a growth disadvantage upon K. pneumoniae, possibly by imposing a metabolic burden, the mechanism of which remains to be determined.

  13. Phenotypic plasticity in bacterial plasmids.

    PubMed Central

    Turner, Paul E

    2004-01-01

    Plasmid pB15 was previously shown to evolve increased horizontal (infectious) transfer at the expense of reduced vertical (intergenerational) transfer and vice versa, a key trade-off assumed in theories of parasite virulence. Whereas the models predict that susceptible host abundance should determine which mode of transfer is selectively favored, host density failed to mediate the trade-off in pB15. One possibility is that the plasmid's transfer deviates from the assumption that horizontal spread (conjugation) occurs in direct proportion to cell density. I tested this hypothesis using Escherichia coli/pB15 associations in laboratory serial culture. Contrary to most models of plasmid transfer kinetics, my data show that pB15 invades static (nonshaking) bacterial cultures only at intermediate densities. The results can be explained by phenotypic plasticity in traits governing plasmid transfer. As cells become more numerous, the plasmid's conjugative transfer unexpectedly declines, while the trade-off between transmission routes causes vertical transfer to increase. Thus, at intermediate densities the plasmid's horizontal transfer can offset selection against plasmid-bearing cells, but at high densities pB15 conjugates so poorly that it cannot invade. I discuss adaptive vs. nonadaptive causes for the phenotypic plasticity, as well as potential mechanisms that may lead to complex transfer dynamics of plasmids in liquid environments. PMID:15166133

  14. Plasmid acquisition in microgravity

    NASA Technical Reports Server (NTRS)

    Juergensmeyer, Margaret A.; Juergensmeyer, Elizabeth A.; Guikema, James A.

    1995-01-01

    In microgravity, bacteria often show an increased resistance to antibiotics. Bacteria can develop resistance to an antibiotic after transformation, the acquisition of DNA, usually in the form of a plasmid containing a gene for resistance to one or more antibiotics. In order to study the capacity of bacteria to become resistant to antibiotics in microgravity, we have modified the standard protocol for transformation of Escherichia coli for use in the NASA-flight-certified hardware package, The Fluid Processing Apparatus (FPA). Here we report on the ability of E. coli to remain competent for long periods of time at temperatures that are readily available on the Space Shuttle, and present some preliminary flight results.

  15. Plasmid mapping computer program.

    PubMed

    Nolan, G P; Maina, C V; Szalay, A A

    1984-01-11

    Three new computer algorithms are described which rapidly order the restriction fragments of a plasmid DNA which has been cleaved with two restriction endonucleases in single and double digestions. Two of the algorithms are contained within a single computer program (called MPCIRC). The Rule-Oriented algorithm, constructs all logical circular map solutions within sixty seconds (14 double-digestion fragments) when used in conjunction with the Permutation method. The program is written in Apple Pascal and runs on an Apple II Plus Microcomputer with 64K of memory. A third algorithm is described which rapidly maps double digests and uses the above two algorithms as adducts. Modifications of the algorithms for linear mapping are also presented. PMID:6320105

  16. A plasmid in Streptococcus pneumoniae.

    PubMed Central

    Smith, M D; Guild, W R

    1979-01-01

    Plasmid deoxyribonucleic acid has been detected in three related laboratory strains of Streptococcus pneumoniae. Strains D39S, R36, and R36NC each contain a minimum of two copies per cell of a 2.0-megadalton plasmid (pDP1). A plasmid twice as large as this smaller one is also present in much lower quantity in these strains, but neither plasmid is present in four strains related to these or in a drug-resistant clinical isolate from Paris. The plasmid yield was not amplified in the presence of chloramphenicol. No phenotype has been correlated with the presence of pDP1, which has existed in strains carried for many years in laboratory collections. Images PMID:33961

  17. Characterization of ESBL disseminating plasmids.

    PubMed

    Brolund, Alma; Sandegren, Linus

    2016-01-01

    Bacteria producing extended-spectrum β-lactamases (ESBLs) constitute a globally increasing problem that contributes to treatment complications and elevated death rates. The extremely successful dissemination by ESBL-producing Enterobacteriaceae during the latest decades is a result of the combination of mobilization, evolution and horizontal spread of β-lactamase genes on plasmids. In parallel, spread of these plasmids to particularly well-adapted bacterial clones (outbreak clones) has expanded. In this review we describe ESBL-producing bacteria and the genetic mechanisms for dissemination of ESBL resistance. We describe available methodology for studying plasmids and the importance of including plasmids in epidemiological typing as natural parts of the organisms. Plasmids play a fundamental role in how resistance arises and disseminates.

  18. A Site-Specific Integrative Plasmid Found in Pseudomonas aeruginosa Clinical Isolate HS87 along with A Plasmid Carrying an Aminoglycoside-Resistant Gene

    PubMed Central

    Tai, Cui; Jiang, Xiaofei; Zhang, Jie; Harrison, Ewan M.; Jia, Shiru; Deng, Zixin; Rajakumar, Kumar; Ou, Hong-Yu

    2016-01-01

    Plasmids play critical roles in bacterial fitness and evolution of Pseudomonas aeruginosa. Here two plasmids found in a drug-resistant P. aeruginosa clinical isolate HS87 were completely sequenced. The pHS87b plasmid (11.2 kb) carries phage-related genes and function-unknown genes. Notably, pHS87b encodes an integrase and has an adjacent tRNAThr-associated attachment site. A corresponding integrated form of pHS87b at the tRNAThr locus was identified on the chromosome of P. aeruginosa, showing that pHS87b is able to site-specifically integrate into the 3’-end of the tRNAThr gene. The pHS87a plasmid (26.8 kb) displays a plastic structure containing a putative replication module, stability factors and a variable region. The RepA of pHS87a shows significant similarity to the replication proteins of pPT23A-family plasmids. pHS87a carries a transposon Tn6049, a truncated insertion sequence ΔIS1071 and a Tn402-like class 1 integron which contains an aacA4 cassette that may confer aminoglycoside resistance. Thus, pHS87b is a site-specific integrative plasmid whereas pHS87a is a plastic antibiotic resistance plasmid. The two native plasmids may promote the fitness and evolution of P. aeruginosa. PMID:26841043

  19. Selection of a multidrug resistance plasmid by sublethal levels of antibiotics and heavy metals.

    PubMed

    Gullberg, Erik; Albrecht, Lisa M; Karlsson, Christoffer; Sandegren, Linus; Andersson, Dan I

    2014-01-01

    How sublethal levels of antibiotics and heavy metals select for clinically important multidrug resistance plasmids is largely unknown. Carriage of plasmids generally confers substantial fitness costs, implying that for the plasmid-carrying bacteria to be maintained in the population, the plasmid cost needs to be balanced by a selective pressure conferred by, for example, antibiotics or heavy metals. We studied the effects of low levels of antibiotics and heavy metals on the selective maintenance of a 220-kbp extended-spectrum β-lactamase (ESBL) plasmid identified in a hospital outbreak of Klebsiella pneumoniae and Escherichia coli. The concentrations of antibiotics and heavy metals required to maintain plasmid-carrying bacteria, the minimal selective concentrations (MSCs), were in all cases below (almost up to 140-fold) the MIC of the plasmid-free susceptible bacteria. This finding indicates that the very low antibiotic and heavy metal levels found in polluted environments and in treated humans and animals might be sufficiently high to maintain multiresistance plasmids. When resistance genes were moved from the plasmid to the chromosome, the MSC decreased, showing that MSC for a specific resistance conditionally depends on genetic context. This finding suggests that a cost-free resistance could be maintained in a population by an infinitesimally low concentration of antibiotic. By studying the effect of combinations of several compounds, it was observed that for certain combinations of drugs each new compound added lowered the minimal selective concentration of the others. This combination effect could be a significant factor in the selection of multidrug resistance plasmids/bacterial clones in complex multidrug environments. Importance: Antibiotic resistance is in many pathogenic bacteria caused by genes that are carried on large conjugative plasmids. These plasmids typically contain multiple antibiotic resistance genes as well as genes that confer resistance to

  20. Mobilization functions of the bacteriocinogenic plasmid pRJ6 of Staphylococcus aureus.

    PubMed

    Varella Coelho, Marcus Livio; Ceotto, Hilana; Madureira, Danielle Jannuzzi; Nes, Ingolf F; Bastos, Maria do Carmo de Freire

    2009-06-01

    Plasmid pRJ6 is the first known bacteriocinogenic mobilizable (Mob) plasmid of Staphylococcus aureus. Its Mob region is composed of four mob genes (mobCDAB) arranged as an operon, a genetic organization uncommon among S. aureus Mob plasmids. oriT (pRJ6) was detected in a region of 431 bp, positioned immediately upstream of mobC. This region, when cloned into pCN37, was able to confer mobilization to the re-combinant plasmid only in the presence of pRJ6. The entire Mob region, including oriT (pRJ6), is much more similar to Mob regions from several coagulase-negative staphylococci plasmids, although some remarkable similarities with S. aureus Mob plasmids can also be noted. These similarities include the presence within oriT (pRJ6) of the three mcb (MobC binding sites), firstly described in pC221 and pC223, an identical nick site also found in these same plasmids, and a nearly identical sra(pC223) site (sequence recognized by MobA). pRJ6 was successfully transferred to S. epidermidis by conjugation in the presence of the conjugative plasmid pGOl. Altogether these findings suggest that pRJ6 might have been originally a coagulase-negative staphylococci plasmid that had been transferred successfully to S. aureus. PMID:19557350

  1. Comparative study on the antibiotic susceptibility and plasmid profiles of Vibrio alginolyticus strains isolated from four Tunisian marine biotopes.

    PubMed

    Lajnef, Rim; Snoussi, Mejdi; Romalde, Jesús López; Nozha, Cohen; Hassen, Abdennaceur

    2012-12-01

    The antibiotic resistance patterns and the plasmids profiles of the predominant etiological agent responsible for vibriosis in Tunisia, V. alginolyticus were studied to contribute to control their spread in some Mediterranean aquaculture farms and seawater. The sixty-nine V. alginolyticus strains isolated from different marine Tunisian biotopes (bathing waters, aquaculture and conchylicole farms and a river connected to the seawater during the cold seasons) were multi-drug resistant with high resistance rate to ampicillin, kanamycin, doxycyclin, erythromycin, imipinem, and nalidixic acid. The multiple resistance index ranged from 0.3 to 0.7 for the isolates of Khenis, from 0.5 to 0.8 for those of Menzel Jmil, from 0.5 to 0.75 (Hergla) and from 0.3 to 0.7 for the isolates of Oued Soltane. The high value of antibiotic resistance index was recorded for the V. alginolyticus population isolated from the fish farm in Hergla (ARI = 0.672) followed by the population isolated from the conchylicole station of Menzel Jmil (ARI = 0.645). The results obtained by the MIC tests confirmed the resistance of the V. alginolyticus to ampicillin, erythromycin, kanamycin, cefotaxime, streptomycin and trimethoprim. Plasmids were found in 79.48 % of the strains analyzed and 30 different plasmid profiles were observed. The strains had a high difference in the size of plasmids varying between 0.5 and 45 kb. Our study reveals that the antibiotic-resistant bacteria are widespread in the aquaculture and conchylicole farm relatively to others strains isolated from seawater. PMID:22918722

  2. Role of plasmids in Lactobacillus brevis BSO 464 hop tolerance and beer spoilage.

    PubMed

    Bergsveinson, Jordyn; Baecker, Nina; Pittet, Vanessa; Ziola, Barry

    2015-02-01

    Specific isolates of lactic acid bacteria (LAB) can grow in the harsh beer environment, thus posing a threat to brew quality and the economic success of breweries worldwide. Plasmid-localized genes, such as horA, horC, and hitA, have been suggested to confer hop tolerance, a trait required for LAB survival in beer. The presence and expression of these genes among LAB, however, do not universally correlate with the ability to grow in beer. Genome sequencing of the virulent beer spoilage organism Lactobacillus brevis BSO 464 revealed the presence of eight plasmids, with plasmids 1, 2, and 3 containing horA, horC, and hitA, respectively. To investigate the roles that these and the other five plasmids play in L. brevis BSO 464 growth in beer, plasmid curing with novobiocin was used to derive 10 plasmid variants. Multiplex PCRs were utilized to determine the presence or absence of each plasmid, and how plasmid loss affected hop tolerance and growth in degassed (noncarbonated) beer was assessed. Loss of three of the eight plasmids was found to affect hop tolerance and growth in beer. Loss of plasmid 2 (horC and 28 other genes) had the most dramatic effect, with loss of plasmid 4 (120 genes) and plasmid 8 (47 genes) having significant, but smaller, impacts. These results support the contention that genes on mobile genetic elements are essential for bacterial growth in beer and that beer spoilage ability is not dependent solely on the three previously described hop tolerance genes or on the chromosome of a beer spoilage LAB isolate.

  3. Role of Plasmids in Lactobacillus brevis BSO 464 Hop Tolerance and Beer Spoilage

    PubMed Central

    Bergsveinson, Jordyn; Baecker, Nina; Pittet, Vanessa

    2014-01-01

    Specific isolates of lactic acid bacteria (LAB) can grow in the harsh beer environment, thus posing a threat to brew quality and the economic success of breweries worldwide. Plasmid-localized genes, such as horA, horC, and hitA, have been suggested to confer hop tolerance, a trait required for LAB survival in beer. The presence and expression of these genes among LAB, however, do not universally correlate with the ability to grow in beer. Genome sequencing of the virulent beer spoilage organism Lactobacillus brevis BSO 464 revealed the presence of eight plasmids, with plasmids 1, 2, and 3 containing horA, horC, and hitA, respectively. To investigate the roles that these and the other five plasmids play in L. brevis BSO 464 growth in beer, plasmid curing with novobiocin was used to derive 10 plasmid variants. Multiplex PCRs were utilized to determine the presence or absence of each plasmid, and how plasmid loss affected hop tolerance and growth in degassed (noncarbonated) beer was assessed. Loss of three of the eight plasmids was found to affect hop tolerance and growth in beer. Loss of plasmid 2 (horC and 28 other genes) had the most dramatic effect, with loss of plasmid 4 (120 genes) and plasmid 8 (47 genes) having significant, but smaller, impacts. These results support the contention that genes on mobile genetic elements are essential for bacterial growth in beer and that beer spoilage ability is not dependent solely on the three previously described hop tolerance genes or on the chromosome of a beer spoilage LAB isolate. PMID:25501474

  4. Role of plasmids in Lactobacillus brevis BSO 464 hop tolerance and beer spoilage.

    PubMed

    Bergsveinson, Jordyn; Baecker, Nina; Pittet, Vanessa; Ziola, Barry

    2015-02-01

    Specific isolates of lactic acid bacteria (LAB) can grow in the harsh beer environment, thus posing a threat to brew quality and the economic success of breweries worldwide. Plasmid-localized genes, such as horA, horC, and hitA, have been suggested to confer hop tolerance, a trait required for LAB survival in beer. The presence and expression of these genes among LAB, however, do not universally correlate with the ability to grow in beer. Genome sequencing of the virulent beer spoilage organism Lactobacillus brevis BSO 464 revealed the presence of eight plasmids, with plasmids 1, 2, and 3 containing horA, horC, and hitA, respectively. To investigate the roles that these and the other five plasmids play in L. brevis BSO 464 growth in beer, plasmid curing with novobiocin was used to derive 10 plasmid variants. Multiplex PCRs were utilized to determine the presence or absence of each plasmid, and how plasmid loss affected hop tolerance and growth in degassed (noncarbonated) beer was assessed. Loss of three of the eight plasmids was found to affect hop tolerance and growth in beer. Loss of plasmid 2 (horC and 28 other genes) had the most dramatic effect, with loss of plasmid 4 (120 genes) and plasmid 8 (47 genes) having significant, but smaller, impacts. These results support the contention that genes on mobile genetic elements are essential for bacterial growth in beer and that beer spoilage ability is not dependent solely on the three previously described hop tolerance genes or on the chromosome of a beer spoilage LAB isolate. PMID:25501474

  5. Selection of a Multidrug Resistance Plasmid by Sublethal Levels of Antibiotics and Heavy Metals

    PubMed Central

    Gullberg, Erik; Albrecht, Lisa M.; Karlsson, Christoffer; Sandegren, Linus

    2014-01-01

    ABSTRACT How sublethal levels of antibiotics and heavy metals select for clinically important multidrug resistance plasmids is largely unknown. Carriage of plasmids generally confers substantial fitness costs, implying that for the plasmid-carrying bacteria to be maintained in the population, the plasmid cost needs to be balanced by a selective pressure conferred by, for example, antibiotics or heavy metals. We studied the effects of low levels of antibiotics and heavy metals on the selective maintenance of a 220-kbp extended-spectrum β-lactamase (ESBL) plasmid identified in a hospital outbreak of Klebsiella pneumoniae and Escherichia coli. The concentrations of antibiotics and heavy metals required to maintain plasmid-carrying bacteria, the minimal selective concentrations (MSCs), were in all cases below (almost up to 140-fold) the MIC of the plasmid-free susceptible bacteria. This finding indicates that the very low antibiotic and heavy metal levels found in polluted environments and in treated humans and animals might be sufficiently high to maintain multiresistance plasmids. When resistance genes were moved from the plasmid to the chromosome, the MSC decreased, showing that MSC for a specific resistance conditionally depends on genetic context. This finding suggests that a cost-free resistance could be maintained in a population by an infinitesimally low concentration of antibiotic. By studying the effect of combinations of several compounds, it was observed that for certain combinations of drugs each new compound added lowered the minimal selective concentration of the others. This combination effect could be a significant factor in the selection of multidrug resistance plasmids/bacterial clones in complex multidrug environments. PMID:25293762

  6. pA506, a conjugative plasmid of the plant epiphyte Pseudomonas fluorescens A506.

    PubMed

    Stockwell, Virginia O; Davis, Edward W; Carey, Alyssa; Shaffer, Brenda T; Mavrodi, Dmitri V; Hassan, Karl A; Hockett, Kevin; Thomashow, Linda S; Paulsen, Ian T; Loper, Joyce E

    2013-09-01

    Conjugative plasmids are known to facilitate the acquisition and dispersal of genes contributing to the fitness of Pseudomonas spp. Here, we report the characterization of pA506, the 57-kb conjugative plasmid of Pseudomonas fluorescens A506, a plant epiphyte used in the United States for the biological control of fire blight disease of pear and apple. Twenty-nine of the 67 open reading frames (ORFs) of pA506 have putative functions in conjugation, including a type IV secretion system related to that of MOBP6 family plasmids and a gene cluster for type IV pili. We demonstrate that pA506 is self-transmissible via conjugation between A506 and strains of Pseudomonas spp. or the Enterobacteriaceae. The origin of vegetative replication (oriV) of pA506 is typical of those in pPT23A family plasmids, which are present in many pathovars of Pseudomonas syringae, but pA506 lacks repA, a defining locus for pPT23A plasmids, and has a novel partitioning region. We selected a plasmid-cured derivative of A506 and compared it to the wild type to identify plasmid-encoded phenotypes. pA506 conferred UV resistance, presumably due to the plasmid-borne rulAB genes, but did not influence epiphytic fitness of A506 on pear or apple blossoms in the field. pA506 does not appear to confer resistance to antibiotics or other toxic elements. Based on the conjugative nature of pA506 and the large number of its genes that are shared with plasmids from diverse groups of environmental bacteria, the plasmid is likely to serve as a vehicle for genetic exchange between A506 and its coinhabitants on plant surfaces.

  7. Partial Characterization of R-Plasmids from Pasteurella multocida Isolated from Turkeys

    PubMed Central

    Berman, Stephen M.; Hirsh, Dwight C.

    1978-01-01

    Pasteurella multocida, isolated from turkeys during an outbreak of septicemic disease (“fowl cholera”), was found to be resistant to tetracycline, streptomycin, and sulfonamides. Agarose gel electrophoretic analysis of DNA from these isolates indicated the presence of extrachromosomal elements. Plasmid DNA was isolated by cesium chloride-ethidium bromide density centrifugation. Escherichia coli was transformed to antimicrobic resistance with this DNA. Two plasmids were isolated. One of these plasmids had a buoyant density of 1.7158 g/cm3 (56.9 mol% guanine plus cytosine) and a molecular weight of 4.4 × 106 and conferred resistance to tetracycline, streptomycin, and sulfonamides. The other, having a buoyant density of 1.7198 g/cm3 (61 mol% guanine plus cytosine) and a molecular weight of 3.44 × 106, conferred resistance to streptomycin and sulfonamides. Streptomycin resistance was mediated by streptomycin phosphotransferase. Compatibility group testing indicated that neither plasmid belonged to any of 13 compatibility groups (of conjugal plasmids). Both plasmids were also found to be compatible with three small, nonconjugative resistance plasmids. Images PMID:708012

  8. Plasmid incidence, antibiotic and metal resistance among enterobacteriaceae isolated from Algerian streams.

    PubMed

    Habi, S; Daba, H

    2009-11-15

    Enterobacteriaceae isolates from surface water were examined to assess impact of feacal and/or metal pollution on heavy metal, antibiotics resistance and plasmid incidence. A bi-modal CMI distribution was noted for cadmium and mercury. On the other hand, modal distribution was observed for Pb. Critical metal concentration were >8, >32, > or =4096 microg mL(-1) for mercury, cadmium and lead, respectively. High resistance to Pb and low resistance to Cd were remarked in stream water polluted with heavy metal. Resistance to antibiotics was most frequent to erythromycin (45.45-68.8%), tetracyclin family (14-61.11%), streptomycin (16-24%) and furan (8.16-24.1%). Bacterial resistance to some antibiotics (kanamycin, tetracyclin, doxycyclin, furan and chloramphenicol) was significantly different (p < 0.05) between streams water. Analysis of antibiotic resistance by principal component analysis showed a clear difference between fresh water and urban waste water for two principal components (1, 2) and the difference between principal component scores of antibiotic could not be related to the faecal pollution level. No difference was found between stream water subjected or not to contamination from metallic or poultry waste. The frequency of strains carrying plasmids was higher in urban waste water than metal and/or low faecal polluted stream water. No correlation was observed between plasmid and metal resistance. PMID:20180322

  9. Plasmid-mediated quinolone resistance

    PubMed Central

    Jacoby, George A.; Strahilevitz, Jacob; Hooper, David C.

    2014-01-01

    Summary Three mechanisms for plasmid-mediated quinolone resistance (PMQR) have been discovered since 1998. Plasmid genes qnrA, qnrB, qnrC, qnrD, qnrS, and qnrVC code for proteins of the pentapeptide repeat family that protects DNA gyrase and topoisomerase IV from quinolone inhibition. The qnr genes appear to have been acquired from chromosomal genes in aquatic bacteria, are usually associated with mobilizing or transposable elements on plasmids, and are often incorporated into sul1-type integrons. The second plasmid-mediated mechanism involves acetylation of quinolones with an appropriate amino nitrogen target by a variant of the common aminoglycoside acetyltransferase AAC(6′)-Ib. The third mechanism is enhanced efflux produced by plasmid genes for pumps QepAB and OqxAB. PMQR has been found in clinical and environmental isolates around the world and appears to be spreading. The plasmid-mediated mechanisms provide only low-level resistance that by itself does not exceed the clinical breakpoint for susceptibility but nonetheless facilitates selection of higher-level resistance and makes infection by pathogens containing PMQR harder to treat. PMID:25584197

  10. A rational proposal for plasmid nomenclature.

    PubMed

    Campos, P; Martín Luengo, F

    1989-09-01

    We propose a more rational system for nomenclature of wild plasmids of bacteria. With this proposal for nomenclature of bacterial plasmids, it is established in an unambiguous way: 1) if a plasmid is wild or derivative, and 2) in which species and bacterial strain it was found (in the case of wild plasmids).

  11. Characterization and comparative analysis of antibiotic resistance plasmids isolated from a wastewater treatment plant

    PubMed Central

    Rahube, Teddie O.; Viana, Laia S.; Koraimann, Günther; Yost, Christopher K.

    2014-01-01

    A wastewater treatment plant (WWTP) is an environment high in nutrient concentration with diverse bacterial populations and can provide an ideal environment for the proliferation of mobile elements such as plasmids. WWTPs have also been identified as reservoirs for antibiotic resistance genes that are associated with human pathogens. The objectives of this study were to isolate and characterize self-transmissible or mobilizable resistance plasmids associated with effluent from WWTP. An enrichment culture approach designed to capture plasmids conferring resistance to high concentrations of erythromycin was used to capture plasmids from an urban WWTP servicing a population of ca. 210,000. DNA sequencing of the plasmids revealed diversity of plasmids represented by incompatibility groups IncU, col-E, IncFII and IncP-1β. Genes coding resistance to clinically relevant antibiotics (macrolide, tetracycline, beta-lactam, trimethoprim, chloramphenicol, sulphonamide), quaternary ammonium compounds and heavy metals were co-located on these plasmids, often within transposable and integrative mobile elements. Several of the plasmids were self-transmissible or mobilizable and could be maintained in the absence of antibiotic selection. The IncFII plasmid pEFC36a showed the highest degree of sequence identity to plasmid R1 which has been isolated in England more than 50 years ago from a patient suffering from a Salmonella infection. Functional conservation of key regulatory features of this F-like conjugation module were demonstrated by the finding that the conjugation frequency of pEFC36a could be stimulated by the positive regulator of plasmid R1 DNA transfer genes, TraJ. PMID:25389419

  12. Dual Targeting of Intracellular Pathogenic Bacteria with a Cleavable Conjugate of Kanamycin and an Antibacterial Cell-Penetrating Peptide.

    PubMed

    Brezden, Anna; Mohamed, Mohamed F; Nepal, Manish; Harwood, John S; Kuriakose, Jerrin; Seleem, Mohamed N; Chmielewski, Jean

    2016-08-31

    Bacterial infection caused by intracellular pathogens, such as Mycobacterium, Salmonella, and Brucella, is a burgeoning global health epidemic that necessitates urgent action. However, the therapeutic value of a number of antibiotics, including aminoglycosides, against intracellular pathogenic bacteria is compromised due to their inability to traverse eukaryotic membranes. For this significant problem to be addressed, a cleavable conjugate of the antibiotic kanamycin and a nonmembrane lytic, broad-spectrum antimicrobial peptide with efficient mammalian cell penetration, P14LRR, was prepared. This approach allows kanamycin to enter mammalian cells as a conjugate linked via a tether that breaks down in the reducing environment within cells. Potent antimicrobial activity of the P14KanS conjugate was demonstrated in vitro, and this reducible conjugate effectively cleared intracellular pathogenic bacteria within macrophages more potently than that of a conjugate lacking the disulfide moiety. Notably, successful clearance of Mycobacterium tuberculosis within macrophages was observed with the dual antibiotic conjugate, and Salmonella levels were significantly reduced in an in vivo Caenorhabditis elegans model.

  13. Processing of Nonconjugative Resistance Plasmids by Conjugation Nicking Enzyme of Staphylococci

    PubMed Central

    Pollet, Rebecca M.; Ingle, James D.; Hymes, Jeff P.; Eakes, Thomas C.; Eto, Karina Yui; Kwong, Stephen M.; Ramsay, Joshua P.; Firth, Neville

    2016-01-01

    ABSTRACT Antimicrobial resistance in Staphylococcus aureus presents an increasing threat to human health. This resistance is often encoded on mobile plasmids, such as pSK41; however, the mechanism of transfer of these plasmids is not well understood. In this study, we first examine key protein-DNA interactions formed by the relaxase enzyme, NES, which initiates and terminates the transfer of the multidrug resistance plasmid pSK41. Two loops on the NES protein, hairpin loops 1 and 2, form extensive contacts with the DNA hairpin formed at the oriT region of pSK41, and here we establish that these contacts are essential for proper DNA cleavage and religation by the full 665-residue NES protein in vitro. Second, pSK156 and pCA347 are nonconjugative Staphylococcus aureus plasmids that contain sequences similar to the oriT region of pSK41 but differ in the sequence predicted to form a DNA hairpin. We show that pSK41-encoded NES is able to bind, cleave, and religate the oriT sequences of these nonconjugative plasmids in vitro. Although pSK41 could mobilize a coresident plasmid harboring its cognate oriT, it was unable to mobilize plasmids containing the pSK156 and pCA347 variant oriT mimics, suggesting that an accessory protein like that previously shown to confer specificity in the pWBG749 system may also be involved in transmission of plasmids containing a pSK41-like oriT. These data indicate that the conjugative relaxase in trans mechanism recently described for the pWBG749 family of plasmids also applies to the pSK41 family of plasmids, further heightening the potential significance of this mechanism in the horizontal transfer of staphylococcal plasmids. IMPORTANCE Understanding the mechanism of antimicrobial resistance transfer in bacteria such as Staphylococcus aureus is an important step toward potentially slowing the spread of antimicrobial-resistant infections. This work establishes protein-DNA interactions essential for the transfer of the Staphylococcus aureus

  14. Construction of small plasmid vectors for use in genetic improvement of the extremely acidophilic Acidithiobacillus caldus.

    PubMed

    Meng, Jianzhou; Wang, Huiyan; Liu, Xiangmei; Lin, Jianqun; Pang, Xin; Lin, Jianqiang

    2013-10-01

    The genetic improvement of biomining bacteria including Acidithiobacillus caldus could facilitate the bioleaching process of sulfur-containing minerals. However, the available vectors for use in A. caldus are very scanty and limited to relatively large broad-host-range IncQ plasmids. In this study, a set of small, mobilizable plasmid vectors (pBBR1MCS-6, pMSD1 and pMSD2) were constructed based on plasmid pBBR1MCS-2, which does not belong to the IncQ, IncW, or IncP groups. The function of the tac promoter on 5.8-kb pMSD2 was determined by inserting a kanamycin-resistant reporter gene. The resulting recombinant pMSD2-Km was successfully transferred by conjugation into A. caldus MTH-04 with transfer frequency of 1.38±0.64×10(-5). The stability and plasmid copy number of pMSD2-Km in A. caldus MTH-04 were 75±2.7% and 5-6 copies per cell, respectively. By inserting an arsABC operon into pMSD2, an arsenic-resistant recombinant pMSD2-As was constructed and transferred into A. caldus MTH-04 by conjugation. The arsenic tolerance of A. caldus MTH-04 containing pMSD2-As was obviously increased up to 45mM of NaAsO2. These vectors could be applied in genetic improvement of A. caldus as well as other bioleaching bacteria.

  15. Effect of Mutations on the Binding of Kanamycin-B to RNA Hairpins Derived from the Mycobacterium tuberculosis Ribosomal A-Site.

    PubMed

    Truitt, Amber R; Choi, Bok-Eum; Li, Jenny; Soto, Ana Maria

    2015-12-29

    Kanamycin is an aminoglycoside antibiotic used in the treatment of drug-resistant tuberculosis. Mutations at the rRNA A-site have been associated with kanamycin resistance in Mycobacterium tuberculosis clinical isolates. Understanding the effect of these mutations on the conformation of the M. tuberculosis A-site is critical for understanding the mechanisms of antibiotic resistance in M. tuberculosis. In this work, we have studied RNA hairpins derived from the M. tuberculosis A-site, the wild type and three mutants at the following positions (M. tuberculosis/Escherichia coli numbering): A1400/1408 → G, C1401/1409 → U, and the double mutant G1483/1491 C1401/1409 → UA. Specifically, we used circular dichroism, ultraviolet spectroscopy, and fluorescence spectroscopy to characterize the conformation, stability, and binding affinity of kanamycin-B and other aminoglycoside antibiotics for these RNA hairpins. Our results show that the mutations affect the conformation of the decoding site, with the mutations at position 1401/1409 resulting in significant destabilizations. Interestingly, the mutants bind paromomycin with weaker affinity than the wild type, but they bind kanamycin-B with similar affinity than the wild type. The results suggest that the presence of mutations does not prevent kanamycin-B from binding. Instead, kanamycin may promote different interactions with a third partner in the mutants compared to the wild type. Furthermore, our results with longer and shorter hairpins suggest that the region of the A-site that varies among organisms may have modulating effects on the binding and interactions of the A-site. PMID:26560864

  16. Apramycin resistance plasmids in Escherichia coli: possible transfer to Salmonella typhimurium in calves.

    PubMed Central

    Hunter, J. E.; Shelley, J. C.; Walton, J. R.; Hart, C. A.; Bennett, M.

    1992-01-01

    An outbreak of salmonellosis in calves was monitored for persistence of Salmonella typhimurium excretion in faeces and the effect of treatment with apramycin. Prior to treatment apramycin-resistant Escherichia coli were present but all S. typhimurium isolates were sensitive. Following the treatment of six calves with apramycin, apramycin-resistant S. typhimurium were isolated from two treated calves and one untreated calf. Plasmid profiles of E. coli and S. typhimurium were compared and plasmids conferring resistance to apramycin and several other antibiotics were transferred by conjugation in vitro from calf E. coli and S. typhimurium isolates to E. coli K-12 and from E. coli to S. typhimurium. The plasmids conjugated with high frequency in vitro from E. coli to S. typhimurium, and hybridized to a DNA probe specific for the gene encoding aminoglycoside acetyltransferase 3-IV (AAC(3)-IV) which confers resistance to apramycin, gentamicin, netilmicin and tobramycin. Images Fig. 1 PMID:1582469

  17. Xylella fastidiosa plasmid-encoded PemK toxin is an endoribonuclease.

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Stable inheritance of pXF-RIV11 in Xylella fastidiosa is conferred by the pemI/pemK plasmid addiction system. PemK serves as a toxin inhibiting bacterial growth; PemI is the corresponding antitoxin that blocks activity of PemK toxin by direct binding. PemK toxin and PemI antitoxin were over-expre...

  18. 35S Promoter Methylation in Kanamycin-Resistant Kalanchoe (Kalanchoe pinnata L.) Plants Expressing the Antimicrobial Peptide Cecropin P1 Transgene.

    PubMed

    Shevchuk, T V; Zakharchenko, N S; Tarlachkov, S V; Furs, O V; Dyachenko, O V; Buryanov, Y I

    2016-09-01

    Transgenic kalanchoe plants (Kalanchoe pinnata L.) expressing the antimicrobial peptide cecropin P1 gene (cecP1) under the control of the 35S cauliflower mosaic virus 35S RNA promoter and the selective neomycin phosphotransferase II (nptII) gene under the control of the nopaline synthase gene promoter were studied. The 35S promoter methylation and the cecropin P1 biosynthesis levels were compared in plants growing on media with and without kanamycin. The low level of active 35S promoter methylation further decreases upon cultivation on kanamycin-containing medium, while cecropin P1 synthesis increases. PMID:27682168

  19. Phage type conversion in Salmonella enterica serotype Enteritidis caused by the introduction of a resistance plasmid of incompatibility group X (IncX).

    PubMed Central

    Brown, D. J.; Baggesen, D. L.; Platt, D. J.; Olsen, J. E.

    1999-01-01

    The plasmid pOG670, a 54 kb, conjugative plasmid that specifies resistance to ampicillin and kanamycin and belonging to the incompatibility group X (IncX), was transferred into 10 isolates of Salmonella enterica serotype Enteritidis belonging to 10 different phage types (PT1, 2, 3, 4, 8, 9, 9b, 10, 11 and 13). Acquisition of the plasmid by these strains did not result in the loss of any resident plasmids but resulted in phage type conversion in 8 of the 10 strains (PT1, 2, 4, 8, 9, 9b, 10 and 11). The observed changes in phage type were found to result from the loss of sensitivity to 3 of the 10 typing phages used (phages 3, 5 and 7). Where the conversion resulted in a change to a defined phage type, both the new and original PTs belonged to the same, previously described, evolutionary lines. Enteritidis PTs 1, 4 and 8, commonly associated with poultry world-wide, were converted to PTs 21, 6 and 13a respectively. The results indicate a different route for phage type conversion Enteritidis from others reported in the literature and, although IncX plasmids are not normally present in PT8 or PT13a, may suggest a possible mechanism/link connecting these phage types. PMID:10098781

  20. Entire sequence of the colonization factor coli surface antigen 6-encoding plasmid pCss165 from an enterotoxigenic Escherichia coli clinical isolate.

    PubMed

    Wajima, Takeaki; Sabui, Subrata; Kano, Shigeyuki; Ramamurthy, Thandavarayan; Chatterjee, Nabendu Sekhar; Hamabata, Takashi

    2013-11-01

    Coli surface antigen 6 (CS6) is one of the most prevalent colonization factors among enterotoxigenic Escherichia coli (ETEC) isolated in developing countries. Although it is known that CS6 is encoded by a plasmid, there are no reports on the sequence analysis of the CS6-encoding plasmid or genes exhibiting similar behavior to CS6. Here, we report the isolation of the CS6-encoding plasmid, pCss165Kan, from 4266 ΔcssB::kanamycin (Km) and its complete nucleotide sequence. This plasmid consisted of 165,311bp and 222 predicted coding sequences. Remarkably, there were many insertion sequence (IS) elements, which comprised 24.4% of the entire sequence. Virulence-associated genes such as heat-stable enterotoxin, homologues of ATP-binding cassette transporter in enteroaggregative E. coli (EAEC), and ETEC autotransporter A were also present, although the ETEC autotransporter A gene was disrupted by the integration of IS629. We found that 2 transcriptional regulators belonging to the AraC family were not involved in CS6 expression. Interestingly, pCss165 had conjugative transfer genes, as well as 3 toxin-antitoxin systems that potentially exclude other plasmid-free host bacteria. These genes might be involved in the prevalence of CS6 among ETEC isolates. PMID:23933356

  1. Genomic and Functional Characterization of qnr-Encoding Plasmids from Municipal Wastewater Biosolid Klebsiella pneumoniae Isolates

    PubMed Central

    Kaplan, Ella; Sela, Noa; Doron-Faigenboim, Adi; Navon-Venezia, Shiri; Jurkevitch, Edouard; Cytryn, Eddie

    2015-01-01

    Municipal wastewater treatment facilities are considered to be “hotspots” for antibiotic resistance, since they conjoin high densities of environmental and fecal bacteria with selective pressure in the form of sub-therapeutic concentrations of antibiotics. Discharged effluents and biosolids from these facilities can disseminate antibiotic resistant genes to terrestrial and aquatic environments, potentially contributing to the increasing global trend in antibiotic resistance. This phenomenon is especially pertinent when resistance genes are associated with mobile genetic elements such as conjugative plasmids, which can be transferred between bacterial phyla. Fluoroquinolones are among the most abundant antibiotic compounds detected in wastewater treatment facilities, especially in biosolids, where due to their hydrophobic properties they accumulate to concentrations that may exceed 40 mg/L. Although fluoroquinolone resistance is traditionally associated with mutations in the gyrA/topoisomerase IV genes, there is increasing evidence of plasmid-mediated quinolone resistance, which is primarily encoded on qnr genes. In this study, we sequenced seven qnr-harboring plasmids from a diverse collection of Klebsiella strains, isolated from dewatered biosolids from a large wastewater treatment facility in Israel. One of the plasmids, termed pKPSH-11XL was a large (185.4 kbp), multi-drug resistance, IncF-type plasmid that harbored qnrB and 10 additional antibiotic resistance genes that conferred resistance to five different antibiotic families. It was highly similar to the pKPN3-like plasmid family that has been detected in multidrug resistant clinical Klebsiella isolates. In contrast, the six additional plasmids were much smaller (7–9 Kbp) and harbored a qnrS -type gene. These plasmids were highly similar to each other and closely resembled pGNB2, a plasmid isolated from a German wastewater treatment facility. Comparative genome analyses of pKPSH-11XL and other pKPN3

  2. Genomic and Functional Characterization of qnr-Encoding Plasmids from Municipal Wastewater Biosolid Klebsiella pneumoniae Isolates.

    PubMed

    Kaplan, Ella; Sela, Noa; Doron-Faigenboim, Adi; Navon-Venezia, Shiri; Jurkevitch, Edouard; Cytryn, Eddie

    2015-01-01

    Municipal wastewater treatment facilities are considered to be "hotspots" for antibiotic resistance, since they conjoin high densities of environmental and fecal bacteria with selective pressure in the form of sub-therapeutic concentrations of antibiotics. Discharged effluents and biosolids from these facilities can disseminate antibiotic resistant genes to terrestrial and aquatic environments, potentially contributing to the increasing global trend in antibiotic resistance. This phenomenon is especially pertinent when resistance genes are associated with mobile genetic elements such as conjugative plasmids, which can be transferred between bacterial phyla. Fluoroquinolones are among the most abundant antibiotic compounds detected in wastewater treatment facilities, especially in biosolids, where due to their hydrophobic properties they accumulate to concentrations that may exceed 40 mg/L. Although fluoroquinolone resistance is traditionally associated with mutations in the gyrA/topoisomerase IV genes, there is increasing evidence of plasmid-mediated quinolone resistance, which is primarily encoded on qnr genes. In this study, we sequenced seven qnr-harboring plasmids from a diverse collection of Klebsiella strains, isolated from dewatered biosolids from a large wastewater treatment facility in Israel. One of the plasmids, termed pKPSH-11XL was a large (185.4 kbp), multi-drug resistance, IncF-type plasmid that harbored qnrB and 10 additional antibiotic resistance genes that conferred resistance to five different antibiotic families. It was highly similar to the pKPN3-like plasmid family that has been detected in multidrug resistant clinical Klebsiella isolates. In contrast, the six additional plasmids were much smaller (7-9 Kbp) and harbored a qnrS -type gene. These plasmids were highly similar to each other and closely resembled pGNB2, a plasmid isolated from a German wastewater treatment facility. Comparative genome analyses of pKPSH-11XL and other pKPN3-like

  3. Auditory thresholds and kanamycin-induced hearing loss in the guinea pig assessed by a positive reinforcement procedure.

    PubMed

    Prosen, C A; Petersen, M R; Moody, D B; Stebbins, W C

    1978-02-01

    Absolute thresholds from 125 Hz to 52 kHz are determined for six guinea pigs trained by a positive reinforcement method. Four to five hundred trials were conducted during daily testing sessions and little between- or within-subject variability was found. Two of the six animals were subsequently treated with kanamycin and the development of a hearing loss for the high frequencies was followed. Loss of outer and to a lesser extent inner hair cells was well correlated with the threshold shift observed. Contrary to the experience of previous investigators, this operant training procedure has proved as efficient as that for other species of experimental animals, such as the monkey and the chinchilla. It holds excellent promise for future auditory behavioral work with the guinea pig.

  4. Characterization of the transition-state structure of the reaction of kanamycin nucleotidyltransferase by heavy-atom kinetic isotope effects.

    PubMed

    Gerratana, B; Frey, P A; Cleland, W W

    2001-03-01

    The transition-state structure for the reaction catalyzed by kanamycin nucleotidyltransferase has been determined from kinetic isotope effects. The primary (18)O isotope effects at pH 5.7 (close to the optimum pH) and at pH 7.7 (away from the optimum pH) are respectively 1.016 +/- 0.003 and 1.014 +/- 0.002. Secondary (18)O isotope effects of 1.0033 +/- 0.0004 and 1.0024 +/- 0.0002 for both nonbridge oxygen atoms were measured respectively at pH 5.7 and 7.7. These isotope effects are consistent with a concerted reaction with a slightly associative transition-state structure.

  5. Prevalence and significance of plasmid maintenance functions in the virulence plasmids of pathogenic bacteria.

    PubMed

    Sengupta, Manjistha; Austin, Stuart

    2011-07-01

    Virulence functions of pathogenic bacteria are often encoded on large extrachromosomal plasmids. These plasmids are maintained at low copy number to reduce the metabolic burden on their host. Low-copy-number plasmids risk loss during cell division. This is countered by plasmid-encoded systems that ensure that each cell receives at least one plasmid copy. Plasmid replication and recombination can produce plasmid multimers that hinder plasmid segregation. These are removed by multimer resolution systems. Equitable distribution of the resulting monomers to daughter cells is ensured by plasmid partition systems that actively segregate plasmid copies to daughter cells in a process akin to mitosis in higher organisms. Any plasmid-free cells that still arise due to occasional failures of replication, multimer resolution, or partition are eliminated by plasmid-encoded postsegregational killing systems. Here we argue that all of these three systems are essential for the stable maintenance of large low-copy-number plasmids. Thus, they should be found on all large virulence plasmids. Where available, well-annotated sequences of virulence plasmids confirm this. Indeed, virulence plasmids often appear to contain more than one example conforming to each of the three system classes. Since these systems are essential for virulence, they can be regarded as ubiquitous virulence factors. As such, they should be informative in the search for new antibacterial agents and drug targets.

  6. Building mosaics of therapeutic plasmid gene vectors.

    PubMed

    Tolmachov, Oleg E

    2011-12-01

    Plasmids are circular or linear DNA molecules propagated extra-chromosomally in bacteria. Evolution shaped plasmids are inherently mosaic structures with individual functional units represented by distinct segments in the plasmid genome. The patchwork of plasmid genetic modules is a convenient template and a model for the generation of artificial plasmids used as vehicles for gene delivery into human cells. Plasmid gene vectors are an important tool in gene therapy and in basic biomedical research, where these vectors offer efficient transgene expression in many settings in vitro and in vivo. Plasmid vectors can be attached to nuclear directing ligands or transferred by electroporation as naked DNA to deliver the payload genes to the nuclei of the target cells. Transgene expression silencing by plasmid sequences of bacterial origin and immune stimulation by bacterial unmethylated CpG motifs can be avoided by the generation of plasmid-based minimized DNA vectors, such as minicircles. Systems of efficient site-specific integration into human chromosomes and stable episomal maintenance in human cells are being developed for further reduction of the chances for transgene silencing. The successful generation of plasmid vectors is governed by a number of vector design rules, some of which are common to all gene vectors, while others are specific to plasmid vectors. This review is focused both on the guiding principles and on the technical know-how of plasmid gene vector design. PMID:22023476

  7. Coincident plasmids and antimicrobial resistance in marine bacteria isolated from polluted and unpolluted Atlantic Ocean Samples

    SciTech Connect

    Baya, A.M.; Brayton, P.R.; Brown, V.L.; Grimes, D.J.; Russek-Cohen, E.; Colwell, R.R.

    1986-06-01

    Sewage effluent and outfall confluence samples were collected at the Barceloneta Regional Treatment Plant in Barceloneta, Puerto Rico; outfall confluence samples at Ocean City, Md., were also collected. Samples from uncontaminated open ocean areas served as clean-water controls. Bacteria were enriched in marine broth 2216 amended with 1 ..mu..g of one of a set of chemical selected for study per ml: nitrobenzene, dibutyl phthalate, m-cresol, o-cresol, 4-nitroaniline, bis(tributyltin) oxide, and quinone. MICs of the chemicals were determined individually for all isolates. Bacterial isolates were evaluated for resistance to nine different antibiotics and for the presence of plasmid DNA. Treated sewage was found to contain large numbers of bacteria simultaneously possessing antibiotic resistance, chemical resistance, and multiple bands of plasmic DNA. Bacteria resistant to penicillin, erythromycin, nalidixic acid, ampicillin, m-cresol, quinone, and bis(tributyltin) oxide were detected in nearly all samples, but only sewage outfall confluence samples yielded bacterial isolates that were resistant to streptomycin. Bacteria resistant to a combination of antibiotics, including kanamycin, chloramphenicol, gentamicin, and tetracycline, were isolated only from sewage effluent samples. It is concluded that bacterial isolates derived from toxic chemical wastes more frequently contain plasmid DNA and demonstrate antimicrobial resistance than do bacterial isolates from domestic sewage-impacted waters or from uncontaminated open ocean sites.

  8. Antimicrobial Resistance and Plasmid Profile of Bacterial Strains Isolated from the Urbanized Eltsovka-1 River (Russia).

    PubMed

    Lobova, Tatiana I; Yemelyanova, Elena; Andreeva, Irina S; Puchkova, Larisa I; Repin, Vladimir Ye

    2015-08-01

    Antimicrobial resistance and plasmid profile of Gram-positive and Gram-negative bacterial strains isolated from the urbanized Eltsovka-1 River (Russia) were investigated. Sequencing of the 16S rRNA of of G+ strains showed 99-100% identity to that of Bacillus aerophilus, Bacillus altitudinis, Bacillus amyloliquefaciens, Bacillus anthrancis, Bacillus barbaricus, Bacillus cereus, Bacillus flexus, Bacillus indriensis, Bacillus stratosphericus, Bacillus subtilis subsp. subtilis, Bacillus thuringiensis, Streptomyces albidoflavus, Streptomyces albus, Streptomyces exfoliatus, Streptomyces odorifer, and Streptomyces sampsonii. Sequencing of the 16S rRNA of G-strains was similar in 99-100% to that of Aeromonas bestiarum, Aeromonas encheleia, Aeromonas hydrophila, A. hydrophila subsp. anaerogenes, A. hydrophila subsp. dhakensis, Aeromonas media, Aeromonas molluscorum, Aeromonas popoffii, Aeromonas salmonicida subsp. masoucida, A. salmonicida subsp. pectinolytica, A. salmonicida subsp. salmonicida, Aeromonas punctata, Aeromonas sobria, and Shewanella putrefaciens. The highest percentage (88.4%) of strains was resistant to polymyxin B followed by 69% to lincomycin, 61.5% to benzilpenicillin, 57.7% to ampicillin, and 50% to carbenicillin. A low level of resistance (4%) was found to kanamycin (8%), to streptomycin (11.5%), to neomycin and tetracycline, and (15%) to erythromycin. No resistance was found to gentamycin, monomycin, and chloroamphenicol. The majority (80.7%) of strains was multidrug-resistant. Ninety-two percent of all strains carried plasmid DNA of various sizes.

  9. Evolution of IncHI1 plasmids: two distinct lineages.

    PubMed

    Cain, Amy K; Hall, Ruth M

    2013-09-01

    The IncHI1 plasmid pSRC27-H from Salmonella enterica serovar Typhimurium carries a region containing several genes that confer resistance to different antibiotics, and this resistance region is in the same position as related resistance regions in a group of sequenced IncHI1 plasmids from various sources that includes pHCM1. Four further additional segments are found in pHCM1 relative to another IncHI1 plasmid, R27. Using PCR or DNA sequencing to detect the presence or absence of each of these additional segments in the same position in the IncHI1 backbone, plasmid pSRC27-H was found to include them. However, in one case the additional segment was smaller in pSRC27-H, lacking a transposon carrying a second resistance region in pHCM1. The sequences of IncHI1 plasmids, pO111_1 and pMAK1, were also examined and found to share the same or closely related additional segments. The structure of the additional material in pHCM1, pO111_1 and pMAK1 was examined, and potential novel transposons were identified. These additional segments define an IncHI1 lineage (pHCM1, pO111_1, pMAK1, pSRC27-H) which we designated type 2 to distinguish it from type 1 (R27, pAKU_1, pP-stx-12). A segment from the Escherichia coli genome and an adjacent copy of IS1 in pHCM1 was defined by comparison to pO111_1 and pMAK1, which lack it. pSRC27-H also lacks it. This structure is present in the same position in R27 and type 1 plasmids, but in the opposite orientation, and appears to have been incorporated via IS1-mediated transposition. The PCRs developed provide a simple means of distinguishing type 1 and type 2 IncHI1 plasmids based on the presence or absence of variable regions.

  10. Outer membrane proteomics of kanamycin-resistant Escherichia coli identified MipA as a novel antibiotic resistance-related protein.

    PubMed

    Li, Hui; Zhang, Dan-feng; Lin, Xiang-min; Peng, Xuan-xian

    2015-06-01

    Antibiotic-resistant bacteria are a great threat to human health and food safety and there is an urgent need to understand the mechanisms of resistance for combating these bacteria. In the current study, comparative proteomic methodologies were applied to identify Escherichia coli K-12 outer membrane (OM) proteins related to kanamycin resistance. Mass spectrometry and western blotting results revealed that OM proteins TolC, Tsx and OstA were up-regulated, whereas MipA, OmpA, FadL and OmpW were down-regulated in kanamycin-resistant E. coli K-12 strain. Genetic deletion of tolC (ΔtolC-Km) led to a 2-fold decrease in the minimum inhibitory concentration (MIC) of kanamycin and deletion of mipA (ΔmipA-Km) resulted in a 4-fold increase in the MIC of kanamycin. Changes in the MICs for genetically modified strains could be completely recovered by gene complementation. Compared with the wild-type strain, the survival capability of ΔompA-Km was significantly increased and that of Δtsx-Km was significantly decreased. We further evaluated the role and expression of MipA in response to four other antibiotics including nalidixic acid, streptomycin, chloramphenicol and aureomycin, which suggested that MipA was a novel OM protein related to antibiotic resistance. PMID:25940639

  11. Outer membrane proteomics of kanamycin-resistant Escherichia coli identified MipA as a novel antibiotic resistance-related protein.

    PubMed

    Li, Hui; Zhang, Dan-feng; Lin, Xiang-min; Peng, Xuan-xian

    2015-06-01

    Antibiotic-resistant bacteria are a great threat to human health and food safety and there is an urgent need to understand the mechanisms of resistance for combating these bacteria. In the current study, comparative proteomic methodologies were applied to identify Escherichia coli K-12 outer membrane (OM) proteins related to kanamycin resistance. Mass spectrometry and western blotting results revealed that OM proteins TolC, Tsx and OstA were up-regulated, whereas MipA, OmpA, FadL and OmpW were down-regulated in kanamycin-resistant E. coli K-12 strain. Genetic deletion of tolC (ΔtolC-Km) led to a 2-fold decrease in the minimum inhibitory concentration (MIC) of kanamycin and deletion of mipA (ΔmipA-Km) resulted in a 4-fold increase in the MIC of kanamycin. Changes in the MICs for genetically modified strains could be completely recovered by gene complementation. Compared with the wild-type strain, the survival capability of ΔompA-Km was significantly increased and that of Δtsx-Km was significantly decreased. We further evaluated the role and expression of MipA in response to four other antibiotics including nalidixic acid, streptomycin, chloramphenicol and aureomycin, which suggested that MipA was a novel OM protein related to antibiotic resistance.

  12. Origin and Evolution of Rickettsial Plasmids

    PubMed Central

    El Karkouri, Khalid; Pontarotti, Pierre; Raoult, Didier; Fournier, Pierre-Edouard

    2016-01-01

    Background Rickettsia species are strictly intracellular bacteria that have undergone a reductive genomic evolution. Despite their allopatric lifestyle, almost half of the 26 currently validated Rickettsia species have plasmids. In order to study the origin, evolutionary history and putative roles of rickettsial plasmids, we investigated the evolutionary processes that have shaped 20 plasmids belonging to 11 species, using comparative genomics and phylogenetic analysis between rickettsial, microbial and non-microbial genomes. Results Plasmids were differentially present among Rickettsia species. The 11 species had 1 to 4 plasmid (s) with a size ranging from 12 kb to 83 kb. We reconstructed pRICO, the last common ancestor of the current rickettsial plasmids. pRICO was vertically inherited mainly from Rickettsia/Orientia chromosomes and diverged vertically into a single or multiple plasmid(s) in each species. These plasmids also underwent a reductive evolution by progressive gene loss, similar to that observed in rickettsial chromosomes, possibly leading to cryptic plasmids or complete plasmid loss. Moreover, rickettsial plasmids exhibited ORFans, recent gene duplications and evidence of horizontal gene transfer events with rickettsial and non-rickettsial genomes mainly from the α/γ-proteobacteria lineages. Genes related to maintenance and plasticity of plasmids, and to adaptation and resistance to stress mostly evolved under vertical and/or horizontal processes. Those involved in nucleotide/carbohydrate transport and metabolism were under the influence of vertical evolution only, whereas genes involved in cell wall/membrane/envelope biogenesis, cycle control, amino acid/lipid/coenzyme and secondary metabolites biosynthesis, transport and metabolism underwent mainly horizontal transfer events. Conclusion Rickettsial plasmids had a complex evolution, starting with a vertical inheritance followed by a reductive evolution associated with increased complexity via

  13. Origin-of-transfer sequences facilitate mobilisation of non-conjugative antimicrobial-resistance plasmids in Staphylococcus aureus.

    PubMed

    O'Brien, Frances G; Yui Eto, Karina; Murphy, Riley J T; Fairhurst, Heather M; Coombs, Geoffrey W; Grubb, Warren B; Ramsay, Joshua P

    2015-09-18

    Staphylococcus aureus is a common cause of hospital, community and livestock-associated infections and is increasingly resistant to multiple antimicrobials. A significant proportion of antimicrobial-resistance genes are plasmid-borne, but only a minority of S. aureus plasmids encode proteins required for conjugative transfer or Mob relaxase proteins required for mobilisation. The pWBG749 family of S. aureus conjugative plasmids can facilitate the horizontal transfer of diverse antimicrobial-resistance plasmids that lack Mob genes. Here we reveal that these mobilisable plasmids carry copies of the pWBG749 origin-of-transfer (oriT) sequence and that these oriT sequences facilitate mobilisation by pWBG749. Sequences resembling the pWBG749 oriT were identified on half of all sequenced S. aureus plasmids, including the most prevalent large antimicrobial-resistance/virulence-gene plasmids, pIB485, pMW2 and pUSA300HOUMR. oriT sequences formed five subfamilies with distinct inverted-repeat-2 (IR2) sequences. pWBG749-family plasmids encoding each IR2 were identified and pWBG749 mobilisation was found to be specific for plasmids carrying matching IR2 sequences. Specificity of mobilisation was conferred by a putative ribbon-helix-helix-protein gene smpO. Several plasmids carried 2-3 oriT variants and pWBG749-mediated recombination occurred between distinct oriT sites during mobilisation. These observations suggest this relaxase-in trans mechanism of mobilisation by pWBG749-family plasmids is a common mechanism of plasmid dissemination in S. aureus.

  14. Plasmids as stochastic model systems

    NASA Astrophysics Data System (ADS)

    Paulsson, Johan

    2003-05-01

    Plasmids are self-replicating gene clusters present in on average 2-100 copies per bacterial cell. To reduce random fluctuations and thereby avoid extinction, they ubiquitously autoregulate their own synthesis using negative feedback loops. Here I use van Kampen's Ω-expansion for a two-dimensional model of negative feedback including plasmids and ther replication inhibitors. This analytically summarizes the standard perspective on replication control -- including the effects of sensitivity amplification, exponential time-delays and noisy signaling. I further review the two most common molecular sensitivity mechanisms: multistep control and cooperativity. Finally, I discuss more controversial sensitivity schemes, such as noise-enhanced sensitivity, the exploitation of small-number combinatorics and double-layered feedback loops to suppress noise in disordered environments.

  15. Construction and application of an expression vector from the new plasmid pLAtc1 of Acidithiobacillus caldus.

    PubMed

    Zhang, Ming-Jiang; Jiang, Cheng-Ying; You, Xiao-Yan; Liu, Shuang-Jiang

    2014-05-01

    In this study, a recently sequenced 9.8-kb plasmid, pLAtc1, from Acidithiobacillus caldus strain SM-1 was characterized and developed into an expression vector. The pLAtc1 backbone carried an oriV, three rep genes, five mob genes, a Nic site, and an addiction system. Multilocus sequence analysis indicated that pLAtc1 was phylogenetically more related to the IncQ-like broad host range plasmids than to other IncQ plasmids. pLAtc1 was able to replicate and reside in Gram-negative Escherichia coli, Comamonas testosteroni, but not in Gram-positive Corynebacterium glutamicum. pLAtc1 was mobilized via conjugation into E. coli BL21 and A. caldus SM-1 from E. coli S17-1. Quantitative PCR revealed seven and four copies of plasmid in A. caldus and E. coli cells, respectively. The expression vector pLAtcE was constructed from pLAtc1 by introducing a regulatable promoter (P tetH ), a transcriptional terminator, a multiple cloning site, a kanamycin resistance gene, and a streptomycin resistance gene. The functionality of pLAtcE was demonstrated by expressing a gene encoding enhanced green fluorescence protein in E. coli and in A. caldus. pLAtcE was used to express α-ketoglutarate dehydrogenase (sucAB) and succinate dehydrogenase (sdhA) genes in A. caldus. The newly engineered strain that harbored sucAB and sdhA on a plasmid pLAtcE-sucA-sucB-sdhA grew better than the parent strain SM-1/pLAtcE in tetrathionate and glucose-supplemented medium and produced more acidity and resulted in a more oxidative environment. This study created a useful molecular tool for genetic manipulation of the thermoacidophilic and autotrophic A. caldus.

  16. Primary structure of a chloramphenicol acetyltransferase specified by R plasmids.

    PubMed

    Shaw, W V; Packman, L C; Burleigh, B D; Dell, A; Morris, H R; Hartley, B S

    Naturally occurring isolates of chloramphenicol-resistant bacteria commonly synthesise chloramphenicol acetyltransferase (EC 2.3.28; CAT) in amounts which are sufficient to account for the resistance phenotype and often harbour plasmids which carry the structural gene for CAT. The findings of CAT in such diverse prokaryotes as Proteus mirabilis, Agrobacterium tumefaciens, Streptomyces sp., and a soil Flavobacterium has led to speculation concerning the origin and evolution of the more commonly observed CAT variants specified by plasmids in clinically important bacteria. To provide a more solid basis for studying the evolution and spread of CAT within prokaryotes we chose to determine the complete amino acid sequence of a type I variant of CAT, the variant known to be associated with most F-like plasmids conferring chloramphenicol resistance. The sequence has been determined by combining the results obtained from manual and automated sequential degradation with those obtained by mass spectrometry of peptides generated by enzymatic digestion. The directly determined primary structure is identical with that predicted by the DNA sequence analysis of the chloramphenicol resistance transponson Tn9 known to specify a type I variant of chloramphenicol acetyltransferase.

  17. A recombinant plasmid containing CpG motifs as a novel vaccine adjuvant for immune protection against herpes simplex virus 2.

    PubMed

    He, Zhuojing; Xu, Juan; Tao, Wei; Fu, Ting; He, Fang; Hu, Ruxi; Jia, Lan; Hong, Yan

    2016-08-01

    The aim of the present study was to evaluate the efficacy of a herpes simplex virus type 2 (HSV-2) DNA vaccine co‑immunized with a plasmid adjuvant containing CpG motifs. A novel eukaryotic expression plasmid vector containing kanamycin resistance gene (pcDNA3Kan) was acquired from pET‑28a(+) and pcDNA3 plasmids. A gene encoding full length HSV‑2 glycoprotein D (gD) was amplified from the pcDNA3‑gD plasmid, which was cloned into pcDNA3Kan resulting in the construction of the recombinant plasmid pcDNA3Kan‑gD (pgD). A DNA segment containing 8 CpG motifs was synthesized, and cloned into pcDNA3Kan, resulting in the recombinant plasmid pcDNA3Kan‑CpG (pCpG). Mice were co‑inoculated with pgD (used as a DNA vaccine) and pCpG (used as an adjuvant) by bilateral intramuscular injection. Mice inoculated with pgD+pCpG showed higher titers of antibodies than those inoculated with the DNA vaccine alone (P<0.05). In addition, mice inoculated with pgD+pCpG showed the highest percentage of CD4+ T cells in the blood of all the groups (P﹤0.05). Thus, the present study demonstrated that pCpG could stimulate the HSV‑2 DNA vaccine to induce a stronger cell‑mediated immune response than the DNA vaccine alone. The aim of the present study was to evaluate the efficacy of a HSV‑2 DNA vaccine (pgD) co‑immunized with a plasmid adjuvant containing CpG motifs (pCpG). Whether the pCpG would be able to stimulate the pgD to induce a stronger immune response compared with pgD alone.

  18. A recombinant plasmid containing CpG motifs as a novel vaccine adjuvant for immune protection against herpes simplex virus 2.

    PubMed

    He, Zhuojing; Xu, Juan; Tao, Wei; Fu, Ting; He, Fang; Hu, Ruxi; Jia, Lan; Hong, Yan

    2016-08-01

    The aim of the present study was to evaluate the efficacy of a herpes simplex virus type 2 (HSV-2) DNA vaccine co‑immunized with a plasmid adjuvant containing CpG motifs. A novel eukaryotic expression plasmid vector containing kanamycin resistance gene (pcDNA3Kan) was acquired from pET‑28a(+) and pcDNA3 plasmids. A gene encoding full length HSV‑2 glycoprotein D (gD) was amplified from the pcDNA3‑gD plasmid, which was cloned into pcDNA3Kan resulting in the construction of the recombinant plasmid pcDNA3Kan‑gD (pgD). A DNA segment containing 8 CpG motifs was synthesized, and cloned into pcDNA3Kan, resulting in the recombinant plasmid pcDNA3Kan‑CpG (pCpG). Mice were co‑inoculated with pgD (used as a DNA vaccine) and pCpG (used as an adjuvant) by bilateral intramuscular injection. Mice inoculated with pgD+pCpG showed higher titers of antibodies than those inoculated with the DNA vaccine alone (P<0.05). In addition, mice inoculated with pgD+pCpG showed the highest percentage of CD4+ T cells in the blood of all the groups (P﹤0.05). Thus, the present study demonstrated that pCpG could stimulate the HSV‑2 DNA vaccine to induce a stronger cell‑mediated immune response than the DNA vaccine alone. The aim of the present study was to evaluate the efficacy of a HSV‑2 DNA vaccine (pgD) co‑immunized with a plasmid adjuvant containing CpG motifs (pCpG). Whether the pCpG would be able to stimulate the pgD to induce a stronger immune response compared with pgD alone. PMID:27357208

  19. [The relationship of plasmids from environmental Yersinia isolates and the virulence plasmid of enteropathogenic Yersinia strains].

    PubMed

    Hoffmann, B; Strauch, E; Appel, B; Nattermann, H

    2002-01-01

    The human pathogenic strains of Yersinia harbour a conserved plasmid carrying the Yop virulon. The virulence plasmid of Yersinia enterocolitica strains belonging to the serogroups O:3 and O:9 were used as probes to detect homologous sequences in plasmids of "avirulent" Yersinia strains. "Avirulent" Yersinia strains (Y. enterocolitica biogroup 1A, Y. intermedia, Y. kristensenii and Y. frederiksenii) lack the virulence plasmid. They are widely distributed in the environment and can frequently be isolated from clinical samples. Hybridisation experiments revealed a number of common genetic elements of the virulence plasmid and the plasmids of "avirulent" Yersinia strains. These elements were identified as genes involved in plasmid replication, as an endonuclease gene and as mobile genetic elements. However, none of the plasmid encoded virulence genes was present in the plasmids of "avirulent" Yersinia strains. The frequent occurrence and the possible etiological relevance of "avirulent" isolates will be discussed.

  20. Plasmid Diversity and Adaptation Analyzed by Massive Sequencing of Escherichia coli Plasmids.

    PubMed

    de Toro, María; Garcilláon-Barcia, M Pilar; De La Cruz, Fernando

    2014-12-01

    Whole-genome sequencing is revolutionizing the analysis of bacterial genomes. It leads to a massive increase in the amount of available data to be analyzed. Bacterial genomes are usually composed of one main chromosome and a number of accessory chromosomes, called plasmids. A recently developed methodology called PLACNET (for plasmid constellation networks) allows the reconstruction of the plasmids of a given genome. Thus, it opens an avenue for plasmidome analysis on a global scale. This work reviews our knowledge of the genetic determinants for plasmid propagation (conjugation and related functions), their diversity, and their prevalence in the variety of plasmids found by whole-genome sequencing. It focuses on the results obtained from a collection of 255 Escherichia coli plasmids reconstructed by PLACNET. The plasmids found in E. coli represent a nonaleatory subset of the plasmids found in proteobacteria. Potential reasons for the prevalence of some specific plasmid groups will be discussed and, more importantly, additional questions will be posed.

  1. IncP-1β Plasmids Are Important Carriers of Fitness Traits for Variovorax Species in the Mycosphere--Two Novel Plasmids, pHB44 and pBS64, with Differential Effects Unveiled.

    PubMed

    Zhang, Miaozhi; Warmink, Jan; Pereira E Silva, Michele C; Brons, Jolanda; Smalla, Kornelia; van Elsas, Jan Dirk

    2015-07-01

    The Laccaria proxima mycosphere strongly selects Variovorax paradoxus cells. Fifteen independent V. paradoxus strains, isolated from mycospheres sampled at two occasions, were investigated with respect to the occurrence of plasmids of sizes <60-100 kb. Two V. paradoxus strains, HB44 and BS64, were found to contain such plasmids, which were coined pHB44 and pBS64. Replicon typing using a suite of plasmid-specific PCR systems indicated that both plasmids belong to the IncP-1β group. Also, both were able to mobilize selectable IncQ group plasmids into Escherichia coli as well as Pseudomonas fluorescens. Moreover, they showed stable replication in these organisms, confirming their broad host range. Strain BS64 was cured of pBS64 and plasmid pHB44 was subsequently moved into this cured strain by making use of the IncQ group tracer plasmid pSUP104, which was then removed at elevated temperature. Thus, both plasmids could be screened for their ability to confer a phenotype upon strain BS64. No evidence for the presence of genes for xenobiotic degradation and/or antibiotic or heavy metal resistances was found for either of the two plasmids. Remarkably, both could stimulate the production of biofilm material by strain BS64. Also, the population densities of pBS64-containing strain BS64 were temporarily raised in liquid as well as soil systems (versus the plasmid-cured strain), both in the presence of the fungal host Lyophyllum sp. strain Karsten. Strikingly, plasmid pHB44 significantly enhanced the fitness of strain BS64 in soil containing Lyophyllum sp. strain Karsten, but decreased its fitness in soil supplemented with extra FeCl3. The effect was noted both in separate (no inter-strain competition) and joint (competition) inoculations.

  2. Genomics of high molecular weight plasmids isolated from an on-farm biopurification system.

    PubMed

    Martini, María C; Wibberg, Daniel; Lozano, Mauricio; Torres Tejerizo, Gonzalo; Albicoro, Francisco J; Jaenicke, Sebastian; van Elsas, Jan Dirk; Petroni, Alejandro; Garcillán-Barcia, M Pilar; de la Cruz, Fernando; Schlüter, Andreas; Pühler, Alfred; Pistorio, Mariano; Lagares, Antonio; Del Papa, María F

    2016-01-01

    The use of biopurification systems (BPS) constitutes an efficient strategy to eliminate pesticides from polluted wastewaters from farm activities. BPS environments contain a high microbial density and diversity facilitating the exchange of information among bacteria, mediated by mobile genetic elements (MGEs), which play a key role in bacterial adaptation and evolution in such environments. Here we sequenced and characterized high-molecular-weight plasmids from a bacterial collection of an on-farm BPS. The high-throughput-sequencing of the plasmid pool yielded a total of several Mb sequence information. Assembly of the sequence data resulted in six complete replicons. Using in silico analyses we identified plasmid replication genes whose encoding proteins represent 13 different Pfam families, as well as proteins involved in plasmid conjugation, indicating a large diversity of plasmid replicons and suggesting the occurrence of horizontal gene transfer (HGT) events within the habitat analyzed. In addition, genes conferring resistance to 10 classes of antimicrobial compounds and those encoding enzymes potentially involved in pesticide and aromatic hydrocarbon degradation were found. Global analysis of the plasmid pool suggest that the analyzed BPS represents a key environment for further studies addressing the dissemination of MGEs carrying catabolic genes and pathway assembly regarding degradation capabilities. PMID:27321040

  3. Genomics of high molecular weight plasmids isolated from an on-farm biopurification system.

    PubMed

    Martini, María C; Wibberg, Daniel; Lozano, Mauricio; Torres Tejerizo, Gonzalo; Albicoro, Francisco J; Jaenicke, Sebastian; van Elsas, Jan Dirk; Petroni, Alejandro; Garcillán-Barcia, M Pilar; de la Cruz, Fernando; Schlüter, Andreas; Pühler, Alfred; Pistorio, Mariano; Lagares, Antonio; Del Papa, María F

    2016-06-20

    The use of biopurification systems (BPS) constitutes an efficient strategy to eliminate pesticides from polluted wastewaters from farm activities. BPS environments contain a high microbial density and diversity facilitating the exchange of information among bacteria, mediated by mobile genetic elements (MGEs), which play a key role in bacterial adaptation and evolution in such environments. Here we sequenced and characterized high-molecular-weight plasmids from a bacterial collection of an on-farm BPS. The high-throughput-sequencing of the plasmid pool yielded a total of several Mb sequence information. Assembly of the sequence data resulted in six complete replicons. Using in silico analyses we identified plasmid replication genes whose encoding proteins represent 13 different Pfam families, as well as proteins involved in plasmid conjugation, indicating a large diversity of plasmid replicons and suggesting the occurrence of horizontal gene transfer (HGT) events within the habitat analyzed. In addition, genes conferring resistance to 10 classes of antimicrobial compounds and those encoding enzymes potentially involved in pesticide and aromatic hydrocarbon degradation were found. Global analysis of the plasmid pool suggest that the analyzed BPS represents a key environment for further studies addressing the dissemination of MGEs carrying catabolic genes and pathway assembly regarding degradation capabilities.

  4. Genomics of high molecular weight plasmids isolated from an on-farm biopurification system

    PubMed Central

    Martini, María C.; Wibberg, Daniel; Lozano, Mauricio; Torres Tejerizo, Gonzalo; Albicoro, Francisco J.; Jaenicke, Sebastian; van Elsas, Jan Dirk; Petroni, Alejandro; Garcillán-Barcia, M. Pilar; de la Cruz, Fernando; Schlüter, Andreas; Pühler, Alfred; Pistorio, Mariano; Lagares, Antonio; Del Papa, María F.

    2016-01-01

    The use of biopurification systems (BPS) constitutes an efficient strategy to eliminate pesticides from polluted wastewaters from farm activities. BPS environments contain a high microbial density and diversity facilitating the exchange of information among bacteria, mediated by mobile genetic elements (MGEs), which play a key role in bacterial adaptation and evolution in such environments. Here we sequenced and characterized high-molecular-weight plasmids from a bacterial collection of an on-farm BPS. The high-throughput-sequencing of the plasmid pool yielded a total of several Mb sequence information. Assembly of the sequence data resulted in six complete replicons. Using in silico analyses we identified plasmid replication genes whose encoding proteins represent 13 different Pfam families, as well as proteins involved in plasmid conjugation, indicating a large diversity of plasmid replicons and suggesting the occurrence of horizontal gene transfer (HGT) events within the habitat analyzed. In addition, genes conferring resistance to 10 classes of antimicrobial compounds and those encoding enzymes potentially involved in pesticide and aromatic hydrocarbon degradation were found. Global analysis of the plasmid pool suggest that the analyzed BPS represents a key environment for further studies addressing the dissemination of MGEs carrying catabolic genes and pathway assembly regarding degradation capabilities. PMID:27321040

  5. Virulence Plasmids of Spore-Forming Bacteria.

    PubMed

    Adams, Vicki; Li, Jihong; Wisniewski, Jessica A; Uzal, Francisco A; Moore, Robert J; McClane, Bruce A; Rood, Julian I

    2014-12-01

    Plasmid-encoded virulence factors are important in the pathogenesis of diseases caused by spore-forming bacteria. Unlike many other bacteria, the most common virulence factors encoded by plasmids in Clostridium and Bacillus species are protein toxins. Clostridium perfringens causes several histotoxic and enterotoxin diseases in both humans and animals and produces a broad range of toxins, including many pore-forming toxins such as C. perfringens enterotoxin, epsilon-toxin, beta-toxin, and NetB. Genetic studies have led to the determination of the role of these toxins in disease pathogenesis. The genes for these toxins are generally carried on large conjugative plasmids that have common core replication, maintenance, and conjugation regions. There is considerable functional information available about the unique tcp conjugation locus carried by these plasmids, but less is known about plasmid maintenance. The latter is intriguing because many C. perfringens isolates stably maintain up to four different, but closely related, toxin plasmids. Toxin genes may also be plasmid-encoded in the neurotoxic clostridia. The tetanus toxin gene is located on a plasmid in Clostridium tetani, but the botulinum toxin genes may be chromosomal, plasmid-determined, or located on bacteriophages in Clostridium botulinum. In Bacillus anthracis it is well established that virulence is plasmid determined, with anthrax toxin genes located on pXO1 and capsule genes on a separate plasmid, pXO2. Orthologs of these plasmids are also found in other members of the Bacillus cereus group such as B. cereus and Bacillus thuringiensis. In B. thuringiensis these plasmids may carry genes encoding one or more insecticidal toxins.

  6. p39R861-4, A Type 2 A/C2 Plasmid Carrying a Segment from the A/C1 Plasmid RA1.

    PubMed

    Anantham, Sashindran; Harmer, Christopher J; Hall, Ruth M

    2015-12-01

    The largest plasmid in the strain 39R861, which is used as a plasmid size standard, was recovered by conjugation and sequenced to determine its exact size. Plasmid p39R861-4 transferred at high frequency. Although reported to be the A/C1 plasmid RA1, p39R861-4 is a 155794-bp Type 2 A/C2 plasmid, in which a 39-kb segment, derived from RA1 that includes a relative of the RA1 resistance island, replaces 26.5 kb of the Type 2 backbone. p39R861-4 includes a single copy of IS10 and two resistance islands with a CR2-sul2 region in each of them. The 84 kb of backbone between the resistance islands is inverted relative to other known A/C plasmids and this inversion has arisen through recombination between the CR2-sul2 regions that are inversely oriented. The two resistance islands present before this inversion occurred were one related to but longer than that found in RA1, and one that is a form of the ARI-B island and identical to ARI-B in the A/C2 plasmid R55. They contain genes conferring resistance to tetracycline (tetA(D)), sulfonamides (sul2), and florfenicol and chloramphenicol (floR). The tet(D) determinant is flanked by two IS26 in a transposon-like structure named Tntet(D). Both resistance islands contain remnants of the two ends of the integrative element GIsul2, consistent with the sul2 gene being mobilized by GIsul2 rather than by CR2. PMID:26167918

  7. Positive epistasis between co-infecting plasmids promotes plasmid survival in bacterial populations.

    PubMed

    San Millan, Alvaro; Heilbron, Karl; MacLean, R Craig

    2014-03-01

    Plasmids have a key role in the horizontal transfer of genes among bacteria. Although plasmids are catalysts for bacterial evolution, it is challenging to understand how they can persist in bacterial populations over the long term because of the burden they impose on their hosts (the 'plasmid paradox'). This paradox is especially perplexing in the case of 'small' plasmids, which are unable to self-transfer by conjugation. Here, for the first time, we investigate how interactions between co-infecting plasmids influence plasmid persistence. Using an experimental model system based on interactions between a diverse assemblage of 'large' plasmids and a single small plasmid, pNI105, in the pathogenic bacterium Pseudomonas aeruginosa, we demonstrate that positive epistasis minimizes the cost associated with carrying multiple plasmids over the short term and increases the stability of the small plasmid over a longer time scale. In support of these experimental data, bioinformatic analysis showed that associations between small and large plasmids are more common than would be expected owing to chance alone across a range of families of bacteria; more generally, we find that co-infection with multiple plasmids is more common than would be expected owing to chance across a wide range of bacterial phyla. Collectively, these results suggest that positive epistasis promotes plasmid stability in bacterial populations. These findings pave the way for future mechanistic studies aimed at elucidating the molecular mechanisms of plasmid-plasmid interaction, and evolutionary studies aimed at understanding how the coevolution of plasmids drives the spread of plasmid-encoded traits.

  8. Effects of genes exerting growth inhibition and plasmid stability on plasmid maintenance.

    PubMed

    Boe, L; Gerdes, K; Molin, S

    1987-10-01

    Plasmid stabilization mediated by the parA+ and parB+ genes of the R1 plasmid and the ccd+ and sop+ genes of the F plasmid was tested on a mini-R1 plasmid and a pBR322 plasmid derivative. The mini-R1 plasmid is thought to be unstably inherited owing to a low copy number and to random segregation of the plasmid at cell division, whereas cells harboring the pBR322 derivative used in this work are lost through competition with plasmid-free cells, mainly as a result of the shorter generation time of cells without plasmids. The pBR322 derivative carries a fusion between part of the atp operon of Escherichia coli and the bacteriophage lambda pR promoter, and the cI857 repressor gene. The insertion of sop+ from the F plasmid or parB+ from the R1 plasmid reduced the loss frequency by a factor of 10(3) for the pBR322 derivative and by at least a factor of 10(2) for the mini-R1 plasmid. Insertion of parA+ from the R1 plasmid decreased the loss frequency of the pBR322 derivative by a factor of 10 and that of the mini-R1 plasmid by a factor of 50. When ccd+ from the F plasmid was inserted, the loss frequency of the pBR322 derivative was decreased by a factor of 10, but it had only a marginal effect on the stability of the mini-R1 plasmid. In no case was any significant structural instability of the plasmids observed.

  9. Conjugal Transfer of Plasmid-Borne Multiple Antibiotic Resistance in Streptococcus faecalis var. zymogenes

    PubMed Central

    Jacob, Alan E.; Hobbs, Susan J.

    1974-01-01

    A strain of Streptococcus faecalis var. zymogenes, designated JH1, had high-level resistance to the antibiotics streptomycin, kanamycin, neomycin, erythromycin, and tetracycline. These resistances were lost en bloc from approximately 0.1% of cells grown in nutrient broth at 45 C. The frequency of resistance loss was not increased by growth in the presence of the “curing” agents acriflavine or acridine orange, but after prolonged storage in nutrient agar 17% of cells became antibiotic sensitive. Covalently closed circular deoxyribonucleic acid (DNA) molecules were isolated from the parental strain and from antibiotic-sensitive segregants by using cesium chloride-ethidium bromide gradients. DNA molecular species were identified by using neutral sucrose gradients. Strain JH1 contained two covalently closed circular DNA species of molecular weights 50 × 106 and 38 × 106. An antibiotic-sensitive segregant, strain JH1-9, had lost the larger molecular species. A second sensitive segregant, strain JH1-5, had also lost the larger molecular species but a new molecular species of approximate molecular weight 6 × 106 was present. The antibiotic resistances that were curable from the parental strain were transferred to antibiotic-sensitive strains of S. faecalis and to strain JH1-9, during mixed incubation in nutrient broth at 37 C. Data to be described are interpreted to suggest that the transfer is by a conjugal mechanism. Analysis of the plasmid species in recipient clones showed that all had received the plasmid of molecular weight 50 × 106. Strain JH1-5 was not a good recipient. Analysis of one successful recipient clone of JH1-5 revealed that it had gained the 50 × 106 molecular weight plasmid but lost the 6 × 106 molecular weight species. These data are interpreted to mean that the multiple antibiotic resistance is borne by a transferable plasmid of 50 × 106 molecular weight, and that in clone JH1-5 this plasmid suffered a large deletion leaving only a 6

  10. Microwave effects on plasmid DNA

    SciTech Connect

    Sagripanti, J.L.; Swicord, M.L.; Davis, C.C.

    1987-05-01

    The exposure of purified plasmid DNA to microwave radiation at nonthermal levels in the frequency range from 2.00 to 8.75 GHz produces single- and double-strand breaks that are detected by agarose gel electrophoresis. Microwave-induced damage to DNA depends on the presence of small amounts of copper. This effect is dependent upon both the microwave power and the duration of the exposure. Cuprous, but not cupric, ions were able to mimic the effects produced by microwaves on DNA.

  11. Development of a self-replicating plasmid system for Mycoplasma hyopneumoniae

    PubMed Central

    2013-01-01

    Mycoplasma hyopneumoniae is a prevalent swine respiratory pathogen that is a major cause of economic loss to pig producers. Control is achieved by a combination of antimicrobials, vaccination and management practices, but current vaccines offer only partial control and there is a need for improved preventative strategies. A major barrier to advances in understanding the pathogenesis of M. hyopneumoniae and in developing new vaccines is the lack of tools to genetically manipulate the organism. We describe the development and optimisation of the first successful plasmid-based system for the genetic manipulation of M. hyopneumoniae. Our artificial plasmids contain the origin of replication (oriC) of M. hyopneumoniae along with tetM, conferring resistance to tetracycline. With these plasmids, we have successfully transformed M. hyopneumoniae strain 232 by electroporation, generating tetracycline resistant organisms. The persistence of extrachromosomal plasmid and maintenance of plasmid DNA over serial passages shows that these artificial plasmids are capable of self-replication in M. hyopneumoniae. In addition to demonstrating the amenability of M. hyopneumoniae to genetic manipulation and in optimising the conditions necessary for successful transformation, we have used this system to determine the minimum functional oriC of M. hyopneumoniae. In doing so, we have developed a plasmid with a small oriC that is stably maintained over multiple passages that may be useful in generating targeted gene disruptions. In conclusion, we have generated a set of plasmids that will be valuable in studies of M. hyopneumoniae pathogenesis and provide a major step forward in the study of this important swine pathogen. PMID:23895236

  12. TEM-1-encoding small plasmids impose dissimilar fitness costs on Haemophilus influenzae and Haemophilus parainfluenzae.

    PubMed

    Søndergaard, Annette; Lund, Marianne; Nørskov-Lauritsen, Niels

    2015-12-01

    Only two beta-lactamases, TEM-1 and ROB-1, have been observed in Haemophilus influenzae, while four different TEM but no ROB enzymes have been found in Haemophilus parainfluenzae. In order to investigate the mechanisms behind the dissemination of small beta-lactamase-encoding plasmids in H. influenzae and H. parainfluenzae, we assessed the fitness cost of three TEM-1- (pPN223, pA1209, pA1606), one TEM-15- (pSF3) and one ROB-1-bearing (pB1000) plasmid when expressed in either bacterial species. All plasmids were stable in H. influenzae and H. parainfluenzae except pB1000, which showed on average (sample mean) 76% curing in H. parainfluenzae after 5  days of subculture. Competition assays between isogenic strains with and without plasmid showed no competitive disadvantage of pPN223 and pA1606 in H. influenzae, or of pA1209 in H. parainfluenzae. In contrast, pSF3 and pB1000 were associated with significant competitive disadvantages in both species. Some of the competitive disadvantages may be related to differences in plasmid copy number and mRNA expression of the beta-lactamase genes, as revealed by quantitative PCR analysis. In conclusion, plasmids encoding TEM beta-lactamases isolated from H. influenzae and H. parainfluenzae can be stably transferred between species. The fast curing of pB1000 in H. parainfluenzae observed in this study correlates to the fact that ROB-1 has never been reported for this species. TEM-1-encoding plasmids are associated with the lowest level of fitness cost, but different TEM-1 plasmids confer different levels of fitness cost on the two hosts.

  13. Isolation and characterization of a new plasmid from a Flavobacterium sp. which carries the genes for degradation of 2,4-dichlorophenoxyacetate.

    PubMed

    Chaudhry, G R; Huang, G H

    1988-09-01

    A Flavobacterium sp. (strain 50001), capable of degrading 2,4-dichlorophenoxyacetate (2,4-D), 2-methyl-4-chlorophenoxyacetate, and 2-chlorobenzoate and imparting resistance to mercury, harbored a degradative plasmid, pRC10. Cured strains of the Flavobacterium sp. lost the plasmid as well as the ability to degrade these chlorinated compounds. Comparison of this plasmid with the well-characterized 2,4-D-degradative plasmid pJP4 from Alcaligenes eutrophus showed regions of homology between the two plasmids. Restriction fragments of plasmid pRC10 which shared homology with the regions conferring 2,4-D-degradative genes (tfd) of plasmid pJP4 were cloned into a broad-host-range plasmid and studied in Pseudomonas putida. From the results obtained, the cloned DNA fragment expressed the genes for 2,4-D monooxygenase (tfdA) and 2,4-dichlorophenol hydroxylase (tfdB). In spite of the similarity in function, the size (45 kilobases) and restriction pattern of plasmid pRC10 were considerably different from those of pJP4 (80 kilobases). This may be due to the difference in the microbial background during evolution of the two plasmids.

  14. Trimethoprim resistance in urinary pathogens in northern Scotland: epidemic spread of a resistance plasmid encoding the type Ib trimethoprim-resistant dihydrofolate reductase.

    PubMed

    Young, H K; Hillyear, J K

    1994-11-01

    The prevalence of trimethoprim resistance in enterobacterial urinary pathogens from hospitalised patients in the Angus district of northern Scotland (22.8%) was twice that found in similar isolates from patients attending general practitioners (11.2%). Thirty-three of the 143 trimethoprim-resistant strains were shown to harbour transferable plasmids conferring high-level trimethoprim resistance. In total, 17 different plasmid types were distinguished. Two plasmids, pUK1184 and pUK1185, accounted for 36% of the trimethoprim resistance plasmids and were shown by restriction endonuclease digestion fingerprints to be closely related to plasmid pUK28, previously demonstrated to be endemic in urinary pathogens in the Edinburgh area. Only 21% of the plasmids were shown to encode the type Ia trimethoprim-resistant dihydrofolate reductase, whereas 70% of the trimethoprim resistance plasmids were found to encode the type Ib dihydrofolate reductase. Hybridisation of the trimethoprim resistance plasmids identified in this study with gene probes specific for the integrase genes of transposons Tn7 and Tn21 indicates that the dhfrIa is rarely present within Tn7 or related transposons in these plasmids and may be more prevalent within Tn21-like transposons. In contrast, with the exception of the two endemic plasmids that harboured the dhfrIb gene within a Tn7-like transposon, the majority of dhfrIb genes were not found to be associated with either Tn7- or Tn21-like structures.

  15. Characterization of plasmids in bacterial fish pathogen.

    PubMed Central

    Toranzo, A E; Barja, J L; Colwell, R R; Hetrick, F M

    1983-01-01

    Plasmid profiles of representative fish pathogens, Aeromonas salmonicida, Aeromonas hydrophila, Vibrio anguillarum, Pasteurella piscicida, Yersinia ruckeri, Edwardsiella tarda, and Renibacterium salmoninarum, were determined by agarose gel electrophoresis with four different plasmid detection methods. A combination of two methods was required to detect the plasmids present in these strains and to calculate precisely the molecular weights of the plasmids. Of 38 strains, 28 harbored one or more plasmids, with the majority of strains demonstrating multiplasmid banding. Similarity in plasmid banding between strains was noted and related to geographic source. Five strains of A. salmonicida possessed six plasmid bands having molecular weights of 8.6 X 10(6), 8.4 X 10(6), 8.1 X 10(6), 3.6 X 10(6), 3.5 X 10(6), and 3.4 X 10(6). Four P. piscicida isolates shared three plasmid bands having molecular weights of 37 X 10(6), 15 X 10(6), and 5 X 10(6), and five A. hydrophila strains harbored a common plasmid having a molecular weight of ca. 20 X 10(6) to 30 X 10(6). The highest-molecular-weight plasmids (145 X 10(6) and 130 X 10(6) were detected in V. anguillarum. From curing experiments, it was found that in A. hydrophila strain 79-62, a loss of resistance to tetracycline was associated with loss of plasmid content in all susceptible derivatives, suggesting plasmid-mediated tetracycline resistance. Cell surface characteristics and metabolic properties were also modified in cured derivatives of A. hydrophila strain 79-62. Images PMID:6822413

  16. Superporous agarose anion exchangers for plasmid isolation.

    PubMed

    Tiainen, Peter; Gustavsson, Per-Erik; Ljunglöf, Anders; Larsson, Per-Olof

    2007-01-01

    Superporous agarose beads have wide, connecting flow pores allowing large molecules such as plasmids to be transported into the interior of the beads by convective flow. The pore walls provide additional surface for plasmid binding thus increasing the binding capacity of the adsorbent. Novel superporous agarose anion exchangers have been prepared, differing with respect to bead diameter, superpore diameter and type of anion-exchange functional group (poly(ethyleneimine) and quaternary amine). The plasmid binding capacities were obtained from breakthrough curves and compared with the binding capacity of homogeneous agarose beads of the same particle size. Significantly, the smaller diameter superporous agarose beads were found to have four to five times higher plasmid binding capacity than the corresponding homogeneous agarose beads. The experimentally determined plasmid binding capacity was compared with the theoretically calculated surface area for each adsorbent and fair agreement was found. Confocal microscopy studies of beads with adsorbed, fluorescently labelled plasmids aided in the interpretation of the results. Superporous poly(ethyleneimine)-substituted beads with a high ion capacity (230 micromol/ml) showed a plasmid binding of 3-4 mg/ml adsorbent. Superporous quaternary amine-substituted beads had a lower ion capacity (81 micromol/ml) and showed a correspondingly lower plasmid binding capacity (1-2 mg/ml adsorbent). In spite of the lower capacity, the beads with quaternary amine ligand were preferred, due to their much better plasmid recovery (70-100% recovery). Interestingly, both capacity and recovery was improved when the plasmid adsorption step was carried out in the presence of a moderate salt concentration. The most suitable superporous bead type (45-75 microm diameter beads; 4 microm superpores; quaternary amine ligand) was chosen for the capture of plasmid DNA from a clarified alkaline lysate. Two strategies were evaluated, one with and one

  17. Synthesis, characterization and in vitro evaluation of amphiphilic ion pairs of erythromycin and kanamycin antibiotics with liposaccharides.

    PubMed

    Pignatello, Rosario; Simerska, Pavla; Leonardi, Antonio; Abdelrahim, Adel S; Petronio, Giulio Petronio; Fuochi, Virginia; Furneri, Pio Maria; Ruozi, Barbara; Toth, Istvan

    2016-09-14

    The hydrophilic ion paring strategy (HIP) is a method explored to improve the cell/tissue uptake of poorly adsorbed drugs and to optimize their physico-chemical characteristics. In this context, we here describe the synthesis of some ion pairs of two model cationic antibiotics, erythromycin (ERY) and kanamycin A (KAN), with liposaccharides having different levels of lipophilicity and charge. The formation of drug-liposaccharide complexes was confirmed by Fourier transform infrared spectroscopy (FT-IR), differential scanning calorimetry (DSC) and powder X-ray diffraction (PXRD) analysis. The effect of the amphiphilic liposaccharide moieties on the antimicrobial activity of ERY and KAN was assessed by measuring the minimal inhibitory concentration (MIC) of the compounds against a panel of bacterial strains that were susceptible or resistant to the parent antibiotics. The ion pairing did not depress the in vitro antibiotic activity, although no lowering of MIC values was registered. The experimental findings would motivate the future investigation of this ion pairing strategy in drug design, for instance allowing improvement of the encapsulation efficiency of hydrophilic antibiotics in lipid-based nanocarriers, or changing their in vivo biodistribution and pharmacokinetic profile. PMID:27236014

  18. pLS101 plasmid vector

    DOEpatents

    Lacks, S.A.; Balganesh, T.S.

    1985-02-19

    Disclosed is recombinant plasmid pLS101, consisting essentially of a 2.0 Kb ma1M gene fragment ligated to a 4.4 Kb Tcr DNA fragment, which is particularly useful for transforming Gram-positive bacteria. This plasmid contains at least four restriction sites suitable for inserting exogeneous gene sequences. Also disclosed is a method for plasmid isolation by penicillin selection, as well as processes for enrichment of recombinant plasmids in Gram-positive bacterial systems. 5 figs., 2 tabs.

  19. pLS010 plasmid vector

    DOEpatents

    Lacks, Sanford A.; Balganesh, Tanjore S.

    1988-01-01

    Disclosed is recombinant plasmid pLS101, consisting essentially of a 2.0 Kb malM gene fragment ligated to a 4.4 Kb T.sub.c r DNA fragment, which is particularly useful for transforming Gram-positive bacteria. This plasmid contains at least four restriction sites suitable for inserting exogeneous gene sequences. Also disclosed is a method for plasmid isolation by penicillin selection, as well as processes for enrichment of recombinant plasmids in Gram-positive bacterial systems.

  20. Attenuation of virulence by P and V plasmids in Vibrio cholerae: strains suitable for oral immunization*

    PubMed Central

    Sinha, V. B.; Srivastava, Brahm S.

    1979-01-01

    In a virulent strain of Vibrio cholerae, KB9, P and V plasmids were introduced by bacterial conjugation. Characterization of PV isolates and systematic screening of them in animal models of cholera revealed that a large number of PV isolates were non-pathogenic, owing to the loss of ability to synthesize toxin. Results obtained with two such strains, designated as KB9:PV and CD24, are described. The strains with plasmids were stable during in vitro cultivation or during two successive passages in rabbit intestine. Protection conferred by PV strains was determined in mouse protection tests and in the rabbit ileal loop model. The plasmid strains were immunogenic. In view of the results, it is proposed that PV-bearing attenuated strains should be tried in oral immunization. PMID:316741

  1. Metabolic pathway for poly(3-hydroxybutyrate-co-3-hydroxyvalerate) formation in Nocardia corallina: inactivation of mutB by chromosomal integration of a kanamycin resistance gene.

    PubMed Central

    Valentin, H F; Dennis, D

    1996-01-01

    The gene encoding the large subunit of the methylmalonyl-coenzyme A (CoA) mutase in Nocardia corallina (mutBNc) was cloned. A 4.3-kbp BamHI fragment containing almost the entire mutBNc was identified by Southern hybridization experiments employing a digoxigenin-labeled probe deduced from mutB of Streptomyces cinnamonensis, mutBNc was interrupted by insertion of a kanamycin resistance gene block (mutB::kan or mutB::neo) and introduced into N. corallina to obtain mutB-negative strains by homologous recombination. Four of sixteen kanamycin-resistant clones occurred via double-crossover events and harbored only the interrupted mutBNc. These exhibited no growth on odd-chain fatty acids in the presence of kanamycin but exhibited wild-type growth on even-chain fatty acids, glucose, and succinate. Whereas the wild type of N. corallina accumulates a copolyester of 3-hydroxybutyrate (3HB) and 3-hydroxyvalerate (3HV) containing more than 60 mol% 3HV from most carbon sources, mutB-negative strains accumulated poly(3HB-co-3HV) containing only 2 to 6 mol% 3HV. Methylmalonyl-CoA mutase activity was not found in these clones. Therefore, this study provides strong evidence that the majority of 3HV units in poly(3HB-co-3HV) accumulated by N. corallina are synthesized via the methylmalonyl-CoA pathway. PMID:8593043

  2. Plasmid metagenomics reveals multiple antibiotic resistance gene classes among the gut microbiomes of hospitalised patients.

    PubMed

    Jitwasinkul, Tossawan; Suriyaphol, Prapat; Tangphatsornruang, Sithichoke; Hansen, Martin Asser; Hansen, Lars Hestbjerg; Sørensen, Søren Johannes; Permpikul, Chairat; Rongrungruang, Yong; Tribuddharat, Chanwit

    2016-09-01

    Antibiotic resistance genes are rapidly spread between pathogens and the normal flora, with plasmids playing an important role in their circulation. This study aimed to investigate antibiotic resistance plasmids in the gut microbiome of hospitalised patients. Stool samples were collected from seven inpatients at Siriraj Hospital (Bangkok, Thailand) and were compared with a sample from a healthy volunteer. Plasmids from the gut microbiomes extracted from the stool samples were subjected to high-throughput DNA sequencing (GS Junior). Newbler-assembled DNA reads were categorised into known and unknown sequences (using >80% alignment length as the cut-off), and ResFinder was used to classify the antibiotic resistance gene pools. Plasmid replicon modules were used for plasmid typing. Forty-six genes conferring resistance to several classes of antibiotics were identified in the stool samples. Several antibiotic resistance genes were shared by the patients; interestingly, most were reported previously in food animals and healthy humans. Four antibiotic resistance genes were found in the healthy subject. One gene (aph3-III) was identified in the patients and the healthy subject and was related to that in cattle. Uncommon genes of hospital origin such as blaTEM-124-like and fosA, which confer resistance to extended-spectrum β-lactams and fosfomycin, respectively, were identified. The resistance genes did not match the patients' drug treatments. In conclusion, several plasmid types were identified in the gut microbiome; however, it was difficult to link these to the antibiotic resistance genes identified. That the antibiotic resistance genes came from hospital and community environments is worrying. PMID:27530840

  3. Plasmid metagenomics reveals multiple antibiotic resistance gene classes among the gut microbiomes of hospitalised patients.

    PubMed

    Jitwasinkul, Tossawan; Suriyaphol, Prapat; Tangphatsornruang, Sithichoke; Hansen, Martin Asser; Hansen, Lars Hestbjerg; Sørensen, Søren Johannes; Permpikul, Chairat; Rongrungruang, Yong; Tribuddharat, Chanwit

    2016-09-01

    Antibiotic resistance genes are rapidly spread between pathogens and the normal flora, with plasmids playing an important role in their circulation. This study aimed to investigate antibiotic resistance plasmids in the gut microbiome of hospitalised patients. Stool samples were collected from seven inpatients at Siriraj Hospital (Bangkok, Thailand) and were compared with a sample from a healthy volunteer. Plasmids from the gut microbiomes extracted from the stool samples were subjected to high-throughput DNA sequencing (GS Junior). Newbler-assembled DNA reads were categorised into known and unknown sequences (using >80% alignment length as the cut-off), and ResFinder was used to classify the antibiotic resistance gene pools. Plasmid replicon modules were used for plasmid typing. Forty-six genes conferring resistance to several classes of antibiotics were identified in the stool samples. Several antibiotic resistance genes were shared by the patients; interestingly, most were reported previously in food animals and healthy humans. Four antibiotic resistance genes were found in the healthy subject. One gene (aph3-III) was identified in the patients and the healthy subject and was related to that in cattle. Uncommon genes of hospital origin such as blaTEM-124-like and fosA, which confer resistance to extended-spectrum β-lactams and fosfomycin, respectively, were identified. The resistance genes did not match the patients' drug treatments. In conclusion, several plasmid types were identified in the gut microbiome; however, it was difficult to link these to the antibiotic resistance genes identified. That the antibiotic resistance genes came from hospital and community environments is worrying.

  4. The Complete Sequence and Comparative Analysis of a Multidrug-Resistance and Virulence Multireplicon IncFII Plasmid pEC302/04 from an Extraintestinal Pathogenic Escherichia coli EC302/04 Indicate Extensive Diversity of IncFII Plasmids

    PubMed Central

    Ho, Wing Sze; Yap, Kien-Pong; Yeo, Chew Chieng; Rajasekaram, Ganeswrie; Thong, Kwai Lin

    2016-01-01

    Extraintestinal pathogenic Escherichia coli (ExPEC) that causes extraintestinal infections often harbor plasmids encoding fitness traits such as resistance and virulence determinants that are of clinical importance. We determined the complete nucleotide sequence of plasmid pEC302/04 from a multidrug-resistant E. coli EC302/04 which was isolated from the tracheal aspirate of a patient in Malaysia. In addition, we also performed comparative sequence analyses of 18 related IncFIIA plasmids to determine the phylogenetic relationship and diversity of these plasmids. The 140,232 bp pEC302/04 is a multireplicon plasmid that bears three replication systems (FII, FIA, and FIB) with subtype of F2:A1:B1. The plasmid is self-transmissible with a complete transfer region. pEC302/04 also carries antibiotic resistance genes such as blaTEM−1 and a class I integron containing sul1, cml and aadA resistance genes, conferring multidrug resistance (MDR) to its host, E. coli EC302/04. Besides, two iron acquisition systems (SitABCD and IutA-IucABCD) which are the conserved virulence determinants of ExPEC-colicin V or B and M (ColV/ColBM)-producing plasmids were identified in pEC302/04. Multiple toxin-antitoxin (TA)-based addiction systems (i.e., PemI/PemK, VagC/VagD, CcdA/CcdB, and Hok/Sok) and a plasmid partitioning system, ParAB, and PsiAB, which are important for plasmid maintenance were also found. Comparative plasmid analysis revealed only one conserved gene, the repA1 as the core genome, showing that there is an extensive diversity among the IncFIIA plasmids. The phylogenetic relationship of 18 IncF plasmids based on the core regions revealed that ColV/ColBM-plasmids and non-ColV/ColBM plasmids were separated into two distinct groups. These plasmids, which carry highly diverse genetic contents, are also mosaic in nature. The atypical combination of genetic materials, i.e., the MDR- and ColV/ColBM-plasmid-virulence encoding regions in a single ExPEC plasmid is rare but of clinical

  5. Conference Resolution

    NASA Astrophysics Data System (ADS)

    2009-04-01

    Since the first IUPAP International Conference on Women in Physics (Paris, March 2002) and the Second Conference (Rio de Janeiro, May 2005), progress has continued in most countries and world regions to attract girls to physics and advance women into leadership roles, and many working groups have formed. The Third Conference (Seoul, October 2008), with 283 attendees from 57 countries, was dedicated to celebrating the physics achievements of women throughout the world, networking toward new international collaborations, building each participant's capacity for career success, and aiding the formation of active regional working groups to advance women in physics. Despite the progress, women remain a small minority of the physics community in most countries.

  6. Thermosensitive antibiotic resistance plasmids in enterobacteria.

    PubMed

    Smith, H W; Parsell, Z; Green, P

    1978-11-01

    Of 775 conjugative plasmids found in enterobacteria mediating antibiotic resistance, 24 (3.1%) were thermosensitive (ts); they were most common in Klebsiella pneumoniae. Ts plasmids were also found in all the samples of sewage and river water examined. Over half of 73 ts plasmids from unrelated sources mediated resistance to chloramphenicol in addition to several other antibiotics. Many of them mediated resistance to mercury (53.4%), arsenite (38.4%) and tellurite (79.5%) but not to copper, cobalt and silver. Fifty-eight belonged to incompatibility group H2 and 12 belonged to the H1 group. Resistance to mercury, arsenite and tellurite was common in strains containing H2 plasmids but not in H1 plasmids. The 73 plasmids transferred at high rates at 22 and 28 degrees C and at lower rates at 15 degrees C; they transferred at very low rates or not at all at 37 degrees C. They could be divided into two sets according to whether they transferred at a high or at a low rate at 33 degrees C. Unlike the prototype plasmid, Rts 1, they were solely or mainly ts for transfer and not for replication and only one of them brought about a marked reduction in growth rate of its host organism at 42 degrees C. None of the 73 plasmids mediated colicin or haemolysin production. Three plasmids, all from K. pneumoniae, mediated utilization of lactose, two of sucrose and raffinose and three, all belonging to group H1, of citrate. None of the plasmids increased the pathogenicity of Salmonella typhimurium for chicks or Escherichia coli K12 for mice.

  7. Survival in soils of an herbicide-resistant Pseudomonas putida strain bearing a recombinant TOL plasmid

    SciTech Connect

    Ramos, J.L.; Duque, E.; Ramos-Gonzalez, M.-I. )

    1991-01-01

    Pseudomonas putida EEZ15(pWW0-EB62) is a phosphinothricin (PPT)-resistant strain with a recombinant TOL plasmid which allows the strain to grown on p-ethylbenzoate. The survival of this strain in sterile agricultural soils depends on the physicochemical properties of the soil. The recombinant pWW0-EB62 plasmid and its catabolic functions were stable for periods of up to 1 month in bacteria introduced in unamended soils and only conferred selective advantage to the host bacteria without the plasmid or with the natural pWW0 plasmid when the soils were amended with low amounts of p-ethylbenzoate. The addition to soils of aromatics that are cometabolized by P. putida EEZ15(pWW0-EB62) had a detrimental effect on the survival of the bacteria, whereas low amounts of aromatics that are not metabolized by this bacterium had no effect on their survival. Survival of P. putida EEZ15(pWW0-EB62) was better at 4 and 25{degree}C than at 37{degree}C. The host bacterium carrying the recombinant pWW0-EB62 plasmid was established in unsterile soils.

  8. Plasmid Conjugation from Proteobacteria as Evidence for the Origin of Xenologous Genes in Cyanobacteria

    PubMed Central

    Encinas, David; Garcillán-Barcia, M. Pilar; Santos-Merino, María; Delaye, Luis; Moya, Andrés

    2014-01-01

    Comparative genomics have shown that 5% of Synechococcus elongatus PCC 7942 genes are of probable proteobacterial origin. To investigate the role of interphylum conjugation in cyanobacterial gene acquisition, we tested the ability of a set of prototype proteobacterial conjugative plasmids (RP4, pKM101, R388, R64, and F) to transfer DNA from Escherichia coli to S. elongatus. A series of BioBrick-compatible, mobilizable shuttle vectors was developed. These vectors were based on the putative origin of replication of the Synechococcus resident plasmid pANL. Not only broad-host-range plasmids, such as RP4 and R388, but also narrower-host-range plasmids, such as pKM101, all encoding MPFT-type IV secretion systems, were able to transfer plasmid DNA from E. coli to S. elongatus by conjugation. Neither MPFF nor MPFI could be used as interphylum DNA delivery agents. Reciprocally, pANL-derived cointegrates could be introduced in E. coli by electroporation, where they conferred a functional phenotype. These results suggest the existence of potentially ample channels of gene flow between proteobacteria and cyanobacteria and point to MPFT-based interphylum conjugation as a potential mechanism to explain the proteobacterial origin of a majority of S. elongatus xenologous genes. PMID:24509315

  9. Survival in soils of an herbicide-resistant Pseudomonas putida strain bearing a recombinant TOL plasmid.

    PubMed Central

    Ramos, J L; Duque, E; Ramos-Gonzalez, M I

    1991-01-01

    Pseudomonas putida EEZ15(pWW0-EB62) is a phosphinothricin (PPT)-resistant strain with a recombinant TOL plasmid which allows the strain to grow on p-ethylbenzoate. The survival of this strain in sterile agricultural soils depends on the physicochemical properties of the soil. The recombinant pWW0-EB62 plasmid and its catabolic functions were stable for periods of up to 1 month in bacteria introduced in unamended soils and only conferred selective advantage to the host bacteria without the plasmid or with the natural pWW0 plasmid when the soils were amended with low amounts of p-ethylbenzoate. The addition to soils of aromatics that are cometabolized by P. putida EEZ15(pWW0-EB62) had a detrimental effect on the survival of the bacteria, whereas low amounts of aromatics that are not metabolized by this bacterium had no effect on their survival. Survival of P. putida EEZ15(pWW0-EB62) was better at 4 and 25 degrees C than at 37 degrees C. The host bacterium carrying the recombinant pWW0-EB62 plasmid was established in unsterile soils. PMID:2036014

  10. Biomedical Conferences

    NASA Technical Reports Server (NTRS)

    1976-01-01

    As a result of Biomedical Conferences, Vivo Metric Systems Co. has produced cardiac electrodes based on NASA technology. Frequently in science, one highly specialized discipline is unaware of relevant advances made in other areas. In an attempt to familiarize researchers in a variety of disciplines with medical problems and needs, NASA has sponsored conferences that bring together university scientists, practicing physicians and manufacturers of medical instruments.

  11. Complete Nucleotide Sequence of pGA45, a 140,698-bp IncFIIY Plasmid Encoding blaIMI-3-Mediated Carbapenem Resistance, from River Sediment

    PubMed Central

    Dang, Bingjun; Mao, Daqing; Luo, Yi

    2016-01-01

    Plasmid pGA45 was isolated from the sediments of Haihe River using Escherichia coli CV601 (gfp-tagged) as recipients and indigenous bacteria from sediment as donors. This plasmid confers reduced susceptibility to imipenem which belongs to carbapenem group. Plasmid pGA45 was fully sequenced on an Illumina HiSeq 2000 sequencing system. The complete sequence of plasmid pGA45 was 140,698 bp in length with an average G + C content of 52.03%. Sequence analysis shows that pGA45 belongs to IncFIIY group and harbors a backbone region which shares high homology and gene synteny to several other IncF plasmids including pNDM1_EC14653, pYDC644, pNDM-Ec1GN574, pRJF866, pKOX_NDM1, and pP10164-NDM. In addition to the backbone region, plasmid pGA45 harbors two notable features including one blaIMI-3-containing region and one type VI secretion system region. The blaIMI-3-containing region is responsible for bacteria carbapenem resistance and the type VI secretion system region is probably involved in bacteria virulence, respectively. Plasmid pGA45 represents the first complete nucleotide sequence of the blaIMI-harboring plasmid from environment sample and the sequencing of this plasmid provided insight into the architecture used for the dissemination of blaIMI carbapenemase genes. PMID:26941718

  12. Complete Nucleotide Sequence of pGA45, a 140,698-bp IncFIIY Plasmid Encoding bla IMI-3-Mediated Carbapenem Resistance, from River Sediment.

    PubMed

    Dang, Bingjun; Mao, Daqing; Luo, Yi

    2016-01-01

    Plasmid pGA45 was isolated from the sediments of Haihe River using Escherichia coli CV601 (gfp-tagged) as recipients and indigenous bacteria from sediment as donors. This plasmid confers reduced susceptibility to imipenem which belongs to carbapenem group. Plasmid pGA45 was fully sequenced on an Illumina HiSeq 2000 sequencing system. The complete sequence of plasmid pGA45 was 140,698 bp in length with an average G + C content of 52.03%. Sequence analysis shows that pGA45 belongs to IncFIIY group and harbors a backbone region which shares high homology and gene synteny to several other IncF plasmids including pNDM1_EC14653, pYDC644, pNDM-Ec1GN574, pRJF866, pKOX_NDM1, and pP10164-NDM. In addition to the backbone region, plasmid pGA45 harbors two notable features including one bla IMI-3-containing region and one type VI secretion system region. The bla IMI-3-containing region is responsible for bacteria carbapenem resistance and the type VI secretion system region is probably involved in bacteria virulence, respectively. Plasmid pGA45 represents the first complete nucleotide sequence of the bla IMI-harboring plasmid from environment sample and the sequencing of this plasmid provided insight into the architecture used for the dissemination of bla IMI carbapenemase genes.

  13. Complete Nucleotide Sequence of pGA45, a 140,698-bp IncFIIY Plasmid Encoding bla IMI-3-Mediated Carbapenem Resistance, from River Sediment.

    PubMed

    Dang, Bingjun; Mao, Daqing; Luo, Yi

    2016-01-01

    Plasmid pGA45 was isolated from the sediments of Haihe River using Escherichia coli CV601 (gfp-tagged) as recipients and indigenous bacteria from sediment as donors. This plasmid confers reduced susceptibility to imipenem which belongs to carbapenem group. Plasmid pGA45 was fully sequenced on an Illumina HiSeq 2000 sequencing system. The complete sequence of plasmid pGA45 was 140,698 bp in length with an average G + C content of 52.03%. Sequence analysis shows that pGA45 belongs to IncFIIY group and harbors a backbone region which shares high homology and gene synteny to several other IncF plasmids including pNDM1_EC14653, pYDC644, pNDM-Ec1GN574, pRJF866, pKOX_NDM1, and pP10164-NDM. In addition to the backbone region, plasmid pGA45 harbors two notable features including one bla IMI-3-containing region and one type VI secretion system region. The bla IMI-3-containing region is responsible for bacteria carbapenem resistance and the type VI secretion system region is probably involved in bacteria virulence, respectively. Plasmid pGA45 represents the first complete nucleotide sequence of the bla IMI-harboring plasmid from environment sample and the sequencing of this plasmid provided insight into the architecture used for the dissemination of bla IMI carbapenemase genes. PMID:26941718

  14. Complete Nucleotide Sequence of IncP-1β Plasmid pDTC28 Reveals a Non-Functional Variant of the blaGES-Type Gene.

    PubMed

    Dang, Bingjun; Mao, Daqing; Luo, Yi

    2016-01-01

    Plasmid pDTC28 was isolated from the sediments of Haihe River using E. coli CV601 (gfp-tagged) as recipient and indigenous bacteria from the sediment as donors. This plasmid confers reduced susceptibility to tetracycline and sulfamethoxazole. The complete sequence of plasmid pDTC28 was 61,503 bp in length with an average G+C content of 64.09%. Plasmid pDTC28 belongs to the IncP-1β group by phylogenetic analysis. The backbones of plasmid pDTC28 and other IncP-1β plasmids are very classical and conserved, whereas the accessory regions of these plasmids are diverse. A blaGES-5-like gene was found on the accessory region, and this blaGES-5-like gene contained 18 silent mutations and 7 missense mutations compared with the blaGES-5 gene. The mutations resulted in 7 amino acid substitutions in GES-5 carbapenemase, causing the loss of function of the blaGES-5-like gene on plasmid pDTC28 against carbapenems and even β-lactams. The enzyme produced by the blaGES-5-like gene cassette may be a new variant of GES-type enzymes. Thus, the plasmid sequenced in this study will expand our understanding of GES-type β-lactamases and provide insights into the genetic platforms used for the dissemination of GES-type genes. PMID:27152950

  15. Replication and Control of Circular Bacterial Plasmids

    PubMed Central

    del Solar, Gloria; Giraldo, Rafael; Ruiz-Echevarría, María Jesús; Espinosa, Manuel; Díaz-Orejas, Ramón

    1998-01-01

    An essential feature of bacterial plasmids is their ability to replicate as autonomous genetic elements in a controlled way within the host. Therefore, they can be used to explore the mechanisms involved in DNA replication and to analyze the different strategies that couple DNA replication to other critical events in the cell cycle. In this review, we focus on replication and its control in circular plasmids. Plasmid replication can be conveniently divided into three stages: initiation, elongation, and termination. The inability of DNA polymerases to initiate de novo replication makes necessary the independent generation of a primer. This is solved, in circular plasmids, by two main strategies: (i) opening of the strands followed by RNA priming (theta and strand displacement replication) or (ii) cleavage of one of the DNA strands to generate a 3′-OH end (rolling-circle replication). Initiation is catalyzed most frequently by one or a few plasmid-encoded initiation proteins that recognize plasmid-specific DNA sequences and determine the point from which replication starts (the origin of replication). In some cases, these proteins also participate directly in the generation of the primer. These initiators can also play the role of pilot proteins that guide the assembly of the host replisome at the plasmid origin. Elongation of plasmid replication is carried out basically by DNA polymerase III holoenzyme (and, in some cases, by DNA polymerase I at an early stage), with the participation of other host proteins that form the replisome. Termination of replication has specific requirements and implications for reinitiation, studies of which have started. The initiation stage plays an additional role: it is the stage at which mechanisms controlling replication operate. The objective of this control is to maintain a fixed concentration of plasmid molecules in a growing bacterial population (duplication of the plasmid pool paced with duplication of the bacterial population

  16. A novel suicide shuttle plasmid for Streptococcus suis serotype 2 and Streptococcus equi ssp. zooepidemicus gene mutation

    PubMed Central

    Liu, Rui; Zhang, Ping; Su, Yiqi; Lin, Huixing; Zhang, Hui; Yu, Lei; Ma, Zhe; Fan, Hongjie

    2016-01-01

    The mariner-based Himar1 system has been utilized for creating mutant libraries of many Gram-positive bacteria. Streptococcus suis serotype 2 (SS2) and Streptococcus equi ssp. zooepidemicus (SEZ) are primary pathogens of swine that threaten the swine industry in China. To provide a forward-genetics technology for finding virulent phenotype-related genes in these two pathogens, we constructed a novel temperature-sensitive suicide shuttle plasmid, pMar4s, which contains the Himar1 system transposon, TnYLB-1, and the Himar1 C9 transposase from pMarA and the repTAs temperature-sensitive fragment from pSET4s. The kanamycin (Kan) resistance gene was in the TnYLB-1 transposon. Temperature sensitivity and Kan resistance allowed the selection of mutant strains and construction of the mutant library. The SS2 and SEZ mutant libraries were successfully constructed using the pMar4s plasmid. Inverse-Polymerase Chain Reaction (Inverse-PCR) results revealed large variability in transposon insertion sites and that the library could be used for phenotype alteration screening. The thiamine biosynthesis gene apbE was screened for its influence on SS2 anti-phagocytosis; likewise, the sagF gene was identified to be a hemolytic activity-related gene in SEZ. pMar4s was suitable for mutant library construction, providing more information regarding SS2 and SEZ virulence factors and illustrating the pathogenesis of swine streptococcosis. PMID:27256117

  17. A novel suicide shuttle plasmid for Streptococcus suis serotype 2 and Streptococcus equi ssp. zooepidemicus gene mutation.

    PubMed

    Liu, Rui; Zhang, Ping; Su, Yiqi; Lin, Huixing; Zhang, Hui; Yu, Lei; Ma, Zhe; Fan, Hongjie

    2016-01-01

    The mariner-based Himar1 system has been utilized for creating mutant libraries of many Gram-positive bacteria. Streptococcus suis serotype 2 (SS2) and Streptococcus equi ssp. zooepidemicus (SEZ) are primary pathogens of swine that threaten the swine industry in China. To provide a forward-genetics technology for finding virulent phenotype-related genes in these two pathogens, we constructed a novel temperature-sensitive suicide shuttle plasmid, pMar4s, which contains the Himar1 system transposon, TnYLB-1, and the Himar1 C9 transposase from pMarA and the repTAs temperature-sensitive fragment from pSET4s. The kanamycin (Kan) resistance gene was in the TnYLB-1 transposon. Temperature sensitivity and Kan resistance allowed the selection of mutant strains and construction of the mutant library. The SS2 and SEZ mutant libraries were successfully constructed using the pMar4s plasmid. Inverse-Polymerase Chain Reaction (Inverse-PCR) results revealed large variability in transposon insertion sites and that the library could be used for phenotype alteration screening. The thiamine biosynthesis gene apbE was screened for its influence on SS2 anti-phagocytosis; likewise, the sagF gene was identified to be a hemolytic activity-related gene in SEZ. pMar4s was suitable for mutant library construction, providing more information regarding SS2 and SEZ virulence factors and illustrating the pathogenesis of swine streptococcosis. PMID:27256117

  18. PemK toxin encoded by the Xylella fastidiosa IncP-1 plasmid pXF-RIV11 is a ribonuclease

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Stable inheritance of the IncP-1 plasmid pXF-RIV11 in Xylella fastidiosa is conferred by the pemI/pemK plasmid addiction system. PemK serves as a toxin inhibiting bacterial growth; PemI is the corresponding antitoxin that blocks activity of PemK toxin by direct binding. Here, PemK toxin and PemI ant...

  19. Thermosensitive H1 plasmids determining citrate utilization.

    PubMed

    Smith, H W; Parsell, Z; Green, P

    1978-12-01

    Twelve thermosensitive H1 plasmids from strains of Salmonella typhi that had caused outbreaks of chloramphenicol-resistant typhoid fever in Vietnam, Thailand and India mediated citrate utilization (Cit+) in a prototrophic Escherichia coli K12 strain but not in the S. typhi strains from which they were derived. Four H1 plasmids from a similar outbreak in Mexico differed from the Far Eastern plasmids in not mediating citrate utlization but in mediating mercury resistance. H1 plasmids resembling the Far Eastern and the Mexican plasmids in regard to citrate utilization and mercury resistance were found in sewage in Britain. Citrate utilization was transferred to eight pathogenic strains of E. coli and to one strain each of Shigella flexneri and Shigella sonnei. Cultures of Cit+ bacteria grew more rapidly in citrate media at 28 degrees C than at 37 degrees C. Plasmid mutants that were more efficient at utilizing citrate were present in all such cultures--they grew equally well or better at 37 degrees C than at 28 degrees C. None of 222 strains of E. coli or Shigella that contained a variety of different plasmids were able to utilize citrate. This property was not transferred to the prototrophic E. coli K12 strain from Citrobacter (3 strains), Salmonella (39 strains), Proteus (44 strains), Klebsiella pneumoniae (33 strains) or Pseudomonas aeruginosa (44 strains).

  20. Rolling-circle replication of bacterial plasmids.

    PubMed Central

    Khan, S A

    1997-01-01

    Many bacterial plasmids replicate by a rolling-circle (RC) mechanism. Their replication properties have many similarities to as well as significant differences from those of single-stranded DNA (ssDNA) coliphages, which also replicate by an RC mechanism. Studies on a large number of RC plasmids have revealed that they fall into several families based on homology in their initiator proteins and leading-strand origins. The leading-strand origins contain distinct sequences that are required for binding and nicking by the Rep proteins. Leading-strand origins also contain domains that are required for the initiation and termination of replication. RC plasmids generate ssDNA intermediates during replication, since their lagging-strand synthesis does not usually initiate until the leading strand has been almost fully synthesized. The leading- and lagging-strand origins are distinct, and the displaced leading-strand DNA is converted to the double-stranded form by using solely the host proteins. The Rep proteins encoded by RC plasmids contain specific domains that are involved in their origin binding and nicking activities. The replication and copy number of RC plasmids, in general, are regulated at the level of synthesis of their Rep proteins, which are usually rate limiting for replication. Some RC Rep proteins are known to be inactivated after supporting one round of replication. A number of in vitro replication systems have been developed for RC plasmids and have provided insight into the mechanism of plasmid RC replication. PMID:9409148

  1. Generalized transduction of small Yersinia enterocolitica plasmids.

    PubMed

    Hertwig, S; Popp, A; Freytag, B; Lurz, R; Appel, B

    1999-09-01

    To study phage-mediated gene transfer in Yersinia, the ability of Yersinia phages to transduce naturally occurring plasmids was investigated. The transduction experiments were performed with a temperate phage isolated from a pathogenic Yersinia enterocolitica strain and phage mixtures isolated from sewage. Small plasmids (4.3 and 5.8 kb) were transduced at a frequency of 10(-5) to 10(-7)/PFU. However, we could not detect the transduction of any indigenous virulence plasmid (ca. 72 kb) in pathogenic Yersinia strains. Transductants obtained by infection with the temperate phage were lysogenic and harbored the phage genome in their chromosomes.

  2. pRMH760, a precursor of A/C₂ plasmids carrying blaCMY and blaNDM genes.

    PubMed

    Harmer, Christopher J; Hall, Ruth M

    2014-10-01

    To investigate the evolution of plasmids in the repA/C2 group carrying genes conferring resistance to cephalosporins (bla(CMY)) or to carbapenems (bla(NDM)) and cephalosporins (bla(CMY)), the sequence of plasmid pRMH760 that lacks the β-lactamase genes was determined and compared to all available A/C2 plasmid sequences. pRMH760 is 170.6 kb and carries several antibiotic resistance genes in a 45.1 kb complex transposon structure located upstream of the rhs gene. In plasmid pR148, the closest relative of pRMH760, the antibiotic resistance island is in the same position but the resistance genes differ. pRMH760 also contains a deletion in the rhs gene. Sequenced A/C2 plasmids containing bla(CMY) or bla(CMY) and bla(NDM) have backbones closely related to the pRMH760/pR148 backbone, and they include resistance islands in the same location, indicating that they arose from a plasmid related to pRMH760/pR148. However, the gene content of this resistance island differs in each case, and the island family was designated ARI-A. The bla(NDM) gene is within ARI-A. The ISEcp1-bla(CMY) fragment is located elsewhere and is always in the same location, consistent with a single acquisition event. Plasmids containing only bla(CMY) carry a second resistance island, designated ARI-B, which includes the sul2 gene and a variable set of further resistance genes. Nine A/C2 plasmids that were not of this type (type 1) were found to have a similar backbone that can be simply distinguished by the presence of two exchanged regions and two insertions. Antibiotic resistance islands in type 2 plasmids are in different locations and have different structures.

  3. Plasmids as Tools for Containment.

    PubMed

    García, José L; Díaz, Eduardo

    2014-10-01

    Active containment systems are a major tool for reducing the uncertainty associated with the introduction of monocultures, genetically engineered or not, into target habitats for a large number of biotechnological applications (e.g., bioremediation, bioleaching, biopesticides, biofuels, biotransformations, live vaccines, etc.). While biological containment reduces the survival of the introduced organism outside the target habitat and/or upon completion of the projected task, gene containment strategies reduce the lateral spread of the key genetic determinants to indigenous microorganisms. In fundamental research, suicide circuits become relevant tools to address the role of gene transfer, mainly plasmid transfer, in evolution and how this transfer contributes to genome plasticity and to the rapid adaptation of microbial communities to environmental changes. Many lethal functions and regulatory circuits have been used and combined to design efficient containment systems. As many new genomes are being sequenced, novel lethal genes and regulatory elements are available, e.g., new toxin-antitoxin modules, and they could be used to increase further the current containment efficiencies and to expand containment to other organisms. Although the current containment systems can increase the predictability of genetically modified organisms in the environment, containment will never be absolute, due to the existence of mutations that lead to the appearance of surviving subpopulations. In this sense, orthogonal systems (xenobiology) appear to be the solution for setting a functional genetic firewall that will allow absolute containment of recombinant organisms. PMID:26104372

  4. Auxotrophic markers pyrF and proC can replace antibiotic markers on protein production plasmids in high-cell-density Pseudomonas fluorescens fermentation.

    PubMed

    Schneider, Jane C; Jenings, Annika F; Mun, Deborah M; McGovern, Patricia M; Chew, Lawrence C

    2005-01-01

    The use of antibiotic-resistance genes as selectable markers in transgenic organisms is coming under increased scrutiny, for fear that they may spread to human pathogens, thereby reducing the effectiveness of antibiotic therapy. A current Pseudomonas fluorescens protein expression system uses a tetracycline resistance gene (tetR/tetA) to maintain an expression plasmid under control of a repressible promoter and a kanamycin resistance gene (kanR) to maintain a plasmid carrying a repressor gene. We investigated using auxotrophic markers to replace these two antibiotic resistance genes: pyrF (encoding orotidine-5'-phosphate decarboxylase) in place of tetR/tetA and proC (encoding pyrroline-5-carboxylate reductase) in place of kanR, complementing their respective precise chromosomal deletions created by allele exchange using a suicide vector carrying pyrF as a counterselectable marker. The resulting strains, devoid of antibiotic-resistance genes, were shown to achieve high productivity of nitrilase and thermostable alpha-amylase equal to that of the former antibiotic-resistant production host. The production plasmids were stable. The pyrF (uracil-dependent) background of the production host strain also allows us to sequentially alter the genome to incorporate other desired genomic changes, deletions, or insertions using 5'-fluoroorotic acid counterselection, restoring the selectable marker after each step.

  5. SIMPLAS: A Simulation of Bacterial Plasmid Maintenance.

    ERIC Educational Resources Information Center

    Dunn, A.; And Others

    1988-01-01

    This article describes a computer simulation of bacterial physiology during growth in a chemostat. The program was designed to help students to appreciate and understand the related effects of parameters which influence plasmid persistence in bacterial populations. (CW)

  6. Comparison of 10 IncP plasmids: homology in the regions involved in plasmid replication.

    PubMed Central

    Chikami, G K; Guiney, D G; Schmidhauser, T J; Helinski, D R

    1985-01-01

    We have examined the DNA homology in the replication regions of 10 IncP plasmids independently isolated from several different countries. Two regions of RK2, the best-studied plasmid of this group, are required for vegetative DNA replication: the origin of replication (oriV) and the trfA region, which codes for a gene product necessary for replication. Six of nine IncP plasmids studied were identical to RK2 in the oriV and trfA regions as shown by Southern hybridization. Three P plasmids, R751, R772, and R906, showed weaker homology with the RK2 trfA, region and hybridized to different-sized HaeII fragments than the other six plasmids. R751, R772, and R906 hybridized to the region of the RK2 replication origin which expresses P incompatibility but differed markedly from RK2 and the other six plasmids in the GC-rich region of the origin required for replication. These data indicate that the P-group plasmids can be divided into two subgroups: IncP alpha, which includes the RK2-like plasmids, and IncP beta which includes the R751-like plasmids. Images PMID:2985542

  7. Plasmid-mediated mineralization of 4-chlorobiphenyl.

    PubMed Central

    Shields, M S; Hooper, S W; Sayler, G S

    1985-01-01

    Strains of Alcaligenes and Acinetobacter spp. were isolated from a mixed culture already proven to be proficient at complete mineralization of monohalogenated biphenyls. These strains were shown to harbor a 35 X 10(6)-dalton plasmid mediating a complete pathway for 4-chlorobiphenyl (4CB) oxidation. Subsequent plasmid curing of these bacteria resulted in the abolishment of the 4CB mineralization phenotype and loss of even early 4CB metabolism by Acinetobacter spp. Reestablishment of the Alcaligenes plasmid, denoted pSS50, in the cured Acinetobacter spp. via filter surface mating resulted in the restoration of 4CB mineralization abilities. 4CB mineralization, however, proved to be an unstable characteristic in some subcultured strains. Such loss was not found to coincide with any detectable alteration in plasmid size. Cultures capable of complete mineralization, as well as those limited to partial metabolism of 4CB, produced 4-chlorobenzoate as a metabolite. Demonstration of mineralization of a purified 14C-labeled chlorobenzoate showed it to be a true intermediate in 4CB mineralization. Unlike the mineralization capability, the ability to produce a metabolite has proven to be stable on subculture. These results indicate the occurrence of a novel plasmid, or evolved catabolic plasmid, that mediates the complete mineralization of 4CB. Images PMID:2993249

  8. The master activator of IncA/C conjugative plasmids stimulates genomic islands and multidrug resistance dissemination.

    PubMed

    Carraro, Nicolas; Matteau, Dominick; Luo, Peng; Rodrigue, Sébastien; Burrus, Vincent

    2014-10-01

    Dissemination of antibiotic resistance genes occurs mostly by conjugation, which mediates DNA transfer between cells in direct contact. Conjugative plasmids of the IncA/C incompatibility group have become a substantial threat due to their broad host-range, the extended spectrum of antimicrobial resistance they confer, their prevalence in enteric bacteria and their very efficient spread by conjugation. However, their biology remains largely unexplored. Using the IncA/C conjugative plasmid pVCR94ΔX as a prototype, we have investigated the regulatory circuitry that governs IncA/C plasmids dissemination and found that the transcriptional activator complex AcaCD is essential for the expression of plasmid transfer genes. Using chromatin immunoprecipitation coupled with exonuclease digestion (ChIP-exo) and RNA sequencing (RNA-seq) approaches, we have identified the sequences recognized by AcaCD and characterized the AcaCD regulon. Data mining using the DNA motif recognized by AcaCD revealed potential AcaCD-binding sites upstream of genes involved in the intracellular mobility functions (recombination directionality factor and mobilization genes) in two widespread classes of genomic islands (GIs) phylogenetically unrelated to IncA/C plasmids. The first class, SGI1, confers and propagates multidrug resistance in Salmonella enterica and Proteus mirabilis, whereas MGIVmi1 in Vibrio mimicus belongs to a previously uncharacterized class of GIs. We have demonstrated that through expression of AcaCD, IncA/C plasmids specifically trigger the excision and mobilization of the GIs at high frequencies. This study provides new evidence of the considerable impact of IncA/C plasmids on bacterial genome plasticity through their own mobility and the mobilization of genomic islands.

  9. An Invertron-Like Linear Plasmid Mediates Intracellular Survival and Virulence in Bovine Isolates of Rhodococcus equi

    PubMed Central

    Valero-Rello, Ana; Hapeshi, Alexia; Anastasi, Elisa; Alvarez, Sonsiray; Scortti, Mariela; Meijer, Wim G.; MacArthur, Iain

    2015-01-01

    We report a novel host-associated virulence plasmid in Rhodococcus equi, pVAPN, carried by bovine isolates of this facultative intracellular pathogenic actinomycete. Surprisingly, pVAPN is a 120-kb invertron-like linear replicon unrelated to the circular virulence plasmids associated with equine (pVAPA) and porcine (pVAPB variant) R. equi isolates. pVAPN is similar to the linear plasmid pNSL1 from Rhodococcus sp. NS1 and harbors six new vap multigene family members (vapN to vapS) in a vap pathogenicity locus presumably acquired via en bloc mobilization from a direct predecessor of equine pVAPA. Loss of pVAPN rendered R. equi avirulent in macrophages and mice. Mating experiments using an in vivo transconjugant selection strategy demonstrated that pVAPN transfer is sufficient to confer virulence to a plasmid-cured R. equi recipient. Phylogenetic analyses assigned the vap multigene family complement from pVAPN, pVAPA, and pVAPB to seven monophyletic clades, each containing plasmid type-specific allelic variants of a precursor vap gene carried by the nearest vap island ancestor. Deletion of vapN, the predicted “bovine-type” allelic counterpart of vapA, essential for virulence in pVAPA, abrogated pVAPN-mediated intramacrophage proliferation and virulence in mice. Our findings support a model in which R. equi virulence is conferred by host-adapted plasmids. Their central role is mediating intracellular proliferation in macrophages, promoted by a key vap determinant present in the common ancestor of the plasmid-specific vap islands, with host tropism as a secondary trait selected during coevolution with specific animal species. PMID:25895973

  10. The Master Activator of IncA/C Conjugative Plasmids Stimulates Genomic Islands and Multidrug Resistance Dissemination

    PubMed Central

    Luo, Peng; Rodrigue, Sébastien; Burrus, Vincent

    2014-01-01

    Dissemination of antibiotic resistance genes occurs mostly by conjugation, which mediates DNA transfer between cells in direct contact. Conjugative plasmids of the IncA/C incompatibility group have become a substantial threat due to their broad host-range, the extended spectrum of antimicrobial resistance they confer, their prevalence in enteric bacteria and their very efficient spread by conjugation. However, their biology remains largely unexplored. Using the IncA/C conjugative plasmid pVCR94ΔX as a prototype, we have investigated the regulatory circuitry that governs IncA/C plasmids dissemination and found that the transcriptional activator complex AcaCD is essential for the expression of plasmid transfer genes. Using chromatin immunoprecipitation coupled with exonuclease digestion (ChIP-exo) and RNA sequencing (RNA-seq) approaches, we have identified the sequences recognized by AcaCD and characterized the AcaCD regulon. Data mining using the DNA motif recognized by AcaCD revealed potential AcaCD-binding sites upstream of genes involved in the intracellular mobility functions (recombination directionality factor and mobilization genes) in two widespread classes of genomic islands (GIs) phylogenetically unrelated to IncA/C plasmids. The first class, SGI1, confers and propagates multidrug resistance in Salmonella enterica and Proteus mirabilis, whereas MGIVmi1 in Vibrio mimicus belongs to a previously uncharacterized class of GIs. We have demonstrated that through expression of AcaCD, IncA/C plasmids specifically trigger the excision and mobilization of the GIs at high frequencies. This study provides new evidence of the considerable impact of IncA/C plasmids on bacterial genome plasticity through their own mobility and the mobilization of genomic islands. PMID:25340549

  11. Clostridium perfringens type A-E toxin plasmids.

    PubMed

    Freedman, John C; Theoret, James R; Wisniewski, Jessica A; Uzal, Francisco A; Rood, Julian I; McClane, Bruce A

    2015-05-01

    Clostridium perfringens relies upon plasmid-encoded toxin genes to cause intestinal infections. These toxin genes are associated with insertion sequences that may facilitate their mobilization and transfer, giving rise to new toxin plasmids with common backbones. Most toxin plasmids carry a transfer of clostridial plasmids locus mediating conjugation, which likely explains the presence of similar toxin plasmids in otherwise unrelated C. perfringens strains. The association of many toxin genes with insertion sequences and conjugative plasmids provides virulence flexibility when causing intestinal infections. However, incompatibility issues apparently limit the number of toxin plasmids maintained by a single cell.

  12. Conference Summary

    NASA Technical Reports Server (NTRS)

    Harrington, James L., Jr.

    2000-01-01

    Celebrations and special events were in order this year as the Minority University-Space Interdisciplinary Network (MU-SPIN) Program and NASA's Minority University Research and Education Division (MURED) both reached their 10th anniversaries. In honor of this occasion, the 2000 Annual Users' Conference held at Morris Brown College (MBC) in Atlanta, Georgia, September 11-15, 2000, was the first to be jointly hosted by MU-SPIN and MURED. It was particularly fitting that this anniversary should fall in the year 2000. The start of the new millennium propelled us to push bold new ideas and renew our commitment to minority university participation in all areas of NASA. With the theme 'Celebrating Our Tenth Year With Our Eyes on the Prize,' the conference provided a national forum for showcasing successful MU-SPIN and MURED Program (MUREP) experiences to enhance faculty/student development in areas of scientific and technical research and education. Our NASA-relevant conference agenda resulted in a record-breaking 220 registered attendees. Using feedback from past participants, we designed a track of student activities closely tailored to their interests. The resulting showcase of technical assistance and best practices set a new standard for our conferences in the years to come. This year's poster session was our largest ever, with over 50 presentations from students, faculty, and teachers. Posters covered a broad range of NASA activities from 'A Study of the Spiral Galaxy M101' to 'Network Cabling Characteristics.'

  13. Cloning, nucleotide sequence, and expression of the chromate resistance determinant of Pseudomonas aeruginosa plasmid pUM505.

    PubMed Central

    Cervantes, C; Ohtake, H; Chu, L; Misra, T K; Silver, S

    1990-01-01

    The chromate resistance determinant of Pseudomonas aeruginosa plasmid pUM505 was cloned into broad-host-range vector pSUP104. The hybrid plasmid containing an 11.1-kilobase insert conferred chromate resistance and reduced uptake of chromate in P. aeruginosa PAO1. Resistance to chromate was not expressed in Escherichia coli. Contiguous 1.6- and 6.3-kilobase HindIII fragments from this plasmid hybridized to pUM505 but not to P. aeruginosa chromosomal DNA and only weakly to chromate resistance plasmids pLHB1 and pMG6. Further subcloning produced a plasmid with an insert of 2,145 base pairs, which was sequenced. Analysis of deletions revealed that a single open reading frame was sufficient to determine chromate resistance. This open reading frame encodes a highly hydrophobic polypeptide, ChrA, of 416 amino acid residues that appeared to be expressed in E. coli under control of the T7 promoter. No significant homology was found between ChrA and proteins in the amino acid sequence libraries, but 29% amino acid identity was found with the ChrA amino acid sequence for another chromate resistance determinant sequenced in this laboratory from an Alcaligenes eutrophus plasmid (A. Nies, D. Nies, and S. Silver, submitted for publication). Images FIG. 3 FIG. 5 PMID:2152903

  14. Limited-host-range plasmid of Agrobacterium tumefaciens: molecular and genetic analyses of transferred DNA.

    PubMed Central

    Yanofsky, M; Montoya, A; Knauf, V; Lowe, B; Gordon, M; Nester, E

    1985-01-01

    A tumor-inducing (Ti) plasmid from a strain of Agrobacterium tumefaciens that induces tumors on only a limited range of plants was characterized and compared with the Ti plasmids from strains that induce tumors on a wide range of plants. Whereas all wide-host-range Ti plasmids characterized to date contain closely linked oncogenic loci within a single transferred DNA (T-DNA) region, homology to these loci is divided into two widely separated T-DNA regions on the limited-host-range plasmid. These two plasmid regions, TA-DNA and TB-DNA, are separated by approximately 25 kilobases of DNA which is not maintained in the tumor. The TA-DNA region resembles a deleted form of the wide-host-range TL-DNA and contains a region homologous to the cytokinin biosynthetic gene. However, a region homologous to the two auxin biosynthetic loci of the wide-host-range plasmid mapped within the TB-DNA region. These latter genes play an important role in tumor formation because mutations in these loci result in a loss of virulence on Nicotiana plants. Furthermore, the TB-DNA region alone conferred tumorigenicity onto strains with an intact set of vir genes. Our results suggest that factors within both the T-DNA and the vir regions contribute to the expression of host range in Agrobacterium species. There was a tremendous variation among plants in susceptibility to tumor formation by various A. tumefaciens strains. This variation occurred not only among different plant species, but also among different varieties of plants within the same genus. Images PMID:4008445

  15. N15: the linear phage-plasmid.

    PubMed

    Ravin, Nikolai V

    2011-03-01

    The lambdoid phage N15 of Escherichia coli is very unusual among temperate phages in that its prophage is not integrated into chromosome but is a linear plasmid molecule with covalently closed ends. Upon infection the phage DNA circularises via cohesive ends, then phage-encoded enzyme, protelomerase, cuts at an inverted repeat site and forms hairpin ends (telomeres) of the linear plasmid prophage. Replication of the N15 prophage is initiated at an internally located ori site and proceeds bidirectionally resulting in formation of duplicated telomeres. Then the N15 protelomerase cuts duplicated telomeres generating two linear plasmid molecules with hairpin telomeres. Stable inheritance of the plasmid prophage is ensured by partitioning operon similar to the F factor sop operon. Unlike F sop, the N15 centromere consists of four inverted repeats dispersed in the genome. The multiplicity and dispersion of centromeres are required for efficient partitioning of a linear plasmid. The centromeres are located in N15 genome regions involved in phage replication and control of lysogeny, and binding of partition proteins at these sites regulates these processes. Two N15-related lambdoid Siphoviridae phages, φKO2 in Klebsiella oxytoca and pY54 in Yersinia enterocolitica, also lysogenize their hosts as linear plasmids, as well as Myoviridae marine phages VP882 and VP58.5 in Vibrio parahaemolyticus and ΦHAP-1 in Halomonas aquamarina. The genomes of all these phages contain similar protelomerase genes, lysogeny modules and replication genes, as well as plasmid-partitioning genes, suggesting that these phages may belong to a group diverged from a common ancestor.

  16. A versatile low-copy-number cloning vector derived from plasmid F.

    PubMed

    Shi, J; Biek, D P

    1995-10-16

    We have constructed a cloning vector based on plasmid mini-F for use in Escherichia coli. Plasmid pZC320 consists of the ori-2 replication unit of F that confers very low copy number (lcn), and includes the sop partition functions to insure stable plasmid maintenance in the absence of selection. A multiple cloning site (MCS) containing 16 unique restriction sites is located within the 5' end of the lacZ alpha gene. Expression of lacZ alpha is under the control of the wild-type lactose operator/promoter (lacOP) region and is efficiently repressed by the lacI repressor. Clones containing inserts can be detected using the blue/white screen for beta-galactosidase (beta Gal). A T7 promoter allows transcription of cloned inserts in the presence of T7 RNA polymerase. We have demonstrated the use of this lcn vector for cloning the regulated tetracycline-resistance genes from Tn10, which confer only low-level resistance when present at high copy number.

  17. Human clinical trials of plasmid DNA vaccines.

    PubMed

    Liu, Margaret A; Ulmer, Jeffrey B

    2005-01-01

    This article gives an overview of DNA vaccines with specific emphasis on the development of DNA vaccines for clinical trials and an overview of those trials. It describes the preclinical research that demonstrated the efficacy of DNA vaccines as well as an explication of the immunologic mechanisms of action. These include the induction of cognate immune responses, such as the generation of cytolytic T lymphocytes (CTL) as well as the effect of the plasmid DNA upon the innate immune system. Specific issues related to the development of DNA as a product candidate are then discussed, including the manufacture of plasmid, the qualification of the plasmid DNA product, and the safety testing necessary for initiating clinical trials. Various human clinical trials for infectious diseases and cancer have been initiated or completed, and an overview of these trials is given. Finally, because the early clinical trials have shown less than optimal immunogenicity, methods to increase the potency of the vaccines are described. PMID:16291211

  18. Preparation of Pichia pastoris expression plasmids.

    PubMed

    Logez, Christel; Alkhalfioui, Fatima; Byrne, Bernadette; Wagner, Renaud

    2012-01-01

    When planning any heterologous expression experiment, the very first critical step is related to the design of the overall strategy, hence to the selection of the most adapted expression vector. The very flexible Pichia pastoris system offers a broad range of possibilities for the production of secreted, endogenous or membrane proteins thanks to a combination of various plasmid backbones, selection markers, promoters and fusion sequences introduced into dedicated host strains. The present chapter provides some guidelines on the choice of expression vectors and expression strategies. It also brings the reader a complete toolbox from which plasmids and fusion sequences can be picked and assembled to set up appropriate expression vectors. Finally, it provides standard starting protocols for the preparation of the selected plasmids and their use for host strain transformation.

  19. Diversity and Homogeneity among Small Plasmids of Aeromonas salmonicida subsp. salmonicida Linked with Geographical Origin

    PubMed Central

    Attéré, Sabrina A.; Vincent, Antony T.; Trudel, Mélanie V.; Chanut, Romain; Charette, Steve J.

    2015-01-01

    Furunculosis, which is caused by Aeromonas salmonicida subsp. salmonicida, is a major salmonid disease in fish farms worldwide. Several plasmids found in this bacterium confer phenotypes such drug resistance and virulence. Small plasmids (pAsa1, pAsa2, pAsa3, and pAsal1) related to ColE1- and ColE2-type replicons are usually present in its normal plasmidome. In the present study, with the objective to investigate if these plasmids display particularities related to the origin of the isolates bearing them, a total of 153 isolates, including 78 new and 75 previously described, were analyzed for the presence of small plasmids by PCR and DNA restriction fragment profiling. A geographical dichotomy between Canadian and European isolates for their propensity to do not have pAsa3 or pAsal1 was found. In addition, the genotyping analysis led to the identification of two European isolates harboring an unusual pAsal1. An investigation by next-generation sequencing (NGS) of these two isolates shed light on two pAsal1 variants (pAsal1C and pAsal1D). As with pAsal1B, another pAsal1 variant previously described, these two new variants bore a second insertion sequence (ISAS5) in addition to the usual ISAS11. The characterization of these variants suggested that they could predominate over the wild-type pAsal1 in stressful conditions such as growth at temperatures of 25°C and above. To obtain a comprehensive portrait of the mutational pressure on small plasmids, 26 isolates whose DNA had been sequenced by NGS were investigated. pAsa3 and pAsal1 were more prone to mutations than pAsa1 and pAsa2, especially in the mobA gene, which encodes a relaxase and a primase. Lastly, the average copy number of each plasmid per cell was assessed using raw sequencing data. A clear trend with respect to the relative proportion per cell of each plasmid was identified. Our large-scale study revealed a geographical dichotomy in small plasmid repertoire in addition to a clear trend for pAsa3 and p

  20. Distribution of small native plasmids in Streptococcus pyogenes in India.

    PubMed

    Bergmann, René; Nerlich, Andreas; Chhatwal, Gursharan S; Nitsche-Schmitz, D Patric

    2014-05-01

    Complete characterization of a Streptococcus pyogenes population from a defined geographic region comprises information on the plasmids that circulate in these bacteria. Therefore, we determined the distribution of small plasmids (<5kb) in a collection of 279 S. pyogenes isolates from India, where diversity of strains and incidence rates of S. pyogenes infections are high. The collection comprised 77 emm-types. For plasmid detection and discrimination, we developed PCRs for different plasmid replication initiation protein genes, the putative repressor gene copG and bacteriocin genes dysA and scnM57. Plasmid distribution was limited to 13 emm-types. Co-detection analysis using aforementioned PCRs revealed four distinct plasmid sub-types, two of which were previously unknown. Representative plasmids pA852 and pA996 of the two uncharacterized plasmid sub-types were sequenced. These two plasmids could be assigned to the pMV158 and the pC194/pUB110 family of rolling-circle plasmids, respectively. The majority of small plasmids found in India belonged to the two newly characterized sub-types, with pA852- and pA996-like plasmids amounting to 42% and 22% of all detected plasmids, respectively. None of the detected plasmids coded for a known antibiotic resistance gene. Instead, all of the four plasmid sub-types carried known or potential bacteriocin genes. These genes may have influence on the evolutionary success of certain S. pyogenes genotypes. Notably, pA852-like plasmids were found in all isolates of the most prevalent emm-type 11.0. Together, a priori fitness of this genotype and increased fitness due to the acquired plasmids may have rendered type emm11.0 successful and caused the prevalence of pA852-like plasmids in India.

  1. Electrotransfer of Plasmid Vector DNA into Muscle

    NASA Astrophysics Data System (ADS)

    Miyazaki, Satsuki; Miyazaki, Jun-Ichi

    Wolff et al. (1990) first reported that plasmid DNA injected into skeletal muscle is taken up by muscle cells and the genes in the plasmid are expressed for more than two months thereafter, although the transfected DNA does not usually undergo chromosomal integration (Wolff et al., 1991, 1992). However, the relatively low expression levels attained by this method have hampered its applications for uses other than as a DNA vaccine (Davis et al., 1995). There are a number of reports analyzing the conditions that affect the efficiency of gene transfer by intramuscular DNA injection and assessing the fine structures of expression plasmid vectors that may affect expression levels (Davis et al., 1993; Liang et al., 1996; Norman et al., 1997). Furthermore, various attempts were done to improve the efficiency of gene transfer by intramus cular DNA injection. Consequently, regenerating muscle was shown to produce 80-fold or more protein than did normal muscle, following injection of an expression plas-mid. Muscle regeneration was induced by treatment with cardiotoxin or bupivacaine (Wells, 1993; Vitadello et al., 1994). We previously demonstrated that by combining a strong promoter and bupivacaine pretreatment intramuscular injection of an IL-5 expression plasmid results in IL-5 production in muscle at a level sufficient to induce marked proliferation of eosinophils in the bone marrow and eosinophil infiltration of various organs (Tokui et al., 1997). It was also reported that a single intramuscular injection of an erythropoietin expression plasmid produced physiologically significant elevations in serum erythropoietin levels and increased hematocrits in adult mice (Tripathy et al., 1996). Hematocrits in these animals remained elevated at >60% for at least 90 days after a single injection. However, improvements to this method have not been sufficient to extend its applications including clinical use.

  2. Spread of Plasmids Carrying Multiple GES Variants.

    PubMed

    Cuzon, Gaelle; Bogaerts, Pierre; Bauraing, Caroline; Huang, Te-Din; Bonnin, Rémy A; Glupczynski, Youri; Naas, Thierry

    2016-08-01

    Five GES-producing Enterobacteriaceae isolates that displayed an extended-spectrum β-lactamase (ESBL) phenotype harbored two GES variants: GES-7 ESBL and GES-6 carbapenemase. In all isolates, the two GES alleles were located on the same integron that was inserted into an 80-kb IncM1 self-conjugative plasmid. Whole-genome sequencing suggested in vivo horizontal gene transfer of the plasmid along with clonal diffusion of Enterobacter cloacae To our knowledge, this is the first description in Europe of clustered Enterobacteriaceae isolates carrying two GES β-lactamases, of which one has extended activity toward carbapenems. PMID:27216071

  3. Plasmidal maintenance of composite DNA derived from polyoma related plasmid, L factor.

    PubMed Central

    Saito, H; Uehara, H; Kusano, T; Oishi, M

    1987-01-01

    Recently, we reported a multicopy mammalian plasmid with a structure related to polyoma. The plasmid, named L factor, was found at a high copy number (5,000 or more per cell) in a subclone derived from mouse L cells. We attempted to utilize L factor as a plasmid vector for mammalian cells. A series of composite DNA consisting of L factor and a foreign (herpes simplex virus tk) were constructed. These DNA could be established as plasmids after transfection to several mouse cell lines, although the copy number of the re-established plasmids was considerably less than that observed for the original subclone. The composite DNA maintained the structure of the original DNA after prolonged culture and the copy number remained constant even with no selective pressure. A composite DNA, with no DNA sequence corresponding to polyoma T antigen, could also be established as a plasmid in a mouse L cell line in which polyoma T antigen is expressed. The potential use of the plasmid is discussed. Images PMID:2825120

  4. Plasmid introduction in metal-stressed, subsurface-derived microcosms: plasmid fate and community response.

    PubMed

    Smets, Barth F; Morrow, Jayne B; Arango Pinedo, Catalina

    2003-07-01

    The nonconjugal IncQ plasmids pMOL187 and pMOL222, which contain the metal resistance-encoding genes czc and ncc, were introduced by using Escherichia coli as a transitory delivery strain into microcosms containing subsurface-derived parent materials. The microcosms were semicontinuously dosed with an artificial groundwater to set a low-carbon flux and a target metal stress (0, 10, 100, and 1,000 micro M CdCl(2)), permitting long-term community monitoring. The broad-host-range IncPalpha plasmid RP4 was also transitorily introduced into a subset of microcosms. No novel community phenotype was detected after plasmid delivery, due to the high background resistances to Cd and Ni. At fixed Cd doses, however, small but consistent increases in Cd(r) or Ni(r) density were measured due to the introduction of a single pMOL plasmid, and this effect was enhanced by the joint introduction of RP4; the effects were most significant at the highest Cd doses. The pMOL plasmids introduced could, however, be monitored via czc- and ncc-targeted infinite-dilution PCR (ID-PCR) methods, because these genes were absent from the indigenous community: long-term presence of czc (after 14 or 27 weeks) was contingent on the joint introduction of RP4, although RP4 cointroduction was not yet required to ensure retention of ncc after 8 weeks. Plasmids isolated from Ni(r) transconjugants further confirmed the presence and retention of a pMOL222-sized plasmid. ID-PCR targeting the RP4-specific trafA gene revealed retention of RP4 for at least 8 weeks. Our findings confirm plasmid transfer and long-term retention in low-carbon-flux, metal-stressed subsurface communities but indicate that the subsurface community examined has limited mobilization potential for the IncQ plasmids employed.

  5. Complete nucleotide sequences of bla(CTX-M)-harboring IncF plasmids from community-associated Escherichia coli strains in the United States.

    PubMed

    Li, Jun-Jie; Spychala, Caressa N; Hu, Fupin; Sheng, Ji-Fang; Doi, Yohei

    2015-01-01

    Community-associated infections due to Escherichia coli producing CTX-M-type extended-spectrum β-lactamases are increasingly recognized in the United States. The bla(CTX-M) genes are frequently carried on IncF group plasmids. In this study, bla(CTX-M-15)-harboring plasmids pCA14 (sequence type 131 [ST131]) and pCA28 (ST44) and bla(CTX-M-14)-harboring plasmid pCA08 (ST131) were sequenced and characterized. The three plasmids were closely related to other IncFII plasmids from continents outside the United States in the conserved backbone region and multiresistance regions (MRRs). Each of the bla(CTX-M-15)-carrying plasmids pCA14 and pCA28 belonged to F31:A4:B1 (FAB [FII, FIA, FIB] formula) and showed a high level of similarity (92% coverage of pCA14 and 99% to 100% nucleotide identity), suggesting a possible common origin. The blaC(TX-M-14)-carrying plasmid pCA08 belonged to F2:A2:B20 and was highly similar to pKF3-140 from China (88% coverage of pCA08 and 99% to 100% nucleotide identity). All three plasmids carried multiple antimicrobial resistance genes and modules associated with virulence and biochemical pathways, which likely confer selective advantages for their host strains. The bla(CTX-M)-carrying IncFII-IA-IB plasmids implicated in community-associated infections in the United States shared key structural features with those identified from other continents, underscoring the global nature of this plasmid epidemic.

  6. Next conference

    NASA Astrophysics Data System (ADS)

    Hexemer, Alexander; Toney, Michael F.

    2010-11-01

    After the successful conference on Synchrotron Radiation in Polymer Science (SRPS) in Rolduc Abbey (the Netherlands), we are now looking forward to the next meeting in this topical series started in 1995 by H G Zachmann, one of the pioneers of the use of synchrotron radiation techniques in polymer science. Earlier meetings were held in Hamburg (1995), Sheffield (2002), Kyoto (2006), and Rolduc (2009). In September of 2012 the Synchrotron Radiation and Polymer Science V conferences will be organized in a joint effort by the SLAC National Accelerator Laboratory and Lawrence Berkeley National Laboratory. Stanford Linear Accelerator Laboratory Stanford Linear Accelerator Laboratory Advanced Light Source at LBL Advanced Light Source at LBL The conference will be organised in the heart of beautiful San Francisco. The program will consist of invited and contributed lectures divided in sessions on the use of synchrotron SAXS/WAXD, imaging and tomography, soft x-rays, x-ray spectroscopy, GISAXS and reflectivity, micro-beams and hyphenated techniques in polymer science. Poster contributions are more than welcome and will be highlighted during the poster sessions. Visits to both SLAC as well as LBL will be organised. San Francisco can easily be reached. It is served by two major international airports San Francisco International Airport and Oakland International Airport. Both are being served by most major airlines with easy connections to Europe and Asia as well as national destinations. Both also boast excellent connections to San Francisco city centre. We are looking forward to seeing you in the vibrant city by the Bay in September 2012. Golden gate bridge Alexander Hexemer Lawrence Berkeley National Laboratory, Advanced Light Source, Berkeley, CA 94720, USA Michael F Toney Stanford Synchrotron Radiation Lightsource, Menlo Pk, CA 94025, USA E-mail: ahexemer@lbl.gov, mftoney@slac.stanford.edu

  7. Conference Summary

    NASA Astrophysics Data System (ADS)

    Ellis, R. S.

    2008-10-01

    This first Subaru international conference has highlighted the remarkably diverse and significant contributions made using the 8.2m Subaru telescope by both Japanese astronomers and the international community. As such, it serves as a satisfying tribute to the pioneering efforts of Professors Keiichi Kodaira and Sadanori Okamura whose insight and dedication is richly rewarded. Here I try to summarize the recent impact of wide field science in extragalactic astronomy and cosmology and take a look forward to the key questions we will address in the near future.

  8. Conferences revisited

    NASA Astrophysics Data System (ADS)

    Radcliffe, Jonathan

    2008-08-01

    Way back in the mid-1990s, as a young PhD student, I wrote a Lateral Thoughts article about my first experience of an academic conference (Physics World 1994 October p80). It was a peach of a trip - most of the lab decamped to Grenoble for a week of great weather, beautiful scenery and, of course, the physics. A whole new community was there for me to see in action, and the internationality of it all helped us to forget about England's non-appearance in the 1994 World Cup finals.

  9. P1 plasmid replication requires methylated DNA.

    PubMed Central

    Abeles, A L; Austin, S J

    1987-01-01

    Plasmids driven by the plasmid replication origin of bacteriophage P1 cannot be established in Escherichia coli strains that are defective for the DNA adenine methylase (dam). Using a composite plasmid that has two origins, we show that the P1 origin cannot function even in a plasmid that is already established in a dam strain. An in vitro replication system for the P1 origin was developed that uses as a substrate M13 replicative-form DNA containing the minimal P1 origin. The reaction mixture contains a crude extract of E. coli and purified P1 RepA protein. In addition to being RepA dependent, synthesis was shown to be dependent on methylation of the dam methylase-sensitive sites of the substrate DNA. As the P1 origin contains five such sites in a small region known to be critical for origin function, it can be concluded that methylation of these sites is a requirement for initiation. This suggests that the postreplicational methylation of the origin may control reinitiation and contribute to the accuracy of the highly stringent copy-number control of the origin in vivo. PMID:2826133

  10. Simple method for identification of plasmid-coded proteins.

    PubMed

    Sancar, A; Hack, A M; Rupp, W D

    1979-01-01

    Proteins encoded by plasmid DNA are specifically labeled in UV-irradiated cells of Escherichia coli carrying recA and uvrA mutations because extensive degradation of the chromosome DNA occurs concurrently with amplification of plasmid DNA.

  11. Plasmids spread very fast in heterogeneous bacterial communities.

    PubMed Central

    Dionisio, Francisco; Matic, Ivan; Radman, Miroslav; Rodrigues, Olivia R; Taddei, François

    2002-01-01

    Conjugative plasmids can mediate gene transfer between bacterial taxa in diverse environments. The ability to donate the F-type conjugative plasmid R1 greatly varies among enteric bacteria due to the interaction of the system that represses sex-pili formations (products of finOP) of plasmids already harbored by a bacterial strain with those of the R1 plasmid. The presence of efficient donors in heterogeneous bacterial populations can accelerate plasmid transfer and can spread by several orders of magnitude. Such donors allow millions of other bacteria to acquire the plasmid in a matter of days whereas, in the absence of such strains, plasmid dissemination would take years. This "amplification effect" could have an impact on the evolution of bacterial pathogens that exist in heterogeneous bacterial communities because conjugative plasmids can carry virulence or antibiotic-resistance genes. PMID:12524329

  12. A novel method of plasmid isolation using laundry detergent.

    PubMed

    Yadav, P; Yadav, A; Garg, V; Datta, T K; Goswami, S L; De, S

    2011-07-01

    Since the discovery of plasmid, various methods have been developed to isolate plasmid DNA. All the methods have one common and important target of isolating plasmid DNA of high quality and quantity in less time. These methods are not completely safe because of use of toxic chemicals compounds. The developed protocol for plasmid extraction is based on the alkaline lysis method of plasmid preparation (extraction atpH 8.0) with slight modifications. Cell lysis reagent sodium dodecyl sulfate is replaced by lipase enzyme present in laundry detergent. A good plasmid preparation can be made, which is well suited for subsequent molecular biology applications. By taking safety measures on count, contaminants like, RNA and protein can be completely avoided with maximized plasmid yield. The resultant plasmid quality and quantity can be well comparable to other prevalent methods.

  13. E2F1-CDK1 pathway activation in kanamycin-induced spiral ganglion cell apoptosis and the protective effect of CR8.

    PubMed

    Liu, Yu-ying; Wang, Guo-peng; Peng, Zhe; Guo, Jing-ying; Wu, Qian; Xie, Jing; Gong, Shu-sheng

    2016-03-23

    Cochlear hair cell loss results in the secondary loss of spiral ganglion cells (SGCs). The death of these SGCs is due to apoptosis. The E2F1-cyclin dependent kinase 1 (CDK1) pathway is believed to represent an important mechanism of neuronal cell death. However, the role of this pathway in spiral ganglion neuronal apoptosis has not yet been reported. In this study, we deafened guinea pigs with a subcutaneous injection of kanamycin followed by an intravenous infusion of furosemide and then assayed the expression levels of cleaved caspase-3, E2F1, CDK1 and cleaved caspase-9 during the induced SGC apoptosis. Our results revealed that co-administration of kanamycin and furosemide rapidly induced hair cell loss in the guinea pigs and then resulted in a progressive loss of SGCs. Expression levels of E2F1 and CDK1 were obviously up-regulated at 1 and 3 days after deafening. Cleaved caspase-9 also increased robustly 1 or 2 weeks after the deafening procedure. The up-regulation of E2F1, CDK1 and cleaved caspase-9 was significantly attenuated by the systemic injection of CR8 (1mg/kg/day, intraperitoneally) starting at 5min after deafening. These findings indicate that the activation of the E2F1-CDK1 pathway and cell cycle re-entry contributes to the apoptosis of SGCs and that the selective inhibition of this signaling cascade may represent an attractive therapeutic strategy. CR8 has the potential to protect SGCs from apoptosis. PMID:26905670

  14. Exchange of chromosomal and plasmid alleles in Escherichia coli by selection for loss of a dominant antibiotic sensitivity marker.

    PubMed Central

    Russell, C B; Dahlquist, F W

    1989-01-01

    Transfer of an allele from a donor DNA to a recipient DNA molecule was selected by the loss of a dominant conditional lethal mutation previously incorporated ito the gene of interest in the recipient DNA. Both the Escherichia coli chromosome and plasmids carrying E. coli genes were used successfully as donor molecules. Recipient molecules for these exchanges were constructed in vitro by using the rpsL gene, which confers sensitivity to streptomycin, to replace segments of specific E. coli genes located either on multicopy plasmids or in the E. coli chromosome. Plasmids carrying such replacements were capable of acquiring chromosomal alleles of the gene(s) of interest, and strains carrying rpsL replacements in the chromosome were capable of acquiring plasmid-encoded alleles at the sight of the rpsL replacement. In both situations, these allele transfers resulted in loss of the rpsL gene from the recipient DNA molecule. The desired transfer events constituted a large percentage of these events, which gave rise to viable colonies when appropriate donor-recipient pairs were subjected to streptomycin selection. Thus, this is a useful approach for transferring alleles of interest from plasmids to the E. coli chromosome and vice versa. PMID:2651409

  15. Presence of a virulence-associated plasmid in Yersinia pseudotuberculosis.

    PubMed Central

    Gemski, P; Lazere, J R; Casey, T; Wohlhieter, J A

    1980-01-01

    We have shown that Yersinia pseudotuberculosis can possess plasmids which are similar in size and function to the previously described Vwa plasmids of Y. enterocolitica. These plasmids are associated with the production of V and W antigens (calcium dependency) and pathogenicity of the organism. Further investigation of these plasmids from Y. pseudotuberculosis and Y. enterocolitica with restriction endonucleases revealed significant differences in their fragmentation pattern. Images Fig. 1 Fig. 2 Fig. 3 PMID:6249747

  16. Plasmid mediated enhancement of uv resistance in Streptococcus faecalis

    SciTech Connect

    Miehl, R.; Miller, M.; Yasbin, R.E.

    1980-01-01

    A 38.5-Mdal plasmid of Streptococcus faecalis subdp. zymogenes has been shown to enhance survival following uv irradiation. In addition, the presence of this plasmid increases the mutation frequencies following uv irradiation and enhanced W-reactivation. The data presented indicate that S. faecalis has an inducible error-prone repair system and that the plasmid enhances these repair functions.

  17. High and prolonged sulfamidase secretion by the liver of MPS-IIIA mice following hydrodynamic tail vein delivery of antibiotic-free pFAR4 plasmid vector.

    PubMed

    Quiviger, M; Arfi, A; Mansard, D; Delacotte, L; Pastor, M; Scherman, D; Marie, C

    2014-12-01

    Mucopolysaccharidosis type IIIA (MPS-IIIA) or Sanfilippo A syndrome is a lysosomal storage genetic disease that results from the deficiency of the N-sulfoglucosamine sulfohydrolase (SGSH) protein, a sulfamidase required for the degradation of heparan sulfate glycosaminoglycans (GAGs). The accumulation of these macromolecules leads to somatic organ pathologies, severe neurodegeneration and death. To assess a novel gene therapy approach based on prolonged secretion of the missing enzyme by the liver, mediated by hydrodynamic gene delivery, we first compared a kanamycin and an antibiotic-free expression plasmid vector, called pFAR4. Thanks to the reduced vector size, pFAR4 derivatives containing either a ubiquitous or a liver-specific promoter mediated a higher reporter gene expression level than the control plasmid. Hydrodynamic delivery of SGSH-encoding pFAR4 into MPS-IIIA diseased mice led to high serum levels of sulfamidase protein that was efficiently taken up by neighboring organs, as shown by the correction of GAG accumulation. A similar reduction in GAG content was also observed in the brain, at early stages of the disease. Thus, this study contributes to the effort towards the development of novel biosafe non-viral gene vectors for therapeutic protein expression in the liver, and represents a first step towards an alternative gene therapy approach for the MPS-IIIA disease.

  18. A simple classification method for residual antibiotics using E. coli cells transformed by the calcium chloride method and drug resistance plasmid DNA.

    PubMed

    Lin, S Y; Kondo, F

    2001-01-01

    Using three different plasmid DNA codings for kanamycin (KM), chloramphenicol (CP), and ampicillin- (AMP) and tetracycline- (TC) resistance, four different competent Escherichia coli strains were transformed by the calcium chloride method to produce KM-, CP- and AMP- and TC-resistant strains. Evaluation of minimum inhibitory concentrations (MIC) of 22 antibiotics, showed KM-resistant E. coli to be cross resistant only to fradiomycin (FRM); CP-resistant E. coli, especially HB101 and JM109 strains, exhibited cross-resistance only to thiamphenicol (TP). On the other hand, AMP- and TC-resistant E. coli showed cross resistance to several penicillins, tetracyclines and erythromycin. E. coli ATCC-27166, the strain most sensitive to all drugs in this experiment, was employed for disc diffusion experiments and from the pattern of appearance of the inhibition zone, eight major antibiotics were divided into three groups depending on their activity against containing each of the three plasmids. Only gentamicin (GM) activity was not affected by any of the drug resistant strains. Assay techniques utilizing three resistant strains may be the technique for screening foods for antibiotic residues in the future.

  19. Sequence analysis of plasmid pKJ50 from Bifidobacterium longum.

    PubMed

    Park, M S; Shin, D W; Lee, K H; Ji, G E

    1999-03-01

    The complete nucleotide sequence of a plasmid, pKJ50, isolated from an intestinal bacterium, Bifidobacterium longum KJ, has been determined. The plasmid was analysed and found to be 4960 bp in size with a G+C content of 61.7 mol%. Computer analysis of sequence data revealed three major ORFs encoding putative proteins of 31.5 (ORFI), 24.5 (ORFII) and 38.6 kDa (ORFIII). ORFI encodes a protein with a pI of 10.18 and shows relatively high amino acid sequence similarity (more than 60%) with several plasmid replication proteins from Gram-positive and -negative bacteria. Southern blot analysis showed that pKJ50 accumulates an ssDNA intermediate, suggesting that it replicates by a rolling-circle mechanism. Upstream of ORFI, three sets of repeated sequences resembling iteron structures of related plasmids were identified. ORFIII encodes a protein with a pI of 10.97. It also shows a high level of amino acid sequence similarity with some plasmid mobilization proteins. Upstream of ORFIII, a 12 bp stretch resembles an oriT DNA sequence with inverted repeats identical to those found in conjugative plasmids. Hydropathy plot analysis of ORFII, encoding an acidic protein (pI = 4.95), suggests it is a transmembrane protein. Several interesting palindromic sequences, repeat sequences and hairpin-loop structures around ORFI, which might confer regulatory effects on the replication of the plasmid, were also noted. Reverse transcriptase PCR (RT-PCR) and in vitro translation confirmed the expression of ORFI and ORFII. RT-PCR produced amplified DNA fragments of the expected sizes, corresponding to ORFI and ORFII. However, no RT-PCR product corresponding to ORFIII was obtained. In vitro translation showed protein bands of the expected sizes, corresponding to each ORF. A shuttle vector capable of transforming Bifidobacterium animalis MB209 was constructed by cloning pKJ50 and a chloramphenicol resistance gene into pBR322.

  20. Analysis of pSC138, the multidrug resistance plasmid of Salmonella enterica serotype Choleraesuis SC-B67.

    PubMed

    Ye, Jiehua; Su, Lin-Hui; Chen, Chyi-Liang; Hu, Songnian; Wang, Jianbing; Yu, Jun; Chiu, Cheng-Hsun

    2011-03-01

    Salmonella enterica serotype Choleraesuis (S. Choleraesuis) usually causes systemic infections in man and needs antimicrobial treatment. Multidrug resistance (MDR) in S. Choleraesuis is thus a great concern in the treatment of systemic non-typhoid salmonellosis. A large plasmid, pSC138, was identified in 2002 from a S. Choleraesuis strain SC-B67 that was resistant to all antimicrobial agents commonly used to treat salmonellosis, including ciprofloxacin and ceftriaxone. Complete DNA sequence of the plasmid had been determined previously (Chiu et al., 2005). In the present study, the sequence of pSC138 was reannotated in detail and compared with several newly sequenced plasmids. Some transposable elements and drug resistance genes were further delineated. Plasmid pSC138 was 138,742 bp in length and consisted of 177 open reading frames (ORFs). While 134 of the ORFs displayed significant identity levels to other plasmid and prokaryotic sequences, the remaining 43 ORFs have not been previously reported. Mobile elements, including two integrons, seven insertion sequences and eight transposons, and a truncated prophage together encompass at least 66,781 bp (48.1%) of the plasmid genome. The sequence of pSC138 consists of three major regions: a large composite transposable region Tn6088 with a Tn21-like backbone inserted by a variety of integrons or transposable elements; a transfer/maintenance region that contains a conserved ISEcp1-mediated transposon-like element Tn6092, carrying an AmpC gene, bla(CMY-2), that confers the ceftriaxone resistance; and a Rep_3 type of replication region. Another seven bacteremic strains of S. Choleraesuis that expressed the same MDR phenotype were identified during 2003-2008. The same Rep_3 type replicase and the bla(CMY-2)-containing, ISEcp1-mediated transposon-like element were found in the MDR isolates, suggesting a successful preservation and dissemination of the MDR plasmid. Comparison of pSC138 with other recently published plasmids

  1. Analysis of pSC138, the multidrug resistance plasmid of Salmonella enterica serotype Choleraesuis SC-B67.

    PubMed

    Ye, Jiehua; Su, Lin-Hui; Chen, Chyi-Liang; Hu, Songnian; Wang, Jianbing; Yu, Jun; Chiu, Cheng-Hsun

    2011-03-01

    Salmonella enterica serotype Choleraesuis (S. Choleraesuis) usually causes systemic infections in man and needs antimicrobial treatment. Multidrug resistance (MDR) in S. Choleraesuis is thus a great concern in the treatment of systemic non-typhoid salmonellosis. A large plasmid, pSC138, was identified in 2002 from a S. Choleraesuis strain SC-B67 that was resistant to all antimicrobial agents commonly used to treat salmonellosis, including ciprofloxacin and ceftriaxone. Complete DNA sequence of the plasmid had been determined previously (Chiu et al., 2005). In the present study, the sequence of pSC138 was reannotated in detail and compared with several newly sequenced plasmids. Some transposable elements and drug resistance genes were further delineated. Plasmid pSC138 was 138,742 bp in length and consisted of 177 open reading frames (ORFs). While 134 of the ORFs displayed significant identity levels to other plasmid and prokaryotic sequences, the remaining 43 ORFs have not been previously reported. Mobile elements, including two integrons, seven insertion sequences and eight transposons, and a truncated prophage together encompass at least 66,781 bp (48.1%) of the plasmid genome. The sequence of pSC138 consists of three major regions: a large composite transposable region Tn6088 with a Tn21-like backbone inserted by a variety of integrons or transposable elements; a transfer/maintenance region that contains a conserved ISEcp1-mediated transposon-like element Tn6092, carrying an AmpC gene, bla(CMY-2), that confers the ceftriaxone resistance; and a Rep_3 type of replication region. Another seven bacteremic strains of S. Choleraesuis that expressed the same MDR phenotype were identified during 2003-2008. The same Rep_3 type replicase and the bla(CMY-2)-containing, ISEcp1-mediated transposon-like element were found in the MDR isolates, suggesting a successful preservation and dissemination of the MDR plasmid. Comparison of pSC138 with other recently published plasmids

  2. Sequences of Two Related Multiple Antibiotic Resistance Virulence Plasmids Sharing a Unique IS26-Related Molecular Signature Isolated from Different Escherichia coli Pathotypes from Different Hosts

    PubMed Central

    Venturini, Carola; Hassan, Karl A.; Roy Chowdhury, Piklu; Paulsen, Ian T.; Walker, Mark J.; Djordjevic, Steven P.

    2013-01-01

    Enterohemorrhagic Escherichia coli (EHEC) and atypical enteropathogenic E. coli (aEPEC) are important zoonotic pathogens that increasingly are becoming resistant to multiple antibiotics. Here we describe two plasmids, pO26-CRL125 (125 kb) from a human O26:H- EHEC, and pO111-CRL115 (115kb) from a bovine O111 aEPEC, that impart resistance to ampicillin, kanamycin, neomycin, streptomycin, sulfathiazole, trimethoprim and tetracycline and both contain atypical class 1 integrons with an identical IS26-mediated deletion in their 3´-conserved segment. Complete sequence analysis showed that pO26-CRL125 and pO111-CRL115 are essentially identical except for a 9.7 kb fragment, present in the backbone of pO26-CRL125 but absent in pO111-CRL115, and several indels. The 9.7 kb fragment encodes IncI-associated genes involved in plasmid stability during conjugation, a putative transposase gene and three imperfect repeats. Contiguous sequence identical to regions within these pO26-CRL125 imperfect repeats was identified in pO111-CRL115 precisely where the 9.7 kb fragment is missing, suggesting it may be mobile. Sequences shared between the plasmids include a complete IncZ replicon, a unique toxin/antitoxin system, IncI stability and maintenance genes, a novel putative serine protease autotransporter, and an IncI1 transfer system including a unique shufflon. Both plasmids carry a derivate Tn21 transposon with an atypical class 1 integron comprising a dfrA5 gene cassette encoding resistance to trimethoprim, and 24 bp of the 3´-conserved segment followed by Tn6026, which encodes resistance to ampicillin, kanymycin, neomycin, streptomycin and sulfathiazole. The Tn21-derivative transposon is linked to a truncated Tn1721, encoding resistance to tetracycline, via a region containing the IncP-1α oriV. Absence of the 5 bp direct repeats flanking Tn3-family transposons, indicates that homologous recombination events played a key role in the formation of this complex antibiotic resistance

  3. Cloning of a Thiobacillus ferrooxidans plasmid in Escherichia coli

    SciTech Connect

    Holmes, D.S.; Lobos, J.H.; Bopp, L.H.; Welch, G.C.

    1984-01-01

    Three separate plasmids of 6, 7, 16, and >23 kilobases were purified from a single clone of Thiobacillus ferrooxidans ATCC 33020 grown in the presence of uranium. The 6.7-kilobase plasmid (pTfl) was cloned separately into the HindIII or BamHI site of Escherichia coli plasmid pBR322. Restriction maps of the recombinant plasmids, termed pTf100 and pTf110, respectively, were constructed, creating potential cloning vehicles for exchanging genetic information between E. coli and T. ferrooxidans. Evidence from restriction enzyme analysis and Southern blot DNA-DNA hybridization indicates that the three native plasmids share little sequence homology.

  4. Emergence and Distribution of Plasmids Bearing the blaOXA-51-like gene with an upstream ISAba1 in carbapenem-resistant Acinetobacter baumannii isolates in Taiwan.

    PubMed

    Chen, Te-Li; Lee, Yi-Tzu; Kuo, Shu-Chen; Hsueh, Po-Ren; Chang, Feng-Yee; Siu, Leung-Kei; Ko, Wen-Chien; Fung, Chang-Phone

    2010-11-01

    The bla(OXA-51)-like gene with an upstream ISAba1 (ISAba1-bla(OXA-51)-like gene) was originally found on the chromosomes of carbapenem-resistant or -susceptible Acinetobacter baumannii isolates. However, a plasmid-borne ISAba1-bla(OXA-51)-like gene has recently been identified in Acinetobacter genomic species 13TU and several A. baumannii isolates in Taiwan, and all of the isolates are carbapenem resistant. This study aimed to characterize the plasmids bearing the ISAba1-bla(OXA-51)-like gene and their significance in A. baumannii. Among the 117 ISAba1-bla(OXA-51)-like-harboring isolates collected from 10 hospitals in Taiwan, 58 isolates (49.6%) from 24 clones had the genes located on plasmids that likely originated from a common progenitor. Among the 58 isolates, four had additional copy of the ISAba1-bla(OXA-51)-like gene on their chromosomes. Based on the analysis of these four isolates, the plasmid-located ISAba1-bla(OXA-51)-like gene appeared to be acquired via one-ended transposition (Tn6080). The isolates with a plasmid bearing the ISAba1-bla(OXA-51)-like gene had higher rates of resistance to imipenem (98% versus 46.6%; P < 0.001) and meropenem (98% versus 69%; P = 0.019) than those with the genes chromosomally encoded, which is most likely due to increased gene dosage provided by the higher copy number of associated plasmids. Transformation with a recombinant plasmid harboring only the ISAba1-bla(OXA-51)-like gene was enough to confer a high level of carbapenem resistance to A. baumannii, eliminating the possible contribution of other factors on the original plasmids. This study demonstrated that the carbapenem resistance-associated plasmids carrying the ISAba1-bla(OXA-51)-like gene are widespread in A. baumannii strains in Taiwan.

  5. Dissemination of plasmid-encoded AmpC β-lactamases in antimicrobial resistant Salmonella serotypes originating from humans, pigs and the swine environment.

    PubMed

    Keelara, Shivaramu; Thakur, Siddhartha

    2014-09-17

    The aim of this study was to characterize and determine the inter-serovar exchange of AmpC β-lactamase conferring plasmids isolated from humans, pigs and the swine environment. Plasmids isolated from a total of 21 antimicrobial resistant (AMR) Salmonella isolates representing human clinical cases (n=6), pigs (n=6) and the swine farm environment (n=9) were characterized by replicon typing and restriction digestion, inter-serovar transferability by conjugation, and presence of AmpC β-lactamase enzyme encoding gene blaCMY-2 by southern hybridization. Based on replicon typing, the majority (17/21, 81%) of the plasmids belonged to the I1-Iγ Inc group and were between 70 and 103kb. The potential for inter-serovar plasmid transfer was further confirmed by the PCR detection of AMR genes on the plasmids isolated from trans-conjugants. Plasmids from Salmonella serovars Anatum, Ouakam, Johannesburg and Typhimurium isolated from the same cohort of pigs and their environment and S. Heidelberg from a single human clinical isolate had identical plasmids based on digestion with multiple restriction enzymes (EcoRI, HindIII and PstI) and southern blotting. We demonstrated likely horizontal inter-serovar exchange of plasmid-encoding AmpC β-lactamases resistance among MDR Salmonella serotypes isolated from pigs, swine farm environment and clinical human cases. This study provides valuable information on the role of the swine farm environment and by extension other livestock farm environments, as a potential reservoir of resistant bacterial strains that potentially transmit resistance determinants to livestock, in this case, swine, humans and possibly other hosts by horizontal exchange of plasmids.

  6. Plasmid flux in Escherichia coli ST131 sublineages, analyzed by plasmid constellation network (PLACNET), a new method for plasmid reconstruction from whole genome sequences.

    PubMed

    Lanza, Val F; de Toro, María; Garcillán-Barcia, M Pilar; Mora, Azucena; Blanco, Jorge; Coque, Teresa M; de la Cruz, Fernando

    2014-12-01

    Bacterial whole genome sequence (WGS) methods are rapidly overtaking classical sequence analysis. Many bacterial sequencing projects focus on mobilome changes, since macroevolutionary events, such as the acquisition or loss of mobile genetic elements, mainly plasmids, play essential roles in adaptive evolution. Existing WGS analysis protocols do not assort contigs between plasmids and the main chromosome, thus hampering full analysis of plasmid sequences. We developed a method (called plasmid constellation networks or PLACNET) that identifies, visualizes and analyzes plasmids in WGS projects by creating a network of contig interactions, thus allowing comprehensive plasmid analysis within WGS datasets. The workflow of the method is based on three types of data: assembly information (including scaffold links and coverage), comparison to reference sequences and plasmid-diagnostic sequence features. The resulting network is pruned by expert analysis, to eliminate confounding data, and implemented in a Cytoscape-based graphic representation. To demonstrate PLACNET sensitivity and efficacy, the plasmidome of the Escherichia coli lineage ST131 was analyzed. ST131 is a globally spread clonal group of extraintestinal pathogenic E. coli (ExPEC), comprising different sublineages with ability to acquire and spread antibiotic resistance and virulence genes via plasmids. Results show that plasmids flux in the evolution of this lineage, which is wide open for plasmid exchange. MOBF12/IncF plasmids were pervasive, adding just by themselves more than 350 protein families to the ST131 pangenome. Nearly 50% of the most frequent γ-proteobacterial plasmid groups were found to be present in our limited sample of ten analyzed ST131 genomes, which represent the main ST131 sublineages. PMID:25522143

  7. Intrauterine Infection with Plasmid-Free Chlamydia muridarum Reveals a Critical Role of the Plasmid in Chlamydial Ascension and Establishes a Model for Evaluating Plasmid-Independent Pathogenicity

    PubMed Central

    Chen, Jianlin; Yang, Zhangsheng; Sun, Xin; Tang, Lingli; Ding, Yiling; Xue, Min; Zhou, Zhiguang; Baseman, Joel

    2015-01-01

    Intravaginal infection with plasmid-competent but not plasmid-free Chlamydia muridarum induces hydrosalpinx in mouse upper genital tract, indicating a critical role of the plasmid in chlamydial pathogenicity. To evaluate the contribution of the plasmid to chlamydial ascension and activation of tubal inflammation, we delivered plasmid-free C. muridarum directly into the endometrium by intrauterine inoculation. We found that three of the six mouse strains tested, including CBA/J, C3H/HeJ, and C57BL/6J, developed significant hydrosalpinges when 1 × 107 inclusion-forming units (IFU) of plasmid-free C. muridarum were intrauterinally inoculated. Even when the inoculum was reduced to 1 × 104 IFU, the CBA/J mice still developed robust hydrosalpinx. The hydrosalpinx development in CBA/J mice correlated with increased organism ascension to the oviduct following the intrauterine inoculation. The CBA/J mice intravaginally infected with the same plasmid-free C. muridarum strain displayed reduced ascending infection and failed to develop hydrosalpinx. These observations have demonstrated a critical role of the plasmid in chlamydial ascending infection. The intrauterine inoculation of the CBA/J mice with plasmid-free C. muridarum not only resulted in more infection in the oviduct but also stimulated more inflammatory infiltration and cytokine production in the oviduct than the intravaginal inoculation, suggesting that the oviduct inflammation can be induced by plasmid-independent factors, which makes the hydrosalpinx induction in CBA/J mice by intrauterine infection with plasmid-free C. muridarum a suitable model for investigating plasmid-independent pathogenic mechanisms. PMID:25870225

  8. Plasmid Flux in Escherichia coli ST131 Sublineages, Analyzed by Plasmid Constellation Network (PLACNET), a New Method for Plasmid Reconstruction from Whole Genome Sequences

    PubMed Central

    Garcillán-Barcia, M. Pilar; Mora, Azucena; Blanco, Jorge; Coque, Teresa M.; de la Cruz, Fernando

    2014-01-01

    Bacterial whole genome sequence (WGS) methods are rapidly overtaking classical sequence analysis. Many bacterial sequencing projects focus on mobilome changes, since macroevolutionary events, such as the acquisition or loss of mobile genetic elements, mainly plasmids, play essential roles in adaptive evolution. Existing WGS analysis protocols do not assort contigs between plasmids and the main chromosome, thus hampering full analysis of plasmid sequences. We developed a method (called plasmid constellation networks or PLACNET) that identifies, visualizes and analyzes plasmids in WGS projects by creating a network of contig interactions, thus allowing comprehensive plasmid analysis within WGS datasets. The workflow of the method is based on three types of data: assembly information (including scaffold links and coverage), comparison to reference sequences and plasmid-diagnostic sequence features. The resulting network is pruned by expert analysis, to eliminate confounding data, and implemented in a Cytoscape-based graphic representation. To demonstrate PLACNET sensitivity and efficacy, the plasmidome of the Escherichia coli lineage ST131 was analyzed. ST131 is a globally spread clonal group of extraintestinal pathogenic E. coli (ExPEC), comprising different sublineages with ability to acquire and spread antibiotic resistance and virulence genes via plasmids. Results show that plasmids flux in the evolution of this lineage, which is wide open for plasmid exchange. MOBF12/IncF plasmids were pervasive, adding just by themselves more than 350 protein families to the ST131 pangenome. Nearly 50% of the most frequent γ–proteobacterial plasmid groups were found to be present in our limited sample of ten analyzed ST131 genomes, which represent the main ST131 sublineages. PMID:25522143

  9. Plasmid flux in Escherichia coli ST131 sublineages, analyzed by plasmid constellation network (PLACNET), a new method for plasmid reconstruction from whole genome sequences.

    PubMed

    Lanza, Val F; de Toro, María; Garcillán-Barcia, M Pilar; Mora, Azucena; Blanco, Jorge; Coque, Teresa M; de la Cruz, Fernando

    2014-12-01

    Bacterial whole genome sequence (WGS) methods are rapidly overtaking classical sequence analysis. Many bacterial sequencing projects focus on mobilome changes, since macroevolutionary events, such as the acquisition or loss of mobile genetic elements, mainly plasmids, play essential roles in adaptive evolution. Existing WGS analysis protocols do not assort contigs between plasmids and the main chromosome, thus hampering full analysis of plasmid sequences. We developed a method (called plasmid constellation networks or PLACNET) that identifies, visualizes and analyzes plasmids in WGS projects by creating a network of contig interactions, thus allowing comprehensive plasmid analysis within WGS datasets. The workflow of the method is based on three types of data: assembly information (including scaffold links and coverage), comparison to reference sequences and plasmid-diagnostic sequence features. The resulting network is pruned by expert analysis, to eliminate confounding data, and implemented in a Cytoscape-based graphic representation. To demonstrate PLACNET sensitivity and efficacy, the plasmidome of the Escherichia coli lineage ST131 was analyzed. ST131 is a globally spread clonal group of extraintestinal pathogenic E. coli (ExPEC), comprising different sublineages with ability to acquire and spread antibiotic resistance and virulence genes via plasmids. Results show that plasmids flux in the evolution of this lineage, which is wide open for plasmid exchange. MOBF12/IncF plasmids were pervasive, adding just by themselves more than 350 protein families to the ST131 pangenome. Nearly 50% of the most frequent γ-proteobacterial plasmid groups were found to be present in our limited sample of ten analyzed ST131 genomes, which represent the main ST131 sublineages.

  10. Chloramphenicol Resistance Plasmids in Escherichia coli Isolated from Diseased Piglets

    PubMed Central

    Jørgensen, Sigrid Tue

    1978-01-01

    The plasmids in 19 chloramphenicol-resistant Escherichia coli strains of three pig pathogenic antigen types were studied in conjugation and transduction experiments. The plasmids had identical resistance patterns: streptomycin, spectinomycin, sulfonamides, and chloramphenicol (Sm, Sp, Su, Cm) and belonged to IncFII. One plasmid carried ampicillin resistance in addition. Restriction enzyme analysis of the deoxyribonucleic acid from five of the plasmids originating from the same herd showed that their digestion patterns with EcoRI were indistinguishable. EcoRI cleaved the deoxyribonucleic acid of a sixth plasmid from the same herd and displayed nine of the ten bands of the other five plasmids plus an additional six. It appears that the five plasmids with identical restriction patterns have a common origin and may be copies of the same plasmid from which the sixth may have developed. Four strains carried two plasmids each. In two of these strains, a plasmid with a tetracycline marker (Tc), or possibly the tetracycline marker alone, recombined frequently with the Sm Sp Su Cm plasmid without destroying any known function of the latter. The possibility that Tc is carried on a translocation sequence is discussed. Images PMID:352263

  11. Plasmid-associated aggregation in Thermus thermophilus HB8

    SciTech Connect

    Mather, M.W.; Fee, J.A. )

    1990-01-01

    Thermus thermophilus HB8, a moderate thermophile, exhibits visible aggregation when growing on a rich broth. Strain HB8 also contains two cryptic plasmids. The authors isolated cured strains from HB8 and observed that loss of the 47-MDa plasmid was correlated with loss of aggregation. An enrichment procedure was developed for aggregating cells and used to demonstrate that aggregation was restored upon transformation of a cured strain with plasmid DNA. The aggregation phenotype of transformed cells was variably stable; most did not retain either the plasmid or the phenotype for prolonged periods of growth. Hybridization experiments using a partial sequence from the 47-MDa plasmid suggested the presence of a repeated DNA sequence on this plasmid and on the chromosome. This is the first report of a phenotype associated with a plasmid from a Thermus strain.

  12. The Influence of Biofilms in the Biology of Plasmids.

    PubMed

    Cook, Laura C C; Dunny, Gary M

    2014-10-01

    The field of plasmid biology has historically focused on bacteria growing in liquid culture. Surface-attached communities of bacterial biofilms have recently been understood to be the normal environment of bacteria in the natural world. Thus, studies examining plasmid replication, maintenance, and transfer in biofilms are essential for a true understanding of bacterial plasmid biology. This article reviews the current knowledge of the interplay between bacterial biofilms and plasmids, focusing on the role of plasmids in biofilm development and the role of biofilms in plasmid maintenance, copy-number control, and transfer. The studies examined herein highlight the importance of biofilms as an important ecological niche in which bacterial plasmids play an essential role.

  13. Pathway of plasmid transformation in pneumococcus

    SciTech Connect

    Guild, W.R.; Saunders, C.W.

    1981-01-01

    Plasmids transform Streptococcus pneumoniae by a process involving low efficiency assembly of replicons from fragments of single strands that have entered the cell separately. Transformation of preexisting replicons is much more efficient. We have cloned the erm gene of pIP501 into pMV158, which so far as we know is the first example of cloning in a pneumococcus host-vector system.

  14. Plasmid DNA production for therapeutic applications.

    PubMed

    Lara, Alvaro R; Ramírez, Octavio T; Wunderlich, Martin

    2012-01-01

    Plasmid DNA (pDNA) is the base for promising DNA vaccines and gene therapies against many infectious, acquired, and genetic diseases, including HIV-AIDS, Ebola, Malaria, and different types of cancer, enteric pathogens, and influenza. Compared to conventional vaccines, DNA vaccines have many advantages such as high stability, not being infectious, focusing the immune response to only those antigens desired for immunization and long-term persistence of the vaccine protection. Especially in developing countries, where conventional effective vaccines are often unavailable or too expensive, there is a need for both new and improved vaccines. Therefore the demand of pDNA is expected to rise significantly in the near future. Since the injection of pDNA usually only leads to a weak immune response, several milligrams of DNA vaccine are necessary for immunization protection. Hence, there is a special interest to raise the product yield in order to reduce manufacturing costs. In this chapter, the different stages of plasmid DNA production are reviewed, from the vector design to downstream operation options. In particular, recent advances on cell engineering for improving plasmid DNA production are discussed. PMID:22160904

  15. Metal chelate affinity precipitation of RNA and purification of plasmid DNA

    NASA Technical Reports Server (NTRS)

    Balan, Sindhu; Murphy, Jason; Galaev, Igor; Kumar, Ashok; Fox, George E.; Mattiasson, Bo; Willson, Richard C.

    2003-01-01

    The affinity of metal chelates for amino acids, such as histidine, is widely used in purifying proteins, most notably through six-histidine 'tails'. We have found that metal affinity interactions can also be applied to separation of single-stranded nucleic acids through interactions involving exposed purines. Here we describe a metal affinity precipitation method to resolve RNA from linear and plasmid DNA. A copper-charged copolymer of N-isopropyl acrylamide (NIPAM) and vinyl imidazole (VI) is used to purify plasmid from an alkaline lysate of E. coli. The NIPAM units confer reversible solubility on the copolymer while the imidazole chelates metal ions in a manner accessible to interaction with soluble ligands. RNA was separated from the plasmid by precipitation along with the polymer in the presence of 800 mM NaCl. Bound RNA could be recovered by elution with imidazole and separated from copolymer by a second precipitation step. RNA binding showed a strong dependence on temperature and on the type of buffer used.

  16. Asbestos fibers mediate transformation of monkey cells by exogenous plasmid DNA

    SciTech Connect

    Appel, J.D.; Fasy, T.M.; Kohtz, D.S.; Kohtz, J.D.; Johnson, E.M. )

    1988-10-01

    The authors have tested the ability of chrysotile asbestos fibers to introduce plasmid DNA into monkey COS-7 cells and the ability of this DNA to function in both replication and gene expression. Chrysotile fibers are at least as effective as calcium phosphate in standard transfection assays at optimal ratios of asbestos to DNA. After transfection with chrysotile, a minor percentage of introduced plasmid DNA bearing a simian virus 40 origin of replication replicates after 24 hr. Fragmentation of entering DNA is more prominent with asbestos than with calcium phosphate, and after 72 hr most DNA introduced by asbestos is associated with chromosomal DNA. Cells transfected with plasmid p11-4, bearing the p53 protooncogene, express this gene. Cells transfected with pSV2-neo express a gene conferring resistance of antibiotic G418, allowing isolation of colonies of transformed cells after 18 days. The introduction of exogenous DNA into eukaryotic cells could cause mutations in several ways and thus contribute to asbestos-induced oncogenesis.

  17. Invasion of E. coli biofilms by antibiotic resistance plasmids.

    PubMed

    Król, Jaroslaw E; Wojtowicz, Andrzej J; Rogers, Linda M; Heuer, Holger; Smalla, Kornelia; Krone, Stephen M; Top, Eva M

    2013-07-01

    In spite of the contribution of plasmids to the spread of antibiotic resistance in human pathogens, little is known about the transferability of various drug resistance plasmids in bacterial biofilms. The goal of this study was to compare the efficiency of transfer of 19 multidrug resistance plasmids into Escherichia coli recipient biofilms and determine the effects of biofilm age, biofilm-donor exposure time, and donor-to-biofilm attachment on this process. An E. coli recipient biofilm was exposed separately to 19 E. coli donors, each with a different plasmid, and transconjugants were determined by plate counting. With few exceptions, plasmids that transferred well in a liquid environment also showed the highest transferability in biofilms. The difference in transfer frequency between the most and least transferable plasmid was almost a million-fold. The 'invasibility' of the biofilm by plasmids, or the proportion of biofilm cells that acquired plasmids within a few hours, depended not only on the type of plasmid, but also on the time of biofilm exposure to the donor and on the ability of the plasmid donor to attach to the biofilm, yet not on biofilm age. The efficiency of donor strain attachment to the biofilm was not affected by the presence of plasmids. The most invasive plasmid was pHH2-227, which based on genome sequence analysis is a hybrid between IncU-like and IncW plasmids. The wide range in transferability in an E. coli biofilm among plasmids needs to be taken into account in our fight against the spread of drug resistance.

  18. Conference summary

    NASA Astrophysics Data System (ADS)

    Rebolo, R.

    ``Brown dwarfs come of age" was a stimulating conference attended by a large number of very active researchers, including many young students and post-docs who were largely responsible for the lively atmosphere that we enjoyed during the full meeting. Major theoretical and observational challenges currently faced in the study of brown dwarfs were reviewed. Key spectroscopic work is being conducted to determine atmospheric temperatures, surface gravities and metallicities, essential to understand the evolution of substellar objects. Research on ultracool atmospheres is extended down to temperatures typical of the atmosphere of the Earth. Characterisation of brown dwarfs at all wavelengths from X-ray to radio is ongoing and investigation of time domain phenomena reveal interesting new processes in cool atmospheres. In addition to talks on these topics, a large number of presentations addressed the formation and evolution of brown dwarfs, the lower end of the Initial Mass Function, the properties of substellar binaries, the angular momentum and disk evolution in very low-mass systems, results of large scale surveys aimed to find the lowest luminosity and coolest brown dwarfs, searches in star clusters delineating the evolution with age of the properties of brown dwarfs, binary searches and subsequent follow-up work enabling dynamical mass determinations. The excellent level of the review talks, oral and poster presentations and the work of the enthusiastic researchers that attended the meeting ensure a brilliant future for substellar research 18 years after the discovery of the first brown dwarfs.

  19. Unique Plasmids Generated via pUC Replicon Mutagenesis in an Error-Prone Thermophile Derived from Geobacillus kaustophilus HTA426

    PubMed Central

    Kobayashi, Jyumpei; Tanabiki, Misaki; Doi, Shohei; Kondo, Akihiko; Ohshiro, Takashi

    2015-01-01

    The plasmid pGKE75-catA138T, which comprises pUC18 and the catA138T gene encoding thermostable chloramphenicol acetyltransferase with an A138T amino acid replacement (CATA138T), serves as an Escherichia coli-Geobacillus kaustophilus shuttle plasmid that confers moderate chloramphenicol resistance on G. kaustophilus HTA426. The present study examined the thermoadaptation-directed mutagenesis of pGKE75-catA138T in an error-prone thermophile, generating the mutant plasmid pGKE75αβ-catA138T responsible for substantial chloramphenicol resistance at 65°C. pGKE75αβ-catA138T contained no mutation in the catA138T gene but had two mutations in the pUC replicon, even though the replicon has no apparent role in G. kaustophilus. Biochemical characterization suggested that the efficient chloramphenicol resistance conferred by pGKE75αβ-catA138T is attributable to increases in intracellular CATA138T and acetyl-coenzyme A following a decrease in incomplete forms of pGKE75αβ-catA138T. The decrease in incomplete plasmids may be due to optimization of plasmid replication by RNA species transcribed from the mutant pUC replicon, which were actually produced in G. kaustophilus. It is noteworthy that G. kaustophilus was transformed with pGKE75αβ-catA138T using chloramphenicol selection at 60°C. In addition, a pUC18 derivative with the two mutations propagated in E. coli at a high copy number independently of the culture temperature and high plasmid stability. Since these properties have not been observed in known plasmids, the outcomes extend the genetic toolboxes for G. kaustophilus and E. coli. PMID:26319877

  20. Unique plasmids generated via pUC replicon mutagenesis in an error-prone thermophile derived from Geobacillus kaustophilus HTA426.

    PubMed

    Kobayashi, Jyumpei; Tanabiki, Misaki; Doi, Shohei; Kondo, Akihiko; Ohshiro, Takashi; Suzuki, Hirokazu

    2015-11-01

    The plasmid pGKE75-catA138T, which comprises pUC18 and the catA138T gene encoding thermostable chloramphenicol acetyltransferase with an A138T amino acid replacement (CATA138T), serves as an Escherichia coli-Geobacillus kaustophilus shuttle plasmid that confers moderate chloramphenicol resistance on G. kaustophilus HTA426. The present study examined the thermoadaptation-directed mutagenesis of pGKE75-catA138T in an error-prone thermophile, generating the mutant plasmid pGKE75(αβ)-catA138T responsible for substantial chloramphenicol resistance at 65°C. pGKE75(αβ)-catA138T contained no mutation in the catA138T gene but had two mutations in the pUC replicon, even though the replicon has no apparent role in G. kaustophilus. Biochemical characterization suggested that the efficient chloramphenicol resistance conferred by pGKE75(αβ)-catA138T is attributable to increases in intracellular CATA138T and acetyl-coenzyme A following a decrease in incomplete forms of pGKE75(αβ)-catA138T. The decrease in incomplete plasmids may be due to optimization of plasmid replication by RNA species transcribed from the mutant pUC replicon, which were actually produced in G. kaustophilus. It is noteworthy that G. kaustophilus was transformed with pGKE75(αβ)-catA138T using chloramphenicol selection at 60°C. In addition, a pUC18 derivative with the two mutations propagated in E. coli at a high copy number independently of the culture temperature and high plasmid stability. Since these properties have not been observed in known plasmids, the outcomes extend the genetic toolboxes for G. kaustophilus and E. coli.

  1. Conjugative transfer of an IncA/C plasmid-borne blaCMY-2 gene through genetic re-arrangements with an IncX1 plasmid

    PubMed Central

    2013-01-01

    Background Our observation that in the Mexican Salmonella Typhimurium population none of the ST19 and ST213 strains harbored both the Salmonella virulence plasmid (pSTV) and the prevalent IncA/C plasmid (pA/C) led us to hypothesize that restriction to horizontal transfer of these plasmids existed. We designed a conjugation scheme using ST213 strain YU39 as donor of the blaCMY-2 gene (conferring resistance to ceftriaxone; CRO) carried by pA/C, and two E. coli lab strains (DH5α and HB101) and two Typhimurium ST19 strains (SO1 and LT2) carrying pSTV as recipients. The aim of this study was to determine if the genetic background of the different recipient strains affected the transfer frequencies of pA/C. Results YU39 was able to transfer CRO resistance, via a novel conjugative mechanism, to all the recipient strains although at low frequencies (10-7 to 10-10). The presence of pSTV in the recipients had little effect on the conjugation frequency. The analysis of the transconjugants showed that three different phenomena were occurring associated to the transfer of blaCMY-2: 1) the co-integration of pA/C and pX1; 2) the transposition of the CMY region from pA/C to pX1; or 3) the rearrangement of pA/C. In addition, the co-lateral mobilization of a small (5 kb) ColE1-like plasmid was observed. The transconjugant plasmids involving pX1 re-arrangements (either via co-integration or ISEcp1-mediated transposition) obtained the capacity to conjugate at very high levels, similar to those found for pX1 (10-1). Two versions of the region containing blaCMY-2 were found to transpose to pX1: the large version was inserted into an intergenic region located where the “genetic load” operons are frequently inserted into pX1, while the short version was inserted into the stbDE operon involved in plasmid addiction system. This is the first study to report the acquisition of an extended spectrum cephalosporin (ESC)-resistance gene by an IncX1 plasmid. Conclusions We showed that the

  2. Functional Activity of Plasmid DNA after Entry into the Atmosphere of Earth Investigated by a New Biomarker Stability Assay for Ballistic Spaceflight Experiments

    PubMed Central

    Thiel, Cora S.; Tauber, Svantje; Schütte, Andreas; Schmitz, Burkhard; Nuesse, Harald; Moeller, Ralf; Ullrich, Oliver

    2014-01-01

    Sounding rockets represent an excellent platform for testing the influence of space conditions during the passage of Earth's atmosphere and re-entry on biological, physical and chemical experiments for astrobiological purposes. We designed a robust functionality biomarker assay to analyze the biological effects of suborbital spaceflights prevailing during ballistic rocket flights. During the TEXUS-49 rocket mission in March 2011, artificial plasmid DNA carrying a fluorescent marker (enhanced green fluorescent protein: EGFP) and an antibiotic resistance cassette (kanamycin/neomycin) was attached on different positions of rocket exterior; (i) circular every 90 degree on the outer surface concentrical of the payload, (ii) in the grooves of screw heads located in between the surface application sites, and (iii) on the surface of the bottom side of the payload. Temperature measurements showed two major peaks at 118 and 130°C during the 780 seconds lasting flight on the inside of the recovery module, while outer gas temperatures of more than 1000°C were estimated on the sample application locations. Directly after retrieval and return transport of the payload, the plasmid DNA samples were recovered. Subsequent analyses showed that DNA could be recovered from all application sites with a maximum of 53% in the grooves of the screw heads. We could further show that up to 35% of DNA retained its full biological function, i.e., mediating antibiotic resistance in bacteria and fluorescent marker expression in eukariotic cells. These experiments show that our plasmid DNA biomarker assay is suitable to characterize the environmental conditions affecting DNA during an atmospheric transit and the re-entry and constitute the first report of the stability of DNA during hypervelocity atmospheric transit indicating that sounding rocket flights can be used to model the high-speed atmospheric entry of organics-laden artificial meteorites. PMID:25426925

  3. Functional activity of plasmid DNA after entry into the atmosphere of earth investigated by a new biomarker stability assay for ballistic spaceflight experiments.

    PubMed

    Thiel, Cora S; Tauber, Svantje; Schütte, Andreas; Schmitz, Burkhard; Nuesse, Harald; Moeller, Ralf; Ullrich, Oliver

    2014-01-01

    Sounding rockets represent an excellent platform for testing the influence of space conditions during the passage of Earth's atmosphere and re-entry on biological, physical and chemical experiments for astrobiological purposes. We designed a robust functionality biomarker assay to analyze the biological effects of suborbital spaceflights prevailing during ballistic rocket flights. During the TEXUS-49 rocket mission in March 2011, artificial plasmid DNA carrying a fluorescent marker (enhanced green fluorescent protein: EGFP) and an antibiotic resistance cassette (kanamycin/neomycin) was attached on different positions of rocket exterior; (i) circular every 90 degree on the outer surface concentrical of the payload, (ii) in the grooves of screw heads located in between the surface application sites, and (iii) on the surface of the bottom side of the payload. Temperature measurements showed two major peaks at 118 and 130 °C during the 780 seconds lasting flight on the inside of the recovery module, while outer gas temperatures of more than 1000 °C were estimated on the sample application locations. Directly after retrieval and return transport of the payload, the plasmid DNA samples were recovered. Subsequent analyses showed that DNA could be recovered from all application sites with a maximum of 53% in the grooves of the screw heads. We could further show that up to 35% of DNA retained its full biological function, i.e., mediating antibiotic resistance in bacteria and fluorescent marker expression in eukaryotic cells. These experiments show that our plasmid DNA biomarker assay is suitable to characterize the environmental conditions affecting DNA during an atmospheric transit and the re-entry and constitute the first report of the stability of DNA during hypervelocity atmospheric transit indicating that sounding rocket flights can be used to model the high-speed atmospheric entry of organics-laden artificial meteorites.

  4. Functional activity of plasmid DNA after entry into the atmosphere of earth investigated by a new biomarker stability assay for ballistic spaceflight experiments.

    PubMed

    Thiel, Cora S; Tauber, Svantje; Schütte, Andreas; Schmitz, Burkhard; Nuesse, Harald; Moeller, Ralf; Ullrich, Oliver

    2014-01-01

    Sounding rockets represent an excellent platform for testing the influence of space conditions during the passage of Earth's atmosphere and re-entry on biological, physical and chemical experiments for astrobiological purposes. We designed a robust functionality biomarker assay to analyze the biological effects of suborbital spaceflights prevailing during ballistic rocket flights. During the TEXUS-49 rocket mission in March 2011, artificial plasmid DNA carrying a fluorescent marker (enhanced green fluorescent protein: EGFP) and an antibiotic resistance cassette (kanamycin/neomycin) was attached on different positions of rocket exterior; (i) circular every 90 degree on the outer surface concentrical of the payload, (ii) in the grooves of screw heads located in between the surface application sites, and (iii) on the surface of the bottom side of the payload. Temperature measurements showed two major peaks at 118 and 130 °C during the 780 seconds lasting flight on the inside of the recovery module, while outer gas temperatures of more than 1000 °C were estimated on the sample application locations. Directly after retrieval and return transport of the payload, the plasmid DNA samples were recovered. Subsequent analyses showed that DNA could be recovered from all application sites with a maximum of 53% in the grooves of the screw heads. We could further show that up to 35% of DNA retained its full biological function, i.e., mediating antibiotic resistance in bacteria and fluorescent marker expression in eukaryotic cells. These experiments show that our plasmid DNA biomarker assay is suitable to characterize the environmental conditions affecting DNA during an atmospheric transit and the re-entry and constitute the first report of the stability of DNA during hypervelocity atmospheric transit indicating that sounding rocket flights can be used to model the high-speed atmospheric entry of organics-laden artificial meteorites. PMID:25426925

  5. Protection by low-dose kanamycin against noise-induced hearing loss in mice: dependence on dosing regimen and genetic background.

    PubMed

    Ohlemiller, Kevin K; Rybak Rice, Mary E; Rosen, Allyson D; Montgomery, Scott C; Gagnon, Patricia M

    2011-10-01

    We recently demonstrated that sub-chronic low-dose kanamycin (KM, 300 mg/kg sc, 2×/day, 10 days) dramatically reduces permanent noise-induced hearing loss (NIHL) and hair cell loss in 1 month old CBA/J mice (Fernandez et al., 2010, J. Assoc. Res. Otolaryngol. 11, 235-244). Protection by KM remained for at least 48 h after the last dose, and appeared to involve a cumulative effect of multiple doses as part of a preconditioning process. The first month of life lies within the early 'sensitive period' for both cochlear noise and ototoxic injury in mice, and CBA/J mice appear exquisitely vulnerable to noise during this period (Ohlemiller et al., 2011; Hearing Res. 272, 13-20). From our initial data, we could not rule out 1) that less rigorous treatment protocols than the intensive one we applied may be equally-or more-protective; 2) that protection by KM is tightly linked to processes unique to the sensitive period for noise or ototoxins; or 3) that protection by KM is exclusive to CBA/J mice. The present experiments address these questions by varying the number and timing of fixed doses (300 mg/kg sc) of KM, as well as the age at treatment in CBA/J mice. We also tested for protection in young C57BL/6J (B6) mice. We find that nearly complete protection against at least 2 h of intense (110 dB SPL) broadband noise can be observed in CBA/J mice at least for ages up to 1 year. Reducing dosing frequency to as little as once every other day (a four-fold decrease in dosing frequency) appeared as protective as twice per day. However, reducing the number of doses to just 1 or 2, followed by noise 24 or 48 h later greatly reduced protection. Notably, hearing thresholds and hair cells in young B6 mice appeared completely unprotected by the same regimen that dramatically protects CBA/J mice. We conclude that protective effects of KM against NIHL in CBA/J mice can be engaged by a wide range of dosing regimens, and are not exclusive to the sensitive period for noise or ototoxins

  6. Complete Nucleotide Sequence of the IncN Plasmid Encoding IMP-6 and CTX-M-2 from Emerging Carbapenem-Resistant Enterobacteriaceae in Japan

    PubMed Central

    Kayama, Shizuo; Shigemoto, Norifumi; Kuwahara, Ryuichi; Oshima, Kenshiro; Hirakawa, Hideki; Hisatsune, Junzo; Jové, Thomas; Nishio, Hisaaki; Yamasaki, Katsutoshi; Wada, Yasunao; Ueshimo, Takeshi; Miura, Tetsuya; Sueda, Taijiro; Onodera, Makoto; Yokozaki, Michiya; Hattori, Masahira; Ohge, Hiroki

    2014-01-01

    We have determined the DNA sequence of Klebsiella pneumoniae multidrug resistance plasmid pKPI-6, which is a self-transmissible IncN-type plasmid. pKPI-6 harboring blaIMP-6 and blaCTX-M-2 confers a stealth-type carbapenem resistance phenotype on members of the family Enterobacteriaceae that is not detectable with imipenem. pKPI-6 is already epidemic in Japan, favoring the dissemination of IMP-6 and CTX-M-2 in members of the family Enterobacteriaceae. PMID:25487806

  7. Antimicrobial resistance and the ecology of Escherichia coli plasmids.

    PubMed Central

    Platt, D. J.; Sommerville, J. S.; Kraft, C. A.; Timbury, M. C.

    1984-01-01

    Four hundred and seven clinical isolates of Escherichia coli were examined for the presence of plasmids. These isolates comprised 189 which were collected irrespective of antimicrobial resistance (VP) and 218 which were collected on the basis of high-level trimethoprim resistance (TPR). The VP isolates were divided into drug sensitive (VPS) and drug-resistant (VPR) subpopulations. Plasmids were detected in 88% of VP isolates (81% of VPS and 94% of VPR) and 98% of TPR isolates. The distribution of plasmids in both groups and subpopulations was very similar. However, there were small but statistically significant differences between the plasmid distributions. These showed that more isolates in the resistant groups harboured plasmids than in the sensitive subpopulation (VPS) and that the number of plasmids carried by resistant isolates was greater. Multiple drug resistance was significantly more common among TPR isolates than the VPR subpopulation and this was paralleled by increased numbers of plasmids. Fifty-eight per cent of VPR and 57% of TPR isolates transferred antimicrobial resistance and plasmids to E. coli K12. Of the R+ isolates, 60% carried small plasmids (MW less than 20Md) and 52% of these co-transferred with R-plasmids. These results are discussed. PMID:6389695

  8. Helper plasmid cloning in Streptococcus sanguis: cloning of a tetracycline resistance determinant from the Streptococcus mutans chromosome.

    PubMed

    Tobian, J A; Macrina, F L

    1982-10-01

    A model system for testing the helper plasmid cloning system of Gryczan et al. (Mol. Gen. Genet. 177:459-467, 1980) was devised for the Streptococcus sanguis (Challis) host-vector system. In this system, linearized pVA736 plasmid efficiently transformed an S. sanguis (Challis) host containing a homologous plasmid, pVA380-1, but did not transform a plasmidless host or a host containing a nonhomologous plasmid, pVA380. In addition, whereas monomeric circular pVA736 transformed a plasmidless host with two-hit kinetics, it transformed a pVA380-1-containing host with one-hit kinetics. This helper plasmid cloning system was used to isolate two HindIII fragments (5.0 megadaltons [Mdal] and 1.9 Mdal in size) from the chromosome of Streptococcus mutans V825 which conferred high-level tetracycline resistance. One tetracycline-resistant clone was examined and found to contain three plasmids which were sized and designated pVA868 (9.0 Mdal), pVA869 (9.5 Mdal), and pVA870 (9.8 Mdal). Results of Southern blot hybridization and restriction endonuclease digestion confirmed that all three chimeras were composed of two HindIII fragments of the S. mutans V825 chromosome, as well as a large portion, varying in size for each chimera, of the 2.8 Mdal cloning vector, pVA380-1. Incompatibility observed between pVA380-1 and each of the chimeras indicated that replication of the chimeras was governed by the pVA380-1 replicative origin. Southern blotting experiments revealed that the chimeras hybridized to Tn916, providing the first evidence that transposon-related genes of enteric streptococcal origin are disseminated among oral streptococci.

  9. Comparative genomics of IncP-1ε plasmids from water environments reveals diverse and unique accessory genetic elements.

    PubMed

    Oliveira, Cláudia S; Moura, Alexandra; Henriques, Isabel; Brown, Celeste J; Rogers, Linda M; Top, Eva M; Correia, António

    2013-11-01

    The goal of this study was to determine and compare the complete genome sequences of three new broad-host-range conjugative plasmids. Plasmids pMLUA1, pMLUA3 and pMLUA4 were previously recovered from estuarine water by exogenous plasmid isolation and ranged in size from ∼55 to 59 kb. Comparative genomics showed that their backbone region was identical to the prototype pKJK5 and other IncP1-ε plasmids captured from soils. The accessory region was inserted between the tra region and parA, and presented the typical IncP-1ε ISPa17 and Tn402-like transposon modules. Nevertheless, new class 1 integrons were identified (In794, carrying aadA5 and In795, carrying qacF5-aadA5), as well as a composite transposon IS26-msr(E)-mph(E)-IS26 carrying genes that confer resistance to macrolides. A new insertion sequence, termed ISUnCu17, was also identified on pMLUA3. The architecture of the accessory regions implies the occurrence of multiple insertions and deletions. These data support the notion that IncP-1 plasmids from the ε subgroup are proficient in the capture of diverse genetic elements, including antibiotic resistance genes, and thus may contribute to the co-selection of several resistance determinants. This study constitutes the first report of completely sequenced IncP-1ε plasmids from water environments, and enhances our understanding of the geographic distribution and genetic diversity of these replicons.

  10. The Complete Sequences and Ecological Roles of Two IncP-1β Plasmids, pHB44 and pBS64, Isolated from the Mycosphere of Laccaria proxima.

    PubMed

    Zhang, Miaozhi; Brons, Jolanda K; van Elsas, Jan Dirk

    2016-01-01

    Two novel plasmids, coined pHB44 and pBS64, were recently found in Variovorax paradoxus strains HB44 and BS64 isolated from the mycosphere of Laccaria proxima, on two different sampling occasions. We here describe the full sequences of pHB44 and pBS64 and establish their evolutionary placement and ecological function. Both plasmids, unique for mycospheric V. paradoxus, were around 58 kb in size. They possessed, in a very similar fashion, three main plasmid backbone regions, which were predicted to be involved in plasmid replication, central control of maintenance, and conjugational transfer. Phylogenetic inference on the basis of seven selected and concatenated plasmid backbone genes provided solid evidence for the placement of the two plasmids in the IncP-1β1 group, with the recently isolated IncP-1β1 plasmid pMBUI8 as the closest relative. A comparative analysis of the sequences present in each of the recombinational hot spots (RHS) I to III across plasmids pHB44, pBS64, and pMBUI8 revealed the insertions found in plasmids pHB44 and pBS64 to be different from those of pMBUI8. Whereas, in the former two plasmids, RHS I and III were devoid of any major inserts, their RHS II regions contained inserts of 15,043 (pHB44) and 16,406 kb (pBS64), against about 9,3 kb for pMBUI8. Interestingly, these regions were highly similar across plasmids pHB44 and pBS64, and differed from that of pMBUI8. Closer inspection revealed the insert in the former plasmids to contain, next to transposases, an "mmf" gene cassette previously reported to encode metal "responsiveness" in the PromA plasmid pMOL98. Whereas the plasmid pHB44 RHS II contained the canonical mmf sequence, that in pBS64 contained, in addition, a "two-gene duplicated region" flanking the mmf C2 gene. In vitro experiments on the growth and survival of strains with or without plasmid pHB44 suggested this plasmid was involved in the binding and import of Fe(3+) as well as V(3+) ions into the host cells, thus yielding a

  11. Osa protein constitutes a strong oncogenic suppression system that can block vir-dependent transfer of IncQ plasmids between Agrobacterium cells and the establishment of IncQ plasmids in plant cells.

    PubMed

    Lee, Lan-Ying; Gelvin, Stanton B

    2004-11-01

    The osa (oncogenic suppressive activity) gene of the IncW group plasmid pSa is sufficient to suppress tumorigenesis by Agrobacterium tumefaciens. osa confers oncogenic suppression by inhibiting VirE2 protein export. This result is similar, but not identical, to that of oncogenic suppression by the IncQ plasmid RSF1010. We conducted a series of experiments to compare oncogenic suppression by these two systems. Agrobacterium strains harboring plasmids containing osa are more able to effect oncogenic suppression than are similar strains containing various RSF1010 derivatives. When osa is present within a donor Agrobacterium strain that also carries a derivative of RSF1010, the transfer of RSF1010 derivatives to recipient bacteria and their establishment in plants are blocked. Oncogenic suppression is still effected when the osa gene is integrated into the Agrobacterium chromosome, suggesting that it is the osa gene product that is active in suppression and that suppression does not require a protein-nucleic acid intermediate like that described for IncQ plasmids. Extracellular complementation experiments with tobacco leaf disks indicated that Osa blocks stable transfer of RSF1010 to plant cells by inhibiting transfer of VirE2, which is essential for the transfer of RSF1010 into plant cells, and not by inhibiting the actual transfer of RSF1010 itself. Our results suggest that Osa and RSF1010 cause oncogenic suppression by using different mechanisms. PMID:15489437

  12. Central Nervous Activity upon Systemic Salicylate Application in Animals with Kanamycin-Induced Hearing Loss--A Manganese-Enhanced MRI (MEMRI) Study.

    PubMed

    Gröschel, Moritz; Götze, Romy; Müller, Susanne; Ernst, Arne; Basta, Dietmar

    2016-01-01

    This study investigated the effect of systemic salicylate on central auditory and non-auditory structures in mice. Since cochlear hair cells are known to be one major target of salicylate, cochlear effects were reduced by using kanamycin to remove or impair hair cells. Neuronal brain activity was measured using the non-invasive manganese-enhanced magnetic resonance imaging technique. For all brain structures investigated, calcium-related neuronal activity was increased following systemic application of a sodium salicylate solution: probably due to neuronal hyperactivity. In addition, it was shown that the central effect of salicylate was not limited to the auditory system. A general alteration of calcium-related activity was indicated by an increase in manganese accumulation in the preoptic area of the anterior hypothalamus, as well as in the amygdala. The present data suggest that salicylate-induced activity changes in the auditory system differ from those shown in studies of noise trauma. Since salicylate action is reversible, central pharmacological effects of salicylate compared to those of (permanent) noise-induced hearing impairment and tinnitus might induce different pathophysiologies. These should therefore, be treated as different causes with the same symptoms. PMID:27078034

  13. Central Nervous Activity upon Systemic Salicylate Application in Animals with Kanamycin-Induced Hearing Loss--A Manganese-Enhanced MRI (MEMRI) Study.

    PubMed

    Gröschel, Moritz; Götze, Romy; Müller, Susanne; Ernst, Arne; Basta, Dietmar

    2016-01-01

    This study investigated the effect of systemic salicylate on central auditory and non-auditory structures in mice. Since cochlear hair cells are known to be one major target of salicylate, cochlear effects were reduced by using kanamycin to remove or impair hair cells. Neuronal brain activity was measured using the non-invasive manganese-enhanced magnetic resonance imaging technique. For all brain structures investigated, calcium-related neuronal activity was increased following systemic application of a sodium salicylate solution: probably due to neuronal hyperactivity. In addition, it was shown that the central effect of salicylate was not limited to the auditory system. A general alteration of calcium-related activity was indicated by an increase in manganese accumulation in the preoptic area of the anterior hypothalamus, as well as in the amygdala. The present data suggest that salicylate-induced activity changes in the auditory system differ from those shown in studies of noise trauma. Since salicylate action is reversible, central pharmacological effects of salicylate compared to those of (permanent) noise-induced hearing impairment and tinnitus might induce different pathophysiologies. These should therefore, be treated as different causes with the same symptoms.

  14. Central Nervous Activity upon Systemic Salicylate Application in Animals with Kanamycin-Induced Hearing Loss - A Manganese-Enhanced MRI (MEMRI) Study

    PubMed Central

    Gröschel, Moritz; Götze, Romy; Müller, Susanne; Ernst, Arne; Basta, Dietmar

    2016-01-01

    This study investigated the effect of systemic salicylate on central auditory and non-auditory structures in mice. Since cochlear hair cells are known to be one major target of salicylate, cochlear effects were reduced by using kanamycin to remove or impair hair cells. Neuronal brain activity was measured using the non-invasive manganese-enhanced magnetic resonance imaging technique. For all brain structures investigated, calcium-related neuronal activity was increased following systemic application of a sodium salicylate solution: probably due to neuronal hyperactivity. In addition, it was shown that the central effect of salicylate was not limited to the auditory system. A general alteration of calcium-related activity was indicated by an increase in manganese accumulation in the preoptic area of the anterior hypothalamus, as well as in the amygdala. The present data suggest that salicylate-induced activity changes in the auditory system differ from those shown in studies of noise trauma. Since salicylate action is reversible, central pharmacological effects of salicylate compared to those of (permanent) noise-induced hearing impairment and tinnitus might induce different pathophysiologies. These should therefore, be treated as different causes with the same symptoms. PMID:27078034

  15. Cochlear repair by transplantation of human cord blood CD133+ cells to nod-scid mice made deaf with kanamycin and noise.

    PubMed

    Revoltella, Roberto P; Papini, Sandra; Rosellini, Alfredo; Michelini, Monica; Franceschini, Valeria; Ciorba, Andrea; Bertolaso, Lucia; Magosso, Sara; Hatzopoulos, Stavros; Lorito, Guiscardo; Giordano, Pietro; Simoni, Edi; Ognio, Emanuela; Cilli, Michele; Saccardi, Riccardo; Urbani, Serena; Jeffery, Rosemary; Poulsom, Richard; Martini, Alessandro

    2008-01-01

    We investigated the fate of human cord blood CD133+ hematopoietic stem cells (HSC) transplanted intravenously (IV) into irradiated nod-scid mice previously made deaf by ototoxic treatment with kanamycin and/ or intense noise, to verify whether HSC engraft the cochlea and contribute to inner ear restoration, in vivo. We tested the presence of HLA.DQalpha1 by PCR, used for traceability of engrafted cells, finding evidence that HSC migrated to various host tissues, including the organ of Corti (OC). By histology, antibody and lectin-staining analysis, we confirmed that HSC IV transplantation in mice previously damaged by ototoxic agents correlated with the repair process and stimulation ex novo of morphological recovery in the inner ear, while the cochlea of control oto-injured, nontransplanted mice remained seriously damaged. Dual color FISH analysis also provided evidence of positive engraftment in the inner ear and in various mouse tissues, also revealing small numbers of heterokaryons, probably derived from fusion of donor with endogenous cells, for up to 2 months following transplantation. These observations offer the first evidence that transplanted human HSC migrating to the inner ear of oto-injured mice may provide conditions for the resumption of deafened cochlea, emerging as a potential strategy for inner ear rehabilitation. PMID:18819255

  16. Structures of replication initiation proteins from staphylococcal antibiotic resistance plasmids reveal protein asymmetry and flexibility are necessary for replication

    PubMed Central

    Carr, Stephen B.; Phillips, Simon E.V.; Thomas, Christopher D.

    2016-01-01

    Antibiotic resistance in pathogenic bacteria is a continual threat to human health, often residing in extrachromosomal plasmid DNA. Plasmids of the pT181 family are widespread and confer various antibiotic resistances to Staphylococcus aureus. They replicate via a rolling circle mechanism that requires a multi-functional, plasmid-encoded replication protein to initiate replication, recruit a helicase to the site of initiation and terminate replication after DNA synthesis is complete. We present the first atomic resolution structures of three such replication proteins that reveal distinct, functionally relevant conformations. The proteins possess a unique active site and have been shown to contain a catalytically essential metal ion that is bound in a manner distinct from that of any other rolling circle replication proteins. These structures are the first examples of the Rep_trans Pfam family providing insights into the replication of numerous antibiotic resistance plasmids from Gram-positive bacteria, Gram-negative phage and the mobilisation of DNA by conjugative transposons. PMID:26792891

  17. Community-wide plasmid gene mobilization and selection

    PubMed Central

    Sentchilo, Vladimir; Mayer, Antonia P; Guy, Lionel; Miyazaki, Ryo; Green Tringe, Susannah; Barry, Kerrie; Malfatti, Stephanie; Goessmann, Alexander; Robinson-Rechavi, Marc; van der Meer, Jan R

    2013-01-01

    Plasmids have long been recognized as an important driver of DNA exchange and genetic innovation in prokaryotes. The success of plasmids has been attributed to their independent replication from the host's chromosome and their frequent self-transfer. It is thought that plasmids accumulate, rearrange and distribute nonessential genes, which may provide an advantage for host proliferation under selective conditions. In order to test this hypothesis independently of biases from culture selection, we study the plasmid metagenome from microbial communities in two activated sludge systems, one of which receives mostly household and the other chemical industry wastewater. We find that plasmids from activated sludge microbial communities carry among the largest proportion of unknown gene pools so far detected in metagenomic DNA, confirming their presumed role of DNA innovators. At a system level both plasmid metagenomes were dominated by functions associated with replication and transposition, and contained a wide variety of antibiotic and heavy metal resistances. Plasmid families were very different in the two metagenomes and grouped in deep-branching new families compared with known plasmid replicons. A number of abundant plasmid replicons could be completely assembled directly from the metagenome, providing insight in plasmid composition without culturing bias. Functionally, the two metagenomes strongly differed in several ways, including a greater abundance of genes for carbohydrate metabolism in the industrial and of general defense factors in the household activated sludge plasmid metagenome. This suggests that plasmids not only contribute to the adaptation of single individual prokaryotic species, but of the prokaryotic community as a whole under local selective conditions. PMID:23407308

  18. Large linear plasmids of Borrelia species that cause relapsing fever.

    PubMed

    Miller, Shelley Campeau; Porcella, Stephen F; Raffel, Sandra J; Schwan, Tom G; Barbour, Alan G

    2013-08-01

    Borrelia species of relapsing fever (RF) and Lyme disease (LD) lineages have linear chromosomes and both linear and circular plasmids. Unique to RF species, and little characterized to date, are large linear plasmids of ∼160 kb, or ∼10% of the genome. By a combination of Sanger and next-generation methods, we determined the sequences of large linear plasmids of two New World species: Borrelia hermsii, to completion of its 174-kb length, and B. turicatae, partially to 114 kb of its 150 kb. These sequences were then compared to corresponding sequences of the Old World species B. duttonii and B. recurrentis and to plasmid sequences of LD Borrelia species. The large plasmids were largely colinear, except for their left ends, about 27 kb of which was inverted in New World species. Approximately 60% of the B. hermsii lp174 plasmid sequence was repetitive for 6 types of sequence, and half of its open reading frames encoded hypothetical proteins not discernibly similar to proteins in the database. The central ∼25 kb of all 4 linear plasmids was syntenic for orthologous genes for plasmid maintenance or partitioning in Borrelia species. Of all the sequenced linear and circular plasmids in Borrelia species, the large plasmid's putative partition/replication genes were most similar to those of the 54-kb linear plasmids of LD species. Further evidence for shared ancestry was the observation that two of the hypothetical proteins were predicted to be structurally similar to the LD species' CspA proteins, which are encoded on the 54-kb plasmids.

  19. Ornamental fish as a source of plasmid-mediated quinolone resistance genes and antibiotic resistance plasmids.

    PubMed

    Dobiasova, Hana; Kutilova, Iva; Piackova, Veronika; Vesely, Tomas; Cizek, Alois; Dolejska, Monika

    2014-07-16

    Growing ornamental fish industry is associated with public health concerns including extensive antibiotic use accompanied by increasing antibiotic resistance. The aim of this study was to analyze Aeromonas isolates from imported tropical ornamental fish and coldwater koi carps bred in the Czech Republic to assess the potential risk of ornamental fish as a source of plasmid-mediated quinolone resistance genes (PMQR) and antibiotic resistance plasmids. A collection of Aeromonas spp. with reduced susceptibility to ciprofloxacin (MIC ≥ 0.05 mg/L) was selected for the detection of PMQR genes. Isolates harbouring PMQR genes were further analyzed for the additional antibiotic resistance, integron content, clonality, biofilm production and transferability of PMQR genes by conjugation and transformation. Comparative analysis of plasmids carrying PMQR genes was performed. Fifteen (19%, n=80) isolates from koi carps and 18 (24%, n=76) isolates from imported ornamental fish were positive for qnrS2, aac(6')-Ib-cr or qnrB17 genes. PMQR-positive isolates from imported ornamental fish showed higher MIC levels to quinolones, multiresistance and diverse content of antibiotic resistance genes and integrons compared to the isolates from the carps. Related IncU plasmids harbouring qnrS2 and aac(6')-Ib-cr genes were found in Aeromonas spp. from imported ornamental fish and koi carps from various geographical areas. Ornamental fish may represent a potential source of multiresistant bacteria and mobile genetic elements for the environment and for humans.

  20. Photonic Plasmid Stability of Transformed Salmonella Typhimurium: A Comparison of Three Unique Plasmids

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Background: Acquiring a highly stable photonic plasmid in transformed Salmonella Typhimurium for use in biophotonic studies of bacterial tracking in vivo is critical to experimental paradigm development. The objective of this study was to determine stability of transformed Salmonella Typhimurium (S....

  1. Photonic plasmid stability of transformed Salmonella typhimurium: A comparison of three unique plasmids

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Acquiring a highly stable photonic plasmid in transformed Salmonella typhimurium for use in biophotonic studies of bacterial tracking in vivo is critical to experimental paradigm development. The objective of this study was to determine stability of transformed Salmonella typhimurium (S. typh-lux) u...

  2. Transcriptome modulations due to A/C2 plasmid acquisition.

    PubMed

    Lang, Kevin S; Johnson, Timothy J

    2015-07-01

    Plasmids play an important role in driving the genetic diversity of bacteria. Horizontal gene transfer via plasmids is crucial for the dissemination of antimicrobial resistance genes. Many factors contribute to the persistence of plasmids within bacterial populations, and it has been suggested that epistatic interactions between the host chromosome and plasmid contribute to the fitness of a particular plasmid-host combination. However, such interactions have been shown to differ between bacterial hosts. In this study, RNA-Seq was performed in six different strains, spanning three species, to characterize the influence of host background on the A/C2 plasmid transcriptome. In five of these strains, chromosomal transcriptomes were compared in the presence and absence of A/C2 plasmid pAR060302. Host-specific effects on plasmid gene expression were identified, and acquisition of pAR060302 resulted in changes in the expression of chromosomal genes involved in metabolism and energy production. These results suggest that A/C2 plasmid fitness is, in part, dependent on host chromosome content, as well as environmental factors. PMID:26079188

  3. Plasmid genes required for microcin B17 production.

    PubMed Central

    San Millán, J L; Kolter, R; Moreno, F

    1985-01-01

    The production of the antibiotic substance microcin B17 (Mcc) is determined by a 3.5-kilobase DNA fragment from plasmid pMccB17. Several Mcc- mutations on plasmid pMccB17 were obtained by both transposon insertion and nitrosoguanidine mutagenesis. Plasmids carrying these mutations were tested for their ability to complement Mcc- insertion or deletion mutations on pMM102 (pMM102 is a pBR322 derivative carrying the region encoding microcin B17). Results from these experiments indicate that at least four plasmid genes are required for microcin production. PMID:2993228

  4. Analysis of Genetic Toggle Switch Systems Encoded on Plasmids

    NASA Astrophysics Data System (ADS)

    Loinger, Adiel; Biham, Ofer

    2009-08-01

    Genetic switch systems with mutual repression of two transcription factors, encoded on plasmids, are studied using stochastic methods. The plasmid copy number is found to strongly affect the behavior of these systems. More specifically, the average time between spontaneous switching events quickly increases with the number of plasmids. It was shown before that for a single copy encoded on the chromosome, the exclusive switch is more stable than the general switch. Here we show that when the switch is encoded on a sufficiently large number of plasmids, the situation is reversed and the general switch is more stable than the exclusive switch. These predictions can be tested experimentally using methods of synthetic biology.

  5. Plasmid Recombination in a Rad52 Mutant of Saccharomyces Cerevisiae

    PubMed Central

    Dornfeld, K. J.; Livingston, D. M.

    1992-01-01

    Using plasmids capable of undergoing intramolecular recombination, we have compared the rates and the molecular outcomes of recombination events in a wild-type and a rad52 strain of Saccharomyces cerevisiae. The plasmids contain his3 heteroalleles oriented in either an inverted or a direct repeat. Inverted repeat plasmids recombine approximately 20-fold less frequently in the mutant than in the wild-type strain. Most events from both cell types have continuous coconversion tracts extending along one of the homologous segments. Reciprocal exchange occurs in fewer than 30% of events. Direct repeat plasmids recombine at rates comparable to those of inverted repeat plasmids in wild-type cells. Direct repeat conversion tracts are similar to inverted repeat conversion tracts in their continuity and length. Inverted and direct repeat plasmid recombination differ in two respects. First, rad52 does not affect the rate of direct repeat recombination as drastically as the rate of inverted repeat recombination. Second, direct repeat plasmids undergo crossing over more frequently than inverted repeat plasmids. In addition, crossovers constitute a larger fraction of mutant than wild-type direct repeat events. Many crossover events from both cell types are unusual in that the crossover HIS3 allele is within a plasmid containing the parental his3 heteroalleles. PMID:1644271

  6. Plasmid genes required for microcin B17 production.

    PubMed

    San Millán, J L; Kolter, R; Moreno, F

    1985-09-01

    The production of the antibiotic substance microcin B17 (Mcc) is determined by a 3.5-kilobase DNA fragment from plasmid pMccB17. Several Mcc- mutations on plasmid pMccB17 were obtained by both transposon insertion and nitrosoguanidine mutagenesis. Plasmids carrying these mutations were tested for their ability to complement Mcc- insertion or deletion mutations on pMM102 (pMM102 is a pBR322 derivative carrying the region encoding microcin B17). Results from these experiments indicate that at least four plasmid genes are required for microcin production.

  7. Plasmids foster diversification and adaptation of bacterial populations in soil.

    PubMed

    Heuer, Holger; Smalla, Kornelia

    2012-11-01

    It is increasingly being recognized that the transfer of conjugative plasmids across species boundaries plays a vital role in the adaptability of bacterial populations in soil. There are specific driving forces and constraints of plasmid transfer within bacterial communities in soils. Plasmid-mediated genetic variation allows bacteria to respond rapidly with adaptive responses to challenges such as irregular antibiotic or metal concentrations, or opportunities such as the utilization of xenobiotic compounds. Cultivation-independent detection and capture of plasmids from soil bacteria, and complete sequencing have provided new insights into the role and ecology of plasmids. Broad host range plasmids such as those belonging to IncP-1 transfer a wealth of accessory functions which are carried by similar plasmid backbones. Plasmids with a narrower host range can be more specifically adapted to particular species and often transfer genes which complement chromosomally encoded functions. Plasmids seem to be an ancient and successful strategy to ensure survival of a soil population in spatial and temporal heterogeneous conditions with various environmental stresses or opportunities that occur irregularly or as a novel challenge in soil.

  8. The General Conference Mennonites.

    ERIC Educational Resources Information Center

    Ediger, Marlow

    General Conference Mennonites and Old Order Amish are compared and contrasted in the areas of physical appearance, religious beliefs, formal education, methods of farming, and home settings. General Conference Mennonites and Amish differ in physical appearance and especially in dress. The General Conference Mennonite men and women dress the same…

  9. Parent Conferences. Beginnings Workshop.

    ERIC Educational Resources Information Center

    Duffy, Roslyn; And Others

    1997-01-01

    Presents six workshop sessions on parent conferences: (1) "Parents' Perspectives on Conferencing" (R. Duffy); (2) "Three Way Conferences" (G. Zeller); (3) "Conferencing with Parents of Infants" (K. Albrecht); (4) "Conferencing with Parents of School-Agers" (L. G. Miller); (5) "Cross Cultural Conferences" (J. Gonzalez-Mena); and (6) "Working with…

  10. Comparative Genomics of an IncA/C Multidrug Resistance Plasmid from Escherichia coli and Klebsiella Isolates from Intensive Care Unit Patients and the Utility of Whole-Genome Sequencing in Health Care Settings

    PubMed Central

    Hazen, Tracy H.; Zhao, LiCheng; Boutin, Mallory A.; Stancil, Angela; Robinson, Gwen; Harris, Anthony D.; Rasko, David A.

    2014-01-01

    The IncA/C plasmids have been implicated for their role in the dissemination of β-lactamases, including gene variants that confer resistance to expanded-spectrum cephalosporins, which are often the treatment of last resort against multidrug-resistant, hospital-associated pathogens. A blaFOX-5 gene was detected in 14 Escherichia coli and 16 Klebsiella isolates that were cultured from perianal swabs of patients admitted to an intensive care unit (ICU) of the University of Maryland Medical Center (UMMC) in Baltimore, MD, over a span of 3 years. Four of the FOX-encoding isolates were obtained from subsequent samples of patients that were initially negative for an AmpC β-lactamase upon admission to the ICU, suggesting that the AmpC β-lactamase-encoding plasmid was acquired while the patient was in the ICU. The genomes of five E. coli isolates and six Klebsiella isolates containing blaFOX-5 were selected for sequencing based on their plasmid profiles. An ∼167-kb IncA/C plasmid encoding the FOX-5 β-lactamase, a CARB-2 β-lactamase, additional antimicrobial resistance genes, and heavy metal resistance genes was identified. Another FOX-5-encoding IncA/C plasmid that was nearly identical except for a variable region associated with the resistance genes was also identified. To our knowledge, these plasmids represent the first FOX-5-encoding plasmids sequenced. We used comparative genomics to describe the genetic diversity of a plasmid encoding a FOX-5 β-lactamase relative to the whole-genome diversity of 11 E. coli and Klebsiella isolates that carry this plasmid. Our findings demonstrate the utility of whole-genome sequencing for tracking of plasmid and antibiotic resistance gene distribution in health care settings. PMID:24914121

  11. Development of pVCR94ΔX from Vibrio cholerae, a prototype for studying multidrug resistant IncA/C conjugative plasmids

    PubMed Central

    Carraro, Nicolas; Sauvé, Maxime; Matteau, Dominick; Lauzon, Guillaume; Rodrigue, Sébastien; Burrus, Vincent

    2013-01-01

    Antibiotic resistance has grown steadily in Vibrio cholerae over the last few decades to become a major threat in countries affected by cholera. Multi-drug resistance (MDR) spreads among clinical and environmental V. cholerae strains by lateral gene transfer often mediated by integrative and conjugative elements (ICEs) of the SXT/R391 family. However, in a few reported but seemingly isolated cases, MDR in V. cholerae was shown to be associated with other self-transmissible genetic elements such as conjugative plasmids. IncA/C conjugative plasmids are often found associated with MDR in isolates of Enterobacteriaceae. To date, IncA/C plasmids have not been commonly found in V. cholerae or other species of Vibrio. Here we present a detailed analysis of pVCR94ΔX derived from pVCR94, a novel IncA/C conjugative plasmid identified in a V. cholerae clinical strain isolated during the 1994 Rwandan cholera outbreak. pVCR94 was found to confer resistance to sulfamethoxazole, trimethoprim, ampicillin, streptomycin, tetracycline, and chloramphenicol and to transfer at very high frequency. Sequence analysis revealed its mosaic nature as well as high similarity of the core genes responsible for transfer and maintenance with other IncA/C plasmids and ICEs of the SXT/R391 family. Although IncA/C plasmids are considered a major threat in antibiotics resistance, their basic biology has received little attention, mostly because of the difficulty to genetically manipulate these MDR conferring elements. Therefore, we developed a convenient derivative from pVCR94, pVCR94Δ X, a 120.5-kb conjugative plasmid which only codes for sulfamethoxazole resistance. Using pVCR94Δ X, we identified the origin of transfer (oriT) and discovered an essential gene for transfer, both located within the shared backbone, allowing for an annotation update of all IncA/C plasmids. pVCR94Δ X may be a useful model that will provide new insights on the basic biology of IncA/C conjugative plasmids. PMID

  12. Rapid compensatory evolution promotes the survival of conjugative plasmids.

    PubMed

    Harrison, Ellie; Dytham, Calvin; Hall, James P J; Guymer, David; Spiers, Andrew J; Paterson, Steve; Brockhurst, Michael A

    2016-01-01

    Conjugative plasmids play a vital role in bacterial adaptation through horizontal gene transfer. Explaining how plasmids persist in host populations however is difficult, given the high costs often associated with plasmid carriage. Compensatory evolution to ameliorate this cost can rescue plasmids from extinction. In a recently published study we showed that compensatory evolution repeatedly targeted the same bacterial regulatory system, GacA/GacS, in populations of plasmid-carrying bacteria evolving across a range of selective environments. Mutations in these genes arose rapidly and completely eliminated the cost of plasmid carriage. Here we extend our analysis using an individual based model to explore the dynamics of compensatory evolution in this system. We show that mutations which ameliorate the cost of plasmid carriage can prevent both the loss of plasmids from the population and the fixation of accessory traits on the bacterial chromosome. We discuss how dependent the outcome of compensatory evolution is on the strength and availability of such mutations and the rate at which beneficial accessory traits integrate on the host chromosome. PMID:27510852

  13. Horizontal gene transfer of stress resistance genes through plasmid transport.

    PubMed

    Shoeb, Erum; Badar, Uzma; Akhter, Jameela; Shams, Hina; Sultana, Maria; Ansari, Maqsood A

    2012-03-01

    The horizontal gene transfer of plasmid-determined stress tolerance was achieved under lab conditions. Bacterial isolates, Enterobacter cloacae (DGE50) and Escherichia coli (DGE57) were used throughout the study. Samples were collected from contaminated marine water and soil to isolate bacterial strains having tolerance against heavy metals and antimicrobial agents. We have demonstrated plasmid transfer, from Amp(+)Cu(+)Zn(-) strain (DGE50) to Amp(-)Cu(-)Zn(+) strain (DGE57), producing Amp(+)Cu(+)Zn(+) transconjugants (DGE(TC50→57)) and Amp(+)Cu(-)Zn(+) transformants (DGE(TF50→57)). DGE57 did not carry any plasmid, therefore, it can be speculated that zinc tolerance gene in DGE57 is located on chromosome. DGE50 was found to carry three plasmids, out of which two were transferred through conjugation into DGE57, and only one was transferred through transformation. Plasmid transferred through transformation was one out of the two transferred through conjugation. Through the results of transformation it was revealed that the genes of copper and ampicillin tolerance in DGE50 were located on separate plasmids, since only ampicillin tolerance genes were transferred through transformation as a result of one plasmid transfer. By showing transfer of plasmids under lab conditions and monitoring retention of respective phenotype via conjugation and transformation, it is very well demonstrated how multiple stress tolerant strains are generated in nature. PMID:22805823

  14. Functional identification of Xylella fastidiosa plasmid replication and stability factors

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Xylella fastidiosa (Xf) strain RIV11 harbors a 25 kbp plasmid (pXFRIV11) belonging to the incP1 incompatibility group. Replication and stability factors of pXFRIV11 were identified and used to construct plasmids able to replicate in both Xf and Escherichia coli. Sequences required for replication i...

  15. High frequency generalized transduction by miniMu plasmid phage.

    PubMed

    Wang, B M; Liu, L; Groisman, E A; Casadaban, M J; Berg, C M

    1987-06-01

    Deletion derivatives of phage Mu which replicate as multicopy plasmids, and also transpose and package like Mu, have been developed for the in vivo cloning of bacterial genes. We show here that these miniMu plasmid phage are also efficient at generalized transduction and that both in vivo cloning and generalized transduction of a given gene can be accomplished in a single experiment.

  16. Positive selection and compensatory adaptation interact to stabilize non-transmissible plasmids.

    PubMed

    San Millan, A; Peña-Miller, R; Toll-Riera, M; Halbert, Z V; McLean, A R; Cooper, B S; MacLean, R C

    2014-10-10

    Plasmids are important drivers of bacterial evolution, but it is challenging to understand how plasmids persist over the long term because plasmid carriage is costly. Classical models predict that horizontal transfer is necessary for plasmid persistence, but recent work shows that almost half of plasmids are non-transmissible. Here we use a combination of mathematical modelling and experimental evolution to investigate how a costly, non-transmissible plasmid, pNUK73, can be maintained in populations of Pseudomonas aeruginosa. Compensatory adaptation increases plasmid stability by eliminating the cost of plasmid carriage. However, positive selection for plasmid-encoded antibiotic resistance is required to maintain the plasmid by offsetting reductions in plasmid frequency due to segregational loss. Crucially, we show that compensatory adaptation and positive selection reinforce each other's effects. Our study provides a new understanding of how plasmids persist in bacterial populations, and it helps to explain why resistance can be maintained after antibiotic use is stopped.

  17. Positive selection and compensatory adaptation interact to stabilize non-transmissible plasmids

    PubMed Central

    Millan, A. San; Peña-Miller, R.; Toll-Riera, M.; Halbert, Z. V.; McLean, A. R.; Cooper, B. S.; MacLean, R. C.

    2014-01-01

    Plasmids are important drivers of bacterial evolution, but it is challenging to understand how plasmids persist over the long term because plasmid carriage is costly. Classical models predict that horizontal transfer is necessary for plasmid persistence, but recent work shows that almost half of plasmids are non-transmissible. Here we use a combination of mathematical modelling and experimental evolution to investigate how a costly, non-transmissible plasmid, pNUK73, can be maintained in populations of Pseudomonas aeruginosa. Compensatory adaptation increases plasmid stability by eliminating the cost of plasmid carriage. However, positive selection for plasmid-encoded antibiotic resistance is required to maintain the plasmid by offsetting reductions in plasmid frequency due to segregational loss. Crucially, we show that compensatory adaptation and positive selection reinforce each other’s effects. Our study provides a new understanding of how plasmids persist in bacterial populations, and it helps to explain why resistance can be maintained after antibiotic use is stopped. PMID:25302567

  18. Functional relationships between plasmids and their significance for metabolism and symbiotic performance of Rhizobium leguminosarum bv. trifolii.

    PubMed

    Stasiak, Grażyna; Mazur, Andrzej; Wielbo, Jerzy; Marczak, Małgorzata; Zebracki, Kamil; Koper, Piotr; Skorupska, Anna

    2014-11-01

    Rhizobium leguminosarum bv. trifolii TA1 (RtTA1) is a soil bacterium establishing a highly specific symbiotic relationship with clover, which is based on the exchange of molecular signals between the host plant and the microsymbiont. The RtTA1 genome is large and multipartite, composed of a chromosome and four plasmids, which comprise approximately 65 % and 35 % of the total genome, respectively. Extrachromosomal replicons were previously shown to confer significant metabolic versatility to bacteria, which is important for their adaptation in the soil and nodulation competitiveness. To investigate the contribution of individual RtTA1 plasmids to the overall cell phenotype, metabolic properties and symbiotic performance, a transposon-based elimination strategy was employed. RtTA1 derivatives cured of pRleTA1b or pRleTA1d and deleted in pRleTA1a were obtained. In contrast to the in silico predictions of pRleTA1b and pRleTA1d, which were described as chromid-like replicons, both appeared to be completely curable. On the other hand, for pRleTA1a (symbiotic plasmid) and pRleTA1c, which were proposed to be unessential for RtTA1 viability, it was not possible to eliminate them at all (pRleTA1c) or entirely (pRleTA1a). Analyses of the phenotypic traits of the RtTA1 derivatives obtained revealed the functional significance of individual plasmids and their indispensability for growth, certain metabolic pathways, production of surface polysaccharides, autoaggregation, biofilm formation, motility and symbiotic performance. Moreover, the results allow us to suggest broad functional cooperation among the plasmids in shaping the phenotypic properties and symbiotic capabilities of rhizobia.

  19. Exogenous Isolation of Mobilizing Plasmids from Polluted Soils and Sludges

    PubMed Central

    Top, Eva; De Smet, Ingrid; Verstraete, Willy; Dijkmans, Roger; Mergeay, Max

    1994-01-01

    Exogenous plasmid isolation was used to assess the presence of mobilizing plasmids in several soils and activated sludges. Triparental matings were performed with Escherichia coli (a member of the γ subgroup of the Proteobacteria) as the donor of an IncQ plasmid (pMOL155, containing the heavy metal resistance genes czc: Cor, Znr, and Cdr), Alcaligenes eutrophus (a member of the β subgroup of the Proteobacteria) as the recipient, and indigenous microorganisms from soil and sludge samples as helper strains. We developed an assay to assess the plasmid mobilization potential of a soil ecosystem on the basis of the number of transconjugants obtained after exogenous isolations. After inoculation into soil of several concentrations of a helper strain (E. coli CM120 harboring IncP [IncP1] mobilizing plasmid RP4), the log numbers of transconjugants obtained from exogenous isolations with different soil samples were a linear function of the log numbers of helper strain CM120(RP4) present in the soils. Four soils were analyzed for the presence of mobilizing elements, and mobilizing plasmids were isolated from two of these soils. Several sludge samples from different wastewater treatment plants yielded much higher numbers of transconjugants than the soil samples, indicating that higher numbers of mobilizing strains were present. The mobilizing plasmids isolated from Gent-O sludge and one plasmid isolated from Eislingen soil hybridized to the repP probe, whereas the plasmids isolated from Essen soil did not hybridize to a large number of rep probes (repFIC, repHI1, repH12, repL/M, repN, repP, repT, repU, repW, repX). This indicates that in Essen soil, broad-host-range mobilizing plasmids belonging to other incompatibility groups may be present. Images PMID:16349216

  20. IncP-1β plasmids of Comamonas sp. and Delftia sp. strains isolated from a wastewater treatment plant mediate resistance to and decolorization of the triphenylmethane dye crystal violet.

    PubMed

    Stolze, Yvonne; Eikmeyer, Felix; Wibberg, Daniel; Brandis, Gerrit; Karsten, Christina; Krahn, Irene; Schneiker-Bekel, Susanne; Viehöver, Prisca; Barsch, Aiko; Keck, Matthias; Top, Eva M; Niehaus, Karsten; Schlüter, Andreas

    2012-08-01

    The application of toxic triphenylmethane dyes such as crystal violet (CV) in various industrial processes leads to large amounts of dye-contaminated sludges that need to be detoxified. Specific bacteria residing in wastewater treatment plants (WWTPs) are able to degrade triphenylmethane dyes. The objective of this work was to gain insights into the genetic background of bacterial strains capable of CV degradation. Three bacterial strains isolated from a municipal WWTP harboured IncP-1β plasmids mediating resistance to and decolorization of CV. These isolates were assigned to the genera Comamonas and Delftia. The CV-resistance plasmid pKV29 from Delftia sp. KV29 was completely sequenced. In addition, nucleotide sequences of the accessory regions involved in conferring CV resistance were determined for plasmids pKV11 and pKV36 from the other two isolates. Plasmid pKV29 contains typical IncP-1β backbone modules that are highly similar to those of previously sequenced IncP-1β plasmids that confer antibiotic resistance, degradative capabilities or mercury resistance. The accessory regions located between the conjugative transfer (tra) and mating pair formation modules (trb) of all three plasmids analysed share common modules and include a triphenylmethane reductase gene, tmr, that is responsible for decolorization of CV. Moreover, these accessory regions encode other enzymes that are dispensable for CV degradation and hence are involved in so-far-unknown metabolic pathways. Analysis of plasmid-mediated degradation of CV in Escherichia coli by ultra-high-performance liquid chromatography-electrospray ionization-quadrupole-time-of-flight MS revealed that leuco crystal violet was the first degradation product. Michler's ketone and 4-dimethylaminobenzaldehyde appeared as secondary degradation metabolites. Enzymes encoded in the E. coli chromosome seem to be responsible for cleavage of leuco crystal violet. Plasmid-mediated degradation of triphenylmethane dyes such as CV

  1. Salmonella enterica serovar Typhimurium virulence-resistance plasmids derived from the pSLT carrying nonconventional class 1 integrons with dfrA12 gene in their variable region and sul3 in the 3' conserved segment.

    PubMed

    Beutlich, Janine; Rodicio, M Rosario; Mendoza, M Carmen; García, Patricia; Kirchner, Miranda; Luzzi, Ida; Mevius, Dik; Threlfall, John; Helmuth, Reiner; Guerra, Beatriz

    2013-12-01

    Drug-resistant derivatives of serovar-specific virulence plasmids, such as pSLT, in clinically-relevant Salmonella enterica serovar Typhimurium strains, represent a threat for human health. We have analysed 14 S. Typhimurium isolates recovered in Italy and the United Kingdom from swine and from cases of human infection for the presence of virulence-resistance (VR) plasmids. They were negative for the multidrug resistance (MDR) region of the Salmonella genomic island 1 (SGI1), but expressed resistance to ampicillin, chloramphenicol, streptomycin/spectinomycin, sulfamethoxazole, and tetracyclines. The isolates were characterised by XbaI pulsed-field gel electrophoresis, multilocus sequence typing, and detection of resistance and virulence determinants (PCR/sequencing). Identification of VR plasmids was accomplished by PCR detection of bla genes (encoding ampicillin resistance), class 1 integrons and the pSLT virulence gene spvC. Plasmid analyses were performed by alkaline lysis, S1-nuclease digestion, replicon typing, conjugation, restriction analyses, and Southern blot/hybridization. Two blaOXA-1 positive isolates contained pSLT-derived plasmids related to pUO-StVR2. In nine isolates, eight from swine and one from a patient, MDR-conferring-IncFII-VR plasmids were detected. They contained the blaTEM-1 gene as well as a nonconventional class 1 integron with dfrA12-aadA2 gene cassettes in its variable region, and a sul3 gene in the 3' conserved segment. Restriction analysis suggested a novel pSLT variant. The results obtained underline the role of swine as a potential reservoir for the blaTEM-1-IncFII-plasmids. The occurrence and spread of virulence- and MDR-conferring plasmids should be considered as a potential public health problem.

  2. Competition between plasmid-bearing and plasmid-free organisms in a chemostat with nutrient recycling and an inhibitor.

    PubMed

    Yuan, Sanling; Xiao, Dongmei; Han, Maoan

    2006-07-01

    The asymptotic behavior of solutions of a model for competition between plasmid-bearing and plasmid-free organisms in the chemostat with two distributed delays and an external inhibitor is considered. The model presents a refinement of the one considered by Lu and Hadeler [Z. Lu, K.P. Hadeler, Model of plasmid-bearing plasmid-free competition in the chemostat with nutrient recycling and an inhibitor, Math. Biosci. 167 (2000) p. 177]. The delays model the fact that the nutrient is partially recycled after the death of the biomass by bacterial decomposition. Furthermore, it is assumed that there is inter-specific competition between the plasmid-bearing and plasmid-free organisms as well as intra-specific competition within each population. Conditions for boundedness of solutions and existence of non-negative equilibrium are given. Analysis of the extinction of the organisms, including plasmid-bearing and plasmid-free organisms, and the uniform persistence of the system are also carried out. By constructing appropriate Liapunov-like functionals, some sufficient conditions of global attractivity to the extinction equilibria are obtained and the combined effects of the delays and the inhibitor are studied.

  3. The qacC Gene Has Recently Spread between Rolling Circle Plasmids of Staphylococcus, Indicative of a Novel Gene Transfer Mechanism

    PubMed Central

    Wassenaar, Trudy M.; Ussery, David W.; Ingmer, Hanne

    2016-01-01

    Resistance of Staphylococcus species to quaternary ammonium compounds, frequently used as disinfectants and biocides, can be attributed to qac genes. Most qac gene products belong to the Small Multidrug Resistant (SMR) protein family, and are often encoded by rolling-circle (RC) replicating plasmids. Four classes of SMR-type qac gene families have been described in Staphylococcus species: qacC, qacG, qacJ, and qacH. Within their class, these genes are highly conserved, but qacC genes are extremely conserved, although they are found in variable plasmid backgrounds. The lower degree of sequence identity of these plasmids compared to the strict nucleotide conservation of their qacC means that this gene has recently spread. In the absence of insertion sequences or other genetic elements explaining the mobility, we sought for an explanation of mobilization by sequence comparison. Publically available sequences of qac genes, their flanking genes and the replication gene that is invariably present in RC-plasmids were compared to reconstruct the evolutionary history of these plasmids and to explain the recent spread of qacC. Here we propose a new model that explains how qacC is mobilized and transferred to acceptor RC-plasmids without assistance of other genes, by means of its location in between the Double Strand replication Origin (DSO) and the Single-Strand replication Origin (SSO). The proposed mobilization model of this DSO-qacC-SSO element represents a novel mechanism of gene mobilization in RC-plasmids, which has also been employed by other genes, such as lnuA (conferring lincomycin resistance). The proposed gene mobility has aided to the wide spread of clinically relevant resistance genes in Staphylococcus populations. PMID:27729906

  4. Dynamics of a Class 1 Integron Located on Plasmid or Chromosome in Two Aeromonas spp. Strains

    PubMed Central

    Pérez-Valdespino, Abigail; Lazarini-Martínez, Alfredo; Rivera-González, Alejandro X.; García-Hernández, Normand; Curiel-Quesada, Everardo

    2016-01-01

    Integrons are non-mobile bacterial genetic elements that carry different cassettes conferring antibiotic resistance. Cassettes can excise or integrate by action of an integron-encoded integrase, enabling bacteria to face environmental challenges. In this work, the functionality and dynamics of two integrons carrying the same cassette arrangement (dfrA12–orfF–aadA2), but located on plasmid or chromosome in two different strains were studied. In order to demonstrate the functionality of the Class 1 integrase, circular cassette integration intermediaries were PCR amplified by PCR using extrachromosomal DNA extracted from bacteria grown in the presence or absence of cassette-encoded antibiotics. Circular aadA2 and dfrA12–orfF–aadA2 cassettes were detected in cultures grown either in the presence or absence of antibiotics in both strains. No dfrA12–orfF circular intermediates could be detected under any culture conditions. These results show that both integrons are functional. However, these elements show different dynamics and functionality since the presence of streptomycin led to detectable gene rearrangements in the variable region only in the strain with the plasmid-born integron. In addition, complete integration products were demonstrated using a receptor molecule carrying an empty integron. In this case, integration products were observed in both strains even in the absence of antibiotics, but they were more evident in the strain with the plasmid-located integron when streptomycin was present in the culture medium. This suggests that integrons in the two strains respond differently to streptomycin even though DNA sequences upstream the intI1 gene, including the lexA boxes of both integrons are identical. PMID:27733851

  5. Plasmid Copy Number Determination by Quantitative Polymerase Chain Reaction.

    PubMed

    Anindyajati; Artarini, A Anita; Riani, Catur; Retnoningrum, Debbie S

    2016-01-01

    Recombinant therapeutic proteins are biopharmaceutical products that develop rapidly for years. Recombinant protein production in certain hosts requires vector expression harboring the gene encoding the corresponding protein. Escherichia coli is the prokaryote organism mostly used in recombinant protein production, commonly using a plasmid as the expression vector. Recombinant protein production is affected by plasmid copy number harboring the encoded gene, hence the determination of plasmid copy number also plays an important role in establishing a recombinant protein production system. On the industrial scale, a low copy number of plasmids are more suitable due to their better stability. In the previous study we constructed pCAD, a plasmid derived from the low copy number pBR322 plasmid. This study was aimed to confirm pCAD's copy number by quantitative polymerase chain reaction (qPCR). Plasmid copy number was determined by comparing the quantification signal from the plasmid to those from the chromosome. Copy number was then calculated by using a known copy number plasmid as a standard. Two pairs of primers, called tdk and ori, were designed for targeting a single gene tdk in the chromosome and a conserved domain in the plasmid's ori, respectively. Primer quality was analyzed in silico using PrimerSelect DNASTAR and PraTo software prior to in vitro evaluation on primer specificity and efficiency as well as optimization of qPCR conditions. Plasmid copy number determination was conducted on E. coli lysates harboring each plasmid, with the number of cells ranging from 10(2)-10(5) cells/μL. Cells were lysed by incubation at 95ºC for 10 minutes, followed by immediate freezing at -4°C. pBR322 plasmid with the copy number of ~19 copies/cell was used as the standard, while pJExpress414-sod plasmid possessing the high copy number pUC ori was also determined to test the method being used. In silico analysis based on primer-primer and primer-template interactions showed

  6. Bacterial plasmids: autonomous replication and vehicles for gene cloning.

    PubMed

    Helinski, D R

    1979-11-01

    The use of recombinant DNA techniques in the analysis of the structure and replication of bacterial plasmids has provided much information on the properties of these genetic elements and has led to the construction of plasmid elements that are potentially very useful as gene cloning vehicles in Escherichia coli and other gram-negative bacteria. The genetic and molecular properties of plasmids mini-F, ColE1, and RK2 are described with particular emphasis on the origin and direction of replication and the identification of genetic regions essential for maintenance of these elements in the extra-chromosomal state. Low molecular weight derivatives of each of these plasmids have been obtained and a restriction enzyme map determined for these various derivatives. A hybrid DNA molecule consisting of a low molecular weight derivative of ColE1 joined to a segment of bacteriophage DNA has been constructed and shown to be capable of existing either as a plasmid element or packaged as an infectious viral particle. Finally, several of the low molecular weight derivatives of these plasmids described have certain advantages as vehicles for the cloning of DNA including derivatives of he broad host range plasmid RK2 that may be useful for gene cloning in gram-negative bacteria distantly related to E. coli.

  7. Plasmid-mediated mineralization of naphthalene, phenanthrene, and anthracene.

    PubMed Central

    Sanseverino, J; Applegate, B M; King, J M; Sayler, G S

    1993-01-01

    The well-characterized plasmid-encoded naphthalene degradation pathway in Pseudomonas putida PpG7(NAH7) was used to investigate the role of the NAH plasmid-encoded pathway in mineralizing phenanthrene and anthracene. Three Pseudomonas strains, designated 5R, DFC49, and DFC50, were recovered from a polynuclear aromatic hydrocarbon-degrading inoculum developed from a manufactured gas plant soil slurry reactor. Plasmids pKA1, pKA2, and pKA3, approximately 100 kb in size, were isolated from these strains and characterized. These plasmids have homologous regions of upper and lower NAH7 plasmid catabolic genes. By conjugation experiments, these plasmids, including NAH7, have been shown to encode the genotype for mineralization of [9-14C]phenanthrene and [U-14C]anthracene, as well as [1-14C]naphthalene. One strain, Pseudomonas fluorescens 5RL, which has the complete lower pathway inactivated by transposon insertion in nahG, accumulated a metabolite from phenanthrene and anthracene degradation. This is the first direct evidence to indicate that the NAH plasmid-encoded catabolic genes are involved in degradation of polynuclear aromatic hydrocarbons other than naphthalene. Images PMID:8328809

  8. Why There Are No Essential Genes on Plasmids.

    PubMed

    Tazzyman, Samuel J; Bonhoeffer, Sebastian

    2015-12-01

    Mobile genetic elements such as plasmids are important for the evolution of prokaryotes. It has been suggested that there are differences between functions coded for by mobile genes and those in the "core" genome and that these differences can be seen between plasmids and chromosomes. In particular, it has been suggested that essential genes, such as those involved in the formation of structural proteins or in basic metabolic functions, are rarely located on plasmids. We model competition between genotypically varying bacteria within a single population to investigate whether selection favors a chromosomal location for essential genes. We find that in general, chromosomal locations for essential genes are indeed favored. This is because the inheritance of chromosomes is more stable than that for plasmids. We define the "degradation" rate as the rate at which chance genetic processes, for example, mutation, deletion, or translocation, render essential genes nonfunctioning. The only way in which plasmids can be a location for functioning essential genes is if chromosomal genes degrade faster than plasmid genes. If the two degradation rates are equal, or if plasmid genes degrade faster than chromosomal genes, functioning essential genes will be found only on chromosomes.

  9. Bioinformatics-Based Molecular Classification of Arthrobacter Plasmids.

    PubMed

    Mihăşan, Marius

    2015-12-01

    The omnipresence of Arthrobacter species in polluted and toxic soils indicates their great potential in environmental biotechnologies, but practical applications of these bacteria are scarce mainly due to the availability of useful genetic engineering tools. Although many fully sequenced Arthrobacter genomes have been deposited in GenBank, little is known about the biology of their plasmids, especially the core functions: replication and partition. In this study the available Arthrobacter plasmid sequences were analyzed in order to identify their putative replication origin. At least the oris from the cryptic plasmids pXZ10142, pCG1, and pBL1 appear to work in this genus. Based on ParA homolog sequences, the Arthrobacter specific plasmids were classified into 4 clades. Iteron-like sequences were identified on most of the plasmids, indicating the position of the putative Arthrobacter specific oris. Although attempts were made to identify the core gene set required for plasmid replication in this genus, it was not possible. The plasmid proteomes showed a rather low similarity.

  10. An updated view of plasmid conjugation and mobilization in Staphylococcus

    PubMed Central

    Ramsay, Joshua P.; Kwong, Stephen M.; Murphy, Riley J. T.; Yui Eto, Karina; Price, Karina J.; Nguyen, Quang T.; O'Brien, Frances G.; Grubb, Warren B.; Coombs, Geoffrey W.; Firth, Neville

    2016-01-01

    ABSTRACT The horizontal gene transfer facilitated by mobile genetic elements impacts almost all areas of bacterial evolution, including the accretion and dissemination of antimicrobial-resistance genes in the human and animal pathogen Staphylococcus aureus. Genome surveys of staphylococcal plasmids have revealed an unexpected paucity of conjugation and mobilization loci, perhaps suggesting that conjugation plays only a minor role in the evolution of this genus. In this letter we present the DNA sequences of historically documented staphylococcal conjugative plasmids and highlight that at least 3 distinct and widely distributed families of conjugative plasmids currently contribute to the dissemination of antimicrobial resistance in Staphylococcus. We also review the recently documented “relaxase-in trans” mechanism of conjugative mobilization facilitated by conjugative plasmids pWBG749 and pSK41, and discuss how this may facilitate the horizontal transmission of around 90% of plasmids that were previously considered non-mobilizable. Finally, we enumerate unique sequenced S. aureus plasmids with a potential mechanism of mobilization and predict that at least 80% of all non-conjugative S. aureus plasmids are mobilizable by at least one mechanism. We suggest that a greater research focus on the molecular biology of conjugation is essential if we are to recognize gene-transfer mechanisms from our increasingly in silico analyses. PMID:27583185

  11. Analysis of chromosomal integration and deletions of yeast plasmids.

    PubMed Central

    Cameron, J R; Philippsen, P; Davis, R W

    1977-01-01

    Plasmid DNAs from six strains of Saccharomyces cerevisiae were compared. Three different plasmids were found, designated Scp 1, Scp 2 and Scp 3, with monomer lengths of 6.19, 6.06 and 5.97 kilobases as referenced to sequenced phiX174 DNA. DNA from each of the plasmids was inserted into a lambda vector DNA. Hybrid phage containing inserted DNA of the desired size were enriched by genetic selection and their DNAs analysed by rapid techniques. All three plasmids share the same organization, two unique sequences separated by two inverted repeats, and share basically the same DNA sequences. Scp 2 and Scp 3 differ from Scp 1 by missing a unique HpaI site and by having small overlapping deletions in the same region. The HpaI site in Scp 1 is, therefore, in a nonessential region and suitable for insertion of foreign DNA in the potential use of the yeast plasmid as a vector. Hybridization of labelled cloned plasmid DNA to restriction fragments of linear yeast DNA separated on agarose gels showed that the plasmid DNA was not stably integrated into the yeast chromosomal DNA. Images PMID:331256

  12. An updated view of plasmid conjugation and mobilization in Staphylococcus.

    PubMed

    Ramsay, Joshua P; Kwong, Stephen M; Murphy, Riley J T; Yui Eto, Karina; Price, Karina J; Nguyen, Quang T; O'Brien, Frances G; Grubb, Warren B; Coombs, Geoffrey W; Firth, Neville

    2016-01-01

    The horizontal gene transfer facilitated by mobile genetic elements impacts almost all areas of bacterial evolution, including the accretion and dissemination of antimicrobial-resistance genes in the human and animal pathogen Staphylococcus aureus. Genome surveys of staphylococcal plasmids have revealed an unexpected paucity of conjugation and mobilization loci, perhaps suggesting that conjugation plays only a minor role in the evolution of this genus. In this letter we present the DNA sequences of historically documented staphylococcal conjugative plasmids and highlight that at least 3 distinct and widely distributed families of conjugative plasmids currently contribute to the dissemination of antimicrobial resistance in Staphylococcus. We also review the recently documented "relaxase-in trans" mechanism of conjugative mobilization facilitated by conjugative plasmids pWBG749 and pSK41, and discuss how this may facilitate the horizontal transmission of around 90% of plasmids that were previously considered non-mobilizable. Finally, we enumerate unique sequenced S. aureus plasmids with a potential mechanism of mobilization and predict that at least 80% of all non-conjugative S. aureus plasmids are mobilizable by at least one mechanism. We suggest that a greater research focus on the molecular biology of conjugation is essential if we are to recognize gene-transfer mechanisms from our increasingly in silico analyses. PMID:27583185

  13. Whole-genome sequencing of gentamicin-resistant Campylobacter coli isolated from U.S. retail meats reveals novel plasmid-mediated aminoglycoside resistance genes.

    PubMed

    Chen, Yuansha; Mukherjee, Sampa; Hoffmann, Maria; Kotewicz, Michael L; Young, Shenia; Abbott, Jason; Luo, Yan; Davidson, Maureen K; Allard, Marc; McDermott, Patrick; Zhao, Shaohua

    2013-11-01

    Aminoglycoside resistance in Campylobacter has been routinely monitored in the United States in clinical isolates since 1996 and in retail meats since 2002. Gentamicin resistance first appeared in a single human isolate of Campylobacter coli in 2000 and in a single chicken meat isolate in 2007, after which it increased rapidly to account for 11.3% of human isolates and 12.5% of retail isolates in 2010. Pulsed-field gel electrophoresis analysis indicated that gentamicin-resistant C. coli isolates from retail meat were clonal. We sequenced the genomes of two strains of this clone using a next-generation sequencing technique in order to investigate the genetic basis for the resistance. The gaps of one strain were closed using optical mapping and Sanger sequencing, and this is the first completed genome of C. coli. The two genomes are highly similar to each other. A self-transmissible plasmid carrying multiple antibiotic resistance genes was revealed within both genomes, carrying genes encoding resistance to gentamicin, kanamycin, streptomycin, streptothricin, and tetracycline. Bioinformatics analysis and experimental results showed that gentamicin resistance was due to a phosphotransferase gene, aph(2")-Ig, not described previously. The phylogenetic relationship of this newly emerged clone to other Campylobacter spp. was determined by whole-genome single nucleotide polymorphisms (SNPs), which showed that it clustered with the other poultry isolates and was separated from isolates from livestock.

  14. One-step plasmid construction for generation of knock-out mutants in cyanobacteria: studies of glycogen metabolism in Synechococcus sp. PCC 7002.

    PubMed

    Jacobsen, Jacob H; Rosgaard, Lisa; Sakuragi, Yumiko; Frigaard, Niels-Ulrik

    2011-02-01

    Genome sequences of microorganisms typically contain hundreds of genes with vaguely defined functions. Targeted gene inactivation and phenotypic characterization of the resulting mutant strains is a powerful strategy to investigate the function of these genes. We have adapted the recently reported uracil-specific excision reagent (USER) cloning method for targeted gene inactivation in cyanobacteria and used it to inactivate genes in glycogen metabolism in Synechococcus sp. PCC 7002. Knock-out plasmid constructs were made in a single cloning step, where transformation of E. coli yielded about 90% colonies with the correct construct. The two homologous regions were chosen independently of each other and of restriction sites in the target genome. Mutagenesis of Synechococcus sp. PCC 7002 was tested with four antibiotic resistance selection markers (spectinomycin, erythromycin, kanamycin, and gentamicin), and both single-locus and double-loci mutants were prepared. We found that Synechococcus sp. PCC 7002 contains two glycogen phosphorylases (A0481/glgP and A2139/agpA) and that both need to be genetically inactivated to eliminate glycogen phosphorylase activity in the cells.

  15. Plasmid-mediated fluoroquinolone resistance determinants in Escherichia coli from community uncomplicated urinary tract infection in an area of high prevalence of quinolone resistance.

    PubMed

    Longhi, C; Conte, M P; Marazzato, M; Iebba, V; Totino, V; Santangelo, F; Gallinelli, C; Pallecchi, L; Riccobono, E; Schippa, S; Comanducci, A

    2012-08-01

    In Italy fluoroquinolones (FQs) are extensively prescribed in empirical therapy of uncomplicated urinary tract infection (UTI) despite recommendations in national guidelines and widespread antibiotic resistance in community. To survey the dissemination of plasmid-mediated quinolone resistance in a peak area of FQs consumption, E. coli strains from 154 community and 41 local hospital patients were collected; low level ciprofloxacin resistance qnrA, qnrB, qnrS, and aac(6)'-Ib-cr genes were screened by PCR and patterns of transferable resistances were determined. Clinical ciprofloxacin resistance in hospital doubled community value, while overall rates of FQ resistance genes were similar (31.6% and 27.8%). Prevalence of aac(6')-Ib-cr gene was 11% in outpatients (21%, inpatients) and risk of harbouring this variant was significantly associated with gentamicin resistance; linkage to ceftazidime resistance was significant (P=0.001) and six out of eight strains produced CTX-M-15 and TEM-1 beta lactamases. In transconjugants, the unique pattern ampicillin/kanamycin-gentamicin/ ESBL + was associated with aac(6')-Ib-cr gene presence and with an increase of ciprofloxacin MIC value. Data highlight the need to monitor the resistance risk factors in the local community to provide clinicians with well-grounded guidelines for UTI therapy.

  16. Molecular classification of IncP-9 naphthalene degradation plasmids

    SciTech Connect

    Izmalkova, T.Y.; Mavrodi, D.V.; Sokolov, S.L.; Kosheleva, I.A.; Smalla, K.; Thomas, C.M.; Boronin, A.M.

    2006-07-15

    A large collection of naphthalene-degrading fluorescent Pseudomonas strains isolated from sites contaminated with coal tar and crude oil was screened for the presence of IncP-9 plasmids. Seventeen strains were found to carry naphthalene catabolic plasmids ranging in size from 83 to 120kb and were selected for further study. Results of molecular genotyping revealed that 15 strains were closely related to P. putida, one to P. fluorescens, and one to P. aeruginosa. All catabolic plasmids found in these strains, with the exception of pBS216, pSN11, and p8909N-1, turned out to belong to IncP-9 {beta}-subgroup. Plasmids pBS216, pSN11, and p8909N-1 were identified as members of IncP-9 {delta}-subgroup. One plasmid, pBS2, contains fused replicons of IncP-9 {beta} and IncP-7 groups. RFLP analyses of the naphthalene catabolic plasmids revealed that organisation of the replicon correlates well with the overall plasmid structure. Comparative PCR studies with conserved oligonucleotide primers indicated that genes for key enzymes of naphthalene catabolism are highly conserved among all studied plasmids. Three bacterial strains, P. putida BS202, P. putida BS3701, and P. putida BS3790, were found to have two different salicylate hydroxylase genes one of which has no similarity to the 'classic' enzyme encoded by nahG gene. Discovery of a large group of plasmid with unique nahR suggested that the regulatory loop may also represent a variable part of the pathway for catabolism of naphthalene in fluorescent Pseudomonas spp.

  17. [Isolation and determination of silver-resistant bacteria plasmids].

    PubMed

    Li, Junmin; Jin, Zexin

    2006-02-01

    Through the enrichment of the active mud obtained from three chemical plants and the domestication with different concentration Ag+ solution, thirty bacteria strains with silver (Ag+)-resistance were isolated, among which, the highest Ag+ -resistant concentration was 80 mg x ml(-1). The plasmids in these bacteria were extracted, with the detection rate of 76.67%. The elimination rate of the plasmid in HAg4 bacteria was 98.75% by 40 mmol x L(-1) sodium benzoate, and 77.78% by 350 microg x ml(-1) acridine orange. It was suggested that the Ag+ -resistance of bacteria was highly correlated with their plasmids.

  18. Pharmaceutical grade large-scale plasmid DNA manufacturing process.

    PubMed

    Schmeer, Marco; Schleef, Martin

    2014-01-01

    For pharmaceutical applications of plasmid DNA, either direct or indirect, certain quality standards are required. Whereas for direct gene transfer into human "Good Manufacturing Practice" (GMP) grade is mandatory, for GMP production of, e.g., viral vectors (AAV, etc.) the plasmid DNA used needs not necessarily be produced under GMP. Besides such regulatory aspects up-scaling of the plasmid DNA production process from research laboratory scale (up to a few milligrams) to industrial scales (milligram to gram scales) is an issue that is addressed here.

  19. Modern and simple construction of plasmid: saving time and cost.

    PubMed

    Nakayama, Hideki; Shimamoto, Nobuo

    2014-11-01

    Construction of plasmids has been occupying a significant fraction of laboratory work in most fields of experimental biology. Tremendous effort was made to improve the traditional method for constructing plasmids, in which DNA fragments digested with restriction enzymes were ligated. However, the traditional method remained to be a standard protocol more than 40 years. At last, several recent inventions are rapidly and completely replacing the traditional method, because they are far quicker with less cost, and requiring less material. We here introduce three such methods that cover up most of the cases. Moreover, they are complementary with each other. Our lab protocols are provided for "no strain, no pain" construction of plasmids.

  20. Combination of essential oils and antibiotics reduce antibiotic resistance in plasmid-conferred multidrug resistant bacteria.

    PubMed

    Yap, Polly Soo Xi; Lim, Swee Hua Erin; Hu, Cai Ping; Yiap, Beow Chin

    2013-06-15

    In this study we investigated the relationship between several selected commercially available essential oils and beta-lactam antibiotics on their antibacterial effect against multidrug resistant bacteria. The antibacterial activity of essential oils and antibiotics was assessed using broth microdilution. The combined effects between essential oils of cinnamon bark, lavender, marjoram, tea tree, peppermint and ampicillin, piperacillin, cefazolin, cefuroxime, carbenicillin, ceftazidime, meropenem, were evaluated by means of the checkerboard method against beta-lactamase-producing Escherichia coli. In the latter assays, fractional inhibitory concentration (FIC) values were calculated to characterize interaction between the combinations. Substantial susceptibility of the bacteria toward natural antibiotics and a considerable reduction in the minimum inhibitory concentrations (MIC) of the antibiotics were noted in some paired combinations of antibiotics and essential oils. Out of 35 antibiotic-essential oil pairs tested, four of them showed synergistic effect (FIC≤0.5) and 31 pairs showed no interaction (FIC>0.5-4.0). The preliminary results obtained highlighted the occurrence of a pronounced synergistic relationship between piperacillin/cinnamon bark oil, piperacillin/lavender oil, piperacillin/peppermint oil as well as meropenem/peppermint oil against two of the three bacteria under study with a FIC index in the range 0.26-0.5. The finding highlighted the potential of peppermint, cinnamon bark and lavender essential oils being as antibiotic resistance modifying agent. Reduced usage of antibiotics could be employed as a treatment strategy to decrease the adverse effects and possibly to reverse the beta-lactam antibiotic resistance.

  1. Influenza Plasmid DNA Vaccines: Progress and Prospects.

    PubMed

    Bicho, Diana; Queiroz, João António; Tomaz, Cândida Teixeira

    2015-01-01

    Current influenza vaccines have long been used to fight flu infectious; however, recent advances highlight the importance of produce new alternatives. Even though traditional influenza vaccines are safe and usually effective, they need to be uploaded every year to anticipate circulating flu viruses. This limitation together with the use of embryonated chicken eggs as the substrate for vaccine production, is time-consuming and could involve potential biohazards in growth of new virus strains. Plasmid DNA produced by prokaryote microorganisms and encoding foreign proteins had emerged as a promising therapeutic tool. This technology allows the expression of a gene of interest by eukaryotic cells in order to induce protective immune responses against the pathogen of interest. In this review, we discuss the strategies to choose the best DNA vaccine to be applied in the treatment and prevention of influenza. Specifically, we give an update of influenza DNA vaccines developments, all involved techniques, their main characteristics, applicability and technical features to obtain the best option against influenza infections.

  2. Transposon-mediated mobilization of chromosomally located catabolic operons of the CAM plasmid by TOL plasmid transposon Tn4652 and CAM plasmid transposon Tn3614.

    PubMed

    Mäe, A A; Heinaru, A L

    1994-04-01

    The CAM (camphor degradation) plasmid is integrated into the chromosome of Pseudomonas putida PaW-line strains and is not self-transferable as a plasmid via conjugation. Our results show that the mobilization of chromosomally located CAM and the integration of cam-operons into the chromosome of the new Cam+ transconjugants is a recA-independent process mediated by transposons Tn4652 (17 kbp) and Tn3614 (7.2 kbp). Transposon Tn3614 is apparently identical to the left-hand and the right-hand sequences of the TOL plasmid pWW0 transposon Tn4654. The insertion of Tn401 inside the left-hand terminal IR of Tn4652 completely inhibited the mobilization of CAM. According to our data transposons Tn4652 and Tn3614 together with CAM plasmid catabolic operons are integrated into the chromosome. We propose that in pseudomonads the transposons Tn4652 and Tn3614 play a key role in the evolution and spread of new catabolic plasmids in nature. PMID:8012608

  3. 76 FR 64083 - Reliability Technical Conference; Notice of Technical Conference

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-10-17

    ... From the Federal Register Online via the Government Publishing Office DEPARTMENT OF ENERGY Federal Energy Regulatory Commission Reliability Technical Conference; Notice of Technical Conference Take notice that the Federal Energy Regulatory Commission will hold a Technical Conference on Tuesday, November...

  4. Photoinduced silver nanoparticles/nanorings on plasmid DNA scaffolds.

    PubMed

    Liu, Jianhua; Zhang, Xiaoliang; Yu, Mei; Li, Songmei; Zhang, Jindan

    2012-01-23

    Biological scaffolds are being actively explored for the synthesis of nanomaterials with novel structures and unexpected properties. Toroidal plasmid DNA separated from the Bacillus host is applied as a sacrificial mold for the synthesis of silver nanoparticles and nanorings. The photoirradiation method is applied to reduce Ag(I) on the plasmid. The nanoparticles are obtained by varying the concentration of the Ag(I) ion solution and the exposure time of the plasmid-Ag(I) complex under UV light at 254 nm and room temperature. It is found that the plasmid serves not only as a template but also as a reductant to drive the silver nucleation and deposition. The resulting nanoparticles have a face-centered cubic (fcc) crystal structure and 20-30 nm average diameter. The detailed mechanism is discussed, and other metals or alloys could also be synthesized with this method.

  5. A series of template plasmids for Escherichia coli genome engineering.

    PubMed

    Deb, Shalini S; Reshamwala, Shamlan M S; Lali, Arvind M

    2016-06-01

    Metabolic engineering strategies often employ multi-copy episomal vectors to overexpress genes. However, chromosome-based overexpression is preferred as it avoids the use of selective pressure and reduces metabolic burden on the cell. We have constructed a series of template plasmids for λ Red-mediated Escherichia coli genome engineering. The template plasmids allow construction of genome integrating cassettes that can be used to integrate single copies of DNA sequences at predetermined sites or replace promoter regions. The constructed cassettes provide flexibility in terms of expression levels achieved and antibiotics used for selection, as well as allowing construction of marker-free strains. The modular design of the template plasmids allows replacement of genetic parts to construct new templates. Gene integration and promoter replacement using the template plasmids are illustrated. PMID:27071533

  6. Plasmid maintenance systems suitable for GMO-based bacterial vaccines.

    PubMed

    Spreng, Simone; Viret, Jean-François

    2005-03-18

    Live carrier-based bacterial vaccines represent a vaccine strategy that offers exceptional flexibility. Commensal or attenuated strains of pathogenic bacteria can be used as live carriers to present foreign antigens from unrelated pathogens to the immune system, with the aim of eliciting protective immune responses. As for oral immunisation, such an approach obviates the usual loss of antigen integrity observed during gastrointestinal passage and allows the delivery of a sufficient antigen dose to the mucosal immune system. Antibiotic and antibiotic-resistance genes have traditionally been used for the maintenance of recombinant plasmid vectors in bacteria used for biotechnological purposes. However, their continued use may appear undesirable in the field of live carrier-based vaccine development. This review focuses on strategies to omit antibiotic resistance determinants in live bacterial vaccines and discusses several balanced lethal-plasmid stabilisation systems with respect to maintenance of plasmid inheritance and antigenicity of plasmid-encoded antigen in vivo.

  7. Functional Analysis of a Bacitracin Resistance Determinant Located on ICECp1, a Novel Tn916-Like Element from a Conjugative Plasmid in Clostridium perfringens

    PubMed Central

    Han, Xiaoyan; Du, Xiang-Dang; Southey, Luke; Bulach, Dieter M.; Seemann, Torsten; Yan, Xu-Xia; Bannam, Trudi L.

    2015-01-01

    Bacitracins are mixtures of structurally related cyclic polypeptides with antibiotic properties. They act by interfering with the biosynthesis of the bacterial cell wall. In this study, we analyzed an avian necrotic enteritis strain of Clostridium perfringens that was resistant to bacitracin and produced NetB toxin. We identified a bacitracin resistance locus that resembled a bacitracin resistance determinant from Enterococcus faecalis. It contained the structural genes bcrABD and a putative regulatory gene, bcrR. Mutagenesis studies provided evidence that both bcrA and bcrB are essential for bacitracin resistance, and that evidence was supported by the results of experiments in which the introduction of both the bcrA and bcrB genes into a bacitracin-susceptible C. perfringens strain was required to confer bacitracin resistance. The wild-type strain was shown to contain at least three large, putatively conjugative plasmids, and the bcrRABD locus was localized to an 89.7-kb plasmid, pJIR4150. This plasmid was experimentally shown to be conjugative and was sequenced. The sequence revealed that it also carries a tpeL toxin gene and is related to the pCW3 family of conjugative antibiotic resistance and toxin plasmids from C. perfringens. The bcr genes were located on a genetic element, ICECp1, which is related to the Tn916 family of integrative conjugative elements (ICEs). ICECp1 appears to be the first Tn916-like element shown to confer bacitracin resistance. In summary, we identified in a toxin-producing C. perfringens strain a novel mobile bacitracin resistance element which was experimentally shown to be essential for bacitracin resistance and is carried by a putative ICE located on a conjugative plasmid. PMID:26282424

  8. A new regulatory element modulates homoserine lactone-mediated autoinduction of Ti plasmid conjugal transfer.

    PubMed Central

    Hwang, I; Cook, D M; Farrand, S K

    1995-01-01

    Conjugal transfer of the Agrobacterium tumefaciens nopaline-type Ti plasmid pTiC58 is induced by agrocinopines A and B, opines secreted by crown gall tumors induced by the bacterium. This regulation functions through the transcriptional repressor, AccR. However, actual transcription of the tra genes is regulated by autoinduction through the activator TraR and the substituted homoserine lactone second messenger, Agrobacterium autoinducer (AAI). We have identified a new regulatory element that modulates the response of TraR to AAI. The gene, called traM, suppresses TraR-AAI activation of transcription of tra genes carried on recombinant clones. The suppression could be relieved by increasing the expression of TraR but not by increasing AAI levels. traM is located between traR and traAF on pTiC58 and is transcribed in the clockwise direction. The 306-bp gene encodes an 11.2-kDa protein showing no significant relatedness to other proteins in the databases. Mutations in traM in pTiC58 conferred a transfer-constitutive phenotype, and strains harboring the Ti plasmid produced easily detectable amounts of AAI. These same mutations engineered into the transfer-constitutive Ti plasmid pTiC58 delta accR conferred a hyperconjugal phenotype and very high levels of AAI production. Expression of traM required TraR, indicating that transcription of the gene is regulated by the autoinduction system. TraM had no effect on the expression of traR, demonstrating that the suppressive effect is not due to repression of the gene encoding the activator. These results suggest that TraM is not a direct transcriptional regulator. Since the suppressive effect is demonstrable only when traM is overexpressed with respect to traR, we suggest that TraM functions to sequester TraR from the very small amounts of AAI produced under conditions when the agrocinopines are not present. PMID:7814335

  9. Gene regulation of plasmid- and chromosome-determined inorganic ion transport in bacteria.

    PubMed Central

    Silver, S; Walderhaug, M

    1992-01-01

    Regulation of chromosomally determined nutrient cation and anion uptake systems shows important similarities to regulation of plasmid-determined toxic ion resistance systems that mediate the outward transport of deleterious ions. Chromosomally determined transport systems result in accumulation of K+, Mg2+, Fe3+, Mn2+, PO4(3-), SO4(2-), and additional trace nutrients, while bacterial plasmids harbor highly specific resistance systems for AsO2-, AsO4(3-), CrO4(2-), Cd2+, Co2+, Cu2+, Hg2+, Ni2+, SbO2-, TeO3(2-), Zn2+, and other toxic ions. To study the regulation of these systems, we need to define both the trans-acting regulatory proteins and the cis-acting target operator DNA regions for the proteins. The regulation of gene expression for K+ and PO4(3-) transport systems involves two-component sensor-effector pairs of proteins. The first protein responds to an extracellular ionic (or related) signal and then transmits the signal to an intracellular DNA-binding protein. Regulation of Fe3+ transport utilizes the single iron-binding and DNA-binding protein Fur. The MerR regulatory protein for mercury resistance both represses and activates transcription. The ArsR regulatory protein functions as a repressor for the arsenic and antimony(III) efflux system. Although the predicted cadR regulatory gene has not been identified, cadmium, lead, bismuth, zinc, and cobalt induce this system in a carefully regulated manner from a single mRNA start site. The cadA Cd2+ resistance determinant encodes an E1(1)-1E2-class efflux ATPase (consisting of two polypeptides, rather than the one earlier identified). Cadmium resistance is also conferred by the czc system (which confers resistances to zinc and cobalt in Alcaligenes species) via a complex efflux pump consisting of four polypeptides. These two cadmium efflux systems are not otherwise related. For chromate resistance, reduced cellular accumulation is again the resistance mechanism, but the regulatory components are not identified

  10. Transfer of plasmids by conjugation in Streptococcus pneumoniae

    SciTech Connect

    Smith, M.D.; Shoemaker, N.B.; Burdett, V.; Guild, W.R.

    1980-01-01

    Transfer of resistance plasmids occurred by conjugation in Streptococcus pneumoniae (pneumococcus) similiarly to the process in other streptococcal groups. The 20-megadalton plasmid pIP501 mediated its own DNase-resistant transfer by filter mating and mobilized the 3.6-megadalton non-self-transmissible pMV158. Pneumococcal strains acted as donors or as recipients for intraspecies transfers and for interspecific transfers with Streptococcus faecalis. Transfer-deficient mutants of pIP501 have been found.

  11. The A to Z of A/C plasmids.

    PubMed

    Harmer, Christopher J; Hall, Ruth M

    2015-07-01

    Plasmids belonging to incompatibility groups A and C (now A/C) were among the earliest to be associated with antibiotic resistance in Gram-negative bacteria. A/C plasmids are large, conjugative plasmids with a broad host range. The prevalence of A/C plasmids in collections of clinical isolates has revealed their importance in the dissemination of extended-spectrum β-lactamases and carbapenemases. They also mobilize SGI1-type resistance islands. Revived interest in the family has yielded many complete A/C plasmid sequences, revealing that RA1, designated A/C1, is different from the remainder, designated A/C2. There are two distinct A/C2 lineages. Backbones of 128-130 kb include over 120 genes or ORFs encoding proteins of at least 100 amino acids, but very few have been characterized. Genes potentially required for replication, stability and transfer have been identified, but only the replication system of RA1 and the regulation of transfer have been studied. There is enormous variety in the antibiotic resistance genes carried by A/C2 plasmids but they are usually clustered in larger regions at various locations in the backbone. The ARI-A and ARI-B resistance islands are always at a specific location but have variable content. ARI-A is only found in type 1 A/C2 plasmids, which disseminate blaCMY-2 and blaNDM-1 genes, whereas ARI-B, carrying the sul2 gene, is found in both type 1 and type 2. This review summarizes current knowledge of A/C plasmids, and highlights areas of research to be considered in the future.

  12. The Addgene repository: an international nonprofit plasmid and data resource

    PubMed Central

    Kamens, Joanne

    2015-01-01

    The Addgene Repository (http://www.addgene.org) was founded to accelerate research and discovery by improving access to useful, high-quality research materials and information. The repository archives plasmids generated by scientists, conducts quality control, annotates the associated data and makes the plasmids and their data available to the scientific community. Plasmid associated data undergoes ongoing curation by members of the scientific community and by Addgene scientists. The growing database contains information on >31 000 unique plasmids spanning most experimental biological systems and organisms. The library includes a large number of plasmid tools for use in a wide variety of research areas, such as empty backbones, lentiviral resources, fluorescent protein vectors and genome engineering tools. The Addgene Repository database is always evolving with new plasmid deposits so it contains currently pertinent resources while ensuring the information on earlier deposits is still available. Custom search and browse features are available to access information on the diverse collection. Extensive educational materials and information are provided by the database curators to support the scientists that are accessing the repository's materials and data. PMID:25392412

  13. Plasmid Stability in Pseudomonas fluorescens in the Rhizosphere

    PubMed Central

    van der Bij, A. J.; de Weger, L. A.; Tucker, W. T.; Lugtenberg, B.

    1996-01-01

    Plasmids belonging to various incompatibility (Inc) groups were introduced into the efficiently root-colonizing strain Pseudomonas fluorescens WCS365, and their stabilities in complex and minimal media and in the rhizospheres of tomato, wheat, and potato plants grown under gnotobiotic conditions without selection pressure were tested. The IncP plasmid was found to be highly unstable under all conditions tested, whereas the IncQ and IncW plasmids showed intermediate stabilities and the plasmids pVSP41 and pWTT2081, for which the Inc group is unknown, both containing the origin of replication (rep) and stability (sta) regions of the Pseudomonas aeruginosa pVS1 replicon, were stably maintained under all conditions tested. Growth experiments in which cells of strain WCS365 carrying the plasmid pWTT2081 were grown in the presence of WCS365 without the plasmid showed that the presence of pWTT2081 acts as a burden. We conclude that pVSP41 and pWTT2081 are valuable as stable vectors for the functional analysis of genes involved in root colonization, provided that control cells carry the empty vector. PMID:16535259

  14. Electrotransformation of Thiobacillus ferrooxidans with plasmids containing a mer determinant.

    PubMed Central

    Kusano, T; Sugawara, K; Inoue, C; Takeshima, T; Numata, M; Shiratori, T

    1992-01-01

    The mer operon from a strain of Thiobacillus ferrooxidans (C. Inoue, K. Sugawara, and T. Kusano, Mol. Microbiol. 5:2707-2718, 1991) consists of the regulatory gene merR and an operator-promoter region followed by merC and merA structural genes and differs from other known gram-negative mer operons. We have constructed four potential shuttle plasmids composed of a T. ferrooxidans-borne cryptic plasmid, a pUC18 plasmid, and the above-mentioned mer determinant as a selectable marker. Mercury ion-sensitive T. ferrooxidans strains were electroporated with constructed plasmids, and one strain, Y4-3 (of 30 independent strains tested), was found to have a transformation efficiency of 120 to 200 mercury-resistant colonies per microgram of plasmid DNA. This recipient strain was confirmed to be T. ferrooxidans by physiological, morphological, and chemotaxonomical data. The transformants carried a plasmid with no physical rearrangements through 25 passages under no selective pressure. Cell extracts showed mercury ion-dependent NADPH oxidation activity. Images PMID:1400213

  15. A New Shuttle Plasmid That Stably Replicates in Clostridium acetobutylicum.

    PubMed

    Lee, Sang-Hyun; Kwon, Min-A; Choi, Sunwha; Kim, Sooah; Kim, Jungyeon; Shin, Yong-An; Kim, Kyoung Heon

    2015-10-01

    We have developed a new shuttle plasmid, designated as pLK1-MCS that can replicate in both Clostridium acetobutylicum and Escherichia coli, by combining the pUB110 and pUC19 plasmids. Plasmid pLK1-MCS replicated more stably than previously reported plasmids containing either the pIM13 or the pAMβ1 replicon in the absence of antibiotic selective pressure. The transfer frequency of pLK1-MCS into C. acetobutylicum was similar to the transfer frequency of other shuttle plasmids. We complemented C. acetobutylicum ML1 (that does not produce solvents such as acetone, butanol, and ethanol owing to loss of the megaplasmid pSOL1 harboring the adhE1-ctfAB-adc operon) by introducing pLK1-MCS carrying the adhE1-ctfAB-adc operon into C. acetobutylicum ML1. The transformed cells were able to resume anaerobic solvent production, indicating that the new shuttle plasmid has the potential for practical use in microbial biotechnology.

  16. Transformation of Rhizobium meliloti 41 with plasmid DNA.

    PubMed Central

    Kiss, G B; Kálmán, Z

    1982-01-01

    Plasmid pGV1106, a derivative of the wide-host-range plasmid S-a of the W incompatibility group, was introduced into Rhizobium meliloti 41 by plasmid-mediated mobilization to overcome the restriction of foreign DNA. The mobilized plasmid pKK2 differed from the original pGV1106 by an extra piece of DNA of 1.3 kilobase pairs which supposedly originated from pJB3JI used for mobilization. If pKK2 was isolated from R. meliloti 41, it could be successfully reintroduced by transformation. The transformation frequency was low (10 to 54 colonies per micrograms of plasmid DNA) but reproducible, and several lines of evidence showed that it was the consequence of plasmid DNA uptake. The small size (10.3 kilobases) and elevated copy number (10 to 15 copies per cell) of pKK2 make it a potentially useful cloning vector for the study of symbiotic nitrogen fixation genes of R. meliloti 41. Images PMID:6279558

  17. District Leadership Conference Planner.

    ERIC Educational Resources Information Center

    Washington State Coordinating Council for Occupational Education, Olympia.

    This manual provides usable guidelines and planning forms and materials for planning district leadership conferences, which were designed and initiated in Washington State to meet the problems in student enrollment and, consequently, Distributive Education Clubs of America membership. The conferences have become a useful means to increase…

  18. [Conference Time Kit.

    ERIC Educational Resources Information Center

    National School Public Relations Association, Washington, DC.

    This multimedia kit, for use with and by teachers from kindergarten through the upper elementary grades, consists of four components: 1) a filmstrip for teachers; 2) the 1970 edition of a handbook, "Conference Time for Teachers and Parents"; 3) a filmstrip for parents; 4) a supporting parent information leaflet "How To Confer Successfully with…

  19. [Kweichow planned parenthood conference].

    PubMed

    1978-12-15

    On December 5th the Kweichow Provincial Planned Parenthood Leadership Group held its 1st conference to discuss the problems of planned parenthood in the province. Miao Chun-ting, deputy secretary of the provincial CCP committee and head of the provincial planned parenthood leadership group, presided over the conference.

  20. From Conference to Journal

    ERIC Educational Resources Information Center

    McCartney, Robert; Tenenberg, Josh

    2008-01-01

    Revising and extending conference articles for journal publication benefits both authors and readers. The new articles are more complete, and benefit from peer review, feedback from conference presentation, and greater editorial consistency. For those articles that are appropriate, we encourage authors to do this, and present two examples of such…

  1. The Conference in Retrospect.

    ERIC Educational Resources Information Center

    Gardner, Marjorie H.

    1982-01-01

    Presents an overview of the 6th International Conference on Chemical Education held at the University of Maryland (August 9-14, 1981), focusing on such organizational activities as roster building, people activating, innovative publishing, resolution and recommendation drafting, conference infrastructure and managerial mode, hospitality center,…

  2. The Learning Conference

    ERIC Educational Resources Information Center

    Ravn, Ib

    2007-01-01

    Purpose: The purpose of this paper is to call attention to the fact that conferences for professionals rely on massive one-way communication and hence produce little learning for delegates--and to introduce an alternative, the "learning conference", that involves delegates in fun and productive learning processes. Design/methodology/approach: A…

  3. ASE Annual Conference 2010

    ERIC Educational Resources Information Center

    McCune, Roger

    2010-01-01

    In this article, the author describes the ASE Annual Conference 2010 which was held at Nottingham after a gap of 22 years. As always, the main conference was preceded by International Day, an important event for science educators from across the world. There were two strands to the programme: (1) "What works for me?"--sharing new ideas and tried…

  4. Lyndon Johnson's Press Conferences.

    ERIC Educational Resources Information Center

    Cooper, Stephen

    Because President Lyndon Johnson understood well the publicity value of the American news media, he sought to exploit them. He saw reporters as "torch bearers" for his programs and policies and used the presidential press conference chiefly for promotional purposes. Although he met with reporters often, his press conferences were usually…

  5. Sex, prions, and plasmids in yeast.

    PubMed

    Kelly, Amy C; Shewmaker, Frank P; Kryndushkin, Dmitry; Wickner, Reed B

    2012-10-01

    Even deadly prions may be widespread in nature if they spread by infection faster than they kill off their hosts. The yeast prions [PSI+] and [URE3] (amyloids of Sup35p and Ure2p) were not found in 70 wild strains, while [PIN+] (amyloid of Rnq1p) was found in ∼16% of the same population. Yeast prion infection occurs only by mating, balancing the detrimental effects of carrying the prion. We estimated the frequency of outcross mating as about 1% of mitotic doublings from the known detriment of carrying the 2-μm DNA plasmid (∼1%) and its frequency in wild populations (38/70). We also estimated the fraction of total matings that are outcross matings (∼23-46%) from the fraction of heterozygosity at the highly polymorphic RNQ1 locus (∼46%). These results show that the detriment of carrying even the mildest forms of [PSI+], [URE3], or [PIN+] is greater than 1%. We find that Rnq1p polymorphisms in wild strains include several premature stop codon alleles that cannot propagate [PIN+] from the reference allele and others with several small deletions and point mutations which show a small transmission barrier. Wild strains carrying [PIN+] are far more likely to be heterozygous at RNQ1 and other loci than are [pin-] strains, probably reflecting its being a sexually transmitted disease. Because sequence differences are known to block prion propagation or ameliorate its pathogenic effects, we hypothesize that polymorphism of RNQ1 was selected to protect cells from detrimental effects of the [PIN+] prion.

  6. Dye affinity cryogels for plasmid DNA purification.

    PubMed

    Çimen, Duygu; Yılmaz, Fatma; Perçin, Işık; Türkmen, Deniz; Denizli, Adil

    2015-11-01

    The aim of this study is to prepare megaporous dye-affinity cryogel discs for the purification of plasmid DNA (pDNA) from bacterial lysate. Poly(hydroxyethyl methacrylate) [PHEMA] cryogel discs were produced by free radical polymerization initiated by N,N,N',N'-tetramethylene diamine (TEMED) and ammonium persulfate (APS) redox pair in an ice bath. Cibacron Blue F3GA was used as an affinity ligand (loading amount: 68.9μmol/g polymer). The amount of pDNA adsorbed onto the PHEMA-Cibacron Blue F3GA cryogel discs first increased and then reached a plateau value (i.e., 32.5mg/g cryogel) at 3.0mg/mL pDNA concentration. Compared with the PHEMA cryogel (0.11mg/g cryogel), the pDNA adsorption capacity of the PHEMA-Cibacron Blue F3GA cryogel (32.4mg/g polymer) was improved significantly due to the Cibacron Blue 3GA immobilization onto the polymeric matrix. pDNA adsorption amount decreased from 11.7mg/g to 1.1mg/g with the increasing of NaCl concentration. The maximum pDNA adsorption was achieved at 4°C. The overall recovery of pDNA was calculated as 90%. The PHEMA-Cibacron Blue F3GA cryogel discs could be used five times without decreasing the pDNA adsorption capacity significantly. The results show that the PHEMA-Cibacron Blue F3GA cryogel discs promise high selectivity for pDNA. PMID:26249596

  7. ICCK Conference Final Report

    SciTech Connect

    Green, William H.

    2013-05-28

    The 7th International Conference on Chemical Kinetics (ICCK) was held July 10-14, 2011, at Massachusetts Institute of Technology (MIT), in Cambridge, MA, hosted by Prof. William H. Green of MIT's Chemical Engineering department. This cross-disciplinary meeting highlighted the importance of fundamental understanding of elementary reactions to the full range of chemical investigations. The specific conference focus was on elementary-step kinetics in both the gas phase and in condensed phase. The meeting provided a unique opportunity to discuss how the same reactive species and reaction motifs manifest under very different reaction conditions (e.g. atmospheric, aqueous, combustion, plasma, in nonaqueous solvents, on surfaces.). The conference featured special sessions on new/improved experimental techniques, improved models and data analysis for interpreting complicated kinetics, computational kinetics (especially rate estimates for large kinetic models), and a panel discussion on how the community should document/archive kinetic data. In the past, this conference had been limited to homogeneous gas-phase and liquid-phase systems. This conference included studies of heterogeneous kinetics which provide rate constants for, or insight into, elementary reaction steps. This Grant from DOE BES covered about half of the subsidies we provided to students and postdocs who attended the conference, by charging them reduced-rate registration fees. The complete list of subsidies provided are listed in Table 1 below. This DOE funding was essential to making the conference affordable to graduate students, and indeed the attendance at this conference was higher than at previous conferences in this series. Donations made by companies provided additional subsidies, leveraging the DOE funding. The conference was very effective in educating graduate students and important in fostering scientific interactions, particularly between scientists studying gas phase and liquid phase kinetics

  8. Characterization of a cryptic plasmid from a Greenland ice core Arthrobacter isolate and construction of a shuttle vector that replicates in psychrophilic high G+C Gram-positive recipients.

    PubMed

    Miteva, Vanya; Lantz, Sarah; Brenchley, Jean

    2008-05-01

    Over 60 Greenland glacial isolates were screened for plasmids and antibiotic resistance/sensitivity as the first step in establishing a genetic system. Sequence analysis of a small, cryptic, 1,950 bp plasmid, p54, from isolate GIC54, related to Arthrobacter agilis, showed a region similar to that found in theta replicating Rhodococcus plasmids. A 6,002 bp shuttle vector, pSVJ21, was constructed by ligating p54 and pUC18 and inserting a chloramphenicol acetyl transferase (CAT) cassette conferring chloramphenicol resistance. Candidate Gram-positive recipients were chosen among glacial isolates based on phylogenetic relatedness, relatively short doubling times at low temperatures, sensitivity to antibiotics, and absence of indigenous plasmids. We developed an electroporation protocol and transformed seven isolates related to members of the Arthrobacter, Microbacterium, Curtobacterium, and Rhodoglobus genera with pSVJ21. Plasmid stability was demonstrated by successive transformation into Escherichia coli and four Gram-positive isolates, growth without antibiotic, and plasmid re-isolation. This shuttle vector and our transformation protocol provide the basis for genetic experiments with different high G+C Gram-positive hosts to study cold adaptation and expression of cold-active enzymes at low temperatures.

  9. Dissemination of IncFII(K)-type plasmids in multiresistant CTX-M-15-producing Enterobacteriaceae isolates from children in hospital paediatric oncology wards.

    PubMed

    Dolejska, Monika; Brhelova, Eva; Dobiasova, Hana; Krivdova, Jana; Jurankova, Jana; Sevcikova, Alena; Dubska, Lenka; Literak, Ivan; Cizek, Alois; Vavrina, Martin; Kutnikova, Lucia; Sterba, Jaroslav

    2012-12-01

    In this study, extended-spectrum β-lactamase (ESBL)-producing Enterobacteriaceae isolates in children with malignancies hospitalised at a paediatric oncology department in the Czech Republic were investigated. From June 2009 to January 2010, a total of 50 ESBL-producing faecal isolates of Enterobacteriaceae were obtained from 28 patients. These isolates were characterised with regard to ESBL enzymes, plasmid-mediated quinolone resistance genes, multilocus sequence typing (MLST) and plasmids conferring resistance to cephalosporins and fluoroquinolones. ESBL-producing isolates included Klebsiella pneumoniae (n=36), Escherichia coli (n=7), Klebsiella oxytoca (n=3), Enterobacter cloacae (n=2) and Citrobacter freundii (n=2). Klebsiella pneumoniae isolates belonged to 7 MLST types, including sequence types ST280, ST321, ST323 and ST416 as well as the novel types ST626, ST627 and ST628. The multiresistant epidemic clone E. coli B2-O25b-ST131 was detected in one patient. The gene bla(CTX-M-15) was found on large conjugative IncFII(K) plasmids along with bla(TEM-1), bla(OXA-1), qnrB1, aac(6')-Ib-cr, strA, sul2, aac(3')-II and tet(A) genes in most isolates. Dissemination of IncFII(K) plasmids among various Enterobacteriaceae isolates was considered an important aspect of nosocomial colonisation in the wards by Enterobacteriaceae species producing ESBLs. This is the first study documenting multiple antibiotic resistance elements, including qnr genes, in IncFII(K) plasmids in various bacterial species isolated in a single hospital department. The results highlight the evolution of IncFII(K) plasmids into new variants containing novel antibiotic resistance elements and their important role in spreading ESBL-producing bacteria among hospitalised patients.

  10. Radiosensitivity of plasmid DNA: role of topology and concentration

    NASA Astrophysics Data System (ADS)

    Giustranti, C.; Pérez, C.; Rousset, S.; Balanzat, E.; Sage, E.

    1999-01-01

    Using the plasmid relaxation assay, the induction of single strand breaks (SSB) by ionizing radiation was investigated in two plasmids of different length, pBS and pSP189. The dose-response was linear for both plasmids but pSP189 exhibited a three times higher sensitivity than pBS. This disparity may be explained by a reduced accessibility to hydroxyl radicals due to a different topology of each plasmid, i.e. degree of compaction, as observed with electron microscopy. pBS plasmid was also exposed at various DNA concentrations to rays. The yield of SSB decreased with increasing concentration, suggesting a diminution in the amount of hydroxyl radicals efficient for radiolytic attack. This effect of concentration was also observed with densely ionizing radiation. In conclusion, the accessibility of DNA is a key-parameter in the formation of damage in vitro and in vivo as well. En utilisant la technique de relaxation de plasmide, l'induction de cassures simple brin (SSB) par les radiations ? a été comparée dans deux plasmides de taille différente, pSP189 et pBS. La relation dose-effet est linéaire pour les deux plasmides, mais il se forme trois fois plus de SSB dans pSP189 que dans pBS. Cette disparité semble pouvoir être reliée au degré de compaction différent des plasmides, observé en microscopie électronique. Elle s'expliquerait en terme d'accessibilité aux espèces radicalaires formées lors de la radiolyse de l'eau. Le plasmide pBS, à différentes concentrations, a été ensuite exposé aux radiations γ. Le taux de cassures décroit lorsque la concentration en ADN croit, suggérant une diminution du nombre de radicaux pouvant efficacement réagir avec l'ADN. Cet effet a également été mis en évidence lors d'une irradiation avec des particules de TEL élevé. En conclusion, l'accessibilité de l'ADN est un paramètre- clé dans la formation des dommages, tant in vitro que in vivo.

  11. Incompatibility Protein IncC and Global Regulator KorB Interact in Active Partition of Promiscuous Plasmid RK2

    PubMed Central

    Rosche, Thomas M.; Siddique, Azeem; Larsen, Michelle H.; Figurski, David H.

    2000-01-01

    Replication of the broad-host-range, IncPα plasmid RK2 requires two plasmid loci: trfA, the replication initiator gene, and oriV, the origin of replication. While these determinants are sufficient for replication in a wide variety of bacteria, they do not confer the stable maintenance of parental RK2 observed in its hosts. The product of the incC gene has been proposed to function in the stable maintenance of RK2 because of its relatedness to the ParA family of ATPases, some of which are known to be involved in the active partition of plasmid and chromosomal DNA. Here we show that IncC has the properties expected of a component of an active partition system. The smaller polypeptide product of incC (IncC2) exhibits a strong, replicon-independent incompatibility phenotype with RK2. This incompatibility phenotype requires the global transcriptional repressor, KorB, and the target for incC-mediated incompatibility is a KorB-binding site (OB). We found that KorB and IncC interact in vivo by using the yeast two-hybrid system and in vitro by using partially purified proteins. Elevated expression of the incC and korB genes individually has no obvious effect on Escherichia coli cell growth, but their simultaneous overexpression is toxic, indicating a possible interaction of IncC-KorB complexes with a vital host target. A region of RK2 bearing incC, korB, and multiple KorB-binding sites is able to stabilize an unstable, heterologous plasmid in an incC-dependent manner. Finally, elevated levels of IncC2 cause RK2 to aggregate, indicating a possible role for IncC in plasmid pairing. These findings demonstrate that IncC, KorB, and at least one KorB-binding site are components of an active partition system for the promiscuous plasmid RK2. PMID:11029420

  12. CONFERENCE NOTE: Conference on Precision Electromagnetic Measurements

    NASA Astrophysics Data System (ADS)

    1991-01-01

    The next Conference on Precision Electromagnetic Measurements (CPEM), will be held from 9 to 12 June 1992 at the Centre des Nouvelles Industries et Technologies (CNIT), La Défense, Paris, France. This conference, which is held every two years and whose importance and high level, confirmed by thirty years' experience, are recognized throughout the world, can be considered as a forum in which scientists, metrologists and professionals will have the opportunity to present and compare their research results on fundamental constants, standards and new techniques of precision measurement in the electromagnetic domain. Topics The following topics are regarded as the most appropriate for this conference: realization of units and fundamental constants d.c. a.c. and high voltage time and frequency radio-frequency and microwaves dielectrics, antennas, fields lasers, fibre optics advanced instrumentation, cryoelectronics. There will also be a session on international cooperation. Conference Language The conference language will be English. No translation will be provided. Organizers Société des Electriciens et des Electroniciens (SEE). Bureau National de Métrologie (BNM) Sponsors Institute of Electrical and Electronics Engineers (IEEE) Instrumentation & Measurement Society Union Radio Scientifique Internationale United States National Institute of Standards and Technology Centre National d'Etudes des Télécommunications Mouvement Français pour la Qualité, Section Métrologie Comité National Français de Radioélectricité Scientifique Contact Jean Zara, CPEM 92 publicity, Bureau National de Métrologie, 22, rue Monge, 75005 Paris Tel.: (33) 1 46 34 48 16, Fax: (33) 1 46 34 48 63

  13. Extrachromosomal plasmids in the plant pathogenic fungus Rhizoctonia solani.

    PubMed

    Jabaji-Hare, S H; Burger, G; Forget, L; Lang, B F

    1994-05-01

    Extrachromosomal DNA elements were found in field isolates of Rhizoctonia solani belonging to anastomosis groups (AG) 1-5. An isolate of AG-5 (Rh41) contains a 3.6-kbp plasmid (pRS188) which has a similar A+T content to mitochondrial DNA. pRS188 is linear and has knob structures at its ends, as revealed by electron microscopy. Exonuclease digestions show that the linear ends of pRS188 are protected, and remain protected even after proteinase K digestion. pRS188 does not hybridise to nuclear or mitochondrial DNAs of its host isolate (Rh41), to total DNAs of other plasmid-less AG-5 isolates, or to total DNA of plasmid-harbouring isolates belonging to different AGs. Cellular-fractionation experiments suggest that pRS188 is associated with mitochondria, but it remains undecided whether this occurs inside or outside of the organelles. The nucleotide sequence of about 60% of the plasmid has been determined, revealing no open reading frame longer than 91 amino acids, and no known gene or genetic element is detected in the sequence contigs of 300-1572 bp length. Similar studies were performed with the plasmid pRS104 present in an isolate of AG-4 (Rh36), the sequence of which exhibits essentially the same features as pRS188 except that its A+T content resembles that of nuclear DNA. Pathogenicity tests reveal that the isolates Rh41 and R36 are as virulent as the plasmid-less isolates of AG-4 and -5, indicating that the plasmids do not play any role in pathogenicity.

  14. Plasmids and Rickettsial Evolution: Insight from Rickettsia felis

    PubMed Central

    Gillespie, Joseph J.; Beier, Magda S.; Rahman, M. Sayeedur; Ammerman, Nicole C.; Shallom, Joshua M.; Purkayastha, Anjan; Sobral, Bruno S.; Azad, Abdu F.

    2007-01-01

    Background The genome sequence of Rickettsia felis revealed a number of rickettsial genetic anomalies that likely contribute not only to a large genome size relative to other rickettsiae, but also to phenotypic oddities that have confounded the categorization of R. felis as either typhus group (TG) or spotted fever group (SFG) rickettsiae. Most intriguing was the first report from rickettsiae of a conjugative plasmid (pRF) that contains 68 putative open reading frames, several of which are predicted to encode proteins with high similarity to conjugative machinery in other plasmid-containing bacteria. Methodology/Principal Findings Using phylogeny estimation, we determined the mode of inheritance of pRF genes relative to conserved rickettsial chromosomal genes. Phylogenies of chromosomal genes were in agreement with other published rickettsial trees. However, phylogenies including pRF genes yielded different topologies and suggest a close relationship between pRF and ancestral group (AG) rickettsiae, including the recently completed genome of R. bellii str. RML369-C. This relatedness is further supported by the distribution of pRF genes across other rickettsiae, as 10 pRF genes (or inactive derivatives) also occur in AG (but not SFG) rickettsiae, with five of these genes characteristic of typical plasmids. Detailed characterization of pRF genes resulted in two novel findings: the identification of oriV and replication termination regions, and the likelihood that a second proposed plasmid, pRFδ, is an artifact of the original genome assembly. Conclusion/Significance Altogether, we propose a new rickettsial classification scheme with the addition of a fourth lineage, transitional group (TRG) rickettsiae, that is unique from TG and SFG rickettsiae and harbors genes from possible exchanges with AG rickettsiae via conjugation. We offer insight into the evolution of a plastic plasmid system in rickettsiae, including the role plasmids may have played in the acquirement of

  15. Genetic characterization of two fully sequenced multi-drug resistant plasmids pP10164-2 and pP10164-3 from Leclercia adecarboxylata

    PubMed Central

    Sun, Fengjun; Zhou, Dongsheng; Sun, Qiang; Luo, Wenbo; Tong, Yigang; Zhang, Defu; Wang, Qian; Feng, Wei; Chen, Weijun; Fan, Yahan; Xia, Peiyuan

    2016-01-01

    We previously reported the complete sequence of the resistance plasmid pP10164-NDM, harboring blaNDM (conferring carbapenem resistance) and bleMBL (conferring bleomycin resistance), which is recovered from a clinical Leclercia adecarboxylata isolate P10164 from China. This follow-up work disclosed that there were still two multidrug-resistant (MDR) plasmids pP10164-2 and pP10164-3 coexisting in this strain. pP10164-2 and pP10164-3 were completely sequenced and shown to carry a wealth of resistance genes, which encoded the resistance to at least 10 classes of antibiotics (β-lactams. macrolides, quinolones, aminoglycosides, tetracyclines, amphenicols, quaternary ammonium compounds, sulphonamides, trimethoprim, and rifampicin) and 7 kinds of heavy mental (mercury, silver, copper, nickel, chromate, arsenic, and tellurium). All of these antibiotic resistance genes are associated with mobile elements such as transposons, integrons, and insertion sequence-based transposable units, constituting a total of three novel MDR regions, two in pP10164-2 and the other one in pP10164-3. Coexistence of three resistance plasmids pP10164-NDM, pP10164-2 and pP10164-3 makes L. adecarboxylata P10164 tend to become extensively drug-resistant. PMID:27658354

  16. 47 CFR 1.248 - Prehearing conferences; hearing conferences.

    Code of Federal Regulations, 2010 CFR

    2010-10-01

    ... 47 Telecommunication 1 2010-10-01 2010-10-01 false Prehearing conferences; hearing conferences. 1.248 Section 1.248 Telecommunication FEDERAL COMMUNICATIONS COMMISSION GENERAL PRACTICE AND PROCEDURE Hearing Proceedings Prehearing Procedures § 1.248 Prehearing conferences; hearing conferences. (a)...

  17. Role of IncP-1β plasmids pWDL7::rfp and pNB8c in chloroaniline catabolism as determined by genomic and functional analyses.

    PubMed

    Król, J E; Penrod, J T; McCaslin, H; Rogers, L M; Yano, H; Stancik, A D; Dejonghe, W; Brown, C J; Parales, R E; Wuertz, S; Top, E M

    2012-02-01

    Broad-host-range catabolic plasmids play an important role in bacterial degradation of man-made compounds. To gain insight into the role of these plasmids in chloroaniline degradation, we determined the first complete nucleotide sequences of an IncP-1 chloroaniline degradation plasmid, pWDL7::rfp and its close relative pNB8c, as well as the expression pattern, function, and bioaugmentation potential of the putative 3-chloroaniline (3-CA) oxidation genes. Based on phylogenetic analysis of backbone proteins, both plasmids are members of a distinct clade within the IncP-1β subgroup. The plasmids are almost identical, but whereas pWDL7::rfp carries a duplicate inverted catabolic transposon, Tn6063, containing a putative 3-CA oxidation gene cluster, dcaQTA1A2BR, pNB8c contains only a single copy of the transposon. No genes for an aromatic ring cleavage pathway were detected on either plasmid, suggesting that only the upper 3-CA degradation pathway was present. The dcaA1A2B gene products expressed from a high-copy-number vector were shown to convert 3-CA to 4-chlorocatechol in Escherichia coli. Slight differences in the dca promoter region between the plasmids and lack of induction of transcription of the pNB8c dca genes by 3-CA may explain previous findings that pNB8C does not confer 3-CA transformation. Bioaugmentation of activated sludge with pWDL7::rfp accelerated removal of 3-CA, but only in the presence of an additional carbon source. Successful bioaugmentation requires complementation of the upper pathway genes with chlorocatechol cleavage genes in indigenous bacteria. The genome sequences of these plasmids thus help explain the molecular basis of their catabolic activities.

  18. The ars operon of Escherichia coli confers arsenical and antimonial resistance.

    PubMed Central

    Carlin, A; Shi, W; Dey, S; Rosen, B P

    1995-01-01

    The chromosomally encoded arsenical resistance (ars) operon subcloned into a multicopy plasmid was found to confer a moderate level of resistance to arsenite and antimonite in Escherichia coli. When the operon was deleted from the chromosome, the cells exhibited hypersensitivity to arsenite, antimonite, and arsenate. Expression of the ars genes was inducible by arsenite. By Southern hybridization, the operon was found in all strains of E. coli examined but not in Salmonella typhimurium, Pseudomonas aeruginosa, or Bacillus subtilis. PMID:7860609

  19. CFE-1, a novel plasmid-encoded AmpC beta-lactamase with an ampR gene originating from Citrobacter freundii.

    PubMed

    Nakano, Ryuichi; Okamoto, Ryoichi; Nakano, Yumiko; Kaneko, Kenichi; Okitsu, Naohiro; Hosaka, Yoshio; Inoue, Matsuhisa

    2004-04-01

    A clinical isolate of Escherichia coli from a patient in Japan, isolate KU6400, was found to produce a plasmid-encoded beta-lactamase that conferred resistance to extended-spectrum cephalosporins and cephamycins. Resistance arising from production of a beta-lactamase could be transferred by either conjugation or transformation with plasmid pKU601 into E. coli ML4947. The substrate and inhibition profiles of this enzyme resembled those of the AmpC beta-lactamase. The resistance gene of pKU601, which was cloned and expressed in E. coli, proved to contain an open reading frame showing 99.8% DNA sequence identity with the ampC gene of Citrobacter freundii GC3. DNA sequence analysis also identified a gene upstream of ampC whose sequence was 99.0% identical to the ampR gene from C. freundii GC3. In addition, a fumarate operon (frdABCD) and an outer membrane lipoprotein (blc) surrounding the ampR-ampC genes in C. freundii were identified, and insertion sequence (IS26) elements were observed on both sides of the sequences identified (forming an IS26 composite transposon); these results confirm the evidence of the translocation of a beta-lactamase-associated gene region from the chromosome to a plasmid. Finally, we describe a novel plasmid-encoded AmpC beta-lactamase, CFE-1, with an ampR gene derived from C. freundii.

  20. Isolation and characterization of linear deoxyribonucleic acid plasmids from Kluyveromyces lactis and the plasmid-associated killer character.

    PubMed Central

    Gunge, N; Tamaru, A; Ozawa, F; Sakaguchi, K

    1981-01-01

    Two linear deoxyribonucleic acid plasmids, designated pGK11 and pGK12, were isolated from the yeast Kluyveromyces lactis IFO 1267. pGK11 and pGK12 had molecular weights of 5.4 X 10(6) and 8.4 X 10(6), respectively. Both plasmids possessed the same density of 1.687 g/cm3, lighter than the densities of mitochondrial (1.692 g/cm3) and nuclear (1.699 g/cm3) deoxyribonucleic acids. A restriction map of pGK11 was constructed from digestions by EcoRI, HindIII, PstI, and BamHI. pGK12 was cleaved by EcoRI into seven fragments and by BamHI into two fragments K. lactis IFO 1267 killed Saccharomyces cerevisiae sensitive and killer strains and certain strains of Saccharomyces italicus, K. lactis, Kluyveromyces thermotolerans, and K. vanudenii. All K. lactis strains lacking the pGK1 plasmids were nonkillers. A hybrid was constructed between K. lactis IFO 1267 and a nonkiller K. lactis strain lacking the plasmids and subjected to tetrad analysis after sporulation. The killer character was extrachromosomally transmitted in all tetrads in association with the pGK1 plasmids. The double-stranded ribonucleic acid killer plasmid could not be detected in any K. lactis killer strains. It is thus highly probable that the killer character is mediated by the linear deoxyribonucleic acid plasmids. A single chromosomal gene was found which was responsible for the resistance to the K. lactis killer. Images PMID:6257636

  1. Plasma-activated air mediates plasmid DNA delivery in vivo

    PubMed Central

    Edelblute, Chelsea M; Heller, Loree C; Malik, Muhammad A; Bulysheva, Anna; Heller, Richard

    2016-01-01

    Plasma-activated air (PAA) provides a noncontact DNA transfer platform. In the current study, PAA was used for the delivery of plasmid DNA in a 3D human skin model, as well as in vivo. Delivery of plasmid DNA encoding luciferase to recellularized dermal constructs was enhanced, resulting in a fourfold increase in luciferase expression over 120 hours compared to injection only (P < 0.05). Delivery of plasmid DNA encoding green fluorescent protein (GFP) was confirmed in the epidermal layers of the construct. In vivo experiments were performed in BALB/c mice, with skin as the delivery target. PAA exposure significantly enhanced luciferase expression levels 460-fold in exposed sites compared to levels obtained from the injection of plasmid DNA alone (P < 0.001). Expression levels were enhanced when the plasma reactor was positioned more distant from the injection site. Delivery of plasmid DNA encoding GFP to mouse skin was confirmed by immunostaining, where a 3-minute exposure at a 10 mm distance displayed delivery distribution deep within the dermal layers compared to an exposure at 3 mm where GFP expression was localized within the epidermis. Our findings suggest PAA-mediated delivery warrants further exploration as an alternative approach for DNA transfer for skin targets. PMID:27110584

  2. Bacterial plasmid transfer under space flight conditions: The Mobilisatsia experience

    NASA Astrophysics Data System (ADS)

    de Boever, P.; Ilyin, V.; Mahillon, J.; Mergeay, M.

    Background Microorganisms are subject to a genetic evolution which may lead to the capacity to colonize new environments and to cause infections Central players in this evolutionary process are mobile genetic elements phages plasmids and transposons The latter help to mobilize and reorganize genes be it within a given genome intragenomic mobility or between bacterial cells intercellular mobility Confined environment and space flight related factors such as microgravity and cosmic radiation may influence the frequency with which mobile genetic elements are exchanged between microorganisms Aim Within the frame of the Mobilisatsia experiment a triparental microbial plasmid transfer was promoted aboard the International Space Station ISS The efficiency of the plasmid exchange process was compared with a synchronously performed ground control experiment An experiment was carried out with well-characterized Gram-negative test strains and one experiment was done with Gram-positive test strains Results The experiment took place during the Soyouz Mission 8 to the ISS from April 19th until April 30th 2004 Liquid cultures of the bacterial strains Cupriavidus metallidurans AE815 final recipient Escherichia coli CM1962 carrying a mobilisable vector with a nickel-resistance marker and E coli CM140 carrying the Broad Host Range plasmid RP4 for the Gram-negative experiment and Bacillus thuringiensis Bti AND931 carrying the conjugative plasmid pXO16 Bti 4Q7 with mobilisable vector pC194 carrying a resistance to chloramphenicol and Bti GBJ002

  3. Mitochondrial DNAs and plasmids as taxonomic characteristics in Trichoderma viride.

    PubMed Central

    Meyer, R J

    1991-01-01

    Mitochondrial DNA (mtDNA) was purified from 12 isolates of the Trichoderma viride aggregate and found to be, on the average, 32.7 kb in size. Plasmids were present in the mtDNA preparations from 8 of 12 strains of T. viride examined. Plasmids in four of the strains produced ladderlike banding patterns on gels, and these plasmids were studied in detail. The ladderlike patterns were produced by single molecules that were supercoiled to various degrees. Plasmids from two of the strains do not have homology with the mtDNA but do have a limited amount of homology with each other. No phenotype could be associated with the presence of a plasmid. Restriction endonuclease digestion of the mtDNAs produced patterns in which the presence or absence of certain fragments correlated with the classification of the strains into T. viride group I or II. Phenetic cluster analysis and parsimony analysis of the fragment patterns produced groups that corresponded to T. viride groups I and II. The fragment patterns were very diverse, with nearly all strains having a unique pattern. However, two strains of T. viride group I from widely different geographical locations did have identical restriction patterns for all the enzymes used in this study. This result indicates that it may not be possible to use mtDNA restriction patterns alone to identify Trichoderma strains. Images PMID:1768099

  4. Dcm methylation is detrimental to plasmid transformation in Clostridium thermocellum

    SciTech Connect

    Guss, Adam M; Olson, Daniel G.; Caiazza, Nicky; Lynd, Lee R

    2012-01-01

    BACKGROUND: Industrial production of biofuels and other products by cellulolytic microorganisms is of interest but hindered by the nascent state of genetic tools. Although a genetic system for Clostridium thermocellum DSM1313 has recently been developed, available methods achieve relatively low efficiency and similar plasmids can transform C. thermocellum at dramatically different efficiencies. RESULTS: We report an increase in transformation efficiency of C. thermocellum for a variety of plasmids by using DNA that has been methylated by Escherichia coli Dam but not Dcm methylases. When isolated from a dam+ dcm+ E. coli strain, pAMG206 transforms C. thermocellum 100-fold better than the similar plasmid pAMG205, which contains an additional Dcm methylation site in the pyrF gene. Upon removal of Dcm methylation, transformation with pAMG206 showed a four- to seven-fold increase in efficiency; however, transformation efficiency of pAMG205 increased 500-fold. Removal of the Dcm methylation site from the pAM205 pyrF gene via silent mutation resulted in increased transformation efficiencies equivalent to that of pAMG206. Upon proper methylation, transformation efficiency of plasmids bearing the pMK3 and pB6A origins of replication increased ca. three orders of magnitude. CONCLUSION: E. coli Dcm methylation decreases transformation efficiency in C. thermocellum DSM1313. The use of properly methylated plasmid DNA should facilitate genetic manipulation of this industrially relevant bacterium.

  5. Plasma-activated air mediates plasmid DNA delivery in vivo.

    PubMed

    Edelblute, Chelsea M; Heller, Loree C; Malik, Muhammad A; Bulysheva, Anna; Heller, Richard

    2016-01-01

    Plasma-activated air (PAA) provides a noncontact DNA transfer platform. In the current study, PAA was used for the delivery of plasmid DNA in a 3D human skin model, as well as in vivo. Delivery of plasmid DNA encoding luciferase to recellularized dermal constructs was enhanced, resulting in a fourfold increase in luciferase expression over 120 hours compared to injection only (P < 0.05). Delivery of plasmid DNA encoding green fluorescent protein (GFP) was confirmed in the epidermal layers of the construct. In vivo experiments were performed in BALB/c mice, with skin as the delivery target. PAA exposure significantly enhanced luciferase expression levels 460-fold in exposed sites compared to levels obtained from the injection of plasmid DNA alone (P < 0.001). Expression levels were enhanced when the plasma reactor was positioned more distant from the injection site. Delivery of plasmid DNA encoding GFP to mouse skin was confirmed by immunostaining, where a 3-minute exposure at a 10 mm distance displayed delivery distribution deep within the dermal layers compared to an exposure at 3 mm where GFP expression was localized within the epidermis. Our findings suggest PAA-mediated delivery warrants further exploration as an alternative approach for DNA transfer for skin targets. PMID:27110584

  6. Conjugative plasmids: vessels of the communal gene pool

    PubMed Central

    Norman, Anders; Hansen, Lars H.; Sørensen, Søren J.

    2009-01-01

    Comparative whole-genome analyses have demonstrated that horizontal gene transfer (HGT) provides a significant contribution to prokaryotic genome innovation. The evolution of specific prokaryotes is therefore tightly linked to the environment in which they live and the communal pool of genes available within that environment. Here we use the term supergenome to describe the set of all genes that a prokaryotic ‘individual’ can draw on within a particular environmental setting. Conjugative plasmids can be considered particularly successful entities within the communal pool, which have enabled HGT over large taxonomic distances. These plasmids are collections of discrete regions of genes that function as ‘backbone modules’ to undertake different aspects of overall plasmid maintenance and propagation. Conjugative plasmids often carry suites of ‘accessory elements’ that contribute adaptive traits to the hosts and, potentially, other resident prokaryotes within specific environmental niches. Insight into the evolution of plasmid modules therefore contributes to our knowledge of gene dissemination and evolution within prokaryotic communities. This communal pool provides the prokaryotes with an important mechanistic framework for obtaining adaptability and functional diversity that alleviates the need for large genomes of specialized ‘private genes’. PMID:19571247

  7. Synthesis of hybrid bacterial plasmids containing highly repeated satellite DNA.

    PubMed

    Brutlag, D; Fry, K; Nelson, T; Hung, P

    1977-03-01

    Hybrid plasmid molecules containing tandemly repeated Drosophila satellite DNA were constructed using a modification of the (dA)-(dT) homopolymer procedure of Lobban and Kaiser (1973). Recombinant plasmids recovered after transformation of recA bacteria contained 10% of the amount of satellite DNA present in the transforming molecules. The cloned plasmids were not homogenous in size. Recombinant plasmids isolated from a single colony contained populations of circular molecules which varied both in the length of the satellite region and in the poly(dA)-(dt) regions linking satellite and vector. While subcloning reduced the heterogeneity of these plasmid populations, continued cell growth caused further variations in the size of the repeated regions. Two different simple sequence satellites of Drosophila melanogaster (1.672 and 1.705 g/cm3) were unstable in both recA and recBC hosts and in both pSC101 and pCR1 vectors. We propose that this recA-independent instability of tandemly repeated sequences is due to unequal intramolecular recombination events in replicating DNA molecules, a mechanism analogous to sister chromatid exchange in eucaryotes. PMID:403010

  8. Genetic transformation of Rhodopseudomonas sphaeroides by plasmid DNA.

    PubMed Central

    Fornari, C S; Kaplan, S

    1982-01-01

    A broad-host-range cloning vector, pUI81, was constructed in vitro from plasmids RSF1010 and pSL25 (a pBR322 derivative) and used to assay for transformation in Rhodopseudomonas sphaeroides. Washing cells with 500 mM Tris was an effective means of inducing competence for DNA uptake. Transformation frequencies as high as 10(-5) (transformants per viable cell) have been achieved by incubating Tris-treated cells with plasmid DNA, 100 mM CaCl2, and 20% polyethylene glycol 6000. Maximum frequencies were obtained when recipient cells were spread onto selective media after a 6.5-h outgrowth period in antibiotic-free medium. The structure (open circular versus closed, covalent circular), size, and concentration of plasmid DNA all significantly affected the transformation frequency. Four different plasmids, all small and suitable as cloning vectors, have been introduced by transformation into several different R. sphaeroides strains. Recombinant DNA carried on small, nonconjugative plasmids with broad host ranges can now be directly transferred to R. sphaeroides by this method. Images PMID:6981642

  9. Aircraft Engine Emissions. [conference

    NASA Technical Reports Server (NTRS)

    1977-01-01

    A conference on a aircraft engine emissions was held to present the results of recent and current work. Such diverse areas as components, controls, energy efficient engine designs, and noise and pollution reduction are discussed.

  10. Conference Summary Final Remarks

    NASA Astrophysics Data System (ADS)

    Greiner, Walter

    2007-05-01

    Finally we come to the last talk. The end of the Conference is near! I try to reflect on an interesting Conference, with many different - diverse - topics and 5 parallel afternoon sessions. How to solve this difficulty? I do it my way and present a selection of what I personally found interesting. I illustrate these topics with the help of slides which are borrowed from various speakers at the conference. There are outstanding problems, which will also find attention and interest if explained to non-nuclear physicists, common people. I will address four such topics which were were discussed at this conference: Heavy-Ion Cancer Therapy Extension of the Periodic Table - Superheavy Elements Nuclear Astrophysics Hot compressed elementary matter - Production - Phases

  11. DNA sequencing conference, 2

    SciTech Connect

    Cook-Deegan, R.M.; Venter, J.C.; Gilbert, W.; Mulligan, J.; Mansfield, B.K.

    1991-06-19

    This conference focused on DNA sequencing, genetic linkage mapping, physical mapping, informatics and bioethics. Several were used to study this sequencing and mapping. This article also discusses computer hardware and software aiding in the mapping of genes.

  12. Lunar & Planetary Science Conference.

    ERIC Educational Resources Information Center

    Warner, Jeffrey L.; And Others

    1982-01-01

    Summaries of different topics discussed at the Lunar and Planetary Science Conference are presented to provide updated information to nonplanetologists. Some topics include Venus, isotopes, chondrites, creation science, cosmic dust, cratering, moons and rings, igneous rocks, and lunar soil. (DC)

  13. Multiphoton processes: conference proceedings

    SciTech Connect

    Lambropoulos, P.; Smith, S.J.

    1984-01-01

    The chapters of this volume represent the invited papers delivered at the conference. They are arranged according to thermatic proximity beginning with atoms and continuing with molecules and surfaces. Section headings include multiphoton processes in atoms, field fluctuations and collisions in multiphoton process, and multiphoton processes in molecules and surfaces. Abstracts of individual items from the conference were prepared separately for the data base. (GHT)

  14. Conference scene: DGVS spring conference 2009.

    PubMed

    Kolligs, Frank Thomas

    2009-10-01

    The 3rd annual DGVS Spring Conference of the German Society for Gastroenterology (Deutsche Gesellschaft für Verdauungs- und Stoffwechselkrankheiten) was held at the Seminaris Campus Hotel in Berlin, Germany, on 8-9 May, 2009. The conference was organized by Roland Schmid and Matthias Ebert from the Technical University of Munich, Germany. The central theme of the meeting was 'translational gastrointestinal oncology: towards personalized medicine and individualized therapy'. The conference covered talks on markers for diagnosis, screening and surveillance of colorectal cancer, targets for molecular therapy, response prediction in clinical oncology, development and integration of molecular imaging in gastrointestinal oncology and translational research in clinical trial design. Owing to the broad array of topics and limitations of space, this article will focus on biomarkers, response prediction and the integration of biomarkers into clinical trials. Presentations mentioned in this summary were given by Matthias Ebert (Technical University of Munich, Germany), Esmeralda Heiden (Epigenomics, Berlin, Germany), Frank Kolligs (University of Munich, Germany), Florian Lordick (University of Heidelberg, Germany), Hans Jorgen Nielsen (University of Copenhagen, Denmark), Anke Reinacher-Schick (University of Bochum, Germany), Christoph Röcken (University of Berlin, Germany), Wolff Schmiegel (University of Bochum, Germany) and Thomas Seufferlein (University of Halle, Germany).

  15. Modern and simple construction of plasmid: saving time and cost.

    PubMed

    Nakayama, Hideki; Shimamoto, Nobuo

    2014-11-01

    Construction of plasmids has been occupying a significant fraction of laboratory work in most fields of experimental biology. Tremendous effort was made to improve the traditional method for constructing plasmids, in which DNA fragments digested with restriction enzymes were ligated. However, the traditional method remained to be a standard protocol more than 40 years. At last, several recent inventions are rapidly and completely replacing the traditional method, because they are far quicker with less cost, and requiring less material. We here introduce three such methods that cover up most of the cases. Moreover, they are complementary with each other. Our lab protocols are provided for "no strain, no pain" construction of plasmids. PMID:25359266

  16. Association between specific plasmids and relapse in typhoid fever.

    PubMed Central

    Gotuzzo, E; Morris, J G; Benavente, L; Wood, P K; Levine, O; Black, R E; Levine, M M

    1987-01-01

    We studied isolates from 73 patients hospitalized with typhoid fever in Lima, Peru. Of these 73 patients, 11 (15%) suffered a clinical relapse, with fever and positive blood cultures, within 3 months of their original illness. Using plasmids as epidemiologic markers, we found that three patients who subsequently relapsed were initially infected with more than one strain of Salmonella typhi. There was a highly significant association between relapse and isolation of a strain containing either a 24- or a 38-kilobase plasmid at the time of the original infection; however, we were unable to show any evidence of homology between these two plasmids. Our data indicate that infection with multiple strains is not uncommon in this endemic area and suggest that relapse may be partly strain dependent. Images PMID:2821064

  17. A novel plasmid pEA68 of Erwinia amylovora and the description of a new family of plasmids.

    PubMed

    Ismail, Emadeldeen; Blom, Jochen; Bultreys, Alain; Ivanović, Milan; Obradović, Aleksa; van Doorn, Joop; Bergsma-Vlami, Maria; Maes, Martine; Willems, Anne; Duffy, Brion; Stockwell, Virginia O; Smits, Theo H M; Puławska, Joanna

    2014-12-01

    Recent genome analysis of Erwinia amylovora, the causal agent of fire blight disease on Rosaceae, has shown that the chromosome is highly conserved among strains and that plasmids are the principal source of genomic diversity. A new circular plasmid, pEA68, was found in E. amylovora strain 692 (LMG 28361), isolated in Poland from Sorbus (mountain ash) with fire blight symptoms. Annotation of the 68,763-bp IncFIIa-type plasmid revealed that it contains 79 predicted CDS, among which two operons (tra, pil) are associated with mobility. The plasmid is maintained stably in E. amylovora and does not possess genes associated with antibiotic resistance or known virulence genes. Curing E. amylovora strain 692 of pEA68 did not influence its virulence in apple shoots nor amylovoran synthesis. Of 488 strains of E. amylovora from seventeen countries, pEA68 was only found in two additional strains from Belgium. Although the spread of pEA68 is currently limited to Europe, pEA68 comprises, together with pEA72 and pEA78 both found in North America, a new plasmid family that spans two continents. PMID:25178659

  18. A novel plasmid pEA68 of Erwinia amylovora and the description of a new family of plasmids.

    PubMed

    Ismail, Emadeldeen; Blom, Jochen; Bultreys, Alain; Ivanović, Milan; Obradović, Aleksa; van Doorn, Joop; Bergsma-Vlami, Maria; Maes, Martine; Willems, Anne; Duffy, Brion; Stockwell, Virginia O; Smits, Theo H M; Puławska, Joanna

    2014-12-01

    Recent genome analysis of Erwinia amylovora, the causal agent of fire blight disease on Rosaceae, has shown that the chromosome is highly conserved among strains and that plasmids are the principal source of genomic diversity. A new circular plasmid, pEA68, was found in E. amylovora strain 692 (LMG 28361), isolated in Poland from Sorbus (mountain ash) with fire blight symptoms. Annotation of the 68,763-bp IncFIIa-type plasmid revealed that it contains 79 predicted CDS, among which two operons (tra, pil) are associated with mobility. The plasmid is maintained stably in E. amylovora and does not possess genes associated with antibiotic resistance or known virulence genes. Curing E. amylovora strain 692 of pEA68 did not influence its virulence in apple shoots nor amylovoran synthesis. Of 488 strains of E. amylovora from seventeen countries, pEA68 was only found in two additional strains from Belgium. Although the spread of pEA68 is currently limited to Europe, pEA68 comprises, together with pEA72 and pEA78 both found in North America, a new plasmid family that spans two continents.

  19. Conjugative plasmid transfer in gram-positive bacteria.

    PubMed

    Grohmann, Elisabeth; Muth, Günther; Espinosa, Manuel

    2003-06-01

    Conjugative transfer of bacterial plasmids is the most efficient way of horizontal gene spread, and it is therefore considered one of the major reasons for the increase in the number of bacteria exhibiting multiple-antibiotic resistance. Thus, conjugation and spread of antibiotic resistance represents a severe problem in antibiotic treatment, especially of immunosuppressed patients and in intensive care units. While conjugation in gram-negative bacteria has been studied in great detail over the last decades, the transfer mechanisms of antibiotic resistance plasmids in gram-positive bacteria remained obscure. In the last few years, the entire nucleotide sequences of several large conjugative plasmids from gram-positive bacteria have been determined. Sequence analyses and data bank comparisons of their putative transfer (tra) regions have revealed significant similarities to tra regions of plasmids from gram-negative bacteria with regard to the respective DNA relaxases and their targets, the origins of transfer (oriT), and putative nucleoside triphosphatases NTP-ases with homologies to type IV secretion systems. In contrast, a single gene encoding a septal DNA translocator protein is involved in plasmid transfer between micelle-forming streptomycetes. Based on these clues, we propose the existence of two fundamentally different plasmid-mediated conjugative mechanisms in gram-positive microorganisms, namely, the mechanism taking place in unicellular gram-positive bacteria, which is functionally similar to that in gram-negative bacteria, and a second type that occurs in multicellular gram-positive bacteria, which seems to be characterized by double-stranded DNA transfer. PMID:12794193

  20. Involvement of Linear Plasmids in Aerobic Biodegradation of Vinyl Chloride

    SciTech Connect

    BRIGMON, ROBINL.

    2004-06-14

    Pseudomonas putida strain AJ and Ochrobactrum strain TD were isolated from hazardous waste sites based on their ability to use vinyl chloride (VC) as a sole source of carbon and energy under aerobic conditions. Strains AJ and TD also use ethene and ethylene oxide as growth substrates. Strain AJ contained a linear megaplasmid (approximately 260 kb) when grown on VC or ethene, but no circular plasmids. While growing on ethylene oxide, the size of the linear plasmid in strain AJ decreased to approximately 100 kb, although its ability to use VC as a substrate was retained. The linear plasmids in strain AJ were cured and its ability to consume VC, ethene, and ethylene oxide was lost following growth on a rich substrate (Luria-Bertani broth) through at least three transfers. Strain TD contained three linear plasmids, ranging in size from approximately 100 kb to 320 kb, when growing on VC or ethene. As with strain AJ, the linear plasmids in strain TD were cured following growth on Luria -Bertani broth and its ability to consume VC and ethene was lost. Further analysis of these linear plasmids may help reveal the pathway for VC biodegradation in strains AJ and TD and explain why this process occurs at many but not all sites where groundwater is contaminated with chloroethenes. Metabolism of VC and ethene by strains AJ and TD is initiated by an alkene monooxygenase. Their yields during growth on VC (0.15-0.20 mg total suspended solids per mg VC) are similar to the yields reported for other isolates i.e., Mycobacterium sp., Nocardioides sp., and Pseudomonas sp.

  1. Plasmid vector with temperature-controlled gene expression

    SciTech Connect

    Kravchenko, V.V.; Yamshchikov, V.F.; Pletnev, A.G.

    1986-02-01

    In plasmid pBR327, a fragment 169 b.p. long including promotor p/sub 3/ of the bla gene has been deleted. The deletional derivative so obtained (pSP2) has been used to construct a recombinant plasmid bearing a fragment of phage lambda DNA with the p/sub R/ promotor and the gene of the temperature-sensitive repressor cI. It has been shown that the plasmid vector so constructed (pCE119) with promotor cR performs repressor-cI-controlled transcription of the bla gene, as a result of which induction for an hour at 42/sup 0/C leads to an almost 100-fold increase in the amount of product of the bla gene as compared with that at 32/sup 0/C. The possibility of the use of plasmid cPE119 for the expression of other genes has been demonstrated for the case of the semisynthetic ..beta..-galactosidase gene of E. coli. In this case, on induction of the cells with recombinant plasmid pCEZ12 for 3 hours at 42/sup 0/C, a 300-fold increase in the amount of active ..beta..-galactosidase, as compared with that at 32/sup 0/C, was observed. It is important to point out that under these conditions (at 42/sup 0/C), at least 99% of the cells containing the plasmid retain the phenotype lacZ/sup +/, which indicates the stability of the proposed vector system

  2. Replication and Maintenance of Linear Phage-Plasmid N15.

    PubMed

    Ravin, Nikolai V

    2015-02-01

    The lambdoid phage N15 of Escherichia coli is very unusual among temperate phages in that its prophage is not integrated into the chromosome but is a linear plasmid molecule with covalently closed ends (telomeres). Upon infection, the phage DNA circularizes via cohesive ends, and then a special phage enzyme of the tyrosine recombinase family, protelomerase, cuts at another site and joins the ends, forming hairpin telomeres of the linear plasmid prophage. Replication of the N15 prophage is initiated at an internally located ori site and proceeds bidirectionally, resulting in the formation of duplicated telomeres. The N15 protelomerase cuts them, generating two linear plasmid molecules with hairpin telomeres. Stable inheritance of the plasmid prophage is ensured by a partitioning operon similar to the F factor sop operon. Unlike the F centromere, the N15 centromere consists of four inverted repeats dispersed in the genome. The multiplicity and dispersion of centromeres are required for efficient partitioning of a linear plasmid. The centromeres are located in the N15 genome regions involved in phage replication and control of lytic development, and binding of partition proteins at these sites regulates these processes. The family of N15-like linear phage-plasmids includes lambdoid phages ɸKO2 and pY54, as well as Myoviridae phages ΦHAP-1, VHML, VP882, Vp58.5, and vB_VpaM_MAR of marine gamma-proteobacteria. The genomes of these phages contain similar protelomerase genes, lysogeny control modules, and replication genes, suggesting that these phages may belong to a group diverged from a common ancestor.

  3. Anion exchange purification of plasmid DNA using expanded bed adsorption.

    PubMed

    Ferreira, G N; Cabral, J M; Prazeres, D M

    2000-01-01

    Recent developments in gene therapy with non-viral vectors and DNA vaccination have increased the demand for large amounts of pharmaceutical-grade plasmid DNA. The high viscosity of process streams is of major concern in the purification of plasmids, since it can cause high back pressures in column operations, thus limiting the throughput. In order to avoid these high back pressures, expanded bed anion exchange chromatography was evaluated as an alternative to fixed bed chromatography. A Streamline 25 column filled with 100 ml of Streamline QXL media, was equilibrated with 0.5 M NaCl in TE (10 mM Tris, 1 mM EDTA, pH = 8.0) buffer at an upward flow of 300 cmh-1, E. coli lysates (obtained from up to 3 liters of fermentation broth) were injected in the column. After washing out the unbound material, the media was allowed to sediment and the plasmid was eluted with 1 M NaCl in TE buffer at a downward flow of 120 cmh-1. Purification factors of 36 +/- 1 fold, 26 +/- 0.4 plasmid purity, and close to 100% yields were obtained when less than one settled column volume of plasmid feed was injected. However, both recovery yield and purity abruptly decreased when larger amounts were processed-values of 35 +/- 2 and 5 +/- 0.7 were obtained for the recovery yield and purity, respectively, when 250 ml of feedstock were processed. In these cases, gel clogging and expansion collapse were observed. The processing of larger volumes, thus larger plasmid quantities, was only possible by performing an isopropanol precipitation step prior to the chromatographic step. This step led to an enhancement of the purification step.

  4. Detection of plasmid mediated colistin resistance (MCR-1) in Escherichia coli and Salmonella enterica isolated from poultry and swine in Spain.

    PubMed

    Quesada, Alberto; Ugarte-Ruiz, María; Iglesias, M Rocío; Porrero, M Concepción; Martínez, Remigio; Florez-Cuadrado, Diego; Campos, María J; García, María; Píriz, Segundo; Sáez, José Luis; Domínguez, Lucas

    2016-04-01

    Recent findings suggest that use of colistin as a last resort antibiotic is seriously threatened by the rise of a new plasmid mediated mechanism of resistance (MCR-1). This work identifies, for the first time in Southern Europe, the gene mcr-1 in nine strains from farm animals (poultry and swine) corresponding to five Escherichia coli and four Salmonella enterica, among which three belong to serovar Typhimurium and one to Rissen. The MCR-1 was found encoded by a plasmid highly mobilizable by conjugation to the E. coli J53 strain. Two E. coli strains carried two determinants, mcr-1 plus pmrA or pmrB mutations, known to confer colistin resistance.

  5. Detection of plasmid mediated colistin resistance (MCR-1) in Escherichia coli and Salmonella enterica isolated from poultry and swine in Spain.

    PubMed

    Quesada, Alberto; Ugarte-Ruiz, María; Iglesias, M Rocío; Porrero, M Concepción; Martínez, Remigio; Florez-Cuadrado, Diego; Campos, María J; García, María; Píriz, Segundo; Sáez, José Luis; Domínguez, Lucas

    2016-04-01

    Recent findings suggest that use of colistin as a last resort antibiotic is seriously threatened by the rise of a new plasmid mediated mechanism of resistance (MCR-1). This work identifies, for the first time in Southern Europe, the gene mcr-1 in nine strains from farm animals (poultry and swine) corresponding to five Escherichia coli and four Salmonella enterica, among which three belong to serovar Typhimurium and one to Rissen. The MCR-1 was found encoded by a plasmid highly mobilizable by conjugation to the E. coli J53 strain. Two E. coli strains carried two determinants, mcr-1 plus pmrA or pmrB mutations, known to confer colistin resistance. PMID:27033921

  6. Conjugation is necessary for a bacterial plasmid to survive under protozoan predation.

    PubMed

    Cairns, Johannes; Jalasvuori, Matti; Ojala, Ville; Brockhurst, Michael; Hiltunen, Teppo

    2016-02-01

    Horizontal gene transfer by conjugative plasmids plays a critical role in the evolution of antibiotic resistance. Interactions between bacteria and other organisms can affect the persistence and spread of conjugative plasmids. Here we show that protozoan predation increased the persistence and spread of the antibiotic resistance plasmid RP4 in populations of the opportunist bacterial pathogen Serratia marcescens. A conjugation-defective mutant plasmid was unable to survive under predation, suggesting that conjugative transfer is required for plasmid persistence under the realistic condition of predation. These results indicate that multi-trophic interactions can affect the maintenance of conjugative plasmids with implications for bacterial evolution and the spread of antibiotic resistance genes.

  7. Mutagenesis of dimeric plasmids by the transposon. gamma. delta. (Tn1000)

    SciTech Connect

    Liu, L.; Berg, C.M. )

    1990-05-01

    The Escherichia coli F factor mediates conjugal transfer of a plasmid such as pBR322 primarily by replicative transposition of transposon {gamma}{delta} (Tn1000) from F to that plasmid to form a cointegrate intermediate. Although resolution of this cointegrate always yields a plasmid containing a single {gamma}{delta} insertion, the occasional recovery of transposon-free plasmids after connuugal transfer has led to alternative hypotheses for F mobilization. The authors show here that {gamma}{delta}-free plasmids are found after F-mediated conjugal transfer only when the donor plasmid is a dimer and the recipient is Rec{sup +}.

  8. PCR-directed in vivo plasmid construction using homologous recombination in baker's yeast.

    PubMed

    Andersen, Erik C

    2011-01-01

    A variety of applications require the creation of custom-designed plasmids, including transgenic reporters, heterologous gene fusions, and phenotypic rescue plasmids. These plasmids are created traditionally using restriction digests and in vitro ligation reactions, but these techniques are dependent on available restriction sites and can be laborious given the size and number of fragments to be ligated. The baker's yeast Saccharomyces cerevisiae provides a powerful platform to create nearly any plasmid through PCR-directed yeast-mediated ligation. This technique can ligate complex plasmids of up to 50 kilobasepairs (kb) in vivo to produce plasmids with precisely defined sequences.

  9. Construction of a bioluminescence reporter plasmid for Francisella tularensis.

    PubMed

    Bina, Xiaowen R; Miller, Mark A; Bina, James E

    2010-11-01

    A Francisella tularensis shuttle vector that constitutively expresses the Photorhabdus luminescens lux operon in type A and type B strains of F. tularensis was constructed. The bioluminescence reporter plasmid was introduced into the live vaccine strain of F. tularensis and used to follow F. tularensis growth in a murine intranasal challenge model in real-time by bioluminescence imaging. The results show that the new bioluminescence reporter plasmid represents a useful tool for tularemia research that is suitable for following F. tularensis growth in both in vitro and in vivo model systems. PMID:20620161

  10. Esc1, a Nuclear Periphery Protein Required for Sir4-Based Plasmid Anchoring and Partitioning

    PubMed Central

    Andrulis, Erik D.; Zappulla, David C.; Ansari, Athar; Perrod, Severine; Laiosa, Catherine V.; Gartenberg, Marc R.; Sternglanz, Rolf

    2002-01-01

    A targeted silencing screen was performed to identify yeast proteins that, when tethered to a telomere, suppress a telomeric silencing defect caused by truncation of Rap1. A previously uncharacterized protein, Esc1 (establishes silent chromatin), was recovered, in addition to well-characterized proteins Rap1, Sir1, and Rad7. Telomeric silencing was slightly decreased in Δesc1 mutants, but silencing of the HM loci was unaffected. On the other hand, targeted silencing by various tethered proteins was greatly weakened in Δesc1 mutants. Two-hybrid analysis revealed that Esc1 and Sir4 interact via a 34-amino-acid portion of Esc1 (residues 1440 to 1473) and a carboxyl-terminal domain of Sir4 known as PAD4 (residues 950 to 1262). When tethered to DNA, this Sir4 domain confers efficient partitioning to otherwise unstable plasmids and blocks the ability of bound DNA segments to rotate freely in vivo. Here, both phenomena were shown to require ESC1. Sir protein-mediated partitioning of a telomere-based plasmid also required ESC1. Fluorescence microscopy of cells expressing green fluorescent protein (GFP)-Esc1 showed that the protein localized to the nuclear periphery, a region of the nucleus known to be functionally important for silencing. GFP-Esc1 localization, however, was not entirely coincident with telomeres, the nucleolus, or nuclear pore complexes. Our data suggest that Esc1 is a component of a redundant pathway that functions to localize silencing complexes to the nuclear periphery. PMID:12417731

  11. Vaccination with Human Papillomavirus Pseudovirus-Encapsidated Plasmids Targeted to Skin Using Microneedles

    PubMed Central

    Kines, Rhonda C.; Zarnitsyn, Vladimir; Johnson, Teresa R.; Pang, Yuk-Ying S.; Corbett, Kizzmekia S.; Nicewonger, John D.; Gangopadhyay, Anu; Chen, Man; Liu, Jie; Prausnitz, Mark R.; Schiller, John T.; Graham, Barney S.

    2015-01-01

    Human papilloma virus-like particles (HPV VLP) serve as the basis of the current licensed vaccines for HPV. We have previously shown that encapsidation of DNA expressing the model antigen M/M2 from respiratory syncytial virus (RSV) in HPV pseudovirions (PsV) is immunogenic when delivered intravaginally. Because the HPV capsids confer tropism for basal epithelium, they represent attractive carriers for vaccination targeted to the skin using microneedles. In this study we asked: 1) whether HPV16 VLP administered by microneedles could induce protective immune responses to HPV16 and 2) whether HPV16 PsV-encapsidated plasmids delivered by microneedles could elicit immune responses to both HPV and the antigen delivered by the transgene. Mice immunized with HPV16 VLP coated microneedles generated robust neutralizing antibody responses and were protected from HPV16 challenge. Microneedle arrays coated with HPV16-M/M2 or HPV16-F protein (genes of RSV) were then tested and dose-dependent HPV and F-specific antibody responses were detected post-immunization, and M/M2-specific T-cell responses were detected post RSV challenge, respectively. HPV16 PsV-F immunized mice were fully protected from challenge with HPV16 PsV and had reduced RSV viral load in lung and nose upon intranasal RSV challenge. In summary, HPV16 PsV-encapsidated DNA delivered by microneedles induced neutralizing antibody responses against HPV and primed for antibody and T-cell responses to RSV antigens encoded by the encapsidated plasmids. Although the immunogenicity of the DNA component was just above the dose response threshold, the HPV-specific immunity was robust. Taken together, these data suggest microneedle delivery of lyophilized HPV PsV could provide a practical, thermostable combined vaccine approach that could be developed for clinical evaluation. PMID:25785935

  12. Genetic transformation of a clinical (genital tract), plasmid-free isolate of Chlamydia trachomatis: engineering the plasmid as a cloning vector.

    PubMed

    Wang, Yibing; Kahane, Simona; Cutcliffe, Lesley T; Skilton, Rachel J; Lambden, Paul R; Persson, Kenneth; Bjartling, Carina; Clarke, Ian N

    2013-01-01

    Our study had three objectives: to extend the plasmid-based transformation protocol to a clinical isolate of C. trachomatis belonging to the trachoma biovar, to provide "proof of principle" that it is possible to "knock out" selected plasmid genes (retaining a replication competent plasmid) and to investigate the plasticity of the plasmid. A recently developed, plasmid-based transformation protocol for LGV isolates of C. trachomatis was modified and a plasmid-free, genital tract C. trachomatis isolate from Sweden (SWFP-) was genetically transformed. Transformation of this non-LGV C. trachomatis host required a centrifugation step, but the absence of the natural plasmid removed the need for plaque purification of transformants. Transformants expressed GFP, were penicillin resistant and iodine stain positive for accumulated glycogen. The transforming plasmid did not recombine with the host chromosome. A derivative of pGFP::SW2 carrying a deletion of the plasmid CDS5 gene was engineered. CDS5 encodes pgp3, a protein secreted from the inclusion into the cell cytoplasm. This plasmid (pCDS5KO) was used to transform C. trachomatis SWFP-, and established that pgp3 is dispensable for plasmid function. The work shows it is possible to selectively delete segments of the chlamydial plasmid, and this is the first step towards a detailed molecular dissection of the role of the plasmid. The 3.6 kb β-galactosidase cassette was inserted into the deletion site of CDS5 to produce plasmid placZ-CDS5KO. Transformants were penicillin resistant, expressed GFP and stained for glycogen. In addition, they expressed β-galactosidase showing that the lacZ cassette was functional in C. trachomatis. An assay was developed that allowed the visualisation of individual inclusions by X-gal staining. The ability to express active β-galactosidase within chlamydial inclusions is an important advance as it allows simple, rapid assays to measure directly chlamydial infectivity without the need for

  13. A highly selectable and highly transferable Ti plasmid to study conjugal host range and Ti plasmid dissemination in complex ecosystems.

    PubMed

    Teyssier-Cuvelle, S; Oger, P; Mougel, C; Groud, K; Farrand, S K; Nesme, X

    2004-07-01

    A conjugal donor system, ST2, was constructed to study the conjugal dissemination of a Ti plasmid to wild-type recipient bacteria in vitro and in situ. The system consisted of a polyauxotrophic derivative of C58 harboring a hyperconjugative and highly selectable Ti plasmid, pSTiEGK, which was constructed by inserting a multiple antibiotic resistance cassette in the traM- mcpA region of pTiC58Delta accR. ST2 transfers pSTiEGK constitutively at frequencies up to 10(-1) to plasmidless Agrobacterium recipients. The host range of pSTiEGK includes all the known genomic species of Agrobacterium, indigenous soil agrobacteria and some Rhizobium and Phyllobacterium spp. All transconjugants became pathogenic upon acquisition of the Ti plasmid and were also able to transfer pSTiEGK by conjugation. This host range was indistinguishable from that of its wild-type parent pTiC58, and therefore pSTiEGK constitute a valid proxy to study the dissemination of Ti plasmids directly in the environment. Transconjugants can be selected on a combination of four antibiotics, which efficiently prevents the growth of the indigenous microbiota present in complex environments. The transfer of pSTiEGK to members of the genus Agrobacterium was affected primarily by the plasmid content of the recipient strain (10(3)- to 10(5)-fold reduction), e.g., the presence of incompatible plasmids. As a consequence, a species should be considered permissive to Ti transfer whenever one permissive isolate is found. PMID:15164241

  14. Genetic Characterization of ExPEC-Like Virulence Plasmids among a Subset of NMEC.

    PubMed

    Nicholson, Bryon A; West, Aaron C; Mangiamele, Paul; Barbieri, Nicolle; Wannemuehler, Yvonne; Nolan, Lisa K; Logue, Catherine M; Li, Ganwu

    2016-01-01

    Neonatal Meningitis Escherichia coli (NMEC) is one of the most common causes of neonatal bacterial meningitis in the US and elsewhere resulting in mortality or neurologic deficits in survivors. Large plasmids have been shown experimentally to increase the virulence of NMEC in the rat model of neonatal meningitis. Here, 9 ExPEC-like plasmids were isolated from NMEC and sequenced to identify the core and accessory plasmid genes of ExPEC-like virulence plasmids in NMEC and create an expanded plasmid phylogeny. Results showed sequenced virulence plasmids carry a strongly conserved core of genes with predicted functions in five distinct categories including: virulence, metabolism, plasmid stability, mobile elements, and unknown genes. The major functions of virulence-associated and plasmid core genes serve to increase in vivo fitness by adding multiple iron uptake systems to the genetic repertoire to facilitate NMEC's survival in the host's low iron environment, and systems to enhance bacterial resistance to host innate immunity. Phylogenetic analysis based on these core plasmid genes showed that at least two lineages of ExPEC-like plasmids could be discerned. Further, virulence plasmids from Avian Pathogenic E. coli and NMEC plasmids could not be differentiated based solely on the genes of the core plasmid genome.

  15. Diversity of Plasmids and Antimicrobial Resistance Genes in Multidrug-Resistant Escherichia coli Isolated from Healthy Companion Animals.

    PubMed

    Jackson, C R; Davis, J A; Frye, J G; Barrett, J B; Hiott, L M

    2015-09-01

    The presence and transfer of antimicrobial resistance genes from commensal bacteria in companion animals to more pathogenic bacteria may contribute to dissemination of antimicrobial resistance. The purpose of this study was to determine antimicrobial resistance gene content and the presence of genetic elements in antimicrobial resistant Escherichia coli from healthy companion animals. In our previous study, from May to August, 2007, healthy companion animals (155 dogs and 121 cats) from three veterinary clinics in the Athens, GA, USA area were sampled and multidrug-resistant E. coli (n = 36; MDR, resistance to ≥ 2 antimicrobial classes) were obtained. Of the 25 different plasmid replicon types tested by PCR, at least one plasmid replicon type was detected in 94% (34/36) of the MDR E. coli; four isolates contained as many as five different plasmid replicons. Nine replicon types (FIA, FIB, FII, I2, A/C, U, P, I1 and HI2) were identified with FIB, FII, I2 as the most common pattern. The presence of class I integrons (intI) was detected in 61% (22/36) of the isolates with eight isolates containing aminoglycoside- and/or trimethoprim-resistance genes in the variable cassette region of intI. Microarray analysis of a subset of the MDR E. coli (n = 9) identified the presence of genes conferring resistance to aminoglycosides (aac, aad, aph and strA/B), β-lactams (ampC, cmy, tem and vim), chloramphenicol (cat), sulfonamides (sulI and sulII), tetracycline [tet(A), tet(B), tet(C), tet(D) and regulator, tetR] and trimethoprim (dfrA). Antimicrobial resistance to eight antimicrobials (ampicillin, cefoxitin, ceftiofur, amoxicillin/clavulanic acid, streptomycin, gentamicin, sulfisoxazole and trimethoprim-sulfamethoxazole) and five plasmid replicons (FIA, FIB, FII, I1 and I2) were transferred via conjugation. The presence of antimicrobial resistance genes, intI and transferable plasmid replicons indicate that E. coli from companion animals may play an important role in the

  16. Genetic characterization of three qnrS1-harbouring multidrug-resistance plasmids and qnrS1-containing transposons circulating in Ho Chi Minh City, Vietnam

    PubMed Central

    Le, Vien; Nhu, Nguyen Thi Khanh; Cerdeno-Tarraga, Ana; Campbell, James I.; Tuyen, Ha Thanh; Nhu, Tran Do Hoang; Tam, Pham Thi Thanh; Schultsz, Constance; Thwaites, Guy; Thomson, Nicholas R.

    2015-01-01

    Plasmid-mediated quinolone resistance (PMQR) refers to a family of closely related genes that confer decreased susceptibility to fluoroquinolones. PMQR genes are generally associated with integrons and/or plasmids that carry additional antimicrobial resistance genes active against a range of antimicrobials. In Ho Chi Minh City (HCMC), Vietnam, we have previously shown a high frequency of PMQR genes within commensal Enterobacteriaceae. However, there are limited available sequence data detailing the genetic context in which the PMQR genes reside, and a lack of understanding of how these genes spread across the Enterobacteriaceae. Here, we aimed to determine the genetic background facilitating the spread and maintenance of qnrS1, the dominant PMQR gene circulating in HCMC. We sequenced three qnrS1-carrying plasmids in their entirety to understand the genetic context of these qnrS1-embedded plasmids and also the association of qnrS1-mediated quinolone resistance with other antimicrobial resistance phenotypes. Annotation of the three qnrS1-containing plasmids revealed a qnrS1-containing transposon with a closely related structure. We screened 112 qnrS1-positive commensal Enterobacteriaceae isolated in the community and in a hospital in HCMC to detect the common transposon structure. We found the same transposon structure to be present in 71.4 % (45/63) of qnrS1-positive hospital isolates and in 36.7 % (18/49) of qnrS1-positive isolates from the community. The resulting sequence analysis of the qnrS1 environment suggested that qnrS1 genes are widely distributed and are mobilized on elements with a common genetic background. Our data add additional insight into mechanisms that facilitate resistance to multiple antimicrobials in Gram-negative bacteria in Vietnam. PMID:26272054

  17. Genetic characterization of three qnrS1-harbouring multidrug-resistance plasmids and qnrS1-containing transposons circulating in Ho Chi Minh City, Vietnam.

    PubMed

    Le, Vien; Nhu, Nguyen Thi Khanh; Cerdeno-Tarraga, Ana; Campbell, James I; Tuyen, Ha Thanh; Nhu, Tran Do Hoang; Tam, Pham Thi Thanh; Schultsz, Constance; Thwaites, Guy; Thomson, Nicholas R; Baker, Stephen

    2015-08-01

    Plasmid-mediated quinolone resistance (PMQR) refers to a family of closely related genes that confer decreased susceptibility to fluoroquinolones. PMQR genes are generally associated with integrons and/or plasmids that carry additional antimicrobial resistance genes active against a range of antimicrobials. In Ho Chi Minh City (HCMC), Vietnam, we have previously shown a high frequency of PMQR genes within commensal Enterobacteriaceae. However, there are limited available sequence data detailing the genetic context in which the PMQR genes reside, and a lack of understanding of how these genes spread across the Enterobacteriaceae. Here, we aimed to determine the genetic background facilitating the spread and maintenance of qnrS1, the dominant PMQR gene circulating in HCMC. We sequenced three qnrS1-carrying plasmids in their entirety to understand the genetic context of these qnrS1-embedded plasmids and also the association of qnrS1-mediated quinolone resistance with other antimicrobial resistance phenotypes. Annotation of the three qnrS1-containing plasmids revealed a qnrS1-containing transposon with a closely related structure. We screened 112 qnrS1-positive commensal Enterobacteriaceae isolated in the community and in a hospital in HCMC to detect the common transposon structure. We found the same transposon structure to be present in 71.4 % (45/63) of qnrS1-positive hospital isolates and in 36.7 % (18/49) of qnrS1-positive isolates from the community. The resulting sequence analysis of the qnrS1 environment suggested that qnrS1 genes are widely distributed and are mobilized on elements with a common genetic background. Our data add additional insight into mechanisms that facilitate resistance to multiple antimicrobials in Gram-negative bacteria in Vietnam.

  18. Synthetic Fatty Acids Prevent Plasmid-Mediated Horizontal Gene Transfer

    PubMed Central

    Getino, María; Sanabria-Ríos, David J.; Fernández-López, Raúl; Campos-Gómez, Javier; Sánchez-López, José M.; Fernández, Antonio; Carballeira, Néstor M.

    2015-01-01

    ABSTRACT Bacterial conjugation constitutes a major horizontal gene transfer mechanism for the dissemination of antibiotic resistance genes among human pathogens. Antibiotic resistance spread could be halted or diminished by molecules that interfere with the conjugation process. In this work, synthetic 2-alkynoic fatty acids were identified as a novel class of conjugation inhibitors. Their chemical properties were investigated by using the prototype 2-hexadecynoic acid and its derivatives. Essential features of effective inhibitors were the carboxylic group, an optimal long aliphatic chain of 16 carbon atoms, and one unsaturation. Chemical modification of these groups led to inactive or less-active derivatives. Conjugation inhibitors were found to act on the donor cell, affecting a wide number of pathogenic bacterial hosts, including Escherichia, Salmonella, Pseudomonas, and Acinetobacter spp. Conjugation inhibitors were active in inhibiting transfer of IncF, IncW, and IncH plasmids, moderately active against IncI, IncL/M, and IncX plasmids, and inactive against IncP and IncN plasmids. Importantly, the use of 2-hexadecynoic acid avoided the spread of a derepressed IncF plasmid into a recipient population, demonstrating the feasibility of abolishing the dissemination of antimicrobial resistances by blocking bacterial conjugation. PMID:26330514

  19. [Chromatographic separation of plasmid DNA by anion-exchange cryogel].

    PubMed

    Guo, Yantao; Shen, Shaochuan; Yun, Junxian; Yao, Kejian

    2012-08-01

    Plasmid DNA (pDNA) is used as an important vector for gene therapy, and its wide application is restricted by the purity and yield. To obtain high-purity pDNA, a chromatographic method based on anion-exchange supermacroporous cryogel was explored. The anion-exchange cryogel was prepared by grafting diethylaminoethyl-dextran to the epoxide groups of polyacrylamide-based matrix and pUC19 plasmid was used as a target to test the method. The plasmid was transferred into Escherichia coli DH5alpha, cultivated, harvested and lysed. The obtained culture was centrifuged and the supernatant was used as the plasmid feedstock, which was loaded into the anion-exchange cryogel bed for chromatographic separation. By optimizing the pH of running buffer and the elution conditions, high-purity pDNA was obtained by elution with 0.5 mol/L sodium chloride solution at pH 6.6. Compared to the traditional methods for purification of pDNA, animal source enzymes and toxic reagents were not involved in the present separation process, ensuring the safety of both the purification operations and the obtained pDNA.

  20. Controlled plasmid gene transfer to murine renal carcinoma by hexadecylphosphocholine.

    PubMed

    Settelen, Nathalie; Roch, Olivier; Bock, David; Rooke, Ronald; Braun, Serge; Meyer, Olivier

    2004-01-01

    We report here that the anticancer drug hexadecylphosphocholine (HPC) can control plasmid DNA-mediated gene transfer to renal carcinoma following intratumoral administration. Significant improvement of gene expression levels could be achieved depending on HPC dose administered. Optimal concentration of HPC co-injected with plasmid DNA was found to be 0.2% (w/v) showing up to a 10-fold increase in reporter gene expression levels when compared to DNA administered alone. In vivo gene transfer activity of HPC was not affected by the nature of the diluent used, i.e. glucose-based or saline-based isotonic solutions. Although in vitro transfection activity of HPC formulations could not be evidenced, a liposome leakage assay revealed that HPC could significantly destabilize stable lipid membranes suggesting that a possible membrane permeation enhancer activity of HPC combined to the physical stress induced by the intratumor injection may facilitate plasmid DNA entry inside the cells resulting in increased gene expression. HPC/plasmid formulations represent new and attractive non-viral gene delivery systems with potential in cancer gene therapy and vaccination. PMID:14684287

  1. Tragedy of the commons among antibiotic resistance plasmids.

    PubMed

    Smith, Jeff

    2012-04-01

    As social interactions are increasingly recognized as important determinants of microbial fitness, sociobiology is being enlisted to better understand the evolution of clinically relevant microbes and, potentially, to influence their evolution to aid human health. Of special interest are situations in which there exists a "tragedy of the commons," where natural selection leads to a net reduction in fitness for all members of a population. Here, I demonstrate the existence of a tragedy of the commons among antibiotic resistance plasmids of bacteria. In serial transfer culture, plasmids evolved a greater ability to superinfect already-infected bacteria, increasing plasmid fitness when evolved genotypes were rare. Evolved plasmids, however, fell victim to their own success, reducing the density of their bacterial hosts when they became common and suffering reduced fitness through vertical transmission. Social interactions can thus be an important determinant of evolution for the molecular endosymbionts of bacteria. These results also identify an avenue of evolution that reduces proliferation of both antibiotic resistance genes and their bacterial hosts. PMID:22486703

  2. Tragedy of the commons among antibiotic resistance plasmids.

    PubMed

    Smith, Jeff

    2012-04-01

    As social interactions are increasingly recognized as important determinants of microbial fitness, sociobiology is being enlisted to better understand the evolution of clinically relevant microbes and, potentially, to influence their evolution to aid human health. Of special interest are situations in which there exists a "tragedy of the commons," where natural selection leads to a net reduction in fitness for all members of a population. Here, I demonstrate the existence of a tragedy of the commons among antibiotic resistance plasmids of bacteria. In serial transfer culture, plasmids evolved a greater ability to superinfect already-infected bacteria, increasing plasmid fitness when evolved genotypes were rare. Evolved plasmids, however, fell victim to their own success, reducing the density of their bacterial hosts when they became common and suffering reduced fitness through vertical transmission. Social interactions can thus be an important determinant of evolution for the molecular endosymbionts of bacteria. These results also identify an avenue of evolution that reduces proliferation of both antibiotic resistance genes and their bacterial hosts.

  3. [Chromatographic separation of plasmid DNA by anion-exchange cryogel].

    PubMed

    Guo, Yantao; Shen, Shaochuan; Yun, Junxian; Yao, Kejian

    2012-08-01

    Plasmid DNA (pDNA) is used as an important vector for gene therapy, and its wide application is restricted by the purity and yield. To obtain high-purity pDNA, a chromatographic method based on anion-exchange supermacroporous cryogel was explored. The anion-exchange cryogel was prepared by grafting diethylaminoethyl-dextran to the epoxide groups of polyacrylamide-based matrix and pUC19 plasmid was used as a target to test the method. The plasmid was transferred into Escherichia coli DH5alpha, cultivated, harvested and lysed. The obtained culture was centrifuged and the supernatant was used as the plasmid feedstock, which was loaded into the anion-exchange cryogel bed for chromatographic separation. By optimizing the pH of running buffer and the elution conditions, high-purity pDNA was obtained by elution with 0.5 mol/L sodium chloride solution at pH 6.6. Compared to the traditional methods for purification of pDNA, animal source enzymes and toxic reagents were not involved in the present separation process, ensuring the safety of both the purification operations and the obtained pDNA. PMID:23185899

  4. Characterization of the Lactobacillus plantarum plasmid pCD033 and generation of the plasmid free strain L. plantarum 3NSH.

    PubMed

    Heiss, Silvia; Grabherr, Reingard; Heinl, Stefan

    2015-09-01

    Lactobacillus plantarum CD033, a strain isolated from grass silage in Austria, harbors a 7.9 kb plasmid designated pCD033. Sequence analysis identified 14 open reading frames and 8 of these were supposed to be putative coding sequences. Gene annotation revealed no putative essential genes being plasmid encoded, but a plasmid addiction system based on a PemI/PemK-like toxin-antitoxin system, able to stabilize plasmid maintenance. Absence of a replication initiation protein, a double strand origin as well as a single strand origin on plasmid pCD033 suggests replication via a new type of theta mechanism, whereby plasmid replication is potentially initiated and regulated by non-coding RNA. Detailed examination of segregational stability of plasmid vectors consisting of pCD033-fragments, combined with a selection marker, resulted in definition of a stably maintained minimal replicon. A gene encoding a RepB/OrfX-like protein was found to be not essential for plasmid replication. Alignment of the amino acid sequence of this protein with related proteins unveiled a highly conserved amino acid motif (LLDQQQ). L. plantarum CD033 was cured of pCD033 resulting in the novel plasmid free strain L. plantarum 3NSH. Plasmid curing demonstrated that no essential features are provided by pCD033 under laboratory conditions.

  5. The replication origin of a repABC plasmid

    PubMed Central

    2011-01-01

    Background repABC operons are present on large, low copy-number plasmids and on some secondary chromosomes in at least 19 α-proteobacterial genera, and are responsible for the replication and segregation properties of these replicons. These operons consist, with some variations, of three genes: repA, repB, and repC. RepA and RepB are involved in plasmid partitioning and in the negative regulation of their own transcription, and RepC is the limiting factor for replication. An antisense RNA encoded between the repB-repC genes modulates repC expression. Results To identify the minimal region of the Rhizobium etli p42d plasmid that is capable of autonomous replication, we amplified different regions of the repABC operon using PCR and cloned the regions into a suicide vector. The resulting vectors were then introduced into R. etli strains that did or did not contain p42d. The minimal replicon consisted of a repC open reading frame under the control of a constitutive promoter with a Shine-Dalgarno sequence that we designed. A sequence analysis of repC revealed the presence of a large A+T-rich region but no iterons or DnaA boxes. Silent mutations that modified the A+T content of this region eliminated the replication capability of the plasmid. The minimal replicon could not be introduced into R. etli strain containing p42d, but similar constructs that carried repC from Sinorhizobium meliloti pSymA or the linear chromosome of Agrobacterium tumefaciens replicated in the presence or absence of p42d, indicating that RepC is an incompatibility factor. A hybrid gene construct expressing a RepC protein with the first 362 amino acid residues from p42d RepC and the last 39 amino acid residues of RepC from SymA was able to replicate in the presence of p42d. Conclusions RepC is the only element encoded in the repABC operon of the R. etli p42d plasmid that is necessary and sufficient for plasmid replication and is probably the initiator protein. The oriV of this plasmid resides

  6. Nucleotide sequence of a small cryptic plasmid from Acidithiobacillus ferrooxidans strain A-6

    SciTech Connect

    F. Roberto

    2003-10-01

    A 2.1 kb cryptic plasmid from Acidithiobacillus ferrooxidans strain A-6 was isolated and cloned into the E. coli vector plasmid, pUC128. The cloned plasmid was mapped by restriction enzyme fragment analysis and subsequently sequenced. At this time over half the plasmid sequence has been determined and compared to sequences in the GenBank nucleotide and protein sequence databases. Much of the plasmid remains cryptic, but substantial nucleotide and protein sequence similarities have been observed to the putative replication protein, RepA, of the small cryptic plasmids pAYS and pAYL found in the ammonia-oxidizing Nitrosomonas sp. Strain ENI-11. These results suggest an entirely new class of plasmid is maintained in at least one strain of Acidithiobacillus ferrooxidans and other acidophilic bacteria, and raises interesting questions about the origin of this plasmid in acidic environments.

  7. A Time-Efficient and User-Friendly Method for Plasmid DNA Restriction Analysis.

    ERIC Educational Resources Information Center

    LaBanca, Frank; Berg, Claire M.

    1998-01-01

    Describes an experiment in which plasmid DNA is digested with restriction enzymes that cleave the plasmid either once or twice. The DNA is stained, loaded on a gel, electrophoresed, and viewed under normal laboratory conditions during electrophoresis. (DDR)

  8. Small plasmids in Streptococcus dysgalactiae subsp. equisimilis isolated from human infections in southern India and sequence analysis of two novel plasmids.

    PubMed

    Bergmann, René; Nitsche-Schmitz, D Patric

    2015-05-01

    Small plasmids are frequently found in S. pyogenes isolates from human infections in India. Streptococcus dysgalactiae subsp. equisimilis (SDSE) is a streptococcal subspecies that is genetically similar to S. pyogenes and has a similar ecology. Therefore, we determined the distribution of small plasmids in a collection of 254 SDSE isolates, comprising 44 different emm-types and emm non-typable strains, from southern India, utilizing an established PCR based method. Briefly, 1.2% (n=3) of the isolates were positive for repA (encoding the replication initiation protein A) and 1.6% (n=4) were repB positive (encoding the replication initiation protein B). One isolate (G315) showed a co-detection of repB and dysA (encoding the bacteriocin dysgalacticin) which is characteristic for previously described pDN281/pW2580-like plasmids, observed in SDSE and S. pyogenes. The remaining plasmid bearing isolates showed no characteristic co-detection of known plasmid-associated genes. Thus, plasmids pG271 and pG279, representatives for repB and repA harboring plasmids, respectively, were analyzed. The plasmids pG271 and pG279 could be assigned to the pMV158 and the pC194/pUB110 family of rolling-circle plasmids, respectively. Like the characterized small native plasmids of S. pyogenes from India, the SDSE plasmids discovered and described in this study did not carry any of the known antibiotic resistance genes. SDSE bore less of the investigated small native plasmids that were distinct from the small native plasmids of S. pyogenes of the same geographic region. This indicates a low rate of lateral transfer of these genetic elements between these two related streptococcal species.

  9. The Complete Sequences and Ecological Roles of Two IncP-1β Plasmids, pHB44 and pBS64, Isolated from the Mycosphere of Laccaria proxima

    PubMed Central

    Zhang, Miaozhi; Brons, Jolanda K.; van Elsas, Jan Dirk

    2016-01-01

    Two novel plasmids, coined pHB44 and pBS64, were recently found in Variovorax paradoxus strains HB44 and BS64 isolated from the mycosphere of Laccaria proxima, on two different sampling occasions. We here describe the full sequences of pHB44 and pBS64 and establish their evolutionary placement and ecological function. Both plasmids, unique for mycospheric V. paradoxus, were around 58 kb in size. They possessed, in a very similar fashion, three main plasmid backbone regions, which were predicted to be involved in plasmid replication, central control of maintenance, and conjugational transfer. Phylogenetic inference on the basis of seven selected and concatenated plasmid backbone genes provided solid evidence for the placement of the two plasmids in the IncP-1β1 group, with the recently isolated IncP-1β1 plasmid pMBUI8 as the closest relative. A comparative analysis of the sequences present in each of the recombinational hot spots (RHS) I to III across plasmids pHB44, pBS64, and pMBUI8 revealed the insertions found in plasmids pHB44 and pBS64 to be different from those of pMBUI8. Whereas, in the former two plasmids, RHS I and III were devoid of any major inserts, their RHS II regions contained inserts of 15,043 (pHB44) and 16,406 kb (pBS64), against about 9,3 kb for pMBUI8. Interestingly, these regions were highly similar across plasmids pHB44 and pBS64, and differed from that of pMBUI8. Closer inspection revealed the insert in the former plasmids to contain, next to transposases, an “mmf” gene cassette previously reported to encode metal “responsiveness” in the PromA plasmid pMOL98. Whereas the plasmid pHB44 RHS II contained the canonical mmf sequence, that in pBS64 contained, in addition, a “two-gene duplicated region” flanking the mmf C2 gene. In vitro experiments on the growth and survival of strains with or without plasmid pHB44 suggested this plasmid was involved in the binding and import of Fe3+ as well as V3+ ions into the host cells, thus

  10. Description of a 2,683-Base-Pair Plasmid Containing qnrD in Two Providencia rettgeri Isolates

    PubMed Central

    Cambau, Emmanuelle; Neuwirth, Catherine; Nenninger, Thomas; Mbadi, Aurore; Brasme, Lucien; Vernet-Garnier, Véronique; Bajolet, Odile; de Champs, Christophe

    2012-01-01

    qnr genes are plasmid-mediated quinolone resistance genes mainly harbored on large conjugative multiresistant plasmids. The qnrD gene was recently observed in Salmonella enterica on a small nonconjugative plasmid (p2007057). We describe two strains of Providencia rettgeri harboring qnrD on nonconjugative plasmids. The plasmids were 99% identical, with 2,683 bp and four open reading frames, including qnrD, but exhibited only 53% identity with the plasmid found in S. enterica. PMID:21986831

  11. Plasmid Mediated Antibiotic Resistance in Isolated Bacteria From Burned Patients

    PubMed Central

    Beige, Fahimeh; Baseri Salehi, Majid; Bahador, Nima; Mobasherzadeh, Sina

    2014-01-01

    Background: Nowadays, the treatment of burned patients is difficult because of the high frequency of infection with antibiotic resistance bacteria. Objectives: This study was conducted to evaluate the level of antibiotic resistance in Gram-negative bacteria and its relation with the existence of plasmid. Materials and Methods: The samples were collected from two hundred twenty hospitalized burned patients in Isfahan burn hospital during a three-month period (March 2012 to June 2012). The samples were isolated and the Gram-negative bacteria were identified using phenotypic method and API 20E System. Antibiotic susceptibility and plasmid profile were determined by standard Agar disc diffusion and plasmid spin column extraction methods. Results: Totally 117 Gram-negative bacteria were isolated, the most common were Pseudomonas aerugionsa (37.6%), P. fluorescens (25.6%), Acinetobacter baumanii (20/5%) and Klebsiella pneumoniae (7.6%), respectively. The isolates showed high frequency of antibiotic resistance against ceftazidime and co-amoxiclave (100%) and low frequency of antibiotic resistance against amikacin with (70%).The results indicated that 60% of the isolates harboured plasmid. On the other hand, the patients infected with A. baumanii and P. aeruginosa were cured (with 60% frequency) whereas, those infected with P. fluorescens were not cured. Hence, probably antibiotic resistance markers of A. baumanii and P. aeruginosa are plasmid mediated; however, P. fluorescens is chromosomally mediated. Conclusions: Based on our findings, P. aerugionsa is a major causative agent of wound infections and amikacin could be considered as a more effective antibiotic for treatment of the burned patients. PMID:25789121

  12. Plasmid copy number underlies adaptive mutability in bacteria.

    PubMed

    Sano, Emiko; Maisnier-Patin, Sophie; Aboubechara, John Paul; Quiñones-Soto, Semarhy; Roth, John R

    2014-11-01

    The origin of mutations under selection has been intensively studied using the Cairns-Foster system, in which cells of an Escherichia coli lac mutant are plated on lactose and give rise to 100 Lac+ revertants over several days. These revertants have been attributed variously to stress-induced mutagenesis of nongrowing cells or to selective improvement of preexisting weakly Lac+ cells with no mutagenesis. Most revertant colonies (90%) contain stably Lac+ cells, while others (10%) contain cells with an unstable amplification of the leaky mutant lac allele. Evidence is presented that both stable and unstable Lac+ revertant colonies are initiated by preexisting cells with multiple copies of the F'lac plasmid, which carries the mutant lac allele. The tetracycline analog anhydrotetracycline (AnTc) inhibits growth of cells with multiple copies of the tetA gene. Populations with tetA on their F'lac plasmid include rare cells with an elevated plasmid copy number and multiple copies of both the tetA and lac genes. Pregrowth of such populations with AnTc reduces the number of cells with multiple F'lac copies and consequently the number of Lac+ colonies appearing under selection. Revertant yield is restored rapidly by a few generations of growth without AnTc. We suggest that preexisting cells with multiple F'lac copies divide very little under selection but have enough energy to replicate their F'lac plasmids repeatedly until reversion initiates a stable Lac+ colony. Preexisting cells whose high-copy plasmid includes an internal lac duplication grow under selection and produce an unstable Lac+ colony. In this model, all revertant colonies are initiated by preexisting cells and cannot be stress induced. PMID:25173846

  13. Supercoiling, knotting and replication fork reversal in partially replicated plasmids

    PubMed Central

    Olavarrieta, L.; Martínez-Robles, M. L.; Sogo, J. M.; Stasiak, A.; Hernández, P.; Krimer, D. B.; Schvartzman, J. B.

    2002-01-01

    To study the structure of partially replicated plasmids, we cloned the Escherichia coli polar replication terminator TerE in its active orientation at different locations in the ColE1 vector pBR18. The resulting plasmids, pBR18-TerE@StyI and pBR18-TerE@EcoRI, were analyzed by neutral/neutral two-dimensional agarose gel electrophoresis and electron microscopy. Replication forks stop at the Ter–TUS complex, leading to the accumulation of specific replication intermediates with a mass 1.26 times the mass of non-replicating plasmids for pBR18-TerE@StyI and 1.57 times for pBR18-TerE@EcoRI. The number of knotted bubbles detected after digestion with ScaI and the number and electrophoretic mobility of undigested partially replicated topoisomers reflect the changes in plasmid topology that occur in DNA molecules replicated to different extents. Exposure to increasing concentrations of chloroquine or ethidium bromide revealed that partially replicated topoisomers (CCCRIs) do not sustain positive supercoiling as efficiently as their non-replicating counterparts. It was suggested that this occurs because in partially replicated plasmids a positive ΔLk is absorbed by regression of the replication fork. Indeed, we showed by electron microscopy that, at least in the presence of chloroquine, some of the CCCRIs of pBR18-Ter@StyI formed Holliday-like junction structures characteristic of reversed forks. However, not all the positive supercoiling was absorbed by fork reversal in the presence of high concentrations of ethidium bromide. PMID:11809877

  14. Plasmid profiling of bacterial isolates from confined environments

    NASA Astrophysics Data System (ADS)

    van Houdt, Rob; Provoost, Ann; Coninx, Ilse; Leys, Natalie; Mergeay, Max

    Plasmid profiling of bacterial isolates from confined environments R. Van Houdt, I. Coninx, A. Provoost, N. Leys, and M. Mergeay Expertise group for Molecular and Cellular Biology, Institute for Environment, Health and Safety, Belgian Nuclear Research Centre (SCK•CEN), Boeretang 200, B-2400 Mol, Belgium. Human exploration of extreme and isolated hostile environments such as space requires special confined small volume habitats to protect and house the crew. However, human confinement in such small volume habitats has restrictions on waste disposal and personal hygiene and inevitably generates a particular community of microorganisms within the habitat. These microorganisms are mainly originating from the crew (skin, mucous membranes, upper respiratory tract, mouth, and gastrointestinal tract) but also include the residing environmental microorganisms. Earth-based confined habitats such as the Antarctic Research Station Concordia are used as test beds for long-duration spaceflights to study the physiologic and psychological adaptation to isolated environments. The dynamics of the environmental microbial population in such a test bed could render additional insights in assessing the potential health risks in long-duration space missions. Not only total bacterial contamination levels are important, but it is essential to identify also the predominant microbial taxa and their mobile genetic elements (MGE). These MGEs could be exchanged between bacteria by horizontal gene transfer and may alter the pathogenic potential since they often carry antibiotic resistance or more in general adaptation-enhancing traits. In this study several bacterial strains isolated in the Concordia research station were examined for their plasmid content. An optimized protocol for extraction of large plasmids showed the present of at least one plasmid in 50% of the strains. For all strains the minimal inhibitory concentration of a range of antibiotics was determined indicating resistance to

  15. GeneGuard: A modular plasmid system designed for biosafety.

    PubMed

    Wright, Oliver; Delmans, Mihails; Stan, Guy-Bart; Ellis, Tom

    2015-03-20

    Synthetic biology applications in biosensing, bioremediation, and biomining envision the use of engineered microbes beyond a contained laboratory. Deployment of such microbes in the environment raises concerns of unchecked cellular proliferation or unwanted spread of synthetic genes. While antibiotic-resistant plasmids are the most utilized vectors for introducing synthetic genes into bacteria, they are also inherently insecure, acting naturally to propagate DNA from one cell to another. To introduce security into bacterial synthetic biology, we here took on the task of completely reformatting plasmids to be dependent on their intended host strain and inherently disadvantageous for others. Using conditional origins of replication, rich-media compatible auxotrophies, and toxin-antitoxin pairs we constructed a mutually dependent host-plasmid platform, called GeneGuard. In this, replication initiators for the R6K or ColE2-P9 origins are provided in trans by a specified host, whose essential thyA or dapA gene is translocated from a genomic to a plasmid location. This reciprocal arrangement is stable for at least 100 generations without antibiotic selection and is compatible for use in LB medium and soil. Toxin genes ζ or Kid are also employed in an auxiliary manner to make the vector disadvantageous for strains not expressing their antitoxins. These devices, in isolation and in concert, severely reduce unintentional plasmid propagation in E. coli and B. subtilis and do not disrupt the intended E. coli host's growth dynamics. Our GeneGuard system comprises several versions of modular cargo-ready vectors, along with their requisite genomic integration cassettes, and is demonstrated here as an efficient vector for heavy-metal biosensors.

  16. [Cloning and identification of an Agrobacterium radiobacter 5D-1 chromosome fragment involved in control of nitrogen metabolism, biosynthesis of indolylacetic acid and replication of ColE1 plasmids].

    PubMed

    Kameneva, S V; Rusliakova, M V; Muronets, E M; Elanskaia, I V

    2001-07-01

    Pleiotropic chromosomal mutations were earlier identified in saprophytic associative bacterium Agrobacterium radiobacter 5D-1. The mutations changed nitrogen metabolism, disturbed synthesis of indolylacetic acid (IAA), and conferred the ability to sustain replication of ColE1 plasmid derivatives, which are not normally maintained in bacteria other than Escherichia. The mutations were designated Nr (Nitrogen metabolism) and assigned to a single cluster on an A. radiobacter genetic map. A 420-bp fragment AGH23.1.1 was cloned from an agrobacterial genomic library. Introduced in the Nr mutants as a part of a pUC18-based recombinant plasmid, the AGH23.1.1 fragment complemented the Nr mutations with respect to nitrogen metabolism and IAA biosynthesis, but transformants still sustained replication of ColE1 plasmids. Transformation with the linear AGH23.1.1 fragment was due to substitution of a mutant allele of the nr gene with its wild-type counterpart as a result of recombination and completely restored the wild type in the Nr mutants, including the inability to maintain ColE1 plasmids. The AGH23.1.1 fragment and its flanking regions were sequenced. The established sequence was shown to contain two open reading frames (ORFs) coding for proteins with unknown functions. Thus, the cloned fragment contained a gene(s) that controls nitrogen metabolism and IAA synthesis and prevent replication of ColE1 plasmids in A. radiobacter cells. Possible variants of the genetic control of these processes are considered.

  17. Virulence genes promote conjugative transfer of the Ti plasmid between Agrobacterium strains.

    PubMed Central

    Steck, T R; Kado, C I

    1990-01-01

    Certain virulence region operons of the Agrobacterium tumefaciens Ti plasmid promoted conjugative Ti plasmid transfer. Mutations in the vir region of pTiC58 inhibited conjugative plasmid transfer between A. tumefaciens strains. Mutations in virA, virG, 5' virB, and virE had the greatest effect on plasmid transfer, and mutations in virC had no effect. Transfer inhibition in vir mutants occurred in the presence or absence of acetosyringone. PMID:2318813

  18. Plasmid pCS1966, a new selection/counterselection tool for lactic acid bacterium strain construction based on the oroP gene, encoding an orotate transporter from Lactococcus lactis.

    PubMed

    Solem, Christian; Defoor, Els; Jensen, Peter Ruhdal; Martinussen, Jan

    2008-08-01

    In this paper we describe the new selection/counterselection vector pCS1966, which is suitable for both sequence-specific integration based on homologous recombination and integration in a bacteriophage attachment site. This plasmid harbors oroP, which encodes a dedicated orotate transporter, and can replicate only in Escherichia coli. Selection for integration is performed primarily by resistance to erythromycin; alternatively, the ability to utilize orotate as a pyrimidine source in a pyrimidine auxotrophic mutant could be utilized. Besides allowing the cell to utilize orotate, the transporter renders the cell sensitive to 5-fluoroorotate. This sensitivity is used to select for loss of the plasmid. When expressed from its own promoter, oroP was toxic to E. coli, whereas in Lactococcus lactis the level of expression of oroP from a chromosomal copy was too low to confer 5-fluoroorotate sensitivity. In order to obtain a plasmid that confers 5-fluoroorotate sensitivity when it is integrated into the chromosome of L. lactis and at the same time can be stably maintained in E. coli, the expression of the oroP gene was controlled from a synthetic promoter conferring these traits. To demonstrate its use, a number of L. lactis strains expressing triosephosphate isomerase (tpiA) at different levels were constructed.

  19. Antimicrobial resistance-conferring plasmids with similarity to virulence plasmids from avian pathogenic Escherichia coli strains in Salmonella enterica serovar Kentucky isolates from poultry

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Salmonella enterica, a leading cause of food-borne gastroenteritis worldwide, may be found in any raw food of animal, vegetable, or fruit origin. Salmonella serovars differ in distribution, virulence, and host specificity. Salmonella enterica serovar Kentucky, though often found in the food supply, ...

  20. Plasmid vectors for Xylella fastidiosa utilizing a toxin-antitoxin system for plasmid stability in the absence of antibiotic selection

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The phytopathogen Xylella fastidiosa causes disease in a variety of important crop and landscape plants. Functional genetic studies have led to a broader understanding of virulence mechanisms used by this pathogen in the grapevine host. Plasmid shuttle vectors are important tools in studies of bacte...

  1. Molecular characterisation of extended-spectrum β-lactamase- and plasmid AmpC-producing Escherichia coli strains isolated from broilers in Béjaïa, Algeria.

    PubMed

    Belmahdi, Mohamed; Bakour, Sofiane; Al Bayssari, Charbel; Touati, Abdelaziz; Rolain, Jean-Marc

    2016-09-01

    This study aimed to characterise the molecular support of antibiotic resistance in expanded-spectrum cephalosporin (ESC)-resistant Escherichia coli isolates recovered from healthy broilers in Béjaïa, northeast Algeria. A total of 61 intestinal swabs from slaughtered broilers from four regions in Béjaïa locality, Algeria, were collected between February and April 2014, from which 20 ESC-resistant E. coli strains were isolated. Escherichia coli isolates were identified by classical biochemical and MALDI-TOF methods. Antibiotic susceptibility testing was performed using disk diffusion and Etest methods. Screening for β-lactamases, aminoglycoside-modifying enzyme (AME)-encoding genes and qnr determinants was performed by PCR and sequencing. Clonal relatedness was determined using molecular typing by multilocus sequence typing (MLST). Antibiotic susceptibility testing revealed that the isolates showed high rates of resistance (>90%) to amoxicillin, amoxicillin/clavulanic acid, piperacillin/tazobactam, aztreonam, ceftazidime, streptomycin, tobramycin, nalidixic acid and ciprofloxacin. Low rates of resistance were observed for kanamycin (35%), amikacin (30%), cefoxitin (20%) and cefotaxime (15%). Molecular characterisation revealed that all of the isolates expressed the blaTEM-1 gene. Fourteen of them harboured the blaSHV-12 gene, two harboured the blaCTX-M-1 gene and four isolates harboured blaCMY-2. Screening for AME-encoding genes demonstrated that all isolates contained the aadA gene. In addition, qnrA was detected as the quinolone resistance determinant in 13 isolates. MLST revealed four known sequence types (STs), including ST744, ST38, ST1011 and ST2179, as well as one new sequence type (ST5086). Here we report the first study describing the clonal diversity of extended-spectrum β-lactamase (ESBL)- and plasmid AmpC-producing E. coli isolated from healthy broilers in Algeria. PMID:27530851

  2. 78 FR 27963 - Reliability Technical Conference; Notice of Technical Conference

    Federal Register 2010, 2011, 2012, 2013, 2014

    2013-05-13

    ... From the Federal Register Online via the Government Publishing Office DEPARTMENT OF ENERGY Federal Energy Regulatory Commission Reliability Technical Conference; Notice of Technical Conference Take notice that the Federal Energy Regulatory Commission will hold a Technical Conference on Tuesday, July 9,...

  3. Chromosome and Plasmids of the Tick-Borne Relapsing Fever Agent Borrelia hermsii

    PubMed Central

    2016-01-01

    The zoonotic pathogen Borrelia hermsii bears its multiple paralogous genes for variable antigens on several linear plasmids. Application of combined long-read and short-read next-generation sequencing provided complete sequences for antigen-encoding plasmids as well as other linear and circular plasmids and the linear chromosome of the genome. PMID:27284141

  4. Mix and match of KPC-2 encoding plasmids in Enterobacteriaceae-comparative genomics.

    PubMed

    Chmelnitsky, Inna; Shklyar, Maya; Leavitt, Azita; Sadovsky, Evgeniya; Navon-Venezia, Shiri; Ben Dalak, Maayan; Edgar, Rotem; Carmeli, Yehuda

    2014-06-01

    We performed comparative sequence analysis of 3 blaKPC-2 encoding plasmids to examine evolution of these plasmids and their dissemination. We found that all of them have an IncN replicon with a newly determined IncN plasmid sequence type (ST), ST15. The 2 Klebsiella pneumoniae (KPN) plasmids also harbor an IncF2A1-B1- replicon. The blaKPC-2 is located in the Tn4401c transposon with a newly discovered mutation in the P2 promoter. Screening of the 27 additional blaKPC-2 carrying plasmids from Enterobacter cloacae, Escherichia coli (EC), and K. pneumoniae showed that: all KPN and EC plasmids are IncN plasmids belonging to ST15; 4/7 KPN and 1/6 EC plasmids contain an additional IncF2A1-B1- replicon; all Enterobacter plasmids belong to neither IncN nor IncF2A1-B1- replicon plasmids; 6/7 KPN and 2/5 EC plasmids carry the mutated P2 promoter. Study of the blaKPC-2 environment, transposon, pMLST, and Inc group suggests transposon and plasmid inter- and intra-species dissemination and evolution.

  5. Approaches to investigating the ecology of plasmids in marine bacterial communities.

    PubMed

    Sobecky, Patricia A

    2002-11-01

    To better understand prokaryotic gene flux in marine ecosystems and to determine whether or not environmental parameters can effect the composition and structure of plasmid populations in marine bacterial communities, information on the distribution, diversity, and ecological traits of marine plasmids is necessary. This mini-review highlights recent insights gained into the molecular diversity and ecology of plasmids occurring in marine microbial communities.

  6. Plasmid-chromosome recombination of irradiated shuttle vector DNA in African Green Monkey kidney cells

    SciTech Connect

    Mudgett, J.S.

    1987-01-01

    An autonomously replicating shuttle vector was used to investigate the enhancement of plasmid-chromosome recombination in mammalian host cells by ultraviolet light and gamma radiation. Sequences homologous to the shuttle vector were stably inserted into the genome of African Green Monkey kidney cells to act as the target substrate for these recombination events. The SV40- and pBR322-derived plasmid DNA was irradiated with various doses of radiation before transfection into the transformed mammalian host cells. Ultraviolet light (UV) was found not to induce homologous plasmid-chromosome recombination, while gamma radiation increased the frequency of recombinant plasmids detected. The introduction of specific double-strand breaks in the plasmid or prolonging the time of plasmid residence in the mammalian host cells also enhanced plasmid-chromosome recombination. In contrast, plasmid mutagenesis was found to be increased by plasmid UV irradiation, but not to change with time. Plasmid survival, recombination, and mutagenesis were not affected by treating the mammalian host cells with UV light prior to plasmid transfection. The amp/sup r/ recombinant plasmid molecules analyzed were found to be mostly the result of nonconservative exchanges which appeared to involve both homologous and possibly nonhomologous interactions with the host chromosome.

  7. Cranfield Conference on Information Retrieval.

    ERIC Educational Resources Information Center

    Kuo, Franklin F.

    The Third Cranfield Conference on Mechanised Information Storage and Retrieval Systems was held on 20-23 July 1971 in Cranfield, England. The report describes a number of the key papers presented at this conference. (Author)

  8. Planning a Women's Studies Conference.

    ERIC Educational Resources Information Center

    Saul, Jean Rannells

    1992-01-01

    Describes the organization and implementation of a women's studies conference. Discusses fund raising, identifying speakers, developing publicity, local arrangement efforts, and providing hospitality. Includes nine recommendations and a suggested conference timeline. (CFR)

  9. Isolation of a novel plasmid from Couchioplanes caeruleus and construction of two plasmid vectors for gene expression in Actinoplanes missouriensis.

    PubMed

    Jang, Moon-Sun; Fujita, Azusa; Ikawa, Satomi; Hanawa, Keitaro; Yamamura, Hideki; Tamura, Tomohiko; Hayakawa, Masayuki; Tezuka, Takeaki; Ohnishi, Yasuo

    2015-01-01

    To date, no plasmid vector has been developed for the rare actinomycete Actinoplanes missouriensis. Moreover, no small circular plasmid has been reported to exist in the genus Actinoplanes. Here, a novel plasmid, designated pCAZ1, was isolated from Couchioplanes caeruleus subsp. azureus via screening for small circular plasmids in Actinoplanes (57 strains) and Couchioplanes (2 strains). Nucleotide sequencing revealed that pCAZ1 is a 5845-bp circular molecule with a G + C content of 67.5%. The pCAZ1 copy number was estimated at 30 per chromosome. pCAZ1 contains seven putative open reading frames, one of which encodes a protein containing three motifs conserved among plasmid-encoded replication proteins that are involved in the rolling-circle mechanism of replication. Detection of single-stranded DNA intermediates in C. caeruleus confirmed that pCAZ1 replicates by this mechanism. The ColE1 origin from pBluescript SK(+) and the oriT sequence with the apramycin resistance gene aac(3)IV from pIJ773 were inserted together into pCAZ1, to construct the Escherichia coli-A. missouriensis shuttle vectors, pCAM1 and pCAM2, in which the foreign DNA fragment was inserted into pCAZ1 in opposite directions. pCAM1 and pCAM2 were successfully transferred to A. missouriensis through the E. coli-mediated conjugative transfer system. The copy numbers of pCAM1 and pCAM2 in A. missouriensis were estimated to be one and four per chromosome, respectively. Thus, these vectors can be used as effective genetic tools for homologous and heterologous gene expression studies in A. missouriensis.

  10. Annual Conference Abstracts

    ERIC Educational Resources Information Center

    Engineering Education, 1976

    1976-01-01

    Presents the abstracts of 158 papers presented at the American Society for Engineering Education's annual conference at Knoxville, Tennessee, June 14-17, 1976. Included are engineering topics covering education, aerospace, agriculture, biomedicine, chemistry, computers, electricity, acoustics, environment, mechanics, and women. (SL)

  11. Government Quality Conference Proceedings

    NASA Technical Reports Server (NTRS)

    1992-01-01

    The Government Quality Conference was an attempt to bring together executive organizations and senior individuals in the Federal Government that have a desire to improve productivity. It was designed to provide an exchange of ideas based on experience, and to encourage individual management initiatives to tap the capabilities of Federal employees.

  12. Conducting Telephone Conference IEPs

    ERIC Educational Resources Information Center

    Patterson, Philip Patrick; Petit, Constance; Williams, Shandelyn

    2007-01-01

    Synchronizing the availability of team members for Individual Education Plan (IEP) meetings can be a daunting task. Fortunately, the Individuals with Disabilities Education Improvement Act of 2004 permits alternative means of conducting such meetings. An example of an alternate means is a telephone conference, whereby parents communicate over the…

  13. Conference Rules, Part 1

    ERIC Educational Resources Information Center

    Kerber, Linda K.

    2008-01-01

    Most academic conferences are preceded by some effort to make the sessions different from the usual format, but the usual format overwhelmingly prevails. That is: Each panel discussion runs no longer than two hours, during which two, three, or four specialists stand at a lectern and talk. Sometimes they will read a prepared paper; sometimes they…

  14. International waste management conference

    SciTech Connect

    Not Available

    1989-01-01

    This book contains the proceedings of the international waste management conference. Topics covered include: Quality assurance in the OCR WM program; Leading the spirit of quality; Dept. of Energy hazardous waste remedial actions program; management of hazardous waste projects; and System management and quality assurance.

  15. REGIONAL CONFERENCE SUMMARIES, 1966.

    ERIC Educational Resources Information Center

    Bureau of Adult, Vocational, and Technical Education (DHEW/OE), Washington, DC. Div. of Vocational and Technical Education.

    AN AVERAGE OF 200 TEACHER EDUCATORS, STATE DIRECTORS, LAYMEN, AND REPRESENTATIVES OF VARIOUS AGENCIES ATTENDED EACH OF NINE REGIONAL CONFERENCES CONDUCTED THROUGHOUT THE UNITED STATES TO DISCUSS THE INFLUENCE OF SOCIAL AND ECONOMIC CHANGES AND PROBLEMS IN PLANNING AND CONDUCTING VOCATIONAL AND TECHNICAL EDUCATION PROGRAMS. MAJOR SPEECHES PRESENTED…

  16. Grammar! A Conference Report.

    ERIC Educational Resources Information Center

    King, Lid, Ed.; Boaks, Peter, Ed.

    Papers from a conference on the teaching of grammar, particularly in second language instruction, include: "Grammar: Acquisition and Use" (Richard Johnstone); "Grammar and Communication" (Brian Page); "Linguistic Progression and Increasing Independence" (Bernardette Holmes); "La grammaire? C'est du bricolage!" ("Grammar? That's Hardware!") (Barry…

  17. Annual Conference Abstracts

    ERIC Educational Resources Information Center

    Journal of Engineering Education, 1972

    1972-01-01

    Includes abstracts of papers presented at the 80th Annual Conference of the American Society for Engineering Education. The broad areas include aerospace, affiliate and associate member council, agricultural engineering, biomedical engineering, continuing engineering studies, chemical engineering, civil engineering, computers, cooperative…

  18. Metabolic Engineering X Conference

    SciTech Connect

    Flach, Evan

    2015-05-07

    The International Metabolic Engineering Society (IMES) and the Society for Biological Engineering (SBE), both technological communities of the American Institute of Chemical Engineers (AIChE), hosted the Metabolic Engineering X Conference (ME-X) on June 15-19, 2014 at the Westin Bayshore in Vancouver, British Columbia. It attracted 395 metabolic engineers from academia, industry and government from around the globe.

  19. APPA 2011 Conference Highlights

    ERIC Educational Resources Information Center

    Facilities Manager, 2011

    2011-01-01

    This article presents highlights of APPA conference that was held on July 16-18, 2011. The highlights feature photos of 2011-2012 board of directors, outgoing senior regional representatives to the board, meritorious service award, APPA fellow, president's recognition and gavel exchange, and diamond business partner award.

  20. Creating Better Satellite Conferences.

    ERIC Educational Resources Information Center

    Horner, Tommy

    1998-01-01

    Presents four ways to improve broadcasts of company satellite conferences, including creative site selection (using facilities at educational institutions rather than hotel rooms); creative programming (using graphics and other interruptions to break up lectures or speeches); creative crew selection; and creative downlink site activities (to…

  1. Conference on Censorship.

    ERIC Educational Resources Information Center

    Meltzer, Milton; And Others

    In this collection of seven speeches from the University of Missouri Conference on Censorship, writers focus on the various aspects of censorship. Speeches are by (1) Milton Meltzer, who lauds those writers who were forced to battle with censors; (2) Enid Olson, who explores the censorship problems faced by teachers and school librarians; (3)…

  2. The interparliamentary conference

    SciTech Connect

    Not Available

    1990-01-01

    The purpose of this conference was to provide a forum for exchange of information on environmental problems with global origins and consequences. The areas of major concern included the following: global climate change; deforestation and desertification; preservation of biological diversity; safeguarding oceans and water resources; population growth; destruction of the stratospheric ozone layer; and sustainable development.

  3. Microbicides 2006 conference

    PubMed Central

    Ramjee, Gita; Shattock, Robin; Delany, Sinead; McGowan, Ian; Morar, Neetha; Gottemoeller, Megan

    2006-01-01

    Current HIV/AIDS statistics show that women account for almost 60% of HIV infections in Sub-Saharan Africa. HIV prevention tools such as male and female condoms, abstinence and monogamy are not always feasible options for women due to various socio-economic and cultural factors. Microbicides are products designed to be inserted in the vagina or rectum prior to sex to prevent HIV acquisition. The biannual Microbicides conference took place in Cape Town, South Africa from 23–26 April 2006. The conference was held for the first time on the African continent, the region worst affected by the HIV/AIDS pandemic. The conference brought together a record number of 1,300 scientists, researchers, policy makers, healthcare workers, communities and advocates. The conference provided an opportunity for an update on microbicide research and development as well as discussions around key issues such as ethics, acceptability, access and community involvement. This report discusses the current status of microbicide research and development, encompassing basic and clinical science, social and behavioural science, and community mobilisation and advocacy activities. PMID:17038196

  4. 2002 NASPSA Conference Abstracts.

    ERIC Educational Resources Information Center

    Journal of Sport & Exercise Psychology, 2002

    2002-01-01

    Contains abstracts from the 2002 conference of the North American Society for the Psychology of Sport and Physical Activity. The publication is divided into three sections: the preconference workshop, "Effective Teaching Methods in the Classroom;" symposia (motor development, motor learning and control, and sport psychology); and free…

  5. On the Conference Circuit.

    ERIC Educational Resources Information Center

    Tyckoson, David A.

    1987-01-01

    Summarizes three conference presentations on the effects of the economic climate on academic libraries in Iowa. These presentations focused on the impact of austerity budgets on collection development, library services and personnel, and possible management approaches to retrenchment in these areas. (CLB)

  6. Conference on Navajo Orthography.

    ERIC Educational Resources Information Center

    Ohannessian, Sirarpi; And Others

    This report on the Conference on Navajo Orthography, held in Albuquerque, New Mexico on May 2-3, 1969 constitutes a summary of the discussion and decisions of a meeting which was convened by the Center for Applied Linguistics under contract with the Bureau of Indian Affairs to agree on an orthography for the Navajo language. The immediate purpose…

  7. Report on the Conference.

    ERIC Educational Resources Information Center

    Brown, Ralph S.

    1983-01-01

    The themes of the 1982 annual conference of the American Association of University Professors are outlined. They include the importance of planning, selective versus across-the-board retrenchment strategies, definitions and problems of financial exigency, program reduction, and affirmative action claims. (MSE)

  8. Open Mind Conference

    NASA Technical Reports Server (NTRS)

    King, Alexander H.

    1995-01-01

    Open Mind, The Association for the achievement of diversity in higher education, met in conference in Albuquerque, New Mexico, between October 16 and 18, 1992. A number of workgroups met to discuss the goals, structure, and generally evaluate the Association and its achievements. A summary of the workgroup sessions and their minutes are included.

  9. A Conference of Hope.

    ERIC Educational Resources Information Center

    American Printing House for the Blind, Louisville, KY. Dept. of Educational Research.

    Presented are the proceedings of the First Historic Helen Keller World Conference on Services to Deaf-Blind Youths and Adults, held in New York City in September, 1977 on the theme "The Deaf-Blind Person in the Community." Reports have the following titles and authors: "Definition, Demography, Causes and Prevention of Deaf-Blindness; Finding and…

  10. IATUL Conference 1985.

    ERIC Educational Resources Information Center

    Information Services and Use, 1985

    1985-01-01

    Summarizes presentations at conference on theme "The future of information resources for science and technology and role of libraries": industrial and commercial use of national, regional, and university resources; balance between public- and private-sector resources; local access in national and regional context; access to information in…

  11. arsRBOCT Arsenic Resistance System Encoded by Linear Plasmid pHZ227 in Streptomyces sp. Strain FR-008

    PubMed Central

    Wang, Lianrong; Chen, Shi; Xiao, Xiang; Huang, Xi; You, Delin; Zhou, Xiufen; Deng, Zixin

    2006-01-01

    In the arsenic resistance gene cluster from the large linear plasmid pHZ227, two novel genes, arsO (for a putative flavin-binding monooxygenase) and arsT (for a putative thioredoxin reductase), were coactivated and cotranscribed with arsR1-arsB and arsC, respectively. Deletion of the ars gene cluster on pHZ227 in Streptomyces sp. strain FR-008 resulted in sensitivity to arsenic, and heterologous expression of the ars gene cluster in the arsenic-sensitive Streptomyces strains conferred resistance on the new hosts. The pHZ227 ArsB protein showed homology to the yeast arsenite transporter Acr3p. The pHZ227 ArsC appears to be a bacterial thioredoxin-dependent ArsC-type arsenate reductase with four conserved cysteine thioredoxin-requiring motifs. PMID:16672525

  12. Expansion of a plasmid classification system for Gram-positive bacteria and determination of the diversity of plasmids in Staphylococcus aureus strains of human, animal, and food origins.

    PubMed

    Lozano, Carmen; García-Migura, Lourdes; Aspiroz, Carmen; Zarazaga, Myriam; Torres, Carmen; Aarestrup, Frank Møller

    2012-08-01

    An expansion of a previously described plasmid classification was performed and used to reveal the plasmid content of a collection of 92 Staphylococcus aureus strains of different origins. rep genes of other genera were detected in Staphylococcus. S1 pulsed-field gel electrophoresis (PFGE) hybridizations were performed with 18 representative S. aureus strains, and a high number of plasmids of different sizes and organizations were detected.

  13. ALA Conference 2009: Chicago Hope

    ERIC Educational Resources Information Center

    Berry, John N., III

    2009-01-01

    There is joy among those who have the funds to go to Chicago for the American Library Association (ALA) annual conference, July 9-15. Every librarian knows there is nothing better than a Chicago gathering, with the city's wonderful haunts, museums, restaurants, and fine memories of past conferences. The conference program covers nearly every…

  14. Summary: A Very Timely Conference

    NASA Astrophysics Data System (ADS)

    Wyse, Rosemary F. G.

    2012-04-01

    The conference poster includes a very apt phrase that describes a primary motivation for this conference: Time discovers truth. This aphorism, attributed to Seneca, was certainly affirmed by the many exciting talks and discussions at this conference, in both formal and informal settings.

  15. The stb Operon Balances the Requirements for Vegetative Stability and Conjugative Transfer of Plasmid R388

    PubMed Central

    Guynet, Catherine; Cuevas, Ana; Moncalián, Gabriel; de la Cruz, Fernando

    2011-01-01

    The conjugative plasmid R388 and a number of other plasmids carry an operon, stbABC, adjacent to the origin of conjugative transfer. We investigated the role of the stbA, stbB, and stbC genes. Deletion of stbA affected both conjugation and stability. It led to a 50-fold increase in R388 transfer frequency, as well as to high plasmid loss. In contrast, deletion of stbB abolished conjugation but provoked no change in plasmid stability. Deletion of stbC showed no effect, neither in conjugation nor in stability. Deletion of the entire stb operon had no effect on conjugation, which remained as in the wild-type plasmid, but led to a plasmid loss phenotype similar to that of the R388ΔstbA mutant. We concluded that StbA is required for plasmid stability and that StbA and StbB control conjugation. We next observed the intracellular positioning of R388 DNA molecules and showed that they localize as discrete foci evenly distributed in live Escherichia coli cells. Plasmid instability of the R388ΔΔstbA mutant correlated with aberrant localization of the plasmid DNA molecules as clusters, either at one cell pole, at both poles, or at the cell center. In contrast, plasmid molecules in the R388ΔΔstbB mutant were mostly excluded from the cell poles. Thus, results indicate that defects in both plasmid maintenance and transfer are a consequence of variations in the intracellular positioning of plasmid DNA. We propose that StbA and StbB constitute an atypical plasmid stabilization system that reconciles two modes of plasmid R388 physiology: a maintenance mode (replication and segregation) and a propagation mode (conjugation). The consequences of this novel concept in plasmid physiology will be discussed. PMID:21625564

  16. Plasmid-Chromosome Recombination of Irradiated Shuttle Vector DNA in African Green Monkey Kidney Cells.

    NASA Astrophysics Data System (ADS)

    Mudgett, John Stuart

    1987-09-01

    An autonomously replicating shuttle vector was used to investigate the enhancement of plasmid-chromosome recombination in mammalian host cells by ultraviolet light and gamma radiation. Sequences homologous to the shuttle vector were stably inserted into the genome of African Green Monkey kidney cells to act as the target substrate for these recombination events. The SV40- and pBR322-derived plasmid DNA was irradiated with various doses of radiation before transfection into the transformed mammalian host cells. The successful homologous transfer of the bacterial ampicillin resistance (amp^{rm r}) gene from the inserted sequences to replace a mutant amp^->=ne on the shuttle vector was identified by plasmid extraction and transformation into E. coli host cells. Ultraviolet light (UV) was found not to induce homologous plasmid-chromosome recombination, while gamma radiation increased the frequency of recombinant plasmids detected. The introduction of specific double -strand breaks in the plasmid or prolonging the time of plasmid residence in the mammalian host cells also enhanced plasmid-chromosome recombination. In contrast, plasmid mutagenesis was found to be increased by plasmid UV irradiation, but not to change with time. Plasmid survival, recombination, and mutagenesis were not affected by treating the mammalian host cells with UV light prior to plasmid transfection. The amp^{rm r} recombinant plasmid molecules analyzed were found to be mostly the result of nonconservative exchanges which appeared to involve both homologous and possibly nonhomologous interactions with the host chromosome. The observation that these recombinant structures were obtained from all of the plasmid alterations investigated suggests a common mechanistic origin for plasmid -chromosome recombination in these mammalian cells.

  17. Parallel compensatory evolution stabilizes plasmids across the parasitism-mutualism continuum.

    PubMed

    Harrison, Ellie; Guymer, David; Spiers, Andrew J; Paterson, Steve; Brockhurst, Michael A

    2015-08-01

    Plasmids drive genomic diversity in bacteria via horizontal gene transfer [1, 2]; nevertheless, explaining their survival in bacterial populations is challenging [3]. Theory predicts that irrespective of their net fitness effects, plasmids should be lost: when parasitic (costs outweigh benefits), plasmids should decline due to purifying selection [4-6], yet under mutualism (benefits outweigh costs), selection favors the capture of beneficial accessory genes by the chromosome and loss of the costly plasmid backbone [4]. While compensatory evolution can enhance plasmid stability within populations [7-15], the propensity for this to occur across the parasitism-mutualism continuum is unknown. We experimentally evolved Pseudomonas fluorescens and its mercury resistance mega-plasmid, pQBR103 [16], across an environment-mediated parasitism-mutualism continuum. Compensatory evolution stabilized plasmids by rapidly ameliorating the cost of plasmid carriage in all environments. Genomic analysis revealed that, in both parasitic and mutualistic treatments, evolution repeatedly targeted the gacA/gacS bacterial two-component global regulatory system while leaving the plasmid sequence intact. Deletion of either gacA or gacS was sufficient to completely ameliorate the cost of plasmid carriage. Mutation of gacA/gacS downregulated the expression of ∼17% of chromosomal and plasmid genes and appears to have relieved the translational demand imposed by the plasmid. Chromosomal capture of mercury resistance accompanied by plasmid loss occurred throughout the experiment but very rarely invaded to high frequency, suggesting that rapid compensatory evolution can limit this process. Compensatory evolution can explain the widespread occurrence of plasmids and allows bacteria to retain horizontally acquired plasmids even in environments where their accessory genes are not immediately useful.

  18. Complete sequence of three plasmids from Bacillus thuringiensis INTA-FR7-4 environmental isolate and comparison with related plasmids from the Bacillus cereus group.

    PubMed

    Amadio, Ariel F; Benintende, Graciela B; Zandomeni, Rubén O

    2009-11-01

    Bacillus thuringiensis is an insect pathogen used worldwide as a bioinsecticide. It belongs to the Bacillus cereus sensu lato group as well as Bacillus anthracis and B. cereus. Plasmids from this group of organisms have been implicated in pathogenicity as they carry the genes responsible for different types of diseases that affect mammals and insects. Some plasmids, like pAW63 and pBT9727, encode a functional conjugation machinery allowing them to be transferred to a recipient cell. They also share extensive homology with the non-functional conjugation apparatus of pXO2 from B. anthracis. In this study we report the complete sequence of three plasmids from an environmental B. thuringiensis isolate from Argentina, obtained by a shotgun sequencing method. We obtained the complete nucleotide sequence of plasmids pFR12 (12,095bp), pFR12.5 (12,459bp) and pFR55 (55,712bp) from B. thuringiensis INTA-FR7-4. pFR12 and pFR12.5 were classified as cryptic as they do not code for any obvious functions besides replication and mobilization. Both small plasmids were classified as RCR plasmids due to similarities with the replicases they encode. Plasmid pFR55 showed a structural organization similar to that observed for plasmids pAW63, pBT9727 and pXO2. pFR55 also shares a tra region with these plasmids, containing genes related to T4SS and conjugation. A comparison between pFR55 and conjugative plasmids led to the postulation that pFR55 is a conjugative plasmid. Genes related to replication functions in pFR55 are different to those described for plasmids with known complete sequences. pFR55 is the first completely sequenced plasmid with a replication machinery related to that of ori44. The analysis of the complete sequence of plasmids from an environmental isolate of B. thuringiensis permitted the identification of a near complete conjugation apparatus in pFR55, resembling those of plasmids pAW63, pBT9727 and pXO2. The availability of this sequence is a step forward in the study

  19. Incidence of Plasmids in Marine Vibrio spp. Isolated from an Oil Field in the Northwestern Gulf of Mexico

    PubMed Central

    Hada, Howard S.; Sizemore, Ronald K.

    1981-01-01

    Presumptive marine Vibrio spp. were collected from an operational oil field and control site located in the northwestern Gulf of Mexico. Of 440 isolates analyzed for the presence of extrachromosomal deoxyribonucleic acid elements or plasmids by using the cleared lysate and agarose gel techniques, 31% showed distinct plasmid bands on agarose gels. A majority of the plasmids detected were estimated to have molecular masses of 10 × 106 or less. Multiple plasmids were observed in approximately half of the plasmid-containing strains. A number of isolates contained plasmids with similar banding and mobility patterns. The oil field area had noticeably more plasmid-containing strains (35 versus 23% in the control site) and a greater number of plasmids per plasmid-containing strain (an average of 2.5 plasmids, versus 1.5 in the control site). Oil field discharges might have resulted in increased plasmid incidence and diversity. Images PMID:16345685

  20. A novel reference plasmid for the qualitative detection of genetically modified rice in food and feed.

    PubMed

    Li, Liang; Dong, Mei; An, Na; Liang, Lixia; Wan, Yusong; Jin, Wujun

    2015-01-01

    Rice is one of the most important food crops in the world. Genetically modified (GM) technology has been used in rice to confer herbicide tolerance and pathogen or insect resistance. China invests heavily in research on GM rice. By the end of 2014, at least 250 transgenic rice lines had been developed in China. To monitor the presence of GM rice in food and feed, we collected information on foreign elements from 250 transgenic rice lines and found 5 elements, including the Agrobacterium tumefaciens nopaline synthase terminator (T-NOS), the cauliflower mosaic virus 35S promoter (CaMV35S), the ubiquitin gene (Ubi), the bar gene, and the hygromycin phosphotransferase gene (Hpt), that are commonly present in GM rice. Therefore, we constructed a novel plasmid (pBJGMM001) that contains fragments of these elements and two endogenous reference genes (the sucrose phosphate synthase gene, SPS, and the phosphoenolpyruvate carboxylase gene, PEPC). pBJGMM001 can serve as a standard for detecting 96% of GM rice lines in China. The primers, amplicons, reaction mixture, and PCR program were developed based on Chinese National Standards. The protocol was validated and determined to be suitable for practical use in monitoring and identifying GM rice. PMID:26495318

  1. A novel reference plasmid for the qualitative detection of genetically modified rice in food and feed.

    PubMed

    Li, Liang; Dong, Mei; An, Na; Liang, Lixia; Wan, Yusong; Jin, Wujun

    2015-01-01

    Rice is one of the most important food crops in the world. Genetically modified (GM) technology has been used in rice to confer herbicide tolerance and pathogen or insect resistance. China invests heavily in research on GM rice. By the end of 2014, at least 250 transgenic rice lines had been developed in China. To monitor the presence of GM rice in food and feed, we collected information on foreign elements from 250 transgenic rice lines and found 5 elements, including the Agrobacterium tumefaciens nopaline synthase terminator (T-NOS), the cauliflower mosaic virus 35S promoter (CaMV35S), the ubiquitin gene (Ubi), the bar gene, and the hygromycin phosphotransferase gene (Hpt), that are commonly present in GM rice. Therefore, we constructed a novel plasmid (pBJGMM001) that contains fragments of these elements and two endogenous reference genes (the sucrose phosphate synthase gene, SPS, and the phosphoenolpyruvate carboxylase gene, PEPC). pBJGMM001 can serve as a standard for detecting 96% of GM rice lines in China. The primers, amplicons, reaction mixture, and PCR program were developed based on Chinese National Standards. The protocol was validated and determined to be suitable for practical use in monitoring and identifying GM rice.

  2. A Novel Reference Plasmid for the Qualitative Detection of Genetically Modified Rice in Food and Feed

    PubMed Central

    Li, Liang; Dong, Mei; An, Na; Liang, Lixia; Wan, Yusong; Jin, Wujun

    2015-01-01

    Rice is one of the most important food crops in the world. Genetically modified (GM) technology has been used in rice to confer herbicide tolerance and pathogen or insect resistance. China invests heavily in research on GM rice. By the end of 2014, at least 250 transgenic rice lines had been developed in China. To monitor the presence of GM rice in food and feed, we collected information on foreign elements from 250 transgenic rice lines and found 5 elements, including the Agrobacterium tumefaciens nopaline synthase terminator (T-NOS), the cauliflower mosaic virus 35S promoter (CaMV35S), the ubiquitin gene (Ubi), the bar gene, and the hygromycin phosphotransferase gene (Hpt), that are commonly present in GM rice. Therefore, we constructed a novel plasmid (pBJGMM001) that contains fragments of these elements and two endogenous reference genes (the sucrose phosphate synthase gene, SPS, and the phosphoenolpyruvate carboxylase gene, PEPC). pBJGMM001 can serve as a standard for detecting 96% of GM rice lines in China. The primers, amplicons, reaction mixture, and PCR program were developed based on Chinese National Standards. The protocol was validated and determined to be suitable for practical use in monitoring and identifying GM rice. PMID:26495318

  3. Plasmid-Controlled Variation in the Content of Methylated Bases in Bacteriophage Lambda Deoxyribonucleic Acid

    PubMed Central

    Hattman, Stanley

    1972-01-01

    The N6-methyladenine (MeAde) and 5-methylcytosine (MeC) contents in deoxyribonucleic acid (DNA) of bacteriophage lambda has been analyzed as a function of host specificity. The following facts have emerged: (i) lambda grown on strains harboring the P1 prophage contain ca. 70 more MeAde residues/DNA molecule than lambda grown either in the P1-sensitive parent, or in a P1 immune-defective lysogen which does not confer P1 modification; (ii) lambda grown on strains harboring the N-3 drug-resistance factor contain ca. 60 more MeC residues/DNA molecule than lambda grown on the parental strain lacking the factor; (iii) lambda grown in Escherichia coli B strains is devoid of MeC, whereas lambda grown in a B (N-3) host contains a high level of MeC; (iv) the MeAde content in lambda DNA is not affected by the N-3 factor. These results suggest that P1 controls an adenine-specific DNA methylase, and that the N-3 plasmid controls a cytosine-specific DNA methylase. The N-3 factor has been observed previously to direct cytosine-specific methylation of phage P22 DNA and E. coli B DNA in vivo; in vitro studies presented here demonstrate this activity. PMID:4561202

  4. [Plasmids of streptomycetes strains isolated from soils of Ukraine with different anthropogenic loading].

    PubMed

    Luk'ianchuk, V V; Polishchuk, L V; Matseliukh, B P

    2010-01-01

    Screening of plasmid DNA was carried out among 94 streptomycetes cultures which were isolated from the samples of Ukrainian soils with different anthropogenic contamination. Seventeen streptomycetes strains containing plasmid DNA were found. It is established that some cultures contain more than one plasmid (Streptomyces sp.M15, S.sp.T8, S.sp.T19). Depending on a molecular sizes the found plasmids were divided in 2 groups: 3 kb-15 kb, and 30 kb-70 kb. Research of a few morphological and physiological properties of plasmid strains of streptomycetes was carried out. The paper is presented in Ukrainian. PMID:21117293

  5. Hybridization studies with a DNA probe derived from the virulence region of the 60 Mdal plasmid of Salmonella typhimurium.

    PubMed Central

    Poppe, C; Curtiss, R; Gulig, P A; Gyles, C L

    1989-01-01

    Plasmid DNA of 68 strains of Salmonella that belonged to 18 serovars and exhibited 48 different plasmid profiles was examined for hybridization with a 32P-labelled DNA probe which consisted of a 3750 base pairs (bp) HindIII-HindIII fragment derived from the virulence region of the 60 megadalton (Mdal) plasmid of Salmonella typhimurium. The 32 Mdal plasmid of S. cholerae-suis, the 50 Mdal plasmid of S. dublin, the 36 Mdal plasmid of S. enteritidis, the 60 Mdal plasmid of S. gallinarum, the 60 Mdal plasmid of S. pullorum, and the 60 Mdal plasmid of S. typhimurium, plasmids that have been associated with virulence, all hybridized with the probe. Digestion of plasmid DNA of these strains with PvuII and hybridization with the probe revealed that the plasmids of strains of all six serovars contained fragments of approximately 2520 and 1520 bp that hybridized with the probe. Similarly, hybridization with BglI digests of DNA of the virulence-associated plasmids of strains of these six serovars showed that all six plasmids contained a fragment of approximately 3690 bp that hybridized with the probe. No other plasmids of these strains nor any plasmids of 12 other Salmonella serovars hybridized with the probe. Chromosomal DNA did not hybridize with the probe. The 60 Mdal plasmids of S. gallinarum and S. pullorum showed similar digestion patterns with restriction endonucleases BglI, BglII and PvuII. Images Fig. 2. Fig. 3. Fig. 4. PMID:2686827

  6. Tn5406, a New Staphylococcal Transposon Conferring Resistance to Streptogramin A and Related Compounds Including Dalfopristin

    PubMed Central

    Haroche, Julien; Allignet, Jeanine; El Solh, Névine

    2002-01-01

    We characterized a new transposon, Tn5406 (5,467 bp), in a clinical isolate of Staphylococcus aureus (BM3327). It carries a variant of vgaA, which encodes a putative ABC protein conferring resistance to streptogramin A but not to mixtures of streptogramins A and B. It also carries three putative genes, the products of which exhibit significant similarities (61 to 73% amino acid identity) to the three transposases of the staphylococcal transposon Tn554. Like Tn554, Tn5406 failed to generate target repeats. In BM3327, the single copy of Tn5406 was inserted into the chromosomal att554 site, which is the preferential insertion site of Tn554. In three other independent S. aureus clinical isolates, Tn5406 was either present as a single plasmid copy (BM3318), as two chromosomal copies (BM3252), or both in the chromosome and on a plasmid (BM3385). The Tn5406-carrying plasmids also contain two other genes, vgaB and vatB. The insertion sites of Tn5406 in BM3252 were studied: one copy was in att554, and one copy was in the additional SCCmec element. Amplification experiments revealed circular forms of Tn5406, indicating that this transposon might be active. To our knowledge, a transposon conferring resistance to streptogramin A and related compounds has not been previously described. PMID:12121902

  7. Plasmid DNA damage induced by helium atmospheric pressure plasma jet

    NASA Astrophysics Data System (ADS)

    Han, Xu; Cantrell, William A.; Escobar, Erika E.; Ptasinska, Sylwia

    2014-03-01

    A helium atmospheric pressure plasma jet (APPJ) is applied to induce damage to aqueous plasmid DNA. The resulting fractions of the DNA conformers, which indicate intact molecules or DNA with single- or double-strand breaks, are determined using agarose gel electrophoresis. The DNA strand breaks increase with a decrease in the distance between the APPJ and DNA samples under two working conditions of the plasma source with different parameters of applied electric pulses. The damage level induced in the plasmid DNA is also enhanced with increased plasma irradiation time. The reactive species generated in the APPJ are characterized by optical emission spectra, and their roles in possible DNA damage processes occurring in an aqueous environment are also discussed.

  8. Rapid Construction of Recombinant Plasmids by QuickStep-Cloning.

    PubMed

    Jajesniak, Pawel; Wong, Tuck Seng

    2017-01-01

    QuickStep-Cloning is a novel molecular cloning technique that builds upon the concepts of asymmetric PCR and megaprimer-based amplification of whole plasmid. It was designed specifically to address the major drawbacks of previously reported cloning methods. The fully optimized protocol allows for a seamless integration of a long DNA fragment into any position within a plasmid of choice, in a time-efficient and cost-effective manner, without the need of a tedious DNA gel purification, a restriction digestion, and an enzymatic ligation. QuickStep-Cloning can be completed in less than 6 h, significantly faster than most of the existing cloning methods, while retaining high efficiency. PMID:27671943

  9. Replisome Assembly at Bacterial Chromosomes and Iteron Plasmids

    PubMed Central

    Wegrzyn, Katarzyna E.; Gross, Marta; Uciechowska, Urszula; Konieczny, Igor

    2016-01-01

    The proper initiation and occurrence of DNA synthesis depends on the formation and rearrangements of nucleoprotein complexes within the origin of DNA replication. In this review article, we present the current knowledge on the molecular mechanism of replication complex assembly at the origin of bacterial chromosome and plasmid replicon containing direct repeats (iterons) within the origin sequence. We describe recent findings on chromosomal and plasmid replication initiators, DnaA and Rep proteins, respectively, and their sequence-specific interactions with double- and single-stranded DNA. Also, we discuss the current understanding of the activities of DnaA and Rep proteins required for replisome assembly that is fundamental to the duplication and stability of genetic information in bacterial cells. PMID:27563644

  10. Current trends in separation of plasmid DNA vaccines: a review.

    PubMed

    Ghanem, Ashraf; Healey, Robert; Adly, Frady G

    2013-01-14

    Plasmid DNA (pDNA)-based vaccines offer more rapid avenues for development and production if compared to those of conventional virus-based vaccines. They do not rely on time- or labour-intensive cell culture processes and allow greater flexibility in shipping and storage. Stimulating antibodies and cell-mediated components of the immune system are considered as some of the major advantages associated with the use of pDNA vaccines. This review summarizes the current trends in the purification of pDNA vaccines for practical and analytical applications. Special attention is paid to chromatographic techniques aimed at reducing the steps of final purification, post primary isolation and intermediate recovery, in order to reduce the number of steps necessary to reach a purified end product from the crude plasmid.

  11. The Standard European Vector Architecture (SEVA) plasmid toolkit.

    PubMed

    Durante-Rodríguez, Gonzalo; de Lorenzo, Víctor; Martínez-García, Esteban

    2014-01-01

    The Standard European Vector Architecture (SEVA) toolkit is a simple and powerful resource for constructing optimal plasmid vectors based on a backbone and three interchangeable modules flanked by uncommon restriction sites. Functional modules encode several origins of replication, diverse antibiotic selection markers, and a variety of cargoes with different applications. The backbone and DNA modules have been minimized and edited for flaws in their sequence and/or functionality. A protocol for the utilization of the SEVA platform to construct transcriptional and translational fusions between a promoter under study (the arsenic-responsive Pars of Pseudomonas putida KT2440) and the reporter lacZ gene is described. The resulting plasmid collection was instrumental to measure and compare the β-galactosidase activity that report gene expression (i.e., transcription and translation) in different genetic backgrounds.

  12. Liquid-Crystalline Mesophases of Plasmid DNA in Bacteria

    NASA Astrophysics Data System (ADS)

    Reich, Ziv; Wachtel, Ellen J.; Minsky, Abraham

    1994-06-01

    Bacterial plasmids may often reach a copy number larger than 1000 per cell, corresponding to a total amount of DNA that may exceed the amount of DNA within the bacterial chromosome. This observation highlights the problem of cellular accommodation of large amounts of closed-circular nucleic acids, whose interwound conformation offers negligible DNA compaction. As determined by x-ray scattering experiments conducted on intact bacteria, supercoiled plasmids segregate within the cells into dense clusters characterized by a long-range order. In vitro studies performed at physiological DNA concentrations indicated that interwound DNA spontaneously forms liquid crystalline phases whose macroscopic structural properties are determined by the features of the molecular supercoiling. Because these features respond to cellular factors, DNA supercoiling may provide a sensitive regulatory link between cellular parameters and the packaging modes of interwound DNA in vivo.

  13. Plasmids and packaging cell lines for use in phage display

    DOEpatents

    Bradbury, Andrew M.

    2012-07-24

    The invention relates to a novel phagemid display system for packaging phagemid DNA into phagemid particles which completely avoids the use of helper phage. The system of the invention incorporates the use of bacterial packaging cell lines which have been transformed with helper plasmids containing all required phage proteins but not the packaging signals. The absence of packaging signals in these helper plasmids prevents their DNA from being packaged in the bacterial cell, which provides a number of significant advantages over the use of both standard and modified helper phage. Packaged phagemids expressing a protein or peptide of interest, in fusion with a phage coat protein such as g3p, are generated simply by transfecting phagemid into the packaging cell line.

  14. Spheroplast formation and plasmid isolation from Rhodococcus spp.

    PubMed

    Assaf, N A; Dick, W A

    1993-12-01

    The genus Rhodococcus comprises aerobic gram-positive actinomycetes that show considerable morphological and metabolic diversity and are known to be involved in the development of plant diseases and degradation of environmental pollutants. We describe a method for cell lysis and large plasmid DNA isolation from Rhodococcus by creating lysozyme susceptible cells by predigestion with the enzyme mutanolysin. Mutanolysin action resulted in the liberation of reducing sugars and free amino acids from the peptidoglycan layers of the cell wall. A 1-h predigestion with mutanolysin followed by a 0.5-h incubation with lysozyme resulted in spheroplast formation. Complete lysis of cells and efficient isolation of intact large plasmid DNA (108 kb) from wild-type Rhodococcus strains was confirmed.

  15. Cationic lipids delay the transfer of plasmid DNA to lysosomes.

    PubMed

    Wattiaux, R; Jadot, M; Laurent, N; Dubois, F; Wattiaux-De Coninck, S

    1996-10-14

    Plasmid 35S DNA, naked or associated with different cationic lipid preparations was injected to rats. Subcellular distribution of radioactivity in the liver one hour after injection, was established by centrifugation methods. Results show that at that time, 35S DNA has reached lysosomes. On the contrary, when 35S DNA was complexed with lipids, radioactivity remains located in organelles whose distribution after differential and isopycnic centrifugation, is clearly distinct from that of arylsulfatase, lysosome marker enzyme. Injection of Triton WR 1339, a specific density perturbant of lysosomes, four days before 35S DNA injection causes a density decrease of radioactivity bearing structures, apparent one hour after naked 35S DNA injection but visible only after more than five hours, when 35S DNA associated with a cationic lipid is injected. These observations show that cationic lipids delay the transfer to lysosomes, of plasmid DNA taken up by the liver.

  16. Quantification of plasmid DNA copies in the nucleus after lipoplex and polyplex transfection.

    PubMed

    Cohen, Richard N; van der Aa, Marieke A E M; Macaraeg, Nichole; Lee, Ai Ping; Szoka, Francis C

    2009-04-17

    Nuclear uptake of plasmid DNA is one of the many cellular barriers that limit the efficiency of non-viral gene delivery systems. We have determined the number of plasmids that reach the nucleus of a transfected cell using an internally standardized quantitative PCR (qPCR) assay. We isolated nuclei using two different protocols: a density gradient technique and a detergent-based method. The density gradient procedure yielded nuclei with substantially less adhering plasmids on the outside of the nuclei. Using the density gradient protocol we determined that cells transfected with Lipofectamine lipoplexes or polyethylenimine polyplexes contained between 75 and 50,000 plasmids/nucleus, depending on the applied plasmid dose. Any increase above 3000 plasmids/nucleus resulted in only marginal increases in transgene expression. Furthermore, lipoplex-delivered plasmids were more efficiently expressed, on the basis of protein expression per plasmid number in the nucleus, than polyplex-delivered plasmids. This indicates that polymer may remain bound to some plasmids in the nucleus. Lastly, by sorting transfected cells into high- and low-expressing sub-populations, we observe that a sub-population of cells contain 3x greater plasmids/nucleus but express nearly 100x more transgene than other cells within a single transfection reaction. Taken together these results suggest the importance of considering the processes downstream from nuclear entry for strategies to improve the efficiency of gene transfer reagents.

  17. Investigating the impact of bisphosphonates and structurally related compounds on bacteria containing conjugative plasmids.

    PubMed

    Nash, Rebekah P; McNamara, Dan E; Ballentine, W Keith; Matson, Steven W; Redinbo, Matthew R

    2012-08-10

    Bacterial plasmids propagate through microbial populations via the directed process of conjugative plasmid transfer (CPT). Because conjugative plasmids often encode antibiotic resistance genes and virulence factors, several approaches to inhibit CPT have been described. Bisphosphonates and structurally related compounds (BSRCs) were previously reported to disrupt conjugative transfer of the F (fertility) plasmid in Escherichia coli. We have further investigated the effect of these compounds on the transfer of two additional conjugative plasmids, pCU1 and R100, between E. coli cells. The impact of BSRCs on E. coli survival and plasmid transfer was found to be dependent on the plasmid type, the length of time the E. coli were exposed to the compounds, and the ratio of plasmid donor to plasmid recipient cells. Therefore, these data indicate that BSRCs produce a range of effects on the conjugative transfer of bacterial plasmids in E. coli. Since their impact appears to be plasmid type-dependent, BSRCs are unlikely to be applicable as broad inhibitors of antibiotic resistance propagation.

  18. Presence and analysis of plasmids in human and animal associated arcobacter species.

    PubMed

    Douidah, Laid; De Zutter, Lieven; Van Nieuwerburgh, Filip; Deforce, Dieter; Ingmer, Hanne; Vandenberg, Olivier; Van den Abeele, Anne-Marie; Houf, Kurt

    2014-01-01

    In this study, we report the screening of four Arcobacter species for the presence of small and large plasmids. Plasmids were present in 9.9% of the 273 examined strains. One Arcobacter cryaerophilus and four Arcobacter butzleri plasmids were selected for further sequencing. The size of three small plasmids isolated from A. butzleri and the one from A. cryaerophilus strains ranged between 4.8 and 5.1 kb, and the size of the large plasmid, isolated from A. butzleri, was 27.4 kbp. The G+C content of all plasmids ranged between 25.4% and 26.2%. A total of 95% of the large plasmid sequence represents coding information, which contrasts to the 20 to 30% for the small plasmids. Some of the open reading frames showed a high homology to putative conserved domains found in other related organisms, such as replication, mobilization and genes involved in type IV secretion system. The large plasmid carried 35 coding sequences, including seven genes in a contiguous region of 11.6 kbp that encodes an orthologous type IV secretion system found in the Wolinella succinogenes genome, Helicobacter pylori and Campylobacter jejuni plasmids, which makes this plasmid interesting for further exploration.

  19. Characterization of two novel plasmids from Geobacillus sp. 610 and 1121 strains.

    PubMed

    Kananavičiūtė, Rūta; Butaitė, Elena; Citavičius, Donaldas

    2014-01-01

    We describe two cryptic low molecular weight plasmids, pGTD7 (3279bp) and pGTG5 (1540bp), isolated from Geobacillus sp. 610 and 1121 strains, respectively. Homology analysis of the replication protein (Rep) sequences and detection of ssDNA indicate that both of them replicate via rolling circle mechanism. As revealed by sequence similarities of dso region and Rep protein, plasmid pGTD7 belongs to pC194/pUB110 plasmid family. The replicon of pGTD7 was proved to be functional in another Geobacillus host. For this purpose, a construct pUCK7, containing a replicon of the analyzed plasmid, was created and transferred to G. stearothermophilus NUB3621R strain by electroporation. Plasmid pGTG5, based on Rep protein sequence similarity, was found to be related mostly to some poorly characterized bacterial plasmids. Rep proteins encoded by these plasmids contain conservative motifs that are most similar to those of Microviridae phages. This feature suggests that pGTG5, together with other plasmids containing the same motifs, could constitute a new family of bacterial plasmids. To date, pGTG5 is the smallest plasmid identified in bacteria belonging to the genus Geobacillus. The two plasmids described in this study can be used for the construction of new vectors suitable for biotechnologically important bacteria of the genus Geobacillus.

  20. Dynamics of the IncW genetic backbone imply general trends in conjugative plasmid evolution.

    PubMed

    Fernández-López, Raúl; Garcillán-Barcia, M Pilar; Revilla, Carlos; Lázaro, Miguel; Vielva, Luis; de la Cruz, Fernando

    2006-11-01

    Plasmids cannot be understood as mere tools for genetic exchange: they are themselves subject to the forces of evolution. Their genomic and phylogenetic features have been less studied in this respect. Focusing on the IncW incompatibility group, which includes the smallest known conjugative plasmids, we attempt to unveil some common trends in plasmid evolution. The functional modules of IncW genetic backbone are described, with emphasis on their architecture and relationships to other plasmid groups. Some plasmid regions exhibit strong phylogenetic mosaicism, in striking contrast to others of unusual synteny conservation. The presence of genes of unknown function that are widely distributed in plasmid genomes is also emphasized, exposing the existence of ill-defined yet conserved plasmid functions. Conjugation is an essential hallmark of IncW plasmid biology and special attention is given to the organization and evolution of its transfer modules. Genetic exchange between plasmids and their hosts is analysed by following the evolution of the type IV secretion system. Adaptation of the trw conjugative machinery to pathogenicity functions in Bartonella is discussed as an example of how plasmids can change their host modus vivendi. Starting from the phage paradigm, our analysis articulates novel concepts that apply to plasmid evolution.