PSI:Biology-Materials Repository: A Biologist’s Resource for Protein Expression Plasmids
Cormier, Catherine Y.; Park, Jin G.; Fiacco, Michael; Steel, Jason; Hunter, Preston; Kramer, Jason; Singla, Rajeev; LaBaer, Joshua
2011-01-01
The Protein Structure Initiative:Biology-Materials Repository (PSI:Biology-MR; MR; http://psimr.asu.edu) sequence-verifies, annotates, stores, and distributes the protein expression plasmids and vectors created by the Protein Structure Initiative (PSI). The MR has developed an informatics and sample processing pipeline that manages this process for thousands of samples per month from nearly a dozen PSI centers. DNASU (http://dnasu.asu.edu), a freely searchable database, stores the plasmid annotations, which include the full-length sequence, vector information, and associated publications for over 130,000 plasmids created by our laboratory, by the PSI and other consortia, and by individual laboratories for distribution to researchers worldwide. Each plasmid links to external resources, including the PSI Structural Biology Knowledgebase (http://sbkb.org), which facilitates cross-referencing of a particular plasmid to additional protein annotations and experimental data. To expedite and simplify plasmid requests, the MR uses an expedited material transfer agreement (EP-MTA) network, where researchers from network institutions can order and receive PSI plasmids without institutional delays. Currently over 39,000 protein expression plasmids and 78 empty vectors from the PSI are available upon request from DNASU. Overall, the MR’s repository of expression-ready plasmids, its automated pipeline, and the rapid process for receiving and distributing these plasmids more effectively allows the research community to dissect the biological function of proteins whose structures have been studied by the PSI. PMID:21360289
Cormier, Catherine Y.; Mohr, Stephanie E.; Zuo, Dongmei; Hu, Yanhui; Rolfs, Andreas; Kramer, Jason; Taycher, Elena; Kelley, Fontina; Fiacco, Michael; Turnbull, Greggory; LaBaer, Joshua
2010-01-01
The Protein Structure Initiative Material Repository (PSI-MR; http://psimr.asu.edu) provides centralized storage and distribution for the protein expression plasmids created by PSI researchers. These plasmids are a resource that allows the research community to dissect the biological function of proteins whose structures have been identified by the PSI. The plasmid annotation, which includes the full length sequence, vector information and associated publications, is stored in a freely available, searchable database called DNASU (http://dnasu.asu.edu). Each PSI plasmid is also linked to a variety of additional resources, which facilitates cross-referencing of a particular plasmid to protein annotations and experimental data. Plasmid samples can be requested directly through the website. We have also developed a novel strategy to avoid the most common concern encountered when distributing plasmids namely, the complexity of material transfer agreement (MTA) processing and the resulting delays this causes. The Expedited Process MTA, in which we created a network of institutions that agree to the terms of transfer in advance of a material request, eliminates these delays. Our hope is that by creating a repository of expression-ready plasmids and expediting the process for receiving these plasmids, we will help accelerate the accessibility and pace of scientific discovery. PMID:19906724
Modulation of ColE1-like Plasmid Replication for Recombinant Gene Expression
Camps, Manel
2010-01-01
ColE1-like plasmids constitute the most popular vectors for recombinant protein expression. ColE1 plasmid replication is tightly controlled by an antisense RNA mechanism that is highly dynamic, tuning plasmid metabolic burden to the physiological state of the host. Plasmid homeostasis is upset upon induction of recombinant protein expression because of non-physiological levels of expression and because of the frequently biased amino acid composition of recombinant proteins. Disregulation of plasmid replication is the main cause of collapse of plasmid-based expression systems because of a simultaneous increase in the metabolic burden (due to increased average copy number) and in the probability of generation of plasmid-free cells (due to increased copy number variation). Interference between regulatory elements of co-resident plasmids causes comparable effects on plasmid stability (plasmid incompatibility). Modulating plasmid copy number for recombinant gene expression aims at achieving a high gene dosage while preserving the stability of the expression system. Here I present strategies targeting plasmid replication for optimizing recombinant gene expression. Specifically, I review approaches aimed at modulating the antisense regulatory system (as well as their implications for plasmid incompatibility) and innovative strategies involving modulation of host factors, of R-loop formation, and of the timing of recombinant gene expression. PMID:20218961
Back to basics: pBR322 and protein expression systems in E. coli.
Balbás, Paulina; Bolívar, Francisco
2004-01-01
The extensive variety of plasmid-based expression systems in E. coli resulted from the fact that there is no single strategy for achieving maximal expression of every cloned gene. Although a number of strategies have been implemented to deal with problems associated to gene transcription and translation, protein folding, secretion, location, posttranslational modifications, particularities of different strains, and the like and more integrated processes have been developed, the basic plasmid-borne elements and their interaction with the particular host strain will influence the overall expression system and final productivity. Plasmid vector pBR322 is a well-established multipurpose cloning vector in laboratories worldwide, and a large number of derivatives have been created for specific applications and research purposes, including gene expression in its natural host, E. coli, and few other bacteria. The early characterization of the molecule, including its nucleotide sequence, replication and maintenance mechanisms, and determination of its coding regions, accounted for its success, not only as a universal cloning vector, but also as a provider of genes and an origin of replication for other intraspecies vectors. Since the publication of the aforementioned reviews, novel discoveries pertaining to these issues have appeared in the literature that deepen the understanding of the plasmid's features, behavior, and impact in gene expression systems, as well as some important strain characteristics that affect plasmid replication and stability. The objectives of this review include updating and discussing the new information about (1) the replication and maintenance of pBR322; (2) the host-related modulation mechanisms of plasmid replication; (3) the effects of growth rate on replication control, stability, and recombinant gene expression; (4) ways for plasmid amplification and elimination. Finally, (5) a summary of novel ancillary studies about pBR322 is presented.
Plasmid expression and maintenance during long-term starvation-survival of bacteria in well water.
Caldwell, B A; Ye, C; Griffiths, R P; Moyer, C L; Morita, R Y
1989-01-01
Strains of enteric bacteria and pseudomonads containing plasmid R388::Tnl721 (Tpr, Tcr) or pRO101 (Hgr, Tcr) were starved for over 250 days in sterile well water to evaluate effects of starvation-survival on plasmid expression and maintenance. Viable populations dropped to between approximately 0.1 and 1% of the initial populations. Escherichia coli(pRO101) and Pseudomonas cepacia(pRO101) lost both viability and plasmid expression at a lower rate than strains containing R388::Tnl721. Three patterns of host-plasmid interaction were detected: (i) no apparent loss of plasmid expression, (ii) loss of plasmid expression on initial recovery with subsequent expression upon resuscitation, and (iii) loss of capability to produce functional plasmid resistance. PMID:2782868
Process and genes for expression and overexpression of active [FeFe] hydrogenases
Seibert, Michael; King, Paul W; Ghirardi, Maria Lucia; Posewitz, Matthew C; Smolinski, Sharon L
2014-09-16
A process for expression of active [FeFe]-hydrogenase in a host organism that does not contain either the structural gene(s) for [FeFe]-hydrogenases and/or homologues for the maturation genes HydE, HydF and HyG, comprising: cloning the structural hydrogenase gene(s) and/or the maturation genes HydE, HydF and HydG from an organisms that contains these genes into expression plasmids; transferring the plasmids into an organism that lacks a native [FeFe]-hydrogenase or that has a disrupted [FeFe]-hydrogenase and culturing it aerobically; and inducing anaerobiosis to provide [FeFe] hydrogenase biosynthesis and H?2#191 production.
Cao, Yi-zhan; Hao, Chun-qiu; Feng, Zhi-hua; Zhou, Yong-xing; Li, Jin-ge; Jia, Zhan-sheng; Wang, Ping-zhong
2003-02-01
To construct three recombinant shuttle plasmids of adenovirus expression vector which can express hepatitis C virus(HCV) different structure genes(C, C+E1, C+E1+E2) in order to pack adenovirus expression vectors which can express HCV different structure gene effectively. The different HCV structure genes derived from the plasmid pBRTM/HCV1-3011 by using polymerase chain reaction (PCR) were inserted into the backward position of cytomegalovirus(CMV) immediate early promotor element of shuttle plasmid(pAd.CMV-Link.1) of adenovirus expression vector respectively, then the three recombinant plasmids (pAd.HCV-C, pAd.HCV-CE1, pAd.HCV-S) were obtained. The recombinant plasmids were identified by endonuclease, PCR and sequencing. HCV structure genes were expressed transiently with Lipofectamine 2000 coated in HepG2 cells which were confirmed by immunofluorescence and Western-Blot. Insert DNAs of the three recombinant plasmids' were confirmed to be HCV different structure genes by endonuclease, PCR and sequencing. The three recombinant plasmids can express HCV structure gene (C, C+E1, C+E1+E2) transiently in HepG2 cells which were confirmed by immunofluorescence and Western-Blot. The three recombinant shuttle plasmids of adenovirus expression vector can express HCV structure gene(C, C+E1, C+E1+E2) transiently. This should be useful to pack adenovirus expression vector which can express HCV structure genes.
Carnes, Aaron E; Hodgson, Clague P; Luke, Jeremy M; Vincent, Justin M; Williams, James A
2009-10-15
DNA vaccines and gene medicines, derived from bacterial plasmids, are emerging as an important new class of pharmaceuticals. However, the challenges of performing cell lysis processes for plasmid DNA purification at an industrial scale are well known. To address downstream purification challenges, we have developed autolytic Escherichia coli host strains that express endolysin (phage lambdaR) in the cytoplasm. Expression of the endolysin is induced during fermentation by a heat inducible promoter. The endolysin remains in the cytoplasm, where it is separated from its peptidoglycan substrate in the cell wall; hence the cells remain alive and intact and can be harvested by the usual methods. The plasmid DNA is then recovered by autolytic extraction under slightly acidic, low salt buffer conditions and treatment with a low concentration of non-ionic detergent. Under these conditions the E. coli genomic DNA remains associated with the insoluble cell debris and is removed by a solid-liquid separation. Here, we report fermentation, lysis methods, and plasmid purification using autolytic hosts.
Hughes, Stephen R; Butt, Tauseef R; Bartolett, Scott; Riedmuller, Steven B; Farrelly, Philip
2011-08-01
The molecular biological techniques for plasmid-based assembly and cloning of gene open reading frames are essential for elucidating the function of the proteins encoded by the genes. High-throughput integrated robotic molecular biology platforms that have the capacity to rapidly clone and express heterologous gene open reading frames in bacteria and yeast and to screen large numbers of expressed proteins for optimized function are an important technology for improving microbial strains for biofuel production. The process involves the production of full-length complementary DNA libraries as a source of plasmid-based clones to express the desired proteins in active form for determination of their functions. Proteins that were identified by high-throughput screening as having desired characteristics are overexpressed in microbes to enable them to perform functions that will allow more cost-effective and sustainable production of biofuels. Because the plasmid libraries are composed of several thousand unique genes, automation of the process is essential. This review describes the design and implementation of an automated integrated programmable robotic workcell capable of producing complementary DNA libraries, colony picking, isolating plasmid DNA, transforming yeast and bacteria, expressing protein, and performing appropriate functional assays. These operations will allow tailoring microbial strains to use renewable feedstocks for production of biofuels, bioderived chemicals, fertilizers, and other coproducts for profitable and sustainable biorefineries. Published by Elsevier Inc.
Tumor targeting of gene expression through metal-coordinated conjugation with dextran.
Hosseinkhani, Hossein; Aoyama, Teruyoshi; Ogawa, Osamu; Tabata, Yasuhiko
2003-03-07
Tumor targeting of plasmid DNA was achieved through the conjugation of dextran derivatives with chelate residues based on metal coordination. Diethylenetriamine pentaacetic acid (DTPA), spermidine (Sd), and spermine (Sm) were chemically introduced to the hydroxyl groups of dextran to obtain dextran-DTPA, dextran-Sd and dextran-Sm derivatives. Conjugation of the dextran derivative by Zn(2+) coordination decreased the apparent size of the plasmid DNA, depending on the derivative type. The negative zeta potential of plasmid DNA became almost 0 mV after Zn(2+)-coordinated conjugation with dextran-Sm. When the dextran derivative-plasmid DNA conjugates with Zn(2+) coordination were intravenously injected subcutaneously into mice bearing Meth-AR-1 fibrosarcoma, the dextran-Sm-plasmid DNA conjugate significantly enhanced the level of gene expression in the tumor, in contrast to the conjugate of other dextran derivatives and free plasmid DNA. The enhanced gene expression produced by the Zn(2+)-coordinated dextran-Sm-plasmid DNA conjugate was specific to the tumor, whereas a simple mixture of dextran-Sm and plasmid DNA was not effective. The level of gene expression depended on the percentage of chelate residues introduced, the mixing weight ratio of the plasmid DNA/Sm residue used for conjugate preparation, and the plasmid DNA dose. A fluorescent microscopic study revealed that localization of plasmid DNA in the tumor tissue was observed only after injection of the dextran-Sm-plasmid DNA conjugate with Zn(2+) coordination. In addition, the gene expression induced by the conjugate lasted for more than 10 days after the injection. We conclude that Zn(2+)-coordinated dextran-Sm conjugation is a promising way to enable plasmid DNA to target the tumor in gene expression as well as to prolong the duration of gene expression.
Genetic control of ColE1 plasmid stability that is independent of plasmid copy number regulation.
Standley, Melissa S; Million-Weaver, Samuel; Alexander, David L; Hu, Shuai; Camps, Manel
2018-06-16
ColE1-like plasmid vectors are widely used for expression of recombinant genes in E. coli. For these vectors, segregation of individual plasmids into daughter cells during cell division appears to be random, making them susceptible to loss over time when no mechanisms ensuring their maintenance are present. Here we use the plasmid pGFPuv in a recA relA strain as a sensitized model to study factors affecting plasmid stability in the context of recombinant gene expression. We find that in this model, plasmid stability can be restored by two types of genetic modifications to the plasmid origin of replication (ori) sequence: point mutations and a novel 269 nt duplication at the 5' end of the plasmid ori, which we named DAS (duplicated anti-sense) ori. Combinations of these modifications produce a range of copy numbers and of levels of recombinant expression. In direct contradiction with the classic random distribution model, we find no correlation between increased plasmid copy number and increased plasmid stability. Increased stability cannot be explained by reduced levels of recombinant gene expression either. Our observations would be more compatible with a hybrid clustered and free-distribution model, which has been recently proposed based on detection of individual plasmids in vivo using super-resolution fluorescence microscopy. This work suggests a role for the plasmid ori in the control of segregation of ColE1 plasmids that is distinct from replication initiation, opening the door for the genetic regulation of plasmid stability as a strategy aimed at enhancing large-scale recombinant gene expression or bioremediation.
Towards the construction of high-quality mutagenesis libraries.
Li, Heng; Li, Jing; Jin, Ruinan; Chen, Wei; Liang, Chaoning; Wu, Jieyuan; Jin, Jian-Ming; Tang, Shuang-Yan
2018-07-01
To improve the quality of mutagenesis libraries in directed evolution strategy. In the process of library transformation, transformants which have been shown to take up more than one plasmid might constitute more than 20% of the constructed library, thereby extensively impairing the quality of the library. We propose a practical transformation method to prevent the occurrence of multiple-plasmid transformants while maintaining high transformation efficiency. A visual library model containing plasmids expressing different fluorescent proteins was used. Multiple-plasmid transformants can be reduced through optimizing plasmid DNA amount used for transformation based on the positive correlation between the occurrence frequency of multiple-plasmid transformants and the logarithmic ratio of plasmid molecules to competent cells. This method provides a simple solution for a seemingly common but often neglected problem, and should be valuable for improving the quality of mutagenesis libraries to enhance the efficiency of directed evolution strategies.
Madsen, Jonas Stenløkke; Riber, Leise; Kot, Witold; Basfeld, Alrun; Burmølle, Mette; Hansen, Lars Hestbjerg; Sørensen, Søren Johannes
2016-01-01
Horizontal gene transfer (HGT), the transmission of genetic material to a recipient that is not the progeny of the donor, is fundamental in bacterial evolution. HGT is often mediated by mobile genetic elements such as conjugative plasmids, which may be in conflict with the chromosomal elements of the genome because they are independent replicons that may petition their own evolutionary strategy. Here we study differences between type 3 fimbriae encoded on wild type plasmids and in chromosomes. Using known and newly characterized plasmids we show that the expression of type 3 fimbriae encoded on plasmids is systematically different, as MrkH, a c-di-GMP dependent transcriptional activator is not needed for strong expression of the fimbriae. MrkH is required for expression of type 3 fimbriae of the Klebsiella pneumoniae chromosome, wherefrom the fimbriae operon (mrkABCDF) of plasmids is believed to have originated. We find that mrkABCDFs of plasmids are highly expressed via a unique promoter that differs from the original Klebsiella promoter resulting in fundamental behavioral consequences. Plasmid associated mrkABCDFs did not influence the swimming behavior of the host, that hereby acquired an exceptional phenotype being able to both actively swim (planktonic behavior) and express biofilm associated fimbriae (sessile behavior). We show that this exceptional phenotype enhances the conjugal transfer of the plasmid. PMID:27627107
A double-pulse approach for electrotransfection.
Pasquet, L; Bellard, E; Golzio, M; Rols, M P; Teissie, J
2014-12-01
Gene transfer and expression can be obtained by delivering calibrated electric pulses on cells in the presence of plasmids coding for the activity of interest. The electric treatment affects the plasma membrane and induces the formation of a transient complex between nucleic acids and the plasma membrane. It results in a delivery of the plasmid in the cytoplasm. Expression is only obtained if the plasmid is translocated inside the nucleus. This is a key limit in the process. We previously showed that delivery of a high-field short-duration electric pulse was inducing a structural alteration of the nuclear envelope. This study investigates if the double-pulse approach (first pulse to transfer the plasmid to the cytoplasm, and second pulse to induce the structural alteration of the envelope) was a way to enhance the protein expression using the green fluorescent protein as a reporter. We observed that not only the double-pulse approach induced the transfection of a lower number of cells but moreover, these transfected cells were less fluorescent than the cells treated only with the first pulse.
Dorman, Charles J
2014-09-01
Horizontal gene transfer plays an important role in the evolution of bacterial species, conferring new genetic traits on the recipient bacterium that extend its range of phenotypes and plasmids make important contributions to this process. However, the inappropriate expression of newly acquired genes may lead to a loss of competitive fitness, resulting in the elimination of the new gene-bacterium combination. It is thought that transcriptional silencing of horizontally acquired genes offers a route out of this dilemma and that nucleoid-associated proteins, especially those related to the H-NS protein, play a particularly important role in the silencing process. The discovery that many plasmids express orthologues of nucleoid-associated proteins adds an interesting dimension to current models of regulatory integration following lateral transfer of DNA. Other horizontally acquired genetic elements, such as genomic islands, also express nucleoid-associated proteins of their own. Here the interactions of H-NS-like nucleoid-associated proteins encoded by the core genome, genomic islands and plasmids are described. Copyright © 2014 Elsevier Inc. All rights reserved.
Müller, J-M V; Wissemann, J; Meli, M L; Dasen, G; Lutz, H; Heinzerling, L; Feige, K
2011-11-01
Whole blood pharmacokinetics of intratumourally injected naked plasmid DNA coding for equine Interleukin 12 (IL-12) was assessed as a means of in vivo gene transfer in the treatment of melanoma in grey horses. The expression of induced interferon gamma (IFN-g) was evaluated in order to determine the pharmacodynamic properties of in vivo gene transduction. Seven grey horses bearing melanoma were injected intratumourally with 250 µg naked plasmid DNA coding for IL-12. Peripheral blood and biopsies from the injection site were taken at 13 time points until day 14 post injection (p.i.). Samples were analysed using quantitative real-time PCR. Plasmid DNA was quantified in blood samples and mRNA expression for IFN-g in tissue samples. Plasmid DNA showed fast elimination kinetics with more than 99 % of the plasmid disappearing within 36 hours. IFN-g expression increased quickly after IL-12 plasmid injection, but varied between individual horses. Intratumoural injection of plasmid DNA is a feasible method for inducing transgene expression in vivo. Biological activity of the transgene IL-12 was confirmed by measuring expression of IFN-g.
Sacramento, C B; Moraes, J Z; Denapolis, P M A; Han, S W
2010-08-01
The main objective of the present study was to find suitable DNA-targeting sequences (DTS) for the construction of plasmid vectors to be used to treat ischemic diseases. The well-known Simian virus 40 nuclear DTS (SV40-DTS) and hypoxia-responsive element (HRE) sequences were used to construct plasmid vectors to express the human vascular endothelial growth factor gene (hVEGF). The rate of plasmid nuclear transport and consequent gene expression under normoxia (20% O2) and hypoxia (less than 5% O2) were determined. Plasmids containing the SV40-DTS or HRE sequences were constructed and used to transfect the A293T cell line (a human embryonic kidney cell line) in vitro and mouse skeletal muscle cells in vivo. Plasmid transport to the nucleus was monitored by real-time PCR, and the expression level of the hVEGF gene was measured by ELISA. The in vitro nuclear transport efficiency of the SV40-DTS plasmid was about 50% lower under hypoxia, while the HRE plasmid was about 50% higher under hypoxia. Quantitation of reporter gene expression in vitro and in vivo, under hypoxia and normoxia, confirmed that the SV40-DTS plasmid functioned better under normoxia, while the HRE plasmid was superior under hypoxia. These results indicate that the efficiency of gene expression by plasmids containing DNA binding sequences is affected by the concentration of oxygen in the medium.
Sesma, F; Gardiol, D; de Ruiz Holgado, A P; de Mendoza, D
1990-01-01
The citrate plasmid (Cit+ plasmid) from Lactococcus lactis subsp. lactis biovar diacetylactis was cloned into the EcoRI site of plasmid pUC18. This recombinant plasmid enabled Escherichia coli K-12 to transport and utilize citrate as a source of energy, indicating expression of the citrate permease from L. lactis biovar diacetylactis. The citrate permease was under the control of the lac promoter of pUC18. Genetic expression of the Cit+ plasmid in maxicells revealed that the plasmid encoded two polypeptides of 47 and 32 kilodaltons, determined by sodium dodecyl sulfate-polyacrylamide gel electrophoresis. Images PMID:2117878
Fatemeh, Ghaffarifar; Fatemeh, Tabatabaie; Zohreh, Sharifi; Abdolhosein, Dalimiasl; Mohammad Zahir, Hassan; Mehdi, Mahdavi
2012-01-01
TSA (thiol-specific antioxidant antigen) is the immune-dominant antigen of Leishmania major and is considered to be the most promising candidate molecule for a recombinant or DNA vaccine against leishmaniasis. The aim of the present work was to express a plasmid containing the TSA gene in eukaryotic cells. Genomic DNA was extracted, and the TSA gene was amplified by polymerase chain reaction (PCR). The PCR product was cloned into the pTZ57R/T vector, followed by subcloning into the eukaryotic expression vector pcDNA3 (EcoRI and HindIII sites). The recombinant plasmid was characterised by restriction digest and PCR. Eukaryotic Chinese hamster ovary cells were transfected with the plasmid containing the TSA gene. Expression of the L. major TSA gene was confirmed by sodium dodecyl sulphate-polyacrylamide gel electrophoresis and Western blotting. The plasmid containing the TSA gene was successfully expressed, as demonstrated by a band of 22.1 kDa on Western blots. The plasmid containing the TSA gene can be expressed in a eukaryotic cell line. Thus, the recombinant plasmid may potentially be used as a DNA vaccine in animal models.
[Construction of plant expression plasmid of chimera SBR-CT delta A1].
Mai, Sui; Ling, Junqi
2003-08-01
The purpose of this study is to construct plant expression plasmid containing the gene encoding chimera SBR-CT delta A1. The target gene fragment P2, including the gene-encoded chimera SBR-CT delta A1 (3,498-5,378 bp), was obtained by standard PCR amplification. The PCR products were ligated with pGEM-easy vector through TA clone to form plasmid pTSC. The plasmid pTSC and plasmid pPOKII were digested by restricted endonuclease BamHI and KpnI, and the digested products were extracted and purified for recombination. Then the purified P2 and plasmid pPOKII were recombined by T4 DNA ligase to form recombinant plasmid pROSC; inserting bar gene into the plasmid and form pROSB plasmid. The recombined plasmids were isolated and identified by restricted endonuclease cutting and Sanger dideoxy DNA sequencing. P2 gene was linked to pPOKII plasmid and formed recombinant plasmid pROSC. The DNA sequence and orientation were corrected. And bar gene was inserted into pPOSC and form recombinant plasmid pROSB. Plant expression vector pROSC and pROSB containing the gene encoding chimera SBR-CT delta A1, which may provide useful experiment foundation for further study on edible vaccine against caries have been successfully constructed.
Ultrasound enhances in vivo tumor expression of plasmid DNA by PEG-introduced cationized dextran.
Hosseinkhani, Hossein; Tabata, Yasuhiko
2005-11-28
This study is an investigation to experimentally confirm whether or not ultrasound (US) irradiation is effective in enhancing the in vivo gene expression of plasmid DNA in tumor. Dextran was cationized by introducing spermine to the hydroxyl groups to allow to polyionically complex with a plasmid DNA. The cationized dextran prepared was additionally modified with poly(ethylene glycol) (PEG) molecules which have an active ester and methoxy groups at each terminal, to obtain cationized dextran with different percentages of PEG introduced. Various cationized dextrans with or without PEG introduction were mixed with a plasmid DNA of LacZ to form cationized dextran-plasmid DNA complexes. Electrophoretical examination revealed that the plasmid DNA was complexed both with the cationized dextran and PEG-introduced cationized dextran, irrespective of the PEG introduction percentage, although the higher N/P ratio was needed for plasmid DNA complexation with the latter. By complexation with the cationized dextran, the zeta potential of plasmid DNA was changed to be positive. The charge of PEG-introduced cationized dextran-plasmid DNA complexes became close to 0 mV as their percentage of PEG introduced increased, although the molecular size was about 250 nm, irrespective of the PEG introduction. When cationized dextran-plasmid DNA complexes with or without PEG introduction were intravenously injected to mice carrying a subcutaneous Meth-AR-1 fibrosarcoma mass and the subsequent US irradiation to the tumor mass percutaneously, the PEG-introduced cationized dextran-plasmid DNA complex plus US irradiation enhanced the tumor level of gene expression to a significantly high extent compared with the cationized dextran-plasmid DNA complex and free plasmid DNA with or without US irradiation. The enhanced level depended on the time period and timing of US irradiation. Fluorescent microscopic studies revealed that the localization of plasmid DNA and the gene expression were observed in the tumor tissue injected with the PEG-introduced cationized dextran-plasmid DNA complex plus the subsequent US irradiation. We conclude that complexation with the PEG-introduced cationized dextran combined with US irradiation is a promising way to target the plasmid DNA to the tumor for gene expression.
Dormiani, Kianoush; Mir Mohammad Sadeghi, Hamid; Sadeghi-Aliabadi, Hojjat; Forouzanfar, Mahboobeh; Baharvand, Hossein; Ghaedi, Kamran; Nasr-Esfahani, Mohammad Hossein
2017-01-01
Induced pluripotent stem cells are generated from somatic cells by direct reprogramming. These reprogrammed pluripotent cells have different applications in biomedical fields such as regenerative medicine. Although viral vectors are widely used for efficient reprogramming, they have limited applications in the clinic due to the risk for immunogenicity and insertional mutagenesis. Accordingly, we designed and developed a small, non-integrating plasmid named pLENSO/Zeo as a 2A-mediated polycistronic expression vector. In this experimental study, we developed a single plasmid which includes a single expression cassette containing open reading frames of human LIN28, NANOG, SOX2 and OCT4 along with an EGFP reporter gene. Each reprogramming factor is separated by an intervening sequence that encodes a 2A self-processing peptide. The reprogramming cassette is located downstream of a CMV promoter. The vector is easily propagated in the E. coli GT115 strain through a CpG-depleted vector backbone. We evaluated the stability of the constructed vector bioinformatically, and its ability to stoichiometric expression of the reprogramming factors using quantitative molecular methods analysis after transient transfection into HEK293 cells. In the present study, we developed a nonviral episomal vector named pLENSO/ Zeo. Our results demonstrated the general structural stability of the plasmid DNA. This relatively small vector showed concomitant, high-level expression of the four reprogramming factors with similar titers, which are considered as the critical parameters for efficient and consistent reprogramming. According to our experimental results, this stable extrachromosomal plasmid expresses reliable amounts of four reprogramming factors simultaneously. Consequently, these promising results encouraged us to evaluate the capability of pLENSO/Zeo as a simple and feasible tool for generation of induced pluripotent stem cells from primary cells in the future.
Chen, Tingfang; Luo, Na; Xie, Huaping; Wu, Xiushan; Deng, Yun
2010-02-01
In an effort to generate a desired expression construct for making heart-specific expression transgenic zebrafish, a Tol2 plasmid, which can drive EGFP reporter gene specifically expressed in the heart, was modified using subcloning technology. An IRES fragment bearing multiple cloning site (MCS) was amplified directly from pIRES2-EGFP plasmid and was inserted between the CMLC2 promoter and EGFP fragment of the pDestTol2CG vector. This recombinant expression plasmid pTol2-CMLC2-IRES-EGFP can drive any interested gene specifically expressed in the zebrafish heart along with EGFP reporter gene. To test the effectiveness of this new expression plasmid, we constructed pTol2-CMLC2-RED-IRES-EGFP plasmid by inserting another reporter gene DsRed-Monome into MCS downstream of the CMLC2 promoter and injected this transgenic recombinant plasmid into one-cell stage embryos of zebrafish. Under fluorescence microscope, both the red fluorescence and the green fluorescence produced by pTol2-CMLC2-RED-IRES-EGFP were detected specifically in the heart tissue in the same expression pattern. This novel expression construct pTol2-CMLC2-IRES-EGFP will become an important tool for our research on identifying heart development candidate genes' function using zebrafish as a model.
Expression Plasmids for Use in Candida glabrata
Zordan, Rebecca E.; Ren, Yuxia; Pan, Shih-Jung; Rotondo, Giuseppe; Peñas, Alejandro De Las; Iluore, Joseph; Cormack, Brendan P.
2013-01-01
We describe a series of CEN/ARS episomal plasmids containing different Candida glabrata promoters, allowing for a range of constitutive or regulated expression of proteins in C. glabrata. The set of promoters includes three constitutive promoters (EGD2pr, HHT2pr, PDC1pr), two macrophage/phagocytosis-induced promoters (ACO2pr, LYS21pr), and one nutritionally regulated promoter (MET3pr). Each promoter was cloned into two plasmid backbones that differ in their selectable marker, URA3, or the dominant-selectable NAT1 gene, which confers resistance to the drug nourseothricin. Expression from the 12 resulting plasmids was assessed using GFP as a reporter and flow cytometry or quantitative reverse-transcription polymerase chain reaction to assess expression levels. Together this set of plasmids expands the toolkit of expression vectors available for use with C. glabrata. PMID:23934995
Wang, Yibing; Kahane, Simona; Cutcliffe, Lesley T; Skilton, Rachel J; Lambden, Paul R; Persson, Kenneth; Bjartling, Carina; Clarke, Ian N
2013-01-01
Our study had three objectives: to extend the plasmid-based transformation protocol to a clinical isolate of C. trachomatis belonging to the trachoma biovar, to provide "proof of principle" that it is possible to "knock out" selected plasmid genes (retaining a replication competent plasmid) and to investigate the plasticity of the plasmid. A recently developed, plasmid-based transformation protocol for LGV isolates of C. trachomatis was modified and a plasmid-free, genital tract C. trachomatis isolate from Sweden (SWFP-) was genetically transformed. Transformation of this non-LGV C. trachomatis host required a centrifugation step, but the absence of the natural plasmid removed the need for plaque purification of transformants. Transformants expressed GFP, were penicillin resistant and iodine stain positive for accumulated glycogen. The transforming plasmid did not recombine with the host chromosome. A derivative of pGFP::SW2 carrying a deletion of the plasmid CDS5 gene was engineered. CDS5 encodes pgp3, a protein secreted from the inclusion into the cell cytoplasm. This plasmid (pCDS5KO) was used to transform C. trachomatis SWFP-, and established that pgp3 is dispensable for plasmid function. The work shows it is possible to selectively delete segments of the chlamydial plasmid, and this is the first step towards a detailed molecular dissection of the role of the plasmid. The 3.6 kb β-galactosidase cassette was inserted into the deletion site of CDS5 to produce plasmid placZ-CDS5KO. Transformants were penicillin resistant, expressed GFP and stained for glycogen. In addition, they expressed β-galactosidase showing that the lacZ cassette was functional in C. trachomatis. An assay was developed that allowed the visualisation of individual inclusions by X-gal staining. The ability to express active β-galactosidase within chlamydial inclusions is an important advance as it allows simple, rapid assays to measure directly chlamydial infectivity without the need for plaquing, fluorescence or antibody staining.
Newman, Laura E; Schiavon, Cara; Kahn, Richard A
2016-01-01
We describe the construction and uses of a series of plasmids for directing expression to varied levels of exogenous proteins targeted to the mitochondrial matrix or intermembrane space. We found that the level of protein expression achieved, the kinetics of expression and mitochondrial import, and half-life after import can each vary with the protein examined. These factors should be considered when directing localization of an exogenous protein to mitochondria for rescue, proteomics, or other approaches. We describe the construction of a collection of plasmids for varied expression of proteins targeted to the mitochondrial matrix or intermembrane space, using previously defined targeting sequences and strength CMV promoters. The limited size of these compartments makes them particularly vulnerable to artifacts from over-expression. We found that different proteins display different kinetics of expression and import that should be considered when analyzing results from this approach. Finally, this collection of plasmids has been deposited in the Addgene plasmid repository to facilitate the ready access and use of these tools.
Bruni, C B; Musti, A M; Frunzio, R; Blasi, F
1980-01-01
A fragment of deoxyribonucleic acid 5,300 base paris long and containing the promoter-proximal portion of the histidine operon of Escherichia coli K-12, has been cloned in plasmid pBR313 (plasmids pCB2 and pCB3). Restriction mapping, partial nucleotide sequencing, and studies on functional expression in vivo and on protein synthesis in minicells have shown that the fragment contains the regulatory region of the operon, the hisG, hisD genes, and part of the hisC gene. Another plasmid (pCB5) contained the hisG gene and part of the hisD gene. Expression of the hisG gene in the latter plasmid was under control of the tetracycline promoter of the pBR313 plasmid. The in vivo expression of the two groups of plasmids described above, as well as their effect on the expression of the histidine genes not carried by the plasmids but present on the host chromosome, has been studied. The presence of multiple copies of pCB2 or pCB3, but not of pCB5, prevented derepression of the chromosomal histidine operon. Possible interpretations of this phenomenon are discussed. Images PMID:6246067
Using the CRISPR/Cas9 system to eliminate native plasmids of Zymomonas mobilis ZM4.
Cao, Qing-Hua; Shao, Huan-Huan; Qiu, Hui; Li, Tao; Zhang, Yi-Zheng; Tan, Xue-Mei
2017-03-01
The CRISPR/Cas system can be used to simply and efficiently edit the genomes of various species, including animals, plants, and microbes. Zymomonas mobilis ZM4 is a highly efficient, ethanol-producing bacterium that contains five native plasmids. Here, we constructed the pSUZM2a-Cas9 plasmid and a single-guide RNA expression plasmid. The pSUZM2a-Cas9 plasmid was used to express the Cas9 gene cloned from Streptococcus pyogenes CICC 10464. The single-guide RNA expression plasmid pUC-T7sgRNA, with a T7 promoter, can be used for the in vitro synthesis of single-guide RNAs. This system was successfully employed to knockout the upp gene of Escherichia coli and the replicase genes of native Z. mobilis plasmids. This is the first study to apply the CRISPR/Cas9 system of S. pyogenes to eliminate native plasmids in Z. mobilis. It provides a new method for plasmid curing and paves the way for the genomic engineering of Z. mobilis.
Cheng, Mingrong; Zhi, Kangkang; Gao, Xiaoyan; He, Bing; Li, Yingchun; Han, Jiang; Zhang, Zhiping; Wu, Yan
2013-12-18
Cancer is both a systemic and a genetic disease. The pathogenesis of cancer might be related to dampened immunity. Host immunity recognizes nascent malignant cells - a process referred to as immune surveillance. Augmenting immune surveillance and suppressing immune escape are crucial in tumor immunotherapy. A recombinant plasmid capable of co-expressing granulocyte-macrophage colony- stimulating factor (GM-SCF), interleukin-21 (IL-21), and retinoic acid early transcription factor-1 (Rae-1) was constructed, and its effects determined in a mouse model of subcutaneous liver cancer. Serum specimens were assayed for IL-2 and INF-γ by ELISA. Liver cancer specimens were isolated for Rae-1 expression by RT-PCR and Western blot, and splenocytes were analyzed by flow cytometry. The recombinant plasmid inhibited the growth of liver cancer and prolonged survival of tumor-loaded mice. Activation of host immunity might have contributed to this effect by promoting increased numbers and cytotoxicity of natural killer (NK) cells and cytotoxic T lymphocytes (CTL) following expression of GM-SCF, IL-21, and Rae-1. By contrast, the frequency of regulatory T cells was decreased, Consequently, activated CTL and NK cells enhanced their secretion of INF-γ, which promoted cytotoxicity of NK cells and CTL. Moreover, active CTL showed dramatic secretion of IL-2, which stimulates CTL. The recombinant expression plasmid also augmented Rae-1 expression by liver cancer cells. Rae-1 receptor expressing CTL and NK cells removed liver cancer. The recombinant expression plasmid inhibited liver cancer by a mechanism that involved activation of cell-mediated immunity and Rae-1 in liver cancer.
Reprint of "versatile and stable vectors for efficient gene expression in Ralstonia eutropha H16".
Gruber, Steffen; Hagen, Jeremias; Schwab, Helmut; Koefinger, Petra
2014-12-20
The Gram-negative β-proteobacterium Ralstonia eutropha H16 is primarily known for polyhydroxybutyrate (PHB) production and its ability to grow chemolithoautotrophically by using CO2 and H2 as sole carbon and energy sources. The majority of metabolic engineering and heterologous expression studies conducted so far rely on a small number of suitable expression systems. Particularly the plasmid based expression systems already developed for the use in R. eutropha H16 suffer from high segregational instability and plasmid loss after a short time of fermentation. In order to develop efficient and highly stable plasmid expression vectors for the use in R. eutropha H16, a new plasmid design was created including the RP4 partitioning system, as well as various promoters and origins of replication. The application of minireplicons derived from broad-host-range plasmids RSF1010, pBBR1, RP4 and pSa for the construction of expression vectors and the use of numerous, versatile promoters extend the range of feasible expression levels considerably. In particular, the use of promoters derived from the bacteriophage T5 was described for the first time in this work, characterizing the j5 promoter as the strongest promoter yet to be applied in R. eutropha H16. Moreover, the implementation of the RP4 partition sequence in plasmid design increased plasmid stability significantly and enables fermentations with marginal plasmid loss of recombinant R. eutropha H16 for at least 96h. The utility of the new vector family in R. eutropha H16 is demonstrated by providing expression data with different model proteins and consequently further raises the value of this organism as cell factory for biotechnological applications including protein and metabolite production. Copyright © 2014 Elsevier B.V. All rights reserved.
Versatile and stable vectors for efficient gene expression in Ralstonia eutropha H16.
Gruber, Steffen; Hagen, Jeremias; Schwab, Helmut; Koefinger, Petra
2014-09-30
The Gram-negative β-proteobacterium Ralstonia eutropha H16 is primarily known for polyhydroxybutyrate (PHB) production and its ability to grow chemolithoautotrophically by using CO2 and H2 as sole carbon and energy sources. The majority of metabolic engineering and heterologous expression studies conducted so far rely on a small number of suitable expression systems. Particularly the plasmid based expression systems already developed for the use in R. eutropha H16 suffer from high segregational instability and plasmid loss after a short time of fermentation. In order to develop efficient and highly stable plasmid expression vectors for the use in R. eutropha H16, a new plasmid design was created including the RP4 partitioning system, as well as various promoters and origins of replication. The application of minireplicons derived from broad-host-range plasmids RSF1010, pBBR1, RP4 and pSa for the construction of expression vectors and the use of numerous, versatile promoters extend the range of feasible expression levels considerably. In particular, the use of promoters derived from the bacteriophage T5 was described for the first time in this work, characterizing the j5 promoter as the strongest promoter yet to be applied in R. eutropha H16. Moreover, the implementation of the RP4 partition sequence in plasmid design increased plasmid stability significantly and enables fermentations with marginal plasmid loss of recombinant R. eutropha H16 for at least 96 h. The utility of the new vector family in R. eutropha H16 is demonstrated by providing expression data with different model proteins and consequently further raises the value of this organism as cell factory for biotechnological applications including protein and metabolite production. Copyright © 2014 Elsevier B.V. All rights reserved.
Carnes, Aaron E.; Luke, Jeremy M.; Vincent, Justin M.; Anderson, Sheryl; Schukar, Angela; Hodgson, Clague P.; Williams, James A.
2010-01-01
Background For safety considerations, regulatory agencies recommend elimination of antibiotic resistance markers and nonessential sequences from plasmid DNA-based gene medicines. In the present study we analyzed antibiotic-free (AF) vector design criteria impacting bacterial production and mammalian transgene expression. Methods Both CMV-HTLV-I R RNA Pol II promoter (protein transgene) and murine U6 RNA Pol III promoter (RNA transgene) vector designs were studied. Plasmid production yield was assessed through inducible fed-batch fermentation. RNA Pol II-directed EGFP and RNA Pol III-directed RNA expression were quantified by fluorometry and quantitative real-time polymerase chain reaction (RT-PCR), respectively, after transfection of human HEK293 cells. Results Sucrose-selectable minimalized protein and therapeutic RNA expression vector designs that combined an RNA-based AF selection with highly productive fermentation manufacturing (>1,000 mg/L plasmid DNA) and high level in vivo expression of encoded products were identified. The AF selectable marker was also successfully applied to convert existing kanamycin-resistant DNA vaccine plasmids gWIZ and pVAX1 into AF vectors, demonstrating a general utility for retrofitting existing vectors. A minimum vector size for high yield plasmid fermentation was identified. A strategy for stable fermentation of plasmid dimers with improved vector potency and fermentation yields up to 1,740 mg/L was developed. Conclusions We report the development of potent high yield AF gene medicine expression vectors for protein or RNA (e.g. short hairpin RNA or microRNA) products. These AF expression vectors were optimized to exceed a newly identified size threshold for high copy plasmid replication and direct higher transgene expression levels than alternative vectors. PMID:20806425
Koizumi, Shinji; Ohno, Shotaro; Otsuka, Fuminori
2012-01-01
Gene expression processes are now recognized as important targets of the toxic effects exerted by industrial chemicals. The transient transfection assay is a powerful tool to evaluate such effects. Thus, we developed a versatile assay system by constructing a basic reporter plasmid in which the regulatory DNA sequence to be studied can easily be substituted. To verify the performance of this system, reporter plasmids carrying any of the three distinct regulatory sequences, estrogen responsive element (ERE), glucocorticoid responsive element (GRE) and xenobiotic responsive element (XRE) were constructed. After transfection of human cells, these plasmids successfully expressed the relevant reporter genes in response to specific inducers, β-estradiol, dexamethasone and 3-methylcholanthrene, respectively. Several industrial chemicals were assayed using these reporter plasmids, and the ability of p-dimethylaminoazobenzene to elevate GRE- and XRE-mediated transcription was detected. α-Naphthylamine and o-tolidine were also observed to increase the XRE-mediated response. The transfection assay system established here will be useful to evaluate the effects of a wide variety of industrial chemicals.
O'Flaherty, Sarah; Klaenhammer, Todd R
2016-10-15
Clostridium botulinum and Bacillus anthracis produce potent toxins that cause severe disease in humans. New and improved vaccines are needed for both of these pathogens. For mucosal vaccine delivery using lactic acid bacteria, chromosomal expression of antigens is preferred over plasmid-based expression systems, as chromosomal expression circumvents plasmid instability and the need for antibiotic pressure. In this study, we constructed three strains of Lactobacillus acidophilus NCFM expressing from the chromosome (i) the nontoxic host receptor-binding domain of the heavy chain of Clostridium botulinum serotype A neurotoxin (BoNT/A-Hc), (ii) the anthrax protective antigen (PA), and (iii) both the BoNT/A-Hc and the PA. The BoNT/A-Hc vaccine cassette was engineered to contain the signal peptide from the S-layer protein A from L. acidophilus and a dendritic-cell-targeting peptide. A chromosomal region downstream of lba0889 carrying a highly expressed enolase gene was selected for insertion of the vaccine cassettes. Western blot analysis confirmed the heterologous expression of the two antigens from plasmid and chromosome locations. Stability assays demonstrated loss of the vaccine cassettes from expression plasmids without antibiotic maintenance. RNA sequencing showed high expression of each antigen and that insertion of the vaccine cassettes had little to no effect on the transcription of other genes in the chromosome. This study demonstrated that chromosomal integrative recombinant strains are promising vaccine delivery vehicles when targeted into high-expression chromosomal regions. Levels of expression match high-copy-number plasmids and eliminate the requirement for antibiotic selective maintenance of recombinant plasmids. Clostridium botulinum and Bacillus anthracis produce potent neurotoxins that pose a biochemical warfare concern; therefore, effective vaccines against these bacteria are required. Chromosomal expression of antigens is preferred over plasmid-based expression systems since expressing antigens from a chromosomal location confers an advantage to the vaccine strains by eliminating the antibiotic maintenance required for plasmids and negates issues with plasmid instability that would result in loss of the antigen. Lactic acid bacteria, including Lactobacillus acidophilus, have shown potential for mucosal vaccine delivery, as L. acidophilus is bile and acid tolerant, allowing transit through the gastrointestinal tract where cells interact with host epithelial and immune cells, including dendritic cells. In this study, we successfully expressed C. botulinum and B. anthracis antigens in the probiotic L. acidophilus strain NCFM. Both antigens were highly expressed individually or in tandem from the chromosome of L. acidophilus. Copyright © 2016 O'Flaherty and Klaenhammer.
Klaenhammer, Todd R.
2016-01-01
ABSTRACT Clostridium botulinum and Bacillus anthracis produce potent toxins that cause severe disease in humans. New and improved vaccines are needed for both of these pathogens. For mucosal vaccine delivery using lactic acid bacteria, chromosomal expression of antigens is preferred over plasmid-based expression systems, as chromosomal expression circumvents plasmid instability and the need for antibiotic pressure. In this study, we constructed three strains of Lactobacillus acidophilus NCFM expressing from the chromosome (i) the nontoxic host receptor-binding domain of the heavy chain of Clostridium botulinum serotype A neurotoxin (BoNT/A-Hc), (ii) the anthrax protective antigen (PA), and (iii) both the BoNT/A-Hc and the PA. The BoNT/A-Hc vaccine cassette was engineered to contain the signal peptide from the S-layer protein A from L. acidophilus and a dendritic-cell-targeting peptide. A chromosomal region downstream of lba0889 carrying a highly expressed enolase gene was selected for insertion of the vaccine cassettes. Western blot analysis confirmed the heterologous expression of the two antigens from plasmid and chromosome locations. Stability assays demonstrated loss of the vaccine cassettes from expression plasmids without antibiotic maintenance. RNA sequencing showed high expression of each antigen and that insertion of the vaccine cassettes had little to no effect on the transcription of other genes in the chromosome. This study demonstrated that chromosomal integrative recombinant strains are promising vaccine delivery vehicles when targeted into high-expression chromosomal regions. Levels of expression match high-copy-number plasmids and eliminate the requirement for antibiotic selective maintenance of recombinant plasmids. IMPORTANCE Clostridium botulinum and Bacillus anthracis produce potent neurotoxins that pose a biochemical warfare concern; therefore, effective vaccines against these bacteria are required. Chromosomal expression of antigens is preferred over plasmid-based expression systems since expressing antigens from a chromosomal location confers an advantage to the vaccine strains by eliminating the antibiotic maintenance required for plasmids and negates issues with plasmid instability that would result in loss of the antigen. Lactic acid bacteria, including Lactobacillus acidophilus, have shown potential for mucosal vaccine delivery, as L. acidophilus is bile and acid tolerant, allowing transit through the gastrointestinal tract where cells interact with host epithelial and immune cells, including dendritic cells. In this study, we successfully expressed C. botulinum and B. anthracis antigens in the probiotic L. acidophilus strain NCFM. Both antigens were highly expressed individually or in tandem from the chromosome of L. acidophilus. PMID:27496774
Quorum-quenching limits quorum-sensing exploitation by signal-negative invaders
NASA Astrophysics Data System (ADS)
Tannières, Mélanie; Lang, Julien; Barnier, Claudie; Shykoff, Jacqui A.; Faure, Denis
2017-01-01
Some bacteria produce and perceive quorum-sensing (QS) signals that coordinate several behaviours, including the costly processes that are exoenzyme production and plasmid transfer. In the case of plasmid transfer, the emergence of QS signal-altered invaders and their policing are poorly documented. In Agrobacterium tumefaciens, the virulence Ti-plasmid encodes both synthesis and sensing of QS-signals, which promote its transfer from a donor to a recipient cell. Here, we reported that QS-altered A. tumefaciens mutants arose during experimental evolution. All showed improved growth compared to their ancestor. Genome sequencing revealed that, though some had lost the Ti-plasmid, most were defective for QS-signal synthesis and Ti-plasmid conjugation (traR mutations) and one exhibited a QS-signal exploitation behaviour, using signal produced by other cells to enhance its own Ti-plasmid transfer. We explored mechanisms that can limit this QS-hijacking. We showed that the A. tumefaciens capacity to inactivate QS-signals by expressing QS-degrading enzyme could attenuate dissemination of the QS signal-negative Ti-plasmids. This work shows that enzymatic QS-disruption whether encoded by the QS-producing Ti-plasmid itself, by a companion plasmid in the same donor cells, or by one in the recipient cells, in all cases can serve as a mechanism for controlling QS exploitation by QS signal-negative mutants.
Development of Novel Peptide Inhibitors of the Estrogen Receptor
1997-10-01
plasmids used for the transfection experiments described below included pERE-TK- CAT , an estrogen responsive chloramphenicol acetylase reporter plasmid...The inhibitory potential of expressed fragments of ER were assessed by measuring the activity of chloramphenicol acetyltransferase ( CAT ) enzyme...with an ER expression plasmid (pCMV-ER) and an estrogen-responsive reporter plasmid (pERE-TK- CAT ) in order to look for inhibition of an ER mediated
Kamensek, Urska; Tesic, Natasa; Sersa, Gregor; Kos, Spela; Cemazar, Maja
2017-01-01
Electrotransfer mediated delivery of interleukin-12 (IL-12) gene, encoded on a plasmid vector, has already been demonstrated to have a potent antitumor efficacy and great potential for clinical application. In the present study, our aim was to construct an optimized IL-12-encoding plasmid that is safe from the regulatory point of view. In light of previous studies demonstrating that IL-12 should be released in a tumor localized manner for optimal efficacy, the strong ubiquitous promoter was replaced with a weak endogenous promoter of the collagen 2 gene, which is specific for fibroblasts. Next, to comply with increasing regulatory demands for clinically used plasmids, the expression cassette was cloned in a plasmid lacking the antibiotic resistance gene. The constructed fibroblast-specific and antibiotic-free IL-12 plasmid was demonstrated to support low IL-12 expression after gene electrotransfer in selected cell lines. Furthermore, the removal of antibiotic resistance did not affect the plasmid expression profile and lowered its cytotoxicity. With optimal IL-12 expression and minimal transgene non-specific effects, i.e., low cytotoxicity, the constructed plasmid could be especially valuable for different modern immunological approaches to achieve localized boosting of the host's immune system. Copyright © 2016 Elsevier Inc. All rights reserved.
Møller, Thea S. B.; Liu, Gang; Boysen, Anders; Thomsen, Line E.; Lüthje, Freja L.; Mortensen, Sisse; Møller-Jensen, Jakob; Olsen, John E.
2017-01-01
Horizontal gene transfer (HGT) is the major mechanism responsible for spread of antibiotic resistance. Antibiotic treatment has been suggested to promote HGT, either by directly affecting the conjugation process itself or by selecting for conjugations subsequent to DNA transfer. However, recent research suggests that the effect of antibiotic treatment on plasmid conjugation frequencies, and hence the spread of resistance plasmids, may have been overestimated. We addressed the question by quantifying transfer proteins and conjugation frequencies of a blaCTX−M−1 encoding IncI1 resistance plasmid in Escherichia coli MG1655 in the presence and absence of therapeutically relevant concentrations of cefotaxime (CTX). Analysis of the proteome by iTRAQ labeling and liquid chromatography tandem mass spectrometry revealed that Tra proteins were significantly up-regulated in the presence of CTX. The up-regulation of the transfer machinery was confirmed at the transcriptional level for five selected genes. The CTX treatment did not cause induction of the SOS-response as revealed by absence of significantly regulated SOS associated proteins in the proteome and no significant up-regulation of recA and sfiA genes. The frequency of plasmid conjugation, measured in an antibiotic free environment, increased significantly when the donor was pre-grown in broth containing CTX compared to growth without this drug, regardless of whether blaCTX-M-1 was located on the plasmid or in trans on the chromosome. The results shows that antibiotic treatment can affect expression of a plasmid conjugation machinery and subsequent DNA transfer. PMID:29238335
Lu, Jiamiao; Williams, James A.; Luke, Jeremy; Zhang, Feijie; Chu, Kirk; Kay, Mark A.
2017-01-01
We previously developed a mini-intronic plasmid (MIP) expression system in which the essential bacterial elements for plasmid replication and selection are placed within an engineered intron contained within a universal 5′ UTR noncoding exon. Like minicircle DNA plasmids (devoid of bacterial backbone sequences), MIP plasmids overcome transcriptional silencing of the transgene. However, in addition MIP plasmids increase transgene expression by 2 and often >10 times higher than minicircle vectors in vivo and in vitro. Based on these findings, we examined the effects of the MIP intronic sequences in a recombinant adeno-associated virus (AAV) vector system. Recombinant AAV vectors containing an intron with a bacterial replication origin and bacterial selectable marker increased transgene expression by 40 to 100 times in vivo when compared with conventional AAV vectors. Therefore, inclusion of this noncoding exon/intron sequence upstream of the coding region can substantially enhance AAV-mediated gene expression in vivo. PMID:27903072
2006-04-01
Fig. 2B). In addition, luciferase assay on cells co-transfected with constructs expressing firefly and renilla luciferase genes showed a significant...positive cells. (C) BT474 cells were co-transfected with pGL3 plasmid expressing firefly luciferase, pRL plasmid expressing renilla luciferase, and...genes Per1 (A) and Bmal1 (B). BT474 cells were transfected with Per1 (A) and Bmal1 (B) firefly luciferase reporters, pRL plasmid expressing renilla
Inducible expression of photoacoustic reporter gene tyrosinase in cells using a single plasmid
NASA Astrophysics Data System (ADS)
Paproski, Robert J.; Zemp, Roger J.
2012-02-01
We have previously demonstrated that tyrosinase is a reporter gene for photoacoustic imaging since tyrosinase is the rate-limiting step in the synthesis of melanin, a pigment capable of producing strong photoacoustic signals. We previously created a cell line capable of inducible tyrosinase expression (important due to toxicity of melanin) by stably transfecting tyrosinase in MCF-7 Tet-OnR cell line (Clontech) which expresses a doxycycline-controlled transactivator. Unfortunately, Clontech provides few Tet-On Advanced cell lines making it difficult to have inducible tyrosinase expression in cell lines not provided by Clontech. In order to simplify the creation of cell lines with inducible expression of tyrosinase, we created a single plasmid that encodes both the transactivator as well as tyrosinase. PCR was used to amplify both the transactivator and tyrosinase from the Tet-OnR Advanced and pTRE-Tight-TYR plasmids, respectively. Both PCR products were cloned into the pEGFP-N1 plasmid and the newly created plasmid was transfected into ZR-75-1, MCF-7, and MIA PaCa-1 cells using lipofectamine. After several days, brown melanin was only observed in cells incubated with doxycycline, suggesting that the newly created single plasmid allowed inducible tyrosinase expression in many different cells lines.
Yi, Y; Zhang, M; Liu, C
2001-06-01
To set up an efficient expressing system for recombinant hepatitis B virus surface antigen (HBsAg) in dhfr gene negative CHO cell line. HBsAg gene expressing plasmid pCI-dhfr-S was constructed by integrating HBsAg gene into plasmid pCI which carries dhfr gene. The HBsAg expressing cell line was set up by transfection of plasmid pCI-dhfr-S into dhfr gene negative CHO cell line in the way of lipofectin. Under the selective pressure of MTX, 18 of 28 clonized cell lines expressed HBsAg, 4 of them reached a high titer of 1:32 and protein content 1-3 micrograms/ml. In this study, the high level expression of HBsAg demonstrated that the dhfr negative mammalian cell line when recombined with plasmid harboring the corresponding deleted gene can efficiently express the foreign gene. The further steps toward building optimum conditions of the expressing system and the increase of expressed product are under study.
Xiang, Xi; Tang, Yuanjiao; Leng, Qianying; Zhang, Lingyan; Qiu, Li
2016-02-01
The purpose of this study was to optimize an ultrasound-targeted microbubble destruction (UTMD) technique to improve the in vivo transfection efficiency of the gene encoding enhanced green fluorescent protein (EGFP) in the synovial pannus in an antigen-induced arthritis rabbit model. A mixture of microbubbles and plasmids was locally injected into the knee joints of an antigen-induced arthritis (AIA) rabbits. The plasmid concentrations and ultrasound conditions were varied in the experiments. We also tested local articular and intravenous injections. The rabbits were divided into five groups: (1) ultrasound+microbubbles+plasmid; (2) ultrasound+plasmid; (3) microbubble+plasmid; (4) plasmid only; (5) untreated controls. EGFP expression was observed by fluorescent microscope and immunohistochemical staining in the synovial pannus of each group. The optimal plasmid dosage and ultrasound parameter were determined based on the results of EGFP expression and the present and absent of tissue damage under light microscopy. The irradiation procedure was performed to observe the duration of the EGFP expression in the synovial pannus and other tissues and organs, as well as the damage to the normal cells. The optimal condition was determined to be a 1-MHz ultrasound pulse applied for 5 min with a power output of 2 W/cm(2) and a 20% duty cycle along with 300 μg of plasmid. Under these conditions, the synovial pannus showed significant EGFP expression without significant damage to the surrounding normal tissue. The EGFP expression induced by the local intra-articular injection was significantly more increased than that induced by the intravenous injection. The EGFP expression in the synovial pannus of the ultrasound+microbubbles+plasmid group was significantly higher than that of the other four groups (P<0.05). The expression peaked on day 5, remained detectable on day 40 and disappeared on day 60. No EGFP expression was detected in the other tissues and organs. The UTMD technique can significantly enhance the in vivo gene transfection efficiency without significant tissue damage in the synovial pannus of an AIA model. Thus, this could become a safe and effective non-viral gene transfection procedure for arthritis therapy. Copyright © 2015 Elsevier B.V. All rights reserved.
Giguère, Steeve; Hondalus, Mary K.; Yager, Julie A.; Darrah, Patricia; Mosser, David M.; Prescott, John F.
1999-01-01
Rhodococcus equi is a facultative intracellular pathogen of macrophages and a cause of pneumonia in young horses (foals) and immunocompromised people. Isolates of R. equi from pneumonic foals typically contain large, 85- or 90-kb plasmids encoding a highly immunogenic virulence-associated protein (VapA). The objective of this study was to determine the role of the 85-kb plasmid and VapA in the intracellular survival and virulence of R. equi. Clinical isolates containing the plasmid and expressing VapA efficiently replicated within mouse macrophages in vitro, while plasmid-cured derivatives of these organisms did not multiply intracellularly. An isolate harboring the large plasmid also replicated in the tissues of experimentally infected mice, whereas its plasmid-cured derivative was rapidly cleared. All foals experimentally infected with a plasmid-containing clinical isolate developed severe bronchopneumonia, whereas the foals infected with its plasmid-cured derivative remained asymptomatic and free of visible lung lesions. By day 14 postinfection, lung bacterial burdens had increased considerably in foals challenged with the plasmid-containing clinical isolate. In contrast, bacteria could no longer be cultured from the lungs of foals challenged with the isogenic plasmid-cured derivative. A recombinant, plasmid-cured derivative expressing wild-type levels of VapA failed to replicate in macrophages and remained avirulent for both mice and foals. These results show that the 85-kb plasmid of R. equi is essential for intracellular replication within macrophages and for development of disease in the native host, the foal. However, expression of VapA alone is not sufficient to restore the virulence phenotype. PMID:10377138
Cloning of cellulase genes from acidothermus cellulolyticus
Lastick, deceased, Stanley M.; Tucker, Melvin P.; Grohmann, Karel
1996-01-01
A process is described for moving fragments that code for cellulase activity from the genome of A. cellulolyticus to several plasmid vectors and the subsequent expression of active cellulase acitivty in E. coli.
Electrotransfer of Plasmid Vector DNA into Muscle
NASA Astrophysics Data System (ADS)
Miyazaki, Satsuki; Miyazaki, Jun-Ichi
Wolff et al. (1990) first reported that plasmid DNA injected into skeletal muscle is taken up by muscle cells and the genes in the plasmid are expressed for more than two months thereafter, although the transfected DNA does not usually undergo chromosomal integration (Wolff et al., 1991, 1992). However, the relatively low expression levels attained by this method have hampered its applications for uses other than as a DNA vaccine (Davis et al., 1995). There are a number of reports analyzing the conditions that affect the efficiency of gene transfer by intramuscular DNA injection and assessing the fine structures of expression plasmid vectors that may affect expression levels (Davis et al., 1993; Liang et al., 1996; Norman et al., 1997). Furthermore, various attempts were done to improve the efficiency of gene transfer by intramus cular DNA injection. Consequently, regenerating muscle was shown to produce 80-fold or more protein than did normal muscle, following injection of an expression plas-mid. Muscle regeneration was induced by treatment with cardiotoxin or bupivacaine (Wells, 1993; Vitadello et al., 1994). We previously demonstrated that by combining a strong promoter and bupivacaine pretreatment intramuscular injection of an IL-5 expression plasmid results in IL-5 production in muscle at a level sufficient to induce marked proliferation of eosinophils in the bone marrow and eosinophil infiltration of various organs (Tokui et al., 1997). It was also reported that a single intramuscular injection of an erythropoietin expression plasmid produced physiologically significant elevations in serum erythropoietin levels and increased hematocrits in adult mice (Tripathy et al., 1996). Hematocrits in these animals remained elevated at >60% for at least 90 days after a single injection. However, improvements to this method have not been sufficient to extend its applications including clinical use.
Cloning of cellulase genes from Acidothermus cellulolyticus
Lastick, S.M.; Tucker, M.P.; Grohmann, K.
1996-05-07
A process is described for moving fragments that code for cellulase activity from the genome of A. cellulolyticus to several plasmid vectors and the subsequent expression of active cellulase activity in E. coli. 5 figs.
Coulson, Garry B.; Miranda-CasoLuengo, Aleksandra A.; Miranda-CasoLuengo, Raúl; Wang, Xiaoguang; Oliver, Jenna; Willingham-Lane, Jennifer M.
2015-01-01
Rhodococcus equi is a facultative intracellular pathogen of macrophages, relying on the presence of a conjugative virulence plasmid harboring a 21-kb pathogenicity island (PAI) for growth in host macrophages. The PAI encodes a family of 6 virulence-associated proteins (Vaps) in addition to 20 other proteins. The contribution of these to virulence has remained unclear. We show that the presence of only 3 virulence plasmid genes (of 73 in total) is required and sufficient for intracellular growth. These include a single vap family member, vapA, and two PAI-located transcriptional regulators, virR and virS. Both transcriptional regulators are essential for wild-type-level expression of vapA, yet vapA expression alone is not sufficient to allow intracellular growth. A whole-genome microarray analysis revealed that VirR and VirS substantially integrate themselves into the chromosomal regulatory network, significantly altering the transcription of 18% of all chromosomal genes. This pathoadaptation involved significant enrichment of select gene ontologies, in particular, enrichment of genes involved in transport processes, energy production, and cellular metabolism, suggesting a major change in cell physiology allowing the bacterium to grow in the hostile environment of the host cell. The results suggest that following the acquisition of the virulence plasmid by an avirulent ancestor of R. equi, coevolution between the plasmid and the chromosome took place, allowing VirR and VirS to regulate the transcription of chromosomal genes in a process that ultimately promoted intracellular growth. Our findings suggest a mechanism for cooption of existing chromosomal traits during the evolution of a pathogenic bacterium from an avirulent saprophyte. PMID:26015480
Genetic Stability of Streptomyces Lividans pIJ702 in Response to Spaceflight
NASA Astrophysics Data System (ADS)
Lim, K. S.; Goins, T. L.; Voeikova, T. A.; Pyle, B. H.
2008-06-01
Streptomyces lividans carrying plasmid pIJ702 encoding genes for thiostrepton resistance (tsr-) and melanin production (mel+) was plated on agar and flown on the Russian satellite Foton-M3 for 16 days. The percentage loss of plasmid expression in flight samples was lower than that in ground samples when both samples were grown in enriched (ISP) media. Differences in media content also affect plasmid expression rate; ISP media have a higher loss of plasmid expression than samples in minimum media when both were grown on ground conditions. Results suggest that stress resulted in the increased expression of plasmid pIJ702 by S. lividans. Screening of thiostrepton resistant white (tsr+ mel-) mutants showed similar proportions of variants in ground samples and flight samples. To determine if there are mutations in the mel gene, DNA extracted from flight and control white mutants was amplified and gel electrophoresis of amplified products show no major mutation in the products. Sequencing of amplified products is required to identify mutations resulting in loss of pigmentation.
Tran, Dinh Thi Minh; Phan, Trang Thi Phuong; Huynh, Thanh Kieu; Dang, Ngan Thi Kim; Huynh, Phuong Thi Kim; Nguyen, Tri Minh; Truong, Tuom Thi Tinh; Tran, Thuoc Linh; Schumann, Wolfgang; Nguyen, Hoang Duc
2017-07-25
Besides Escherichia coli, Bacillus subtilis is an important bacterial species for the production of recombinant proteins. Recombinant genes are inserted into shuttle expression vectors which replicate in both E. coli and in B. subtilis. The ligation products are first transformed into E. coli cells, analyzed for correct insertions, and the correct recombinant plasmids are then transformed into B. subtilis. A major problem using E. coli cells can be the strong basal level of expression of the recombinant protein which may interfere with the stability of the cells. To minimize this problem, we developed strong expression vectors being repressed in E. coli and inducer-free in B. subtilis. In general, induction of IPTG-inducible expression vectors is determined by the regulatory lacI gene encoding the LacI repressor in combination with the lacO operator on the promoter. To investigate the inducer-free properties of the vectors, we constructed inducer-free expression plasmids by removing the lacI gene and characterized their properties. First, we examined the ability to repress a reporter gene in E. coli, which is a prominent property facilitating the construction of the expression vectors carrying a target gene. The β-galactosidase (bgaB gene) basal levels expressed from Pgrac01-bgaB could be repressed at least twice in the E. coli cloning strain. Second, the inducer-free production of BgaB from four different plasmids with the Pgrac01 promoter in B. subtilis was investigated. As expected, BgaB expression levels of inducer-free constructs are at least 37 times higher than that of the inducible constructs in the absence of IPTG, and comparable to those in the presence of the inducer. Third, using efficient IPTG-inducible expression vectors containing the strong promoter Pgrac100, we could convert them into inducer-free expression plasmids. The BgaB production levels from the inducer-free plasmid in the absence of the inducer were at least 4.5 times higher than that of the inducible vector using the same promoter. Finally, we used gfp as a reporter gene in combination with the two promoters Pgrac01 and Pgrac100 to test the new vector types. The GFP expression levels could be repressed at least 1.5 times for the Pgrac01-gfp+ inducer-free construct in E. coli. The inducer-free constructs Pgrac01-gfp+ and Pgrac100-gfp+ allowed GFP expression at high levels from 23 × 10 4 to 32 × 10 4 RFU units and 9-13% of total intracellular proteins. We could reconfirm the two major advantages of the new inducer-free expression plasmids: (1) Strong repression of the target gene expression in the E. coli cloning strain, and (2) production of the target protein at high levels in B. subtilis in the absence of the inducer. We propose a general strategy to generate inducer-free expression vector by using IPTG-inducible vectors, and more specifically we developed inducer-free expression plasmids using IPTG-inducible promoters in the absence of the LacI repressor. These plasmids could be an excellent choice for high-level production of recombinant proteins in B. subtilis without the addition of inducer and at the same time maintaining a low basal level of the recombinant proteins in E. coli. The repression of the recombinant gene expression would facilitate cloning of genes that potentially inhibit the growth of E. coli cloning strains. The inducer-free expression plasmids will be extended versions of the current available IPTG-inducible expression vectors for B. subtilis, in which all these vectors use the same cognate promoters. These inducer-free and previously developed IPTG-inducible expression plasmids will be a useful cassette to study gene expression at a small scale up to a larger scale up for the production of recombinant proteins.
Zhao, Yan; Cao, Yongsheng; Cui, Lihong; Ma, Bo; Mu, Xiaoyu; Li, Yanwei; Zhang, Zhihui; Li, Dan; Wei, Wei; Gao, Mingchun; Wang, Junwei
2014-01-01
DNA vaccine is a promising strategy for protection against virus infection. However, little is known on the efficacy of vaccination with two plasmids for expressing the glycoprotein D (gD) and glycoprotein B (gB) of duck enteritis virus (DEV) in inducing immune response and immunoprotection against virulent virus infection in Pekin ducks. In this study, two eukaryotic expressing plasmids of pcDNA3.1-gB and pcDNA3.1-gD were constructed. Following transfection, the gB and gD expressions in DF1 cells were detected. Groups of ducks were vaccinated with pcDNA3.1-gB and/or pcDNA3.1-gD, and boosted with the same vaccine on day 14 post primary vaccination. We found that intramuscular vaccinations with pcDNA3.1-gB and/or pcDNA3.1-gD, but not control plasmid, stimulated a high frequency of CD4+ and CD8+ T cells in Pekin ducks, particularly with both plasmids. Similarly, vaccination with these plasmids, particularly with both plasmids, promoted higher levels of neutralization antibodies against DEV in Pekin ducks. More importantly, vaccination with both plasmids significantly reduced the virulent DEV-induced mortality in Pekin ducks. Our data indicated that vaccination with plasmids for expressing both gB and gD induced potent cellular and humoral immunity against DEV in Pekin ducks. Therefore, this vaccination strategy may be used for the prevention of DEV infection in Pekin ducks. PMID:24736466
Zhao, Yan; Cao, Yongsheng; Cui, Lihong; Ma, Bo; Mu, Xiaoyu; Li, Yanwei; Zhang, Zhihui; Li, Dan; Wei, Wei; Gao, Mingchun; Wang, Junwei
2014-01-01
DNA vaccine is a promising strategy for protection against virus infection. However, little is known on the efficacy of vaccination with two plasmids for expressing the glycoprotein D (gD) and glycoprotein B (gB) of duck enteritis virus (DEV) in inducing immune response and immunoprotection against virulent virus infection in Pekin ducks. In this study, two eukaryotic expressing plasmids of pcDNA3.1-gB and pcDNA3.1-gD were constructed. Following transfection, the gB and gD expressions in DF1 cells were detected. Groups of ducks were vaccinated with pcDNA3.1-gB and/or pcDNA3.1-gD, and boosted with the same vaccine on day 14 post primary vaccination. We found that intramuscular vaccinations with pcDNA3.1-gB and/or pcDNA3.1-gD, but not control plasmid, stimulated a high frequency of CD4+ and CD8+ T cells in Pekin ducks, particularly with both plasmids. Similarly, vaccination with these plasmids, particularly with both plasmids, promoted higher levels of neutralization antibodies against DEV in Pekin ducks. More importantly, vaccination with both plasmids significantly reduced the virulent DEV-induced mortality in Pekin ducks. Our data indicated that vaccination with plasmids for expressing both gB and gD induced potent cellular and humoral immunity against DEV in Pekin ducks. Therefore, this vaccination strategy may be used for the prevention of DEV infection in Pekin ducks.
Manipulation of VviAGL11 expression changes the seed content in grapevine (Vitis vinifera L.).
Malabarba, Jaiana; Buffon, Vanessa; Mariath, Jorge E A; Maraschin, Felipe S; Margis-Pinheiro, Márcia; Pasquali, Giancarlo; Revers, Luís F
2018-04-01
Seedlessness in grapes is a desirable trait, especially for in natura consumption. Previously, we showed that VviAGL11 is the main responsible gene for seed morphogenesis in grapevine. Here we tested the function of this gene in grapevine with the use of plant plasmids. VviAGL11 was cloned into silencing and overexpression versions of p28iIR plasmid. Reproductive grapevine bunches from different seeded and seedless cultivars were separately treated with VviAGL11-harboring plasmids, along with controls. Plasmids were detected in leaves after a month of treatment, and berries, leaves, stems and seeds were analyzed for ectopic gene expression by RT-qPCR after 90 days of plasmid injection. Fruits from the seedless 'Linda' treated with the VviAGL11-overexpression plasmid showed high expression levels of VviAGL11 and exhibited small seeds that were not found in the untreated control samples. Mature grapes from seeded 'Italia' and 'Ruby' bunches treated with the VviAGL11-silencing plasmid showed decreased VviAGL11 expression, reduced number of seeds and increased number of seed traces. The present study confirms that VviAGL11 is a key master regulator of seed morphogenesis in grapevine and corroborates with the applicability of plant plasmids as promising biotechnological tools to functionally test genes in perennial plants in a rapid and confident way. Copyright © 2018 Elsevier B.V. All rights reserved.
Reporter gene expression in dendritic cells after gene gun administration of plasmid DNA.
Watkins, Craig; Hopkins, John; Harkiss, Gordon
2005-07-21
Dendritic cells (DC) play an integral role in plasmid DNA vaccination. However, the interaction between plasmid DNA and DC in vivo is incompletely understood. In this report, we utilise the sheep pseudoafferent cannulation model to examine the interaction between plasmid DNA encoding enhanced green fluorescent protein (pEGFP) and afferent lymph DC (ALDC) following gene gun administration. The results show that peaks of fluorescent ALDC tended to appear around days 1-4 and 9-13, then erratically thereafter for up to 2 months. Phenotypic analysis showed that EGFP+ ALDC expressed MHC class II, WC6, CD1b, and SIRPalpha markers. Plasmid, detected by PCR, was found in lymph cells and cell-free plasma on a daily basis, and was present variably for up to 2 months. Plasmid was also detected in purified CD1b+ ALDC, but the presence of plasmid did not correlate with EGFP expression by ALDC. Free EGFP in afferent lymph plasma was detectable by luminometry only after three administrations of the plasmid. The results show that gene gun administered pEGFP persisted for extended periods after a single administration, leeching out of skin on a daily basis. The plasmid was associated with both the cellular and fluid components of afferent lymph. EGFP protein appeared in afferent lymph in a pulsatile manner, but associated only with ALDC.
Construction of pTM series plasmids for gene expression in Brucella species.
Tian, Mingxing; Qu, Jing; Bao, Yanqing; Gao, Jianpeng; Liu, Jiameng; Wang, Shaohui; Sun, Yingjie; Ding, Chan; Yu, Shengqing
2016-04-01
Brucellosis, the most common widespread zoonotic disease, is caused by Brucella spp., which are facultative, intracellular, Gram-negative bacteria. With the development of molecular biology techniques, more and more virulence-associated factors have been identified in Brucella spp. A suitable plasmid system is an important tool to study virulence genes in Brucella. In this study, we constructed three constitutive replication plasmids (pTM1-Cm, pTM2-Amp, and pTM3-Km) using the replication origin (rep) region derived from the pBBR1-MCS vector. Also, a DNA fragment containing multiple cloning sites (MCSs) and a terminator sequence derived from the pCold vector were produced for complementation of the deleted genes. Besides pGH-6×His, a plasmid containing the groE promoter of Brucella spp. was constructed to express exogenous proteins in Brucella with high efficiency. Furthermore, we constructed the inducible expression plasmid pZT-6×His, containing the tetracycline-inducible promoter pzt1, which can induce expression by the addition of tetracycline in the Brucella culture medium. The constructed pTM series plasmids will play an important role in the functional investigation of Brucella spp. Copyright © 2016 Elsevier B.V. All rights reserved.
Nácher-Vázquez, Montserrat; Ruiz-Masó, José A.; Mohedano, María L.; del Solar, Gloria; Aznar, Rosa; López, Paloma
2017-01-01
The exopolysaccharide synthesized by Lactobacillus sakei MN1 is a dextran with antiviral and immunomodulatory properties of potential utility in aquaculture. In this work we have investigated the genetic basis of dextran production by this bacterium. Southern blot hybridization experiments demonstrated the plasmidic location of the dsrLS gene, which encodes the dextransucrase involved in dextran synthesis. DNA sequencing of the 11,126 kbp plasmid (pMN1) revealed that it belongs to a family which replicates by the theta mechanism, whose prototype is pUCL287. The plasmid comprises the origin of replication, repA, repB, and dsrLS genes, as well as seven open reading frames of uncharacterized function. Lb. sakei MN1 produces dextran when sucrose, but not glucose, is present in the growth medium. Therefore, plasmid copy number and stability, as well as dsrLS expression, were investigated in cultures grown in the presence of either sucrose or glucose. The results revealed that pMN1 is a stable low-copy-number plasmid in both conditions. Gene expression studies showed that dsrLS is constitutively expressed, irrespective of the carbon source present in the medium. Moreover, dsrLS is expressed from a monocistronic transcript as well as from a polycistronic repA-repB-orf1-dsrLS mRNA. To our knowledge, this is the first report of a plasmid-borne dextransucrase-encoding gene, as well as the first time that co-transcription of genes involved in plasmid maintenance and replication with a gene encoding an enzyme has been established. PMID:29209293
Dong, Xiaoya; Zhang, Ke; Gao, Yuqian; Qi, Yuancheng; Shen, Jinwen; Qiu, Liyou
2012-01-01
Three hygromycin B phosphotransferase (hph) gene expression systems for culinary-medicinal Oyster mushroom, Pleurotus ostreatus, plasmid pSHC, pAN7-1, and pBHt1 were evaluated through PEG/CaCl(2)-mediated protoplast transformation. Plasmid pSHC is a newly constructed hph gene expression system, composed of Escherichia coli hph gene, the P. ostreatus sdi promoter, and the CaMV35S terminator. The vector pAN7-1 was commonly used for integrative transformation in filamentous fungi. Plasmid pBHtl is a T-DNA binary vector, usually introduced into fungi by Agrobacterium-mediated transformation. The results showed that plasmids pSHC, pAN7-1, and pBHt1 were all integrated into the host chromosomes and expressed hygromycin B resistance in P. ostreatus. pAN7-1 had the highest transformation efficiency and hph gene expression level, pSHC the second, and pBHt1 the lowest. Growth rates of the transformants on plates containing hygromycin B were in correspondence with their hph gene expression levels. To our knowledge, this is the first report on integrated transformation of plasmid pAN7-1 and pBHt1 in P. ostreatus.
Gene delivery by a steroid-peptide nucleic acid conjugate.
Rebuffat, Alexandre G; Nawrocki, Andrea R; Nielsen, Peter E; Bernasconi, Alessio G; Bernal-Mendez, Eloy; Frey, Brigitte M; Frey, Felix J
2002-09-01
We previously introduced a method called steroid-mediated gene delivery (SMGD), which uses steroid receptors as shuttles to facilitate the nuclear uptake of transfected DNA. Here, we describe a SMGD strategy with peptide nucleic acids (PNAs) that allowed linkage of a steroid molecule to a defined position in a plasmid without disturbing its gene expression. We synthesized and tested several bifunctional steroid derivatives [patent in process of nationalization] and finally selected the compound named DEX-bisPNA, a molecule consisting of a dexamethasone moiety linked to a PNA clamp (bisPNA) through a 30-atom chemical spacer. Dex-bisPNA binds to the glucocorticoid receptor (GR) as well as to reporter plasmids containing the corresponding PNA binding sites, translocates the GR from the cytoplasm into the nucleus, and increases the delivery of plasmid to the nucleus, resulting in enhanced GR-dependent expression of the reporter gene. The SMGD effect was more pronounced in growth-arrested cells than in proliferating cells. The specificity for the GR was shown by the reversion of the SMGD effect in the presence of dexamethasone as well as an enhanced expression in GR-positive cells but not in GR-negative cells. Thus, SMGD with PNA is a promising strategy for nonviral gene delivery into target tissues expressing specific steroid receptors.
Su, Buli; Zhang, Zhe; Wu, Mianbin; Lin, Jianping; Yang, Lirong
2016-05-26
High costs and low production efficiency are a serious constraint to bio-based xylitol production. For industrial-scale production of xylitol, a plasmid-free Escherichia coli for arabitol-free xylitol production from corncob hemicellulosic hydrolysate has been constructed. Instead of being plasmid and inducer dependent, this strain relied on multiple-copy integration of xylose reductase (XR) genes into the chromosome, where their expression was controlled by the constitutive promoter P43. In addition, to minimize the flux from L-arabinose to arabitol, two strategies including low XR total activity and high selectivity of XR has been adopted. Arabitol was significantly decreased using plasmid-free strain which had lower XR total activity and an eight point-mutations of XR with a 27-fold lower enzyme activity toward L-arabinose was achieved. The plasmid-free strain in conjunction with this mutant XR can completely eliminate arabitol formation in xylitol production. In fed-batch fermentation, this plasmid-free strain produced 143.8 g L(-1) xylitol at 1.84 g L(-1) h(-1) from corncob hemicellulosic hydrolysate. From these results, we conclude that this route by plasmid-free E. coli has potential to become a commercially viable process for xylitol production.
Su, Buli; Zhang, Zhe; Wu, Mianbin; Lin, Jianping; Yang, Lirong
2016-01-01
High costs and low production efficiency are a serious constraint to bio-based xylitol production. For industrial-scale production of xylitol, a plasmid-free Escherichia coli for arabitol-free xylitol production from corncob hemicellulosic hydrolysate has been constructed. Instead of being plasmid and inducer dependent, this strain relied on multiple-copy integration of xylose reductase (XR) genes into the chromosome, where their expression was controlled by the constitutive promoter P43. In addition, to minimize the flux from L-arabinose to arabitol, two strategies including low XR total activity and high selectivity of XR has been adopted. Arabitol was significantly decreased using plasmid-free strain which had lower XR total activity and an eight point-mutations of XR with a 27-fold lower enzyme activity toward L-arabinose was achieved. The plasmid-free strain in conjunction with this mutant XR can completely eliminate arabitol formation in xylitol production. In fed-batch fermentation, this plasmid-free strain produced 143.8 g L−1 xylitol at 1.84 g L−1 h−1 from corncob hemicellulosic hydrolysate. From these results, we conclude that this route by plasmid-free E. coli has potential to become a commercially viable process for xylitol production. PMID:27225023
Douris, Aphrodite; Fedorka-Cray, Paula J; Jackson, Charlene R
2007-01-01
A total of 60 Salmonella enterica serovar Agona isolates (25 pan-susceptible isolates and 35 isolates resistant to five or more antimicrobials) submitted to the National Antimicrobial Resistance Monitoring System-Enteric Bacteria (NARMS) from 1997 through 2003 were examined for plasmids and class 1 integrons. Samples originated from cattle, turkey, chicken, and swine presented at federally inspected slaughter and processing plants. Large plasmids (33-291 kb) were present in 83% of the isolates resistant to five or more antimicrobials; however, 16% of the pan-susceptible isolates also had large plasmids. The presence of large plasmids did not correspond to the isolate source or the year the isolate was recovered but did appear to correspond to XbaI pulsed-field gel electrophoresis (PFGE) patterns. Two sizes of large plasmids appeared most often: 145.4 kb and 97 kb. Class 1 integrons were not detected on plasmids but were detected on the chromosome of 8% (2/25) of the pan-susceptible isolates and 49% (17/35) of the isolates with multiple drug resistance. Expression of multiple drug resistance among S. Agona isolates occurred regardless of the presence of class 1 integrons, suggesting that plasmids play an equally important role in the development of resistant S. Agona. More research is needed to understand better the mechanisms by which S. Agona acquires, harbors, and transfers resistance determinants.
Hosseinkhani, Hossein; Tabata, Yasuhiko
2004-05-31
The objective of this study is to investigate feasibility of a non-viral gene carrier with repeated RGD sequences (Pronectin F+) in tumor targeting for gene expression. The Pronectin F+ was cationized by introducing spermine (Sm) to the hydroxyl groups to allow to polyionically complex with plasmid DNA. The cationized Pronectin F+ prepared was additionally modified with poly(ethylene glycol) (PEG) molecules which have active ester and methoxy groups at the terminal, to form various PEG-introduced cationized Pronectin F+. The cationized Pronectin F+ with or without PEGylation at different extents was mixed with a plasmid DNA of LacZ to form respective cationized Pronectin F+-plasmid DNA complexes. The plasmid DNA was electrophoretically complexed with cationized Pronectin F+ and PEG-introduced cationized Pronectin F+, irrespective of the PEGylation extent, although the higher N/P ratio of complexes was needed for complexation with the latter Pronectin F+. The molecular size and zeta potential measurements revealed that the plasmid DNA was reduced in size to about 250 nm and the charge was changed to be positive by the complexation with cationized Pronectin F+. For the complexation with PEG-introduced cationized Pronectin F+, the charge of complex became neutral being almost 0 mV with the increasing PEGylation extents, while the molecular size was similar to that of cationized Pronectin F+. When cationized Pronectin F+-plasmid DNA complexes with or without PEGylation were intravenously injected to mice carrying a subcutaneous Meth-AR-1 fibrosarcoma mass, the PEG-introduced cationized Pronectin F+-plasmid DNA complex specifically enhanced the level of gene expression in the tumor, to a significantly high extent compared with the cationized Pronectin F+-plasmid DNA complexes and free plasmid DNA. The enhanced level of gene expression depended on the percentage of PEG introduced, the N/P ratio, and the plasmid DNA dose. A fluorescent microscopic study revealed that the localization of plasmid DNA in the tumor tissue was observed only for the PEG-introduced cationized Pronectin F+-plasmid DNA complex injected. We conclude that the PEGylation of cationized Pronectin F+ is a promising way to enable the plasmid DNA to target to the tumor for gene expression. Coyright 2004 Elsevier B.V.
Yang, Shihui; Vera, Jessica M; Grass, Jeff; Savvakis, Giannis; Moskvin, Oleg V; Yang, Yongfu; McIlwain, Sean J; Lyu, Yucai; Zinonos, Irene; Hebert, Alexander S; Coon, Joshua J; Bates, Donna M; Sato, Trey K; Brown, Steven D; Himmel, Michael E; Zhang, Min; Landick, Robert; Pappas, Katherine M; Zhang, Yaoping
2018-01-01
Zymomonas mobilis is a natural ethanologen being developed and deployed as an industrial biofuel producer. To date, eight Z. mobilis strains have been completely sequenced and found to contain 2-8 native plasmids. However, systematic verification of predicted Z. mobilis plasmid genes and their contribution to cell fitness has not been hitherto addressed. Moreover, the precise number and identities of plasmids in Z. mobilis model strain ZM4 have been unclear. The lack of functional information about plasmid genes in ZM4 impedes ongoing studies for this model biofuel-producing strain. In this study, we determined the complete chromosome and plasmid sequences of ZM4 and its engineered xylose-utilizing derivatives 2032 and 8b. Compared to previously published and revised ZM4 chromosome sequences, the ZM4 chromosome sequence reported here contains 65 nucleotide sequence variations as well as a 2400-bp insertion. Four plasmids were identified in all three strains, with 150 plasmid genes predicted in strain ZM4 and 2032, and 153 plasmid genes predicted in strain 8b due to the insertion of heterologous DNA for expanded substrate utilization. Plasmid genes were then annotated using Blast2GO, InterProScan, and systems biology data analyses, and most genes were found to have apparent orthologs in other organisms or identifiable conserved domains. To verify plasmid gene prediction, RNA-Seq was used to map transcripts and also compare relative gene expression under various growth conditions, including anaerobic and aerobic conditions, or growth in different concentrations of biomass hydrolysates. Overall, plasmid genes were more responsive to varying hydrolysate concentrations than to oxygen availability. Additionally, our results indicated that although all plasmids were present in low copy number (about 1-2 per cell), the copy number of some plasmids varied under specific growth conditions or due to heterologous gene insertion. The complete genome of ZM4 and two xylose-utilizing derivatives is reported in this study, with an emphasis on identifying and characterizing plasmid genes. Plasmid gene annotation, validation, expression levels at growth conditions of interest, and contribution to host fitness are reported for the first time.
Peng, J B; Yan, W M; Bao, X Z
1994-07-01
Two arsenic-resistant plasmids were constructed and introduced into Thiobacillus ferrooxidans strains by conjugation. The plasmids with the replicon of wide-host-range plasmid RSF1010 were stable in T. ferrooxidans. The arsenic resistance genes originating from the heterotroph were expressed in this obligately autotrophic bacterium, but the promoter derived from T. ferrooxidans showed no special function in its original host.
Rapid high-throughput cloning and stable expression of antibodies in HEK293 cells.
Spidel, Jared L; Vaessen, Benjamin; Chan, Yin Yin; Grasso, Luigi; Kline, J Bradford
2016-12-01
Single-cell based amplification of immunoglobulin variable regions is a rapid and powerful technique for cloning antigen-specific monoclonal antibodies (mAbs) for purposes ranging from general laboratory reagents to therapeutic drugs. From the initial screening process involving small quantities of hundreds or thousands of mAbs through in vitro characterization and subsequent in vivo experiments requiring large quantities of only a few, having a robust system for generating mAbs from cloning through stable cell line generation is essential. A protocol was developed to decrease the time, cost, and effort required by traditional cloning and expression methods by eliminating bottlenecks in these processes. Removing the clonal selection steps from the cloning process using a highly efficient ligation-independent protocol and from the stable cell line process by utilizing bicistronic plasmids to generate stable semi-clonal cell pools facilitated an increased throughput of the entire process from plasmid assembly through transient transfections and selection of stable semi-clonal cell pools. Furthermore, the time required by a single individual to clone, express, and select stable cell pools in a high-throughput format was reduced from 4 to 6months to only 4 to 6weeks. Copyright © 2016 The Authors. Published by Elsevier B.V. All rights reserved.
Hong, Hyerim; Jung, Jaejoon; Park, Woojun
2014-01-01
Acquisition of the extracellular tetracycline (TC) resistance plasmid pAST2 affected host gene expression and phenotype in the oil-degrading soil bacterium, Acinetobacter oleivorans DR1. Whole-transcriptome profiling of DR1 cells harboring pAST2 revealed that all the plasmid genes were highly expressed under TC conditions, and the expression levels of many host chromosomal genes were modulated by the presence of pAST2. The host energy burden imposed by replication of pAST2 led to (i) lowered ATP concentrations, (ii) downregulated expression of many genes involved in cellular growth, and (iii) reduced growth rate. Interestingly, some phenotypes were restored by deleting the plasmid-encoded efflux pump gene tetH, suggesting that the membrane integrity changes resulting from the incorporation of efflux pump proteins also resulted in altered host response under the tested conditions. Alteration of membrane integrity by tetH deletion was shown by measuring permeability of fluorescent probe and membrane hydrophobicity. The presence of the plasmid conferred peroxide and superoxide resistance to cells, but only peroxide resistance was diminished by tetH gene deletion, suggesting that the plasmid-encoded membrane-bound efflux pump protein provided peroxide resistance. The downregulation of fimbriae-related genes presumably led to reduced swimming motility, but this phenotype was recovered by tetH gene deletion. Our data suggest that not only the plasmid replication burden, but also its encoded efflux pump protein altered host chromosomal gene expression and phenotype, which also alters the ecological fitness of the host in the environment. PMID:25229538
Hong, Hyerim; Jung, Jaejoon; Park, Woojun
2014-01-01
Acquisition of the extracellular tetracycline (TC) resistance plasmid pAST2 affected host gene expression and phenotype in the oil-degrading soil bacterium, Acinetobacter oleivorans DR1. Whole-transcriptome profiling of DR1 cells harboring pAST2 revealed that all the plasmid genes were highly expressed under TC conditions, and the expression levels of many host chromosomal genes were modulated by the presence of pAST2. The host energy burden imposed by replication of pAST2 led to (i) lowered ATP concentrations, (ii) downregulated expression of many genes involved in cellular growth, and (iii) reduced growth rate. Interestingly, some phenotypes were restored by deleting the plasmid-encoded efflux pump gene tetH, suggesting that the membrane integrity changes resulting from the incorporation of efflux pump proteins also resulted in altered host response under the tested conditions. Alteration of membrane integrity by tetH deletion was shown by measuring permeability of fluorescent probe and membrane hydrophobicity. The presence of the plasmid conferred peroxide and superoxide resistance to cells, but only peroxide resistance was diminished by tetH gene deletion, suggesting that the plasmid-encoded membrane-bound efflux pump protein provided peroxide resistance. The downregulation of fimbriae-related genes presumably led to reduced swimming motility, but this phenotype was recovered by tetH gene deletion. Our data suggest that not only the plasmid replication burden, but also its encoded efflux pump protein altered host chromosomal gene expression and phenotype, which also alters the ecological fitness of the host in the environment.
Elimination of the cryptic plasmid in Leuconostoc citreum by CRISPR/Cas9 system.
Jang, Ye-Ji; Seo, Seung-Oh; Kim, Seul-Ah; Li, Ling; Kim, Tae-Jip; Kim, Sun Chang; Jin, Yong-Su; Han, Nam Soo
2017-06-10
Leuconostoc spp. are important lactic acid bacteria for the fermentation of foods. In particular, L. citreum strains isolated from various foods have been used as host strains for genetic and metabolic engineering studies. In order to develop a food-grade genetic engineering system, L. citreum CB2567 was isolated from Kimchi. However, the isolated bacterium contained a cryptic plasmid which was difficult to eliminate. As the existence of the plasmid might hinder strain engineering, we eliminated the plasmid using an RNA-guided DNA endonuclease CRISPR/Cas9 system. We demonstrated that a plasmid-free L. citreum CB2567 host strain could be efficiently constructed through a two-step procedure: 1) transformation of the "killer" plasmid expressing Cas9 endonuclease and a guide RNA (gRNA) targeting for a specific sequence in the cryptic plasmid, and 2) serial subculture without antibiotics for curing the killer plasmid. When the crude extract of L. citreum expressing Cas9 and the guide RNA was incubated with a PCR fragment containing the specific sequence recognized by the guide RNA, the PCR fragment was cleaved. Also, the cryptic plasmid pCB42 was successfully eliminated from the host strain after transforming the plasmid harboring Cas9 and the guide RNA. The Cas9 and gRNA expression plasmid used in this study can be applied for genome engineering purposes by additionally introducing an editing DNA template to repair the double strand DNA breakage caused by Cas9 in the genome of L. citreum. This study demonstrates the feasibility of developing CRISPR/Cas9-based genetic engineering tools to develop a safe host strain and construct food-grade lactic acid bacteria without residual antibiotic markers. Copyright © 2017 Elsevier B.V. All rights reserved.
A plasmid-based reverse genetics system for influenza A virus.
Pleschka, S; Jaskunas, R; Engelhardt, O G; Zürcher, T; Palese, P; García-Sastre, A
1996-01-01
A reverse genetics system for negative-strand RNA viruses was first successfully developed for influenza viruses. This technology involved the transfection of in vitro-reconstituted ribonucleoprotein (RNP) complexes into influenza virus-infected cells. We have now developed a method that allows intracellular reconstitution of RNP complexes from plasmid-based expression vectors. Expression of a viral RNA-like transcript is achieved from a plasmid containing a truncated human polymerase I (polI) promoter and a ribozyme sequence that generates the desired 3' end by autocatalytic cleavage. The polI-driven plasmid is cotransfected into human 293 cells with polII-responsive plasmids that express the viral PB1, PB2, PA, and NP proteins. This exclusively plasmid-driven system results in the efficient transcription and replication of the viral RNA-like reporter and allows the study of cis- and trans-acting signals involved in the transcription and replication of influenza virus RNAs. Using this system, we have also been able to rescue a synthetic neuraminidase gene into a recombinant influenza virus. This method represents a convenient alternative to the previously established RNP transfection system. PMID:8648766
Gebhardt, Michael J; Jacobson, Rachael K; Shuman, Howard A
2017-01-01
The development of plasmid-mediated gene expression control in bacteria revolutionized the field of bacteriology. Many of these expression control systems rely on the addition of small molecules, generally metabolites or non-metabolized analogs thereof, to the growth medium to induce expression of the genes of interest. The paradigmatic example of an expression control system is the lac system from Escherichia coli, which typically relies on the Ptac promoter and the Lac repressor, LacI. In many cases, however, constitutive gene expression is desired, and other experimental approaches require the coordinated control of multiple genes. While multiple systems have been developed for use in E. coli and its close relatives, the utility and/or functionality of these tools does not always translate to other species. For example, for the Gram-negative pathogen, Legionella pneumophila, a causative agent of Legionnaires' Disease, the aforementioned Ptac system represents the only well-established expression control system. In order to enhance the tools available to study bacterial gene expression in L. pneumophila, we developed a plasmid, pON.mCherry, which confers constitutive gene expression from a mutagenized LacI binding site. We demonstrate that pON.mCherry neither interferes with other plasmids harboring an intact LacI-Ptac expression system nor alters the growth of Legionella species during intracellular growth. Furthermore, the broad-host range plasmid backbone of pON.mCherry allows constitutive gene expression in a wide variety of Gram-negative bacterial species, making pON.mCherry a useful tool for the greater research community.
Peng, Ji-Bin; Yan, Wang-Ming; Bao, Xue-Zhen
1994-01-01
Two arsenic-resistant plasmids were constructed and introduced into Thiobacillus ferrooxidans strains by conjugation. The plasmids with the replicon of wide-host-range plasmid RSF1010 were stable in T. ferrooxidans. The arsenic resistance genes originating from the heterotroph were expressed in this obligately autotrophic bacterium, but the promoter derived from T. ferrooxidans showed no special function in its original host. PMID:16349341
Shao, Jun-Li; Long, Yue-Sheng; Chen, Gu; Xie, Jun; Xu, Zeng-Fu
2010-06-01
Agrobacterium tumefaciens transfers DNA from its Ti plasmid to plant host cells. The genes located within the transferred DNA of Ti plasmid including the octopine synthase gene (OCS) are expressed in plant host cells. The 3'-flanking region of OCS gene, known as OCS terminator, is widely used as a transcriptional terminator of the transgenes in plant expression vectors. In this study, we found the reversed OCS terminator (3'-OCS-r) could drive expression of hygromycin phosphotransferase II gene (hpt II) and beta-glucuronidase gene in Escherichia coli, and expression of hpt II in A. tumefaciens. Furthermore, reverse transcription-polymerase chain reaction analysis revealed that an open reading frame (ORF12) that is located downstream to the 3'-OCS-r was transcribed in A. tumefaciens, which overlaps in reverse with the coding region of the OCS gene in octopine Ti plasmid.
Expression of recombinant myostatin propeptide pPIC9K-Msp plasmid in Pichia pastoris.
Du, W; Xia, J; Zhang, Y; Liu, M J; Li, H B; Yan, X M; Zhang, J S; Li, N; Zhou, Z Y; Xie, W Z
2015-12-28
Myostatin propeptide can inhibit the biological activity of myostatin protein and promote muscle growth. To express myostatin propeptide in vitro with a higher biological activity, we performed codon optimization on the sheep myostatin propeptide gene sequence, and mutated aspartic acid-76 to alanine based on the codon usage bias of Pichia pastoris and the enhanced biological activity of myostatin propeptide mutant. Modified myostatin propeptide gene was cloned into the pPIC9K plasmid to form the recombinant plasmid pPIC9K-Msp. Recombinant plasmid pPIC9K-Msp was transformed into Pichia pastoris GS115 by electrotransformation. Transformed cells were screened, and methanol was used to induce expression. SDS-PAGE and western blotting were used to verify the successful expression of myostatin propeptide with biological activity in Pichia pastoris, providing the basis for characterization of this protein.
Vectors for co-expression of an unrestricted number of proteins
Scheich, Christoph; Kümmel, Daniel; Soumailakakis, Dimitri; Heinemann, Udo; Büssow, Konrad
2007-01-01
A vector system is presented that allows generation of E. coli co-expression clones by a standardized, robust cloning procedure. The number of co-expressed proteins is not limited. Five ‘pQLink’ vectors for expression of His-tag and GST-tag fusion proteins as well as untagged proteins and for cloning by restriction enzymes or Gateway cloning were generated. The vectors allow proteins to be expressed individually; to achieve co-expression, two pQLink plasmids are combined by ligation-independent cloning. pQLink co-expression plasmids can accept an unrestricted number of genes. As an example, the co-expression of a heterotetrameric human transport protein particle (TRAPP) complex from a single plasmid, its isolation and analysis of its stoichiometry are shown. pQLink clones can be used directly for pull-down experiments if the proteins are expressed with different tags. We demonstrate pull-down experiments of human valosin-containing protein (VCP) with fragments of the autocrine motility factor receptor (AMFR). The cloning method avoids PCR or gel isolation of restriction fragments, and a single resistance marker and origin of replication are used, allowing over-expression of rare tRNAs from a second plasmid. It is expected that applications are not restricted to bacteria, but could include co-expression in other hosts such as Bacluovirus/insect cells. PMID:17311810
Luo, Zhao-Qing; Farrand, Stephen K.
2001-01-01
Conjugal transfer of Agrobacterium tumefaciens Ti plasmids is regulated by quorum sensing via TraR and its cognate autoinducer, N-(3-oxo-octanoyl)-l-homoserine lactone. We isolated four Tn5-induced mutants of A. tumefaciens C58 deficient in TraR-mediated activation of tra genes on pTiC58ΔaccR. These mutations also affected the growth of the bacterium but had no detectable influence on the expression of two tester gene systems that are not regulated by quorum sensing. In all four mutants Tn5 was inserted in a chromosomal open reading frame (ORF) coding for a product showing high similarity to RNase D, coded for by rnd of Escherichia coli, an RNase known to be involved in tRNA processing. The wild-type allele of the rnd homolog cloned from C58 restored the two phenotypes to each mutant. Several ORFs, including a homolog of cya2, surround A. tumefaciens rnd, but none of these genes exerted a detectable effect on the expression of the tra reporter. In the mutant, traR was expressed from the Ti plasmid at a level about twofold lower than that in NT1. The expression of tra, but not the growth rate, was partially restored by increasing the copy number of traR or by disrupting traM, a Ti plasmid gene coding for an antiactivator specific for TraR. The mutation in rnd also slightly reduced expression of two tested vir genes but had no detectable effect on tumor induction by this mutant. Our data suggest that the defect in tra gene induction in the mutants results from lowered levels of TraR. In turn, production of sufficient amounts of TraR apparently is sensitive to a cellular function requiring RNase D. PMID:11395455
Hou, Chao; Wu, Qianni; Ouyang, Chen; Huang, Ting
2016-09-01
In order to explore the potential effects of interleukin (IL)-35 on IL-10, transforming growth factor-β (TGF-β), interferon-γ (INF)-γ, IL-12 and IL-17, a pcDNA3.1‑IL-35 plasmid was injected into the vitreous cavity of BALB/c mice. Enzyme-linked immunosorbent assay, western blot analysis and quantitative PCR analysis were performed to confirm the successful expression of IL-35. Slit-lamp biomicroscopy, hematoxylin and eosin staining and immunofluorescence were employed to detect the status of eyes, and western blot analysis was performed to examine the expression of corneal graft rejection-related cytokines. There were no abnormalities in the eyes pre-mydriasis or post-mydriasis and no injuries to the cornea or retina following the injection of IL-35-expressing plasmid. An immunofluorescence assay detected the positive expression of IL-35 in corneal epithelial cells from IL-35‑injected mice and negative staining in the control group. Further study revealed that IL-35 enhanced the expression of IL-10 and TGF-β which reached their highest levels at 1 and 2 weeks after injection, respectively (p<0.01). Moreover, the expression of INF-γ and IL-12 was decreased significantly at 2 weeks after the injection of IL-35-expressing plasmid (p<0.05), and the expression of IL-17 was suppressed notably at 4 weeks after the injection (p<0.05). The intravitreal injection of IL-35-expressing plasmid in mice downregulates the expression of pro-inflammatory cytokines and upregulates the expression of anti-inflammatory cytokines. Thus, IL-35 may further be assessed as a potential target for the treatment of corneal graft rejection.
Deb, J K; Nath, N
1999-06-01
Corynebacteria are pleomorphic, asporogenous, Gram-positive bacteria. Included in this group are nonpathogenic soil corynebacteria, which are widely used for the industrial production of amino acids and detergents, and in biotransformation of steroids. Other members of this group are plant and animal pathogens. This review summarizes the current information available about the plasmids of corynebacteria. The emphasis is mainly on the small plasmids, which have been used for construction of vectors for expression of genes in these bacteria. Moreover, considerable information is now available on their nucleotide sequence, gene organization and modes of replication, which would make it possible to further manipulate these plasmids. Other plasmid properties, such as incompatibility and host range, are also discussed. Finally, use of these plasmids as cloning vectors for the expression of heterologous proteins using corynebacteria as hosts is also summarized to highlight the potential of these bacteria as hosts for recombinant DNA.
Live, attenuated Salmonella typhimurium vectoring Campylobacter antigens.
Sizemore, Donata R; Warner, Beth; Lawrence, Julie; Jones, Amy; Killeen, Kevin P
2006-05-01
We describe the evaluation of three live, attenuated deltaphoP/Q Salmonella enteric serovar Typhimurium strains expressing PEB1 minus its signal sequence (PEB1-ss) from three different plasmids: a pBR-based asd plasmid, an arabinose-based runaway plasmid, which each expressed PEB1-ss in the bacterial cytosol, and a PEB1::HlyA fusion plasmid that directs secretion of PEB1-ss into the extracellular milieu. Serum IgG responses specific for PEB1-ss were induced by pBR-derived and runaway plasmids, with 100 and 90% seroconversion, respectively, at a 1:500 dilution of anti-sera as measured by Western blot analysis, while the PEB1-ss::HlyA fusion plasmid induced serum IgG in only 20% of the mice. Although significant levels of anti-PEB serum IgG were induced, no protection against oral Campylobacter jejuni challenge was observed.
Imipenem-resistance in Serratia marcescens is mediated by plasmid expression of KPC-2.
Su, W-Q; Zhu, Y-Q; Deng, N-M; Li, L
2017-04-01
Imipenem is a broad-spectrum carbapenem antibiotic with applications against severe bacterial infections. Here, we describe the identification of imipenem-resistant Serratia marcescens in our hospital and the role of plasmid-mediated KPC-2 expression in imipenem resistance. We used the modified Hodge test to detect carbapenemase produced in imipenem-resistant strains. His resistance can be transferred to E. coli in co-culture tests, which implicates the plasmid in imipenem resistance. PCR amplification from the plasmid identified two products consistent with KPC-2 of 583 and 1050 bp that were also present in E. coli after co-culture. The restriction pattern for both plasmids was identical, supporting the transfer from the S. marcescens isolate to E. coli. Finally, gene sequencing confirmed KPC-2 in the plasmid. Due to the presence of KPC-2 in the imipenem-resistant S. marcescens, we propose that KPC-2 mediates antibiotic resistance in the S. marcescens isolate.
Hon, Shuen; Lanahan, Anthony; Tian, Liang; ...
2016-04-22
Clostridium thermocellum is a promising candidate for ethanol production from cellulosic biomass, but requires metabolic engineering to improve ethanol yield. A key gene in the ethanol production pathway is the bifunctional aldehyde and alcohol dehydrogenase, adhE. To explore the effects of overexpressing wild-type, mutant, and exogenous adhEs, we developed a new expression plasmid, pDGO144, that exhibited improved transformation efficiency and better gene expression than its predecessor, pDGO-66. This new expression plasmid will allow for many other metabolic engineering and basic research efforts in C. thermocellum. As proof of concept, we used this plasmid to express 12 different adhE genes (bothmore » wild type and mutant) from several organisms. Ethanol production varied between clones immediately after transformation, but tended to converge to a single value after several rounds of serial transfer. The previously described mutant C. thermocellum D494G adhE gave the best ethanol production, which is consistent with previously published results.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Hon, Shuen; Lanahan, Anthony; Tian, Liang
Clostridium thermocellum is a promising candidate for ethanol production from cellulosic biomass, but requires metabolic engineering to improve ethanol yield. A key gene in the ethanol production pathway is the bifunctional aldehyde and alcohol dehydrogenase, adhE. To explore the effects of overexpressing wild-type, mutant, and exogenous adhEs, we developed a new expression plasmid, pDGO144, that exhibited improved transformation efficiency and better gene expression than its predecessor, pDGO-66. This new expression plasmid will allow for many other metabolic engineering and basic research efforts in C. thermocellum. As proof of concept, we used this plasmid to express 12 different adhE genes (bothmore » wild type and mutant) from several organisms. Ethanol production varied between clones immediately after transformation, but tended to converge to a single value after several rounds of serial transfer. The previously described mutant C. thermocellum D494G adhE gave the best ethanol production, which is consistent with previously published results.« less
Hon, Shuen; Lanahan, Anthony A; Tian, Liang; Giannone, Richard J; Hettich, Robert L; Olson, Daniel G; Lynd, Lee R
2016-12-01
Clostridium thermocellum is a promising candidate for ethanol production from cellulosic biomass, but requires metabolic engineering to improve ethanol yield. A key gene in the ethanol production pathway is the bifunctional aldehyde and alcohol dehydrogenase, adhE . To explore the effects of overexpressing wild-type, mutant, and exogenous adhE s, we developed a new expression plasmid, pDGO144, that exhibited improved transformation efficiency and better gene expression than its predecessor, pDGO-66. This new expression plasmid will allow for many other metabolic engineering and basic research efforts in C. thermocellum . As proof of concept, we used this plasmid to express 12 different adhE genes (both wild type and mutant) from several organisms. Ethanol production varied between clones immediately after transformation, but tended to converge to a single value after several rounds of serial transfer. The previously described mutant C. thermocellum D494G adhE gave the best ethanol production, which is consistent with previously published results.
Reimer, D L; Kong, S; Monck, M; Wyles, J; Tam, P; Wasan, E K; Bally, M B
1999-05-01
The transfer of plasmid expression vectors to cells is essential for transfection after administration of lipid-based DNA formulations (lipoplexes). A murine i.p. B16/BL6 tumor model was used to characterize DNA delivery, liposomal lipid delivery, and gene transfer after regional (i.p.) administration of free plasmid DNA and DNA lipoplexes. DNA lipoplexes were prepared using cationic dioleoyldimethylammonium chloride/dioleoylphosphatidylethanolamine (50:50 mol ratio) liposomes mixed with plasmid DNA (1 microgram DNA/10 nmol lipid). The plasmid used contained the chloramphenicol acetyltransferase gene and chloramphenicol acetyltransferase expression (mU/g tumor) was measured to estimate transfection efficiency. Tumor-associated DNA and liposomal lipid levels were measured to estimate the efficiency of lipid-mediated DNA delivery to tumors. Plasmid DNA delivery was estimated using [3H]-labeled plasmid as a tracer, dot blot analysis, and/or Southern analysis. Liposomal lipid delivery was estimated using [14C]-dioleoylphosphatidylethanolamine as a liposomal lipid marker. Gene expression in the B16/BL6 tumors was highly variable, with values ranging from greater than 2,000 mU/g tumor to less than 100 mU/g tumor. There was a tendency to observe enhanced transfection in small (<250 mg) tumors. Approximately 18% of the injected dose of DNA was associated with these small tumors 2 h after i.p. administration. Southern analysis of extracted tumor DNA indicated that plasmid DNA associated with tumors was intact 24 h after administration. DNA and associated liposomal lipid are efficiently bound to tumors after regional administration; however, it is unclear whether delivery is sufficient to abet internalization and appropriate subcellular localization of the expression vector.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Yang, Shihui; Vera, Jessica M.; Grass, Jeff
Zymomonas mobilis is a natural ethanologen being developed and deployed as an industrial biofuel producer. To date, eight Z. mobilis strains have been completely sequenced and found to contain 2-8 native plasmids. However, systematic verification of predicted Z. mobilis plasmid genes and their contribution to cell fitness has not been hitherto addressed. Moreover, the precise number and identities of plasmids in Z. mobilis model strain ZM4 have been unclear. The lack of functional information about plasmid genes in ZM4 impedes ongoing studies for this model biofuel-producing strain. In this study, we determined the complete chromosome and plasmid sequences of ZM4more » and its engineered xylose-utilizing derivatives 2032 and 8b. Compared to previously published and revised ZM4 chromosome sequences, the ZM4 chromosome sequence reported here contains 65 nucleotide sequence variations as well as a 2400-bp insertion. Four plasmids were identified in all three strains, with 150 plasmid genes predicted in strain ZM4 and 2032, and 153 plasmid genes predicted in strain 8b due to the insertion of heterologous DNA for expanded substrate utilization. Plasmid genes were then annotated using Blast2GO, InterProScan, and systems biology data analyses, and most genes were found to have apparent orthologs in other organisms or identifiable conserved domains. To verify plasmid gene prediction, RNA-Seq was used to map transcripts and also compare relative gene expression under various growth conditions, including anaerobic and aerobic conditions, or growth in different concentrations of biomass hydrolysates. Overall, plasmid genes were more responsive to varying hydrolysate concentrations than to oxygen availability. Additionally, our results indicated that although all plasmids were present in low copy number (about 1-2 per cell), the copy number of some plasmids varied under specific growth conditions or due to heterologous gene insertion. The complete genome of ZM4 and two xylose-utilizing derivatives is reported in this study, with an emphasis on identifying and characterizing plasmid genes. Furthermore, plasmid gene annotation, validation, expression levels at growth conditions of interest, and contribution to host fitness are reported for the first time.« less
Yang, Shihui; Vera, Jessica M.; Grass, Jeff; ...
2018-05-02
Zymomonas mobilis is a natural ethanologen being developed and deployed as an industrial biofuel producer. To date, eight Z. mobilis strains have been completely sequenced and found to contain 2-8 native plasmids. However, systematic verification of predicted Z. mobilis plasmid genes and their contribution to cell fitness has not been hitherto addressed. Moreover, the precise number and identities of plasmids in Z. mobilis model strain ZM4 have been unclear. The lack of functional information about plasmid genes in ZM4 impedes ongoing studies for this model biofuel-producing strain. In this study, we determined the complete chromosome and plasmid sequences of ZM4more » and its engineered xylose-utilizing derivatives 2032 and 8b. Compared to previously published and revised ZM4 chromosome sequences, the ZM4 chromosome sequence reported here contains 65 nucleotide sequence variations as well as a 2400-bp insertion. Four plasmids were identified in all three strains, with 150 plasmid genes predicted in strain ZM4 and 2032, and 153 plasmid genes predicted in strain 8b due to the insertion of heterologous DNA for expanded substrate utilization. Plasmid genes were then annotated using Blast2GO, InterProScan, and systems biology data analyses, and most genes were found to have apparent orthologs in other organisms or identifiable conserved domains. To verify plasmid gene prediction, RNA-Seq was used to map transcripts and also compare relative gene expression under various growth conditions, including anaerobic and aerobic conditions, or growth in different concentrations of biomass hydrolysates. Overall, plasmid genes were more responsive to varying hydrolysate concentrations than to oxygen availability. Additionally, our results indicated that although all plasmids were present in low copy number (about 1-2 per cell), the copy number of some plasmids varied under specific growth conditions or due to heterologous gene insertion. The complete genome of ZM4 and two xylose-utilizing derivatives is reported in this study, with an emphasis on identifying and characterizing plasmid genes. Furthermore, plasmid gene annotation, validation, expression levels at growth conditions of interest, and contribution to host fitness are reported for the first time.« less
Tagliavia, Marcello; Cuttitta, Angela
2016-01-01
High rates of plasmid instability are associated with the use of some expression vectors in Escherichia coli, resulting in the loss of recombinant protein expression. This is due to sequence alterations in vector promoter elements caused by the background expression of the cloned gene, which leads to the selection of fast-growing, plasmid-containing cells that do not express the target protein. This phenomenon, which is worsened when expressing toxic proteins, results in preparations containing very little or no recombinant protein, or even in clone loss; however, no methods to prevent loss of recombinant protein expression are currently available. We have exploited the phenomenon of translational coupling, a mechanism of prokaryotic gene expression regulation, in order to select cells containing plasmids still able to express recombinant proteins. Here we designed an expression vector in which the cloned gene and selection marker are co-expressed. Our approach allowed for the selection of the recombinant protein-expressing cells and proved effective even for clones encoding toxic proteins.
A Simple And Rapid Minicircle DNA Vector Manufacturing System
Kay, Mark A; He, Cheng-Yi; Chen, Zhi-Ying
2010-01-01
Minicircle DNA vectors consisting of a circular expression cassette devoid of the bacterial plasmid DNA backbone provides several advantages including sustained transgene expression in quiescent cells/tissues. Their use has been limited by labor-intensive production. We report on a strategy for making multiple genetic modifications in E.coli to construct a producer strain that stably expresses a set of inducible minicircle-assembly enzymes, the øC31-integrase and I-SceI homing-endonuclease. This bacterial strain is capable of producing highly purified minicircle yields in the same time frame as routine plasmid DNA. It is now feasible for minicircle DNA vectors to replace routine plasmids in mammalian transgene expression studies. PMID:21102455
Avdeeva, S V; Khaĭdarova, N V; Logunov, D Iu; Neugodova, G L; Sevast'ianova, G A; Tarantul, V Z; Naroditskiĭ, B S
2003-01-01
A method was elaborated to evaluate the biological activity of expression products of gene in the plasmid vectors, which are crucial for the synthesis of growth factor of blood vessels. It was proven as possible that the chrioallantonic membrane (CAM) of chicken's embryos could be transfected by recombinant plasmids containing both the reporter and target genes. The efficiency of CAM transfection was assessed by a plasmid carrying the reporter gene of green fluorescent protein (GFP). Finally, it was demonstrated that, at an infiltration of the recombinant plasmid containing the human angiogenine gene, its expression products induce the neovascularization in the CAM cells of chicken's embryos and stimulate an accretion in vessels of the 1st, 2nd and 3d orders.
Expression of membrane targeted aequorin in Xenopus laevis oocytes.
Daguzan, C; Nicolas, M T; Mazars, C; Leclerc, C; Moreau, M
1995-08-01
We described here a system for high level of expression of the calcium activated photoprotein aequorin. This protein has been targeted to the plasma membrane of Xenopus oocyte by nuclear microinjection of a plasmid containing a construction of a chimeric cDNA encoding a fusion protein composed of the photoprotein aequorin and the 5-HT1A receptor. The expression of this fusion protein is placed under the control of RSV promoter. Functional photoprotein was reconstituted in the oocyte by incubation with coelenterazine. The amount of photoprotein 24 h after nuclear microinjection of the plasmid was sufficient to trigger a detectable light emission following calcium entry. The efficiency of the expression is correlated with the dose of plasmid injected. Intracytoplasmic injection of the plasmid always failed in photoprotein expression. Targeting of the apoprotein was demonstrated by immunolocalization under confocal microscopy. In our experimental conditions, the apoprotein was always localized at the animal pole above the nucleus. We never observed expression and targeting to the plasma membrane of the vegetal pole. WE suggest that such expression might be of great interest for the study of numerous problems of developmental biology, in which calcium-dependent pathways are involved.
Khanizadeh, Sayyad; Ravanshad, Mehrdad; Hosseini, SeyedYounes; Davoodian, Parivash; Nejati Zadeh, Azim; Sarvari, Jamal
2015-01-01
In this study, to clarify the SMAD4 blocking impact on fibrosis process, we investigated its down-regulation by shRNA on activated human LX-2 cell, in vitro. Liver fibrosis is a critical consequence of chronic damage to the liver that can progress toward advanced diseases, liver cirrhosis and hepatocellular carcinoma (HCC). Different SMAD proteins play as major mediators in the fibrogenesis activity of hepatic stellate cells through TGF-β pathways, but the extent of SMAD4 as a co-SMAD protein remained less clear. vector expressing verified shRNA targeting human SMAD4 gene was transfected into LX-2 cells. The GFP expressing plasmid was transfected in the same manner as a control group while leptin treated cells were employed as positive controls. Subsequently, total RNA was extracted and real-time PCR was performed to measure the mRNA levels of SMAD4, COL-1A1, α-SMA, TGF-β and TIMP-1. Furthermore, trypan blue exclusion was performed to test the effect of plasmid transfection and SMAD4 shutting-down on cellular viability. The results indicated that the expression of SMAD4was down-regulated following shRNA transfection intoLX-2 cells (P<0.001). The gene expression analysis of fibrotic genes in LX-2 cells showed that SMAD4 blocking by shRNA significantly reduced the expression level of fibrotic genes when compared to control plasmids (P<0.001). Vector expressing SMAD4-shRNA induced no significant cytotoxic or proliferative effects on LX-2 cells as determined by viability assay (P<0.05). The results of this study suggested that knockdown of SMAD4 expression in stellate cell can control the progression of fibrogenesis through TGF-β pathway blocking.
Yu, Xuya; Ji, Sen-Lin; He, Yi-Long; Ren, Meng-Fei; Xu, Jun-Wei
2014-01-01
We report the construction of a plasmid, pJW-EXP, designed for the expression of homologous and heterologous genes in Ganoderma lucidum. pJW-EXP was generated from the plasmid pMD19-T by inserting the G. lucidum glyceraldehyde-3-phosphate dehydrogenase gene promoter, the G. lucidum iron-sulfur protein subunit of succinate dehydrogenase gene terminator and the homologous carboxin-resistance gene as selection marker. This expression plasmid can be efficiently transformed into Ganoderma through polyethylene glycol-mediated protoplast transformation. Southern blot analysis showed that most of the integrated DNA appeared as multiple copies in the genome. The applicability of the constructed plasmid was tested by expression of the truncated G. lucidum 3-hydroxy-3-methylglutaryl coenzyme A reductase (HMGR) gene that encodes the catalytic domain of HMGR. Overexpression of the truncated HMGR gene, which is a key gene in the biosynthetic pathway of the antitumor compounds, ganoderic acids, increased the transcription of the HMGR gene and enhanced ganoderic acid accumulation. pJW-EXP can serve as a useful tool in the genetic improvement and metabolic engineering of Ganoderma.
The 987P fimbrial gene cluster of enterotoxigenic Escherichia coli is plasmid encoded.
Schifferli, D M; Beachey, E H; Taylor, R K
1990-01-01
A clone containing the 987P fimbrial gene cluster was selected from a cosmid library of total DNA of the prototype Escherichia coli strain 987 by using 987P-specific antiserum. A subclone of 12 kilobases containing all of the genes required for fimbrial expression on a nonfimbriated K-12 strain of E. coli and a DNA fragment internal to the fimbrial subunit gene were used to probe the prototype strain and various isolates of 987P-fimbriated enterotoxigenic E. coli. All strains had several plasmids, as shown by agarose gel electrophoresis, and each of five strains which expressed 987P fimbriae showed a plasmid of 35 to 40 megadaltons (MDa) hybridizing to both 987P-specific probes. Hybridization to restricted DNA of strain 987 supported a plasmid origin for the cloned 987P gene cluster. Moreover, an isogenic strain which had lost its 35-MDa plasmid was no longer capable of synthesizing fimbrial subunits, but regained fimbrial expression after reintroduction of the TnphoA (Tn5 IS50L::phoA)-tagged 35-MDa plasmid. Absence of fimbrial subunit synthesis in K-12 strains transformed with the 35-MDa plasmid alone suggested the requirement of regulatory elements existing in strain 987 but missing in K-12 strains. A probe for the heat-stable enterotoxin STIa hybridized in each of the 987P-fimbriated strains to the plasmid containing the 987P genes and in most of these strains to an additional plasmid which contained the gene for the heat-stable enterotoxin STII. Occurrence of the 987P and STIa genes on the same replicon correlates with epidemiological observations, STIa being the most prevalent toxin produced by 987P-fimbriated E. coli. Images PMID:1967167
Takala, T M; Saris, P E J; Tynkkynen, S S H
2003-01-01
A new food-grade host/vector system for Lactobacillus casei based on lactose selection was constructed. The wild-type non-starter host Lb. casei strain E utilizes lactose via a plasmid-encoded phosphotransferase system. For food-grade cloning, a stable lactose-deficient mutant was constructed by deleting a 141-bp fragment from the phospho-beta-galactosidase gene lacG via gene replacement. The deletion resulted in an inactive phospho-beta-galactosidase enzyme with an internal in-frame deletion of 47 amino acids. A complementation plasmid was constructed containing a replicon from Lactococcus lactis, the lacG gene from Lb. casei, and the constitutive promoter of pepR for lacG expression from Lb. rhamnosus. The expression of the lacG gene from the resulting food-grade plasmid pLEB600 restored the ability of the lactose-negative mutant strain to grow on lactose to the wild-type level. The vector pLEB600 was used for expression of the proline iminopeptidase gene pepI from Lb. helveticus in Lb. casei. The results show that the food-grade expression system reported in this paper can be used for expression of foreign genes in Lb. casei.
Wanarska, Marta; Hildebrandt, Piotr; Kur, Józef
2007-01-01
The pLysN plasmid containing the T7 lysozyme gene under control of the lac promoter was constructed to facilitate cell disintegration after expression of recombinant proteins in arabinose-induced expression systems. The usefulness of this plasmid was tested in Escherichia coli TOP10 and E. coli LMG194 cells carrying pBADMHADgeSSB plasmid containing Deinococcus geothermalis SSB protein gene under control of the araBAD promoter. The results showed that low-level expression of T7 lysozyme did not interfere with the target SSB protein production, and that the freezing-thawing treatment was sufficient for disruption of the E. coli cells producing low amounts of T7 lysozyme.
Barbieri, Nicolle L.; Vande Vorde, Jessica A.; Baker, Alison R.; Horn, Fabiana; Li, Ganwu; Logue, Catherine M.; Nolan, Lisa K.
2017-01-01
Avian pathogenic Escherichia coli (APEC) is the etiologic agent of colibacillosis, an important cause of morbidity and mortality in poultry. Though, many virulence factors associated with APEC pathogenicity are known, their regulation remains unclear. FNR (fumarate and nitrate reduction) is a well-known global regulator that works as an oxygen sensor and has previously been described as a virulence regulator in bacterial pathogens. The goal of this study was to examine the role of FNR in the regulation of APEC virulence factors, such as Type I fimbriae, and processes such as adherence and invasion, type VI secretion, survival during oxidative stress, and growth in iron-restricted environments. To accomplish this goal, APEC O1, a well-characterized, highly virulent, and fully sequenced strain of APEC harboring multiple virulence mechanisms, some of which are plasmid-linked, was compared to its FNR mutant for expression of various virulence traits. Deletion of FNR was found to affect APEC O1's adherence, invasion and expression of ompT, a plasmid-encoded outer membrane protein, type I fimbriae, and aatA, encoding an autotransporter. Indeed, the fnr− mutant showed an 8-fold reduction in expression of type I fimbriae and a highly significant (P < 0.0001) reduction in expression of fimA, ompT (plasmid-borne), and aatA. FNR was also found to regulate expression of the type VI secretion system, affecting the expression of vgrG. Further, FNR was found to be important to APEC O1's growth in iron-deficient media and survival during oxidative stress with the mutant showing a 4-fold decrease in tolerance to oxidative stress, as compared to the wild type. Thus, our results suggest that FNR functions as an important regulator of APEC virulence. PMID:28690981
Quantification of Plasmid Copy Number with Single Colour Droplet Digital PCR.
Plotka, Magdalena; Wozniak, Mateusz; Kaczorowski, Tadeusz
2017-01-01
Bacteria can be considered as biological nanofactories that manufacture a cornucopia of bioproducts most notably recombinant proteins. As such, they must perfectly match with appropriate plasmid vectors to ensure successful overexpression of target genes. Among many parameters that correlate positively with protein productivity plasmid copy number plays pivotal role. Therefore, development of new and more accurate methods to assess this critical parameter will result in optimization of expression of plasmid-encoded genes. In this study, we present a simple and highly accurate method for quantifying plasmid copy number utilizing an EvaGreen single colour, droplet digital PCR. We demonstrate the effectiveness of this method by examining the copy number of the pBR322 vector within Escherichia coli DH5α cells. The obtained results were successfully validated by real-time PCR. However, we observed a strong dependency of the plasmid copy number on the method chosen for isolation of the total DNA. We found that application of silica-membrane-based columns for DNA purification or DNA isolation with use of bead-beating, a mechanical cell disruption lead to determination of an average of 20.5 or 7.3 plasmid copies per chromosome, respectively. We found that recovery of the chromosomal DNA from purification columns was less efficient than plasmid DNA (46.5 ± 1.9% and 87.4 ± 5.5%, respectively) which may lead to observed differences in plasmid copy number. Besides, the plasmid copy number variations dependent on DNA template isolation method, we found that droplet digital PCR is a very convenient method for measuring bacterial plasmid content. Careful determination of plasmid copy number is essential for better understanding and optimization of recombinant proteins production process. Droplet digital PCR is a very precise method that allows performing thousands of individual PCR reactions in a single tube. The ddPCR does not depend on running standard curves and is a straightforward and reliable method to quantify the plasmid copy number. Therefore we believe that the ddPCR designed in this study will be widely used for any plasmid copy number calculation in the future.
Quantification of Plasmid Copy Number with Single Colour Droplet Digital PCR
Plotka, Magdalena; Wozniak, Mateusz; Kaczorowski, Tadeusz
2017-01-01
Bacteria can be considered as biological nanofactories that manufacture a cornucopia of bioproducts most notably recombinant proteins. As such, they must perfectly match with appropriate plasmid vectors to ensure successful overexpression of target genes. Among many parameters that correlate positively with protein productivity plasmid copy number plays pivotal role. Therefore, development of new and more accurate methods to assess this critical parameter will result in optimization of expression of plasmid-encoded genes. In this study, we present a simple and highly accurate method for quantifying plasmid copy number utilizing an EvaGreen single colour, droplet digital PCR. We demonstrate the effectiveness of this method by examining the copy number of the pBR322 vector within Escherichia coli DH5α cells. The obtained results were successfully validated by real-time PCR. However, we observed a strong dependency of the plasmid copy number on the method chosen for isolation of the total DNA. We found that application of silica-membrane-based columns for DNA purification or DNA isolation with use of bead-beating, a mechanical cell disruption lead to determination of an average of 20.5 or 7.3 plasmid copies per chromosome, respectively. We found that recovery of the chromosomal DNA from purification columns was less efficient than plasmid DNA (46.5 ± 1.9% and 87.4 ± 5.5%, respectively) which may lead to observed differences in plasmid copy number. Besides, the plasmid copy number variations dependent on DNA template isolation method, we found that droplet digital PCR is a very convenient method for measuring bacterial plasmid content. Careful determination of plasmid copy number is essential for better understanding and optimization of recombinant proteins production process. Droplet digital PCR is a very precise method that allows performing thousands of individual PCR reactions in a single tube. The ddPCR does not depend on running standard curves and is a straightforward and reliable method to quantify the plasmid copy number. Therefore we believe that the ddPCR designed in this study will be widely used for any plasmid copy number calculation in the future. PMID:28085908
2006-06-01
factors. T47DY cells were cotransfected with a PR construct, a PRE- luciferase plasmid and a renilla plasmid, for transfection control. The cells...PR-B or S294A PR-B, PRE-luciferase reporter constructs and a Renilla control plasmid. Cells were treated for 24hrs with or without R5020 (10nM...plasmid and a plasmid constitutively expressing renilla luciferase for transfection control. Cell were starved for one day and treated with or without
Zhang, Yan; Yin, Chong; Hu, Lifang; Chen, Zhihao; Zhao, Fan; Li, Dijie; Ma, Jianhua; Ma, Xiaoli; Su, Peihong; Qiu, Wuxia; Yang, Chaofei; Wang, Pai; Li, Siyu; Zhang, Ge; Wang, Liping; Qian, Airong; Xian, Cory J
2018-02-01
Microtubule actin crosslinking factor 1 (MACF1) is a large spectraplakin protein known to have crucial roles in regulating cytoskeletal dynamics, cell migration, growth, and differentiation. However, its role and action mechanism in bone remain unclear. The present study investigated optimal conditions for effective transfection of the large plasmid PEGFP-C1A-ACF7 (∼21 kbp) containing full-length human MACF1 cDNA, as well as the potential role of MACF1 in bone formation. To enhance MACF1 expression, the plasmid was transfected into osteogenic cells by electroporation in vitro and into mouse calvaria with nanoparticles. Then, transfection efficiency, osteogenic marker expression, calvarial thickness, and bone formation were analyzed. Notably, MACF1 overexpression triggered a drastic increase in osteogenic gene expression, alkaline phosphatase activity, and matrix mineralization in vitro. Mouse calvarial thickness, mineral apposition rate, and osteogenic marker protein expression were significantly enhanced by local transfection. In addition, MACF1 overexpression promoted β-catenin expression and signaling. In conclusion, MACF1 overexpression by transfecting the large plasmid containing full-length MACF1 cDNA promotes osteoblast differentiation and bone formation via β-catenin signaling. Current data will provide useful experimental parameters for the transfection of large plasmids and a novel strategy based on promoting bone formation for prevention and therapy of bone disorders.
Expression of recombinant green fluorescent protein in Bacillus methanolicus.
Nilasari, Dewi; Dover, Nir; Rech, Sabine; Komives, Claire
2012-01-01
Microbial biocatalysts are used in a wide range of industries to produce large scale quantities of proteins, amino acids, and commodity chemicals. While the majority of these processes use glucose or other low-cost sugars as the substrate, Bacillus methanolicus is one example of a biocatalyst that has shown sustained growth on methanol as a carbon source at elevated temperature (50-53°C optimum) resulting in reduced feed and utility costs. Specifically, the complete chemical process enabled by this approach takes methane from natural gas, and following a low-cost conversion to methanol, can be used for the production of high value products. In this study, production of recombinant green fluorescent protein (GFPuv) by B. methanolicus is explored. A plasmid was constructed that incorporates the methanol dehydrogenase (mdh) promoter of B. methanolicus MGA3 together with the GFPuv gene. The plasmid, pNW33N, was shown to be effective for expression in other Bacillus strains, although not previously in B. methanolicus. A published electroporation protocol for transformation of B. methanolicus was modified to result in expression of GFP using plasmid pNW33N-mdh-GFPuv (pNmG). Transformation was confirmed by both agarose gel electrophoresis and by observation of green fluorescence under UV light exposure. The mass yield of cells and protein were measured in shake flask experiments. The optimum concentration of methanol for protein production was found to be at 200 mM. Higher concentrations than 200 mM resulted in slightly higher biomass production but lower amounts of recombinant protein. Copyright © 2012 American Institute of Chemical Engineers (AIChE).
Wang, Xiao-ying; Bao, Lang; Zhao, Ming-cai; Zhang, Hui-dong; Long, Yang
2006-05-01
To express a recombinant fusion protein CFP10-ESAT6 of Mycobacterium tuberculosis, and obtain the polyclonal antibodies of this fusion protein by immune rabbit. The 630 bp cfpl0-esat6 fusion gene fragments were amplified from the genomic DNA of a Mycobacterium tuberculosis reference strain H37Rv and inserted into the expression plasmid pET32a (+) to generate the recombinant plasmid pET-cfp10-esat6. The recombinat expression plasmid was transformed into E. coli BL21 (DE3). The fused protein CFP10-ESAT6 with His-tag was expressed after inducing with IPTG and purified with affinity chromatography. This protein was used to immune the rabbit to obtained the polyclonal antibodies, and been analyzed with Western-blot and ELISA. The recombinant plasmid pET-cfp10-esat6 was success fully constructed, the recombinant fusion protein CFP10-ESAT6 could be expressed at relatively high levels, and the polyclonal antibodies of fusion protein were obtained. The successful construction and expression of the recombinant fusion protein CFP10-ESAT6 and the obtained polyclonal antibodies will be very helpful for the development of new anti-tuberculosis vaccine and the clinical serologic diagnosis.
Feng, Yong-qian; Zha, Xiao-jun; Zhai, Chao-yang
2007-07-01
To construct the eucaryotic recombinant plasmid of pYES2/LactoferricinB expressing in yeast of S. cerevisiae, of which the expressed protein antibacterial activity was verified in preliminary. By self-template PCR method, the gene of Lactoferricin B and its several sequence mutations were amplified with the parts of the pre-synthesized single chains. And then Lactoferricin B gene and its mutants were cloned into the vector of pYES2 to construct the recombined expression plasmid pYES2/Lactoferricin B etc. extracted and used to transform the yeast S. cerevisiae. The expressions of proteins were determined after induced by galactose. The expression proteins were collected and purified by hydronium-exchange column, and the bacterial inhibited test was applied to identify the protein antibacterial activities. The PCR amplifying and DNA sequencing tests indicated that the purpose plasmid contained the Lactoferricin B gene and several mutations. The induced target proteins were confirmed by SDS-PAGE electrophoresis and mass spectrum test. The protein antibacterial activities of mutations were verified in preliminary. The recombined plasmid pYES2/Lactoferricin B etc. are successfully constructed and induced to express in yeast cell of S. cerevisiae; the obtained recombined protein of Lactoferricin B provides a basis for further research work on the biological function and antibacterial activity.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Zhang, Hai-Li; Zhang, Ming-Zhen; Li, Xiang-Yong
2012-11-15
Highlights: ► An easy and direct way to prepare QDs–DNA complexes was developed. ► Surface charge of QDs was tuned with different ratio of amino and glycolate. ► Transfection efficiency was dependent on the surface zeta potentials of QDs. ► Cellular toxicity of this gene vectors is much lower than commercial liposome. ► Whole intracellular behavior of QDs–DNA complexes can be monitored in real time. -- Abstract: Nanoparticle carrier has been developed by combining water-soluble quantum dots and plasmid DNA expressed enhanced green fluorescent protein (EGFP) in a convenient and direct way. First the QDs with different surface charges weremore » obtained by coating with amino and carboxyl terminals at different ratios. Then plasmid DNA was conjugated to QDs via electrostatic interaction. The resultant QDs–DNA complexes showed enhanced resistance to DNase I digestion. The following transfection experiments demonstrated that the transfection efficiency was dependent on the surface charges on QDs. The real time imaging of the transfection process showed that the nanoparticles experienced binding, penetrating the cell membrane and entering cytoplasm in the first 6 h of transfection. The green fluorescence of EGFP began to appear after 18 h transfection and plasmid DNA was fully expressed in the following 6 h. This new QDs–DNA platform showed great potential as new gene delivery carrier.« less
Belperron, Alexia A.; Feltquate, David; Fox, Barbara A.; Horii, Toshihiro; Bzik, David J.
1999-01-01
The liver- and blood-stage-expressed serine repeat antigen (SERA) of Plasmodium falciparum is a candidate protein for a human malaria vaccine. We compared the immune responses induced in mice immunized with SERA-expressing plasmid DNA vaccines delivered by intramuscular (i.m.) injection or delivered intradermally by Gene Gun immunization. Mice were immunized with a pcdna3 plasmid encoding the entire 47-kDa domain of SERA (amino acids 17 to 382) or the N-terminal domain (amino acids 17 to 110) of SERA. Minimal antibody responses were detected following DNA vaccination with the N-terminal domain of SERA, suggesting that the N-terminal domain alone is not highly immunogenic by this route of vaccine delivery. Immunization of mice by Gene Gun delivery of the 47-kDa domain of SERA elicited a significantly higher serum antibody titer to the antigen than immunization of mice by i.m. injection with the same plasmid did. The predominant isotype subclass of the antibodies elicited to the SERA protein following i.m. and Gene Gun immunizations with SERA plasmid DNA was immunoglobulin G1. Coimmunization of mice with SERA plasmid DNA and a plasmid expressing the hepatitis B surface antigen (pCMV-s) by the i.m. route resulted in higher anti-SERA titers than those generated in mice immunized with the SERA DNA plasmid alone. Vaccination with DNA may provide a viable alternative or may be used in conjunction with protein-based subunit vaccines to maximize the efficacy of a human malaria vaccine that includes immunogenic regions of the SERA protein. PMID:10496891
Effects of different cytokines on immune responses of rainbow trout in a virus DNA vaccination model
Cao, Yongsheng; Zhang, Qiya; Xu, Liming; Li, Shaowu; Wang, Di; Zhao, Jingzhuang; Liu, Hongbai; Feng, Jian; Lu, Tongyan
2017-01-01
Seven rainbow trout cytokine genes (interleukin (IL)-2, IL-8, IL-15, IL-17, IL-1β, intracellular interferon (iIFN) 1a, and IFN-γ2) were evaluated for their adjuvant effects on a DNA vaccine, called pG, containing the glycoprotein gene of infectious hematopoietic necrosis virus (IHNV). Distinct DNA constructs in expression plasmid pcDNA3.1 encoding a cytokine gene were generated. Immunofluorescence assays in rainbow trout gonadal cells demonstrated successful protein expression from all these constructs. Subsequently, fish were immunized with pG alone or together with a cytokine expression plasmid. Results showed that each cytokine plasmids at an appropriate dose showed notable effects on immune gene expression. IL-17 and IFN-γ2 can enhance early specific IgM response. All cytokines, except IL-8, can benefit initial neutralizing antibody (NAb) titers. At 35 days post immunization (dpi), NAb titers of fish immunized with pG and IL-2, iIFN1a, or IFN-γ2 plasmids remained at high levels (1:160). NAb titers of fish immunized with pG alone decreased to 1:40. IL-8 or IL-1β can enhance antigen-specific proliferative T-cell responses at 14 dpi. At 28 dpi, coinjection of pG with IL-2, IL-8, IL-15, or IL-17 plasmids induced considerably stronger lymphocyte proliferation than that with injection of pG alone. All cytokine plasmids delivered with pG plasmid enhanced protection of trout against IHNV-mediated mortality. These results indicate that the type and dose of trout cytokine genes injected into fish affect quality of immune response to DNA vaccination. PMID:29348820
Klessen, C; Schmidt, K H; Gumpert, J; Grosse, H H; Malke, H
1989-01-01
To circumvent problems encountered in the synthesis of active chymosin in a number of bacteria and fungi, a recombinant DNA L-form expression system that directed the complete secretion of fully activable prochymosin into the extracellular culture medium was developed. The expression plasmid constructions involved the in-frame fusion of prochymosin cDNA minus codons 1 to 4 to streptococcal pyrogenic exotoxin type A gene (speA') sequences, including the speA promoter, ribosomal binding site, and signal sequence and five codons of mature SpeA. Secretion of fusion prochymosin enzymatically and immunologically indistinguishable from bovine prochymosin was achieved after transformation of two stable protoplast type L-form strains derived from Proteus mirabilis. The secreted proenzyme was converted by autocatalytic processing to chymosin showing milk-clotting activity. In controlled laboratory fermentation processes, a maximum specific rate of activable prochymosin synthesis of 0.57 x 10(-3)/h was determined from the time courses of biomass dry weight and product formation. Yields as high as 40 +/- 10 micrograms/ml were obtained in the cell-free culture fluid of strain L99 carrying a naturally altered expression plasmid of increased segregational stability. The expression-secretion system described may be generally useful for production of recombinant mammalian proteins synthesized intracellularly as aberrantly folded insoluble aggregates. Images PMID:2499253
Copy number variability of expression plasmids determined by cell sorting and Droplet Digital PCR.
Jahn, Michael; Vorpahl, Carsten; Hübschmann, Thomas; Harms, Hauke; Müller, Susann
2016-12-19
Plasmids are widely used for molecular cloning or production of proteins in laboratory and industrial settings. Constant modification has brought forth countless plasmid vectors whose characteristics in terms of average plasmid copy number (PCN) and stability are rarely known. The crucial factor determining the PCN is the replication system; most replication systems in use today belong to a small number of different classes and are available through repositories like the Standard European Vector Architecture (SEVA). In this study, the PCN was determined in a set of seven SEVA-based expression plasmids only differing in the replication system. The average PCN for all constructs was determined by Droplet Digital PCR and ranged between 2 and 40 per chromosome in the host organism Escherichia coli. Furthermore, a plasmid-encoded EGFP reporter protein served as a means to assess variability in reporter gene expression on the single cell level. Only cells with one type of plasmid (RSF1010 replication system) showed a high degree of heterogeneity with a clear bimodal distribution of EGFP intensity while the others showed a normal distribution. The heterogeneous RSF1010-carrying cell population and one normally distributed population (ColE1 replication system) were further analyzed by sorting cells of sub-populations selected according to EGFP intensity. For both plasmids, low and highly fluorescent sub-populations showed a remarkable difference in PCN, ranging from 9.2 to 123.4 for ColE1 and from 0.5 to 11.8 for RSF1010, respectively. The average PCN determined here for a set of standardized plasmids was generally at the lower end of previously reported ranges and not related to the degree of heterogeneity. Further characterization of a heterogeneous and a homogeneous population demonstrated considerable differences in the PCN of sub-populations. We therefore present direct molecular evidence that the average PCN does not represent the true number of plasmid molecules in individual cells.
Lv, Xiangqi; Tan, Jing; Liu, Dongdong; Wu, Ping; Cui, Xiaoguang
2012-06-01
Lung ischemia-reperfusion injury (LIRI) remains a significant problem after lung transplantation. A crucial signaling enzyme involved in inflammation and apoptosis during LIRI is p38 mitogen-activated protein kinase (MAPK). Gene silencing of p38α by short hairpin RNA (shRNA) can downregulate p38α expression. The lungs have an extremely large surface area, which makes the absorption of shRNA highly effective. Therefore, we evaluated the therapeutic efficacy of p38α shRNA plasmids in a rat model of lung transplantation. The delivery of p38α shRNA plasmid was performed by intratracheal administration 48 hours before transplantation into donor rats. Control animals received scrambled shRNA plasmids. Reverse-transcription polymerase chain reaction and Western blots were used to assess gene silencing efficacy. The therapeutic effects of shRNA plasmids were evaluated by lung function tests. We determined the levels of inflammatory cytokines, the level of intercellular adhesion molecule 1 (ICAM-1), c-Myc mRNA expression, and ICAM-1 protein expression, and the presence of cell apoptosis. Rats administered p38α shRNA plasmids showed a significant downregulation in lung expression of p38α transcripts and protein levels. Compared with the control group, the p38α shRNA group showed a higher pulmonary vein oxygen level, lower wet weight-to-dry weight ratio, lower lung injury score, and lower serum levels of tumor necrosis factor-α, interleukin-6, and interleukin-8. Messenger RNA levels of ICAM-1 and c-Myc in the p38α shRNA group were dramatically lower than in the control group. Levels of ICAM-1 protein expression exhibited a similar trend. Cell apoptosis decreased in the p38α shRNA group vs the control group. Intratracheal administration of p38α shRNA plasmids provided therapeutic effects in a rat model of lung transplantation. Crown Copyright © 2012. Published by Elsevier Inc. All rights reserved.
The effect of mutation on Rhodococcus equi virulence plasmid gene expression and mouse virulence.
Ren, Jun; Prescott, John F
2004-11-15
An 81 kb virulence plasmid containing a pathogenicity island (PI) plays a crucial role in the pathogenesis of Rhodococcus equi pneumonia in foals but its specific function in virulence and regulation of plasmid-encoded virulence genes is unclear. Using a LacZ selection marker developed for R. equi in this study, in combination with an apramycin resistance gene, an efficient two-stage homologous recombination targeted gene mutation procedure was used to mutate three virulence plasmid genes, a LysR regulatory gene homologue (ORF4), a ResD-like two-component response regulator homologue (ORF8), and a gene (ORF10) of unknown function that is highly expressed by R. equi inside macrophages, as well as the chromosomal gene operon, phoPR. Virulence testing by liver clearance after intravenous injection in mice showed that the ORF4 and ORF8 mutants were fully attenuated, that the phoPR mutant was hypervirulent, and that virulence of the ORF10 mutant remained unchanged. A virulence plasmid DNA microarray was used to compare the plasmid gene expression profile of each of the four gene-targeted mutants against the parental R. equi strain. Changes were limited to PI genes and gene induction was observed for all mutants, suggesting that expression of virulence plasmid genes is dominated by a negative regulatory network. The finding of attenuation of ORF4 and ORF8 mutants despite enhanced transcription of vapA suggests that factors other than VapA are important for full expression of virulence. ORF1, a putative Lsr antigen gene, was strongly and similarly induced in all mutants, implying a common regulatory pathway affecting this gene for all four mutated genes. ORF8 is apparently the centre of this common pathway. Two distinct highly correlated gene induction patterns were observed, that of the ORF4 and ORF8 mutants, and that of the ORF10 and phoPR mutants. The gene induction pattern distinguishing these two groups paralleled their virulence in mice.
Mahant, Aakash; Saubi, Narcís; Eto, Yoshiki; Guitart, Núria; Gatell, Josep Ma; Hanke, Tomáš; Joseph, Joan
2017-08-03
One of the critical issues that should be addressed in the development of a BCG-based HIV vaccine is genetic plasmid stability. Therefore, to address this issue we have considered using integrative vectors and the auxotrophic mutant of BCG complemented with a plasmid carrying a wild-type complementing gene. In this study, we have constructed an integrative E. coli-mycobacterial shuttle plasmid, p2auxo.HIVA int , expressing the HIV-1 clade A immunogen HIVA. This shuttle vector uses an antibiotic resistance-free mechanism for plasmid selection and maintenance. It was first transformed into a glycine auxotrophic E. coli strain and subsequently transformed into a lysine auxotrophic Mycobacterium bovis BCG strain to generate the vaccine BCG.HIVA 2auxo.int . Presence of the HIVA gene sequence and protein expression was confirmed. We demonstrated that the in vitro stability of the integrative plasmid p2auxo.HIVA int was increased 4-fold, as compared with the BCG strain harboring the episomal plasmid, and was genetically and phenotypically characterized. The BCG.HIVA 2auxo.int vaccine in combination with modified vaccinia virus Ankara (MVA).HIVA was found to be safe and induced HIV-1 and Mycobacterium tuberculosis-specific interferon-γ-producing T-cell responses in adult BALB/c mice. We have engineered a more stable and immunogenic BCG-vectored vaccine using the prototype immunogen HIVA. Thus, the use of integrative expression vectors and the antibiotic-free plasmid selection system based on "double" auxotrophic complementation are likely to improve the mycobacterial vaccine stability in vivo and immunogenicity to develop not only recombinant BCG-based vaccines expressing second generation of HIV-1 immunogens but also other major pediatric pathogens to prime protective responses shortly following birth.
Plasmid-Mediated Bioaugmentation for the Bioremediation of Contaminated Soils
Garbisu, Carlos; Garaiyurrebaso, Olatz; Epelde, Lur; Grohmann, Elisabeth; Alkorta, Itziar
2017-01-01
Bioaugmentation, or the inoculation of microorganisms (e.g., bacteria harboring the required catabolic genes) into soil to enhance the rate of contaminant degradation, has great potential for the bioremediation of soils contaminated with organic compounds. Regrettably, cell bioaugmentation frequently turns into an unsuccessful initiative, owing to the rapid decrease of bacterial viability and abundance after inoculation, as well as the limited dispersal of the inoculated bacteria in the soil matrix. Genes that encode the degradation of organic compounds are often located on plasmids and, consequently, they can be spread by horizontal gene transfer into well-established, ecologically competitive, indigenous bacterial populations. Plasmid-mediated bioaugmentation aims to stimulate the spread of contaminant degradation genes among indigenous soil bacteria by the introduction of plasmids, located in donor cells, harboring such genes. But the acquisition of plasmids by recipient cells can affect the host’s fitness, a crucial aspect for the success of plasmid-mediated bioaugmentation. Besides, environmental factors (e.g., soil moisture, temperature, organic matter content) can play important roles for the transfer efficiency of catabolic plasmids, the expression of horizontally acquired genes and, finally, the contaminant degradation activity. For plasmid-mediated bioaugmentation to be reproducible, much more research is needed for a better selection of donor bacterial strains and accompanying plasmids, together with an in-depth understanding of indigenous soil bacterial populations and the environmental conditions that affect plasmid acquisition and the expression and functioning of the catabolic genes of interest. PMID:29062312
van Mastrigt, Oscar; Lommers, Marcel M A N; de Vries, Yorick C; Abee, Tjakko; Smid, Eddy J
2018-03-23
Lactic acid bacteria can carry multiple plasmids affecting their performance in dairy fermentations. The expression of plasmid-encoded genes and the activity of the corresponding proteins is severely affected by changes in the number of plasmid copies. We studied the impact of growth rate on dynamics of plasmid copy numbers at high growth rates in chemostat cultures and down to near-zero growth rates in retentostat cultures. Five plasmids of the dairy strain Lactococcus lactis FM03-V1 were selected which varied in size (3 to 39 kb), in replication mechanism (theta or rolling-circle) and in putative (dairy-associated) functions. Copy numbers ranged from 1.5 to 40.5 and the copy number of theta-type replicating plasmids were negatively correlated to the plasmid size. Despite the extremely wide range of growth rates (0.0003 h -1 to 0.6 h -1 ), copy numbers of the five plasmids were stable and only slightly increased at near-zero growth rates showing that the plasmid replication rate was strictly controlled. One low-copy number plasmid, carrying a large exopolysaccharide gene cluster, was segregationally unstable during retentostat cultivations reflected in complete loss of the plasmid in one of the retentostat cultures. The copy number of the five plasmids was also hardly affected by varying the pH value, nutrient limitation or presence of citrate (maximum 2.2-fold) signifying the stability in copy number of the plasmids. Importance Lactococcus lactis is extensively used in starter cultures for dairy fermentations. Important traits for growth and survival of L. lactis in dairy fermentations are encoded by genes located on plasmids, such as genes involved in lactose and citrate metabolism, protein degradation and oligopeptide uptake and bacteriophage resistance. Because the number of plasmid copies could affect the expression of plasmid-encoded genes, it is important to know the factors that influence the plasmid copy numbers. We monitored plasmid copy numbers of L. lactis at near-zero growth rates, characteristic for cheese ripening. Moreover, we analysed the effect of pH, nutrient limitation and presence of citrate. This showed that plasmid copy numbers were stable giving insight into plasmid copy number dynamics in dairy fermentations. Copyright © 2018 American Society for Microbiology.
Fast and efficient three-step target-specific curing of a virulence plasmid in Salmonella enterica.
de Moraes, Marcos H; Teplitski, Max
2015-12-01
Virulence plasmids borne by serovars of Salmonella enterica carry genes involved in its pathogenicity, as well as other functions. Characterization of phenotypes associated with virulence plasmids requires a system for efficiently curing strains of their virulence plasmids. Here, we developed a 3-step protocol for targeted curing of virulence plasmids. The protocol involves insertion of an I-SecI restriction site linked to an antibiotic resistance gene into the target plasmid using λ-Red mutagenesis, followed by the transformation with a temperature-sensitive auxiliary plasmid which carries I-SecI nuclease expressed from a tetracycline-inducible promoter. Finally, the auxiliary plasmid is removed by incubation at 42 °C and the plasmid-less strains are verified on antibiotic-containing media. This method is fast and very efficient: over 90 % of recovered colonies lacked their virulence plasmid.
Ruan, Junzhong; Duan, Yong; Li, Fugen; Wang, Zitong
2017-01-01
In order to achieve a synergistic effect on anti-tumour and anti-angiogenesis activity, we designed and constructed a DNA vaccine that expresses MUC1and VEGFR2 in the same reading frame. The aim of this study was to investigate the anti-tumour activity of this DNA vaccine. Furthermore, we also investigated the enhanced synergistic anti-Lewis lung carcinoma effect of this DNA vaccine by using GM-CSF as an adjuvant. A series of DNA plasmids encoding MUC1, VEGFR2, GM-CSF, and their conjugates were constructed and injected into mice intramuscularly (i.m.) followed by an electric pulse. The humoral and cellular immune responses after immunization were detected by enzyme-linked immunosorbent assay (ELISA) and enzyme-linked immunospot (ELISPOT), respectively. To evaluate the anti-tumour efficacy of these plasmids, murine models with MUC1-expressing tumours were generated. After injection into the tumour-bearing mouse model, the plasmid carrying the fusion gene of MUC1 and VEGFR2 showed stronger inhibition of tumour growth than the plasmid expressing MUC1 or VEGFR2 alone, which indicated that MUC1 and VEGFR2 could exert a synergistic anti-tumour effect. Furthermore, mice vaccinated with the combination of the GM-CSF expressing plasmid and the plasmid carrying the fusion gene of MUC1 and VEGFR2 showed an increased inhibition in the growth of MUC1-expressing tumours and prolonged mouse survival. These observations emphasize the potential of the synergistic anti-tumour and anti-angiogenesis strategy used in DNA vaccines, and the potential of the GM-CSF gene as an adjuvant for DNA vaccines, which could represent a promising approach for tumour immunotherapy. © 2016 John Wiley & Sons Australia, Ltd.
ELF5 in epithelial ovarian carcinoma tissues and biological behavior in ovarian carcinoma cells.
Yan, Hongchao; Qiu, Linglin; Xie, Xiaolei; Yang, He; Liu, Yongli; Lin, Xiaoman; Huang, Hongxiang
2017-03-01
The expression of E74-like factor 5 (ELF5) in epithelial ovarian carcinoma tissues and its effects on biological behavior in ovarian carcinoma cells were assessed in search for a new approach for gene treatment of epithelial ovarian carcinoma. RT-PCR technology was applied to detect the expression of ELF5 mRNA in epithelial ovarian carcinoma (n=49), borderline ovarian epithelial tumor (n=19), benign ovarian epithelial tumor (n=31) and normal ovarian tissues (n=40). Then, we transfected recombinant plasmid pcDNA3.1‑ELF5+EGFP into human ovarian carcinoma SKOV3 cells (recombinant plasmid group) in vitro and screened out stably transfected cells to conduct multiplication culture. Western blot analysis was performed to detect the expression of ELF5 protein in the different groups. Flow cytometry was employed to detect cell apoptosis and cycles. ELF5 mRNA in epithelial ovarian carcinoma and borderline ovarian epithelial tumor tissues were significantly lower (P<0.05) than those in benign ovarian epithelial tumor and normal ovarian tissues. ELF5 protein expression in the cells of recombinant plasmid group was significantly higher compared with empty plasmid and blank control groups. The capacity of cell reproductive recombinant plasmid group at each time point decreased (P<0.05). Flow cytometry detection showed that 67.03% of cells in recombinant plasmid group was blocked in G0/G1 phase (P<0.05), compared with empty plasmid group (37.17%) and blank control group (38.24%). Apoptotic rate of recombinant plasmid group was significantly lower (31.4±1.9%; P<0.05), compared with that of empty plasmid group (9.1±2.2%) and blank control group (8.7±1.5%), and the differences were statistically significant. In conclusion, ELF5 interfered with cell cycle of human ovarian carcinoma SKOV3 cells and promoted apoptosis of human ovarian carcinoma SKOV3 cells inhibiting their growth and invasive capacity; and thus providing a new approach to gene treatment of ovarian carcinoma.
Yamamoto, T; Okawa, N; Endo, T; Kaji, A
1991-08-01
The ras gene was fused with the DNA sequence of OmpF signal peptide or with the DNA sequence of OmpF signal peptide plus the amino terminal portion of the OmpF gene. They were placed in plasmids together with the bacteriophage lambda PL promoter. These plasmids were introduced into Escherichia coli strain K-12 and the OmpF signal peptide fusion proteins were expressed. These fusion proteins were identified as 29.0 and 30.0 kDa proteins. However, processed products of these proteins were not found in the extract. The fusion proteins were localized mostly in the cytoplasm and the inner membrane, but none of them was secreted into the periplasmic space. On the other hand, the ras protein alone was found in the cytoplasm and not in the inner membrane. Viable counts of E. coli harbouring these plasmids decreased when these fused proteins were induced. Induction of the ras protein alone did not harm cells. These observations suggest that insertion of the heterologous proteins into the inner membrane may cause the bactericidal effect.
NASA Technical Reports Server (NTRS)
Hedenstierna, K. O.; Lee, Y. H.; Yang, Y.; Fox, G. E.
1993-01-01
A prototype stable RNA identification cassette for monitoring genetically engineered plasmids carried by strains of Escherichia coli has been developed. The cassette consists of a Vibrio proteolyticus 5S ribosomal RNA (rRNA) gene surrounded by promoters and terminators from the rrnB operon of Escherischia coli. The identifier RNA is expressed and successfully processed so that approximately 30% of the 5S rRNA isolated from either whole cells or 70S ribosomes is of the V. proteolyticus type. Cells carrying the identifier are readily detectable by hybridization. Accurate measurements show that the identification cassette has little effect on fitness compared to a strain containing an analogous plasmid carrying wild type E. coli 5S rRNA, and the V. proteolyticus 5S rRNA gene is not inactivated after prolonged growth. These results demonstrate the feasibility of developing small standardized identification cassettes that can utilize already existing highly sensitive rRNA detection methods. Cassettes of this type could in principle be incorporated into either the engineered regions of recombinant plasmids or their hosts.
Zhang, Yan; Li, Wenhua; Wang, Liming; Shen, Ping; Xie, Zhixiong
2013-11-01
Artificial plasmid DNA transformation of Escherichia coli induced by calcium chloride is a routine technique in molecular biology and genetic engineering processes, but its mechanism has remained elusive. Because adenosine monophosphate (AMP) has been found to regulate natural transformation in Haemophilus influenza, we aimed to investigate the effects of AMP and its derivatives on E. coli transformation by treating competence with different concentrations of them. Analysis of the transformation efficiencies revealed that AMP inhibited the artificial plasmid DNA transformation of E. coli in a concentration- and time-dependent manner. Furthermore, we found that AMP had no effect on the expression of the transformed gene but that the intracellular AMP level of the competent cells rose after a 6 h treatment. These results suggested that the intracellular AMP level had an important role in E. coli transformation. And these have useful implications for the further investigation of the mechanism of E. coli transformation.
USDA-ARS?s Scientific Manuscript database
A three-plasmid yeast expression system utilizing the portable small ubiquitin-like modifier (SUMO) vector set combined with the efficient endogenous yeast protease Ulp1 was developed for production of large amounts of soluble functional protein in Saccharomyces cerevisiae. Each vector has a differ...
Genetic engineering of Lactobacillus diolivorans.
Pflügl, Stefan; Marx, Hans; Mattanovich, Diethard; Sauer, Michael
2013-07-01
In this study, we developed a toolbox for genetic manipulation of Lactobacillus diolivorans, a promising production organism for 1,3-propanediol from glycerol. Two major findings play a key role for successful transformation of this organism: (1) the absence of a native plasmid, because a native plasmid is a major obstacle for transformation of L. diolivorans, and (2) the absence of DNA methylation. A suitable expression plasmid, pSHM, for homologous and heterologous protein expression in L. diolivorans was constructed. This plasmid is based on the replication origin repA of L. diolivorans. The native glyceraldehyde-3-phosphate dehydrogenase promoter is used for constitutive expression of the genes of interest. Functional expression of genes in L. diolivorans was shown with two examples: production of green fluorescent protein resulted in a 40- to 60-fold higher fluorescence of the obtained clones compared with the wild-type strain. Finally, the homologous overexpression of a putatively NADPH-dependent 1,3-propanediol oxidoreductase improved 1,3-propanediol production by 20% in batch cultures. © 2013 Federation of European Microbiological Societies. Published by John Wiley & Sons Ltd. All rights reserved.
Wei, Baojun; Wei, Yuxiang; Zhang, Kuo; Yang, Changmei; Wang, Jing; Xu, Ruihuan; Zhan, Sien; Lin, Guigao; Wang, Wei; Liu, Min; Wang, Lunan; Zhang, Rui; Li, Jinming
2008-01-01
To construct a one-plasmid expression system of the armored RNA containing long chimeric RNA by increasing the number and affinity of the pac site. The plasmid pET-MS2-pac was constructed with one C-variant pac site, and then the plasmid pM-CR-2C containing 1,891-bp chimeric sequences and two C-variant pac sites was produced. Meanwhile, three plasmids (pM-CR-C, pM-CR-2W and pM-CR-W) were obtained as parallel controls with a different number and affinity of the pac site. Finally, the armored RNA was expressed and purified. The armored RNA with 1,891 bases target RNA was expressed successfully by the one-plasmid expression system with two C-variant pac sites, while for one pac site, no matter whether the affinity was changed or not, only the 1,200 bases target RNA was packaged. It was also found that the C-variant pac site could increase the expression efficiency of the armored RNA. The armored RNA with 1,891-bp exogenous RNA in our study showed the characterization of ribonuclease resistance and stability at different time points and temperature conditions. The armored RNA with 1,891 bases exogenous RNA was constructed and the expression system can be used as a platform for preparation of the armored RNA containing long RNA sequences. Copyright 2008 S. Karger AG, Basel.
NASA Astrophysics Data System (ADS)
Bae, Ju Yun; Laplaza, José; Jeffries, Thomas W.
Orientation of adjacent genes has been reported to affect their expression in eukaryotic systems, and metabolic engineering also often makes repeated use of a few promoters to obtain high expression. To improve transcriptional control in heterologous expression, we examined how these factors affect gene expression and enzymatic activity in Saccharomyces cerevisiae. We assembled d-xylose reductase (XYL1) and d-xylitol dehydrogenase (XYL2) in four ways. Each pair of genes was placed in two different tandem (l→2→ or √1√2), convergent (1→√2), and divergent (√1 2→) orientations in autonomous plasmids. The TEF1 promoter was used to drive XYL1 and the TDH3 promoter to drive XYL2 in each of the constructs. The effects of gene orientation on growth, transcription, and enzyme activity were analyzed. The transcription level as measured by quantitative PCR (q-PCR) correlated with enzyme activities, but our data did not show a significant effect of gene orientation. To test the possible dilution of promoter strength due to multiple use of the same promoter, we examined the level of expression of XYL1 driven by either the TEF1 or TDH3 promoter when carried on a single copy plasmid. We then coexpressed XYL2 from either a single or multicopy plasmid, which was also driven by the same promoter. XYL2 transcript and enzyme expression increased with plasmid copy number, while the expression of XYLl was constant regardless of the number of other TEF1 or TDH3 promoters present in the cell. According to our data, there is no significant effect of gene orientation or multiple promoter use on gene transcription and translation when genes are expressed from plasmids; however, other factors could affect expression of adjacent genes in chromosomes.
Lin, Bing-Ying; Jin, Zhi-Qiang; Li, Mei
2006-11-01
To construct a plant effective expression vector driven by a fruit specific promoter for the expression of hepatitis B virus surface antigen (HBsAg), to further improve the expression of exogenous gene in plant, and to prepare for the development of an effective anti-hepatitis vaccine. Tomato fruit-specific promoters' gene 2A12 and E8 were respectively introduced to pBPFOmega7 to form pB2A12 and pBE8. The DNA fragment containing HBsAg-s gene from plasmid YEP-HBs was inserted respectively into pB2A12 and pBE8 to form pB2A12-HBs and pBE8-HBs. The fragment containing "p35S+2A12+Omega+HBsAg-s+Tnos" of the pB2A12-HBs was sub-cloned into plasmid pCAMBIA1301 to yield the reconstructed plant binary expression plasmid pCAM2A12-HBs, and the fragment containing "p35S+E8+Omega+HBsAg-s+Tnos" of the pBE8-HBs was sub-cloned into plasmid pCAMBIA1301 to yield the plasmid pCAME8-HBs. The inserted gene HBsAg and fruit-specific promoters in the reconstructed plant binary expression vectors were confirmed by sequencing. Then, pCAM2A12-HBs and pCAME8-HBs were directly introduced into Agrobacterium tumefaciens strain EHA105. Digestion with restriction enzymes proved that all recombinant vectors had the inserts with expected length of the target fragments, and the sequencing results were confirmed correct. In this study, plant expression vector containing HBsAg gene driven by fruit specific promoter and CaMV35s promoter was successfully constructed.
Plasmid fermentation process for DNA immunization applications.
Carnes, Aaron E; Williams, James A
2014-01-01
Plasmid DNA for immunization applications must be of the highest purity and quality. The ability of downstream purification to efficiently produce a pure final product is directly influenced by the performance of the upstream fermentation process. While several clinical manufacturing facilities already have validated fermentation processes in place to manufacture plasmid DNA for use in humans, a simple and inexpensive laboratory-scale fermentation process can be valuable for in-house production of plasmid DNA for use in animal efficacy studies. This chapter describes a simple fed-batch fermentation process for producing bacterial cell paste enriched with high-quality plasmid DNA. A constant feeding strategy results in a medium cell density culture with continuously increasing plasmid amplification towards the end of the process. Cell banking and seed culture preparation protocols, which can dramatically influence final product yield and quality, are also described. These protocols are suitable for production of research-grade plasmid DNA at the 100 mg-to-1.5 g scale from a typical 10 L laboratory benchtop fermentor.
Bleckmann, Maren; Schürig, Margitta; Chen, Fang-Fang; Yen, Zen-Zen; Lindemann, Nils; Meyer, Steffen; Spehr, Johannes; van den Heuvel, Joop
2016-01-01
The Baculovirus Expression Vector System (BEVS) is widely used to produce high amounts of recombinant proteins. Nevertheless, generating recombinant baculovirus in high quality is rather time-consuming and labor-intensive. Alternatively, virus-free expression in insect cells did not achieve similar expression levels for most proteins so far. The transactivation method is a promising approach for protein expression in Sf21 cells. It combines advantages of BEVS and plasmid-based expression by activating strong virus-dependent promoters on a transfected plasmid by baculoviral coinfection. Here, we identified expression elements required for transactivation. Therefore, we designed several vectors comprising different viral promoters or promoter combinations and tested them for eGFP expression using the automated BioLector microcultivation system. Remarkably, only the combination of the very late promoter p10 together with the homologous region 5 (hr5) could boost expression during transactivation. Other elements, like p10 alone or the late viral promoter polH, did not respond to transactivation. A new combination of hr5 and p10 with the strongest immediate early OpMNPV viral promoter OpIE2 improved the yield of eGFP by ~25% in comparison to the previous applied hr5-IE1-p10 expression cassette. Furthermore, we observed a strong influence of the transcription termination sequence and vector backbone on the level of expression. Finally, the expression levels for transactivation, BEVS and solely plasmid-based expression were compared for the marker protein eGFP, underlining the potential of transactivation for fast recombinant protein expression in Sf21 cells. In conclusion, essential elements for transactivation could be identified. The optimal elements were applied to generate an improved vector applicable in virus-free plasmid-based expression, transactivation and BEVS.
Reddy, Kotla S; Rashmi, Brabhi R; Dechamma, Hosur J; Gopalakrishna, Susarla; Banumathi, N; Suryanarayana, Veluvarthy V S; Reddy, Golla R
2012-05-01
Foot and mouth disease (FMD) can be controlled by regular vaccination and restriction of the movement of infected animals in the endemic countries. Although presently used, tissue culture inactivated vaccine gives protection, it has several limitations, including a short duration of immunity. DNA vaccine delivered through microparticles could comprise an alternative approach to conventional vaccine when aiming to circumvent these limitations. We constructed the expression plasmid (pVAC-1D) containing 1D gene FMD virus serotype Asia 1. Poly(D,L-lactide-co-glycolide) (PLG) microparticles were prepared and coated with the pVAC-1D plasmid. Guinea pigs were vaccinated with PLG-coated and naked DNA vaccine constructs intramuscularly. The humoral response was measured by an enzyme-linked immunosorbent assay (ELISA) and the serum neutralization test (SNT). Analysis of the persistence and the expression of pVAC-1D plasmid construct was carried out by quantitative polymerase chain reaction (qPCR). The humoral response lasted for 1 year, as measured by ELISA and SNT. Analysis of the persistence and the expression of pVAC-1D plasmid construct by qPCR has shown that pVAC-1D expression was seen for a longer duration compared to the naked DNA vaccine. Microparticles coated plasmid DNA-injected guinea pigs were protected when challenged with FMD virus. The present study has shown that the delivery of plasmid coated on cationic PLG microparticles enhance the duration of immunity of the DNA vaccine constructs. Copyright © 2012 John Wiley & Sons, Ltd.
von Wright, A; Bridges, B A
1980-08-01
To detect the effect of the postulated inducible error-prone repair system ('SOS repair') on the bacterial chromosome, an Hfr Escherichia coli strain JC5088 recA was u.v.-irradiated immediately before mating it with recipients in which SOS repair was supposed to be functioning through tif expression, u.v. irradiation or the presence of plasmid pKM101. The recombinant yields of these crosses were compared with those obtained in corresponding crosses with recipients in which SOS repair either was not induced or was totally eliminated by the lexA mutation. No difference in marker recovery efficiency could be detected between these two sets of recipients and thus no induced repair process acting on donor DNA could be demonstrated. The possible reasons for this finding are discussed.
A Droplet Microfluidic Platform for Automating Genetic Engineering.
Gach, Philip C; Shih, Steve C C; Sustarich, Jess; Keasling, Jay D; Hillson, Nathan J; Adams, Paul D; Singh, Anup K
2016-05-20
We present a water-in-oil droplet microfluidic platform for transformation, culture and expression of recombinant proteins in multiple host organisms including bacteria, yeast and fungi. The platform consists of a hybrid digital microfluidic/channel-based droplet chip with integrated temperature control to allow complete automation and integration of plasmid addition, heat-shock transformation, addition of selection medium, culture, and protein expression. The microfluidic format permitted significant reduction in consumption (100-fold) of expensive reagents such as DNA and enzymes compared to the benchtop method. The chip contains a channel to continuously replenish oil to the culture chamber to provide a fresh supply of oxygen to the cells for long-term (∼5 days) cell culture. The flow channel also replenished oil lost to evaporation and increased the number of droplets that could be processed and cultured. The platform was validated by transforming several plasmids into Escherichia coli including plasmids containing genes for fluorescent proteins GFP, BFP and RFP; plasmids with selectable markers for ampicillin or kanamycin resistance; and a Golden Gate DNA assembly reaction. We also demonstrate the applicability of this platform for transformation in widely used eukaryotic organisms such as Saccharomyces cerevisiae and Aspergillus niger. Duration and temperatures of the microfluidic heat-shock procedures were optimized to yield transformation efficiencies comparable to those obtained by benchtop methods with a throughput up to 6 droplets/min. The proposed platform offers potential for automation of molecular biology experiments significantly reducing cost, time and variability while improving throughput.
NASA Astrophysics Data System (ADS)
Himmah, Karimatul; Dluha, Nurul; Anyndita, Nadya V. M.; Rifa'i, Muhaimin; Widodo
2017-05-01
The Epstein - Barr virus (EBV) causes severe infections that may lead to cancers such as nasopharyngeal carcinoma. Development of effective EBV vaccines is necessary to prevent the virus spreading throughout the community. TheEBV has a surface protein gp 350/220, which serves as an antigen to help interact with host cells. Epitopes of the protein can potentially serve as bases for a vaccine. In a previous study, we have found a conserved epitope of gp 350/220 from all strains EBV through an in silico approach. The aim of this study is to design and overproduce a recombinant peptide of epitope gp 350/220 in E. coli. DNA encoding the conserved epitope was synthesized and cloned into plasmid pET-22b(+); the recombinant plasmid was transformed into E. coli strains DH5α and BL21. The transformed plasmid DNA was isolated and confirmed by restriction using XbaI and PstI enzymes followed by DNA sequencing. Protein expression was induced by isopropyl-D-thiogalactopyranoside (IPTG) with final concentrations of 0.1, 0.2, 1, and 2 mM in consecutive times. An osmotic shock method was used to isolate protein from periplasmic fraction of E. coli DH5α and BL21. The SDS-PAGE analysis was carried out to detect peptide target (3.4 kDa). Based on this result, the induction process did not work properly, and thus needs further investigation.
Expression of Duplicate msa Genes in the Salmonid Pathogen Renibacterium salmoninarum
Rhodes, Linda D.; Coady, Alison M.; Strom, Mark S.
2002-01-01
Renibacterium salmoninarum is a gram-positive bacterium responsible for bacterial kidney disease of salmon and trout. R. salmoninarum has two identical copies of the gene encoding major soluble antigen (MSA), an immunodominant, extracellular protein. To determine whether one or both copies of msa are expressed, reporter plasmids encoding a fusion of MSA and green fluorescent protein controlled by 0.6 kb of promoter region from msa1 or msa2 were constructed and introduced into R. salmoninarum. Single copies of the reporter plasmids integrated into the chromosome by homologous recombination. Expression of mRNA and protein from the integrated plasmids was detected, and transformed cells were fluorescent, demonstrating that both msa1 and msa2 are expressed under in vitro conditions. This is the first report of successful transformation and homologous recombination in R. salmoninarum. PMID:12406741
Cruz, P E; Khalil, P L; Dryden, T D; Chiou, H C; Fink, P S; Berberich, S J; Bigley, N J
1999-03-05
DNA molecules complexed with an asialoglycoprotein-polycation conjugate, consisting of asialoorosomucoid (ASOR) coupled to poly-L-lysine, can enter hepatocytes which bear receptors for ASOR. We used this receptor-mediated DNA delivery system to deliver plasmid DNA encoding glycoprotein D (gD) of herpes simplex virus type 1 to ASOR-positive cells. Maximum expression of gD protein was seen at 3 days after injection of this preparation in approximately 13% of cells from BALB/c mice [hepatocytes from mice injected intravenously (i.v.) or peritoneal exudate cells from mice injected intraperitoneally (i.p.)]. In comparison with mice injected with either the plasmid vector alone or the gD-containing plasmid uncomplexed to ASOR, mice immunized with gD-containing plasmid complexed with ASOR-poly-L-lysine induced marked antigen-specific CTL responses. BALB/c mice immunized with gD-DNA developed a T-cell-mediated CTL response against target cells expressing gD and MHC class II glycoproteins, but not against cells expressing only gD and MHC class I molecules. In C3H mice, gD-DNA induced a T-cell-mediated CTL response against target cells expressing gD and class I MHC molecules. Serum anti-gD antibody in low titers were produced in both strains of mice. DNA complexed with ASOR-poly-L-lysine induced CTL responses in mice.
Lu, Yuming; Chen, Xi; Wu, Yuxuan; Wang, Yanping; He, Yuqing; Wu, Yan
2013-01-01
A circular plasmid containing a gene coding sequence has been broadly used for studying gene regulation in cells. However, to accommodate a quick screen plasmid construction and preparation can be time consuming. Here we report a PCR amplified dsDNA fragments (PCR-fragments) based transient expression system (PCR-TES) for suiting in the study of gene regulation in plant cells. Instead of transforming plasmids into plant cells, transient expression of PCR-fragments can be applicable. The transformation efficiency and expression property of PCR-fragments are comparable to transformation using plasmids. We analyzed the transformation efficiency in PCR-TES at transcription and protein levels. Our results indicate that the PCR-TES is as versatile as the conventional transformation system using plasmid DNA. Through reconstituting PYR1-mediated ABA signaling pathway in Arabidopsis mesophyll protoplasts, we were not only validating the practicality of PCR-TES but also screening potential candidates of CDPK family members which might be involved in the ABA signaling. Moreover, we determined that phosphorylation of ABF2 by CPK4 could be mediated by ABA-induced PYR1 and ABI1, demonstrating a crucial role of CDPKs in the ABA signaling. In summary, PCR-TES can be applicable to facilitate analyzing gene regulation and for the screen of putative regulatory molecules at the high throughput level in plant cells.
Lu, Yuming; Chen, Xi; Wu, Yuxuan; Wang, Yanping; He, Yuqing; Wu, Yan
2013-01-01
A circular plasmid containing a gene coding sequence has been broadly used for studying gene regulation in cells. However, to accommodate a quick screen plasmid construction and preparation can be time consuming. Here we report a PCR amplified dsDNA fragments (PCR-fragments) based transient expression system (PCR-TES) for suiting in the study of gene regulation in plant cells. Instead of transforming plasmids into plant cells, transient expression of PCR-fragments can be applicable. The transformation efficiency and expression property of PCR-fragments are comparable to transformation using plasmids. We analyzed the transformation efficiency in PCR-TES at transcription and protein levels. Our results indicate that the PCR-TES is as versatile as the conventional transformation system using plasmid DNA. Through reconstituting PYR1-mediated ABA signaling pathway in Arabidopsis mesophyll protoplasts, we were not only validating the practicality of PCR-TES but also screening potential candidates of CDPK family members which might be involved in the ABA signaling. Moreover, we determined that phosphorylation of ABF2 by CPK4 could be mediated by ABA-induced PYR1 and ABI1, demonstrating a crucial role of CDPKs in the ABA signaling. In summary, PCR-TES can be applicable to facilitate analyzing gene regulation and for the screen of putative regulatory molecules at the high throughput level in plant cells. PMID:23468926
NASA Astrophysics Data System (ADS)
McKnight, Timothy E.; Melechko, Anatoli V.; Griffin, Guy D.; Guillorn, Michael A.; Merkulov, Vladimir I.; Serna, Francisco; Hensley, Dale K.; Doktycz, Mitchel J.; Lowndes, Douglas H.; Simpson, Michael L.
2003-05-01
We demonstrate the integration of vertically aligned carbon nanofibre (VACNF) elements with the intracellular domains of viable cells for controlled biochemical manipulation. Deterministically synthesized VACNFs were modified with either adsorbed or covalently-linked plasmid DNA and were subsequently inserted into cells. Post insertion viability of the cells was demonstrated by continued proliferation of the interfaced cells and long-term (> 22 day) expression of the introduced plasmid. Adsorbed plasmids were typically desorbed in the intracellular domain and segregated to progeny cells. Covalently bound plasmids remained tethered to nanofibres and were expressed in interfaced cells but were not partitioned into progeny, and gene expression ceased when the nanofibre was no longer retained. This provides a method for achieving a genetic modification that is non-inheritable and whose extent in time can be directly and precisely controlled. These results demonstrate the potential of VACNF arrays as an intracellular interface for monitoring and controlling subcellular and molecular phenomena within viable cells for applications including biosensors, in vivo diagnostics, and in vivo logic devices.
Expression of human growth hormone by the eukaryotic alga, Chlorella.
Hawkins, R L; Nakamura, M
1999-06-01
A method to use Chlorella to express a recombinant heterologous protein that can be recovered from the extracellular medium has been developed. Plasmids are constructed with an extracellular secretion signal sequence inserted between a promoter region and a gene for human growth hormone (hGH). The plasmids also contain a Kanr region which confers resistance to the antibiotic G418. Protoplasts are prepared by enzymatic treatment, and the plasmid is introduced by incubation of the protoplasts with polyethylene glycol and dimethyl sulfoxide. Cells are then grown in the presence of G418, and the medium is collected from 6 days after transfection. hGH is measured by immunoassay, and values for expressed hGH of about 200-600 ng/ml are obtained.
Plasmid analyses in clinical isolates of Bacteroides fragilis and other Bacteroides species.
Wallace, B L; Bradley, J E; Rogolsky, M
1981-01-01
Plasmid analyses were performed on Bacteroides strains isolated from clinical specimens. Of 32 Bacteroides strains, 8 were found to contain plasmids. Seven of these eight strains were B. fragilis, and the other one was B. distasonis. Three of these eight strains harbored only a 3.0-megadalton plasmid. Two strains had only a 2.0-megadalton plasmid, and one had 2.0-, 3.0-megadalton plasmid. Of the remaining two strains, one had 2.0-, 3.0-, and 5.0-megadalton plasmids, and the other had 3.0- and 5.0-megadalton plasmids. Beta-Lactamase was produced by 93% of the clinical isolates. Seven of the eight plasmid-carrying strains were cadmium resistant, five were zinc resistant, four were mercury resistant, and two expressed a brick-red fluorescence under ultraviolet light. None of these traits could be associated with a plasmid after performing either curing experiments or genetic transfer experiments by cell-to-cell contact. Images PMID:6974737
Transfected Cell Microarrays for the Expression of Membrane-Displayed Single-Chain Antibodies
2011-01-01
v) yeast extract, 0.005% (w/v) NaCl, and 50 μg/ml kanamycin. The broth was stored at 4◦C for up to 3 months. 4. QIAGEN Plasmid Midi kit (Qiagen) or...ampi- cillin. The broth was stored at 4◦C for up to 3 months. 16. QIAprep spin miniprep kit and QIAGEN Plasmid Midi kit (Qiagen) or PureYield Plasmid...was stored at 4◦C for up to 3 months. 8. QIAGEN Plasmid Midi kit (Qiagen) or PureYield Plasmid Midiprep System (Promega Corp.) was stored at room tem
Liu, N; Shi, H G; Zhang, W; Gu, B
2016-11-09
Objective: To investigate the crosstalk between canonical Wnt/β-catenin and noncanonical Wnt/Ca 2+ pathway in osteoblast differentiation process of periodontal ligament stem cell (PDLSC) in inflammatory microenvironments. Methods: PDLSCs were obtained from human healthy individuals(H-PDLSC) and patients with periodontitis(P-PDLSC). The H/P-PDLSCs were transfected with β-catenin siRNA. Cell morphology was observed under fluorescent microscope and transfection efficiency was easured by Western blotting after transfection of PDLSC. The mRNA expressions of Runt-related transcription factor 2(Runx2), β-catenin and nemo like kinase(NLK) were detected by real time PCR, the protein expressions of calcium/calmodulin-dependent protein kinase Ⅱ (CaMK Ⅱ) and NLK were examined by Western blotting and the CaMK Ⅱ was observed by immunofluorescence staining, respectively. Results: The β-catenin expressions in H/P-PDLSCs were inhibited specifically and efficiently by treatment of β-catenin-siRNA for 24 h. After a 3-day-osteogenic process, results of real-time quantitative PCR showed that the Runx2 mRNA expression in P-PDLSC siRNA β-catenin transfected group(4.553 ± 0.659) was significantly higher than that in P-PDLSC empty plasmid control group(1.918 ± 0.315) ( P= 0.000). A similar trend was observed in the NLK mRNA expression tests(7.341 ± 1.331 vs. 5.664 ± 0.792) ( P= 0.030). Accordingly, the protein expression levels of CaMK Ⅱ, NLK were higher in P-PDLSC siRNA β-catenin transfected group than that in P-PDLSC empty plasmid control group in osteogenic differentiation condition for 3 days. CaMKⅡ was more strongly induced in P-PDLSC siRNA β-catenin group than that in P-PDLSC empty plasmid control group after PDLSC cultured in osteogenic medium for 3 days. Conclusions: Both canonical Wnt/β-catenin and noncanonical Wnt/Ca 2+ pathway could regulate the osteogenic differentiation potential of P-PDLSC. Suppression of β-catenin by siRNA promoted osteogenic differentiation via increasing noncanonical Wnt signaling pathway of PDLSC in inflammatory microenvironments.
Zabeau, M; Stanley, K K
1982-01-01
Hybrid plasmids carrying cro-lacZ gene fusions have been constructed by joining DNA segments carrying the PR promoter and the start of the cro gene of bacteriophage lambda to the lacZ gene fragment carried by plasmid pLG400 . Plasmids in which the translational reading frames of the cro and lacZ genes are joined in-register (type I) direct the synthesis of elevated levels of cro-beta-galactosidase fusion protein amounting to 30% of the total cellular protein, while plasmids in which the genes are fused out-of-register (type II) produce a low level of beta-galactosidase protein. Sequence rearrangements downstream of the cro initiator AUG were found to influence the efficiency of translation, and have been correlated with alterations in the RNA secondary structure of the ribosome-binding site. Plasmids which direct the synthesis of high levels of beta-galactosidase are conditionally lethal and can only be propagated when the PR promoter is repressed. Deletion of sequences downstream of the lacZ gene restored viability, indicating that this region of the plasmid encodes a function which inhibits the growth of the cells. The different applications of these plasmids for expression of cloned genes are discussed. Images Fig. 6. PMID:6327257
Recombinant microorganisms for increased production of organic acids
Yi, Jian [East Lansing, MI; Kleff, Susanne [East Lansing, MI; Guettler, Michael V [Holt, MI
2012-02-21
Disclosed are recombinant microorganisms for producing organic acids. The recombinant microorganisms express a polypeptide that has the enzymatic activity of an enzyme that is utilized in the pentose phosphate cycle. The recombinant microorganism may include recombinant Actinobacillus succinogenes that has been transformed to express a Zwischenferment (Zwf) gene. The recombinant microorganisms may be useful in fermentation processes for producing organic acids such as succinic acid and lactic acid. Also disclosed are novel plasmids that are useful for transforming microorganisms to produce recombinant microorganisms that express enzymes such as Zwf.
Recombinant microorganisms for increased production of organic acids
Yi, Jian; Kleff, Susanne; Guettler, Michael V
2013-04-30
Disclosed are recombinant microorganisms for producing organic acids. The recombinant microorganisms express a polypeptide that has the enzymatic activity of an enzyme that is utilized in the pentose phosphate cycle. The recombinant microorganism may include recombinant Actinobacillus succinogenes that has been transformed to express a Zwischenferment (Zwf) gene. The recombinant microorganisms may be useful in fermentation processes for producing organic acids such as succinic acid and lactic acid. Also disclosed are novel plasmids that are useful for transforming microorganisms to produce recombinant microorganisms that express enzymes such as Zwf.
Hosseinkhani, Hossein; Aoyama, Ternyoshi; Yamamoto, Shingo; Ogawa, Osamu; Tabata, Yasuhiko
2002-10-01
The purpose of this study is to examine the ultrasound (US)-enhanced gene expression by the complexes of a plasmid DNA with gelatin derivatives of aminization. Gelatin derivatives with different introduced extents of ethylenediamine (Ed), spermidine (Sd), and spermine (Sm) were prepared with a water-soluble carbodiimide. The molecular size and zeta potential of the gelatin derivatives before and after complexation with the plasmid DNA were examined. After incubation with the complexes with or without US exposure, the DNA expression of rat gastric mucosal cells was measured to evaluate the effect of the type of gelatin derivatives on their gene expression. The cell uptake of the complexes, the cell viability, and the buffering effect of gelatin derivatives were examined. The apparent molecular size and zeta potential of gelatin derivatives became larger as their aminization extent increased although the Sm gelatin derivative of higher aminization showed a larger value than other corresponding derivatives. Irrespective of the type of gelatin derivatives, the apparent molecular size of plasmid DNA was reduced by increasing the gelatin-DNA mixing ratio to attain a saturated value of about 150 nm. The condensed gelatin-DNA complexes showed the zeta potential of 10-15 mV. The cells incubated with the complex exhibited significantly stronger luciferase activities than free plasmid DNA, and the activity was further enhanced by US irradiation. The enhancement was significant for the Sm derivative compared with the corresponding Ed and Sd derivatives. The amount of plasmid DNA internalized into the cells was significantly increased by the complexation with every gelatin derivative, whereas US irradiation did not significantly increase the DNA internalization. US irradiation had no effect on the viability of cells incubated with every gelatin derivative-plasmid DNA complex, although the viability was decreased by the complex incubation. The buffering capacity of Sm derivative was higher than that of Ed and Sd derivatives and comparable with that of polyethylene amine. Among amine derivatives of gelatin, the Sm derivative enabled the plasmid DNA to induce the US-enhanced gene expression of cells in vitro most effectively because of the superior buffering effect.
Martella, Andrea; Matjusaitis, Mantas; Auxillos, Jamie; Pollard, Steven M; Cai, Yizhi
2017-07-21
Mammalian plasmid expression vectors are critical reagents underpinning many facets of research across biology, biomedical research, and the biotechnology industry. Traditional cloning methods often require laborious manual design and assembly of plasmids using tailored sequential cloning steps. This process can be protracted, complicated, expensive, and error-prone. New tools and strategies that facilitate the efficient design and production of bespoke vectors would help relieve a current bottleneck for researchers. To address this, we have developed an extensible mammalian modular assembly kit (EMMA). This enables rapid and efficient modular assembly of mammalian expression vectors in a one-tube, one-step golden-gate cloning reaction, using a standardized library of compatible genetic parts. The high modularity, flexibility, and extensibility of EMMA provide a simple method for the production of functionally diverse mammalian expression vectors. We demonstrate the value of this toolkit by constructing and validating a range of representative vectors, such as transient and stable expression vectors (transposon based vectors), targeting vectors, inducible systems, polycistronic expression cassettes, fusion proteins, and fluorescent reporters. The method also supports simple assembly combinatorial libraries and hierarchical assembly for production of larger multigenetic cargos. In summary, EMMA is compatible with automated production, and novel genetic parts can be easily incorporated, providing new opportunities for mammalian synthetic biology.
Du, Guangsheng; Lv, Jiagao; He, Li; Ma, Yexin
2011-06-01
In order to investigate the influence of silencing soluble epoxide hydrolase (sEH) with double-stranded small interfering RNA (siRNA) on cardiomyocytes apoptosis induced by doxorubicin (DOX), two plasmids containing siRNA sequences specific to sEH were constructed and transfected into the primary cultured cardiomyocytes by using FuGENE HD transfection agents. The mRNA and protein expression levels of sEH were detected by semiquantitative RT-PCR and Western blotting respectively, and the plasmids that silenced sEH most significantly were selected, and renamed EH-R. The plasmids carrying a nonspecific siRNA coding sequence (PCN) served as the negative control. Cardiomyocytes were divided into four groups: control group, DOX group, PCN+DOX group, and EH-R+DOX group. Apoptosis of cardiomyocytes was induced by DOX at a concentration of 1 μmol/L. Apoptosis rate of cardiomyocytes was determined by flow cytometery. The protein expression levels of Bcl-2 and Bax were detected by Western blotting. The results showed that the expression of sEH was down-regulated by EH-R plasmid. The expression levels of sEH mRNA and protein in the EH-R+DOX group were significantly decreased as compared with other groups (P<0.01). As compared with the control group, the apoptosis rate of cardiomyocytes in three DOX-treated groups was obviously increased, the expression levels of Bax increased, and those of Bcl-2 decreased (P<0.01). However, the expression levels of Bax were decreased, those of Bcl-2 increased and the apoptosis rate of cardiomyocytes obviously decreased in EH-R+DOX group when compared with those in the DOX group and the PCN+DOX group (P<0.01 for each). It was concluded that the recombinant plasmids could be successfully constructed, and transfected into the primary cultured cardiomyocytes. They could ameliorate the DOX-induced cardiomyocytes apoptosis by selectively inhibiting the expression of sEH with RNAi and increasing the expression of Bcl-2.
Lu, Y; Li, H; Fu, J
2000-04-01
To establish a suitable model for studying the different mechanisms of mutation between expressed and non-expressed genes in mammalian cells. The NIH3T3 cells were transfected with the linearized pMCLacI/Neo DNAs by liposome-mediated transfection, and grew in the presence of G418. One drug resistant cell clone was selected to proliferate and to be analyzed with Southern blot and RT-PCR analyses on its genomic DNAs. (1) Multiple copies of pMCLacI/Neo plasmid DNA were intactly integrated in the genomic DNAs of the cell clone. (2) One of lac I target genes in the integrated plasmid could be transcribed in the NIH3T3 cells while the other could not. (3) The pMCLacI/Neo plasmid DNA could be efficiently rescued from the genomic DNAs of the cell clone with the average rescue efficiency of 410 cfu/microg DNA. The NIH3T3 cell line containing copies of a stably integrated pMCLacI/Neo has been established. The two lacI target genes in the cell line could imitate the functional states of expressed and non-expressed genes in mammalian cells respectively. The cell line will be a useful model for studying the different mechanisms of mutation between expressed and non-expressed genes in mammalian cells.
One pyrimidine dimer inactivates expression of a transfected gene in xeroderma pigmentosum cells
DOE Office of Scientific and Technical Information (OSTI.GOV)
Protic-Sabljic, M.; Kraemer, K.H.
1985-10-01
The authors have developed a host cell reactivation assay of DNA repair utilizing UV-treated plasmid vectors. The assay primarily reflects cellular repair of transcriptional activity of damaged DNA measured indirectly as enzyme activity of the transfected genes. They studied three plasmids (pSV2cat, 5020 base pairs; pSV2catSVgpt, 7268 base pairs; and pRSVcat, 5027 base pairs) with different sizes and promoters carrying the bacterial cat gene (CAT, chloramphenicol acetyltransferase) in a construction that permits cat expression in human cells. All human simian virus 40-transformed cells studied expressed high levels of the transfected cat gene. UV treatment of the plasmids prior to transfectionmore » resulted in differential decrease in CAT activity in different cell lines. With pSV2catSVgpt, UV inactivation of CAT expression was greater in the xeroderma pigmentosum group A and D lines than in the other human cell lines tested. The D0 of the CAT inactivation curve was 50 J X m-2 for pSV2cat and for pRSVcat in the xeroderma pigmentosum group A cells. The similarity of the D0 data in the xeroderma pigmentosum group A cells for three plasmids of different size and promoters implies they all have similar UV-inactivation target size. UV-induced pyrimidine dimer formation in the plasmids was quantified by assay of the number of UV-induced T4 endonuclease V-sensitive sites. In the most sensitive xeroderma pigmentosum cells, with all three plasmids, one UV-induced pyrimidine dimer inactivates a target of about 2 kilobases, close to the size of the putative CAT mRNA.« less
ERIC Educational Resources Information Center
Bornhorst, Joshua A.; Deibel, Michael A.; Mulnix, Amy B.
2004-01-01
A novel experimental sequence for the advanced undergraduate laboratory course has been developed at Earlham College. Utilizing recent improvements in molecular techniques for a time-sensitive environment, undergraduates were able to create a chimera of a selected gene and green fluorescent protein (GFP) in a bacterial expression plasmid over the…
Neuron-derived orphan receptor 1 promoted human pulmonary artery smooth muscle cells proliferation.
Wang, Chang-Guo; Lei, Wei; Li, Chang; Zeng, Da-Xiong; Huang, Jian-An
2015-05-01
As a transcription factor of the nuclear receptor superfamily, neuron-derived orphan receptor 1 (NOR1) is induced rapidly in response to various extracellular stimuli. But, it is still unclear its role in pulmonary artery smooth muscle cells proliferation. Human PASMCs were cultured in vitro and stimulated by serum. The special antisense oligodeoxynucleotides (AS-ODNs) were used to knockdown human NOR1 gene expression. Real-time PCR and Western-blot were used to evaluate the gene expression and protein levels. Fetal bovine serum (FBS) induced human PASMCs proliferation in a dose dependent manner. Furthermore, FBS promoted NOR1 gene expression in a dose dependent manner and a time dependent manner. 10% FBS induced a maximal NOR1 mRNA levels at 2 h. FBS also induced a significant higher NOR1 protein levels as compared with control. The NOR1 over-expressed plasmid significantly promoted DNA synthesis and cells proliferation. Moreover, the special AS-ODNs against human NOR1 not only prevented NOR1 expression but also inhibited DNA synthesis and cells proliferation significantly. The NOR1 over-expression plasmid could up-regulate cyclin D1 expression markedly, but the AS-ODNs inhibited cyclin D1 expression significantly. So, we concluded that NOR1 could promote human PASMCs proliferation. Cyclin D1 might be involved in this process.
Automated sample-preparation technologies in genome sequencing projects.
Hilbert, H; Lauber, J; Lubenow, H; Düsterhöft, A
2000-01-01
A robotic workstation system (BioRobot 96OO, QIAGEN) and a 96-well UV spectrophotometer (Spectramax 250, Molecular Devices) were integrated in to the process of high-throughput automated sequencing of double-stranded plasmid DNA templates. An automated 96-well miniprep kit protocol (QIAprep Turbo, QIAGEN) provided high-quality plasmid DNA from shotgun clones. The DNA prepared by this procedure was used to generate more than two mega bases of final sequence data for two genomic projects (Arabidopsis thaliana and Schizosaccharomyces pombe), three thousand expressed sequence tags (ESTs) plus half a mega base of human full-length cDNA clones, and approximately 53,000 single reads for a whole genome shotgun project (Pseudomonas putida).
NASA Astrophysics Data System (ADS)
Zheng, Fengrong; Sun, Xiuqin; Liu, Hongzhan; Wu, Xingan; Zhong, Nan; Wang, Bo; Zhou, Guodong
2010-01-01
Lymphocystis disease, caused by the lymphocystis disease virus (LCDV), is a significant worldwide problem in fish industry causing substantial economic losses. In this study, we aimed to develop the DNA vaccine against LCDV, using DNA vaccination technology. We evaluated plasmid pEGFP-N2-LCDV1.3 kb as a DNA vaccine candidate. The plasmid DNA was transiently expressed after liposome transfection into the eukaryotic COS 7 cell line. The distribution and expression of the DNA vaccine (pEGFP-N2-LCDV1.3kb) were also analyzed in tissues of the vaccinated Japanese flounder by PCR, RT-PCR and fluorescent microscopy. Results from PCR analysis indicated that the vaccine-containing plasmids were distributed in injected muscle, the muscle opposite the injection site, the hind intestine, gill, spleen, head, kidney and liver, 6 and 25 days after vaccination. The vaccine plasmids disappeared 100 d post-vaccination. Fluorescent microscopy revealed green fluorescence in the injected muscle, the muscle opposite the injection site, the hind intestine, gill, spleen, head, kidney and liver of fish 48 h post-vaccination, green fluorescence did not appear in the control treated tissue. Green fluorescence became weak at 60 days post-vaccination. RT-PCR analysis indicated that the mcp gene was expressed in all tested tissues of vaccinated fish 6-50 days post-vaccination. These results demonstrate that the antigen encoded by the DNA vaccine is distributed and expressed in all of the tissues analyzed in the vaccinated fish. The antigen would therefore potentially initiate a specific immune response. the plasmid DNA was injected into Japanese flounder ( Paralichthys olivaceus) intramuscularly and antibodies against LCDV were evaluated. The results indicate that the plasmid encoded DNA vaccine could induce an immune response to LCDV and would therefore offer immune protection against LCD. Further studies are required for the development and application of this promising DNA vaccine.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Hervey, IV, William Judson; Khalsa-Moyers, Gurusahai K; Lankford, Patricia K
Protein enrichments of engineered, affinity-tagged (or bait ) fusion proteins with interaction partners are often laden with background, non-specific proteins, due to interactions that occur in vitro as an artifact of the technique. Furthermore, the in vivo expression of the bait protein may itself affect physiology or metabolism. In this study, intrinsic affinity purification challenges were investigated in a model protein complex, DNA-dependent RNA polymerase (RNAP), encompassing chromosome- and plasmid-encoding strategies for bait proteins in two different microbial species: Escherichia coli and Rhodopseudomonas palustris. Isotope ratio measurements of bait protein expression strains relative to native, wild-type strains were performed bymore » liquid chromatography tandem mass spectrometry (LC-MS-MS) to assess bait protein expression strategies in each species. Authentic interacting proteins of RNAP were successfully discerned from artifactual co-isolating proteins by the isotopic differentiation of interactions as random or targeted (I-DIRT) method (A. J. Tackett et al. J. Proteome Res. 2005, 4 (5), 1752-1756). To investigate broader effects of bait protein production in the bacteria, we compared proteomes from strains harboring a plasmid that encodes an affinity-tagged subunit (RpoA) of the RNAP complex with the corresponding wild-type strains using stable isotope metabolic labeling. The ratio of RpoA abundance in plasmid strains versus wild type was 0.8 for R. palustris and 1.7 for E. coli. While most other proteins showed no appreciable difference, proteins significantly increased in abundance in plasmid-encoded bait-expressing strains of both species included the plasmid encoded antibiotic resistance protein, GenR and proteins involved in amino acid biosynthesis. Together, these local, complex-specific and more global, whole proteome isotopic abundance ratio measurements provided a tool for evaluating both in vivo and in vitro effects of plasmid-encoding strategies for bait protein expression. This approach has the potential for enabling discovery of protein-protein interactions among the growing number of sequenced microbial species without the need for development of chromosomal insertion systems.« less
Antibiotic free selection for the high level biosynthesis of a silk-elastin-like protein
Barroca, Mário; Rodrigues, Paulo; Sobral, Rómulo; Costa, M. Manuela R.; Chaves, Susana R.; Machado, Raul; Casal, Margarida; Collins, Tony
2016-01-01
Silk-elastin-like proteins (SELPs) are a family of genetically engineered recombinant protein polymers exhibiting mechanical and biological properties suited for a wide range of applications in the biomedicine and materials fields. They are being explored as the next generation of biomaterials but low productivities and use of antibiotics during production undermine their economic viability and safety. We have developed an industrially relevant, scalable, fed-batch process for the high level production of a novel SELP in E. coli in which the commonly used antibiotic selection marker of the expression vector is exchanged for a post segregational suicide system, the separate-component-stabilisation system (SCS). SCS significantly augments SELP productivity but also enhances the product safety profile and reduces process costs by eliminating the use of antibiotics. Plasmid content increased following induction but no significant differences in plasmid levels were discerned when using SCS or the antibiotic selection markers under the controlled fed-batch conditions employed. It is suggested that the absence of competing plasmid-free cells improves host cell viability and enables increased productivity with SCS. With the process developed, 12.8 g L−1 purified SELP was obtained, this is the highest SELP productivity reported to date and clearly demonstrates the commercial viability of these promising polymers. PMID:27982135
Palumbo, R. Noelle; Zhong, Xiao; Panus, David; Han, Wenqing; Ji, Weihang; Wang, Chun
2012-01-01
DNA vaccination using cationic polymers as carriers has the potential to be a very powerful method of immunotherapy, but typical immune responses generated have been less than robust. To better understand the details of DNA vaccine delivery in vivo, we prepared polymer/DNA complexes using three structurally distinct cationic polymers and fluorescently labeled plasmid DNA and injected them intradermally into mice. We analyzed transgene expression (luciferase) and the local tissue distribution of the labeled plasmid at the injection site at various time points (from hours to days). Comparable numbers of luciferase expressing cells were observed in the skin of mice receiving naked plasmid or polyplexes one day after transfection. At day 4, however, the polyplexes appeared to result in more transfected skin cells than naked plasmid. Live animal imaging revealed that naked plasmid dispersed quickly in the skin of mice after injection and had a wider distribution than any of the three types of polyplexes. However, naked plasmid level dropped to below detection limit after 24 h, whereas polyplexes persisted for up to 2 weeks. The PEGylated polyplexes had a significantly wider distribution in the tissue than the nonPEGylated polyplexes. PEGylated polyplexes also distributed more broadly among dermal fibroblasts and allowed greater interaction with antigen-presenting cells (APCs) (dendritic cells and macrophages) starting at around 24 h post-injection. By day 4, co-localization of polyplexes with APCs was observed at the injection site regardless of polymer structure, whereas small amounts of polyplexes were found in the draining lymph nodes. These in vivo findings demonstrate the superior stability of PEGylated polyplexes in physiological milieu and provide important insight on how cationic polymers could be optimized for DNA vaccine delivery. PMID:22300619
Selifonov, S A; Starozoĭtov, I I
1990-12-01
It was shown that two different enzymes of aromatic ring oxidative meta-cleavage (2,3-dihydroxybiphenyl-1,2-dioxygenase), DBO and catechol-2,3-dioxygenase, C230) function in Pseudomonas strains with a plasmid and chromosomal genetic control of biphenyl and toluate catabolism. A comparative analysis of DBO's and C230's expressed by the pBS241 biphenyl degradative plasmid in P. putida BS893, pBS311 in P. putida U83, chromosomal genes in P. putida BF and C230 from P. putida PaW160 (pWWO) was carried out. It was found that the DBO's of all strains under study are highly specialized enzymes in respect of 2,3-dihydroxybiphenyl cleavage and are also able to cleave 3-methyl-catechol and catechol (but not 4-methylcatechol) at low rates. In contrast with DBO's, in Pseudomonas strains the substrate specificities of all C230's are variable. The C230's expressed by the D-plasmids pBS241 and pBC311 have a moderate affinity for catechol, 3-methyl- and 4-methylcatechol, but are unable to cleave 2,3-dihydroxybiphenyl. The C230 which is encoded by the chromosomal structure gene from P. putida BF is very similar to C230 which codes for the TOL-plasmid pWWO. These plasmid differ from C230's expressed by biphenyl D-plasmids due to their capability to cleave 2,3-dihydroxybiphenyl in addition to catechol cleavage. All DBO's and C230's under study possess a number of properties that are typical for the enzymes having an oxidative meta-cleaving effect. The different roles of these enzymes in biphenyl and toluate catabolism in Pseudomonas strains are discussed.
Diao, Yong; Zhao, Xiao-Feng; Lin, Jun-Sheng; Wang, Qi-Zhao; Xu, Rui-An
2011-01-07
To investigate the effect of transgenic expression of kallistatin (Kal) on carbon tetrachloride (CCl(4))-induced liver injury by intramuscular (im) electrotransfer of a Kal-encoding plasmid formulated with poly-L-glutamate (PLG). The pKal plasmid encoding Kal gene was formulated with PLG and electrotransferred into mice skeletal muscle before the administration of CCl4. The expression level of Kal was measured. The serum biomarker levels of alanine aminotransferase (ALT), aspartate aminotransferase (AST), malonyldialdehyde (MDA), and tumor necrosis factor (TNF)-α were monitored. The extent of CCl4-induced liver injury was analyzed histopathologically. The transgene of Kal was sufficiently expressed after an im injection of plasmid formulated with PLG followed by electroporation. In the Kal gene-transferred mice, protection against CCl4-induced liver injury was reflected by significantly decreased serum ALT, AST, MDA and TNF-α levels compared to those in control mice (P<0.01 to 0.05 in a dose-dependent manner). Histological observations also revealed that hepatocyte necrosis, hemorrhage, vacuolar change and hydropic degeneration were apparent in mice after CCl4 administration. In contrast, the damage was markedly attenuated in the Kal gene-transferred mice. The expression of hepatic fibrogenesis marker transforming growth factor-β1 was also reduced in the pKal transferred mice. Intramuscular electrotransfer of plasmid pKal which was formulated with PLG significantly alleviated the CCl4-induced oxidative stress and inflammatory response, and reduced the liver damage in a mouse model.
Construction of Stable Fluorescent Reporter Plasmids for Use in Staphylococcus aureus
Rodriguez, Michelle D.; Paul, Zubin; Wood, Charles E.; Rice, Kelly C.; Triplett, Eric W.
2017-01-01
Here, the genes encoding three different fluorescent proteins were cloned into the stably maintained Staphylococcus aureus shuttle vector pKK30. The resulting plasmids were transformed into two S. aureus strains; SH1000 and RN4220. Stability assays illustrated that the three recombinant plasmids retained near 100% maintenance in vitro for 160 generations. S. aureus strain SH1000 expressing green fluorescent protein was then inoculated in an ovine model and in vivo stability for 6 days was demonstrated. In essence, these reporter plasmids represent a useful set of tools for dynamic imaging studies in S. aureus. These three reporter plasmids are available through BEI Resources. PMID:29312199
Construction of Stable Fluorescent Reporter Plasmids for Use in Staphylococcus aureus.
Rodriguez, Michelle D; Paul, Zubin; Wood, Charles E; Rice, Kelly C; Triplett, Eric W
2017-01-01
Here, the genes encoding three different fluorescent proteins were cloned into the stably maintained Staphylococcus aureus shuttle vector pKK30. The resulting plasmids were transformed into two S. aureus strains; SH1000 and RN4220. Stability assays illustrated that the three recombinant plasmids retained near 100% maintenance in vitro for 160 generations. S. aureus strain SH1000 expressing green fluorescent protein was then inoculated in an ovine model and in vivo stability for 6 days was demonstrated. In essence, these reporter plasmids represent a useful set of tools for dynamic imaging studies in S. aureus . These three reporter plasmids are available through BEI Resources.
Downie, Kelsey; Adetola, Gbolagade; Carstens, Eric B
2013-11-01
Autographa californica nucleopolyhedrovirus late expression factor 3 (LEF-3) is required for late viral gene expression probably through its numerous functions related to DNA replication, including nuclear localization of the virus helicase P143 and binding to ssDNA. LEF-3 appears to interact with itself as a homo-oligomer, although the details of this oligomeric structure are not yet known. To examine LEF-3-LEF-3 interactions, a bimolecular fluorescent protein complementation assay was used. Pairs of recombinant plasmids expressing full-length LEF-3 fused to one of two complementary fragments (V1 or V2) of a variant of yellow fluorescent protein named 'Venus' were constructed. Plasmids expressing fusions with complementary fragments of Venus were co-transfected into Sf21 cells and analysed by fluorescence microscopy. Co-transfected plasmids expressing full-length V1-LEF-3 and V2-LEF-3 showed positive fluorescence, confirming the formation of homo-oligomers. A series of truncated V1/V2-LEF-3 fusions was constructed and used to investigate interactions with one another as well as with full-length LEF-3.
Hughes, E J; Bayly, R C; Skurray, R A
1984-01-01
Alcaligenes eutrophus wild-type strain 345 metabolizes m- and p-toluate via a catechol meta-cleavage pathway. DNA analysis, curing studies, and transfer of this phenotype by conjugation and transformation showed that the degradative genes are encoded on a self-transmissible 85-kilobase plasmid, pRA1000. HindIII and XhoI restriction endonuclease analysis of pRA1000 showed it to be similar to the archetypal TOL plasmid, pWWO, differing in the case of HindIII only by the absence of fragments B and D present in pWWO. In strain 345, the presence of pRA1000 prevented the expression of chromosomally encoded enzymes required for the degradation of p-cresol, whereas these enzymes were expressed in strains cured of pRA1000. On the basis of studies with an R68.45-pRA1000 cointegrate plasmid, pRA1001, we conclude that the gene(s) responsible for the effect of p-cresol degradation resides within or near the m- and p-toluate degradative region on pRA1000. Images PMID:6325399
A New Suite of Plasmid Vectors for Fluorescence-Based Imaging of Root Colonizing Pseudomonads
Wilton, Rosemarie; Ahrendt, Angela J.; Shinde, Shalaka; ...
2018-02-01
In the terrestrial ecosystem, plant-microbe symbiotic associations are ecologically and economically important processes. To better understand these associations at structural and functional levels, different molecular and biochemical tools are applied. In this study, we have constructed a suite of vectors that incorporates several new elements into the rhizosphere stable, broad-host vector pME6031. The new vectors are useful for studies requiring multi-color tagging and visualization of plant-associated, Gram negative bacterial strains such as Pseudomonas plant growth promotion and biocontrol strains. A number of genetic elements, including constitutive promoters and signal peptides that target secretion to the periplasm, have been evaluated. Severalmore » next generation fluorescent proteins, namely mTurquoise2, mNeonGreen, mRuby2, DsRed-Express2 and E2-Crimson have been incorporated into the vectors for whole cell labeling or protein tagging. Secretion of mTurquoise2 and mNeonGreen into the periplasm of Pseudomonas fluorescens SBW25 has also been demonstrated, providing a vehicle for tagging proteins in the periplasmic compartment. A higher copy number version of select plasmids has been produced by introduction of a previously described repA mutation, affording an increase in protein expression levels. The utility of these plasmids for fluorescence-based imaging is demonstrated by root colonization of Solanum lycopersicum seedlings by P. fluorescens SBW25 in a hydroponic growth system. As a result, the plasmids are stably maintained during root colonization in the absence of selective pressure for more than two weeks.« less
A New Suite of Plasmid Vectors for Fluorescence-Based Imaging of Root Colonizing Pseudomonads
DOE Office of Scientific and Technical Information (OSTI.GOV)
Wilton, Rosemarie; Ahrendt, Angela J.; Shinde, Shalaka
In the terrestrial ecosystem, plant-microbe symbiotic associations are ecologically and economically important processes. To better understand these associations at structural and functional levels, different molecular and biochemical tools are applied. In this study, we have constructed a suite of vectors that incorporates several new elements into the rhizosphere stable, broad-host vector pME6031. The new vectors are useful for studies requiring multi-color tagging and visualization of plant-associated, Gram negative bacterial strains such as Pseudomonas plant growth promotion and biocontrol strains. A number of genetic elements, including constitutive promoters and signal peptides that target secretion to the periplasm, have been evaluated. Severalmore » next generation fluorescent proteins, namely mTurquoise2, mNeonGreen, mRuby2, DsRed-Express2 and E2-Crimson have been incorporated into the vectors for whole cell labeling or protein tagging. Secretion of mTurquoise2 and mNeonGreen into the periplasm of Pseudomonas fluorescens SBW25 has also been demonstrated, providing a vehicle for tagging proteins in the periplasmic compartment. A higher copy number version of select plasmids has been produced by introduction of a previously described repA mutation, affording an increase in protein expression levels. The utility of these plasmids for fluorescence-based imaging is demonstrated by root colonization of Solanum lycopersicum seedlings by P. fluorescens SBW25 in a hydroponic growth system. As a result, the plasmids are stably maintained during root colonization in the absence of selective pressure for more than two weeks.« less
A novel bicistronic sensor vector for detecting caspase-3 activation.
Vagner, Tatyana; Mouravlev, Alexandre; Young, Deborah
2015-01-01
Apoptosis is involved in pathological cell death of a wide range of human diseases. One of the most important biochemical markers of apoptosis is activation of caspase-3. Ability to detect caspase-3 activation early in the pathological process is important for determining the timing for interfering with apoptosis initiation and prevention of cell damage. Techniques allowing detection of caspase-3 activity at a single cell level show increased sensitivity, compared to biochemical assays; therefore, we developed a novel bicistronic caspase-3 sensor vector enabling detection of caspase-3 activity in individual cells. We employed green fluorescent protein (GFP) as a reporter for caspase-3 activation in our constructs and assessed the functionality of the generated constructs in transiently transfected Neuro2A and HEK293 cells under basal conditions and following application of okadaic acid (OA) or staurosporine (STS) to induce apoptosis. To ensure responsiveness of the new sensor vector to active caspase-3, we co-transfected the sensor with plasmid(s) overexpressing active caspase-3 and quantified GFP fluorescence using a plate reader. We observed an increase in GFP expression in cells transfected with the new bicistronic caspase-3 sensor in response to both OA and STS. We also showed a significant increase in GFP fluorescence intensity in cells co-expressing the sensor with the plasmid(s) encoding active caspase-3. We generated a novel bicistronic caspase-3 sensor vector which relies on a transcription factor/response element system. The obtained sensor combines high sensitivity of the single cell level detection with the possibility of automated quantification. Copyright © 2015 Elsevier Inc. All rights reserved.
USDA-ARS?s Scientific Manuscript database
Plasmids that contain a disrupted genome of the Junonia coenia densovirus (JcDNV) integrate into the chromosomes of the somatic cells of insects. When subcloned individually, both the P9 inverted terminal repeat (P9-ITR) and the P93-ITR promote the chromosomal integration of vector plasmids in insec...
Nakayama, Kosuke; Ohmori, Takeshi; Ishikawa, Satoshi; Iwata, Natsumi; Seto, Yasuo; Kawahara, Kazuyoshi
2016-05-01
The plasmid encoding His-tagged organophosphorus hydrolase (OPH) cloned from Sphingobium fuliginis was modified to be transferred back to this bacterium. The replication function of S. amiense plasmid was inserted at downstream of OPH gene, and S. fuliginis was transformed with this plasmid. The transformant produced larger amount of active OPH with His-tag than E. coli.
Zhang, Qun; Shu, Fu-Li; Jiang, Yu-Feng; Huang, Xin-En
2015-01-01
In this study, influence caused by expression plasmids of connective tissue growth factor (CTGF) and tissue inhibitor of metalloproteinase-1 (TIMP-1) short hairpin RNA (shRNA) on mRNA expression of CTGF,TIMP-1,procol-α1 and PCIII in hepatic tissue with hepatic fibrosis, a precancerous condition, in rats is analyzed. To screen and construct shRNA expression plasimid which effectively interferes RNA targets of CTGF and TIMP-1 in rats. 50 cleaning Wistar male rats are allocated randomly at 5 different groups after precancerous fibrosis models and then injection of shRNA expression plasimids. Plasmid psiRNA-GFP-Com (CTGF and TIMP-1 included), psiRNA-GFP-CTGF, psiRNA-GFP-TIMP-1 and psiRNA- DUO-GFPzeo of blank plasmid are injected at group A, B, C and D, respectively, and as model control group that none plasimid is injected at group E. In 2 weeks after last injection, to hepatic tissue at different groups, protein expression of CTGF, TIMP-1, procol-α1and PC III is tested by immunohistochemical method and,mRNA expression of CTGF,TIMP-1,procol-α1 and PCIII is measured by real-time PCR. One-way ANOVA is used to comparison between-groups. Compared with model group, there is no obvious difference of mRNA expression among CTGF,TIMP-1,procol-α1,PC III and of protein expression among CTGF, TIMP-1, procol-α1, PC III in hepatic tissue at group injected with blank plasmid. Expression quantity of mRNA of CTGF, TIMP-1, procol-α1 and PCIII at group A, B and C decreases, protein expression of CTGF, TIMP-1, procol-α1, PC III in hepatic tissue is lower, where the inhibition of combination RNA interference group (group A) on procol-α1 mRNA transcription and procol-α1 protein expression is superior to that of single interference group (group B and C) (P<0.01 or P<0.05). RNA interference on CTGF and/or TIMP-1 is obviously a inhibiting factor for mRNA and protein expression of CTGF, TIMP-1, procol-α1 and PCIII. Combination RNA interference on genes of CTGF and TIMP-1 is superior to that of single RNA interference, and this could be a contribution for prevention of precancerous condition.
Jiwaji, Meesbah; Daly, Rónán; Pansare, Kshama; McLean, Pauline; Yang, Jingli; Kolch, Walter; Pitt, Andrew R
2010-12-31
The importance of appropriate normalization controls in quantitative real-time polymerase chain reaction (qPCR) experiments has become more apparent as the number of biological studies using this methodology has increased. In developing a system to study gene expression from transiently transfected plasmids, it became clear that normalization using chromosomally encoded genes is not ideal, at it does not take into account the transfection efficiency and the significantly lower expression levels of the plasmids. We have developed and validated a normalization method for qPCR using a co-transfected plasmid. The best chromosomal gene for normalization in the presence of the transcriptional activators used in this study, cadmium, dexamethasone, forskolin and phorbol-12-myristate 13-acetate was first identified. qPCR data was analyzed using geNorm, Normfinder and BestKeeper. Each software application was found to rank the normalization controls differently with no clear correlation. Including a co-transfected plasmid encoding the Renilla luciferase gene (Rluc) in this analysis showed that its calculated stability was not as good as the optimised chromosomal genes, most likely as a result of the lower expression levels and transfection variability. Finally, we validated these analyses by testing two chromosomal genes (B2M and ActB) and a co-transfected gene (Rluc) under biological conditions. When analyzing co-transfected plasmids, Rluc normalization gave the smallest errors compared to the chromosomal reference genes. Our data demonstrates that transfected Rluc is the most appropriate normalization reference gene for transient transfection qPCR analysis; it significantly reduces the standard deviation within biological experiments as it takes into account the transfection efficiencies and has easily controllable expression levels. This improves reproducibility, data validity and most importantly, enables accurate interpretation of qPCR data.
Suarez, D L; Schultz-Cherry, S
2000-01-01
Vaccination of poultry with naked plasmid DNA has been successfully demonstrated with several different poultry pathogens, but the technology needs to be further developed before it can be practically implemented. Many different methods can conceivably enhance the efficacy of DNA vaccines, and this report examines the use of different eukaryotic expression vectors with different promoters and different adjuvants to express the influenza hemagglutinin protein. Four different promoters in five different plasmids were used to express the hemagglutinin protein of an H5 avian influenza virus, including two different immediate early cytomegaloviruses (CMVs), Rous sarcoma virus, chicken actin, and simian virus 40 promoters. All five constructs expressed detectable hemagglutinin protein in cell culture, but the pCI-neo HA plasmid with the CMV promoter provided the best response in chickens when vaccinated intramuscularly at 1 day of age on the basis of antibody titer and survivability after challenge with a highly pathogenic avian influenza virus at 6 wk postinoculation. A beneficial response was observed in birds boostered at 3 wk of age, in birds given larger amounts of DNA, and with the use of multiple injection sites to administer the vaccine. With the use of the pCI-neo construct, the effects of different adjuvants designed to increase the uptake of plasmid DNA, including 25% sucrose, diethylaminoethyl dextran, calcium phosphate, polybrene, and two different cationic liposomes, were examined. Both liposomes tested enhanced antibody titers as compared with the positive controls, but the other chemical adjuvants decreased the antibody response as compared with the control chickens that received just the plasmid alone. The results observed are promising for continued studies, but continued improvements in vaccine response and reduced costs are necessary before the technology can be commercially developed.
Inman, Melissa; Perng, Guey-Chuen; Henderson, Gail; Ghiasi, Homayon; Nesburn, Anthony B.; Wechsler, Steven L.; Jones, Clinton
2001-01-01
The latency-associated transcript (LAT) is the only abundant herpes simplex virus type 1 (HSV-1) transcript expressed during latency. In the rabbit eye model, LAT null mutants do not reactivate efficiently from latency. We recently demonstrated that the LAT null mutant dLAT2903 induces increased levels of apoptosis in trigeminal ganglia of infected rabbits compared to LAT+ strains (G.-C. Perng, C. Jones, J. Ciacci-Zarella, M. Stone, G. Henderson, A. Yokht, S. M. Slanina, F. M. Hoffman, H. Ghiasi, A. B. Nesburn, and C. S. Wechsler, Science 287:1500–1503, 2000).The same study also demonstrated that a plasmid expressing LAT nucleotides 301 to 2659 enhanced cell survival of transfected cells after induction of apoptosis. Consequently, we hypothesized that LAT enhances spontaneous reactivation in part, because it promotes survival of infected neurons. Here we report on the ability of plasmids expressing different portions of the 5′ end of LAT to promote cell survival after induction of apoptosis. A plasmid expressing the first 1.5 kb of LAT (LAT nucleotides 1 to 1499) promoted cell survival in neuro-2A (mouse neuronal) and CV-1 (monkey fibroblast) cells. A plasmid expressing just the first 811 nucleotides of LAT promoted cell survival less efficiently. Plasmids expressing the first 661 nucleotides or less of LAT did not promote cell survival. We previously showed that a mutant expressing just the first 1.5 kb of LAT has wild-type spontaneous reactivation in rabbits, and a mutant expressing just the first 811 nucleotides of LAT has a reactivation frequency higher than that of dLAT2903 but lower than that of wild-type virus. In addition, mutants reported here for the first time, expressing just the first 661 or 76 nucleotides of LAT, had spontaneous reactivation indistinguishable from that of the LAT null mutant dLAT2903. In summary, these studies provide evidence that there is a functional relationship between the ability of LAT to promote cell survival and its ability to enhance spontaneous reactivation. PMID:11264353
Fumoto, Shintaro; Nishimura, Koyo; Nishida, Koyo; Kawakami, Shigeru
2016-01-01
Evaluation methods for determining the distribution of transgene expression in the body and the in vivo fate of viral and non-viral vectors are necessary for successful development of in vivo gene delivery systems. Here, we evaluated the spatial distribution of transgene expression using tissue clearing methods. After hydrodynamic injection of plasmid DNA into mice, whole tissues were subjected to tissue clearing. Tissue clearing followed by confocal laser scanning microscopy enabled evaluation of the three-dimensional distribution of transgene expression without preparation of tissue sections. Among the tested clearing methods (ClearT2, SeeDB, and CUBIC), CUBIC was the most suitable method for determining the spatial distribution of transgene expression in not only the liver but also other tissues such as the kidney and lung. In terms of the type of fluorescent protein, the observable depth for green fluorescent protein ZsGreen1 was slightly greater than that for red fluorescent protein tdTomato. We observed a depth of ~1.5 mm for the liver and 500 μm for other tissues without preparation of tissue sections. Furthermore, we succeeded in multicolor deep imaging of the intracellular fate of plasmid DNA in the murine liver. Thus, tissue clearing would be a powerful approach for determining the spatial distribution of plasmid DNA and transgene expression in various murine tissues.
An efficient procedure for the expression and purification of HIV-1 protease from inclusion bodies.
Nguyen, Hong-Loan Thi; Nguyen, Thuy Thi; Vu, Quy Thi; Le, Hang Thi; Pham, Yen; Trinh, Phuong Le; Bui, Thuan Phuong; Phan, Tuan-Nghia
2015-12-01
Several studies have focused on HIV-1 protease for developing drugs for treating AIDS. Recombinant HIV-1 protease is used to screen new drugs from synthetic compounds or natural substances. However, large-scale expression and purification of this enzyme is difficult mainly because of its low expression and solubility. In this study, we constructed 9 recombinant plasmids containing a sequence encoding HIV-1 protease along with different fusion tags and examined the expression of the enzyme from these plasmids. Of the 9 plasmids, pET32a(+) plasmid containing the HIV-1 protease-encoding sequence along with sequences encoding an autocleavage site GTVSFNF at the N-terminus and TEV plus 6× His tag at the C-terminus showed the highest expression of the enzyme and was selected for further analysis. The recombinant protein was isolated from inclusion bodies by using 2 tandem Q- and Ni-Sepharose columns. SDS-PAGE of the obtained HIV-1 protease produced a single band of approximately 13 kDa. The enzyme was recovered efficiently (4 mg protein/L of cell culture) and had high specific activity of 1190 nmol min(-1) mg(-1) at an optimal pH of 4.7 and optimal temperature of 37 °C. This procedure for expressing and purifying HIV-1 protease is now being scaled up to produce the enzyme on a large scale for its application. Copyright © 2015 Elsevier Inc. All rights reserved.
Zheng, Fengrong; Sun, Xiuqin; Wu, Xing'an; Liu, Hongzhan; Li, Jiye; Wu, Suqi; Zhang, Jinxing
2011-01-01
Here, we report the construction of a vaccine against lymphocystis disease virus (LCDV) using nucleic acid vaccination technology. A fragment of the major capsid protein encoding gene from an LCDV isolated from China (LCDV-cn) was cloned into an eukaryotic expression vector pEGFP-N2, yielding a recombinant plasmid pEGFP-N2-LCDV-cn0.6 kb. This plasmid was immediately expressed after liposomal transfer into the Japanese flounder embryo cell line. The recombinant plasmid was inoculated into Japanese flounder via two routes (intramuscular injection and hypodermic injection) at three doses (0.1, 5, and 15 μg), and then T-lymphopoiesis in different tissues and antibodies raised against LCDV were evaluated. The results indicated that this recombinant plasmid induced unique humoral or cell-mediated immune responses depending on the inoculation route and conferred immune protection. Furthermore, the humoral immune responses and protective effects were significantly increased at higher vaccine doses via the two injection routes. Plasmid pEGFP-N2-LCDV0.6 kb is therefore a promising vaccine candidate against LCDV in Japanese flounder. PMID:21789044
Saubi, Narcís; Gea-Mallorquí, Ester; Ferrer, Pau; Hurtado, Carmen; Sánchez-Úbeda, Sara; Eto, Yoshiki; Gatell, Josep M; Hanke, Tomáš; Joseph, Joan
2014-01-01
In this study, we have engineered a new mycobacterial vaccine design by using an antibiotic-free plasmid selection system. We assembled a novel Escherichia coli (E. coli)–mycobacterial shuttle plasmid p2auxo.HIVA, expressing the HIV-1 clade A immunogen HIVA. This shuttle vector employs an antibiotic resistance-free mechanism for plasmid selection and maintenance based on glycine complementation in E. coli and lysine complementation in mycobacteria. This plasmid was first transformed into glycine auxotroph of E. coli strain and subsequently transformed into lysine auxotroph of Mycobacterium bovis BCG strain to generate vaccine BCG.HIVA2auxo. We demonstrated that the episomal plasmid p2auxo.HIVA was stable in vivo over a 7-week period and genetically and phenotypically characterized the BCG.HIVA2auxo vaccine strain. The BCG.HIVA2auxo vaccine in combination with modified vaccinia virus Ankara (MVA). HIVA was safe and induced HIV-1 and Mycobacterium tuberculosis-specific interferon-γ-producing T-cell responses in adult BALB/c mice. Polyfunctional HIV-1-specific CD8+ T cells, which produce interferon-γ and tumor necrosis factor-α and express the degranulation marker CD107a, were induced. Thus, we engineered a novel, safer, good laboratory practice–compatible BCG-vectored vaccine using prototype immunogen HIVA. This antibiotic-free plasmid selection system based on “double” auxotrophic complementation might be a new mycobacterial vaccine platform to develop not only recombinant BCG-based vaccines expressing second generation of HIV-1 immunogens but also other major pediatric pathogens to prime protective response soon after birth. PMID:26015961
Wang, Yarong; Du, Dewei; Li, Zhanting; Wei, Junxia; Yang, Angang
2012-01-01
Relative deficiency in production of glycoprotein hormone erythropoietin (Epo) is a major cause of renal anemia. This study planned to investigate whether the hypoxia-regulated system of Epo expression, constructed by fusing Epo gene to the chimeric phosphoglycerate kinase (PGK) hypoxia response elements (HRE) in combination with cytomegalovirus immediate-early (CMV IE) basal gene promoter and delivered by plasmid intramuscular injection, might provide a long-term physiologically regulated Epo secretion expression to correct the anemia in adenine-induced uremic rats. Plasmid vectors (pHRE-Epo) were synthesized by fusing human Epo cDNA to the HRE/CMV promoter. Hypoxia-inducible activity of this promoter was evaluated first in vitro and then in vivo in healthy and uremic rats (n = 30 per group). The vectors (pCMV-Epo) in which Epo expression was directed by a constitutive CMV gene promoter served as control. ANOVA and Student's t-test were used to analyze between-group differences. A high-level expression of Epo was induced by hypoxia in vitro and in vivo. Though both pHRE-Epo and pCMV-Epo corrected anemia, the hematocrit of the pCMV-Epo-treated rats exceeded the normal (P < 0.05), but that of the pHRE-Epo-treated rats didn't. Hypoxia-regulated system of Epo gene expression constructed by fusing Epo to the HRE/CMV promoter and delivered by plasmid intramuscular injection may provide a long-term and stable Epo expression and secretion in vivo to correct the anemia in adenine-induced uremic rats. PMID:22990115
NASA Technical Reports Server (NTRS)
Jiao, S.; Williams, P.; Safda, N.; Schultz, E.; Wolff, J. A.
1993-01-01
We have previously proposed the use of primary muscle cells as a "platform," or "vehicle" for intracerebral transgene expression. Brain grafts of minced muscle, or cultured muscle cells persisted in rat brains for at least 6 mo without any decrease in graft size, or tumor formation. Stable, but moderate levels of intracerebral transgene expression were obtained by transplanting plasmid-transfected myotubes in culture. In the present study, high and stable levels of intracerebral transgene expression were achieved by the co-transplantation of plasmid-transfected myoblasts and myotubes in culture. Approximately 5 X 10(5) myoblasts and myotubes were transfected with 10 micrograms pRSVL plasmid DNA, and 30 micrograms Lipofectin (BRL), respectively. They were mixed together (total cell number was 1 million), and stereotactically injected into the caudate nucleus of an adult rat brain. The activity of luciferase, the product of transgene expression, was stable for at least 4 mo, and much higher than the levels in myotube grafts, or co-grafts of myoblasts and minced muscle. Presumably, the myotubes served as a framework on which the myoblasts can form myotubes. The sections of brains transplanted with co-graft of myoblasts, and myotubes transfected with pRSVLac-Z were stained immunofluorescently for beta-galactosidase activity. The muscle grafts contained beta-galactosidase positive myofibers 4 mo after transplantation. Such high and stable levels of in vivo expression after postnatal gene transfer have rarely been achieved. Primary muscle cells are useful vehicle for transgene expression in brains, and potentially valuable for gene therapy of degenerative neurological disorders.
Chen, Yu-Hua; Zhou, Bi-Yun; Wu, Guo-Cai; Liao, De-Quan; Li, Jing; Liang, Si-Si; Wu, Xian-Jin; Xu, Jun-Fa; Chen, Yong-Hua; Di, Xiao-Qing; Lin, Qiong-Yan
2018-02-14
This study aims to investigate the effects of exogenous interleukin (IL)-37 on the biological characteristics of human lung adenocarcinoma A549 cells and the chemotaxis of regulatory T (Treg) cells. After isolating the CD4+ CD25+ Treg cells from the peripheral blood, flow cytometry was used to detect the purity of the Treg cells. A549 cells were divided into blank (no transfection), empty plasmid (transfection with pIRES2-EGFP empty plasmid) or IL-37 group (transfection with pIRES2-EGFP-IL-37 plasmid). RT-PCR was used to detect mRNA expression of IL-37 and ELISA to determine IL-37 and MMP-9 expressions. Western blotting was applied to detect the protein expressions of PCNA, Ki-67, Cyclin D1, CDK4, cleaved caspase-3 and cleaved caspase-9. MTT assay, flow cytometry, scratch test and transwell assay were performed to detect cell proliferation, cycle, apoptosis, migration and invasion. Effect of exogenous IL-37 on the chemotaxis of Treg cells was measured through transwell assay. Xenograft models in nude mice were eastablished to detect the impact of IL-37 on A549 cells. The IL-37 group had a higher IL-37 expression, cell apoptosis in the early stage and percentage of cells in the G0/G1 phase than the blank and empty plasmid groups. The IL-37 group had a lower MMP-9 expression, optical density (OD), percentage of cells in the S and G2/M phases, migration, invasion and chemotaxis of CD4+CD25+ Foxp3+ Treg cells. The xenograft volume and weight of nude mice in the IL-37 group were lower than those in the blank and empty plasmid groups. Compared with the blank and empty plasmid groups, the IL-37 group had significantly reduced expression of PCNA, Ki-67, Cyclin D1 and CDK4 but elevated expression of cleaved caspase-3 and cleaved caspase-9. Therefore, exogenous IL-37 inhibits the proliferation, migration and invasion of human lung adenocarcinoma A549 cells as well as the chemotaxis of Treg cells while promoting the apoptosis of A549 cells.
USDA-ARS?s Scientific Manuscript database
In Yersinia pestis, Y. pseudotuberculosis, and Y, enterocolitica, phenotypic expression of virulence plasmid (pYV: 70-kb)-associated genetic determinants may include low calcium response (Lcr, pin point colony, size = 0.36 mm), colony morphology (size = 1.13 mm), crystal violet (CV) binding (dark-v...
USDA-ARS?s Scientific Manuscript database
In Yersinia pestis, Y. pseudotuberculosis, and Y, enterocolitica, phenotypic expression of several virulence plasmid (pYV: 70-kb)-associated genetic determinants may include low calcium response (Lcr, pin point colony, size = 0.36 mm), colony morphology (size = 1.13 mm), crystal violet (CV) binding...
Turnbull, Gillian A.; Ousley, Margaret; Walker, Allan; Shaw, Eve; Morgan, J. Alun W.
2001-01-01
Arthrobacter globiformis D47 was shown to degrade a range of substituted phenylurea herbicides in soil. This strain contained two plasmids of approximately 47 kb (pHRIM620) and 34 kb (pHRIM621). Plasmid-curing experiments produced plasmid-free strains as well as strains containing either the 47- or the 34-kb plasmid. The strains were tested for their ability to degrade diuron, which demonstrated that the degradative genes were located on the 47-kb plasmid. Studies on the growth of these strains indicated that the ability to degrade diuron did not offer a selective advantage to A. globiformis D47 on minimal medium designed to contain the herbicide as a sole carbon source. The location of the genes on a plasmid and a lack of selection would explain why the degradative phenotype, as with many other pesticide-degrading bacteria, can be lost on subculture. A 22-kb EcoRI fragment of plasmid pHRIM620 was expressed in Escherichia coli and enabled cells to degrade diuron. Transposon mutagenesis of this fragment identified one open reading frame that was essential for enzyme activity. A smaller subclone of this gene (2.5 kb) expressed in E. coli coded for the protein that degraded diuron. This gene and its predicted protein sequence showed only a low level of protein identity (25% over ca. 440 amino acids) to other database sequences and was named after the enzyme it encoded, phenylurea hydrolase (puhA gene). PMID:11319111
Lafuente, M J; Petit, T; Gancedo, C
1997-12-22
We have constructed a series of plasmids to facilitate the fusion of promoters with or without coding regions of genes of Schizosaccharomyces pombe to the lacZ gene of Escherichia coli. These vectors carry a multiple cloning region in which fission yeast DNA may be inserted in three different reading frames with respect to the coding region of lacZ. The plasmids were constructed with the ura4+ or the his3+ marker of S. pombe. Functionality of the plasmids was tested measuring in parallel the expression of fructose 1,6-bisphosphatase and beta-galactosidase under the control of the fbp1+ promoter in different conditions.
Godovikova, Valentina; Goetting-Minesky, M. Paula; Shin, Jae M.; Kapila, Yvonne L.; Rickard, Alexander H.
2015-01-01
Oral pathogens, including Treponema denticola, initiate the dysregulation of tissue homeostasis that characterizes periodontitis. However, progress of research on the roles of T. denticola in microbe-host interactions and signaling, microbial communities, microbial physiology, and molecular evolution has been hampered by limitations in genetic methodologies. This is typified by an extremely low transformation efficiency and inability to transform the most widely studied T. denticola strain with shuttle plasmids. Previous studies have suggested that robust restriction-modification (R-M) systems in T. denticola contributed to these problems. To facilitate further molecular genetic analysis of T. denticola behavior, we optimized existing protocols such that shuttle plasmid transformation efficiency was increased by >100-fold over prior reports. Here, we report routine transformation of T. denticola ATCC 35405 with shuttle plasmids, independently of both plasmid methylation status and activity of the type II restriction endonuclease encoded by TDE0911. To validate the utility of this methodological advance, we demonstrated expression and activity in T. denticola of a flavin mononucleotide-based fluorescent protein (FbFP) that is active under anoxic conditions. Addition of routine plasmid-based fluorescence labeling to the Treponema toolset will enable more-rigorous and -detailed studies of the behavior of this organism. PMID:26162875
Yu, Feng; Li, Hua; Bu, Xuefeng; Zhang, Yongjun
2012-01-01
To investigate the effects of integrin-β1 gene expression inhibited by shRNA on invasion of pancreatic carcinoma PANC-1 cells in vitro. The eukaryotic expression plasmid of short hairpin RNA (shRNA) targeting integrin-β1 gene (integrin-β1-shRNA) was constructed and transfected into PANC-1 cells. The expressions of integrin-β1 mRNA and protein were detected by real-time quantitative polymerase chain reaction (PCR) and western blot assay, respectively. The invasive ability of PANC-1 cells was observed with a transwell cell culture chamber and the expressions of MMP-2 and MMP-9 were assayed. Compared to the untransfected group, recombinant expression plasmid integrin-β1-shRNA resulted in reduction of integrin-β1 mRNA and protein by 78.58%±7.24% and 92.88%±3.18%, respectively and the average number of invading PANC-1 cells were decreased from 52±5 to 21±4 (p<0.01) and the expressions of MMP-2 and MMP-9 were inhibited. Recombinant expression plasmid integrin-β1- shRNA can inhibit the expression of integrin-β1 gene and suppress the invasion of PANC-1 cells in vitro significantly.
Royo, Jose Luis; Moreno-Ruiz, Emilia; Cebolla, Angel; Santero, Eduardo
2005-03-16
In our laboratory we have analyzed different factors to maximize the yield in heterologous protein expression for long-term cultivation, by combination of an efficient cascade expression system and stable integration in the bacterial chromosome. In this work, we have explored this system for the production of indigo dye as a model for biotechnological production, by expressing in Escherichia coli the thnA1A2A3A4 genes from Sphingomonas macrogolitabida strain TFA, which encode the components of a tetralin dioxygenase activity. We compared Ptac, and the Pm-based cascade expression circuit in a multicopy plasmid and stably integrated into the bacterial chromosome. Plasmid-based expression systems resulted in instability of indigo production when serially diluted batch experiments were performed without a selective pressure. This problem was solved by integrating the expression module in the chromosome. Despite the gene dosage reduction, the synergic effect of the cascade expression system produced comparable expression to the dioxygenase activity in the plasmid configuration but could be stably maintained for at least 5 days. Here, we show that the cascade amplification circuit integrated in the chromosome could be an excellent system for tight control and stable production of recombinant products.
An electrospun scaffold integrating nucleic acid delivery for treatment of full thickness wounds
Kobsa, Serge; Kristofik, Nina J.; Sawyer, Andrew J.; Bothwell, Alfred L.M.; Kyriakides, Themis R.; Saltzman, W. Mark
2013-01-01
We developed a multi-functional construct capable of controlled delivery of bioactive substances that can improve wound repair by supporting the intrinsic ability of the skin to heal. We synthesized electrospun scaffolds—composed of a blend of the degradable polymers poly(L-lactide) (PLA) or polycaprolactone (PCL)—that produce highly efficient non-viral in vivo gene delivery to cells in the wound bed, provide a protective barrier during early wound healing, and support cell migration and growth. This multi-functional material was tested for its influence on wound healing: scaffolds were loaded with plasmids encoding keratinocyte growth factor (KGF) and applied to full thickness wounds in mice. Compared to scaffolds with control plasmids, animals receiving the KGF plasmid-loaded scaffold produced significant enhancements in wound healing, which was quantified by improvements in the rate of wound re-epithelialization, keratinocyte proliferation, and granulation response. Further, we quantified the expression level of endogenous and plasmid-derived KGF in wound samples: qRT-PCR on wound sections revealed a correlation between the levels of plasmid-derived protein expression and histological analysis of wound healing, revealing an inverse relationship between the expression level of exogenous KGF and the size of the unhealed epithelial layer in wounds. Our findings suggest that engineered nanofiber PLA/PCL scaffolds are capable of highly efficient controlled DNA delivery and are promising materials for treatment of cutaneous wounds. PMID:23453058
Mizutani, Kimihiko
2015-01-01
Homologous recombination is a system for repairing the broken genomes of living organisms by connecting two DNA strands at their homologous sequences. Today, homologous recombination in yeast is used for plasmid construction as a substitute for traditional methods using restriction enzymes and ligases. This method has various advantages over the traditional method, including flexibility in the position of DNA insertion and ease of manipulation. Recently, the author of this review reported the construction of plasmids by homologous recombination in the methanol-utilizing yeast Pichia pastoris, which is known to be an excellent expression host for secretory proteins and membrane proteins. The method enabled high-throughput construction of expression systems of proteins using P. pastoris; the constructed expression systems were used to investigate the expression conditions of membrane proteins and to perform X-ray crystallography of secretory proteins. This review discusses the mechanisms and applications of homologous recombination, including the production of proteins for X-ray crystallography.
Intranasal Delivery of pGDNF Nanoparticles for Parkinson's Disease
NASA Astrophysics Data System (ADS)
Harmon, Brendan Trevor
Parkinson's disease (PD) is a progressive neurodegenerative disorder that primarily affects the dopaminergic A9 nigrostriatal tract. For dopamine neurons specifically, glial cell-derived neurotrophic factor (GDNF) has been shown to promote their survival and proliferation both in culture and in vivo. GDNF has also proven to be neuroprotective and restorative in various animal models of PD and some human clinical trials. However, its delivery to the brain has required invasive surgical routes which are not clinically practical for many patients. The main objective of this project was to test intranasal delivery to the brain of a nanoparticle vector incorporating an expression plasmid for GDNF (pGDNF). The intranasal route circumvents the blood-brain barrier, allowing larger sized vectors into the central nervous system while avoiding peripheral distribution. This approach would provide a renewable source of GDNF within the target areas of the brain, the striatum and the substantia nigra (SN) without the need for surgical injections or frequent re-dosing. A PEGylated polylysine compacted plasmid nanoparticle vector (PEG-CK30), developed by Copernicus Therapeutics, Inc., has been shown to transfect neurons and glial cells in vivo while lacking the safety issues present with other vectors. The first goal of this work was to determine if these PEG-CK30 compacted plasmid nanoparticles can successfully transfect cells and express the reporter protein, enhanced green fluorescent protein (eGFP) in the rat brain after intranasal administration. Initial in vivo experiments utilized the expression plasmid pCG, expressing eGFP under the fast-acting cytomegalovirus (CMV) promoter. Intranasal administration of pCG nanoparticles resulted in evidence of transfection of brain cells, as shown both qualitatively, by GFP-immunohistochemistry, and quantitatively, by GFP-ELISA. Expression was detected throughout the rat brain two days post-administration. Following the proof-of-principle study with pCG, a new plasmid was created by Copernicus Therapeutics, Inc. to better mimic their long-lasting pGDNF plasmid while providing both GDNF as well as the reporter function of eGFP. This eGFP-GDNF plasmid was used to monitor expression and cell-types transfected. This expression plasmid, called pUGG, was first characterized in vitro to verify protein expression. Transfection experiments in SHEP-1 neuroblastoma cells, ventral midbrain cultures, and N27 dopaminergic cells all demonstrated that pUGG expressed bioactive eGFP and GDNF. However, cleavage of the two proteins did not occur and the expressed protein emerged as a fusion construct which was not detectable by GDNF-ELISA, although it was detected by GFP-ELISA. The next goal was to determine if pUGG was able to transfect cells in vivo in rat brain. Direct striatal injection of pUGG nanoparticles showed significant eGFP expression at the site of injection both 7 and 14 days post-administration with no difference in eGFP expression between the two time-points. GFP-immunohistochemistry at the striatal injection site revealed expression of eGFP-positive cells as well as evidence of GDNF's bioactivity as indicated by neurite outgrowth. Moving forward, we administered pUGG nanoparticles intranasally to rats and found significant expression seven days later throughout the brain, with highest levels in the forebrain areas (olfactory bulb and frontal cortex). Significant expression was also seen along the rostral-caudal axis of the brain compared with naked pUGG plasmid. The final goal of this work was to examine whether intranasal pGDNF pre-treatment could generate sufficient GDNF to protect SN dopamine neurons after a unilateral 6-hydroxydopmaine (6-OHDA) lesion, a common animal model for PD. Copernicus' pGDNF plasmid was utilized for the neuroprotection experiments to avoid possible confounds due to the GFP fusion produced by pUGG. Tyrosine hydroxylase-immunostaining density was used as a marker for dopamine neurons in the SN and their nerve terminals in the striatum. Dopamine cell counts were also performed in the SN. Intranasal delivery of pGDNF significantly protected dopamine neurons in the rat 6-OHDA model of PD. This was revealed in three ways. First, pGDNF treatments reduced amphetamine-induced circling behavior, suggesting a prevention of dopamine loss on the 6-OHDA-lesioned side. Second, pGDNF increased TH staining density and dopamine cell counts in the SN on the 6-OHDA-lesioned side. This result was direct evidence of neuroprotection of dopamine cell bodies. Third, pGDNF increased TH staining density in the striatum on the 6-OHDA-lesioned side. This result was direct evidence of protection of dopaminergic nerve terminals. Intranasal pGDNF nanoparticles provided greater neuroprotection than naked pGDNF for all measures. This result was consistent with our previous findings that pGDNF nanoparticles produce more GDNF in brain than the naked plasmid. Collectively, these results demonstrate that intranasal delivery of Copernicus' pGDNF nanoparticles has great clinical potential as a new, non-invasive and non-viral gene therapy approach for early stage Parkinson's disease. By promoting recovery of damaged neurons and preventing further cell loss, symptoms may be reversed and disease progression may be stopped.
Irie, T; Honda, Y; Hirano, T; Sato, T; Enei, H; Watanabe, T; Kuwahara, M
2001-09-01
It was reported that Pleurotus ostreatus was transformed unstably using recombinant plasmids containing a hygromycin B phosphotransferase gene (hph) under the control of Aspergillus nidulans expression signals, and that the plasmids were maintained extrachromosomally in the transformants. Here we report a stable and integrative transformation of the fungus to hygromycin B resistance, using a recombinant hph fused with Lentinus edodes glyceraldehyde-3-phosphate dehydrogenase expression signals. Restriction-enzyme-mediated integration (REMI) was also tried and increased the transformation efficiency about ten-fold.
Relevance of miR-21 in regulation of tumor suppressor gene PTEN in human cervical cancer cells.
Peralta-Zaragoza, Oscar; Deas, Jessica; Meneses-Acosta, Angélica; De la O-Gómez, Faustino; Fernández-Tilapa, Gloria; Gómez-Cerón, Claudia; Benítez-Boijseauneau, Odelia; Burguete-García, Ana; Torres-Poveda, Kirvis; Bermúdez-Morales, Victor Hugo; Madrid-Marina, Vicente; Rodríguez-Dorantes, Mauricio; Hidalgo-Miranda, Alfredo; Pérez-Plasencia, Carlos
2016-03-14
Expression of the microRNA miR-21 has been found to be altered in almost all types of cancers and it has been classified as an oncogenic microRNA or oncomir. Due to the critical functions of its target proteins in various signaling pathways, miR-21 is an attractive target for genetic and pharmacological modulation in various cancers. Cervical cancer is the second most common cause of death from cancer in women worldwide and persistent HPV infection is the main etiologic agent. This malignancy merits special attention for the development of new treatment strategies. In the present study we analyze the role of miR-21 in cervical cancer cells. To identify the downstream cellular target genes of upstream miR-21, we silenced endogenous miR-21 expression in a cervical intraepithelial neoplasia-derived cell lines using siRNAs. The effect of miR-21 on gene expression was assessed in cervical cancer cells transfected with the siRNA expression plasmid pSIMIR21. We identified the tumor suppressor gene PTEN as a target of miR-21 and determined the mechanism of its regulation throughout reporter construct plasmids. Using this model, we analyzed the expression of miR-21 and PTEN as well as functional effects such as autophagy and apoptosis induction. In SiHa cells, there was an inverse correlation between miR-21 expression and PTEN mRNA level as well as PTEN protein expression in cervical cancer cells. Transfection with the pSIMIR21 plasmid increased luciferase reporter activity in construct plasmids containing the PTEN-3'-UTR microRNA response elements MRE21-1 and MRE21-2. The role of miR-21 in cell proliferation was also analyzed in SiHa and HeLa cells transfected with the pSIMIR21 plasmid, and tumor cells exhibited markedly reduced cell proliferation along with autophagy and apoptosis induction. We conclude that miR-21 post-transcriptionally down-regulates the expression of PTEN to promote cell proliferation and cervical cancer cell survival. Therefore, it may be a potential therapeutic target in gene therapy for cervical cancer.
Shifera, Amde Selassie; Hardin, John A.
2009-01-01
The Renilla luciferase gene is commonly used as an internal control in luciferase-based reporter gene assays to normalize the values of the experimental reporter gene for variations that could be caused by transfection efficiency and sample handling. Various plasmids encoding Renilla luciferase under different promoter constructs are commercially available. The validity of the use of Renilla luciferase as an internal control is based on the assumption that it is constitutively expressed in transfected cells and that its constitutive expression is not modulated by experimental factors that could result in either the upregulation or the downregulation of the amounts of the enzyme produced. During the past ten years, a number of reports have appeared that identified a variety of conditions that could alter the basal constitutive expression of Renilla luciferase. The use of Renilla luciferase in those circumstances would not be valid and an alternative way of normalization would be necessary. This review covers the factors that have been reported thus far as modulating the expression of Renilla luciferase from plasmid constructs. PMID:19788887
Sevillano, Laura; Díaz, Margarita; Santamaría, Ramón I
2017-09-26
The industrial use of enzymes produced by microorganisms is continuously growing due to the need for sustainable solutions. Nevertheless, many of the plasmids used for recombinant production of proteins in bacteria are based on the use of antibiotic resistance genes as selection markers. The safety concerns and legal requirements surrounding the increased use of antibiotic resistance genes have made the development of new antibiotic-free approaches essential. In this work, a system completely free of antibiotic resistance genes and useful for the production of high yields of proteins in Streptomyces is described. This system is based on the separation of the two components of the yefM/yoeBsl (antitoxin/toxin) operon; the toxin (yoeBsl) gene, responsible for host death, is integrated into the genome and the antitoxin gene (yefMsl), which inactivates the toxin, is located in the expression plasmid. To develop this system, the toxin gene was integrated into the genome of a strain lacking the complete operon, and the antibiotic resistance gene integrated along with the toxin was eliminated by Cre recombinase to generate a final host strain free of any antibiotic resistance marker. In the same way, the antibiotic resistance gene from the final expression plasmid was removed by Dre recombinase. The usefulness of this system was analysed by checking the production of two hydrolases from different Streptomyces. Production of both proteins, with potential industrial use, was high and stable over time after strain storage and after serial subcultures. These results support the robustness and stability of the positive selection system developed. The total absence of antibiotic resistance genes makes this system a powerful tool for using Streptomyces as a host to produce proteins at the industrial level. This work is the first Streptomyces antibiotic marker-free system to be described. Graphical abstract Antibiotic marker-free platform for protein expression in Streptomyces. The antitoxin gene present in the expression plasmid counteracts the effect of the toxin gene in the genome. In absence of the expression plasmid, the toxin causes cell death ensuring that only plasmid-containing cells persist.
Analysis of protein function in clinical C. albicans isolates
Gerami-Nejad, Maryam; Forche, Anja; McClellan, Mark; Berman, Judith
2012-01-01
Clinical isolates are prototrophic and hence are not amenable to genetic manipulation using nutritional markers. Here we describe a new set of plasmids carrying the NAT1 (nourseothricin) drug resistance marker (Shen et al., 2005) that can be used both in clinical isolates and in laboratory strains. We constructed novel plasmids containing HA-NAT1 or MYC-NAT1 cassettes to facilitate PCR-mediated construction of strains with C-terminal epitope-tagged proteins and a NAT1-pMet3-GFP plasmid to enable conditional expression of proteins with or without the green fluorescent protein fused at the N-terminus. Furthermore, for proteins that require both the endogenous N- and C-termini for function, we have constructed a GF-NAT1-FP cassette carrying truncated alleles that facilitate insertion of an intact, single copy of GFP internal to the coding sequence. In addition, GFP-NAT1, RFP-NAT1, and M-Cherry-NAT1 plasmids were constructed expressing two differently labeled gene products for the study of protein co-expression and co-localization in vivo. Together, these vectors provide a useful set of genetic tools for studying diverse aspects of gene function in C. albicans clinical as well as laboratory strains. PMID:22777821
Aleshin, SE; Timofeev, AV; Khoretonenko, MV; Zakharova, LG; Pashvykina, GV; Stephenson, JR; Shneider, AM; Altstein, AD
2005-01-01
Background Heterologous prime-boost immunization protocols using different gene expression systems have proven to be successful tools in protecting against various diseases in experimental animal models. The main reason for using this approach is to exploit the ability of expression cassettes to prime or boost the immune system in different ways during vaccination procedures. The purpose of the project was to study the ability of recombinant vaccinia virus (VV) and bacterial plasmid, both carrying the NS1 gene from tick-borne encephalitis (TBE) virus under the control of different promoters, to protect mice against lethal challenge using a heterologous prime-boost vaccination protocol. Results The heterologous prime-boost vaccination protocol, using a VV recombinant and bacterial plasmid, both containing the NS1 TBE virus protein gene under the control of different promoters, achieved a high level of protection in mice against lethal challenge with a highly pathogenic TBE virus strain. No signs of pronounced TBE infection were detected in the surviving animals. Conclusion Heterologous prime-boost vaccination protocols using recombinant VV and bacterial plasmids could be used for the development of flavivirus vaccines. PMID:16076390
Shashidharamurthy, R; Machiah, D; Bozeman, E N; Srivatsan, S; Patel, J; Cho, A; Jacob, J; Selvaraj, P
2012-09-01
Therapeutic use and function of recombinant molecules can be studied by the expression of foreign genes in mice. In this study, we have expressed human Fcγ receptor-Ig fusion molecules (FcγR-Igs) in mice by administering FcγR-Ig plasmid DNAs hydrodynamically and compared their effectiveness with purified molecules in blocking immune-complex (IC)-mediated inflammation in mice. The concentration of hydrodynamically expressed FcγR-Igs (CD16A(F)-Ig, CD32A(R)-Ig and CD32A(H)-Ig) reached a maximum of 130 μg ml(-1) of blood within 24 h after plasmid DNA administration. The in vivo half-life of FcγR-Igs was found to be 9-16 days and western blot analysis showed that the FcγR-Igs were expressed as a homodimer. The hydrodynamically expressed FcγR-Igs blocked 50-80% of IC-mediated inflammation up to 3 days in a reverse passive Arthus reaction model. Comparative analysis with purified molecules showed that hydrodynamically expressed FcγR-Igs are more efficient than purified molecules in blocking IC-mediated inflammation and had a higher half-life. In summary, these results suggest that the administration of a plasmid vector with the FcγR-Ig gene can be used to study the consequences of blocking IC binding to FcγRs during the development of inflammatory diseases. This approach may have potential therapeutic value in treating IC-mediated inflammatory autoimmune diseases such as lupus, arthritis and autoimmune vasculitis.
Davis, R; Vapnek, D
1976-01-01
The amounts of plasmid deoxyribonucleic acid (DNA) and the levels of the in vivo transcription of the Escherichia coli plasmids R538-1 (repressed for conjugal transfer) and R538-1drd (derepressed for transfer) were determined by DNA-DNA hybridization and DNA-ribonucleic acid hybridization, respectively. The results demonstrate that the level of plasmid transcription is increased by two-fold in the strain carrying the derepressed plasmid, compared to an isogenic strain carrying the repressed plasmid, whereas the amount of plasmid DNA is approximately the same, suggesting that the transfer genes are under transcriptional control. Levels of plasmid DNA, plasmid DNA transcription, and chloramphenicol acetyltransferase activity were also compared in a mutant strain that carried the R538-1drd plasmid and was resistant to high levels of antibiotics. This strain produces about 13 copies of plasmid DNA per chromosome compared to five copies for the parent strain. The level of transcription of plasmid DNA was found to be twofold higher in the high-level resistant strain, whereas the level of chloramphenition, acetyltransferase activity was increased by 10-fold. In addition the levels of plasmid DNA transcription and chloramphenicol acetyltransferase activity in the high-level resistant strain were found to be further increased by the presence of high levels of chloramphenicol in the growth medium. The amount of plasmid DNA remained constant under these conditions, indicating that high levels of chloramphenicol can stimulate the expression of plasmid genes at the level of transcription in this strain. PMID:767321
Zhang, Hua; Feng, Juan; Chen, Hongsheng; Li, Jiada; Luo, Hunjin; Feng, Yong
2015-12-01
To study the role of dysfunction of nuclear localization signals (NLS) of MITF protein in the pathogenesis of Waardenburg syndrome. Eukaryotic expression plasmid pCMV-MITF-Flag was used as a template to generate mutant plasmid pCMV-MITF△NLS-Flag by molecular cloning technique in order to design the mutagenic primers. The UACC903 cells were transfected transiently with MITF and MITF△NLS plasmids, and the luciferase activity assays were performed to determine their impact on the transcriptional activities of target gene tyrosinase (TYR). The oligonucleotide 5'-GAACGAAGAAGAAGATTT-3' was subcloned into pEGFP-N1 to generate recombinant eukaryotic expression plasmid pEGFP-N1-MITF-NLS. The NIH3T3 cells were transfected separately with MITF, MITF△NLS, pEGFP-N1 and pEGFP-N1-NLS plasmids, and their subcellular distribution was observed by immunoflorescence assays. Expression plasmids for the mutant MITF△NLS with loss of core NLS sequence and pEGFP-N1-NLS coupled with MITF△NLS were successfully generated. Compared with the wild-type MITF, MITF△NLS was not able to transactivate the transcriptional activities of promoter TYR and did not affect the normal function of MITF. MITF△NLS was only localized in the cytoplasm and pEGFP-N1 was found in both the cytoplasm and nucleus, whereas pEGFP-N1-NLS was mainly located in the nucleus. This study has confirmed the localization function of NLS sequence 213ERRRRF218 within the MITF protein. Mutant MITF with loss of NLS has failed to transactivate the transcriptional activities of target gene TYR, which can result in melanocyte defects and cause WS.
Zhou, Jingxiang; Xue, Jiangdong; Wang, Qiuju; Zhu, Xia; Li, Xingwei; Lv, Wenliang; Zhang, Dongming
2014-06-01
In order to construct the recombinant plasmid of pIRES-ORF81, the nucleic acid isolated from Koi herpes virus-CJ (KHV-CJ) strains was used as a template to insert the ORF81 gene fragments amplified by PCR into the pIRES-neo, a kind of eukaryotic expression vector. Using Western blotting analysis, it was verified that ORF81 gene protein can be expressed correctly by pIRES-ORF81, after MFC cells were transfected. The recombinant plasmid pIRES-ORF81 was set into three immunization dose gradients: 1, 10, and 50 μg/carp. Empty plasmid group, PBS group, and blank control group were set simultaneously. Giving intramuscular injections to healthy carps with an average body mass of 246 ± 20 g, indirect ELISA was used to regularly determine antibody levels after three times immunization injection. Neutralizing antibodies were detected by neutralization assay. The results of inoculation tests showed that the pIRES-ORF81 recombinant plasmid can induce the production of carp-specific antibodies. The differences of immune effect between the three different doses of immune gradients were not significant (P > 0.05), but they can induce the production of neutralizing antibodies. After 25 d of inoculation, carp mortality of pIRES-neo empty vector treatment groups was 85%, while the carp mortality of eukaryotic expression recombinant plasmid pIRES-ORF81 injected with three different doses of immune gradients was 20, 17.5, and 12.5%, respectively. Differences in comparison to the control group were highly significant (P < 0.01). However, histopathological section of immunohistochemistry organization revealed no significant changes. It demonstrated that the DNA vaccine pIRES-ORF81 constructed in the experiment displayed a good protective effect against KHV, which had the potential to industrial applications.
Choi, Younho; Kim, Seongok; Hwang, Hyelyeon; Kim, Kwang-Pyo; Kang, Dong-Hyun
2014-01-01
The aim of this study was to elucidate the function of the plasmid-borne mcp (methyl-accepting chemotaxis protein) gene, which plays pleiotropic roles in Cronobacter sakazakii ATCC 29544. By searching for virulence factors using a random transposon insertion mutant library, we identified and sequenced a new plasmid, pCSA2, in C. sakazakii ATCC 29544. An in silico analysis of pCSA2 revealed that it included six putative open reading frames, and one of them was mcp. The mcp mutant was defective for invasion into and adhesion to epithelial cells, and the virulence of the mcp mutant was attenuated in rat pups. In addition, we demonstrated that putative MCP regulates the motility of C. sakazakii, and the expression of the flagellar genes was enhanced in the absence of a functional mcp gene. Furthermore, a lack of the mcp gene also impaired the ability of C. sakazakii to form a biofilm. Our results demonstrate a regulatory role for MCP in diverse biological processes, including the virulence of C. sakazakii ATCC 29544. To the best of our knowledge, this study is the first to elucidate a potential function of a plasmid-encoded MCP homolog in the C. sakazakii sequence type 8 (ST8) lineage. PMID:25332122
Choi, Younho; Kim, Seongok; Hwang, Hyelyeon; Kim, Kwang-Pyo; Kang, Dong-Hyun; Ryu, Sangryeol
2015-01-01
The aim of this study was to elucidate the function of the plasmid-borne mcp (methyl-accepting chemotaxis protein) gene, which plays pleiotropic roles in Cronobacter sakazakii ATCC 29544. By searching for virulence factors using a random transposon insertion mutant library, we identified and sequenced a new plasmid, pCSA2, in C. sakazakii ATCC 29544. An in silico analysis of pCSA2 revealed that it included six putative open reading frames, and one of them was mcp. The mcp mutant was defective for invasion into and adhesion to epithelial cells, and the virulence of the mcp mutant was attenuated in rat pups. In addition, we demonstrated that putative MCP regulates the motility of C. sakazakii, and the expression of the flagellar genes was enhanced in the absence of a functional mcp gene. Furthermore, a lack of the mcp gene also impaired the ability of C. sakazakii to form a biofilm. Our results demonstrate a regulatory role for MCP in diverse biological processes, including the virulence of C. sakazakii ATCC 29544. To the best of our knowledge, this study is the first to elucidate a potential function of a plasmid-encoded MCP homolog in the C. sakazakii sequence type 8 (ST8) lineage. Copyright © 2015, American Society for Microbiology. All Rights Reserved.
Corridon, Peter R.; Rhodes, George J.; Leonard, Ellen C.; Basile, David P.; Gattone, Vincent H.; Bacallao, Robert L.
2013-01-01
Gene therapy has been proposed as a novel alternative to treat kidney disease. This goal has been hindered by the inability to reliably deliver transgenes to target cells throughout the kidney, while minimizing injury. Since hydrodynamic forces have previously shown promising results, we optimized this approach and designed a method that utilizes retrograde renal vein injections to facilitate transgene expression in rat kidneys. We show, using intravital fluorescence two-photon microscopy, that fluorescent albumin and dextrans injected into the renal vein under defined conditions of hydrodynamic pressure distribute broadly throughout the kidney in live animals. We found injection parameters that result in no kidney injury as determined by intravital microscopy, histology, and serum creatinine measurements. Plasmids, baculovirus, and adenovirus vectors, designed to express EGFP, EGFP-actin, EGFP-occludin, EGFP-tubulin, tdTomato-H2B, or RFP-actin fusion proteins, were introduced into live kidneys in a similar fashion. Gene expression was then observed in live and ex vivo kidneys using two-photon imaging and confocal laser scanning microscopy. We recorded widespread fluorescent protein expression lasting more than 1 mo after introduction of transgenes. Plasmid and adenovirus vectors provided gene transfer efficiencies ranging from 50 to 90%, compared with 10–50% using baculovirus. Using plasmids and adenovirus, fluorescent protein expression was observed 1) in proximal and distal tubule epithelial cells; 2) within glomeruli; and 3) within the peritubular interstitium. In isolated kidneys, fluorescent protein expression was observed from the cortex to the papilla. These results provide a robust approach for gene delivery and the study of protein function in live mammal kidneys. PMID:23467422
Genomic Analysis and Isolation of RNA Polymerase II Dependent Promoters from Spodoptera frugiperda.
Bleckmann, Maren; Fritz, Markus H-Y; Bhuju, Sabin; Jarek, Michael; Schürig, Margitta; Geffers, Robert; Benes, Vladimir; Besir, Hüseyin; van den Heuvel, Joop
2015-01-01
The Baculoviral Expression Vector System (BEVS) is the most commonly used method for high expression of recombinant protein in insect cells. Nevertheless, expression of some target proteins--especially those entering the secretory pathway--provides a severe challenge for the baculovirus infected insect cells, due to the reorganisation of intracellular compounds upon viral infection. Therefore, alternative strategies for recombinant protein production in insect cells like transient plasmid-based expression or stable expression cell lines are becoming more popular. However, the major bottleneck of these systems is the lack of strong endogenous polymerase II dependent promoters, as the strong baculoviral p10 and polH promoters used in BEVS are only functional in presence of the viral transcription machinery during the late phase of infection. In this work we present a draft genome and a transcriptome analysis of Sf21 cells for the identification of the first known endogenous Spodoptera frugiperda promoters. Therefore, putative promoter sequences were identified and selected because of high mRNA level or in analogy to other strong promoters in other eukaryotic organism. The chosen endogenous Sf21 promoters were compared to early viral promoters for their efficiency to trigger eGFP expression using transient plasmid based transfection in a BioLector Microfermentation system. Furthermore, promoter activity was not only shown in Sf21 cells but also in Hi5 cells. The novel endogenous Sf21 promoters were ranked according to their activity and expand the small pool of available promoters for stable insect cell line development and transient plasmid expression in insect cells. The best promoter was used to improve plasmid based transient transfection in insect cells substantially.
Knockdown of the bovine prion gene PRNP by RNA interference (RNAi) technology.
Sutou, Shizuyo; Kunishi, Miho; Kudo, Toshiyuki; Wongsrikeao, Pimprapar; Miyagishi, Makoto; Otoi, Takeshige
2007-07-26
Since prion gene-knockout mice do not contract prion diseases and animals in which production of prion protein (PrP) is reduced by half are resistant to the disease, we hypothesized that bovine animals with reduced PrP would be tolerant to BSE. Hence, attempts were made to produce bovine PRNP (bPRNP) that could be knocked down by RNA interference (RNAi) technology. Before an in vivo study, optimal conditions for knocking down bPRNP were determined in cultured mammalian cell systems. Factors examined included siRNA (short interfering RNA) expression plasmid vectors, target sites of PRNP, and lengths of siRNAs. Four siRNA expression plasmid vectors were used: three harboring different cloning sites were driven by the human U6 promoter (hU6), and one by the human tRNAVal promoter. Six target sites of bovine PRNP were designed using an algorithm. From 1 (22 mer) to 9 (19, 20, 21, 22, 23, 24, 25, 27, and 29 mer) siRNA expression vectors were constructed for each target site. As targets of siRNA, the entire bPRNP coding sequence was connected to the reporter gene of the fluorescent EGFP, or of firefly luciferase or Renilla luciferase. Target plasmid DNA was co-transfected with siRNA expression vector DNA into HeLaS3 cells, and fluorescence or luminescence was measured. The activities of siRNAs varied widely depending on the target sites, length of the siRNAs, and vectors used. Longer siRNAs were less effective, and 19 mer or 21 mer was generally optimal. Although 21 mer GGGGAGAACTTCACCGAAACT expressed by a hU6-driven plasmid with a Bsp MI cloning site was best under the present experimental conditions, the corresponding tRNA promoter-driven plasmid was almost equally useful. The effectiveness of this siRNA was confirmed by immunostaining and Western blotting. Four siRNA expression plasmid vectors, six target sites of bPRNP, and various lengths of siRNAs from 19 mer to 29 mer were examined to establish optimal conditions for knocking down of bPRNP in vitro. The most effective siRNA so far tested was 21 mer GGGGAGAACTTCACCGAAACT driven either by a hU6 or tRNA promoter, a finding that provides a basis for further studies in vivo.
Sehgal, Lalit; Budnar, Srikanth; Bhatt, Khyati; Sansare, Sneha; Mukhopadhaya, Amitabha; Kalraiya, Rajiv D; Dalal, Sorab N
2012-10-01
The study of protein-protein interactions, protein localization, protein organization into higher order structures and organelle dynamics in live cells, has greatly enhanced the understanding of various cellular processes. Live cell imaging experiments employ plasmid or viral vectors to express the protein/proteins of interest fused to a fluorescent protein. Unlike plasmid vectors, lentiviral vectors can be introduced into both dividing and non dividing cells, can be pseudotyped to infect a broad or narrow range of cells, and can be used to generate transgenic animals. However, the currently available lentiviral vectors are limited by the choice of fluorescent protein tag, choice of restriction enzyme sites in the Multiple Cloning Sites (MCS) and promoter choice for gene expression. In this report, HIV-1 based bi-cistronic lentiviral vectors have been generated that drive the expression of multiple fluorescent tags (EGFP, mCherry, ECFP, EYFP and dsRed), using two different promoters. The presence of a unique MCS with multiple restriction sites allows the generation of fusion proteins with the fluorescent tag of choice, allowing analysis of multiple fusion proteins in live cell imaging experiments. These novel lentiviral vectors are improved delivery vehicles for gene transfer applications and are important tools for live cell imaging in vivo.
Lin, Tzu-Lung; Pan, Yi-Jiun; Hsieh, Pei-Fang; Hsu, Chun-Ru; Wu, Meng-Chuan; Wang, Jin-Town
2016-08-17
Analysis of the genome of Klebsiella pneumoniae NTUH-K2044 strain revealed the presence of two clustered regularly interspaced short palindromic repeats (CRISPR) arrays separated with CRISPR-associated (cas) genes. Carbapenem-resistant K. pneumoniae isolates were observed to be less likely to have CRISPR-Cas than sensitive strains (5/85 vs. 22/132). Removal of the transcriptional repressor, H-NS, was shown to prevent the transformation of plasmids carrying a spacer and putative proto-spacer adjacent motif (PAM). The CRISPR-Cas system also decreased pUC-4K plasmid stability, resulting in plasmid loss from the bacteria with acquisition of new spacers. Analysis of the acquired proto-spacers in pUC-4K indicated that 5'-TTN-3' was the preferred PAM in K. pneumoniae. Treatment of cells by imipenem induced hns expression, thereby decreasing cas3 expression and consequently repressed CRISPR-Cas activity resulted in increase of plasmid stability. In conclusion, NTUH-K2044 CRISPR-Cas contributes to decrease of plasmid transformation and stability. Through repression of CRISPR-Cas activity by induced H-NS, bacteria might be more able to acquire DNA to confront the challenge of imipenem.
Yudin, M A; Bykov, V N; Nikiforov, A S; Al-Shekhadat, R I; Ivanov, I M; Ustinova, T M
2018-04-01
We compared the efficiency of delivery of plasmid DNA (active ingredient concentration 1 mg/kg) that provides production of nerve growth factor (NGF) after intravenous administration to rats and after administration by hydroporation. The method of hydroporation ensured plasmid penetration into the liver tissue and lengthened the time of its detection in the organ. DNA concentration in 1 h after its introduction by hydroporation or intravenous route was 0.7 and 0.05 ng/mg tissue, respectively. The use of this transfection method ensured preservation of NGF DNA in the liver tissue at a level of 0.24 ng/mg of tissue 1 day after administration of the plasmid construct, while after intravenous administration, expression of the analyzed DNA was not detected in blood and liver samples. After hydroporation, the maximum of relative normalized expression of cDNA (270 rel. units) was observed after 4 h, and after 1 day, this parameter decreased to 35 rel. units. Introduction of plasmid DNA of NGF by hydroporation prevented the development of disorders of neuromuscular conduction in a rats model of toxic neuropathy induced by subacute administration of malathion in a dose of 0.5 LD 50 .
Lin, Tzu-Lung; Pan, Yi-Jiun; Hsieh, Pei-Fang; Hsu, Chun-Ru; Wu, Meng-Chuan; Wang, Jin-Town
2016-01-01
Analysis of the genome of Klebsiella pneumoniae NTUH-K2044 strain revealed the presence of two clustered regularly interspaced short palindromic repeats (CRISPR) arrays separated with CRISPR-associated (cas) genes. Carbapenem-resistant K. pneumoniae isolates were observed to be less likely to have CRISPR-Cas than sensitive strains (5/85 vs. 22/132). Removal of the transcriptional repressor, H-NS, was shown to prevent the transformation of plasmids carrying a spacer and putative proto-spacer adjacent motif (PAM). The CRISPR-Cas system also decreased pUC-4K plasmid stability, resulting in plasmid loss from the bacteria with acquisition of new spacers. Analysis of the acquired proto-spacers in pUC-4K indicated that 5′-TTN-3′ was the preferred PAM in K. pneumoniae. Treatment of cells by imipenem induced hns expression, thereby decreasing cas3 expression and consequently repressed CRISPR-Cas activity resulted in increase of plasmid stability. In conclusion, NTUH-K2044 CRISPR-Cas contributes to decrease of plasmid transformation and stability. Through repression of CRISPR-Cas activity by induced H-NS, bacteria might be more able to acquire DNA to confront the challenge of imipenem. PMID:27531594
Amon, Wolfgang; White, Robert E; Farrell, Paul J
2006-05-01
Epstein-Barr virus (EBV) establishes a latent persistence from which it can be reactivated to undergo lytic replication. Late lytic-cycle gene expression is linked to lytic DNA replication, as it is sensitive to the same inhibitors that block lytic replication, and it has recently been shown that the viral origin of lytic replication (ori lyt) is required in cis for late-gene expression. During the lytic cycle, the viral genome forms replication compartments, which are usually adjacent to promyelocytic leukaemia protein (PML) nuclear bodies. A tetracycline repressor DNA-binding domain-enhanced green fluorescent protein fusion was used to visualize replicating plasmids carrying a tetracycline operator sequence array. ori lyt mediated the production of plasmid replication compartments that were associated with PML nuclear bodies. Plasmids carrying ori lyt and EBV itself were visualized in the same cells and replicated in similar regions of the nucleus, further supporting the validity of the plasmids for studying late-gene regulation.
Minichromosome assembly of non-integrated plasmid DNA transfected into mammalian cells.
Reeves, R; Gorman, C M; Howard, B
1985-01-01
The nucleoprotein structures formed on various plasmid expression vectors transfected into mammalian cells by both the calcium phosphate and DEAE-dextran methods have been studied. We demonstrate by a variety of means that mammalian cells are capable of rapidly assembling non-integrated circular plasmids (both replicating and non-replicating) into typical "minichromosomes" containing nucleosomes with a 190 bp repetitive spacing. Treatment of recipient cells with sodium butyrate for a short period of time (12-16 h) immediately following transfection markedly increased the DNase I digestion sensitivity of the newly assembled plasmid chromatin. Furthermore, minichromosomes isolated from such butyrate-treated cells are depleted in histone H1 and contain highly acetylated forms of histone H4. These findings are entirely consistent with our earlier speculation (Gorman et al., Nucleic Acids Res. 11, 1044; 1983) that appropriate butyrate treatment might stimulate transient expression of newly transfected genes by facilitating their assembly into an "active" type of chromatin structure. Images PMID:3859838
Winteler, H V; Schneidinger, B; Jaeger, K E; Haas, D
1996-01-01
The anaerobically inducible arcDABC operon encodes the enzymes of the arginine deiminase pathway in Pseudomonas aeruginosa. Upon induction, the arcAB mRNAs and proteins reach high intracellular levels, because of a strong anaerobically controlled promoter and mRNA processing in arcD, leading to stable downstream transcripts. We explored the usefulness of this system for the construction of expression vectors. The lacZ gene of Escherichia coli was expressed to the highest levels when fused close to the arc promoter. Insertion of lacZ further downstream into arcA or arcB did not stabilize the intrinsically unstable lacZ mRNA. On the contrary, lacZ mRNA appeared to be a vulnerable endonuclease target destabilizing arcAB mRNAs in the 5'-to-3' direction in P. aeruginosa. The native arc promoter was modified for optional expression in the -10 sequence and in the -40 region, which is a binding site for the anaerobic regulator ANR. In P. aeruginosa grown either anaerobically or with oxygen limitation in unshaken cultures, this promoter was stronger than the induced tac promoter. The P. aeruginosa lipAH genes, which encode extracellular lipase and lipase foldase, respectively, were fused directly to the modified arc promoter in an IncQ vector plasmid. Semianaerobic static cultures of P. aeruginosa PAO1 carrying this recombinant plasmid overproduced extracellular lipase 30-fold during stationary phase compared with the production by strain PAO1 without the plasmid. Severe oxygen limitation, in contrast, resulted in poor lipase productivity despite effective induction of the ANR-dependent promoter, suggesting that secretion of active lipase is blocked by the absence of oxygen. In conclusion, the modified arc promoter is useful for driving the expression of cloned genes in P. aeruginosa during oxygen-limited growth and stationary phase. PMID:8795231
Evolution and comparative genomics of pAQU-like conjugative plasmids in Vibrio species.
Li, Ruichao; Ye, Lianwei; Wong, Marcus Ho Yin; Zheng, Zhiwei; Chan, Edward Wai Chi; Chen, Sheng
2017-09-01
To investigate a set of MDR conjugative plasmids found in Vibrio species and characterize the underlying evolution process. pAQU-type plasmids from Vibrio species were sequenced using both Illumina and PacBio platforms. Bioinformatics tools were utilized to analyse the typical MDR regions and core genes in the plasmids. The nine pAQU-type plasmids ranged from ∼160 to 206 kb in size and were found to harbour as many as 111 core genes encoding conjugative, replication and maintenance functions. Eight plasmids were found to carry a typical MDR region, which contained various accessory and resistance genes, including ISCR1-blaPER-1-bearing complex class 1 integrons, ISCR2-floR, ISCR2-tet(D)-tetR-ISCR2, qnrVC6, a Tn10-like structure and others associated with mobile elements. Comparison between a plasmid without resistance genes and different MDR plasmids showed that integration of different mobile elements, such as IS26, ISCR1, ISCR2, IS10 and IS6100, into the plasmid backbone was the key mechanism by which foreign resistance genes were acquired during the evolution process. This study identified pAQU-type plasmids as emerging MDR conjugative plasmids among important pathogens from different origins in Asia. These findings suggest that aquatic bacteria constitute a major reservoir of resistance genes, which may be transmissible to other human pathogens during food production and processing. © The Author 2017. Published by Oxford University Press on behalf of the British Society for Antimicrobial Chemotherapy. All rights reserved. For Permissions, please email: journals.permissions@oup.com.
Dong, Bo; Feng, Jing; Lin, Hai; Li, Lanxiang; Su, Dingding; Tu, Di; Zhu, Weijuan; Yang, Qing; Ren, Xiaofeng
2013-11-19
Porcine circovirus type 2 (PCV2) is associated with many kinds of diseases including postweaning multisystemic wasting syndrome (PMWS). It affects the immune system of swine and causes huge epidemic losses every year. In our previous study, we provided evidence that DNA plasmid bearing porcine IL-15 (pVAX-pIL-15) might serve as an immune enhancer for DNA plasmid encoding porcine reproductive and respiratory syndrome virus GP5 gene. In this study, PCV2 open reading frame (ORF)2 gene was cloned into the eukaryotic expression vector pVAX, resulting in the plasmid pVAX-PCV2-ORF2. Transient expression of the plasmid in BHK-21 cells could be detected using immunofluorescence assay. Experimental mice were divided into 5 groups and immunized with PBS, pVAX, pVAX-pIL-15, pVAX-PCV2-ORF2 or pVAX-pIL-15 plus pVAX-PCV2-ORF2. The results showed that the mice co-inoculated with pVAX-PCV2-ORF2 plus pVAX-pIL-15 had higher humoral and cellular immune responses than the others. In addition, DNA plasmid bearing PCV2 ORF2 gene had a protective effect against challenge with PCV2 in mice which could be promoted with the utilization of pIL-15. Copyright © 2013 Elsevier Ltd. All rights reserved.
Characterization of Endogenous Plasmids from Lactobacillus salivarius UCC118▿ †
Fang, Fang; Flynn, Sarah; Li, Yin; Claesson, Marcus J.; van Pijkeren, Jan-Peter; Collins, J. Kevin; van Sinderen, Douwe; O'Toole, Paul W.
2008-01-01
The genome of Lactobacillus salivarius UCC118 comprises a 1.83-Mb chromosome, a 242-kb megaplasmid (pMP118), and two smaller plasmids of 20 kb (pSF118-20) and 44 kb (pSF118-44). Annotation and bioinformatic analyses suggest that both of the smaller plasmids replicate by a theta replication mechanism. Furthermore, it appears that they are transmissible, although neither possesses a complete set of conjugation genes. Plasmid pSF118-20 encodes a toxin-antitoxin system composed of pemI and pemK homologs, and this plasmid could be cured when PemI was produced in trans. The minimal replicon of pSF118-20 was determined by deletion analysis. Shuttle vector derivatives of pSF118-20 were generated that included the replication region (pLS203) and the replication region plus mobilization genes (pLS208). The plasmid pLS203 was stably maintained without selection in Lactobacillus plantarum, Lactobacillus fermentum, and the pSF118-20-cured derivative strain of L. salivarius UCC118 (strain LS201). Cloning in pLS203 of genes encoding luciferase and green fluorescent protein, and expression from a constitutive L. salivarius promoter, demonstrated the utility of this vector for the expression of heterologous genes in Lactobacillus. This study thus expands the knowledge base and vector repertoire of probiotic lactobacilli. PMID:18390685
Kumar, Amit; Wonganan, Piyanuch; Sandoval, Michael A.; Li, Xinran; Zhu, Saijie; Cui, Zhengrong
2012-01-01
Previously, it was shown that microneedle-mediated transcutaneous immunization with plasmid DNA can potentially induce a stronger immune response than intramuscular injection of the same plasmid DNA. In the present study, we showed that the immune responses induced by transcutaneous immunization by applying plasmid DNA onto a skin area pretreated with solid microneedles were significantly enhanced by coating the plasmid DNA on the surface of cationic nanoparticles. In addition, the net surface charge of the DNA-coated nanoparticles significantly affected their in vitro skin permeation and their ability to induce immune responses in vivo. Transcutaneous immunization with plasmid DNA-coated net positively charged anoparticles elicited a stronger immune response than with plasmid DNA-coated net negatively charged nanoparticles or by intramuscular immunization with plasmid DNA alone. Transcutaneous immunization with plasmid DNA-coated net positively charged nanoparticles induced comparable immune responses as intramuscular injection of them, but transcutaneous immunization was able to induce specific mucosal immunity and a more balanced T helper type 1 and type 2 response. The ability of the net positively charged DNA-coated nanoparticles to induce a strong immune response through microneedle-mediated transcutaneous immunization may be attributed to their ability to increase the expression of the antigen gene encoded by the plasmid and to more effectively stimulate the maturation of antigen-presenting cells. PMID:22921518
The 2-micron plasmid as a nonselectable, stable, high copy number yeast vector
NASA Technical Reports Server (NTRS)
Ludwig, D. L.; Bruschi, C. V.
1991-01-01
The endogenous 2-microns plasmid of Saccharomyces cerevisiae has been used extensively for the construction of yeast cloning and expression plasmids because it is a native yeast plasmid that is able to be maintained stably in cells at high copy number. Almost invariably, these plasmid constructs, containing some or all 2-microns sequences, exhibit copy number levels lower than 2-microns and are maintained stably only under selective conditions. We were interested in determining if there was a means by which 2-microns could be utilized for vector construction, without forfeiting either copy number or nonselective stability. We identified sites in the 2-microns plasmid that could be used for the insertion of genetic sequences without disrupting 2-microns coding elements and then assessed subsequent plasmid constructs for stability and copy number in vivo. We demonstrate the utility of a previously described 2-microns recombination chimera, pBH-2L, for the manipulation and transformation of 2-microns as a pure yeast plasmid vector. We show that the HpaI site near the STB element in the 2-microns plasmid can be utilized to clone yeast DNA of at least 3.9 kb with no loss of plasmid stability. Additionally, the copy number of these constructs is as high as levels reported for the endogenous 2-microns.
Wallis, T S; Paulin, S M; Plested, J S; Watson, P R; Jones, P W
1995-01-01
Plasmid-bearing and plasmid-free isolates and a plasmid-cured strain of Salmonella dublin were compared for virulence in calves. The plasmid-bearing strains were highly virulent, causing severe enteric and systemic disease with high mortality. In contrast, the plasmid-free strains caused diarrhea but only low mortality. The infection kinetics of a wild-type and a derivative plasmid-cured strain were compared. Both strains were isolated in high numbers from intestinal sites at 3 and 6 days after oral challenge and were isolated at comparable frequencies from systemic sites at 3 days, but not at 6 days, when the wild-type strain was predominant. The strains were equally invasive in intestinal epithelia with and without Peyer's patch and elicited comparable secretory and inflammatory responses and intestinal pathology in ligated ileal loops. The effect of the virulence plasmid on growth kinetics and on the outer membrane protein profile was assessed in an in vivo growth chamber. The virulence plasmid did not influence either extracellular growth or the expression of major outer membrane proteins. These observations demonstrate that the virulence plasmid is not involved in either the enteric phase of infection or the systemic dissemination of S. dublin but probably mediates the persistence of S. dublin at systemic sites. PMID:7790094
Kuipers, Grietje; Karyolaimos, Alexandros; Zhang, Zhe; Ismail, Nurzian; Trinco, Gianluca; Vikström, David; Slotboom, Dirk Jan; de Gier, Jan-Willem
2017-12-16
To optimize the production of membrane and secretory proteins in Escherichia coli, it is critical to harmonize the expression rates of the genes encoding these proteins with the capacity of their biogenesis machineries. Therefore, we engineered the Lemo21(DE3) strain, which is derived from the T7 RNA polymerase-based BL21(DE3) protein production strain. In Lemo21(DE3), the T7 RNA polymerase activity can be modulated by the controlled co-production of its natural inhibitor T7 lysozyme. This setup enables to precisely tune target gene expression rates in Lemo21(DE3). The t7lys gene is expressed from the pLemo plasmid using the titratable rhamnose promoter. A disadvantage of the Lemo21(DE3) setup is that the system is based on two plasmids, a T7 expression vector and pLemo. The aim of this study was to simplify the Lemo21(DE3) setup by incorporating the key elements of pLemo in a standard T7-based expression vector. By incorporating the gene encoding the T7 lysozyme under control of the rhamnose promoter in a standard T7-based expression vector, pReX was created (ReX stands for Regulated gene eXpression). For two model membrane proteins and a model secretory protein we show that the optimized production yields obtained with the pReX expression vector in BL21(DE3) are similar to the ones obtained with Lemo21(DE3) using a standard T7 expression vector. For another secretory protein, a c-type cytochrome, we show that pReX, in contrast to Lemo21(DE3), enables the use of a helper plasmid that is required for the maturation and hence the production of this heme c protein. Here, we created pReX, a T7-based expression vector that contains the gene encoding the T7 lysozyme under control of the rhamnose promoter. pReX enables regulated T7-based target gene expression using only one plasmid. We show that with pReX the production of membrane and secretory proteins can be readily optimized. Importantly, pReX facilitates the use of helper plasmids. Furthermore, the use of pReX is not restricted to BL21(DE3), but it can in principle be used in any T7 RNAP-based strain. Thus, pReX is a versatile alternative to Lemo21(DE3).
Biochemical and genetic analysis of the yeast proteome with a movable ORF collection
Gelperin, Daniel M.; White, Michael A.; Wilkinson, Martha L.; Kon, Yoshiko; Kung, Li A.; Wise, Kevin J.; Lopez-Hoyo, Nelson; Jiang, Lixia; Piccirillo, Stacy; Yu, Haiyuan; Gerstein, Mark; Dumont, Mark E.; Phizicky, Eric M.; Snyder, Michael; Grayhack, Elizabeth J.
2005-01-01
Functional analysis of the proteome is an essential part of genomic research. To facilitate different proteomic approaches, a MORF (moveable ORF) library of 5854 yeast expression plasmids was constructed, each expressing a sequence-verified ORF as a C-terminal ORF fusion protein, under regulated control. Analysis of 5573 MORFs demonstrates that nearly all verified ORFs are expressed, suggests the authenticity of 48 ORFs characterized as dubious, and implicates specific processes including cytoskeletal organization and transcriptional control in growth inhibition caused by overexpression. Global analysis of glycosylated proteins identifies 109 new confirmed N-linked and 345 candidate glycoproteins, nearly doubling the known yeast glycome. PMID:16322557
Król, J. E.; Penrod, J. T.; McCaslin, H.; Rogers, L. M.; Yano, H.; Stancik, A. D.; Dejonghe, W.; Brown, C. J.; Parales, R. E.; Wuertz, S.
2012-01-01
Broad-host-range catabolic plasmids play an important role in bacterial degradation of man-made compounds. To gain insight into the role of these plasmids in chloroaniline degradation, we determined the first complete nucleotide sequences of an IncP-1 chloroaniline degradation plasmid, pWDL7::rfp and its close relative pNB8c, as well as the expression pattern, function, and bioaugmentation potential of the putative 3-chloroaniline (3-CA) oxidation genes. Based on phylogenetic analysis of backbone proteins, both plasmids are members of a distinct clade within the IncP-1β subgroup. The plasmids are almost identical, but whereas pWDL7::rfp carries a duplicate inverted catabolic transposon, Tn6063, containing a putative 3-CA oxidation gene cluster, dcaQTA1A2BR, pNB8c contains only a single copy of the transposon. No genes for an aromatic ring cleavage pathway were detected on either plasmid, suggesting that only the upper 3-CA degradation pathway was present. The dcaA1A2B gene products expressed from a high-copy-number vector were shown to convert 3-CA to 4-chlorocatechol in Escherichia coli. Slight differences in the dca promoter region between the plasmids and lack of induction of transcription of the pNB8c dca genes by 3-CA may explain previous findings that pNB8C does not confer 3-CA transformation. Bioaugmentation of activated sludge with pWDL7::rfp accelerated removal of 3-CA, but only in the presence of an additional carbon source. Successful bioaugmentation requires complementation of the upper pathway genes with chlorocatechol cleavage genes in indigenous bacteria. The genome sequences of these plasmids thus help explain the molecular basis of their catabolic activities. PMID:22101050
Upadhya, Archana; Sangave, Preeti C
2016-10-01
Cell penetrating peptides are useful tools for intracellular delivery of nucleic acids. Delivery of plasmid DNA, a large nucleic acid, poses a challenge for peptide mediated transport. The paper investigates and compares efficacy of five novel peptide designs for complexation of plasmid DNA and subsequent delivery into cells. The peptides were designed to contain reported DNA condensing agents and basic cell penetrating sequences, octa-arginine (R 8 ) and CHK 6 HC coupled to cell penetration accelerating peptides such as Bax inhibitory mutant peptide (KLPVM) and a peptide derived from the Kaposi fibroblast growth factor (kFGF) membrane translocating sequence. A tryptophan rich peptide, an analogue of Pep-3, flanked with CH 3 on either ends was also a part of the study. The peptides were analysed for plasmid DNA complexation, protection of peptide-plasmid DNA complexes against DNase I, serum components and competitive ligands by simple agarose gel electrophoresis techniques. Hemolysis of rat red blood corpuscles (RBCs) in the presence of the peptides was used as a measure of peptide cytotoxicity. Plasmid DNA delivery through the designed peptides was evaluated in two cell lines, human cervical cancer cell line (HeLa) and (NIH/3 T3) mouse embryonic fibroblasts via expression of the secreted alkaline phosphatase (SEAP) reporter gene. The importance of hydrophobic sequences in addition to cationic sequences in peptides for non-covalent plasmid DNA complexation and delivery has been illustrated. An alternative to the employment of fatty acid moieties for enhanced gene transfer has been proposed. Comparison of peptides for plasmid DNA complexation and delivery of peptide-plasmid DNA complexes to cells estimated by expression of a reporter gene, SEAP. Copyright © 2016 European Peptide Society and John Wiley & Sons, Ltd. Copyright © 2016 European Peptide Society and John Wiley & Sons, Ltd.
Novel Minicircle Vector for Gene Therapy in Murine Myocardial Infarction
Huang, Mei; Chen, ZhiYing; Hu, Shijun; Jia, Fangjun; Li, Zongjin; Hoyt, Grant; Robbins, Robert C.; Kay, Mark A.; Wu, Joseph C.
2011-01-01
Background Conventional plasmids for gene therapy produce low-level and short-term gene expression. In this study, we develop a novel non-viral vector which robustly and persistently expresses the hypoxia inducible factor-1 alpha (HIF-1α) therapeutic gene in the heart, leading to functional benefits following myocardial infarction (MI). Methods and Results We first created minicircles carrying double fusion (MC-DF) reporter gene consisting of firefly luciferase and enhanced green fluorescent protein (Fluc-eGFP) for noninvasive measurement of transfection efficiency. Mouse C2C12 myoblasts and normal FVB mice were used for in vitro and in vivo confirmation, respectively. Bioluminescence imaging (BLI) showed stable minicircle gene expression in the heart for >12 weeks and the activity level was 5.6±1.2 fold stronger than regular plasmid at day 4 (P<0.01). Next, we created minicircles carrying hypoxia inducible factor-1 alpha (MC-HIF-1α) therapeutic gene for treatment of MI. Adult FVB mice underwent LAD ligation and were injected intramyocardially with (1) MC-HIF-1α, (2) regular plasmid carrying HIF-1α (PL-HIF-1α) as positive control, and (3) PBS as negative control (n=10/group). Echocardiographic study showed a significantly greater improvement of left ventricular ejection fraction (LVEF) in the minicircle group (51.3%±3.6%) compared to regular plasmid group (42.3%±4.1%) and saline group (30.5%±2.8%) at week 4 (P<0.05 for both). Histology demonstrated increased neoangiogenesis in both treatment groups. Finally, Western blot showed minicircles express >50% higher HIF-1α level than regular plasmid. Conclusion Taken together, this is the first study to demonstrate that minicircles can significantly improve transfection efficiency, duration of transgene expression, and cardiac contractility. Given the serious drawbacks associated with most viral vectors, we believe this novel non-viral vector can be of great value for cardiac gene therapy protocols. PMID:19752373
Plasmids containing the gene for DNA polymerase I from Streptococcus pneumoniae
Lacks, S.A.; Martinez, S.; Lopez, P.; Espinosa, M.
1991-03-26
A method is disclosed for cloning the gene which encodes a DNA polymerase-exonuclease of Streptococcus pneumoniae. Plasmid pSM22, the vector containing the pneumocccal polA gene, facilitates the expression of 50-fold greater amounts of the PolI enzyme. 1 figure.
Subang, Maria C; Fatah, Rewas; Wu, Ying; Hannaman, Drew; Rice, Jason; Evans, Claire F; Chernajovsky, Yuti; Gould, David
2015-01-01
Immune responses to expressed foreign transgenes continue to hamper progress of gene therapy development. Translated foreign proteins with intracellular location are generally less accessible to the immune system, nevertheless they can be presented to the immune system through both MHC Class I and Class II pathways. When the foreign protein luciferase was expressed following intramuscular delivery of plasmid DNA in outbred mice, expression rapidly declined over 4 weeks. Through modifications to the expression plasmid and the luciferase transgene we examined the effect of detargeting expression away from antigen-presenting cells (APCs), targeting expression to skeletal muscle and fusion with glycine-alanine repeats (GAr) that block MHC-Class I presentation on the duration of luciferase expression. De-targeting expression from APCs with miR142-3p target sequences incorporated into the luciferase 3'UTR reduced the humoral immune response to both native and luciferase modified with a short GAr sequence but did not prolong the duration of expression. When a skeletal muscle specific promoter was combined with the miR target sequences the humoral immune response was dampened and luciferase expression persisted at higher levels for longer. Interestingly, fusion of luciferase with a longer GAr sequence promoted the decline in luciferase expression and increased the humoral immune response to luciferase. These studies demonstrate that expression elements and transgene modifications can alter the duration of transgene expression but other factors will need to overcome before foreign transgenes expressed in skeletal muscle are immunologically silent.
Dynamic monitoring of horizontal gene transfer in soil
NASA Astrophysics Data System (ADS)
Cheng, H. Y.; Masiello, C. A.; Silberg, J. J.; Bennett, G. N.
2015-12-01
Soil microbial gene expression underlies microbial behaviors (phenotypes) central to many aspects of C, N, and H2O cycling. However, continuous monitoring of microbial gene expression in soils is challenging because genetically-encoded reporter proteins widely used in the lab are difficult to deploy in soil matrices: for example, green fluorescent protein cannot be easily visualized in soils, even in the lab. To address this problem we have developed a reporter protein that releases small volatile gases. Here, we applied this gas reporter in a proof-of-concept soil experiment, monitoring horizontal gene transfer, a microbial activity that alters microbial genotypes and phenotypes. Horizontal gene transfer is central to bacterial evolution and adaptation and is relevant to problems such as the spread of antibiotic resistance, increasing metal tolerance in superfund sites, and bioremediation capability of bacterial consortia. This process is likely to be impacted by a number of matrix properties not well-represented in the petri dish, such as microscale variations in water, nutrients, and O2, making petri-dish experiments a poor proxy for environmental processes. We built a conjugation system using synthetic biology to demonstrate the use of gas-reporting biosensors in safe, lab-based biogeochemistry experiments, and here we report the use of these sensors to monitor horizontal gene transfer in soils. Our system is based on the F-plasmid conjugation in Escherichia coli. We have found that the gas signal reports on the number of cells that acquire F-plasmids (transconjugants) in a loamy Alfisol collected from Kellogg Biological Station. We will report how a gas signal generated by transconjugants varies with the number of F-plasmid donor and acceptor cells seeded in a soil, soil moisture, and soil O2 levels.
Li, Yan-Jie; Cao, Jiang; Chen, Chong; Wang, Dong-Yang; Zeng, Ling-Yu; Pan, Xiu-Ying; Xu, Kai-Lin
2010-02-01
This study was purposed to construct a lentiviral vector encoding red fluorescent protein (DsRed) and transfect DsRed into EL4 cells for establishing mouse leukemia/lymphoma model expressing DsRed. The bicistronic SIN lentiviral transfer plasmid containing the genes encoding neo and internal ribosomal entry site-red fluorescent protein (IRES-DsRed) was constructed. Human embryonic kidney 293FT cells were co-transfected with the three plasmids by liposome method. The viral particles were collected and used to transfect EL4 cells, then the cells were selected by G418. The results showed that the plasmid pXZ208-neo-IRES-DsRed was constructed successfully, and the viral titer reached to 10(6) U/ml. EL4 cells were transfected by the viral solution efficiently. The transfected EL4 cells expressing DsRed survived in the final concentration 600 microg/ml of G418. The expression of DsRed in the transfected EL4 cells was demonstrated by fluorescence microscopy and flow cytometry. In conclusion, the EL4/DsRed cell line was established successfully.
NASA Astrophysics Data System (ADS)
Sun, Xiao-Hong; Baltimore, David
1989-04-01
To study the effect of poliovirus protein 2A on cellular RNA translation, the tat control system of human immunodeficiency virus (HIV) was used. Protein 2A was expressed from a plasmid construct (pHIV/2A) incorporating the HIV long terminal repeat. Protein synthesis was measured by using chloramphenicol acetyltransferase as a reporter gene driven by the Rous sarcoma virus long terminal repeat. When HIV/2A was contransfected with the reporter, addition of a tat-producing plasmid caused at least a 50-fold drop in chloramphenicol acetyltransferase synthesis. A HeLa cell line carrying HIV/2A was established. In it, tat expression caused more than a 10-fold drop in chloramphenicol acetyltransferase synthesis from the reporter plasmid. Furthermore, 2A induction by tat caused cleavage of the cellular translation factor P220, a part of eukaryotic translation initiation factor 4F. Thus protein 2A can, by itself, carry out the inhibition of cellular protein synthesis characteristic of a poliovirus infection. Also, the HIV tat activation provides a very effective method to control gene expression in mammalian cells.
Kanofsky, Konstantin; Lehmeyer, Mona; Schulze, Jutta; Hehl, Reinhard
2016-01-01
Plants recognize pathogens by microbe-associated molecular patterns (MAMPs) and subsequently induce an immune response. The regulation of gene expression during the immune response depends largely on cis-sequences conserved in promoters of MAMP-responsive genes. These cis-sequences can be analyzed by constructing synthetic promoters linked to a reporter gene and by testing these constructs in transient expression systems. Here, the use of the parsley (Petroselinum crispum) protoplast system for analyzing MAMP-responsive synthetic promoters is described. The synthetic promoter consists of four copies of a potential MAMP-responsive cis-sequence cloned upstream of a minimal promoter and the uidA reporter gene. The reporter plasmid contains a second reporter gene, which is constitutively expressed and hence eliminates the requirement of a second plasmid used as a transformation control. The reporter plasmid is transformed into parsley protoplasts that are elicited by the MAMP Pep25. The MAMP responsiveness is validated by comparing the reporter gene activity from MAMP-treated and untreated cells and by normalizing reporter gene activity using the constitutively expressed reporter gene.
GFP as a marker for transient gene transfer and expression in Mycoplasma hyorhinis.
Ishag, Hassan Z A; Liu, Maojun; Yang, Ruosong; Xiong, Qiyan; Feng, Zhixin; Shao, Guoqing
2016-01-01
Mycoplasma hyorhinis (M. hyorhinis) is an opportunistic pathogen of pigs and has been shown to transform cell cultures, which has increased the interest of researchers. The green florescence proteins (GFP) gene of Aquorea victoria, proved to be a vital marker to identify transformed cells in mixed populations. Use of GFP to observe gene transfer and expression in M. hyorhinis (strain HUB-1) has not been described. We have constructed a pMD18-O/MHRgfp plasmid containing the p97 gene promoter, origin of replication, tetracycline resistance marker and GFP gene controlled by the p97 gene promoter. The plasmid transformed into M. hyorhinis with a frequency of ~4 × 10(-3) cfu/µg plasmid DNA and could be detected by PCR amplification of the GFP gene from the total DNA of the transformant mycoplasmas. Analysis of a single clone grown on KM2-Agar containing tetracycline, showed a green fluorescence color. Conclusively, this report suggests the usefulness of GFP to monitor transient gene transfer and expression in M. hyorhinis, eventually minimizing screening procedures for gene transfer and expression.
Takahashi, Yuki; Vikman, Elin; Nishikawa, Makiya; Ando, Mitsuru; Watanabe, Yoshihiko; Takakura, Yoshinobu
2010-09-01
The in vivo half-life of interferons (IFNs) is very short, and its extension would produce a better therapeutic outcome in IFN-based therapy. Delivery of IFN genes is one solution for providing a sustained supply. IFNs have a variety of functions, including the suppression of transgene expression, through interaction with IFN receptors (IFNRs). This suppression could prevent IFNs from being expressed from vectors delivered. Silencing the expression of IFNAR and IFNGR, the receptors for type I and II IFNs, respectively, in cells expressing IFNs may prolong transgene expression of IFNs. Mouse melanoma B16-BL6 cells or mouse liver were selected as a site expressing IFNs (not a target for IFN gene therapy) and IFN-expressing plasmid DNA was delivered with or without small interfering RNA (siRNA) targeting IFNRs. Transfection of B16-BL6 cells with siRNA targeting IFNAR1 subunit (IFNAR1) resulted in the reduced expression of IFNAR on the cell surface. This silencing significantly increased the IFN-beta production in cells that were transfected with IFN-beta-expressing plasmid DNA. Similar results were obtained with the combination of IFN-gamma and IFNGR. Co-injection of IFN-beta-expressing plasmid DNA with siRNA targeting IFNAR1 into mice resulted in sustained plasma concentration of IFN-beta. These results provide experimental evidence that the RNAi-mediated silencing of IFNRs in cells expressing IFN, such as hepatocytes, is an effective approach for improving transgene expression of IFNs when their therapeutic target comprises cells other than those expressing IFNs.
[Prokaryotic expression and histological localization of the Taenia solium CDC37 gene].
Huang, Jiang; Li, Bo; Dai, Jia-Lin; Zhang, Ai-Hua
2013-02-01
To express Taenia solium gene encoding cell division cycle 37 protein (TsCDC37) and investigate its antigenicity and localization in adults of Taenia solium. The complete coding sequence of TsCDC37 was amplified by PCR based on the recombinant plasmid clone from the cDNA library of adult Taenia solium. The PCR product was cloned into a prokaryotic expression vector pET-28a (+). The recombinant expression plasmid was identified by PCR, double endonuclease digestion and sequencing. The recombinant plasmid was transformed into E. coli BL21/DE3 and followed by expression of the protein induced by IPTG. The mice were immunized subcutaneously with purified recombinant TsCDC37 formulated in Freund's adjuvant. The antigenicity of the recombinant protein was examined by Western blotting. The localization of TsCDC37 in adult worms was demonstrated by immunofluorescent technique. The recombinant expression vector was constructed successfully. The recombinant protein was about M(r) 52 000, it was then purified and specifically recognized by immuno sera of SD rats and sera from patients infected with Taenia solium, Taenia saginata or Taenia asiatica. The immunofluorescence assay revealed that TsCDC37 located at the tegument of T. solium adult and the eggs. TsCDC37 gene has been expressed with immunoreactivity. The recombinant protein is mainly expressed in tegument and egg, and is a common antigen of the three human taenia cestodes.
Jiang, Xiaoou; Yu, Han; Teo, Cui Rong; Tan, Genim Siu Xian; Goh, Sok Chin; Patel, Parasvi; Chua, Yiqiang Kevin; Hameed, Nasirah Banu Sahul; Bertoletti, Antonio; Patzel, Volker
2016-09-01
Dumbbell-shaped DNA minimal vectors lacking nontherapeutic genes and bacterial sequences are considered a stable, safe alternative to viral, nonviral, and naked plasmid-based gene-transfer systems. We investigated novel molecular features of dumbbell vectors aiming to reduce vector size and to improve the expression of noncoding or coding RNA. We minimized small hairpin RNA (shRNA) or microRNA (miRNA) expressing dumbbell vectors in size down to 130 bp generating the smallest genetic expression vectors reported. This was achieved by using a minimal H1 promoter with integrated transcriptional terminator transcribing the RNA hairpin structure around the dumbbell loop. Such vectors were generated with high conversion yields using a novel protocol. Minimized shRNA-expressing dumbbells showed accelerated kinetics of delivery and transcription leading to enhanced gene silencing in human tissue culture cells. In primary human T cells, minimized miRNA-expressing dumbbells revealed higher stability and triggered stronger target gene suppression as compared with plasmids and miRNA mimics. Dumbbell-driven gene expression was enhanced up to 56- or 160-fold by implementation of an intron and the SV40 enhancer compared with control dumbbells or plasmids. Advanced dumbbell vectors may represent one option to close the gap between durable expression that is achievable with integrating viral vectors and short-term effects triggered by naked RNA.
Wang, Jin Yuan; Carrasco, Jose A.; Lloyd, Scott A.; Mellado-Sanchez, Gabriela; Diaz-McNair, Jovita; Franco, Olga; Buskirk, Amanda D.; Nataro, James P.; Pasetti, Marcela F.
2014-01-01
Live attenuated bacteria hold great promise as multivalent mucosal vaccines against a variety of pathogens. A major challenge of this approach has been the successful delivery of sufficient amounts of vaccine antigens to adequately prime the immune system without overattenuating the live vaccine. Here we used a live attenuated Salmonella enterica serovar Typhi strain to create a bivalent mucosal plague vaccine that produces both the protective F1 capsular antigen of Yersinia pestis and the LcrV protein required for secretion of virulence effector proteins. To reduce the metabolic burden associated with the coexpression of F1 and LcrV within the live vector, we balanced expression of both antigens by combining plasmid-based expression of F1 with chromosomal expression of LcrV from three independent loci. The immunogenicity and protective efficacy of this novel vaccine were assessed in mice by using a heterologous prime-boost immunization strategy and compared to those of a conventional strain in which F1 and LcrV were expressed from a single low-copy-number plasmid. The serum antibody responses to lipopolysaccharide (LPS) induced by the optimized bivalent vaccine were indistinguishable from those elicited by the parent strain, suggesting an adequate immunogenic capacity maintained through preservation of bacterial fitness; in contrast, LPS titers were 10-fold lower in mice immunized with the conventional vaccine strain. Importantly, mice receiving the optimized bivalent vaccine were fully protected against lethal pulmonary challenge. These results demonstrate the feasibility of distributing foreign antigen expression across both chromosomal and plasmid locations within a single vaccine organism for induction of protective immunity. PMID:25332120
Genetic manipulation of Treponema denticola.
Kuramitsu, Howard K; Chi, Bo; Ikegami, Akihiko
2005-07-01
The oral anaerobic spirochete, Treponema denticola, has been implicated in the etiology of human periodontal diseases; however, the molecular basis for the virulence of these organisms is still unclear. Potential pathogenic factors expressed by T. denticola have recently begun to be identified through the development of gene transfer approaches in this organism following electroporetic transformation. Several antibiotic resistance markers have been developed for use in the construction of monospecific mutants in these organisms. In addition, these antibiotic resistance cassettes have been more recently utilized to construct shuttle plasmids for complementation analysis of the mutants. These plasmids were also used to express heterologous spirochete genes in T. denticola. The transformation of other spirochetes such as T. phagedenis with these plasmids further suggests that it should be possible to develop similar gene transfer systems in other cultivable treponemes.
Plasmids containing the gene for DNA polymerase I from Streptococcus pneumoniae
Lacks, S.A.; Martinez, S.; Lopez, P.; Espinosa, M.
1987-08-28
A method is disclosed for cloning the gene which encodes a DNA polymerase-exonuclease of /und Streptococcus/ /und pneumoniae/. Plasmid pSM22, the vector containing the pneumococcal polA gene, facilitates the expression of 50-fold greater amounts of the PolI enzyme. 1 fig., 1 tab.
Role of plasmids in Lactobacillus brevis BSO 464 hop tolerance and beer spoilage.
Bergsveinson, Jordyn; Baecker, Nina; Pittet, Vanessa; Ziola, Barry
2015-02-01
Specific isolates of lactic acid bacteria (LAB) can grow in the harsh beer environment, thus posing a threat to brew quality and the economic success of breweries worldwide. Plasmid-localized genes, such as horA, horC, and hitA, have been suggested to confer hop tolerance, a trait required for LAB survival in beer. The presence and expression of these genes among LAB, however, do not universally correlate with the ability to grow in beer. Genome sequencing of the virulent beer spoilage organism Lactobacillus brevis BSO 464 revealed the presence of eight plasmids, with plasmids 1, 2, and 3 containing horA, horC, and hitA, respectively. To investigate the roles that these and the other five plasmids play in L. brevis BSO 464 growth in beer, plasmid curing with novobiocin was used to derive 10 plasmid variants. Multiplex PCRs were utilized to determine the presence or absence of each plasmid, and how plasmid loss affected hop tolerance and growth in degassed (noncarbonated) beer was assessed. Loss of three of the eight plasmids was found to affect hop tolerance and growth in beer. Loss of plasmid 2 (horC and 28 other genes) had the most dramatic effect, with loss of plasmid 4 (120 genes) and plasmid 8 (47 genes) having significant, but smaller, impacts. These results support the contention that genes on mobile genetic elements are essential for bacterial growth in beer and that beer spoilage ability is not dependent solely on the three previously described hop tolerance genes or on the chromosome of a beer spoilage LAB isolate.
Role of Plasmids in Lactobacillus brevis BSO 464 Hop Tolerance and Beer Spoilage
Bergsveinson, Jordyn; Baecker, Nina; Pittet, Vanessa
2014-01-01
Specific isolates of lactic acid bacteria (LAB) can grow in the harsh beer environment, thus posing a threat to brew quality and the economic success of breweries worldwide. Plasmid-localized genes, such as horA, horC, and hitA, have been suggested to confer hop tolerance, a trait required for LAB survival in beer. The presence and expression of these genes among LAB, however, do not universally correlate with the ability to grow in beer. Genome sequencing of the virulent beer spoilage organism Lactobacillus brevis BSO 464 revealed the presence of eight plasmids, with plasmids 1, 2, and 3 containing horA, horC, and hitA, respectively. To investigate the roles that these and the other five plasmids play in L. brevis BSO 464 growth in beer, plasmid curing with novobiocin was used to derive 10 plasmid variants. Multiplex PCRs were utilized to determine the presence or absence of each plasmid, and how plasmid loss affected hop tolerance and growth in degassed (noncarbonated) beer was assessed. Loss of three of the eight plasmids was found to affect hop tolerance and growth in beer. Loss of plasmid 2 (horC and 28 other genes) had the most dramatic effect, with loss of plasmid 4 (120 genes) and plasmid 8 (47 genes) having significant, but smaller, impacts. These results support the contention that genes on mobile genetic elements are essential for bacterial growth in beer and that beer spoilage ability is not dependent solely on the three previously described hop tolerance genes or on the chromosome of a beer spoilage LAB isolate. PMID:25501474
Kanika, Nirmala Devi; Tar, Moses; Tong, Yuehong; Kuppam, Dwaraka Srinivasa Rao; Melman, Arnold; Davies, Kelvin Paul
2009-10-01
Intracorporal injection of plasmids encoding opiorphins into retired breeder rats can result in animals developing a priapic-like condition. Microarray analysis demonstrated that following intracorporal gene transfer of plasmids expressing opiorphins the most significantly upregulated gene in corporal tissue was the ornithine decarboxylase gene (ODC). Quantitative RT-PCR confirmed the upregulation of ODC, as well as other genes involved in polyamine synthesis, such as arginase-I and -II, polyamine oxidase, spermidine synthase, spermidine acetyltransferase (SAT), and S-adenosylmethionine decarboxylase. Western blot analysis demonstrated upregulation of arginase-I and -II, ODC, and SAT at the protein level. Levels of the polyamine putrescine were upregulated in animals treated with opiorphin-expressing plasmids compared with controls. A direct role for the upregulation of polyamine synthesis in the development of the priapic-like condition was supported by the observation that the ODC inhibitor 1,3-diaminopropane, when added to the drinking water of animals treated with plasmids expressing opiorphins, prevented experimental priapism. We also demonstrate that in sickle cell mice, another model of priapism, there is increased expression of the mouse opiorphin homologue in corporal tissue compared with the background strain at a life stage prior to evidence of priapism. At a life stage when there is onset of priapism, there is increased expression of the enzymes involved in polyamine synthesis (ODC and arginase-I and -II). Our results suggest that the upregulation of enzymes involved in the polyamine synthetic pathway may play a role in the development of experimental priapism and represent a target for the prevention of priapism.
Kanika, Nirmala Devi; Tar, Moses; Tong, Yuehong; Kuppam, Dwaraka Srinivasa Rao; Melman, Arnold
2009-01-01
Intracorporal injection of plasmids encoding opiorphins into retired breeder rats can result in animals developing a priapic-like condition. Microarray analysis demonstrated that following intracorporal gene transfer of plasmids expressing opiorphins the most significantly upregulated gene in corporal tissue was the ornithine decarboxylase gene (ODC). Quantitative RT-PCR confirmed the upregulation of ODC, as well as other genes involved in polyamine synthesis, such as arginase-I and -II, polyamine oxidase, spermidine synthase, spermidine acetyltransferase (SAT), and S-adenosylmethionine decarboxylase. Western blot analysis demonstrated upregulation of arginase-I and -II, ODC, and SAT at the protein level. Levels of the polyamine putrescine were upregulated in animals treated with opiorphin-expressing plasmids compared with controls. A direct role for the upregulation of polyamine synthesis in the development of the priapic-like condition was supported by the observation that the ODC inhibitor 1,3-diaminopropane, when added to the drinking water of animals treated with plasmids expressing opiorphins, prevented experimental priapism. We also demonstrate that in sickle cell mice, another model of priapism, there is increased expression of the mouse opiorphin homologue in corporal tissue compared with the background strain at a life stage prior to evidence of priapism. At a life stage when there is onset of priapism, there is increased expression of the enzymes involved in polyamine synthesis (ODC and arginase-I and -II). Our results suggest that the upregulation of enzymes involved in the polyamine synthetic pathway may play a role in the development of experimental priapism and represent a target for the prevention of priapism. PMID:19657052
Su, Jianguo; Zhu, Zuoyan; Wang, Yaping; Xiong, Feng; Zou, Jun
2008-01-01
The ability to utilize the RNA interference (RNAi) machinery for silencing target-gene expression has created a lot of excitement in the research community. In the present study, we used a cytomegalovirus (CMV) promoter-driven DNA template approach to induce short hairpin RNA (shRNA) triggered RNAi to block exogenous Enhanced Green Fluorescent Protein (EGFP) and endogenous No Tail (NTL) gene expressions. We constructed three plasmids, pCMV-EGFP-CMV-shGFP-SV40, pCMV-EGFP-CMV-shNTL-SV40, and pCMV-EGFP-CMV-shScrambled-SV40, each containing a CMV promoter driving an EGFP reporter cDNA and DNA coding for one shRNA under the control of another CMV promoter. The three shRNA-generating plasmids and pCMV-EGFP control plasmid were introduced into zebrafish embryos by microinjection. Samples were collected at 48 h after injection. Results were evaluated by phenotype observation and real-time fluorescent quantitative reverse-transcription polymerase chain reaction (Q-PCR). The shGFP-generating plasmid significantly inhibited the EGFP expression viewed under fluorescent microscope and reduced by 70.05 +/- 1.26% of exogenous EGFP gene mRNA levels compared with controls by Q-PCR. The shRNA targeting endogenous NTL gene resulted in obvious NTL phenotype of 30 +/- 4% and decreased the level of their corresponding mRNAs up to 54.52 +/- 2.05% compared with nontargeting control shRNA. These data proved the feasibility of the CMV promoter-driven shRNA expression technique to be used to inhibit exogenous and endogenous gene expressions in zebrafish in vivo.
Breau, Cathy; Cameron, D William; Desjardins, Marc; Lee, B Craig
2012-01-31
Chancroid, a sexually transmitted genital ulcer disease caused by the Gram-negative bacterium Haemophilus ducreyi, facilitates the acquisition and transmission of HIV. An effective vaccine against chancroid has not been developed. In this preliminary study, the gene encoding the H. ducreyi outer membrane hemoglobin receptor HgbA was cloned into the plasmid pTETnir15. The recombinant construct was introduced into the attenuated Salmonella typhimurium SL3261 strain and stable expression was induced in vitro under anaerobic conditions. The vaccine strain was delivered into the temperature-dependent rabbit model of chancroid by intragastric immunization as a single dose, or as three doses administered at two-weekly intervals. No specific antibody to HgbA was elicited after either dose schedule. Although the plasmid vector survived in vivo passage for up to 15 days following single oral challenge, HgbA expression was restricted to plasmid isolates recovered one day after immunization. Rabbits inoculated with the 3-dose booster regimen achieved no protective immunity from homologous challenge. These results emphasize that refinements in plasmid design to enhance a durable heterologous protein expression are necessary for the development of a live oral vaccine against chancroid. Copyright © 2011 Elsevier B.V. All rights reserved.
Liang, Xiao; Li, Chenmeng; Wang, Wenya; Li, Qiang
2018-05-18
Metabolic engineering and synthetic biology usually require universal expression systems for stable and efficient gene expression in various organisms. In this study, a host-independent and stable T7 expression system had been developed by integrating T7 RNA polymerase and its cognate transcriptional units in single plasmid. The expression of T7 RNA polymerase was restricted below its lethal threshold using a T7 RNA polymerase antisense gene cassette, which allowed long periods of cultivation and protein production. In addition, by designing ribosome binding sites, we further tuned the expression capacity of this novel T7 system within a wide range. This host-independent expression system efficiently expressed genes in five different Gram-negative strains and one Gram-positive strain and was also shown to be applicable in a real industrial d- p-hydroxyphenylglycine production system.
Yen-Ting-Liu; Sau, Saumitra; Ma, Chien-Hui; Kachroo, Aashiq H; Rowley, Paul A; Chang, Keng-Ming; Fan, Hsiu-Fang; Jayaram, Makkuni
2014-01-01
Summary The multi-copy 2 micron plasmid of Saccharomyces cerevisiae, a resident of the nucleus, is remarkable for its high chromosome-like stability. The plasmid does not appear to contribute to the fitness of the host, nor does it impose a significant metabolic burden on the host at its steady state copy number. The plasmid may be viewed as a highly optimized selfish DNA element whose genome design is devoted entirely towards efficient replication, equal segregation and copy number maintenance. A partitioning system comprised of two plasmid coded proteins, Rep1 and Rep2, and a partitioning locus STB is responsible for equal or nearly equal segregation of plasmid molecules to mother and daughter cells. Current evidence supports a model in which the Rep-STB system promotes the physical association of the plasmid with chromosomes and thus plasmid segregation by a hitchhiking mechanism. The Flp site-specific recombination system housed by the plasmid plays a critical role in maintaining steady state plasmid copy number. A decrease in plasmid population due to rare missegregation events is rectified by plasmid amplification via a recombination induced rolling circle replication mechanism. Appropriate plasmid amplification, without runaway increase in copy number, is ensured by positive and negative regulation of FLP gene expression by plasmid coded proteins and by the control of Flp level/activity through host mediated post-translational modification(s) of Flp. The Flp system has been successfully utilized to understand mechanisms of site-specific recombination, to bring about directed genetic alterations for addressing fundamental problems in biology, and as a tool in biotechnological applications. PMID:25541598
Yen-Ting-Liu; Sau, Saumitra; Ma, Chien-Hui; Kachroo, Aashiq H; Rowley, Paul A; Chang, Keng-Ming; Fan, Hsiu-Fang; Jayaram, Makkuni
2014-10-01
The multi-copy 2 micron plasmid of Saccharomyces cerevisiae, a resident of the nucleus, is remarkable for its high chromosome-like stability. The plasmid does not appear to contribute to the fitness of the host, nor does it impose a significant metabolic burden on the host at its steady state copy number. The plasmid may be viewed as a highly optimized selfish DNA element whose genome design is devoted entirely towards efficient replication, equal segregation and copy number maintenance. A partitioning system comprised of two plasmid coded proteins, Rep1 and Rep2, and a partitioning locus STB is responsible for equal or nearly equal segregation of plasmid molecules to mother and daughter cells. Current evidence supports a model in which the Rep-STB system promotes the physical association of the plasmid with chromosomes and thus plasmid segregation by a hitchhiking mechanism. The Flp site-specific recombination system housed by the plasmid plays a critical role in maintaining steady state plasmid copy number. A decrease in plasmid population due to rare missegregation events is rectified by plasmid amplification via a recombination induced rolling circle replication mechanism. Appropriate plasmid amplification, without runaway increase in copy number, is ensured by positive and negative regulation of FLP gene expression by plasmid coded proteins and by the control of Flp level/activity through host mediated post-translational modification(s) of Flp. The Flp system has been successfully utilized to understand mechanisms of site-specific recombination, to bring about directed genetic alterations for addressing fundamental problems in biology, and as a tool in biotechnological applications.
In vitro expression of erythropoietin by transfected human mesenchymal stromal cells.
Mok, P-L; Cheong, S-K; Leong, C-F; Othman, A
2008-01-01
Mesenchymal stromal cells (MSC) are pluripotent progenitor cells that can be found in human bone marrow (BM). These cells have low immunogenicity and could suppress alloreactive T-cell responses. In the current study, MSC were tested for their capacity to carry and deliver the erythropoietin (EPO) gene in vitro. Expanded BM MSC was transfected with EPO-encoded plasmid pMCV1.2 and EPO-encoded MIDGE (minimalistic immunologically defined gene expression) vector by electroporation. The expressed EPO was used to induce hematopoietic stem cells (HSC) into erythroid colonies. The results showed that the MIDGE vector was more effective and stable than the plasmid (pMCV1.2) in delivering EPO gene into MSC. The supernatants containing EPO obtained from the transfected cell culture were able to induce the differentiation of HSC into erythroid colonies. MSC hold promise as a cell factory for the production of biologic molecules, and MIDGE vector is more effective and stable than the plasmid in nucleofection involving the EPO gene.
NASA Astrophysics Data System (ADS)
Sasaki, Shota; Hokari, Yutaro; Kanzaki, Makoto; Kaneko, Toshiro
2015-09-01
Gene transfection, which is the process of deliberately introducing nucleic acids into cells, is expected to play an important role in medical treatment because the process is necessary for gene therapy and creation of induced pluripotent stem (iPS) cells. However, the conventional transfection methods have some problems, so we focus attention on promising transfection methods by atmospheric pressure plasma (APP). We have previously reported that the cell membrane permeability, which is closely related with gene transfection, is improved using a cell-solution electrode for generating He-APP. He-APP is irradiated to the solution containing the adherent cells and delivery materials such as fluorescent dyes (YOYO-1) and plasmid DNA (GFP). In case of YOYO-1 delivery, more than 80% of cells can be transferred only in the plasma-irradiated area and the spatially-selective membrane permeabilization is realized by the plasma irradiation. In addition, it is confirmed that plasmid DNA is transfected and the GFP genes are expressed using same APP irradiation system with no obvious cellular damage.
Dziewit, Lukasz; Grzesiak, Jakub; Ciok, Anna; Nieckarz, Marta; Zdanowski, Marek K; Bartosik, Dariusz
2013-09-01
Pseudomonas sp. GLE121 (a psychrophilic Antarctic strain) carries three plasmids: pGLE121P1 (6899 bp), pGLE121P2 (8330 bp) and pGLE121P3 (39,583 bp). Plasmids pGLE121P1 and pGLE121P2 show significant sequence similarity to members of the IncP-9 and IncP-7 incompatibility groups, respectively, while the largest replicon, pGLE121P3, is highly related to plasmid pNCPPB880-40 of Pseudomonas syringae pathovar tomato NCPPB880. All three plasmids have a narrow host range, limited to members of the genus Pseudomonas. Plasmid pGLE121P3 encodes a conjugal transfer system, while pGLE121P1 carries only a putative MOB module, conserved in many mobilizable plasmids. Plasmid pGLE121P3 contains an additional load of genetic information, including a pair of genes with homology to the rulAB operon, responsible for ultraviolet radiation (UVR) tolerance. Given the increasing UV exposure in Antarctic regions, the expression of these genes is likely to be an important adaptive response. Copyright © 2013 Elsevier Inc. All rights reserved.
Grove, J R; Deutsch, P J; Price, D J; Habener, J F; Avruch, J
1989-11-25
Plasmids that encode a bioactive amino-terminal fragment of the heat-stable inhibitor of the cAMP-dependent protein kinase, PKI(1-31), were employed to characterize the role of this protein kinase in the control of transcriptional activity mediated by three DNA regulatory elements in the JEG-3 human placental cell line. The 5'-flanking sequence of the human collagenase gene contains the heptameric sequence, 5'-TGAGTCA-3', previously identified as a "phorbol ester" response element. Reporter genes containing either the intact 1.2-kilobase 5'-flanking sequence from the human collagenase gene or just the 7-base pair (bp) response element, when coupled to an enhancerless promoter, each exhibit both cAMP and phorbol ester-stimulated expression in JEG-3 cells. Cotransfection of either construct with plasmids encoding PKI(1-31) inhibits cAMP-stimulated but not basal- or phorbol ester-stimulated expression. Pretreatment of cells with phorbol ester for 1 or 2 days abrogates completely the response to rechallenge with phorbol ester but does not alter the basal expression of either construct; cAMP-stimulated expression, while modestly inhibited, remains vigorous. The 5'-flanking sequence of the human chorionic gonadotropin-alpha subunit (HCG alpha) gene has two copies of the sequence, 5'-TGACGTCA-3', contained in directly adjacent identical 18-bp segments, previously identified as a cAMP-response element. Reporter genes containing either the intact 1.5 kilobase of 5'-flanking sequence from the HCG alpha gene, or just the 36-bp tandem repeat cAMP response element, when coupled to an enhancerless promoter, both exhibit a vigorous cAMP stimulation of expression but no response to phorbol ester in JEG-3 cells. Cotransfection with plasmids encoding PKI(1-31) inhibits both basal and cAMP-stimulated expression in a parallel fashion. The 5'-flanking sequence of the human enkephalin gene mediates cAMP-stimulated expression of reporter genes in both JEG-3 and CV-1 cells. Plasmids encoding PKI(1-31) inhibit the expression that is stimulated by the addition of cAMP analogs in both cell lines; basal expression, however, is inhibited by PKI(1-31) only in the JEG-3 cell line and not in the CV-1 cells. These observations indicate that, in JEG-3 cells, PKI(1-31) is a specific inhibitor of kinase A-mediated gene transcription, but it does not modify kinase C-directed transcription.(ABSTRACT TRUNCATED AT 400 WORDS)
Kumar, Amit; Wonganan, Piyanuch; Sandoval, Michael A; Li, Xinran; Zhu, Saijie; Cui, Zhengrong
2012-10-28
Previously, it was shown that microneedle-mediated transcutaneous immunization with plasmid DNA can potentially induce a stronger immune response than intramuscular injection of the same plasmid DNA. In the present study, we showed that the immune responses induced by transcutaneous immunization by applying plasmid DNA onto a skin area pretreated with solid microneedles were significantly enhanced by coating the plasmid DNA on the surface of cationic nanoparticles. In addition, the net surface charge of the DNA-coated nanoparticles significantly affected their in vitro skin permeation and their ability to induce immune responses in vivo. Transcutaneous immunization with plasmid DNA-coated net positively charged nanoparticles elicited a stronger immune response than with plasmid DNA-coated net negatively charged nanoparticles or by intramuscular immunization with plasmid DNA alone. Transcutaneous immunization with plasmid DNA-coated net positively charged nanoparticles induced comparable immune responses as intramuscular injection of them, but transcutaneous immunization was able to induce specific mucosal immunity and a more balanced T helper type 1 and type 2 response. The ability of the net positively charged DNA-coated nanoparticles to induce a strong immune response through microneedle-mediated transcutaneous immunization may be attributed to their ability to increase the expression of the antigen gene encoded by the plasmid and to more effectively stimulate the maturation of antigen-presenting cells. Copyright © 2012 Elsevier B.V. All rights reserved.
Burbank, Lindsey P; Stenger, Drake C
2016-08-01
The phytopathogen Xylella fastidiosa causes disease in a variety of important crop and landscape plants. Functional genetic studies have led to a broader understanding of virulence mechanisms used by this pathogen in the grapevine host. Plasmid shuttle vectors are important tools in studies of bacterial genetics but there are only a limited number of plasmid vectors available that replicate in X. fastidiosa, and even fewer that are retained without antibiotic selection. Two plasmids are described here that show stable replication in X. fastidiosa and are effective for gene complementation both in vitro and in planta. Plasmid maintenance is facilitated by incorporation of the PemI/PemK plasmid addiction system, consisting of PemK, an endoribonuclease toxin, and its cognate antitoxin, PemI. Vector pXf20pemIK utilizes a native X. fastidiosa replication origin as well as a high-copy-number pUC origin for propagation in Escherichia coli cloning strains. Broad-host-range vector pBBR5pemIK is a medium- to low-copy-number plasmid based on the pBBR1 backbone. Both plasmids are maintained for extended periods of time in the absence of antibiotic selection, as well as up to 14 weeks in grapevine, without affecting bacterial fitness. These plasmids present an alternative to traditional complementation and expression vectors which rely on antibiotic selection for plasmid retention.
Singh, Praveen K; Ramachandran, Gayetri; Ramos-Ruiz, Ricardo; Peiró-Pastor, Ramón; Abia, David; Wu, Ling J; Meijer, Wilfried J J
2013-10-01
Horizontal gene transfer mediated by plasmid conjugation plays a significant role in the evolution of bacterial species, as well as in the dissemination of antibiotic resistance and pathogenicity determinants. Characterization of their regulation is important for gaining insights into these features. Relatively little is known about how conjugation of Gram-positive plasmids is regulated. We have characterized conjugation of the native Bacillus subtilis plasmid pLS20. Contrary to the enterococcal plasmids, conjugation of pLS20 is not activated by recipient-produced pheromones but by pLS20-encoded proteins that regulate expression of the conjugation genes. We show that conjugation is kept in the default "OFF" state and identified the master repressor responsible for this. Activation of the conjugation genes requires relief of repression, which is mediated by an anti-repressor that belongs to the Rap family of proteins. Using both RNA sequencing methodology and genetic approaches, we have determined the regulatory effects of the repressor and anti-repressor on expression of the pLS20 genes. We also show that the activity of the anti-repressor is in turn regulated by an intercellular signaling peptide. Ultimately, this peptide dictates the timing of conjugation. The implications of this regulatory mechanism and comparison with other mobile systems are discussed.
Agaphonov, Michael O
2017-12-01
The use of plasmids possessing a regulatable gene coding for a site-specific recombinase together with its recognition sequences significantly facilitates genome manipulations since it allows self-excision of the portion of the genetic construct integrated into the host genome. Stable maintenance of such plasmids in Escherichia coli, which is used for plasmid preparation, requires prevention of recombinase synthesis in this host, which can be achieved by interrupting the recombinase gene with an intron. Based on this approach, Saccharomyces cerevisiae and Hansenula polymorpha self-excising vectors possessing intronated gene for Cre recombinase and its recognition sites (LoxP) were previously constructed. However, this work shows instability of the H. polymorpha vectors during plasmid maintenance in E. coli cells. This could be due to recombination between the loxP sites caused by residual expression of the cre gene. Prevention of translation reinitiation on an internal methionine codon completely solved this problem. A similar modification was made in a self-excising vector designed for S. cerevisiae. Apart from substantial improvement of yeast self-excising vectors, the obtained results also narrow down the essential part of Cre sequence. © FEMS 2017. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Martinez, A.; York, S.W.; Yomano, L.P.
1999-10-01
Previous studies have shown an unexpectedly high nutrient requirement for efficient ethanol production by ethanologenic recombinants of Escherichia coli B such as LY01 which contain chromosomally integrated Zymomonas mobilis genes (pdc, adhB) encoding the ethanol pathway. The basis for this requirement has been identified as a media-dependent effect on the expression of the Z. mobilis genes rather than a nutritional limitation. Ethanol production was substantially increased without additional nutrients simply by increasing the level of pyruvate decarboxylase activity. This was accomplished by adding a multicopy plasmid containing pdc alone (but not adhB alone) to strain LY01, and by adding multicopymore » plasmids which express pdc and adhB from strong promoters. New strong promoters were isolated from random fragments of Z. mobilis DNA and characterized but were not used to construct integrated biocatalysts. These promoters contained regions resembling recognition sites for 3 different E. coli sigma factors: {sigma}{sup 70}, {sigma}{sup 38}, and {sigma}{sup 28}. The most effective plasmid-based promoters for fermentation were recognized by multiple sigma factors, expressed both pdc and adhB at high levels, and produced ethanol efficiently while allowing up to 80% reduction in complex nutrients as compared to LY01. The ability to utilize multiple sigma factors may be advantageous to maintain the high levels of PDC and ADH needed for efficient ethanol production throughout batch fermentation.« less
The p40 Subunit of Interleukin (IL)-12 Promotes Stabilization and Export of the p35 Subunit
Jalah, Rashmi; Rosati, Margherita; Ganneru, Brunda; Pilkington, Guy R.; Valentin, Antonio; Kulkarni, Viraj; Bergamaschi, Cristina; Chowdhury, Bhabadeb; Zhang, Gen-Mu; Beach, Rachel Kelly; Alicea, Candido; Broderick, Kate E.; Sardesai, Niranjan Y.; Pavlakis, George N.; Felber, Barbara K.
2013-01-01
IL-12 is a 70-kDa heterodimeric cytokine composed of the p35 and p40 subunits. To maximize cytokine production from plasmid DNA, molecular steps controlling IL-12p70 biosynthesis at the posttranscriptional and posttranslational levels were investigated. We show that the combination of RNA/codon-optimized gene sequences and fine-tuning of the relative expression levels of the two subunits within a cell resulted in increased production of the IL-12p70 heterodimer. We found that the p40 subunit plays a critical role in enhancing the stability, intracellular trafficking, and export of the p35 subunit. This posttranslational regulation mediated by the p40 subunit is conserved in mammals. Based on these findings, dual gene expression vectors were generated, producing an optimal ratio of the two subunits, resulting in a ∼1 log increase in human, rhesus, and murine IL-12p70 production compared with vectors expressing the wild type sequences. Such optimized DNA plasmids also produced significantly higher levels of systemic bioactive IL-12 upon in vivo DNA delivery in mice compared with plasmids expressing the wild type sequences. A single therapeutic injection of an optimized murine IL-12 DNA plasmid showed significantly more potent control of tumor development in the B16 melanoma cancer model in mice. Therefore, the improved IL-12p70 DNA vectors have promising potential for in vivo use as molecular vaccine adjuvants and in cancer immunotherapy. PMID:23297419
[Study of neutralization antibodie induced by DNA vaccine of HCV envelope protein 2 in mice].
Shao, Shengwen; Zhou, Hongchang; Tong, Yimin; Ren, Yanli; Chen, Zhihui
2011-05-01
To explore the feasibility of induction of neutralization antibodies against hepatitis C virus (HCV) infection by HCV envelope 2 protein (E2) DNA vaccines immunization. Two kinds of expression plasmids of HCV envelope 2 protein, plasmid pCI-1b661 Delta encoding hydrophobic carboxyl terminal truncated E2 and pCI-1b661 Delta encoding E2 with deletion of hypervariable region 1 (HVR1) and carboxyl terminal, were constructed and respectively transfeted 293T cells, and truncated E2 protein in whole cell lysate and supernatant of 293T cells were analyzed by Western blot. After BALB/c mouse were intramuscularly immunized by the plasmids, sera antibodies against HVR1 were detected by ELISA and the neutralization activity of the antibodies were assayed with HCV pseudotype particle (HCVpp). Both plasmids could express secretary truncated E2 protein. All the mice immunized with plasmid pCI-1b661 produced HVR1 antibodies,while no HVR1 antibodies were detected in pCI-1b661 Delta immunized mice. The sera neutralization percentages against HCVpp in pCI1lb661 Delta and pCI-lb661 Delta immunized mice were (78.5 +/- 13.8)% and (38.7 +/- 6.5)%, respectively (P <0.01). Sera neutralization activity against HCVpp was positive correlated with the level of HVR1 antibodies in pCI-1b661 immunized mice (r = 0.967, P<0.01). DNA vaccines expressing truncated E2 protein could induce neutralization antibodies against HCV, and neutralization antibodies mainly was consisted of the antibodies against HVR1.
Nitrogen-fixing nodules induced by Agrobacterium tumefaciens harboring Rhizobium phaseoli plasmids.
Martínez, E; Palacios, R; Sánchez, F
1987-01-01
Rhizobium phaseoli CFN299 forms nitrogen-fixing nodules in Phaseolus vulgaris (bean) and in Leucaena esculenta. It has three plasmids of 185, 225, and 410 kilobases. The 410-kilobase plasmid contains the nitrogenase structural genes. We have transferred these plasmids to the plasmid-free strain Agrobacterium tumefaciens GMI9023. Transconjugants containing different combinations of the R. phaseoli plasmids were obtained, and they were exhaustively purified before nodulation was assayed. Only transconjugants harboring the 410-kilobase plasmid nodulate P. vulgaris and L. esculenta. Nodules formed by all such transconjugants are able to reduce acetylene. Transconjugants containing the whole set of plasmids from CFN299 nodulate better and fix more nitrogen than the transconjugants carrying only the Sym plasmid. Microscopic analysis of nodules induced by A. tumefaciens transconjugants reveals infected cells and vascular bundles. None of the A. tumefaciens transconjugants, not even the one with the whole set of plasmids from CFN299, behaves in symbiosis like the original R. phaseoli strain; the transconjugants produce fewer nodules and have lower acetylene reduction (25% as compared to the original R. phaseoli strain) and more amyloplasts per nodule. More than 2,000 bacterial isolates from nodules of P. vulgaris and L. esculenta formed by the transconjugants were analyzed by different criteria. Not a single rhizobium could be detected. Our results show that R. phaseoli plasmids may be expressed in the A. tumefaciens background and direct the formation of effective, differentiated nodules. Images PMID:3584072
Strategy to approach stable production of recombinant nattokinase in Bacillus subtilis.
Chen, Po Ting; Chiang, Chung-Jen; Chao, Yun-Peng
2007-01-01
Bacillus subtilis (B. subtilis) is widely accepted as an excellent host cell for the secretory production of recombinant proteins. In this study, a shuttle vector was constructed by fusion of Staphylococcus aureus (S. aureus) plasmid pUB110 with Escherichia coli (E. coli) plasmid pUC18 and used for the expression of nattokinase in B. subtilis. The pUB110/pUC-based plasmid was found to exhibit high structural instability with the identification of a DNA deletion between two repeated regions. An initial attempt was made to eliminate the homologous site in the plasmid, whereas the stability of the resulting plasmid was not improved. In an alternative way, the pUC18-derived region in this hybrid vector was replaced by the suicidal R6K plasmid origin of E. coli. As a consequence, the pUB110/R6K-based plasmid displayed full structural stability, leading to a high-level production of recombinant nattokinase in the culture broth. This was mirrored by the detection of a very low level of high molecular weight DNAs generated by the plasmid. Moreover, 2-fold higher nattokinase production was obtained by B. subtilis strain carrying the pUB110/R6K-based plasmid as compared to the cell with the pAMbeta1-derived vector, a plasmid known to have high structural stability. Overall, it indicates the feasibility of the approach by fusing two compatible plasmid origins for stable and efficient production of recombinant nattokinase in B. subtilis.
[Construction and expression of recombinant human serum albumin-EPO fusion protein].
Huang, Ying-Chun; Gou, Xing-Hua; Han, Lei; Li, De-Hua; Zhao, Lan-Ying; Wu, Qia-Qing
2011-05-01
OBJECTIVE To construct the recombinant plasmid pCI-HLE encoding human serum album-EPO (HSA-EPO) fusion protein and to express it in CHO cell. The cDNA encoding human serum album and EPO were amplified by PCR, and then spliced with the synsitic DNA fragment encoding GS (GGGGS), by overlap PCR extension to form LEPO. After BamH I digestion, the HSA and LEPO was ligated to generate the fusion HSA-EPO gene and was then cloned into the expression vector pCI-neo to generate the recombinant plasmid pCI-HLE. The plasmid pCI-HLE was transfected into CHO cell by liposome protocol. Then, the recombinant cells were screened by G418 and identified by PCR and Western blot. Expression of fusion protein was evaluated by Enzyme Linked Immunosorbent Assay (ELISA). Restrictive enzymes digestion and DNA sequencing revealed that HSA-EPO fusion gene was cloned into expression vector pCI-neo successfully. PCR and Western blot analysis confirmed that the fusion gene was integrated in the genome of CHO cells and expressed successfully. The HSA-EPO production varied from 86 Iu/(mL x 10(6) x 72 h) to 637 IU/(mLx 10(6) x 72 h). The results confirmed that HSA-EPO fusion gene can be expressed in the CHO cells, with EPO immunogenicity, which could serve as foundation for the development of long-lasting recombinant HSA-EPO protein.
[Construction of the superantigen SEA transfected laryngocarcinoma cells].
Ji, Xiaobin; Jingli, J V; Liu, Qicai; Xie, Jinghua
2013-04-01
To construct an eukaryotic expression vectors containing superantigen staphylococcal enterotoxin A (SEA) gene, and to identify its expression in laryngeal squamous carcinoma cells. SEA full-length gene fragment was obtained from ATCC13565 genome of the staphylococcus, referencing standard strains producing SEA. Coding sequence of SEA was artificially synthetized. Than, SEA gene fragments was subcloned into eukaryotic expression vector pIRES-EGFP. The recombinant plasmid pSEA-IRES-EGFP was constructed and was transfected to laryngocarcinoma Hep-2 cells. Resistant clones were screened by G418. The expression of SEA in laryngocarcinoma cells was identified with ELISA and RT-PCR method. The subclone of artificially synthetized SEA gene was subclone to eukaryotic expression vector pires-EGFP. Flanking sequence confirmed that SEA sequence was fully identical to the coding sequence of standard staphylococcus strains ATCC13565 in Genbank. After recombinant plasmid transfected to laryngocarcinoma cells, the resistant clones was obtained after screening for two weeks. The clones were selected. The specific gene fragment was obtained by RT-PCR amplification. ELISA assay confirmed that the content of SEA protein in supernatant fluid of cell culture had reached about Pg level. The recombinant eukaryotic expression vector containing superantigen SEA gene is successfully constructed, and is capable of effective expression and continued secretion of SEA protein in laryngochrcinoma Hep-2 cells after recombinant plasmid transfected to laryngocarcinoma cells.
Lacks, Sanford A.; Balganesh, Tanjore S.
1988-01-01
Disclosed is recombinant plasmid pLS101, consisting essentially of a 2.0 Kb malM gene fragment ligated to a 4.4 Kb T.sub.c r DNA fragment, which is particularly useful for transforming Gram-positive bacteria. This plasmid contains at least four restriction sites suitable for inserting exogeneous gene sequences. Also disclosed is a method for plasmid isolation by penicillin selection, as well as processes for enrichment of recombinant plasmids in Gram-positive bacterial systems.
Jang, Moon-Sun; Fujita, Azusa; Ikawa, Satomi; Hanawa, Keitaro; Yamamura, Hideki; Tamura, Tomohiko; Hayakawa, Masayuki; Tezuka, Takeaki; Ohnishi, Yasuo
2015-01-01
To date, no plasmid vector has been developed for the rare actinomycete Actinoplanes missouriensis. Moreover, no small circular plasmid has been reported to exist in the genus Actinoplanes. Here, a novel plasmid, designated pCAZ1, was isolated from Couchioplanes caeruleus subsp. azureus via screening for small circular plasmids in Actinoplanes (57 strains) and Couchioplanes (2 strains). Nucleotide sequencing revealed that pCAZ1 is a 5845-bp circular molecule with a G + C content of 67.5%. The pCAZ1 copy number was estimated at 30 per chromosome. pCAZ1 contains seven putative open reading frames, one of which encodes a protein containing three motifs conserved among plasmid-encoded replication proteins that are involved in the rolling-circle mechanism of replication. Detection of single-stranded DNA intermediates in C. caeruleus confirmed that pCAZ1 replicates by this mechanism. The ColE1 origin from pBluescript SK(+) and the oriT sequence with the apramycin resistance gene aac(3)IV from pIJ773 were inserted together into pCAZ1, to construct the Escherichia coli-A. missouriensis shuttle vectors, pCAM1 and pCAM2, in which the foreign DNA fragment was inserted into pCAZ1 in opposite directions. pCAM1 and pCAM2 were successfully transferred to A. missouriensis through the E. coli-mediated conjugative transfer system. The copy numbers of pCAM1 and pCAM2 in A. missouriensis were estimated to be one and four per chromosome, respectively. Thus, these vectors can be used as effective genetic tools for homologous and heterologous gene expression studies in A. missouriensis. Copyright © 2014 Elsevier Inc. All rights reserved.
Protection from ischemic heart injury by a vigilant heme oxygenase-1 plasmid system.
Tang, Yao Liang; Tang, Yi; Zhang, Y Clare; Qian, Keping; Shen, Leping; Phillips, M Ian
2004-04-01
Although human heme oxygenase-1 (hHO-1) could provide a useful approach for cellular protection in the ischemic heart, constitutive overexpression of hHO-1 may lead to unwanted side effects. To avoid this, we designed a hypoxia-regulated hHO-1 gene therapy system that can be switched on and off. This vigilant plasmid system is composed of myosin light chain-2v promoter and a gene switch that is based on an oxygen-dependent degradation domain from the hypoxia inducible factor-1-alpha. The vector can sense ischemia and switch on the hHO-1 gene system, specifically in the heart. In an in vivo experiment, the vigilant hHO-1 plasmid or saline was injected intramyocardially into myocardial infarction mice or sham operation mice. After gene transfer, expression of hHO-1 was only detected in the ischemic heart treated with vigilant hHO-1 plasmids. Masson trichrome staining showed significantly fewer fibrotic areas in vigilant hHO-1 plasmids-treated mice compared with saline control (43.0%+/-4.8% versus 62.5%+/-3.3%, P<0.01). The reduction of interstitial fibrosis is accompanied by an increase in myocardial hHO-1 expression in peri-infarct border areas, concomitant with higher Bcl-2 levels and lower Bax, Bak, and caspase 3 levels in the ischemic myocardium compared with saline control. By use of a cardiac catheter, heart from vigilant hHO-1 plasmids-treated mice showed improved recovery of contractile and diastolic performance after myocardial infarction compared with saline control. This study documents the beneficial regulation and therapeutic potential of vigilant plasmid-mediated hHO-1 gene transfer. This novel gene transfer strategy can provide cardiac-specific protection from future repeated bouts of ischemic injury.
Hoggard, Timothy; Liachko, Ivan; Burt, Cassaundra; Meikle, Troy; Jiang, Katherine; Craciun, Gheorghe; Dunham, Maitreya J.; Fox, Catherine A.
2016-01-01
The ability of plasmids to propagate in Saccharomyces cerevisiae has been instrumental in defining eukaryotic chromosomal control elements. Stable propagation demands both plasmid replication, which requires a chromosomal replication origin (i.e., an ARS), and plasmid distribution to dividing cells, which requires either a chromosomal centromere for segregation or a plasmid-partitioning element. While our knowledge of yeast ARSs and centromeres is relatively advanced, we know less about chromosomal regions that can function as plasmid partitioning elements. The Rap1 protein-binding site (RAP1) present in transcriptional silencers and telomeres of budding yeast is a known plasmid-partitioning element that functions to anchor a plasmid to the inner nuclear membrane (INM), which in turn facilitates plasmid distribution to daughter cells. This Rap1-dependent INM-anchoring also has an important chromosomal role in higher-order chromosomal structures that enhance transcriptional silencing and telomere stability. Thus, plasmid partitioning can reflect fundamental features of chromosome structure and biology, yet a systematic screen for plasmid partitioning elements has not been reported. Here, we couple deep sequencing with competitive growth experiments of a plasmid library containing thousands of short ARS fragments to identify new plasmid partitioning elements. Competitive growth experiments were performed with libraries that differed only in terms of the presence or absence of a centromere. Comparisons of the behavior of ARS fragments in the two experiments allowed us to identify sequences that were likely to drive plasmid partitioning. In addition to the silencer RAP1 site, we identified 74 new putative plasmid-partitioning motifs predicted to act as binding sites for DNA binding proteins enriched for roles in negative regulation of gene expression and G2/M-phase associated biology. These data expand our knowledge of chromosomal elements that may function in plasmid partitioning and suggest underlying biological roles shared by such elements. PMID:26865697
Larsen, Rachel A.; Cusumano, Christina; Fujioka, Akina; Lim-Fong, Grace; Patterson, Paula; Pogliano, Joe
2007-01-01
Prokaryotes rely on a distant tubulin homolog, FtsZ, for assembling the cytokinetic ring essential for cell division, but are otherwise generally thought to lack tubulin-like polymers that participate in processes such as DNA segregation. Here we characterize a protein (TubZ) from the Bacillus thuringiensis virulence plasmid pBtoxis, which is a member of the tubulin/FtsZ GTPase superfamily but is only distantly related to both FtsZ and tubulin. TubZ assembles dynamic, linear polymers that exhibit directional polymerization with plus and minus ends, movement by treadmilling, and a critical concentration for assembly. A point mutation (D269A) that alters a highly conserved catalytic residue within the T7 loop completely eliminates treadmilling and allows the formation of stable polymers at a much lower protein concentration than the wild-type protein. When expressed in trans, TubZ(D269A) coassembles with wild-type TubZ and significantly reduces the stability of pBtoxis, demonstrating a direct correlation between TubZ dynamics and plasmid maintenance. The tubZ gene is in an operon with tubR, which encodes a putative DNA-binding protein that regulates TubZ levels. Our results suggest that TubZ is representative of a novel class of prokaryotic cytoskeletal proteins important for plasmid stability that diverged long ago from the ancient tubulin/FtsZ ancestor. PMID:17510284
Duguay, Brett A; Huang, Kate Wei-Chen; Kulka, Marianna
2018-04-18
Mast cells are important immune cells that have significant roles in mediating allergy and asthma. Therefore, studying the molecular mechanisms regulating these and other processes in mast cells is important to elucidate. Methods such as lipofection, transduction, and electroporation are often employed to dissect these mechanisms by disrupting gene expression in mast cell lines. However, as with other leukocytes, human mast cells (HMCs) are often refractory to the delivery of plasmids by lipofection. In this study, we investigated the utility of lipid nanoparticles (LNPs) containing the ionizable cationic lipids 1,2-dioleoyloxy-3-dimethylaminopropane, 1,2-dioleyloxy-3-dimethylaminopropane, or 2,2-dilinoleyl-4-(2-dimethylaminoethyl)-[1,3]-dioxolane for the delivery of plasmid DNA into HMC lines. Herein, we demonstrate for the first time the use of LNPs to achieve significant and reproducible levels of plasmid DNA transfection in HMC-1.2 and laboratory of allergic diseases 2 (LAD2) cells. These levels reached 53.2% and 16.0% in HMC-1.2 and LAD2 cells, respectively; and outperformed Lipofectamine 3000 in both cases. Moreover, cell viability in the transfected cells remained above 65% for all LNP conditions tested. Together, these observations illustrate the efficacy of this technique for mast cell researchers and further support the use of LNPs for nucleic acid delivery into leukocytes. ©2018 Society for Leukocyte Biology.
Roles of Long and Short Replication Initiation Proteins in the Fate of IncP-1 Plasmids
Yano, Hirokazu; Deckert, Gail E.; Rogers, Linda M.
2012-01-01
Broad-host-range IncP-1 plasmids generally encode two replication initiation proteins, TrfA1 and TrfA2. TrfA2 is produced from an internal translational start site within trfA1. While TrfA1 was previously shown to be essential for replication in Pseudomonas aeruginosa, its role in other bacteria within its broad host range has not been established. To address the role of TrfA1 and TrfA2 in other hosts, efficiency of transformation, plasmid copy number (PCN), and plasmid stability were first compared between a mini-IncP-1β plasmid and its trfA1 frameshift variant in four phylogenetically distant hosts: Escherichia coli, Pseudomonas putida, Sphingobium japonicum, and Cupriavidus necator. TrfA2 was sufficient for replication in these hosts, but the presence of TrfA1 enhanced transformation efficiency and PCN. However, TrfA1 did not contribute to, and even negatively affected, long-term plasmid persistence. When trfA genes were cloned under a constitutive promoter in the chromosomes of the four hosts, strains expressing either both TrfA1 and TrfA2 or TrfA1 alone, again, generally elicited a higher PCN of an IncP1-β replicon than strains expressing TrfA2 alone. When a single species of TrfA was produced at different concentrations in E. coli cells, TrfA1 maintained a 3- to 4-fold higher PCN than TrfA2 at the same TrfA concentrations, indicating that replication mediated by TrfA1 is more efficient than that by TrfA2. These results suggest that the broad-host-range properties of IncP-1 plasmids are essentially conferred by TrfA2 and the intact replication origin alone but that TrfA1 is nonetheless important to efficiently establish plasmid replication upon transfer into a broad range of hosts. PMID:22228734
Luo, Shun-Tao; Tian, Wen-Hong; Wang, Gang; Dong, Xiao-Yan; Yang, Li; Wu, Xiao-Bing
2009-11-01
GLuc (Gaussia luciferase) is a secreted luciferase with high sensitivity. In this study, we primarily compared expression character of PTTR with that of PCMV, relied on easy secretion, high sensitivity and simple and fast detection of GLuc. We firstly constructed two plasmids pAAV2-neo-TTR-GLuc and pAAV2-neo-CMV-GLuc. Then, 4 cell lines were transfected with the two plasmids in aid of Lipofectamine 2000, including Huh7 and HepG2, which are derived from liver cells, as well as HEK293 and HeLaS3 cells, which are non-liver cell lines. We monitored the expression of GLuc in the supernatant of these cell cultures at different time points post-transfection. Furthermore, we injected the two plasmids with different doses into BALB/c mice by the means of hydrodynamic delivery and monitored the GLuc expression in vivo with 2.5 microl tail tip blood since 2 h post-injection. The cell assay results suggested that the expression of GLuc driven by CMV promoter was significantly higher than that of GLuc driven by TTR promoter. And, the luciferase activity of GLuc driven by CMV promoter was 50-300 times higher than that of GLuc driven by TTR promoter in HEK293 and HeLaS3 cell lines, but less than 10 times higher than that of GLuc driven by TTR promoter in the HepG2 and Huh7 cell lines, indicating the relative liver-specificity of TTR promoter. In the animal assay, the higher luciferase activity was determined in CMV promoter group than in TTR promoter group at different doses of the two plasmids. But the expression patterns for the two promoters differed obviously. The expression of GLuc driven by CMV promoter reached the maximum 10 hours post-injection and declined rapidly; while the expression of GLuc driven by TTR promoter reached the maximum 48 hours after delivery, and declined very slowly. These results implied that PTTR could keep expression of driven gene in a long time although its expression intensity is lower than PCMV's. Thus, it is more suitable for maintaining longer expression of target genes in liver.
Lacks, S.A.; Balganesh, T.S.
1985-02-19
Disclosed is recombinant plasmid pLS101, consisting essentially of a 2.0 Kb ma1M gene fragment ligated to a 4.4 Kb Tcr DNA fragment, which is particularly useful for transforming Gram-positive bacteria. This plasmid contains at least four restriction sites suitable for inserting exogeneous gene sequences. Also disclosed is a method for plasmid isolation by penicillin selection, as well as processes for enrichment of recombinant plasmids in Gram-positive bacterial systems. 5 figs., 2 tabs.
Study of the Regulation of Telomere Replication by Characterizing the Cdc-13p Pathway in Yeast
2001-01-01
lev- 2.0 els of interaction or protein expression. (C) XhoI di- gested DNA from wild-type strain or cdc13A strains carrying a centromere plasmid with...expressed from 5). HA-Cdcl3-lp (Fig. 7, lane 2) and HA-Cdcl3-2p (Fig. 7, the centromere plasmid pKT/EST1 (Mitchell et al. 1993) lane 3) also interacted...sup- telomerase-mediated telomere lengthening. For the plants the need for Estip in telomere maintenance POLl mutations, this TLCl-dependent length
2008-06-01
verified the insertion of the genes in our expression plasmids and in our lentivirus vectors. Transduction/selection of the 293T with mutated E2F... mutation created in this gene is located in the PEA targeted region of EF-2, it prevents the interaction of these 2 proteins and thus the cell death...We have cloned this mutated elongation factor in an expression vector and in a lentivirus plasmid also encoding a marker gene . The mEF-2-lentivirus
Huang, Yuping; Wang, Yajun; Zeng, Baosheng; Liu, Zhaoxia; Xu, Xuejiao; Meng, Qian; Huang, Yongping; Yang, Guang; Vasseur, Liette; Gurr, Geoff M; You, Minsheng
2017-10-01
RNA polymerase type III (Pol-III) promoters such as U6 are commonly used to express small RNAs, including short hairpin RNAs (shRNAs) and single guide RNAs (sgRNAs). Functional U6 promoters are widely used in CRISPR systems, and their characterization can facilitate genome editing of non-model organisms. In the present study, six U6 small nuclear RNA (snRNA) promoters containing two conserved elements of a proximal sequence element (PSEA) and a TATA box, were identified and characterized in the diamondback moth (Plutella xylostella) genome. Relative efficiency of the U6 promoters to express shRNA induced EGFP knockdown was tested in a P. xylostella cell line, revealing that the PxU6:3 promoter had the strongest expression effect. Further work with the PxU6:3 promoter showed its efficacy in EGFP knockout using CRISPR/Cas9 system in the cells. The expression plasmids with versatile Pxabd-A gene specific sgRNA driven by the PxU6:3 promoter, combined with Cas9 mRNA, could induce mutagenesis at specific genomic loci in vivo. The phenotypes induced by sgRNA expression plasmids were similar to those done in vitro transcription sgRNAs. A plasmid with two tandem arranged PxU6:3:sgRNA expression cassettes targeting Pxabd-A loci was generated, which caused a 28,856 bp fragment deletion, suggesting that the multi-sgRNA expression plasmid can be used for multi-targeting. Our work indicates that U6 snRNA promoters can be used for functional studies of genes with the approach of reverse genetics in P. xylostella. These essential promoters also provide valuable potential for CRISPR-derived gene drive as a tactic for population control in this globally significant pest. Copyright © 2017 Elsevier Ltd. All rights reserved.
A gene expression system offering multiple levels of regulation: the Dual Drug Control (DDC) system.
Sudomoina, Marina; Latypova, Ekaterina; Favorova, Olga O; Golemis, Erica A; Serebriiskii, Ilya G
2004-04-29
Whether for cell culture studies of protein function, construction of mouse models to enable in vivo analysis of disease epidemiology, or ultimately gene therapy of human diseases, a critical enabling step is the ability to achieve finely controlled regulation of gene expression. Previous efforts to achieve this goal have explored inducible drug regulation of gene expression, and construction of synthetic promoters based on two-hybrid paradigms, among others. In this report, we describe the combination of dimerizer-regulated two-hybrid and tetracycline regulatory elements in an ordered cascade, placing expression of endpoint reporters under the control of two distinct drugs. In this Dual Drug Control (DDC) system, a first plasmid expresses fusion proteins to DBD and AD, which interact only in the presence of a small molecule dimerizer; a second plasmid encodes a cassette transcriptionally responsive to the first DBD, directing expression of the Tet-OFF protein; and a third plasmid encodes a reporter gene transcriptionally responsive to binding by Tet-OFF. We evaluate the dynamic range and specificity of this system in comparison to other available systems. This study demonstrates the feasibility of combining two discrete drug-regulated expression systems in a temporally sequential cascade, without loss of dynamic range of signal induction. The efficient layering of control levels allowed by this combination of elements provides the potential for the generation of complex control circuitry that may advance ability to regulate gene expression in vivo.
Li, Dao-kun; Bao, Lang; Zhang, Ying; Sun, Zhan
2010-03-01
To study the immunity of Loa22 from Leptospira interrogans serovar Lai strain 56601 by expressing its protein in BCG. Amplified the mature peptide of Loa22 gene from the genome of of Leptospira interrogans serovar Lai strain 56601 and constructed recombinant plasmid rpMV36l-1oa22 with the E. coli-BCG integrating shuttle plasmid pMV361 and the Loa22 mature peptide gene. The rpMV36l-1oa22 plasmid was transformed into BCG by electroporation. The rBCG bearing rpMV36l-1oa22 was induced by high temperature of 45 degrees C and expressed protein was identified by SDS-PAGE and Western Blotting. Fifth 6-week-old BALB/c mice were randomly divided into five groups, which were inoculated intraperitoneally two times at 0-day and 21-day with BCG, rBCG-pMV361, rI3CG-1oa22, Loa22 and killed whole-leptospires respectively. All animals were dislocated from cervical vertebra on the 14Ih day after the last immunization. The proliferative reaction of splenic lymphocyte in tuitro were tested by XTT. The rpMV36l-1oa22 plasmid was constructed successfully and transformed into BCG. The rBCG expressed a 19 X io specifical protein identified by SDS-PAGE and Western Blotting. The splenic lymphocyte proliferate activity (SI) in rBCG-ioa22 group in intro was significantly higher than those in BCG group and rBCG-pMV361 group. We explored the expressing feasibility of Loa22 in Mycobacterium bovis BCG. may therefore make further researches on the induction of protective immunity against human and animal leptospirosis.
Woods, J P; Heinecke, E L; Goldman, W E
1998-04-01
We developed an efficient electrotransformation system for the pathogenic fungus Histoplasma capsulatum and used it to examine the effects of features of the transforming DNA on transformation efficiency and fate of the transforming DNA and to demonstrate fungal expression of two recombinant Escherichia coli genes, hph and lacZ. Linearized DNA and plasmids containing Histoplasma telomeric sequences showed the greatest transformation efficiencies, while the plasmid vector had no significant effect, nor did the derivation of the selectable URA5 marker (native Histoplasma gene or a heterologous Podospora anserina gene). Electrotransformation resulted in more frequent multimerization, other modification, or possibly chromosomal integration of transforming telomeric plasmids when saturating amounts of DNA were used, but this effect was not observed with smaller amounts of transforming DNA. We developed another selection system using a hygromycin B resistance marker from plasmid pAN7-1, consisting of the E. coli hph gene flanked by Aspergillus nidulans promoter and terminator sequences. Much of the heterologous fungal sequences could be removed without compromising function in H. capsulatum, allowing construction of a substantially smaller effective marker fragment. Transformation efficiency increased when nonselective conditions were maintained for a time after electrotransformation before selection with the protein synthesis inhibitor hygromycin B was imposed. Finally, we constructed a readily detectable and quantifiable reporter gene by fusing Histoplasma URA5 with E. coli lacZ, resulting in expression of functional beta-galactosidase in H. capsulatum. Demonstration of expression of bacterial genes as effective selectable markers and reporters, together with a highly efficient electrotransformation system, provide valuable approaches for molecular genetic analysis and manipulation of H. capsulatum, which have proven useful for examination of targeted gene disruption, regulated gene expression, and potential virulence determinants in this fungus.
Gay, Glen; Wagner, Drew T.; Keatinge-Clay, Adrian T.; Gay, Darren C.
2014-01-01
The ability to rapidly customize an expression vector of choice is a valuable tool for any researcher involved in high-throughput molecular cloning for protein overexpression. Unfortunately, it is common practice to amend or neglect protein targets if the gene that encodes the protein of interest is incompatible with the multiple-cloning region of a preferred expression vector. To address this issue, a method was developed to quickly exchange the multiple-cloning region of the popular expression plasmid pET-28 with a ligation-independent cloning cassette, generating pGAY-28. This cassette contains dual inverted restriction sites that reduce false positive clones by generating a linearized plasmid incapable of self-annealing after a single restriction-enzyme digest. We also establish that progressively cooling the vector and insert leads to a significant increase in ligation-independent transformation efficiency, demonstrated by the incorporation of a 10.3 kb insert into the vector. The method reported to accomplish plasmid reconstruction is uniquely versatile yet simple, relying on the strategic placement of primers combined with homologous recombination of PCR products in yeast. PMID:25304917
Lim, C K; Smith, M C; Petty, J; Baumberg, S; Wootton, J C
1989-12-01
The aphD gene of Streptomyces griseus, encoding a streptomycin 6-phosphotransferase (SPH), was sub-cloned in the pBR322-based expression vector pRK9 (which contains the Serratia marcescens trp promoter) with selection for expression of streptomycin resistance in Escherichia coli. Two hybrid plasmids, pCKL631 and pCKL711, were isolated which conferred resistance. Both contained a approximately 2 kbp fragment already suspected to include aphD. The properties of in vitro deletion derivatives of these plasmids were consistent with the presumed location of aphD. In vitro deletion of a sequence including most of the trp promoter largely, but not quite completely, abolished the ability of the plasmid to confer streptomycin resistance, confirming that expression was indeed principally from the trp promoter. A polypeptide of approximately 34.5 kDa was present in minicells containing plasmids that conferred streptomycin resistance, but was absent when the plasmids contained in vitro deletions removing streptomycin resistance. Part of the fragment was sequenced and an open reading frame corresponding to aphD identified. A computer-assisted comparison of the deduced SPH sequence with those of other antibiotic phosphotransferases suggested a common structure A-B-C-D-E, where B and D were conserved between all sequences compared while A, C and E divided between the streptomycin and hygromycin B phosphotransferases on one hand and kanamycin/neomycin ones on the other. A composite sequence data base was searched for homologues to consensus matrices constructed from five approximately 12-residue subsequences within blocks B and D. For one subsequence, corresponding to the N-terminal portion of block D, those sequences from the database that yielded the highest homology scores comprised almost entirely either antibiotic phosphotransferases or eukaryotic protein kinases. Possible evolutionary implications of this homology, previously described by other groups, are discussed.
Application of methylation in improving plasmid transformation into Helicobacter pylori.
Zhao, Huilin; Xu, Linlin; Rong, Qianyu; Xu, Zheng; Ding, Yunfei; Zhang, Ying; Wu, Yulong; Li, Boqing; Ji, Xiaofei
2018-05-23
Helicobacter pylori is an important gastrointestinal pathogen. Its strains possess different levels of powerful restriction modification systems, which are significant barriers to genetic tools used for studying the role of functional genes in its pathogenesis. Methylating vectors in vitro was reported as an alternative to overcome this barrier in several bacteria. In this study we used two H. pylori-E. coli shuttle plasmids and several single/double-crossover homologous recombination gene-targeting plasmids, to test the role of methylation in H. pylori transformation. According to our results, transformants could be obtained only after shuttle plasmids were methylated before transformation. It is helpful in gene complementation and over-expression although at a low frequency. The frequency of gene-targeting transformation was also increased after methylation, especially for the single-crossover recombination plasmids, the transformants of which could only be obtained after methylation. For the double-crossover recombination targeting plasmids, the initial yield of transformants was 0.3-0.8 × 10 2 CFUs per microgram plasmid DNA. With the help of methylation, the yield was increased to 0.4-1.3 × 10 2 CFUs per microgram plasmid DNA. These results suggest that in vitro methylation can improve H. pylori transformation by different plasmids, which will benefit the pathogenic mechanism research. Copyright © 2018. Published by Elsevier B.V.
Yang, Xian-Xian; Zhang, Mei; Yan, Zhao-Wen; Zhang, Ru-Hong; Mu, Xiong-Zheng
2008-01-01
To construct a high effective eukaryotic expressing plasmid PcDNA 3.1-MSX-2 encoding Sprague-Dawley rat MSX-2 gene for the further study of MSX-2 gene function. The full length SD rat MSX-2 gene was amplified by PCR, and the full length DNA was inserted in the PMD1 8-T vector. It was isolated by restriction enzyme digest with BamHI and Xhol, then ligated into the cloning site of the PcDNA3.1 expression plasmid. The positive recombinant was identified by PCR analysis, restriction endonudease analysis and sequence analysis. Expression of RNA and protein was detected by RT-PCR and Western blot analysis in PcDNA3.1-MSX-2 transfected HEK293 cells. Sequence analysis and restriction endonudease analysis of PcDNA3.1-MSX-2 demonstrated that the position and size of MSX-2 cDNA insertion were consistent with the design. RT-PCR and Western blot analysis showed specific expression of mRNA and protein of MSX-2 in the transfected HEK293 cells. The high effective eukaryotic expression plasmid PcDNA3.1-MSX-2 encoding Sprague-Dawley Rat MSX-2 gene which is related to craniofacial development can be successfully reconstructed. It may serve as the basis for the further study of MSX-2 gene function.
Liu, Xiangmei; Lin, Jianqun; Zhang, Zheng; Bian, Jiang; Zhao, Qing; Liu, Ying; Lin, Jianqiang; Yan, Wangming
2007-01-01
A genetic transfer system for introducing foreign genes to biomining microorganisms is urgently needed. Thus, a conjugative gene transfer system was investigated for a moderately thermophilic, extremely acidophilic biomining bacterium, Acidithiobacillus caldus MTH-04. The broad-host-range IncP plasmids RP4 and R68.45 were transferred directly into A. caldus MTH-04 from Escherichia coli by conjugation at relatively high frequencies. Additionally the broad-host-range IncQ plasmids pJRD215, pVLT33, and pVLT35 were also transferred into A. caldus MTH-04 with the help of plasmid RP4 or strains with plasmid RP4 integrated into their chromosome, such as E. coli SM10. The Km(r) and Sm(r) selectable markers from these plasmids were successfully expressed in A. caldus MTH-04. Futhermore, the IncP and IncQ plasmids were transferred back into E. coli cells from A. caldus MTH-04, thereby confirming the initial transfer of these plasmids from E. coli to A. caldus MTH-04. All the IncP and IncQ plasmids studied were stable in A. caldus MTH-04. Consequently, this development of a conjugational system for A. caldus MTH-04 will greatly facilitate its genetic study.
Melnikov, Olga; Zaritsky, Arieh; Zarka, Aliza; Boussiba, Sammy; Malchin, Natalia; Yagil, Ezra; Kolot, Mikhail
2009-07-01
The integrase (Int) of the lambda-like coliphage HK022 catalyzes the site-specific integration and excision of the phage DNA into and from the chromosome of its host, Escherichia coli. Int recognizes two different pairs of recombining sites attP x attB and attL x attR for integration and excision, respectively. This system was adapted to the cyanobacterium Anabaena sp. strain PCC 7120 as a potential tool for site-specific gene manipulations in the cyanobacterium. Two plasmids were consecutively cointroduced by conjugation into Anabaena cells, one plasmid that expresses HK022 Int recombinase and the other plasmid that carries the excision substrate P(glnA)-attL-T1/T2-attR-lacZ, where T1/T2 are the strong transcription terminators of rrnB, to prevent expression of the lacZ reporter under the constitutive promoter P(glnA). The Int-catalyzed site-specific recombination reaction was monitored by the expression of lacZ emanating as a result of T1/T2 excision. Int catalyzed the site-specific excision reaction in Anabaena cells when its substrate was located either on the plasmid or on the chromosome with no need to supply an accessory protein, such as integration host factor and excisionase (Xis), which are indispensable for this reaction in its host, E. coli.
Zhang, Xi; Si, Ying-Jian; Chen, Xing-Hua; Liu, Yao; Gao, Li; Gao, Lei; Peng, Xian-Gui; Wang, Qing-Yu
2008-06-01
This study was aimed to investigate the effect of vcam-1 gene-modified human umbilical cord blood derived stromal cells (CBDSCs) on hematopoietic regulation so as to establish the experimental foundation for further study. The target gene vcam-1 was cloned into the shuttle plasmid with the report gene GFP. The recombinant shuttle plasmid was transformed into BJ5183 bacteria to recombine with backbone vector pAdeasy-l, and the recombinant adenoviral vector ad-vcam-1-gfp was confirmed after transfection with CBDSCs. The results indicated that two fragments of about 9 kb and 2 kb were obtained after digestion of recombinant plasmid pAdTrack-vcam-1 with NotIand XhoI, and single fragment of 600 bp was obtained after amplification with PCR; two fragments of about 31 kb and 4 kb were obtained after digestion of recombinant plasmid pad-vcam-1-gfp with PacI, which suggested a successful homologous recombination. The expression of vcam-1 gene in ad-vcam-1-gfp transfected CBDSCs could be detected by immunocytochemistry, RT-PCR and fluorescent microscopy. It is concluded that the recombinant adenoviral vector ad-vcam-1-gfp has been constructed successfully, and the expression of vcam-1 is up-regulated in CBDSCs transfected by gene ad-vcam-1-gfp.
Tong, Yan Qing; Xin, Bing; Zhu, Li
2014-01-01
Background: Plasmid transfer among bacteria provides a means for dissemination of resistance. Plasmid Analysis has made it possible to track plasmids that induce resistance in bacterial population. Objectives: To screen the presence of herb-resistance plasmid in Escherichia coli strains and determine the transferability of this resistance plasmid directly from E. coli to the Gram-positive, Staphylococcus aureus. Materials and Methods: The donor strain E. coli CP9 and recipient strain S. aureus RN450RF were isolated from UTI patients. E. coli CP9 was highly resistant to herbal concoction. Isolates of S. aureus RN450RF were fully susceptible. Total plasmid DNA was prepared and transferred into E. coli DH5α. Transconjugants were selected on agar plates containing serial dilutions of herbal concoction. Resistance plasmid was transferred to susceptible S. aureus RN450RFin triple replicas. The mating experiments were repeated twice. Results: The identified 45 kb herb-resistance plasmid could be transferred from E. coli CP9 isolates to E. coli DH5α. As a consequence E. coli DH5α transconjugant MIC increased from 0.0125 g/mL to 0.25 g/mL. The plasmid was easily transferred from E. coli CP9 strain to S. aureus RN450RF with a mean transfer rate of 1×10-2 transconjugants/recipient. The E. coli donor and the S. aureus RN450RF transconjugant contained a plasmid of the same size, which was absent in the recipient before mating. Susceptibility testing showed that the S. aureus RN450RF transconjugant was resistant to herbal concoction. Conclusions: E. coli herb-resistance plasmid can replicate and be expressed in S. aureus. PMID:25147679
Malpartida, F; Zalacaín, M; Jiménez, A; Davies, J
1983-11-30
The gene encoding the phosphotransferase enzyme that modifies hygromycin B in its producing organism Streptomyces hygroscopicus, has been cloned in the Streptomyces vector pIJ41. Two plasmids, pFM4 and pFM6, containing 2.1 and 19.6 kb inserts of Streptomyces hygroscopicus DNA, respectively, which express the modifying enzyme, have been isolated. A 3.1 kb PstI restriction fragment from pFM4 was inserted in the Streptomyces vector pIJ350 and the resulting plasmids, pMZ11.1 and pMZ11.2, express the hygromycin B-resistance phenotype. The utility of this dominant marker for cloning experiments is discussed in the text.
Eye drop delivery of nano-polymeric micelle formulated genes with cornea-specific promoters.
Tong, Yaw-Chong; Chang, Shwu-Fen; Liu, Chia-Yang; Kao, Winston W-Y; Huang, Chong Heng; Liaw, Jiahorng
2007-11-01
This study evaluates the eye drop delivery of genes with cornea-specific promoters, i.e., keratin 12 (K12) and keratocan (Kera3.2) promoters, by non-ionic poly(ethylene oxide)-poly(propylene oxide)-poly(ethylene oxide) (PEO-PPO-PEO) polymeric micelles (PM) to mouse and rabbit eyes, and investigates the underlying mechanisms. Three PM-formulated plasmids (pCMV-Lac Z, pK12-Lac Z and pKera3.2-Lac Z) containing the Lac Z gene for beta-galactosidase (beta-Gal) whose expression was driven by the promoter of either the cytomegalovirus early gene, the keratin 12 gene or the keratocan gene, were characterized by critical micelle concentration (CMC), dynamic light scattering (DLS), and atomic force microscopy (AFM). Transgene expression in ocular tissue after gene delivery was analyzed by 5-bromo-4-chloro-3-indolyl-beta-D-galactoside (X-Gal) color staining, 1,2-dioxetane beta-Gal enzymatic activity measurement, and real-time polymerase chain reaction (PCR) analysis. The delivery mechanisms of plasmid-PM on mouse and rabbit corneas were evaluated by EDTA and RGD (arginine-glycine-aspartic acid) peptide. The sizes of the three plasmid-PM complexes were around 150-200 nm with unimodal distribution. Enhanced stability was found for three plasmid-PM formulations after DNase I treatment. After six doses of eye drop delivery of pK12-Lac Z-PM three times a day, beta-Gal activity was significantly increased in both mouse and rabbit corneas. Stroma-specific Lac Z expression was only found in pKera3.2-Lac Z-PM-treated animals with pretreatment by 5 mM EDTA, an opener of junctions. Lac Z gene expression in both pK12-Lac Z-PM and pKera3.2-Lac Z-PM delivery groups was decreased by RGD peptide pretreatment. Cornea epithelium- and stroma-specific gene expression could be achieved using cornea-specific promoters of keratin 12 and keratocan genes, and the gene was delivered with PM formulation through non-invasive, eye drop in mice and rabbits. The transfection mechanism of plasmid-PM may involve endocytosis and particle size dependent paracellular transport. 2007 John Wiley & Sons, Ltd
Characterization of the aes gene of Escherichia coli encoding an enzyme with esterase activity.
Peist, R; Koch, A; Bolek, P; Sewitz, S; Kolbus, T; Boos, W
1997-01-01
malQ mutants of Escherichia coli lacking amylomaltase cannot grow on maltose. They express the maltose system constitutively and are sensitive to maltose when grown on another carbon source. In an attempt to isolate a multicopy suppressor that would result in growth on maltose, we transformed a malQ mutant with a gene bank of E. coli DNA which had been digested with Sau3a and cloned in pBR322. We screened the transformants on MacConkey maltose plates. A colony was isolated that appeared to be resistant to maltose and was pink on these plates, but it was still unable to grow on minimal medium with maltose as the carbon source. The plasmid was isolated, and the gene causing this phenotype was characterized. The deduced amino acid sequence of the encoded protein shows homology to that of lipases and esterases. We termed the gene aes, for acetyl esterase. Extracts of cells harboring plasmid-encoded aes under its own promoter exhibit a fivefold higher capacity to hydrolyze p-nitrophenyl acetate than do extracts of cells of plasmid-free strains. Similarly, strains harboring plasmid-encoded aes are able to grow on triacetyl glycerol (triacetin) whereas the plasmid-free strains are not. The expression of plasmid-encoded aes resulted in strong repression of the maltose transport genes in malT+ strains (10-fold reduction), but not in a malT(Con) strain which is independent of the inducer. Also, overproduction of MalT counteracted the Aes-dependent repression, indicating a direct interaction between MalT and Aes. PMID:9401025
Nunes, Catherine; Sousa, Angela; Nunes, José C; Morão, António M; Sousa, Fani; Queiroz, João A
2014-06-01
The present study describes the integration of membrane technology with monolithic chromatography to obtain plasmid DNA with high quality. Isolation and clarification of plasmid DNA lysate were first conducted by a microfiltration step, by using a hydrophilic nylon microfiltration membrane, avoiding the need of centrifugation. For the total elimination of the remaining impurities, a suitable purification step is required. Monolithic stationary phases have been successfully applied as an alternative to conventional supports. Thus, the sample recovered from the membrane process was applied into a nongrafted CarbonylDiImidazole disk. Throughout the global procedure, a reduced level of impurities such as proteins and RNA was obtained, and no genomic DNA was detectable in the plasmid DNA sample. The chromatographic process demonstrated an efficient performance on supercoiled plasmid DNA purity and recovery (100 and 84.44%, respectively). Thereby, combining the membrane technology to eliminate some impurities from lysate sample with an efficient chromatographic strategy to purify the supercoiled plasmid DNA arises as a powerful approach for industrial-scale systems aiming at plasmid DNA purification. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Sam, Mohammad Reza; Azadbakhsh, Azadeh Sadat; Farokhi, Farrah; Rezazadeh, Kobra; Sam, Sohrab; Zomorodipour, Alireza; Haddad-Mashadrizeh, Aliakbar; Delirezh, Nowruz; Mokarizadeh, Aram
2016-05-01
Ex-vivo gene therapy of hemophilias requires suitable bioreactors for secretion of hFIX into the circulation and stem cells hold great potentials in this regard. Viral vectors are widely manipulated and used to transfer hFIX gene into stem cells. However, little attention has been paid to the manipulation of hFIX transgene itself. Concurrently, the efficacy of such a therapeutic approach depends on determination of which vectors give maximal transgene expression. With this in mind, TF-1 (primary hematopoietic lineage) and rat-bone marrow mesenchymal stem cells (BMSCs) were transfected with five hFIX-expressing plasmids containing different combinations of two human β-globin (hBG) introns inside the hFIX-cDNA and Kozak element and hFIX expression was evaluated by different methods. In BMSCs and TF-1 cells, the highest hFIX level was obtained from the intron-less and hBG intron-I,II containing plasmids respectively. The highest hFIX activity was obtained from the cells that carrying the hBG intron-I,II containing plasmids. BMSCs were able to produce higher hFIX by 1.4 to 4.7-fold increase with activity by 2.4 to 4.4-fold increase compared to TF-1 cells transfected with the same constructs. BMSCs and TF-1 cells could be effectively bioengineered without the use of viral vectors and hFIX minigene containing hBG introns could represent a particular interest in stem cell-based gene therapy of hemophilias. Copyright © 2016 International Alliance for Biological Standardization. Published by Elsevier Ltd. All rights reserved.
Zhan, Sien; Li, Jinming; Xu, Ruihuan; Wang, Lunan; Zhang, Kuo; Zhang, Rui
2009-01-01
The branched DNA (bDNA) assay is a reliable method for quantifying the RNA of human immunodeficiency virus type 1 (HIV-1). The positive controls and standards for this assay for the detection of HIV-1 consist of naked RNA, which is susceptible to degradation by RNase. Armored RNA is a good candidate for an RNase-resistant positive control or standard. However, its use has been limited by the maximal length of the exogenous RNA packaged into virus-like particles by routine armored RNA technology. In the present study, we produced armored long RNA (armored L-RNA) controls or standards (AR-HIV-pol-3034b) for a bDNA assay of HIV-1 by increasing the amount and affinity of the pac sites (the pac site is a specific 19-nucleotide stem-loop region located at the 5′ terminus of the MS2 bacteriophage replicase gene) by a one-plasmid double-expression system. AR-HIV-pol-3034b was completely resistant to DNase and RNase, was stable in normal human EDTA-preserved plasma at 4°C for at least 6 months, and produced reproducible, linear results in the Versant HIV-1 RNA 3.0 assay. In conclusion, AR-HIV-pol-3034b could act as a positive control or standard in a bDNA assay for the detection of HIV-1. In addition, the one-plasmid double-expression system can be used as a better platform than the one-plasmid expression system and the two-plasmid coexpression system for expressing armored L-RNA. PMID:19494069
Zhan, Sien; Li, Jinming; Xu, Ruihuan; Wang, Lunan; Zhang, Kuo; Zhang, Rui
2009-08-01
The branched DNA (bDNA) assay is a reliable method for quantifying the RNA of human immunodeficiency virus type 1 (HIV-1). The positive controls and standards for this assay for the detection of HIV-1 consist of naked RNA, which is susceptible to degradation by RNase. Armored RNA is a good candidate for an RNase-resistant positive control or standard. However, its use has been limited by the maximal length of the exogenous RNA packaged into virus-like particles by routine armored RNA technology. In the present study, we produced armored long RNA (armored L-RNA) controls or standards (AR-HIV-pol-3034b) for a bDNA assay of HIV-1 by increasing the amount and affinity of the pac sites (the pac site is a specific 19-nucleotide stem-loop region located at the 5' terminus of the MS2 bacteriophage replicase gene) by a one-plasmid double-expression system. AR-HIV-pol-3034b was completely resistant to DNase and RNase, was stable in normal human EDTA-preserved plasma at 4 degrees C for at least 6 months, and produced reproducible, linear results in the Versant HIV-1 RNA 3.0 assay. In conclusion, AR-HIV-pol-3034b could act as a positive control or standard in a bDNA assay for the detection of HIV-1. In addition, the one-plasmid double-expression system can be used as a better platform than the one-plasmid expression system and the two-plasmid coexpression system for expressing armored L-RNA.
Zhang, Kao; Jin, Huijun; Zhong, Fei; Li, Xiujin; Neng, Changai; Chen, Huihui; Li, Wenyan; Wen, Jiexia
2012-11-04
To construct recombinant adenovirus containing canine interferon-gamma (cIFN-gamma) gene and to investigate its antiviral activity against canine parvovirus in Madin-Darby canine kidney cells (MDCK). [Methods] The cIFN-gamma gene was inserted into adenovirus shuttle plasmid to construct pShuttle3-cIFN-gamma expression vector, from which the cIFN-gamma expression cassette was transferred into the adenovirus genomic plasmid pAdeno-X by specific restriction sites to generate recombinant adenovirus genomic plasmid pAd-cIFN-gamma. The pAd-cIFN-gamma plasmid was linearized by digestion and transfected into human embryonic kidney (HEK) 293T cells to generate the replication-defective cIFN-gamma recombinant adenovirus (Ad-cIFN-gamma). To analyze its anti-canine parvovirus activity, the MDCK cells were pre-infected by Ad-cIFN-gamma recombinant adenovirus, and then infected by canine parvovirus. The antiviral activity of the Ad-cIFN-gamma recombinant adenovirus against parvovirus was analyzed. The recombinant adenovirus containing cIFN-gamma gene was constructed by the ligation method. The recombinant adenovirus could mediates recombinant cIFN-gamma secretory expression in MDCK cells. The Ad-cIFN-gamma recombinant adenovirus could significantly inhibit canine parvovirus replication in MDCK cells pre-infected with the recombinant adenovirus. These results indicate that the Ad-cIFN-gamma recombinant adenovirus has the potent antiviral activity against canine parvovirus. The Ad-cIFN-gamma recombinant adenovirus was successfully constructed by the ligation method and possessed a powerful antiviral activity against canine parvovirus.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Funabashi, Hisakage; Takatsu, Makoto; Saito, Mikako
2010-10-01
Research highlights: {yields} SV40-DTS worked as a DTS in ES cells as well as other types of cells. {yields} Sox2 regulatory region 2 worked as a DTS in ES cells and thus was termed as SRR2-DTS. {yields} SRR2-DTS was suggested as an ES cell-specific DTS. -- Abstract: In this report, the effects of two DNA nuclear targeting sequence (DTS) candidates on the gene expression efficiency in ES cells were investigated. Reporter plasmids containing the simian virus 40 (SV40) promoter/enhancer sequence (SV40-DTS), a DTS for various types of cells but not being reported yet for ES cells, and the 81 basemore » pairs of Sox2 regulatory region 2 (SRR2) where two transcriptional factors in ES cells, Oct3/4 and Sox2, are bound (SRR2-DTS), were introduced into cytoplasm in living cells by femtoinjection. The gene expression efficiencies of each plasmid in mouse insulinoma cell line MIN6 cells and mouse ES cells were then evaluated. Plasmids including SV40-DTS and SRR2-DTS exhibited higher gene expression efficiency comparing to plasmids without these DTSs, and thus it was concluded that both sequences work as a DTS in ES cells. In addition, it was suggested that SRR2-DTS works as an ES cell-specific DTS. To the best of our knowledge, this is the first report to confirm the function of DTSs in ES cells.« less
Basarkar, Ashwin; Singh, Jagdish
2009-01-01
Determine the efficiency of cationic nanoparticles prepared by blending poly (lactide-co-glycolide; PLGA) and methacrylate copolymer (Eudragit(R) E100) to deliver a therapeutic gene encoding mouse interleukin-10, in vitro and in vivo. Nanoparticles prepared with PLGA and E100 were evaluated for delivery of plasmid DNA encoding mouse interleukin-10 in vitro and in vivo in mice upon intramuscular injection. Blood-glucose, serum interferon-gamma levels and histology of pancreas were studied to determine therapeutic efficacy. Histological evaluation of skeletal muscle from the injection site was performed to assess the biocompatibility of nanoparticles. PLGA/E100 nanoparticles showed endosomal escape evidenced by confocal microscopy and buffering ability. Transfecting HEK293 cells with plasmid-loaded PLGA/E100 nanoparticles resulted in significantly (p < 0.05) greater expression of interleukin-10 compared to PLGA nanoparticles. Mice treated with PLGA/E100 nanoparticles displayed higher serum levels of interleukin-10 and lower blood glucose levels compared to those treated with interleukin-10 plasmid alone or PLGA nanoparticles. High expression of interleukin-10 facilitated suppression of interferon-gamma levels and reduced islet infiltration. Histology of muscle showed that nanoparticles were biocompatible and did not cause chronic inflammatory response. Nanoparticles prepared by blending PLGA with methacrylate can efficiently and safely deliver plasmid DNA encoding mouse interleukin-10 leading to prevention of autoimmune diabetes.
Son, Yeon Jeong; Ryu, Ae Jin; Li, Ling; Han, Nam Soo; Jeong, Ki Jun
2016-01-15
Leuconostoc is a hetero-fermentative lactic acid bacteria, and its importance is widely recognized in the dairy industry. However, due to limited genetic tools including plasmids for Leuconostoc, there has not been much extensive research on the genetics and engineering of Leuconostoc yet. Thus, there is a big demand for high-copy-number plasmids for useful gene manipulation and overproduction of recombinant proteins in Leuconostoc. Using an existing low-copy plasmid, the copy number of plasmid was increased by random mutagenesis followed by FACS-based high-throughput screening. First, a random library of plasmids was constructed by randomizing the region responsible for replication in Leuconostoc citreum; additionally, a superfolder green fluorescent protein (sfGFP) was used as a reporter protein. With a high-speed FACS sorter, highly fluorescent cells were enriched, and after two rounds of sorting, single clone exhibiting the highest level of sfGFP was isolated. The copy number of the isolated plasmid (pCB4270) was determined by quantitative PCR (qPCR). It was found that the isolated plasmid has approximately a 30-fold higher copy number (approx. 70 copies per cell) than that of the original plasmid. From the sequence analysis, a single mutation (C→T) at position 4690 was found, and we confirmed that this single mutation was responsible for the increased plasmid copy number. The effectiveness of the isolated high-copy-number plasmid for the overproduction of recombinant proteins was successfully demonstrated with two protein models Glutathione-S-transferase (GST) and α-amylase. The high-copy number plasmid was successfully isolated by FACS-based high-throughput screening of a plasmid library in L. citreum. The isolated plasmid could be a useful genetic tool for high-level gene expression in Leuconostoc, and for extending the applications of this useful bacteria to various areas in the dairy and pharmaceutical industries.
Taylor, David M; Kabashi, Edor; Agar, Jeffrey N; Minotti, Sandra; Durham, Heather D
2005-01-01
Heat shock proteins (Hsps) with chaperoning function work together with the ubiquitin-proteasome pathway to prevent the accumulation of misfolded, potentially toxic proteins, as well as to control catabolism of the bulk of cytoplasmic, cellular protein. There is evidence for the involvement of both systems in neurodegenerative disease, and a therapeutic target is the heat shock transcription factor, Hsf1, which mediates upregulation of Hsps in response to cellular stress. The mechanisms regulating expression of proteasomal proteins in mammalian cells are less well defined. To assess any direct effect of Hsf1 on expression of proteasomal subunits and activity in mammalian cells, a plasmid encoding a constitutively active form of Hsf1 (Hsf1act) was expressed in mouse embryonic fibroblasts lacking Hsf1 and in cultured human myoblasts. Plasmid encoding an inactivatible form of Hsf1 (Hsf1inact) served as control. In cultures transfected with plasmid hsf1act, robust expression of the major stress-inducible Hsp, Hsp70, occurred but not in cultures transfected with hsf1inact. No significant changes in the level of expression of representative proteasomal proteins (structural [20Salpha], a nonpeptidase beta subunit [20Sbeta3], or 2 regulatory subunits [19S subunit 6b, 11 Salpha]) or in chymotrypsin-, trypsin-, and caspaselike activities of the proteasome were measured. Thus, stress-induced or pharmacological activation of Hsf1 in mammalian cells would upregulate Hsps but not directly affect expression or activity of proteasomes.
Liu, Mingming; Asada, Masahito; Cao, Shinuo; Adjou Moumouni, Paul Franck; Vudriko, Patrick; Efstratiou, Artemis; Hakimi, Hassan; Masatani, Tatsunori; Sunaga, Fujiko; Kawazu, Shin-Ichiro; Yamagishi, Junya; Xuan, Xuenan
2017-09-01
The development of gene manipulation techniques has been reported in many protozoan parasites over the past few years. However, these techniques have not yet been established for Babesia gibsoni. Here, we report for the first time, the successful transient transfection of B. gibsoni. The plasmid containing the firefly luciferase reporter gene (pBS-ELA) was transfected into B. gibsoni by an AMAXA 4D Nucleofector™ device. Transfection using program FA113 and Lonza buffer SF showed the highest luciferase expression. Twenty micrograms of plasmid produced the highest relative transfection efficiency. The fluorescent protein-expressing parasites were determined by GFP-containing plasmid (pBS-EGA) at 48 and 72h post transfection. This finding is the first step towards a stable transfection method for B. gibsoni, which may contribute to a better understanding of the biology of the parasite. Copyright © 2017 Elsevier B.V. All rights reserved.
Yin, Ji-Yuan; Guo, Chao-Qun; Wang, Zi; Yu, Mei-Ling; Gao, Shuai; Bukhari, Syed M; Tang, Li-Jie; Xu, Yi-Gang; Li, Yi-Jing
2016-11-01
Using two-step plasmid integration in the presence of 5-fluorouracil (5-FU), we developed a stable and markerless Lactobacillus casei strain for vaccine antigen expression. The upp of L. casei, which encodes uracil phosphoribosyltransferase (UPRTase), was used as a counterselection marker. We employed the Δupp isogenic mutant, which is resistant to 5-FU, as host and a temperature-sensitive suicide plasmid bearing upp expression cassette as counterselectable integration vector. Extrachromosomal expression of UPRTase complemented the mutated chromosomal upp allele and restored sensitivity to 5-FU. The resultant genotype can either be wild type or recombinant. The efficacy of the system was demonstrated by insertion and expression of porcine rotavirus (PRV) VP4. To improve VP4 expression, we analyzed L. casei transcriptional profiles and selected the constitutive highly expressed enolase gene (eno). The VP4 inserted after the eno termination codon were screened in the presence of 5-FU. Using genomic PCR amplification, we confirmed that VP4 was successfully integrated and stably inherited for at least 50 generations. Western blot demonstrated that VP4 was steadily expressed in medium with different carbohydrates. RT-qPCR and ELISA analysis showed that VP4 expression from the chromosomal location was similar to that achieved by a plasmid expression system. Applying the recombinant strain to immunize BALB/c mice via oral administration revealed that the VP4-expressing L. casei could induce both specific local and systemic humoral immune responses in mice. Overall, the improved gene replacement system represents an efficient method for chromosome recombination in L. casei and provides a safe tool for vaccine production.
Optimization of a one-step heat-inducible in vivo mini DNA vector production system.
Nafissi, Nafiseh; Sum, Chi Hong; Wettig, Shawn; Slavcev, Roderick A
2014-01-01
While safer than their viral counterparts, conventional circular covalently closed (CCC) plasmid DNA vectors offer a limited safety profile. They often result in the transfer of unwanted prokaryotic sequences, antibiotic resistance genes, and bacterial origins of replication that may lead to unwanted immunostimulatory responses. Furthermore, such vectors may impart the potential for chromosomal integration, thus potentiating oncogenesis. Linear covalently closed (LCC), bacterial sequence free DNA vectors have shown promising clinical improvements in vitro and in vivo. However, the generation of such minivectors has been limited by in vitro enzymatic reactions hindering their downstream application in clinical trials. We previously characterized an in vivo temperature-inducible expression system, governed by the phage λ pL promoter and regulated by the thermolabile λ CI[Ts]857 repressor to produce recombinant protelomerase enzymes in E. coli. In this expression system, induction of recombinant protelomerase was achieved by increasing culture temperature above the 37°C threshold temperature. Overexpression of protelomerase led to enzymatic reactions, acting on genetically engineered multi-target sites called "Super Sequences" that serve to convert conventional CCC plasmid DNA into LCC DNA minivectors. Temperature up-shift, however, can result in intracellular stress responses and may alter plasmid replication rates; both of which may be detrimental to LCC minivector production. We sought to optimize our one-step in vivo DNA minivector production system under various induction schedules in combination with genetic modifications influencing plasmid replication, processing rates, and cellular heat stress responses. We assessed different culture growth techniques, growth media compositions, heat induction scheduling and temperature, induction duration, post-induction temperature, and E. coli genetic background to improve the productivity and scalability of our system, achieving an overall LCC DNA minivector production efficiency of ∼ 90%.We optimized a robust technology conferring rapid, scalable, one-step in vivo production of LCC DNA minivectors with potential application to gene transfer-mediated therapeutics.
Effects of nano-TiO2 on antibiotic resistance transfer mediated by RP4 plasmid.
Qiu, Zhigang; Shen, Zhiqiang; Qian, Di; Jin, Min; Yang, Dong; Wang, Jingfeng; Zhang, Bin; Yang, Zhongwei; Chen, Zhaoli; Wang, Xinwei; Ding, Chengshi; Wang, Daning; Li, Jun-Wen
2015-01-01
The potential risks of nano-materials and the spread of antibiotic resistance genes (ARGs) have become two major global public concerns. Studies have confirmed that nano-alumina can promote the spread of ARGs mediated by plasmids. Nano-titanium dioxide (TiO(2)), an excellent photocatalytic nano-material, has been widely used and is often present in aqueous environments. At various nano-material concentrations, bacterial density, matting time, and matting temperature, nano-TiO(2) can significantly promote the conjugation of RP4 plasmid in Escherichia coli. We developed a mathematical model to quantitatively describe the conjugation process and used this model to evaluate the effects of nano-TiO(2) on the spread of ARGs. We obtained analytical solutions for total and resistant bacteria, which were enumerated by the abundance of genetic loci unique to the plasmid and the chromosome using qPCR. Our results showed that the mathematic model was able to fit the experimental data well and can be used to quantitatively evaluate the effects of nano-TiO(2). According to our model, the presence of nano-TiO(2) decreased the bacterial growth rate from 0.0360 to 0.0323 min(-1) and increased the conjugative transfer rate from 6.69 × 10(-12) to 3.93 × 10(-10 )mL cell(-1) min(-1). These results indicate that nano-TiO(2) inhibited bacterial growth and promoted conjugation simultaneously. The data for morphology and mRNA expression also demonstrated this phenomenon. Our results confirm that environmental nano-TiO(2) may cause the spread of ARGs and thus poses an environmental risk. In addition, we provide a potential method for monitoring changes in ARGs that result from conjugation and evaluating the effects of antimicrobial substances on ARG expression.
Optimization of a One-Step Heat-Inducible In Vivo Mini DNA Vector Production System
Wettig, Shawn; Slavcev, Roderick A.
2014-01-01
While safer than their viral counterparts, conventional circular covalently closed (CCC) plasmid DNA vectors offer a limited safety profile. They often result in the transfer of unwanted prokaryotic sequences, antibiotic resistance genes, and bacterial origins of replication that may lead to unwanted immunostimulatory responses. Furthermore, such vectors may impart the potential for chromosomal integration, thus potentiating oncogenesis. Linear covalently closed (LCC), bacterial sequence free DNA vectors have shown promising clinical improvements in vitro and in vivo. However, the generation of such minivectors has been limited by in vitro enzymatic reactions hindering their downstream application in clinical trials. We previously characterized an in vivo temperature-inducible expression system, governed by the phage λ pL promoter and regulated by the thermolabile λ CI[Ts]857 repressor to produce recombinant protelomerase enzymes in E. coli. In this expression system, induction of recombinant protelomerase was achieved by increasing culture temperature above the 37°C threshold temperature. Overexpression of protelomerase led to enzymatic reactions, acting on genetically engineered multi-target sites called “Super Sequences” that serve to convert conventional CCC plasmid DNA into LCC DNA minivectors. Temperature up-shift, however, can result in intracellular stress responses and may alter plasmid replication rates; both of which may be detrimental to LCC minivector production. We sought to optimize our one-step in vivo DNA minivector production system under various induction schedules in combination with genetic modifications influencing plasmid replication, processing rates, and cellular heat stress responses. We assessed different culture growth techniques, growth media compositions, heat induction scheduling and temperature, induction duration, post-induction temperature, and E. coli genetic background to improve the productivity and scalability of our system, achieving an overall LCC DNA minivector production efficiency of ∼90%.We optimized a robust technology conferring rapid, scalable, one-step in vivo production of LCC DNA minivectors with potential application to gene transfer-mediated therapeutics. PMID:24586704
Agúndez, Leticia; González-Prieto, Coral; Machón, Cristina; Llosa, Matxalen
2012-01-01
Background Bacterial conjugation is a mechanism for horizontal DNA transfer between bacteria which requires cell to cell contact, usually mediated by self-transmissible plasmids. A protein known as relaxase is responsible for the processing of DNA during bacterial conjugation. TrwC, the relaxase of conjugative plasmid R388, is also able to catalyze site-specific integration of the transferred DNA into a copy of its target, the origin of transfer (oriT), present in a recipient plasmid. This reaction confers TrwC a high biotechnological potential as a tool for genomic engineering. Methodology/Principal Findings We have characterized this reaction by conjugal mobilization of a suicide plasmid to a recipient cell with an oriT-containing plasmid, selecting for the cointegrates. Proteins TrwA and IHF enhanced integration frequency. TrwC could also catalyze integration when it is expressed from the recipient cell. Both Y18 and Y26 catalytic tyrosil residues were essential to perform the reaction, while TrwC DNA helicase activity was dispensable. The target DNA could be reduced to 17 bp encompassing TrwC nicking and binding sites. Two human genomic sequences resembling the 17 bp segment were accepted as targets for TrwC-mediated site-specific integration. TrwC could also integrate the incoming DNA molecule into an oriT copy present in the recipient chromosome. Conclusions/Significance The results support a model for TrwC-mediated site-specific integration. This reaction may allow R388 to integrate into the genome of non-permissive hosts upon conjugative transfer. Also, the ability to act on target sequences present in the human genome underscores the biotechnological potential of conjugative relaxase TrwC as a site-specific integrase for genomic modification of human cells. PMID:22292089
Zhang, Kang; Su, Lingqia; Duan, Xuguo; Liu, Lina; Wu, Jing
2017-02-20
We recently constructed a Bacillus subtilis strain (CCTCC M 2016536) from which we had deleted the srfC, spoIIAC, nprE, aprE and amyE genes. This strain is capable of robust recombinant protein production and amenable to high-cell-density fermentation. Because the promoter is among the factors that influence the production of target proteins, optimization of the initial promoter, P amyQ from Bacillus amyloliquefaciens, should improve protein expression using this strain. This study was undertaken to develop a new, high-level expression system in B. subtilis CCTCC M 2016536. Using the enzyme β-cyclodextrin glycosyltransferase (β-CGTase) as a reporter protein and B. subtilis CCTCC M 2016536 as the host, nine plasmids equipped with single promoters were screened using shake-flask cultivation. The plasmid containing the P amyQ' promoter produced the greatest extracellular β-CGTase activity; 24.1 U/mL. Subsequently, six plasmids equipped with dual promoters were constructed and evaluated using this same method. The plasmid containing the dual promoter P HpaII -P amyQ' produced the highest extracellular β-CGTase activity (30.5 U/mL) and was relatively glucose repressed. The dual promoter P HpaII -P amyQ' also mediated substantial extracellular pullulanase (90.7 U/mL) and α-CGTase expression (9.5 U/mL) during shake-flask cultivation, demonstrating the general applicability of this system. Finally, the production of β-CGTase using the dual-promoter P HpaII -P amyQ' system was investigated in a 3-L fermenter. Extracellular expression of β-CGTase reached 571.2 U/mL (2.5 mg/mL), demonstrating the potential of this system for use in industrial applications. The dual-promoter P HpaII -P amyQ' system was found to support superior expression of extracellular proteins in B. subtilis CCTCC M 2016536. This system appears generally applicable and is amenable to scale-up.
USDA-ARS?s Scientific Manuscript database
In addition to microarray technology, which provides a robust method to study protein function in a rapid, economical, and proteome-wide fashion, plasmid-based functional proteomics is an important technology for rapidly obtaining large quantities of protein and determining protein function across a...
A xyIE-iceC transcriptional fusion was created by ligating a DNA fragment harboring the cloned xyIE structural gene from the TOL plasmid of Pseudomonas putida mt-2 into the cloned iceC gene of Pseudomonas syringae Cit7. This fusion construct was integrated into chromosome of Pseu...
Transferable green fluorescence-tagged pEI2 in Edwardsiella ictaluri
USDA-ARS?s Scientific Manuscript database
The pEI2 plasmid of Edwardsiella ictaluri isolate, I49, was tagged using a Tn10-GFP-kan cassette to create the green fluorescence-expressing derivative I49-gfp. The Tn10-GFP-kan insertion site was mapped by plasmid sequencing to 663 bp upstream of orf2 and appeared to be at a neutral site in the pla...
Portlock, Joylette L; Keravala, Annahita; Bertoni, Carmen; Lee, Solomon; Rando, Thomas A; Calos, Michele P
2006-08-01
Peripheral vascular disease (PVD), characterized by insufficient blood supply to extremities, can be a devastating illness. Although many gene therapy strategies for PVD using vascular endothelial growth factor (VEGF) have resulted in increased blood vessel formation, the vessels are often impermanent and regress after therapy, probably because of the short-lived VEGF expression mediated by gene therapy vectors (14 days or less). phiC31 integrase is a recombinase originally isolated from a bacteriophage of Streptomyces. This integrase performs efficient chromosomal integration of plasmid DNA into mammalian genomes that results in long-term transgene expression. In this study, gene transfer was achieved by intramuscular injection of VEGF and integrase plasmid DNAs into the tibialis anterior muscle in the mouse hindlimb, followed by electroporation of the muscle with needle electrodes. We observed VEGF levels significantly above background 40 days after injection in animals that received phiC31 integrase and the VEGF plasmid. Site-specific integration of plasmid DNA in the chromosomes of muscle tissue was verified by polymerase chain reaction at a common integration site. These results suggest the possible utility of the phiC31 integrase system to treat ischemic disease.
Development of a novel rDNA based plasmid for enhanced cell surface display on Yarrowia lipolytica.
Bulani, Siyavuya Ishmael; Moleleki, Lucy; Albertyn, Jacobus; Moleleki, Ntsane
2012-05-20
In this study, a novel rDNA based plasmid was developed for display of heterologous proteins on the cell surface of Yarrowia lipolytica using the C-terminal end of the glycosylphosphatidylinositol (GPI) anchored Y. lipolytica cell wall protein 1 (YlCWP1). mCherry was used as a model protein to assess the efficiency of the constructed plasmid. Y. lipolytica transformants harbouring the expression cassettes showed a purple colour phenotype on selective YNB-casamino plates as compared to control cells indicating that mCherry was displayed on the cells. Expression of mCherry on cells of Y. lipolytica was confirmed by both fluorescent microscopy and flow cytometry. Furthermore, SDS-PAGE analysis and matrix-assisted laser desorption/ionization (MALDI)-time-of (TOF)-mass spectrometry (MS) peptide mass fingerprinting (PMF) confirmed that the protein cleaved from the yeast cells using enterokinase was mCherry. Efficient cleavage of mCherry reported in this work offers an alternative purification method for displayed heterologous proteins on Y. lipolytica cells using the plasmid constructed in this study. The developed displaying system offers great potential for industrial production and purification of heterologous proteins at low cost.
Electrotransfer of the full-length dog dystrophin into mouse and dystrophic dog muscles.
Pichavant, Christophe; Chapdelaine, Pierre; Cerri, Daniel G; Bizario, Joao C S; Tremblay, Jacques P
2010-11-01
Duchenne muscular dystrophy (DMD) is an X-linked genetic disease characterized by the absence of dystrophin (427 kDa). An approach to eventually restore this protein in patients with DMD is to introduce into their muscles a plasmid encoding dystrophin cDNA. Because the phenotype of the dystrophic dog is closer to the human phenotype than is the mdx mouse phenotype, we have studied the electrotransfer of a plasmid carrying the full-length dog dystrophin (FLDYS(dog)) in dystrophic dog muscle. To achieve this nonviral delivery, the FLDYS(dog) cDNA was cloned in two plasmids containing either a cytomegalovirus or a muscle creatine kinase promoter. In both cases, our results showed that the electrotransfer of these large plasmids (∼17 kb) into mouse muscle allowed FLDYS(dog) expression in the treated muscle. The electrotransfer of pCMV.FLDYS(dog) in a dystrophic dog muscle also led to the expression of dystrophin. In conclusion, introduction of the full-length dog dystrophin cDNA by electrotransfer into dystrophic dog muscle is a potential approach to restore dystrophin in patients with DMD. However, the electrotransfer procedure should be improved before applying it to humans.
Chen, Q; Janssen, D B; Witholt, B
1995-01-01
Growth of Pseudomonas oleovorans GPo1, which contains the OCT plasmid, on octane results in changes in the membrane phospholipid fatty acid composition. These changes were not found for GPo12, an OCT-plasmid-cured variant of GPo1, during growth in the presence or absence of octane, implying the involvement of OCT-plasmid-encoded functions. When recombinant strain GPo12(pGEc47) carrying the alk genes from the OCT plasmid was grown on octane, the cells showed the same changes in fatty acid composition as those found for GPo1, indicating that such changes result from induction and expression of the alk genes. This finding was corroborated by inducing GPo12(pGEc47) with dicyclopropylketone (DCPK), a gratuitous inducer of the alk genes. Further experiments showed that the increase of the mean acyl chain length of fatty acids is related to the expression of alkB, which encodes a major integral membrane protein, while the formation of trans unsaturated fatty acids mainly results from the effects of 1-octanol, an octane oxidation product. PMID:7592483
Gruber, Steffen; Schwab, Helmut; Koefinger, Petra
2015-12-25
The Gram-negative bacterium Escherichia coli is currently the most efficient and widely used prokaryotic host for recombinant protein and metabolite production. However, due to some limitations and to various interesting features of other Gram-negative bacteria efficient vector systems applicable to a broad range are desired. Basic building blocks for plasmid-based vectors include besides the need for a suitable selection marker in the first line a proper replication and maintenance system. In addition to these basic requirements, further elements are needed for Gram-negative bacteria beyond E. coli, such as Pseudomonas pudita, Ralstonia eutropha, Burkholderia glumae or Acinetobacter sp.. Established building blocks have to be adapted and new building blocks providing the desired functions need to be identified and exploited. This minireview addresses so far described and used genetic elements for broad host range replication, efficient plasmid maintenance, and conjugative plasmid transfer as well as expression elements and protein secretion signals. The industrially important bacterium R. eutropha H16 was chosen as a model organism to provide specific data on the effectivity and utility of building blocks based on such genetic elements. Copyright © 2015 Elsevier B.V. All rights reserved.
Song, Xiu-Guang; Bian, Peng-Fei; Yu, Shu-Li; Zhao, Xiu-Hua; Xu, Wei; Bu, Xue-Hui; Li, Xia; Ma, Li-Xian
2013-01-01
AIM: To investigate the expression of the hepatitis B virus (HBV) 1.3-fold genome plasmid (pHBV1.3) in an immortalized mouse hepatic cell line induced by SV40 T-antigen (SV40T) expression. METHODS: Mouse hepatic cells were isolated from mouse liver tissue fragments from 3-5 d old Kunming mice by the direct collagenase digestion method and cultured in vitro. The pRSV-T plasmid was transfected into mouse hepatic cells to establish an SV40LT-immortalized mouse hepatic cell line. The SV40LT-immortalized mouse hepatic cells were identified and transfected with the pHBV1.3 plasmid. The levels of hepatitis B surface antigen (HBsAg) and hepatitis B e antigen (HBeAg) in the supernatant were determined by an electrochemiluminescence immunoassay at 24, 48, 72 and 96 h after transfection. The expressions of HBsAg and hepatitis B c antigen (HBcAg) in the cells were investigated by indirect immunofluorescence analysis. The presence of HBV DNA replication intermediates in the transfected cells and viral particles in the supernatant of the transfected cell cultures was monitored using the Southern hybridization assay and transmission electronic microscopy, respectively. RESULTS: The pRSV-T plasmid was used to immortalize mouse hepatocytes and an SV40LT-immortalized mouse hepatic cell line was successfully established. SV40LT-immortalized mouse hepatic cells have the same morphology and growth characteristics as primary mouse hepatic cells can be subcultured and produce albumin and cytokeratin-18 in vitro. Immortalized mouse hepatic cells did not show the characteristics of tumor cells, as alpha-fetoprotein levels were comparable (0.58 ± 0.37 vs 0.61 ± 0.31, P = 0.37). SV40LT-immortalized mouse hepatic cells were then transfected with the pHBV1.3 plasmid, and it was found that the HBV genome replicated in SV40LT-immortalized mouse hepatic cells. The levels of HBsAg and HBeAg continuously increased in the supernatant after the transfection of pHBV1.3, and began to decrease 72 h after transfection. The expressions of HBsAg and HBcAg were observed in the pHBV1.3-transfected cells. HBV DNA replication intermediates were also observed at 72 h after transfection, including relaxed circular DNA, double-stranded DNA and single-stranded DNA. Furthermore, a few 42 nm Dane particles, as well as many 22 nm subviral particles with a spherical or filamentous shape, were detected in the supernatant. CONCLUSION: SV40T expression can immortalize mouse hepatic cells, and the pHBV1.3-transfected SV40T-immortalized mouse hepatic cell line can be a new in vitro cell model. PMID:24307795
Song, Xiu-Guang; Bian, Peng-Fei; Yu, Shu-Li; Zhao, Xiu-Hua; Xu, Wei; Bu, Xue-Hui; Li, Xia; Ma, Li-Xian
2013-11-28
To investigate the expression of the hepatitis B virus (HBV) 1.3-fold genome plasmid (pHBV1.3) in an immortalized mouse hepatic cell line induced by SV40 T-antigen (SV40T) expression. Mouse hepatic cells were isolated from mouse liver tissue fragments from 3-5 d old Kunming mice by the direct collagenase digestion method and cultured in vitro. The pRSV-T plasmid was transfected into mouse hepatic cells to establish an SV40LT-immortalized mouse hepatic cell line. The SV40LT-immortalized mouse hepatic cells were identified and transfected with the pHBV1.3 plasmid. The levels of hepatitis B surface antigen (HBsAg) and hepatitis B e antigen (HBeAg) in the supernatant were determined by an electrochemiluminescence immunoassay at 24, 48, 72 and 96 h after transfection. The expressions of HBsAg and hepatitis B c antigen (HBcAg) in the cells were investigated by indirect immunofluorescence analysis. The presence of HBV DNA replication intermediates in the transfected cells and viral particles in the supernatant of the transfected cell cultures was monitored using the Southern hybridization assay and transmission electronic microscopy, respectively. The pRSV-T plasmid was used to immortalize mouse hepatocytes and an SV40LT-immortalized mouse hepatic cell line was successfully established. SV40LT-immortalized mouse hepatic cells have the same morphology and growth characteristics as primary mouse hepatic cells can be subcultured and produce albumin and cytokeratin-18 in vitro. Immortalized mouse hepatic cells did not show the characteristics of tumor cells, as alpha-fetoprotein levels were comparable (0.58 ± 0.37 vs 0.61 ± 0.31, P = 0.37). SV40LT-immortalized mouse hepatic cells were then transfected with the pHBV1.3 plasmid, and it was found that the HBV genome replicated in SV40LT-immortalized mouse hepatic cells. The levels of HBsAg and HBeAg continuously increased in the supernatant after the transfection of pHBV1.3, and began to decrease 72 h after transfection. The expressions of HBsAg and HBcAg were observed in the pHBV1.3-transfected cells. HBV DNA replication intermediates were also observed at 72 h after transfection, including relaxed circular DNA, double-stranded DNA and single-stranded DNA. Furthermore, a few 42 nm Dane particles, as well as many 22 nm subviral particles with a spherical or filamentous shape, were detected in the supernatant. SV40T expression can immortalize mouse hepatic cells, and the pHBV1.3-transfected SV40T-immortalized mouse hepatic cell line can be a new in vitro cell model.
Liu, Fang; Li, Li; Zhang, Wei; Wang, Qi
2013-04-01
This research was to construct the lentiviral expression vector for anti- p185(erbB2) mouse/human chimeric antibody and to determine the expression of the chimeric antibody gene in 293T cells transfected with this vector. The genes (vL and vH) coding light and heavy chain of variable regions of anti-p185(erbB2) mAb and the constant regions of human IgG1 (kappa and gamma1) were cloned with PCR method. The target genes were assembled by three-primers PCR method to obtain the chimeric light chain (L) and the chimeric heavy chain (H). Both chains inserted into the down stream and upper stream of IRES gene of the plasmid pVAX1/IRES respectively. We digested the plasmid pVAX1/ H-IRES-L with endoenzyme and subcloned H-IRES-L into the lentiviral vector pWPI. The enzyme digestion and sequence analysis showed that the lentiviral expression vector pWPI/H-IRES-L was constructed correctly. Then, it was transfected into 293T cells and after 48h, GFP protein expression in 293T cells were detected by fluorescent microscope and the chimeric antibody expression was detected by RT-PCR and direct ELISA. The results showed that after 293T cells were transfected with recombination plasmid, both light and heavy chains of the chimeric antibody genes could express together. The chimeric antibody expressed could bind to p185(erbB2) specifically. This research may lay a sound foundation for further study of anti-p185(erbB2) engineered antibody.
Fate of plasmids containing Mu DNA: chromosome association and mobilization.
Bialy, H; Waggoner, B T; Pato, M L
1980-01-01
The fluorescent dye, diamidinophenylindole-dihydrochloride (DAPI) can be added to CsCl gradients to enhance the density resolution of DNA species, independent of their topological configurations. When Proteus mirabilis and Escherichia coli strains carrying an RP4::Mucts plasmid were examined with the use of such a technique, it was found that after thermal induction of the prophage essentially al of the plasmid DNA became associated with the chromosome. This quantitative association is detergent-RNase- and pronase-resistant and dependent on the expression of Mu genes. The association is temporally, and probably functionally, correlated with the onset of Mu DNA replication. Genetic studies with F'::mini Mu plasmids indicate that some of the association results in stable Hfr formation, and does not require the product of Mu gene B.
Chen, X; Li, Y; Xiong, K; Wagner, T E
1994-01-01
A novel cytoplasmic gene expression system has been developed. This system differs from other expression systems in that it relies on the co-delivery of plasmid DNA and T7 RNA polymerase (RNAP) during transfection. The plasmid contains a T7 RNAP gene driven by the T7 promoter (T7 autogene) and a functional/reporter gene driven by another T7 promoter (T7T7/T7-gene construct). Once this DNA-enzyme complex is introduced into eukaryotic cells, the transcription of the T7 RNAP and the functional/reporter genes is initiated by the co-delivered T7 RNAP. The T7 RNAP, which is responsible for the initiation and maintenance of expression of both T7 and functional/reporter genes, is replenished by translation of newly synthesized T7 mRNA. This T7 system was designed in such a manner that the expression of the functional/reporter genes can occur in the cytoplasm and does not require any nuclear involvement. When transfected by either a pT7T7/T7Luc or a pT7T7/T7hGH plasmids with the cointroduced T7 RNAP, mouse L cells were found to express high levels of luciferase immediately after transfection, apparently due to the cytoplasmic gene expression; the expression of human growth hormone (hGH) could be sustained for at least 6 days. Both T7 and hGH mRNA were expressed by the cells transfected with pT7T7/T7hGH. These results suggest that this cytoplasmic expression system may be used for certain targets of somatic gene therapy. Images PMID:8029020
Golden Gate Assembly of CRISPR gRNA expression array for simultaneously targeting multiple genes.
Vad-Nielsen, Johan; Lin, Lin; Bolund, Lars; Nielsen, Anders Lade; Luo, Yonglun
2016-11-01
The engineered CRISPR/Cas9 technology has developed as the most efficient and broadly used genome editing tool. However, simultaneously targeting multiple genes (or genomic loci) in the same individual cells using CRISPR/Cas9 remain one technical challenge. In this article, we have developed a Golden Gate Assembly method for the generation of CRISPR gRNA expression arrays, thus enabling simultaneous gene targeting. Using this method, the generation of CRISPR gRNA expression array can be accomplished in 2 weeks, and contains up to 30 gRNA expression cassettes. We demonstrated in the study that simultaneously targeting 10 genomic loci or simultaneously inhibition of multiple endogenous genes could be achieved using the multiplexed gRNA expression array vector in human cells. The complete set of plasmids is available through the non-profit plasmid repository Addgene.
MacDonald, Chris; Piper, Robert C.
2015-01-01
Here we expand the set of tools for genetically manipulating Saccharomyces cerevisiae. We show that puromycin-resistance can be achieved in yeast through expression of a bacterial puromycin-resistance gene optimized to the yeast codon bias, which in turn serves as an easy to use dominant genetic marker suitable for gene disruption. We have constructed a similar DNA cassette expressing yeast codon-optimized mutant human dihydrofolate reductase (DHFR) that confers resistance to methotrexate and can also be used as a dominant selectable marker. Both of these drug-resistant marker cassettes are flanked by loxP sites allowing for their excision from the genome following expression of cre-recombinase. Finally, we have created a series of plasmids for low-level constitutive expression of cre-recombinase in yeast that allows for efficient excision of loxP-flanked markers. PMID:25688547
Epsilon-toxin plasmids of Clostridium perfringens type D are conjugative.
Hughes, Meredith L; Poon, Rachael; Adams, Vicki; Sayeed, Sameera; Saputo, Juliann; Uzal, Francisco A; McClane, Bruce A; Rood, Julian I
2007-11-01
Isolates of Clostridium perfringens type D produce the potent epsilon-toxin (a CDC/U.S. Department of Agriculture overlap class B select agent) and are responsible for several economically significant enterotoxemias of domestic livestock. It is well established that the epsilon-toxin structural gene, etx, occurs on large plasmids. We show here that at least two of these plasmids are conjugative. The etx gene on these plasmids was insertionally inactivated using a chloramphenicol resistance cassette to phenotypically tag the plasmid. High-frequency conjugative transfer of the tagged plasmids into the C. perfringens type A strain JIR325 was demonstrated, and the resultant transconjugants were shown to act as donors in subsequent mating experiments. We also demonstrated the transfer of "unmarked" native epsilon-toxin plasmids into strain JIR325 by exploiting the high transfer frequency. The transconjugants isolated in these experiments expressed functional epsilon-toxin since their supernatants had cytopathic effects on MDCK cells and were toxic in mice. Using the widely accepted multiplex PCR approach for toxin genotyping, these type A-derived transconjugants were genotypically type D. These findings have significant implications for the C. perfringens typing system since it is based on the toxin profile of each strain. Our study demonstrated the fluid nature of the toxinotypes and their dependence upon the presence or absence of toxin plasmids, some of which have for the first time been shown to be conjugative.
Komoto, Satoshi; Fukuda, Saori; Ide, Tomihiko; Ito, Naoto; Sugiyama, Makoto; Yoshikawa, Tetsushi; Murata, Takayuki; Taniguchi, Koki
2018-04-18
An entirely plasmid-based reverse genetics system for rotaviruses was established very recently. We improved the reverse genetics system to generate recombinant rotavirus by transfecting only 11 cDNA plasmids for its 11 gene segments under the condition of increasing the ratio of the cDNA plasmids for NSP2 and NSP5 genes. Utilizing this highly efficient system, we then engineered infectious recombinant rotaviruses expressing bioluminescent (NanoLuc luciferase) and fluorescent (EGFP and mCherry) reporters. These recombinant rotaviruses expressing reporters remained genetically stable during serial passages. Our reverse genetics approach and recombinant rotaviruses carrying reporter genes will be great additions to the tool kit for studying the molecular virology of rotavirus, and for developing future next-generation vaccines and expression vectors. IMPORTANCE Rotavirus is one of the most important pathogens causing severe gastroenteritis in young children worldwide. In this paper, we describe a robust and simple reverse genetics system based on only rotavirus cDNAs, and its application for engineering infectious recombinant rotaviruses harboring bioluminescent (NanoLuc) and fluorescent (EGFP and mCherry) protein genes. This highly efficient reverse genetics system and recombinant RVAs expressing reporters could be powerful tools for the study of different aspects of rotavirus replication. Furthermore, they may be useful for next-generation vaccine production for this medically important virus. Copyright © 2018 American Society for Microbiology.
Lobato-Márquez, Damián; Molina-García, Laura; Moreno-Córdoba, Inma; García-Del Portillo, Francisco; Díaz-Orejas, Ramón
2016-01-01
Certain Salmonella enterica serovars belonging to subspecies I carry low-copy-number virulence plasmids of variable size (50-90 kb). All of these plasmids share the spv operon, which is important for systemic infection. Virulence plasmids are present at low copy numbers. Few copies reduce metabolic burden but suppose a risk of plasmid loss during bacterial division. This drawback is counterbalanced by maintenance modules that ensure plasmid stability, including partition systems and toxin-antitoxin (TA) loci. The low-copy number virulence pSLT plasmid of Salmonella enterica serovar Typhimurium encodes three auxiliary maintenance systems: one partition system ( parAB ) and two TA systems ( ccdAB ST and vapBC2 ST ). The TA module ccdAB ST has previously been shown to contribute to pSLT plasmid stability and vapBC2 ST to bacterial virulence. Here we describe a novel assay to measure plasmid stability based on the selection of plasmid-free cells following elimination of plasmid-containing cells by ParE toxin, a DNA gyrase inhibitor. Using this new maintenance assay we confirmed a crucial role of parAB in pSLT maintenance. We also showed that vapBC2 ST , in addition to contribute to bacterial virulence, is important for plasmid stability. We have previously shown that ccdAB ST encodes an inactive CcdB ST toxin. Using our new stability assay we monitored the contribution to plasmid stability of a ccdAB ST variant containing a single mutation (R99W) that restores the toxicity of CcdB ST . The "activation" of CcdB ST (R99W) did not increase pSLT stability by ccdAB ST . In contrast, ccdAB ST behaves as a canonical type II TA system in terms of transcriptional regulation. Of interest, ccdAB ST was shown to control the expression of a polycistronic operon in the pSLT plasmid. Collectively, these results show that the contribution of the CcdB ST toxin to pSLT plasmid stability may depend on its role as a co-repressor in coordination with CcdA ST antitoxin more than on its toxic activity.
Design and construction of functional AAV vectors.
Gray, John T; Zolotukhin, Serge
2011-01-01
Using the basic principles of molecular biology and laboratory techniques presented in this chapter, researchers should be able to create a wide variety of AAV vectors for both clinical and basic research applications. Basic vector design concepts are covered for both protein coding gene expression and small non-coding RNA gene expression cassettes. AAV plasmid vector backbones (available via AddGene) are described, along with critical sequence details for a variety of modular expression components that can be inserted as needed for specific applications. Protocols are provided for assembling the various DNA components into AAV vector plasmids in Escherichia coli, as well as for transferring these vector sequences into baculovirus genomes for large-scale production of AAV in the insect cell production system.
Dark proteins: effect of inclusion body formation on quantification of protein expression.
Iafolla, Marco A J; Mazumder, Mostafizur; Sardana, Vandit; Velauthapillai, Tharsan; Pannu, Karanbir; McMillen, David R
2008-09-01
Plasmid-borne gene expression systems have found wide application in the emerging fields of systems biology and synthetic biology, where plasmids are used to implement simple network architectures, either to test systems biology hypotheses about issues such as gene expression noise or as a means of exerting artificial control over a cell's dynamics. In both these cases, fluorescent proteins are commonly applied as a means of monitoring the expression of genes in the living cell, and efforts have been made to quantify protein expression levels through fluorescence intensity calibration and by monitoring the partitioning of proteins among the two daughter cells after division; such quantification is important in formulating the predictive models desired in systems and synthetic biology research. A potential pitfall of using plasmid-based gene expression systems is that the high protein levels associated with expression from plasmids can lead to the formation of inclusion bodies, insoluble aggregates of misfolded, nonfunctional proteins that will not generate fluorescence output; proteins caught in these inclusion bodies are thus "dark" to fluorescence-based detection methods. If significant numbers of proteins are incorporated into inclusion bodies rather than becoming biologically active, quantitative results obtained by fluorescent measurements will be skewed; we investigate this phenomenon here. We have created two plasmid constructs with differing average copy numbers, both incorporating an unregulated promoter (P(LtetO-1) in the absence of TetR) expressing the GFP derivative enhanced green fluorescent protein (EGFP), and inserted them into Escherichia coli bacterial cells (a common model organism for work on the dynamics of prokaryotic gene expression). We extracted the inclusion bodies, denatured them, and refolded them to render them active, obtaining a measurement of the average number of EGFP per cell locked into these aggregates; at the same time, we used calibrated fluorescent intensity measurements to determine the average number of active EGFP present per cell. Both measurements were carried out as a function of cellular doubling time, over a range of 45-75 min. We found that the ratio of inclusion body EGFP to active EGFP varied strongly as a function of the cellular growth rate, and that the number of "dark" proteins in the aggregates could in fact be substantial, reaching ratios as high as approximately five proteins locked into inclusion bodies for every active protein (at the fastest growth rate), and dropping to ratios well below 1 (for the slowest growth rate). Our results suggest that efforts to compare computational models to protein numbers derived from fluorescence measurements should take inclusion body loss into account, especially when working with rapidly growing cells. 2008 Wiley-Liss, Inc.
A Java-based tool for the design of classification microarrays.
Meng, Da; Broschat, Shira L; Call, Douglas R
2008-08-04
Classification microarrays are used for purposes such as identifying strains of bacteria and determining genetic relationships to understand the epidemiology of an infectious disease. For these cases, mixed microarrays, which are composed of DNA from more than one organism, are more effective than conventional microarrays composed of DNA from a single organism. Selection of probes is a key factor in designing successful mixed microarrays because redundant sequences are inefficient and limited representation of diversity can restrict application of the microarray. We have developed a Java-based software tool, called PLASMID, for use in selecting the minimum set of probe sequences needed to classify different groups of plasmids or bacteria. The software program was successfully applied to several different sets of data. The utility of PLASMID was illustrated using existing mixed-plasmid microarray data as well as data from a virtual mixed-genome microarray constructed from different strains of Streptococcus. Moreover, use of data from expression microarray experiments demonstrated the generality of PLASMID. In this paper we describe a new software tool for selecting a set of probes for a classification microarray. While the tool was developed for the design of mixed microarrays-and mixed-plasmid microarrays in particular-it can also be used to design expression arrays. The user can choose from several clustering methods (including hierarchical, non-hierarchical, and a model-based genetic algorithm), several probe ranking methods, and several different display methods. A novel approach is used for probe redundancy reduction, and probe selection is accomplished via stepwise discriminant analysis. Data can be entered in different formats (including Excel and comma-delimited text), and dendrogram, heat map, and scatter plot images can be saved in several different formats (including jpeg and tiff). Weights generated using stepwise discriminant analysis can be stored for analysis of subsequent experimental data. Additionally, PLASMID can be used to construct virtual microarrays with genomes from public databases, which can then be used to identify an optimal set of probes.
Choi, Jae Woong; Yim, Sung Sun; Kim, Min Jeong; Jeong, Ki Jun
2015-12-29
In most bacteria, various jumping genetic elements including insertion sequences elements (IS elements) cause a variety of genetic rearrangements resulting in harmful effects such as genome and recombinant plasmid instability. The genetic stability of a plasmid in a host is critical for high-level production of recombinant proteins, and in this regard, the development of an IS element-free strain could be a useful strategy for the enhanced production of recombinant proteins. Corynebacterium glutamicum, which is a workhorse in the industrial-scale production of various biomolecules including recombinant proteins, also has several IS elements, and it is necessary to identify the critical IS elements and to develop IS element deleted strain. From the cultivation of C. glutamicum harboring a plasmid for green fluorescent protein (GFP) gene expression, non-fluorescent clones were isolated by FACS (fluorescent activated cell sorting). All the isolated clones had insertions of IS elements in the GFP coding region, and two major IS elements (ISCg1 and ISCg2 families) were identified. By co-cultivating cells harboring either the isolated IS element-inserted plasmid or intact plasmid, it was clearly confirmed that cells harboring the IS element-inserted plasmids became dominant during the cultivation due to their growth advantage over cells containing intact plasmids, which can cause a significant reduction in recombinant protein production during cultivation. To minimize the harmful effects of IS elements on the expression of heterologous genes in C. glutamicum, two IS element free C. glutamicum strains were developed in which each major IS element was deleted, and enhanced productivity in the engineered C. glutamicum strain was successfully demonstrated with three models: GFP, poly(3-hydroxybutyrate) [P(3HB)] and γ-aminobutyrate (GABA). Our findings clearly indicate that the hopping of IS elements could be detrimental to the production of recombinant proteins in C. glutamicum, emphasizing the importance of developing IS element free host strains.
Skin Electroporation: Effects on Transgene Expression, DNA Persistence and Local Tissue Environment
Roos, Anna-Karin; Eriksson, Fredrik; Timmons, James A.; Gerhardt, Josefine; Nyman, Ulrika; Gudmundsdotter, Lindvi; Bråve, Andreas; Wahren, Britta; Pisa, Pavel
2009-01-01
Background Electrical pulses have been used to enhance uptake of molecules into living cells for decades. This technique, often referred to as electroporation, has become an increasingly popular method to enhance in vivo DNA delivery for both gene therapy applications as well as for delivery of vaccines against both infectious diseases and cancer. In vivo electrovaccination (gene delivery followed by electroporation) is currently being investigated in several clinical trials, including DNA delivery to healthy volunteers. However, the mode of action at molecular level is not yet fully understood. Methodology/Principal Findings This study investigates intradermal DNA electrovaccination in detail and describes the effects on expression of the vaccine antigen, plasmid persistence and the local tissue environment. Gene profiling of the vaccination site showed that the combination of DNA and electroporation induced a significant up-regulation of pro-inflammatory genes. In vivo imaging of luciferase activity after electrovaccination demonstrated a rapid onset (minutes) and a long duration (months) of transgene expression. However, when the more immunogenic prostate specific antigen (PSA) was co-administered, PSA-specific T cells were induced and concurrently the luciferase expression became undetectable. Electroporation did not affect the long-term persistence of the PSA-expressing plasmid. Conclusions/Significance This study provides important insights to how DNA delivery by intradermal electrovaccination affects the local immunological responses of the skin, transgene expression and clearance of the plasmid. As the described vaccination approach is currently being evaluated in clinical trials, the data provided will be of high significance. PMID:19789652
Efficient production of antibody Fab fragment by transient gene expression in insect cells.
Mori, Keita; Hamada, Hirotsugu; Ogawa, Takafumi; Ohmuro-Matsuyama, Yuki; Katsuda, Tomohisa; Yamaji, Hideki
2017-08-01
Transient gene expression allows a rapid production of diverse recombinant proteins in early-stage preclinical and clinical developments of biologics. Insect cells have proven to be an excellent platform for the production of functional recombinant proteins. In the present study, the production of an antibody Fab fragment by transient gene expression in lepidopteran insect cells was investigated. The DNA fragments encoding heavy-chain (Hc; Fd fragment) and light-chain (Lc) genes of an Fab fragment were individually cloned into the plasmid vector pIHAneo, which contained the Bombyx mori actin promoter downstream of the B. mori nucleopolyhedrovirus (BmNPV) IE-1 transactivator and the BmNPV HR3 enhancer for high-level expression. Trichoplusia ni BTI-TN-5B1-4 (High Five) cells were co-transfected with the resultant plasmid vectors using linear polyethyleneimine. When the transfection efficiency was evaluated, a plasmid vector encoding an enhanced green fluorescent protein (EGFP) gene was also co-transfected. Transfection and culture conditions were optimized based on both the flow cytometry of the EGFP expression in transfected cells and the yield of the secreted Fab fragments determined by enzyme-linked immunosorbent assay (ELISA). Under optimal conditions, a yield of approximately 120 mg/L of Fab fragments was achieved in 5 days in a shake-flask culture. Transient gene expression in insect cells may offer a promising approach to the high-throughput production of recombinant proteins. Copyright © 2017 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.
Uchimaru, K; Endo, K; Fujinuma, H; Zukerberg, L; Arnold, A; Motokura, T
1996-05-01
Cyclin D1 is one of the key regulators in G1 progression in the cell cycle and is also a candidate oncogene (termed PRAD1 or bcl-1) in several types of human tumors. We report a collaboration of the cyclin D1 gene with ras and a mutated form of p53 (p53-mt) in neoplastic transformation. Transfection of cyclin D1 alone or in combination with ras or with p53-mt was not sufficient for focus formation of rat embryonic fibroblasts. However, focus formation induced by co-transfection of ras and p53-mt was enhanced in the presence of the cyclin D1-expression plasmid. Co-transfection of ras- and p53-mt-transformants with the cyclin D1-expression plasmid resulted in reduced serum dependency in vitro. Furthermore, the transformants expressing exogenous cyclin D1 grew faster than those without the cyclin D1 plasmid when injected into nude mice. These observations strengthen the significance of cyclin D1 overexpression through gene rearrangement or gene amplification observed in human tumors as a step in multistep oncogenesis; deregulated expression of cyclin D1 may reduce the requirement for growth factors and may stimulate in vivo growth.
2012-01-01
Background Lactic acid bacteria (LAB) play an important role in agricultural as well as industrial biotechnology. Development of improved LAB strains using e.g. library approaches is often limited by low transformation efficiencies wherefore one reason could be differences in the DNA methylation patterns between the Escherichia coli intermediate host for plasmid amplification and the final LAB host. In the present study, we examined the influence of DNA methylation on transformation efficiency in LAB and developed a direct cloning approach for Lactobacillus plantarum CD033. Therefore, we propagated plasmid pCD256 in E. coli strains with different dam/dcm-methylation properties. The obtained plasmid DNA was purified and transformed into three different L. plantarum strains and a selection of other LAB species. Results Best transformation efficiencies were obtained using the strain L. plantarum CD033 and non-methylated plasmid DNA. Thereby we achieved transformation efficiencies of ~ 109 colony forming units/μg DNA in L. plantarum CD033 which is in the range of transformation efficiencies reached with E. coli. Based on these results, we directly transformed recombinant expression vectors received from PCR/ligation reactions into L. plantarum CD033, omitting plasmid amplification in E. coli. Also this approach was successful and yielded a sufficient number of recombinant clones. Conclusions Transformation efficiency of L. plantarum CD033 was drastically increased when non-methylated plasmid DNA was used, providing the possibility to generate expression libraries in this organism. A direct cloning approach, whereby ligated PCR-products where successfully transformed directly into L. plantarum CD033, obviates the construction of shuttle vectors containing E. coli-specific sequences, as e.g. a ColEI origin of replication, and makes amplification of these vectors in E. coli obsolete. Thus, plasmid constructs become much smaller and occasional structural instability or mutagenesis during E. coli propagation is excluded. The results of our study provide new genetic tools for L. plantarum which will allow fast, forward and systems based genetic engineering of this species. PMID:23098256
Ferreira, Joseane Cristina; Penha Filho, Rafael Antonio Casarin; Kuaye, Ana Paula Yorika; Andrade, Leonardo Neves; Berchieri Junior, Angelo; Darini, Ana Lúcia da Costa
2018-06-01
The expression of plasmid-mediated quinolone resistance (PMQR) genes confers low-level quinolone and fluoroquinolones resistance alone. However, the association to chromosomal resistance mechanisms determines an expressively higher resistance in Enterobacteriaceae. These mechanisms are horizontally disseminated within plasmids and have contributed to the emergence of bacteria with reduced susceptibility or resistant to therapies worldwide. The epidemiological characterization of PMQR dissemination is highly relevant in the scientific and medical context, to investigate the dissemination within enterobacteria, from different populations, including humans and food-producing animals. In the present study, 200 Enterobacteriaceae isolates were harvested from poultry with cloacal swabs and identified as Escherichia coli (90.5%), Escherichia fergusonii (5.5%), Klebsiella oxytoca (2.5%) and Klebsiella pneumoniae (1.5%). Among isolates evaluated, 46 (23%) harboured PMQR genes including qnrB (43/200), qnrS (2/200) and aac(6')-Ib-cr (1/200). All isolates carrying PMQR genes showed multidrug-resistance phenotype. The 36 E. coli isolates showed 18 different PFGE types. All E. fergusonii isolates showed the same PFGE type. The two Klebsiella oxytoca belonged to two different PFGE types. The phylogenetic groups A, B1, and D were found among the E. coli harboring PMQR genes. Based on the phylogenetic analysis and PFGE, the population structure of E. coli isolates was diverse, even within the same farm. All isolates carrying qnrB and qnrS genes also harboured ColE-like plasmids. The Southern blot hybridization using the S1-PFGE revealed that the qnrB genes were located on low molecular weight plasmids, smaller than 10Kb. Resistance plasmids were sequenced and showed 100% identity with plasmid pPAB19-3. The association of PMQR genes with mobile genetic elements, such as transferable plasmids, favours the selection and dissemination of (fluoro) quinolones resistant bacteria among food-producing animals, and may play an important role in the current increased prevalence of resistant bacteria in different environments reported worldwide. Copyright © 2018. Published by Elsevier B.V.
A Transmissible Plasmid Controlling Camphor Oxidation in Pseudomonas putida
Rheinwald, J. G.; Chakrabarty, A. M.; Gunsalus, I. C.
1973-01-01
Earlier papers demonstrated an extensive genetic exchange among fluorescent Pseudomonads; this one documents for genes specifying enzymes of peripheral dissimilation an extrachromosomal array, segregation, and frequent interstrain transfer. An hypothesis is presented of a general mechanism for the formation and maintenance of metabolic diversity. The example used, the path of oxidative cleavage of the carbocyclic rings of the bicyclic monoterpene D- and L-camphor, terminates in acetate release and isobutyrate chain debranching. By transduction, two gene linkage groups are shown for the reactions before and after isobutyrate. The group for reactions before isobutyrate is plasmid borne, contransferable by conjugation, mitomycin curable, and shows a higher segregation rate from cells that are multiplasmid rather than carrying a single plasmid. The genes that code for isobutyrate and essential anaplerotic and amphibolic metabolism are chromosomal. By conjugation plasmid-borne genes are transferred at a higher frequency than are chromosomal, and are transferred in homologous crosses more frequently than between heterologous species. Most isobutyrate-positive fluorescent pseudomonad strains will accept and express the camphor plasmid. PMID:4351810
Cloning of human prourokinase cDNA without the signal peptide and expression in Escherichia coli.
Hu, B; Li, J; Yu, W; Fang, J
1993-01-01
Human prourokinase (pro-UK) cDNA without the signal peptide was obtained using synthetic oligonucleotide and DNA recombination techniques and was successfully expressed in E. coli. The plasmid pMMUK which contained pro-UK cDNA (including both the entire coding sequence and the sequence for signal peptide) was digested with Hind III and PstI, so that the N-terminal 371-bp fragment could be recovered. A 304-bp fragment was collected from the 371-bp fragment after partial digestion with Fnu4HI in order to remove the signal peptide sequence. An intermediate plasmid was formed after this 304-bp fragment and the synthetic oligonucleotide was ligated with pUC18. Correctness of the ligation was confirmed by enzyme digestion and sequencing. By joining the PstI-PstI fragment of pro-UK to the plasmid we obtained the final plasmid which contained the entire coding sequence of pro-UK without the signal peptide. The coding sequence with correct orientation was inserted into pBV220 under the control of the temperature-induced promoter PRPL, and mature pro-UK was expressed in E. coli at 42 degrees C. Both sonicated supernatant and inclusion bodies of the bacterial host JM101 showed positive results by ELISA and FAPA assays. After renaturation, the biological activity of the expressed product was increased from 500-1000IU/L to about 60,000IU/L. The bacterial pro-UK showed a molecular weight of about 47,000 daltons by Western blot analysis. It can be completely inhibited by UK antiserum but not by t-PA antiserum nor by normal rabbit serum.
Avila, D M; Robinson, A K; Kaushal, V; Barnes, L D
1991-01-01
The APA1 gene in Saccharomyces cerevisiae encodes Ap4A phosphorylase I, the catabolic enzyme for diadenosine 5',5"'-P1,P4-tetraphosphate (Ap4A). APA1 has been inserted into a multicopy plasmid and into a centromeric plasmid with a GAL1 promoter. Enhanced expression of APA1 via the plasmids resulted in 10- and 90-fold increases in Ap4A phosphorylase activity, respectively, as assayed in vitro. However, the intracellular concentration of Ap4A exhibited increases of 2- and 15-fold, respectively, from the two different plasmids. Intracellular Ap4A increased 3- to 20-fold during growth on galactose of a transformant with APA1 under the control of the GAL1 promoter. Intracellular adenosine 5'-P1-tetraphospho-P4-5"'-guanosine (Ap4G) and diguanosine 5',5"'-P1,P4-tetraphosphate (Gp4G) also increased in the transformant under these conditions. The chromosomal locus of APA1 has been disrupted in a haploid strain. The Ap4A phosphorylase activity decreased by 80% and the intracellular Ap4A concentration increased by a factor of five in the null mutant. These results with the null mutant agree with previous results reported by Plateau et al. (P. Plateau, M. Fromant, J.-M. Schmitter, J.-M. Buhler, and S. Blancquet, J. Bacteriol. 171:6437-6445, 1989). The paradoxical increase in Ap4A upon enhanced expression of APA1 indicates that the metabolic consequences of altered gene expression may be more complex than indicated solely by assay of enzymatic activity of the gene product. PMID:1660456
Avila, D M; Robinson, A K; Kaushal, V; Barnes, L D
1991-12-01
The APA1 gene in Saccharomyces cerevisiae encodes Ap4A phosphorylase I, the catabolic enzyme for diadenosine 5',5"'-P1,P4-tetraphosphate (Ap4A). APA1 has been inserted into a multicopy plasmid and into a centromeric plasmid with a GAL1 promoter. Enhanced expression of APA1 via the plasmids resulted in 10- and 90-fold increases in Ap4A phosphorylase activity, respectively, as assayed in vitro. However, the intracellular concentration of Ap4A exhibited increases of 2- and 15-fold, respectively, from the two different plasmids. Intracellular Ap4A increased 3- to 20-fold during growth on galactose of a transformant with APA1 under the control of the GAL1 promoter. Intracellular adenosine 5'-P1-tetraphospho-P4-5"'-guanosine (Ap4G) and diguanosine 5',5"'-P1,P4-tetraphosphate (Gp4G) also increased in the transformant under these conditions. The chromosomal locus of APA1 has been disrupted in a haploid strain. The Ap4A phosphorylase activity decreased by 80% and the intracellular Ap4A concentration increased by a factor of five in the null mutant. These results with the null mutant agree with previous results reported by Plateau et al. (P. Plateau, M. Fromant, J.-M. Schmitter, J.-M. Buhler, and S. Blancquet, J. Bacteriol. 171:6437-6445, 1989). The paradoxical increase in Ap4A upon enhanced expression of APA1 indicates that the metabolic consequences of altered gene expression may be more complex than indicated solely by assay of enzymatic activity of the gene product.
[Immunogenicity of chimeric gene vaccine Mtb8.4/hIL12].
Li, Hui; Li, Rong; Zhong, Sen; Luo, Yue-bei; Ren, Hong; Deng, Cun-liang
2006-09-01
To construct chimeric gene vaccine Mtb8.4/hIL-12, express it in COS-7 cells and study its immunogenicity. Chimeric gene Mtb8.4/hIL-12 was amplified by PCR and cloned into the eukaryotic vector pCI-neo to construct the recombinant plasmid pCI-neo-Mtb8.4/hIL12. After the recombinant plasmid was identified by restriction enzyme digestion analysis, PCR and DNA sequencing, COS-7 cells were transfected with pCI-neo-Mtb8.4/hIL12 through cationic liposome. 48 hours later, the expression of mRNA was detected by RT-PCR and the level of hIL-12 in culture supernatant and cell lysates were detected by Western blot. C57BL/6N mice were vaccinated with chimeric gene vaccine Mtb8.4/hIL-12 three times at the interval of 3 weeks each time. Four weeks after the final inoculation, three mice were sacrificed to assess the cytotoxicity of CTLs and response to cytokine. The recombinant plasmid pCI-neo-Mtb8.4/hIL12 was constructed successfully. After COS-7 cells were transfected with pCI-neo-Mtb8.4/hIL12, chimeric gene Mtb8.4/hIL12 was expressed in COS-7 cells. The chimeric gene vaccine could induce strong antigen-specific immune response. With the increase of IFN-gamma and IL-2 secretion and the decrease of IL-4 secretion, the cytotoxicity of specific CTLs was heightened. Recombinant plasmid pCI-neo-Mtb8.4/hIL12 has been successfully constructed and expressed in COS-7 cells. The constructed chimeric gene vaccine Mtb8.4/hIL12 is of strong immunogenicity and can obviously induce the cytotoxicity of CTLs.
Nitric oxide synthase gene transfer for erectile dysfunction in a rat model.
Chancellor, M B; Tirney, S; Mattes, C E; Tzeng, E; Birder, L A; Kanai, A J; de Groat, W C; Huard, J; Yoshimura, N
2003-05-01
To determine whether over-expression of nitric oxide synthase (NOS) in the corpus cavernosum of the penis improves erectile function, as NO is an important transmitter for genitourinary tract function, mediating smooth muscle relaxation and being essential for penile erection. The inducible form of the enzyme NOS (iNOS) was introduced into the corpus cavernosum of adult Sprague-Dawley rats (250-300 g) by injecting a solution of plasmid, adenovirus or adenovirus-transduced myoblast cells (adeno-myoblasts). Plasmid, adenovirus and adeno-myoblasts encoding the expression of the beta-galactosidase reporter gene were also injected into rats. Throughout the corpora cavernosum there was expression of beta-galactosidase after injecting each of the three solutions. Maximum staining was greatest for adeno-myoblast, then adenovirus and then plasmid. The mean (sd) basal intracavernosal pressure (ICP) of iNOS-treated animals (adenovirus and adeno-myoblast) increased to 55 (23) cmH2O, compared with naive animals with a basal ICP of 5 (6) cmH2O (P = 0.001). Stimulating the cavernosal nerve (15 Hz, 1.5 ms, 10-40 V, 1 min) resulted in a doubling of the ICP (adenovirus and adeno-myoblast) from the basal level of the iNOS-treated animals. Direct in situ measurement of NO showed the release of 1-1.3 micro mol/L in the adeno-myoblast penis. Myoblast-mediated gene therapy was more successful for delivering iNOS into the corpus cavernosum than direct adenovirus injection or plasmid transfection. Surprisingly, implanting muscle cells into the penis is not only feasible but also beneficial. Gene therapy for NOS may open new avenues of treatment for erectile dysfunction. Control of NOS expression would be necessary to prevent priapism.
Yin, Xiaotao; Wang, Wei; Tian, Renli; Xu, Yuanji; Yan, Jinqi; Zhang, Wei; Gao, Jiangping; Yu, Jiyun
2013-08-01
To construct a prokaryotic expression plasmid pET28a-survivin, optimize the recombinant protein expression conditions in E.coli, and purify the survivin recombinant protein and identify its antigenicity. Survivin cDNA segment was amplified by PCR and cloned into prokaryotic expression vector pET28a(+) to construct the recombinant expression vector pET28a-survivin. The expression vector was transformed into BL21 (DE3) and the fusion protein survivin/His was induced by IPTG. The fusion protein was purified through Ni affinity chromatography. The antigenicity of the purified survivin protein was identified by Western blotting and ELISA. The recombinant expression vector was verified successfully by BamHI and HindIII. The fusion protein induced by IPTG was obtained with Mr; about 24 000. The purity of the purified protein reached 90% by SDS-PAGE analysis. And the antigenicity of the survivin protein was validated by Western blotting and ELISA. The prokaryotic expression plasmid pET28a-survivin was successfully constructed and the survivin protein was expressed and purified in E.coli. The antigenicity of the purified survivin protein was demonstrated desirable.
Taylor, David M.; Kabashi, Edor; Agar, Jeffrey N.; Minotti, Sandra; Durham, Heather D.
2005-01-01
Heat shock proteins (Hsps) with chaperoning function work together with the ubiquitin-proteasome pathway to prevent the accumulation of misfolded, potentially toxic proteins, as well as to control catabolism of the bulk of cytoplasmic, cellular protein. There is evidence for the involvement of both systems in neurodegenerative disease, and a therapeutic target is the heat shock transcription factor, Hsf1, which mediates upregulation of Hsps in response to cellular stress. The mechanisms regulating expression of proteasomal proteins in mammalian cells are less well defined. To assess any direct effect of Hsf1 on expression of proteasomal subunits and activity in mammalian cells, a plasmid encoding a constitutively active form of Hsf1 (Hsf1act) was expressed in mouse embryonic fibroblasts lacking Hsf1 and in cultured human myoblasts. Plasmid encoding an inactivatible form of Hsf1 (Hsf1inact) served as control. In cultures transfected with plasmid hsf1act, robust expression of the major stress-inducible Hsp, Hsp70, occurred but not in cultures transfected with hsf1inact. No significant changes in the level of expression of representative proteasomal proteins (structural [20Sα], a nonpeptidase beta subunit [20Sβ3], or 2 regulatory subunits [19S subunit 6b, 11Sα]) or in chymotrypsin-, trypsin-, and caspaselike activities of the proteasome were measured. Thus, stress-induced or pharmacological activation of Hsf1 in mammalian cells would upregulate Hsps but not directly affect expression or activity of proteasomes. PMID:16184768
Heuer, Holger; Fox, Randal E; Top, Eva M
2007-03-01
IncP-1 plasmids are known to be promiscuous, but it is not understood if they are equally well adapted to various species within their host range. Moreover, little is known about their fate in bacterial communities. We determined if the IncP-1beta plasmid pB10 was unstable in some Proteobacteria, and whether plasmid stability was enhanced after long-term carriage in a single host and when regularly switched between isogenic hosts. Plasmid pB10 was found to be very unstable in Pseudomonas putida H2, and conferred a high cost (c. 20% decrease in fitness relative to the plasmid-free host). H2(pB10) was then evolved under conditions that selected for plasmid maintenance, with or without regular plasmid transfer (host-switching). When tested in the ancestral host, the evolved plasmids were more stable and their cost was significantly reduced (9% and 16% for plasmids from host-switched and nonswitched lineages, respectively). Our findings suggest that IncP-1 plasmids can rapidly adapt to an unfavorable host by improving their overall stability, and that regular conjugative transfer accelerates this process.
Novosadova, E V; Manuilova, E S; Arsen'eva, E L; Khaidarova, N V; Dolotov, O V; Inozemtseva, L S; Kozachenkov, K Yu; Tarantul, V Z; Grivennikov, I A
2005-07-01
The effects of pub gene on proliferation and initial stages of differentiation of embryonic mouse stem cells were studied in vitro. To this end we used enhanced expression of human pub gene (hpub) and suppression of expression of mouse endogenous pub gene with RNA-interference in embryonic stem cells. Proliferative activity of genetically modified polyclonal lines of the embryonic stem cells transfected with plasmids carrying expressing hpub gene or plasmids generating small interference RNA to this gene did not differ from that of the control cells. Inhibition of expression of endogenous pub gene in embryonic stem cells using small interference RNA 2-fold decreased the formation of embryoid bodies, at the same time additional expression of exogenous hpub gene almost 2-fold increased their number in comparison with the control. It was hypothesized that pub gene participates in early stages of differentiation of embryonic stem cells leading to the formation of embryoid bodies.
Expression and use of the green fluorescent protein as a reporter system in Legionella pneumophila.
Köhler, R; Bubert, A; Goebel, W; Steinert, M; Hacker, J; Bubert, B
2000-01-01
The gene encoding the green fluorescent protein (GFP) was used as a reporter gene in Legionella pneumophila. To analyze GFP expression in Legionella, transcriptional fusions of gfp with the Legionella-specific mip (Macrophage Infectivity Potentiator) promoter (P(mip)) and the sod (SuperOxide Dismutase) promoter (P(sod)) derived from Listeria monocytogenes were constructed. Following transformation into the virulent L. pneumophila strain JR 32, strong GFP-mediated fluorescence was detected with both plasmids, although the sod promoter was associated with a 1ten-fold higher intensity. No fluorescence was observed in L. pneumophila transformed with the promoterless gfp gene. Comparison of fluorescence yields between various L. pneumophila strains that differ in their virulence characteristics and were transformed with the P(mip)-gfp carrying plasmid revealed no differences in GFP expression. Infection studies using Acanthamoeba castellanii as host and recombinant L. pneumophila strains carrying the P(mip)-gfp and P(sod)-gfp fusions indicated that the mip promoter was expressed when the bacteria replicated intracellularly. GFP expression was also used to monitor, in infected A. castellanii cells, the intracellular survival of, and incidence of host-cell killing by. L. pneumophila strains that vary in their virulence properties. As quantified by flow cytometry the highly virulent L. pneumophila strain Corby was twice as infectious to A. castellanii as the Philadelphia strain JR 32. Using the avirulent Philadelphia derivative 25D invasion but no intracellular multiplication was observed. In addition, we examined by flow cytometry the influence of cytochalasin D, cycloheximide, and methylamine on the uptake of Legionella by A. castellanii. In conclusion, gfp appears to be a convenient reporter gene whose expression in Legionella can be followed in real time and allows analysis of promoter activities in Legionella and monitoring of the infection process.
Scaleable processes for the manufacture of therapeutic quantities of plasmid DNA.
Shamlou, Parviz Ayazi
2003-06-01
The need for scaleable processes to manufacture therapeutic plasmid DNA (pDNA) is easy to overlook when attention is focused primarily on vector design and establishment of early clinical results. pDNA is a large molecule and has properties that are similar to those of the contaminating chromosomal DNA. These, combined with the low initial concentration of plasmids in the host cell, provide unique process challenges that require significant upfront design to establish robust manufacturing processes that can also comply with current Good Manufacturing Practice ('cGMP') and produce milligram-to-kilogram quantities of pDNA product. This review describes promising scaleable processes that are currently being assessed for production of therapeutic supercoiled pDNA. Fermentation strategies for improving supercoiled plasmid yield and reducing contaminant concentrations are reviewed, and downstream processes are assessed for their ability to efficiently remove cellular contaminants, separate the supercoiled form of the pDNA from its open circular and linear forms, and prepare the purified drug substance for formulation. Current strategies are presented for developing stable delivery systems, and approaches to quality assurance and quality control are discussed.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Hendrick, C.A.; Haskins, W.P.; Vidaver, A.K.
1984-07-01
Gene transfer systems for phytopathogenic corynebacteria have not been reported previously. In this paper a conjugative 46-megadalton plasmid (pDG101) found in Corynebacterium flaccumfaciens subsp. oorii CO101 is described that mediates resistance to arsenite, arsenate, and antimony(III). Transfer of the plasmid from CO101 to four other strains from the C. flaccumfaciens group occurred between cells immobilized on nitrocellulose filters or on agar surfaces. Transconjugant strains expressed the same levels of metal resistance as the donor strain and were able to act as donor strains in subsequent matings. The physical presence of the plasmid was detected by agarose gel electrophoresis. Arsenite-sensitive derivativesmore » of the donor and transconjugant strains were obtained after heat treatment; these were cured of pDG101.« less
DNA fusion product of phage P2 with plasmid pBR322 - A new phasmid
NASA Technical Reports Server (NTRS)
Nicoletti, M.; Bertani, G.
1983-01-01
The chromosome of the temperate bacteriophage P2 and that of the plasmid pBR322 have been joined in vitro after treatment with restriction endonuclease EcoRI. The fusion product - a phasmid - can behave as a plasmid, as a phage and as a prophage. It can replicate its DNA under the control of either the specific replication mechanism of the parent phage in a polA mutant or that of the parent plasmid in a rep mutant. Several interesting interactions between the two replication modes are indicated. In particular, phage particles may be produced even when the phage mode of DNA replication is blocked, and this throws new light on the involvement of the early gene A in the regulation of late gene expression in phage P2.
Groom, Joseph; Chung, Daehwan; Kim, Sun-Ki; Guss, Adam; Westpheling, Janet
2018-05-28
A limitation to the engineering of cellulolytic thermophiles is the availability of functional, thermostable (≥ 60 °C) replicating plasmid vectors for rapid expression and testing of genes that provide improved or novel fuel molecule production pathways. A series of plasmid vectors for genetic manipulation of the cellulolytic thermophile Caldicellulosiruptor bescii has recently been extended to Clostridium thermocellum, another cellulolytic thermophile that very efficiently solubilizes plant biomass and produces ethanol. While the C. bescii pBAS2 replicon on these plasmids is thermostable, the use of homologous promoters, signal sequences and genes led to undesired integration into the bacterial chromosome, a result also observed with less thermostable replicating vectors. In an attempt to overcome undesired plasmid integration in C. thermocellum, a deletion of recA was constructed. As expected, C. thermocellum ∆recA showed impaired growth in chemically defined medium and an increased susceptibility to UV damage. Interestingly, we also found that recA is required for replication of the C. bescii thermophilic plasmid pBAS2 in C. thermocellum, but it is not required for replication of plasmid pNW33N. In addition, the C. thermocellum recA mutant retained the ability to integrate homologous DNA into the C. thermocellum chromosome. These data indicate that recA can be required for replication of certain plasmids, and that a recA-independent mechanism exists for the integration of homologous DNA into the C. thermocellum chromosome. Understanding thermophilic plasmid replication is not only important for engineering of these cellulolytic thermophiles, but also for developing genetic systems in similar new potentially useful non-model organisms.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Chung, Daehwan; Groom, Joseph; Kim, Sun-Ki
A limitation to the engineering of cellulolytic thermophiles is the availability of functional, thermostable (>/= 60 degrees C) replicating plasmid vectors for rapid expression and testing of genes that provide improved or novel fuel molecule production pathways. A series of plasmid vectors for genetic manipulation of the cellulolytic thermophile Caldicellulosiruptor bescii has recently been extended to Clostridium thermocellum, another cellulolytic thermophile that very efficiently solubilizes plant biomass and produces ethanol. While the C. bescii pBAS2 replicon on these plasmids is thermostable, the use of homologous promoters, signal sequences and genes led to undesired integration into the bacterial chromosome, a resultmore » also observed with less thermostable replicating vectors. In an attempt to overcome undesired plasmid integration in C. thermocellum, a deletion of recA was constructed. As expected, C. thermocellum ..delta..recA showed impaired growth in chemically defined medium and an increased susceptibility to UV damage. Interestingly, we also found that recA is required for replication of the C. bescii thermophilic plasmid pBAS2 in C. thermocellum, but it is not required for replication of plasmid pNW33N. In addition, the C. thermocellum recA mutant retained the ability to integrate homologous DNA into the C. thermocellum chromosome. These data indicate that recA can be required for replication of certain plasmids, and that a recA-independent mechanism exists for the integration of homologous DNA into the C. thermocellum chromosome. Understanding thermophilic plasmid replication is not only important for engineering of these cellulolytic thermophiles, but also for developing genetic systems in similar new potentially useful non-model organisms.« less
Winokur, P. L.; Vonstein, D. L.; Hoffman, L. J.; Uhlenhopp, E. K.; Doern, G. V.
2001-01-01
Escherichia coli is an important pathogen that shows increasing antimicrobial resistance in isolates from both animals and humans. Our laboratory recently described Salmonella isolates from food animals and humans that expressed an identical plasmid-mediated, AmpC-like β-lactamase, CMY-2. In the present study, 59 of 377 E. coli isolates from cattle and swine (15.6%) and 6 of 1,017 (0.6%) isolates of human E. coli from the same geographic region were resistant to both cephamycins and extended-spectrum cephalosporins. An ampC gene could be amplified with CMY-2 primers in 94.8% of animal and 33% of human isolates. Molecular epidemiological studies of chromosomal DNA revealed little clonal relatedness among the animal and human E. coli isolates harboring the CMY-2 gene. The ampC genes from 10 animal and human E. coli isolates were sequenced, and all carried an identical CMY-2 gene. Additionally, all were able to transfer a plasmid containing the CMY-2 gene to a laboratory strain of E. coli. CMY-2 plasmids demonstrated two different plasmid patterns that each showed strong similarities to previously described Salmonella CMY-2 plasmids. Additionally, Southern blot analyses using a CMY-2 probe demonstrated conserved fragments among many of the CMY-2 plasmids identified in Salmonella and E. coli isolates from food animals and humans. These data demonstrate that common plasmids have been transferred between animal-associated Salmonella and E. coli, and identical CMY-2 genes carried by similar plasmids have been identified in humans, suggesting that the CMY-2 plasmid has undergone transfer between different bacterial species and may have been transmitted between food animals and humans. PMID:11557460
Isolation and characterization of novel mutations in the pSC101 origin that increase copy number
DOE Office of Scientific and Technical Information (OSTI.GOV)
Thompson, Mitchell G.; Sedaghatian, Nima; Barajas, Jesus F.
pSC101 is a narrow host range, low-copy plasmid commonly used for genetically manipulating Escherichia coli. As a byproduct of a genetic screen for a more sensitive lactam biosensor, we identified multiple novel mutations that increase the copy number of plasmids with the pSC101 origin. All mutations identified in this study occurred on plasmids which also contained at least one mutation localized to the RepA protein encoded within the origin. Homology modelling predicts that many of these mutations occur within the dimerization interface of RepA. Mutant RepA resulted in plasmid copy numbers between ~31 and ~113 copies/cell, relative to ~5 copies/cellmore » in wild-type pSC101 plasmids. Combining the mutations that were predicted to disrupt multiple contacts on the dimerization interface resulted in copy numbers of ~500 copies/cell, while also attenuating growth in host strains. Fluorescent protein production expressed from an arabinose-inducible promoter on mutant origin derived plasmids did correlate with copy number. Plasmids harboring RepA with one of two mutations, E83K and N99D, resulted in fluorescent protein production similar to that from p15a- (~20 copies/cell) and ColE1- (~31 copies/cell) based plasmids, respectively. The mutant copy number variants retained compatibility with p15a, pBBR, and ColE1 origins of replication. Thus, these pSC101 variants may be useful in future metabolic engineering efforts that require medium or high-copy vectors compatible with p15a- and ColE1-based plasmids.« less
Isolation and characterization of novel mutations in the pSC101 origin that increase copy number
Thompson, Mitchell G.; Sedaghatian, Nima; Barajas, Jesus F.; ...
2018-01-25
pSC101 is a narrow host range, low-copy plasmid commonly used for genetically manipulating Escherichia coli. As a byproduct of a genetic screen for a more sensitive lactam biosensor, we identified multiple novel mutations that increase the copy number of plasmids with the pSC101 origin. All mutations identified in this study occurred on plasmids which also contained at least one mutation localized to the RepA protein encoded within the origin. Homology modelling predicts that many of these mutations occur within the dimerization interface of RepA. Mutant RepA resulted in plasmid copy numbers between ~31 and ~113 copies/cell, relative to ~5 copies/cellmore » in wild-type pSC101 plasmids. Combining the mutations that were predicted to disrupt multiple contacts on the dimerization interface resulted in copy numbers of ~500 copies/cell, while also attenuating growth in host strains. Fluorescent protein production expressed from an arabinose-inducible promoter on mutant origin derived plasmids did correlate with copy number. Plasmids harboring RepA with one of two mutations, E83K and N99D, resulted in fluorescent protein production similar to that from p15a- (~20 copies/cell) and ColE1- (~31 copies/cell) based plasmids, respectively. The mutant copy number variants retained compatibility with p15a, pBBR, and ColE1 origins of replication. Thus, these pSC101 variants may be useful in future metabolic engineering efforts that require medium or high-copy vectors compatible with p15a- and ColE1-based plasmids.« less
Sharma, Shukriti; Citti, Chistine; Sagné, Eveline; Marenda, Marc S.
2015-01-01
Mycoplasma bovis is a cause of pneumonia, mastitis, arthritis and otitis media in cattle throughout the world. However, despite its clinical significance, there is a paucity of tools to genetically manipulate it, impeding our capacity to further explore the molecular basis of its virulence. To address this limitation, we developed a series of homologous and heterologous replicable plasmids from M. bovis and M. agalactiae. The shortest replicable oriC plasmid based on the region downstream of dnaA in M. bovis was 247 bp and contained two DnaA boxes, while oriC plasmids based on the region downstream of dnaA in M. agalactiae strains 5632 and PG2 were 219 bp and 217 bp in length, respectively, and contained only a single DnaA box. The efficiency of transformation in M. bovis and M. agalactiae was inversely correlated with the size of the oriC region in the construct, and, in general, homologous oriC plasmids had a higher transformation efficiency than heterologous oriC plasmids. The larger pWholeoriC45 and pMM21-7 plasmids integrated into the genomic oriC region of M. bovis, while the smaller oriC plasmids remained extrachromosomal for up to 20 serial passages in selective media. Although specific gene disruptions were not be achieved in M. bovis in this study, the oriC plasmids developed here could still be useful as tools in complementation studies and for expression of exogenous genes in both M. bovis and M. agalactiae. PMID:25746296
Li, Xinxin; Wu, Zhihao; Zhang, Chuanfu; Jia, Leili; Song, Hongbin; Xu, Yuanyong
2014-01-01
To construct a eukaryotic expression vector containing human complement receptor 2 (CR2)-Fc and express the CR2-Fc fusion protein in Chinese hamster ovary (CHO) cells. The extracellular domain of human CR2 and IgG1 Fc were respectively amplified, ligated and inserted into the eukaryotic expression vector PCI-neo. After verified by restriction enzyme digestion and sequencing, the recombinant plasmid was transfected into CHO K1 cells. The ones with stable expression of the fusion protein were obtained by means of G418 selection. The expression of the CR2-Fc fusion protein was detected and confirmed by SDS-PAGE and Western blotting. Restriction enzyme digestion and sequencing demonstrated that the recombinant plasmid was valid. SDS-PAGE showed that relative molecular mass (Mr;) of the purified product was consistent with the expected value. Western blotting further proved the single band at the same position. We constructed the eukaryotic expression vector of CR2-Fc/PCI-neo successfully. The obtained fusion protein was active and can be used for the further study of the role in HIV control.
Cloning systems for Rhodococcus and related bacteria
Finnerty, W.R.; Singer, M.E.
1990-08-28
A plasmid transformation system for Rhodococcus was developed using an Escherichia coli-Rhodococcus shuttle plasmid. Rhodococcus sp. H13-A contains three cryptic indigenous plasmids, designated pMVS100, pMVS200 and pMVS300, of 75, 19.5 and 13.4 kilobases (Kb), respectively. A 3.8 Kb restriction fragment of pMVS300 was cloned into pIJ30, a 6.3 Kb pBR322 derivative, containing the E. coli origin of replication (ori) and ampicillin resistance determinant (bla) as well as a Streptomyces gene for thiostrepton resistance, tsr. The resulting 10.1 Kb recombinant plasmid, designated pMVS301, was isolated from E. coli DH1 (pMVS301) and transformed into Rhodococcus sp. AS-50, a derivative of strain H13-A, by polyethylene glycol-assisted transformation of Rhodococcus protoplasts and selection for thiostrepton-resistant transformants. This strain was deposited with the ATCC on Feb. 1, 1988 and assigned ATCC 53719. The plasmid contains the Rhodococcus origin of replication. The plasmid and derivatives thereof can therefore be used to introduce nucleic acid sequences to and from Rhodococcus for subsequent expression and translation into protein. The isolated origin of replication can also be used in the construction of new vectors. 2 figs.
Cloning systems for Rhodococcus and related bacteria
Finnerty, William R.; Singer, Mary E.
1990-01-01
A plasmid transformation system for Rhodococcus was developed using an Escherichia coli-Rhodococcus shuttle plasmid. Rhodococcus sp. H13-A contains three cryptic indigenous plasmids, designated pMVS100, pMVS200 and pMVS300, of 75, 19.5 and 13.4 kilobases (Kb), respectively. A 3.8 Kb restriction fragment of pMVS300 was cloned into pIJ30, a 6.3 Kb pBR322 derivative, containing the E. coli origin of replication (ori) and ampicillin resistance determinant (bla) as well as a Streptomyces gene for thiostrepton resistance, tsr. The resulting 10.1 Kb recombinant plasmid, designated pMVS301, was isolated from E. coli DH1 (pMVS301) and transformed into Rhodococcus sp. AS-50, a derivative of strain H13-A, by polyethylene glycol-assisted transformation of Rhodococcus protoplasts and selection for thiostrepton-resistant transformants. This strain was deposited with the ATCC on Feb. 1, 1988 and assigned ATCC 53719. The plasmid contains the Rhodococcus origin of replication. The plasmid and derivatives thereof can therefore be used to introduce nucleic acid sequences to and from Rhodococcus for subsequent expression and translation into protein. The isolated origin of replication can also be used in the construction of new vectors.
Fast kinetic studies of plasmid DNA transfer in intact yeast cells mediated by electropulsation.
Ganeva, V; Galutzov, B; Teissie, J
1995-09-25
Intact yeast cell Electrotransformation process was investigated. It is a two step process. The plasmid must be pre-mixed and present in contact with the cells during the pulse. During the millisecond field pulse, plasmid DNA is associated to the envelope. It therefore crosses the membrane by a process which lasts several seconds as shown by its sensitivity to a post pulse addition of DNase. Electrotransformation is not supported by an electrophoretic transfer due to the external field nor by a free diffusion across the electropermeabilized envelope. DNA is first bound during the field pulse and then is transferred by a still unknown active process due to cell metabolism.
Mobility of the maize suppressor-mutator element in transgenic tobacco cells.
Masson, P; Fedoroff, N V
1989-01-01
Maize Suppressor-mutator (Spm) transposable elements have been introduced into tobacco cells and a visual assay for Spm activity has been developed using a bacterial beta-glucuronidase gene. The Spm element is mobile in tobacco and can trans-activate excision of a transposition-defective Spm (dSpm) element either from a different site on the same transforming Ti plasmid or from a second plasmid. An Spm element expressed from the stronger cauliflower mosaic virus 35S promoter trans-activates transposition of a dSpm element earlier after its introduction into tobacco cells than an element expressed from its own promoter. Images PMID:2538837
Cloning of cDNA of major antigen of foot and mouth disease virus and expression in E. coli
NASA Astrophysics Data System (ADS)
Küpper, Hans; Keller, Walter; Kurz, Christina; Forss, Sonja; Schaller, Heinz
1981-02-01
Double-stranded DNA copies of the single-stranded genomic RNA of foot and mouth disease virus have been cloned into the Escherichia coli plasmid pBR322. A restriction map of the viral genome was established and aligned with the biochemical map of foot and mouth disease virus. The coding sequence for structural protein VP1, the major antigen of the virus, was identified and inserted into a plasmid vector where the expression of this sequence is under control of the phage λ PL promoter. In an appropriate host the synthesis of antigenic polypeptide can be demonstrated by radioimmunoassay.
Lee, Lin-Han; Hui, Cho-Fat; Chuang, Chi-Mu; Chen, Jyh-Yih
2013-11-01
Electrotransfer of plasmid DNA into skeletal muscle is a common non-viral delivery system for the study of gene function and for gene therapy. However, the effects of epinecidin-1 (epi) on bacterial growth and immune system modulation following its electrotransfer into the muscle of grouper (Epinephelus coioides), a marine fish species, have not been addressed. In this study, pCMV-gfp-epi plasmid was electroporated into grouper muscle, and its effect on subsequent infection with Vibrio vulnificus was examined. Over-expression of epi efficiently reduced bacterial numbers at 24 and 48 h after infection, and augmented the expression of immune-related genes in muscle and liver, inducing a moderate innate immune response associated with pro-inflammatory infiltration. Furthermore, electroporation of pCMV-gfp-epi plasmid without V. vulnificus infection induced moderate expression of certain immune-related genes, particularly innate immune genes. These data suggest that electroporation-mediated gene transfer of epi into the muscle of grouper may hold potential as an antimicrobial therapy for pathogen infection in marine fish. Copyright © 2013 Elsevier Ltd. All rights reserved.
Kinnear, Ekaterina; Caproni, Lisa J; Tregoning, John S
2015-01-01
DNA vaccines can be manufactured cheaply, easily and rapidly and have performed well in pre-clinical animal studies. However, clinical trials have so far been disappointing, failing to evoke a strong immune response, possibly due to poor antigen expression. To improve antigen expression, improved technology to monitor DNA vaccine transfection efficiency is required. In the current study, we compared plasmid encoded tdTomato, mCherry, Katushka, tdKatushka2 and luciferase as reporter proteins for whole animal in vivo imaging. The intramuscular, subcutaneous and tattooing routes were compared and electroporation was used to enhance expression. We observed that overall, fluorescent proteins were not a good tool to assess expression from DNA plasmids, with a highly heterogeneous response between animals. Of the proteins used, intramuscular delivery of DNA encoding either tdTomato or luciferase gave the clearest signal, with some Katushka and tdKatushka2 signal observed. Subcutaneous delivery was weakly visible and nothing was observed following DNA tattooing. DNA encoding haemagglutinin was used to determine whether immune responses mirrored visible expression levels. A protective immune response against H1N1 influenza was induced by all routes, even after a single dose of DNA, though qualitative differences were observed, with tattooing leading to high antibody responses and subcutaneous DNA leading to high CD8 responses. We conclude that of the reporter proteins used, expression from DNA plasmids can best be assessed using tdTomato or luciferase. But, the disconnect between visible expression level and immunogenicity suggests that in vivo whole animal imaging of fluorescent proteins has limited utility for predicting DNA vaccine efficacy.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Leong, JoAnn Ching
A prototype subunit vaccine to IHN virus is being developed by recombinant DNA techniques. The techniques involve the isolation and characterization of the glycoprotein gene, which encodes the viral protein responsible for inducing a protective immune response in fish. The viral glycoprotein gene has been cloned and a restriction map of the cloned gene has been prepared. Preliminary DNA sequence analysis of the cloned gene has been initiated so that manipulation of the gene for maximum expression in appropriate plasmid vectors is possible. A recombinant plasmid containing the viral gene inserted in the proper orientation adjacent to a very strongmore » lambda promoter and ribosome binding site has been constructed. Evaluation of this recombinant plasmid for gene expression is being conducted. Immunization trials with purified viral glycoprotein indicate that fish are protected against lethal doses of IHNV after immersion and intraperitoneal methods of immunization. In addition, cross protection immunization trials indicate that Type 2 and Type 1 IHN virus produce glycoproteins that are cross-protective.« less
Kawasaki, Takeru; Satsuma, Hideki; Fujie, Makoto; Usami, Shoji; Yamada, Takashi
2007-12-01
A green fluorescent protein (GFP)-expressing plasmid was constructed from a filamentous bacteriophage phiRSS1 that infects the phytopathogen Ralstonia solanacearum. This plasmid designated as pRSS12 (4.7 kbp in size) consists of an approximately 2248 bp region of the phiRSS1 RF DNA, including ORF1-ORF3 and the intergenic region (IG), and a Km cassette in addition to the GFP gene. It was easily introduced by electroporation and stably maintained even without selective pressure in strains of R. solanacearum of different races and biovars. Strong green fluorescence emitted from pRSS12-transformed bacterial cells was easily monitored in tomato tissues (stem, petiole, and root) after infection as well as from soil samples. These results suggest that pRSS12 can serve as an easy-to-use GFP-tagging tool for any given strain of R. solanacearum in cytological as well as field studies.
Smith, M D; Flickinger, J L; Lineberger, D W; Schmidt, B
1986-01-01
The goal of this study was to investigate the likelihood of developing useful transformation systems for coryneform bacteria. Two species of coryneform bacteria, Brevibacterium lactofermentum and Corynebacterium lilium, were transformed with chimeras constructed from pUB110 and a cryptic coryneform plasmid (pGX1901). C. lilium protoplasts were also efficiently transfected with phage CS1 DNA. High transformation and transfection frequencies were obtained after only 2 min of lysozyme treatment of lysozyme-sensitive mutants. A series of experiments was also conducted to determine whether DNA from other species of important industrial microbes from the genus Bacillus could be expressed in coryneform bacteria. Evidence of restriction of Bacillus subtilis DNA by B. lactofermentum was observed but could be overcome. A Bacillus amyloliquefaciens alpha-amylase gene (amyEBamP) was subcloned onto a plasmid able to replicate in B. lactofermentum. B. lactofermentum transformants for this plasmid expressed amylase activity and produced material cross-reactive to amylase antibody. Images PMID:3008649
Frazer, Lauren C; Darville, Toni; Chandra-Kuntal, Kumar; Andrews, Charles W; Zurenski, Matthew; Mintus, Margaret; AbdelRahman, Yasser M; Belland, Robert J; Ingalls, Robin R; O'Connell, Catherine M
2012-01-01
Loss of the conserved "cryptic" plasmid from C. trachomatis and C. muridarum is pleiotropic, resulting in reduced innate inflammatory activation via TLR2, glycogen accumulation and infectivity. The more genetically distant C. caviae GPIC is a natural pathogen of guinea pigs and induces upper genital tract pathology when inoculated intravaginally, modeling human disease. To examine the contribution of pCpGP1 to C. caviae pathogenesis, a cured derivative of GPIC, strain CC13, was derived and evaluated in vitro and in vivo. Transcriptional profiling of CC13 revealed only partial conservation of previously identified plasmid-responsive chromosomal loci (PRCL) in C. caviae. However, 2-deoxyglucose (2DG) treatment of GPIC and CC13 resulted in reduced transcription of all identified PRCL, including glgA, indicating the presence of a plasmid-independent glucose response in this species. In contrast to plasmid-cured C. muridarum and C. trachomatis, plasmid-cured C. caviae strain CC13 signaled via TLR2 in vitro and elicited cytokine production in vivo similar to wild-type C. caviae. Furthermore, inflammatory pathology induced by infection of guinea pigs with CC13 was similar to that induced by GPIC, although we observed more rapid resolution of CC13 infection in estrogen-treated guinea pigs. These data indicate that either the plasmid is not involved in expression or regulation of virulence in C. caviae or that redundant effectors prevent these phenotypic changes from being observed in C. caviae plasmid-cured strains.
Poon, S K; Peacock, L; Gibson, W; Gull, K; Kelly, S
2012-02-01
Here, we present a simple modular extendable vector system for introducing the T7 RNA polymerase and tetracycline repressor genes into Trypanosoma brucei. This novel system exploits developments in our understanding of gene expression and genome organization to produce a streamlined plasmid optimized for high levels of expression of the introduced transgenes. We demonstrate the utility of this novel system in bloodstream and procyclic forms of Trypanosoma brucei, including the genome strain TREU927/4. We validate these cell lines using a variety of inducible experiments that recapture previously published lethal and non-lethal phenotypes. We further demonstrate the utility of the single marker (SmOx) TREU927/4 cell line for in vivo experiments in the tsetse fly and provide a set of plasmids that enable both whole-fly and salivary gland-specific inducible expression of transgenes.
Poon, S. K.; Peacock, L.; Gibson, W.; Gull, K.; Kelly, S.
2012-01-01
Here, we present a simple modular extendable vector system for introducing the T7 RNA polymerase and tetracycline repressor genes into Trypanosoma brucei. This novel system exploits developments in our understanding of gene expression and genome organization to produce a streamlined plasmid optimized for high levels of expression of the introduced transgenes. We demonstrate the utility of this novel system in bloodstream and procyclic forms of Trypanosoma brucei, including the genome strain TREU927/4. We validate these cell lines using a variety of inducible experiments that recapture previously published lethal and non-lethal phenotypes. We further demonstrate the utility of the single marker (SmOx) TREU927/4 cell line for in vivo experiments in the tsetse fly and provide a set of plasmids that enable both whole-fly and salivary gland-specific inducible expression of transgenes. PMID:22645659
Enhanced animal growth via ligand-regulated GHRH myogenic-injectable vectors
NASA Technical Reports Server (NTRS)
Draghia-Akli, Ruxandra; Malone, P. Brandon; Hill, Leigh Anne; Ellis, Kenneth M.; Schwartz, Robert J.; Nordstrom, Jeffrey L.
2002-01-01
Regulated animal growth occurred following a single electroporated injection of a mixture of two plasmids (10 microg of DNA), one expressing the GeneSwitch regulator protein, the other an inducible growth hormone releasing hormone (GHRH) gene, into the tibialis anterior muscles of adult SCID mice. Administration of the ligand mifepristone (MFP) up-regulated GHRH expression, as shown by elevations of IGF-I levels, and when MFP dosing was withdrawn, IGF-I returned to baseline levels. Five cycles of IGF-I induction were observed during a five-month period. Chronic MFP dosing for 25 days increased lean body mass, weight gain, and bone mineral density significantly compared with non-MFP treated controls. In summary, long-term drug-regulated GHRH expression was achieved following plasmid-based gene therapy, and chronic induction of GHRH expression in adult animals led to improvements in weight gain and body composition.
Regulation of gene expression in plasmid ColE1: delayed expression of the kil gene.
Zhang, S P; Yan, L F; Zubay, G
1988-01-01
cea, imm, and kil are a cluster of three functionally related genes of the plasmid ColE1. The cea and kil genes are in the same inducible operon, with transcription being initiated from a promoter adjacent to the cea gene. The imm gene is located between the cea and kil genes, but it is transcribed in the opposite direction. Complementary interaction between the imm mRNA and the anti-imm sequences in the middle of the cea-kil transcript causes a pronounced delay in expression of the kil gene when the cea-kil operon is induced. A segment in the overlapping region between the cea and imm genes causes delayed expression of the kil gene in the absence of imm gene transcription. This delay effect increases the yields of colicin synthesized in induced cells. Images PMID:3142845
Enhanced animal growth via ligand-regulated GHRH myogenic-injectable vectors.
Draghia-Akli, Ruxandra; Malone, P Brandon; Hill, Leigh Anne; Ellis, Kenneth M; Schwartz, Robert J; Nordstrom, Jeffrey L
2002-03-01
Regulated animal growth occurred following a single electroporated injection of a mixture of two plasmids (10 microg of DNA), one expressing the GeneSwitch regulator protein, the other an inducible growth hormone releasing hormone (GHRH) gene, into the tibialis anterior muscles of adult SCID mice. Administration of the ligand mifepristone (MFP) up-regulated GHRH expression, as shown by elevations of IGF-I levels, and when MFP dosing was withdrawn, IGF-I returned to baseline levels. Five cycles of IGF-I induction were observed during a five-month period. Chronic MFP dosing for 25 days increased lean body mass, weight gain, and bone mineral density significantly compared with non-MFP treated controls. In summary, long-term drug-regulated GHRH expression was achieved following plasmid-based gene therapy, and chronic induction of GHRH expression in adult animals led to improvements in weight gain and body composition.
Assessing the biocompatibility of click-linked DNA in Escherichia coli
Sanzone, A. Pia; El-Sagheer, Afaf H.; Brown, Tom; Tavassoli, Ali
2012-01-01
The biocompatibility of a triazole mimic of the DNA phosphodiester linkage in Escherichia coli has been evaluated. The requirement for selective pressure on the click-containing gene was probed via a plasmid containing click DNA backbone linkages in each strand of the gene encoding the fluorescent protein mCherry. The effect of proximity of the click linkers on their biocompatibility was also probed by placing two click DNA linkers 4-bp apart at the region encoding the fluorophore of the fluorescent protein. The resulting click-containing plasmid was found to encode mCherry in E. coli at a similar level to the canonical equivalent. The ability of the cellular machinery to read through click-linked DNA was further probed by using the above click-linked plasmid to express mCherry using an in vitro transcription/translation system, and found to also be similar to that from canonical DNA. The yield and fluorescence of recombinant mCherry expressed from the click-linked plasmid was also compared to that from the canonical equivalent, and found to be the same. The biocompatibility of click DNA ligation sites at close proximity in a non-essential gene demonstrated in E. coli suggests the possibility of using click DNA ligation for the enzyme-free assembly of chemically modified genes and genomes. PMID:22904087
Formation of AAV Single Stranded DNA Genome from a Circular Plasmid in Saccharomyces cerevisiae
Cervelli, Tiziana; Backovic, Ana; Galli, Alvaro
2011-01-01
Adeno-associated virus (AAV)-based vectors are promising tools for targeted transfer in gene therapy studies. Many efforts have been accomplished to improve production and purification methods. We thought to develop a simple eukaryotic system allowing AAV replication which could provide an excellent opportunity for studying AAV biology and, more importantly, for AAV vector production. It has been shown that yeast Saccharomyces cerevisiae is able to replicate and form the capsid of many viruses. We investigated the ability of the yeast Saccharomyces cerevisiae to carry out the replication of a recombinant AAV (rAAV). When a plasmid containing a rAAV genome in which the cap gene was replaced with the S. cerevisiae URA3 gene, was co-transformed in yeast with a plasmid expressing Rep68, a significant number of URA3+ clones were scored (more than 30-fold over controls). Molecular analysis of low molecular weight DNA by Southern blotting revealed that single stranded DNA is formed and that the plasmid is entirely replicated. The ssDNA contains the ITRs, URA3 gene and also vector sequences suggesting the presence of two distinct molecules. Its formation was dependent on Rep68 expression and ITR. These data indicate that DNA is not obtained by the canonical AAV replication pathway. PMID:21853137
Formation of AAV single stranded DNA genome from a circular plasmid in Saccharomyces cerevisiae.
Cervelli, Tiziana; Backovic, Ana; Galli, Alvaro
2011-01-01
Adeno-associated virus (AAV)-based vectors are promising tools for targeted transfer in gene therapy studies. Many efforts have been accomplished to improve production and purification methods. We thought to develop a simple eukaryotic system allowing AAV replication which could provide an excellent opportunity for studying AAV biology and, more importantly, for AAV vector production. It has been shown that yeast Saccharomyces cerevisiae is able to replicate and form the capsid of many viruses. We investigated the ability of the yeast Saccharomyces cerevisiae to carry out the replication of a recombinant AAV (rAAV). When a plasmid containing a rAAV genome in which the cap gene was replaced with the S. cerevisiae URA3 gene, was co-transformed in yeast with a plasmid expressing Rep68, a significant number of URA3(+) clones were scored (more than 30-fold over controls). Molecular analysis of low molecular weight DNA by Southern blotting revealed that single stranded DNA is formed and that the plasmid is entirely replicated. The ssDNA contains the ITRs, URA3 gene and also vector sequences suggesting the presence of two distinct molecules. Its formation was dependent on Rep68 expression and ITR. These data indicate that DNA is not obtained by the canonical AAV replication pathway.
Modeling sRNA-Regulated Plasmid Maintenance
Klumpp, Stefan
2017-01-01
We study a theoretical model for the toxin-antitoxin (hok/sok) mechanism for plasmid maintenance in bacteria. Toxin-antitoxin systems enforce the maintenance of a plasmid through post-segregational killing of cells that have lost the plasmid. Key to their function is the tight regulation of expression of a protein toxin by an sRNA antitoxin. Here, we focus on the nonlinear nature of the regulatory circuit dynamics of the toxin-antitoxin mechanism. The mechanism relies on a transient increase in protein concentration rather than on the steady state of the genetic circuit. Through a systematic analysis of the parameter dependence of this transient increase, we confirm some known design features of this system and identify new ones: for an efficient toxin-antitoxin mechanism, the synthesis rate of the toxin’s mRNA template should be lower that of the sRNA antitoxin, the mRNA template should be more stable than the sRNA antitoxin, and the mRNA-sRNA complex should be more stable than the sRNA antitoxin. Moreover, a short half-life of the protein toxin is also beneficial to the function of the toxin-antitoxin system. In addition, we study a therapeutic scenario in which a competitor mRNA is introduced to sequester the sRNA antitoxin, causing the toxic protein to be expressed. PMID:28085919
Mercado-Blanco, J; García, F; Fernández-López, M; Olivares, J
1993-01-01
Melanin production by Rhizobium meliloti GR4 is linked to nonsymbiotic plasmid pRmeGR4b (140 MDa). Transfer of this plasmid to GR4-cured derivatives or to Agrobacterium tumefaciens enables these bacteria to produce melanin. Sequence analysis of a 3.5-kb PstI fragment of plasmid pRmeGR4b has revealed the presence of a open reading frame 1,481-bp that codes for a protein whose sequence shows strong homology to two conserved regions involved in copper binding in tyrosinases and hemocyanins. In vitro-coupled transcription-translation experiments showed that this open reading frame codes for a 55-kDa polypeptide. Melanin production in GR4 is not under the control of the RpoN-NifA regulatory system, unlike that in R. leguminosarum bv. phaseoli 8002. The GR4 tyrosinase gene could be expressed in Escherichia coli under the control of the lacZ promoter. For avoiding confusion with mel genes (for melibiose), a change of the name of the previously reported mel genes of R. leguminosarum bv. phaseoli and other organisms to mep genes (for melanin production) is proposed. Images PMID:8366027
Wirebrand, Lisa; Madhushani, Anjana W K; Irie, Yasuhiko; Shingler, Victoria
2018-01-01
The dmp-system encoded on the IncP-2 pVI150 plasmid of Pseudomonas putida CF600 confers the ability to assimilate (methyl)phenols. Regulation of the dmp-genes is subject to sophisticated control, which includes global regulatory input to subvert expression of the pathway in the presence of preferred carbon sources. Previously we have shown that in P. putida, translational inhibition exerted by the carbon repression control protein Crc operates hand-in-hand with the RNA chaperon protein Hfq to reduce translation of the DmpR regulator of the Dmp-pathway. Here, we show that Crc and Hfq co-target four additional sites to form riboprotein complexes within the proximity of the translational initiation sites of genes encoding the first two steps of the Dmp-pathway to mediate two-layered control in the face of selection of preferred substrates. Furthermore, we present evidence that Crc plays a hitherto unsuspected role in maintaining the pVI150 plasmid within a bacterial population, which has implications for (methyl)phenol degradation and a wide variety of other physiological processes encoded by the IncP-2 group of Pseudomonas-specific mega-plasmids. © 2017 Society for Applied Microbiology and John Wiley & Sons Ltd.
Shan, Xiu-ying; Liu, Zhao-liang; Wang, Biao; Guo, Guo-xiang; Wang, Mei-shui; Zhuang, Fu-lian; Cai, Chuan-shu; Zhang, Ming-feng; Zhang, Yan-ding
2011-07-01
To construct lentivector carrying Tie2-Small interfering RNA (SiRNA), so as to study its influence on malignant melanoma cells. Recombinant plasmid pSilencer 1.0-U6-Tie2-siRNA and plasmid pNL-EGFP were digested with XbaI, ligated a target lentiviral transfer plasmid of pNL-EGFP-U6-Tie2-I or pNL-EGFP-U6-Tie2-II, and then the electrophoresis clones was sequenced. Plasmids of pNL-EGFP-U6-Tie2-I and pNL-EGFP-U6-Tie2-II were constructed and combined with pVSVG and pHelper, respectively, to constitute lentiviral vector system of three plasmids. The Lentiviral vector system was transfected into 293T cell to produce pNL-EGFP-U6-Tie2- I and pNL-EGFP-U6-Tie2-II lentivirus. Then the supernatant was collected to determine the titer. Malignant melanoma cells were infected by both lentiviruses and identified by Realtime RT-PCR to assess inhibitory efficiency. The recombinant lentiviral vectors of Tie2-RNAi were constructed successfully which were analyzed with restriction enzyme digestion and identified by sequencing. And the titer of lentiviral vector was 8.8 x 10(3)/ml, which was determined by 293T cell. The results of Realtime RT-PCR demonstrated that the lentiviral vectors of Tie2-RNAi could infect malignant melanoma cells and inhibit the expression of Tie2 genes in malignant melanoma cells (P<0.01). There was no significant difference in the expression level (P>0.05) between the two lentiviral vectors of Tie2-RNAi. Lentivector carrying Tie2-SiRNA can be constructed successfully and inhibit the expression of Tie2 gene in vitro significantly. The study will supply the theory basis for the further research on the inhibition of tumor growth in vivo.
Perkins, Archibald S.; Kirschmeier, Paul T.; Gattoni-Celli, Sebastiano; Weinstein, I. Bernard
1983-01-01
We have developed a transfection vector for animal cells that contains long terminal repeat (LTR) sequences to promote expression. Plasmid p101/101, a derivative of plasmid pBR322 containing the complete Moloney murine sarcoma virus genome, was cut with restriction enzymes and religated so that both the 5′ and 3′ LTRs were retained and all but about 700 base pairs of the intervening viral sequences were removed. To test this vector, the Escherichia coli gene gpt was cloned into a unique PstI site, between the two LTRs, with guanine and cytosine tailing, a method that can be generalized for insertion of any DNA segment into this vector. When DNA from recombinant plasmids in which the gpt gene was inserted in the same transcriptional polarity as the LTR sequences was transfected onto murine or rat fibroblast cultures, we obtained a high yield of Gpt+ colonies. However, plasmid constructs with the gpt gene in the opposite polarity were virtually devoid of activity. With gpt in the proper orientation, restriction enzyme cuts within the LTRs or between the 5′ LTR and the gpt gene reduced transfection by more than 98%, whereas a cut between the gpt gene and the 3′ LTR gave an 80% reduction in activity. Thus, both 5′ and 3′ LTR sequences are essential for optimal gpt expression, although the 5′ LTR appears to play a more important role. When the LTR-gpt plasmid was transfected onto murine leukemia virus-infected mouse fibroblasts, we obtained evidence that RNA copies became pseudotyped into viral particles which could transfer the Gpt+ phenotype into rodent cells with extremely high efficiency. This vector should prove useful for high-efficiency transduction of a variety of genes in mammalian cells. Images PMID:6308426
Ferreira, Joshua P; Peacock, Ryan W S; Lawhorn, Ingrid E B; Wang, Clifford L
2011-12-01
The human cytomegalovirus and elongation factor 1α promoters are constitutive promoters commonly employed by mammalian expression vectors. These promoters generally produce high levels of expression in many types of cells and tissues. To generate a library of synthetic promoters capable of generating a range of low, intermediate, and high expression levels, the TATA and CAAT box elements of these promoters were mutated. Other promoter variants were also generated by random mutagenesis. Evaluation using plasmid vectors integrated at a single site in the genome revealed that these various synthetic promoters were capable of expression levels spanning a 40-fold range. Retroviral vectors were equipped with the synthetic promoters and evaluated for their ability to reproduce the graded expression demonstrated by plasmid integration. A vector with a self-inactivating long terminal repeat could neither reproduce the full range of expression levels nor produce stable expression. Using a second vector design, the different synthetic promoters enabled stable expression over a broad range of expression levels in different cell lines. The online version of this article (doi:10.1007/s11693-011-9089-0) contains supplementary material, which is available to authorized users.
Evaluation of viral and mammalian promoters for driving transgene expression in mouse liver
DOE Office of Scientific and Technical Information (OSTI.GOV)
Al-Dosari, Mohammed; Zhang Guisheng; Knapp, Joseph E.
2006-01-13
Fifteen luciferase plasmid constructs driven by various promoters including cytomegalovirus (CMV), Rous sarcoma virus (RSV), human serum albumin (SA), {alpha}-1 antitrypsin (AAT), cytochrome P450 CYP1A2, CYP2C9, CYP2C18, CYP2D6, CYP3A4, mouse CYP2b10, human amyloid precursor protein (APP), chicken {beta} actin (ACT), nuclear factor {kappa} B (NF{kappa}B), and heat shock protein 70 (HS) promoters were hydrodynamically introduced into mouse hepatocytes, and the level and persistence of luciferase gene expression were examined. Eight hours post-gene transfer, the CMV and AAT promoters showed the highest activity, followed by the CYP2D6, HS, and RSV promoters which were slightly less active. The human serum albumin promotermore » exhibited the lowest activity among the promoters examined. The time course of gene expression showed a two-phase decline in luciferase activity with a rapid phase within First 5-7 days and a slower decline thereafter. Results from Southern and Northern blot analyses revealed a good correlation between the decline of luciferase activity and the decrease in mRNA level, suggesting promoter silencing as the possible mechanism for the observed transient luciferase gene expression. Inclusion of EBN1 and oriP sequences of Epstein-Barr virus into the plasmid extended the period of active transcription for about one week. These results provide important information concerning the role of promoters in regulating transgene expression and for the proper design of plasmids for gene expression and gene therapy.« less
Cui, Yanbing; Meng, Yiwei; Zhang, Juan; Cheng, Bin; Yin, Huijia; Gao, Chao; Xu, Ping; Yang, Chunyu
2017-01-01
In well-established heterologous hosts, such as Escherichia coli, recombinant proteins are usually intracellular and frequently found as inclusion bodies-especially proteins possessing high rare codon content. In this study, successful secretory expression of three hydrolases, in a constructed inducible or constitutive system, was achieved by fusion with a novel signal peptide (Kp-SP) from an actinomycete. The signal peptide efficiently enabled extracellular protein secretion and also contributed to the active expression of the intracellular recombinant proteins. The thermophilic α-amylase gene of Bacillus licheniformis was fused with Kp-SP. Both recombinants, carrying inducible and constitutive plasmids, showed remarkable increases in extracellular and intracellular amylolytic activity. Amylase activity was observed to be > 10-fold in recombinant cultures with the constitutive plasmid, pBSPPc, compared to that in recombinants lacking Kp-SP. Further, the signal peptide enabled efficient secretion of a thermophilic cellulase into the culture medium, as demonstrated by larger halo zones and increased enzymatic activities detected in both constructs from different plasmids. For heterologous proteins with a high proportion of rare codons, it is difficult to obtain high expression in E. coli owing to the codon bias. Here, the fusion of an archaeal homologue of the amylase encoding gene, FSA, with Kp-SP resulted in > 5-fold higher extracellular activity. The successful extracellular expression of the amylase indicated that the signal peptide also contributed significantly to its active expression and signified the potential value of this novel and versatile signal peptide in recombinant protein production. Copyright © 2016 Elsevier Inc. All rights reserved.
CRISPR interference: RNA-directed adaptive immunity in bacteria and archaea
Marraffini, Luciano A.; Sontheimer, Erik J.
2010-01-01
Sequence-directed genetic interference pathways control gene expression and preserve genome integrity in all kingdoms of life. The importance of such pathways is highlighted by the extensive study of RNA interference (RNAi) and related processes in eukaryotes. In many bacteria and most archaea, clustered, regularly interspaced short palindromic repeats (CRISPRs) are involved in a more recently discovered interference pathway that protects cells from bacteriophages and conjugative plasmids. CRISPR sequences provide an adaptive, heritable record of past infections and express CRISPR RNAs — small RNAs that target invasive nucleic acids. Here, we review the mechanisms of CRISPR interference and its roles in microbial physiology and evolution. We also discuss potential applications of this novel interference pathway. PMID:20125085
Live-Cell Imaging of Filoviruses.
Schudt, Gordian; Dolnik, Olga; Becker, Stephan
2017-01-01
Observation of molecular processes inside living cells is fundamental to a deeper understanding of virus-host interactions in filoviral-infected cells. These observations can provide spatiotemporal insights into protein synthesis, protein-protein interaction dynamics, and transport processes of these highly pathogenic viruses. Thus, live-cell imaging provides the possibility for antiviral screening in real time and gives mechanistic insights into understanding filovirus assembly steps that are dependent on cellular factors, which then represent potential targets against this highly fatal disease. Here we describe analysis of living filovirus-infected cells under maximum biosafety (i.e., BSL4) conditions using plasmid-driven expression of fluorescently labeled viral and cellular proteins and/or viral genome-encoded expression of fluorescently labeled proteins. Such multiple-color and multidimensional time-lapse live-cell imaging analyses are a powerful method to gain a better understanding of the filovirus infection cycle.
A quantitative and high-throughput assay of human papillomavirus DNA replication.
Gagnon, David; Fradet-Turcotte, Amélie; Archambault, Jacques
2015-01-01
Replication of the human papillomavirus (HPV) double-stranded DNA genome is accomplished by the two viral proteins E1 and E2 in concert with host DNA replication factors. HPV DNA replication is an established model of eukaryotic DNA replication and a potential target for antiviral therapy. Assays to measure the transient replication of HPV DNA in transfected cells have been developed, which rely on a plasmid carrying the viral origin of DNA replication (ori) together with expression vectors for E1 and E2. Replication of the ori-plasmid is typically measured by Southern blotting or PCR analysis of newly replicated DNA (i.e., DpnI digested DNA) several days post-transfection. Although extremely valuable, these assays have been difficult to perform in a high-throughput and quantitative manner. Here, we describe a modified version of the transient DNA replication assay that circumvents these limitations by incorporating a firefly luciferase expression cassette in cis of the ori. Replication of this ori-plasmid by E1 and E2 results in increased levels of firefly luciferase activity that can be accurately quantified and normalized to those of Renilla luciferase expressed from a control plasmid, thus obviating the need for DNA extraction, digestion, and analysis. We provide a detailed protocol for performing the HPV type 31 DNA replication assay in a 96-well plate format suitable for small-molecule screening and EC50 determinations. The quantitative and high-throughput nature of the assay should greatly facilitate the study of HPV DNA replication and the identification of inhibitors thereof.
Androgen resistance in squirrel monkeys (Saimiri spp.).
Gross, Katherine L; Westberry, Jenne M; Hubler, Tina R; Sadosky, Patti W; Singh, Ravinder J; Taylor, Robert L; Scammell, Jonathan G
2008-08-01
The goal of this study was to understand the basis for high androgen levels in squirrel monkeys (Saimiri spp.). Mass spectrometry was used to analyze serum testosterone, androstenedione, and dihydrotestosterone of male squirrel monkeys during the nonbreeding (n = 7) and breeding (n = 10) seasons. All hormone levels were elevated compared with those of humans, even during the nonbreeding season; the highest levels occurred during the breeding season. The ratio of testosterone to dihydrotestosterone in squirrel monkeys is high during the breeding season compared to man. Squirrel monkeys may have high testosterone to compensate for inefficient metabolism to dihydrotestosterone. We also investigated whether squirrel monkeys have high androgens to compensate for low-activity androgen receptors (AR). The response to dihydrotestosterone in squirrel monkey cells transfected with AR and AR-responsive reporter plasmids was 4-fold, compared with 28-fold in human cells. This result was not due to overexpression of cellular FKBP51, which causes glucocorticoid and progestin resistance in squirrel monkeys, because overexpression of FKBP51 had no effect on dihydrotestosterone-stimulated reporter activity in a human fibroblast cell line. To test whether the inherently low levels of FKBP52 in squirrel monkeys contribute to androgen insensitivity, squirrel monkey cells were transfected with an AR expression plasmid, an AR-responsive reporter plasmid, and a plasmid expressing FKBP52. Expression of FKBP52 decreased the EC50 or increased the maximal response to dihydrotestosterone. Therefore, the high androgen levels in squirrel monkeys likely compensate for their relatively low 5 alpha-reductase activity during the breeding season and AR insensitivity resulting from low cellular levels of FKBP52.
Li, Chen-Chen; Yu, Ji-Yun; Jiang, Min; Tu, Yi-Xian; Ma, Xiao-Lin; Zhang, Fu-Chun
2011-09-01
To enhance the immunocontraceptive effect of Lagurus lagurus zona pellucida 3 DNA vaccine, and to achieve the prospect of application through the pVAX1-sig-LTB-lZP3-C3d3 different immunity pathway. Two adjuvant molecules were constructed into the recombinant plasmid pVAX1-sig-LTB-lZP3-C3d3 as DNA vaccine which contains Escherichia coli heat-labile enterotoxin B subunit and the molecular adjuvant 3 copies of C3d. The results of RT-PCR and western blot showed that the DNA vaccine was expressed in mRNA and protein level. The female C57BL/6 mice were immunized by three ways: intramuscular injection, intranasal or oral route.Antibody levels and types were detected by ELISA. ELISA results showed that recombinant plasmid pVAX1-sig-LTB-lZP3-C3d3 immunization induced specific IgG, IgA levels were significantly different comparing with control (P<0.01). Antifertility experiment showed that the experimental group reduced the average fertility significantly different compared with the control group (P<0.01). Restriction analysis, RT-PCR and Western blot showed that the recombinant plasmid constructed correctly and can be the expression of mRNA and protein levels.It resulted that the recombinant plasmid pVAX1-sig-LTB-lZP3-C3d3 can induce the specific immune response efficiently and enhance the immunocontraceptive effects.
Yin, Yajuan; Cao, Guangli; Xue, Renyu; Gong, Chengliang
2014-10-01
The Streptomyces bacteriophage, φC31, uses a site-specific integrase enzyme to perform efficient recombination. The recombination system uses specific sequences to integrate exogenous DNA from the phage into a host. The sequences are known as the attP site in the phage and the attB site in the host. The system can be used as a genetic manipulation tool. In this study it has been applied to the transformation of cultured BmN cells and the construction of transgenic Bombyx mori individuals. A plasmid, pSK-attB/Pie1-EGFP/Zeo-PASV40, containing a cassette designed to express a egfp-zeocin fusion gene, was co-transfected into cultured BmN cells with a helper plasmid, pSK-Pie1/NLS-Int/NSL. Expression of the egfp-zeocin fusion gene was driven by an ie-1 promoter, downstream of a φC31 attB site. The helper plasmid encoded the φC31 integrase enzyme, which was flanked by two nuclear localization signals. Expression of the egfp-zeocin fusion gene could be observed in transformed cells. The two plasmids were also transferred into silkworm eggs to obtain transgenic silkworms. Successful integration of the fusion gene was indicated by the detection of green fluorescence, which was emitted by the silkworms. Nucleotide sequence analysis demonstrated that the attB site had been cut, to allow recombination between the attB and endogenous pseudo attP sites in the cultured silkworm cells and silkworm individuals.
BioShuttle-mediated Plasmid Transfer
Braun, Klaus; von Brasch, Leonie; Pipkorn, Ruediger; Ehemann, Volker; Jenne, Juergen; Spring, Herbert; Debus, Juergen; Didinger, Bernd; Rittgen, Werner; Waldeck, Waldemar
2007-01-01
An efficient gene transfer into target tissues and cells is needed for safe and effective treatment of genetic diseases like cancer. In this paper, we describe the development of a transport system and show its ability for transporting plasmids. This non-viral peptide-based BioShuttle-mediated transfer system consists of a nuclear localization address sequence realizing the delivery of the plasmid phNIS-IRES-EGFP coding for two independent reporter genes into nuclei of HeLa cells. The quantification of the transfer efficiency was achieved by measurements of the sodium iodide symporter activity. EGFP gene expression was measured with Confocal Laser Scanning Microscopy and quantified with biostatistical methods by analysis of the frequency of the amplitude distribution in the CLSM images. The results demonstrate that the “BioShuttle”-Technology is an appropriate tool for an effective transfer of genetic material carried by a plasmid. PMID:18026568
Vector Development for the Expression of Foreign Proteins in the Vaccine Strain Brucella abortus S19
Comerci, Diego J.; Pollevick, Guido D.; Vigliocco, Ana M.; Frasch, Alberto C. C.; Ugalde, Rodolfo A.
1998-01-01
A vector for the expression of foreign antigens in the vaccine strain Brucella abortus S19 was developed by using a DNA fragment containing the regulatory sequences and the signal peptide of the Brucella bcsp31 gene. This fragment was cloned in broad-host-range plasmid pBBR4MCS, resulting in plasmid pBEV. As a reporter protein, a repetitive antigen of Trypanosoma cruzi was used. The recombinant fusion protein is stably expressed and secreted into the Brucella periplasmic space, inducing a good antibody response against the T. cruzi antigen. The expression of the repetitive antigen in Brucella neither altered its growth pattern nor generated a toxic or lethal effect during experimental infection. The application of this strategy for the generation of live recombinant vaccines and the tagging of B. abortus S19 vaccine is discussed. This is the first time that a recombinant protein has been expressed in the periplasm of brucellae. PMID:9673273
Zhang, Jian-Xin; Wu, Yun-Feng; Wang, Xiu-Min
2007-11-01
HC-pro gene of Watermelon Mosaic virus was obtained by RT-PCR was 1371bp in length. It was cloned into pPI(9K, then the eucaryotic recombinant expression plasmid pPIC9K-WHC was constructed. After being linearized with restriction endonuclease Sal I , the recombinant plasmid was transformed into Pichia pastoris GS115 by electroporation. The high copy transformants with Mut+ /His+ phenotype were selected by RT-PCR and screening on G418, MD and MM medium. Induced by methanol for 5 days, the culture supernatant was analyzed by SDS-PAGE, the results showed that a specific protein with a molecular weight of about 66 kD was expressed. Western blot analysis proved that the expression protein could specifically bind to HC-Pro polyclonal antibody. Far western blot analysis proved that the expression protein could bind to coat protein, given support to "bridge" hypothesis that HC-Pro help aphid transmission of non-persistent viruses.
Huang, Bi; Bao, Lang; Zhong, Qi; Shang, Zheng-ling; Zhang, Hui-dong; Zhang, Ying
2008-02-01
To construct the eukaryotic experssion vector of LipL32 gene from Leptospira serovar Lai and express the recombinant plasmid in COS-7 cell. The LipL32 gene was amplified from Leptospira strain 017 genomic DNA by PCR and cloned into pcDNA3.1, through restriction nuclease enzyme digestion. Then the recombinant plasmid was transformed into E.coli DH5alpha. After identified by nuclease digestion, PCR and sequencing analysis, the recombinant vector was transfected into COS-7 cell with lipsome. The expression of the target gene was detected by RT-PCR and Western blot. The eukaryotic experssion vector pcDNA3.1-LipL32 was successfully constructed and stably expressed in COS-7 cell. The eukaryotic recombinant vector of outer membrane protein LipL32 gene from Leptospira serovar Lai can be expressed in mammalian cell, which provides an experimental basis for the application of the Leptospira DNA vaccine.
Lebas, Benoît; Galley, Julien; Renaud-Gabardos, Edith; Pujol, Françoise; Lenfant, Françoise; Garmy-Susini, Barbara; Chaufour, Xavier; Prats, Anne-Catherine
2017-04-01
Critical leg ischemia (CLI) represents the ultimate stage of peripheral arterial disease. Despite current surgery advances, patients with CLI have limited therapeutic options. Therapeutic angiogenesis thus appears as a powerful approach, aiming to stimulate vessel formation by angiogenic molecules administration. In this context, combined gene therapy has been proved to be the most efficient. The present study aims to compare, in a preclinical mouse model, the therapeutic benefit of a combination of 2 angiogenic factors fibroblast growth factor 2 (FGF2) and Cyr61 using plasmid and viral vectors, able to generate short- or long-term transgene expression in the leg, respectively. Two therapeutic genes, FGF2 and Cyr61, were introduced into internal ribosome entry site-based expression vectors (FGFiCyr) allowing co-expression of the 2 transgenes. The proangiogenic plasmid pC-FGFiCyr was assessed by intramuscular administration followed by electrotransfer into ischemic legs. To generate long-term transgene expression, the FGFiCyr bicistronic cassette was introduced into an adenoassociated virus-derived vector (rAAV). The rAAV treatment was performed either before or immediately after surgery. Therapeutic effects were analyzed by laser Doppler imaging, clinical score, and angiography. The plasmid pC-FGFiCyr improved revascularization, reperfusion, and clinical score. Surprisingly, when AAV-FGFiCyr was injected 21 or 28 days before surgery, the proangiogenic rAAV was drastically deleterious on all measured parameters. In contrast, when administrated shortly after surgery, AAV-FGFiCyr generated therapeutic benefits, with a significantly better clinical score than after treatment with the plasmid. Therapeutic effects of the angiogenic combination FGF2-Cyr61 is observed with short-term transgene expression, but the treatment is significantly more efficient when a long-term expression viral vector is used. However, the rAAV-FGFiCyr generated therapeutic benefit only when injected in an ischemic leg, whereas the same dose of rAAV exhibited deleterious effects when administrated to healthy animals. These data may contribute to the understanding of the moderate success of proangiogenic treatments in CLI gene therapy clinical assays. Copyright © 2016 Elsevier Inc. All rights reserved.
Wang, Guo-zhong; Liu, Jing-hua; Lü, Shu-zheng; Lü, Yun; Guo, Cheng-jun; Zhao, Dong-hui; Fang, Dong-ping; He, Dong-fang; Zhou, Yuan; Ge, Chang-jiang
2011-05-01
It has been proven that ultrasonic destruction of microbubbles can enhance gene transfection efficiency into the noncardiac cells, but there are few reports about cardiac myocytes. Moreover, the exact mechanisms are not yet clear; whether the characteristic of microbubbles can affect the gene transfection efficiency or not is still controversial. This study was designed to investigate whether the ultrasound destruction of gene-loaded microbubbles could enhance the plasmids carried reporter gene transfection in primary cultured myocardial cell, and evaluate the effects of microbubbles characteristics on the transgene expression in cardiac myocytes. The β-galactosidase plasmids attached to the two types of microbubbles, air-contained sonicated dextrose albumin (ASDA) and perfluoropropane-exposed sonicated dextrose albumin (PESDA) were prepared. The gene transfection into cardiac myocytes was performed in vitro by naked plasmids, ultrasound exposure, ultrasonic destruction of gene-loaded microbubbles and calcium phosphate precipitation, and then the gene expression and cell viability were analyzed. The ultrasonic destruction of gene-loaded microbubbles enhanced gene expression in cardiac myocytes compared with naked plasmid transfection ((51.95 ± 2.41) U/g or (29.28 ± 3.65) U/g vs. (0.84 ± 0.21) U/g, P < 0.01), and ultrasonic destruction PESDA resulted in more significant gene expression than ASDA ((51.95 ± 2.41) U/g vs. (29.28 ± 3.65) U/g, P < 0.05). Ultrasonic destruction of microbubbles during calcium phosphate precipitation gene transfection enhanced β-galactosidase activity nearly 8-fold compared with calcium phosphate precipitation gene transfection alone ((111.35 ± 11.21) U/g protein vs. (14.13 ± 2.58) U/g protein, P < 0.01). Even 6 hours after calcium phosphate precipitation gene transfection, ultrasound-mediated microbubbles destruction resulted in more intense gene expression ((35.63 ± 7.65) U/g vs. (14.13 ± 2.58) U/g, P < 0.05). Ultrasonic destruction of microbubbles might be a promising method for the delivery of non-viral DNA into cardiac myocytes, and the gene tranfection is related to the characteristics of microbubbles.
Phage Lambda P Protein: Trans-Activation, Inhibition Phenotypes and their Suppression
Hayes, Sidney; Erker, Craig; Horbay, Monique A.; Marciniuk, Kristen; Wang, Wen; Hayes, Connie
2013-01-01
The initiation of bacteriophage λ replication depends upon interactions between the oriλ DNA site, phage proteins O and P, and E. coli host replication proteins. P exhibits a high affinity for DnaB, the major replicative helicase for unwinding double stranded DNA. The concept of P-lethality relates to the hypothesis that P can sequester DnaB and in turn prevent cellular replication initiation from oriC. Alternatively, it was suggested that P-lethality does not involve an interaction between P and DnaB, but is targeted to DnaA. P-lethality is assessed by examining host cells for transformation by ColE1-type plasmids that can express P, and the absence of transformants is attributed to a lethal effect of P expression. The plasmid we employed enabled conditional expression of P, where under permissive conditions, cells were efficiently transformed. We observed that ColE1 replication and plasmid establishment upon transformation is extremely sensitive to P, and distinguish this effect from P-lethality directed to cells. We show that alleles of dnaB protect the variant cells from P expression. P-dependent cellular filamentation arose in ΔrecA or lexA[Ind-] cells, defective for SOS induction. Replication propagation and restart could represent additional targets for P interference of E. coli replication, beyond the oriC-dependent initiation step. PMID:23389467
Juergens, Hannes; Varela, Javier A; Gorter de Vries, Arthur R; Perli, Thomas; Gast, Veronica J M; Gyurchev, Nikola Y; Rajkumar, Arun S; Mans, Robert; Pronk, Jack T; Morrissey, John P; Daran, Jean-Marc G
2018-05-01
While CRISPR-Cas9-mediated genome editing has transformed yeast research, current plasmids and cassettes for Cas9 and guide-RNA expression are species specific. CRISPR tools that function in multiple yeast species could contribute to the intensifying research on non-conventional yeasts. A plasmid carrying a pangenomic origin of replication and two constitutive expression cassettes for Cas9 and ribozyme-flanked gRNAs was constructed. Its functionality was tested by analyzing inactivation of the ADE2 gene in four yeast species. In two Kluyveromyces species, near-perfect targeting (≥96%) and homologous repair (HR) were observed in at least 24% of transformants. In two Ogataea species, Ade- mutants were not observed directly after transformation, but prolonged incubation of transformed cells resulted in targeting efficiencies of 9% to 63% mediated by non-homologous end joining (NHEJ). In an Ogataea parapolymorpha ku80 mutant, deletion of OpADE2 mediated by HR was achieved, albeit at low efficiencies (<1%). Furthermore the expression of a dual polycistronic gRNA array enabled simultaneous interruption of OpADE2 and OpYNR1 demonstrating flexibility of ribozyme-flanked gRNA design for multiplexing. While prevalence of NHEJ prevented HR-mediated editing in Ogataea, such targeted editing was possible in Kluyveromyces. This broad-host-range CRISPR/gRNA system may contribute to exploration of Cas9-mediated genome editing in other Saccharomycotina yeasts.
Molecular Toolkit for Gene Expression Control and Genome Modification in Rhodococcus opacus PD630
DeLorenzo, Drew M.; Rottinghaus, Austin G.; Henson, William R.; ...
2018-01-24
Rhodococcus opacus PD630 is a non-model, gram-positive bacterium that possesses desirable traits for lignocellulosic biomass conversion. In particular, it has a relatively rapid growth rate, exhibits genetic tractability, produces high quantities of lipids, and can tolerate and consume toxic, lignin-derived aromatic compounds. Despite these unique, industrially relevant characteristics, R. opacus has been underutilized due to a lack of reliable genetic parts and engineering tools. In this work, we developed a molecular toolbox for reliable gene expression control and genome modification in R. opacus. To facilitate predictable gene expression, a constitutive promoter library spanning ~45-fold in output was constructed. To improvemore » the characterization of available plasmids, the copy numbers of four heterologous and nine endogenous plasmids were determined using quantitative PCR. The molecular toolbox was further expanded by screening a previously unreported antibiotic resistance marker (HygR) and constructing a curable plasmid backbone for temporary gene expression (pB264). Furthermore, a system for genome modification was devised, and three neutral integration sites were identified using a novel combination of transcriptomic data, genomic architecture, and growth rate analysis. Finally, the first reported system for targeted, tunable gene repression in Rhodococcus was developed by utilizing CRISPR interference (CRISPRi). Overall, this work greatly expands the ability to manipulate and engineer R. opacus, making it a viable new chassis for bioproduction from renewable feedstocks.« less
Molecular Toolkit for Gene Expression Control and Genome Modification in Rhodococcus opacus PD630
DOE Office of Scientific and Technical Information (OSTI.GOV)
DeLorenzo, Drew M.; Rottinghaus, Austin G.; Henson, William R.
Rhodococcus opacus PD630 is a non-model, gram-positive bacterium that possesses desirable traits for lignocellulosic biomass conversion. In particular, it has a relatively rapid growth rate, exhibits genetic tractability, produces high quantities of lipids, and can tolerate and consume toxic, lignin-derived aromatic compounds. Despite these unique, industrially relevant characteristics, R. opacus has been underutilized due to a lack of reliable genetic parts and engineering tools. In this work, we developed a molecular toolbox for reliable gene expression control and genome modification in R. opacus. To facilitate predictable gene expression, a constitutive promoter library spanning ~45-fold in output was constructed. To improvemore » the characterization of available plasmids, the copy numbers of four heterologous and nine endogenous plasmids were determined using quantitative PCR. The molecular toolbox was further expanded by screening a previously unreported antibiotic resistance marker (HygR) and constructing a curable plasmid backbone for temporary gene expression (pB264). Furthermore, a system for genome modification was devised, and three neutral integration sites were identified using a novel combination of transcriptomic data, genomic architecture, and growth rate analysis. Finally, the first reported system for targeted, tunable gene repression in Rhodococcus was developed by utilizing CRISPR interference (CRISPRi). Overall, this work greatly expands the ability to manipulate and engineer R. opacus, making it a viable new chassis for bioproduction from renewable feedstocks.« less
Processing of Nonconjugative Resistance Plasmids by Conjugation Nicking Enzyme of Staphylococci
DOE Office of Scientific and Technical Information (OSTI.GOV)
Pollet, Rebecca M.; Ingle, James D.; Hymes, Jeff P.
Antimicrobial resistance inStaphylococcus aureuspresents an increasing threat to human health. This resistance is often encoded on mobile plasmids, such as pSK41; however, the mechanism of transfer of these plasmids is not well understood. In this study, we first examine key protein-DNA interactions formed by the relaxase enzyme, NES, which initiates and terminates the transfer of the multidrug resistance plasmid pSK41. Two loops on the NES protein, hairpin loops 1 and 2, form extensive contacts with the DNA hairpin formed at theoriTregion of pSK41, and here we establish that these contacts are essential for proper DNA cleavage and religation by themore » full 665-residue NES proteinin vitro. Second, pSK156 and pCA347 are nonconjugativeStaphylococcus aureusplasmids that contain sequences similar to theoriTregion of pSK41 but differ in the sequence predicted to form a DNA hairpin. We show that pSK41-encoded NES is able to bind, cleave, and religate theoriTsequences of these nonconjugative plasmidsin vitro. Although pSK41 could mobilize a coresident plasmid harboring its cognateoriT, it was unable to mobilize plasmids containing the pSK156 and pCA347 variantoriTmimics, suggesting that an accessory protein like that previously shown to confer specificity in the pWBG749 system may also be involved in transmission of plasmids containing a pSK41-likeoriT. These data indicate that the conjugative relaxase intransmechanism recently described for the pWBG749 family of plasmids also applies to the pSK41 family of plasmids, further heightening the potential significance of this mechanism in the horizontal transfer of staphylococcal plasmids. IMPORTANCEUnderstanding the mechanism of antimicrobial resistance transfer in bacteria such asStaphylococcus aureusis an important step toward potentially slowing the spread of antimicrobial-resistant infections. This work establishes protein-DNA interactions essential for the transfer of theStaphylococcus aureusmultiresistance plasmid pSK41 by its relaxase, NES. This enzyme also processed variantoriT-like sequences found on numerous plasmids previously considered nontransmissible, suggesting that in conjunction with an uncharacterized accessory protein, these plasmids may be transferred horizontally via a relaxase intransmechanism. These findings have important implications for our understanding of staphylococcal resistance plasmid evolution.« less
Davila, Hugo H; Magee, Thomas R; Vernet, Dolores; Rajfer, Jacob; Gonzalez-Cadavid, Nestor F
2004-11-01
The goal of the present study was to investigate the antifibrotic role of inducible nitric oxide synthase (iNOS) in Peyronie's disease (PD) by determining whether a plasmid expressing iNOS (piNOS) injected into a PD-like plaque can induce regression of the plaque. A PD-like plaque was induced with fibrin in the penile tunica albuginea of mice and then injected with a luciferase-expressing plasmid (pLuc), either alone or with piNOS, following luciferase expression in vivo by bioluminescence imaging. Rats were treated with either piNOS, an empty control plasmid (pC), or saline. Other groups were treated with pC or piNOS, in the absence of fibrin. Tissue sections were stained for collagen, transforming growth factor (TGF) beta1, and plasminogen-activator inhibitor (PAI-1) as profibrotic factors; copper-zinc superoxide dismutase (CuZn SOD) as scavenger of reactive oxygen species (ROS); and nitrotyrosine to detect nitric oxide reaction with ROS. Quantitative image analysis was applied. Both iNOS and xanthine oxido-reductase (XOR; oxidative stress) were estimated by Western blot analysis. Luciferase reporter expression was restricted to the penis, peaked at 3 days after injection, but continued for at least 3 wk. In rats receiving piNOS, iNOS expression also peaked at 3 days, but expression decreased at the end of treatment, when a considerable reduction of plaque size occurred. Protein nitrotyrosine, XOR, and CuZn SOD increased, and TGFbeta1 and PAI-1 decreased. The piNOS gene transfer regressed the PD plaque and expression of profibrotic factors, supporting the view that endogenous iNOS induction in PD is defense mechanism by the tissue against fibrosis.
Sieben, Michaela; Steinhorn, Gregor; Müller, Carsten; Fuchs, Simone; Ann Chin, Laura; Regestein, Lars; Büchs, Jochen
2016-11-01
Plasmids are common vectors to genetically manipulate Escherichia coli or other microorganisms. They are easy to use and considerable experience has accumulated on their application in heterologous protein production. However, plasmids can be lost during cell growth, if no selection pressure like, e.g., antibiotics is used, hampering the production of the desired protein and endangering the economic success of a biotechnological production process. Thus, in this study the Continuously Operated Shaken BIOreactor System (COSBIOS) is applied as a tool for fast parallel testing of strain stability and operation conditions and to evaluate measures to counter such plasmid loss. In specific, by applying various ampicillin concentrations, the lowest effective ampicillin dosage is investigated to secure plasmid stability while lowering adverse ecological effects. A significant difference was found in the growth rates of plasmid-bearing and plasmid-free cells. The undesired plasmid-free cells grew 30% faster than the desired plasmid-bearing cells. During the testing of plasmid stability without antibiotics, the population fraction of plasmid-bearing cells rapidly decreased in continuous culture to zero within the first 48 h. An initial single dosage of ampicillin did not prevent plasmid loss. By contrast, a continuous application of a low dosage of 10 µg/mL ampicillin in the feed medium maintained plasmid stability in the culture. Consequently, the COSBIOS is an apt reactor system for measuring plasmid stability and evaluating methods to enhance this stability. Hence, decreased production of heterologous protein can be prevented. © 2016 American Institute of Chemical Engineers Biotechnol. Prog., 32:1418-1425, 2016. © 2016 American Institute of Chemical Engineers.
[Cloning and gene expression in lactic acid bacteria].
Bondarenko, V M; Beliavskaia, V A
2000-01-01
The possibility of using the genera Lactobacillus and Lactococcus as vector representatives is widely discussed at present. The prospects of the construction of recombinant bacteria are closely connected with the solution of a number of problems: the level of the transcription of cloned genes, the effectiveness of the translation of heterologous mRNA, the stability of protein with respect to bacterial intracellular proteases, the method by protein molecules leave the cell (by secretion or as the result of lysis). To prevent segregation instability, the construction of vector molecules on the basis of stable cryptic plasmids found in wild strains of lactic acid bacteria was proposed. High copying plasmids with low molecular weight were detected in L. plantarum and L. pentosus strains. Several plasmids with molecular weights of 1.7, 1.8 and 2.3 kb were isolated from bacterial cells to be used as the basis for the construction of vector molecules. Genes of chloramphenicol- and erythromycin-resistance from Staphylococcus aureus plasmids were used as marker genes ensuring cell transformation. The vector plasmids thus constructed exhibited high transformation activity in the electroporation of different strains, including L. casei, L. plantarum, L. acidophilus, L. fermentum and L. brevis which could be classified with the replicons of a wide circle of hosts. But the use of these plasmids was limited due to the risk of the uncontrolled dissemination of recombinant plasmids. L. acidophilus were also found to have strictly specific plasmids with good prospects of being used as the basis for the creation of vectors, incapable of dissemination. In addition to the search of strain-specific plasmids, incapable of uncontrolled gene transmission, the use of chromosome-integrated heterologous genes is recommended in cloning to ensure the maximum safety.
Gritz, L; Davies, J
1983-11-01
The plasmid-borne gene hph coding for hygromycin B phosphotransferase (HPH) in Escherichia coli has been identified and its nucleotide sequence determined. The hph gene is 1026 nucleotides long, coding for a protein with a predicted Mr of 39 000. The hph gene was placed in a shuttle plasmid vector, downstream from the promoter region of the cyc 1 gene of Saccharomyces cerevisiae, and an hph construction containing a single AUG in the 5' noncoding region allowed direct selection following transformation in yeast and in E. coli. Thus the hph gene can be used in cloning vectors for both pro- and eukaryotes.
Role of the XIAP-Cooper Axis in Prostate Cancer
2011-04-01
growing yeast transformed with a plasmid encoding human XIAP in Cu-free selective medium. Supplemental Cu was added to the medium 1-2 hours before...human XIAP into yeast deletion strains. We selected 16 deletion strains from the same background as our wild-type control (BY4741) for analysis. These...transformed with the XIAP expression plasmid. This objective is complete. Assess yeast deletion mutants for delivery of copper to XIAP. After
Lucas, Carolina Gonçalves de Oliveira; Rigato, Paula Ordonhez; Gonçalves, Jorge Luiz Santos; Sato, Maria Notomi; Maciel, Milton; Peçanha, Ligia Maria Torres; August, J. Thomas; de Azevedo Marques, Ernesto Torres; de Arruda, Luciana Barros
2014-01-01
We have previously demonstrated that a DNA vaccine encoding HIV-p55gag in association with the lysosomal associated membrane protein-1 (LAMP-1) elicited a greater Gag-specific immune response, in comparison to a DNA encoding the native gag. In vitro studies have also demonstrated that LAMP/Gag was highly expressed and was present in MHCII containing compartments in transfected cells. In this study, the mechanisms involved in these processes and the relative contributions of the increased expression and altered traffic for the enhanced immune response were addressed. Cells transfected with plasmid DNA constructs containing p55gag attached to truncated sequences of LAMP-1 showed that the increased expression of gag mRNA required p55gag in frame with at least 741 bp of the LAMP-1 luminal domain. LAMP luminal domain also showed to be essential for Gag traffic through lysosomes and, in this case, the whole sequence was required. Further analysis of the trafficking pathway of the intact LAMP/Gag chimera demonstrated that it was secreted, at least in part, associated with exosome-like vesicles. Immunization of mice with LAMP/gag chimeric plasmids demonstrated that high expression level alone can induce a substantial transient antibody response, but targeting of the antigen to the endolysosomal/secretory pathways was required for establishment of cellular and memory response. The intact LAMP/gag construct induced polyfunctional CD4+ T cell response, which presence at the time of immunization was required for CD8+ T cell priming. LAMP-mediated targeting to endolysosomal/secretory pathway is an important new mechanistic element in LAMP-mediated enhanced immunity with applications to the development of novel anti-HIV vaccines and to general vaccinology field. PMID:24932692
DOE Office of Scientific and Technical Information (OSTI.GOV)
Tratschin, J.D.; West, M.H.P.; Sandbank, T.
1984-10-01
The authors have used the defective human parvovirus adeno-associated virus (AAV) as a novel eurocaryotic vector (parvector) for the expression of a foreign gene in human cells. The recombinant, pAV2, contains the AAV genome in a pBR322-derived bacterial plasmid. When pAV2 is transfected into human cells together with helper adenovirus particles, the AAV genome is rescued from the recombinant plasmid and replicated to produce infectious AAV particles at high efficiency. To create a vector, we inserted a procaryotic sequence coding for chloramphenicol acetyltransferase (CAT) into derivatives of pAV2 following either of the AAV promoters p/sub 40/ (pAVHiCAT) and p/sub 19/more » (pAVBcCAT). When transfected into human 293 cells or HeLa cells, pAVHiCAT expressed CAT activity in the absence of adenovirus. In the presence of adenovirus, this vector produced increased amounts of CAT activity and the recombinant AAV-CAT genome was replicated. In 293 cells, pAVBcCAT expressed a similar amount of CAT activity in the absence or presence of adenovirus and the recombinant AAV-CAT genome was not replicated. In HeLa cells, pAVBcCAT expressed low levels of CAT activity, but this level was elevated by coinfection with adenovirus particles or by cotransfection with a plasmid which expressed the adenovirus early region 1A (E1A) product. The E1A product is a transcriptional activator and is expressed in 293 cells. Thus, expression from two AAV promoters is differentially regulated: expression from p/sub 19/ is increased by E1A, whereas p/sub 40/ yields high levels of constitutive expression in the absence of E1A. Both AAV vectors were packaged into AAV particles by complementation with wild-type AAV and yielded CAT activity when subsequently infected into cells in the presence of adenovirus.« less
Modeling Transformation and Conjugation in Bacteria Populations
NASA Astrophysics Data System (ADS)
Russo, John; Dong, J. J.
The rise of antibiotic resistance in bacteria populations is a growing threat to medical treatment of diseases. Transformation, where a cell absorbs a plasmid from its environment, and conjugation, direct transfer of a plasmid from one cell to another, are the two main mechanisms of emergence of antibiotic resistance. We model the processes using a combined approach of Kinetic Monte Carlo simulation and differential equations to describe the plasmid-carrying and plasmid-free populations. Through analysis of our results, we characterize the conditions that lead to dominance of the antibiotic resistant population. NSF-DMR #1248387.
Baca, A M; Hol, W G
2000-02-01
Parasite genes often use codons which are rarely used in the highly expressed genes of Escherichia coli, possibly resulting in translational stalling and lower yields of recombinant protein. We have constructed the "RIG" plasmid to overcome the potential codon-bias problem seen in Plasmodium genes. RIG contains the genes that encode three tRNAs (Arg, Ile, Gly), which recognise rare codons found in parasite genes. When co-transformed into E. coli along with expression plasmids containing parasite genes, RIG can greatly increase levels of overexpressed protein. Codon frequency analysis suggests that RIG may be applied to a variety of protozoan and helminth genes.
Xu, Leyuan; Kittrell, Shannon; Yeudall, W Andrew; Yang, Hu
2016-11-01
Folic acid (FA)-decorated polyamidoamine dendrimer G4 (G4-FA) was synthesized and studied for targeted delivery of genes to head and neck cancer cells expressing high levels of folate receptors (FRs). Cellular uptake, targeting specificity, cytocompatibility and transfection efficiency were evaluated. G4-FA competes with free FA for the same binding site. G4-FA facilitates the cellular uptake of DNA plasmids in a FR-dependent manner and selectively delivers plasmids to FR-high cells, leading to enhanced gene expression. G4-FA is a suitable vector to deliver genes selectively to head and neck cancer cells. The fundamental understandings of G4-FA as a vector and its encouraging transfection results for head and neck cancer cells provided support for its further testing in vivo.
Cloning and expression of L-asparaginase gene in Escherichia coli.
Wang, Y; Qian, S; Meng, G; Zhang, S
2001-08-01
The L-asparaginase (ASN) from Escherichia coli AS1.357 was cloned as a DNA fragment generated using polymerase chain reaction technology and primers derived from conserved regions of published ASN gene sequences. Recombinant plasmid pASN containing ASN gene and expression vector pBV220 was transformed in different E. coli host strains. The activity and expression level of ASN in the engineering strains could reach 228 IU/mL of culture fluid and about 50% of the total soluble cell protein respectively, more than 40-fold the enzyme activity of the wild strain. The recombinant plasmid in E. coli AS1.357 remained stable after 72 h of cultivation and 5 h of heat induction without selective pressure. The ASN gene of E. coli AS1.357 was sequenced and had high homology compared to the reported data.
Subunit association of gamma-glutamyltranspeptidase of Escherichia coli K-12.
Hashimoto, W; Suzuki, H; Nohara, S; Tachi, H; Yamamoto, K; Kumagai, H
1995-12-01
gamma-Glutamyltranspeptidase [EC 2.3.2.2] of Escherichia coli K-12 consists of one large subunit and one small subunit, which can be separated from each other by high-performance liquid chromatography. Using ion spray mass spectrometry, the masses of the large and the small subunit were determined to be 39,207 and 20,015, respectively. The large subunit exhibited no gamma-glutamyltranspeptidase activity and the small subunit had little enzymatic activity, but a mixture of the two subunits showed partial recovery of the enzymatic activity. The results of native-polyacrylamide gel electrophoresis suggested that they could partially recombine, and that the recombined dimer exhibited enzymatic activity. The gene of gamma-glutamyltranspeptidase encoded a signal peptide, and the large and small subunits in a single open reading frame in that order. Two kinds of plasmid were constructed encoding the signal peptide and either the large or the small subunit. A gamma-glutamyltranspeptidase-less mutant of E. coli K-12 was transformed with each plasmid or with both of them. The strain harboring the plasmid encoding each subunit produced a small amount of the corresponding subunit protein in the periplasmic space but exhibited no enzymatic activity. The strain transformed with both plasmids together exhibited the enzymatic activity, but its specific activity was approximately 3% of that of a strain harboring a plasmid encoding the intact structural gene. These results indicate that a portion of the separated large and small subunits can be reconstituted in vitro and exhibit the enzymatic activity, and that the expressed large and small subunits independently are able to associate in vivo and be folded into an active structure, though the specific activity of the associated subunits was much lower than that of native enzyme. This suggests that the synthesis of gamma-glutamyltranspeptidase in a single precursor polypeptide and subsequent processing are more effective to construct the intact structure of gamma-glutamyltranspeptidase than the association of the separated large and small subunits.
Protective Cellular Immunity Against Influenza Virus Induced by Plasmid Inoculation of Newborn Mice
Bot, Adrian; Bot, Simona; García-Sastre, Adolfo
1998-01-01
Neonate organisms display an intrinsic disability to mount effective immune responses to infectious agents or conventional vaccines. Whereas low. doses of antigens trigger a suboptimal response, higher doses are frequently associated with tolerance induction. We investigated the ability of a plasmid-expressing nucleoprotein of influenza virus to prime a specific cellular immune response when administered to newborn mice. We found that persistent exposure to antigen following plasmid inoculation of neonates leads to a vigorous priming of specific CTLs rather than tolerance induction. The CTLs were cross-reactive against multiple strains of type A influenza viruses and produced IFNγ but no IL-4. The immunity triggered by plasmid inoculation of neonates was protective in terms of pulmonary virus clearance as well as survival rate following lethal challenge with influenza virus. Whereas the persistence of the plasmid at the site of injection was readily demonstrable in adult mice at 3 months after inoculation, mice immunized as newborns displayed no plasmid at 3 months and very little at 1 month after injection. Thus, DNA-based immunization of neonates may prove an effective and safe vaccination strategy for induction of cellular immunity against microbes that cause serious infectious diseases in the early period of life. PMID:9851359
CRISPR/Cas9-based genome editing in mice by single plasmid injection.
Fujihara, Yoshitaka; Ikawa, Masahito
2014-01-01
CRISPR/Cas-mediated genome modification has opened a new era for elucidating gene function. Gene knockout mice can be generated by injecting humanized Cas9 (hCas9) mRNA and guide RNA (sgRNA) into fertilized eggs. However, delivery of RNA instead of DNA to the fertilized oocyte requires extra preparation and extra care with storage. To simplify the method of delivery, we injected the circular pX330 plasmids expressing both hCas9 and sgRNA and found that mutant mice were generated as efficiently as with RNA injection. Different from the linearized plasmid, the circular plasmid decreased the chance of integration into the host genome. We also developed the pCAG-EGxxFP reporter plasmid for evaluating the sgRNA activity by observing EGFP fluorescence in HEK293T cells. The combination of these techniques allowed us to develop a rapid, easy, and reproducible strategy for targeted mutagenesis in living mice. This chapter provides an experimental protocol for the design of sgRNAs, the construction of pX330-sgRNA and pCAG-EGxxFP-target plasmids, the validation of cleavage efficiency in vitro, and the generation of targeted gene mutant mice. These mice can be generated within a month.
O'Brien, Travis J; Jiang, Guohui; Chun, Gina; Mandel, H George; Westphal, Craig S; Kahen, Kaveh; Montaser, Akbar; States, J Christopher; Patierno, Steven R
2006-11-07
Some hexavalent chromium [Cr(VI)]-containing compounds are lung carcinogens. Once within cells, Cr(VI) is reduced to trivalent chromium [Cr(III)] which displays an affinity for both DNA bases and the phosphate backbone. A diverse array of genetic lesions is produced by Cr including Cr-DNA monoadducts, DNA interstrand crosslinks (ICLs), DNA-Cr-protein crosslinks (DPCs), abasic sites, DNA strand breaks and oxidized bases. Despite the large amount of information available on the genotoxicity of Cr, little is known regarding the molecular mechanisms involved in the removal of these lesions from damaged DNA. Recent work indicates that nucleotide excision repair (NER) is involved in the processing of Cr-DNA adducts in human and rodent cells. In order to better understand this process at the molecular level and begin to identify the Cr-DNA adducts processed by NER, the incision of CrCl(3) [Cr(III)]-damaged plasmid DNA was studied using a thermal-resistant UvrABC NER endonuclease from Bacillus caldotenax (Bca). Treatment of plasmid DNA with Cr(III) (as CrCl(3)) increased DNA binding as a function of dose. For example, at a Cr(III) concentration of 1 microM we observed approximately 2 Cr(III)-DNA adducts per plasmid. At this same concentration of Cr(III) we found that approximately 17% of the plasmid DNA contained ICLs ( approximately 0.2 ICLs/plasmid). When plasmid DNA treated with Cr(III) (1 microM) was incubated with Bca UvrABC we observed approximately 0.8 incisions/plasmid. The formation of endonuclease IV-sensitive abasic lesions or Fpg-sensitive oxidized DNA bases was not detected suggesting that the incision of Cr(III)-damaged plasmid DNA by UvrABC was not related to the generation of oxidized DNA damage. Taken together, our data suggest that a sub-fraction of Cr(III)-DNA adducts is recognized and processed by the prokaryotic NER machinery and that ICLs are not necessarily the sole lesions generated by Cr(III) that are substrates for NER.
Expression of bacteriocin LsbB is dependent on a transcription terminator.
Uzelac, Gordana; Miljkovic, Marija; Lozo, Jelena; Radulovic, Zorica; Tosic, Natasa; Kojic, Milan
2015-10-01
The production of LsbB, leaderless class II bacteriocin, is encoded by genes (lsbB and lmrB) located on plasmid pMN5 in Lactococcus lactis BGMN1-5. Heterologous expression of the lsbB gene using the pAZIL vector (pAZIL-lsbB) in L. lactis subsp. cremoris MG7284 resulted in a significant reduction (more than 30 times) of bacteriocin LsbB expression. Subcloning and deletion experiments with plasmid pMN5 revealed that full expression of LsbB requires the presence of a complete transcription terminator located downstream of the lsbB gene. RNA stability analysis revealed that the presence of a transcription terminator increased the RNA stability by three times and the expression of LsbB by 30 times. The study of the influence of transcription terminator on the expression of other bacteriocin genes (lcnB, for lactococcin B production) indicated that this translational terminator likely functions in a lsbB-specific manner rather than in a general manner. Copyright © 2015 Elsevier GmbH. All rights reserved.
Harker, A R; Olsen, R H; Seidler, R J
1989-01-01
Plasmid pJP4 enables Alcaligenes eutrophus JMP134 to degrade 3-chlorobenzoate and 2,4-dichlorophenoxyacetic acid (TFD). Plasmid pRO101 is a derivative of pJP4 obtained by insertion of Tn1721 into a nonessential region of pJP4. Plasmid pRO101 was transferred by conjugation to several Pseudomonas strains and to A. eutrophus AEO106, a cured isolate of JMP134. AEO106(pRO101) and some Pseudomonas transconjugants grew on TFD. Transconjugants with a chromosomally encoded phenol hydroxylase also degraded phenoxyacetic acid (PAA) in the presence of an inducer of the TFD pathway, namely, TFD or 3-chlorobenzoate. A mutant of one such phenol-degrading strain, Pseudomonas putida PPO300(pRO101), grew on PAA as the sole carbon source in the absence of inducer. This isolate carried a mutant plasmid, designated pRO103, derived from pRO101 through the deletion of a 3.9-kilobase DNA fragment. Plasmid pRO103 constitutively expressed the TFD pathway, and this allowed the metabolism of PAA in the absence of the inducer, TFD. Complementation of pRO103 in trans by a DNA fragment corresponding to the fragment deleted in pRO101 indicates that a negative control-regulatory gene (tfdR) is located on the BamHI E fragment of pRO101. Other subcloning experiments resulted in the cloning of the tfdA monooxygenase gene on a 3.5-kilobase fragment derived from pRO101. This subclone, in the absence of other pRO101 DNA, constitutively expressed the tfdA gene and allowed PPO300 to grow on PAA. Preliminary evidence suggests that the monooxygenase activity encoded by this DNA fragment is feedback-inhibited by phenols. Images PMID:2914848
DOE Office of Scientific and Technical Information (OSTI.GOV)
Depto, A.S.; Stenberg, R.M.
1989-03-01
To better understand the regulation of late gene expression in human cytomegalovirus (CMV)-infected cells, the authors examined expression of the gene that codes for the 65-kilodalton lower-matrix phosphoprotein (pp65). Analysis of RNA isolated at 72 h from cells infected with CMV Towne or ts66, a DNA-negative temperature-sensitive mutant, supported the fact that pp65 is expressed at low levels prior to viral DNA replication but maximally expressed after the initiation of viral DNA replication. To investigate promoter activation in a transient expression assay, the pp65 promoter was cloned into the indicator plasmid containing the gene for chloramphenicol acetyltransferase (CAT). Transfection ofmore » the promoter-CAT construct and subsequent superinfection with CMV resulted in activation of the promoter at early times after infection. Cotransfection with plasmids capable of expressing immediate-early (IE) proteins demonstrated that the promoter was activated by IE proteins and that both IE regions 1 and 2 were necessary. These studies suggest that interactions between IE proteins and this octamer sequence may be important for the regulation and expression of this CMV gene.« less
Ku, Hye-Jin; Park, Myeong Soo; Lee, Ju-Hoon
2015-01-01
A 2.1-kb plasmid was previously isolated from Weissella cibaria KLC140 in kimchi and cloned into pUC19 along with the slpA and gfp genes, resulting in an 8.6-kb pKWCSLGFP construct for use as a novel surface display vector. To reduce the size of the vector, the minimal replicon of pKW2124 was determined. The pKW2124 plasmid contains a putative origin of replication (ori), a potential ribosomal binding site (RBS), and the repA gene encoding a plasmid replication protein. To conduct the minimal replicon experiment, four different PCR products (MR1, ori+RBS+repA; MR2, RBS+repA; MR2’, repA; MR3, fragment of repA) were obtained and cloned into pUC19 (pKUCm1, pKUCm2, pKUCm2’, and pKUCm3, respectively) containing the chloramphenicol acetyltransferase (CAT) gene. These constructed vectors were electroporated into W. confusa ATCC 10881 with different transformation efficiencies of 1.5 × 105 CFU/μg, 1.3 × 101 CFU/μg, and no transformation, respectively, suggesting that the putative ori, RBS, and repA gene are essential for optimum plasmid replication. Subsequent segregational plasmid stability testing of pKUCm1 and pKUCm2 showed that the vector pKUCm1 is highly stable up to 100 generations but pKUCm2 was completely lost after 60 generations, suggesting that the putative ori may be important for plasmid stability in the host strain. In addition, a host range test of pKUCm1 revealed that it has a broad host range spectrum including Weissella, Lactococcus, Leuconostoc, and even Lactobacillus. To verify the application of pKUCm1, the β-galactosidase gene and its promoter region from W. cibaria KSD1 were cloned in the vector, resulting in pKUGal. Expression of the β-galactosidase gene was confirmed using blue-white screening after IPTG induction. The small and stable pKUGal vector will be useful for gene transfer, expression, and manipulation in the Weissella genome and in other lactic acid bacteria. PMID:25691882
Khajanchi, Bijay K; Hasan, Nur A; Choi, Seon Young; Han, Jing; Zhao, Shaohua; Colwell, Rita R; Cerniglia, Carl E; Foley, Steven L
2017-08-02
The degree to which the chromosomal mediated iron acquisition system contributes to virulence of many bacterial pathogens is well defined. However, the functional roles of plasmid encoded iron acquisition systems, specifically Sit and aerobactin, have yet to be determined for Salmonella spp. In a recent study, Salmonella enterica strains isolated from different food sources were sequenced on the Illumina MiSeq platform and found to harbor the incompatibility group (Inc) FIB plasmid. In this study, we examined sequence diversity and the contribution of factors encoded on the IncFIB plasmid to the virulence of S. enterica. Whole genome sequences of seven S. enterica isolates were compared to genomes of serovars of S. enterica isolated from food, animal, and human sources. SeqSero analysis predicted that six strains were serovar Typhimurium and one was Heidelberg. Among the S. Typhimurium strains, single nucleotide polymorphism (SNP)-based phylogenetic analyses revealed that five of the isolates clustered as a single monophyletic S. Typhimurium subclade, while one of the other strains branched with S. Typhimurium from a bovine source. DNA sequence based phylogenetic diversity analyses showed that the IncFIB plasmid-encoded Sit and aerobactin iron acquisition systems are conserved among bacterial species including S. enterica. The IncFIB plasmid was transferred to an IncFIB plasmid deficient strain of S. enterica by conjugation. The transconjugant SE819::IncFIB persisted in human intestinal epithelial (Caco-2) cells at a higher rate than the recipient SE819. Genes of the Sit and aerobactin operons in the IncFIB plasmid were differentially expressed in iron-rich and iron-depleted growth media. Minimal sequence diversity was detected in the Sit and aerobactin operons in the IncFIB plasmids present among different bacterial species, including foodborne Salmonella strains. IncFIB plasmid encoded factors play a role during infection under low-iron conditions in host cells.
Meraviglia, Viviana; Zanon, Alessandra; Lavdas, Alexandros A; Schwienbacher, Christine; Silipigni, Rosamaria; Di Segni, Marina; Chen, Huei-Sheng Vincent; Pramstaller, Peter P; Hicks, Andrew A; Rossini, Alessandra
2015-06-05
Somatic cells can be reprogrammed into induced pluripotent stem cells (iPSCs) by forcing the expression of four transcription factors (Oct-4, Sox-2, Klf-4, and c-Myc), typically expressed by human embryonic stem cells (hESCs). Due to their similarity with hESCs, iPSCs have become an important tool for potential patient-specific regenerative medicine, avoiding ethical issues associated with hESCs. In order to obtain cells suitable for clinical application, transgene-free iPSCs need to be generated to avoid transgene reactivation, altered gene expression and misguided differentiation. Moreover, a highly efficient and inexpensive reprogramming method is necessary to derive sufficient iPSCs for therapeutic purposes. Given this need, an efficient non-integrating episomal plasmid approach is the preferable choice for iPSC derivation. Currently the most common cell type used for reprogramming purposes are fibroblasts, the isolation of which requires tissue biopsy, an invasive surgical procedure for the patient. Therefore, human peripheral blood represents the most accessible and least invasive tissue for iPSC generation. In this study, a cost-effective and viral-free protocol using non-integrating episomal plasmids is reported for the generation of iPSCs from human peripheral blood mononuclear cells (PBMNCs) obtained from frozen buffy coats after whole blood centrifugation and without density gradient separation.
Wang, X; Zhao, L; Zhang, L; Wu, Y; Chou, M; Wei, G
2018-07-01
Rhizobial symbiotic plasmids play vital roles in mutualistic symbiosis with legume plants by executing the functions of nodulation and nitrogen fixation. To explore the gene composition and genetic constitution of rhizobial symbiotic plasmids, comparison analyses of 24 rhizobial symbiotic plasmids derived from four rhizobial genera was carried out. Results illustrated that rhizobial symbiotic plasmids had higher proportion of functional genes participating in amino acid transport and metabolism, replication; recombination and repair; carbohydrate transport and metabolism; energy production and conversion and transcription. Mesorhizobium amorphae CCNWGS0123 symbiotic plasmid - pM0123d had similar gene composition with pR899b and pSNGR234a. All symbiotic plasmids shared 13 orthologous genes, including five nod and eight nif/fix genes which participate in the rhizobia-legume symbiosis process. These plasmids contained nod genes from four ancestors and fix genes from six ancestors. The ancestral type of pM0123d nod genes was similar with that of Rhizobium etli plasmids, while the ancestral type of pM0123d fix genes was same as that of pM7653Rb. The phylogenetic trees constructed based on nodCIJ and fixABC displayed different topological structures mainly due to nodCIJ and fixABC ancestral type discordance. The study presents valuable insights into mosaic structures and the evolution of rhizobial symbiotic plasmids. This study compared 24 rhizobial symbiotic plasmids that included four genera and 11 species, illuminating the functional gene composition and symbiosis gene ancestor types of symbiotic plasmids from higher taxonomy. It provides valuable insights into mosaic structures and the evolution of symbiotic plasmids. © 2018 The Society for Applied Microbiology.
Application of succulent plant leaves for Agrobacterium infiltration-mediated protein production
USDA-ARS?s Scientific Manuscript database
Infiltration of tobacco leaves with a suspension of Agrobacterium tumefaciens harboring a binary plant expression plasmid provides a convenient method for laboratory scale protein production. When expressing plant cell wall degrading enzymes in the widely used tobacco (Nicotiana benthamiana), diffic...
Screening promoters for Anthurium transformation using transient expression
USDA-ARS?s Scientific Manuscript database
Different promoters and tissue types were evaluated for transient '-glucoronidase (GUS) expression in Anthurium andreanum Hort. ‘Marian Seefurth’ following microprojectile bombardment. Plasmids containing the Ubiquitin 2, Actin 1, Cytochrome C1 from rice, Ubiquitin 1 from maize and 35 S promoter fr...
Conjugative DNA Transfer Is Enhanced by Plasmid R1 Partitioning Proteins
Gruber, Christian J.; Lang, Silvia; Rajendra, Vinod K. H.; Nuk, Monika; Raffl, Sandra; Schildbach, Joel F.; Zechner, Ellen L.
2016-01-01
Bacterial conjugation is a form of type IV secretion used to transport protein and DNA directly to recipient bacteria. The process is cell contact-dependent, yet the mechanisms enabling extracellular events to trigger plasmid transfer to begin inside the cell remain obscure. In this study of plasmid R1 we investigated the role of plasmid proteins in the initiation of gene transfer. We find that TraI, the central regulator of conjugative DNA processing, interacts physically, and functionally with the plasmid partitioning proteins ParM and ParR. These interactions stimulate TraI catalyzed relaxation of plasmid DNA in vivo and in vitro and increase ParM ATPase activity. ParM also binds the coupling protein TraD and VirB4-like channel ATPase TraC. Together, these protein-protein interactions probably act to co-localize the transfer components intracellularly and promote assembly of the conjugation machinery. Importantly these data also indicate that the continued association of ParM and ParR at the conjugative pore is necessary for plasmid transfer to start efficiently. Moreover, the conjugative pilus and underlying secretion machinery assembled in the absence of Par proteins mediate poor biofilm formation and are completely dysfunctional for pilus specific R17 bacteriophage uptake. Thus, functional integration of Par components at the interface of relaxosome, coupling protein, and channel ATPases appears important for an optimal conformation and effective activation of the transfer machinery. We conclude that low copy plasmid R1 has evolved an active segregation system that optimizes both its vertical and lateral modes of dissemination. PMID:27486582
Plasmid-mediated resistance to protein biosynthesis inhibitors in staphylococci.
Schwarz, Stefan; Fessler, Andrea T; Hauschild, Tomasz; Kehrenberg, Corinna; Kadlec, Kristina
2011-12-01
Protein biosynthesis inhibitors (PBIs) represent powerful antimicrobial agents for the control of bacterial infections. In staphylococci, numerous resistance genes are known to be involved in resistance to PBIs, most of which mediate resistance to a specific class/subclass of PBIs, though a few genes do confer a multidrug resistance phenotype-up to five classes/subclasses of PBIs. Plasmids play a key role in the dissemination of PBI resistance among staphylococci, as they primarily carry plasmid-borne PBI resistance genes; however, plasmids also can be vectors for transposon-borne PBI resistance genes. Small plasmids that carry single PBI resistance genes are widespread among staphylococci of human and animal origin. Various mechanisms exist by which they can recombine, form cointegrates, or integrate into chromosomal DNA or larger plasmids. We provide an overview of the current knowledge of plasmid-mediated PBI resistance in staphylococci, with particular reference to the currently known PBI resistance genes, their association with mobile genetic elements, and the recombination/integration processes that control their mobility. © 2011 New York Academy of Sciences.
Genome Editing in Human Pluripotent Stem Cells.
Carlson-Stevermer, Jared; Saha, Krishanu
2017-01-01
Genome editing in human pluripotent stem cells (hPSCs) enables the generation of reporter lines and knockout cell lines. Zinc finger nucleases, transcription activator-like effector nucleases (TALENs), and CRISPR/Cas9 technology have recently increased the efficiency of proper gene editing by creating double strand breaks (DSB) at defined sequences in the human genome. These systems typically use plasmids to transiently transcribe nucleases within the cell. Here, we describe the process for preparing hPSCs for transient expression of nucleases via electroporation and subsequent analysis to create genetically modified stem cell lines.
Barucca, A; Capitani, M; Cesca, M; Tomassoni, D; Kazmi, U; Concetti, F; Vincenzetti, L; Concetti, A; Venanzi, F M
2014-11-01
Anti-idiotypic MK2-23 monoclonal antibody (anti-Id MK2-23 mAb), which mimics the high molecular weight melanoma-associated antigen (HMW-MAA), has been used to implement active immunotherapy against melanoma. However, due to safety and standardization issues, this approach never entered extensive clinical trials. In the present study, we investigated the usage of DNA vaccines as an alternative to MK2-23 mAb immunization. MK2-23 DNA plasmids coding for single chain (scFv) MK2-23 antibody were constructed via the insertion of variable heavy (V H) and light (V L) chains of MK2-23 into the pVAC-1mcs plasmids. Two alternative MK2-23 plasmids format V H/V L, and V L/V H were assembled. We demonstrate that both polypeptides expressed by scFv plasmids in vitro retained the ability to mimic HMW-MAA antigen, and to elicit specific anti-HMW-MAA humoral and cellular immunoresponses in immunized mice. Notably, MK2-23 scFv DNA vaccines impaired the onset and growth of transplantable B16 melanoma cells not engineered to express HMW-MAA. This pilot study suggests that optimized MK2-23 scFv DNA vaccines could potentially provide a safer and cost-effective alternative to anti-Id antibody immunization, for melanoma immunotherapy.
Shi, Aiqin; Zheng, Huabao; Yomano, Lorraine P.; York, Sean W.; Shanmugam, Keelnatham T.
2016-01-01
Hydrolysate-resistant Escherichia coli SL100 was previously isolated from ethanologenic LY180 after sequential transfers in AM1 medium containing a dilute acid hydrolysate of sugarcane bagasse and was used as a source of resistance genes. Many genes that affect tolerance to furfural, the most abundant inhibitor, have been described previously. To identify genes associated with inhibitors other than furfural, plasmid clones were selected in an artificial hydrolysate that had been treated with a vacuum to remove furfural. Two new resistance genes were discovered from Sau3A1 libraries of SL100 genomic DNA: nemA (N-ethylmaleimide reductase) and a putative regulatory gene containing a mutation in the coding region, yafC*. The presence of these mutations in SL100 was confirmed by sequencing. A single mutation was found in the upstream regulatory region of nemR (nemRA operon) in SL100. This mutation increased nemA activity 20-fold over that of the parent organism (LY180) in AM1 medium without hydrolysate and increased nemA mRNA levels >200-fold. Addition of hydrolysates induced nemA expression (mRNA and activity), in agreement with transcriptional control. NemA activity was stable in cell extracts (9 h, 37°C), eliminating a role for proteinase in regulation. LY180 with a plasmid expressing nemA or yafC* was more resistant to a vacuum-treated sugarcane bagasse hydrolysate and to a vacuum-treated artificial hydrolysate than LY180 with an empty-vector control. Neither gene affected furfural tolerance. The vacuum-treated hydrolysates inhibited the reduction of N-ethylmaleimide by NemA while also serving as substrates. Expression of the nemA or yafC* plasmid in LY180 doubled the rate of ethanol production from the vacuum-treated sugarcane bagasse hydrolysate. PMID:26826228
Shi, Aiqin; Zheng, Huabao; Yomano, Lorraine P; York, Sean W; Shanmugam, Keelnatham T; Ingram, Lonnie O
2016-01-29
Hydrolysate-resistant Escherichia coli SL100 was previously isolated from ethanologenic LY180 after sequential transfers in AM1 medium containing a dilute acid hydrolysate of sugarcane bagasse and was used as a source of resistance genes. Many genes that affect tolerance to furfural, the most abundant inhibitor, have been described previously. To identify genes associated with inhibitors other than furfural, plasmid clones were selected in an artificial hydrolysate that had been treated with a vacuum to remove furfural. Two new resistance genes were discovered from Sau3A1 libraries of SL100 genomic DNA: nemA (N-ethylmaleimide reductase) and a putative regulatory gene containing a mutation in the coding region, yafC*. The presence of these mutations in SL100 was confirmed by sequencing. A single mutation was found in the upstream regulatory region of nemR (nemRA operon) in SL100. This mutation increased nemA activity 20-fold over that of the parent organism (LY180) in AM1 medium without hydrolysate and increased nemA mRNA levels >200-fold. Addition of hydrolysates induced nemA expression (mRNA and activity), in agreement with transcriptional control. NemA activity was stable in cell extracts (9 h, 37°C), eliminating a role for proteinase in regulation. LY180 with a plasmid expressing nemA or yafC* was more resistant to a vacuum-treated sugarcane bagasse hydrolysate and to a vacuum-treated artificial hydrolysate than LY180 with an empty-vector control. Neither gene affected furfural tolerance. The vacuum-treated hydrolysates inhibited the reduction of N-ethylmaleimide by NemA while also serving as substrates. Expression of the nemA or yafC* plasmid in LY180 doubled the rate of ethanol production from the vacuum-treated sugarcane bagasse hydrolysate. Copyright © 2016, American Society for Microbiology. All Rights Reserved.
Downing, Katrina J.; Leslie, Graeme; Thomson, Jennifer A.
2000-01-01
The cry1Ac7 gene of Bacillus thuringiensis strain 234, showing activity against the sugarcane borer Eldana saccharina, was cloned under the control of the tac promoter. The fusion was introduced into the broad-host-range plasmid pKT240 and the integration vector pJFF350 and without the tac promoter into the broad-host-range plasmids pML122 and pKmM0. These plasmids were introduced into a Pseudomonas fluorescens strain isolated from the phylloplane of sugarcane and the endophytic bacterium Herbaspirillum seropedicae found in sugarcane. The ptac-cry1Ac7 construct was introduced into the chromosome of P. fluorescens using the integration vector pJFF350 carrying the artificial interposon Omegon-Km. Western blot analysis showed that the expression levels of the integrated cry1Ac7 gene were much higher under the control of the tac promoter than under the control of its endogenous promoter. It was also determined that multicopy expression in P. fluorescens and H. seropedicae of ptac-cry1Ac7 carried on pKT240 caused plasmid instability with no detectable protein expression. In H. seropedicae, more Cry1Ac7 toxin was produced when the gene was cloned under the control of the Nmr promoter on pML122 than in the opposite orientation and bioassays showed that the former resulted in higher mortality of E. saccharina larvae than the latter. P. fluorescens 14::ptac-tox resulted in higher mortality of larvae than did P. fluorescens 14::tox. An increased toxic effect was observed when P. fluorescens 14::ptac-tox was combined with P. fluorescens carrying the Serratia marcescens chitinase gene chiA, under the control of the tac promoter, integrated into the chromosome. PMID:10877771
Seki, Daisuke; Takeshita, Nobuo; Oyanagi, Toshihito; Sasaki, Shutaro; Takano, Ikuko; Hasegawa, Masakazu; Takano-Yamamoto, Teruko
2015-09-01
The field of tooth regeneration has progressed in recent years, and human tooth regeneration could become viable in the future. Because induced pluripotent stem (iPS) cells can differentiate into odontogenic cells given appropriate conditions, iPS cells are a potential cell source for tooth regeneration. However, a definitive method to induce iPS cell-derived odontogenic cells has not been established. We describe a novel method of odontoblast differentiation from iPS cells using gene transfection. We generated mouse iPS cell-derived neural crest-like cells (iNCLCs), which exhibited neural crest markers. Next, we differentiated iNCLCs into odontoblast-like cells by transfection of Pax9 and Bmp4 expression plasmids. Exogenous Pax9 upregulated expression of Msx1 and dentin matrix protein 1 (Dmp1) in iNCLCs but not bone morphogenetic protein 4 (Bmp4) or dentin sialophosphoprotein (Dspp). Exogenous Bmp4 upregulated expression of Msx1, Dmp1, and Dspp in iNCLCs, but not Pax9. Moreover, cotransfection of Pax9 and Bmp4 plasmids in iNCLCs revealed a higher expression of Pax9 than when Pax9 plasmid was used alone. In contrast, exogenous Pax9 downregulated Bmp4 overexpression. Cotransfection of Pax9 and Bmp4 synergistically upregulated Dmp1 expression; however, Pax9 overexpression downregulated exogenous Bmp4-induced Dspp expression. Together, these findings suggest that an interaction between exogenous Pax9- and Bmp4-induced signaling modulated Dmp1 and Dspp expression. In conclusion, transfection of Pax9 and Bmp4 expression plasmids in iNCLCs induced gene expression associated with odontoblast differentiation, suggesting that iNCLCs differentiated into odontoblast-like cells. The iPS cell-derived odontoblast-like cells could be a useful cell source for tooth regeneration. It has been reported that induced pluripotent stem (iPS) cells differentiate into odontogenic cells by administration of recombinant growth factors and coculture with odontogenic cells. Therefore, they can be potential cell sources for tooth regeneration. However, these previous methods still have problems, such as usage of other cell types, heterogeneity of differentiated cells, and tumorigenicity. In the present study, a novel method to differentiate iPS cells into odontoblast-like cells without tumorigenicity using gene transfection was established. It is an important advance in the establishment of efficient methods to generate homogeneous functional odontogenic cells derived from iPS cells. ©AlphaMed Press.
Gibert, Marta; Paytubi, Sonia; Beltrán, Sergi; Juárez, Antonio; Balsalobre, Carlos; Madrid, Cristina
2016-12-01
Plasmids of the incompatibility group HI1 (IncHI1) have been isolated from several Gram-negative pathogens and are associated with the spread of multidrug resistance. Their conjugation is tightly regulated and it is inhibited at temperatures higher than 30°C, indicating that conjugation occurs outside warm-blooded hosts. Using R27, the prototype of IncHI1 plasmids, we report that plasmid transfer efficiency in E. coli strongly depends on the physiological state of the donor cells. Conjugation frequency is high when cells are actively growing, dropping sharply when cells enter the stationary phase of growth. Accordingly, our transcriptomic assays show significant downregulation of numerous R27 genes during the stationary phase, including several tra (transfer) genes. Growth phase-dependent regulation of tra genes transcription is independent of H-NS, a silencer of horizontal gene transfer, and ppGpp and RpoS, regulators of the stationary phase, but highly dependent on the plasmid-encoded regulatory circuit TrhR/TrhY-HtdA. The metabolic sensor cAMP, whose synthesis is chromosomally encoded, is also involved in the growth phase regulation of R27 conjugation by modulating htdA expression. Our data suggest that the involvement of regulators encoded by both chromosome and plasmid are required for efficient physiological control of IncHI1 plasmid conjugation. © 2016 Society for Applied Microbiology and John Wiley & Sons Ltd.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Goodyer, P.R.; Torban, E.; Dehbi, M.
1994-09-01
The Wilms` tumor gene encodes a 47-49 kDa transcription factor expressed in kidney, gonads and mesothelium during embryogenesis. Inherited mutations of WT1 lead to aberrant urogenital development and Wilms` tumor, but the role of WT1 in development is not fully understood. Since the human RAR-{alpha} gene contains a potential WT1 binding site at its 5{prime} end, we studied the effect of WT1 co-transfection on expression of an RAR-{alpha} promoter/CAT reporter construct in COS cells. COS cells were plated at 5X10{sup 5} cells/dish in DMEM with 10% FBS and transfected by the Ca/PO4 method with an expression plasmid containing the full-lengthmore » WT1 (-/-) cDNA under the control of the CMV promoter, plasmid containing the RAR-{alpha} promoter (-519 to +36)/CAT reporter and TK/growth hormone plasmid to control for efficiency of transfection. CAT/GH activity at 48 hours was inhibited by co-transfection with increasing amounts of WT1 (-/-); maximum inhibition = 5% of control. WT1 co-transfection did not affect expression of TKGH, nor of a CMV-CAT vector. Expression of WT1 protein in tranfected COS cells was demonstrated by Western blotting. Minimal inhibiton of RAR-{alpha}/CAT activity was seen when cells were co-transfected with vectors containing WT1 deletion mutants, alternate WT1 splicing variants, or WT1 (-/-) cDNA bearing a mutation identified in a patient with Drash syndrome. Gel shift assays indicated binding of WT1 to RAR-{alpha} cDNA but not to an RAR-{alpha} deletion mutant lacking the GCGGGGGGCG site. These observations suggest that WT1 may function to regulate RAR-{alpha} expression during normal development.« less
Heterologous Expression of Gene of Interest Using the Marine Protozoan Perkinsus marinus
NASA Astrophysics Data System (ADS)
Cold, E. R.
2016-02-01
Perkinsus marinus is a marine protozoan parasite that causes "Dermo" disease in eastern oysters (Crassostrea virginica). P. marinus is closely related to Plasmodium falciparum which causes malaria. A recent study has showed that P. marinus causes no pathology damage but an immune response in humanized mouse, providing the bases for a genetically modified P. marinus expressing Plasmodium genes to be used as a vaccination delivery system for malaria and other pathogenic diseases. A modified plasmid vector (pMOE-GFP) based on highly expressed gene tagged with green fluorescence protein and targeted to P. marinus cell wall was used to clone MSP8 and HAP2. MSP8 encodes for merozoite surface in P. falciparum and HAP2 is essential for fusion of male and female gametes; genetic disruption of the HAP2 locus revealed that parasite fertilization is prevented. Using electroporation, MSP8 and HAP2 plasmid were introduced into the P. marinus trophozoites. As controls pMOE-GFP was transfected into P. mediterraneus, P. atlanticus and P. chesapeaki. Transfection conditions included 5x107 Perkinsus trophozoites and 10 µg of plasmid using Nucleofector® technology (D-023 program). The cells were recovered in 3 mL of Perkinsus culture media and transfected trophozoites were examined for green fluorescence. To facilitate subcloning of cells expressing GFP, we optimized a DME: HAM's F12 -5% FBS -containing agar solid medium for plating Perkinsus. Examination of all transfected cells indicates expression of both MSP8 and HAP2. This is the first time that genes of a protozoan parasite have been expressed in a marine protozoan. It was also concluded that P. mediterraneus, P. atlanticus and P. chesapeaki were stable mutation and can be isolated for further research.
Chen, Ting; Huang, Dangsheng; Chen, Guanghui; Yang, Tingshu; Yi, Jun; Tian, Miao
2015-02-01
The adipose tissue-derived stem cells (ADSCs) represent a significant area of the cell therapy. Genetic modification of ADSCs may further improve their therapeutic potential. Here, we aimed to generate a lentiviral vector expressing insulin-like growth factor-I (IGF-1) and investigate the impact of IGF-1 transduction on the properties of cultured ADSCs. Isolated rat ADSCs were assessed by flow cytometric analysis. IGF-1 was cloned and inserted into the pLenO-DCE plasmid to acquire pLenO-DCE-IGF-1 plasmid. Lentivirus was enveloped with pRsv-REV, pMDlg-pRRE and pMD2G plasmids in 293T cells. The ADSCs were transfected with the vectors. And then IGF-1-induced anti-apoptosis was evaluated by annexin V-FITC. Besides, proliferation of cells was detected by MTT assay and EdU. Moreover, Akt phosphorylation was evaluated by Western blotting analysis. Stable expression of IGF-1 in ADSCs was confirmed. ADSCs were positive for CD90 and CD29, but negative for CD31, CD34 and CD45. The transduction of IGF-1 to the ADSCs caused a dramatic increase in P-Akt expression. Over-expression of IGF-1 in ADSCs could improve the paracine of IGF-1 in a time-dependent manner, but could not promote the proliferation of ADSCs. This study indicated that lentiviral vectors offered a promising mean of delivering IGF-1 to the ADSCs. Lentiviral-mediated over-expression of therapeutic IGF-1 gene in ADSCs could prolong the anti-apoptosis effect of IGF-1, which might be induced by the activation of the PI3K/Akt pathway. And our data would improve the efficacy of ADSC-based therapies.
Cappuccio, Jenny A.; Blanchette, Craig D.; Sulchek, Todd A.; Arroyo, Erin S.; Kralj, Joel M.; Hinz, Angela K.; Kuhn, Edward A.; Chromy, Brett A.; Segelke, Brent W.; Rothschild, Kenneth J.; Fletcher, Julia E.; Katzen, Federico; Peterson, Todd C.; Kudlicki, Wieslaw A.; Bench, Graham; Hoeprich, Paul D.; Coleman, Matthew A.
2008-01-01
Here we demonstrate rapid production of solubilized and functional membrane protein by simultaneous cell-free expression of an apolipoprotein and a membrane protein in the presence of lipids, leading to the self-assembly of membrane protein-containing nanolipoprotein particles (NLPs). NLPs have shown great promise as a biotechnology platform for solubilizing and characterizing membrane proteins. However, current approaches are limited because they require extensive efforts to express, purify, and solubilize the membrane protein prior to insertion into NLPs. By the simple addition of a few constituents to cell-free extracts, we can produce membrane proteins in NLPs with considerably less effort. For this approach an integral membrane protein and an apolipoprotein scaffold are encoded by two DNA plasmids introduced into cell-free extracts along with lipids. For this study reported here we used plasmids encoding the bacteriorhodopsin (bR) membrane apoprotein and scaffold protein Δ1–49 apolipoprotein A-I fragment (Δ49A1). Cell free co-expression of the proteins encoded by these plasmids, in the presence of the cofactor all-trans-retinal and dimyristoylphosphatidylcholine, resulted in production of functional bR as demonstrated by a 5-nm shift in the absorption spectra upon light adaptation and characteristic time-resolved FT infrared difference spectra for the bR → M transition. Importantly the functional bR was solubilized in discoidal bR·NLPs as determined by atomic force microscopy. A survey study of other membrane proteins co-expressed with Δ49A1 scaffold protein also showed significantly increased solubility of all of the membrane proteins, indicating that this approach may provide a general method for expressing membrane proteins enabling further studies. PMID:18603642
Prolonging the expression duration of ultrasound-mediated gene transfection using PEI nanoparticles.
Lee, Jyun-Lin; Lo, Chia-Wen; Ka, Shuk-Man; Chen, Ann; Chen, Wen-Shiang
2012-05-30
Ultrasound (US) irradiation has been found to facilitate the inward transport of genetic materials across cell membranes (sonoporation). However, its transfection efficiency is generally low, and the expression duration of transfected gene is short. Polyethylenimine (PEI), a cationic polymer, has been shown to aggregate plasmid DNA and facilitate its internalization. The purpose of this study is to determine whether PEI can also prolong the expression duration after US-mediated transfection. A mixture of pCMViLUC and 22-kDa linear PEI was transfected to cultured cells or mouse muscle by exposure to 1-MHz pulsed US. The duration of expression was assessed periodically following US treatment. As expected, strong expression of luciferase could be found 30days after the treatment of DNA-PEI complex with US exposure, both in vitro and in vivo. However, without US, only very low transfection level could be obtained in vivo. The DNA/PEI complex showed protective effect against digestion of DNase I enzymes as compared with groups without PEI or to which PEI was added following the mixing of plasmid DNA with DNase I. PEI enhanced the US transfection efficiency by increasing both the intracellular uptake of plasmid DNA and the percentage of transfected cells. Most of the DNA uptake occurred at 3h after US exposure, suggesting that endocytosis took place. Moreover, the PEI-facilitated US gene transfection depended on the ratio of PEI and DNA (N/P ratio), which was different for in-vitro and in-vivo conditions. This system could be applied in future human gene therapies. Copyright © 2012 Elsevier B.V. All rights reserved.
Song, Myeong-Sub; Sekhon, Simranjeet Singh; Shin, Woo-Ri; Rhee, Sung-Keun; Ko, Jung Ho; Kim, Sang Yong; Min, Jiho; Ahn, Ji-Young; Kim, Yang-Hoon
2018-05-01
Shigella sonnei isolate invasion plasmid antigen protein, IpaH, was successfully expressed in recombinant overexpression bacterial system. The soluble expression IpaH was enhanced with molecular chaperon co-expressed environment. Specific aptamer IpaH17 was isolated through the SELEX process and showed fM binding affinity. IpaH17-SPR biosensor platform was involved to verify the binding sensitivity and specificity. The IpaH concentration dependent IpaH17-SPR sensor response was highly linear with a linear regression constant of 99.4% in the range between 0 and 100 ng/mL. In addition, S. sonnei revealed the specific RU value and detected in a real-time manner within 1 hour. Our study indicated that IpaH17-SPR sensor can allow for rapid, sensitive and specific determination of Shigella sonnei virulent factor.
Thermophilic Gram-Positive Biocatalysts for Biomass Conversion to Ethanol
DOE Office of Scientific and Technical Information (OSTI.GOV)
Shanmugam, K.T.; Ingram, L.O.; Maupin-Furlow, J.A.
2003-12-01
Production of energy from renewable sources is receiving increased attention due to the finite nature of fossil fuels and the environmental impact associated with the continued large scale use of fossil energy sources. Biomass, a CO2-neutral abundant resource, is an attractive alternate source of energy. Biomass-derived sugars, such as glucose, xylose, and other minor sugars, can be readily fermented to fuel ethanol and commodity chemicals. Extracellular cellulases produced by fungi are commercially developed for depolymerization of cellulose in biomass to glucose for fermentation by appropriate biocatalysts in a simultaneous saccharification and fermentation (SSF) process. Due to the differences in themore » optimum conditions for the activity of the fungal cellulases and the growth and fermentation characteristics of the current industrial biocatalysts, SSF of cellulose is envisioned at conditions that are not optimal for the fungal cellulase activity leading to higher than required cost of cellulase in SSF. We have isolated bacterial biocatalysts whose growth and fermentation requirements match the optimum conditions for commercial fungal cellulase activity (pH 5.0 and 50 deg. C). These isolates fermented both glucose and xylose, major components of cellulose and hemicellulose, respectively, to L(+)-lactic acid. Xylose was metabolized through the pentose-phosphate pathway by these organisms as evidenced by the fermentation profile and analysis of the fermentation products of 13C1-xylose by NMR. As expected for the metabolism of xylose by the pentose-phosphate pathway, 13C-lactate accounted for more than 90% of the total 13C-labeled products. All three strains fermented crystalline cellulose to lactic acid with the addition of fungal cellulase (Spezyme CE) (SSF) at an optimum of about 10 FPU/g cellulose. These isolates also fermented cellulose and sugar cane bagasse hemicellulose acid hydrolysate simultaneously. Based on fatty acid profile and 16S rRNA sequence, these isolates cluster with Bacillus coagulans although B. coagulans type strain, ATCC 7050, failed to utilize xylose as a carbon source. For successful production of ethanol from pyruvate, both pyruvate decarboxylase (PDC) and alcohol dehydrogenase (AHD) need to be produced at optimal levels in these biocatalysts. A plasmid containing the S. ventriculi pdc gene and the adh gene from geobacillus stearothermophilus was constructed using plasmid pWH1520 that was successfully used for expression of pdc in B. megaterium. The resulting portable ethanol (PET) plasmid, pJAM423, was transformed into B. megaterium. After xylose induction, a significant fraction of cell cytoplasm was composed of the S. ventriculi PDC and G. stearothermophilus ADH proteins. In preliminary experiments, the amount of ethanol produced by b. megaterium with plasmid pJAM423 was about twice (20 mM) of the bacterium without the plasmid. These results show that the PET operon is functional in B. megaterium but high level ethanol production needs further genetic and metabolic engineering. A genetic transfer system for the second generation biocatalysts needs to be developed for transferring the plasmid pJAM423 and its derivatives for engineering these organisms for ethanol production from biomass derived sugars and cellulose to ethanol. One of the new biocatalysts, strain P4-102B was found to be transformable with plasmids and the method for introducing plasmid pJAM423 into this strain and expression of the encoded DNA is being optimized. These new second generation biocatalysts have the potential to reduce the cost of SSF by minimizing the amount of fungal cellulases, a significant cost component in the use of biomass as a renewable resource for production of fuels and chemicals.« less
Singer, John T; Phennicie, Ryan T; Sullivan, Matthew J; Porter, Laura A; Shaffer, Valerie J; Kim, Carol H
2010-06-01
To observe real-time interactions between green fluorescent protein-labeled immune cells and invading bacteria in the zebrafish (Danio rerio), a series of plasmids was constructed for the red fluorescent protein (RFP) labeling of a variety of fish and human pathogens. The aim of this study was to create a collection of plasmids that would express RFP pigments both constitutively and under tac promoter regulation and that would be nontoxic and broadly transmissible to a variety of Gram-negative bacteria. DNA fragments encoding the RFP dimeric (d), monomeric (m), and tandem dimeric (td) derivatives d-Tomato, td-Tomato, m-Orange, and m-Cherry were cloned into the IncQ-based vector pMMB66EH in Escherichia coli. Plasmids were mobilized into recipient strains by conjugal mating. Pigment production was inducible in Escherichia coli, Pseudomonas aeruginosa, Edwardsiella tarda, and Vibrio (Listonella) anguillarum strains by isopropyl-beta-d-thiogalactopyranoside (IPTG) treatment. A spontaneous mutant exconjugant of P. aeruginosa PA14 was isolated that expressed td-Tomato constitutively. Complementation analysis revealed that the constitutive phenotype likely was due to a mutation in lacI(q) carried on pMMB66EH. DNA sequence analysis confirmed the presence of five transitions, four transversions, and a 2-bp addition within a 14-bp region of lacI. Vector DNA was purified from this constitutive mutant, and structural DNA sequences for RFP pigments were cloned into the constitutive vector. Exconjugants of P. aeruginosa, E. tarda, and V. anguillarum expressed all pigments in an IPTG-independent fashion. Results from zebrafish infectivity studies indicate that RFP-labeled pathogens will be useful for the study of real-time interactions between host cells of the innate immune system and the infecting pathogen.
He, Weiwei; Mu, Wanmeng; Jiang, Bo; Yan, Xin; Zhang, Tao
2016-04-27
A food grade recombinant Bacillus subtilis that produces d-psicose 3-epimerase (DPEase; EC 5.1.3.30) was constructed by transforming a replicative multicopy plasmid with a d-alanine racemase gene marker into B. subtilis 1A751 with the d-alanine racemase gene knocked out. The DPEase was expressed in B. subtilis without antibiotic resistance genes and without adding antibiotics during fermentation. Whole cells of the food grade recombinant B. subtilis were used to biotransform d-fructose to d-allulose. The two tandem promoters, including the HpaII and P43 promoters, increased expression levels compared to the use of one promoter, HpaII. For large-scale d-allulose production, the optimal enzyme dose was 40 enzyme activity units of dry cells per gram of d-fructose, which produced a 28.5% turnover yield in 60 min. The recombinant plasmid exhibited stability over 100 generations. This food grade recombinant B. subtilis may be used for large-scale d-allulose production in the food industry.
[Asymmetric biosynthesis of d-pseudoephedrine by recombinant Bacillus subtilis].
Peng, Yanhong; Zhang, Liang; Ding, Zhongyang; Wang, Zhengxiang; Shi, Guiyang
2011-07-01
In order to successfully express the carbonyl reductase gene mldh in Bacillus subtilis and complete coenzyme regeneration by B. subtilis glucose dehydrogenase, the promoter PrpsD and the terminator TrpsD from B. subtilis rpsD gene were used as the expression cassette to be a recombinant plasmid pHY300plk-PrpsD-TrpsD. After that, the carbonyl reductase gene mldh was inserted into the previous plasmid and a plasmid pHY300plk-PrpsD-mldh-TrpsD was achieved, followed by transformed into B. subtilis Wb600 to obtain a recombinant B. subtilis Wb600 (pHY300plk-PrpsD-mldh-TrpsD). Subsequently, the results for whole-cell biotransformation from recombinant B. subtilis showed that it could be used to catalyze MAK (1-phenyl- 1-keto-2-methylaminopropane) to d-pseudoephedrine in the presence of glucose. The yield of d-pseudoephedrine could be up to 97.5 mg/L and the conversion rate of MAK was 24.1%. This study indicates the possibility of biotransformation production of d-pseudoephedrine from recombinant B. subtilis.
Water insoluble and soluble lipids for gene delivery.
Mahato, Ram I
2005-04-05
Among various synthetic gene carriers currently in use, liposomes composed of cationic lipids and co-lipids remain the most efficient transfection reagents. Physicochemical properties of lipid/plasmid complexes, such as cationic lipid structure, cationic lipid to co-lipid ratio, charge ratio, particle size and zeta potential have significant influence on gene expression and biodistribution. However, most cationic lipids are toxic and cationic liposomes/plasmid complexes do not disperse well inside the target tissues because of their large particle size. To overcome the problems associated with cationic lipids, we designed water soluble lipopolymers for gene delivery to various cells and tissues. This review provides a critical discussion on how the components of water insoluble and soluble lipids affect their transfection efficiency and biodistribution of lipid/plasmid complexes.
Pittet, Vanessa; Phister, Trevor G.; Ziola, Barry
2013-01-01
Growth of specific lactic acid bacteria in beer leads to spoiled product and economic loss for the brewing industry. Microbial growth is typically inhibited by the combined stresses found in beer (e.g., ethanol, hops, low pH, minimal nutrients); however, certain bacteria have adapted to grow in this harsh environment. Considering little is known about the mechanisms used by bacteria to grow in and spoil beer, transcriptome sequencing was performed on a variant of the beer-spoilage organism Pediococcus claussenii ATCC BAA-344T (Pc344-358). Illumina sequencing was used to compare the transcript levels in Pc344-358 growing mid-exponentially in beer to those in nutrient-rich MRS broth. Various operons demonstrated high gene expression in beer, several of which are involved in nutrient acquisition and overcoming the inhibitory effects of hop compounds. As well, genes functioning in cell membrane modification and biosynthesis demonstrated significantly higher transcript levels in Pc344-358 growing in beer. Three plasmids had the majority of their genes showing increased transcript levels in beer, whereas the two cryptic plasmids showed slightly decreased gene expression. Follow-up analysis of plasmid copy number in both growth environments revealed similar trends, where more copies of the three non-cryptic plasmids were found in Pc344-358 growing in beer. Transcriptome sequencing also enabled the addition of several genes to the P . claussenii ATCC BAA-344T genome annotation, some of which are putatively transcribed as non-coding RNAs. The sequencing results not only provide the first transcriptome description of a beer-spoilage organism while growing in beer, but they also highlight several targets for future exploration, including genes that may have a role in the general stress response of lactic acid bacteria. PMID:24040005
Wei, Yuxiang; Yang, Changmei; Wei, Baojun; Huang, Jie; Wang, Lunan; Meng, Shuang; Zhang, Rui; Li, Jinming
2008-01-01
RNase-resistant, noninfectious virus-like particles containing exogenous RNA sequences (armored RNA) are good candidates as RNA controls and standards in RNA virus detection. However, the length of RNA packaged in the virus-like particles with high efficiency is usually less than 500 bases. In this study, we describe a method for producing armored L-RNA. Armored L-RNA is a complex of MS2 bacteriophage coat protein and RNA produced in Escherichia coli by the induction of a two-plasmid coexpression system in which the coat protein and maturase are expressed from one plasmid and the target RNA sequence with modified MS2 stem-loop (pac site) is transcribed from another plasmid. A 3V armored L-RNA of 2,248 bases containing six gene fragments—hepatitis C virus, severe acute respiratory syndrome coronavirus (SARS-CoV1, SARS-CoV2, and SARS-CoV3), avian influenza virus matrix gene (M300), and H5N1 avian influenza virus (HA300)—was successfully expressed by the two-plasmid coexpression system and was demonstrated to have all of the characteristics of armored RNA. We evaluated the 3V armored L-RNA as a calibrator for multiple virus assays. We used the WHO International Standard for HCV RNA (NIBSC 96/790) to calibrate the chimeric armored L-RNA, which was diluted by 10-fold serial dilutions to obtain samples containing 106 to 102 copies. In conclusion, the approach we used for armored L-RNA preparation is practical and could reduce the labor and cost of quality control in multiplex RNA virus assays. Furthermore, we can assign the chimeric armored RNA with an international unit for quantitative detection. PMID:18305135
Takemasa, Tohru; Yakushiji, Naohisa; Kikuchi, Dale Manjiro; Deocaris, Custer; Widodo; Machida, Masanao; Kiyosawa, Hidenori
2012-01-01
To investigate the feasibility of developing a method for detection of gene doping in power-athletes, we devised an experimental model system. Myostatin is a potent negative regulator of skeletal muscle development and growth, and myostatin-knockout mice exhibit a double-muscle phenotype. To achieve knockdown, we constructed plasmids expressing short hairpin interfering RNAs (shRNAs) against myostatin. These shRNAs were transfected into C2C12 cultured cells or injected into the tibialis anterior (TA) muscle of adult mice. By performing in vitro and in vivo experiments, we found that some shRNAs effectively reduced the expression of myostatin, and that the TA muscle showed hypertrophy of up to 27.9%. Then, using real-time PCR, we tried to detect the shRNA plasmid in the serum or muscles of mice into which it had been injected. Although we were unable to detect the plasmid in serum samples, it was detectable in the treated muscle at least four weeks after induction. We were also able to detect the plasmid in muscle in the vicinity of the TA. This gene doping model system will be useful for further studies aimed at doping control. Key pointsUsing a myostatin knockdown plasmid, we have succeeded in creating a model system for gene doping using mice that resulted in muscle hypertrophy greater than that reported previously.We confirmed that there was a limit of gene doping detection using real-time PCR, either from serum or muscle smple.This model experimental system can be utilized for examining indirect methods of gene doping detection such as immune responses to gene transfer or a profiling approach using DNA microarray.
Takemasa, Tohru; Yakushiji, Naohisa; Kikuchi, Dale Manjiro; Deocaris, Custer; Widodo; Machida, Masanao; Kiyosawa, Hidenori
2012-01-01
To investigate the feasibility of developing a method for detection of gene doping in power-athletes, we devised an experimental model system. Myostatin is a potent negative regulator of skeletal muscle development and growth, and myostatin-knockout mice exhibit a double-muscle phenotype. To achieve knockdown, we constructed plasmids expressing short hairpin interfering RNAs (shRNAs) against myostatin. These shRNAs were transfected into C2C12 cultured cells or injected into the tibialis anterior (TA) muscle of adult mice. By performing in vitro and in vivo experiments, we found that some shRNAs effectively reduced the expression of myostatin, and that the TA muscle showed hypertrophy of up to 27.9%. Then, using real-time PCR, we tried to detect the shRNA plasmid in the serum or muscles of mice into which it had been injected. Although we were unable to detect the plasmid in serum samples, it was detectable in the treated muscle at least four weeks after induction. We were also able to detect the plasmid in muscle in the vicinity of the TA. This gene doping model system will be useful for further studies aimed at doping control. Key pointsUsing a myostatin knockdown plasmid, we have succeeded in creating a model system for gene doping using mice that resulted in muscle hypertrophy greater than that reported previously.We confirmed that there was a limit of gene doping detection using real-time PCR, either from serum or muscle smple.This model experimental system can be utilized for examining indirect methods of gene doping detection such as immune responses to gene transfer or a profiling approach using DNA microarray. PMID:24149203
Ultrasound-targeted hepatic delivery of factor IX in hemophiliac mice.
Anderson, C D; Moisyadi, S; Avelar, A; Walton, C B; Shohet, R V
2016-06-01
Ultrasound-targeted microbubble destruction (UTMD) was used to direct the delivery of plasmid and transposase-based vectors encoding human factor IX (hFIX) to the livers of hemophilia B (FIX-/-) mice. The DNA vectors were incorporated into cationic lipid microbubbles, injected intravenously, and transfected into hepatocytes by acoustic cavitation of the bubbles as they transited the liver. Ultrasound parameters were identified that produced transfection of hepatocytes in vivo without substantial damage or bleeding in the livers of the FIX-deficient mice. These mice were treated with a conventional expression plasmid, or one containing a piggyBac transposon construct, and hFIX levels in the plasma and liver were evaluated at multiple time points after UTMD. We detected hFIX in the plasma by western blotting from mice treated with either plasmid during the 12 days after UTMD, and in the hepatocytes of treated livers by immunofluorescence. Reductions in clotting time and improvements in the percentage of FIX activity were observed for both plasmids, conventional (4.15±1.98%), and transposon based (2.70±.75%), 4 to 5 days after UTMD compared with untreated FIX (-/-) control mice (0.92±0.78%) (P=0.001 and P=0.012, respectively). Reduced clotting times persisted for both plasmids 12 days after treatment (reflecting percentage FIX activity of 3.12±1.56%, P=0.02 and 3.08±0.10%, P=0.001, respectively). Clotting times from an additional set of mice treated with pmGENIE3-hFIX were evaluated for long-term effects and demonstrated a persistent reduction in average clotting time 160 days after a single treatment. These data suggest that UTMD could be a minimally invasive, nonviral approach to enhance hepatic FIX expression in patients with hemophilia.
Chendeb, Mariam; Schneider, Robert; Davidson, Irwin; Fadloun, Anas
2017-01-01
In gene therapy, effective and selective suicide gene expression is crucial. We exploited the endogenous Long INterspersed Element-1 (L1) machinery often reactivated in human cancers to integrate the Herpes Simplex Virus Thymidine Kinase (HSV-TK) suicide gene selectively into the genome of cancer cells. We developed a plasmid-based system directing HSV-TK expression only when reverse transcribed and integrated in the host genome via the endogenous L1 ORF1/2 proteins and an Alu element. Delivery of these new constructs into cells followed by Ganciclovir (GCV) treatment selectively induced mortality of L1 ORF1/2 protein expressing cancer cells, but had no effect on primary cells that do not express L1 ORF1/2. This novel strategy for selective targeting of tumour cells provides high tolerability as the HSV-TK gene cannot be expressed without reverse transcription and integration, and high selectivity as these processes take place only in cancer cells expressing high levels of functional L1 ORF1/2. PMID:28415677
Xu, Jian-zhong; Zhang, Wei-guo
2016-01-01
With the availability of the whole genome sequence of Escherichia coli or Corynebacterium glutamicum, strategies for directed DNA manipulation have developed rapidly. DNA manipulation plays an important role in understanding the function of genes and in constructing novel engineering bacteria according to requirement. DNA manipulation involves modifying the autologous genes and expressing the heterogenous genes. Two alternative approaches, using electroporation linear DNA or recombinant suicide plasmid, allow a wide variety of DNA manipulation. However, the over-expression of the desired gene is generally executed via plasmid-mediation. The current review summarizes the common strategies used for genetically modifying E. coli and C. glutamicum genomes, and discusses the technical problem of multi-layered DNA manipulation. Strategies for gene over-expression via integrating into genome are proposed. This review is intended to be an accessible introduction to DNA manipulation within the bacterial genome for novices and a source of the latest experimental information for experienced investigators. PMID:26834010
Alimolaei, Mojtaba; Golchin, Mehdi; Abshenas, Jalil; Ezatkhah, Majid; Bafti, Mehrdad Shamsaddini
2018-06-01
The alpha-toxin is one of the virulence factors of Clostridium perfringens for gas gangrene in humans and animals or necrotic enteritis in poultry. The C-terminal domain of this toxin ( cpa 247-370 ) was synthesized and cloned into pT1NX vector to construct the pT1NX-alpha plasmid. This surface-expressing plasmid was electroporated into Lactobacillus casei ATCC 393, generating the recombinant L. casei strain expressing alpha-toxoid (LC-α strain). Expression of this modified alpha-toxoid was confirmed by SDS-PAGE, immunoblotting, and direct immunofluorescence microscopy. BALB/c mice, immunized orally by the recombinant LC-α strain, elicited mucosal and significantly humoral immune responses (p < 0.05) and developed a protection against 900 MLD/mL of the standard alpha-toxin. This study showed that this recombinant LC-α strain could be a promising vaccine candidate against gas gangrene and necrotic enteritis.
Farshadpour, Fatemeh; Makvandi, Manoochehr; Taherkhani, Reza
2015-01-01
Background: Hepatitis E Virus (HEV) is the causative agent of enterically transmitted acute hepatitis and has high mortality rate of up to 30% among pregnant women. Therefore, development of a novel vaccine is a desirable goal. Objectives: The aim of this study was to construct tPAsp-PADRE-truncated open reading frame 2 (ORF2) and truncated ORF2 DNA plasmid, which can assist future studies with the preparation of an effective vaccine against Hepatitis E Virus. Materials and Methods: A synthetic codon-optimized gene cassette encoding tPAsp-PADRE-truncated ORF2 protein was designed, constructed and analyzed by some bioinformatics software. Furthermore, a codon-optimized truncated ORF2 gene was amplified by the polymerase chain reaction (PCR), with a specific primer from the previous construct. The constructs were sub-cloned in the pVAX1 expression vector and finally expressed in eukaryotic cells. Results: Sequence analysis and bioinformatics studies of the codon-optimized gene cassette revealed that codon adaptation index (CAI), GC content, and frequency of optimal codon usage (Fop) value were improved, and performance of the secretory signal was confirmed. Cloning and sub-cloning of the tPAsp-PADRE-truncated ORF2 gene cassette and truncated ORF2 gene were confirmed by colony PCR, restriction enzymes digestion and DNA sequencing of the recombinant plasmids pVAX-tPAsp-PADRE-truncated ORF2 (aa 112-660) and pVAX-truncated ORF2 (aa 112-660). The expression of truncated ORF2 protein in eukaryotic cells was approved by an Immunofluorescence assay (IFA) and the reverse transcriptase polymerase chain reaction (RT-PCR) method. Conclusions: The results of this study demonstrated that the tPAsp-PADRE-truncated ORF2 gene cassette and the truncated ORF2 gene in recombinant plasmids are successfully expressed in eukaryotic cells. The immunogenicity of the two recombinant plasmids with different formulations will be evaluated as a novel DNA vaccine in future investigations. PMID:26865938
Melman, A; Biggs, G; Davies, K; Zhao, W; Tar, M T; Christ, G J
2008-03-01
Previous reports have demonstrated that gene transfer with the alpha, or pore-forming, subunit of the human Maxi-K channel (hSlo) restores the decline in erectile capacity observed in established rat models of diabetes and aging. Preliminary data from a human clinical trial also showed safety and potential efficacy in 11 men treated with the same plasmid construct expressing the Maxi-K channel. In all instances, the original plasmid was driven by the heterologous cytomegalovirus promoter which is broadly active in a wide variety of cell and tissue types. To more precisely determine the contribution of the corporal myocyte to the observed physiological effects in vivo, we report here our initial work using a distinct vector (pSMAA-hSlo) in which hSlo gene expression was driven off the mouse smooth muscle alpha-actin (SMAA) promoter. Specifically, older rats, with diminished erectile capacity, were given a single intracorporal injection with either 100 mug pVAX-hSlo or 10, 100 or 1000 mug pSMAA-hSlo, or vector or vehicle alone. Significantly increased intracavernous pressure (ICP) responses to cavernous nerve stimulation were observed for all doses of both plasmids encoding hSlo, relative to control injections. These data confirm and extend previous observations to document that smooth muscle cell-specific expression of hSlo in corporal tissue is both necessary and sufficient to restore erectile function in aging rats.
Optimization of mNeonGreen for Homo sapiens increases its fluorescent intensity in mammalian cells.
Tanida-Miyake, Emiko; Koike, Masato; Uchiyama, Yasuo; Tanida, Isei
2018-01-01
Green fluorescent protein (GFP) is tremendously useful for investigating many cellular and intracellular events. The monomeric GFP mNeonGreen is about 3- to 5-times brighter than GFP and monomeric enhanced GFP and shows high photostability. The maturation half-time of mNeonGreen is about 3-fold faster than that of monomeric enhanced GFP. However, the cDNA sequence encoding mNeonGreen contains some codons that are rarely used in Homo sapiens. For better expression of mNeonGreen in human cells, we synthesized a human-optimized cDNA encoding mNeonGreen and generated an expression plasmid for humanized mNeonGreen under the control of the cytomegalovirus promoter. The resultant plasmid was introduced into HEK293 cells. The fluorescent intensity of humanized mNeonGreen was about 1.4-fold higher than that of the original mNeonGreen. The humanized mNeonGreen with a mitochondria-targeting signal showed mitochondrial distribution of mNeonGreen. We further generated an expression vector of humanized mNeonGreen with 3xFLAG tags at its carboxyl terminus as these tags are useful for immunological analyses. The 3xFLAG-tagged mNeonGreen was recognized well with an anti-FLAG-M2 antibody. These plasmids for the expression of humanized mNeonGreen and mNeonGreen-3xFLAG are useful tools for biological studies in mammalian cells using mNeonGreen.
Li, Hui; Li, Rong; Zhong, Sen; Ren, Hong; Deng, Cun-liang; Shi, Xiao-ling; Wang, Ming-yong
2006-04-01
To construct and express a chimeric Mtb8.4 with signal peptide (MS)/hIL12 eukaryotic expression plasmid, and to study the immunogenicity of the MS/hIL-12 chimeric genetic vaccines. The MS/hIL-12 chimeric gene was amplified by polymerase chain reaction (PCR) and cloned into the eukaryotic expression vector pCI-neo. The correct pCI-neo-MS/hIL12 (pMSI) recombinant plasmid was identified by PCR, restricted enzyme digestion and DNA sequencing. COS-7 cells were transfected with pMSI constructs by cationic liposome. After 48 hours, mRNA of the target gene was detected by RT-PCR, and hIL-12 protein in culture supernatant and cell lysates was detected by Western blot. C57BL/6N mice were vaccinated with MS/hIL-12 chimeric gene vaccine for three times at 3 week intervals. Four weeks after the final inoculation, three mice were sacrificed for measurement of the cytokine response and cytotoxic T lymphocyte (CTL) induction. The accuracy of plasmid construction was confirmed by a number of molecular biological techniques. Transfection of COS-7 cells with plasmids pMSI lead to transient expression of fusion proteins. The IFN-gamma and IL-2 titers were (1,521 +/- 48) ng/L and (755 +/- 41) ng/L in MS/hIL-12 chimeric gene vaccine group, (820 +/- 50) ng/L and (297 +/- 31) ng/L in MS gene vaccine group, (1,487 +/- 40) ng/L and (767 +/- 50) ng/L in BCG group, (121 +/- 16) ng/L and (62 +/- 10) ng/L in vacant vector group, and (48 +/- 16) ng/L and (32 +/- 17) ng/L in PBS group respectively. The levels of IFN-gamma and IL-2 in MS/hIL-12 chimeric gene vaccine group were higher than those of MS gene vaccine group, vacant vector group and PBS group (P < 0.01) and was similar to the BCG group (P > 0.05). The level of IL-4 in BCG group [(91 +/- 11) ng/L] increased significantly as compared to other groups (P < 0.01). When effector-cell-to-target-cell ratio (E:T ratio) were 100:1, 50:1, and 10:1 respectively, the CTL activity was 77.5%, 51.2%, 30.3% in MS/hIL-12 chimeric gene vaccine group, 56.2%, 37.8%, 11.5% in MS gene vaccine group, 28.9%, 21.4%, 9.8% in BCG group. The cytotoxicity in MS/hIL-12 chimeric gene vaccine group was higher than that of other groups (P < 0.01). When used to construct the chimeric gene vaccine, hIL-12 could improve the immunogenicity of MS gene vaccine.
DNA packaging by the Bacillus subtilis defective bacteriophage PBSX.
Anderson, L M; Bott, K F
1985-01-01
Defective bacteriophage PBSX, a resident of all Bacillus subtilis 168 chromosomes, packages fragments of DNA from all portions of the host chromosome when induced by mitomycin C. In this study, the physical process for DNA packaging of both chromosomal and plasmid DNAs was examined. Discrete 13-kilobase (kb) lengths of DNA were packaged by wild-type phage, and the process was DNase I resistant and probably occurred by a head-filling mechanism. Genetically engineered isogenic host strains having a chloramphenicol resistance determinant integrated as a genetic flag at two different regions of the chromosome were used to monitor the packaging of specific chromosomal regions. No dramatic selectivity for these regions could be documented. If the wild-type strain 168 contains autonomously replicating plasmids, especially pC194, the mitomycin C induces an increase in size of resident plasmid DNA, which is then packaged as 13-kb pieces into phage heads. In strain RB1144, which lacks substantial portions of the PBSX resident phage region, mitomycin C treatment did not affect the structure of resident plasmids. Induction of PBSX started rolling circle replication on plasmids, which then became packaged as 13-kb fragments. This alteration or cannibalization of plasmid replication resulting from mitomycin C treatment requires for its function some DNA within the prophage deletion of strain RB1144. Images PMID:3923209
DNASU plasmid and PSI:Biology-Materials repositories: resources to accelerate biological research
Seiler, Catherine Y.; Park, Jin G.; Sharma, Amit; Hunter, Preston; Surapaneni, Padmini; Sedillo, Casey; Field, James; Algar, Rhys; Price, Andrea; Steel, Jason; Throop, Andrea; Fiacco, Michael; LaBaer, Joshua
2014-01-01
The mission of the DNASU Plasmid Repository is to accelerate research by providing high-quality, annotated plasmid samples and online plasmid resources to the research community through the curated DNASU database, website and repository (http://dnasu.asu.edu or http://dnasu.org). The collection includes plasmids from grant-funded, high-throughput cloning projects performed in our laboratory, plasmids from external researchers, and large collections from consortia such as the ORFeome Collaboration and the NIGMS-funded Protein Structure Initiative: Biology (PSI:Biology). Through DNASU, researchers can search for and access detailed information about each plasmid such as the full length gene insert sequence, vector information, associated publications, and links to external resources that provide additional protein annotations and experimental protocols. Plasmids can be requested directly through the DNASU website. DNASU and the PSI:Biology-Materials Repositories were previously described in the 2010 NAR Database Issue (Cormier, C.Y., Mohr, S.E., Zuo, D., Hu, Y., Rolfs, A., Kramer, J., Taycher, E., Kelley, F., Fiacco, M., Turnbull, G. et al. (2010) Protein Structure Initiative Material Repository: an open shared public resource of structural genomics plasmids for the biological community. Nucleic Acids Res., 38, D743–D749.). In this update we will describe the plasmid collection and highlight the new features in the website redesign, including new browse/search options, plasmid annotations and a dynamic vector mapping feature that was developed in collaboration with LabGenius. Overall, these plasmid resources continue to enable research with the goal of elucidating the role of proteins in both normal biological processes and disease. PMID:24225319
Ray, F A; Peabody, D S; Cooper, J L; Cram, L S; Kraemer, P M
1990-01-01
To define the role of SV40 large T antigen in the transformation and immortalization of human cells, we have constructed a plasmid lacking most of the unique coding sequences of small t antigen as well as the SV40 origin of replication. The promoter for T antigen, which lies within the origin of replication, was deleted and replaced by the Rous sarcoma virus promoter. This minimal construct was co-electroporated into normal human fibroblasts of neonatal origin along with a plasmid containing the neomycin resistance gene (neo). Three G418-resistant, T antigen-positive clones were expanded and compared to three T antigen-positive clones that received the pSV3neo plasmid (capable of expressing large and small T proteins and having two origins of replication). Autonomous replication of plasmid DNA was observed in all three clones that received pSV3neo but not in any of the three origin minus clones. Immediately after clonal expansion, several parameters of neoplastic transformation were assayed. Low percentages of cells in T antigen-positive populations were anchorage independent or capable of forming colonies in 1% fetal bovine serum. The T antigen-positive clones generally exhibited an extended lifespan in culture but rarely became immortalized. Large numbers of dead cells were continually generated in all T antigen-positive, pre-crisis populations. Ninety-nine percent of all T antigen-positive cells had numerical or structural chromosome aberrations. Control cells that received the neo gene did not have an extended life span, did not have noticeable numbers of dead cells, and did not exhibit karyotype instability. We suggest that the role of T antigen protein in the transformation process is to generate genetic hypervariability, leading to various consequences including neoplastic transformation and cell death.
Gene expression of osteogenic factors following gene therapy in mandibular lengthening.
Wu, Guoping; Zhou, Bin; Hu, Chunbing; Li, Shaolan
2015-03-01
This study investigated the effect of gene therapy on the expression of osteogenic mediators in mandibular distraction osteogenesis rabbits. Bilateral mandibular osteotomies were performed in 45 New-Zealand rabbits. After a latency of 3 days, the mandibles were elongated using distractors with a rate of 0.8 mm/d for 7 days. After the completion of distraction, the rabbits were randomly divided into 5 groups: 2 μg (0.1 μg/μL) of recombinant plasmid pIRES-hVEGF165-hBMP-2, recombinant plasmid pIRES-hBMP2, recombinant plasmid pIRES-hVEGF165, pIRES, and the same volume of normal saline were injected into the distraction gap of groups A, B, C, D, and E, respectively, followed by electroporation. Three animals were killed at the 7th, 14th, and 28th day after gene transfected in different groups, respectively. The lengthened mandibles were harvested and processed for immunohistochemical examinations; the mean optic densities (MODs) and integral optical density of bone morphogenetic protein (BMP-2) and transforming growth factor β1 (TGF-β1)-positive cells were measured by CMIAS-2001A computerized image analyzer. The data were analyzed with SPSS (SPSS Inc, Chicago, IL). Bone morphogenetic protein 2 and TGF-β1 staining was mainly located in inflammatory cells, monocytes, fibroblasts, osteoblasts, osteocytes, and chondrocytes in the distraction zones. Their strongest expression reached to the peak at the seventh day and decreased at the 14th day of consolidation stage; at the 28th day, they expressed weakly. Image analysis results show that, at the seventh day, the expression of BMP-2 in group B (0.26 ± 0.03, 0.36 ± 0.02) was the strongest; there was significant difference among them (P < 0.01), whereas the expression of TGF-β1 in group C (0.38 ± 0.06, 1.05 ± 0.19) is strongest followed by group A (0.34 ± 0.05, 0.95 ± 0.16) and B (0.33 ± 0.07, 0.90 ± 0.19). At every time point, the level of expression of BMP-2 and TGF-β1 in gene therapy groups (groups A, B, and C) was remarkably higher than those in non-gene therapy groups(groups D and E). There were significant differences between gene therapy groups and non-gene therapy groups (P < 0.05 or P < 0.001). These results indicated that local gene transfection can up-regulate the expression of osteogenic mediators (BMP-2 and TGF-β1), which may promote cell differentiation and proliferation and stimulate extracellular matrix synthesis and new bone formation in distraction gap.
Agrobacterium-mediated transient MaFT expression in mulberry (Morus alba L.) leaves.
Wu, Su-Li; Yang, Xiao-Bing; Liu, Li-Qun; Jiang, Tao; Wu, Hai; Su, Chao; Qian, Yong-Hua; Jiao, Feng
2015-01-01
To optimize Agrobacterium-mediated transient transformation assay in mulberry (Morus alba L.), various infiltration methods, Agrobacterium tumefaciens (A. tumefaciens) strains, and bacterial concentrations were tested in mulberry seedlings. Compared with LBA4404, GV3101 harboring pBE2133 plasmids presented stronger GUS signals at 3 days post infiltration using syringe. Recombinant plasmids pBE2133:GFP and pBE2133:GFP:MaFT were successfully constructed. Transient expression of MaFT:GFP protein was found in leaves, petiole (cross section), and shoot apical meristem (SAM) of mulberry according to the GFP signal. Moreover, MaFT:GFP mRNA was also detected in leaves and SAM via RT-PCR and qRT-PCR. An efficient transient transformation system could be achieved in mulberry seedlings by syringe using A. tumefaciens GV3101 at the OD600 of 0.5. The movement of MaFT expression from leaves to SAM might trigger the precocious flowering of mulberry.
Windass, J D; Newton, C R; De Maeyer-Guignard, J; Moore, V E; Markham, A F; Edge, M D
1982-01-01
An 82 base pair DNA fragment has been synthesised which contains the E. coli trp promoter and operator sequences and also encodes the first Shine Dalgarno sequence of the trp operon. This DNA fragment is flanked by EcoRI and ClaI/TaqI cohesive ends and is thus easy to clone, transfer between vector systems and couple to genes to drive their expression. It has been cloned into plasmid pAT153, producing a convenient trp promoter vector. We have also joined the fragment to a synthetic IFN-alpha 1 gene, using synthetic oligonucleotides to generate a completely natural, highly efficient bacterial translation initiation signal on the promoter proximal side of the IFN gene. Plasmids carrying this construction enable E. coli cells to express IFN-alpha 1 almost constitutively and with significantly higher efficiency than from a lacUV5 promoter based system. Images PMID:6184675
Engineered promoters enable constant gene expression at any copy number in bacteria.
Segall-Shapiro, Thomas H; Sontag, Eduardo D; Voigt, Christopher A
2018-04-01
The internal environment of growing cells is variable and dynamic, making it difficult to introduce reliable parts, such as promoters, for genetic engineering. Here, we applied control-theoretic ideas to design promoters that maintained constant levels of expression at any copy number. Theory predicts that independence to copy number can be achieved by using an incoherent feedforward loop (iFFL) if the negative regulation is perfectly non-cooperative. We engineered iFFLs into Escherichia coli promoters using transcription-activator-like effectors (TALEs). These promoters had near-identical expression in different genome locations and plasmids, even when their copy number was perturbed by genomic mutations or changes in growth medium composition. We applied the stabilized promoters to show that a three-gene metabolic pathway to produce deoxychromoviridans could retain function without re-tuning when the stabilized-promoter-driven genes were moved from a plasmid into the genome.
Tett, Adrian; Spiers, Andrew J; Crossman, Lisa C; Ager, Duane; Ciric, Lena; Dow, J Maxwell; Fry, John C; Harris, David; Lilley, Andrew; Oliver, Anna; Parkhill, Julian; Quail, Michael A; Rainey, Paul B; Saunders, Nigel J; Seeger, Kathy; Snyder, Lori AS; Squares, Rob; Thomas, Christopher M; Turner, Sarah L; Zhang, Xue-Xian; Field, Dawn; Bailey, Mark J
2009-01-01
The plasmid pQBR103 was found within Pseudomonas populations colonizing the leaf and root surfaces of sugar beet plants growing at Wytham, Oxfordshire, UK. At 425 kb it is the largest self-transmissible plasmid yet sequenced from the phytosphere. It is known to enhance the competitive fitness of its host, and parts of the plasmid are known to be actively transcribed in the plant environment. Analysis of the complete sequence of this plasmid predicts a coding sequence (CDS)-rich genome containing 478 CDSs and an exceptional degree of genetic novelty; 80% of predicted coding sequences cannot be ascribed a function and 60% are orphans. Of those to which function could be assigned, 40% bore greatest similarity to sequences from Pseudomonas spp, and the majority of the remainder showed similarity to other c-proteobacterial genera and plasmids. pQBR103 has identifiable regions presumed responsible for replication and partitioning, but despite being tra+ lacks the full complement of any previously described conjugal transfer functions. The DNA sequence provided few insights into the functional significance of plant-induced transcriptional regions, but suggests that 14% of CDSs may be expressed (11 CDSs with functional annotation and 54 without), further highlighting the ecological importance of these novel CDSs. Comparative analysis indicates that pQBR103 shares significant regions of sequence with other plasmids isolated from sugar beet plants grown at the same geographic location. These plasmid sequences indicate there is more novelty in the mobile DNA pool accessible to phytosphere pseudomonas than is currently appreciated or understood. PMID:18043644
Purification of influenza deoxyribonucleic acid-based vaccine using agmatine monolith.
Bicho, D; Caramelo-Nunes, C; Sousa, A; Sousa, F; Queiroz, J A; Tomaz, C T
2016-02-15
Lately, researchers have made several efforts to improve vaccine production to fight highly contagious respiratory diseases like influenza. One of the most promising options for reducing the impact of this virus is DNA vaccination. However, a large quantity of highly pure plasmid DNA (pDNA) is necessary to attain this goal. The present work describes the production and purification of the plasmid NTC7482-41H-VA2HA expressing influenza virus hemagglutinin using an agmatine monolith. This ligand was chosen to purify supercoiled (sc) pDNA from complex lysates because of its versatile multimodal character. Its natural intervention in several biological systems together with its similarity with the highly studied arginine ligand allowed the development of a simpler and more specific purification process. Agmatine works under two strategies: descending ammonium sulfate gradient and ascending sodium chloride gradient. Furthermore, pH manipulation revealed an important role in pDNA isoforms selectivity. Dynamic binding capacity (DBC) experiments were performed varying different parameters and showed an increase with pDNA concentration, while high flow rate and high pH had the opposite effect. Sc pDNA was purified with high yield and was efficient with respect to cell transfection and cell viability. This monolith showed to be appropriate to purify the plasmid NTC7482-41H-VA2HA, providing a valuable tool for pDNA influenza vaccines preparation. Copyright © 2016. Published by Elsevier B.V.
Guo, Lei; Rhen, Turk
2017-10-01
Sex is determined by temperature during embryogenesis in snapping turtles, Chelydra serpentina. Previous studies in this species show that dihydrotestosterone (DHT) induces ovarian development at temperatures that normally produce males or mixed sex ratios. The feminizing effect of DHT is associated with increased expression of FoxL2, suggesting that androgens regulate transcription of FoxL2. To test this hypothesis, we cloned the proximal promoter (1.6kb) and coding sequence for snapping turtle FoxL2 (tFoxL2) in frame with mCherry to produce a fluorescent reporter. The tFoxL2-mCherry fusion plasmid or mCherry control plasmid were stably transfected into mouse KK1 granulosa cells. These cells were then treated with 0, 1, 10, or 100nM DHT to assess androgen effects on tFoxL2-mCherry expression. In contrast to the main hypothesis, DHT did not alter expression of the tFoxL2-mCherry reporter. However, normal serum increased expression of tFoxL2-mCherry when compared to charcoal-stripped serum, indicating that the cloned region of tFoxL2 contains cis regulatory elements. We also used the tFoxL2-mCherry plasmid as an expression vector to test the hypothesis that DHT and tFoxL2 interact to regulate expression of endogenous genes in granulosa cells. While tFoxL2-mCherry and DHT had independent effects on mouse FoxL2, FshR, GnRHR, and StAR expression, tFoxL2-mCherry potentiated low concentration DHT effects on mouse aromatase expression. Further studies will be required to determine whether synergistic regulation of aromatase by DHT and FoxL2 also occurs in turtle gonads during the sex-determining period, which would explain the feminizing effect of DHT in this species. Copyright © 2017 Elsevier Inc. All rights reserved.
Nambiar, P. T. C.; Ma, S.-W.; Iyer, V. N.
1990-01-01
A region of DNA which determined the production of the insecticidal toxin of Bacillus thuringiensis subsp. israelensis was cloned into a derivative of a broad-host-range group IncQ plasmid vector of gram-negative bacteria. The plasmid which we constructed was transferred by conjugative mobilization into a Bradyrhizobium species that nodulates pigeon peas. In this species the construction was maintained stably in the absence of selection and expressed the gene that was installed. Experiments in a greenhouse with the strain which we constructed indicated that this organism provides protection against root nodule damage by the larvae of the insect Rivellia angulata (Diptera). Images PMID:16348294
Vectorology and Factor Delivery in Induced Pluripotent Stem Cell Reprogramming
2014-01-01
Induced pluripotent stem cell (iPSC) reprogramming requires sustained expression of multiple reprogramming factors for a limited period of time (10–30 days). Conventional iPSC reprogramming was achieved using lentiviral or simple retroviral vectors. Retroviral reprogramming has flaws of insertional mutagenesis, uncontrolled silencing, residual expression and re-activation of transgenes, and immunogenicity. To overcome these issues, various technologies were explored, including adenoviral vectors, protein transduction, RNA transfection, minicircle DNA, excisable PiggyBac (PB) transposon, Cre-lox excision system, negative-sense RNA replicon, positive-sense RNA replicon, Epstein-Barr virus-based episomal plasmids, and repeated transfections of plasmids. This review provides summaries of the main vectorologies and factor delivery systems used in current reprogramming protocols. PMID:24625220
Feeney, Mistianne; Punja, Zamir K
2015-01-01
Hemp (Cannabis sativa L.) suspension culture cells were transformed with Agrobacterium tumefaciens strain EHA101 carrying the binary plasmid pNOV3635. The plasmid contains a phosphomannose isomerase (PMI) selectable marker gene. Cells transformed with PMI are capable of metabolizing the selective agent mannose, whereas cells not expressing the gene are incapable of using the carbon source and will stop growing. Callus masses proliferating on selection medium were screened for PMI expression using a chlorophenol red assay. Genomic DNA was extracted from putatively transformed callus lines, and the presence of the PMI gene was confirmed using PCR and Southern hybridization. Using this method, an average transformation frequency of 31.23% ± 0.14 was obtained for all transformation experiments, with a range of 15.1-55.3%.
Isolation and expression of a Bacillus cereus gene encoding benzil reductase.
Maruyama, R; Nishizawa, M; Itoi, Y; Ito, S; Inoue, M
2001-12-20
Benzil was reduced stereospecifically to (S)-benzoin by Bacillus cereus strain Tim-r01. To isolate the gene responsible for asymmetric reduction, we constructed a library consisting of Escherichia coli clones that harbored plasmids expressing Bacillus cereus genes. The library was screened using the halo formation assay, and one clone showed benzil reduction to (S)-benzoin. Thus, this clone seemed to carry a plasmid encoding a Bacillus cereus benzil reductase. The deduced amino acid sequence had marked homologies to the Bacillus subtilis yueD protein (41% identity), the yeast open reading frame YIR036C protein (31%), and the mammalian sepiapterin reductases (28% to 30%), suggesting that benzil reductase is a novel short-chain de-hydrogenases/ reductase. Copyright 2001 John Wiley & Sons, Inc.
Denis-Larose, Claude; Bergeron, Hélène; Labbé, Diane; Greer, Charles W.; Hawari, Jalal; Grossman, Matthew J.; Sankey, Bruce M.; Lau, Peter C. K.
1998-01-01
The replication region of a 100-kb desulfurization plasmid (pSOX) from Rhodococcus sp. strain X309 was localized to a 4-kb KpnI fragment, and its sequence was determined. The amino acid sequence of one of the predicted open reading frames (ORFs) was related to the putative replication (Rep) protein sequences of the mycobacterial pLR7 family of plasmids. Three of the five predicted ORF products were identified by radiolabelling with the Escherichia coli T7 polymerase/promoter system. In E. coli, the Rep protein of pSOX was apparently synthesized in a shortened form, 21.3 kDa instead of the predicted 41.3 kDa, as a result of an internal initiation. This situation is reminescent of that for some bacterial Rep proteins. A shuttle plasmid was constructed with the pSOX origin, pBluescript II KS−, and the chloramphenicol resistance (Cmr) gene from pRF29. This new shuttle plasmid was used to demonstrate expression of the Bacillus subtilis sacB gene in a strain of Rhodococcus, rendering it sensitive to the presence of sucrose. PMID:9797291
Kis antitoxin couples plasmid R1 replication and parD (kis,kid) maintenance modules.
López-Villarejo, Juan; Diago-Navarro, Elizabeth; Hernández-Arriaga, Ana María; Díaz-Orejas, Ramón
2012-03-01
The coupling between the replication and parD (kis, kid) maintenance modules of R1 has been revisited here by the isolation of a significant collection of conditional replication mutants in the pKN1562 mini-R1 plasmid, and in its derivative, pJLV01, specifically affected in the RNase activity of the Kid toxin. This new analysis aims to identify key factors in this coupling. For this purpose we have quantified and characterized the restriction introduced by parD to isolate conditional replication mutants of this plasmid, a signature of the modular coupling. This restriction depends on the RNase activity of the Kid toxin and it is relieved by either over-expression of the Kis antitoxin or by preventing its degradation by Lon and ClpAP proteases. Based on these data and on the correlation between copy numbers and parD transcriptional levels obtained in the different mutants, it is proposed that a reduction of Kis antitoxin levels in response to inefficient plasmid replication is the key factor for coupling plasmid replication and parD modules. Copyright © 2012 Elsevier Inc. All rights reserved.
Kalariya, Mayurkumar; Amiji, Mansoor M
2013-09-10
The purpose of this study was to develop a water-in-oil-in-water (W/O/W) multiple emulsions-based vaccine delivery system for plasmid DNA encoding the gp100 peptide antigen for melanoma immunotherapy. The gp100 encoding plasmid DNA was encapsulated in the inner-most aqueous phase of squalane oil containing W/O/W multiple emulsions using a two-step emulsification method. In vitro transfection ability of the encapsulated plasmid DNA was investigated in murine dendritic cells by transgene expression analysis using fluorescence microscopy and ELISA methods. Prophylactic immunization using the W/O/W multiple emulsions encapsulated the gp100 encoding plasmid DNA vaccine significantly reduced tumor volume in C57BL/6 mice during subsequent B16-F10 tumor challenge. In addition, serum Th1 cytokine levels and immuno-histochemistry of excised tumor tissues indicated activation of cytotoxic T-lymphocytes mediated anti-tumor immunity causing tumor growth suppression. The W/O/W multiple emulsions-based vaccine delivery system efficiently delivers the gp100 plasmid DNA to induce cell-mediated anti-tumor immunity. Copyright © 2013 Elsevier B.V. All rights reserved.
The genetic basis of the fitness costs of antimicrobial resistance: a meta-analysis approach.
Vogwill, Tom; MacLean, R Craig
2015-03-01
The evolution of antibiotic resistance carries a fitness cost, expressed in terms of reduced competitive ability in the absence of antibiotics. This cost plays a key role in the dynamics of resistance by generating selection against resistance when bacteria encounter an antibiotic-free environment. Previous work has shown that the cost of resistance is highly variable, but the underlying causes remain poorly understood. Here, we use a meta-analysis of the published resistance literature to determine how the genetic basis of resistance influences its cost. We find that on average chromosomal resistance mutations carry a larger cost than acquiring resistance via a plasmid. This may explain why resistance often evolves by plasmid acquisition. Second, we find that the cost of plasmid acquisition increases with the breadth of its resistance range. This suggests a potentially important limit on the evolution of extensive multidrug resistance via plasmids. We also find that epistasis can significantly alter the cost of mutational resistance. Overall, our study shows that the cost of antimicrobial resistance can be partially explained by its genetic basis. It also highlights both the danger associated with plasmidborne resistance and the need to understand why resistance plasmids carry a relatively low cost.
Influence of Space Flight Factors on the Genetic Properties of Streptomyces Lividans 66 (PIJ702)
NASA Technical Reports Server (NTRS)
Tabakov, V. Yu.; Voeikova, T. A.; Tairbekov, M. G.; Goins, T. L.; Martinson, V. G.; Pyle, B. H.
2006-01-01
Gram-positive Streptomyces bacteria display genetic instability in response to external factors. Strain S. lividans 66 harbors the multicopy plasmid pIJ702 with selective and differential marker genes for antibiotic thiostrepton resistance and melanin production. Culture plates of modified ISP agar medium with and without thiostrepton were flown on Foton-M2. Suboptimal flight temperatures, which were simulated for asynchronous ground controls, resulted in slow growth and failure to differentiate and sporulate. Flight samples and asynchronous controls showed a high frequency of failing to express plasmid markers compared to laboratory controls. This was associated with loss of plasmid DNA and likely resulted from suboptimal temperatures for flight cultures and controls. Neither restriction fragment length polymorphism, nor polymerase chain reaction amplification coupled with denaturing gradient gel electrophoresis, revealed differences between pIJ702 DNA from flight vs. control clones. Mutations of the plasmid marker genes resulting from specific spaceflight factors, e.g., microgravity and radiation, were not detected.
Misic, V; El-Mogy, M; Geng, S; Haj-Ahmad, Y
2016-01-01
Endonuclease G (EndoG) is a mitochondrial apoptosis regulator that also has roles outside of programmed cell death. It has been implicated as a defence DNase involved in the degradation of exogenous DNA after transfection of mammalian cells and in homologous recombination of viral and endogenous DNA. In this study, we looked at the effect of EndoG depletion on plasmid DNA uptake and the levels of homologous recombination in HeLa cells. We show that the proposed defence role of EndoG against uptake of non-viral DNA vectors does not extend to the cervical carcinoma HeLa cells, as targeting of EndoG expression by RNA interference failed to increase intracellular plasmid DNA levels. However, reducing EndoG levels in HeLa cells resulted in a statistically significant reduction of homologous recombination between two plasmid DNA substrates. These findings suggest that non-viral DNA vectors are also substrates for EndoG in its role in homologous recombination.
Shao, Huanhuan; Cao, Qinghua; Zhao, Hongyan; Tan, Xuemei; Feng, Hong
2015-01-01
A native plasmid (pSU01) was detected by genome sequencing of Bacillus subtilis strain S1-4. Two pSU01-based shuttle expression vectors pSU02-AP and pSU03-AP were constructed enabling stable replication in B. subtilis WB600. These vectors contained the reporter gene aprE, encoding an alkaline protease from Bacillus pumilus BA06. The expression vector pSU03-AP only possessed the minimal replication elements (rep, SSO, DSO) and exhibited more stability on structure, suggesting that the rest of the genes in pSU01 (ORF1, ORF2, mob, hsp) were unessential for the structural stability of plasmid in B. subtilis. In addition, recombinant production of the alkaline protease was achieved more efficiently with pSU03-AP whose copy number was estimated to be more than 100 per chromosome. Furthermore, pSU03-AP could also be used to transform and replicate in B. pumilus BA06 under selective pressure. In conclusion, pSU03-AP is expected to be a useful tool for gene expression in Bacillus subtilis and B. pumilus.
Generation of a Tet-On Expression System to Study Transactivation Ability of Tax-2.
Bignami, Fabio; Sozzi, Riccardo Alessio; Pilotti, Elisabetta
2017-01-01
HTLV Tax proteins (Tax-1 and Tax-2) are known to be able to transactivate several host cellular genes involved in complex molecular pathways. Here, we describe a stable and regulated high-level expression model based on Tet-On system, to study the capacity of Tax-2 to transactivate host genes. In particular, the Jurkat Tet-On cell line suitable for evaluating the ability of Tax-2 to stimulate transactivation of a specific host gene, CCL3L1 (C-C motif chemokine ligand 3 like 1 gene), was selected. Then, a plasmid expressing tax-2 gene under control of a tetracycline-response element was constructed. To avoid the production of a fusion protein between the report gene and the inserted gene, a bidirectional plasmid was designed. Maximum expression and fast response time were achieved by using nucleofection technology as transfection method. After developing an optimized protocol for efficiently transferring tax-2 gene in Jurkat Tet-On cellular model and exposing transfected cells to Dox (doxycycline, a tetracycline derivate), a kinetics of tax-2 expression through TaqMan Real-time PCR assay was determined.
Inoue, Masaharu; Kikuchi, Maho; Komoriya, Tomoe; Watanabe, Kunitomo; Kouno, Hideki
2007-01-01
Clostridium perfringens (C. perfringens) is a Gram-positive bacterial pathogen that widely propagets in the soil and the gastrointestinal tract of human and animals. This bacteria causes food poisoning, gas gangrene and other various range of infectious diseases. But there is no standard diagnosis method of C. perfringens. In order to develop a new type of immunoassay for clinical purpose, we studied expression and extracellular secretion of recombinant alpha-toxin having enzyme activity in E. coli expression system. Cloning was carried out after PCR amplification from C. perfringens GAI 94074 which was clinical isolate. Three kinds of fragment were cloned using pET100/D-TOPO vector. These fragments coded for ribosome binding site, signal peptide, and alpha-toxin gene respectively. Recombinant pET100 plasmid transformed into TOP 10 cells and the obtained plasmids were transformed into BL21 (DE3) cells. Then, the transformants were induced expression with IPTG. In conclusion, we successfully cloned, expressed and exteracellular secreted C. perfringens alpha-toxin containing signal peptide. Biologically, the obtained recombinant protein was positive for phospholipase C activity.
Ma, Bing-cun; Yang, Xin; Wang, Hong-ning; Cao, Hai-peng; Xu, Peng-wei; Ding, Meng-die; Liu, Hui
2016-01-01
To obtain adhesive and safe lactic acid bacteria (LAB) strains for expressing heterologous antigens, we screened LAB inhabitants in intestine of Tibetan chickens by analyzing their adhesion and safety properties and the selected LAB was engineered to express heterologous antigen (UTEpi C-A) based on chromosomal integration strategy. We demonstrated that a new Lactobacillu salivarius TCMM17 strain is strongly adhesive to chicken intestinal epithelial cells, contains no endogenous plasmids, is susceptible to tested antimicrobials, and shows no toxicities. In order to examine the potential of TCMM17 strain as heterogenous antigen delivering vehicle, we introduced a UTEpi C-A expression cassette in its chromosome by constructing a non-replicative plasmid (pORI280-UUTEpi C-AD). The recombinant TCMM17 strain (∆TCMM17) stably was found to keep the gene cassette through 50 generations, and successfully displayed EpiC encoded by the cassette on its surface. This work provides a universal platform for development of novel oral vaccines and expression of further antigens of avian pathogens.
Ruiz-Masó, José Á.; Luengo, Luis M.; Moreno-Córdoba, Inmaculada; Díaz-Orejas, Ramón; del Solar, Gloria
2017-01-01
Although differing in size, encoded traits, host range, and replication mechanism, both narrow-host-range theta-type conjugative enterobacterial plasmid R1 and promiscuous rolling-circle-type mobilizable streptococcal plasmid pMV158 encode a transcriptional repressor protein, namely CopB in R1 and CopG in pMV158, involved in replication control. The gene encoding CopB or CopG is cotranscribed with a downstream gene that encodes the replication initiator Rep protein of the corresponding plasmid. However, whereas CopG is an auto-repressor that inhibits transcription of the entire copG-repB operon, CopB is expressed constitutively and represses a second, downstream promoter that directs transcription of repA. As a consequence of the distinct regulatory pathways implied by CopB and CopG, these repressor proteins play a different role in control of plasmid replication during the steady state: while CopB has an auxiliary role by keeping repressed the regulated promoter whenever the plasmid copy number is above a low threshold, CopG plays a primary role by acting coordinately with RNAII. Here, we have studied the role of the regulatory circuit mediated by these transcriptional repressors during the establishment of these two plasmids in a new host cell, and found that excess Cop repressor molecules in the recipient cell result in a severe decrease in the frequency and/or the velocity of appearance of transformant colonies for the cognate plasmid but not for unrelated plasmids. Using the pMV158 replicon as a model system, together with highly sensitive real-time qPCR and inverse PCR methods, we have also analyzed the effect of CopG on the kinetics of repopulation of the plasmid in Streptococcus pneumoniae. We show that, whereas in the absence of CopG pMV158 repopulation occurs mainly during the first 45 min following plasmid transfer, the presence of the transcriptional repressor in the recipient cell severely impairs the replicon repopulation and makes the plasmid replicate at approximately the same rate as the chromosome at any time after transformation, which results in maximal plasmid loss rate in the absence of selection. Overall, these findings indicate that unrepressed activity of the Cop-regulated promoter is crucial for the successful colonization of the recipient bacterial cells by the plasmid. PMID:29250051
Gutiérrez, Jorge; Criado, Raquel; Martín, María; Herranz, Carmen; Cintas, Luis M.; Hernández, Pablo E.
2005-01-01
The gene encoding mature enterocin P (EntP), an antimicrobial peptide from Enterococcus faecium P13, was cloned into the pPICZαA expression vector to generate plasmid pJC31. This plasmid was integrated into the genome of P. pastoris X-33, and EntP was heterologously secreted from the recombinant P. pastoris X-33t1 derivative at a higher production and antagonistic activity than from E. faecium P13. PMID:15980385
NASA Astrophysics Data System (ADS)
Golkar, Nasim; Samani, Soliman Mohammadi; Tamaddon, Ali Mohammad
2016-05-01
Aimed to prepare an enhanced gene delivery system with low cytotoxicity and high transfection efficiency, various cholesterol-conjugated derivates of low generation polyamidoamine (PAMAM) dendrimers were prepared. The conjugates were characterized by TNBS assay, FTIR, and 1H-NMR spectroscopy. Self-assembly of the dendrimer conjugates (G1-Chol, G2-Chol, and G3-Chol) was investigated by pyrene assay. Following formation of the complexes between enhanced green fluorescence protein plasmid and the dendrimer conjugates at various N (primary amine)/P (phosphate) mole ratios, plasmid condensation, biologic stability, cytotoxicity, and protein expression were investigated. The conjugates self-assembled into micellar dispersions with the critical micelle concentration values (<50 µg/ml) depending on the dendrimer generation and cholesterol/amine mole ratio. Cholesterol conjugation resulted in higher resistance of the condensed plasmid DNA in a competition assay with heparin sulfate. Also, the transfection efficiency was determined higher for the cholesterol conjugates than unmodified dendrimers in HepG2 cells, showing the highest for G2-Chol at 40 % degree of cholesterol modification (G2-Chol40 %) among various dendrimer generations. Interestingly, such conjugate showed a complete protection of plasmid against serum nucleases. Our results confirmed that the cholesterol conjugation to PAMAM dendrimers of low generations bearing little cytotoxicity improves their several physicochemical and biological characteristics required for an enhanced delivery of plasmid DNA into cells.
Fu, Lixia; Lu, Chengping
2013-06-01
Bacterial ghost is a novel vaccine platform, and its safe and efficient production depends largely upon a suitable and functional vector. In this study, a series of temperature-inducible plasmids, carrying Phix174 lysis gene E and/or staphylococcal nuclease A (SNA) gene, were constructed and evaluated in Escherichia coli. The results showed that the direct product of SNA (pBV220-SNA) could degrade the plasmid and genomic DNA of E. coli while the fusion product of gene E and partial Cro gene (pKF396M-2) lost the ability to lyse the host strain. The insertion of enhancer T7g10 elements and Shine-Dalgarno box (ESD) between them (pKF396M-3) could resume the function of gene E. Using plasmid pKF396M-4 with gene E and SNA, respectively, under the immediate control of promoter pR and pL, the remnant plasmids and genomic DNA of E. coli were eliminated, and the rates of inactivation increased by two orders of magnitude over that obtained with the exclusive use of E-mediated lysis plasmid. By substituting these two genes with customized multiple cloning sites sequences, the plasmid could be modified to a dual expression vector (pKF396M-5).
2017-01-01
Experiments in synthetic biology and microbiology can benefit from protein expression systems with low cell-to-cell variability (noise) and expression levels precisely tunable across a useful dynamic range. Despite advances in understanding the molecular biology of microbial gene regulation, many experiments employ protein-expression systems exhibiting high noise and nearly all-or-none responses to induction. I present an expression system that incorporates elements known to reduce gene expression noise: negative autoregulation and bicistronic transcription. I show by stochastic simulation that while negative autoregulation can produce a more gradual response to induction, bicistronic expression of a repressor and gene of interest can be necessary to reduce noise below the extrinsic limit. I synthesized a plasmid-based system incorporating these principles and studied its properties in Escherichia coli cells, using flow cytometry and fluorescence microscopy to characterize induction dose-response, induction/repression kinetics and gene expression noise. By varying ribosome binding site strengths, expression levels from 55–10,740 molecules/cell were achieved with noise below the extrinsic limit. Individual strains are inducible across a dynamic range greater than 20-fold. Experimental comparison of different regulatory networks confirmed that bicistronic autoregulation reduces noise, and revealed unexpectedly high noise for a conventional expression system with a constitutively expressed transcriptional repressor. I suggest a hybrid, low-noise expression system to increase the dynamic range. PMID:29084263
Yamanaka, Atsushi; Pitaksajjakul, Pannamthip; Ramasoota, Pongrama; Konishi, Eiji
2015-11-09
Most candidate dengue vaccines currently under development induce neutralizing antibodies, which are considered important for immunoprotection. However, the concomitant induction of infection-enhancing antibodies is an unavoidable concern. In contrast, a neutralizing antibody developed for passive immunotherapy has been engineered to eliminate its enhancing activity. Therefore, a strategy for the long-term expression of enhancing-activity-free neutralizing antibodies may resolve this concern. A mouse monoclonal antibody, 7F4, of the IgG3 subclass and with no detectable enhancing activity, was selected as the model neutralizing antibody to evaluate the potential of this strategy. Equal amounts of commercial vector (pFUSE)-based plasmids containing 7F4 heavy (H)- or light (L)-chain variable region genes were mixed and used for the cotransfection of 293T cells and co-delivery into ICR and BALB/c mice. The recombinant plasmids were designed to express IgG2b or IgG3 subclass antibodies (p7F4G2b or p7F4G3, respectively). 293T cells transfected with 2 μg of p7F4G2b or p7F4G3 produced approximately 15,000 or 800 ng/ml IgG in the culture fluids, respectively. The dose is expressed as the total amount of H- and L-chain plasmids. Neutralizing antibody was detected dose-dependently in ICR mice inoculated with 50-200 μg of p7F4G2b. A 1:2 dilution of sera from ICR and BALB/c mice inoculated with 100 μg of p7F4G3 showed average plaque reduction levels of >70% on day 3 and >90% on days 5-9. BALB/c mice maintained detectable neutralizing antibody for at least 3 months. The neutralizing antibody expressed by p7F4G3 in mice showed no enhancing activity. Although the expression of neutralizing antibodies from immunoglobulin genes is a type of passive immunization, its durability can be utilized as a dengue vaccine strategy. This "proof-of-concept" study using a mouse model demonstrates that the enhancing-activity-free characteristic of this strategy augurs well for dengue vaccine development, although further improvement is required. Copyright © 2015 Elsevier Ltd. All rights reserved.
Lee, Min Woo; Rogers, Elizabeth E; Stenger, Drake C
2010-12-01
Xylella fastidiosa strain riv11 harbors a 25-kbp plasmid (pXF-RIV11) belonging to the IncP-1 incompatibility group. Replication and stability factors of pXF-RIV11 were identified and used to construct plasmids able to replicate in X. fastidiosa and Escherichia coli. Replication in X. fastidiosa required a 1.4-kbp region from pXF-RIV11 containing a replication initiation gene (trfA) and the adjacent origin of DNA replication (oriV). Constructs containing trfA and oriV from pVEIS01, a related IncP-1 plasmid of the earthworm symbiont Verminephrobacter eiseniae, also were competent for replication in X. fastidiosa. Constructs derived from pXF-RIV11 but not pVEIS01 replicated in Agrobacterium tumefaciens, Xanthomonas campestris, and Pseudomonas syringae. Although plasmids bearing replication elements from pXF-RIV11 or pVEIS01 could be maintained in X. fastidiosa under antibiotic selection, removal of selection resulted in plasmid extinction after 3 weekly passages. Addition of a toxin-antitoxin addiction system (pemI/pemK) from pXF-RIV11 improved plasmid stability such that >80 to 90% of X. fastidiosa cells retained plasmid after 5 weekly passages in the absence of antibiotic selection. Expression of PemK in E. coli was toxic for cell growth, but toxicity was nullified by coexpression of PemI antitoxin. Deletion of N-terminal sequences of PemK containing the conserved motif RGD abolished toxicity. In vitro assays revealed a direct interaction of PemI with PemK, suggesting that antitoxin activity of PemI is mediated by toxin sequestration. IncP-1 plasmid replication and stability factors were added to an E. coli cloning vector to constitute a stable 6.0-kbp shuttle vector (pXF20-PEMIK) suitable for use in X. fastidiosa.
Li, Dexi; Wang, Yang; Schwarz, Stefan; Cai, Jiachang; Fan, Run; Li, Jun; Feßler, Andrea T; Zhang, Rong; Wu, Congming; Shen, Jianzhong
2016-06-01
To identify and characterize the oxazolidinone/phenicol resistance gene optrA in Staphylococcus isolates. Fifty porcine staphylococci with florfenicol MICs of ≥16 mg/L were screened by PCR for the presence of the optrA gene. Transferability of optrA was examined by transformation and conjugation. Functionality of this gene was confirmed by cloning and expression in a susceptible Staphylococcus host. The optrA-carrying plasmid was completely sequenced and analysed. A single Staphylococcus sciuri was optrA positive. This isolate carried the optrA gene on the 60 563 bp multiresistance plasmid pWo28-3, which also harboured the resistance genes, cfr, fexA, aadD, ble and aacA-aphD. Plasmid pWo28-3 is composed of three regions (A, B and C). Region A, which harboured all resistance genes except optrA, showed ≥99.8% nucleotide sequence identity to the corresponding region of plasmids pJP1 and pJP1-like from Jeotgalicoccus pinnipedialis and Staphylococcus lentus, respectively. The optrA gene located in region B differed from the optrA gene of the Enterococcus faecalis plasmid pE349 by four nucleotide substitutions, which also resulted in amino acid substitutions. This optrA variant also conferred resistance to oxazolidinones and phenicols in staphylococci. The 28 genes in region C represent the plasmid backbone and were apparently acquired from staphylococci, enterococci and nosocomiicocci. This is the first report of the optrA gene in staphylococci and of the coexistence of optrA and cfr on the same plasmid. Dissemination of this plasmid will substantially limit the efficacy of oxazolidinones. Surveillance of optrA in staphylococci of both human and animal origin is urgently warranted. © The Author 2016. Published by Oxford University Press on behalf of the British Society for Antimicrobial Chemotherapy. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.
Nagata, Kazuya; Itaka, Keiji; Baba, Miyuki; Uchida, Satoshi; Ishii, Takehiko; Kataoka, Kazunori
2014-06-10
The recovery of neurologic function after peripheral nerve injury often remains incomplete because of the prolonged reinnervation process, which leads to skeletal muscle atrophy and articular contracture from disuse over time. To rescue the skeletal muscle and promote functional recovery, insulin-like growth factor-1 (IGF-1), a potent myogenic factor, was introduced into the muscle by hydrodynamic injection of IGF-1-expressing plasmid DNA using a biocompatible nonviral gene carrier, a polyplex nanomicelle. In a mouse model of sciatic nerve injury, the introduction of IGF-1 into the skeletal muscle of the paralyzed limb effectively alleviated a decrease in muscle weight compared with that in untreated control mice. Histologic analysis of the muscle revealed the IGF-1-expressing plasmid DNA (pDNA) to have a myogenic effect, inducing muscle hypertrophy with the upregulation of the myogenic regulatory factors, myogenin and MyoD. The evaluation of motor function by walking track analysis revealed that the group that received the hydrodynamic injection of IGF-1-expressing pDNA using the polyplex nanomicelle had significantly early recovery of motor function compared with groups receiving negative control pDNA and untreated controls. Early recovery of sensation in the distal area of sciatic nerve injury was also induced by the introduction of IGF-1-expressing pDNA, presumably because of the effect of secreted IGF-1 protein in the vicinity of the injured sciatic nerve exerting a synergistic effect with muscle hypertrophy, inducing a more favorable prognosis. This approach of introducing IGF-1 into skeletal muscle is promising for the treatment of peripheral nerve injury by promoting early motor function recovery. Copyright © 2014 Elsevier B.V. All rights reserved.
Li, Zhe; Qu, Hongnan; Li, Chun; Zhou, Xiaohong
2013-12-01
In this study, four engineered Saccharomyces cerevisiae carrying xylanase, β-xylosidase and xylose reductase genes by different transcriptional regulations were constructed to directly convert xylan to xylitol. According to the results, the high-copy number plasmid required a rigid selection for promoter characteristics, on the contrast, the selection of promoters could be more flexible for low-copy number plasmid. For cell growth and xylitol production, glucose and galactose were found more efficient than other sugars. The semi-aerobic condition and feeding of co-substrates were taken to improve the yield of xylitol. It was found that the strain containing high-copy number plasmid had the highest xylitol yield, but it was sensitive to the change of fermentation. However, the strain carrying low-copy number plasmid was more adaptable to different processes. By optimization of the transcriptional regulation and fermentation processes, the xylitol concentration could be increased of 1.7 folds and the yield was 0.71 g xylitol/g xylan. Copyright © 2013 Elsevier Ltd. All rights reserved.
Kim, Min-Ji; Seo, Min-Ju; Shin, Kyung-Chul; Oh, Deok-Kun
2017-01-01
To increase the production of 10S-hydroxy-8(E)-octadecenoic acid from oleic acid by whole recombinant Escherichia coli cells expressing Nostoc punctiforme 10S-dioxygenase with the aid of a chaperone. The optimal conditions for 10S-hydroxy-8(E)-octadecenoic acid production by recombinant cells co-expressing chaperone plasmid were pH 9, 35 °C, 15 % (v/v) dimethyl sulfoxide, 40 g cells l -1 , and 10 g oleic acid l -1 . Under these conditions, recombinant cells co-expressing chaperone plasmid produced 7.2 g 10S-hydroxy-8(E)-octadecenoic acid l -1 within 30 min, with a conversion yield of 72 % (w/w) and a volumetric productivity of 14.4 g l -1 h -1 . The activity of recombinant cells expressing 10S-dioxygenase was increased by 200 % with the aid of a chaperone, demonstrating the first biotechnological production of 10S-hydroxy-8(E)-octadecenoic acid using recombinant cells expressing 10S-dioxygenase.
AJUBA increases the cisplatin resistance through hippo pathway in cervical cancer.
Bi, Lihong; Ma, Feng; Tian, Rui; Zhou, Yanli; Lan, Weiguang; Song, Quanmao; Cheng, Xiankui
2018-02-20
Though LIM-domain protein AJUBA was identified as a putative oncogene, the function and underlying mechanisms of AJUBA in cervical cancer remain largely unknown. Firstly, AJUBA expression was detected via real-time quantitative PCR in patients' samples. Furthermore, Hela and Siha cells were transfected with AJUBA-overexpressing plasmids, and then exposed to cisplatin, the apoptosis was measured by cytometry assay. In addition, the expression of YAP and TAZ was disclosed through western blot assay. Our results revealed that AJUBA expression was significantly higher in the cervical cancer patients resistant to cisplatin treatment compared with cervical cancer patients sensitive to cisplatin treatment. In addition, overall survival time was significantly shorter in the cervical cancer patients with high AJUBA expression compare with those with low AJUBA expression using kaplan-meier analysis. Hela and Siha cells transfected with AJUBA-expressing plasmids exposed to cisplatin treatment had higher survival rate compared with the cells transfected with empty vector control. Mechanistic studies revealed the AJUBA upregulated the downstream targets YAP and TAZ. These results suggest that high AJUBA level enhances cervical cancer cells drug resistance to cisplatin, also associates with decreased patient survival times. Copyright © 2017 Elsevier B.V. All rights reserved.
Lopata, M A; Cleveland, D W; Sollner-Webb, B
1984-01-01
Using a plasmid containing the bacterial chloramphenicol acetyl transferase gene, we have assayed for transient expression of DNA introduced into mouse L cells by a variety of transfection conditions. High efficiency uptake and expression of this foreign DNA have been achieved by modifying the DEAE dextran mediated transfection procedure of McCutchan and Pagano (1) to include a shock with either dimethyl sulfoxide or glycerol. Inclusion of the shock step can increase expression of the transfected gene a surprising approximately 50 fold. With plasmid constructs that do not replicate after transfection, we can readily detect CAT activity in an overnight autoradiographic exposure from less than 0.1% of an extract from a 60 mm dish of transfected cells. We have determined the amounts of DNA, the amount and time course of DEAE-dextran and dimethyl sulfoxide treatments, the effects of additional DNA, and the time after transfection which yield maximal expression. Overall, this transfection protocol using DEAE-dextran coupled to a shock treatment is simple, straightforward, and gives consistently high levels of expression of the input DNA. Images PMID:6589587
Systems for the expression of orthogonal translation components in eubacterial host cells
Ryu, Youngha; Schultz, Peter G.
2013-01-22
The invention related to compositions and methods for the in vivo production of polypeptides comprising one or more unnatural amino acids. Specifically, the invention provides plasmid systems for the efficient eubacterial expression of polypeptides comprising one or more unnatural acids at genetically-programmed positions.
Systems for the expression of orthogonal translation components in eubacterial host cells
Ryu, Youngha [San Diego, CA; Schultz, Peter G [La Jolla, CA
2011-06-14
The invention relates to compositions and methods for the in vivo production of polypeptides comprising one or more unnatural amino acids. Specifically, the invention provides plasmid systems for the efficient eubacterial expression of polypeptides comprising one or more unnatural amino acids at genetically-programmed positions.
Systems for the expression of orthogonal translation components eubacterial host cells
Ryu, Youngha [San Diego, CA; Schultz, Peter G [La Jolla, CA
2012-06-12
The invention relates to compositions and methods for the in vivo production of polypeptides comprising one or more unnatural amino acids. Specifically, the invention provides plasmid systems for the efficient eubacterial expression of polypeptides comprising one or more unnatural amino acids at genetically-programmed positions.
Zhou, Haizhu; Gao, Yunhang; Gao, Guang; Lou, Yujie
2015-12-01
Enhancing cellulose digestibility in animals is important for improving the utilization of forage, which can decrease the amount of food used in animal production. The aim of the present study was to achieve recombinant expression of the cellulase gene in Lactococcus lactis and evaluate the effects of oral administration of the recombinant L. lactis on fiber digestibility in geese. Cellulase (Cell) and green fluorescent protein (GFP) genes were cloned into a L. lactis expression vector (pNZ8149) to construct the recombinant expression plasmid (pNZ8149-GFP-Cell). Then, the recombinant expression plasmid was transformed into L. lactis (NZ3900) competent cells by electroporation to obtain recombinant L. lactis (pNZ8149-GFP-Cell/NZ3900) in which protein expression was induced by Nisin. Expression of GFP and Cell by the recombinant L. lactis was confirmed using SDS-PAGE, fluorescence detection, and Congo red assays. A feeding experiment showed that oral administration of pNZ8149-GFP-Cell/NZ3900 significantly increased the digestibility of dietary fiber in geese fed either a maize stalk diet or a rice chaff diet. Therefore, oral administration of recombinant L. lactis cells expressing the cellulase gene increases fiber digestibility in geese, offering a way to increase the utilization of dietary fiber in geese.
McLenigan, Mary P.; Kulaeva, Olga I.; Ennis, Don G.; Levine, Arthur S.; Woodgate, Roger
1999-01-01
The Escherichia coli umuD and umuC genes comprise an operon and encode proteins that are involved in the mutagenic bypass of normally replication-inhibiting DNA lesions. UmuD is, however, unable to function in this process until it undergoes a RecA-mediated cleavage reaction to generate UmuD′. Many homologs of umuDC have now been identified. Most are located on bacterial chromosomes or on broad-host-range R plasmids. One such putative homolog, humD (homolog of umuD) is, however, found on the bacteriophage P1 genome. Interestingly, humD differs from other umuD homologs in that it encodes a protein similar in size to the posttranslationally generated UmuD′ protein and not UmuD, nor is it in an operon with a cognate umuC partner. To determine if HumD is, in fact, a bona fide homolog of the prokaryotic UmuD′-like mutagenesis proteins, we have analyzed the ability of HumD to complement UmuD′ functions in vivo as well as examined HumD’s physical properties in vitro. When expressed from a high-copy-number plasmid, HumD restored cellular mutagenesis and increased UV survival to normally nonmutable recA430 lexA(Def) and UV-sensitive ΔumuDC recA718 lexA(Def) strains, respectively. Complementing activity was reduced when HumD was expressed from a low-copy-number plasmid, but this observation is explained by immunoanalysis which indicates that HumD is normally poorly expressed in vivo. In vitro analysis revealed that like UmuD′, HumD forms a stable dimer in solution and is able to interact with E. coli UmuC and RecA nucleoprotein filaments. We conclude, therefore, that bacteriophage P1 HumD is a functional homolog of the UmuD′-like proteins, and we speculate as to the reasons why P1 might require the activity of such a protein in vivo. PMID:10559166
DOE Office of Scientific and Technical Information (OSTI.GOV)
Leong, JoAnn Ching
The IHNV glycoprotein has been identified as the virion protein which elicits neutralizing antibody in rabbits and induces protective immunity in fish to homologous and heterologous strains of IHNV (Engelking and Leong, 1989). These findings suggested that genetic engineering might be used to develop an economically feasible IHNV vaccine for fish. Thus, a clone of the IHNV glycoprotein gene was made and expression of a portion of this gene in bacteria resulted in a prototype IHNV subunit vaccine. Only 350 bases of IHNV sequence was expressed in this initial vaccine construction because there were 16 cysteine residues in the glycoproteinmore » gene. Previous work with the rabies glycoprotein had shown that when the entire gene was expressed in bacteria, a denatured protein was produced, presumably because appropriate folding mechanisms for disulfide bond formation in protein were absent in E. coli. The IHNV vaccine clone contained a region of the gene which encoded only one cysteine residue. Despite the efficacy of the vaccine in laboratory trials, it seemed useful to determine whether other regions of the IHNV glycoprotein gene would be expressed in an antigenically recognizable form in bacteria and thereby, provide increased protection in fish. The recombinant plasmids pXL2, pXL3, and pXL7 were constructed so that all regions of the glycoprotein gene were expressed in bacteria as trpE-G fusion proteins. All of these recombinant plasmids produced fusion proteins that were also analyzed in Western immunoblots with anti-IHNV sera and specific monoclonal antibodies. These results were compared with the proteins produced by p52G and p618G, the plasmids identified in the original vaccine construction. The results of this comparison are shown.« less
Li, Lei; Cotmore, Susan F.
2013-01-01
The 121-nucleotide left-end telomere of Minute Virus of Mice (MVM) can be folded into a Y-shaped hairpin with short axial ears that are highly conserved within genus Parvovirus. To explore their potential role(s) during infection, we constructed infectious plasmid clones that lacked one or other ear. Although these were nonviable when transfected into A9 cells, excision of the viral genome and DNA amplification appeared normal, and viral transcripts and proteins were expressed, but progeny virion production was minimal, supporting the idea of a potential role for the ears in genome packaging. To circumvent the absence of progeny that confounded further analysis of these mutants, plasmids were transfected into 293T cells both with and without an adenovirus helper construct, generating single bursts of progeny. These virions bound to A9 cells and were internalized but failed to initiate viral transcription, protein expression, or DNA replication. No defects in mutant virion stability or function could be detected in vitro. Significantly, mutant capsid gene expression and DNA replication could be rescued by coinfection with wild-type virions carrying a replication-competent, capsid-gene-replacement vector. To pinpoint where such complementation occurred, prior transfection of plasmids expressing only MVM nonstructural proteins was explored. NS1 alone, but not NS2, rescued transcription and protein expression from both P4 and P38 promoters, whereas NS1 molecules deleted for their C-terminal transactivation domain did not. These results suggest that the mutant virions reach the nucleus, uncoat, and are converted to duplex DNA but require an intact left-end hairpin structure to form the initiating transcription complex. PMID:23903839
2011-01-01
Background Streptomyces species are a major source of antibiotics. They usually grow slowly at their optimal temperature and fermentation of industrial strains in a large scale often takes a long time, consuming more energy and materials than some other bacterial industrial strains (e.g., E. coli and Bacillus). Most thermophilic Streptomyces species grow fast, but no gene cloning systems have been developed in such strains. Results We report here the isolation of 41 fast-growing (about twice the rate of S. coelicolor), moderately thermophilic (growing at both 30°C and 50°C) Streptomyces strains, detection of one linear and three circular plasmids in them, and sequencing of a 6996-bp plasmid, pTSC1, from one of them. pTSC1-derived pCWH1 could replicate in both thermophilic and mesophilic Streptomyces strains. On the other hand, several Streptomyces replicons function in thermophilic Streptomyces species. By examining ten well-sporulating strains, we found two promising cloning hosts, 2C and 4F. A gene cloning system was established by using the two strains. The actinorhodin and anthramycin biosynthetic gene clusters from mesophilic S. coelicolor A3(2) and thermophilic S. refuineus were heterologously expressed in one of the hosts. Conclusions We have developed a gene cloning and expression system in a fast-growing and moderately thermophilic Streptomyces species. Although just a few plasmids and one antibiotic biosynthetic gene cluster from mesophilic Streptomyces were successfully expressed in thermophilic Streptomyces species, we expect that by utilizing thermophilic Streptomyces-specific promoters, more genes and especially antibiotic genes clusters of mesophilic Streptomyces should be heterologously expressed. PMID:22032628
Iron control of the Vibrio fischeri luminescence system in Escherichia coli.
Dunlap, P V
1992-01-01
Iron influences luminescence in Vibrio fischeri; cultures iron-restricted for growth rate induce luminescence at a lower optical density (OD) than faster growing, iron-replete cultures. An iron restriction effect analogous to that in V. fischeri (slower growth, induction of luminescence at a lower OD) was established using Escherichia coli tonB and tonB+ strains transformed with recombinant plasmids containing the V. fischeri lux genes (luxR luxICDABEG) and grown in the presence and absence of the iron chelator ethylenediamine-di(o-hydroxylphenyl acetic acid) (EDDHA). This permitted the mechanism of iron control of luminescence to be examined. A fur mutant and its parent strain containing the intact lux genes exhibited no difference in the OD at induction of luminescence. Therefore, an iron-binding repressor protein apparently is not involved in iron control of luminescence. Furthermore, in the tonB and in tonB+ strains containing lux plasmids with Mu dI(lacZ) fusions in luxR, levels of beta-galactosidase activity (expression from the luxR promoter) and luciferase activity (expression from the luxICDABEG promoter) both increased by a similar amount (8-9 fold each for tonB, 2-3 fold each for tonB+) in the presence of EDDHA. Similar results were obtained with the luxR gene present on a complementing plasmid. The previously identified regulatory factors that control the lux system (autoinducer-LuxR protein, cyclic AMP-cAMP receptor protein) differentially control expression from the luxR and luxICDABEG promoters, increasing expression from one while decreasing expression from the other. Consequently, these results suggest that the effect of iron on the V. fischeri luminescence system is indirect.
Engineering Escherichia coli into a protein delivery system for mammalian cells.
Reeves, Analise Z; Spears, William E; Du, Juan; Tan, Kah Yong; Wagers, Amy J; Lesser, Cammie F
2015-05-15
Many Gram-negative pathogens encode type 3 secretion systems, sophisticated nanomachines that deliver proteins directly into the cytoplasm of mammalian cells. These systems present attractive opportunities for therapeutic protein delivery applications; however, their utility has been limited by their inherent pathogenicity. Here, we report the reengineering of a laboratory strain of Escherichia coli with a tunable type 3 secretion system that can efficiently deliver heterologous proteins into mammalian cells, thereby circumventing the need for virulence attenuation. We first introduced a 31 kB region of Shigella flexneri DNA that encodes all of the information needed to form the secretion nanomachine onto a plasmid that can be directly propagated within E. coli or integrated into the E. coli chromosome. To provide flexible control over type 3 secretion and protein delivery, we generated plasmids expressing master regulators of the type 3 system from either constitutive or inducible promoters. We then constructed a Gateway-compatible plasmid library of type 3 secretion sequences to enable rapid screening and identification of sequences that do not perturb function when fused to heterologous protein substrates and optimized their delivery into mammalian cells. Combining these elements, we found that coordinated expression of the type 3 secretion system and modified target protein substrates produces a nonpathogenic strain that expresses, secretes, and delivers heterologous proteins into mammalian cells. This reengineered system thus provides a highly flexible protein delivery platform with potential for future therapeutic applications.
Wang, Yun-Liang; Dong, Feng-Lin; Yang, Jian; Li, Zhi; Zhi, Qiao-Ming; Zhao, Xin; Yang, Yong; Li, De-Chun; Shen, Xiao-Chun; Zhou, Jin
2015-01-01
Epidermal growth factor-like domain multiple 7 (EGFL7), a secreted protein specifically expressed by endothelial cells during embryogenesis, recently was identified as a critical gene in tumor metastasis. Epithelial-mesenchymal transition (EMT) was found to be closely related with tumor progression. Accordingly, it is important to investigate the migration and EMT change after knock-down of EGFL7 gene expression in human pancreatic cancer cells. EGFL7 expression was firstly testified in 4 pancreatic cancer cell lines by real-time polymerase chain reaction (Real-time PCR) and western blot, and the highest expression of EGFL7 was found in PANC-1 cell line. Then, PANC-1 cells transfected with small interference RNA (siRNA) of EGFL7 using plasmid vector were named si-PANC-1, while transfected with negative control plasmid vector were called NC-PANC-1. Transwell assay was used to analyze the migration of PANC-1 cells. Real-time PCR and western blotting were used to detect the expression change of EGFL7 gene, EMT markers like E-Cadherin, N-Cadherin, Vimentin, Fibronectin and transcription factors like snail, slug in PANC-1, NC- PANC-1, and si-PANC-1 cells, respectively. After successful plasmid transfection, EGFL7 gene were dramatically knock-down by RNA interference in si-PANC-1 group. Meanwhile, migration ability decreased significantly, compared with PANC-1 and NC-PANC-1 group. Meanwhile, the expression of epithelial phenotype marker E-Cadherin increased and that of mesenchymal phenotype markers N-Cadherin, Vimentin, Fibronectin dramatically decreased in si-PANC-1 group, indicating a reversion of EMT. Also, transcription factors snail and slug decreased significantly after RNA interference. Current study suggested that highly-expressed EGFL7 promotes migration of PANC-1 cells and acts through transcription factors snail and slug to induce EMT, and further study is needed to confirm this issue.
Zeng, Bo; Zeng, Zhen; Liu, Chang; Yang, Yaying
2017-06-01
Objective To investigate the effect of Golgi α-mannosidase II (GM2) gene knockdown on adhesion abilities of BGC-823 human gastric carcinoma cells. Methods Three plasmid vectors expressing GM2 shRNAs and a negative control plasmid vector were designed, constructed and then transfected into BGC-823 cells by Lipofectamine TM 2000. After transfection, the mRNA and protein levels of GM2 in BGC-823 cells were detected by real-time quantitative PCR (qRT-PCR) and Western blotting to evaluate the transfection efficacy. The best plasmid for GM2 gene knockdown was selected and stably transfected into BGC-823 cells. Adhesion abilities of BGC-823 cells after GM2 gene silencing were observed by cell-cell, cell-matrix and cell-endothelial cell adhesion assays. At the same time, the expressions of E-cadherin, P-selectin, CD44v6 and intercellular adhesion molecule-1 (ICAM-1) proteins were detected by Western blotting after GM2 gene knockdown. Results The expression of GM2 was effectively knockdown in GM2-shRNA-2-transfected BGC-823 cells. Compared with the blank control group and the negative control group, the intercellular adhesion ability of the GM2-shRNA-2-transfected cells increased significantly, while their cell-matrix and cell-endothelium adhesion abilities markedly decreased. In GM2-shRNA-2 transfection group, E-cadherin expression was significantly elevated and the P-selectin expression was significantly reduced, while the expression levels of CD44v6 and ICAM-1 were not obviously changed. Conclusion After GM2 gene knockdown, the intercellular adhesion ability of gastric carcinoma BGC-823 cells is enhanced, while the adhesion abilities with the extracellular matrix and endothelial cells are weakened. The changes might be related to the up-regulated expression of E-cadherin and the down-regulation of P-selectin.
Mardanov, Andrey V; Strakhova, Taisia S; Smagin, Vladimir A; Ravin, Nikolai V
2007-06-15
A new Escherichia coli host/vector system has been developed to allow a dual regulation of both the plasmid copy number and gene expression. The new pN15E vectors are low copy number plasmids based on the replicon of temperate phage N15, comprising the repA replicase gene and cB repressor gene, controlling the plasmid copy number. Regulation of pN15E copy number is achieved through arabinose-inducible expression of phage N15 antirepressor protein, AntA, whose gene was integrated into the chromosome of the host strain under control of the PBAD promoter. The host strain also carried phage N15 partition operon, sop, allowing stable inheritance of pN15E vectors in the absence of selection pressure. In the first vector, pN15E4, the same PBAD promoter controls expression of a cloned gene. The second vector, pN15E6, carries the phage T5 promoter with a double lac operator repression module thus allowing independent regulation of promoter activity and copy number. Using the lacZ gene to monitor expression in these vectors, we show that the ratio of induction/repression can be about 7600-fold for pN15E4 and more than 15,000-fold for pN15E6. The low copy number of these vectors ensures very low basal level of expression allowing cloning genes encoding toxic products that was demonstrated by the stable maintenance of a gene encoding a restriction endonuclease in pN15E4. The tight control of transcription and the potential to regulate gene activities quantitatively over wide ranges will open up new approaches in the study of gene function in vivo and controlled expression of heterologous genes.
Hydrodynamic gene delivery in human skin using a hollow microneedle device.
Dul, M; Stefanidou, M; Porta, P; Serve, J; O'Mahony, C; Malissen, B; Henri, S; Levin, Y; Kochba, E; Wong, F S; Dayan, C; Coulman, S A; Birchall, J C
2017-11-10
Microneedle devices have been proposed as a minimally invasive delivery system for the intradermal administration of nucleic acids, both plasmid DNA (pDNA) and siRNA, to treat localised disease or provide vaccination. Different microneedle types and application methods have been investigated in the laboratory, but limited and irreproducible levels of gene expression have proven to be significant challenges to pre-clinical to clinical progression. This study is the first to explore the potential of a hollow microneedle device for the delivery and subsequent expression of pDNA in human skin. The regulatory approved MicronJet600® (MicronJet hereafter) device was used to deliver reporter plasmids (pCMVβ and pEGFP-N1) into viable excised human skin. Exogenous gene expression was subsequently detected at multiple locations that were distant from the injection site but within the confines of the bleb created by the intradermal bolus. The observed levels of gene expression in the tissue are at least comparable to that achieved by the most invasive microneedle application methods e.g. lateral application of a microneedle. Gene expression was predominantly located in the epidermis, although also evident in the papillary dermis. Optical coherence tomography permitted real time visualisation of the sub-surface skin architecture and, unlike a conventional intradermal injection, MicronJet administration of a 50μL bolus appears to create multiple superficial microdisruptions in the papillary dermis and epidermis. These were co-localised with expression of the pCMVβ reporter plasmid. We have therefore shown, for the first time, that a hollow microneedle device can facilitate efficient and reproducible gene expression of exogenous naked pDNA in human skin using volumes that are considered to be standard for intradermal administration, and postulate a hydrodynamic effect as the mechanism of gene delivery. Copyright © 2017 Elsevier B.V. All rights reserved.
Scorza, T.; Grubb, K.; Smooker, P.; Rainczuk, A.; Proll, D.; Spithill, T. W.
2005-01-01
A major goal of current malaria vaccine programs is to develop multivalent vaccines that will protect humans against the many heterologous malaria strains that circulate in endemic areas. We describe a multiepitope DNA vaccine, derived from a genomic Plasmodium chabaudi adami DS DNA expression library of 30,000 plasmids, which induces strain-transcending immunity in mice against challenge with P. c. adami DK. Segregation of this library and DNA sequence analysis identified vaccine subpools encoding open reading frames (ORFs)/peptides of >9 amino acids [aa] (the V9+ pool, 303 plasmids) and >50 aa (V50+ pool, 56 plasmids), respectively. The V9+ and V50+ plasmid vaccine subpools significantly cross-protected mice against heterologous P. c. adami DK challenge, and protection correlated with the induction of both specific gamma interferon production by splenic cells and opsonizing antibodies. Bioinformatic analysis showed that 22 of the V50+ ORFs were polypeptides conserved among three or more Plasmodium spp., 13 of which are predicted hypothetical proteins. Twenty-nine of these ORFs are orthologues of predicted Plasmodium falciparum sequences known to be expressed in the blood stage, suggesting that this vaccine pool encodes multiple blood-stage antigens. The results have implications for malaria vaccine design by providing proof-of-principle that significant strain-transcending immunity can be induced using multiepitope blood-stage DNA vaccines and suggest that both cellular responses and opsonizing antibodies are necessary for optimal protection against P. c. adami. PMID:15845504
Use of the alr gene as a food-grade selection marker in lactic acid bacteria.
Bron, Peter A; Benchimol, Marcos G; Lambert, Jolanda; Palumbo, Emmanuelle; Deghorain, Marie; Delcour, Jean; De Vos, Willem M; Kleerebezem, Michiel; Hols, Pascal
2002-11-01
Both Lactococcus lactis and Lactobacillus plantarum contain a single alr gene, encoding an alanine racemase (EC 5.1.1.1), which catalyzes the interconversion of D-alanine and L-alanine. The alr genes of these lactic acid bacteria were investigated for their application as food-grade selection markers in a heterologous complementation approach. Since isogenic mutants of both species carrying an alr deletion (Deltaalr) showed auxotrophy for D-alanine, plasmids carrying a heterologous alr were constructed and could be selected, since they complemented D-alanine auxotrophy in the L. plantarum Deltaalr and L. lactis Deltaalr strains. Selection was found to be highly stringent, and plasmids were stably maintained over 200 generations of culturing. Moreover, the plasmids carrying the heterologous alr genes could be stably maintained in wild-type strains of L. plantarum and L. lactis by selection for resistance to D-cycloserine, a competitive inhibitor of Alr (600 and 200 micro g/ml, respectively). In addition, a plasmid carrying the L. plantarum alr gene under control of the regulated nisA promoter was constructed to demonstrate that D-cycloserine resistance of L. lactis is linearly correlated to the alr expression level. Finally, the L. lactis alr gene controlled by the nisA promoter, together with the nisin-regulatory genes nisRK, were integrated into the chromosome of L. plantarum Deltaalr. The resulting strain could grow in the absence of D-alanine only when expression of the alr gene was induced with nisin.
Allon, Nahum; Saxena, Ashima; Chambers, Carolyn; Doctor, Bhupendra P
2012-06-10
We formulated a new gene delivery system based on targeted liposomes. The efficacy of the delivery system was demonstrated in in vitro and in vivo models. The targeting moiety consists of a high-affinity 7-amino-acid peptide, covalently and evenly conjugated to the liposome surface. The targeting peptide acts as an endothelin antagonist, and accelerates liposome binding and internalization. It is devoid of other biological activity. Liposomes with high phosphatidyl serine (PS) were specially formulated to help their fusion with the endosomal membrane at low pH and enable release of the liposome payload into the cytoplasm. A DNA payload, pre-compressed by protamine, was encapsulated into the liposomes, which directed the plasmid into the cell's nucleus. Upon exposure to epithelial cells, binding of the liposomes occurred within 5-10 min, followed by facilitated internalization of the complex. Endosomal escape was complete within 30 min, followed by DNA accumulation in the nucleus 2h post-transfection. A549 lung epithelial cells transfected with plasmid encoding for GFP encapsulated in targeted liposomes expressed significantly more protein than those transfected with plasmid complexed with Lipofectamine. The intra-tracheal instillation of plasmid encoding for GFP encapsulated in targeted liposomes into rat lungs resulted in the expression of GFP in bronchioles and alveoli within 5 days. These results suggest that this delivery system has great potential in targeting genes to lungs. Copyright © 2011 Elsevier B.V. All rights reserved.