Bioconversion of sugar cane crop residues with white-rot fungiPleurotus sp.

PubMed

Ortega, G M; Martínez, E O; Betancourt, D; González, A E; Otero, M A

1992-07-01

Four mushroom strains ofPleurotus spp. were cultivated on sugar cane crop residues for 30 days at 26°C. Biochemical changes affected the substrate as a result of fungal growth, in terms of nitrogen, lignin, cellulose and hemicellulose contents. All strains showed a strong ligninolytic activity together with variable cellulolytic and xylanolytic action.Pleurotus sajor-caju attacked lignin and cellulose at the same rate, showing a degradation of 47% and 55%, respectively. A better balance was shown by theP. ostreatus-P. pulmonarius hybrid, which exhibited the poorest cellulolytic action (39%) and the highest ligninolytic activity (67%). The average composition of mushroom fruit bodies, in terms of nitrogen, carbohydrates, fats and amino acid profiles, was determined. Crude protein and total carbohydrate varied from 23% to 33% and 36% to 68% of dry matter, respectively. Fat ranged from 3.3% to 4.7% and amino acid content from 12.2% to 22.2%. Slight evidence for a nitrogen fixing capability was encountered in the substrate to fruit body balance.

Antioxidant activity via DPPH, gram-positive and gram-negative antimicrobial potential in edible mushrooms.

PubMed

Ahmad, Nisar; Mahmood, Fazal; Khalil, Shahid Akbar; Zamir, Roshan; Fazal, Hina; Abbasi, Bilal Haider

2014-10-01

Edible mushrooms (EMs) are nutritionally rich source of proteins and essential amino acids. In the present study, the antioxidant activity via 1,1-diphenyl-2-picrylhydrazyl (DPPH) and antimicrobial potential in EMs (Pleurotus ostreatus, Morchella esculenta, P. ostreatus (Black), P. ostreatus (Yellow) and Pleurotus sajor-caju) were investigated. The DPPH radical scavenging activity revealed that the significantly higher activity (66.47%) was observed in Morchella esculenta at a maximum concentration. Similarly, the dose-dependent concentrations (200, 400, 600, 800 and 1000 µg) were also used for other four EMs. Pleurotus ostreatus exhibited 36.13% activity, P. ostreatus (Black (B)) exhibited 30.64%, P. ostreatus (Yellow (Y)) exhibited 40.75% and Pleurotus sajor-caju exhibited 47.39% activity at higher concentrations. Furthermore, the antimicrobial potential were investigated for its toxicity against gram-negative bacterial strains (Escherichia coli, Pseudomonas aeroginosa, Salmonella typhi, Klebsiella pneumonia, Erwinia carotovora and Agrobacterium tumifaciens), gram-positive bacterial strains (Bacillus subtilis, Bacillus atrophaeus and Staphylococcus aureus) and a fungal strain (Candida albicans) in comparison with standard antibiotics. Antimicrobial screening revealed that the ethanol extract of P. ostreatus was active against all microorganism tested except E. coli. Maximum zone of inhibition (13 mm) was observed against fungus and A. tumifaciens. P. sajor-caju showed best activities (12.5 mm) against B. subtilis, B. atrophaeus and K. pneumonia. P. ostreatus (Y) showed best activities against P. aeroginosa (21.83 mm), B. atrophaeus (20 mm) and C. albicans (21 mm). P. ostreatus (B) exhibited best activities against C. albicans (16 mm) and slightly lower activities against all other microbes except S. typhi. M. esculenta possess maximum activities in terms of inhibition zone against all microorganisms tested except S. typhi. © The Author(s) 2012.

Comparative evaluation of five Pleurotus species for their growth behaviour and yield performance using wheat straw as a substrate.

PubMed

Holkar, Somnath Kadappa; Chandra, Ram

2016-01-01

Pleurotus spp. is one of the most important edible mushrooms cultivated in India. The present study was an attempt to compare five Pleurotus species in context of actual time required for each growth stage viz., spawn run period, number of days required for initiation of pin heads of sporophores, average weight of fruiting bodies in all the flushes and total yield. The spawn run period in all the five species were recorded between 18 days-21 days, similarly for initiation of pinheads 5 days -7 days were required after spawn run period. A total of 24 days to 27 days, 34 days to 37 days and 47 days to 53 days were required for harvesting the I, II and III flushes respectively. An average number of 41 to 70 sporophores per bag containing 1 kg of dry substrates were obtained from all the Pleurotus species. Maximum 14 g weight of single sporophore was recorded from P. florida, similarly, an average maximum diameter of 5.3 cm of sporophores of P. florida was observed whereas the diameter of sporophores in rest of the species ranged from 3.0 cm to 3.2 cm. The number of sporophores were obtained from P. sajor-caju (n-70) and all the species showed significant difference with respect to the number of sporophores in a bunch at probability level of P = 0.05. Maximum weight of single bunch was recorded (58 g) in P. florida and total yield of 740 gkg(-1) of dry matter was recorded in P. florida.

Utilization of agro-resources by radiation treatment -production of animal feed and mushroom from oil palm wastes

NASA Astrophysics Data System (ADS)

Kume, Tamikazu; Matsuhashi, Shinpei; Hashimoto, Shoji; Awang, Mat Rasol; Hamdini, Hassan; Saitoh, Hideharu

1993-10-01

The production of animal feeds and mushrooms from oil palm cellulosic wasres by radiation and fermentation has been investigated in order to utilize the agro-resources and to reduce the smoke pollution. The process is as follows: decontamination of microorganisms in fermentation media of empty fruit bunch of oil palm (EFB) by irradiation, inoculation of useful fungi, and subsequently production of proteins and edible mushrooms. The dose of 25 kGy was required for the sterilization of contaminating bacteria whereas the dose of 10 kGy was enough to eliminate the fungi. Among many kinds of fungi tested, C. cinereus and P. sajor-caju were selected as the most suitable microorganism for the fermentation of EFB. The protein content of the product increased to 13 % and the crude fiber content decreased to 20% after 30 days of incubation with C. cinereus at 30°C in solid state fermentation. P. sajor-caju was suitable for the mushroom production on EFB with rice bran.

Can fungi compete with marine sources for chitosan production?

PubMed

Ghormade, V; Pathan, E K; Deshpande, M V

2017-11-01

Chitosan, a β-1,4-linked glucosamine polymer is formed by deacetylation of chitin. It has a wide range of applications from agriculture to human health care products. Chitosan is commercially produced from shellfish, shrimp waste, crab and lobster processing using strong alkalis at high temperatures for long time periods. The production of chitin and chitosan from fungal sources has gained increased attention in recent years due to potential advantages in terms of homogenous polymer length, high degree of deacetylation and solubility over the current marine source. Zygomycetous fungi such as Absidia coerulea, Benjaminiella poitrasii, Cunninghamella elegans, Gongrenella butleri, Mucor rouxii, Mucor racemosus and Rhizopus oryzae have been studied extensively. Isolation of chitosan are reported from few edible basidiomycetous fungi like Agaricus bisporus, Lentinula edodes and Pleurotus sajor-caju. Other organisms from mycotech industries explored for chitosan production are Aspergillus niger, Penicillium chrysogenum, Saccharomyces cerevisiae and other wine yeasts. Number of aspects such as value addition to the existing applications of fungi, utilization of waste from agriculture sector, and issues and challenges for the production of fungal chitosan to compete with existing sources, metabolic engineering and novel applications have been discussed to adjudge the potential of fungal sources for commercial chitosan production. Copyright © 2017 Elsevier B.V. All rights reserved.

Improvement of dry matter digestibility of water hyacinth by solid state fermentation using white rot fungi.

PubMed

Mukherjee, R; Ghosh, M; Nandi, B

2004-08-01

Feeding value of water hyacinth biomass colonized by three species of white rot fungi during solid-state fermentation was investigated. All three organisms proved to be efficient degraders and enhanced dry matter digestibility. Loss of organic matter was maximum (23.6+/-0.1% dry wt) after 48 days by P. ostreatus. C. indica showed maximum cellulose degradation (18.5+/-0.1% dry wt) than other two fungi after 48 days of incubation. In all cases, an extensive removal of hemicellulose at the initial growth period and a delayed degradation of lignin were observed. Hemicellulolysis was maximum (46.3+/-0.1% dry wt) by C. indica, but delignification (14.2+/-0.2% dry wt) by P. sajor-caju after 48 days. The amount of reducing sugar in the degraded biomass decreased at early stages, but increased as degradation progressed in all three cases (maximum 1.1+/-0.05% dry wt after 48 days by C. indica). Soluble nitrogen content increased only during 16-32 days of incubation (highest 1.1+/-0.1% dry wt after 32 days by P. sajor-caju). Crude protein of the bioconverted biomass increased gradually up to 32 days but decreased thereafter (maximum 10.3+/-0.1% dry wt after 32 days by P. sajor - caju). Per cent change in in vitro dry matter digestibility of degraded substrates enhanced gradually after 8 days and reached maximum after 32 days but thereafter decreased (highest + 20.4+/-0.3% dry wt by P. sajor-caju). The results demonstrated the efficient degrading capacity of the test fungi and their potential use in conversion of water hyacinth biomass into mycoprotein-rich ruminant feed, more so by P. sajor-caju.

Low-cost and low maintenance preservation of Agaricus brasiliensis cultures.

PubMed

Maia, Scheila C; Toledo, Rômulo C C; Almeida, Ana Paula M M; da Silva, Romildo; Rinker, Danny Lee; Dias, Eustáquio S

2012-06-01

Agaricus brasiliensis cultures quickly lose viability when stored at cool temperatures, even for a short period of time. We evaluated several low-cost preservation methods using varied substrates, preservation solutions, and storage temperatures. Agaricus brasiliensis was intolerant to freezing temperatures, making liquid nitrogen use and deep-freezing methods impossible for its preservation. The best preservation conditions for the A. brasiliensis CS1 strain tested in this study were obtained by using rice as substrate and water as preservation solution, with storage at room temperature or when using soil, mushroom cultivation compost, or rice and stored at 10 °C without preservation solution. Those cultures that were reactivated showed the same productivity attributes as the control. In addition, no effect on productivity or biological efficiency was observed through successive subculturing of the strain (CS1). Parboiled rice was successfully used for other A. brasiliensis strains (CS2, CS5, CS7, CS9, and CS10), and also for Pleurotus ostreatus, P. sajor-caju, and Lentinula edodes.

Simplified and lower cost methods for culinary-medicinal mushrooms cultivation.

PubMed

Cleaver, Phillip D; Bailey, Cody; Holliday, John C

2012-01-01

The importance and prospect of growing mushrooms through utilization of low-cost, technologically simple methods for developing Third World countries has recently been outlined. Three different species from genus Pleurotus (P. djamor, P. pulmonarius, and P. sajor-caju) and one from genus Hypsizygus (H. ulmarius) were studied. Whole stalk wheat straw, shredded wheat straw, and ground maize cob (Zea mays) were used as the substrates. Wheat straw is the post-harvest stalk of Triticum aestivum. Biological efficiency (BE), growth dynamics, and photographs are provided for each cultivated strain, on different substrates, and substrate treatment comparisons are made. From several experiments conducted with various technologically simple methods of cultivation, it was found that all above mentioned species can be successfully cultivated at the village level in any country, be it highly developed or the poorest country on earth.

[Comparative study on the productivity of strains of Pleurotus spp. in commercial cultivation].

PubMed

Vogel, F; Salmones, D

2000-12-01

This paper describes the commercial production of two strains of Pleurotus pulmonarius, selected in the laboratory for their rapid mycelial development and high production of basidiomata, and one commercial strain of Pleurotus ostreatus. Substrate preparation, impact of pathogens and environmental conditions necessary for the production and quality of the fruiting bodies required are discussed.

Effect on heavy metals concentration from vermiconversion of agro-waste mixed with landfill leachate.

PubMed

Azizi, Abu Bakar; Choy, May Yee; Noor, Zalina Mahmood; Noorlidah, Abdullah

2015-04-01

Spent Pleurotus sajor-caju compost mixed with livestock excreta, i.e. cow dung or goat manure, was contaminated with landfill leachate and vermiremediated in 75 days. Results showed an extreme decrease of heavy metals, i.e. Cd, Cr and Pb up to 99.81% removal as effect of vermiconversion process employing epigeic earthworms i.e. Lumbricus rubellus. In addition, there were increments of Cu and Zn from 15.01% to 85.63%, which was expected as non-accumulative in L. rubellus and secreted out as contained in vermicompost. This phenomenon is due to dual effects of heavy metal excretion period and mineralisation. Nonetheless, the increments were 50-fold below the limit set by EU and USA compost limits and the Malaysian Recommended Site Screening Levels for Contaminated Land (SSLs). Moreover, the vermicompost C:N ratio range is 20.65-22.93 and it can be an advantageous tool to revitalise insalubrious soil by acting as soil stabiliser or conditioner. Copyright © 2015 Elsevier Ltd. All rights reserved.

Iron bioavailability from cereal products enriched with Pleurotus ostreatus mushrooms in rats with induced anaemia.

PubMed

Reguła, Julita; Krejpcio, Zbigniew; Staniek, Halina

2016-06-02

Oyster mushroom Pleurotus ostreatus is good source of iron. However, there is a limited data concerning bioavailability of iron from oyster mushroom and also cereal products containing this mushroom. The aim of this study was to assess bioavailability of iron from products with an addition of Pleurotus ostreatus in male rats with anaemia. Investigations were conducted in two stages. In the first stage iron deficiency was developed in rats. For this purpose 6 weeks old 36 male Wistar rats were fed a AIN-93M diet deficient in iron and 6 males received a standard AIN-93M diet. In the second stage of the study the assessment of Fe bioavailability from cereal products enriched with dried Pleurotus ostreatus. After experiment the animals were killed and blood and heart, liver, spleen and kidneys were collected for biochemical tests. Feeding male Wistar rats supplemented with dried Pleurotus ostreatus mushrooms diets resulted in the restitution of the systemic Fe level, as manifested by an increase of the level comparable to the control group for: iron transferrin saturation rate, haemoglobin and mean corpuscular volume. Values of hematocrit, mean corpuscular haemoglobin and mean corpuscular haemoglobin concentration in animals fed products supplemented with Pleurotus ostreatus were significantly higher compared to animals fed products with no Fe added. The highest MCV value was recorded when 20% of dried oyster mushrooms were added. Iron levels in the blood serum, the liver and kidneys in animals fed cereal products considerably exceeded values recorded at the beginning of the experiment and were similar to the control values. Product may be a valuable source of iron in the nutrition of individuals with a deficiency of this element, first of all patients with absorption and metabolism disorders, but also may add variety to the traditional daily diet.

Oyster mushroom cultivation with rice and wheat straw.

PubMed

Zhang, Ruihong; Li, Xiujin; Fadel, J G

2002-05-01

Cultivation of the oyster mushroom, Pleurotus sajor-caju, on rice and wheat straw without nutrient supplementation was investigated. The effects of straw size reduction method and particle size, spawn inoculation level, and type of substrate (rice straw versus wheat straw) on mushroom yield, biological efficiency, bioconversion efficiency, and substrate degradation were determined. Two size reduction methods, grinding and chopping, were compared. The ground straw yielded higher mushroom growth rate and yield than the chopped straw. The growth cycles of mushrooms with the ground substrate were five days shorter than with the chopped straw for a similar particle size. However, it was found that when the straw was ground into particles that were too small, the mushroom yield decreased. With the three spawn levels tested (12%, 16% and 18%), the 12% level resulted in significantly lower mushroom yield than the other two levels. Comparing rice straw with wheat straw, rice straw yielded about 10% more mushrooms than wheat straw under the same cultivation conditions. The dry matter loss of the substrate after mushroom growth varied from 30.1% to 44.3%. The straw fiber remaining after fungal utilization was not as degradable as the original straw fiber, indicating that the fungal fermentation did not improve the feed value of the straw.

Production of mycelial biomass by the Amazonian edible mushroom Pleurotus albidus.

PubMed

Kirsch, Larissa de Souza; de Macedo, Ana Júlia Porto; Teixeira, Maria Francisca Simas

2016-01-01

Edible mushroom species are considered as an adequate source of food in a healthy diet due to high content of protein, fiber, vitamins, and a variety of minerals. The representatives of Pleurotus genus are characterized by distinct gastronomic, nutritional, and medicinal properties among the edible mushrooms commercialized worldwide. In the present study, the growth of mycelial biomass of Pleurotus albidus cultivated in submerged fermentation was evaluated. Saccharose, fructose, and maltose were the three main carbon sources for mycelial biomass formation with corresponding yields of 7.28gL(-1), 7.07gL(-1), and 6.99gL(-1). Inorganic nitrogen sources did not stimulate growth and the optimal yield was significantly higher with yeast extract (7.98gL(-1)). The factorial design used to evaluate the influence of saccharose and yeast extract concentration, agitation speed, and initial pH indicated that all variables significantly influenced the production of biomass, especially the concentration of saccharose. The greater amount of saccharose resulted in the production of significantly more biomass. The highest mycelial biomass production (9.81gL(-1)) was reached in the medium formulated with 30.0gL(-1) saccharose, 2.5gL(-1) yeast extract, pH 7.0, and a speed of agitation at 180rpm. Furthermore, P. albidus manifested different aspects of morphology and physiology under the growth conditions employed. Media composition affected mycelial biomass production indicating that the diversification of carbon sources promoted its improvement and can be used as food or supplement. Copyright © 2016 Sociedade Brasileira de Microbiologia. Published by Elsevier Editora Ltda. All rights reserved.

Electrical stimulation in white oyster mushroom (Pleurotus florida) production

NASA Astrophysics Data System (ADS)

Roshita, I.; Nurfazira, K. M. P.; Fern, C. Shi; Ain, M. S. Nur

2017-09-01

White oyster mushroom (Pleurotus florida) is an edible mushroom that gained popularity due to its nutritional values, low production cost and ease of cultivation. There are several research reported on the mushroom fruiting bodies which were actively developed when applying electrical shock treatment. This study was aimed to investigate the effects of different electrical voltages on the growth and yield of white oyster mushroom (Pleurotus florida). Five different electrical voltages had been applied during spawning period which were 6V, 9V, 12V, 15V and mushroom bags without any treatment served as control. Treatment at 6V showed the highest rate for mycelium growth while 15V took the shortest time for fruiting body formation. However, no significant different (P>0.05) among all the treatments was observed for the time taken for the mycelium to fill-up the bag and pinhead emergence. The total fresh weight and percentage of biological efficiency for treatment at 9V showed higher values compared to control. Treatment at 9V also showed the largest pileus diameter and the most firm in the pileus texture. Meanwhile, treatment at 6V showed the highest a* value (redness). In addition, different electrical voltage treatments applied did not show any significant effect on substrate utilization efficiency, colour L* and b* values. In conclusion, among all the electrical treatments applied, 9V could be considered as the best treatment to enhance the yield of white oyster mushroom.

Antioxidant activity, anti-proliferative activity, and amino acid profiles of ethanolic extracts of edible mushrooms.

PubMed

Panthong, S; Boonsathorn, N; Chuchawankul, S

2016-10-17

Biological activities of various mushrooms have recently been discovered, particularly, immunomodulatory and antitumor activities. Herein, three edible mushrooms, Auricularia auricula-judae (AA), Pleurotus abalonus (PA) and Pleurotus sajor-caju (PS) extracted using Soxhlet ethanol extraction were evaluated for their antioxidative, anti-proliferative effects on leukemia cells. Using the Folin-Ciocalteau method and Trolox equivalent antioxidant capacity assay, phenolics and antioxidant activity were found in all sample mushrooms. Additionally, anti-proliferative activity of mushroom extracts against U937 leukemia cells was determined using a viability assay based on mitochondrial activity. PA (0.5 mg/mL) and AA (0.25-0.5 mg/mL) significantly reduced cell viability. Interestingly, PS caused a hormetic-like biphasic dose-response. Low doses (0-0.25 mg/L) of PS promoted cell proliferation up to 140% relative to control, whereas higher doses (0.50 mg/mL) inhibited cell proliferation. Against U937 cells, AA IC 50 was 0.28 ± 0.04 mg/mL, which was lower than PS or PA IC 50 (0.45 ± 0.01 and 0.49 ± 0.001 mg/mL, respectively). Furthermore, lactate dehydrogenase (LDH) leakage conferred cytotoxicity. PS and PA were not toxic to U937 cells at any tested concentration; AA (0.50 mg/mL) showed high LDH levels and caused 50% cytotoxicity. Additionally, UPLC-HRMS data indicated several phytochemicals known to support functional activities as either antioxidant or anti-proliferative. Glutamic acid was uniquely found in ethanolic extracts of AA, and was considered an anti-cancer amino acid with potent anti-proliferative effects on U937 cells. Collectively, all mushroom extracts exhibited antioxidant effects, but their anti-proliferative effects were dose-dependent. Nevertheless, the AA extract, with highest potency, is a promising candidate for future applications.

A Macrosphelide as the Unexpected Product of a Pleurotus ostreatus Strain-Mediated Biotransformation of Halolactones Containing the gem-Dimethylcyclohexane Ring. Part 1.

PubMed

Wińska, Katarzyna; Mączka, Wanda; Grabarczyk, Małgorzata; Sugimoto, Kenji; Matsuya, Yuji; Szumny, Antoni; Anioł, Mirosław

2016-06-30

The aim of the study was to obtain new compounds during biotransformation of two halocompounds, the δ-bromo and δ-iodo-γ-bicyclolactones 1 and 2. Unexpectedly Pleurotus ostreatus produced together with the hydroxylactone, 2-hydroxy-4,4-dimethyl-9-oxabicyclo[4.3.0]nonane-8-one (3), its own metabolite (3S,9S,15S)-(6E,12E)-3,9,15-trimethyl-4,10,16-trioxacyclohexa-deca-6,12-diene-1,5,8,11,14-pentaone (4). The method presented here, in which this macrosphelide 4 was obtained by biotransformation, has not been previously described in the literature. To the best of our knowledge, this compound has been prepared only by chemical synthesis to date. This is the first report on the possibility of the biosynthesis of this compound by the Pleurotus ostreatus strain. The conditions and factors, like temperature, salts, organic solvents, affecting the production of this macrosphelide by Pleurotus ostreatus strain were examined. The highest yield of macroshphelide production was noticed for halolactones, as well with iodide, bromide, iron and copper (2+) ions as inductors.

Toxicity of organic and inorganic nanoparticles to four species of white-rot fungi.

PubMed

Galindo, T P S; Pereira, R; Freitas, A C; Santos-Rocha, T A P; Rasteiro, M G; Antunes, F; Rodrigues, D; Soares, A M V M; Gonçalves, F; Duarte, A C; Lopes, I

2013-08-01

The rapid development of nanoparticles (NP) for industrial applications and large-volume manufacturing, with its subsequent release into the environment, raised the need to understand and characterize the potential effects of NP to biota. Accordingly, this work aimed to assess sublethal effects of five NP to the white-rot fungi species Trametes versicolor, Lentinus sajor caju, Pleurotus ostreatus, and Phanerochaete chrysosporium. Each species was exposed to serial dilutions of the following NP: organic-vesicles of SDS/DDAB and of Mo/NaO; gold-NP, quantum dot CdSe/ZnS, and Fe/Co. Fungi growth rate was monitored every day, and at the end of assay the mycelium from each replicate was collected to evaluate possible changes in its chemical composition. For all NP-suspensions the following parameters were characterized: hydrodynamic diameter, surface charge, aggregation index, zeta potential, and conductivity. All tested NP tended to aggregate when suspended in aqueous media. The obtained results showed that gold-NP, CdSe/ZnS, Mo/NaO, and SDS/DDAB significantly inhibited the growth of fungi with effects on the mycelium chemical composition. Among the tested NP, gold-NP and CdSe/ZnS were the ones exerting a higher effect on the four fungi. Finally to our knowledge, this is the first study reporting that different types of NP induce changes in the chemical composition of fungi mycelium. Copyright © 2013 Elsevier B.V. All rights reserved.

Valorization of spent oyster mushroom substrate and laccase recovery through successive solid state cultivation of Pleurotus, Ganoderma, and Lentinula strains.

PubMed

Economou, Christina N; Diamantopoulou, Panagiota A; Philippoussis, Antonios N

2017-06-01

Spent mushroom substrate (SMS) of Pleurotus ostreatus was supplemented with wheat bran and soybean flour in various proportions to obtain C/N ratios of 10, 20, and 30, and their effect was evaluated in successive cultivation of Pleurotus ostreatus, Pleurotus pulmonarius, Ganoderma adspersum, Ganoderma resinaceum, and Lentinula edodes strains with respect to mycelium growth rate, biomass concentration, recovery of the enzyme laccase and crude exopolysaccharides, and also with additional fruiting body production. All fungi showed the highest growth rate on unamended SMS (C/N 30), with G. resinaceum being the fastest colonizer (Kr = 9.84 mm day -1 ), while biomass concentration maximized at C/N 10. Moreover, supplementation affected positively laccase activity, with P. pulmonarius furnishing the highest value (44,363.22 U g -1 ) at C/N 20. On the contrary, L. edodes growth, fruiting, and laccase secretion were not favored by SMS supplementation. Fruiting body formation was promoted at C/N 30 for Ganoderma and at C/N 20 for Pleurotus species. Exopolysaccharide production of further studied Pleurotus strains was favored at a C/N 20 ratio, at the initial stage of SMS colonization. The obtained results support the potential effective utilization of supplemented SMS for laccase production from Ganoderma spp. and for new fruiting body production of Pleurotus spp.

Salinity induced effects on the growth rates and mycelia composition of basidiomycete and zygomycete fungi.

PubMed

Venâncio, C; Pereira, R; Freitas, A C; Rocha-Santos, T A P; da Costa, J P; Duarte, A C; Lopes, I

2017-12-01

Soil salinization, as the combination of primary and secondary events, can adversely affect organisms inhabiting this compartment. In the present study, the effects of increased salinity were assessed in four species of terrestrial fungi: Lentinus sajor caju, Phanerochaete chrysosporium, Rhizopus oryzae and Trametes versicolor. The mycelial growth and biochemical composition of the four fungi were determined under three exposure scenarios: 1) exposure to serial dilutions of natural seawater (SW), 2) exposure to serial concentrations of NaCl (potential surrogate of SW); and 3) exposure to serial concentrations of NaCl after a period of pre-exposure to low levels of NaCl. The toxicity of NaCl was slightly higher than that of SW, for all fungi species: the conductivities causing 50% of growth inhibition (EC 50 ) were within 14.9 and 22.0 mScm -1 for NaCl and within 20.2 and 34.1 mScm -1 for SW. Phanerochaete chrysosporium showed to be the less sensitive species, both for NaCl and SW. Exposure to NaCl caused changes in the biochemical composition of fungi, mainly increasing the production of polysaccharides. When fungi were exposed to SW this pattern of biochemical response was not observed. Fungi pre-exposed to low levels of salinity presented higher EC 50 than fungi non-pre-exposed, though 95% confidence limits overlapped, with the exception of P. chrysosporium. Pre-exposure to low levels of NaCl also induced changes in the biochemical composition of the mycelia of L. sajor caju and R. oryzae, relatively to the respective control. These results suggest that some terrestrial fungi may acquire an increased tolerance to NaCl after being pre-exposed to low levels of this salt, thus, suggesting their capacity to persist in environments that will undergo salinization. Furthermore, NaCl could be used as a protective surrogate of SW to derive safe salinity levels for soils, since it induced toxicity similar or higher than that of SW. Copyright © 2017 Elsevier Ltd. All

Use of maize wastewater for the cultivation of the Pleurotus spp. mushroom and optimization of its biological efficiency.

PubMed

Loss, Edenes; Royer, Andrea Rafaela; Barreto-Rodrigues, Marcio; Barana, Ana Claudia

2009-07-30

This study evaluated the Pleurotus spp. mushroom production process using an effluent from the maize agroindustrial process as a carbon and nitrogen source and as a wetting agent. A complete experimental design based on factorial planning was used to optimize the biological efficiency and evaluate the effect of the concentration of effluent, pH and species of Pleurotus. The results indicated that the effluent affects the biological efficiency for the production of both species of mushrooms at all pH values studied. The maximum biological efficiency predicted by the model (81.36%) corresponded to the point defined by the effluent contents (X(1)=1), pH (X(2)=-1) and fungus species (X(3)=1), specifically 50%, 5.0 and P. floridae, respectively. The results demonstrated that the effluent is a good alternative for the production of Pleurotus mushrooms.

Evaluation of productivity and antioxidant profile of solid-state cultivated macrofungi Pleurotus albidus and Pycnoporus sanguineus.

PubMed

Gambato, Gabriela; Todescato, Kelly; Pavão, Elisa Maria; Scortegagna, Angélica; Fontana, Roselei Claudete; Salvador, Mirian; Camassola, Marli

2016-05-01

The aim of this study was to investigate the production profile of Pleurotus albidus and Pycnoporus sanguineus on different waste substrates containing natural phenolics, and also to investigate whether phenolic-rich substrates can improve the phenolic content of these macrofungi. The medium formulated with Pinus sp. sawdust (PSW) made possible the highest yields (2.62±0.73%) of P. sanguineus. However, the supplementation of PSW with apple waste (AW) resulted in better P. albidus yields (23.94±2.92%). The results indicated that the substrate composition affected macrofungi production, also the chemical composition and the presence of phenolic compounds in the production media influence phenolic content and antioxidant activity in macrofungi. Copyright © 2016 Elsevier Ltd. All rights reserved.

[Degradation of fluorene and fluoranthene by the basidiomycete Pleurotus ostreatus].

PubMed

Pozdnyakova, N N; Chernyshova, M P; Grinev, V S; Landesman, E O; Koroleva, O V; Turkovskaya, O V

2016-01-01

The dependence of the degree of fluorene and fluoranthene degradation by the fungus Pleurotus ostreatus D1 on the culture medium composition has been studied. Polycyclic aromatic hydrocarbons (PAHs) have been transformed in Kirk’s medium (under conditions of laccase production) with the formation of a quinone metabolite and 9-fluorenone upon the use of fluoranthene and fluorene as substrates, respectively. More complete degradation with the formation of an intermediate metabolite, phthalic acid that has undergone subsequent utilization, has occurred in basidiomycete-rich medium (under the production of both laccase and versatile peroxidase). The formation of phthalic acid as a metabolite of fluoranthene degradation by lignolytic fungi has been revealed for the first time. The data allow the supposition that both extracellular laccase and laccase on the mycelium surface can participate in the initial stages of PAH metabolism, while versatile peroxidase is necessary for the oxidation of the formed metabolites. A scheme of fluorene metabolism by Pleurotus ostreatus D1 is suggested.

Production of ligninolytic enzymes by solid-state fermentation using Pleurotus eryngii.

PubMed

Akpinar, Merve; Urek, Raziye Ozturk

2012-01-01

Pleurotus eryngii (DC.) Gillet (MCC58) was investigated for its ability to produce various ligninolytic enzymes such as laccase (Lac), manganese peroxidase (MnP), aryl alcohol oxidase (AAO), and lignin peroxidase (LiP) by solid-state fermentation (SSF), which was carried out using a support substrate from the fruit juice industry. The chemical content of grape waste from this industry was studied. Also, the production patterns of these extracellular enzymes were researched during the growth of the organism for a period of 20 days and the protein, reducing sugar, and nitrogen levels were monitored during the stationary cultivation. The highest Lac activity was obtained as 2247.62 ± 75 U/L on day 10 in the presence of 750 µM Mn²⁺, while the highest MnP activity was attained as 2198.44 ± 65 U/L on day 15 in the presence of 500 µM Mn²⁺. Decolorization of methyl orange and reactive red 2 azo dyes was also achieved with ligninolytic enzymes, produced in SSF of P. eryngii.

Diseases and pests noxious to Pleurotus spp. mushroom crops.

PubMed

Bellettini, Marcelo B; Bellettini, Sebastião; Fiorda, Fernanda A; Pedro, Alessandra C; Bach, Fabiane; Fabela-Morón, Miriam F; Hoffmann-Ribani, Rosemary

The Pleurotus genus is one of most extensively studied white-rot fungi due to its exceptional ligninolytic properties. It is an edible mushroom that possesses biological effects, as it contains important bioactive molecules. It is a rich source of nutrients, particularly proteins, minerals as well as vitamins B, C and D. In basidiomycete fungi, intensive cultivations of edible mushrooms can often be affected by some bacterial, mold and virus diseases that rather frequently cause dramatic production loss. These infections are facilitated by the particular conditions under which mushroom cultivation is commonly carried out such as warm temperatures, humidity, carbon dioxide (CO 2 ) levels and presence of pests. There is not much bibliographic information related to pests of mushrooms and their substrates. The updated review presents a practical checklist of diseases and pests of the Pleurotus genus, providing useful information that may help different users. Copyright © 2017 Asociación Argentina de Microbiología. Publicado por Elsevier España, S.L.U. All rights reserved.

Effect of Pseudomonas sp. P7014 on the growth of edible mushroom Pleurotus eryngii in bottle culture for commercial production.

PubMed

Kim, Min Keun; Math, Renukaradhya K; Cho, Kye Man; Shin, Ki Jae; Kim, Jong Ok; Ryu, Jae San; Lee, Young Han; Yun, Han Dae

2008-05-01

Addition of bacterial culture strain P7014 and its supernatant to the mushroom growing media resulted in mushroom mycelia run faster. Mycelial growth rate of Pleurotus eryngii was increased up to 1.6 fold and primordial formation was induced one day earlier. Moreover, it was supposed that addition of bacteria had beneficial applications for commercial mushroom production, which appreciably reduced total number of days for cultivation of about 5+/-2 days compared with uninoculated, which took 55+/-2 days.

Effect of supplementing crop substrate with defatted pistachio meal on Agaricus bisporus and Pleurotus ostreatus production.

PubMed

Pardo-Giménez, Arturo; Catalán, Luis; Carrasco, Jaime; Álvarez-Ortí, Manuel; Zied, Diego; Pardo, José

2016-08-01

This work assesses the agronomic performance of defatted pistachio meal, after oil extraction, as a nutritional substrate supplement when growing the mushroom species Agaricus bisporus (Lange) Imbach and Pleurotus ostreatus (Jacq.) P. Kumm. Materials were applied at different doses at spawning. Along with non-supplemented substrates, commercial nutritional supplements were used as controls. Proximate analysis of mushrooms is also considered. For the cultivation of champignon, defatted pistachio meal has provided larger mushrooms (unitary weight and cap diameter) with firmer texture and greater content in dry weight and protein, without significant alterations in quantitative parameters. For Pleurotus ostreatus, the supplement led to significant yield increase, even providing up to 34.4% of increment compared to non-supplementation with meal, reaching a biological efficiency of 129.9 kg dt(-1) , when applied to the 15 g kg(-1) compost dose. Supplementation has also been conducted to increase dry weight, protein and fibre within carpophores and to decrease the energy value. Defatted pistachio meal has similar or better results compared to the commercial supplements used as reference. Compost supplementation with defatted pistachio meal in A. bisporus concerns mainly the quantitative parameters (size, texture, dry weight and protein). Based on the results obtained, this technique has greater potential of development for P. ostreatus commercial crops, basically due to expected increases in production, with a direct impact on benefits and crop profitability. © 2015 Society of Chemical Industry. © 2015 Society of Chemical Industry.

Temperature affects the production, activity and stability of ligninolytic enzymes in Pleurotus ostreatus and Trametes versicolor.

PubMed

Snajdr, J; Baldrian, P

2007-01-01

Enzyme activity was determined in cultures of Pleurotus ostreatus and Trametes versicolor with cellulose as a sole C source and high C/N ratio. The fungi were able to grow and produce laccase and Mn-peroxidase (MnP) at 5-35 degrees C, the highest production being recorded at 25-30 degrees C in P. ostreatus and at 35 degrees C in T. versicolor. Production of both enzymes at 10 degrees C accounted only for 4-20% of the maximum value. Temperature optima for enzyme activity were 50 and 55 degrees C for P. ostreatus and T. versicolor laccases, respectively, and 60 degrees C for MnP. Temperatures causing 50% loss of activity after 24 h were 32 and 47 degrees C for laccases and 36 and 30 degrees C for MnP from P. ostreatus and T. versicolor, respectively.

Effects of Different Substrates on Lignocellulosic Enzyme Expression, Enzyme Activity, Substrate Utilization and Biological Efficiency of Pleurotus Eryngii.

PubMed

Xie, Chunliang; Yan, Li; Gong, Wenbing; Zhu, Zuohua; Tan, Senwei; Chen, Du; Hu, Zhenxiu; Peng, Yuande

2016-01-01

Pleurotus eryngii is one of the most valued and delicious mushrooms which are commercially cultivated on various agro-wastes. How different substrates affect lignocellulosic biomass degradation, lignocellulosic enzyme production and biological efficiency in Pleurotus eryngii was unclear. In this report, Pleurotus eryngii was cultivated in substrates including ramie stalks, kenaf stalks, cottonseed hulls and bulrush stalks. The results showed that ramie stalks and kenaf stalks were found to best suitable to cultivate Pleurotus eryngii with the biological efficiency achieved at 55% and 57%, respectively. In order to establish correlations between different substrates and lignocellulosic enzymes expression, the extracellular proteins from four substrates were profiled with high throughput TMT-based quantitative proteomic approach. 241 non-redundant proteins were identified and 74 high confidence lignocellulosic enzymes were quantified. Most of the cellulases, hemicellulases and lignin depolymerization enzymes were highly up-regulated when ramie stalks and kenaf stalks were used as carbon sources. The enzyme activities results suggested cellulases, hemicellulases and lignin depolymerization enzymes were significantly induced by ramie stalks and kenaf stalks. The lignocelluloses degradation, most of the lignocellulosic enzymes expressions and activities of Pleurotus eryngii had positive correlation with the biological efficiency, which depend on the nature of lignocellulosic substrates. In addition, the lignocellulosic enzymes expression profiles during Pleurotus eryngii growth in different substrates were obtained. The present study suggested that most of the lignocellulosic enzymes expressions and activities can be used as tools for selecting better performing substrates for commercial mushroom cultivation. © 2016 The Author(s) Published by S. Karger AG, Basel.

Lignocellulolytic enzyme production of Pleurotus ostreatus growth in agroindustrial wastes

PubMed Central

da Luz, José Maria Rodrigues; Nunes, Mateus Dias; Paes, Sirlaine Albino; Torres, Denise Pereira; de Cássia Soares da Silva, Marliane; Kasuya, Maria Catarina Megumi

2012-01-01

The mushroom Pleurotus ostreatus has nutritional and medicinal characteristics that depend on the growth substrate. In nature, this fungus grows on dead wood, but it can be artificially cultivated on agricultural wastes (coffee husks, eucalyptus sawdust, corncobs and sugar cane bagasse). The degradation of agricultural wastes involves some enzyme complexes made up of oxidative (laccase, manganese peroxidase and lignin peroxidase) and hydrolytic enzymes (cellulases, xylanases and tanases). Understanding how these enzymes work will help to improve the productivity of mushroom cultures and decrease the potential pollution that can be caused by inadequate discharge of the agroindustrial residues. The objective of this work was to assess the activity of the lignocellulolytic enzymes produced by two P. ostreatus strains (PLO 2 and PLO 6). These strains were used to inoculate samples of coffee husks, eucalyptus sawdust or eucalyptus bark add with or without 20 % rice bran. Every five days after substrate inoculation, the enzyme activity and soluble protein concentration were evaluated. The maximum activity of oxidative enzymes was observed at day 10 after inoculation, and the activity of the hydrolytic enzymes increased during the entire period of the experiment. The results show that substrate composition and colonization time influenced the activity of the lignocellulolytic enzymes. PMID:24031982

Genetic diversity of Kenyan native oyster mushroom (Pleurotus).

PubMed

Otieno, Ojwang D; Onyango, Calvin; Onguso, Justus Mungare; Matasyoh, Lexa G; Wanjala, Bramwel W; Wamalwa, Mark; Harvey, Jagger J W

2015-01-01

Members of the genus Pleurotus, also commonly known as oyster mushroom, are well known for their socioeconomic and biotechnological potentials. Despite being one of the most important edible fungi, the scarce information about the genetic diversity of the species in natural populations has limited their sustainable utilization. A total of 71 isolates of Pleurotus species were collected from three natural populations: 25 isolates were obtained from Kakamega forest, 34 isolates from Arabuko Sokoke forest and 12 isolates from Mount Kenya forest. Amplified fragment length polymorphism (AFLP) was applied to thirteen isolates of locally grown Pleurotus species obtained from laboratory samples using five primer pair combinations. AFLP markers and internal transcribed spacer (ITS) sequences of the ribosomal DNA were used to estimate the genetic diversity and evaluate phylogenetic relationships, respectively, among and within populations. The five primer pair combinations generated 293 polymorphic loci across the 84 isolates. The mean genetic diversity among the populations was 0.25 with the population from Arabuko Sokoke having higher (0.27) diversity estimates compared to Mount Kenya population (0.24). Diversity between the isolates from the natural population (0.25) and commercial cultivars (0.24) did not differ significantly. However, diversity was greater within (89%; P > 0.001) populations than among populations. Homology search analysis against the GenBank database using 16 rDNA ITS sequences randomly selected from the two clades of AFLP dendrogram revealed three mushroom species: P. djamor, P. floridanus and P. sapidus; the three mushrooms form part of the diversity of Pleurotus species in Kenya. The broad diversity within the Kenyan Pleurotus species suggests the possibility of obtaining native strains suitable for commercial cultivation. © 2015 by The Mycological Society of America.

Secretion of laccase and manganese peroxidase by Pleurotus strains cultivate in solid-state using Pinus spp. sawdust

PubMed Central

Camassola, Marli; da Rosa, Letícia O.; Calloni, Raquel; Gaio, Tamara A.; Dillon, Aldo J.P.

2013-01-01

Pleurotus species secrete phenol oxidase enzymes: laccase (Lcc) and manganese peroxidase (MnP). New genotypes of these species show potential to be used in processes aiming at the degradation of phenolic compounds, polycyclic aromatic hydrocarbons and dyes. Hence, a screening of some strains of Pleurotus towards Lcc and MnP production was performed in this work. Ten strains were grown through solid-state fermentation on a medium based on Pinus spp. sawdust, wheat bran and calcium carbonate. High Lcc and MnP activities were found with these strains. Highest Lcc activity, 741 ± 245 U gdm−1 of solid state-cultivation medium, was detected on strain IB11 after 32 days, while the highest MnP activity occurred with strains IB05, IB09, and IB11 (5,333 ± 357; 4,701 ± 652; 5,999 ± 1,078 U gdm−1, respectively). The results obtained here highlight the importance of further experiments with lignocellulolytic enzymes present in different strains of Pleurotus species. Such results also indicate the possibility of selecting more valuable strains for future biotechnological applications, in soil bioremediation and biological biomass pre-treatment in biofuels production, for instance, as well as obtaining value-added products from mushrooms, like phenol oxidase enzymes. PMID:24159307

Proteases of Wood Rot Fungi with Emphasis on the Genus Pleurotus.

PubMed

Inácio, Fabíola Dorneles; Ferreira, Roselene Oliveira; de Araujo, Caroline Aparecida Vaz; Brugnari, Tatiane; Castoldi, Rafael; Peralta, Rosane Marina; de Souza, Cristina Giatti Marques

2015-01-01

Proteases are present in all living organisms and they play an important role in physiological conditions. Cell growth and death, blood clotting, and immune defense are all examples of the importance of proteases in maintaining homeostasis. There is growing interest in proteases due to their use for industrial purposes. The search for proteases with specific characteristics is designed to reduce production costs and to find suitable properties for certain industrial sectors, as well as good producing organisms. Ninety percent of commercialized proteases are obtained from microbial sources and proteases from macromycetes have recently gained prominence in the search for new enzymes with specific characteristics. The production of proteases from saprophytic basidiomycetes has led to the identification of various classes of proteases. The genus Pleurotus has been extensively studied because of its ligninolytic enzymes. The characteristics of this genus are easy cultivation techniques, high yield, low nutrient requirements, and excellent adaptation. There are few studies in the literature about proteases of Pleurotus spp. This review gathers together information about proteases, especially those derived from basidiomycetes, and aims at stimulating further research about fungal proteases because of their physiological importance and their application in various industries such as biotechnology and medicine.

Investigation of Pleurotus ostreatus pretreatment on switchgrass for ethanol production

NASA Astrophysics Data System (ADS)

Slavens, Shelyn Gehle

Fungal pretreatment using the white-rot fungus Pleurotus ostreatus on switchgrass for ethanol production was studied. In a small-scale storage study, small switchgrass bales were inoculated with fungal spawn and automatically watered to maintain moisture. Sampled at 25, 53, and 81 d, the switchgrass composition was determined and liquid hot water (LHW) pretreatment was conducted. Fungal pretreatment significantly decreased the xylan and lignin content; glucan was not significantly affected by fungal loading. The glucan, xylan, and lignin contents significantly decreased with increased fungal pretreatment time. The effects of the fungal pretreatment were not highly evident after the LHW pretreatment, showing only changes based on sampling time. Although other biological activity within the bales increased cellulose degradation, the fungal pretreatment successfully reduced the switchgrass lignin and hemicellulose contents. In a laboratory-scale nutrient supplementation study, copper, manganese, glucose, or water was added to switchgrass to induce production of ligninolytic enzymes by P. ostreatus. After 40 d, ligninolytic enzyme activities and biomass composition were determined and simultaneous saccharification and fermentation (SSF) was conducted to determine ethanol yield. Laccase activity was similar for all supplements and manganese peroxidase (MnP) activity was significantly less in copper-treated samples than in the other fungal-inoculated samples. The fungal pretreatment reduced glucan, xylan, and lignin content, while increasing extractable sugars content. The lowest lignin contents occurred in the water-fungal treated samples and produced the greatest ethanol yields. The greatest lignin contents occurred in the copper-fungal treated samples and produced the lowest ethanol yields. Manganese-fungal and glucose-fungal treated samples had similar, intermediate lignin contents and produced similar, intermediate ethanol yields. Ethanol yields from switchgrass

Proteases of Wood Rot Fungi with Emphasis on the Genus Pleurotus

PubMed Central

Inácio, Fabíola Dorneles; Ferreira, Roselene Oliveira; de Araujo, Caroline Aparecida Vaz; Peralta, Rosane Marina; de Souza, Cristina Giatti Marques

2015-01-01

Proteases are present in all living organisms and they play an important role in physiological conditions. Cell growth and death, blood clotting, and immune defense are all examples of the importance of proteases in maintaining homeostasis. There is growing interest in proteases due to their use for industrial purposes. The search for proteases with specific characteristics is designed to reduce production costs and to find suitable properties for certain industrial sectors, as well as good producing organisms. Ninety percent of commercialized proteases are obtained from microbial sources and proteases from macromycetes have recently gained prominence in the search for new enzymes with specific characteristics. The production of proteases from saprophytic basidiomycetes has led to the identification of various classes of proteases. The genus Pleurotus has been extensively studied because of its ligninolytic enzymes. The characteristics of this genus are easy cultivation techniques, high yield, low nutrient requirements, and excellent adaptation. There are few studies in the literature about proteases of Pleurotus spp. This review gathers together information about proteases, especially those derived from basidiomycetes, and aims at stimulating further research about fungal proteases because of their physiological importance and their application in various industries such as biotechnology and medicine. PMID:26180792

The ligninolytic peroxidases in the genus Pleurotus: divergence in activities, expression, and potential applications.

PubMed

Knop, Doriv; Yarden, Oded; Hadar, Yitzhak

2015-02-01

Mushrooms of the genus Pleurotus are comprised of cultivated edible ligninolytic fungi with medicinal properties and a wide array of biotechnological and environmental applications. Like other white-rot fungi (WRF), they are able to grow on a variety of lignocellulosic biomass substrates and degrade both natural and anthropogenic aromatic compounds. This is due to the presence of the non-specific oxidative enzymatic systems, which are mainly consisted of lacasses, versatile peroxidases (VPs), and short manganese peroxidases (short-MnPs). Additional, less studied, peroxidase are dye-decolorizing peroxidases (DyPs) and heme-thiolate peroxidases (HTPs). During the past two decades, substantial information has accumulated concerning the biochemistry, structure and function of the Pleurotus ligninolytic peroxidases, which are considered to play a key role in many biodegradation processes. The production of these enzymes is dependent on growth media composition, pH, and temperature as well as the growth phase of the fungus. Mn(2+) concentration differentially affects the expression of the different genes. It also severs as a preferred substrate for these preoxidases. Recently, sequencing of the Pleurotus ostreatus genome was completed, and a comprehensive picture of the ligninolytic peroxidase gene family, consisting of three VPs and six short-MnPs, has been established. Similar enzymes were also discovered and studied in other Pleurotus species. In addition, progress has been made in the development of molecular tools for targeted gene replacement, RNAi-based gene silencing and overexpression of genes of interest. These advances increase the fundamental understanding of the ligninolytic system and provide the opportunity for harnessing the unique attributes of these WRF for applied purposes.

Optimization of laccase production by Pleurotus ostreatus IMI 395545 using the Taguchi DOE methodology.

PubMed

Periasamy, Rathinasamy; Palvannan, Thayumanavan

2010-12-01

Production of laccase using a submerged culture of Pleurotus orstreatus IMI 395545 was optimized by the Taguchi orthogonal array (OA) design of experiments (DOE) methodology. This approach facilitates the study of the interactions of a large number of variables spanned by factors and their settings, with a small number of experiments, leading to considerable savings in time and cost for process optimization. This methodology optimizes the number of impact factors and enables to calculate their interaction in the production of industrial enzymes. Eight factors, viz. glucose, yeast extract, malt extract, inoculum, mineral solution, inducer (1 mM CuSO₄) and amino acid (l-asparagine) at three levels and pH at two levels, with an OA layout of L18 (2¹ × 3⁷) were selected for the proposed experimental design. The laccase yield obtained from the 18 sets of fermentation experiments performed with the selected factors and levels was further processed with Qualitek-4 software. The optimized conditions shared an enhanced laccase expression of 86.8% (from 485.0 to 906.3 U). The combination of factors was further validated for laccase production and reactive blue 221 decolorization. The results revealed an enhanced laccase yield of 32.6% and dye decolorization up to 84.6%. This methodology allows the complete evaluation of main and interaction factors. © 2010 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim

Optimization of cultural conditions for biosurfactant production by Pleurotus djamor in solid state fermentation.

PubMed

Velioglu, Zulfiye; Ozturk Urek, Raziye

2015-11-01

Being eco-friendly, less toxic, more biodegradable and biocompatible, biological surfactants have higher activity and stability compared to synthetic ones. In spite of the fact that there are abundant benefits of biosurfactants over the synthetic congeners, the problem related with the economical and large scale production proceeds. The utilization of several industrial wastes in the production media as substrates reduces the production cost. This current study aims optimization of biosurfactant production conditions by Pleurotus djamor, grown on sunflower seed shell, grape wastes or potato peels as renewable cheap substrates in solid state fermentation. After determination of the best substrate for biosurfactant production, we indicate optimum size and amount of solid substrate, volume of medium, temperature, pH and Fe(2+) concentrations on biosurfactant production. In optimum conditions, by reducing water surface tension to 28.82 ± 0.3 mN/m and having oil displacement diameter of 3.9 ± 0.3 cm, 10.205 ± 0.5 g/l biosurfactant was produced. Moreover, chemical composition of biosurfactant produced in optimum condition was determined by FTIR. Lastly, laboratory's large-scale production was carried out in optimum conditions in a tray bioreactor designed by us and 8.9 ± 0.5 g/l biosurfactant was produced with a significant surface activity (37.74 ± 0.3 mN/m). With its economical suggestions and applicability of laboratory's large-scale production, this work indicates the possibility of using low cost agro-industrial wastes as renewable substrates for biosurfactant production. Therefore, using economically produced biosurfactant will reduce cost in several applications such as bioremediation, oil recovery and biodegradation of toxic chemicals. Copyright © 2015 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.

Effects of fungal (Lentinussajor-caju) treated oil palm frond on performance and carcass characteristics in finishing goats

PubMed Central

Chanjula, Pin; Petcharat, Vasun; Cherdthong, Anusorn

2017-01-01

Objective This experiment was conducted to investigate the effects of fungal treated oil palm fronds (FTOPF) on performance, carcass traits, meat quality, and muscle chemical composition. Methods Eighteen growing crossbred male goats (Thai Native×Anglo Nubian) with 18.7±2.0 kg of initial body weight (BW) were stratified and blocked by BW in a randomized complete block design. Three diets containing 30% of oil palm fronds (OPF) either untreated (UOPF) or treated with Lentinussajor-caju (FTOPF) with or without urea (FTOPFU) were used as roughage sources in total mixed rations (TMRs). The diets were offered ad libitum and weight gain was determined. At the end of the experimental period, the harvest data and carcass characteristics of the goats were recorded, and muscular longissimus dorsi composition was determined. Results No significant effect of fungal treated (FT) inclusion was observed in any of the feed intake, growth performance, and carcass characteristics. Likewise, no apparent effects on carcass composition and muscle chemical composition were detected in this study, except for hind leg and chump were affected (p<0.05) by FT inclusion. Conclusion In conclusion, feeding of fungal (Lentinussajor-caju) treated oil palm frond in TMR diet did not affect performance and carcass characteristics in finishing goats. PMID:28446002

Effects of fungal (Lentinussajor-caju) treated oil palm frond on performance and carcass characteristics in finishing goats.

PubMed

Chanjula, Pin; Petcharat, Vasun; Cherdthong, Anusorn

2017-06-01

This experiment was conducted to investigate the effects of fungal treated oil palm fronds (FTOPF) on performance, carcass traits, meat quality, and muscle chemical composition. Eighteen growing crossbred male goats (Thai Native×Anglo Nubian) with 18.7±2.0 kg of initial body weight (BW) were stratified and blocked by BW in a randomized complete block design. Three diets containing 30% of oil palm fronds (OPF) either untreated (UOPF) or treated with Lentinussajor-caju (FTOPF) with or without urea (FTOPFU) were used as roughage sources in total mixed rations (TMRs). The diets were offered ad libitum and weight gain was determined. At the end of the experimental period, the harvest data and carcass characteristics of the goats were recorded, and muscular longissimus dorsi composition was determined. No significant effect of fungal treated (FT) inclusion was observed in any of the feed intake, growth performance, and carcass characteristics. Likewise, no apparent effects on carcass composition and muscle chemical composition were detected in this study, except for hind leg and chump were affected (p<0.05) by FT inclusion. In conclusion, feeding of fungal ( Lentinussajor-caju ) treated oil palm frond in TMR diet did not affect performance and carcass characteristics in finishing goats.

An insight into nutritional profile of selected Pleurotus species.

PubMed

Irshad, A; Sharif, S; Riaz, M; Anjum, F

2018-01-01

The global demand for good quality food indicates that consumers are more concerned about a particular diet associated with good health and lower risk for certain ailments. Mushrooms are widely used as healthy nutritious food. In the present study, the nutritional composition of four different Pleurotus sp. was determined. Prior to extraction, all the selected mushrooms were subjected for proximate composition analysis. The protein, fat, ash, total carbohydrate, fiber and energy contents were in the range of (16.07- 25.15%), (0.64-2.02%), (2.1-9.14%), (65.66-82.47%), (6.21-54.12%) and (342.20-394.30Kcal/100g), respectively. The spectrophotometric analysis showed that the concentration of protein was in the range of 45.78-33.47 mg/g in all Pleurotus sp. High performance liquid chromatographic analysis of sugars showed six different mono and disaccharides in all the selected mushrooms. The fatty acid profile by gas chromatography-mass spectrometry revealed that the main fatty acids in selected mushrooms were present in the order linoliec acid> oleic acid> palmitic acid. The results suggested that all the Pleurotus sp. could be considered as a rich source of nutrients.

Preliminary investigations into the bioconversion of gamma irradiated agricultural waste by Pleurotus spp.

NASA Astrophysics Data System (ADS)

Gbedemah, C. M.; Obodai, M.; Sawyerr, L. C.

1998-06-01

The application of gamma irradiation for pretreatment of lignocellulosic materials for their hydrolysis and to increase their digestibility for rumen animal have been reported in the literature. Gamma irradiation of corn stover in combination with sodium hydroxide for bioconversion of polysaccharide into protein by Pleurotus spp has also been reported. In this study experiments were designed to find out whether gamma radiation could serve both as a decontaminating agent as well as hydrolytic agent of sawdust for the bioconversion of four varieties of Pleurotus spp. Preliminary results indicate that a dose of 20kGy of gamma irradiation increase the yield of Pleurotus eous var ET-8 whilst decreasing the yield of other varieties.

Oyster Culinary-Medicinal Mushroom, Pleurotus ostreatus (Higher Basidiomycetes), Growth in Grain-Based Diet Improves Broiler Chicken Production.

PubMed

Santos, Mateus P; Marcante, Rafael C; Santana, Thiago T; Tanaka, Henrique S; Funari, Pascoal; Alberton, Luiz R; Faria, Eliete V; Valle, Juliana S; Colauto, Nelson B; Linde, Giani A

2015-01-01

Many alternative compounds have been tested to improve poultry performance but few of them have previously used mycelial-colonized substrate to partially replace standard diet in broiler chickens. The objective of this study was to evaluate broiler chicken production, health, and meat sensory characteristics, with partial replacement of the standard diet by Pleurotus ostreatus-colonized substrate. One hundred fifty 1-day-old male Cobb chicks were given standard diet partially replaced by 0, 5, 10, 100, or 200 g·kg⁻¹ of P. ostreatus-colonized substrate and randomly distributed into five treatments. Each treatment had three replicates, with 10 birds per replicate, totaling 30 birds. The replacement of the standard diet by 10 g·kg⁻¹ of colonized substrate increased (P≤0.05) chicken body mass up to 57% at 21 days, and up to 28% at 42 days. In general, partial replacement of standard diet by colonized substrate increased hematocrits and typical lymphocytes, and reduced low density lipoproteins. Also, it reduced chicken production period up to 21% and there is no meat taste alteration. The use of P. ostreatus-colonized substrate in chicken feeding is an alternative method to improve broiler chicken production.

Laccase isoenzymes of Pleurotus eryngii: characterization, catalytic properties, and participation in activation of molecular oxygen and Mn2+ oxidation.

PubMed Central

Muñoz, C; Guillén, F; Martínez, A T; Martínez, M J

1997-01-01

Two laccase isoenzymes produced by Pleurotus eryngii were purified to electrophoretic homogeneity (42- and 43-fold) with an overall yield of 56.3%. Laccases I and II from this fungus are monomeric glycoproteins with 7 and 1% carbohydrate content, molecular masses (by sodium dodecyl sulfate-polyacrylamide gel electrophoresis) of 65 and 61 kDa, and pIs of 4.1 and 4.2, respectively. The highest rate of 2,2'-azino-bis(3-ethylbenzothiazoline-6-sulfonate) oxidation for laccase I was reached at 65 degrees C and pH 4, and that for laccase II was reached at 55 degrees C and pH 3.5. Both isoenzymes are stable at high pH, retaining 60 to 70% activity after 24 h from pH 8 to 12. Their amino acid compositions and N-terminal sequences were determined, the latter strongly differing from those of laccases of other basidiomycetes. Antibodies against laccase I reacted with laccase II, as well as with laccases from Pleurotus ostreatus, Pleurotus pulmonarius, and Pleurotus floridanus. Different hydroxy- and methoxy-substituted phenols and aromatic amines were oxidized by the two laccase isoenzymes from P. eryngii, and the influence of the nature, number, and disposition of aromatic-ring substituents on kinetic constants is discussed. Although both isoenzymes presented similar substrate affinities, the maximum rates of reactions catalyzed by laccase I were higher than those of laccase II. In reactions with hydroquinones, semiquinones produced by laccase isoenzymes were in part converted into quinones via autoxidation. The superoxide anion radical produced in the latter reaction dismutated, producing hydrogen peroxide. In the presence of manganous ion, the superoxide union was reduced to hydrogen peroxide with the concomitant production of manganic ion. These results confirmed that laccase in the presence of hydroquinones can participate in the production of both reduced oxygen species and manganic ions. PMID:9172335

Induction of a T-Helper 1 (Th1) Immune Response in Mice by an Extract from the Pleurotus eryngii (Eringi) Mushroom

PubMed Central

Kameyama, Natsuko; Ito, Akira; Imai, Soichi

2012-01-01

Abstract To assess the effect of edible mushroom extracts on the induction of T-helper 1 (Th1) immunity, we examined differences in interferon-gamma (IFN-γ) and interleukin (IL)-4 production in mice induced by hot-water extracts of 15 species of edible mushroom. Extracts from Agaricus bisporus, Flammulina velutipes, Hypsizigus marmoreus, Lentinula edodes, and Lyophyllum decastes induced both IFN-γ and IL-4 production in mice, whereas extracts from Pleurotus ostreatus only induced IL-4. In contrast, extracts from Agaricus blazei, Grifola frondosa, Morchella esculenta, Pholiota nameko, Pleurotus citrinopileatus, and Pleurotus eryngii induced only IFN-γ production. In particular, the extract from P. eryngii induced high levels of IFN-γ and reduced levels of IL-4. We further investigated the use of a trial immunogen using the P. eryngii extract as a Th1 immunostimulator. An oil-in-water emulsion of the hot-water extract from P. eryngii (immunostimulator) and ovalbumin (OVA; antigen) was used as a trial immunogen. This immunogen induced strong OVA-specific IgG2a antibody production in mice compared with the negative controls. In addition, OVA-specific IgG1 antibody levels were lower than those for the negative controls. Marked increases in serum IFN-γ levels and high-level production of IFN-γ in the culture supernatant from the CD4+ spleen cells in the trial immunogen group mice were observed. Our results suggested that the hot-water extract from P. eryngii induced Th1 immunity by acting as an immunostimulator. PMID:23134464

Biodegradation and detoxification of olive mill wastewater by selected strains of the mushroom genera Ganoderma and Pleurotus.

PubMed

Ntougias, Spyridon; Baldrian, Petr; Ehaliotis, Constantinos; Nerud, Frantisek; Antoniou, Theodoros; Merhautová, Věra; Zervakis, Georgios I

2012-07-01

Thirty-nine white-rot fungi belonging to nine species of Agaricomycotina (Basidiomycota) were initially screened for their ability to decrease olive-mill wastewater (OMW) phenolics. Four strains of Ganoderma australe, Ganoderma carnosum, Pleurotus eryngii and Pleurotus ostreatus, were selected and further examined for key-aspects of the OMW biodegradation process. Fungal growth in OMW-containing batch cultures resulted in significant decolorization (by 40-46% and 60-65% for Ganoderma and Pleurotus spp. respectively) and reduction of phenolics (by 64-67% and 74-81% for Ganoderma and Pleurotus spp. respectively). COD decrease was less pronounced (12-29%). Cress-seeds germination increased by 30-40% when OMW was treated by Pleurotus strains. Toxicity expressed as inhibition of Aliivibrio fischeri luminescence was reduced in fungal-treated OMW samples by approximately 5-15 times compared to the control. As regards the pertinent enzyme activities, laccase and Mn-independent peroxidase were detected for Ganoderma spp. during the entire incubation period. In contrast, Pleurotus spp. did not exhibit any enzyme activities at early growth stages; instead, high laccase (five times greater than those of Ganoderma spp.) and Mn peroxidases activities were determined at the end of treatment. OMW decolorization by Ganoderma strains was strongly correlated to the reduction of phenolics, whereas P. eryngii laccase activity was correlated with the effluent's decolorization. Copyright © 2012 Elsevier Ltd. All rights reserved.

An aryl-alcohol oxidase of Pleurotus sapidus: heterologous expression, characterization, and application in a 2-enzyme system.

PubMed

Galperin, Ilya; Javeed, Aysha; Luig, Hanno; Lochnit, Günter; Rühl, Martin

2016-09-01

Aryl-alcohol oxidases (AAOs) are enzymes supporting the degradation of lignin by fungal derived class II peroxidases produced by white-rot fungi. AAOs are able to generate H2O2 as a by-product via oxidation of an aryl-alcohol into its correspondent aldehyde. In this study, an AAO was heterologously expressed in a basidiomycete host for the first time. The gene for an AAO of the white-rot fungus Pleurotus sapidus, a close relative to the oyster mushroom Pleurotus ostreatus, was cloned into an expression vector and put under control of the promotor of the glyceraldehyde-3-phosphate dehydrogenase gene 2 (gpdII) of the button mushroom Agaricus bisporus. The expression vector was transformed into the model basidiomycete Coprinopsis cinerea, and several positive transformants were obtained. The best producing transformants were grown in shake-flasks and in a stirred tank reactor reaching enzymatic activities of up to 125 U L(-1) using veratryl alcohol as a substrate. The purified AAO was biochemically characterized and compared to the previously described native and recombinant AAOs from other Pleurotus species. In addition, a two-enzyme system comprising a dye-decolorizing peroxidase (DyP) from Mycetinis scorodonius and the P. sapidus AAO was successfully employed to bleach the anthraquinone dye Reactive Blue 5.

Solid-State Treatment of Castor Cake Employing the Enzymatic Cocktail Produced from Pleurotus djamor Fungi.

PubMed

Sánchez-Cantú, Manuel; Ortiz-Moreno, Liliana; Ramos-Cassellis, María E; Marín-Castro, Marco; De la Cerna-Hernández, C

2018-06-01

In this work, the enzymatic cocktail produced by Pleurotus djamor fungi extracted at pH of 4.8 and 5.3 was employed for castor cake solid-state treatment. Proximal, X-ray powder diffraction and scanning electron microscopy analysis of the pristine castor cake were carried out. First, Pleurotus djamor stain was inoculated in castor cake for the enzymatic production and the enzymatic activity was determined. The maximum enzymatic activity was identified at days 14 (65.9 UI/gss) and 11 (140.3 UI/gss) for the enzymatic cocktail obtained at pH 5.3 and 4.8, respectively. Then, the enzymatic cocktail obtained at the highest enzymatic activity days was employed directly over castor cake. Lignin was degraded throughout incubation time achieving a 47 and 45% decrease for the cocktail produced at pH 4.8 and 5.3, correspondingly. These results were corroborated by the SEM and XRD analysis where a higher porosity and xylan degradation were perceived throughout the enzymatic treatment.

Decolourisation of mushroom farm wastewater by Pleurotus ostreatus.

PubMed

Rodríguez Pérez, Suyén; García Oduardo, Nora; Bermúdez Savón, Rosa C; Fernández Boizán, Maikel; Augur, Christopher

2008-07-01

Mushroom production on coffee pulp as substrate generates an intense black residual liquid, which requires suitable treatment. In the present study, Pleurotus ostreatus growth in wastewater from mushroom farm was evaluated as a potential biological treatment process for decolourisation as well as to obtain biomass (liquid inoculum). Culture medium components affecting mycelial growth were determined, evaluating colour removal. Laccase activity was monitored during the process. P. ostreatus was able to grow in non diluted WCP. Highest biomass yield was obtained when glucose (10 g/l) was added. The addition of this carbon source was necessary for efficient decolourisation. Agitation of the culture improved biodegradation of WCP as well as fungal biomass production. Laccase and manganese-independent peroxidase activities were detected during fungal treatment of the WCP by P. ostreatus CCEBI 3024. The laccase enzyme showed good correlation with colour loss. Both wastewater colour and pollution load (as chemical oxygen demand) decreased more than 50% after 10 days of culture. Phenols were reduced by 92%.

Cultivation of Pleurotus ostreatus and other edible mushrooms.

PubMed

Sánchez, Carmen

2010-02-01

Pleurotus ostreatus is the second most cultivated edible mushroom worldwide after Agaricus bisporus. It has economic and ecological values and medicinal properties. Mushroom culture has moved toward diversification with the production of other mushrooms. Edible mushrooms are able to colonize and degrade a large variety of lignocellulosic substrates and other wastes which are produced primarily through the activities of the agricultural, forest, and food-processing industries. Particularly, P. ostreatus requires a shorter growth time in comparison to other edible mushrooms. The substrate used for their cultivation does not require sterilization, only pasteurization, which is less expensive. Growing oyster mushrooms convert a high percentage of the substrate to fruiting bodies, increasing profitability. P. ostreatus demands few environmental controls, and their fruiting bodies are not often attacked by diseases and pests, and they can be cultivated in a simple and cheap way. All this makes P. ostreatus cultivation an excellent alternative for production of mushrooms when compared to other mushrooms.

Antibacterial activity of Mediterranean Oyster mushrooms, species of genus Pleurotus (higher Basidiomycetes).

PubMed

Schillaci, Domenico; Arizza, Vincenzo; Gargano, Maria Letizia; Venturella, Giuseppe

2013-01-01

Extracts of the Mediterranean culinary-medicinal Oyster mushrooms Pleurotus eryngii var. eryngii, P. eryngii var. ferulae, P. eryngii var. elaeoselini, and P. nebrodensis were tested for their in vitro growth inhibitory activity against a group of bacterial reference strains of medical relevance: Staphylococcus aureus ATCC 25923, S. epidermidis RP62A, Pseudomonas aeruginosa ATCC 15442, and Escherichia coli ATCC10536. All of the Pleurotus species analyzed inhibited the tested microorganisms in varying degrees. The data included in this paper for P. nebrodensis and P. eryngii var. elaeoselinii are new reports.

Production and molecular characterization of somatic hybrids between Pleurotus florida and Lentinula edodes.

PubMed

Mallick, Pijush; Sikdar, Samir Ranjan

2014-08-01

Nine inter-generic somatic hybrids named as pfle were produced through PEG-mediated protoplast fusion between Pleurotus florida and Lentinula edodes using double selection method. Hybridity of the newly developed strains was established on the basis of colony morphology, mycelial growth, hyphal traits, fruit-body productivity and inter single sequence repeat (ISSR) marker profiling. Hybrid population was assessed with different phenotypic variables by one-way analysis of variance. Principal component matrices were analyzed for the six phenotypic variables in scatter plot showing maximum positive correlation between each variable for all strains examined. Six ISSR primers generated 66 reproducible fragments with 98.48 % polymorphism. The dendrogram thus created based on unweighted pair-group method with mathematic averages method of clustering and Euclidean distance which exhibited three major groups between the parents and pfle hybrids. Though P. florida parent remained in one group but it showed different degrees of genetic distance with all the hybrid lines belonging to the other two groups while L. edodes was most distantly related to all the hybrid lines. L. edodes specific sequence-rich ISSR amplicon was recorded in all the hybrid lines and in L. edodes but not in P. florida. All the fruit body generating pfle hybrid lines could produce basidiocarp on paddy straw in sub-tropical climate and showed phenotypic resemblance to the P. florida parent.

Statistical Optimization of Laccase Production and Delignification of Sugarcane Bagasse by Pleurotus ostreatus in Solid-State Fermentation

PubMed Central

Karp, Susan Grace; Faraco, Vincenza; Amore, Antonella; Letti, Luiz Alberto Junior; Thomaz Soccol, Vanete; Soccol, Carlos Ricardo

2015-01-01

Laccases are oxidative enzymes related to the degradation of phenolic compounds, including lignin units, with concomitant reduction of oxygen to water. Delignification is a necessary pretreatment step in the process of converting plant biomass into fermentable sugars. The objective of this work was to optimize the production of laccases and to evaluate the delignification of sugarcane bagasse by Pleurotus ostreatus in solid-state fermentation. Among eight variables (pH, water activity, temperature, and concentrations of CuSO4, (NH4)2SO4, KH2PO4, asparagine, and yeast extract), copper sulfate and ammonium sulfate concentrations were demonstrated to significantly influence laccase production. The replacement of ammonium sulfate by yeast extract and the addition of ferulic acid as inducer provided increases of 5.7- and 2.0-fold, respectively, in laccase activity. Optimization of laccase production as a function of yeast extract, copper sulfate, and ferulic acid concentrations was performed by response surface methodology and optimal concentrations were 6.4 g/L, 172.6 μM, and 1.86 mM, respectively. Experimentally, the maximum laccase activity of 151.6 U/g was produced at the 5th day of solid-state fermentation. Lignin content in sugarcane bagasse was reduced from 31.89% to 26.36% after 5 days and to 20.79% after 15 days by the biological treatment of solid-state fermentation. PMID:26180784

Six new ergostane-type steroids from king trumpet mushroom (Pleurotus eryngii) and their inhibitory effects on nitric oxide production.

PubMed

Kikuchi, Takashi; Maekawa, Yukina; Tomio, Arisa; Masumoto, Yuki; Yamamoto, Taishi; In, Yasuko; Yamada, Takeshi; Tanaka, Reiko

2016-11-01

Six new ergostane-type steroids; (22E)-3β,5α,6α,11-tetrahydroxy-9(11)-seco-ergosta-7,22-dien-9-one (1), (22E)-8,14-epoxyergosta-6,22-diene-3β,5α,9α-triol (2), (22E)-4α,5α-epoxyergosta-7,22-diene-3β,6β-diol (3), (22E)-3β,4β,5α-trihydroxyergosta-7,22-dien-6-one (4), (22E)-ergosta-7,22-diene-3β,5β,6α-triol (5), and (22E)-6β-methoxyergosta-7,22-diene-3β,5α-diol 3-O-β-d-glucopyranoside (6) were isolated from the fruiting bodies of king trumpet mushroom (Pleurotus eryngii), along with fourteen known compounds (7-20). All isolated compounds were evaluated for their inhibitory effects on macrophage activation using a nitric oxide production inhibition assay. Copyright © 2016. Published by Elsevier Inc.

Three new amino acid derivatives from edible mushroom Pleurotus ostreatus.

PubMed

Lu, Xiao-Jie; Feng, Bao-Min; Chen, Shao-Fei; Zhao, Dan; Chen, Gang; Wang, Hai-Feng; Pei, Yue-Hu

2017-12-01

Three new amino acid derivatives, oxalamido-L-phenylalanine methyl ester (1), oxalamido-L-leucine methyl ester (2), and lumichrome hydrolyzate (3), together with nine known compounds (4-12), were isolated from the solid culture of edible mushroom Pleurotus ostreatus. Their structures were elucidated on the basis of extensive spectroscopic analysis. The absolute configurations of 1 and 2 were established by the chiral synthesis and confirmed by circular dichroism (CD) analysis of their total synthesis products and natural isolates. All new compounds were evaluated for their antioxidant effects, antimicrobial activities, and cytotoxic activity. Compounds 1-3 showed weak antifungal activities against Candida albicans with minimum inhibitory concentration (MIC) value of 500 μg/ml.

Medicinal and antimicrobial role of the oyster culinary-medicinal mushroom Pleurotus ostreatus (higher Basidiomycetes) cultivated on banana agrowastes in India.

PubMed

Kunjadia, Prashant D; Nagee, Anju; Pandya, Parth Y; Mukhopadhyaya, Pratap N; Sanghvi, Gaurav V; Dave, Gaurav S

2014-01-01

Oyster mushrooms, species of the genus Pleurotus, are recognized for producing secondary metabolites with important medicinal properties. Investigations were carried out to evaluate the antioxidative and antimicrobial properties of the edible mushroom Pleurotus ostreatus (MTCC142) extracts cultivated on banana agrowastes. Ethanolic extracts showed antimicrobial activities against gram-positive and gram-negative bacteria, and their in vitro antifungal activities against all fungi tested revealed a promising role. Qualitative phytochemical analysis of Pleurotus grown on yeast dextrose broth and banana agrowaste confirmed the presence of steroids, cardiac glycosides, terpenoids, and alkaloids, whereas ethanolic extract after 40 days exhibited a phenol concentration of 521.67 µg/mL in banana waste compared to 155 µg/mL in yeast dextrose broth. The minimum inhibitory concentration of ethanolic extracts ranged from 19.74 to 56.84 mg/mL and 35.53 to 102.31 mg/mL in solid-state and submerged grown mycelium extracts, respectively, after 40 days. Moreover, banana agrowaste could be a significant economic source for the production of the oyster mushroom P. ostreatus. The nutritive, medicinal, and antimicrobial properties of P. ostreatus can be used to develop a new nutraceutical formulation; it can also be used as an additive to routine and fast food.

Iron translocation in Pleurotus ostreatus basidiocarps: production, bioavailability, and antioxidant activity.

PubMed

Yokota, M E; Frison, P S; Marcante, R C; Jorge, L F; Valle, J S; Dragunski, D C; Colauto, N B; Linde, G A

2016-02-22

Translocation of minerals from substrate to mushrooms can change the medicinal characteristics, commercial value, and biological efficiency of mushroom. In the present study, we demonstrated that addition of iron to the substrate reduces the yield of Pleurotus ostreatus mushroom. The biological efficiency of the mushroom varied from 36.53% on the unsupplemented substrate to 2.08% for the substrate with 500 mg/kg iron added. The maximum iron concentration obtained for mushroom was 478.66 mg/kg (dry basis) and the maximum solubility in vitro was 293.70 mg/kg (dry basis). Iron translocation increased the ash and protein content, reduced antioxidant activity, and enhanced the aroma and flavor characteristics of the mushroom. However mushroom has higher amounts of iron than vegetables like collard greens, it is not feasible to use mushrooms as the only dietary source of iron. The study also indicated that because of more bioaccumulation of iron in mycelium than in the mushroom, mycelium and not mushroom, could be a better alternative as a non-animal iron source.

Antioxidant properties of fruiting bodies, mycelia, and fermented products of the culinary-medicinal king oyster mushroom, Pleurotus eryngii (higher Basidiomycetes), with high ergothioneine content.

PubMed

Liang, Chih-Hung; Ho, Kung-Jui; Huang, Ling-Yi; Tsai, Ching-Hsuan; Lin, Shin-Yi; Mau, Jeng-Leun

2013-01-01

The culinary-medicinal king oyster mushroom Pleurotus eryngii is known to contain ergothioneine, and its products, including fruiting bodies, mycelia, and solid-state fermented products (adlay and buckwheat), were prepared to study their antioxidant properties. Fruiting bodies, regular and Hi-Ergo mycelia, and fermented products contained 2.05, 1.68, 5.76, 0.79-0.80 mg/g of ergothioneine, respectively. On the basis of the results obtained, P. eryngii products had effective antioxidant activity, reducing power, and scavenging ability on 1,1-diphenyl-2-picrylhydrazyl radicals and chelating ability on ferrous ions. Hi-Ergo mycelia was the most effective in the first 3 antioxidant properties in addition to its ergothioneine content. In addition, fruiting bodies were more effective in all antioxidant properties than regular mycelia. For ethanolic and hot water extracts from mycelia and fruiting bodies, the correlation coefficients between total phenol contents and each antioxidant attribute were 0.483-0.921. Overall, P. eryngii products with high amounts of ergothioneine could be used beneficially as a functional food.

Bioconversion of lignocellulosic residues by Agrocybe cylindracea and Pleurotus ostreatus mushroom fungi--assessment of their effect on the final product and spent substrate properties.

PubMed

Koutrotsios, Georgios; Mountzouris, Konstantinos C; Chatzipavlidis, Iordanis; Zervakis, Georgios I

2014-10-15

Nine agro-industrial and forestry by-products were subjected to solid-state fermentation by Agrocybe cylindracea and Pleurotus ostreatus, and the process and end-products were comparatively evaluated. Grape marc waste plus cotton gin trash was the best performing medium for both fungi, while substrate composition had a marked effect on most cultivation parameters. Biological efficiency was positively correlated with nitrogen, lignin and ash, and negatively with hemicelluloses and carbohydrate content of substrates. Spent substrates demonstrated high reductions in hemicelluloses and cellulose in contrast to lignin; fibre fractions were correlated with nitrogen, fat and ash content of initial materials, while residual mycelial biomass was affected by mushroom productivity. Mushroom proximate analysis revealed significant variations of constituents depending on the substrate. Crude protein and fat were correlated with substrates nitrogen for both species. Alternative cultivation substrates of high potential are proposed, while spent material could be exploited as animal feed due to its upgraded properties. Copyright © 2014 Elsevier Ltd. All rights reserved.

Intra- and inter-isolate variation of ribosomal and protein-coding genes in Pleurotus: implications for molecular identification and phylogeny on fungal groups.

PubMed

He, Xiao-Lan; Li, Qian; Peng, Wei-Hong; Zhou, Jie; Cao, Xue-Lian; Wang, Di; Huang, Zhong-Qian; Tan, Wei; Li, Yu; Gan, Bing-Cheng

2017-06-26

The internal transcribed spacer (ITS), RNA polymerase II second largest subunit (RPB2), and elongation factor 1-alpha (EF1α) are often used in fungal taxonomy and phylogenetic analysis. As we know, an ideal molecular marker used in molecular identification and phylogenetic studies is homogeneous within species, and interspecific variation exceeds intraspecific variation. However, during our process of performing ITS, RPB2, and EF1α sequencing on the Pleurotus spp., we found that intra-isolate sequence polymorphism might be present in these genes because direct sequencing of PCR products failed in some isolates. Therefore, we detected intra- and inter-isolate variation of the three genes in Pleurotus by polymerase chain reaction amplification and cloning in this study. Results showed that intra-isolate variation of ITS was not uncommon but the polymorphic level in each isolate was relatively low in Pleurotus; intra-isolate variations of EF1α and RPB2 sequences were present in an unexpectedly high amount. The polymorphism level differed significantly between ITS, RPB2, and EF1α in the same individual, and the intra-isolate heterogeneity level of each gene varied between isolates within the same species. Intra-isolate and intraspecific variation of ITS in the tested isolates was less than interspecific variation, and intra-isolate and intraspecific variation of RPB2 was probably equal with interspecific divergence. Meanwhile, intra-isolate and intraspecific variation of EF1α could exceed interspecific divergence. These findings suggested that RPB2 and EF1α are not desirable barcoding candidates for Pleurotus. We also discussed the reason why rDNA and protein-coding genes showed variants within a single isolate in Pleurotus, but must be addressed in further research. Our study demonstrated that intra-isolate variation of ribosomal and protein-coding genes are likely widespread in fungi. This has implications for studies on fungal evolution, taxonomy

Influence of customized cooking methods on the phenolic contents and antioxidant activities of selected species of oyster mushrooms (Pleurotus spp.).

PubMed

Tan, Yee-Shin; Baskaran, Asweni; Nallathamby, Neeranjini; Chua, Kek-Heng; Kuppusamy, Umah Rani; Sabaratnam, Vikineswary

2015-05-01

Nutritional value of cooked food has been considered to be lower compared to the fresh produce. However, many reports showed that processed fruits and vegetables including mushrooms may retain antioxidant activity. Pleurotus spp. as one of the edible mushroom are in great demand globally and become one of the most popular mushrooms grown worldwide with 25-fold increase in production from 1960-2009. The effects of three different cooking methods (boiling, microwave and pressure cooking) on the antioxidant activities of six different types of oyster mushrooms (Pleurotus eryngii, P citrinopileatus, P. cystidiosus P. flabellatus, P. floridanus and P. pulmonarius) were assessed. Free radical scavenging (DPPH) and reducing power (TEAC) were used to evaluate the antioxidant activities and the total phenolic contents were determined by Folin-Ciocalteu reagent. Pressure cooking improved the scavenging abilities of P. floridanus (>200 %), P. flabellatus (117.6 %), and P. pulmonarius (49.1 %) compared to the uncooked samples. On the other hand, the microwaved Pleurotus eryngii showed 17 % higher in the TEAC value when compared to the uncooked sample. There was, however, no correlation between total phenolic content and antioxidant activities. There could be presence of other bioactive components in the processed mushrooms that may have contributed to the antioxidant activity. These results suggested that customized cooking method can be used to enhance the nutritional value of mushrooms and promote good health.

Preliminary study on antifungal effect of commercial essential oils against white rot fungi

NASA Astrophysics Data System (ADS)

Khalid, Nurul Izzaty; Baharum, Azizah; Daud, Fauzi

2015-09-01

Protecting and preserving wood plastic composite from deterioration caused by fungal attack is a high challenge issue to cater nowadays. The objective of this study was to carry out a screening test towards antifungal effect of essential oil and to investigate the potential of raw materials that will be used as basic material for manufacturing wood plastic composite against white rot fungi. Essential oils from four types of natural products comprising cinnamon, lemongrass, lavender and geranium have been screened for their ability to inhibit five types of white rot fungi species which are Lentinus squarrosulus, Pleuorotus pulmonarius, Lentinus sp., Pleuorotus sajor-caju and Lignosus rhinocerus. The antifungal evaluation showed that no inhibitory effect against tested white rot fungi since the mycelia completely filled the plates. From the observation, mycelia of L. squarrosulus, P. pulmonarius and Lentinus sp. were found to filled the surface of falcon tubes with rubber sawdust after 15 days. Mycelia of L. squarrosulus and P. pulmonarius also were found to completely covered the surface of media that contain polypropylene and maleic anhydride grafted polypropylene on it. Therefore, this report proved that the main materials that will be applicable in manufacturing of wood plastic composite had potential to be degraded by this type of fungal attack.

Economic benefit analysis of cultivating Pleurotus ostreatus with rape straw

NASA Astrophysics Data System (ADS)

Guan, Qinlan; Gong, Mingfu; Tang, Mei

2018-04-01

The cultivation of Pleurotus ostreatus with rape straw not only can save the cultivation cost of P. ostreatus, but also can reuse the resources and protect the environment. By adding different proportion of rape straw to the cultivation material of P. ostreatus, the reasonable amount of rape straw was selected and the economic benefit of P. ostreatus cultivated with the optimum amount of rape straw was analyzed. The results showed that adding 10% to 40% rape straw to the cultivation material of P. ostreatus did not affect the yield and biological conversion rate of P. ostreatus, and the ratio of production and investment of the amount of rape straw in the range of 10% to 50% was higher than of cottonseed husk alone as the main material of the formula.

Olive Mill Waste Enhances α-Glucan Content in the Edible Mushroom Pleurotus eryngii

PubMed Central

Avni, Sharon; Ezove, Nirit; Hanani, Hilla; Yadid, Itamar; Karpovsky, Michal; Hayby, Hilla; Gover, Ofer; Hadar, Yitzhak; Schwartz, Betty; Danay, Ofer

2017-01-01

Mushroom polysaccharides are edible polymers that have numerous reported biological functions; the most common effects are attributed to β-glucans. In recent years, it became apparent that the less abundant α-glucans also possess potent effects in various health conditions. Here we explore several Pleurotus species for their total, β and α-glucan content. Pleurotus eryngii was found to have the highest total glucan concentrations and the highest α-glucans proportion. We also found that the stalks (stipe) of the fruit body contained higher glucan content then the caps (pileus). Since mushrooms respond markedly to changes in environmental and growth conditions, we developed cultivation methods aiming to increase the levels of α and β-glucans. Using olive mill solid waste (OMSW) from three-phase olive mills in the cultivation substrate. We were able to enrich the levels mainly of α-glucans. Maximal total glucan concentrations were enhanced up to twice when the growth substrate contained 80% of OMSW compared to no OMSW. Taking together this study demonstrate that Pleurotus eryngii can serve as a potential rich source of glucans for nutritional and medicinal applications and that glucan content in mushroom fruiting bodies can be further enriched by applying OMSW into the cultivation substrate. PMID:28718825

Olive Mill Waste Enhances α-Glucan Content in the Edible Mushroom Pleurotus eryngii.

PubMed

Avni, Sharon; Ezove, Nirit; Hanani, Hilla; Yadid, Itamar; Karpovsky, Michal; Hayby, Hilla; Gover, Ofer; Hadar, Yitzhak; Schwartz, Betty; Danay, Ofer

2017-07-18

Mushroom polysaccharides are edible polymers that have numerous reported biological functions; the most common effects are attributed to β-glucans. In recent years, it became apparent that the less abundant α-glucans also possess potent effects in various health conditions. Here we explore several Pleurotus species for their total, β and α-glucan content. Pleurotus eryngii was found to have the highest total glucan concentrations and the highest α-glucans proportion. We also found that the stalks (stipe) of the fruit body contained higher glucan content then the caps (pileus). Since mushrooms respond markedly to changes in environmental and growth conditions, we developed cultivation methods aiming to increase the levels of α and β-glucans. Using olive mill solid waste (OMSW) from three-phase olive mills in the cultivation substrate. We were able to enrich the levels mainly of α-glucans. Maximal total glucan concentrations were enhanced up to twice when the growth substrate contained 80% of OMSW compared to no OMSW. Taking together this study demonstrate that Pleurotus eryngii can serve as a potential rich source of glucans for nutritional and medicinal applications and that glucan content in mushroom fruiting bodies can be further enriched by applying OMSW into the cultivation substrate.

Pleurotus eryngii Ameliorates Lipopolysaccharide-Induced Lung Inflammation in Mice

PubMed Central

Andoh, Tsugunobu; Ouchi, Kenji; Inatomi, Satoshi

2014-01-01

Pleurotus eryngii (P. eryngii) is consumed as a fresh cultivated mushroom worldwide and demonstrated to have multiple beneficial effects. We investigated the anti-inflammatory effect of P. eryngii in mice with acute lung injury (ALI). Intranasal instillation of lipopolysaccharide (LPS) (10 μg/site/mouse) induced marked lung inflammation (increase in the number of inflammatory cells, protein leakage, and production of nitric oxide in bronchoalveolar lavage fluid) as well as histopathological damage in the lung, 6 h after treatment. Mice administered heat-treated P. eryngii (0.3–1 g/kg, p.o. (HTPE)) 1 h before LPS challenge showed decreased pulmonary inflammation and ameliorated histopathological damage. These results suggest that HTPE has anti-inflammatory effects against ALI. Thus, P. eryngii itself may also have anti-inflammatory effects and could be a beneficial food for the prevention of ALI induced by bacterial infection. PMID:24799939

Pleurotus eryngii Ameliorates Lipopolysaccharide-Induced Lung Inflammation in Mice.

PubMed

Kawai, Junya; Andoh, Tsugunobu; Ouchi, Kenji; Inatomi, Satoshi

2014-01-01

Pleurotus eryngii (P. eryngii) is consumed as a fresh cultivated mushroom worldwide and demonstrated to have multiple beneficial effects. We investigated the anti-inflammatory effect of P. eryngii in mice with acute lung injury (ALI). Intranasal instillation of lipopolysaccharide (LPS) (10  μ g/site/mouse) induced marked lung inflammation (increase in the number of inflammatory cells, protein leakage, and production of nitric oxide in bronchoalveolar lavage fluid) as well as histopathological damage in the lung, 6 h after treatment. Mice administered heat-treated P. eryngii (0.3-1 g/kg, p.o. (HTPE)) 1 h before LPS challenge showed decreased pulmonary inflammation and ameliorated histopathological damage. These results suggest that HTPE has anti-inflammatory effects against ALI. Thus, P. eryngii itself may also have anti-inflammatory effects and could be a beneficial food for the prevention of ALI induced by bacterial infection.

Characterization and immunomodulatory effects of glucans from Pleurotus albidus, a promising species of mushroom for farming and biomass production.

PubMed

Castro-Alves, Victor Costa; Gomes, Daniel; Menolli, Nelson; Sforça, Maurício Luís; Nascimento, João Roberto Oliveira do

2017-02-01

Polysaccharides from a number of mushroom species are recognized as functional food ingredients with potential health benefits, including immunomodulatory effects. In this study, polysaccharides extracted from the basidiome with cold water (BaCW), hot water (BaHW), and hot alkali (BaHA) solution, and exo- (MyEX) and endopolysaccharides (MyEN) from the submerged culture of Pleurotus albidus, a promising species for farming and biomass production, were analyzed for their chemical composition and structure and immunomodulatory effects on macrophages. Compositional (HPAEC-PAD and HPSEC-RID/MWD) and structural (FT-IR, 1D- and 2D-NMR) analyses identified BaCW and MyEX as β-(1,6)-branched β-(1,3)-glucans, BaHW and MyEN as α-(1,3)-(1,2)-branched α-(1,6)-glucans, and BaHA as a mixture of α-(1,6)- and β-(1,3)-glucans. BaCW and MyEX stimulated the production of tumor necrosis factor alpha (TNF-α) and nitric oxide (NO), but not interleukin-6 (IL-6), and decreased phagocytosis of zymosan particles. In contrast, BaHW and MyEN induced TNF-α, NO and IL-6 production, and increased zymosan phagocytosis, while BaHA displayed intermediary effects in comparison the other polysaccharides. In conclusion, the basidiome and the submerged culture of P. albidus are sources of easily extractable α- and β-glucans with potential immunomodulatory effects. Copyright © 2016 Elsevier B.V. All rights reserved.

Production of versatile peroxidase from Pleurotus eryngii by solid-state fermentation using agricultural residues and evaluation of its catalytic properties.

PubMed

Palma, C; Lloret, L; Sepúlveda, L; Contreras, E

2016-01-01

Interest in production of ligninolytic enzymes has been growing over recent years for their use in various applications such as recalcitrant pollutants bioremediation; specifically, versatile peroxidase (VP) presents a great potential due to its catalytic versatility. The proper selection of the fermentation mode and the culture medium should be an imperative to ensure a successful production by an economic and available medium that favors the process viability. VP was produced by solid-state fermentation (SSF) of Pleurotus eryngii, using the agricultural residue banana peel as growth medium; an enzymatic activity of 10,800 U L(-1) (36 U g(-1) of substrate) was detected after 18 days, whereas only 1800 U L(-1) was reached by conventional submerged fermentation (SF) with glucose-based medium. The kinetic parameters were determined by evaluating the H2O2 and Mn(2+) concentration effects on the Mn(3+)-tartrate complex formation. The results indicated that although the H2O2 inhibitory effect was observed for the enzyme produced by both media, the reaction rates for VP obtained by SSF were less impacted. This outcome suggests the presence of substances released from banana peel during the fermentation, which might exhibit a protective effect resulting in an improved kinetic behavior of the enzyme.

Isolation of Fungal Pathogens to an Edible Mushroom, Pleurotus eryngii, and Development of Specific ITS Primers

PubMed Central

Kim, Sang-Woo; Kim, Sinil; Lee, Hyun-Jun; Park, Ju-Wan

2013-01-01

Fungal pathogens have caused severe damage to the commercial production of Pleurotus eryngii, the king oyster mushroom, by reducing production yield, causing deterioration of commercial value, and shortening shelf-life. Four strains of pathogenic fungi, including Trichoderma koningiopsis DC3, Phomopsis sp. MP4, Mucor circinelloides MP5, and Cladosporium bruhnei MP6, were isolated from the bottle culture of diseased P. eryngii. A species-specific primer set was designed for each fungus from the ITS1-5.8S rDNA-ITS2 sequences. PCR using the ITS primer set yielded a unique DNA band for each fungus without any cross-reaction, proving the validity of our method in detection of mushroom fungal pathogens. PMID:24493949

A reappraisal of the Pleurotus eryngii complex - new species and taxonomic combinations based on the application of a polyphasic approach, and an identification key to Pleurotus taxa associated with Apiaceae plants.

PubMed

Zervakis, Georgios I; Ntougias, Spyridon; Gargano, Maria Letizia; Besi, Maria I; Polemis, Elias; Typas, Milton A; Venturella, Giuseppe

2014-01-01

The Pleurotus eryngii species-complex comprises choice edible mushrooms growing on roots and lower stem residues of Apiaceae (umbellifers) plants. Material deriving from extensive sampling was studied by mating compatibility, morphological and ecological criteria, and through analysis of ITS1-5.8S-ITS2 and IGS1 rRNA sequences. Results revealed that P. eryngii sensu stricto forms a diverse and widely distributed aggregate composed of varieties elaeoselini, eryngii, ferulae, thapsiae, and tingitanus. Pleurotuseryngii subsp. tuoliensis comb. nov. is a phylogenetically sister group to the former growing only on various Ferula species in Asia. The existence of Pleurotusnebrodensis outside of Sicily (i.e., in Greece) is reported for the first time on the basis of molecular data, while P. nebrodensis subsp. fossulatus comb. nov. is a related Asiatic taxon associated with the same plant (Prangos ferulacea). Last, Pleurotusferulaginis sp. nov. grows on Ferulago campestris in northeast Italy, Slovenia and Hungary; it occupies a distinct phylogenetic position accompanied with significant differences in spore size and mating incompatibility versus other Pleurotus populations. Coevolution with umbellifers and host/substrate specificity seem to play key roles in speciation processes within this fungal group. An identification key to the nine Pleurotus taxa growing in association with Apiaceae plants is provided. Copyright © 2014 The British Mycological Society. Published by Elsevier Ltd. All rights reserved.

Toward an Increased Functionality in Oyster ( Pleurotus) Mushrooms Produced on Grape Marc or Olive Mill Wastes Serving as Sources of Bioactive Compounds.

PubMed

Koutrotsios, Georgios; Kalogeropoulos, Nick; Kaliora, Andriana C; Zervakis, Georgios I

2018-06-20

Pleurotus ostreatus, P. eryngii, and P. nebrodensis were cultivated on nonconventional substrates containing grape marc (GMC) or olive mill byproducts (OMB); wheat straw (WHS) served as control. GMC-based media demonstrated equal/better mushroom productivity than WHS for P. eryngii and P. nebrodensis, while the cultivation performance of P. eryngii was improved in OMB-based media. Both GMC and OMB substrates led to large increase of fruit-bodies content in phenolic acids, resveratrol, triterpenic compounds, and ergosterol; in particular, P. eryngii mushrooms presented significantly more total phenolics and exhibited much higher antioxidant activity (2- to 8-fold increase). Furthermore, substrates containing GMC or OMB presented up to 27% increase in mushroom β-glucans. Overall, Pleurotus species responded in a different and mostly substrate-specific manner by selectively absorbing organic compounds. Phenolics and squalene content of substrates correlated very well with mushrooms antioxidant activity and ergosterol, respectively; the same was observed for triterpenics' content of substrates and mushrooms.

Cultivation of different strains of king oyster mushroom (Pleurotus eryngii) on saw dust and rice straw in Bangladesh.

PubMed

Moonmoon, Mahbuba; Uddin, Md Nazim; Ahmed, Saleh; Shelly, Nasrat Jahan; Khan, Md Asaduzzaman

2010-10-01

Pleurotus eryngii is a popular mushroom due to its excellent consistency of cap and stem, culinary qualities and longer shelf life. In Bangladesh, where Pleurotus mushrooms are very popular, P. eryngii may take position among the consumers, but currently this mushroom is not cultivated in large scale there. In this study, 3 strains of P. eryngii such as Pe-1 (native to Bangladesh), Pe-2 (germplasm collected from China) and Pe-3 (germplasm collected from Japan) were cultivated on saw dust and rice straw and their growth and yield parameters were investigated. Pe-1 on saw dust showed the highest biological yield and efficiency (73.5%) than other strains. Also, the mycelium run rate and number of fruiting bodies were higher in Pe-1 than other two strains. The quality of mushroom strains was near about similar. On saw dust, the yield and efficiency were better than those cultivated on rice straw, however, on straw; the mushroom fruiting bodies were larger in size. This study shows the prospects of P. eryngii cultivation in Bangladesh and suggests further study in controlled environment for higher yield and production.

[Use of ITS and ISSR markers in the molecular characterisation of Pleurotus djamor hybrid strains].

PubMed

Aguilar Doroteo, Leticia; Zárate Segura, Paola Berenice; Villanueva Arce, Ramón; Yáñez Fernández, Jorge; Garín Aguilar, María Eugenia; Guadarrama Mendoza, Paula Cecilia; Valencia Del Toro, Gustavo

Molecular characterisation of wild type Pleurotus species is important for germplasm conservation and its further use for genetic improvement. No molecular studies have been performed with monokaryons used for producing hybrid strains, either with the reconstituted strains obtained by pairing those monokaryons. The molecular characterisation of parental dikaryons, hybrid, and reconstituted strains as well as monokaryotic strains, is therefore of utmost importance. To carry out the molecular identification of Pleurotus djamor strains, i.e. dikaryotic wild type strains, hybrid strains, and the monokaryotic strains used for the hybrid formation. Five wild type strains of P. djamor from different states in Mexico were collected and molecularly identified by sequencing the ITS1-5.8-ITS2 region using ITS1 and ITS4 universal oligonucleotides. Four hybrid strains were obtained by pairing neohaplonts of two wild type strains selected. Six ISSR markers were used for the molecular characterisation of monokaryotic and dikaryotic strains. Using the ITS markers, an amplified product of 700bp was obtained in five wild type strains, with a 99-100% similarity with P. djamor. A total of 95 fragments were obtained using the ISSR markers, with 99% of polymorphism. Wild type strains were identified as P. djamor, and were clearly grouped with Mexican strains from other states of Mexico. ISSR markers allowed the generation of polymorphic bands in monokaryotic and dikaryotic strains, splitting both types of strains. The high degree of polymorphism indicates the genetic diversity of P. djamor, an advantage in mushroom production and in the improving of the species. Copyright © 2017 Asociación Española de Micología. Publicado por Elsevier España, S.L.U. All rights reserved.

Rare earth elements concentration in mushroom cultivation substrates affects the production process and fruit-bodies content of Pleurotus ostreatus and Cyclocybe cylindracea.

PubMed

Koutrotsios, Georgios; Danezis, Georgios P; Georgiou, Constantinos A; Zervakis, Georgios I

2018-04-20

Concentrations of 16 rare earth elements (REEs) and two actinides were determined for the first time both in cultivated mushrooms and in their production substrates by inductively coupled plasma mass spectroscopy. Moreover, the effect of REEs on cultivation parameters and composition of the final product was assessed, together with their potential use for authentication purposes. The concentrations of REEs varied greatly among seven cultivation substrates and correlated with measurements in Cyclocybe cylindracea mushrooms; no such correlation was established in Pleurotus ostreatus. Reduction of hemicellulose, cellulose, and lignin in substrates during P. ostreatus cultivation was positively correlated with REE concentrations, which also affected the production performance depending on the species examined. In all cases, a negative correlation was established between bioconcentration factors (BCF) in mushrooms and REE content in substrates, while the effect of substrate composition on BCF values varied according to the element studied. The estimated daily intake values of REEs through mushroom consumption was at much lower levels than those reported as potentially harmful for human health. The content of REEs in cultivation substrates and in mushrooms revealed that the bioaccumulation of elements differed in each fungus. The nature/origin of substrates seemed to affect the concentration of REEs in mushrooms to a considerable extent. © 2018 Society of Chemical Industry. © 2018 Society of Chemical Industry.

Submerged Cultivation of Pleurotus sapidus with Molasses: Aroma Dilution Analyses by Means of Solid Phase Microextraction and Stir Bar Sorptive Extraction.

PubMed

Trapp, Tobias; Zajul, Martina; Ahlborn, Jenny; Stephan, Alexander; Zorn, Holger; Fraatz, Marco Alexander

2018-03-14

The basidiomycete Pleurotus sapidus (PSA) was grown in submerged cultures with molasses as substrate for the production of mycelium as a protein source for food applications. The volatilomes of the substrate, the submerged culture, and the mycelia were analyzed by gas chromatography-tandem mass spectrometry-olfactometry. For compound identification, aroma dilution analyses by means of headspace solid phase microextraction and stir bar sorptive extraction were performed via variation of the split vent flow rate. Among the most potent odorants formed by PSA were arylic compounds (e.g., p-anisaldehyde), unsaturated carbonyls (e.g., 1-octen-3-one, ( E)-2-octenal, ( E, E)-2,4-decadienal), and cyclic monoterpenoids (e.g., 3,9-epoxy- p-menth-1-ene, 3,6-dimethyl-3a,4,5,7a-tetrahydro-1-benzofuran-2(3 H)-one). Several compounds from the latter group were described for the first time in Pleurotus spp. After separation of the mycelia from the medium, the aroma compounds were mainly enriched in the culture supernatant. The sensory analysis of the mycelium correlated well with the instrumental results.

Biodegradation of ciprofloxacin by white rot fungus Pleurotus ostreatus.

PubMed

Singh, Sushil Kumar; Khajuria, Robinka; Kaur, Loveleen

2017-05-01

Unrestricted and reckless use of antibiotics has resulted in their accumulation in environment. This, in turn, has led to the emergence of multiple drug-resistant microbes. The present study focuses on degradation of ciprofloxacin (CIP) by an edible white rot fungus Pleurotus ostreatus. Effect of CIP was determined on radial growth and biomass of P. ostreatus. Titrimetric and spectrophotometric assays were carried out to assess the degrading potential of P. ostreatus towards CIP. It was found that CIP has a stimulatory effect on growth and enzyme activity of P. ostreatus. Maximum enzyme (glucanase, ligninases, laccase) production was observed at the highest concentration of CIP (500 ppm). Antibiotic degradation of about 68.8, 94.25 and 91.34% was estimated after 14 days of incubation at 500 ppm CIP using Titrimetric, Indigo carmine and Methyl orange assay, respectively. Degradation of CIP was further validated by high performance liquid chromatography (HPLC) and microbiological analysis. HPLC analysis revealed 95.07% degradation while microbiological test also exhibited a decreased antimicrobial activity of degraded products against Escherichia coli, Staphylococcus aureus and Streptococcus pyogenes. To the best of our knowledge, this is the first study wherein P. ostreatus was used for the degradation of ciprofloxacin.

Suppression of tumor growth by Pleurotus ferulae ethanol extract through induction of cell apoptosis, and inhibition of cell proliferation and migration.

PubMed

Wang, Weilan; Chen, Kaixu; Liu, Qing; Johnston, Nathan; Ma, Zhenghai; Zhang, Fuchun; Zheng, Xiufen

2014-01-01

Cancer is the second leading cause of death worldwide. Edible medicinal mushrooms have been used in traditional medicine as regimes for cancer patients. Recently anti-cancer bioactive components from some mushrooms have been isolated and their anti-cancer effects have been tested. Pleurotus ferulae, a typical edible medicinal mushroom in Xinjiang China, has also been used to treat cancer patients in folk medicine. However, little studies have been reported on the anti-cancer components of Pleurotus ferulae. This study aims to extract bioactive components from Pleurotus ferulae and to investigate the anti-cancer effects of the extracts. We used ethanol to extract anti-cancer bioactive components enriched with terpenoids from Pleurotus ferulae. We tested the anti-tumour effects of ethanol extracts on the melanoma cell line B16F10, the human gastric cancer cell line BGC 823 and the immortalized human gastric epithelial mucosa cell line GES-1 in vitro and a murine melanoma model in vivo. Cell toxicity and cell proliferation were measured by MTT assays. Cell cycle progression, apoptosis, caspase 3 activity, mitochondrial membrane potential (MMP), migration and gene expression were studied in vitro. PFEC suppressed tumor cell growth, inhibited cell proliferation, arrested cells at G0/G1 phases and was not toxic to non-cancer cells. PFEC also induced cell apoptosis and necrosis, increased caspase 3 activity, reduced the MMP, prevented cell invasion and changed the expression of genes associated with apoptosis and the cell cycle. PFEC delayed tumor formation and reduced tumor growth in vivo. In conclusion, ethanol extracted components from Pleurotus ferulae exert anti-cancer effects through direct suppression of tumor cell growth and invasion, demonstrating its therapeutic potential in cancer treatment.

Telomere Organization in the Ligninolytic Basidiomycete Pleurotus ostreatus▿ †

PubMed Central

Pérez, Gúmer; Pangilinan, Jasmyn; Pisabarro, Antonio G.; Ramírez, Lucía

2009-01-01

Telomeres are structural and functional chromosome regions that are essential for the cell cycle to proceed normally. They are, however, difficult to map genetically and to identify in genome-wide sequence programs because of their structure and repetitive nature. We studied the telomeric and subtelomeric organization in the basidiomycete Pleurotus ostreatus using a combination of molecular and bioinformatics tools that permitted us to determine 19 out of the 22 telomeres expected in this fungus. The telomeric repeating unit in P. ostreatus is TTAGGG, and the numbers of repetitions of this unit range between 25 and 150. The mapping of the telomere restriction fragments to linkage groups 6 and 7 revealed polymorphisms compatible with those observed by pulsed field gel electrophoresis separation of the corresponding chromosomes. The subtelomeric regions in Pleurotus contain genes similar to those described in other eukaryotic systems. The presence of a cluster of laccase genes in chromosome 6 and a bipartite structure containing a Het-related protein and an alcohol dehydrogenase are especially relevant; this bipartite structure is characteristic of the Pezizomycotina fungi Neurospora crassa and Aspergillus terreus. As far as we know, this is the first report describing the presence of such structures in basidiomycetes and the location of a laccase gene cluster in the subtelomeric region, where, among others, species-specific genes allowing the organism to adapt rapidly to the environment usually map. PMID:19114509

Electrochemistry Combined with LC-HRMS: Elucidating Transformation Products of the Recalcitrant Pharmaceutical Compound Carbamazepine Generated by the White-Rot Fungus Pleurotus ostreatus.

PubMed

Seiwert, Bettina; Golan-Rozen, Naama; Weidauer, Cindy; Riemenschneider, Christina; Chefetz, Benny; Hadar, Yitzhak; Reemtsma, Thorsten

2015-10-20

Transformation products (TPs) of environmental pollutants must be identified to understand biodegradation processes and reaction mechanisms and to assess the efficiency of treatment processes. The combination of oxidation by an electrochemical cell (EC) with analysis by liquid chromatography-high-resolution mass spectrometry (LC-HRMS) is a rapid approach for the determination and identification of TPs generated by natural microbial processes. Electrochemically generated TPs of the recalcitrant pharmaceutical carbamazepine (CBZ) were used for a target screening for TPs formed by the white-rot fungus Pleurotus ostreatus. EC with LC-HRMS facilitates detection and identification of TPs because the product spectrum is not superimposed with biogenic metabolites and elevated substrate concentrations can be used. A group of 10 TPs formed in the microbial process were detected by target screening for molecular ions, and another 4 were detected by screening on the basis of characteristic fragment ions. Three of these TPs have never been reported before. For CBZ, EC with LC-HRMS was found to be more effective than software tools in defining targets for the screening and faster than nontarget screening alone in TP identification. EC with LC-HRMS may be used to feed MS databases with spectra of possible TPs of larger numbers of environmental contaminants for an efficient target screening.

Bioaccumulation of Hg in the mushroom Pleurotus ostreatus

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bressa, G.; Cima, L.; Costa, P.

1988-10-01

The possibility of utilizing industrial, urban, and other wastes for the growth of a product which is directly edible by humans is fascinating. However, it is possible that many wastes containing toxic substances, for example, heavy metals, could reach the food chain and produce adverse effects on human health. To this end, we studied the possibility of bioaccumulation of Hg by a mushroom, Pleurotus ostreatus, grown on an artificial compost containing this element. Concentrations of 0.05, 0.1, and 0.2 mg/kg of Hg as Hg(NO/sub 3/)/sub 2/.H/sub 2/O were added to three groups of the same compost, successively inoculated with themore » mycelia of the mushroom. Higher concentrations strongly reduced the growth of the mycelia and therefore were not utilized. The concentrations of Hg in the substrate and in the mushroom were evaluated by AAS. The range of the accumulation factor was found to be 65-140, i.e., very marked. This finding suggests that the cultivation of P. ostreatus on substrates containing Hg from industrial and urban wastes could involve possible risks to human health.« less

Production of bio-fertilizer from microwave vacuum pyrolysis of waste palm shell for cultivation of oyster mushroom (Pleurotus ostreatus)

NASA Astrophysics Data System (ADS)

Lun Nam, Wai; Huan Su, Man; Phang, Xue Yee; Chong, Min Yee; Keey Liew, Rock; Ma, Nyuk Ling; Lam, Su Shiung

2017-11-01

Microwave vacuum pyrolysis of waste palm shell (WPS) was performed to produce biochar, which was then tested as bio-fertilizer in growing Oyster mushroom (Pleurotus ostreatus). The pyrolysis approach generated a biochar containing a highly porous structure with a high BET surface area (up to 1250 m2/g) and a low moisture content (≤ 10 wt%), exhibiting desirable adsorption properties to be used as bio-fertilizer since it can act as a housing that provides many sites on which living microorganisms (mycelium or plant-growth promoting bacteria) and organic nutrients can be attached or adsorbed onto. This could in turn stimulate plant growth by increasing the availability and supply of nutrients to the targeted host plant. The results from growing Oyster mushroom using the biochar record an impressive growth rate and a monthly production of up to about 550 g of mushroom. The shorter time for mycelium growth on whole baglog (30 days) and the highest yield of Oyster mushroom (550 g) was obtained from the cultivation medium added with 20 g of biochar. Our results demonstrate that the biochar-based bio-fertilizer produce from microwave vacuum pyrolysis of WPS show exceptional promise as an alternative growing substrate for mushroom cultivation.

Production of bio-fertilizer from microwave vacuum pyrolysis of palm kernel shell for cultivation of Oyster mushroom (Pleurotus ostreatus).

PubMed

Nam, Wai Lun; Phang, Xue Yee; Su, Man Huan; Liew, Rock Keey; Ma, Nyuk Ling; Rosli, Mohd Haqqi Nazilli Bin; Lam, Su Shiung

2018-05-15

Microwave vacuum pyrolysis of palm kernel shell (PKS) was performed to produce biochar, which was then tested as bio-fertilizer in growing Oyster mushroom (Pleurotus ostreatus). The pyrolysis approach produced biochar containing a highly porous structure with a high BET surface area of up to 270m 2 /g and low moisture content (≤10wt%), exhibiting desirable adsorption properties to be used as bio-fertilizer since it can act as a housing that provides many sites on which living microorganisms (mycelium or plant-growth promoting bacteria) and organic nutrients can be attached or adsorbed onto. This could in turn stimulate plant growth by increasing the availability and supply of nutrients to the targeted host plant. The results from growing Oyster mushroom using the biochar recorded an impressive growth rate and a monthly production of up to about 550g of mushroom. A shorter time for mycelium growth on one whole baglog (21days) and the highest yield of Oyster mushroom (550g) were obtained from cultivation medium added with 20g of biochar. Our results demonstrate that the biochar-based bio-fertilizer produced from microwave vacuum pyrolysis of PKS shows exceptional promise as growth promoting material for mushroom cultivation. Copyright © 2017 Elsevier B.V. All rights reserved.

[The composition of volatile components of cepe (Boletus edulis) and oyster mushrooms (Pleurotus ostreatus)].

PubMed

Misharina, T A; Mukhutdinova, S M; Zharikova, G G; Terenina, M B; Krikunova, N I

2009-01-01

The composition of aroma compounds in cooked and canned cepe (Boletus edulis) and in cooked oyster mushrooms (Pleurotus ostreatus) is studied using capillary gas chromatography and chromatography-mass spectrometry. It is found that unsaturated alcohols and ketones containing eight atoms of carbon determine the aroma of raw mushrooms and take part in the formation of the aroma of cooked mushrooms as well. The content of these compounds was the highest in canned cepes. In oyster mushrooms, the concentration of these alcohols and ketones was lower in comparison with cepes. The content of aliphatic and aromatic aldehydes was much higher in oyster mushrooms. Volatile aliphatic and heterocyclic Maillard reaction products and isomeric octenols and octenones formed the aroma of cooked and canned mushrooms.

The Effects of Different Substrates on the Growth, Yield, and Nutritional Composition of Two Oyster Mushrooms (Pleurotus ostreatus and Pleurotus cystidiosus).

PubMed

Hoa, Ha Thi; Wang, Chun-Li; Wang, Chong-Ho

2015-12-01

The study was conducted to compare the effects of different agro-wastes on the growth, yield, and nutritional composition of oyster mushrooms Pleurotus ostreatus (PO) and Pleurotus cystidiosus (PC). Seven substrate formulas including sawdust (SD), corncob (CC), sugarcane bagasse (SB) alone and in combination of 80 : 20, 50 : 50 ratio between SD and CC, SD and SB were investigated. The results indicated that different substrate formulas gave a significant difference in total colonization period, characteristics of fruiting bodies, yield, biological efficiency (BE), nutritional composition and mineral contents of two oyster mushrooms PO and PC. The results showed that increasing CC and SB reduced C/N ratio, and enhanced some mineral contents (Ca, P, and Mg) of substrate formulas. The increased amount of CC and SB of substrate formulas enhanced protein, ash, mineral contents (Ca, K, Mg, Mn, and Zn) of fruiting bodies of both mushrooms. Substrates with 100% CC and 100% SB were the most suitable substrate formulas for cultivation of oyster mushrooms PO and PC in which they gave the highest values of cap diameter, stipe thickness, mushroom weight, yield, BE, protein, fiber, ash, mineral content (Ca, K, and Mg) and short stipe length. However, substrate formula 100% CC gave the slowest time for the first harvest of both mushrooms PO and PC (46.02 days and 64.24 days, respectively). It is also found that the C/N ratio of substrate formulas has close correlation with total colonization period, mushroom weight, yield, BE and protein content of mushroom PO and PC.

The Effects of Different Substrates on the Growth, Yield, and Nutritional Composition of Two Oyster Mushrooms (Pleurotus ostreatus and Pleurotus cystidiosus)

PubMed Central

Hoa, Ha Thi; Wang, Chong-Ho

2015-01-01

The study was conducted to compare the effects of different agro-wastes on the growth, yield, and nutritional composition of oyster mushrooms Pleurotus ostreatus (PO) and Pleurotus cystidiosus (PC). Seven substrate formulas including sawdust (SD), corncob (CC), sugarcane bagasse (SB) alone and in combination of 80 : 20, 50 : 50 ratio between SD and CC, SD and SB were investigated. The results indicated that different substrate formulas gave a significant difference in total colonization period, characteristics of fruiting bodies, yield, biological efficiency (BE), nutritional composition and mineral contents of two oyster mushrooms PO and PC. The results showed that increasing CC and SB reduced C/N ratio, and enhanced some mineral contents (Ca, P, and Mg) of substrate formulas. The increased amount of CC and SB of substrate formulas enhanced protein, ash, mineral contents (Ca, K, Mg, Mn, and Zn) of fruiting bodies of both mushrooms. Substrates with 100% CC and 100% SB were the most suitable substrate formulas for cultivation of oyster mushrooms PO and PC in which they gave the highest values of cap diameter, stipe thickness, mushroom weight, yield, BE, protein, fiber, ash, mineral content (Ca, K, and Mg) and short stipe length. However, substrate formula 100% CC gave the slowest time for the first harvest of both mushrooms PO and PC (46.02 days and 64.24 days, respectively). It is also found that the C/N ratio of substrate formulas has close correlation with total colonization period, mushroom weight, yield, BE and protein content of mushroom PO and PC. PMID:26839502

Utilization of Cocoa Pod Husk Waste Composting by Tremella Sp and Pleurotus Sp as A Medium to Growth of Cocoa Seedling

NASA Astrophysics Data System (ADS)

Rahim, Iradhatullah; Nasruddin, A.; Kuswinanti, T.; Asrul, L.; Rasyid, B.

2018-05-01

Cocoa pod husk waste is a problem in the cocoa field, but it potentially as a source of organic matter to improve soil fertility.The paper discuss about the ability of Tremella sp and Pleurotus sp on producing phytohormone and on degrading cocoa pod husks waste. The research start with isolation, screening, and propagation of rot fungi were collected from decayed cocoa plants. The measurement of IAA is according to the method of Glickman and Dessaux (1995), by addition of L-Tryptophan 0.1 g l-1, whereas the Gibberellic Acid content was measured by using the method of Borrow et al., (1955). Composting process of cocoa pod husks waste was revealed during 40 days. This research showed that the IAA and GA3 content in compost fermented with Tremella sp was higher than treatment with Pleurotus sp. Similarly, the result was also observed in the ability of hemicellulose degradation. However, Pleurotus sp was capable to produce compost with higher nutrient levels. Compost fermented by rot fungi gave significant effect to the growth of cocoa seedlings. Nevertheless the difference in varieties of cocoa had no effect on growth of cocoa seedlings. Cocoa pod husk waste composted by Tremella sp and Pleurotus sp gave the significant effect on Leaf Area Index (LAI), Net Assimilation Rate (NAR), Crop Growth Rate (CGR), Root-shoot ratio, and root dry weight of Cocoa seedling.

Growth and production of laccases by the ligninolytic fungi, Pleurotus ostreatus and Botryosphaeria rhodina , cultured on basal medium containing the herbicide, Scepter (imazaquin).

PubMed

Rezende, Maria I; Barbosa, Aneli M; Vasconcelos, Ana-Flora D; Haddad, Renata; Dekker, Robert F H

2005-01-01

The herbicide, Scepter, whose active principle is imazaquin, is commonly used in soybean farming to combat wide-leaf weeds. The basidiomycete, Pleurotus ostreatus , and the ascomycete, Botryosphaeria rhodina , were evaluated for their growth and laccase production when cultured on basal media containing Scepter. Both fungi could grow on the herbicide when cultivated in solid and submerged liquid culture in the presence of Scepter at concentrations of 0-6% (v/v) for P. ostreatus , and up to 0-50% (v/v) for B. rhodina , and in each case produced laccases when assayed against ABTS [2,2(1)-azino-bis(3-ethylbenzthiazoline-6-sulfonic acid)] and 2,6-dimethoxyphenol. P . ostreatus could tolerate up to 6% of Scepter before it became toxic to the fungus, while in the case of B. rhodina , 50% (v/v) Scepter was the highest amount that supported grow, and laccase activity was detectable up to 25% (v/v). An inverse relationship existed between the level of Scepter in the culture medium that supported fungal growth and laccase production. Analysis of the results showed that the fungi studied presented different behaviour towards Scepter in the culture environment. ((c) 2005 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim).

Antioxidant and antibacterial activities of acetonitrile and hexane extracts of Lentinus tigrinus and Pleurotus djamour

USDA-ARS?s Scientific Manuscript database

This paper highlighted the antioxidant and antibacterial activities of Lentinus tigrinus and Pleurotus djamour. Extracts of mushroom fruiting bodies were obtained using hexane and acetonitrile solvents. Acetonitrile extracts of both mushrooms exhibited higher biological activities than hexane extrac...

Structural elucidation of polysaccharide containing 3-O-methyl galactose from fruiting bodies of Pleurotus citrinopileatus.

PubMed

He, Pengfei; Zhang, Anqiang; Zhou, Saijing; Zhang, Fuming; Linhardt, Robert J; Sun, Peilong

2016-11-03

A water-soluble polysaccharide containing 3-O-methyl galactose (PCP60W) was isolated from fruiting bodies of Pleurotus citrinopileatus and purified by anion-exchange and gel column chromatography. This polysaccharide has an average molecular weight of 2.74 × 10 4  Da and its structure was elucidated using monosaccharide composition and methylation analysis combined with one- and two-dimensional (COSY, TOCSY, NOESY, HMQC and HMBC) NMR spectroscopy. PCP60W was shown to be a linear partially 3-O-methylated α-galactopyranan comprised of 6-linked galactose, 6-linked 3-O-methyl galactose and 4-linked glucose in a ratio of 3.0:1.0:0.6. This work provides additional evidence for the view that 3-O-methyl galactose is common to the genus Pleurotus. Copyright © 2016 Elsevier Ltd. All rights reserved.

Comparative culturing of Pleurotus spp. on coffee pulp and wheat straw: biomass production and substrate biodegradation.

PubMed

Salmones, Dulce; Mata, Gerardo; Waliszewski, Krzysztof N

2005-03-01

The results of the cultivation of six strains of Pleurotus (P. djamor (2), P. ostreatus (2) and P. pulmonarius (2)) on coffee pulp and wheat straw are presented. Metabolic activity associated with biomass of each strain was determined, as well as changes in lignin and polysaccharides (cellulose and hemicellulose), phenolic and caffeine contents in substrate samples colonized for a period of up to 36 days. Analysis were made of changes during the mycelium incubation period (16 days) and throughout different stages of fructification. Greater metabolic activity was observed in the wheat straw samples, with a significant increase between 4 and 12 days of incubation. The degradation of polysaccharide compounds was associated with the fruiting stage, while the reduction in phenolic contents was detected in both substrates samples during the first eight days of incubation. A decrease was observed in caffeine content of the coffee pulp samples during fruiting stage, which could mean that some caffeine accumulates in the fruiting bodies.

Quantitative Trait Loci Controlling Vegetative Growth Rate in the Edible Basidiomycete Pleurotus ostreatus

PubMed Central

Larraya, Luis M.; Idareta, Eneko; Arana, Dani; Ritter, Enrique; Pisabarro, Antonio G.; Ramírez, Lucia

2002-01-01

Mycelium growth rate is a quantitative characteristic that exhibits continuous variation. This trait has applied interest, as growth rate is correlated with production yield and increased advantage against competitors. In this work, we studied growth rate variation in the edible basidiomycete Pleurotus ostreatus growing as monokaryotic or dikaryotic mycelium on Eger medium or on wheat straw. Our analysis resulted in identification of several genomic regions (quantitative trait loci [QTLs]) involved in the control of growth rate that can be mapped on the genetic linkage map of this fungus. In some cases monokaryotic and dikaryotic QTLs clustered at the same map position, indicating that there are principal genomic areas responsible for growth rate control. The availability of this linkage map of growth rate QTLs can help in the design of rational strain breeding programs based on genomic information. PMID:11872457

β-Glucan Synthase Gene Overexpression and β-Glucans Overproduction in Pleurotus ostreatus Using Promoter Swapping

PubMed Central

Liu, Dongren; Qi, Yuancheng; Gao, Yuqian; Shen, Jinwen; Qiu, Liyou

2013-01-01

Mushroom β-glucans are potent immunological stimulators in medicine, but their productivities are very low. In this study, we successfully improved its production by promoter engineering in Pleurotus ostreatus. The promoter for β-1,3-glucan synthase gene (GLS) was replaced by the promoter of glyceraldehyde-3-phosphate dehydrogenase gene of Aspergillus nidulans. The homologous recombination fragment for swapping GLS promoter comprised five segments, which were fused by two rounds of combined touchdown PCR and overlap extension PCR (TD-OE PCR), and was introduced into P. ostreatus through PEG/CaCl2-mediated protoplast transformation. The transformants exhibited one to three fold higher transcription of GLS gene and produced 32% to 131% higher yield of β-glucans than the wild type. The polysaccharide yields had a significant positive correlation to the GLS gene expression. The infrared spectra of the polysaccharides all displayed the typical absorption peaks of β-glucans. This is the first report of successful swapping of promoters in filamentous fungi. PMID:23637884

Selenium uptake by edible oyster mushrooms (Pleurotus sp.) from selenium-hyperaccumulated wheat straw.

PubMed

Bhatia, Poonam; Prakash, Ranjana; Prakash, N Tejo

2013-01-01

In an effort to produce selenium (Se)-fortifying edible mushrooms, five species of oyster mushroom (Pleurotus sp.), were cultivated on Se-rich wheat straw collected from a seleniferous belt of Punjab, India. Total selenium was analyzed in the selenium hyperaccumulated wheat straw and the fruiting bodies. Significantly high levels (p<0.0001) of Se uptake were observed in fruiting bodies of all mushrooms grown on Se-rich wheat straw. To the best of our knowledge, accumulation and quantification of selenium in mushrooms has hitherto not been reported with substrates naturally enriched with selenium. The results demonstrate the potential of selenium-rich agricultural residues as substrates for production of Se-enriched mushrooms and the ability of different species of oyster mushrooms to absorb and fortify selenium. The study envisages potential use of selenium-rich agricultural residues towards cultivation of Se-enriched mushrooms for application in selenium supplementation or neutraceutical preparations.

The famous cultivated mushroom Bailinggu is a separate species of the Pleurotus eryngii species complex.

PubMed

Zhao, Mengran; Zhang, Jinxia; Chen, Qiang; Wu, Xiangli; Gao, Wei; Deng, Wangqiu; Huang, Chenyang

2016-09-15

The mushroom of the genus Pleurotus in western China, called Bailinggu, is a precious edible fungus with high economic value. However, its taxonomical position is unclear. Some researchers regard it as a variety of P. eryngii, namely P. eryngii var. tuoliensis, whereas others consider it to be a subspecies of P. eryngii, viz. P. eryngii subsp. tuoliensis. A total of 51 samples representing seven genetic groups of the genus Pleurotus were subjected to a phylogenetic analysis of partial sequences of the translation elongation factor 1 alpha gene (ef1a), the RNA polymerase II largest subunit gene (rpb1), the RNA polymerase II second largest subunit gene (rpb2) and nuc rDNA internal transcribed spacers (ITS). Our data indicate that the mushroom Bailinggu is a lineage independent of P. eryngii and should be lifted as its own species, namely P. tuoliensis. In addition, its known distribution range consists of both western China and Iran.

The effect of oyster mushroom (Pleurotus ostreatus) powder as prebiotic agent on yoghurt quality

NASA Astrophysics Data System (ADS)

Tupamahu, Ivana Putri Christantia; Budiarso, Tri Yahya

2017-05-01

Mushroom has already been known as a good source of proteins, carbohydrates and some vitamins. It is then the objective of this research to find out the effect of oyster mushroom (Pleurotus ostreatus) powder addition on yoghurt fermentation. The resulting yoghurt product will be monitor by measuring its total lactic acids, acidity (pH), lactic acid bacteria (LAB) count, and the organoleptic properties, including colour, taste, flavour and texture. The mushroom were dried and grinded into powder up to 200 mashes, continued with its addition in yoghurt making process. Mushroom powder concentrations of 0%, 0.5%, 1%, and 1.5% were added on the milk to be fermented. The result showed that mushroom powder addition resulting in increase lactic acid concentration, reduced its acidity, and increased LAB viability. Based on the lactic acid counts, acidity, and LAB viability, a concentration of 1.5% powder addition is the optimal concentration for fermentation, but the product is not preferred by the panelists. The addition of 1% mushroom powder resulting in increased yoghurt quality, and the preferred yoghurt product by most of the panelists. It is then proven that the addition of mushroom powder will increase yoghurt quality and public acceptance.

Escaping introns in COI through cDNA barcoding of mushrooms: Pleurotus as a test case.

PubMed

Avin, Farhat A; Subha, Bhassu; Tan, Yee-Shin; Braukmann, Thomas W A; Vikineswary, Sabaratnam; Hebert, Paul D N

2017-09-01

DNA barcoding involves the use of one or more short, standardized DNA fragments for the rapid identification of species. A 648-bp segment near the 5' terminus of the mitochondrial cytochrome c oxidase subunit I (COI) gene has been adopted as the universal DNA barcode for members of the animal kingdom, but its utility in mushrooms is complicated by the frequent occurrence of large introns. As a consequence, ITS has been adopted as the standard DNA barcode marker for mushrooms despite several shortcomings. This study employed newly designed primers coupled with cDNA analysis to examine COI sequence diversity in six species of Pleurotus and compared these results with those for ITS. The ability of the COI gene to discriminate six species of Pleurotus , the commonly cultivated oyster mushroom, was examined by analysis of cDNA. The amplification success, sequence variation within and among species, and the ability to design effective primers was tested. We compared ITS sequences to their COI cDNA counterparts for all isolates. ITS discriminated between all six species, but some sequence results were uninterpretable, because of length variation among ITS copies. By comparison, a complete COI sequences were recovered from all but three individuals of Pleurotus giganteus where only the 5' region was obtained. The COI sequences permitted the resolution of all species when partial data was excluded for P. giganteus . Our results suggest that COI can be a useful barcode marker for mushrooms when cDNA analysis is adopted, permitting identifications in cases where ITS cannot be recovered or where it offers higher resolution when fresh tissue is. The suitability of this approach remains to be confirmed for other mushrooms.

Potential applications of the white rot fungus Pleurotus in bioregenerative life support systems

NASA Astrophysics Data System (ADS)

Manukovsky, N. S.; Kovalev, V. S.; Yu, Ch.; Gurevich, Yu. L.; Liu, H.

Earlier we demonstrated the possibility of using soil-like substrate SLS for plant cultivation in bioregenerative life support systems BLSS We suggest dividing the process of SLS bioregeneration at BLSS conditions into two stages At the first stage plant residues should be used for growing of white rot fungus Pleurotus ostreatus Pleurotus florida etc The fruit bodies could be used as food Spent mushroom compost is carried in SLS and treated by microorganisms and worms at the second stage The possibility of extension of human food ration is only one of the reasons for realization of the suggested two-stage SLS regeneration scheme people s daily consumption of mushrooms is limited to 200 -250 g of wet weight or 20 -25 g of dry weight Multiple tests showed what is more important is that inclusion of mushrooms into the system cycle scheme contributes through various mechanisms to the more stable functioning of vegetative cenosis in general Taking into account the given experimental data we determined the scheme of mushroom module material balance The technological peculiarities of mushroom cultivation at BLSS conditions are being discussed

Characterization of polysaccharides with marked inhibitory effect on lipid accumulation in Pleurotus eryngii.

PubMed

Chen, Jingjing; Yong, Yangyang; Xing, Meichun; Gu, Yifan; Zhang, Zhao; Zhang, Shizhu; Lu, Ling

2013-09-12

Mushrooms have a great potential for the production of useful bioactive metabolites. To explore the bioactive compounds from edible mushrooms for interfering with the development of macrophage-derived foam cells, which is recognized as the hallmark of early atherosclerosis, eight types of mushrooms polysaccharides had been selected to be tested. Consequently, different mushrooms polysaccharides displayed diverse component profiles. Of polysaccharides that we tested, the Pleurotus eryngii polysaccharide had the strongest inhibitory effect on lipid accumulation. Furthermore, through fractionation of DEAE-52 and Sephadex G-100, the polysaccharide from P. eryngii had been successfully purified and identified. By the analysis of IR, GC, and HPLC, the purified polysaccharide was estimated to be 30-38 kDa for the average molecular weight with the monosaccharide composition mainly composed of D-types of mannose, glucose and galactose. Findings presented in this report firstly provide direct evidence, which links the purified polysaccharide moiety with the biological function in foam-cell model. Copyright © 2013 Elsevier Ltd. All rights reserved.

Exponential growth kinetics for Polyporus versicolor and Pleurotus ostreatus in submerged culture

DOE Office of Scientific and Technical Information (OSTI.GOV)

Carroad, P.A.; Wilke, C.R.

1977-04-01

Simple mathematical models for a batch culture of pellet-forming fungi in submerged culture were tested on growth data for Polyporus versicolor (ATCC 12679) and Pleurotus ostreatus (ATCC 9415). A kinetic model based on a growth rate proportional to the two-thirds power of the cell mass was shown to be satisfactory. A model based on a growth rate directly proportional to the cell mass fitted the data equally well, however, and may be preferable because of mathematical simplicity.

Effect of Pleurotus ostreatus and Erwinia carotovora on wheat straw digestibility

DOE Office of Scientific and Technical Information (OSTI.GOV)

Streeter, C.L.; Conway, K.E.; Horn, G.W.

1981-11-01

The objectives of this study were to determine whether growing Pleurotus ostreatus and Erwinia carotovora on wheat straw would synergistically improve the digestibility of straw and whether there was a necessity of sterilizing the straw by autoclaving prior to inoculation. Dry matter decomposition of autoclaved and non-autoclaved straw was similar when both organisms were used in the system after 28 days incubation. However, in vitro ruminal dry matter digestibility of straw was significantly improved (P less than 10) only when the straw was autoclaved prior to inoculation with both organisms. (Refs. 21).

Comparative transcriptomics of Pleurotus eryngii reveals blue-light regulation of carbohydrate-active enzymes (CAZymes) expression at primordium differentiated into fruiting body stage.

PubMed

Xie, Chunliang; Gong, Wenbing; Zhu, Zuohua; Yan, Li; Hu, Zhenxiu; Peng, Yuande

2018-05-01

Blue light is an important environmental factor which could induce mushroom primordium differentiation and fruiting body development. However, the mechanisms of Pleurotus eryngii primordium differentiation and development induced by blue light are still unclear. The CAZymes (carbohydrate-active enzymes) play important roles in degradation of renewable lignocelluloses to provide carbohydrates for fungal growth, development and reproduction. In the present research, the expression profiles of genes were measured by comparison between the Pleurotus eryngii at primordium differentiated into fruiting body stage after blue light stimulation and dark using high-throughput sequencing approach. After assembly and compared to the Pleurotus eryngii reference genome, 11,343 unigenes were identified. 539 differentially expressed genes including white collar 2 type of transcription factor gene, A mating type protein gene, MAP kinase gene, oxidative phosphorylation associated genes, CAZymes genes and other metabolism related genes were identified during primordium differentiated into fruiting body stage after blue light stimulation. KEGG results showed that carbon metabolism, glycolysis/gluconeogenesis and biosynthesis of amino acids pathways were affected during blue light inducing primordia formation. Most importantly, 319 differentially expressed CAZymes participated in carbon metabolism were identified. The expression patterns of six representative CAZymes and laccase genes were further confirmed by qRT-PCR. Enzyme activity results indicated that the activities of CAZymes and laccase were affected in primordium differentiated into fruiting body under blue light stimulation. In conclusion, the comprehensive transcriptome and CAZymes of Pleurotus eryngii at primordium differentiated into fruiting body stage after blue light stimulation were obtained. The biological insights gained from this integrative system represent a valuable resource for future genomic studies on this

Pleurotus ostreatus decreases cornstalk lignin content, potentially improving its suitability for animal feed.

PubMed

Chen, Ying; Fan, Huan; Meng, Fanrui

2017-03-01

The capacity of Pleurotus ostreatus to degrade lignin was investigated in the fermentation of cornstalk. Cornstalk was incubated with P. ostreatus for 30 days, and acid-soluble and acid-insoluble lignins were assessed. The microscopic structure of cornstalk samples was studied by scanning electron microscopy (SEM), and spectroscopic characteristics were measured by X-ray diffraction (XRD), Fourier transform infrared spectroscopy (FTIR) and solid state nuclear magnetic resonance ( 13 C NMR) spectroscopy. During fermentation of cornstalk, the proportion of acid-soluble lignin did not vary significantly (P > 0.05), but that of acid-insoluble lignin decreased gradually from 17.8% on day 0 to 7.6% on day 30 (P < 0.01). SEM revealed that the surface of cornstalk was gradually damaged with cavities increasing in number and size, forming a quasi-network structure. Crystallinity decreased from 35.0 on day 0 to 15.2 on day 30. FTIR and cross-polarization magic angle spinning (CPMAS) 13 C NMR spectra showed that the intensity of the peaks corresponding to lignin, cellulose and hemicellulose also decreased gradually over 30 days. Cornstalk can be effectively degraded by P. ostreatus within 30 days. Pleurotus ostreatus decreases cornstalk lignin content, potentially improving its suitability for animal feed. © 2016 Society of Chemical Industry. © 2016 Society of Chemical Industry.

Potential of Pleurotus ostreatus Mycelium for Selenium Absorption

PubMed Central

Milovanović, Ivan; Brčeski, Ilija; Stajić, Mirjana; Korać, Aleksandra; Vukojević, Jelena; Knežević, Aleksandar

2014-01-01

The aim of this study was to evaluate the effect of high selenium (Se) concentrations on morphophysiological and ultrastructural properties of Pleurotus ostreatus. Mycelium growth was good in media enriched with 5.0, 10.0, and 20.0 mg L−1 of Se, concentration of 500.0 mg L−1 strongly inhibited growth, and 1000.0 mg L−1 was the minimum inhibitory concentration. Contrary to thin-walled, hyaline, branched, and anastomized hyphae with clamp-connections in the control, at Se concentrations of 100.0 and 500.0 mg L−1, they were noticeably short, frequently septed and branched, with a more intensive extracellular matrix, and without clamp-connections. At high Se concentrations, hyphae with intact membrane, without cellular contents, with a high level of vacuolization, and with numerous proteinaceous bodies were observed. Biomass yield ranged between 11.8 g L−1, in the control, and 6.8 g L−1, at an Se concentration of 100.0 mg L−1, while no production was detected at a concentration of 500.0 mg L−1. Se content in the mycelia reached a peak (938.9 μg g−1) after cultivation in the medium enriched with Se at the concentration of 20.0 mg L−1, while the highest absorption level (53.25%) was found in the medium enriched with 5.0 mg L−1 Se. PMID:25003145

Development of nutraceutical formulations based on the mycelium of Pleurotus ostreatus and Agaricus bisporus.

PubMed

Cardoso, Rossana V C; Fernandes, Ângela; Oliveira, M Beatriz P P; Calhelha, Ricardo C; Barros, Lillian; Martins, Anabela; Ferreira, Isabel C F R

2017-06-21

The present work is aimed at developing nutraceutical formulations based on the mycelium of Agaricus bisporus and Pleurotus ostreatus, highlighting the potential of in vitro culture as a tool to improve the production of bioactive compounds, namely phenolic acids and ergosterol. The mycelia of both species were cultured in different solid and liquid media in order to compare the growth rate and yielded biomass. Fruiting bodies, mycelia and culture media were compared regarding the antioxidant activity, anti-inflammatory effects in RAW264.7 cells and cytotoxicity in human tumor cell lines and non-tumor porcine liver cells. P. ostreatus mycelia showed higher contents of ergosterol and phenolic compounds, and stronger antioxidant activity than the corresponding fruiting body. P. ostreatus and A. bisporus did not show anti-inflammatory activity, and P. ostreatus was the only one showing cytotoxicity in tumor cell lines. The results show that these mushrooms provide compounds with antioxidant and cytotoxic capacities, with variations among species.

Identification of the nucleophile catalytic residue of GH51 α-l-arabinofuranosidase from Pleurotus ostreatus

DOE PAGES

Amore, Antonella; Iadonisi, Alfonso; Vincent, Florence; ...

2015-12-21

In this paper, the recombinant α-l-arabinofuranosidase from the fungus Pleurotus ostreatus (rPoAbf) was subjected to site-directed mutagenesis in order to identify the catalytic nucleophile residue. Based on bioinformatics and homology modelling analyses, E449 was revealed to be the potential nucleophilic residue. Thus, the mutant E449G of PoAbf was recombinantly expressed in Pichia pastoris and its recombinant expression level and reactivity were investigated in comparison to the wild-type. The design of a suitable set of hydrolysis experiments in the presence or absence of alcoholic arabinosyl acceptors and/or formate salts allowed to unambiguously identify the residue E449 as the nucleophile residue involvedmore » in the retaining mechanism of this GH51 arabinofuranosidase. 1H NMR analysis was applied for the identification of the products and the assignement of their anomeric configuration.« less

Can consumption of antioxidant rich mushrooms extend longevity?: antioxidant activity of Pleurotus spp. and its effects on Mexican fruit flies' (Anastrepha ludens) longevity.

PubMed

Sánchez, José E; Jiménez-Pérez, Gabriela; Liedo, Pablo

2015-12-01

The variability of antioxidant capacity of 14 strains of the edible oyster mushroom Pleurotus spp. was determined, and the effect of selected mushroom supplements on the longevity of the Mexican fruit fly, Anastrepha ludens, was evaluated. The antioxidant capacity of the fruiting bodies was determined by three different methods, measuring the free radical scavenging activity of methanolic extracts, the OH radical scavenging capacity, and the total phenol content. The inhibition percentage of the DPPH radical varied between 32.6 and 85.7% and total phenols varied between 30.6 and 143.3 mg/g. The strains with the highest (Pleurotus djamor ECS-0142) and lowest (Pleurotus ostreatus ECS-1123) antioxidant capacity were selected to study their effect on the survival, life expectancy, and mortality of the Mexican fruit fly A. ludens. The results demonstrated differing responses between male and female flies. High concentrations of mushrooms (5 and 20%) in the diet resulted in a decrease in life expectancy. However, flies on the diet with 1% P. djamor ECS-0142 showed slightly but significantly greater survival than those on the control diet. The possible adverse effect of protein content in mushroom extracts is discussed.

Solid-state fermentation of rapeseed meal with the white-rot fungi trametes versicolor and Pleurotus ostreatus.

PubMed

Żuchowski, Jerzy; Pecio, Łukasz; Jaszek, Magdalena; Stochmal, Anna

2013-12-01

Rapeseed meal is valuable high-protein forage, but its nutritional value is significantly reduced by the presence of a number of antinutrients, including phenolic compounds. Solid-state fermentation with white-rot fungi was used to decrease the sinapic acid concentration of rapeseed meal. After 7 days of growth of Trametes versicolor and Pleurotus ostreatus, the sinapic acid content of rapeseed meal was reduced by 59.9 and 74.5 %, respectively. At the end of the experiment, sinapic acid concentration of T. versicolor cultures decreased by 93%of the initial value; in the case of cultures of P. ostreatus, 93.2 % reduction was observed. Moreover, cultivation of white-rot fungi on rapeseed meal resulted in the intensive production of extracellular laccase, particularly strong during the late phases of growth of T. versicolor. The obtained results confirm that both fungal species may effectively be used to decompose antinutritional phenolics of rapeseed meal. Rapeseed meal may also find use as an inexpensive and efficient substrate for a biotechnological production of laccase by white-rot fungi.

Mineralization of polycyclic aromatic hydrocarbons by the white rot fungus Pleurotus ostreatus

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bezalel, L.; Hadar, Y.; Cerniglia, C.E.

White rot fungi, including Pleurotus ostreatus, have the ability to efficiently degrade lignin, a naturally occurring aromatic polymer. Previous work has found these organisms were able to degrade PAHs and in some cases to mineralize them; most of the work was done with Phanerochaete chrysosporium. P. ostreatus differs from P. chrysosporium in its lignin degradation mechanism. In this study, enzymatic activities were monitored during P. ostreatus growth in the presence of PAHs and the fungus`s ability to mineralize catechol and various PAHs was demonstrated. 29 refs., 3 figs., 1 tab.

Characterization of Pleurotus ostreatus biofilms by using the calgary biofilm device.

PubMed

Pesciaroli, Lorena; Petruccioli, Maurizio; Fedi, Stefano; Firrincieli, Andrea; Federici, Federico; D'Annibale, Alessandro

2013-10-01

The adequacy of the Calgary biofilm device, often referred to as the MBEC system, as a high-throughput approach to the production and subsequent characterization of Pleurotus ostreatus biofilms was assessed. The hydroxyapatite-coating of pegs was necessary to enable biofilm attachment, and the standardization of vegetative inocula ensured a uniform distribution of P. ostreatus biofilms, which is necessary for high-throughput evaluations of several antimicrobials and exposure conditions. Scanning electron microscopy showed surface-associated growth, the occurrence of a complex aggregated growth organized in multilayers or hyphal bundles, and the encasement of hyphae within an extracellular matrix (ECM), the extent of which increased with time. Chemical analyses showed that biofilms differed from free-floating cultures for their higher contents of total sugars (TS) and ECM, with the latter being mainly composed of TS and, to a lesser extent, protein. Confocal laser scanning microscopy analysis of 4-day-old biofilms showed the presence of interspersed interstitial voids and water channels in the mycelial network, the density and compactness of which increased after a 7-day incubation, with the novel occurrence of ECM aggregates with an α-glucan moiety. In 4- and 7-day-old biofilms, tolerance to cadmium was increased by factors of 3.2 and 11.1, respectively, compared to coeval free-floating counterparts.

Morphological and molecular characterization of yellow oyster mushroom, Pleurotus citrinopileatus, hybrids obtained by interspecies mating.

PubMed

Rosnina, A G; Tan, Yee Shin; Abdullah, Noorlidah; Vikineswary, S

2016-02-01

Pleurotus citrinopileatus (yellow oyster mushroom) has an attractive shape and yellow colour but the fragile texture complicates packaging, and its strong aroma is unappealing to consumers. This study aimed to improve the characteristics and yield of P. citrinopileatus by interspecies mating between monokaryotic cultures of P. citrinopileatus and P. pulmonarius. Ten monokaryon cultures of the parental lines were crossed in all combinations to obtain hybrids. Eleven compatible mating pairs were obtained and cultivated to observe their sporophore morphology and yield. The selected hybrid, i.e. P1xC9, was beige in colour while hybrid P3xC8 was yellow in colour. Their sporophores had less offensive aroma, improved texture and higher yield. The DNA sequences of these hybrids were found to be in the same clade as the P. citrinopileatus parent with a bootstrap value of 99%. High bootstrap values indicate high genetic homology between hybrids and the P. citrinopileatus parent. The biological efficiencies of these hybrids P1xC9 (70.97%) and P3xC8 (52.14%) were also higher than the P. citrinopileatus parent (35.63%). Interspecies hybrids obtained by this mating technique can lead to better strains of mushrooms for genetic improvement of the Pleurotus species.

High temperature enhances the ability of Trichoderma asperellum to infect Pleurotus ostreatus mycelia

PubMed Central

Qiu, Zhiheng; Wu, Xiangli; Zhang, Jinxia

2017-01-01

Trichoderma asperellum is one of the species which can be isolated from contaminated Pleurotus ostreatus cultivation substrate with green mold disease. This study focused on the relationship between high temperature and infectivity of T. asperellum to P. ostreatus. Antagonism experiments between T. asperellum and P. ostreatus mycelia revealed that high temperature-treated P. ostreatus mycelia were more easily infected by T. asperellum and covered by conidia. Microscopic observation also showed that P. ostreatus mycelia treated with high temperature could adsorb more T. asperellum conidia. Furthermore, conidia obtained from T. asperellum mycelia grown at 36°C featured higher germination rate compared with that incubated at 28°C. High temperature-treated T. asperellum mycelia can produce conidia in shorter periods, and T. asperellum mycelia were less sensitive to high temperature than P. ostreatus. Deactivated P. ostreatus mycelia can induce T. asperellum cell wall-degrading enzymes (CWDEs) and P. ostreatus mycelia subjected to high temperature showed induced CWDEs more effective than those incubated at 28°C. Moreover, T. asperellum showed higher CWDEs activity at high temperature. In dual cultures, hydrogen peroxide (H2O2) increased after 36°C, and high concentration of H2O2 could significantly inhibit the growth of P. ostreatus mycelia. In summary, our findings indicated for the first time that high temperature can induce a series of mechanisms to enhance infection abilities of T. asperellum to P. ostreatus mycelia and to cause Pleurotus green mold disease. PMID:29073211

High temperature enhances the ability of Trichoderma asperellum to infect Pleurotus ostreatus mycelia.

PubMed

Qiu, Zhiheng; Wu, Xiangli; Zhang, Jinxia; Huang, Chenyang

2017-01-01

Trichoderma asperellum is one of the species which can be isolated from contaminated Pleurotus ostreatus cultivation substrate with green mold disease. This study focused on the relationship between high temperature and infectivity of T. asperellum to P. ostreatus. Antagonism experiments between T. asperellum and P. ostreatus mycelia revealed that high temperature-treated P. ostreatus mycelia were more easily infected by T. asperellum and covered by conidia. Microscopic observation also showed that P. ostreatus mycelia treated with high temperature could adsorb more T. asperellum conidia. Furthermore, conidia obtained from T. asperellum mycelia grown at 36°C featured higher germination rate compared with that incubated at 28°C. High temperature-treated T. asperellum mycelia can produce conidia in shorter periods, and T. asperellum mycelia were less sensitive to high temperature than P. ostreatus. Deactivated P. ostreatus mycelia can induce T. asperellum cell wall-degrading enzymes (CWDEs) and P. ostreatus mycelia subjected to high temperature showed induced CWDEs more effective than those incubated at 28°C. Moreover, T. asperellum showed higher CWDEs activity at high temperature. In dual cultures, hydrogen peroxide (H2O2) increased after 36°C, and high concentration of H2O2 could significantly inhibit the growth of P. ostreatus mycelia. In summary, our findings indicated for the first time that high temperature can induce a series of mechanisms to enhance infection abilities of T. asperellum to P. ostreatus mycelia and to cause Pleurotus green mold disease.

Degradation of Green Polyethylene by Pleurotus ostreatus

PubMed Central

da Luz, José Maria Rodrigues; Paes, Sirlaine Albino; Ribeiro, Karla Veloso Gonçalves; Mendes, Igor Rodrigues; Kasuya, Maria Catarina Megumi

2015-01-01

We studied the biodegradation of green polyethylene (GP) by Pleurotus ostreatus. The GP was developed from renewable raw materials to help to reduce the emissions of greenhouse gases. However, little information regarding the biodegradation of GP discarded in the environment is available. P. ostreatus is a lignocellulolytic fungus that has been used in bioremediation processes for agroindustrial residues, pollutants, and recalcitrant compounds. Recently, we showed the potential of this fungus to degrade oxo-biodegradable polyethylene. GP plastic bags were exposed to sunlight for up to 120 days to induce the initial photodegradation of the polymers. After this period, no cracks, pits, or new functional groups in the structure of GP were observed. Fragments of these bags were used as the substrate for the growth of P. ostreatus. After 30 d of incubation, physical and chemical alterations in the structure of GP were observed. We conclude that the exposure of GP to sunlight and its subsequent incubation in the presence of P. ostreatus can decrease the half-life of GP and facilitate the mineralization of these polymers. PMID:26076188

Degradation of Green Polyethylene by Pleurotus ostreatus.

PubMed

da Luz, José Maria Rodrigues; Paes, Sirlaine Albino; Ribeiro, Karla Veloso Gonçalves; Mendes, Igor Rodrigues; Kasuya, Maria Catarina Megumi

2015-01-01

We studied the biodegradation of green polyethylene (GP) by Pleurotus ostreatus. The GP was developed from renewable raw materials to help to reduce the emissions of greenhouse gases. However, little information regarding the biodegradation of GP discarded in the environment is available. P. ostreatus is a lignocellulolytic fungus that has been used in bioremediation processes for agroindustrial residues, pollutants, and recalcitrant compounds. Recently, we showed the potential of this fungus to degrade oxo-biodegradable polyethylene. GP plastic bags were exposed to sunlight for up to 120 days to induce the initial photodegradation of the polymers. After this period, no cracks, pits, or new functional groups in the structure of GP were observed. Fragments of these bags were used as the substrate for the growth of P. ostreatus. After 30 d of incubation, physical and chemical alterations in the structure of GP were observed. We conclude that the exposure of GP to sunlight and its subsequent incubation in the presence of P. ostreatus can decrease the half-life of GP and facilitate the mineralization of these polymers.

Molecular Karyotype of the White Rot Fungus Pleurotus ostreatus

PubMed Central

Larraya, Luis M.; Pérez, Gumer; Peñas, María M.; Baars, Johan J. P.; Mikosch, Thomas S. P.; Pisabarro, Antonio G.; Ramírez, Lucía

1999-01-01

The white rot fungus Pleurotus ostreatus is an edible basidiomycete with increasing agricultural and biotechnological importance. Genetic manipulation and breeding of this organism are restricted because of the lack of knowledge about its genomic structure. In this study, we analyzed the genomic constitution of P. ostreatus by using pulsed-field gel electrophoresis optimized for the separation of its chromosomes. We have determined that it contains 11 pairs of chromosomes with sizes ranging from 1.4 to 4.7 Mbp. In addition to chromosome separation, the use of single-copy DNA probes allowed us to resolve the ambiguities caused by chromosome comigration. When the two nuclei present in the dikaryon were separated by protoplasting, analysis of their karyotypes revealed length polymorphisms affecting various chromosomes. This is, to our knowledge, the clearest chromosome separation available for this species. PMID:10427028

Carbohydrate changes during growth and fruiting in Pleurotus ostreatus.

PubMed

Zhou, Shuai; Ma, Fuying; Zhang, Xiaoyu; Zhang, Jingsong

2016-01-01

The carbohydrate distribution in mushrooms is reported changing greatly in its different regions during growth and fruiting. In this study, the carbohydrate distribution in the compost and fruiting bodies of Pleurotus ostreatus was analysed. Sugar, polyol, polysaccharide, and chitin content during different growth phases and in different regions of the mushroom were determined. Results indicate that trehalose, mannitol, and glucose were first accumulated in the compost and then decreased during differentiation and growth of fruiting bodies. Meanwhile, trehalose, mannitol, and glucose also accumulated in the fruiting bodies and primarily distributed in the stipe, base, and pileus region, respectively. Polysaccharides mainly accumulated within the pileus and stipe regions, and chitin was mainly observed in the base region. These findings provide insights into carbohydrate function and utilisation during mushroom growth. Copyright © 2016 British Mycological Society. Published by Elsevier Ltd. All rights reserved.

Disposable diapers biodegradation by the fungus Pleurotus ostreatus.

PubMed

Espinosa-Valdemar, Rosa María; Turpin-Marion, Sylvie; Delfín-Alcalá, Irma; Vázquez-Morillas, Alethia

2011-08-01

This research assesses the feasibility of degrading used disposable diapers, an important component (5-15% in weight) of urban solid waste in Mexico, by the activity of the fungus Pleurotus ostreatus, also known as oyster mushroom. Disposable diapers contain polyethylene, polypropylene and a super absorbent polymer. Nevertheless, its main component is cellulose, which degrades slowly. P. ostreatus has been utilized extensively to degrade cellulosic materials of agroindustrial sources, using in situ techniques. The practice has been extended to the commercial farming of the mushroom. This degradation capacity was assayed to reduce mass and volume of used disposable diapers. Pilot laboratory assays were performed to estimate the usefulness of the following variables on conditioning of used diapers before they act as substrate for P. ostreatus: (1) permanence vs removal of plastic cover; (2) shredding vs grinding; (3) addition of grape wastes to improve structure, nitrogen and trace elements content. Wheat straw was used as a positive control. After 68 days, decrease of the mass of diapers and productivity of fungus was measured. Weight and volume of degradable materials was reduced up to 90%. Cellulose content was diminished in 50% and lignine content in 47%. The highest efficiency for degradation of cellulosic materials corresponded to the substrates that showed highest biological efficiency, which varied from 0% to 34%. Harvested mushrooms had good appearance and protein content and were free of human disease pathogens. This research indicates that growing P. ostreatus on disposable diapers could be a good alternative for two current problems: reduction of urban solid waste and availability of high protein food sources. Copyright © 2011 Elsevier Ltd. All rights reserved.

Diversity Profile and Dynamics of Peptaibols Produced by Green Mould Trichoderma Species in Interactions with Their Hosts Agaricus bisporus and Pleurotus ostreatus.

PubMed

Marik, Tamás; Urbán, Péter; Tyagi, Chetna; Szekeres, András; Leitgeb, Balázs; Vágvölgyi, Máté; Manczinger, László; Druzhinina, Irina S; Vágvölgyi, Csaba; Kredics, László

2017-06-01

Certain Trichoderma species are causing serious losses in mushroom production worldwide. Trichoderma aggressivum and Trichoderma pleuroti are among the major causal agents of the green mould diseases affecting Agaricus bisporus and Pleurotus ostreatus, respectively. The genus Trichoderma is well-known for the production of bioactive secondary metabolites, including peptaibols, which are short, linear peptides containing unusual amino acid residues and being synthesised via non-ribosomal peptide synthetases (NRPSs). The aim of this study was to get more insight into the peptaibol production of T. aggressivum and T. pleuroti. HPLC/MS-based methods revealed the production of peptaibols closely related to hypomurocins B by T. aggressivum, while tripleurins representing a new group of 18-residue peptaibols were identified in T. pleuroti. Putative NRPS genes enabling the biosynthesis of the detected peptaibols could be found in the genomes of both Trichoderma species. In vitro experiments revealed that peptaibols are potential growth inhibitors of mushroom mycelia, and that the host mushrooms may have an influence on the peptaibol profiles of green mould agents. © 2017 Wiley-VHCA AG, Zurich, Switzerland.

Growth of Pleurotus ostreatus on wheat straw and wheat-grain-based media: Biochemical aspects and preparation of mushroom inoculum.

PubMed

Sainos, E; Díaz-Godínez, G; Loera, O; Montiel-González, A M; Sánchez, C

2006-10-01

Mycelial growth, intracellular activity of proteases, laccases and beta-1,3-glucanases, and cytoplasmic protein were evaluated in the vegetative phase of Pleurotus ostreatus grown on wheat straw and in wheat-grain-based media in Petri dishes and in bottles. The productivity of the wheat straw and wheat-grain-based spawn in cylindrical polyethylene bags containing 5 kg of chopped straw was also determined. We observed high activity of proteases and high content of intracellular protein in cultures grown on wheat straw. This suggests that the proteases are not secreted into the medium and that the protein is an important cellular reserve. On the contrary, cultures grown on wheat straw secreted laccases into the medium, which could be induced by this substrate. P. ostreatus grown on media prepared with a combination of wheat straw and wheat grain showed a high radial growth rate in Petri dishes and a high level of mycelial growth in bottles. The productivities of wheat straw and wheat-grain-based spawn were similar. Our results show that cheaper and more productive mushroom spawn can be prepared by developing the mycelium on wheat straw and wheat-grain-based substrates.

Characterization of Pleurotus ostreatus Biofilms by Using the Calgary Biofilm Device

PubMed Central

Pesciaroli, Lorena; Petruccioli, Maurizio; Fedi, Stefano; Firrincieli, Andrea; Federici, Federico

2013-01-01

The adequacy of the Calgary biofilm device, often referred to as the MBEC system, as a high-throughput approach to the production and subsequent characterization of Pleurotus ostreatus biofilms was assessed. The hydroxyapatite-coating of pegs was necessary to enable biofilm attachment, and the standardization of vegetative inocula ensured a uniform distribution of P. ostreatus biofilms, which is necessary for high-throughput evaluations of several antimicrobials and exposure conditions. Scanning electron microscopy showed surface-associated growth, the occurrence of a complex aggregated growth organized in multilayers or hyphal bundles, and the encasement of hyphae within an extracellular matrix (ECM), the extent of which increased with time. Chemical analyses showed that biofilms differed from free-floating cultures for their higher contents of total sugars (TS) and ECM, with the latter being mainly composed of TS and, to a lesser extent, protein. Confocal laser scanning microscopy analysis of 4-day-old biofilms showed the presence of interspersed interstitial voids and water channels in the mycelial network, the density and compactness of which increased after a 7-day incubation, with the novel occurrence of ECM aggregates with an α-glucan moiety. In 4- and 7-day-old biofilms, tolerance to cadmium was increased by factors of 3.2 and 11.1, respectively, compared to coeval free-floating counterparts. PMID:23892744

Stable transformation of Pleurotus ostreatus to hygromycin B resistance using Lentinus edodes GPD expression signals.

PubMed

Irie, T; Honda, Y; Hirano, T; Sato, T; Enei, H; Watanabe, T; Kuwahara, M

2001-09-01

It was reported that Pleurotus ostreatus was transformed unstably using recombinant plasmids containing a hygromycin B phosphotransferase gene (hph) under the control of Aspergillus nidulans expression signals, and that the plasmids were maintained extrachromosomally in the transformants. Here we report a stable and integrative transformation of the fungus to hygromycin B resistance, using a recombinant hph fused with Lentinus edodes glyceraldehyde-3-phosphate dehydrogenase expression signals. Restriction-enzyme-mediated integration (REMI) was also tried and increased the transformation efficiency about ten-fold.

Fungal biodegradation of lignopolystyrene graft copolymers. [Pleurotus ostreatus; Phanerochaete chrysosporium; Trametes versicolor; Gloeophyllum trabeum

DOE Office of Scientific and Technical Information (OSTI.GOV)

Milstein, O.; Gersonde, R.; Huttermann, A.

1992-10-01

White rot basidiomycetes were able to biodegrade styrene (1-phenylethene) graft copolymers of lignin containing different proportions of lignin and polystyrene (poly(1-phenylethylene)). The biodegradation tests were run on lignin-styrene copolymerization products which contained 10.3, 32.2, and 50.4{percent} (wt/wt) lignin. The polymer samples were incubated with the white rot fungi Pleurotus ostreatus, Phanerochaete chrysosporium, and Trametes versicolor and the brown rot fungus Gloeophyllum trabeum. White rot fungi degraded the plastic samples at a rate which increased with increasing lignin content in the copolymer sample. Both polystyrene and lignin components of the copolymer were readily degraded. Polystyrene pellets were not degradable in thesemore » tests. Degradation was verified for both incubated and control samples by weight loss, quantitative UV spectrophotometric analysis of both lignin and styrene residues, scanning electron microscopy of the plastic surface, and the presence of enzymes active in degradation during incubation. Brown rot fungus did not affect any of the plastics. White rot fungi produced and secreted oxidative enzymes associated with lignin degradation in liquid media during incubation with lignin-polystyrene copolymer.« less

Effect of Protocatechuic Acid-Grafted-Chitosan Coating on the Postharvest Quality of Pleurotus eryngii.

PubMed

Liu, Jun; Meng, Chen-Guang; Wang, Xing-Chi; Chen, Yao; Kan, Juan; Jin, Chang-Hai

2016-09-28

Protocatechuic acid-grafted-chitosan (PA-g-CS) solution with antioxidant activity was developed as a novel edible coating material for Pleurotus eryngii postharvest storage. The effect of PA-g-CS coating on the postharvest quality of P. eryngii was investigated by determination of various physicochemical parameters and enzyme activities. Results showed that the antioxidant capacity and viscosity of PA-g-CS solutions were closely related to the grafting degree and were much higher than that of chitosan (CS) solution. At the end of 15 days of storage, serious mushroom browning was observed in the control and CS coating groups. By contrast, PA-g-CS coating groups with medium and high grafting degrees maintained better physical appearance. Among all of the treatment groups, P. eryngii in PA-g-CS III coating group exhibited the highest firmness and the lowest weight loss, browning degree, respiration rate, malondialdehyde content, electrolyte leakage rate, superoxide anion production rate, and hydrogen peroxide content. Moreover, P. eryngii in PA-g-CS III coating group maintained relatively higher antioxidant enzyme activities but lower polyphenol oxidase activity than other treatment groups. Therefore, PA-g-CS III is a promising preservation agent for P. eryngii.

Evaluation of Antioxidant, Anti-cholinesterase, and Anti-inflammatory Effects of Culinary Mushroom Pleurotus pulmonarius.

PubMed

Nguyen, Trung Kien; Im, Kyung Hoan; Choi, Jaehyuk; Shin, Pyung Gyun; Lee, Tae Soo

2016-12-01

Culinary mushroom Pleurotus pulmonarius has been popular in Asian countries. In this study, the anti-oxidant, cholinesterase, and inflammation inhibitory activities of methanol extract (ME) of fruiting bodies of P. pulmonarius were evaluted. The 1,1-diphenyl-2-picryl-hydrazy free radical scavenging activity of ME at 2.0 mg/mL was comparable to that of butylated hydroxytoluene, the standard reference. The ME exhibited significantly higher hydroxyl radical scavenging activity than butylated hydroxytoluene. ME showed slightly lower but moderate inhibitory activity against acetylcholinesterase (AChE) and butyrylcholinesterase than galantamine, a standard AChE inhibitor. It also exhibited protective effect against cytotoxicity to PC-12 cells induced by glutamate (10~100 µg/mL), inhibitory effect on nitric oxide (NO) production and inducible nitric oxide synthase protein expression in lipopolysaccharide-stimulated RAW 264.7 macrophages, and carrageenan-induced paw edema in a rat model. High-performance liquid chromatography analysis revealed the ME of P. pulmonarius contained at least 10 phenolic compounds and some of them were identified by the comparison with known standard phenolics. Taken together, our results demonstrate that fruiting bodies of P. pulmonarius possess antioxidant, anti-cholinesterase, and inflammation inhibitory activities.

Evaluation of Antioxidant, Anti-cholinesterase, and Anti-inflammatory Effects of Culinary Mushroom Pleurotus pulmonarius

PubMed Central

Nguyen, Trung Kien; Im, Kyung Hoan; Choi, Jaehyuk; Shin, Pyung Gyun

2016-01-01

Culinary mushroom Pleurotus pulmonarius has been popular in Asian countries. In this study, the anti-oxidant, cholinesterase, and inflammation inhibitory activities of methanol extract (ME) of fruiting bodies of P. pulmonarius were evaluted. The 1,1-diphenyl-2-picryl-hydrazy free radical scavenging activity of ME at 2.0 mg/mL was comparable to that of butylated hydroxytoluene, the standard reference. The ME exhibited significantly higher hydroxyl radical scavenging activity than butylated hydroxytoluene. ME showed slightly lower but moderate inhibitory activity against acetylcholinesterase (AChE) and butyrylcholinesterase than galantamine, a standard AChE inhibitor. It also exhibited protective effect against cytotoxicity to PC-12 cells induced by glutamate (10~100 µg/mL), inhibitory effect on nitric oxide (NO) production and inducible nitric oxide synthase protein expression in lipopolysaccharide-stimulated RAW 264.7 macrophages, and carrageenan-induced paw edema in a rat model. High-performance liquid chromatography analysis revealed the ME of P. pulmonarius contained at least 10 phenolic compounds and some of them were identified by the comparison with known standard phenolics. Taken together, our results demonstrate that fruiting bodies of P. pulmonarius possess antioxidant, anti-cholinesterase, and inflammation inhibitory activities. PMID:28154487

Establishment of an efficient transformation system for Pleurotus ostreatus.

PubMed

Lei, Min; Wu, Xiangli; Zhang, Jinxia; Wang, Hexiang; Huang, Chenyang

2017-11-21

Pleurotus ostreatus is widely cultivated worldwide, but the lack of an efficient transformation system regarding its use restricts its genetic research. The present study developed an improved and efficient Agrobacterium tumefaciens-mediated transformation method in P. ostreatus. Four parameters were optimized to obtain the most efficient transformation method. The strain LBA4404 was the most suitable for the transformation of P. ostreatus. A bacteria-to-protoplast ratio of 100:1, an acetosyringone (AS) concentration of 0.1 mM, and 18 h of co-culture showed the best transformation efficiency. The hygromycin B phosphotransferase gene (HPH) was used as the selective marker, and EGFP was used as the reporter gene in this study. Southern blot analysis combined with EGFP fluorescence assay showed positive results, and mitotic stability assay showed that more than 75% transformants were stable after five generations. These results showed that our transformation method is effective and stable and may facilitate future genetic studies in P. ostreatus.

Chemical characterization of Pleurotus eryngii polysaccharide and its tumor-inhibitory effects against human hepatoblastoma HepG-2 cells.

PubMed

Ren, Daoyuan; Wang, Ning; Guo, Jianjun; Yuan, Li; Yang, Xingbin

2016-03-15

This study was designed to investigate the chemical characterization and antitumor effects of Pleurotus eryngii polysaccharides (PEP). The crude PEP was fractionated into two fractions, namely PEP-1 and PEP-2. HPLC analysis showed that PEP-1 and PEP-2 were heteropolysaccharides mainly composed of glucose with the average molecular weights of 2.54×10(4)Da (PEP-1) and 4.63×10(5)Da (PEP-2), respectively. High molecular mass PEP-2 was shown to exhibit stronger growth inhibition against human hepatoblastoma HepG-2 cells in comparison with PEP-1. Flow cytometric analysis showed that PEP-2 exerted a stimulatory effect on apoptosis of HepG-2 cells, and induced the cell-cycle arrest at the S-phase, with the observation of intracellular ROS production. These findings suggest that the polysaccharides, especially PEP-2, are very important nutritional ingredients responsible for the anticancer health benefits of P. eryngii. Copyright © 2015 Elsevier Ltd. All rights reserved.

Electron and Fluorescence Microscopy of Extracellular Glucan and Aryl-Alcohol Oxidase during Wheat-Straw Degradation by Pleurotus eryngii

PubMed Central

Barrasa, J. M.; Gutiérrez, A.; Escaso, V.; Guillén, F.; Martínez, M. J.; Martínez, A. T.

1998-01-01

The ligninolytic fungus Pleurotus eryngii grown in liquid medium secreted extracellular polysaccharide (87% glucose) and the H2O2-producing enzyme aryl-alcohol oxidase (AAO). The production of both was stimulated by wheat-straw. Polyclonal antibodies against purified AAO were obtained, and a complex of glucanase and colloidal gold was prepared. With these tools, the localization of AAO and extracellular glucan in mycelium from liquid medium and straw degraded under solid-state fermentation conditions was investigated by transmission electron microscopy (TEM) and fluorescence microscopy. These studies revealed that P. eryngii produces a hyphal sheath consisting of a thin glucan layer. This sheath appeared to be involved in both mycelial adhesion to the straw cell wall during degradation and AAO immobilization on hyphal surfaces, with the latter evidenced by double labeling. AAO distribution during differential degradation of straw tissues was observed by immunofluorescence microscopy. Finally, TEM immunogold studies confirmed that AAO penetrates the plant cell wall during P. eryngii degradation of wheat straw. PMID:9435085

Bioactive compounds and antioxidant activity exhibit high intraspecific variability in Pleurotus ostreatus mushrooms and correlate well with cultivation performance parameters.

PubMed

Koutrotsios, Georgios; Kalogeropoulos, Nick; Stathopoulos, Pantelis; Kaliora, Andriana C; Zervakis, Georgios I

2017-05-01

Experimental data related with oyster mushroom production and nutritional properties usually derive from the examination of only one strain, and hence their representativeness/usefulness is questionable. This work aims at assessing intraspecific variability in Pleurotus ostreatus by studying 16 strains, under the same conditions, in respect to essential cultivation and mushroom quality aspects, and by defining the impact of intrinsic/genetic factors on such parameters. Hence, mushroom yield, earliness, crop length, biological efficiency, productivity, and their content in selected macro and microconstituents (e.g. fatty acids, sterols, individual phenolic compounds, terpenic acids, glucans) as well as their antioxidant properties (i.e., antiradical activity, ferric reducing potential, inhibition of serum oxidation) were assayed. The effect of intrinsic/genetic factors was evident, especially as regards earliness, yield of each production flush and mushroom weight, whereas biological efficiency was not particularly influenced by the cultivated strain. Moreover, phenolics, ergosterol and antiradical activity demonstrated significant variability among strains in contrast to what was observed for fatty acids, β-glucans and ferric reducing potential. The observed heterogeneity reveals the limitations of using a low number of strains for evaluating mushroom production and/or their content in bioactive compounds, and as evidenced, it is valuable for breeding and commercial purposes.

Pleurotus giganteus (Berk. Karun & Hyde), the giant oyster mushroom inhibits NO production in LPS/H2O2 stimulated RAW 264.7 cells via STAT 3 and COX-2 pathways.

PubMed

Baskaran, Asweni; Chua, Kek Heng; Sabaratnam, Vikineswary; Ravishankar Ram, Mani; Kuppusamy, Umah Rani

2017-01-13

Pleurotus giganteus (Berk. Karunarathna and K.D. Hyde), has been used as a culinary mushroom and is known to have medicinal properties but its potential as an anti-inflammatory agent to mitigate inflammation triggered diseases is untapped. In this study, the molecular mechanism underlying the protective effect of ethanol extract of P. giganteus (EPG) against lipopolysaccharide (LPS) and combination of LPS and hydrogen peroxide (H 2 O 2 )-induced inflammation on RAW 264.7 macrophages was investigated. The effect of EPG on nitric oxide (NO) production as an indicator of inflammation in RAW 264.7 macrophages was estimated based on Griess reaction that measures nitrite level. The expressions of inducible nitric oxide synthase (iNOS), cyclooxygenase-2 (COX-2), NF-kB activating protein (NKAP), signal transducer and activator of transcription 3 protein (STAT 3) and glutathione peroxidase (GPx) genes were assessed using real time reverse transcription polymerase chain reaction (RT-PCR) approach. EPG (10 μg/ml) showed the highest reduction in the LPS-induced NO production in RAW 264.7 macrophages and significantly suppressed (p < 0.05) the expression iNOS, STAT 3 and COX-2. There was a significant increase (p < 0.05) in combination of LPS and H 2 O 2 - induced iNOS production when compared to the LPS-induced iNOS production in RAW 264.7 macrophages and this concurred with the NO production which was attenuated by EPG at 10 μg/ml. A significant (p < 0.05) down regulation was observed in the combination of LPS and H 2 O 2 -induced iNOS and GPx expression by EPG. Our data suggest that the anti-inflammatory activity of EPG is mediated via the suppression of the STAT 3 and COX-2 pathways and can serve as potential endogenous antioxidant stimulant.

Anticancer and Immunopotentiating Activities of Crude Polysaccharides from Pleurotus nebrodensis on Mouse Sarcoma 180.

PubMed

Cha, Youn Jeong; Alam, Nuhu; Lee, Jae Seong; Lee, Kyung Rim; Shim, Mi Ja; Lee, Min Woong; Kim, Hye Young; Shin, Pyung Gyun; Cheong, Jong Chun; Yoo, Young Bok; Lee, Tae Soo

2012-12-01

Pleurotus nebrodensis is an edible and commercially available mushroom in Korea. This study was conducted in order to evaluate the anticancer and immunopotentiating activities of crude polysaccharides, extracted in methanol, neutral saline, and hot water (hereafter referred to as Fr. MeOH, Fr. NaCl, and Fr. HW, respectively) from the fruiting bodies of P. nebrodensis. β-Glucan and protein contents in Fr. MeOH, Fr. NaCl, and Fr. HW extracts of P. nebrodensis ranged from 23.79~36.63 g/100 g and 4.45~6.12 g/100 g, respectively. Crude polysaccharides were not cytotoxic against sarcoma 180, HT-29, NIH3T3, and RAW 264.7 cell lines at a range of 10~2,000 µg/mL. Intraperitoneal injection with crude polysaccharides resulted in a life prolongation effect of 11.76~27.06% in mice previously inoculated with sarcoma 180. Treatment with Fr. NaCl resulted in an increase in the numbers of spleen cells by 1.49 fold at the concentration of 50 µg/mL, compared with control. Fr. HW improved the immuno-potentiating activity of B lymphocytes through an increase in alkaline phosphatase activity by 1.65 fold, compared with control at 200 µg/mL. Maximum production of nitric oxide (14.3 µM) was recorded in the Fr. NaCl fraction at 200 µg/mL. Production of tumor necrosis factor-α (TNF-α), interleukin-1β (IL-1β), and interleukin-6 (IL-6) was significantly higher, compared to control, and IL-6 production was highest, in contrast to TNF-α, IL-1β, and positive control, concanavalin at the tested concentration of the various fractions. Results of the current study suggest that polysaccharides extracted from P. nebrodensis have a strong anticancer effect and may be useful as an ingredient of biopharmaceutical products for treatment of cancer.

Influence of xylem ray integrity and degree of polymerization on bending strength of beech wood decayed by Pleurotus ostreatus and Trametes versicolor

Treesearch

Ehsan Bari; Reza Oladi; Olaf Schmidt; Carol A. Clausen; Katie Ohno; Darrel D. Nicholas; Mehrdad Ghodskhah Daryaei; Maryam Karim

2015-01-01

The scope of this research was to evaluate the influence of xylem ray (XR) and degree of polymerization (DP) of holocellulose in Oriental beech wood (Fagus orientalis Lipsky.) on impact bending strength against two white-rot fungi. Beech wood specimens, exposed to Pleurotus ostreatus and Trametes versicolor, were evaluated for...

Heterologous expression of the Pleurotus ostreatus MnP3 gene by the laccase gene promoter in Lentinula edodes.

PubMed

Sato, Toshitsugu; Irie, Toshikazu; Yoshino, Fumihiko

2017-08-01

Lentinula edodes (shiitake), which have a powerful ligninolytic system, is one of the most important edible mushrooms in Asia. In this study, we introduced the manganese peroxidase (MnP, EC 1.11.1.13) gene from Pleurotus ostreatus driven by L. edodes laccase 1 gene promoter into L. edodes for expression. The resulting transformant expressed the recombinant gene and showed a higher level of MnP activity than that of the wild-type strain.

Morphology and mycelial growth rate of Pleurotus spp. strains from the Mexican mixtec region

PubMed Central

Guadarrama-Mendoza, P.C.; del Toro, G. Valencia; Ramírez-Carrillo, R.; Robles-Martínez, F.; Yáñez-Fernández, J.; Garín-Aguilar, M.E.; Hernández, C.G.; Bravo-Villa, G.

2014-01-01

Two native Pleurotus spp. strains (white LB-050 and pale pink LB-051) were isolated from rotten tree trunks of cazahuate (Ipomoea murucoides) from the Mexican Mixtec Region. Both strains were chemically dedikaryotized to obtain their symmetrical monokaryotic components (neohaplonts). This was achieved employing homogenization time periods from 60 to 65 s, and 3 day incubation at 28 °C in a peptone-glucose solution (PGS). Pairing of compatible neohaplonts resulted in 56 hybrid strains which were classified into the four following hybrid types: (R1-nxB1-n, R1-nxB2-1, R2-nxB1-n and R2-nxB2-1). The mycelial growth of Pleurotus spp. monokaryotic and dikaryotic strains showed differences in texture (cottony or floccose), growth (scarce, regular or abundant), density (high, regular or low), and pigmentation (off-white, white or pale pink). To determine the rate and the amount of mycelium growth in malt extract agar at 28 °C, the diameter of the colony was measured every 24 h until the Petri dish was completely colonized. A linear model had the best fit to the mycelial growth kinetics. A direct relationship between mycelial morphology and growth rate was observed. Cottony mycelium presented significantly higher growth rates (p < 0.01) in comparison with floccose mycelium. Thus, mycelial morphology can be used as criterion to select which pairs must be used for optimizing compatible-mating studies. Hybrids resulting from cottony neohaplonts maintained the characteristically high growth rates of their parental strains with the hybrid R1-nxB1-n being faster than the latter. PMID:25477920

Construction of a genetic linkage map and analysis of quantitative trait loci associated with the agronomically important traits of Pleurotus eryngii

Treesearch

Chak Han Im; Young-Hoon Park; Kenneth E. Hammel; Bokyung Park; Soon Wook Kwon; Hojin Ryu; Jae-San Ryu

2016-01-01

Breeding new strains with improved traits is a long-standing goal of mushroom breeders that can be expedited by marker-assisted selection (MAS). We constructed a genetic linkage map of Pleurotus eryngii based on segregation analysis of markers in postmeiotic monokaryons from KNR2312. In total, 256 loci comprising 226 simple sequence-repeat (SSR) markers, 2 mating-type...

Laccase production by the aquatic ascomycete Phoma sp. UHH 5-1-03 and the white rot basidiomycete Pleurotus ostreatus DSM 1833 during submerged cultivation on banana peels and enzyme applicability for the removal of endocrine-disrupting chemicals.

PubMed

Libardi, Nelson; Gern, Regina Maria Miranda; Furlan, Sandra Aparecida; Schlosser, Dietmar

2012-07-01

This work aimed to study the production of laccase from Pleurotus ostreatus DSM 1833 and Phoma sp. UHH 5-1-03 using banana peels as alternative carbon source, the subsequent partial purification and characterization of the enzyme, as well the applicability to degrade endocrine disruptors. The laccase stability with pH and temperature, the optimum pH, the K (m) and V(max) parameters, and the molar mass were determined. Tests were conducted for assessing the ability of degradation of the endocrine disruptors t-nonylphenol, bisphenol A, and 17α-ethinylestradiol. Laccase production of 752 and 1,117 U L⁻¹ was obtained for Phoma sp. and P. ostreatus, respectively. Phoma sp. laccase showed higher stability with temperature and pH. The laccase from both species showed higher affinity by syringaldazine. The culture broth with banana peels induced the production of two isoforms of P. ostreatus (58.7 and 21 kDa) and one of Phoma sp. laccase (72 kDa). In the first day of incubation, the concentrations of bisphenol A and 17α-ethinylestradiol were reduced to values close to zero and after 3 days the concentration of t-nonylphenol was reduced in 90% by the P. ostreatus laccase, but there was no reduction in its concentration by the Phoma sp. laccase.

Biological activities of the polysaccharides produced in submerged culture of two edible Pleurotus ostreatus mushrooms.

PubMed

Vamanu, Emanuel

2012-01-01

Exopolysaccharides (EPS) and internal (intracellular) polysaccharides (IPS) obtained from the Pleurotus ostreatus M2191 and PBS281009 cultivated using the batch system revealed an average of between 0.1-2 (EPS) and 0.07-1.5 g/L/day (IPS). The carbohydrate analysis revealed that the polysaccharides comprised 87-89% EPS and 68-74% IPS. The investigation of antioxidant activity in vitro revealed a good antioxidant potential, particularly for the IPS and EPS isolated from PBS281009, as proved by the EC(50) value for DPPH, ABTS scavenging activity, reducing power, and iron chelating activity.

Separation of active laccases from Pleurotus sapidus culture supernatant using aqueous two-phase systems in centrifugal partition chromatography.

PubMed

Schwienheer, C; Prinz, A; Zeiner, T; Merz, J

2015-10-01

For the production of bio active compounds, e.g., active enzymes or antibodies, a conserved purification process with a minimum loss of active compounds is necessary. In centrifugal partition chromatography (CPC), the separation effect is based on the different distribution of the components to be separated between two immiscible liquid phases. Thereby, one liquid phase is kept stationary in chambers by a centrifugal field and the mobile phase is pumped through via connecting ducts. Aqueous two phase systems (ATPS) are known to provide benign conditions for biochemical products and seem to be promising when used in CPC for purification tasks. However, it is not known if active biochemical compounds can "survive" the conditions in a CPC where strong shear forces can occur due to the two-phasic flow under centrifugal forces. Therefore, this aspect has been faced within this study by the separation of active laccases from a fermentation broth of Pleurotus sapidus. After selecting a suitable ATPS and operating conditions, the activity yield was calculated and the preservation of the active enzymes could be observed. Therefore, CPC could be shown as potentially suitable for the purification of bio-active compounds. Copyright © 2015 Elsevier B.V. All rights reserved.

Abiotic and biotic degradation of oxo-biodegradable plastic bags by Pleurotus ostreatus.

PubMed

da Luz, José Maria Rodrigues; Paes, Sirlaine Albino; Bazzolli, Denise Mara Soares; Tótola, Marcos Rogério; Demuner, Antônio Jacinto; Kasuya, Maria Catarina Megumi

2014-01-01

In this study, we evaluated the growth of Pleurotus ostreatus PLO6 using oxo-biodegradable plastics as a carbon and energy source. Oxo-biodegradable polymers contain pro-oxidants that accelerate their physical and biological degradation. These polymers were developed to decrease the accumulation of plastic waste in landfills. To study the degradation of the plastic polymers, oxo-biodegradable plastic bags were exposed to sunlight for up to 120 days, and fragments of these bags were used as substrates for P. ostreatus. We observed that physical treatment alone was not sufficient to initiate degradation. Instead, mechanical modifications and reduced titanium oxide (TiO2) concentrations caused by sunlight exposure triggered microbial degradation. The low specificity of lignocellulolytic enzymes and presence of endomycotic nitrogen-fixing microorganisms were also contributing factors in this process.

Antioxidant Potential of White Oyster Culinary-Medicinal Mushroom, Pleurotus florida (Higher Basidiomycetes).

PubMed

Ganeshpurkar, Aditya; Pardhi, Priya; Bhadoriya, Santosh Singh; Jain, Nikhil; Rai, Gopal; Jain, Alok Pal

2015-01-01

The present work was focused to evaluate in vitro antioxidant of Pleurotus florida. The hydroethanolic extract was prepared by macerating basidiocarp with water:ethanol (1:1). The antioxidant potential was evaluated by 1,1-diphenyl-2-picryl-hydrazyl (DPPH) radical scavenging activity, reducing power, chelating effects on ferrous ions, total antioxidant capacity, and lipid peroxidation inhibitory activity. Further total flavonoid and phenolic content was also estimated. The comparison between different antioxidant assays was done by correlation coefficient. The results from the antioxidant assays showed that hydroethanolic extract (HEE) might act as radical scavenger to a certain extent. The distinct scavenging activities of HEE can be due to the diverse phytochemical constituents. Being a rich source of antioxidants, P. florida can be used as an accessible source of natural antioxidants with consequential health benefits.

Abiotic and Biotic Degradation of Oxo-Biodegradable Plastic Bags by Pleurotus ostreatus

PubMed Central

da Luz, José Maria Rodrigues; Paes, Sirlaine Albino; Bazzolli, Denise Mara Soares; Tótola, Marcos Rogério; Demuner, Antônio Jacinto; Kasuya, Maria Catarina Megumi

2014-01-01

In this study, we evaluated the growth of Pleurotus ostreatus PLO6 using oxo-biodegradable plastics as a carbon and energy source. Oxo-biodegradable polymers contain pro-oxidants that accelerate their physical and biological degradation. These polymers were developed to decrease the accumulation of plastic waste in landfills. To study the degradation of the plastic polymers, oxo-biodegradable plastic bags were exposed to sunlight for up to 120 days, and fragments of these bags were used as substrates for P. ostreatus. We observed that physical treatment alone was not sufficient to initiate degradation. Instead, mechanical modifications and reduced titanium oxide (TiO2) concentrations caused by sunlight exposure triggered microbial degradation. The low specificity of lignocellulolytic enzymes and presence of endomycotic nitrogen-fixing microorganisms were also contributing factors in this process. PMID:25419675

Development of natural cellulase inhibitor mediated intensified biological pretreatment technology using Pleurotus florida for maximum recovery of cellulose from paddy straw under solid state condition.

PubMed

Naresh Kumar, Manickam; Ravikumar, Rajarathinam; Thenmozhi, Senniyappan; Kirupa Sankar, Muthuvelu

2017-11-01

Inhibitor mediated intensified bio-pretreatment (IMBP) technology using natural cellulase inhibitor (NCI) for maximum cellulose recovery from paddy straw was studied. Pretreatment was carried out under solid state condition. Supplementation of 8% NCI in pretreatment medium improves cellulose recovery and delignification by 1.2 and 1.5-fold respectively, compared to conventional bio-pretreatment due to inhibition of 61% of cellulase activity in IMBP. Further increase in NCI concentration showed negative effect on Pleurotus florida growth and suppress the laccase productivity by 1.1-fold. Laccase activity in IMBP was found to be 2.0U/mL on 19 th day, which is higher than (1.5U/mL) conventional bio-pretreatment. Physico-chemical modifications in paddy straw before and after pretreatment were analysed by SEM, ATR-FTIR, XRD and TGA. According to these findings, the IMBP technology can be a viable eco-friendly technology for sustainable production of bioethanol with maximum cellulose recovery. Copyright © 2017 Elsevier Ltd. All rights reserved.

Biotransformation of 1,8-cineole by solid-state fermentation of Eucalyptus waste from the essential oil industry using Pleurotus ostreatus and Favolus tenuiculus.

PubMed

Omarini, Alejandra; Dambolena, José Sebastián; Lucini, Enrique; Jaramillo Mejía, Santiago; Albertó, Edgardo; Zygadlo, Julio A

2016-03-01

Biotechnological conversion of low-cost agro-industrial by-products, such as industrial waste or terpenes from the distillation of essential oils from plants into more valuable oxygenated derivatives, can be achieved by using microbial cells or enzymes. In Argentina, the essential oil industry produces several tons of waste each year that could be used as raw materials in the production of industrially relevant and value-added compounds. In this study, 1,8-cineole, one of the components remaining in the spent leaves of the Eucalyptus cinerea waste, was transformed by solid-state fermentation (SSF) using the two edible mushrooms Pleurotus ostreatus and Favolus tenuiculus. As a result, two new oxygenated derivatives of 1,8-cineole were identified: 1,3,3-trimethyl-2-oxabicyclo [2.2.2]octan-6-ol and 1,3,3-trimethyl-2-oxabicyclo [2.2.2]octan-6-one. Additionally, changes in the relative percentages of other aroma compounds present in the substrate were observed during SSF. Both fungal strains have the ability to produce aroma compounds with potential applications in the food and pharmaceutical industries.

The degradation of three-ringed polycyclic aromatic hydrocarbons by wood-inhabiting fungus Pleurotus ostreatus and soil-inhabiting fungus Agaricus bisporus.

PubMed

Pozdnyakova, Natalia; Dubrovskaya, Ekaterina; Chernyshova, Marina; Makarov, Oleg; Golubev, Sergey; Balandina, Svetlana; Turkovskaya, Olga

2018-05-01

The degradation of two isomeric three-ringed polycyclic aromatic hydrocarbons by the white rot fungus Pleurotus ostreatus D1 and the litter-decomposing fungus Agaricus bisporus F-8 was studied. Despite some differences, the degradation of phenanthrene and anthracene followed the same scheme, forming quinone metabolites at the first stage. The further fate of these metabolites was determined by the composition of the ligninolytic enzyme complexes of the fungi. The quinone metabolites of phenanthrene and anthracene produced in the presence of only laccase were observed to accumulate, whereas those formed in presence of laccase and versatile peroxidase were metabolized further to form products that were further included in basal metabolism (e.g. phthalic acid). Laccase can catalyze the initial attack on the PAH molecule, which leads to the formation of quinones, and that peroxidase ensures their further oxidation, which eventually leads to PAH mineralization. A. bisporus, which produced only laccase, metabolized phenanthrene and anthracene to give the corresponding quinones as the dominant metabolites. No products of further utilization of these compounds were detected. Thus, the fungi's affiliation with different ecophysiological groups and their cultivation conditions affect the composition and dynamics of production of the ligninolytic enzyme complex and the completeness of PAH utilization. Copyright © 2018 British Mycological Society. Published by Elsevier Ltd. All rights reserved.

Degradation of Oxo-Biodegradable Plastic by Pleurotus ostreatus

PubMed Central

da Luz, José Maria Rodrigues; Paes, Sirlaine Albino; Nunes, Mateus Dias; da Silva, Marliane de Cássia Soares; Kasuya, Maria Catarina Megumi

2013-01-01

Growing concerns regarding the impact of the accumulation of plastic waste over several decades on the environmental have led to the development of biodegradable plastic. These plastics can be degraded by microorganisms and absorbed by the environment and are therefore gaining public support as a possible alternative to petroleum-derived plastics. Among the developed biodegradable plastics, oxo-biodegradable polymers have been used to produce plastic bags. Exposure of this waste plastic to ultraviolet light (UV) or heat can lead to breakage of the polymer chains in the plastic, and the resulting compounds are easily degraded by microorganisms. However, few studies have characterized the microbial degradation of oxo-biodegradable plastics. In this study, we tested the capability of Pleurotus ostreatus to degrade oxo-biodegradable (D2W) plastic without prior physical treatment, such as exposure to UV or thermal heating. After 45 d of incubation in substrate-containing plastic bags, the oxo-biodegradable plastic, which is commonly used in supermarkets, developed cracks and small holes in the plastic surface as a result of the formation of hydroxyl groups and carbon-oxygen bonds. These alterations may be due to laccase activity. Furthermore, we observed the degradation of the dye found in these bags as well as mushroom formation. Thus, P. ostreatus degrades oxo-biodegradable plastics and produces mushrooms using this plastic as substrate. PMID:23967057

Degradation of oxo-biodegradable plastic by Pleurotus ostreatus.

PubMed

da Luz, José Maria Rodrigues; Paes, Sirlaine Albino; Nunes, Mateus Dias; da Silva, Marliane de Cássia Soares; Kasuya, Maria Catarina Megumi

2013-01-01

Growing concerns regarding the impact of the accumulation of plastic waste over several decades on the environmental have led to the development of biodegradable plastic. These plastics can be degraded by microorganisms and absorbed by the environment and are therefore gaining public support as a possible alternative to petroleum-derived plastics. Among the developed biodegradable plastics, oxo-biodegradable polymers have been used to produce plastic bags. Exposure of this waste plastic to ultraviolet light (UV) or heat can lead to breakage of the polymer chains in the plastic, and the resulting compounds are easily degraded by microorganisms. However, few studies have characterized the microbial degradation of oxo-biodegradable plastics. In this study, we tested the capability of Pleurotus ostreatus to degrade oxo-biodegradable (D2W) plastic without prior physical treatment, such as exposure to UV or thermal heating. After 45 d of incubation in substrate-containing plastic bags, the oxo-biodegradable plastic, which is commonly used in supermarkets, developed cracks and small holes in the plastic surface as a result of the formation of hydroxyl groups and carbon-oxygen bonds. These alterations may be due to laccase activity. Furthermore, we observed the degradation of the dye found in these bags as well as mushroom formation. Thus, P. ostreatus degrades oxo-biodegradable plastics and produces mushrooms using this plastic as substrate.

Cultivation of the culinary-medicinal Lung Oyster mushroom, Pleurotus pulmonarius (Fr.) Quél. (Agaricomycetideae) on grass plants in Taiwan.

PubMed

Liang, Zeng-Chin; Wu, Kuan-Jzen; Wang, Jinn-Chyi; Lin, Chorng-Horng; Wu, Chiu-Yeh

2011-01-01

Cultivation of the culinary-medicinal Lung Oyster mushroom, Pleurotus pulmonarius, on the stalks of three grass plants, i.e., Panicum repens, Pennisetum purpureum, and Zea mays were investigated. The effects of various combinatorial substrates on mushroom mycelial growth and yield calculated as biological efficiency (BE) were determined. Among 9 experimental substrates, the most suitable substrate for mycelial growth was 45ZMS:45S, followed by 45PRS:45S; their mycelial growth rates were obviously quicker than that of the control substrate. The BEs of all the experimental substrates respectively containing P. repens stalk, P. purpureum stalk and Z. mays stalk were higher than that of the control (39.55%) during the 2.5 months of cultivation period. The best substrate in terms of BE was 60ZMS:30S (58.33%), followed by 45PRS:45S (57.16%), 45ZMS:45S (49.86%), and 30ZMS:60S (47.20%). Based on the BE of the tested substrates, Z mays stalk appeared to be the best alternative material for the production of P. pulmonarius.

Taxonomic Identity, Geographic Distribution, and Commercial Exploitation of the Culinary-Medicinal Mushroom Pleurotus nebrodensis (Basidiomycetes).

PubMed

Venturella, Giuseppe; Zervakis, Georgios I; Polemis, Elias; Gargano, Maria Letizia

2016-01-01

An updated overview of the outcome of studies conducted on the culinary-medicinal mushroom Pleurotus nebrodensis is presented by placing emphasis on the clarification of the taxonomic identity of P. nebrodensis and other related taxa possessing entirely white to cream basidiomes, which grow in association with different plants of the family Apiaceae. Cultivation techniques, quality of the product sold and sales price, as well as nutritional and medicinal aspects are discussed. Taking also into consideration the high economic importance of P. nebrodensis, it is essential to proceed with the verification of the commercial strains currently available in the international market under the name of "P. nebrodensis" since it is very probable that many (or most) of them do not represent the real P. nebrodensis. TO confirm this hypothesis, an in silico analysis was conducted on a large of number of ITS1-5.8S-ITS2 rRNA sequences deposited in the National Center for Biotechnology Information database under the name P. nebrodensis. Results demonstrated that all "P nebrodensis" material examined from China (plus several sequences of no reported origin) corresponded to P. eryngii subsp. tuoliensis, with only 2 exceptions, which were grouped within P. eryngii sensu stricto. The real P. nebrodensis biological material from Italy and Greece is certified and is available upon request by the authors at the University of Palermo and the Agricultural University of Athens.

Selenium bioaccessibility and speciation in biofortified Pleurotus mushrooms grown on selenium-rich agricultural residues.

PubMed

Bhatia, Poonam; Aureli, Federica; D'Amato, Marilena; Prakash, Ranjana; Cameotra, Swaranjit Singh; Nagaraja, Tejo Prakash; Cubadda, Francesco

2013-09-01

Cultivation of saprophytic fungi on selenium-rich substrates can be an effective means to produce selenium-fortified food. Pleurotus florida, an edible species of oyster mushrooms, was grown on wheat straw from the seleniferous belt of Punjab (India) and its potential to mobilize and accumulate selenium from the growth substrate was studied. Selenium concentration in biofortified mushrooms was 800 times higher compared with control samples grown on wheat straw from non selenium-rich areas (141 vs 0.17 μg Se g(-1) dry weight). Seventy-five percent of the selenium was extracted after in vitro simulated gastrointestinal digestion and investigation of the selenium molecular fractions by size exclusion HPLC-ICP-MS revealed that proteins and any other high molecular weight selenium-containing molecule were hydrolyzed to peptides and low molecular weight selenocompounds. Analysis of the gastrointestinal hydrolysates by anion exchange HPLC-ICP-MS showed that the bioaccessible selenium was mainly present as selenomethionine, a good bioavailable source of selenium, which accounted for 73% of the sum of the detected species. This study demonstrates the feasibility of producing selenium-biofortified edible mushrooms using selenium-rich agricultural by-products as growth substrates. The proposed approach can be used to evaluate whether selenium-contaminated plant waste materials harvested from high-selenium areas may be used to produce selenium-biofortified edible mushrooms based on the concentration, bioaccessibility and speciation of selenium in the mushrooms. Copyright © 2013 Elsevier Ltd. All rights reserved.

Optimization of β-glucan synthase gene primers for molecular DNA fingerprinting in Pleurotus pulmonarious

NASA Astrophysics Data System (ADS)

Kadir, Zaiton Abdul; Daud, Fauzi; Mohamad, Azhar; Senafi, Sahidan; Jamaludin, Ferlynda Fazleen

2015-09-01

Pleurotus pulmonarius is an edible mushroom in Malaysia and commonly known as Oyster mushroom. The species are important not only for nutritional values but also for pharmaceutical importance related to bioactive compounds in polysaccharides such as β glucan. Hence, β-glucan synthase gene (BGS) pathways which are related to the production of the β-glucan might be useful as marker for molecular DNA fingerprinting in P. pulmonarius. Conserved regions of β-glucan gene were mined from public database and aligned. Consensus from the alignment was used to design the primers by using Primer 3 software. Eight primers were designed and a single primer pair (BGF3: 5' TCTTGGCGAGTTCGAAGAAT 3'; BGR3: 5' TTCCGATCTTGGTCTGGAAG 3') was optimized at Ta (annealing temperature) 57.1°C to produce PCR product ranging from 400-500 bp. Optimum components for PCR reactions were 5.0 µl of 10× PCR buffer, 1.5 µl of 25 mM MgCl2, 1 µl of 10 mM dNTP, 1 µl of β-glucan primers, 0.1 µl of 5 units/ml Taq polymerase and 2 µl DNA template. PCR program was set at 34 PCR cycles by using Bio-Rad T100 Thermal Cycler. Initial denaturation was set at 94°C for 2 min, denaturation at 94°C for 1 minute, primer annealing at 45°C to 60°C (gradient temperature) for 50 seconds, followed by elongation at 72°C for 1 minute and further extension 5 minutes for last cycle PCR prior to end the program cycle. Thus, this information revealed that the primer of β-glucan gene designed could be used as targeted markers in screening population strains of P. pulmonarius.

Combined remediation of Cd-phenanthrene co-contaminated soil by Pleurotus cornucopiae and Bacillus thuringiensis FQ1 and the antioxidant responses in Pleurotus cornucopiae.

PubMed

Jiang, Juan; Liu, Hongying; Li, Qiao; Gao, Ni; Yao, Yuan; Xu, Heng

2015-10-01

Remediation of soil co-contaminated with heavy metals and PAHs by mushroom and bacteria is a novel technique. In this study, the combined remediation effect of mushroom (Pleurotus cornucopiae) and bacteria (FQ1, Bacillus thuringiensis) on Cd and phenanthrene co-contaminated soil was investigated. The effect of bacteria (B. thuringiensis) on mushroom growth, Cd accumulation, phenanthrene degradation by P. cornucopiae and antioxidative responses of P. cornucopiae were studied. P. cornucopiae could adapt easily and grow well in Cd-phenanthrene co-contaminated soil. It was found that inoculation of FQ1 enhanced mushroom growth (biomass) and Cd accumulation with the increment of 26.68-43.58% and 14.29-97.67% respectively. Up to 100% and 95.07% of phenanthrene were removed in the bacteria-mushroom (B+M) treatment respectively spiked with 200mg/kg and 500mg/kg phenanthrene. In addition, bacterial inoculation alleviated oxidative stress caused by co-contamination with relative decreases in lipid peroxidation and enzyme activity, including malondialdehyde (MDA), superoxide dismutase (SOD), catalase (CAT), and peroxidase (POD). This study demonstrated that the integrated remediation strategy of bacteria and mushroom is an effective and promising method for Cd-phenanthrene co-contaminated soil bioremediation. Copyright © 2015 Elsevier Inc. All rights reserved.

Influence of calcium and silicon supplementation into Pleurotus ostreatus substrates on quality of fresh and canned mushrooms.

PubMed

Thongsook, T; Kongbangkerd, T

2011-08-01

Supplements of gypsum (calcium source), pumice (silicon source) and pumice sulfate (silicon and calcium source) into substrates for oyster mushrooms (Pleurotus ostreatus) were searched for their effects on production as well as qualities of fresh and canned mushrooms. The addition of pumice up to 30% had no effect on total yield, size distribution and cap diameters. The supplementation of gypsum at 10% decreased the total yield; and although gypsum at 5% did not affect total yield, the treatment increased the proportion of large-sized caps. High content (>10%) of pumice sulfate resulted in the lower yield. Calcium and silicon contents in the fruit bodies were not influenced by supplementations. The centrifugal drip loss values and solid content of fresh mushrooms, and the percentage of weight gained and firmness of canned mushrooms, cultivated in substrates supplemented with gypsum, pumice and pumice sulfate were significantly (p≤0.05) higher than those of the control. Scanning electron micrographs revealed the more compacted hyphae of mushroom stalks supplemented with silicon and/or calcium after heat treatment, compared to the control. Supplementation of P. ostreatus substrates with 20% pumice was the most practical treatment because it showed no effect on yield and the most cost-effective.

Evaluation of the proximate quality of the combination of Tuna (Thunnus albacares) and white oyster mushroom (Pleurotus ostreatus) nuggets

NASA Astrophysics Data System (ADS)

Yufidasari, H. S.; Prihanto, A. A.; Nurdiani, R.; Jaziri, A. A.

2018-04-01

Nugget is a processed meat product which has great market demand but need variations to increase its nutritional content. Tuna is rich in omega-3 protein, vitamins, and minerals. White oyster mushrooms have high nutritional content which are about 23-33% protein, 36-68 % carbohydrates and 12-22 % amino acids. The purpose of this research is to evaluate the chemical quality of Tuna nugget (Thunnus albacores) with combination of white oyster mushroom (Pleurotus ostreatus). Complete Randomized Design (RAL) with parameters of Tuna and white oyster mushroom formulation, TJ1 (70 % Tuna: 30 % white oyster mushroom), TJ2 (50 % Tuna: 50 % white oyster mushroom), TJ3 (30 % Tuna: 70 % white oyster mushroom), and Control or K Treatment (100 % Tuna) is used. Results of Tuna nuggets with white oyster mushroom combination showed the highest value of water content in TJ3 50.14 %, protein K 19.6 %, fat TJ3 22.98 %, ash K 3.99 % and 2.47 % crude fiber. From these results, there is a need for further research on fat, ash and coarse fiber content that is used in the manufacture of fish nuggets combined with oyster mushrooms because it failed to meet Indonesian National Standard (SNI).

Effect of light and atmosphere on the cultivation of the golden oyster culinary-medicinal mushroom, Pleurotus citrinopileatus (higher Basidiomycetes).

PubMed

Hu, Shu-Hui; Wu, Chiu-Yeh; Chen, Yu-Kuei; Wang, Jinn-Chyi; Chang, Sue-Joan

2013-01-01

With an aim to explore the productivity and quality of the fruiting body of culinary-medicinal golden oyster mushroom Pleurotus citrinopileatus, the carbon dioxide (CO₂) concentration of the ambient atmosphere was adjusted and a light-emitting diode panel was used to illuminate the colonized mycelium at different wavelengths. Biological efficiency and yield were higher at CO₂ levels of 0.05 and 0.1% than other tested CO₂ levels, and the mature fruiting body showed the highest yellow value at a CO₂ level of 0.1% (of all tested CO₂ levels). The highest biological efficiency and yield was obtained at the 720-nm wavelength. The ergosterol content of the pileus of the fruiting body was higher than that of the stipe in any flush time at a 720-nm wavelength of light and a CO₂ concentration of 0.1%. The decreased percentages of cellulose and lignin at the appearance of primordia were larger than those of mycelial growth duration. The fruiting quality of P. citrinopileatus might thus be enhanced by 720-nm illumination and an atmosphere with a CO₂ concentration of 0.1 to 0.15%.

Morphology and laccase production of white-rot fungi grown on wheat bran flakes under semi-solid-state fermentation conditions.

PubMed

Osma, Johann F; Moilanen, Ulla; Toca-Herrera, José L; Rodríguez-Couto, Susana

2011-05-01

In this paper, we studied the laccase production and the growth morphology of different white-rot fungi, i.e. Pleurotus ostreatus, Trametes pubescens, Cerrena unicolor and Trametes versicolor, cultured under semi-solid-state fermentation conditions using wheat bran flakes as a natural low-cost support substrate. Trametes versicolor exhibited the highest laccase activity per gram of total dry matter, followed by P. ostreatus (63.5 and 58.2Ug(-1) , respectively). In addition, they showed a time profile of laccase production that was quite similar. Growth morphology was studied using environmental microscopic images and analyzed by discrete Fourier transformation-based software to determine the mean diameter of the hyphae, the number of hypha layers and the global micromorphology. The four strains exhibited different micromorphologies of growth. Pleurotus ostreatus presented narrow hyphae, which formed many thick clumps, T. pubescens and T. versicolor showed clumps of different sizes and C. unicolor showed thick hyphae that formed larger clumps, but in less amounts. © 2011 Federation of European Microbiological Societies. Published by Blackwell Publishing Ltd. All rights reserved.

Effect of Pleurotus eryngii stalk residue on the oxidative status and meat quality of broiler chickens.

PubMed

Lee, Tzu-Tai; Ciou, Jhih-Ying; Chiang, Ching-Jen; Chao, Yun-Peng; Yu, Bi

2012-11-07

Pleurotus eryngii stalk residue (PESR) is a byproduct of the edible portion of the fruiting body. The present study was conducted to evaluate the effects of PESR on the oxidative status and meat quality of broilers. Two hundred fifty 1-d-old male broilers (Arbor Acre) were evenly divided by gender and randomly allocated into control (corn-soybean meal diet) or 1.0, 5.0, 10.0, or 20.0 g/kg dried PESR groups. The results revealed that at 35 d, the dried PESR groups displayed a significantly increased water-holding capacity and decreased storage loss of breast and thigh fillets when compared to the control group. Regarding fillets color, the L* (lightness) values were lower and the a* (redness) and b* (yellowness) values were higher following dried PESR supplementation. In 5.0-20.0 g/kg PESR supplementation groups, the activities of antioxidative enzymes were significantly elevated in serum, liver, spleen, and fillet tissues when compared to control group. Additionally, malondialdehyde production was slightly decreased in the PESR supplementation groups. Lower crude fat contents were observed in fillet tissues of 5.0-20.0 g/kg PESR groups when compared with the control group. In conclusion, PESR may potentially be used as an antioxidant to decrease lipid peroxidation and improve meat quality in broilers.

Transcriptional and Enzymatic Profiling of Pleurotus ostreatus Laccase Genes in Submerged and Solid-State Fermentation Cultures

PubMed Central

Castanera, Raúl; Pérez, Gúmer; Omarini, Alejandra; Alfaro, Manuel; Pisabarro, Antonio G.; Faraco, Vincenza; Amore, Antonella

2012-01-01

The genome of the white rot basidiomycete Pleurotus ostreatus includes 12 phenol oxidase (laccase) genes. In this study, we examined their expression profiles in different fungal strains under different culture conditions (submerged and solid cultures) and in the presence of a wheat straw extract, which was used as an inducer of the laccase gene family. We used a reverse transcription-quantitative PCR (RT-qPCR)-based approach and focused on determining the reaction parameters (in particular, the reference gene set for the normalization and reaction efficiency determinations) used to achieve an accurate estimation of the relative gene expression values. The results suggested that (i) laccase gene transcription is upregulated in the induced submerged fermentation (iSmF) cultures but downregulated in the solid fermentation (SSF) cultures, (ii) the Lacc2 and Lacc10 genes are the main sources of laccase activity in the iSmF cultures upon induction with water-soluble wheat straw extracts, and (iii) an additional, as-yet-uncharacterized activity (Unk1) is specifically induced in SSF cultures that complements the activity of Lacc2 and Lacc10. Moreover, both the enzymatic laccase activities and the Lacc gene family transcription profiles greatly differ between closely related strains. These differences can be targeted for biotechnological breeding programs for enzyme production in submerged fermentation reactors. PMID:22467498

Heat treatment of wheat straw by immersion in hot water decreases mushroom yield in Pleurotus ostreatus.

PubMed

Jaramillo Mejía, Santiago; Albertó, Edgardo

2013-01-01

The oyster mushroom, Pleurotus ostreatus, is cultivated worldwide. It is one of the most appreciated mushrooms due to its high nutritional value. Immersion of the substrate in hot water is one of the most popular and worldwide treatment used for mushroom farmers. It is cheap and easy to implement. To compare the yields obtained during mushroom production of P. ostreatus using different pre-treatments (immersion in hot water, sterilization by steam and the use of fungicide) to determine if they influence mushroom crop. Four different treatments of substrate (wheat straw) were carried out: (i) immersion in hot water (IHW); (ii) steam sterilization; (iii) chemical; and (iv) untreated. The residual water from the IHW treatment was used to evaluate the mycelium growth and the production of P. ostreatus. Carbendazim treatment produced highest yields (BE: 106.93%) while IHW produced the lowest BE with 75.83%. Sugars, N, P, K and Ca were found in residual water of IHW treatment. The residual water increased the mycelium growth but did not increase yields. We have proved that IHW treatment of substrate reduced yields at least 20% when compared with other straw treatments such as steam, chemical or untreated wheat straw. Nutrients like sugars, proteins and minerals were found in the residual water extract which is the resultant water where the immersion treatment is carried out. The loss of these nutrients would be the cause of yield decrease. Alternative methods to the use of IHW as treatment of the substrate should be considered to reduce economical loss. Copyright © 2012 Revista Iberoamericana de Micología. Published by Elsevier Espana. All rights reserved.

Changes in chemical components and cytotoxicity at different maturity stages of Pleurotus eryngii fruiting body.

PubMed

Cui, Fengjie; Li, Yunhong; Yang, Yan; Sun, Wenjing; Wu, Di; Ping, Lifeng

2014-12-31

The present study investigated the changes of the chemical components and cytotoxicity potency at 5 developmental stages of Pleurotus eryngii fruiting body. The carbohydrate and protein contents increased along the maturity of fruiting body while fat content decreased. By comparison, the polysaccharide-protein fractions had the highest antiproliferative effect on SGC-7901 and HepG-2 cells in vitro and increasing activity with growing maturity of P. eryngii fruiting body.The maturation process increased the protein content and acid property through the enhanced relative abundance of Asp, Thr, and Glu in polysaccharide-protein fractions. Further purification and electrophoresis identified that the polysaccharide-protein PEG-1with three subunits possibly was the target cytotoxical component. Our findings proved that mature fruiting body of P. eryngii containing these polysaccharide-proteins possessed highly nutritional values and therapeutical benefits.

New sesquiterpenoids from the edible mushroom Pleurotus cystidiosus and their inhibitory activity against α-glucosidase and PTP1B.

PubMed

Tao, Qiao-Qiao; Ma, Ke; Bao, Li; Wang, Kai; Han, Jun-Jie; Zhang, Jin-Xia; Huang, Chen-Yang; Liu, Hong-Wei

2016-06-01

Nine new sesquiterpenoids, clitocybulol derivatives, clitocybulols G-O (1-9) and three known sesquiterpenoids, clitocybulols C-E (10-12), were isolated from the solid culture of the edible fungus Pleurotus cystidiosus. The structures of compounds 1-12 were determined by spectroscopic methods. The absolute configurations of compounds 1-9 were assigned via the circular dichroism (CD) data analysis. Compounds 1, 6 and 10 showed moderate inhibitory activity against protein tyrosine phosphatase-1B (PTP1B) with IC50 values of 49.5, 38.1 and 36.0μM, respectively. Copyright © 2016. Published by Elsevier B.V.

Effect of Spent Mushroom Compost of Pleurotus pulmonarius on Growth Performance of Four Nigerian Vegetables

PubMed Central

Lawal, Muritala Mobolaji; Oyetunji, Olusola Jacob

2011-01-01

Spent mushroom compost (SMC) of Pleurotus pulmonarius (an edible fungus) was used as soil conditioner for the improvement of growth of four common Nigerian vegetables (Abelmoschus esculentus, Lycopersicum esculentum, Capsicum annum and Capsicum chinense). The results of these investigations showed that the vegetables responded well to the SMC treatment. Each of them attained its best growth and gave the highest number of flowers and fruits when planted on 6 kg of depleted garden soil supplemented with 600 g of SMC. The control experiment that has the seedlings of the vegetables planted on 6 kg of depleted garden soil only, without the application of SMC, showed stunted and poor growth, with few or no flower and fruit production. A. esculentus was the best utilizer of iron utilizing 118.0 mg/kg in the SMC used. Similarly; this vegetable utilized 1.48 mg/kg of nitrogen in the SMC. The highest height in each vegetable was attained with 6 kg of depleted garden soil supplemented with 600 g of SMC. At 9 wk, A. esculentus has the mean height of 85.0 cm while these values significantly increased to 100.00 cm at 14 wk (p ≤ 0.05). At 9 wk, L. esculentum has the highest mean height of 65.00 cm which increased to 71.00 cm after 14 wk. It was also observed that A. esculentus has the highest mean number of fruits (9.00), followed in order by C. chinense (8.00) and L. esculentus (7.00) (p ≤ 0.05) while, C. annum produced the least mean number of fruits (5.00). No fruits production was seen in the control experiments. The results of these findings were discussed in relation to the usage of SMC as possible organic fertilizer for the improvement of growth of vegetables in Nigeria. PMID:22783098

Nutritional characterisation of Pleurotus ostreatus (Jacq. ex Fr.) P. Kumm. produced using paper scraps as substrate.

PubMed

Fernandes, Ângela; Barros, Lillian; Martins, Anabela; Herbert, Paulo; Ferreira, Isabel C F R

2015-02-15

Pleurotus ostreatus (Jacq. ex Fr.) P. Kumm. is the third most produced edible mushroom worldwide, due to its ability to colonise and degrade a large variety of lignocellulosic substrates. Therefore, the objective of this work was to evaluate the chemical composition of fruiting bodies of P. ostreatus grown on blank and printed paper substrates, in comparison with samples grown on oat straw (control). The nutritional properties of the control sample were similar to values reported in the literature, while the chemical composition of the samples obtained using paper scraps, either blank or printed, was highly satisfactory. The results obtained validated the nutritional characteristics of the samples, highlighting a profitable means to recycle paper. Copyright © 2014 Elsevier Ltd. All rights reserved.

Mutation-Screening of Pleurotus Ferulae with High Temperature Tolerance by Nitrogen Ion Implantation

NASA Astrophysics Data System (ADS)

Chen, Henglei; Wan, Honggui; Zhang, Jun; Zeng, Xianxian

2008-08-01

In order to obtain Pleurotus ferulae with high temperature tolerance, conidiophores of wild type strain ACK were implanted with nitrogen ions in energy of 5 ~15 keV and dose of 1.5 × 1015 ~ 1.5 × 1016 cm-2, and a mutant CGMCC1763 was isolated subsequently through thermotolerant screening method. It was found that during riper period the surface layer mycelium of the mutant in mushroom bag wasn't aging neither grew tegument even above 30° C. The mycelium endurable temperature of the mutant was increased by 5°C compared to that of the wild type strain. The fruiting bodies growth temperature of the mutant was 18 ~22°C in daytime and 8~14°C at night. The highest growth temperature of fruiting bodies of the mutant was increased about 7°C w.r.t. that of original strain. Through three generations investigations, it was found that the mutant CGMCC1763 was stable with high temperature tolerance.

Antioxidant and antitumor effects of polysaccharides from the fungus Pleurotus abalonus.

PubMed

Ren, Daoyuan; Jiao, Yadong; Yang, Xingbin; Yuan, Li; Guo, Jianjun; Zhao, Yan

2015-07-25

Dietary supplement of edible Pleurotus abalonus (P. abalonus) rich in fungal polysaccharides is associated with anticancer health benefit. We here isolated the polysaccharides (PAP) from the fruiting bodies of P. abalonus, and evaluated the antiproliferative activity of the polysaccharides in human colorectal carcinoma LoVo cells. HPLC analysis showed that PAP consisted of D-mannose, D-ribose, l-rhamnose, D-glucuronic acid, D-glucose and D-galactose, and their corresponding mole percentages were 3.4%, 1.1%, 1.9%, 1.4%, 87.9% and 4.4%, respectively. PAP was shown to exert a high antioxidant activity in vitro and a dose-dependent antiproliferative effect against LoVo cancer cells. Flow cytometry analysis demonstrated that PAP exhibited a stimulatory effect on apoptosis of LoVo cells, and induced the cell-cycle arrest at the S phase. We also found that PAP could increase the generation of intracellular ROS which was a critical mediator in PAP-induced cell growth inhibition. These findings suggest that PAP may serve as a potential novel dietary agent for human colon cancer chemoprevention. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

Cloning and sequencing of a laccase gene from the lignin-degrading basidiomycete Pleurotus ostreatus.

PubMed Central

Giardina, P; Cannio, R; Martirani, L; Marzullo, L; Palmieri, G; Sannia, G

1995-01-01

The gene (pox1) encoding a phenol oxidase from Pleurotus ostreatus, a lignin-degrading basidiomycete, was cloned and sequenced, and the corresponding pox1 cDNA was also synthesized and sequenced. The isolated gene consists of 2,592 bp, with the coding sequence being interrupted by 19 introns and flanked by an upstream region in which putative CAAT and TATA consensus sequences could be identified at positions -174 and -84, respectively. The isolation of a second cDNA (pox2 cDNA), showing 84% similarity, and of the corresponding truncated genomic clones demonstrated the existence of a multigene family coding for isoforms of laccase in P. ostreatus. PCR amplifications of specific regions on the DNA of isolated monokaryons proved that the two genes are not allelic forms. The POX1 amino acid sequence deduced was compared with those of other known laccases from different fungi. PMID:7793961

Nutrient Digestibility, Ruminal Fermentation Activities, Serum Parameters and Milk Production and Composition of Lactating Goats Fed Diets Containing Rice Straw Treated with Pleurotus ostreatus.

PubMed

Kholif, A E; Khattab, H M; El-Shewy, A A; Salem, A Z M; Kholif, A M; El-Sayed, M M; Gado, H M; Mariezcurrena, M D

2014-03-01

The study evaluated replacement of Egyptian berseem clover (BC, Trifolium alexandrinum) with spent rice straw (SRS) of Pleurotus ostreatus basidiomycete in diets of lactating Baladi goats. Nine lactating homo-parity Baladi goats (average BW 23.8±0.4 kg) at 7 d postpartum were used in a triplicate 3×3 Latin square design with 30 d experimental periods. Goats were fed a basal diet containing 0 (Control), 0.25 (SRS25) and 0.45 (SRS45) (w/w, DM basis) of SRS. The Control diet was berseem clover and concentrate mixture (1:1 DM basis). The SRS45 had lowered total feed intake and forages intake compared to Control. The SRS25 and SRS45 rations had the highest digestibilities of DM (p = 0.0241) and hemicellulose (p = 0.0021) compared to Control which had higher (p<0.01) digestibilities of OM (p = 0.0002) and CP (p = 0.0005) than SRS25 and SRS45. Ruminal pH and microbial protein synthesis were higher (p<0.0001) for SRS25 and SRS45 than Control, which also had the highest (p<0.0001) concentration of TVFA, total proteins, non-protein N, and ammonia-N. All values of serum constituents were within normal ranges. The Control ration had higher serum globulin (p = 0.0148), creatinine (p = 0.0150), glucose (p = 0.0002) and cholesterol (p = 0.0016). Both Control and SRS25 groups had the highest (p<0.05) milk (p = 0.0330) and energy corrected milk (p = 0.0290) yields. Fat content was higher (p = 0.0373) with SRS45 and SRS25 groups compared with Control. Replacement of BC with SRS in goat rations increased milk levels of conjugated linoleic acid and unsaturated fatty acids compared with Control. It was concluded that replacing 50% of Egyptian berseem clover with SRS in goat rations improved their productive performance without marked effects on metabolic indicators health.

Nutrient Digestibility, Ruminal Fermentation Activities, Serum Parameters and Milk Production and Composition of Lactating Goats Fed Diets Containing Rice Straw Treated with Pleurotus ostreatus

PubMed Central

Kholif, A. E.; Khattab, H. M.; El-Shewy, A. A.; Salem, A. Z. M.; Kholif, A. M.; El-Sayed, M. M.; Gado, H. M.; Mariezcurrena, M. D.

2014-01-01

The study evaluated replacement of Egyptian berseem clover (BC, Trifolium alexandrinum) with spent rice straw (SRS) of Pleurotus ostreatus basidiomycete in diets of lactating Baladi goats. Nine lactating homo-parity Baladi goats (average BW 23.8±0.4 kg) at 7 d postpartum were used in a triplicate 3×3 Latin square design with 30 d experimental periods. Goats were fed a basal diet containing 0 (Control), 0.25 (SRS25) and 0.45 (SRS45) (w/w, DM basis) of SRS. The Control diet was berseem clover and concentrate mixture (1:1 DM basis). The SRS45 had lowered total feed intake and forages intake compared to Control. The SRS25 and SRS45 rations had the highest digestibilities of DM (p = 0.0241) and hemicellulose (p = 0.0021) compared to Control which had higher (p<0.01) digestibilities of OM (p = 0.0002) and CP (p = 0.0005) than SRS25 and SRS45. Ruminal pH and microbial protein synthesis were higher (p<0.0001) for SRS25 and SRS45 than Control, which also had the highest (p<0.0001) concentration of TVFA, total proteins, non-protein N, and ammonia-N. All values of serum constituents were within normal ranges. The Control ration had higher serum globulin (p = 0.0148), creatinine (p = 0.0150), glucose (p = 0.0002) and cholesterol (p = 0.0016). Both Control and SRS25 groups had the highest (p<0.05) milk (p = 0.0330) and energy corrected milk (p = 0.0290) yields. Fat content was higher (p = 0.0373) with SRS45 and SRS25 groups compared with Control. Replacement of BC with SRS in goat rations increased milk levels of conjugated linoleic acid and unsaturated fatty acids compared with Control. It was concluded that replacing 50% of Egyptian berseem clover with SRS in goat rations improved their productive performance without marked effects on metabolic indicators health. PMID:25049962

Biodegradation of carbamazepine and clarithromycin by Trichoderma harzianum and Pleurotus ostreatus investigated by liquid chromatography - high-resolution tandem mass spectrometry (FTICR MS-IRMPD).

PubMed

Buchicchio, Alessandro; Bianco, Giuliana; Sofo, Adriano; Masi, Salvatore; Caniani, Donatella

2016-07-01

In this study, the capability of pharmaceutical biodegradation of fungus Trichoderma harzianum was evaluated through the comparison with the well-known biodegradation capability of white-rot fungus Pleurotus ostreatus. The study was performed in aqueous phase under aerobic conditions, using two of the most frequently detected drugs in water bodies: carbamazepine and clarithromycin, with concentrations commonly found in treated wastewater (4μg/l and 0.03μg/l respectively). For the first time, we demonstrated that T. harzianum is able to remove carbamazepine and clarithromycin. The analyses were performed by reversed-phase liquid chromatography/mass spectrometry, using high-resolution Fourier-transform ion cyclotron resonance mass spectrometry upon electrospray ionization in positive ion mode. The high selectivity and mass accuracy provided by high-resolution mass spectrometry, allowed us to identify some unknown metabolites. On the basis of our study, the major metabolites detected in liquid culture treated by T. harzianum were: 14-hydroxy-descladinosyl- and descladinosyl-clarithromycin, which are pharmacologically inactive products not dangerous for the environment. Copyright © 2016 Elsevier B.V. All rights reserved.

Bio-remediation of colored industrial wastewaters by the white-rot fungi Phanerochaete chrysosporium and Pleurotus ostreatus and their enzymes.

PubMed

Faraco, V; Pezzella, C; Miele, A; Giardina, P; Sannia, G

2009-04-01

The effect of Phanerochaete chrysosporium and Pleurotus ostreatus whole cells and their ligninolytic enzymes on models of colored industrial wastewaters was evaluated. Models of acid, direct and reactive dye wastewaters from textile industry have been defined on the basis of discharged amounts, economic relevance and representativeness of chemical structures of the contained dyes. Phanerochaete chrysosporium provided an effective decolourization of direct dye wastewater model, reaching about 45% decolourization in only 1 day of treatment, and about 90% decolourization within 7 days, whilst P. ostreatus was able to decolorize and detoxify acid dye wastewater model providing 40% decolourization in only 1 day, and 60% in 7 days. P. ostreatus growth conditions that induce laccase production (up to 130,000 U/l) were identified, and extra-cellular enzyme mixtures, with known laccase isoenzyme composition, were produced and used in wastewater models decolourization. The mixtures decolorized and detoxified the acid dye wastewater model, suggesting laccases as the main agents of wastewater decolourization by P. ostreatus. A laccase mixture was immobilized by entrapment in Cu-alginate beads, and the immobilized enzymes were shown to be effective in batch decolourization, even after 15 stepwise additions of dye for a total exposure of about 1 month.

Immobilization of a Pleurotus ostreatus Laccase Mixture on Perlite and Its Application to Dye Decolourisation

PubMed Central

Salatino, Piero; Sannia, Giovanni

2014-01-01

In the present study, a crude laccase preparation from Pleurotus ostreatus was successfully immobilized on perlite, a cheap porous silica material, and tested for Remazol Brilliant Blue R (RBBR) decolourisation in a fluidized bed recycle reactor. Results showed that RBBR decolourisation is mainly due to enzyme action despite the occurrence of dye adsorption-related enzyme inhibition. Fine tuning of immobilization conditions allowed balancing the immobilization yield and the resulting rate of decolourisation, with the adsorption capacity of the solid biocatalyst. In the continuous lab scale reactor, a maximum conversion degree of 56.1% was achieved at reactor space-time of 4.2 h. Stability and catalytic parameters of the immobilized laccases were also assessed in comparison with the soluble counterparts, revealing an increase in stability, despite a reduction of the catalytic performances. Both effects are most likely ascribable to the occurrence of multipoint attachment phenomena. PMID:24895564

Lignocellulolytic enzyme activity, substrate utilization, and mushroom yield by Pleurotus ostreatus cultivated on substrate containing anaerobic digester solids.

PubMed

Isikhuemhen, Omoanghe S; Mikiashvilli, Nona A

2009-11-01

Solid waste from anaerobic digestion of litter from the commercial production of broiler chickens has limited use as fertilizer. Its disposal is a major problem for digester operators who are seeking alternative use for anaerobic digester solids, also referred to as solid waste (SW). The use of SW as substrates for the cultivation of Pleurotus ostreatus strain MBFBL400 was investigated. Lignocellulolytic enzymes activity, substrate utilization, and mushroom yield were evaluated in ten different substrate combinations (SCs) containing varying amounts of solid waste, wheat straw, and millet. Nutritional content of mushrooms produced on the different substrates was also determined. Substrates containing 70-80% wheat straw, 10-20% SW, and 10-20% millet were found to produce the highest mushroom yield (874.8-958.3 g/kg). Loss of organic matter in all SCs tested varied from 45.8% to 56.2%, which had positive correlation with the biological efficiency. Laccase, peroxidase, and carboxymethylcellulase (CMCase) activities were higher before fruiting, whereas xylanase showed higher activities after mushroom fruiting. SW increased the nutritional content in mushrooms harvested, and the combination of wheat straw and SW with millet significantly improved mushroom yield. Our findings demonstrated the possibility of utilizing anaerobic digester solids in mushroom cultivation. The application of SW as such could improve the financial gains in the overall economy of anaerobic digester plants.

Characterization and in vitro antioxidant activities of polysaccharides from Pleurotus ostreatus.

PubMed

Zhang, Yunxia; Dai, Ling; Kong, Xiaowei; Chen, Liangwen

2012-10-01

Two polysaccharide fractions (PSPO-1a and PSPO-4a) were isolated from the fruiting bodies of Pleurotus ostreatus using ethanol precipitation, anion-exchange chromatography and gel permeation chromatography. Both fractions were heteropolysaccharide containing protein and uronic acid. PSPO-1a was composed of mannose, glucose, galactose, xylose and rhamnose with a molar ratio of 2.47:0.91:1.00:1.66:3.87. PSPO-4a was composed of only three monosaccharides: rhamnose, mannose and galactose with a molar ratio of 0.92:2.69:1.00. The average molecular weight of PSPO-1a and PSPO-4a determined by HPLC were estimated to be 1.8 × 10(4)Da and 1.1 × 10(6)Da respectively. The in vitro tests revealed that two polysaccharides were natural potential antioxidant. Both polysaccharides presented stronger DPPH radical and superoxide anion radical scavenging activity with increasing concentrations, but less effective on scavenging hydroxyl radical. Compared with PSPO-4a, PSPO-1a was the more effective free-radical scavenger. In conclusion, the two polysaccharides may be useful as a naturally potential antioxidant agent for application in food and medicinal fields. Copyright © 2012 Elsevier B.V. All rights reserved.

Characteristics of uranium biosorption from aqueous solutions on fungus Pleurotus ostreatus.

PubMed

Zhao, Changsong; Liu, Jun; Tu, Hong; Li, Feize; Li, Xiyang; Yang, Jijun; Liao, Jiali; Yang, Yuanyou; Liu, Ning; Sun, Qun

2016-12-01

Uranium(VI) biosorption from aqueous solutions was investigated in batch studies by using fungus Pleurotus ostreatus biomass. The optimal biosorption conditions were examined by investigating the reaction time, biomass dosage, pH, temperature, and uranium initial concentration. The interaction between fungus biomass and uranium was confirmed using Fourier transformed infrared (FT-IR), scanning electronic microscopy energy dispersive X-ray (SEM-EDX), and X-ray photoelectron spectroscopy (XPS) analysis. Results exhibited that the maximum biosorption capacity of uranium on P. ostreatus was 19.95 ± 1.17 mg/g at pH 4.0. Carboxylic, amine, as well as hydroxyl groups were involved in uranium biosorption according to FT-IR analysis. The pseudo-second-order model properly evaluated the U(VI) biosorption on fungus P. ostreatus biomass. The Langmuir equation provided better fitting in comparison with Freundlich isotherm models. The obtained thermodynamic parameters suggested that biosorption is feasible, endothermic, and spontaneous. SEM-EDX and XPS were additionally conducted to comprehend the biosorption process that could be described as a complex process involving several mechanisms of physical adsorption, chemisorptions, and ion exchange. Results obtained from this work indicated that fungus P. ostreatus biomass can be used as potential biosorbent to eliminate uranium or other radionuclides from aqueous solutions.

Long term storage of Pleurotus ostreatus and Trametes versicolor isolates using different cryopreservation techniques and its impact on laccase activity.

PubMed

Eichlerová, Ivana; Homolka, Ladislav; Tomšovský, Michal; Lisá, Ludmila

2015-12-01

The strain Pleurotus ostreatus Florida f6, its 45 basidiospore-derived isolates (both monokaryons and dikaryons prepared in our laboratory), Trametes versicolor strain CCBAS 614 and 22 other T. versicolor isolates obtained from the sporocarps collected in distant localities were successfully preserved for 12 y using perlite and straw cryopreservation protocols. All tested isolates survived a 12-year storage in liquid nitrogen (LN) and their laccase production and Poly B411 decolorization capacity was preserved. Also mycelium extension rate and the types of colony appearance of individual isolates remained unchanged. Different cryopreservation techniques were also tested for the short time (24 h) and the long time (6 m) storage of the culture liquid with extracellular laccase produced by T. versicolor strain CCBAS 614. The results showed that 10 % glycerol was the most suitable cryopreservant. The absence of the cryopreservant did not cause high loss of laccase activity in the samples; the presence of DMSO (5 or 10 %) in LN-stored samples caused mostly a decrease of laccase activity. For the preservation of laccase activity in the liquid culture the storage in the freezer at -80 °C is more convenient than the storage in liquid nitrogen. Copyright © 2015 The British Mycological Society. Published by Elsevier Ltd. All rights reserved.

Bioprospecting of powdered pineapple rind as an organic supplement of composted sawdust for Pleurotus ostreatus mushroom cultivation.

PubMed

Narh Mensah, Deborah L; Addo, Peter; Dzomeku, Matilda; Obodai, Mary

2018-03-01

Pineapple rind is a by-product of the pineapple processing industry and contains nutrients and other compounds which must be utilized as a bioresource for socio-economic benefits while preventing the potential problems of improper agroindustrial biomass disposal methods. Pleurotus ostreatus is an edible oyster mushroom with medicinal properties and can be cultivated on various agroindustrial biomass, including sawdust containing supplements. Pineapple rind was powdered and used as a supplement of composted sawdust at 2%, 5%, 10%, 12%, 15%, and 20% (w/w) on dry weight basis. A control treatment consisted of composted sawdust supplemented with rice bran at 12% (the most utilized composition in Ghana). P. ostreatus strain EM-1 was cultivated on these treatments. Factors investigated included the spawn run period, yield, fruiting body weight and size, biological efficiency, and nutritional composition (proximate composition and Copper, Zinc and Lead content) of fruiting bodies harvested from selected high-yielding treatments and the control treatment. Full colonization of all treatments occurred by the 34th day of incubation. Enhanced yield, fruiting body weight and size, and biological efficiency were generally recorded with supplementation at lower concentrations (2% and 5%) compared to treatments supplemented at higher concentrations. There was also a supplement concentration-dependent alteration of the nutritional composition of the mushroom. Powdered pineapple rind can be utilized as an organic supplement at relatively low concentrations in composted sawdust for P. ostreatus strain EM-1 cultivation. The use of lower concentrations of powdered pineapple rind in composted sawdust is advantageous as relatively less input will be required to produce higher P. ostreatus strain EM-1 yields. Utilization of pineapple rind for mushroom cultivation will extend the pineapple plant value chain, intensify mushroom production in a sustainable way, and minimize agricultural

A 4-Nitroquinoleneoxide-Induced Pleurotus eryngii Mutant Variety Increases Pin1 Expression in Rat Brain.

PubMed

Jeong, Yoonhwa; Jung, Mina; Kim, Myeung Ju; Hwang, Cheol Ho

2017-01-01

To develop Pleurotus eryngii varieties with improved medicinal qualities, protoplasts of P. eryngii were mutagenized using 4-nitroquinoleneoxide. The effects of the resulting variant mushrooms on a human cell were evaluated by applying their aqueous extracts to the human hepatoma cell line, HepG2, in vitro and examining any alteration in the proteomes of the treated HepG2. The P. eryngii mutant, NQ2A-12, was selected for its effects on increasing the expression level of Pin1 in HepG2. Pin1 is one of the peptidyl-prolyl cis-trans isomerases known to play an important role in repressing Alzheimer's disease pathogenesis. Validity of NQ2A-12 related to Alzheimer's disease was shown with an enhanced expression of Pin1 in a mouse brain tissue by injecting the NQ2A-12 extract. The mutant mushroom, NQ2A-12, could be developed as a new variety of P. eryngii with potential to protect against Alzheimer's disease.

Ethanol production by Saccharomyces cerevisiae using lignocellulosic hydrolysate from Chrysanthemum waste degradation.

PubMed

Quevedo-Hidalgo, Balkys; Monsalve-Marín, Felipe; Narváez-Rincón, Paulo César; Pedroza-Rodríguez, Aura Marina; Velásquez-Lozano, Mario Enrique

2013-03-01

Ethanol production derived from Saccharomyces cerevisiae fermentation of a hydrolysate from floriculture waste degradation was studied. The hydrolysate was produced from Chrysanthemum (Dendranthema grandiflora) waste degradation by Pleurotus ostreatus and characterized to determine the presence of compounds that may inhibit fermentation. The products of hydrolysis confirmed by HPLC were cellobiose, glucose, xylose and mannose. The hydrolysate was fermented by S. cerevisiae, and concentrations of biomass, ethanol, and glucose were determined as a function of time. Results were compared to YGC modified medium (yeast extract, glucose and chloramphenicol) fermentation. Ethanol yield was 0.45 g g(-1), 88 % of the maximal theoretical value. Crysanthemum waste hydrolysate was suitable for ethanol production, containing glucose and mannose with adequate nutrients for S. cerevisiae fermentation and low fermentation inhibitor levels.

Novel isolation of water-soluble polysaccharides from the fruiting bodies of Pleurotus ostreatus mushrooms.

PubMed

Palacios, Irene; García-Lafuente, Ana; Guillamón, Eva; Villares, Ana

2012-09-01

Novel water-soluble polysaccharides have been isolated from the fruiting bodies of the edible mushroom Pleurotus ostreatus. Three polysaccharide fractions were obtained by ethanol precipitation from cold water, hot water and hot aqueous NaOH extracts. The fractions were purified by size exclusion chromatography showing a unique carbohydrate occurring in each fraction: PC from the cold fraction, PH from the hot fraction and PB from the hot aqueous NaOH fraction. The analysis of the methylated alditol acetates and the NMR studies revealed that all the polysaccharides displayed a linear backbone. PC was formed by α-(1→3),(1→6)-linked galactopyranosyl residues whereas PH and PB consisted of glucose-linked units. PH was exclusively composed of glucopyranosyl units bound by α-(1→4) linkages whereas PB was a β-linked glucan showing (1→3) and (1→6) glycosidic bonds. The analysis of molecular arrangement by complexation with Congo red showed that only the β-linked polysaccharide (PB) displayed a triple helix conformation. Copyright © 2012 Elsevier Ltd. All rights reserved.

Antioxidant and anti-hyperlipidemic effects of mycelia zinc polysaccharides by Pleurotus eryngii var. tuoliensis.

PubMed

Xu, Nuo; Ren, Zhenzhen; Zhang, Jianjun; Song, Xinling; Gao, Zheng; Jing, Huijuan; Li, Shangshang; Wang, Shouxian; Jia, Le

2017-02-01

The aims of this work were designed to investigate the hepatoprotective and antioxidant effects of acidic- and alkali-extractable mycelia zinc polysaccharides (AcMZPS, AlMZPS) from Pleurotus eryngii var. tuoliensis on high-fat-high-cholesterol emulsion-induced hyperlipidemic mice. The in vivo experiments demonstrated that both AcMZPS and AlMZPS had potential hepatoprotective effects by significantly decreasing the levels of LDL-C, VLDL-C, TC, TG, ALT, AST, ALP, MDA and LPO, and remarkably increasing the HDL-C, SOD, GSH-Px, and CAT in serum lipid/liver homogenate, respectively. In addition, four polysaccharide fractions of AcMZPS-1, AcMZPS-2, AlMZPS-1, and AlMZPS-2, purified from AcMZPS and AlMZPS using DEAE chromatography, respectively, were subjected to monosaccharide composition analysis and valuated for the in vitro antioxidant activity. The results obtained in present study suggested that AcMZPS, AlMZPS and their purified fractions could be used as functional foods and natural drugs in preventing the hyperlipidemia and non-alcoholic fatty liver. Copyright © 2016 Elsevier B.V. All rights reserved.

Extraction and Application of Laccases from Shimeji Mushrooms (Pleurotus ostreatus) Residues in Decolourisation of Reactive Dyes and a Comparative Study Using Commercial Laccase from Aspergillus oryzae

PubMed Central

Teixeira, Ricardo Sposina S.; Pereira, Patrícia Maia; Ferreira-Leitão, Viridiana S.

2010-01-01

Oxidases are able to degrade organic pollutants; however, high costs associated with biocatalysts production still hinder their use in environmental biocatalysis. Our study compared the action of a commercial laccase from Aspergillus oryzae and a rich extract from Pleurotus ostreatus cultivation residues in decolourisation of reactive dyes: Drimaren Blue X-3LR (DMBLR), Drimaren Blue X-BLN (DMBBLN), Drimaren Rubinol X-3LR (DMR), and Drimaren Blue C-R (RBBR). The colour removal was evaluated by considering dye concentration, reaction time, absence or presence of the mediator ABTS (2,2′-azino-bis(3-ethylbenzothiazoline-6-sulfonic acid), and the source of laccase. The presence of ABTS was essential for decolourisation of DMR (80–90%, 1 h) and RBBR (80–90%, 24 h) with both laccases. The use of ABTS was not necessary in reactions containing DMBLR (85–97%, 1 h) and DMBBLN (63–84%, 24 h). The decolourisation of DMBBLN by commercial laccase showed levels near 60% while the crude extract presented 80% in 24 h. PMID:21052547

Biodegradation of endocrine disruptors in urban wastewater using Pleurotus ostreatus bioreactor.

PubMed

Křesinová, Zdena; Linhartová, Lucie; Filipová, Alena; Ezechiáš, Martin; Mašín, Pavel; Cajthaml, Tomáš

2018-07-25

The white rot fungus Pleurotus ostreatus HK 35, which is also an edible industrial mushroom commonly cultivated in farms, was tested in the degradation of typical representatives of endocrine disrupters (EDCs; bisphenol A, estrone, 17β-estradiol, estriol, 17α-ethinylestradiol, triclosan and 4-n-nonylphenol); its degradation efficiency under model laboratory conditions was greater than 90% within 12 days and better than that of another published strain P. ostreatus 3004. A spent mushroom substrate from a local farm was tested for its applicability in various batch and trickle-bed reactors in degrading EDCs in model fortified and real communal wastewater. The reactors were tested under various regimes including a pilot-scale trickle-bed reactor, which was finally tested at a wastewater treatment plant. The result revealed that the spent substrate is an efficient biodegradation agent, where the fungus was usually able to remove about 95% of EDCs together with suppression of the estrogenic activity of the sample. The results showed the fungus was able to operate in the presence of bacterial microflora in wastewater without any substantial negative effects on the degradation abilities. Finally, a pilot-scale trickle-bed reactor was installed in a wastewater treatment plant and successfully operated for 10days, where the bioreactor was able to remove more than 76% of EDCs present in the wastewater. Copyright © 2017 Elsevier B.V. All rights reserved.

Lignocellulose degradation during solid-state fermentation: Pleurotus ostreatus versus Phanerochaete chrysosporium

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kerem, Z.; Friesem, D.; Hadar, Y.

Lignocellulose degradation and activities related to lignin degradation were studied in the solid-state fermentation of cotton stalks by comparison two white rot fungi, Pleurotus ostreatus and Phanerochaete chrysosporium. P. chrysosporium grew vigorously, resulting in rapid, nonselective degradation of 55% of the organic components of the cotton stalks within 15 days. In contrast, P. ostreatus grew more slowly with obvious selectivity for lignin degradation and resulting in the degradation of only 20% of the organic matter after 30 days of incubation. The kinetics of {sup 14}C-lignin mineralization exhibited similar differences. In cultures of P. chrysosporium, mineralization ceased after 18 days, resultingmore » in the release of 12% of the total radioactivity as {sup 14}CO{sub 2}. In P. ostreatus, on the other hand, 17% of the total radioactivity was released in a steady rate throughout a period of 60 days of incubation. Laccase activity was only detected in water extracts of the P. ostreatus fermentation. No lignin peroxidase activity was detected in either the water extract or liquid cultures of this fungus. 2-Keto-4-thiomethyl butyric acid cleavage to ethylene correlated to lignin degradation in both fungi. A study of fungal activity under solid-state conditions, in contrast to those done under defined liquid culture, may help to better understand the mechanism involved in lignocellulose degradation.« less

Bioactive formulations prepared from fruiting bodies and submerged culture mycelia of the Brazilian edible mushroom Pleurotus ostreatoroseus Singer.

PubMed

Corrêa, Rúbia Carvalho Gomes; de Souza, Aloisio Henrique Pereira; Calhelha, Ricardo C; Barros, Lillian; Glamoclija, Jasmina; Sokovic, Marina; Peralta, Rosane Marina; Bracht, Adelar; Ferreira, Isabel C F R

2015-07-01

Pleurotus ostreatoroseus is a Brazilian edible mushroom whose chemical characterization and bioactivity still remain underexplored. In this study, the hydrophilic and lipophilic compounds as well as the antioxidant, anti-inflammatory and antimicrobial activities of formulations (ethanol extracts) prepared with its fruiting bodies and submerged culture mycelia were compared. The bioactive formulations contain at least five free sugars, four organic acids, four phenolic compounds and two tocopherols. The fruiting body-based formulation revealed higher reducing power, DPPH scavenging activity, β-carotene bleaching inhibition and lipid peroxidation inhibition in brain homogenates than the mycelium-based preparation, as well as higher anti-inflammatory and antimicrobial activities. The absence of hepatotoxicity was confirmed in porcine liver primary cells. These functional responses can be related to the levels of bioactive components including phenolic acids, organic acids and tocopherols.

Co-cultivation of mutant Penicillium oxalicum SAU(E)-3.510 and Pleurotus ostreatus for simultaneous biosynthesis of xylanase and laccase under solid-state fermentation.

PubMed

Dwivedi, Pallavi; Vivekanand, V; Pareek, Nidhi; Sharma, Amit; Singh, Rajesh P

2011-10-01

Co-cultivation of mutant Penicillium oxalicum SAU(E)-3.510 and Pleurotus ostreatus MTCC 1804 was evaluated for the production of xylanase-laccase mixture under solid-state fermentation (SSF) condition. Growth compatibility between mutant P. oxalicum SAU(E)-3.510 and white rot fungi (P. ostreatus MTCC 1804, Trametes hirsuta MTCC 136 and Pycnoporus sp. MTCC 137) was analyzed by growing them on potato dextrose agar plate. Extracellular enzyme activities were determined spectrophotometrically. Under derived conditions, paired culturing of mutant P. oxalicum SAU(E)-3.510 and P. ostreatus MTCC 1804 resulted in 58% and 33% higher levels of xylanase and laccase production, respectively. A combination of sugarcane bagasse and black gram husk in a ratio of 3:1 was found to be the most ideal solid substrate and support for fungal colonization and enzyme production during co-cultivation. Maximum levels of xylanase (8205.31 ± 168.31 IU g(-1)) and laccase (375.53 ± 34.17 IU g(-1)) during SSF were obtained by using 4 g of solid support with 80% of moisture content. Furthermore, expressions of both xylanase and laccase were characterized during mixed culture by zymogram analysis. Improved levels of xylanase and laccase biosynthesis were achieved by co-culturing the mutant P. oxalicum SAU(E)-3.510 and P. ostreatus MTCC 1804. This may be because of efficient substrate utilization as compared to their respective monocultures in the presence of lignin degradation compounds because of synergistic action of xylanase and laccase. Understanding and developing the process of co-cultivation appears productive for the development of mixed enzyme preparation with tremendous potential for biobleaching. Copyright © 2011 Elsevier B.V. All rights reserved.

Evaluation of the Efficacy of Fermented By-product of Mushroom, Pleurotus ostreatus, as a Fish Meal Replacer in Juvenile Amur Catfish, Silurus asotus: Effects on Growth, Serological Characteristics and Immune Responses

PubMed Central

Katya, Kumar; Yun, Yong-hyun; Park, Gunhyun; Lee, Jeong-Yeol; Yoo, Gwangyeol; Bai, Sungchul C.

2014-01-01

The present experiment was conducted to evaluate the efficacy of dietary fermented by-product of mushroom, Pleurotus ostreatus, (FBPM) as a fish meal (FM) replacer in juvenile Amur catfish, Silurus asotus. A total number of 225 fish averaging 5.7±0.1 g (mean±standard deviation) were fed one of the five experimental diets formulated to replace FM with FBPM at 0%, 5%, 10%, 20%, and 30% (FBPM0, FBPM5, FBPM10, FBPM20, and FBPM30, respectively). At the end of eight weeks of the experiment, average weight gain (WG) of fish fed FBPM0 or FBPM5 were significantly higher than those of fish fed FBPM20 or FBPM30 diets (p<0.05). However, there was no significant differences in WG among the fish fed FBPM0, FBPM5 or FBPM10, and between fish fed FBPM10 or FBPM20, and also between those fed FBPM20 or FBPM30 diets. Lysozyme activity of fish fed FBPM0 or FBPM5 were significantly higher than those of fish fed FBPM10, FBPM20 or FBPM30 diets (p<0.05). The chemiluminescent response of fish fed FBPM5 was significantly higher than those of fish fed FBPM0, FBPM20 or FBPM30 diets (p<0.05). Broken line regression analysis of WG suggested that the maximal dietary inclusion level for FBPM as a FM replacer could be 6.3% without any adverse effects on whole body composition and on serological characteristics. Therefore, these results may indicate that the maximal dietary inclusion level of FBPM as a FM replacer could be 6.3% in juvenile Amur catfish. PMID:25178300

Hypoglycaemic activity of culinary Pleurotus ostreatus and P. cystidiosus mushrooms in healthy volunteers and type 2 diabetic patients on diet control and the possible mechanisms of action.

PubMed

Jayasuriya, W J A Banukie N; Wanigatunge, Chandanie A; Fernando, Gita H; Abeytunga, D Thusitha U; Suresh, T Sugandhika

2015-02-01

This study determined the oral hypoglycaemic effect of suspensions of freeze dried and powdered (SFDP) Pleurotus ostreatus (P.o) and Pleurotus cystidiosus (P.c), using healthy human volunteers and Type 2 diabetic patients on diet control at a dose of 50 mg/kg/body weight, followed by a glucose load. The possible hypoglycaemic mechanisms were evaluated using rats, by examining intestinal glucose absorption and serum levels of insulin, glucokinase (GK) and glycogen synthase kinase (GSK). The P.o and P.c showed a significant reduction (P < 0.05) in fasting and postprandial serum glucose levels of healthy volunteers and reduced the postprandial serum glucose levels and increased the serum insulin levels (P < 0.05) of Type 2 diabetic patients. The P.o and P.c increased the intestinal absorption of glucose but simultaneously reduced the serum glucose levels (P < 0.05) in rats. Both mushrooms reduced the serum GSK and promoted insulin secretion while P.c increased serum GK (P < 0.05). The hypoglycaemic activity of P.o and P.c makes mushrooms beneficial functional foods in diabetes mellitus. The mechanism of hypoglycaemic activity of P.o and P.c is possibly by increasing GK activity and promoting insulin secretion and thereby increasing the utilization of glucose by peripheral tissues, inhibiting GSK and promoting glycogen synthesis. Copyright © 2014 John Wiley & Sons, Ltd.

Determination of Lovastatin, β-glucan, Total Polyphenols, and Antioxidant Activity in Raw and Processed Oyster Culinary-Medicinal Mushroom, Pleurotus ostreatus (Higher Basidiomycetes).

PubMed

Lam, Yu Shan; Okello, Edward J

2015-01-01

The objective of this study was to quantify a number of bioactive compounds and antioxidant activity of the oyster mushroom, Pleurotus. Ostreatus, and characterize the effects of processing, such as blanching, on these outcomes. Dry matter content was 8%. Lovastatin was not detected in this study. β-glucan content of 23.9% and total polyphenol content of 487.12 mg gallic acid equivalent/100 g of dry matter were obtained in raw P. ostreatus. Antioxidant activities as evaluated by 1,1-diphenyl-2-picrylhydrazyl, Trolox equivalent antioxidant capacity, and ferric reducing antioxidant power assays in raw P. ostreatus were 14.46, 16.51, and 11.21 µmol/g, respectively. Blanching did not significantly affect β-glucan content but caused significant decrease in dry matter content, polyphenol content, and antioxidant activities. Mushroom rolls produced from blanched mushrooms and blanching water contained significantly higher amounts of β-glucan, total polyphenol content, and FRAP antioxidant activity compared to blanched mushrooms. In conclusion, P. ostreatus is a good source for β-glucan, dietary polyphenols, and antioxidants. Although the blanching process could affect these properties, re-addition of the blanching water during the production process of mushroom rolls could potentially recover these properties and is therefore recommended.

Fractionation, partial characterization and bioactivity of water-soluble polysaccharides and polysaccharide-protein complexes from Pleurotus geesteranus.

PubMed

Zhang, Mei; Zhu, Lin; Cui, Steve W; Wang, Qi; Zhou, Ting; Shen, Hengsheng

2011-01-01

Fractionation and purification of mushroom polysaccharides is a critical process for mushroom clinical application. After a hot-water treatment, the crude Pleurotus geesteranus (PG) was further fractionated into four fractions (PG-1, -2, -3, -4) using gradient precipitation with water and ammonia sulphate. By controlling the initial polymer concentration and ratio of solvents, this process produced PG fractions with high chemical uniformity and narrow Mw distribution without free proteins. Structurally, PG-1 and PG-2 are pure homopolysaccharide mainly composed of glucose; and PG-3 and PG-4 are heteropolysaccharide-protein complexes. PG-2, a high M(w) fraction mainly composed of glucose presented significant cytotoxicity at the concentration of 200 and 100 μg/ml to human breast cancer cells. Here, we report a new mushroom polysaccharides extraction and fractionation method, with which we produced four fractions of PG with PG-2 appearing effective anti-tumour activity. Crown Copyright © 2010. Published by Elsevier B.V. All rights reserved.

Deproteinization of water-soluble ß-glucan during acid extraction from fruiting bodies of Pleurotus ostreatus mushrooms.

PubMed

Szwengiel, Artur; Stachowiak, Barbara

2016-08-01

Some ß-glucans can be easily extracted from Basidiomycete mushrooms but commonly used extraction procedures are not satisfactory. A simultaneous method for acid extraction and deproteinization in the case of Pleurotus ostreatus was developed using response surface methodology. The optimized extraction conditions proposed here (30°C, 3.8% HCl, 300min, stirring) allow for the simultaneous extraction and deproteinization of polysaccharides. Additionally, the acid extraction yield was 7 times greater than that of hot water extraction. The combined enzymatic digestion with lyticase, ß-glucanase, exo-1,3-ß-d-glucanase, and ß-glucosidase results elucidated that an extract containing ß-1,3-ß-1,6-ß-1,4-glucan. The gel permeation chromatography (GPC) results showed that the two glucan fractions obtained do not contain linked proteins. The weight average molecular weight of the first fraction (Mw=1137kDa) was 60 times higher than that of the second fraction (Mw=19kDa). Copyright © 2016 Elsevier Ltd. All rights reserved.

A novel stirrer design and its application in submerged fermentation of the edible fungus Pleurotus ostreatus.

PubMed

Zhu, Hu; Sun, Jiao; Tian, Baozhen; Wang, Honglin

2015-03-01

In this study, a straight diagonal-pitched blade stirrer was designed, built and characterized in a 5-L fermenter. Compared with the six straight blade Rushton turbine, the power consumption of the new stirrer is lower at a given speed under conditions of no ventilation. The oxygen transference is poorer at the same agitation speed in the cultivation conditions and scales investigated, which confirms that the shear stress of the new stirrer is lower and the gas dispersion is weaker. The new stirrer was installed in a 5-L bioreactor and evaluated in submerged fermentation of the edible fungus Pleurotus ostreatus. The results showed that the maximum dry weight of mycelium is increased by 47 % and reached 7.47 g/L, and the maximum laccase activity is increased by 15 % up to 2,277 U/L. Glucose consumption was also found to be relatively faster. The power consumption is 2.8 % lower than that of the Rushton turbine.

Reproducible and controllable light induction of in vitro fruiting of the white-rot basidiomycete Pleurotus ostreatus.

PubMed

Arjona, Davinia; Aragón, Carlos; Aguilera, José Antonio; Ramírez, Lucía; Pisabarro, Antonio G

2009-05-01

Fruiting is a crucial developmental process in basidiomycetes yet the genetic and molecular factors that control it are not yet fully understood. The search for fruiting inducers is of major relevance for both basic research and for their use in industrial applications. In this paper, an efficient and reproducible protocol for controlled fruiting induction of Pleurotus ostreatus growing on synthetic medium is described. The protocol is based on the control of light intensity and photoperiod and permits the life cycle for this fungus to be completed in less than two weeks. The fruiting bodies produced by this method release fertile spores after 4-5 d of culture. Our results indicate that fruiting induction is solely dependent on the illumination regime and that it occurs long before the available nutrients are depleted in the culture. This protocol will greatly facilitate molecular and developmental biology research in this fungus as it avoids the need for complex culture media based on lignocellulosic materials or the use of chemical inducers.

The Amoebicidal Effect of Ergosterol Peroxide Isolated from Pleurotus ostreatus.

PubMed

Meza-Menchaca, Thuluz; Suárez-Medellín, Jorge; Del Ángel-Piña, Christian; Trigos, Ángel

2015-12-01

Dysentery is an inflammation of the intestine caused by the protozoan parasite Entamoeba histolytica and is a recurrent health problem affecting millions of people worldwide. Because of the magnitude of this disease, finding novel strategies for treatment that does not affect human cells is necessary. Ergosterol peroxide is a sterol particularly known as a major cytotoxic agent with a wide spectrum of biological activities produced by edible and medicinal mushrooms. The aim of this report is to evaluate the amoebicidal activity of ergosterol peroxide (5α, 8α-epidioxy-22E-ergosta-6,22-dien-3β-ol isolated from 5α, 8α-epidioxy-22E-ergosta-6,22-dien-3β-ol) (Jacq.) P. Kumm. f. sp. Florida. Our results show that ergosterol peroxide produced a strong cytotoxic effect against amoebic growth. The inhibitory concentration IC50 of ergosterol peroxide was evaluated. The interaction between E. histolytica and ergosterol peroxide in vitro resulted in strong amoebicidal activity (IC50  = 4.23 nM) that may be due to the oxidatory effect on the parasitic membrane. We also tested selective toxicity of ergosterol peroxide using a cell line CCL-241, a human epithelial cell line isolated from normal human fetal intestinal tissue. To the best of our knowledge, this is the first report on the cytotoxicity of ergosterol peroxide against E. histolytica, which uncovers a new biological property of the lipidic compound isolated from Pleurotus ostreatus (Jacq.) P. Kumm. f. sp. Florida. Copyright © 2015 John Wiley & Sons, Ltd.

Water-soluble polysaccharides from Pleurotus ostreatus var. florida mycelial biomass.

PubMed

Komura, Dirce L; Ruthes, Andrea C; Carbonero, Elaine R; Gorin, Philip A J; Iacomini, Marcello

2014-09-01

Pleurotus ostreatus var. florida known as Hiratake has a high nutritional value, presents medicinal and nutraceutical properties and it is one of the consumed mushrooms in Brazil. Thus, the aim of this study was to characterize the chemical structure of polysaccharides found in mycelial biomass produced by submerged culture of P. ostreatus var. florida in order to compare with those found in P. ostreatus var. florida fruit bodies. Aqueous and alkali extracts obtained from mycelial biomass were purified, 13C NMR, GC-MS and chemical techniques were used to characterize three polysaccharide structures: a mannogalactan (MG-PfM) with α-D-Galp and 3-O-Me-α-D-Galp units, both (1→6)-linked, highly substituted at O-2 by D-Manp, a glycogen-like polymer (GLY-PfM) with α-D-Glp (1→4)-linked main chain, partially substituted at O-6 by α-D-Glcp side chains and a (1→3), (1→6) β-D-glucan (βGLC-PfM) with a main chain of β-D-Glcp (1→3)-linked units, partially substituted at O-6 by side chains of 6-O-substituted β-D-glucopyranosyl units, on an average of one to every two residues of the backbone. These results show the possibility to obtain similar and also different molecules from those found in the fruiting body of the same mushroom species, therefore the submerged culture of mushroom is a promising way to give raise molecules of interest. Copyright © 2014. Published by Elsevier B.V.

Bioremediation of aflatoxin B1-contaminated maize by king oyster mushroom (Pleurotus eryngii).

PubMed

Branà, Maria Teresa; Cimmarusti, Maria Teresa; Haidukowski, Miriam; Logrieco, Antonio Francesco; Altomare, Claudio

2017-01-01

Aflatoxin B1 (AFB1) is the most harmful mycotoxin that occurs as natural contaminant of agricultural commodities, particularly maize. Practical solutions for detoxification of contaminated staples and reduction of agricultural wastes are scarce. We investigated the capability of the white-rot and edible fungus Plerotus eryngii (king oyster mushroom) to degrade AFB1 both in vitro and in a laboratory-scale mushroom cultivation, using a substrate similar to that routinely used in mushroom farms. In malt extract broth, degradation of AFB1 (500 ng/mL) by nine isolates of P. eryngii ranged from 81 to 99% after 10 days growth, and reached 100% for all isolates after 30 days. The growth of P. eryngii on solid medium (malt extract-agar, MEA) was significantly reduced at concentrations of AFB1 500 ng/mL or higher. However, the addition of 5% wheat straw to the culture medium increased the tolerance of P. eryngii to AFB1 and no inhibition was observed at a AFB1 content of 500 ng/mL; degradation of AFB1 in MEA supplemented with 5% wheat straw and 2.5% (w/v) maize flour was 71-94% after 30 days of growth. Further, AFB1 degradation by P. eryngii strain ITEM 13681 was tested in a laboratory-scale mushroom cultivation. The mushroom growth medium contained 25% (w/w) of maize spiked with AFB1 to the final content of 128 μg/kg. Pleurotus eryngii degraded up to 86% of the AFB1 in 28 days, with no significant reduction of either biological efficiency or mushroom yield. Neither the biomass produced on the mushroom substrate nor the mature basidiocarps contained detectable levels of AFB1 or its metabolite aflatoxicol, thus ruling out the translocation of these toxins through the fungal thallus. These findings make a contribution towards the development of a novel technology for remediation of AFB1- contaminated corn through the exploitation of the degradative capability of P. eryngii and its bioconversion into high nutritional value material intended for feed production.

Protein and gene structure of a blue laccase from Pleurotus ostreatus1.

PubMed Central

Giardina, P; Palmieri, G; Scaloni, A; Fontanella, B; Faraco, V; Cennamo, G; Sannia, G

1999-01-01

A new laccase isoenzyme (POXA1b, where POX is phenol oxidase), produced by Pleurotus ostreatus in cultures supplemented with copper sulphate, has been purified and fully characterized. The main characteristics of this protein (molecular mass in native and denaturing conditions, pI and catalytic properties) are almost identical to the previously studied laccase POXA1w. However, POXA1b contains four copper atoms per molecule instead of one copper, two zinc and one iron atom per molecule of POXA1w. Furthermore, POXA1b shows an unusually high stability at alkaline pH. The gene and cDNA coding for POXA1b have been cloned and sequenced. The gene coding sequence contains 1599 bp, interrupted by 15 introns. Comparison of the structure of the poxa1b gene with the two previously studied P. ostreatus laccase genes (pox1 and poxc) suggests that these genes belong to two different subfamilies. The amino acid sequence of POXA1b deduced from the cDNA sequence has been almost completely verified by means of matrix-assisted laser desorption ionization MS. It has been demonstrated that three out of six putative glycosylation sites are post-translationally modified and the structure of the bound glycosidic moieties has been determined, whereas two other putative glycosylation sites are unmodified. PMID:10417329

Fungicide Sensitivity and Characterization of Cobweb Disease on a Pleurotus eryngii Mushroom Crop Caused by Cladobotryum mycophilum

PubMed Central

Kim, Min Keun; Seuk, Su Won; Lee, Young Han; Kim, Hye Ran; Cho, Kye Man

2014-01-01

In 2009–2010, unusual symptoms were observed on Pleurotus eryngii grown in mushroom farms in Gyeongnam Province, Republic of Korea. One of the main symptoms was a cobweb-like growth of fungal mycelia over the surface of the mushroom. The colonies on the surface rapidly overwhelmed the mushrooms and developed several spores within 3–4 days. The colonized surface turned pale brown or yellow. The fruit body eventually turned dark brown and became rancid. Koch’s postulates were completed by spraying and spotting using isolated strains. The phylogenetic tree obtained from the internal transcribed spacer sequence analysis showed that the isolated fungal pathogen corresponded to Cladobotryum mycophilum (99.5%). In the fungicide sensitivity tests, the ED50 values for the isolate with respect to benomyl and carbendazim were from 0.29 to 0.31 ppm. Benzimidazole fungicides were most effective against C. mycophilum, a causal agent of cobweb disease in P. eryngii. PMID:25288989

In vivo bioavailability of selenium in enriched Pleurotus ostreatus mushrooms.

PubMed

da Silva, Marliane C S; Naozuka, Juliana; Oliveira, Pedro V; Vanetti, Maria C D; Bazzolli, Denise M S; Costa, Neuza M B; Kasuya, Maria C M

2010-02-01

The in vivo bioavailability of Se was investigated in enriched Pleurotus ostreatus mushrooms. A bioavailability study was performed using 64 Wistar male rats separated in 8 groups and fed with different diets: without Se, with mushrooms without Se, with enriched mushrooms containing 0.15, 0.30 or 0.45 mg kg(-1) Se and a normal diet containing 0.15 mg kg(-1) of Se using sodium selenate. The experiment was performed in two periods: depletion (14 days) and repletion (21 days), according to the Association of Official Analytical Chemists. After five weeks, the rats were sacrificed under carbon dioxide, and blood was drawn by heart puncture. Blood plasma was separated by centrifugation. The total Se concentration in the plasma of rats fed with enriched mushrooms was higher than in rats fed with a normal diet containing sodium selenate. The plasma protein profiles were obtained using size exclusion chromatography (SEC) and UV detectors. Aliquots of effluents (0.5 mL per minute) were collected throughout in the end of the chromatographic column. However, Se was determined by graphite furnace atomic absorption spectrometry (GF AAS) only in the aliquots where proteins were detected by SEC-UV. The plasma protein profile of rats fed with different diets was similar. The highest Se concentration was observed in a peptide presenting 8 kDa. Furthermore, the higher Se concentration in this peptide was obtained for rats fed with a diet using enriched mushrooms (7 μg L(-1) Se) compared to other diets (2-5 μg L(-1) Se). These results showed that Se-enriched mushrooms can be considered as an alternative Se food source for humans, due to their high bioavailability.

Antihyperlipidemic effects of Pleurotus ostreatus (oyster mushrooms) in HIV-infected individuals taking antiretroviral therapy.

PubMed

Abrams, Donald I; Couey, Paul; Shade, Starley B; Kelly, Mary Ellen; Kamanu-Elias, Nnemdi; Stamets, Paul

2011-08-10

Antiretroviral treatment (ART) regimens in HIV patients commonly cause significant lipid elevations, including increases in both triglycerides and cholesterol. Standard treatments for hypercholesterolemia include the HMG CoA reductase inhibitors, or "statins." Because many ART agents and statins share a common metabolic pathway that uses the cytochrome P450 enzyme system, coadministration of ART with statins could increase statin plasma levels significantly. The oyster mushroom, Pleurotus ostreatus, has been shown in animal models to decrease lipid levels--a finding that has been supported by preliminary data in a small human trial. To assess the safety and efficacy of P. ostreatus in patients with HIV and ART-induced hyperlipidemia, a single-arm, open-label, proof-of-concept study of 8 weeks' duration with a target enrollment of 20 subjects was conducted. Study patients with ART-induced elevated non-HDL cholesterol levels (> 160 mg/dL) were enrolled. Participants received packets of freeze-dried P. ostreatus (15 gm/day) to be administered orally for the 8 week trial period. Lipid levels were drawn every two weeks to assess efficacy. Safety assessments included self-reported incidence of muscle aches and measurement of liver and muscle enzymes. Mean within-person change in lipid levels were estimated using generalized estimating equations to account for repeated observations on individuals. A 30 mg/dL decrease in non-HDL cholesterol was deemed clinically significant. 126 patients were screened to enroll 25, of which 20 completed the 8-week study. The mean age was 46.4 years (36-60). Patients had a mean 13.7 yrs of HIV infection. Mean non-HDL cholesterol was 204.5 mg/dL at day 0 and 200.2 mg/dL at day 56 (mean within-person change = -1.70; 95% confidence interval (CI) = -17.4, 14.0). HDL cholesterol levels increased from 37.8 mg/dL at day 0 to 40.4 mg/dL on day 56 (mean within-person change = 2.6; 95% CI = -0.1, 5.2). Triglycerides dropped from 336.4 mg/dL on day 0

A polysaccharide-peptide complex from abalone mushroom (Pleurotus abalonus) fruiting bodies increases activities and gene expression of antioxidant enzymes and reduces lipid peroxidation in senescence-accelerated mice.

PubMed

Li, L; Ng, T B; Song, M; Yuan, F; Liu, Z K; Wang, C L; Jiang, Y; Fu, M; Liu, F

2007-06-01

The antioxidant effects of a polysaccharide-peptide complex (F22) from mushroom (Pleurotus abalonus)-fruiting bodies were studied. The activities of superoxide dismutase (SOD), catalase (CAT), and glutathione peroxidase (GPx) in the liver, kidney, and brain of senescence-accelerated mice showed a marked increase after treatment with the polysaccharide-peptide complex. Concurrently, the gene expression levels of SOD, CAT, and GPx, as determined with real-time polymerase chain reaction, were up-regulated in the liver, kidney, and brain, whereas the MDA content in these organs declined. The maximal lifespan of the mice was prolonged.

Structure Identification of Triterpene from the Mushroom Pleurotus eryngii with Inhibitory Effects Against Breast Cancer.

PubMed

Xue, Zhaohui; Li, Jiaomei; Cheng, Aiqing; Yu, Wancong; Zhang, Zhijun; Kou, Xiaohong; Zhou, Fengjuan

2015-09-01

Breast cancer is the leading cause of death among women, with approximately 1 million diagnoses annually. Triterpenoids, which have cancer preventive or anti-tumour efficacy towards various tumour cells, may play a role in breast cancer prevention. In our previous study, an acetic ether (EtOAc) fraction from the sporocarp of the edible mushroom Pleurotus eryngii (P. eryngii) exhibited significant tumour cell growth inhibition both in vitro and in vivo. In this study, three pentacyclic triterpenoid compounds (1-3) were isolated from EtOAc extracts using chromatographic separation and were identified using nuclear magnetic resonance (NMR) and mass spectrometry (MS). The compounds were 2, 3, 6, 23-tetrahydroxy-urs-12-en-28 oic acid (1), 2,3,23-trihydroxy-urs-12-en-28 oic acid (2) and lupeol (3). All three purified triterpenes showed significant inhibitory activity against breast cancer MCF-7 cell lines in vitro, with the greatest activity exhibited by compound 1, followed by compound 2 and 3. The IC(50) values were 15.71, 48 and 66.89 μM, respectively. Our study may help elucidate the health benefits of P. eryngii mushroom consumption.

Sesquiterpenoids with PTP1B Inhibitory Activity and Cytotoxicity from the Edible Mushroom Pleurotus citrinopileatus.

PubMed

Tao, Qiao-Qiao; Ma, Ke; Bao, Li; Wang, Kai; Han, Jun-Jie; Wang, Wen-Zhao; Zhang, Jin-Xia; Huang, Chen-Yang; Liu, Hong-Wei

2016-05-01

One new perhydrobenzannulated 5,5-spiroketal sesquiterpene, pleurospiroketal F (1), as well as six new modified bisabolene sesquiterpenes pleurotins A-F (2-7) were isolated from solid-state fermentation of Pleurotus citrinopileatus. The structures of compounds 1-7 were determined by NMR and MS spectroscopic analysis. The absolute configuration of 1 was determined by X-ray diffraction analysis, while the absolute configurations of 3-7 were assigned using the in situ dimolybdenum circular dichroism method and circular dichroism data comparison. Protein tyrosine phosphatase 1B plays a crucial role as a negative regulator of the insulin-dependent signal cascades. Therefore, the protein tyrosine phosphatase 1B inhibitor can be used for treating type 2 diabetes mellitus and obesity. Compounds 2 and 6 showed moderate inhibitory effects on protein tyrosine phosphatase 1B with IC50 s of 32.1 µM and 30.5 µM, respectively. The kinetic study confirmed compound 2 to be a noncompetitive inhibitor. Compounds 1-7 did not show cytotoxic activity against cancer cell lines (IC50 > 50 µM). Georg Thieme Verlag KG Stuttgart · New York.

Secretome analysis of Pleurotus eryngii reveals enzymatic composition for ramie stalk degradation.

PubMed

Xie, Chunliang; Luo, Wei; Li, Zhimin; Yan, Li; Zhu, Zuohua; Wang, Jing; Hu, Zhenxiu; Peng, Yuande

2016-01-01

Pleurotus eryngii (P. eryngii) can secrete large amount of hydrolytic and oxidative enzymes to degrade lignocellulosic biomass. In spite of several researches on the individual lignolytic enzymes, a direct deconstruction of lignocellulose by enzyme mixture is not yet possible. Identifying more high-performance enzymes or enzyme complexes will lead to efficient in vitro lignocelluloses degradation. In this report, secretomic analysis was used to search for the new or interesting enzymes for lignocellulose degradation. Besides, the utilization ability of P. eryngii to ramie stalk substrate was evaluated from the degradation of cellulose, hemicellulose, and lignin in medium and six extracellular enzymes activities during different growth stages were discussed. The results showed that a high biological efficiency of 71% was obtained; cellulose, hemicelluloses, and lignin decomposition rates of P. eryngii were 29.2, 26.0, and 51.2%, respectively. Enzyme activity showed that carboxymethyl cellulase, xylanase, laccase, and peroxidase activity peaks appeared at the primordial initiation stage. In addition, we profiled a global view of the secretome of P. eryngii cultivated in ramie stalk media to understand the mechanism behind lignocellulosic biomass hydrolysis. Eighty-seven nonredundant proteins were identified and a diverse group of enzymes, including cellulases, hemicellulases, pectinase, ligninase, protease, peptidases, and phosphatase implicated in lignocellulose degradation were found. In conclusion, the information in this report will be helpful to better understand the lignocelluloses degradation mechanisms of P. eryngii. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Toughening and its association with the postharvest quality of king oyster mushroom (Pleurotus eryngii) stored at low temperature.

PubMed

Li, Danqing; Qin, Xiaoyi; Tian, Pingping; Wang, Jie

2016-04-01

Toughening-induced textural decay easily occurs in stored mushrooms. The objective of this study was to investigate the textural alteration caused by toughening in relation to other quality attributes of king oyster mushroom (Pleurotus eryngii). Fresh king oyster mushrooms, packed in low-density polyethylene bags, were stored at different low temperatures for 18 days to measure textural and other quality attributes. It was found that toughening occurred twice during the entire storage time. Highly associated change profiles were observed for the lignin content and activities of three important enzymes involved in lignin synthesis. The chitin and cellulose contents exhibited low correlation with toughening. Malondialdehyde content, electrolyte leakage rate and total phenolics content appeared to be related to toughening, but the browning index showed a negative correlation with toughening. Our results suggested that toughening may be mainly caused by lignification and can affect the postharvest quality of the tested mushrooms. Copyright © 2015 Elsevier Ltd. All rights reserved.

Biosorption of malachite green from aqueous solutions by Pleurotus ostreatus using Taguchi method

PubMed Central

2014-01-01

Dyes released into the environment have been posing a serious threat to natural ecosystems and aquatic life due to presence of heat, light, chemical and other exposures stable. In this study, the Pleurotus ostreatus (a macro-fungus) was used as a new biosorbent to study the biosorption of hazardous malachite green (MG) from aqueous solutions. The effective disposal of P. ostreatus is a meaningful work for environmental protection and maximum utilization of agricultural residues. The operational parameters such as biosorbent dose, pH, and ionic strength were investigated in a series of batch studies at 25°C. Freundlich isotherm model was described well for the biosorption equilibrium data. The biosorption process followed the pseudo-second-order kinetic model. Taguchi method was used to simplify the experimental number for determining the significance of factors and the optimum levels of experimental factors for MG biosorption. Biosorbent dose and initial MG concentration had significant influences on the percent removal and biosorption capacity. The highest percent removal reached 89.58% and the largest biosorption capacity reached 32.33 mg/g. The Fourier transform infrared spectroscopy (FTIR) showed that the functional groups such as, carboxyl, hydroxyl, amino and phosphonate groups on the biosorbent surface could be the potential adsorption sites for MG biosorption. P. ostreatus can be considered as an alternative biosorbent for the removal of dyes from aqueous solutions. PMID:24620852

Purification, Characterization, and Functional Role of a Novel Extracellular Protease from Pleurotus ostreatus

PubMed Central

Palmieri, Gianna; Bianco, Carmen; Cennamo, Giovanna; Giardina, Paola; Marino, Gennaro; Monti, Maria; Sannia, Giovanni

2001-01-01

A new extracellular protease (PoSl; Pleurotus ostreatus subtilisin-like protease) from P. ostreatus culture broth has been purified and characterized. PoSl is a monomeric glycoprotein with a molecular mass of 75 kDa, a pI of 4.5, and an optimum pH in the alkaline range. The inhibitory profile indicates that PoSl is a serine protease. The N-terminal and three tryptic peptide sequences of PoSl have been determined. The homology of one internal peptide with conserved sequence around the Asp residue of the catalytic triad in the subtilase family suggests that PoSl is a subtilisin-like protease. This hypothesis is further supported by the finding that PoSl hydrolysis sites of the insulin B chain match those of subtilisin. PoSl activity is positively affected by calcium. A 10-fold decrease in the Km value in the presence of calcium ions can reflect an induced structural change in the substrate recognition site region. Furthermore, Ca2+ binding slows PoSl autolysis, triggering the protein to form a more compact structure. These effects have already been observed for subtilisin and other serine proteases. Moreover, PoSl protease seems to play a key role in the regulation of P. ostreatus laccase activity by degrading and/or activating different isoenzymes. PMID:11375191

Biosorption of malachite green from aqueous solutions by Pleurotus ostreatus using Taguchi method.

PubMed

Chen, Zhengsuo; Deng, Hongbo; Chen, Can; Yang, Ying; Xu, Heng

2014-03-12

Dyes released into the environment have been posing a serious threat to natural ecosystems and aquatic life due to presence of heat, light, chemical and other exposures stable. In this study, the Pleurotus ostreatus (a macro-fungus) was used as a new biosorbent to study the biosorption of hazardous malachite green (MG) from aqueous solutions. The effective disposal of P. ostreatus is a meaningful work for environmental protection and maximum utilization of agricultural residues.The operational parameters such as biosorbent dose, pH, and ionic strength were investigated in a series of batch studies at 25°C. Freundlich isotherm model was described well for the biosorption equilibrium data. The biosorption process followed the pseudo-second-order kinetic model. Taguchi method was used to simplify the experimental number for determining the significance of factors and the optimum levels of experimental factors for MG biosorption. Biosorbent dose and initial MG concentration had significant influences on the percent removal and biosorption capacity. The highest percent removal reached 89.58% and the largest biosorption capacity reached 32.33 mg/g. The Fourier transform infrared spectroscopy (FTIR) showed that the functional groups such as, carboxyl, hydroxyl, amino and phosphonate groups on the biosorbent surface could be the potential adsorption sites for MG biosorption. P. ostreatus can be considered as an alternative biosorbent for the removal of dyes from aqueous solutions.

Evaluation of the Synergistic Effect of Mixed Cultures of White-Rot Fungus Pleurotus ostreatus and Biosurfactant-Producing Bacteria on DDT Biodegradation.

PubMed

Purnomo, Adi Setyo; Ashari, Khoirul; Hermansyah, Farizha Triyogi

2017-07-28

DDT (1,1,1-trichloro-2,2- bis (4-chlorophenyl) ethane) is one of the organic synthetic pesticides that has many negative effects for human health and the environment. The purpose of this study was to investigate the synergistic effect of mixed cutures of white-rot fungus, Pleurotus ostreatus , and biosurfactant-producing bacteria, Pseudomonas aeruginosa and Bacillus subtilis , on DDT biodegradation. Bacteria were added into the P. ostreatus culture (mycelial wet weight on average by 8.53 g) in concentrations of 1, 3, 5, and 10 ml (1 ml ≈ 1.25 × 10 9 bacteria cells/ml culture). DDT was degraded to approximately 19% by P. ostreatus during the 7-day incubation period. The principal result of this study was that the addition of 3 ml of P. aeruginosa into P. ostreatus culture gave the highest DDT degradation rate (approximately 86%) during the 7-day incubation period. This mixed culture combination of the fungus and bacteria also gave the best ratio of optimization of 1.91. DDD (1,1-dichloro-2,2- bis (4-chlorophenyl) ethane), DDE (1,1-dichloro-2,2- bis (4-chlorophenyl) ethylene), and DDMU (1-chloro-2,2- bis (4-chlorophenyl) ethylene) were detected as metabolic products from the DDT degradation by P. ostreatus and P. aeruginosa . The results of this study indicate that P. aeruginosa has a synergistic relationship with P. ostreatus and can be used to optimize the degradation of DDT by P. ostreatus .

Antitumor effect of culinary-medicinal oyster mushroom, Pleurotus ostreatus (Jacq.: Fr.) P. Kumm., derived protein fraction on tumor-bearing mice models.

PubMed

Maiti, Swatilekha; Mallick, Sanjaya Kumar; Bhutia, Sujit Kumar; Behera, Birendra; Mandal, Mohitosh; Maiti, Tapas K

2011-01-01

Previously, we reported the in vitro anticancer and immunomodulatory effect of a protein fraction designated as Cibacron blue affinity purified protein (CBAEP) obtained from the culinary-medicinal oyster mushroom, Pleurotus ostreatus. In the present study, we investigated the in vivo antitumor potential of CBAEP in different tumor-bearing mice models and studied the detailed mechanism of tumor regression in Dalton lymphoma (DL)-bearing mice. The lethal dose (LD50) of CBAEP was found to be 55 mg/kg body weight and sublethal doses (5 mg/kg and 10 mg/kg body weight) showed a prolonged tumor survival time in DL, Sarcoma-180, and B16F0 melanoma tumor-bearing mice. Further, CBAEP reduced about 35.68 and 51.43% DL cell growth in 5 and 10 mg/kg body weight, respectively. The in vivo CBAEP treatment showed an apoptotic feature as demonstrated in morphological study and sub-G0/G1 population in cell cycle and Western blot of DL cells. CBAEP also activated immunosuppression condition in DL tumor-bearing host. It also stimulated immune cells in the presence of nonspecific immunostunulator (LPS and ConA) ex vivo as well as enhanced Th1 response with production of TNF-α, IFN-γ, and IL-2. Moreover, it activated tumor-associated macrophages and NK cells. The present findings revealed the potent antitumor property of CBAEP, which might help in developing a new anticancer drug.

Optimization of substrate preparation for oyster mushroom (Pleurotus ostreatus) cultivation by studying different raw materials and substrate preparation conditions (composting: phases I and II).

PubMed

Vieira, Fabrício Rocha; de Andrade, Meire Cristina Nogueira

2016-11-01

In recent years, oyster mushroom (Pleurotus ostreatus) has become one of the most cultivated mushrooms in the world, mainly in Brazil. Among many factors involved in a mushroom production, substrate preparation is the most critical step, which can be influenced by composting management techniques. Looking forward to optimizing the substrate preparation process, were tested different composting conditions (7 and 14 days of composting with or without conditioning), potential raw materials (decumbens grass, brizantha grass and sugarcane straw) and nitrogen supplementation (with or without wheat bran) on oyster mushroom yield and biological efficiency (BE). The substrate composted for 7 days with conditioning showed higher yield and biological efficiency of mushroom (24.04 and 100.54 %, respectively). Substrates without conditioning (7 and 14 days of composting) showed smaller mushroom yield and biological efficiency. Among the raw materials tested, brizantha grass showed higher mushroom yield followed by decumbens grass, sugarcane straw and wheat straw (28.5, 24.32, 23.5 and 19.27 %, respectively). Brizantha grass also showed higher biological efficiency followed by sugarcane straw, decumbens grass and wheat straw (123.95, 103.70, 96.90 and 86.44 %, respectively). Supplementation with wheat bran improved yield and biological efficiency in all substrate formulations tested; thus, oyster mushroom yield and biological efficiency were influenced by substrate formulation (raw materials), supplementation and composting conditions.

Fates of nickel and fluoranthene during the bioremediation by Pleurotus eryngii in three different soils.

PubMed

Tang, Xia; Dong, Shunwen; Shi, Wenjin; Gao, Ni; Zuo, Lei; Xu, Heng

2016-11-01

This study focused on the bioremediation role of Pleurotus eryngii in different characteristics soils contaminated with nickel (Ni) and fluoranthene. The results of bioremediation experiments showed that fluoranthene had a positive effect on the growth of P. eryngii, whereas Ni exerted a negative influence. The concentration of fluoranthene significantly decreased in inoculated soil accounting for 86.39-91.95% of initial concentration in soils and 71.46-81.76% in non-inoculated soils, which showed that the dissipation of fluoranthene was enhanced by mushroom inoculating. The highest removal rates of fluoranthene in sandy loam, loamy clay, and sandy soils reached to 87.81, 86.39, and 91.95%, respectively, which demonstrated that P. eryngii was more suitable for the bioremediation of sandy soil contaminated with fluoranthene. In addition, the presence of Ni tended to decrease the dissipation of fluoranthene in inoculated soil. Higher ligninolytic enzymes activities were detected in inoculated soils, resulting in the enhanced dissipation of fluoranthene in inoculated soils. Furthermore, P. eryngii had the ability to uptake Ni (4.88-39.53 mg kg -1 ) in co-contamination soil. In conclusion, the inoculating of P. eryngii was effective in remediating of Ni-fluoranthene co-contaminated soils. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Phylogenetic Relationship in Different Commercial Strains of Pleurotus nebrodensis Based on ITS Sequence and RAPD.

PubMed

Alam, Nuhu; Shim, Mi Ja; Lee, Min Woong; Shin, Pyeong Gyun; Yoo, Young Bok; Lee, Tae Soo

2009-09-01

The molecular phylogeny in nine different commercial cultivated strains of Pleurotus nebrodensis was studied based on their internal transcribed spacer (ITS) region and RAPD. In the sequence of ITS region of selected strains, it was revealed that the total length ranged from 592 to 614 bp. The size of ITS1 and ITS2 regions varied among the strains from 219 to 228 bp and 211 to 229 bp, respectively. The sequence of ITS2 was more variable than ITS1 and the region of 5.8S sequences were identical. Phylogenetic tree of the ITS region sequences indicated that selected strains were classified into five clusters. The reciprocal homologies of the ITS region sequences ranged from 99 to 100%. The strains were also analyzed by RAPD with 20 arbitrary primers. Twelve primers were efficient to applying amplification of the genomic DNA. The sizes of the polymorphic fragments obtained were in the range of 200 to 2000 bp. RAPD and ITS analysis techniques were able to detect genetic variation among the tested strains. Experimental results suggested that IUM-1381, IUM-3914, IUM-1495 and AY-581431 strains were genetically very similar. Therefore, all IUM and NCBI gene bank strains of P. nebrodensis were genetically same with some variations.

Gene cloning, expression, and characterization of trehalose-6-phosphate synthase from Pleurotus ostreatus.

PubMed

Lei, Min; Wu, Xiangli; Zhang, Jinxia; Wang, Hexiang; Huang, Chenyang

2017-07-01

Trehalose-6-phosphate synthase (TPS; EC2.4.1.15) catalyzes the first step in trehalose synthesis, which involves transfer of glucose from uridine diphosphate glucose (UDPG) to glucose 6-phosphate (G6P) to form trehalose-6-phosphate. To determine the gene and enzymatic characteristics of TPS in Pleurotus ostreatus, we cloned and sequenced the cDNA of PoTPS1, which contains a 1665 bp open reading frame that encodes a 554-amino acid protein with a predicted molecular weight of 62.01 kDa. This gene was expressed in Escherichia coli BL21 and then the recombinant protein was purified and characterized. Results showed that the optimum pH and temperature for the recombinant PoTPS1 were 7.4 and 30 °C, respectively; the K m value against G6P and UDPG were 0.14 and 0.17 mM, respectively, and the V max and K cat values were 91.86 nkat/g and 5.89 s -1 , respectively. Trehalose content was as high as 158.88 mg g -1 dry weight after heat treatment at 40 °C for 15 h, which was consistent with highest TPS1 activity at that time point. This result indicated that PoTPS1 was responsible for trehalose synthesis in P. ostreatus. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Strategies for dephenolization of raw olive mill wastewater by means of Pleurotus ostreatus.

PubMed

Olivieri, Giuseppe; Russo, Maria Elena; Giardina, Paola; Marzocchella, Antonio; Sannia, Giovanni; Salatino, Piero

2012-05-01

The reduction of polyphenols content in olive mill wastewater (OMW) is a major issue in olive oil manufacturing. Although researchers have pointed out the potential of white-rot fungus in dephenolizing OMW, the results available in the literature mainly concern pretreated (sterilized) OMW. This paper deals with the reduction of polyphenols content in untreated OMW by means of a white-rot fungus, Pleurotus ostreatus. Dephenolization was performed both in an airlift bioreactor and in aerated flasks. The process was carried out under controlled non-sterile conditions, with different operating configurations (batch, continuous, biomass recycling) representative of potential industrial operations. Total organic carbon, polyphenols concentration, phenol oxidase activity, dissolved oxygen concentration, oxygen consumption rate, and pH were measured during every run. Tests were carried out with or without added nutrients (potato starch and potato dextrose) and laccases inducers (i.e., CuSO₄). OMW endogenous microorganisms were competing with P. ostreatus for oxygen during simultaneous fermentation. Dephenolization of raw OMW by P. ostreatus under single batch was as large as 70%. Dephenolization was still extensive even when biomass was recycled up to six times. OMW pre-aeration had to be provided under continuous operation to avoid oxygen consumption by endogenous microorganisms that might spoil the process. The role of laccases in the dephenolization process has been discussed. Dephenolization under batch conditions with biomass recycling and added nutrients proved to be the most effective configuration for OMW polyphenols reduction in industrial plants (42-68% for five cycles).

Relationship between Monokaryotic Growth Rate and Mating Type in the Edible Basidiomycete Pleurotus ostreatus

PubMed Central

Larraya, Luis M.; Pérez, Gúmer; Iribarren, Iñaki; Blanco, Juan A.; Alfonso, Mikel; Pisabarro, Antonio G.; Ramírez, Lucía

2001-01-01

The edible fungus Pleurotus ostreatus (oyster mushroom) is an industrially produced heterothallic homobasidiomycete whose mating is controlled by a bifactorial tetrapolar genetic system. Two mating loci (matA and matB) control different steps of hyphal fusion, nuclear migration, and nuclear sorting during the onset and progress of the dikaryotic growth. Previous studies have shown that the segregation of the alleles present at the matB locus differs from that expected for a single locus because (i) new nonparental B alleles appeared in the progeny and (ii) there was a distortion in the segregation of the genomic regions close to this mating locus. In this study, we pursued these observations by using a genetic approach based on the identification of molecular markers linked to the matB locus that allowed us to dissect it into two genetically linked subunits (matBα and matBβ) and to correlate the presence of specific matBα and matA alleles with differences in monokaryotic growth rate. The availability of these molecular markers and the mating type dependence of growth rate in monokaryons can be helpful for marker-assisted selection of fast-growing monokaryons to be used in the construction of dikaryons able to colonize the substrate faster than the competitors responsible for reductions in the industrial yield of this fungus. PMID:11472908

Effect of Pleurotus eryngii Mushroom β-Glucan on Quality Characteristics of Common Wheat Pasta.

PubMed

Kim, SunHee; Lee, Jo-Won; Heo, Yena; Moon, BoKyung

2016-04-01

The objective of this study was to evaluate the effect of β-glucan-rich fractions (BGRFs) from Pleurotus eryngii mushroom powder on the quality, textural properties, and sensory evaluation of common wheat pasta. Pasta was prepared from semolina flour and common wheat flour by replacing common wheat flour at 2%, 4%, and 6% with BGRFs. Semolina flour showed significantly higher viscosities than common wheat flour samples. However, all viscosities, except the breakdown viscosity, were reduced with increasing percentages of BGRFs. Replacement of the common wheat flour with BGRFs resulted in a reddish brown colored pasta with a lower L* value and a higher a* value. The common wheat pastas containing up to 4% BGRFs were not significantly different from semolina pasta with regard to cooking loss. Addition of up to 2% BGRFs had no significant impact on swelling index and water absorption. The addition of BGRFs in common wheat flour had a positive effect on the quality of common wheat pasta and resulted in hardness values similar to those of semolina pasta. In a sensory evaluation, cooked pasta with 2% BGRFs had the highest overall acceptability score. In summary, the results showed that common wheat flour containing 4% BGRFs could be used to produce pasta with an improved quality and texture properties similar to semolina pasta. © 2016 Institute of Food Technologists®

An environmentally friendly and cost effective technique for the commercial cultivation of oyster mushroom [Pleurotus florida (Mont.) Singer].

PubMed

Panjikkaran, Seeja Thomachan; Mathew, Deepu

2013-03-15

The existing protocol for the cultivation of oyster mushroom (Pleurotus florida) in polyethylene bags leads to environmental pollution amounting to 18 g of polyethylene per 450 g of mushroom, which is the average biological efficiency achieved from a bag. Thus the projected annual global pollution amounts to 2 million tones, corresponding to the production of 48 million tones. Experiments were conducted at Kerala Agricultural University, India, to formulate an oyster mushroom cultivation strategy that reduces this pollution level. Pooled results of experiments at the institute's and farmers' units have shown that reusable plastic buckets having perforations of 1.5 cm × 1.0 cm throughout the side walls could be used to substitute polyethylene bags, while following the standard cultivation protocols. Cultivation in perforated buckets has recorded a biological efficiency of 435.69 ± 56.75 g in 47.07 ± 5.22 days against 459.11 ± 53.52 g in 38.05 ± 4.54 days in polyethylene bags. The rate of contamination in buckets was significantly lower than that in bags: 9.28 ± 2.12 and 12.60 ± 3.73% respectively. Reusable plastic buckets with perforations on the side walls could be used to substitute the conventional polyethylene bags in oyster mushroom cultivation, with no significant difference in yield. Losses due to slight increase in crop duration in buckets will be compensated with a lower rate of contamination. For a unit having a daily output of 100 kg, it was estimated that during 10 years of permanent cultivation following this technique, the cost of cultivation could be reduced to one-tenth and the environmental pollution reduced by at least 730 000 non-degradable polyethylene bags. © 2012 Society of Chemical Industry.

Mycoextraction of radiolabeled cesium and strontium by Pleurotus eryngii mycelia in the presence of alumina nanoparticles: Sorption and accumulation studies.

PubMed

Asztemborska, Monika; Jakubiak, Małgorzata; Rykaczewska, Magdalena; Bembenek, Marcin; Stęborowski, Romuald; Bystrzejewska-Piotrowska, Grażyna

2016-11-01

Widespread use of products based on nanomaterials results in the release of nanoparticles into the environment. Nanoparticles can be taken up by organisms, but they can also coexist with other substances such as radionuclides, thus affecting their uptake or toxicity. In contrast, the sorption capacity of nanoparticles is exploited in water purification. The aim of the study was to investigate: (i) bioaccumulation of cesium and strontium by Pleurotus eryngii mycelia in the presence of alumina nanoparticles (Al 2 O 3 NPs); and (ii) sorption of radionuclides on the surface of nanoparticles. For the experiments, living and dried mycelia were used to permit distinguishing between active uptake and passive sorption of the NPs by P. eryngii. The results are discussed from the perspective of the use of P. eryngii in the mycoextraction of radionuclides. The sorption capacity of Al 2 O 3 NPs and the accumulation by P. eryngii mycelia differ for the applied radioisotopes. The efficiency of Cs and Sr sorption by alumina nanoparticles is 20% and 40%, respectively. Mycelia of P. eryngii have the ability to accumulate 30% of both radioisotopes from the medium. More than 60% of strontium can be removed accumulated from water by P. eryngii mycelia in coexistence with Al 2 O 3 NPs, while the efficiency of cesium removal accumulation is negligible. It was found that alumina nanoparticles do not enhance uptake of radionuclides by P. eryngii mycelia; mycoextraction of radionuclides by mycelia and sorption by Al 2 O 3 NPs are concurrent processes. There was no difference between live or dried mycelia uptake. Copyright © 2016 Elsevier Ltd. All rights reserved.

Identification and Characterization of Small Noncoding RNAs in Genome Sequences of the Edible Fungus Pleurotus ostreatus

PubMed Central

Zhao, Mengran; Hsiang, Tom; Feng, Xiaoxing

2016-01-01

Noncoding RNAs (ncRNAs) have been identified in many fungi. However, no genome-scale identification of ncRNAs has been inventoried for basidiomycetes. In this research, we detected 254 small noncoding RNAs (sncRNAs) in a genome assembly of an isolate (CCEF00389) of Pleurotus ostreatus, which is a widely cultivated edible basidiomycetous fungus worldwide. The identified sncRNAs include snRNAs, snoRNAs, tRNAs, and miRNAs. SnRNA U1 was not found in CCEF00389 genome assembly and some other basidiomycetous genomes by BLASTn. This implies that if snRNA U1 of basidiomycetes exists, it has a sequence that varies significantly from other organisms. By analyzing the distribution of sncRNA loci, we found that snRNAs and most tRNAs (88.6%) were located in pseudo-UTR regions, while miRNAs are commonly found in introns. To analyze the evolutionary conservation of the sncRNAs in P. ostreatus, we aligned all 254 sncRNAs to the genome assemblies of some other Agaricomycotina fungi. The results suggest that most sncRNAs (77.56%) were highly conserved in P. ostreatus, and 20% were conserved in Agaricomycotina fungi. These findings indicate that most sncRNAs of P. ostreatus were not conserved across Agaricomycotina fungi. PMID:27703969

Use of the yeast-like cells of Tremella fuciformis as a cell factory to produce a Pleurotus ostreatus hydrophobin.

PubMed

Zhu, Hanyu; Liu, Dongmei; Wang, Yuanyuan; Ren, Danfeng; Zheng, Liesheng; Chen, Liguo; Ma, Aimin

2017-08-01

To obtain hydrophobin, a Class I hydrophobin gene, Po.hyd from Pleurotus ostreatus, was transformed into the yeast-like cells of Tremella fuciformis using Agrobacterium tumefaciens. The hydrophobin Po.HYD from P. ostreatus was heterogeneously expressed by the yeast-like cells of T. fuciformis. Plasmids harboring the Po.hyd gene driven by endogenous glyceraldehyde-3-phosphate dehydrogenase promoter were transformed by A. tumefaciens. The integration and expression of the rPo.HYD in the T. fuciformis cells were confirmed by PCR, Southern blot, fluorescence microscopy and quantitative real-time PCR. SDS-PAGE demonstrated that the rPo.HYD was extracted with the expected MW of 14 kDa. The yield of purified rPo.HYD was 0.58 mg/g dry wt. The protein, with its ability to stabilize oil droplets, exhibited a better emulsifying activity than the typical food emulsifiers Tween 20 and sodium caseinate. Tremella fuciformis can be used as a cell factory to produce hydrophobin on a large scale for the food industry.

Composted versus Raw Olive Mill Waste as Substrates for the Production of Medicinal Mushrooms: An Assessment of Selected Cultivation and Quality Parameters

PubMed Central

Zervakis, Georgios I.; Koutrotsios, Georgios; Katsaris, Panagiotis

2013-01-01

Two-phase olive mill waste (TPOMW, “alperujo”) is a highly biotoxic sludge-like effluent of the olive-oil milling process with a huge seasonal production. One of the treatment approaches that has so far received little attention is the use of TPOMW as substrate for the cultivation of edible mushrooms. Fifteen fungal strains belonging to five species (Basidiomycota), that is, Agrocybe cylindracea, Pleurotus cystidiosus, P. eryngii, P. ostreatus, and P. pulmonarius, were evaluated for their efficacy to colonize media composed of TPOMW, which was used either raw or composted in mixtures with wheat straw in various ratios. Qualified strains exhibited high values of biological efficiency (e.g., 120–135% for Pleurotus spp. and 125% for A. cylindracea) and productivity in subsequent cultivation experiments on substrates supplemented with 20–40% composted TPOMW or 20% raw TPOMW. Only when supplementation exceeded 60% for raw TPOMW, a negative impact was noted on mushroom yields which could be attributed to the effluent's toxicity (otherwise alleviated in the respective composted TPOMW medium). Earliness and mushroom size as well as quality parameters such as total phenolic content and antioxidant activity did not demonstrate significant differences versus the control wheat-straw substrate. The substrates hemicellulose content was negatively correlated with mycelium growth rates and yields and positively with earliness; in addition, cellulose: lignin ratio presented a positive correlation with mycelium growth and mushroom weight for A. cylindracea and with earliness for all species examined. TPOMW-based media revealed a great potential for the substitution of traditional cultivation substrates by valorizing environmentally hazardous agricultural waste. PMID:24027758

Composted versus raw olive mill waste as substrates for the production of medicinal mushrooms: an assessment of selected cultivation and quality parameters.

PubMed

Zervakis, Georgios I; Koutrotsios, Georgios; Katsaris, Panagiotis

2013-01-01

Two-phase olive mill waste (TPOMW, "alperujo") is a highly biotoxic sludge-like effluent of the olive-oil milling process with a huge seasonal production. One of the treatment approaches that has so far received little attention is the use of TPOMW as substrate for the cultivation of edible mushrooms. Fifteen fungal strains belonging to five species (Basidiomycota), that is, Agrocybe cylindracea, Pleurotus cystidiosus, P. eryngii, P. ostreatus, and P. pulmonarius, were evaluated for their efficacy to colonize media composed of TPOMW, which was used either raw or composted in mixtures with wheat straw in various ratios. Qualified strains exhibited high values of biological efficiency (e.g., 120-135% for Pleurotus spp. and 125% for A. cylindracea) and productivity in subsequent cultivation experiments on substrates supplemented with 20-40% composted TPOMW or 20% raw TPOMW. Only when supplementation exceeded 60% for raw TPOMW, a negative impact was noted on mushroom yields which could be attributed to the effluent's toxicity (otherwise alleviated in the respective composted TPOMW medium). Earliness and mushroom size as well as quality parameters such as total phenolic content and antioxidant activity did not demonstrate significant differences versus the control wheat-straw substrate. The substrates hemicellulose content was negatively correlated with mycelium growth rates and yields and positively with earliness; in addition, cellulose: lignin ratio presented a positive correlation with mycelium growth and mushroom weight for A. cylindracea and with earliness for all species examined. TPOMW-based media revealed a great potential for the substitution of traditional cultivation substrates by valorizing environmentally hazardous agricultural waste.

Determination of statins by gas chromatography - EI/MRM - Tandem mass spectrometry: fermentation of pine samples with Pleurotus ostreatus.

PubMed

Sirén, Heli; Kaijanen, Laura; Kaartinen, Sini; Väre, Monna; Riikonen, Päivi; Jernström, Eeva

2014-06-01

Statins were separated and quantified with gas chromatography-mass spectrometry (GC-EI-MS/MS) using total ion monitoring (TIC) and multiple reactions monitoring (MRM). The MRM method in statins determination has a novelty value, since there are no previous studies on their simultaneous analysis in environmental or plant samples. The method development and optimization was challenging due to the physicochemical similarities of the silylated lovastatin, simvastatin, pravastatin, fluvastatin, and atorvastatin. The results showed that the use of MRM decreased their detection and quantification limits by factors of 2-10 compared to that obtained in TIC monitoring. The concentration calibration was made between 247.5ng/L and 9900ng/L. Limits of detection and quantification were between 50ng/L (lovastatin)-500ng/L (pravastatin) and 250ng/L (lovastatin)-1000ng/L (pravastatin), respectively. Based on the MRM results, the wood bark and phloem samples contained lovastatin, lovastatin-lactone, simvastatin, simvastatin-lactone, and pravastatin. Their concentrations were 250-3000μg/L, i.e. 4.2-50mg/kg in phloem and bark. However, they were not detected in fluids made with Pleurotus ostreatus fermentation of wood core. Copyright © 2014 Elsevier B.V. All rights reserved.

Pleurotus citrinopileatus polysaccharide induces activation of human dendritic cells through multiple pathways.

PubMed

Minato, Ken-Ichiro; Laan, Lisa C; Ohara, Akihiro; van Die, Irma

2016-11-01

Many edible mushrooms have become attractive as "health foods" and as source materials for immunomodulators. To increase our insight in the immune-modulatory properties of a polysaccharide of the oyster mushroom Pleurotus citrinopileatus, PCPS, we analyzed its effects on the function of human dendritic cells (DCs). We showed that PCPS induces upregulation of the surface maturation markers CD80, CD86 and HLA-DR on DCs, indicating its potential to induce DC maturation. In addition, PCPS stimulates DCs to secrete the pro-inflammatory cytokines TNF, IL-1β, IL-6 and IL-12, as well as the anti-inflammatory cytokine IL-10, and induces enhanced mRNA levels of the chemokines CCL2, CCL3, CCL8, CXCL9, CXCL10, and LTA. The secretion of TNF and IL-12 by PCPS-activated DCs could significantly be decreased by an anti-Dectin-1 antibody, as well as by a Syk kinase and a Raf-1 inhibitor, indicating that PCPS induces Dectin-1 signaling at least partly through the Syk- and the Raf-1-dependent pathways in DCs. Structural analysis of PCPS suggests that this polysaccharide is a β-1,3-branched β-1,6-glucan, which is in line with its capacity to activate Dectin-1. We showed that PCPS can induce TLR2 and TLR4, but not TLR3, signaling using TLR-HEK293 reporter cell lines. In human DCs, the effect of PCPS was additively increased by TLR4 activation, and synergistically enhanced by stimulation of TLR2, suggesting that interaction of PCPS with these TLRs contributes to the observed DC modulation. In conclusion, PCPS has the capacity to activate human DCs via multiple pathways. Copyright © 2016 Elsevier B.V. All rights reserved.

Haematopoiesis radioprotection in Balb/c mice by an aqueous mycelium extract from the Basidiomycete Pleurotus ostreatus mushroom.

PubMed

Llauradó, G; Morris, H J; Tamayo, V; Lebeque, Y; Beltrán, Y; Marcos, J; Moukha, S; Creppy, E E; Bermúdez, R C

2015-01-01

The study examined the radioprotective activity of an aqueous extract from Pleurotus ostreatus mycelium administered to Balb/c mice. Male mice were whole-body irradiated on day 0 ((60)Co, at 0.43 Gy/min) and divided into two groups. The extract was administered intraperitoneally to one group (100 mg/kg) on days - 10 to - 6 and - 2 to +1 with respect to the irradiation. The irradiated-control group was injected with saline solution; non-irradiated mice were used as negative controls. The radioprotective effect was evident by increases in bone marrow cellularity (5.1 × 10(6)/femur vs. 1.1 × 10(6)/femur in saline-control mice, p < 0.05), leucocyte counts (10.5 × 10(9)/L vs. 4.5 × 10(9)/L, p < 0.05), and spleen cellularity (11.2 × 10(7)/spleen vs. 6.2 × 10(7)/spleen, p < 0.05). The extract stimulated macrophage phagocytic activity as judged by a faster rate of carbon clearance in terms of absorbance ratios (1.62 vs. 2.01, p < 0.05). Therefore, this extract may be a candidate therapeutic agent with radioprotective activity for haematopoiesis damage, particularly to cells involved in immune function.

Water extract from Pleurotus pulmonarius with antioxidant activity exerts in vivo chemoprophylaxis and chemosensitization for liver cancer.

PubMed

Xu, Wen Wen; Li, Bin; Lai, Emily Tsz Ching; Chen, Lei; Huang, Jim Jun Hui; Cheung, Annie Lai Man; Cheung, Peter Chi Keung

2014-01-01

Chemoprophylaxis and chemosensitization are promising strategies to combat human cancers. Natural antioxidant agents show great promise in cancer therapy, and the use of edible mushrooms against cancer is receiving more interest globally. In this study, the radical scavenging activities including diphenyl-1-picrylhydrazyl, superoxide anion radical, hydroxyl radical, and hydrogen peroxide were compared among hot water extracts from 3 edible mushrooms, among which Pleurotus pulmonarius (Pp) possessed the highest antioxidant potential. Oral administration of Pp 2 wk in advance could markedly inhibit the incidence and size of tumor (Huh7 liver cancer cells) with an inhibition rate of 93.1% in nude mice. No obvious side effect was observed in the Pp-treated mice as indicated by their body weight and histological analysis of major organs. The cancer prevention by Pp treatment might be explained by the inhibition of cancer cell proliferation indicated by reduction of ki-67 staining and the inactivation of phosphoinositide 3-kinase (PI3K)/AKT signaling pathway in the Pp-treated mice. Furthermore, a significant synergistic effect was observed when the mice were treated with a combination of low dose of cisplatin and Pp. Taken together, these results suggest the potential application of Pp as an adjuvant in the chemotherapy of liver cancer.

Effect of oxidation of the non-catalytic β-propeller domain on the substrate specificity of prolyl oligopeptidase from Pleurotus eryngii.

PubMed

Tokai, Shota; Bito, Tomohiro; Shimizu, Katsuhiko; Arima, Jiro

2017-05-27

Enzymes belonging to the S9 family of prolyl oligopeptidases are of interest because of their pharmacological importance and have a non-catalytic β-propeller domain. In this study, we found that the oxidation of Met203, which lies on surface of the β-propeller domain, leads to change in the substrate specificity of eryngase, an enzyme from Pleurotus eryngii and a member of the S9 family of prolyl oligopeptidases. The activity of eryngase for L-Phe-p-nitroanilide was maintained following hydrogen peroxide treatment but was dramatically reduced for other p-nitroanilide substrates. MALDI-TOF MS analysis using tryptic peptides of eryngase indicated that the change in substrate specificity was triggered by oxidizing Met203 to methionine sulfoxide. In addition, mutations of Met203 to smaller residues provided specificities similar to those observed following oxidation of the wild-type enzyme. Substitution of Met203 with Phe significantly decreased activity, indicating that Met203 may be involved in substrate gating. Copyright © 2017 Elsevier Inc. All rights reserved.

Aflatoxin B₁ and M₁ Degradation by Lac2 from Pleurotus pulmonarius and Redox Mediators.

PubMed

Loi, Martina; Fanelli, Francesca; Zucca, Paolo; Liuzzi, Vania C; Quintieri, Laura; Cimmarusti, Maria T; Monaci, Linda; Haidukowski, Miriam; Logrieco, Antonio F; Sanjust, Enrico; Mulè, Giuseppina

2016-08-23

Laccases (LCs) are multicopper oxidases that find application as versatile biocatalysts for the green bioremediation of environmental pollutants and xenobiotics. In this study we elucidate the degrading activity of Lac2 pure enzyme form Pleurotus pulmonarius towards aflatoxin B₁ (AFB₁) and M₁ (AFM₁). LC enzyme was purified using three chromatographic steps and identified as Lac2 through zymogram and LC-MS/MS. The degradation assays were performed in vitro at 25 °C for 72 h in buffer solution. AFB₁ degradation by Lac2 direct oxidation was 23%. Toxin degradation was also investigated in the presence of three redox mediators, (2,2'-azino-bis-[3-ethylbenzothiazoline-6-sulfonic acid]) (ABTS) and two naturally-occurring phenols, acetosyringone (AS) and syringaldehyde (SA). The direct effect of the enzyme and the mediated action of Lac2 with redox mediators univocally proved the correlation between Lac2 activity and aflatoxins degradation. The degradation of AFB₁ was enhanced by the addition of all mediators at 10 mM, with AS being the most effective (90% of degradation). AFM₁ was completely degraded by Lac2 with all mediators at 10 mM. The novelty of this study relies on the identification of a pure enzyme as capable of degrading AFB₁ and, for the first time, AFM₁, and on the evidence that the mechanism of an effective degradation occurs via the mediation of natural phenolic compounds. These results opened new perspective for Lac2 application in the food and feed supply chains as a biotransforming agent of AFB₁ and AFM₁.

Inactivation of a Pleurotus ostreatus versatile peroxidase-encoding gene (mnp2) results in reduced lignin degradation.

PubMed

Salame, Tomer M; Knop, Doriv; Levinson, Dana; Mabjeesh, Sameer J; Yarden, Oded; Hadar, Yitzhak

2014-01-01

Lignin biodegradation by white-rot fungi is pivotal to the earth's carbon cycle. Manganese peroxidases (MnPs), the most common extracellular ligninolytic peroxidases produced by white-rot fungi, are considered key in ligninolysis. Pleurotus ostreatus, the oyster mushroom, is a preferential lignin degrader occupying niches rich in lignocellulose such as decaying trees. Here, we provide direct, genetically based proof for the functional significance of MnP to P. ostreatus ligninolytic capacity under conditions mimicking its natural habitat. When grown on a natural lignocellulosic substrate of cotton stalks under solid-state culture conditions, gene and isoenzyme expression profiles of its short MnP and versatile peroxidase (VP)-encoding gene family revealed that mnp2 was predominately expressed. mnp2, encoding the versatile short MnP isoenzyme 2 was disrupted. Inactivation of mnp2 resulted in three interrelated phenotypes, relative to the wild-type strain: (i) reduction of 14% and 36% in lignin mineralization of stalks non-amended and amended with Mn(2+), respectively; (ii) marked reduction of the bioconverted lignocellulose sensitivity to subsequent bacterial hydrolyses; and (iii) decrease in fungal respiration rate. These results may serve as the basis to clarify the roles of the various types of fungal MnPs and VPs in their contribution to white-rot decay of wood and lignocellulose in various ecosystems. © 2013 Society for Applied Microbiology and John Wiley & Sons Ltd.

Statistical optimization of ultraviolet irradiate conditions for vitamin D₂ synthesis in oyster mushrooms (Pleurotus ostreatus) using response surface methodology.

PubMed

Wu, Wei-Jie; Ahn, Byung-Yong

2014-01-01

Response surface methodology (RSM) was used to determine the optimum vitamin D2 synthesis conditions in oyster mushrooms (Pleurotus ostreatus). Ultraviolet B (UV-B) was selected as the most efficient irradiation source for the preliminary experiment, in addition to the levels of three independent variables, which included ambient temperature (25-45°C), exposure time (40-120 min), and irradiation intensity (0.6-1.2 W/m2). The statistical analysis indicated that, for the range which was studied, irradiation intensity was the most critical factor that affected vitamin D2 synthesis in oyster mushrooms. Under optimal conditions (ambient temperature of 28.16°C, UV-B intensity of 1.14 W/m2, and exposure time of 94.28 min), the experimental vitamin D2 content of 239.67 µg/g (dry weight) was in very good agreement with the predicted value of 245.49 µg/g, which verified the practicability of this strategy. Compared to fresh mushrooms, the lyophilized mushroom powder can synthesize remarkably higher level of vitamin D2 (498.10 µg/g) within much shorter UV-B exposure time (10 min), and thus should receive attention from the food processing industry.

Biodegradation of vegetable and agrowastes by Pleurotus sapidus: a novel strategy to produce mushroom with enhanced yield and nutrition.

PubMed

Singh, M P; Singh, V K

2012-12-22

Edible oyster mushroom Pleurotus sapidus was cultivated, on pea pod shell, cauliflower leaves, radish leaves, brassica straw in various combinations of paddy straw. The mushroom failed to grow on these vegetable wastes separately. However, it grew very well on these vegetable wastes when mixed with various combinations of paddy straw as substrate. Total yield and biological efficiency of the mushroom cultivated on substrate containing 20% and 30% vegetable wastes mixed with 70% and 80% (w/w) of paddy straw was found to be better, when compared with yield and efficiency obtained with paddy straw alone (100%). The protein content in the fruit bodies was found to be higher in the mushroom grown on paddy straw mixed with vegetable wastes than that obtained with paddy straw alone. Similarly, six amino acids (Leu, Ile, Val, Thr, Met and Phe) showed a significant increase when the mushroom was grown on a mixed substrate containing both vegetable wastes and paddy straw. On the contrary, the total sugar and reducing sugar content declined in the mushroom grown on the mixture of paddy straw and other wastes, when compared with the results obtained with paddy straw alone.

Consequence of the antioxidant activities and tyrosinase inhibitory effects of various extracts from the fruiting bodies of Pleurotus ferulae

PubMed Central

Alam, Nuhu; Yoon, Ki Nam; Lee, Jae Seong; Cho, Hae Jin; Lee, Tae Soo

2011-01-01

This study was initiated to screen the antioxidant activities, tyrosinase inhibitory effects on the fruiting bodies of Pleurotus ferulae extracted with acetone, methanol and hot water. The antioxidant activities were performed on β-carotene–linoleic acid, reducing power, DPPH, ferrous ions chelating abilities, and xanthine oxidase. In addition to this, phenolic compounds were also analyzed. The methanolic extract showed the strongest β-carotene–linoleic acid inhibition and high reducing power as compared to other extracts. The scavenging effects on DPPH radicals, the acetonic and methanolic extracts were more effective than hot water extracts. The strongest chelating effect was obtained from the methanolic extract as compared to the tested synthetic antioxidant. Gallic acid, protocatechuic acid, caffeic acid, vanillin, ferulic acid, naringin, resveratrol, naringenin, hesperetin, formononetin and biochanin-A were detected from acetonitrile and hydrochloric acid (5:1) solvent extract. Xanthine oxidase and tyrosinase inhibitory activities of acetonic, methanolic, and hot water extracts of P. ferulae increased with increasing concentration. The results suggested that consumption of P. ferulae might be beneficial to the antioxidant, xanthine oxidase, and tyrosinase protection system of the human body against oxidative damage and others complications. PMID:23961169

Submerged Cultivation of Mycelium with High Ergothioneine Content from the Culinary-Medicinal Golden Oyster Mushroom, Pleurotus citrinopileatus (Higher Basidiomycetes).

PubMed

Lin, Shin-Yi; Chien, Shih-Chang; Wang, Sheng-Yang; Mau, Jeng-Leun

2015-01-01

The optimization of submerged culture of the culinary-medicinal golden oyster mushroom, Pleurotus citrinopileatus, was studied using a one-factor-at-a-time, two-stage stimulation and central composite rotatable design to produce mycelia with high ergothioneine content. The optimal culture conditions for mycelia harvested at day 22 were a temperature of 25°C, an inoculation ratio of 5%, 2% glucose, 0.5% yeast extract, and adjustment of the initial pH value to 10. The biomass and ergothioneine content were 8.28 g/L and 10.65 mg/g dry weight (dw), respectively. The addition of an amino acid precursor increased the ergothioneine content of mycelia; cysteine was the most effective. In addition, the results obtained from central composite rotatable design showed that the recommended combination for cysteine, histidine, and methionine was 8, 4, and 0.5 mmol/L, respectively. The predicted ergothioneine content was 13.90 mg/g dw, whereas the experimental maximal ergothioneine content was 14.57 mg/g dw. With the addition of complex precursors and under optimal culture conditions, mycelia harvested at days 16-20 had higher ergothioneine content. Accordingly, the information obtained could be used to produce mycelia with high ergothioneine content.

Cultivation of oyster mushroom Pleurotus ostreatus on date-palm leaves mixed with other agro-wastes in Saudi Arabia.

PubMed

Alananbeh, Kholoud M; Bouqellah, Nahla A; Al Kaff, Nadia S

2014-12-01

Promoting the use of agricultural waste is one of the newly prepared water and environment friendly agriculture strategies in the Kingdom of Saudi Arabia (KSA). The objective of this research was to study the efficiency of cultivating oyster mushroom (Pleurotus ostreatus) on date palm wastes mixed with other agricultural wastes available in KSA. Four agricultural wastes were mixed with date palm leaves at different ratios, with two supplements and three spawn rates were used. Wheat straw mixed with date palm at ratio of 25 (date palm): 75 (agro-waste) showed the best results in most of the parameters measured. Corn meal was superior over wheat bran as a supplement in all treatments. Parameter values increased with the increase of the spawn rate of P. ostreatus. Treatments with date palm leave wastes contained higher carbohydrates and fibers. No significant differences were found among the fruiting bodies produced on the different agro-wastes studied for the different proximates analyzed. Analyses of metal concentration showed that potassium was the highest in all the treatments tested followed by Na, Mg, Ca, and Zn. This is the first study that reported the success of growing oyster mushroom on date palm leaf wastes mixed with other agro-wastes obtainable in KSA.

Cultivation of oyster mushroom Pleurotus ostreatus on date-palm leaves mixed with other agro-wastes in Saudi Arabia

PubMed Central

Alananbeh, Kholoud M.; Bouqellah, Nahla A.; Al Kaff, Nadia S.

2014-01-01

Promoting the use of agricultural waste is one of the newly prepared water and environment friendly agriculture strategies in the Kingdom of Saudi Arabia (KSA). The objective of this research was to study the efficiency of cultivating oyster mushroom (Pleurotus ostreatus) on date palm wastes mixed with other agricultural wastes available in KSA. Four agricultural wastes were mixed with date palm leaves at different ratios, with two supplements and three spawn rates were used. Wheat straw mixed with date palm at ratio of 25 (date palm): 75 (agro-waste) showed the best results in most of the parameters measured. Corn meal was superior over wheat bran as a supplement in all treatments. Parameter values increased with the increase of the spawn rate of P. ostreatus. Treatments with date palm leave wastes contained higher carbohydrates and fibers. No significant differences were found among the fruiting bodies produced on the different agro-wastes studied for the different proximates analyzed. Analyses of metal concentration showed that potassium was the highest in all the treatments tested followed by Na, Mg, Ca, and Zn. This is the first study that reported the success of growing oyster mushroom on date palm leaf wastes mixed with other agro-wastes obtainable in KSA. PMID:25473372

Biodegradation of toxic chemicals by Pleurotus eryngii in submerged fermentation and solid-state fermentation.

PubMed

Chang, Bea-Ven; Chang, Yi-Ming

2016-04-01

The toxic chemicals bisphenol A (BPA), bisphenol F (BPF), nonylphenol (NP), and tetrabromobisphenol A (TBBPA) are endocrine-disrupting chemicals that have consequently drawn much concern regarding their effect on the environment. The objectives of this study were to investigate the degradation of BPA, BPF, NP, and TBBPA by enzymes from Pleurotus eryngii in submerged fermentation (SmF) and solid-state fermentation (SSF), and also to assess the removal of toxic chemicals in spent mushroom compost (SMC). BPA and BPF were analyzed by high-performance liquid chromatography; NP and TBBPA were analyzed by gas chromatography. NP degradation was enhanced by adding CuSO4 (1 mM), MnSO4 (0.5 mM), gallic acid (1 mM), tartaric acid (20 mM), citric acid (20 mM), guaiacol (1 mM), or 2,2'-azino-bis- (3-ethylbenzothiazoline-6-sulfonic acid; 1 mM), with the last yielding a higher NP degradation rate than the other additives from SmF. The optimal conditions for enzyme activity from SSF were a sawdust/wheat bran ratio of 1:4 and a moisture content of 5 mL/g. The enzyme activities were higher with sawdust/wheat bran than with sawdust/rice bran. The optimal conditions for the extraction of enzyme from SMC required using sodium acetate buffer (pH 5.0, solid/solution ratio 1:5), and extraction over 3 hours. The removal rates of toxic chemicals by P. eryngii, in descending order of magnitude, were SSF > SmF > SMC. The removal rates were BPF > BPA > NP > TBBPA. Copyright © 2014. Published by Elsevier B.V.

Kinetics, equilibrium and thermodynamic studies on biosorption of Ag(I) from aqueous solution by macrofungus Pleurotus platypus.

PubMed

Das, Devlina; Das, Nilanjana; Mathew, Lazar

2010-12-15

Reports are available on silver binding capacity of some microorganisms. However, reports on the equilibrium studies on biosorption of silver by macrofungi are seldom known. The present study was carried out in a batch system using dead biomass of macrofungus Pleurotus platypus for the sorption of Ag(I). P. platypus exhibited the highest silver uptake of 46.7 mg g(-1) of biomass at pH 6.0 in the presence of 200 mg L(-1) Ag(I) at 20°C. Kinetic studies based on fractional power, zero order, first order, pseudo-first order, Elovich, second order and pseudo-second order rate expressions have been carried out. The results showed a very good compliance with the pseudo-first order model. The experimental data were analyzed using two parameter isotherms (Langmuir, Freundlich, Dubinin-Radushkevich, Temkin and Halsey), three parameter isotherms (Redlich-Peterson, Sips, Khan, Koble-Corrigan, Hill, Toth, Radke-Prausmitz, Jossens, Langmuir-Freundlich), four parameter isotherms (Weber-van Vliet, Fritz-Schlunder, Baudu) and five parameter isotherm (Fritz-Schlunder). Thermodynamic parameters of the biosorption (ΔG, ΔH and ΔS) were also determined. The present study confirmed that macrofungus P. platypus may be used as a cost effective efficient biosorbent for the removal of Ag(I) ions from aqueous solution. Copyright © 2010 Elsevier B.V. All rights reserved.

High temperature induced disruption of the cell wall integrity and structure in Pleurotus ostreatus mycelia.

PubMed

Qiu, Zhiheng; Wu, Xiangli; Gao, Wei; Zhang, Jinxia; Huang, Chenyang

2018-05-30

Fungal cells are surrounded by a tight cell wall to protect them from harmful environmental conditions and to resist lysis. The synthesis and assembly determine the shape, structure, and integrity of the cell wall during the process of mycelial growth and development. High temperature is an important abiotic stress, which affects the synthesis and assembly of cell walls. In the present study, the chitin and β-1,3-glucan concentrations in the cell wall of Pleurotus ostreatus mycelia were changed after high-temperature treatment. Significantly higher chitin and β-1,3-glucan concentrations were detected at 36 °C than those incubated at 28 °C. With the increased temperature, many aberrant chitin deposition patches occurred, and the distribution of chitin in the cell wall was uneven. Moreover, high temperature disrupts the cell wall integrity, and P. ostreatus mycelia became hypersensitive to cell wall-perturbing agents at 36 °C. The cell wall structure tended to shrink or distorted after high temperature. The cell walls were observed to be thicker and looser by using transmission electron microscopy. High temperature can decrease the mannose content in the cell wall and increase the relative cell wall porosity. According to infrared absorption spectrum, high temperature broke or decreased the glycosidic linkages. Finally, P. ostreatus mycelial cell wall was easily degraded by lysing enzymes after high-temperature treatment. In other words, the cell wall destruction caused by high temperature may be a breakthrough for P. ostreatus to be easily infected by Trichoderma.

Antioxidant activity of the oyster mushroom, Pleurotus ostreatus, on CCl(4)-induced liver injury in rats.

PubMed

Jayakumar, T; Ramesh, E; Geraldine, P

2006-12-01

This study was undertaken to investigate the putative antioxidant activity of the oyster mushroom Pleurotus ostreatus on CCl(4)-induced liver damage in male Wistar rats. Intraperitoneal administration of CCl(4) (2ml/kg) to rats for 4 days resulted in significantly elevated (p<0.05) serum levels of glutamic oxaloacetic transaminase (SGOT), glutamic pyruvate transaminase (SGPT) and alkaline phosphatase (SALP) compared to controls. In the liver, significantly elevated levels (p<0.05) of malondialdehyde (MDA) and lowered levels (p<0.05) of reduced glutathione (GSH) were observed following CCl(4) administration. Quantitative and qualitative analysis of catalase (CAT), superoxide dismutase (SOD) and glutathione peroxidase (Gpx) revealed lower activities of these antioxidant enzymes in the liver of CCl(4)-administered rats. An analysis of the isozyme pattern of these enzymes revealed variations in relative concentration presumably due to hepatotoxicity. When rats with CCl(4)-induced hepatotoxicity were treated with the extract of P. ostreatus, the serum SGOT, SGPT and SALP levels reverted to near normal, while the hepatic concentration of GSH, CAT, SOD and Gpx were significantly increased (p<0.05) and that of MDA significantly (p<0.05) lowered, when compared to CCl(4)-exposed untreated rats. Histopathological studies confirmed the hepatoprotective effect conferred by the extract of P. ostreatus. These results suggest that an extract of P. ostreatus is able to significantly alleviate the hepatotoxicity induced by CCl(4) in the rat.

Comparative Examination of the Olive Mill Wastewater Biodegradation Process by Various Wood-Rot Macrofungi

PubMed Central

Koutrotsios, Georgios; Zervakis, Georgios I.

2014-01-01

Olive mill wastewater (OMW) constitutes a major cause of environmental pollution in olive-oil producing regions. Sixty wood-rot macrofungi assigned in 43 species were evaluated for their efficacy to colonize solidified OMW media at initially established optimal growth temperatures. Subsequently eight strains of the following species were qualified: Abortiporus biennis, Ganoderma carnosum, Hapalopilus croceus, Hericium erinaceus, Irpex lacteus, Phanerochaete chrysosporium, Pleurotus djamor, and P. pulmonarius. Fungal growth in OMW (25%v/v in water) resulted in marked reduction of total phenolic content, which was significantly correlated with the effluent's decolorization. A. biennis was the best performing strain (it decreased phenolics by 92% and color by 64%) followed by P. djamor and I. lacteus. Increase of plant seeds germination was less pronounced evidencing that phenolics are only partly responsible for OMW's phytotoxicity. Laccase production was highly correlated with all three biodegradation parameters for H. croceus, Ph. chrysosporium, and Pleurotus spp., and so were manganese-independent and manganese dependent peroxidases for A. biennis and I. lacteus. Monitoring of enzymes with respect to biomass production indicated that Pleurotus spp., H. croceus, and Ph. chrysosporium shared common patterns for all three activities. Moreover, generation of enzymes at the early biodegradation stages enhanced the efficiency of OMW treatment. PMID:24987685

Submerged cultivation of mycelium with high ergothioneine content from the culinary-medicinal king oyster mushroom Pleurotus eryngii (higher Basidiomycetes) and its composition.

PubMed

Liang, Chih-Hung; Huang, Ling-Yi; Ho, Kung-Jui; Lin, Shin-Yi; Mau, Jeng-Leun

2013-01-01

The culinary-medicinal king oyster mushroom, Pleurotus eryngii, was used to produce mycelia with high ergothioneine content using a one-factor-at-a-time method. The optimal culture conditions for mycelia harvested at day 14 were 25°C, 10% inoculation rate, 2% glucose, 0.5% yeast extract, and no adjustment to the initial pH value. With histidine or amino acid mix added, biomasses and the ergothioneine content of mycelia were higher than those of the control. The ergothioneine content of mycelia harvested at days 16-20 were higher than that of mycelia harvested at day 14. In addition, the ergothioneine content of mycelia from the fermentor (5.84-5.76 mg/g) was much higher than that of mycelia from the shaken flask (4.93-5.04 mg/g). Mycelia with high ergothioneine content showed a profile of proximate composition similar to that of regular mycelia but lost its characteristic umami taste. Overall, mycelia high in ergothioneine could be prepared by optimal culture conditions, the addition of precursors, prolonged harvest, and aeration in the fermentor.

Differential response of oyster shell powder on enzyme profile and nutritional value of oyster mushroom Pleurotus florida PF05.

PubMed

Naraian, Ram; Narayan, Om Prakash; Srivastava, Jatin

2014-01-01

Oyster mushroom Pleurotus florida was cultivated on different combinations of wheat straw (WS) as basal substrate and oyster shell powder (OSP) supplement. The OSP supplementation considerably responded to different cultivation phases. The mycelium grew fast and showed rapid growth rate (8.91 mmd(-1)) in WS + OSP (97 + 3) combination while WS + OSP (92 + 8) showed maximum laccase (3.133 U/g) and Mn peroxidase (MnP) activities (0.091 U/g). The climax level of laccase (5.433 U/g) and MnP (0.097 U/g) was recorded during fruit body initiation in WS + OSP (97 + 3) and WS + OSP (98 + 2) combinations, respectively. The WS + OSP (97 + 3) combination represented the best condition for mushroom cultivation and produced the highest biological efficiency (147%). In addition, protein and lipid contents in fruit bodies were slightly improved in response to OSP. The carbohydrate was significantly increased by raising concentration of OSP. The highest values of protein, carbohydrate, and lipid noted were 31.3 μg/g, 0.0639 (g/g), and 0.373 (g/g) correspondingly. Conclusively it was evident that lower concentrations of OSP acted positively and relatively to higher concentrations and improved nutritional content which may suitably be used to enhance both yield and nutritional values of mushroom.

Activity of crude cold-water extract of the culinary-medicinal oyster mushroom, Pleurotus ostreatus (Jacq.:Fr.) P.Kumm. (higher Basidiomycetes), and timolol maleate on induced ocular hypertension.

PubMed

Ebigwai, Joseph Kayefor; Edu, Esther Aja; Itam, Edisua Hogan; Mofunanya, Ann Jerry

2012-01-01

Aqueous crude cold-water extract from the fruiting body of the culinary-medicinal oyster mushroom Pleurotus ostreatus was assessed for activity against increased intra-ocular pressure (IOP) in mice. A 0.1% dexamethasone instillation was used to raise the intra-ocular pressure in the animals above the 21-mmHg threshold limit. The extract has intrinsic anti-hypertensive properties that are dose dependent. A comparison analysis indicated that 150 mg/mL of the crude extract produced 57.69% reduction in the intra-ocular pressure, while doses of 100 mg/ mL and 200 mg/mL produced 44.78% and 70.03% IOP reduction, respectively, compared with timolol maleate with 57.69%. The results were significant at 0.05 confidence limit (p < 0.05) when compared to a placebo and therefore support its use for the treatment of increased intra-ocular pressure.

Nonvolatile Taste Components and Antioxidant Properties of Fruiting Body and Mycelium with High Ergothioneine Content from the Culinary-Medicinal Golden Oyster Mushroom Pleurotus citrinopileatus (Agaricomycetes).

PubMed

Lin, Shin-Yi; Chien, Shih-Chang; Wang, Sheng-Yang; Mau, Jeng-Leun

2016-01-01

Pleurotus citrinopileatus mycelium was prepared with high ergothioneine (Hi-Ergo) content and its proximate composition, nonvolatile taste components, and antioxidant properties were studied. The ergothioneine contents of fruiting bodies and Hi-Ergo and regular mycelia were 3.89, 14.57, and 0.37 mg/g dry weight, respectively. Hi-Ergo mycelium contained more dietary fiber, soluble polysaccharides, and ash but less carbohydrates, reducing sugar, fiber, and fat than regular mycelium. However, Hi-Ergo mycelium contained the smallest amounts of total sugars and polyols (47.43 mg/g dry weight). In addition, Hi-Ergo mycelium showed the most intense umami taste. On the basis of the half-maximal effective concentration values obtained, the 70% ethanolic extract from Hi-Ergo mycelium showed the most effective antioxidant activity, reducing power, and scavenging ability, whereas the fruiting body showed the most effective antioxidant activity, chelating ability, and Trolox-equivalent antioxidant capacity. Overall, Hi-Ergo mycelium could be beneficially used as a food-flavoring material or as a nutritional supplement.

Profiling of hepatic gene expression of mice fed with edible japanese mushrooms by DNA microarray analysis: comparison among Pleurotus ostreatus, Grifola frondosa, and Hypsizigus marmoreus.

PubMed

Sato, Mayumi; Tokuji, Yoshihiko; Yoneyama, Shozo; Fujii-Akiyama, Kyoko; Kinoshita, Mikio; Ohnishi, Masao

2011-10-12

To compare and estimate the effects of dietary intake of three kinds of mushrooms (Pleurotus ostreatus, Grifola frondosa, and Hypsizigus marmoreus), mice were fed a diet containing 10-14% of each mushroom for 4 weeks. Triacylglycerol in the liver and plasma decreased and plasma cholesterol increased in the P. ostreatus-fed group compared with those in the control group. Cholesterol in the liver was lower in the G. frondosa-fed group than in the control group, but no changes were found in the H. marmoreus-fed group. DNA microarray analysis of the liver revealed differences of gene expression patterns among mushrooms. Ctp1a and Fabp families were upregulated in the P. ostreatus-fed group, which were considered to promote lipid transport and β-oxidation. In the G. frondosa-fed group, not only the gene involved in signal transduction of innate immunity via TLR3 and interferon but also virus resistance genes, such as Mx1, Rsad2, and Oas1, were upregulated.

Mycoremediation of manganese and phenanthrene by Pleurotus eryngii mycelium enhanced by Tween 80 and saponin.

PubMed

Wu, Minghui; Xu, Yongan; Ding, Wenbo; Li, Yuanyuan; Xu, Heng

2016-08-01

Bioremediation of areas co-contaminated with metals and polycyclic aromatic hydrocarbons (PAHs) by mushrooms has attracted considerable attention in recent years. In this study, Pleurotus eryngii was introduced for the removal of Mn and phenanthrene (Phe) from potato liquid medium (PDL) simultaneously. Effects of Tween 80 and saponin on P. eryngii growth together with Mn uptake as well as Phe removal were investigated. Although pollutants had a negative effect on mycelial morphology and growth, P. eryngii could still tolerate and remove Mn and Phe. Tween 80 increased removal of Mn and Phe through increase of P. eryngii growth, Phe solubility, pollutants bioavailability, and specific surface area of mycelium pellets, moreover, the activities of manganese peroxidase (MnP) and laccase, which played an important role on PAHs biodegradation. The maximal removal of Mn and Phe was achieved (92.17 and 93.85 % after 15 days incubation, respectively) with 0.6 g L(-1) Tween 80. Treatments with saponin markedly inhibited P. eryngii growth (50.17-66.32 % lower relative to control) due to its fungistatic activity. Nevertheless, saponin could slightly enhance Phe removal through increasing solubility of Phe, and Phe removal rate varied from 80.53 to 87.06 % in saponin treatments. Joint stress of Mn and Phe induced a strong antioxidative response, and superoxide dismutase (SOD) activity decreased in surfactants-treated mycelium compared with control. Generally, Tween 80 was more suitable for strengthening mycoremediation by P. eryngii than saponin, and could be a promising alternative for the remediation of heavy metals and PAHs co-contaminated sites by mushrooms.

Differential Expression Patterns of Pleurotus ostreatus Catalase Genes during Developmental Stages and under Heat Stress

PubMed Central

Wang, Lining; Wu, Xiangli; Gao, Wei; Zhao, Mengran; Zhang, Jinxia

2017-01-01

Catalases are ubiquitous hydrogen peroxide-detoxifying enzymes. They participate in fungal growth and development, such as mycelial growth and cellular differentiation, and in protecting fungi from oxidative damage under stressful conditions. To investigate the potential functions of catalases in Pleurotus ostreatus, we obtained two catalase genes from a draft genome sequence of P. ostreatus, and cloned and characterized them (Po-cat1 and Po-cat2). Po-cat1 (group II) and Po-cat2 (group III) encoded putative peptides of 745 and 528 amino acids, respectively. Furthermore, the gene structures were variant between Po-cat1 and Po-cat2. Further research revealed that these two catalase genes have divergent expression patterns during different developmental stages. Po-cat1/Po-cat1 was at a barely detectable level in mycelia, accumulated gradually during reproductive growth, and was maximal in separated spores. But no catalase activity of Po-cat1 was detected by native-PAGE during any part of the developmental stages. In contrast, high Po-cat2/Po-cat2 expression and Po-cat2 activity found in mycelia were gradually lost during reproductive growth, and at a minimal level in separated spores. In addition, these two genes responded differentially under 32 °C and 40 °C heat stresses. Po-cat1 was up-regulated under both temperature conditions, while Po-cat2 was up-regulated at 32 °C but down-regulated at 40 °C. The accumulation of catalase proteins correlated with gene expression. These results indicate that the two divergent catalases in P. ostreatus may play different roles during development and under heat stress. PMID:29160795

One-Pot Enzymatic Production of Lignin-Composites.

PubMed

Ion, Sabina; Opris, Cristina; Cojocaru, Bogdan; Tudorache, Madalina; Zgura, Irina; Galca, Aurelian C; Bodescu, Adina M; Enache, Madalin; Maria, Gabriel-Mihai; Parvulescu, Vasile I

2018-01-01

A novel and efficient one-pot system for green production of artificial lignin bio-composites has been developed. Monolignols such as sinapyl (SA) and coniferyl (CA) alcohols were linked together with caffeic acid (CafAc) affording a polymeric network similar with natural lignin. The interaction of the dissolved SA/CA with CafAc already bound on a solid support (S C2 /S C6 -CafAc) allowed the attachment of the polymeric product direct on the support surface (S C2 /S C6 -CafAc-L 1 and S C2 /S C6 -CafAc-L 2 , from CA and SA, respectively). Accordingly, this procedure offers the advantage of a simultaneous polymer production and deposition. Chemically, oxi-copolymerization of phenolic derivatives (SA/CA and CAfAc) was performed with H 2 O 2 as oxidation reagent using peroxidase enzyme (2-1B mutant of versatile peroxidase from Pleurotus eryngii ) as catalyst. The system performance reached a maximum of conversion for SA and CA of 71.1 and 49.8%, respectively. The conversion is affected by the system polarity as resulted from the addition of a co-solvent (e.g., MeOH, EtOH, or THF). The chemical structure, morphology, and properties of the bio-composites surface were investigated using different techniques, e.g., FTIR, TPD-NH 3 , TGA, contact angle, and SEM. Thus, it was demonstrated that the SA monolignol favored bio-composites with a dense polymeric surface, high acidity, and low hydrophobicity, while CA allowed the production of thinner polymeric layers with high hydrophobicity.

Rational design of Pleurotus eryngii versatile ligninolytic peroxidase for enhanced pH and thermal stability through structure-based protein engineering.

PubMed

Gao, Yu; Li, Jian-Jun; Zheng, Lanyan; Du, Yuguang

2017-11-01

Versatile peroxidase (VP) from Pleurotus eryngii is a high redox potential peroxidase. It has aroused great biotechnological interest due to its ability to oxidize a wide range of substrates, but its application is still limited due to low pH and thermal stability. Since CiP (Coprinopsis cinerea peroxidase) and PNP (peanut peroxidase) exhibited higher pH and thermal stability than VP, several motifs, which might contribute to their pH and thermal stability, were identified through structure and sequence alignment. Six VP variants incorporating the beneficial motifs were designed and constructed. Most variants were nearly completely inactivated except V1 (Variant 1) and V4. V1 showed comparable activity to WT VP against ABTS, while V4 exhibited reduced activity. V1 displayed improved pH stability than WT VP, at pH 3.0 in particular, whereas the pH stability of V4 did not change a lot. The thermal stabilities of V1 and V4 were enhanced with T50 raised by 3°C. The results demonstrated that variants containing the beneficial motifs of CiP and PNP conferred VP with improved pH and thermal stability. © The Author 2017. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

Effects of Cooking and In Vitro Digestion on Antioxidant Properties and Cytotoxicity of the Culinary-Medicinal Mushroom Pleurotus ostreatoroseus (Agaricomycetes).

PubMed

Brugnari, Tatiane; da Silva, Pedro Henrique Alves; Contato, Alex Graça; Inácio, Fabíola Dorneles; Nolli, Mariene Marques; Kato, Camila Gabriel; Peralta, Rosane Marina; de Souza, Cristina Giatti Marques

2018-01-01

In this study we evaluated the antioxidant capacity, antimicrobial activity, and cytotoxicity of an aqueous extract of the Pleurotus ostreatoroseus mushroom, which was cooked. Fresh basidiocarps were heated and steamed at 100°C and the resulting aqueous extract was assessed before and after in vitro digestion. Cooking reduced the amounts of phenolic compounds in the extract. The antioxidant activity of the extract was evaluated through the use of 4 methods. The lowest half-maximal effective concentration (EC50) against ABTS radicals was 0.057 ± 0.002 mg/mL for the uncooked basidiocarp extract. Cooking and the digestive process led to decreased activity (P > 0.05) against ABTS and DPPH radicals. A significant increase in chelating activity (P > 0.05) occurred after the basidiocarps were cooked (EC50 = 0.279 ± 0.007 mg/mL). The reducing power did not significantly change among the different extracts. The uncooked basidiocarp extract was cytotoxic to Vero cells. After cooking and subsequent in vitro digestion, the cytotoxicity of the extracts decreased (P < 0.05). Bacillus subtilis, Staphylococcus aureus, and Candida albicans were sensitive to the fresh mushroom extract. The data showed that after being cooked and digested, the P. ostreatoroseus mushroom maintains antioxidant activity and has a low cytotoxic effect.

Antonella Amore | NREL

Science.gov Websites

Pleurotus ostreatus," Biotechnol. Appl. Biochem. (2014) "Enzymes for Food and Beverage Industries : Current Situation, Challenges and Perspectives" in Advances in Food Biotechnology (2013) " : Enzymatic and Microbial Tools for Bioethanol Production (2013) "Chemico-physical factors affecting food

Influence of low dose of gamma radiation and storage on some vitamins and mineral elements of dried oyster mushrooms (Pleurotus ostreatus).

PubMed

Kortei, Nii Korley; Odamtten, George Tawia; Obodai, Mary; Wiafe-Kwagyan, Michael; Addo, Edward Adotey

2017-05-01

�± 0.001 mg/100 g. Food processing and storage has the potential to slightly alter the stability of vitamins in foods. Pleurotus ostreatus showed appreciable levels of mineral elemental composition, essential vitamins A, C, and D, and can be endorsed as a natural medicinal food product in the food and pharmaceutical industries. The heavy metals detected were with also below the upper limits permissible by the WHO standards and is thus safe for human consumption.

Development and evaluation of Pleurotus tuber-regium-cornstarch composite as a direct compression multifunctional excipient.

PubMed

Okoye, Ebere I; Onyekweli, Anthony O

2016-01-01

The aim was to develop a novel excipient from Pleurotus tuber-regium (PT)-cornstarch (CS) mixture and evaluate its multifunctional characteristics in tablet formulation. Composites were generated from dephytochemicalized PT and CS combined at 1:1 to 4:1 ratios and pregelatinized in a hot water bath at 65°C ± 2°C for 5 min. The paste was dried, pulverized, and screened through 150-μm sieve. PT-CS physical mixtures were prepared and their characteristics/functionalities in tableting chloroquine were compared to those of composites and microcrystalline cellulose (Avicel(®)). PT ash value was 0.40 ± 0.09% and heavy metal contents were below official limits. PT's differential scanning calorimetric (DSC) thermogram depicted broad melting peak at 329.5°C; this peak was attenuated by the presence of CS. Fourier transform infrared (FTIR) spectra predicted compatibility between PT and CS. Composites consolidated better and also flowed better than physical mixtures and Avicel(®). Increasing PT content enhanced the excipients' swellabilities, and composites possessed significantly (P < 0.05) better swelling indices than Avicel(®). The composites underwent fragmentation before plastic deformation with yield pressures significantly (P < 0.05) higher than those of the physical mixtures, which exhibited only plastic deformation. The mechanical properties of chloroquine tablets were acceptable, with the 1:4 (PT:CS) imparting the best properties. Mean disintegration times for the commercial comparator and Avicel(®) -containing tablets were significantly higher (P < 0.05) than those of composites. Drug release from tablets formulated with composites were similar to the commercial comparator, but significantly higher (P < 0.05) than those of Avicel(®). The novel composites are excellent multifunctional excipients, the best (PT:CS 1:4) one showcasing potentially better mechanical functionality than Avicel(®), a popular multifunctional excipient.

Insight into the impact of two structural calcium ions on the properties of Pleurotus eryngii versatile ligninolytic peroxidase.

PubMed

Gao, Yu; Zheng, Lanyan; Li, Jian-Jun; Du, Yuguang

2016-12-15

Two structural Ca 2+ (proximal and distal) is known to be important for ligninolytic peroxidases. However, few studies toward impact of residues involved in two Ca 2+ on properties of ligninolytic peroxidases have been done, especially the proximal one. In this study, mutants of nine residues involved in liganding two Ca 2+ of Pleurotus eryngii versatile peroxidase (VP) were investigated. Most mutants almost completely lost activities, except the mutants of proximal Ca 2+ - S170A and V192T. In comparison with WT (wild type), optimal pH values of S170A, S170D, and V192T shifted from pH 3.0 to pH 3.5. The order of thermal and pH stabilities of WT, V192T, S170A, and S170D is similar to that of their specific activities: WT > V192T > S170A > S170D. The CD (circular dichroism) results of WT and several mutants indicated that mutations had some effects on secondary structures. For the first time, it was observed that the thermostability of ligninolytic peroxidases is related with proximal Ca 2+ too, and the mutant containing distal Ca 2+ only was obtained. Our results clearly demonstrated that enzymatic activities, pH and thermal stabilities, Ca 2+ content, and secondary structures of VP have close relationship with the residues involved in two structural Ca 2+ . Copyright © 2016 Elsevier Inc. All rights reserved.

Aflatoxin B1 and M1 Degradation by Lac2 from Pleurotus pulmonarius and Redox Mediators

PubMed Central

Loi, Martina; Fanelli, Francesca; Zucca, Paolo; Liuzzi, Vania C.; Quintieri, Laura; Cimmarusti, Maria T.; Monaci, Linda; Haidukowski, Miriam; Logrieco, Antonio F.; Sanjust, Enrico; Mulè, Giuseppina

2016-01-01

Laccases (LCs) are multicopper oxidases that find application as versatile biocatalysts for the green bioremediation of environmental pollutants and xenobiotics. In this study we elucidate the degrading activity of Lac2 pure enzyme form Pleurotus pulmonarius towards aflatoxin B1 (AFB1) and M1 (AFM1). LC enzyme was purified using three chromatographic steps and identified as Lac2 through zymogram and LC-MS/MS. The degradation assays were performed in vitro at 25 °C for 72 h in buffer solution. AFB1 degradation by Lac2 direct oxidation was 23%. Toxin degradation was also investigated in the presence of three redox mediators, (2,2′-azino-bis-[3-ethylbenzothiazoline-6-sulfonic acid]) (ABTS) and two naturally-occurring phenols, acetosyringone (AS) and syringaldehyde (SA). The direct effect of the enzyme and the mediated action of Lac2 with redox mediators univocally proved the correlation between Lac2 activity and aflatoxins degradation. The degradation of AFB1 was enhanced by the addition of all mediators at 10 mM, with AS being the most effective (90% of degradation). AFM1 was completely degraded by Lac2 with all mediators at 10 mM. The novelty of this study relies on the identification of a pure enzyme as capable of degrading AFB1 and, for the first time, AFM1, and on the evidence that the mechanism of an effective degradation occurs via the mediation of natural phenolic compounds. These results opened new perspective for Lac2 application in the food and feed supply chains as a biotransforming agent of AFB1 and AFM1. PMID:27563923

An unstructured mathematical model for growth of Pleurotus ostreatus on lignocellulosic material in solid-state fermentation systems

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sarikaya, A.; Ladisch, M.R.

1997-01-01

Inedible plant material, generated in a Controlled Ecological Life Support System (CELSS), should be recycled preferably by bioregenerative methods that utilize enzymes or micro-organisms. This material consists of hemicellulose, cellulose, and lignin with the lignin fraction representing a recalcitrant component that is not readily treated by enzymatic methods. Consequently, the white-rot fungus, Pleurotus ostreatus, is attractive since it effectively degrades lignin and produces edible mushrooms. This work describes an unstructured model for the growth of P. ostreatus in a solid-state fermentation system using lignocellulosic plant materials from Brassica napus (rapeseed) as a substrate at three different particle sizes. A logisticmore » function model based on area was found to fit the surface growth of the mycelium on the solid substrate with respect to time, whereas a model based on diameter, alone, did not fit the data as well. The difference between the two measures of growth was also evident for mycelial growth in a bioreactor designed to facilitate a slow flowrate of air through the 1.5 cm thick mat of lignocellulosic biomass particles. The result is consistent with the concept of competition of the mycelium for the substrate that surrounds it, rather than just substrate that is immediately available to single cells. This approach provides a quantitative measure of P. ostreatus growth on lignocellulosic biomass in a solid-state fermentation system. The experimental data show that the best growth is obtained for the largest particles (1 cm) of the lignocellulosic substrate. 13 refs., 6 figs., 2 tabs.« less

A step forward in laccase exploitation: Recombinant production and evaluation of techno-economic feasibility of the process.

PubMed

Pezzella, Cinzia; Giacobelli, Valerio Guido; Lettera, Vincenzo; Olivieri, Giuseppe; Cicatiello, Paola; Sannia, Giovanni; Piscitelli, Alessandra

2017-10-10

Protein heterologous production offers viable opportunities to tailor laccase properties to specific industrial needs. The high redox potential laccase POXA1b from Pleurotus ostreatus was chosen as case study of marketable enzyme, due to its desirable properties in terms of activity/stability profile, and already assessed applicability. POXA1b was heterologously produced in Pichia pastoris by investigating the effect of inducible and constitutive expression systems on both the yield and the cost of its production. System performances were first assessed in shaken-flasks and then scaled-up in bioreactor. The production level obtained in the inducible system is 42U/mL, while the activity value achieved with the constitutive one is 60U/mL, the highest obtained in constitutive systems so far. The economic feasibility of recombinant laccase production was simulated, describing the case of an Italian small-medium enterprise. Two scenarios were evaluated: Scenario (I) production based on methanol inducible system; Scenario (II) production based on the constitutive system, fed with glycerol. At all the scales the glycerol-based fermentation is more economic than the methanol-based one. The price forecast for rPOXA1b production is 0.34€kU -1 for glycerol-based process, and is very competitive with the current price of commercial laccase. Copyright © 2017 Elsevier B.V. All rights reserved.

Influence of Cadmium and Mercury on Activities of Ligninolytic Enzymes and Degradation of Polycyclic Aromatic Hydrocarbons by Pleurotus ostreatus in Soil

PubMed Central

Baldrian, Petr; in der Wiesche, Carsten; Gabriel, Jiří; Nerud, František; Zadražil, František

2000-01-01

The white-rot fungus Pleurotus ostreatus was able to degrade the polycyclic aromatic hydrocarbons (PAHs) benzo[a]anthracene, chrysene, benzo[b]fluoranthene, benzo[k]fluoranthene, benzo[a]pyrene, dibenzo[a,h]anthracene, and benzo[ghi]perylene in nonsterile soil both in the presence and in the absence of cadmium and mercury. During 15 weeks of incubation, recovery of individual compounds was 16 to 69% in soil without additional metal. While soil microflora contributed mostly to degradation of pyrene (82%) and benzo[a]anthracene (41%), the fungus enhanced the disappearance of less-soluble polycyclic aromatic compounds containing five or six aromatic rings. Although the heavy metals in the soil affected the activity of ligninolytic enzymes produced by the fungus (laccase and Mn-dependent peroxidase), no decrease in PAH degradation was found in soil containing Cd or Hg at 10 to 100 ppm. In the presence of cadmium at 500 ppm in soil, degradation of PAHs by soil microflora was not affected whereas the contribution of fungus was negligible, probably due to the absence of Mn-dependent peroxidase activity. In the presence of Hg at 50 to 100 ppm or Cd at 100 to 500 ppm, the extent of soil colonization by the fungus was limited. PMID:10831426

Immunomodulating and Antiprotozoal Effects of Different Extracts of the Oyster Culinary-Medicinal Mushroom Pleurotus ostreatus (Higher Basidiomycetes) Against Coccidiosis in Broiler.

PubMed

Ullah, Muhammad Irfan; Akhtar, Masood; Iqbal, Zafar; Shahid, Muhammad; Awais, Mian Muhammad

2015-01-01

The culinary-medicinal oyster mushroom Pleurotus ostreatus, procured from local sources, was processed for hot water and methanolic extraction. Extracts obtained were subjected to proximate analysis to determine the amount of crude protein, crude fiber, ash, ether, and nitrogen-free extracts. These extracts were evaluated for immunomodulating and antiprotozoal effects against coccidiosis in a broiler. Cellular immune investigation revealed significantly higher (P < 0.05) lymphoproliferative response to phytohemagglutinin-P in groups administered P. ostreatus extracts compared with controls. Humoral immune investigation revealed higher immunoglobulin (total Ig, IgG, and IgM) titers against sheep red blood cells in treated groups compared with controls. However, nonsignificant (P > 0.05) findings were observed in investigations of lymphoid organs. Antiprotozoal studies revealed a significantly higher (P < 0.05) percentage of protection against coccidiosis in groups administered P. ostreatus extracts when compared with controls. Moreover, lesion scoring and oocysts per gram of droppings observed in the control group were significantly higher (P < 0.05) compared with those in groups administered hot water and methanolic extracts of P. ostreatus. Results concluded that hot water and methanolic extracts of P. ostreatus had strong immune-enhancing activities. Further, these extracts also had excellent antiprotozoal activities against coccidiosis in a broiler.

Molecular characterizations of somatic hybrids developed between Pleurotus florida and Lentinus squarrosulus through inter-simple sequence repeat markers and sequencing of ribosomal RNA-ITS gene.

PubMed

Mallick, Pijush; Chattaraj, Shruti; Sikdar, Samir Ranjan

2017-10-01

The 12 pfls somatic hybrids and 2 parents of Pleurotus florida and Lentinus s quarrosulus were characterized by ISSR and sequencing of rRNA-ITS genes. Five ISSR primers were used and amplified a total of 54 reproducible fragments with 98.14% polymorphism among all the pfls hybrid populations and parental strains. UPGMA-based cluster exhibited a dendrogram with three major groups between the parents and pfls hybrids. Parent P . florida and L . squarrosulus showed different degrees of genetic distance with all the hybrid lines and they showed closeness to hybrid pfls 1m and pfls 1h , respectively. ITS1(F) and ITS4(R) amplified the rRNA-ITS gene with 611-867 bp sequence length. The nucleotide polymorphisms were found in the ITS1, ITS2 and 5.8S rRNA region with different number of bases. Based on rRNA-ITS sequence, UPGMA cluster exhibited three distinct groups between L. squarrosulus and pfls 1p , pfls 1m and pfls 1s , and pfls 1e and P. florida .

Expression of hygromycin B resistance in oyster culinary-medicinal mushroom, Pleurotus ostreatus (Jacq.:Fr.)P. Kumm. (higher Basidiomycetes) using three gene expression systems.

PubMed

Dong, Xiaoya; Zhang, Ke; Gao, Yuqian; Qi, Yuancheng; Shen, Jinwen; Qiu, Liyou

2012-01-01

Three hygromycin B phosphotransferase (hph) gene expression systems for culinary-medicinal Oyster mushroom, Pleurotus ostreatus, plasmid pSHC, pAN7-1, and pBHt1 were evaluated through PEG/CaCl(2)-mediated protoplast transformation. Plasmid pSHC is a newly constructed hph gene expression system, composed of Escherichia coli hph gene, the P. ostreatus sdi promoter, and the CaMV35S terminator. The vector pAN7-1 was commonly used for integrative transformation in filamentous fungi. Plasmid pBHtl is a T-DNA binary vector, usually introduced into fungi by Agrobacterium-mediated transformation. The results showed that plasmids pSHC, pAN7-1, and pBHt1 were all integrated into the host chromosomes and expressed hygromycin B resistance in P. ostreatus. pAN7-1 had the highest transformation efficiency and hph gene expression level, pSHC the second, and pBHt1 the lowest. Growth rates of the transformants on plates containing hygromycin B were in correspondence with their hph gene expression levels. To our knowledge, this is the first report on integrated transformation of plasmid pAN7-1 and pBHt1 in P. ostreatus.

Bioremediation of vegetable and agrowastes by Pleurotus ostreatus: a novel strategy to produce edible mushroom with enhanced yield and nutrition.

PubMed

Singh, V K; Singh, M P

2014-12-24

Pleurotus ostreatus was grown on paddy straw as well as other vegetable and agricultural wastes i.e. pea pod shell, cauliflower leaves, radish leaves and brassica straw in various combinations with paddy straw. The mushroom did not grow on the vegetable wastes separately. The cumulative yield and biological efficiency of the edible oyster mushroom P. ostreatus grown on substrate containing paddy straw in various combinations with different vegetable wastes i.e. 20% and 30 % vegetable wastes mixed with 80% and 70% (w/w) of paddy straw was found to be better, when compared with yield and biological efficiency obtained on paddy straw (100%) alone. The protein content and six essential amino acid contents (Leu, Ile, Val, Thr, Met, Phe) showed a significant increase and total sugar and reducing sugar contents showed decrease in the mushroom fruit bodies grown at different combinations of vegetable wastes with paddy straw as compared to paddy straw alone. However, there was not any significant change in moisture content of mushroom cultivated on different groups of wastes. Hence, results of this investigation suggest that the vegetable wastes which are generally left to rot in situ in many cities and villages causing outbreak of diseases can be bioremediated by edible mushroom P. ostreatus. The added advantage is that we get edible mushroom fruit body with improved nutrition.

Occurrence and accumulation of mercury in two species of wild grown Pleurotus mushrooms from Southeastern Nigeria.

PubMed

Nnorom, Innocent C; Jarzyńska, Grażyna; Falandysz, Jerzy; Drewnowska, Małgorzata; Okoye, Ifunanya; Oji-Nnorom, Chioma G

2012-10-01

The aim of this study was to evaluate the degree of contamination and intake rates, as well as the risk of Hg contained in two wild species of Pleurotus mushrooms--Oyster Mushroom (P. ostreatus) and King Tuber Mushroom (P. tuber-regium)--which are widely consumed in southeastern Nigeria; and to also assess their potential to accumulate Hg. The mean Hg concentrations in caps of P. ostreatus from distant sites of Ekeoba, Ntigha, and Ubakala in Abia State, were 31±11, 28±8, and 29±5 ng g(-1) dry weight, respectively; while the mean concentrations for stipes were 37±5, 36±17, and 28±6 ng g(-1) dw, in the respective communities. The caps and stipes were characterized by a mean bioconcentration factor value of ∼2, indicating that P. ostreatus is a very weak Hg accumulator and probably takes in Hg solely from the wooden substratum. Sclerotia of P. tuber-regium, purchased from five different regional markets: Ukwunwangwu (Uturu), Ekeama (Umuobiala), and Ahonta (Eluama) of Abia State; and from Abakpa market and Eke-Okigwe of Imo State; contained Hg in total range of 3.3 to 180 ng g(-1) dw. A meal consisting of 300 g of caps and stipes of P. ostreatus, or of fresh sclerotia of P. tuber-regium, would expose a consumer to <1.2, and between 0.39 and 1.2 μg Hg, respectively; and, if eaten daily for a week, would contribute less than 0.03%, and between 0.76% and 2.3% of the provisionally tolerable weekly intake (PTWI). The consumption of P. ostreatus and sclerotia of P. tuber-regium harvested from the areas investigated, therefore, poses no toxicological or health risks to the inhabitants. Copyright © 2012 Elsevier Inc. All rights reserved.

Inhibition of platelet aggregation and in vitro free radical scavenging activity of dried fruiting bodies of Pleurotus eous.

PubMed

Suseem, S R; Saral, Mary

2015-07-01

To evaluate the ethyl acetate, methanol and aqueous extracts of dried fruiting bodies of Pleurotus eous for its anti-platelet activity on human volunteer's blood. And also to analyze the free radical scavenging property of the extracts of P.eous by using various in vitro models. Anti-platelet activity of dried fruiting bodies of P.eous was evaluated by in vitro model using blood platelets. Inhibition of platelet aggregation was monitored after pre-incubation of platelets with the crude extracts of mushroom P.eous. Antioxidant activities of extracts of P.eous were evaluated by different in vitro experiments, namely, 1, 1-diphenyl-2-picryl hydrazyl (DPPH), superoxide, hydroxyl radical and lipid peroxide radical models. Crude extracts of mushroom P.eous inhibited platelet aggregation dose-dependently which was induced by adenosine diphosphate (ADP). At a maximum concentration of 10 mg/mL, methanol extract effected 64.02% inhibition of lipid per-oxidation and 50.12% scavenging effect on superoxide anion radical. Aqueous extract of P.eous have shown 69.43% chelating ability on ferrous ions, 24.27% scavenging effect on hydroxyl radical and 49.57% scavenging effect on DPPH radical at 10 mg/mL. Increasing concentrations of the extract were found to cause progressively decreasing of the intensity of absorbance. Anti-platelet effects could be related in part to the polyphenolic compounds present in the extracts. Antioxidant activity results indicated the free radical scavenging property of the extracts of P.eous which might be due to the high content of phenolic compounds and flavonoids.

Crystallization and preliminary X-ray crystallographic analysis of the small subunit of the heterodimeric laccase POXA3b from Pleurotus ostreatus

PubMed Central

Ferraroni, Marta; Scozzafava, Andrea; Ullah, Sana; Tron, Thierry; Piscitelli, Alessandra; Sannia, Giovanni

2014-01-01

Laccases are multicopper oxidases of great biotechnological potential. While laccases are generally monomeric glycoproteins, the white-rot fungus Pleurotus ostreatus produces two closely related heterodimeric isoenzymes composed of a large subunit, homologous to the other fungal laccases, and a small subunit. The sequence of the small subunit does not show significant homology to any other protein or domain of known function and consequently its function is unknown. The highest similarity to proteins of known structure is to a putative enoyl-CoA hydratase/isomerase from Acinetobacter baumannii, which shows an identity of 27.8%. Diffraction-quality crystals of the small subunit of the heterodimeric laccase POXA3b (sPOXA3b) from P. ostreatus were obtained using the sitting-drop vapour-diffusion method at 294 K from a solution consisting of 1.8 M sodium formate, 0.1 M Tris–HCl pH 8.5. The crystals belonged to the tetragonal space group P41212 or P43212, with unit-cell parameters a = 126.6, c = 53.9 Å. The asymmetric unit contains two molecules related by a noncrystallographic twofold axis. A complete data set extending to a maximum resolution of 2.5 Å was collected at 100 K using a wavelength of 1.140 Å. PMID:24419623

Antimicrobial Activity of Extracts of the Oyster Culinary Medicinal Mushroom Pleurotus ostreatus (Higher Basidiomycetes) and Identification of a New Antimicrobial Compound.

PubMed

Younis, Ahmed M; Wu, Fang-Sheng; El Shikh, Hussien H

2015-01-01

Pleurotus ostreatus is an edible mushroom that also has high medicinal values. In this study, P. ostreatus was tested for its ability to inhibit the growth of fungi and bacteria. The freeze-dried fruiting body, broth from submerged culture, and mycelial biomass of P. ostreatus were extracted using alcohols and water as solvents. The extracts were then tested for their antimicrobial activity against the growth of fungi and bacteria. It was observed that the water extract from fruiting bodies had the strongest effect in inhibiting the growth of most fungi. The most sensitive test microfungi to the inhibition were Candida albicans, Cryptococcus humicola, and Trichosporon cutaneum, and the most sensitive test bacteria were Staphylococcus aureus followed by Escherichia coli. Water extracts from culture broth or mycelial biomass were moderately inhibitive to the growth of fungi and bacteria. The alcohol-based solvents from all samples had much less antimicrobial activity against most test microorganisms. An antimicrobial compound was purified from the water extracts of fruiting bodies with Sephadex G 100 column chromatography and characterized by infrared absorption spectrum (IR), nuclear magnetic resonance (NMR), and mass spectroscopic analysis. We have identified this compound to be 3-(2-aminopheny1thio)-3-hydroxypropanoic acid. This purified compound had a minimum inhibitory concentration of 30 µg/mL and 20 µg/mL against the growth of fungi and bacteria, respectively.

21 CFR 101.30 - Percentage juice declaration for foods purporting to be beverages that contain fruit or vegetable...

Code of Federal Regulations, 2012 CFR

2012-04-01

... panel, in type size not less than that required for the declaration of net quantity of contents... Carambola 7.8 Carrot 8.0 Casaba Melon 7.5 Cashew (Caju) 12.0 Celery 3.1 Cherry, dark, sweet 20.0 Cherry, red...

21 CFR 101.30 - Percentage juice declaration for foods purporting to be beverages that contain fruit or vegetable...

Code of Federal Regulations, 2014 CFR

2014-04-01

... panel, in type size not less than that required for the declaration of net quantity of contents... Carambola 7.8 Carrot 8.0 Casaba Melon 7.5 Cashew (Caju) 12.0 Celery 3.1 Cherry, dark, sweet 20.0 Cherry, red...

21 CFR 101.30 - Percentage juice declaration for foods purporting to be beverages that contain fruit or vegetable...

Code of Federal Regulations, 2011 CFR

2011-04-01

... panel, in type size not less than that required for the declaration of net quantity of contents... Carambola 7.8 Carrot 8.0 Casaba Melon 7.5 Cashew (Caju) 12.0 Celery 3.1 Cherry, dark, sweet 20.0 Cherry, red...

21 CFR 101.30 - Percentage juice declaration for foods purporting to be beverages that contain fruit or vegetable...

Code of Federal Regulations, 2013 CFR

2013-04-01

... panel, in type size not less than that required for the declaration of net quantity of contents... Carambola 7.8 Carrot 8.0 Casaba Melon 7.5 Cashew (Caju) 12.0 Celery 3.1 Cherry, dark, sweet 20.0 Cherry, red...

Biochemical and microstructural Ccharacteristics of insoluble and soluble dietary fiber prepared from mushroom sclerotia of Pleurotus tuber-regium, Polyporus rhinocerus, and Wolfiporia cocos.

PubMed

Wong, Ka-Hing; Cheung, Peter C K; Wu, Jin-Zhong

2003-11-19

The proximate composition of sclerotia of Pleurotus tuber-regium, Polyporus rhinoceros, and Wolfiporia cocos, together with the yield, purity, monosaccharide profile, and microstructure of their insoluble dietary fiber (IDF) and soluble dietary fiber (SDF) fractions prepared from AOAC enzymatic-gravimetric methods were investigated and compared. All three sclerotia were typical carbohydrate rich sclerotia [ranging from 90.5 to 98.1% dry matter (DM)] with an exceptionally low amount of crude lipid content (ranging from 0.02 to 0.14% DM). Besides, all three sclerotia possessed substantial amounts of IDF (ranging from 77.4 to 94.6% DM) with notably high levels of nonstarch polysaccharides (NSP) (89.9-92.2% DM) in which glucose was the predominant sugar residue (90.6-97.2% of NSP DM). On the contrary, both the yield (only ranging from 1.45 to 2.50% DM) and the amount of NSP (ranging from 22.4 to 29.6% DM) of the three sclerotial SDF fractions were very low. Scanning electron micrographs showed fragments of interwoven hyphae and insoluble materials in the three sclerotial IDF fractions, but only an amorphous structure of soluble materials was observed in the SDF fractions. The potential use of these fiber preparations was discussed.

In Vivo Iron-Chelating Activity and Phenolic Profiles of the Angel's Wings Mushroom, Pleurotus porrigens (Higher Basidiomycetes).

PubMed

Khalili, Masoumeh; Ebrahimzadeh, Mohammad Ali; Kosaryan, Mehrnoush

2015-01-01

Pleurotus porrigens is an culinary-medicinal mushroom. It is locally called sadafi and is found in the northern regions of Iran, especially in Mazandaran. This mushroom is used to prepare a variety of local and specialty foods. Because of the phenol and flavonoid contents and the strong iron-chelating activity of this mushroom, it was selected for an assay of in vivo iron-chelating activity. Methanolic extract was administered intraperitoneally to iron-overloaded mice at two dosages (200 and 400 mg/kg/24 hours) for a total of 20 days, with a frequency of 5 times a week for 4 successive weeks. The total iron content was determined by atomic absorption spectroscopy. Plasma Fe3+ content was determined using a kit. Liver sections were stained by hematoxylin and eosin and Perls stain. A significant decrease in the plasma concentration of iron was observed in mice treated with extracts (P < 0.001). The animals showed a dramatic decrease in plasma Fe3+ content when compared with the control group (P < 0.001). Also, Perls stain improved the smaller amount of deposited iron in the liver of iron-overloaded mice treated with the extract. Liver sections revealed a marked reduction in the extent of necrotic hepatocytes, fibrous tissues, and pseudo-lobules. A high-performance liquid chromatography method was developed to simultaneously separate 7 phenolic acids in extract. Rutin (1.784 ± 0.052 mg g(-1) of extract) and p-coumaric acid (1.026 ± 0.043 mg g(-1) of extract) were detected as the main flavonoid and phenolic acids in extract, respectively. The extract exhibited satisfactory potency to chelate excessive iron in mice, potentially offering new natural alternatives to treat patients with iron overload. More studies are needed to determine which compounds are responsible for these biological activities.

Batch and fixed-bed biosorption of Cd(II) from aqueous solution using immobilized Pleurotus ostreatus spent substrate.

PubMed

Jin, Yu; Teng, Chunying; Yu, Sumei; Song, Tao; Dong, Liying; Liang, Jinsong; Bai, Xin; Liu, Xuesheng; Hu, Xiaojing; Qu, Juanjuan

2018-01-01

To prevent the blockage in a continuous fix-bed system, Pleurotus Ostreatus spent substrate (POSS), a composite agricultural waste, was immobilized into granular adsorbents (IPOSS) with polymeric matrix, and used to remove Cd(II) from synthetic wastewater in batch experiment as well as in continuous fixed-bed column system. In batch experiment, higher pH, temperature and Cd(II) initial concentration were conducive to a higher biosorption capacity, and the maximum biosorption capacity reached up to 87.2 mg/g at Cd(II) initial concentration of 200 mg/L, pH 6 and 25 °C. The biosorption of Cd(II) onto IPOSS followed the Langmuir isotherm model with the maximum adsorption capacity(q max ) of 100 mg/g. The biosorption was an endothermic reaction and a spontaneous process based on positive value of ΔH 0 and negative value of ΔG 0 . In fixed-bed column system, higher bed depth, lower flow rate and influent Cd(II) concentration led to a longer breakthrough and exhaustion time, and the best performance (equilibrium uptake (q e ) of 14.4 mg, breakthrough time at 31 h and exhaustion time at 78 h) was achieved at a bed depth of 110 cm, a flow rate of 1.2 L/h and an influent concentration of 100 mg/L. Furthermore, regeneration experiment revealed a good reusability of IPOSS with 0.1 M HNO 3 as eluting agent during three cycles of adsorption and desorption. Cd(II) biosorption onto IPOSS mainly relied on a chemical process including ion exchange and complexation or coordination revealed by SEM-EDX, FTIR and XRD analysis. Copyright © 2017. Published by Elsevier Ltd.

Degradation of dyes using crude extract and a thermostable and pH-stable laccase isolated from Pleurotus nebrodensis.

PubMed

Yuan, Xianghe; Tian, Guoting; Zhao, Yongchang; Zhao, Liyan; Wang, Hexiang; Ng, Tzi Bun

2016-08-01

Three laccase isoenzymes (Lac1, Lac2 and Lac3) have been purified to homogeneity from Pleurotus nebrodensis in our previous study. Lac2 was shown to be the dominant isoform, capable of oxidizing the majority of laccase substrates and manifesting good thermostability and pH stability. Hence, Lac2 was selected to decolourize structurally different dyes and the colour removal efficiencies of Lac2 and the crude extract of P. nebrodensis were compared. By monitoring the λmax of the reaction system during the course of biotransformation, clear hypsochromic shifts were observed for most of the dyes examined, illustrating that at least one peak disappeared as a result of laccase treatment. In general, Lac2 was more efficient within a short time (1 h) and the crude extract, in general, could achieve similar or even higher efficiency when the duration of treatment was extended to 24 h. Malachite green (MG) was chosen to study the detoxifying potential of Lac2, because of the relatively simple structure and high toxicity of the dye towards microorganisms. The toxicity of MG towards both bacteria (Bacillus subtilis, Bacillus licheniformis, Pseudomonas fluorescens and Escherichia coli) and fungi (Fusarium graminearum and Trichoderma harzianum) was dramatically decreased and the potential mechanism was estimated by GC-MS as to remove four methyl groups firstly and the two newly formed amine groups would be degraded or polymerized further. The present study facilitates an understanding of the application of P. nebrodensis laccases and furnishes evidence for the safety of their utilization in the treatment of wastewater emanating from textile industries. © 2016 The Author(s).

Degradation of dyes using crude extract and a thermostable and pH-stable laccase isolated from Pleurotus nebrodensis

PubMed Central

Yuan, Xianghe; Tian, Guoting; Zhao, Yongchang; Zhao, Liyan; Wang, Hexiang; Ng, Tzi Bun

2016-01-01

Three laccase isoenzymes (Lac1, Lac2 and Lac3) have been purified to homogeneity from Pleurotus nebrodensis in our previous study. Lac2 was shown to be the dominant isoform, capable of oxidizing the majority of laccase substrates and manifesting good thermostability and pH stability. Hence, Lac2 was selected to decolourize structurally different dyes and the colour removal efficiencies of Lac2 and the crude extract of P. nebrodensis were compared. By monitoring the λmax of the reaction system during the course of biotransformation, clear hypsochromic shifts were observed for most of the dyes examined, illustrating that at least one peak disappeared as a result of laccase treatment. In general, Lac2 was more efficient within a short time (1 h) and the crude extract, in general, could achieve similar or even higher efficiency when the duration of treatment was extended to 24 h. Malachite green (MG) was chosen to study the detoxifying potential of Lac2, because of the relatively simple structure and high toxicity of the dye towards microorganisms. The toxicity of MG towards both bacteria (Bacillus subtilis, Bacillus licheniformis, Pseudomonas fluorescens and Escherichia coli) and fungi (Fusarium graminearum and Trichoderma harzianum) was dramatically decreased and the potential mechanism was estimated by GC–MS as to remove four methyl groups firstly and the two newly formed amine groups would be degraded or polymerized further. The present study facilitates an understanding of the application of P. nebrodensis laccases and furnishes evidence for the safety of their utilization in the treatment of wastewater emanating from textile industries. PMID:27354563

Optimizing edible fungal growth and biodegradation of inedible crop residues using various cropping methods.

PubMed

Nyochembeng, Leopold M; Beyl, Caula A; Pacumbaba, R P

2008-09-01

Long-term manned space flights to Mars require the development of an advanced life support (ALS) ecosystem including efficient food crop production, processing and recycling waste products thereof. Using edible white rot fungi (EWRF) to achieve effective biomass transformation in ALS requires optimal and rapid biodegradative activity on lignocellulosic wastes. We investigated the mycelial growth of Lentinula edodes and Pleurotus ostreatus on processed residues of various crops under various cropping patterns. In single cropping, mycelial growth and fruiting in all strains were significantly repressed on sweet potato and basil. However, growth of the strains was improved when sweet potato and basil residues were paired with rice or wheat straw. Oyster mushroom (Pleurotus) strains were better than shiitake (L. edodes) strains under single, paired, and mixed cropping patterns. Mixed cropping further eliminated the inherent inhibitory effect of sweet potato, basil, or lettuce on fungal growth. Co-cropping fungal species had a synergistic effect on rate of fungal growth, substrate colonization, and fruiting. Use of efficient cropping methods may enhance fungal growth, fruiting, biodegradation of crop residues, and efficiency of biomass recycling.

Fungi-based treatment of brewery wastewater-biomass production and nutrient reduction.

PubMed

Hultberg, M; Bodin, H

2017-06-01

The beer-brewing process produces high amounts of nutrient-rich wastewater, and the increasing number of microbreweries worldwide has created a need for innovative solutions to deal with this waste. In the present study, fungal biomass production and the removal of organic carbon, phosphorus and nitrogen from synthetic brewery wastewater were studied. Different filamentous fungi with a record of safe use were screened for growth, and Trametes versicolor, Pleurotus ostreatus and Trichoderma harzianum were selected for further work. The highest biomass production, 1.78 ± 0.31 g L -1 of dry weight, was observed when P. ostreatus was used for the treatment, while T. harzianum demonstrated the best capability for removing nutrients. The maximum reduction of chemical oxygen demand, 89% of the initial value, was observed with this species. In the removal of total nitrogen and phosphorus, no significant difference was observed between the species, while removal of ammonium varied between the strains. The maximum reduction of ammonium, 66.1% of the initial value, was also found in the T. harzianum treatment. It can be concluded that all treatments provided significant reductions in all water-quality parameters after 3 days of growth and that the utilisation of filamentous fungi to treat brewery wastewater, linked to a deliberate strategy to use the biomass produced, has future potential in a bio-based society.

Response of Pleurotus ostreatus to cadmium exposure

DOE Office of Scientific and Technical Information (OSTI.GOV)

Favero, N.; Bressa, G.; Costa, P.

1990-08-01

The possibility of utilizing agroindustrial wastes in the production of edible, high-quality products (e.g., mushrooms) implies the risk of bringing toxic substances, such as heavy metals, into the human food chain. Thus, growth in the presence of cadmium and cadmium accumulation limits have been studied in the industrially cultivated fungus P. ostreatus. Fruit body production is substantially unaffected in the presence of 25, 139, and 285 mg Cd/kg of dried substrate. Cadmium concentration in fruit bodies is related to cadmium substrate level, the metal being present at higher levels in caps (22-56 mg/kg dry wt) than in stems (13-36 mg/kgmore » dry wt). Concentration factor (CF), very low in the controls (about 2), further decreases in treated specimens. The presence of a cadmium control mechanism in this fungi species is suggested. Fruit body cadmium levels could, however, represent a risk for P. ostreatus consumers, according to FAO/WHO limits related to weekly cadmium intake.« less

An MSH4 homolog, stpp1, from Pleurotus pulmonarius is a "silver bullet" for resolving problems caused by spores in cultivated mushrooms.

PubMed

Okuda, Yasuhito; Murakami, Shigeyuki; Honda, Yoichi; Matsumoto, Teruyuki

2013-08-01

The enormous number of spores produced by fruiting bodies during cultivation of mushrooms can lead to allergic reactions of workers, reduction of commercial value, spread of mushroom disease, pollution of facilities, and depletion of genetic diversity in natural populations. A cultivar harboring a sporulation-deficient (sporeless) mutation would be very useful for preventing these problems, but sporeless commercial cultivars are very limited in usefulness because sporeless traits are often linked with traits that are unfavorable for commercial cultivation. Thus, identifying a causal gene of a sporeless phenotype not linked to the adverse traits in breeding and cultivation is crucial for the establishment of sporeless breeding using a strategy employing targeting induced local lesions in genomes (TILLING) in cultivated mushrooms. We used a Pleurotus pulmonarius (Fr.) Quél. sporeless strain to identify and characterize the single recessive gene controlling the mutation. The 3,853-bp stpp1 gene encodes a protein of 854 amino acids and belongs to the MutS homolog (MSH) family associated with mismatch repair in DNA synthesis or recombination in meiosis. Gene expression analysis of the fruiting body showed that this gene is strongly expressed in the gills. Phenotypic analysis of disruptants formed by gene targeting suggested a reproducible sporeless phenotype. Mutants deficient in a functional copy of this gene have no unfavorable traits for sporeless cultivar breeding, so this gene will be an extremely useful target for efficient and versatile sporeless breeding in P. pulmonarius and various other cultivated mushrooms.

Pleurotus ostreatus inhibits proliferation of human breast and colon cancer cells through p53-dependent as well as p53-independent pathway

PubMed Central

JEDINAK, ANDREJ; SLIVA, DANIEL

2009-01-01

In spite of the global consumption of mushrooms, only two epidemiological studies demonstrated an inverse correlation between mushroom intake and the risk of cancer. Therefore, in the present study we evaluated whether extracts from edible mushrooms Agaricus bisporus (portabella), Flammulina velutipes (enoki), Lentinula edodes (shiitake) and Pleurotus ostreatus (oyster) affect the growth of breast and colon cancer cells. Here, we identified as the most potent, P. ostreatus (oyster mushroom) which suppressed proliferation of breast cancer (MCF-7, MDA-MB-231) and colon cancer (HT-29, HCT-116) cells, without affecting proliferation of epithelial mammary MCF-10A and normal colon FHC cells. Flow cytometry revealed that the inhibition of cell proliferation by P. ostreatus was associated with the cell cycle arrest at G0/G1 phase in MCF-7 and HT-29 cells. Moreover, P. ostreatus induced the expression of the tumor suppressor p53 and cyclin-dependent kinase inhibitor p21(CIP1/WAF1), whereas inhibited the phosphorylation of retinoblastoma Rb protein in MCF-7 cells. In addition, P. ostreatus also up-regulated expression of p21 and inhibited Rb phosphorylation in HT-29 cells, suggesting that that P. ostreatus suppresses the proliferation of breast and colon cancer cells via p53-dependent as well as p53-independent pathway. In conclusion, our results indicated that the edible oyster mushroom has potential therapeutic/preventive effects on breast and colon cancer. PMID:19020765

Selenium Polysaccharide SPMP-2a from Pleurotus geesteranus Alleviates H2O2-Induced Oxidative Damage in HaCaT Cells

PubMed Central

Zhou, Cheng; Huang, Shoucheng

2017-01-01

Selenium- (Se-) enriched polysaccharide SPMP-2a was extracted and purified from Pleurotus geesteranus. SPMP-2a is a white flocculent polysaccharide and soluble in water, with a molecular weight of 3.32 × 104 Da. Fourier transform infrared spectroscopy spectral analysis indicated that it belongs to an acid Se polysaccharide with α-D-glucopyranoside bond. The effects of Se polysaccharide SPMP-2a in P. geesteranus against hydrogen peroxide- (H2O2-) induced oxidative damage in human keratinocytes (HaCaT) cells were evaluated further. Reduced cell viability and elevated apoptotic rates in H2O2-treated HaCaT cells were proven by MTT and flow cytometry assays. Hoechst 33342 staining revealed chromatin condensations in the nuclei of HaCaT cells. However, with the addition of SPMP-2a, cell viability improved, nuclear condensation declined, and cell apoptotic rates dropped significantly. Ultrastructural observation consistently revealed that treatments with SPMP-2a reduced the number of swollen and vacuolar mitochondria in the H2O2-treated cells compared with the controls. Furthermore, SPMP-2a increased the superoxide dismutase (SOD) and catalase (CAT) activities and reduced reactive oxygen species (ROS) content. Western blot analysis showed that SPMP-2a treatment effectively increased B-cell lymphoma 2 (Bcl-2) protein expression. Therefore, SPMP-2a could improve cellular antioxidant enzyme activities, reduce ROS levels, and increase Bcl-2 protein expression levels, thereby reducing cell apoptosis and protecting HaCaT cells from H2O2-induced oxidative damage. PMID:28293636

Detoxification of pulping black liquor with Pleurotus ostreatus or recombinant Pichia pastoris followed by CuO/TiO2/visible photocatalysis.

PubMed

Rivera-Hoyos, Claudia M; Morales-Álvarez, Edwin D; Abelló-Esparza, Juanita; Buitrago-Pérez, Daniel F; Martínez-Aldana, Nicolás; Salcedo-Reyes, Juan C; Poutou-Piñales, Raúl A; Pedroza-Rodríguez, Aura M

2018-02-22

Cellulose-pulping requires chemicals such as Cl 2 , ClO 2 , H 2 O 2 , and O 2 . The black liquor (BL) generated exhibits a high chemical oxygen demand (COD), five-day biochemical oxygen demand (BOD 5 ), and chlorophenol content, along with an augmented colour and increased pH. BL is often discharged into water bodies, where it has a negative impact on the environment. Towards that end, laccases are of great interest for bioremediation, since they can degrade aromatic and non-aromatic compounds while reducing O 2 to water instead of H 2 O 2 . As such, we evaluated Pleurotus ostreatus and Pichia pastoris (which produces rPOXA 1B laccase) in the treatment of synthetic BL (SBL) in an "in vitro" modified Kraft process followed by CuO/TiO 2 /visible light photocatalysis. Treating SBL with P. ostreatus viable biomass (VB) followed by CuO/TiO 2 /visible light photocatalysis resulted in 80.3% COD removal and 70.6% decolourisation. Toxic compounds such as 2-methylphenol, 4-methylphenol, and 2-methoxyphenol were eliminated. Post-treated SBL exhibited low phytotoxicity, as evidenced by a Lactuca sativa L seed germination index (GI) > 50%. Likewise, SBL treatment with P. pastoris followed by VB/CuO/TiO 2 /visible light photocatalysis resulted in 63.7% COD removal and 46% decolourisation. Moreover, this treatment resulted in the elimination of most unwanted compounds, with the exception of 4-chlorophenol. The Lactuca sativa L seed GI of the post-treated SBL was 40%, indicating moderate phytotoxicity.

Assessing the Effect of Composting Cassava Peel Based Substrates on the Yield, Nutritional Quality, and Physical Characteristics of Pleurotus ostreatus (Jacq. ex Fr.) Kummer

PubMed Central

Kortei, N. K.; Dzogbefia, V. P.; Obodai, M.

2014-01-01

Cassava peel based substrate formulations as an alternative substrate were used to grow mushrooms. The effect of two compost heights, three composting periods on the mycelia growth, physical characteristics, yield, and nutritional qualities of Pleurotus ostreatus (Jacq. ex Fr.) Kummer was studied. Mean mycelia growth of 16.2 cm after a period of seven (7) weeks was the best for 1.5 m compost height. Cap diameter and stipe length differed significantly (P < 0.05) with the compost heights (0.8 m and 1.5 m). The yield on compost height of 1.5 m, composted for 5 days, differed significantly (P < 0.05) from that of 0.8 m and gave increasing yields as follows: cassava peels and manure, cassava peels only, cassava peels and corn cobs (1 : 1 ratio), and cassava peels and corn cobs (1 : 1 ratio) with chicken manure. Composting periods (3 and 7 days) gave varying yields depending on the compost height. Based on the findings an interaction of 1.5 m compost height and 5 days composting period on cassava peels and corncobs (1 : 1 ratio) with chicken manure produced the best results. The nutritional quality of the mushrooms also differed significantly (P < 0.05), indicating that cassava peels could be used as a possible substrate in cultivation of mushroom. PMID:25580299

Assessment of Antioxidant and Phenolic Compound Concentrations as well as Xanthine Oxidase and Tyrosinase Inhibitory Properties of Different Extracts of Pleurotus citrinopileatus Fruiting Bodies

PubMed Central

Alam, Nuhu; Yoon, Ki Nam; Lee, Kyung Rim; Kim, Hye Young; Shin, Pyung Gyun; Cheong, Jong Chun; Yoo, Young Bok; Shim, Mi Ja; Lee, Min Woong

2011-01-01

Cellular damage caused by reactive oxygen species has been implicated in several diseases, thus establishing a significant role for antioxidants in maintaining human health. Acetone, methanol, and hot water extracts of Pleurotus citrinopileatus were evaluated for their antioxidant activities against β-carotene-linoleic acid and 1,1-diphenyl-2-picrylhydrazyl (DPPH) radicals, reducing power, ferrous ion-chelating abilities, and xanthine oxidase inhibitory activities. In addition, the tyrosinase inhibitory effects and phenolic compound contents of the extracts were also analyzed. Methanol and acetone extracts of P. citrinopileatus showed stronger inhibition of β-carotene-linoleic acid compared to the hot water extract. Methanol extract (8 mg/mL) showed a significantly high reducing power of 2.92 compared to the other extracts. The hot water extract was more effective than the acetone and methanole extracts for scavenging DPPH radicals. The strongest chelating effect (92.72%) was obtained with 1.0 mg/mL of acetone extract. High performance liquid chromatography analysis detected eight phenolic compounds, including gallic acid, protocatechuic acid, chlorogenic acid, ferulic acid, naringenin, hesperetin, formononetin, and biochanin-A, in an acetonitrile and hydrochloric acid (5 : 1) solvent extract. Xanthine oxidase and tyrosinase inhibitory activities of the acetone, methanol, and hot water extracts increased with increasing concentration. This study suggests that fruiting bodies of P. citrinopileatus can potentially be used as a readily accessible source of natural antioxidants. PMID:22783067

Computational Analysis and Low-Scale Constitutive Expression of Laccases Synthetic Genes GlLCC1 from Ganoderma lucidum and POXA 1B from Pleurotus ostreatus in Pichia pastoris

PubMed Central

Reyes-Guzmán, Edwin Alfredo; Poutou-Piñales, Raúl A.; Reyes-Montaño, Edgar Antonio; Pedroza-Rodríguez, Aura Marina; Rodríguez-Vázquez, Refugio; Cardozo-Bernal, Ángela M.

2015-01-01

Lacasses are multicopper oxidases that can catalyze aromatic and non-aromatic compounds concomitantly with reduction of molecular oxygen to water. Fungal laccases have generated a growing interest due to their biotechnological potential applications, such as lignocellulosic material delignification, biopulping and biobleaching, wastewater treatment, and transformation of toxic organic pollutants. In this work we selected fungal genes encoding for laccase enzymes GlLCC1 in Ganoderma lucidum and POXA 1B in Pleurotus ostreatus. These genes were optimized for codon use, GC content, and regions generating secondary structures. Laccase proposed computational models, and their interaction with ABTS [2, 2′-azino-bis(3-ethylbenzothiazoline-6-sulphonic acid)] substrate was evaluated by molecular docking. Synthetic genes were cloned under the control of Pichia pastoris glyceraldehyde-3-phosphate dehydrogenase (GAP) constitutive promoter. P. pastoris X-33 was transformed with pGAPZαA-LaccGluc-Stop and pGAPZαA-LaccPost-Stop constructs. Optimization reduced GC content by 47 and 49% for LaccGluc-Stop and LaccPost-Stop genes, respectively. A codon adaptation index of 0.84 was obtained for both genes. 3D structure analysis using SuperPose revealed LaccGluc-Stop is similar to the laccase crystallographic structure 1GYC of Trametes versicolor. Interaction analysis of the 3D models validated through ABTS, demonstrated higher substrate affinity for LaccPost-Stop, in agreement with our experimental results with enzymatic activities of 451.08 ± 6.46 UL-1 compared to activities of 0.13 ± 0.028 UL-1 for LaccGluc-Stop. This study demonstrated that G. lucidum GlLCC1 and P. ostreatus POXA 1B gene optimization resulted in constitutive gene expression under GAP promoter and α-factor leader in P. pastoris. These are important findings in light of recombinant enzyme expression system utility for environmentally friendly designed expression systems, because of the wide range of substrates

Computational analysis and low-scale constitutive expression of laccases synthetic genes GlLCC1 from Ganoderma lucidum and POXA 1B from Pleurotus ostreatus in Pichia pastoris.

PubMed

Rivera-Hoyos, Claudia M; Morales-Álvarez, Edwin David; Poveda-Cuevas, Sergio Alejandro; Reyes-Guzmán, Edwin Alfredo; Poutou-Piñales, Raúl A; Reyes-Montaño, Edgar Antonio; Pedroza-Rodríguez, Aura Marina; Rodríguez-Vázquez, Refugio; Cardozo-Bernal, Ángela M

2015-01-01

Lacasses are multicopper oxidases that can catalyze aromatic and non-aromatic compounds concomitantly with reduction of molecular oxygen to water. Fungal laccases have generated a growing interest due to their biotechnological potential applications, such as lignocellulosic material delignification, biopulping and biobleaching, wastewater treatment, and transformation of toxic organic pollutants. In this work we selected fungal genes encoding for laccase enzymes GlLCC1 in Ganoderma lucidum and POXA 1B in Pleurotus ostreatus. These genes were optimized for codon use, GC content, and regions generating secondary structures. Laccase proposed computational models, and their interaction with ABTS [2, 2'-azino-bis(3-ethylbenzothiazoline-6-sulphonic acid)] substrate was evaluated by molecular docking. Synthetic genes were cloned under the control of Pichia pastoris glyceraldehyde-3-phosphate dehydrogenase (GAP) constitutive promoter. P. pastoris X-33 was transformed with pGAPZαA-LaccGluc-Stop and pGAPZαA-LaccPost-Stop constructs. Optimization reduced GC content by 47 and 49% for LaccGluc-Stop and LaccPost-Stop genes, respectively. A codon adaptation index of 0.84 was obtained for both genes. 3D structure analysis using SuperPose revealed LaccGluc-Stop is similar to the laccase crystallographic structure 1GYC of Trametes versicolor. Interaction analysis of the 3D models validated through ABTS, demonstrated higher substrate affinity for LaccPost-Stop, in agreement with our experimental results with enzymatic activities of 451.08 ± 6.46 UL-1 compared to activities of 0.13 ± 0.028 UL-1 for LaccGluc-Stop. This study demonstrated that G. lucidum GlLCC1 and P. ostreatus POXA 1B gene optimization resulted in constitutive gene expression under GAP promoter and α-factor leader in P. pastoris. These are important findings in light of recombinant enzyme expression system utility for environmentally friendly designed expression systems, because of the wide range of substrates

High-Temperature Induced Changes of Extracellular Metabolites in Pleurotus ostreatus and Their Positive Effects on the Growth of Trichoderma asperellum.

PubMed

Qiu, Zhiheng; Wu, Xiangli; Zhang, Jinxia; Huang, Chenyang

2018-01-01

Pleurotus ostreatus is a widely cultivated edible fungus in China. Green mold disease of P. ostreatus which can seriously affect yield is a common disease during cultivation. It occurs mostly after P. ostreatus mycelia have been subjected to high temperatures. However, little information is available on the relationship between high temperature and green mold disease. The aim of this study is to prove that extracellular metabolites of P. ostreatus affected by high temperature can promote the growth of Trichoderma asperellum . After P. ostreatus mycelia was subjected to high temperature, the extracellular fluid of P. ostreatus showed a higher promoting effect on mycelial growth and conidial germination of T. asperellum . The thiobarbituric acid reactive substance (TBARS) content reached the maximum after 48 h at 36°C. A comprehensive metabolite profiling strategy involving gas chromatography-mass spectrometry (GC/MS) combined with liquid chromatography-mass spectrometry (LC/MS) was used to analyze the changes of extracellular metabolites in response to high temperature. A total of 141 differential metabolites were identified, including 84.4% up-regulated and 15.6% down-regulated. Exogenous metabolites whose concentrations were increased after high temperature were randomly selected, and nearly all of them were able to promote the mycelial growth and conidial germination of T. asperellum . The combination of all selected exogenous metabolites also has the promotion effects on the mycelial growth and conidial germination of T. asperellum in a given concentration range in vitro . Overall, these results provide a first view that high temperature affects the extracellular metabolites of P. ostreatus , and the extensive change in metabolites promotes T. asperellum growth.

Malachite Green and Crystal Violet Decolorization by Ganoderma lucidum and Pleurotus ostreatus Supernatant and by rGlLCC1 and rPOXA 1B Concentrates: Molecular Docking Analysis.

PubMed

Morales-Álvarez, Edwin D; Rivera-Hoyos, Claudia M; Poveda-Cuevas, Sergio A; Reyes-Guzmán, Edwin A; Pedroza-Rodríguez, Aura M; Reyes-Montaño, Edgar A; Poutou-Piñales, Raúl A

2018-03-01

Laccases catalyze the oxidation of various aromatic organic compounds concomitantly with molecular oxygen reduction to water. Triphenylmethane dyes are synthetic compounds widely used in diverse industries. Their removal from effluents is difficult, due to their high degree of structural complexity; hence, their high concentration in effluents cause a negative impact on the environment. In the present work, molecular docking was used to evaluate interactions between rGlLCC1 or rPOXA 1B enzymes with Crystal Violet (CV) or Malachite Green (MG) dyes. In addition, removal tests of the two dyes were performed. Van der Waals interactions were obtained for only the CV dye for both GlLCC1 and POXA 1B enzymes. Nevertheless, in the GlLCC1 model, two π-π interactions were observed. For the MG dye only, Van der Waals interactions were obtained. Moreover, amino acid composition interacting in each model with each dye was similar. It is important to highlight that by molecular docking, none of the estimated ligand configurations generated hydrogen bonds. Thus, explaining the difficulty to degrade CV and MG. Regarding CV, maximum decolorization percentage was 23.6 ± 1.0% using Ganoderma lucidum supernatant and 5.0 ± 0.5% with Pleurotus ostreatus supernatant. When using recombinant laccase enzyme concentrates, decolorization percentages were 9.9 ± 0.1 and 7.5 ± 1.0% for rGlLCC1 and rPOXA 1B, respectively. On the other hand, for the MG dye, maximum decolorization percentages were 52.1 ± 5.1 and 2.3 ± 0.2% using G. lucidum and P. ostreatus concentrates, respectively. Whereas with recombinant laccase enzymatic concentrates, values of 9.4 ± 0.8% were obtained, with rGlLCC1, and 2.1 ± 0.1% when using rPOXA 1B. These findings represent an important step in bioremediation processes improvement and efficiency of industry-generated products, using environmentally friendly alternatives.

Effect of different cooking methods on nutritional value and antioxidant activity of cultivated mushrooms.

PubMed

Roncero-Ramos, Irene; Mendiola-Lanao, Mónica; Pérez-Clavijo, Margarita; Delgado-Andrade, Cristina

2017-05-01

Influence of culinary treatments (boiling, microwaving, grilling, and deep frying) on proximate composition and antioxidant capacity of cultivated mushrooms (Agaricus bisporus, Lentinula edodes, Pleurotus ostreatus, and Pleurotus eryngii) was studied. Proximate composition was affected by the cooking method and the mushrooms species. Frying induced more severe losses in protein, ash, and carbohydrates content but increased the fat and energy. Boiling improved the total glucans content by enhancing the β-glucans fraction. A significant decrease was detected in the antioxidant activity especially after boiling and frying, while grilled and microwaved mushrooms reached higher values of antioxidant activity. Maillard reaction products could be partially responsible, as supported by the absorbance values measured at 420 nm. Since cooking techniques clearly influence the nutritional attributes of mushrooms, the proper selection of treatments is a key factor to prevent/reduce nutritional losses. Microwaving and grilling were established as the best processes to maintain the nutritional profile of mushrooms.

Induction of fungal laccase production under solid state bioprocessing of new agroindustrial waste and its application on dye decolorization.

PubMed

Akpinar, Merve; Ozturk Urek, Raziye

2017-06-01

Lignocellulosic wastes are generally produced in huge amounts worldwide. Peach waste of these obtained from fruit juice industry was utilized as the substrate for laccase production by Pleurotus eryngii under solid state bioprocessing (SSB). Its chemical composition was determined and this bioprocess was carried out under stationary conditions at 28 °C. The effects of different compounds; copper, iron, Tween 80, ammonium nitrate and manganese, and their variable concentrations on laccase production were investigated in detail. The optimum production of laccase (43,761.33 ± 3845 U L -1 ) was achieved on the day of 20 by employing peach waste of 5.0 g and 70 µM Cu 2+ , 18 µM Fe 2+ , 0.025% (v/v) Tween 80, 4.0 g L -1 ammonium nitrate, 750 µM Mn 2+ as the inducers. The dye decolorization also researched to determine the degrading capability of laccase produced from peach culture under the above-mentioned conditions. Within this scope of the study, methyl orange, tartrazine, reactive red 2 and reactive black dyes were treated with this enzyme. The highest decolorization was performed with methyl orange as 43 ± 2.8% after 5 min of treatment when compared to other dyes. Up to now, this is the first report on the induction of laccase production by P. eryngii under SSB using peach waste as the substrate.

Effect of growth substrate, method of fermentation, and nitrogen source on lignocellulose-degrading enzymes production by white-rot basidiomycetes.

PubMed

Elisashvili, Vladimir; Kachlishvili, Eva; Penninckx, Michel

2008-11-01

The exploration of seven physiologically different white rot fungi potential to produce cellulase, xylanase, laccase, and manganese peroxidase (MnP) showed that the enzyme yield and their ratio in enzyme preparations significantly depends on the fungus species, lignocellulosic growth substrate, and cultivation method. The fruit residues were appropriate growth substrates for the production of hydrolytic enzymes and laccase. The highest endoglucanase (111 U ml(-1)) and xylanase (135 U ml(-1)) activities were revealed in submerged fermentation (SF) of banana peels by Pycnoporus coccineus. In the same cultivation conditions Cerrena maxima accumulated the highest level of laccase activity (7,620 U l(-1)). The lignified materials (wheat straw and tree leaves) appeared to be appropriate for the MnP secretion by majority basidiomycetes. With few exceptions, SF favored to hydrolases and laccase production by fungi tested whereas SSF was appropriate for the MnP accumulation. Thus, the Coriolopsis polyzona hydrolases activity increased more than threefold, while laccase yield increased 15-fold when tree leaves were undergone to SF instead SSF. The supplementation of nitrogen to the control medium seemed to have a negative effect on all enzyme production in SSF of wheat straw and tree leaves by Pleurotus ostreatus. In SF peptone and ammonium containing salts significantly increased C. polyzona and Trametes versicolor hydrolases and laccase yields. However, in most cases the supplementation of media with additional nitrogen lowered the fungi specific enzyme activities. Especially strong repression of T. versicolor MnP production was revealed.

Identification and Functional Analysis of Pheromone and Receptor Genes in the B3 Mating Locus of Pleurotus eryngii

PubMed Central

Kim, Kyung-Hee; Kang, Young Min; Im, Chak Han; Ali, Asjad; Kim, Sun Young; Je, Hee-Jeong; Kim, Min-Keun; Rho, Hyun Su; Lee, Hyun Sook; Kong, Won-Sik; Ryu, Jae-San

2014-01-01

Pleurotus eryngii has recently become a major cultivated mushroom; it uses tetrapolar heterothallism as a part of its reproductive process. Sexual development progresses only when the A and B mating types are compatible. Such mating incompatibility occasionally limits the efficiency of breeding programs in which crossing within loci-shared strains or backcrossing strategies are employed. Therefore, understanding the mating system in edible mushroom fungi will help provide a short cut in the development of new strains. We isolated and identified pheromone and receptor genes in the B3 locus of P. eryngii and performed a functional analysis of the genes in the mating process by transformation. A genomic DNA library was constructed to map the entire mating-type locus. The B3 locus was found to contain four pheromone precursor genes and four receptor genes. Remarkably, receptor PESTE3.3.1 has just 34 amino acid residues in its C-terminal cytoplasmic region; therefore, it seems likely to be a receptor-like gene. Real-time quantitative RT-PCR (real-time qRT-PCR) revealed that most pheromone and receptor genes showed significantly higher expression in monokaryotic cells than dikaryotic cells. The pheromone genes PEphb3.1 and PEphb3.3 and the receptor gene PESTE3.3.1 were transformed into P5 (A3B4). The transformants were mated with a tester strain (A4B4), and the progeny showed clamp connections and a normal fruiting body, which indicates the proposed role of these genes in mating and fruiting processes. This result also confirms that PESTE3.3.1 is a receptor gene. In this study, we identified pheromone and receptor genes in the B3 locus of P. eryngii and found that some of those genes appear to play a role in the mating and fruiting processes. These results might help elucidate the mechanism of fruiting differentiation and improve breeding efficiency. PMID:25133513

Degradation of Three Aromatic Dyes by White Rot Fungi and the Production of Ligninolytic Enzymes

PubMed Central

Jayasinghe, Chandana; Imtiaj, Ahmed; Lee, Geon Woo; Im, Kyung Hoan; Hur, Hyun; Lee, Min Woong; Yang, Hee-Sun

2008-01-01

This study was conducted to evaluate the degradation of aromatic dyes and the production of ligninolytic enzymes by 10 white rot fungi. The results of this study revealed that Pycnoporus cinnabarinus, Pleurotus pulmonarius, Ganoderma lucidum, Trametes suaveolens, Stereum ostrea and Fomes fomentarius have the ability to efficiently degrade congo red on solid media. However, malachite green inhibited the mycelial growth of these organisms. Therefore, they did not effectively decolorize malachite green on solid media. However, P. cinnabarinus and P. pulmonarius were able to effectively decolorize malachite green on solid media. T. suaveolens and F. rosea decolorized methylene blue more effectively than any of the other fungi evaluated in this study. In liquid culture, G. lucidum, P. cinnabarinus, Naematoloma fasciculare and Pycnoporus coccineus were found to have a greater ability to decolorize congo red. In addition, P. cinnabarinus, G. lucidum and T. suaveolens decolorized methylene blue in liquid media more effectively than any of the other organisms evaluated in this study. Only F. fomentarius was able to decolorize malachite green in liquid media, and its ability to do so was limited. To investigate the production of ligninolytic enzymes in media containing aromatic compounds, fungi were cultured in naphthalene supplemented liquid media. P. coccineus, Coriolus versicolor and P. cinnabarinus were found to produce a large amount of laccase when grown in medium that contained napthalene. PMID:23990745

Systematic Analysis of the Pleurotus ostreatus Laccase Gene (PoLac) Family and Functional Characterization of PoLac2 Involved in the Degradation of Cotton-Straw Lignin.

PubMed

Jiao, Xiaoyu; Li, Guoqing; Wang, Yan; Nie, Fan; Cheng, Xi; Abdullah, Muhammad; Lin, Yi; Cai, Yongping

2018-04-11

Fungal laccases play important roles in the degradation of lignocellulose. Although some PoLac s have been reported in several studies, still no comprehensive bioinformatics study of the LAC family in Pleurotus ostreatus has been reported. In this study, we identified 12 laccase genes in the whole genome sequence of P. ostreatus and their physical characteristics, gene distribution, phylogenic relationships, gene structure, conserved motifs, and cis-elements were also analyzed. The expression patterns of 12 PoLac genes at different developmental stages and under different culture substrates were also analyzed. The results revealed that PoLac2 and PoLac12 may be involved in the degradation of lignin and the formation of the fruiting body, respectively. Subsequently, we overexpressed PoLac2 in P. ostreatus by the Agrobacterium tumefaciens -mediated transformation (ATMT) method. The transformants' laccase activity increased in varying degrees, and the gene expression level of PoLac2 in transformants was 2-8 times higher than that of the wild-type strain. Furthermore, the lignin degradation rate by transgenic fungus over 30 days was 2.36-6.3% higher than that of wild-type. Our data show that overexpression of PoLac2 significantly enhanced the lignin degradation of cotton-straw. To our knowledge, this study is the first report to demonstrate the functions of PoLac2 in P. ostreatus .

Contamination level, distribution and health risk assessment of heavy and toxic metallic and metalloid elements in a cultivated mushroom Pleurotus florida (Mont.) singer.

PubMed

Khani, Rouhollah; Moudi, Maryam; Khojeh, Vahid

2017-02-01

There are great concentrations of toxic metallic and metalloid elements such as lead, arsenic, mercury, cadmium or silver in many species of mushrooms comparative to other fruits and vegetables. In this study, contamination with heavy and toxic metallic and metalloid elements in the cultivated mushroom of (Pleurotus florida (Mont.) Singer) is investigated. P. florida was cultivated on different substrates; wheat straw (as blank), wheat straw + pine cone, wheat straw + soybean straw and wheat straw + urea and the effects of these substrates on contamination levels of Mn, Fe, Cu, Zn, As, Cd, and Pb were analyzed. The results showed that the concentrations of essential elements (Mn, Fe, Cu, and Zn) in the target mushroom are at the typical levels. The estimated daily intakes of studied metallic and metalloid elements were below their oral reference dosage mentioned by the international regulatory bodies. Health risk index (HRI) was calculated to evaluate the consumer's health risk assessment from the metal intake that contaminated in the cultivated mushroom of P. florida on the different nutrient sources. In this study, the individual HRIs were less than 1, which indicates insignificant potential health risk associated with the consumption of target mushroom from the studied substrates. Based on the HRIs values among the toxic metallic and metalloid elements, As in the target mushroom in the substrate of the wheat straw + pine cone is the main sources of risk, and it may cause severe health problems. Thus, this study suggests that the concentrations of heavy and toxic elements should be periodically monitored in cultivated mushrooms.

Oral hypoglycemic activity of culinary-medicinal mushrooms Pleurotus ostreatus and P. cystidiosus (higher basidiomycetes) in normal and alloxan-induced diabetic Wistar rats.

PubMed

Jayasuriya, W J A B; Suresh, T S; Abeytunga, D; Fernando, G H; Wanigatunga, C A

2012-01-01

This study investigates the oral hypoglycemic activity of Pleurotus ostreatus (P.o.) and P. cystidiosus (P.c.) mushrooms on normal and alloxan-induced diabetic Wistar rats. Different doses (250, 500, 750, 1000, and 1250 mg/kg/body weight) of suspensions of freeze-dried and powdered (SFDP) P.o. and P.c. were administered to normal rats, and postprandial serum glucose levels were measured. Optimal time of activity was investigated using the dose 500 mg/kg. Hypoglycemic effect of a single dose of SFDP P.o. and P.c. (500 mg/kg) were investigated using diabetic male and female rats at different stages of estrous cycle and compared with metformin and glibenclamide. Chronic hypoglycemic activity of SFDP P.o. and P.c. (500 mg/kg) was studied using serum glucose levels and glycosylated hemoglobin levels. Maximally effective dose of SFDP P.o. and P.c. was 500 mg/kg. The highest reduction in the serum glucose level was observed 120 minutes after administration of mushrooms. A single dose of P.o. and P.c. significantly (P < 0.05) reduced the serum glucose levels of male diabetic rats. The hypoglycemic activity in female rats was highest in proestrous stage. The hypoglycemic effect of P.o. and P.c. is comparable with metformin and glibenclamide. Daily single administrations of P.o. and P.c. to diabetic rats exert apparent control on the homeostasis of blood glucose. SFDP P.o. and P.c. possessed marked and significant oral hypoglycemic activity. This study suggests the consumption of P.o. and P.c. mushrooms might bring health benefits to mankind as it shows hypoglycemic activity in rats.

Construction of a genetic linkage map and analysis of quantitative trait loci associated with the agronomically important traits of Pleurotus eryngii.

PubMed

Im, Chak Han; Park, Young-Hoon; Hammel, Kenneth E; Park, Bokyung; Kwon, Soon Wook; Ryu, Hojin; Ryu, Jae-San

2016-07-01

Breeding new strains with improved traits is a long-standing goal of mushroom breeders that can be expedited by marker-assisted selection (MAS). We constructed a genetic linkage map of Pleurotus eryngii based on segregation analysis of markers in postmeiotic monokaryons from KNR2312. In total, 256 loci comprising 226 simple sequence-repeat (SSR) markers, 2 mating-type factors, and 28 insertion/deletion (InDel) markers were mapped. The map consisted of 12 linkage groups (LGs) spanning 1047.8cM, with an average interval length of 4.09cM. Four independent populations (Pd3, Pd8, Pd14, and Pd15) derived from crossing between four monokaryons from KNR2532 as a tester strain and 98 monokaryons from KNR2312 were used to characterize quantitative trait loci (QTL) for nine traits such as yield, quality, cap color, and earliness. Using composite interval mapping (CIM), 71 QTLs explaining between 5.82% and 33.17% of the phenotypic variations were identified. Clusters of more than five QTLs for various traits were identified in three genomic regions, on LGs 1, 7 and 9. Regardless of the population, 6 of the 9 traits studied and 18 of the 71 QTLs found in this study were identified in the largest cluster, LG1, in the range from 65.4 to 110.4cM. The candidate genes for yield encoding transcription factor, signal transduction, mycelial growth and hydrolase are suggested by using manual and computational analysis of genome sequence corresponding to QTL region with the highest likelihood odds (LOD) for yield. The genetic map and the QTLs established in this study will help breeders and geneticists to develop selection markers for agronomically important characteristics of mushrooms and to identify the corresponding genes. Copyright © 2016 Elsevier Inc. All rights reserved.

α- and β-d-Glucans from the edible mushroom Pleurotus albidus differentially regulate lipid-induced inflammation and foam cell formation in human macrophage-like THP-1 cells.

PubMed

Castro-Alves, Victor Costa; Nascimento, João Roberto Oliveira do

2018-05-01

Macrophages play an essential role in lipid metabolism; however, the excessive uptake of modified lipids and cholesterol crystals (CC) leads to the formation of pro-inflammatory lipid-laden macrophages called foam cells. Since the α-1,6- and β-1,3-d-glucans from the basidiome and the mycelium of the edible mushroom Pleurotus albidus have previously been shown to regulate macrophage function, these glucans were tested in macrophage-like THP-1 cells previously exposed to acetylated low-density lipoproteins (acLDL) or CC. The glucans inhibited lipid-induced inflammation, but only the β-1,3-d-glucan regulated both the NLRP3 inflammasome activation and the expression of genes involved on lipid efflux in acLDL- or CC-pretreated cells, thereby reducing foam cell formation. In contrast, the two α-1,6-glucans tested inhibited foam cell formation only in acLDL-pretreated cells and had no effect on the expression of the peroxisome proliferator-activated receptor gamma and liver X receptor alpha genes, suggesting that these glucans regulate lipid influx rather than lipid efflux. Thus, α- and β-d-glucans differentially regulate lipid-induced inflammation and foam cell formation in macrophage-like cells. Furthermore, results emphasize that P. albidus has potential to be used as a functional food or as a source for the extraction of biologically-active glucans. Copyright © 2018 Elsevier B.V. All rights reserved.

Effects of pex1 disruption on wood lignin biodegradation, fruiting development and the utilization of carbon sources in the white-rot Agaricomycete Pleurotus ostreatus and non-wood decaying Coprinopsis cinerea.

PubMed

Nakazawa, Takehito; Izuno, Ayako; Horii, Masato; Kodera, Rina; Nishimura, Hiroshi; Hirayama, Yuichiro; Tsunematsu, Yuta; Miyazaki, Yasumasa; Awano, Tatsuya; Muraguchi, Hajime; Watanabe, Kenji; Sakamoto, Masahiro; Takabe, Keiji; Watanabe, Takashi; Isagi, Yuji; Honda, Yoichi

2017-12-01

Peroxisomes are well-known organelles that are present in most eukaryotic organisms. Mutant phenotypes caused by the malfunction of peroxisomes have been shown in many fungi. However, these have never been investigated in Agaricomycetes, which include white-rot fungi that degrade wood lignin in nature almost exclusively and play an important role in the global carbon cycle. Based on the results of a forward genetics study to identify mutations causing defects in the ligninolytic activity of the white-rot Agaricomycete Pleurotus ostreatus, we report phenotypes of pex1 disruptants in P. ostreatus, which are defective in two major features of white-rot Agaricomycetes: lignin biodegradation and mushroom formation. Pex1 disruption was also shown to cause defects in the hyphal growth of P. ostreatus on certain sawdust and minimum media. We also demonstrated that pex1 is essential for fruiting initiation in the non-wood decaying Agaricomycete Coprinopsis cinerea. However, unlike P. ostreatus, significant defects in hyphal growth on the aforementioned agar medium were not observed in C. cinerea. This result, together with previous C. cinerea genetic studies, suggests that the regulation mechanisms for the utilization of carbon sources are altered during the evolution of Agaricomycetes or Agaricales. Copyright © 2017 Elsevier Inc. All rights reserved.

Effects of Eryngii mushroom (Pleurotus eryngii) and Lactobacillus plantarum on growth performance, immunity and disease resistance of Pangasius catfish (Pangasius bocourti, Sauvage 1880).

PubMed

Van Doan, Hien; Doolgindachbaporn, Sompong; Suksri, Amnuaysilpa

2016-10-01

This study was conducted to evaluate the effects of Eryngii mushroom, Pleurotus eryngii (PE), and Lactobacillus plantarum single or combined on growth, innate immune response and disease resistance of the Pangasius catfish, Pangasius bocourti. Two hundred forty fish were divided into four treatments, i.e., 0 g kg(-1) PE (Control, Diet 1), 3 g kg(-1) PE (Diet 2), 10(8) cfu g(-1) L. plantarum (Diet 3) and 3 g kg(-1) PE + 10(8) cfu g(-1) L. plantarum (Diet 4). Fish were culture in glass tanks with water volume approximately of 150 l, and each treatment had four replications with 15 fish per replication. Following 30, 60 and 90 days of the feeding trial, specific growth rate (SGR), feed conversion ratio (FCR), serum lysozyme, phagocytosis and respiratory burst activities were measured. SGR and FCR were significantly improved in fish fed supplemented diets after 90 days of the feeding trial. Serum lysozyme, phagocytosis and respiratory burst activity of fish were significantly stimulated by both PE and L. plantarum diets; however, the highest innate immune response was observed in fish fed synbiotic diet. At the end of the experiment, five fish were randomly selected for a challenge test against Aeromonas hydrophila. The post-challenge survival rate of the fish fed supplemented diets was significantly greater than the control treatment, and the highest post-challenge survival rate was observed in synbiotic diet. The results revealed that dietary supplementation of PE and L. plantarum stimulated growth, immunity and disease resistance of the P. bocourti.

Intercellular production of tamavidin 1, a biotin-binding protein from Tamogitake mushroom, confers resistance to the blast fungus Magnaporthe oryzae in transgenic rice.

PubMed

Takakura, Yoshimitsu; Oka, Naomi; Suzuki, Junko; Tsukamoto, Hiroshi; Ishida, Yuji

2012-05-01

The blast fungus Magnaporthe oryzae, one of the most devastating rice pathogens in the world, shows biotin-dependent growth. We have developed a strategy for creating disease resistance to M. oryzae whereby intercellular production of tamavidin 1, a biotin-binding protein from Pleurotus cornucopiae occurs in transgenic rice plants. The gene that encodes tamavidin 1, fused to the sequence for a secretion signal peptide derived from rice chitinase gene, was connected to the Cauliflower mosaic virus 35S promoter, and the resultant construct was introduced into rice. The tamavidin 1 was accumulated at levels of 0.1-0.2% of total soluble leaf proteins in the transgenic rice and it was localized in the intercellular space of rice leaves. The tamavidin 1 purified from the transgenic rice was active, it bound to biotin and inhibited in vitro growth of M. oryzae by causing biotin deficiency. The transgenic rice plants showed a significant resistance to M. oryzae. This study shows the possibility of a new strategy to engineer disease resistance in higher plants by taking advantage of a pathogen's auxotrophy.

A possible water-soluble inducer for synthesis of cellulase in Aspergillus niger.

PubMed

Zhang, Jian-Guo; Li, Qi-Meng; Thakur, Kiran; Faisal, Shah; Wei, Zhao-Jun

2017-02-01

The synthesis of cellulase in filamentous fungi can be triggered by several inducers. In this study, a bamboo-shoot shell pretreated with Pleurotus ostreatus could promote the formation of cellulases in Aspergillus niger. Further identification, including UPLC-TOF-MS, ultrafiltration, and FT-IR, denoted that the soluble inducer was not a traditional disaccharide but a type of modified lignin polymer. This revelation may result in incipient strategies to ameliorate cellulase productivity. Copyright © 2016 Elsevier Ltd. All rights reserved.

Indian Medicinal Mushrooms as a Source of Antioxidant and Antitumor Agents

PubMed Central

A. Ajith, Thekkuttuparambil; K. Janardhanan, Kainoor

2007-01-01

Medicinal mushrooms occurring in South India namely Ganoderma lucidum, Phellinus rimosus, Pleurotus florida and Pleurotus pulmonaris possessed profound antioxidant and antitumor activities. This indicated that these mushrooms would be valuable sources of antioxidant and antitumor compounds. Investigations also revealed that they had significant antimutagenic and anticarcinogenic activities. Thus, Indian medicinal mushrooms are potential sources of antioxidant and anticancer compounds. However, intensive and extensive investigations are needed to exploit their valuable therapeutic use. PMID:18398492

Notes on a New Productive Strain of King Oyster Mushroom, Pleurotus eryngii (Higher Basidiomycetes), a Prized Italian Culinary-Medicinal Mushroom.

PubMed

Venturella, Giuseppe; Palazzolo, Eristanna; Saiano, Filippo; Gargano, Maria Letizia

2015-01-01

In this paper, the authors provide data on a culinary-medicinal, host-specific variety of P. eryngii species-complex that is known in Italy as "cardoncello". A species description, the techniques of isolation of a new strain (C-142-c), and the preparation of the substratum are illustrated. Data on the productivity of substratum inoculated with C-142-c strain and the nutritional value of cultivated "cardoncello" mushrooms are also provided.

Pleurotus eryngii immobilized Amberlite XAD-16 as a solid-phase biosorbent for preconcentrations of Cd2+ and Co2+ and their determination by ICP-OES.

PubMed

Özdemir, Sadin; Okumuş, Veysi; Kılınç, Ersin; Bilgetekin, Havin; Dündar, Abdurrahman; Ziyadanogˇulları, Berrin

2012-09-15

This article reports a method that is used for the preconcentration and determination of Cd(2+) and Co(2+) in vegetables, using Pleurotus eryngii immobilized Amberlite XAD-16 as a solid-phase biosorbent. The concentrations of metals were determined by inductively coupled plasma-optical spectrometry (ICP-OES). Critical parameters, such as the pH of the solution, flow rate, the amount of biosorbent, type and volume of eluent, and the sample volume, that affect the solid-phase extraction (SPE) procedure were optimized. The optimum extraction conditions were determined as being a pH of 6.0 for Cd(2+) and of 5.0 for Co(2+); a sample flow rate of 2.0 mL min(-1); 200.0mg of biosorbent; and 5.0 mL of 1.0 mol L(-1) HCl as eluent. The capacities of the biosorbent for metal uptake were found to be 11.3 and 9.8 mg g(-1) for Cd(2+) and Co(2+) ions, respectively. Limit of quantitations (LOQs) were found to be 0.67 and 0.82 ng mL(-1), respectively, for Cd(2+) and Co(2+). The linear working curves were observed to be in the linear range from 1.0 to 50.0 ng mL(-1), and possessed high correlation coefficients. The use of the SPE method showed 50.7- and 35.7-fold improvements in the sensitivities of ICP-OES. The developed method was successfully applied to NCS ZC-73014 (a certified reference tea sample). Relative standard deviations (RSD) were lower than 5.0%. The Cd(2+) and Co(2+) concentrations in the different parts (leave, root, stem, and fruit) of purslane, onion, rocket, okra, and aubergine were determined after microwave digestion and solid-phase extraction by P. eryngii immobilized on Amberlite XAD-16. Copyright © 2012 Elsevier B.V. All rights reserved.

[Cellulose acetate membrane electrophoresis CAE and Raman spectroscopy as a method identification of beta-glucans, used as biologically and therapeutically active biomaterials].

PubMed

Pielesz, Anna; Biniaś, Włodzimierz; Paluch, Jadwiga

2012-01-01

The formation of AGEs progressively increases with normal aging, even in the absence of disease (the pathogenesis of diabetes associated vascular disorders and neurodegenerative diseases, including Alzheimer's disease, Parkinson's disease). However, they are formed at accelerated rates in age-related diseases. The polysaccharides might play a role in wound healing, both internally and externally, and also that they could play a role against inflammation and may lead to the production of better medicines to be used as supplements in cancer treatment. The acid hydrolysis was studied with H2SO4 at 80% concentration to determine the most effective procedure for total hydrolysis of beta-glucan. The standard of beta-glucans acid hydrolysate were compared for commercial oat and oatmeal, mushrooms: Pleurotus ostreatus, Fungus and yeast Saccharomyces cerevisiae. The following materials and reagents were used in the examination: reference beta-(1 --> 3)-(1 --> 6)-glucan, oat and oatmeal, mushrooms: Pleurotus ostreatus, Fungus and yeast Saccharomyces cerevisiae. The Raman spectra of the sample solutions (beta-glucan acid hydrolysates) were recorded on a MAGNA-IR 860 with FT-Raman accessory. Sample was irradiated with a 1064 nm line of the T10-8S Nd spectra-physics model: YAG laser and scattered radiation were collected at 180 degrees, using 4 cm(-1) resolution. The polysaccharide was hydrolyzed into component monosaccharides with 80% H2SO4 at 0 degrees C for 30 minutes and monosaccharide derivatives were subjected to electrophoresis, as in a ealier authors study, on a strip of cellulose acetate membrane (CA-SYS-MINI Cellulose Acetate Systems) in 0.2 M Ca(OAc)2 (pH 7.5) at 10 mA, max. 240 V for 1.5 h. The strips were stained with 0.5% toluidine blue in 3% HOAc solution and then rinsed in distilled water and air-dried. A part of the hexoses (for example glucose) are converted, to products such as 5-hydroxymethylfurfural. Various coloured substances, through the Maillard

Heat and microbial treatments for nutritional upgrading of wheat straw

DOE Office of Scientific and Technical Information (OSTI.GOV)

Milstein, O.; Vered, Y.; Sharma, A.

1986-03-01

The ligninolytic activities of four cellulolytic organisms were compared using straw. Only Aspergillus japonicus and Polyporous versicolor appreciably degraded lignin with A. japonicus yielding the most protein. In solid culture, most protein was produced by P. versicolor, closely followed by A. japonicus. Pertreatment of the straw by hot water facilitated biodegradation and protein production. The nutritional value of the residual straw was also increased by some fungal cultures. The greatest amount of degradable polysaccharide in the straw was made available by A. japonicus in liquid media and Pleurotus ostreatus in solid media. 29 references.

High-performance of Agaricus blazei fungus for the biological pretreatment of elephant grass.

PubMed

Dal Picolli, Thais; Regalin Aver, Kaliane; Claudete Fontana, Roselei; Camassola, Marli

2018-01-01

Biological pre-treatment seems to be promising being an eco-friendly process, with no inhibitor generated during the process. The potential for elephant grass pre-treatment with white degradation fungi Pleurotus ostreatus, Agaricus blazei, Lentinula edodes, Pleurotus citrinopileatus, and Pleurotus djamor, in isolated or mixed cultures of these strains, was evaluated. The highest activities of enzymes involved in the degradation of lignocellulosic biomass (laccases, endoglucanases, xylanases, and β-glucosidases) were observed for A. blazei, L. edodes and the combination of P. ostreatus and A. blazei. In the enzymatic hydrolysis, there was greater release of reducing sugars in the pre-treated elephant grass samples by A. blazei during 10 days (338.91 ± 7.39 mg g -1 of biomass). For this sample, higher lignin reductions, 24.81 and 57.45%, after 15 and 35 days of incubation, respectively, were also verified. These data indicate the potential of macromycetes such as A. blazei to perform biological pre-treatments. © 2017 American Institute of Chemical Engineers Biotechnol. Prog., 34:42-50, 2018. © 2017 American Institute of Chemical Engineers.

Chemical Composition and Character Impact Odorants in Volatile Oils from Edible Mushrooms.

PubMed

Usami, Atsushi; Motooka, Ryota; Nakahashi, Hiroshi; Marumoto, Shinsuke; Miyazawa, Mitsuo

2015-11-01

The aim of this study was to investigate the chemical composition and the odor-active components of volatile oils from three edible mushrooms, Pleurotus ostreatus, Pleurotus eryngii, and Pleurotus abalonus, which are well-known edible mushrooms. The volatile components in these oils were extracted by hydrodistillation and identified by GC/MS, GC-olfactometry (GC-O), and aroma extract dilution analysis (AEDA). The oils contained 40, 20, and 53 components, representing 83.4, 86.0, and 90.8% of the total oils in P. ostreatus, P. eryngii, and P. abalonus, respectively. Odor evaluation of the volatile oils from the three edible mushrooms was also carried out using GC-O, AEDA, and odor activity values, by which 13, eight, and ten aroma-active components were identified in P. ostreatus, P. eryngii, and P. abalonus, respectively. The most aroma-active compounds were C8 -aliphatic compounds (oct-1-en-3-ol, octan-3-one, and octanal) and/or C9 -aliphatic aldehydes (nonanal and (2E)-non-2-enal). Copyright © 2015 Verlag Helvetica Chimica Acta AG, Zürich.

Assault Tank T14

DTIC Science & Technology

1944-02-28

oal. machine gun mounted in the turret co» axially with t&e 75mm gun, a ,30 cal. machine gun mounted in the bow of the vehldle, and a .50 cal...openings should be larger. (2) jJJO cal, Co- axial Machine Gun and Mounti (a^ This jnin and mount functioned satisfactorily. (3) ^22 caJU Bow...ball Joint and too little clearance between the mounting pistes causes the mount to be very sticky and difficult to operate. (d^ The travel lock

In Vitro Antioxidant and In Vivo Hypolipidemic Effects of the King Oyster Culinary-Medicinal Mushroom, Pleurotus eryngii var. ferulae DDL01 (Agaricomycetes), in Rats with High-Fat Diet-Induced Fatty Liver and Hyperlipidemia.

PubMed

Choi, Jun-Hui; Kim, Dae-Won; Kim, Seung; Kim, Sung-Jun

2017-01-01

We investigated the effect of the culinary-medicinal mushroom Pleurotus eryngii var. ferulae DDL01 on oxidative damage in the liver and brain and a high-fat/high-cholesterol-induced hyperlipidemic model. In in vitro studies, the water extracts of the fruiting bodies showed strong scavenging activities of DPPH (139.46 ± 3.2 μg) and hydroxyl (139.46 ± 3.2 μg) radicals. Moreover, the extracts showed Fe2+ chelating and reducing abilities, as well as a large amount of polyphenols and an inhibitory effect on lipid peroxidation in the liver and brain tissues. The rats were fed a pellet diet (7.5 g/rat/day) containing P. eryngii var. ferulae DDL01 (PD) for 3 weeks. In the high-fat/high-cholesterol-induced hyperlipidemic rat model, administration of PD caused a significant decrease (P < 0.05) in the levels of serum triacylglycerols, low-density lipoprotein cholesterol, very-low-density lipoprotein cholesterol, aspartate aminotransferase, and alanine aminotransferase and a significant increase (P < 0.05) in the level of high-density lipoprotein cholesterol. PD administration significantly decreased high-fat/high-cholesterol-induced hepatic lipid accumulation. Treatment with the extracts (up to 500 μg/mL) did not significantly affect the viability of HepG2 and 3T3-L1 cells. Our findings suggest that this mushroom has potential as an antiatherogenic dietary source in the development of therapeutic agents and functional foods.

Skin test reactivity of allergic subjects to basidiomycetes’ crude extracts in a tropical environment

PubMed Central

Rivera-Mariani, Félix E.; Nazario-Jiménez, Sylvette; López-Malpica, Fernando; Bolaños-Rosero, Benjamín

2012-01-01

Fungal allergies can be detected by the skin prick test with extracts of the organisms, but not all fungi, including the basidiomycetes, are being examined. We determined the level of sensitization to basidiomycetes in allergic subjects and compared their reactivity to commercial extracts commonly used to detect allergies. Crude spore extracts of the basidiomycetes Ganoderma applanatum, Chlorophyllum molybdites, and Pleurotus ostreatus, which are known to release numerous spores, were examined along with commercial extracts on 33 subjects with asthma, allergic or non-allergic rhinitis. Overall, affected subjects showed the highest reactivity to mites (36%), followed by Ganoderma applanatum (30%), grass (27%) Chlorophyllum molybdites (12%) and Pleurotus ostreatus (12%). Allergic rhinitis patients were most reactive to mites (58%), grass (42%), Ganoderma applanatum (25%), Penicillium spp. (25%), and cat (17%). Those with asthma primarily responded to mites (44%), Ganoderma applanatum (44%), grass (33%), and Pleurotus ostreatus (22%). IgE levels correlated with positive basidiomycetes extracts. This finding, coupled with higher reactivity to basidiospores as compared to mitospores, and the similar sensitivities of patients to G. applanatum and mites, suggest that basidiomycetes are important allergen sources in the tropics. PMID:21506892

Fungal bioremediation of the creosote-contaminated soil: influence of Pleurotus ostreatus and Irpex lacteus on polycyclic aromatic hydrocarbons removal and soil microbial community composition in the laboratory-scale study.

PubMed

Byss, Marius; Elhottová, Dana; Tříska, Jan; Baldrian, Petr

2008-11-01

The aim of this study was to determine the efficacy of selected basidiomycetes in the removing of polycyclic aromatic hydrocarbons (PAH) from the creosote-contaminated soil. Fungi Pleurotus ostreatus and Irpex lacteus were supplemented with creosote-contaminated (50-200 mg kg(-1) PAH) soil originating from a wood-preserving plant and incubated at 15 °C for 120 d. Either fungus degraded PAH with 4-6 aromatic rings more efficiently than the microbial community present initially in the soil. PAH removal was higher in P. ostreatus treatments (55-67%) than in I. lacteus treatments (27-36%) in general. P. ostreatus (respectively, I. lacteus) removed 86-96% (47-59%) of 2-rings PAH, 63-72% (33-45%) of 3-rings PAH, 32-49% (9-14%) of 4-rings PAH and 31-38% (11-13%) of 5-6-rings PAH. MIS (Microbial Identification System) Sherlock analysis of the bacterial community determined the presence of dominant Gram-negative bacteria (G-) Pseudomonas in the inoculated soil before the application of fungi. Complex soil microbial community was characterized by phospholipid fatty acids analysis followed by GC-MS/MS. Either fungus induced the decrease of bacterial biomass (G- bacteria in particular), but the soil microbial community was influenced by P. ostreatus in a different way than by I. lacteus. The bacterial community was stressed more by the presence of I. lacteus than P. ostreatus (as proved by the ratio of the fungal/bacterial markers and by the ratio of trans/cis mono-unsaturated fatty acids). Moreover, P. ostreatus stimulated the growth of Gram-positive bacteria (G+), especially actinobacteria and these results indicate the potential of the positive synergistic interaction of this fungus and actinobacteria in creosote biodegradation.

The potential of organic substrates based on mushroom substrate and straw to dissipate fungicides contained in effluents from the fruit-packaging industry - Is there a role for Pleurotus ostreatus?

PubMed

Karas, Panagiotis A; Makri, Sotirina; Papadopoulou, Evangelia S; Ehaliotis, Constantinos; Menkissoglu-Spiroudi, Urania; Karpouzas, Dimitrios G

2016-02-01

Citrus fruit-packaging plants (FPP) produce large wastewater volumes with high loads of fungicides like ortho-phenylphenol (OPP) and imazalil (IMZ). No methods are in place for the treatment of those effluents and biobeds appear as a viable alternative. We employed a column study to investigate the potential of spent mushroom substrate (SMS) of Pleurotus ostreatus, either alone or in mixture with straw and soil plus a mixture of straw /soil to retain and dissipate IMZ and OPP. The role of P. ostreatus on fungicides dissipation was also investigated by studying in parallel the performance of fresh mushroom substrate of P. ostreatus (FMS) and measuring lignolytic enzymatic activity in the leachates. All substrates effectively reduced the leaching of OPP and IMZ which corresponded to 0.014-1.1% and 0.120-0.420% of their initial amounts respectively. Mass balance analysis revealed that FMS and SMS/Straw/Soil (50/25/25 by vol) offered the most efficient removal of OPP and IMZ from wastewaters respectively. Regardless of the substrate, OPP was restricted in the top 0-20cm of the columns and was bioavailable (extractable with water), compared to IMZ which was less bioavailable (extractable with acetonitrile) but diffused at deeper layers (20-50, 50-80cm) in the SMS- and Straw/Soil-columns. PLFAs showed that fungal abundance was significantly lower in the top layer of all substrates from where the highest pesticide amounts were recovered suggesting an inhibitory effect of fungicides on total fungi in the substrates tested. Our data suggest that biobeds packed with SMS-rich substrates could ensure the efficient removal of IMZ and OPP from wastewaters of citrus FPP. Copyright © 2015 Elsevier Inc. All rights reserved.

Microbial liquefaction of peat for the production of synthetic fuels

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gunasekaran, M.

1988-01-01

Objectives of this study were: to evaluate the potential of using various microorganisms to hydrolyse and liquify peat; to determine the optimal conditions for peat hydrolysis and liquefaction; to study the co-metabolizable substances; to separate the compounds present in liquified peat by alumina and silica acid chromatography and capillary gas chromatography; and to identify the compounds in liquified peat by capillary GC-Mass spectrometry. Organisms used in the study include: Coprinus comatus, Coriolus hirsutus, Ganoderma lucidum, Lentinus edodes, Lenzites trabea, Phanerochaete chrysosporium, Pleurotus ostreatus, P. sapidus, Polyporus adjustus, Neurospora sitophila, Rhizophus arrhizus, Bacillus subtilis, Acinetobacter sp. and Alcaligenes sp. The fungimore » were maintained and cultivated in potato dextrose agar at 30 C. The bacteria were maintained in nutrient agar at 30 C. We have also initiated work on coal solubilization in addition to the studies on peat liquefaction. A relatively new substratum or semi-solid base for culture media called Pluronic F-127, or Polyol (BASF, New Jersey). Objectives of this study were: (1) to study the growth patterns of Candida ML 13 on pluronic as substratum; (2) to determine the rate of microbial coal solubilization on pluronic F-127 amended in different growth media; (3) to separate the mycelial mat of Candida ML 13 from unsolubilized coal particles and solubilized coal products from pluronic F-127; (4) to determine the effects of pH on microbial coal solubilization in pluronic F-127 media; (5) the effect of concentration of pluronic F-127 in media on coal solubilization; and, (6) to study the role of extracellular factors secreted by Candida ML 13 on coal solubilization in pluronic F-127 media. Results are discussed. 4 refs.« less

Diversity of Edible and Medicinal Mushrooms Used in the Noun Division of the West Region of Cameroon.

PubMed

Njouonkou, André Ledoux; De Crop, Eske; Mbenmoun, Abdoulayi Mbouombouo; Kinge, Tonjock Rosemary; Biyé, Elvire Hortense; Verbeken, Annemieke

2016-01-01

This article presents discussions of mushrooms as a source of food, income, as well as medicine among the Bamoun people of the highlands of West Cameroon, where the vegetation is mainly savannah mixed with forest galleries. Like most tribes in tropical Africa, the Bamoun people use a wide range of natural products as mushrooms. This study attempts to identify the various mushrooms exploited by the Bamoun. Ethnomycological surveys and field trips were conducted over 4 years in several villages in the Noun Division. Samples of wild mushrooms were collected from both the savannah and the forest galleries. These were described, preserved, and identified. The study shows that the Bamoun people use at least 40 species of mushrooms for either food or medicine. These species belong to 8 genera: Auricularia, Cantharellus, Ganoderma, Pleurotus, Lactarius, Lactifluus, Russula, and Termitomyces. Species of genera Lactarius, Lactifluus, Russula, and Termitomyces are most often used for food, whereas Ganoderma spp. and Pleurotus tuber-regium are mainly exploited for medicinal purposes. This survey provides an overview of the diversity of mushrooms and their importance to the local people of this area. Since some of the species mentioned by the local population were not fruiting at the time of our field trips, additional investigations are needed to further clarify the diversity and the usage of mushrooms in this region.

Antiviral activity of Basidiomycete mycelia against influenza type A (serotype H1N1) and herpes simplex virus type 2 in cell culture.

PubMed

Krupodorova, Tetiana; Rybalko, Svetlana; Barshteyn, Victor

2014-10-01

In this study, we investigated the in vitro antiviral activity of the mycelia of higher mushrooms against influenza virus type A (serotype H1N1) and herpes simplex virus type 2 (HSV-2), strain BH. All 10 investigated mushroom species inhibited the reproduction of influenza virus strain A/FM/1/47 (H1N1) in MDCK cells reducing the infectious titer by 2.0-6.0 lg ID50. Four species, Pleurotus ostreatus, Fomes fomentarius, Auriporia aurea, and Trametes versicolor, were also determined to be effective against HSV-2 strain BH in RK-13 cells, with similar levels of inhibition as for influenza. For some of the investigated mushroom species-Pleurotus eryngii, Lyophyllum shimeji, and Flammulina velutipes-this is the first report of an anti-influenza effect. This study also reports the first data on the medicinal properties of A. aurea, including anti-influenza and antiherpetic activities. T. versicolor 353 mycelium was found to have a high therapeutic index (324.67), and may be a promising material for the pharmaceutical industry as an anti-influenza and antiherpetic agent with low toxicity. Mycelia with antiviral activity were obtained in our investigation by bioconversion of agricultural wastes (amaranth flour after CO2 extraction), which would reduce the cost of the final product and solve some ecological problems.

Fungal aryl-alcohol oxidase: a peroxide-producing flavoenzyme involved in lignin degradation.

PubMed

Hernández-Ortega, Aitor; Ferreira, Patricia; Martínez, Angel T

2012-02-01

Aryl-alcohol oxidase (AAO) is an extracellular flavoprotein providing the H(2)O(2) required by ligninolytic peroxidases for fungal degradation of lignin, the key step for carbon recycling in land ecosystems. O(2) activation by Pleurotus eryngii AAO takes place during the redox-cycling of p-methoxylated benzylic metabolites secreted by the fungus. Only Pleurotus AAO sequences were available for years, but the number strongly increased recently due to sequencing of different basidiomycete genomes, and a comparison of 112 GMC (glucose-methanol-choline oxidase) superfamily sequences including 40 AAOs is presented. As shown by kinetic isotope effects, alcohol oxidation by AAO is produced by hydride transfer to the flavin, and hydroxyl proton transfer to a base. Moreover, site-directed mutagenesis studies showed that His502 activates the alcohol substrate by proton abstraction, and this result was extended to other GMC oxidoreductases where the nature of the base was under discussion. However, in contrast with that proposed for GMC oxidoreductases, the two transfers are not stepwise but concerted. Alcohol docking at the buried AAO active site resulted in only one catalytically relevant position for concerted transfer, with the pro-R α-hydrogen at distance for hydride abstraction. The expected hydride-transfer stereoselectivity was demonstrated, for the first time in a GMC oxidoreductase, by using the (R) and (S) enantiomers of α-deuterated p-methoxybenzyl alcohol. Other largely unexplained aspects of AAO catalysis (such as the unexpected specificity on substituted aldehydes) can also be explained in the light of the recent results. Finally, the biotechnological interest of AAO in flavor production is extended by its potential in production of chiral compounds taking advantage from the above-described stereoselectivity.

Screening for ligninolytic enzymes from autochthonous fungi and applications for decolorization of Remazole Marine Blue

PubMed Central

Erden, Emre; Ucar, M. Cigdem; Gezer, Tekin; Pazarlioglu, Nurdan Kasikara

2009-01-01

This study presents new and alternative fungal strains for the production of ligninolytic enzymes which have great potential to use in industrial and biotechnological processes. Thirty autochthonous fungal strains were harvested from Bornova-Izmir in Turkiye. In the fresh fruitbody extracts laccase, manganese peroxidase and lignin peroxidase activities, which are the principal enzymes responsible for ligninocellulose degradation by Basidiomycetes, were screened. Spores of some of the basidiomycetes species such as Cortinarius sp., Trametes versicolor, Pleurotus ostreatus, Abortiporus biennis, Lyophyllum subglobisporium, Ramaria stricta, Ganoderma carnosum, Lactarius delicious ve Lepista nuda were isolated and investigated optimum cultivation conditions in submerged fermentation for high yields of ligninolytic enzyme production. In addition, isolated fungal strains were monitored on agar plates whether having the capability of decolorization of a textile dye Remazol Marine Blue. PMID:24031371

Anti-Fungal activity of essential oil from Baeckea frutescens L against Pleuratus ostreatus

NASA Astrophysics Data System (ADS)

Jemi, Renhart; Barus, Ade Irma; Nuwa, Sarinah, Luhan, Gimson

2017-11-01

Ujung Atap is an herb that have distinctive odor on its leaves. The plant's essential oil contains bioactive compounds but has not been investigated its anti-fungal activity against Pleurotus ostreatus. Essential oil from Ujung Atap leaves is one environmentally friendly natural preservative. This study consisted of distillation Ujung Atap leaves with boiled method, determining the number of acid, essential oil ester, and anti-fungal activity against Pleurotus ostreatus. Analysis of the data to calculate anti-fungal activity used probit analysis method to determine the IC50. Results for the distillation of leaves Ujung Atap produce essential oil yield of 0.071% and the average yield of the acid number and the ester of essential oils Ujung Atap leaves are 5.24 and 12.15. Anti-fungal activity Pleurotus ostreatus at a concentration of 1000 µg/mL, 100 µg/mL, 75 µg/mL, 50 µg/mL and 100 µg/mL BA defunct or fungi was declared dead, while at a concentration of 25 µg/mL, 10 µg/mL and 5 µg/mL still occur inhibitory processes. Results obtained probit analysis method IC50 of 35.48 mg/mL; means the essential oil of Ujung Atap leaf can inhibit fungal growth by 50 percent to 35.48 µg/mL concentration.

PCB in the environment: bio-based processes for soil decontamination and management of waste from the industrial production of Pleurotus ostreatus.

PubMed

Siracusa, Giovanna; Becarelli, Simone; Lorenzi, Roberto; Gentini, Alessandro; Di Gregorio, Simona

2017-10-25

Polychlorinated biphenyls (PCBs) are hazardous soil contaminants for which a bio-based technology for their recovery is essential. The objective of this study was to validate the exploitation of spent mushroom substrate (SMS), a low or null cost organic waste derived from the industrial production of P. ostreatus, as bulking agent in a dynamic biopile pilot plant. The SMS shows potential oxidative capacity towards recalcitrant compounds. The aim was consistent with the design of a process of oxidation of highly chlorinated PCBs, which is independent from their reductive dehalogenation. Feasibility was verified at a mesocosm scale and validated at pilot scale in a dynamic biopile pilot plant treating ten tons of a historically contaminated soil (9.28±0.08mg PCB/kg soil dry weight). Mixing of the SMS with the soil was required for the depletion of the contaminants. At the pilot scale, after eight months of incubation, 94.1% depletion was recorded. A positive correlation between Actinobacteria and Firmicutes active metabolism, soil laccase activity and PCB removal was observed. The SMS was found to be exploitable as a versatile low cost organic substrate capable of activating processes for the oxidation of highly chlorinated PCBs. Moreover, its exploitation as bulking agent in biopiles is a valuable management strategy for the re-utilisation of an organic waste deriving from the industrial cultivation of edible mushrooms. Copyright © 2017 Elsevier B.V. All rights reserved.

Analysis of Environmental Stress Factors Using an Artificial Growth System and Plant Fitness Optimization

PubMed Central

Lee, Meonghun; Yoe, Hyun

2015-01-01

The environment promotes evolution. Evolutionary processes represent environmental adaptations over long time scales; evolution of crop genomes is not inducible within the relatively short time span of a human generation. Extreme environmental conditions can accelerate evolution, but such conditions are often stress inducing and disruptive. Artificial growth systems can be used to induce and select genomic variation by changing external environmental conditions, thus, accelerating evolution. By using cloud computing and big-data analysis, we analyzed environmental stress factors for Pleurotus ostreatus by assessing, evaluating, and predicting information of the growth environment. Through the indexing of environmental stress, the growth environment can be precisely controlled and developed into a technology for improving crop quality and production. PMID:25874206

Response of ligninolytic macrofungi to the herbicide atrazine: dose-response bioassays.

PubMed

Cupul, Wilberth Chan; Abarca, Gabriela Heredia; Vázquez, Refugio Rodríguez; Salmones, Dulce; Hernández, Rigoberto Gaitán; Gutiérrez, Enrique Alarcón

2014-01-01

The effect of atrazine concentrations on mycelial growth and ligninolytic enzyme activities of eight native ligninolytic macrofungi isolated in Veracruz, México, were evaluated in a semi-solid culture medium. Inhibition of mycelial growth and growth rates were significantly affected (p=0.05) by atrazine concentrations (468, 937, 1875, and 3750 mg/l). In accordance with the median effective concentration (EC50), Pleurotus sp. strain 1 proved to be the most tolerant isolate to atrazine (EC50=2281.0 mg/l), although its enzyme activity was not the highest. Pycnoporus sanguineus strain 2, Daedalea elegans and Trametes maxima showed high laccase activity (62.7, 31.9, 29.3 U mg/protein, respectively) without atrazine (control); however, this activity significantly increased (p<0.05) (to 191.1, 83.5 and 120.6 U mg/protein, respectively) owing to the effect of atrazine (937 mg/l) in the culture medium. Pleurotus sp. strain 2 and Cymatoderma elegans significantly increased (p<0.05) their manganese peroxidase (MnP) activities under atrazine stress at 468 mg/l. The isolates with high EC50 (Pleurotus sp. strain 1) and high enzymatic activity (P. sanguineus strain 2 and T. maxima) could be considered for future studies on atrazine mycodegradation. Furthermore, this study confirms that atrazine can increase laccase and MnP activities in ligninolytic macrofungi. Copyright © 2014 Asociación Argentina de Microbiología. Publicado por Elsevier España. All rights reserved.

Response of maple sapwood to injury and infection

Treesearch

W.C. Shortle; K.T. Smith; K.R. Dudzik; Sharon Parker

1995-01-01

In sapwood challenge experiments in Acer rubrum, columns of discolouration initiated by wounding and inoculation with pioneer fungi (Cephalosporium sp., Phialophora sp.) were similar in size to untreated wounds. Inoculation with decay fungi (Pleurotus ostreatus, Trametes versicolor) produced...

Release of feruloylated oligosaccharides from wheat bran through submerged fermentation by edible mushrooms.

PubMed

Xie, Chunyan; Wu, Zhiyan; Guo, Hongzhen; Gu, Zhenxin

2014-07-01

Wheat bran, a by-product of the flour industry, is believed to be a raw material for the production of feruloylated oligosaccharides (FOs) because of its high content of conjiont ferulic acid (FA). Studies were carried out to identify edible mushrooms that are able to release FOs from wheat bran. All the six tested mushrooms (Pleurotus ostreatus, Hericium erinaceum, Auricularia auricula, Cordyceps militaris, Agrocybe chaxingu, and Ganoderma lucium) were found to release FOs, and Agrocybe chaxingu had the highest yield, reaching 35.4 µM in wheat bran broth. Enzymes detection showed that these species secreted extracellular enzymes during fermentation, including cellulase and xylanase. Agrocybe chaxingu secreted the significant amount of xylanase (180 mU ml(-1) ), which was responsible for the release of FOs from wheat bran, while Hericium erinaceum secreted FA esterase which could disassemble FOs. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Simultaneously upgrading biogas and purifying biogas slurry using cocultivation of Chlorella vulgaris and three different fungi under various mixed light wavelength and photoperiods.

PubMed

Cao, Weixing; Wang, Xue; Sun, Shiqing; Hu, Changwei; Zhao, Yongjun

2017-10-01

In order to purify biogas slurry and biogas simultaneously, three different fungi, Pleurotus geesteranus (P. geesteranus), Ganoderma lucidum (G. lucidum), and Pleurotus ostreatus (P. ostreatus) were pelletized with Chlorella vulgaris (C. vulgaris). The results showed that the optimal light wavelength ratio for red:blue was 5:5 for these three different fungi-assisted C. vulgaris, resulting in higher specific growth rate as well as nutrient and CO 2 removal efficiency compared with other ratios. G. lucidum/C. vulgaris was screened as the best fungi-mialgae for biogas slurry purification and biogas upgrading with light/dark ratio of 14h:10h, which was also confirmed by the economic efficiency analysis of the energy consumptions. These results will provide a theoretical foundation for large-scale biogas slurry purifying and biogas upgrading using microalgae. Copyright © 2017 Elsevier Ltd. All rights reserved.

Antinociceptive effects of (1→3),(1→6)-linked β-glucan isolated from Pleurotus pulmonarius in models of acute and neuropathic pain in mice: evidence for a role for glutamatergic receptors and cytokine pathways.

PubMed

Baggio, Cristiane Hatsuko; Freitas, Cristina Setim; Martins, Daniel Fernandes; Mazzardo, Leidiane; Smiderle, Fhernanda Ribeiro; Sassaki, Guilherme Lanzi; Iacomini, Marcello; Marques, Maria Consuelo Andrade; Santos, Adair Roberto Soares

2010-10-01

The present study evaluated the antinociceptive effect of (1→3),(1→6)-linked β-glucan (GL) isolated from Pleurotus pulmonarius (Fr.) Quel. in mice and its possible mechanism of action. Intraperitoneal administration of GL inhibited glutamate-induced licking with an ID(50) of 0.34 mg/kg and inhibition of 96% ± 3%. The treatment of animals with GL (1 mg/kg i.p.) inhibited nociception induced by intrathecal injection of N-methyl-D-aspartic acid, α-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid, kainate and interleukin -1β in 67% ± 13%, 89% ± 11%, 74% ± 9%, and 75% ± 7%, respectively, but not the nociceptive response induced by (±)-1-aminocyclopentane-trans-1,3-dicarboxylic acid, substance P, and tumor necrosis factor-α. Moreover, GL (30 mg/kg i.p.) also reduced mechanical allodynia caused by partial sciatic nerve ligation for 2 hours, with inhibition of 47% ± 10% observed 0.5 hours after treatment. When given chronically (twice a day) over 7 days, GL reversed the mechanical allodynia caused by partial sciatic nerve ligation (inhibition of 45% ± 13% to 60% ± 8%). Interestingly, GL did not affect the locomotor activity of mice in an open field test with doses that produce antinociceptive effects. Our findings show that GL inhibits acute and neuropathic pain in mice through mechanisms that involve the inhibition of ionotropic glutamate receptors and the interleukin -1β pathway. This article presents the antinociceptive activity of GL in acute and neuropathic pain with participation of ionotropic glutamate receptors and pro-inflammatory cytokines (interleukin-1β). After further experiments, this compound may represent a new pharmacological agent for the treatment of clinical pain. Copyright © 2010 American Pain Society. Published by Elsevier Inc. All rights reserved.

Ligninolytic peroxidase genes in the oyster mushroom genome: heterologous expression, molecular structure, catalytic and stability properties, and lignin-degrading ability

Treesearch

Elena Fernández-Fueyo; Francisco J Ruiz-Dueñas; María Jesús Martinez; Antonio Romero; Kenneth E Hammel; Francisco Javier Medrano; Angel T. Martínez

2014-01-01

Background: The genome of Pleurotus ostreatus, an important edible mushroom and a model ligninolytic organism of interest in lignocellulose biorefineries due to its ability to delignify agricultural wastes, was sequenced with the purpose of identifying and characterizing the enzymes responsible for lignin degradation. ...

Mushroom growing project at the Los Humeros, Mexico geothermal field

DOE Office of Scientific and Technical Information (OSTI.GOV)

Rangel, M.E.R.

1998-12-01

There are several projects of direct (non-electrical) use of geothermal energy in Mexico. Personnel of the Comision Federal de Electricidad (CFE) have experience in various of these projects, like drying of timber and fruits, space heating, food processing, etc. Taking this in consideration, CFE built the Los Humeros mushroom plant using for heat source the geothermal steam from Well H-1. The main purpose of the project was to take advantage of residual geothermal energy in a food production operation and to develop the appropriate technology. In 1992, existing installations were renovated, preparing appropriate areas for pasteurization, inoculation and production. Themore » mushroom Pleurotus ostreatus var. florida and columbinus was used. A year later, CFE proposed the construction of improved facilities for growing edible mushrooms. New materials and equipment, as well as different operation conditions, were proposed on the basis of the experience gained in the initial project. The construction and renovation activities were completed in 1994.« less

Mechanical properties and chemical composition of beech wood exposed for 30 and 120 days to white-rot fungi

Treesearch

Ehsan Bari; Hamid Reza Taghiyari; Behbood Mohebby; Carol A. Clausen; Olaf Schmidt; Mohammad Ali Tajick Ghanbary; Mohammad Javad Vaseghi

2015-01-01

The effects of exposing specimens of Oriental beech [Fagus sylvatica subsp. orientalis (Lipsky) Greuter and Burdet] to the white-rot fungi Pleurotus ostreatus (Jacq.: Fr.) Kummer and Trametes versicolor (L.: Fr.) Pilát strain 325 have been studied concerning the mechanical properties and...

Life cycle and control of the cyst nematode Heterodera goldeni on rice in Egypt

USDA-ARS?s Scientific Manuscript database

The life cycle and methods for control of the cyst nematode Heterodera goldeni on rice (Oryza sativa) were examined in the greenhouse. Three tests were conducted to study the effects of soil treatments with some plant materials, stems of oyster mushroom (Pleurotus ostreatus), the biocontrol agent Ba...

Self-assembly modified-mushroom nanocomposite for rapid removal of hexavalent chromium from aqueous solution with bubbling fluidized bed.

PubMed

Xu, Fei; Liu, Xu; Chen, Yijiao; Zhang, Ke; Xu, Heng

2016-05-18

A self-assembled modified Pleurotus Cornucopiae material (SMPM) combined with improved Intermittent Bubbling Fluidized Bed (IBFB) was investigated to remove the hexavalent chromium ions in aqueous solution. After the modification, the powder-like raw material gradually self-assembled together to SMPM, which had crinkly porous structure, improved the Cr-accommodation ability in a sound manner. Optimized by Taguchi method, Cr(VI) removal efficiency was up to 75.91% and 48.01% for 100 mg/L and 500 mg/L initial concentration of Cr(VI), respectively. Results indicated that the metal removal was dependent on dosage of adsorbent, particle diameter and treatment time. The experimental data obtained from the biosorption process was successfully correlated with Freundlich isotherm model. Thermodynamic study indicated the endothermic nature of the process. The results confirmed that self-assembly modified Pleurotus Cornucopiae material could be applied for the removal of heavy metal from wastewater in continuous fluidized bed process.

Lignin degradation by selected fungal species.

PubMed

Knežević, Aleksandar; Milovanović, Ivan; Stajić, Mirjana; Lončar, Nikola; Brčeski, Ilija; Vukojević, Jelena; Cilerdžić, Jasmina

2013-06-01

As biological decomposition of plant biomass represents a popular alternative environmental-friendly and economically justified process, screening of ligninolytic enzyme systems of various fungal species is a topical study area. The goal of the study was to obtain clear insight into the dynamics of laccase, Mn-dependent peroxidase, and Mn-independent peroxidase activity and levels of wheat straw lignin degradation in seven wood-rotting fungi. The best laccase producers were Pleurotus ostreatus and Pleurotus eryngii. Lenzites betulinus and Fomitopsis pinicola were the best Mn-dependent peroxidase producers, and P. ostreatus the weakest one. The peak of Mn-independent peroxidase was noted in Dichomytus squalens, and the minimum value in P. ostreatus. The profiles of the three enzymes, obtained by isoelectric focusing, were variable depending on the species and cultivation period. D. squalens was the best lignin degrader (34.1% of total lignin amount), and P. ostreatus and P. eryngii the weakest ones (7.1% and 14.5%, respectively). Copyright © 2013 Elsevier Ltd. All rights reserved.

Self-assembly modified-mushroom nanocomposite for rapid removal of hexavalent chromium from aqueous solution with bubbling fluidized bed

PubMed Central

Xu, Fei; Liu, Xu; Chen, Yijiao; Zhang, Ke; Xu, Heng

2016-01-01

A self-assembled modified Pleurotus Cornucopiae material (SMPM) combined with improved Intermittent Bubbling Fluidized Bed (IBFB) was investigated to remove the hexavalent chromium ions in aqueous solution. After the modification, the powder-like raw material gradually self-assembled together to SMPM, which had crinkly porous structure, improved the Cr-accommodation ability in a sound manner. Optimized by Taguchi method, Cr(VI) removal efficiency was up to 75.91% and 48.01% for 100 mg/L and 500 mg/L initial concentration of Cr(VI), respectively. Results indicated that the metal removal was dependent on dosage of adsorbent, particle diameter and treatment time. The experimental data obtained from the biosorption process was successfully correlated with Freundlich isotherm model. Thermodynamic study indicated the endothermic nature of the process. The results confirmed that self-assembly modified Pleurotus Cornucopiae material could be applied for the removal of heavy metal from wastewater in continuous fluidized bed process. PMID:27188258

Self-assembly modified-mushroom nanocomposite for rapid removal of hexavalent chromium from aqueous solution with bubbling fluidized bed

NASA Astrophysics Data System (ADS)

Xu, Fei; Liu, Xu; Chen, Yijiao; Zhang, Ke; Xu, Heng

2016-05-01

A self-assembled modified Pleurotus Cornucopiae material (SMPM) combined with improved Intermittent Bubbling Fluidized Bed (IBFB) was investigated to remove the hexavalent chromium ions in aqueous solution. After the modification, the powder-like raw material gradually self-assembled together to SMPM, which had crinkly porous structure, improved the Cr-accommodation ability in a sound manner. Optimized by Taguchi method, Cr(VI) removal efficiency was up to 75.91% and 48.01% for 100 mg/L and 500 mg/L initial concentration of Cr(VI), respectively. Results indicated that the metal removal was dependent on dosage of adsorbent, particle diameter and treatment time. The experimental data obtained from the biosorption process was successfully correlated with Freundlich isotherm model. Thermodynamic study indicated the endothermic nature of the process. The results confirmed that self-assembly modified Pleurotus Cornucopiae material could be applied for the removal of heavy metal from wastewater in continuous fluidized bed process.

A patient with mushroom allergy; a new etiological agent of Kounis syndrome.

PubMed

Tepetam, Fatma Merve; Dağdeviren, Bahadır; Bulut, İsmet; Karabay, Can Yücel; Barış, Safa; Aydıner Karakoç, Elif

2016-06-01

Kounis syndrome (KS) is a rarely diagnosed condition which should always be kept in mind when an acute myocardial infarction (AMI) happens in the context of anaphylactic reactions. We report a case of a 31-year old female; 2 hours after the ingestion of the mushroom (Pleurotus ostreatus); she experienced nausea, stomachache, vomiting, dyspnea and chest pain. Electrocardiogram (ECG) showed an ST segment elevation in D1, AVL, precordial leads V1-V4. The blood analysis revealed high levels of CK-MB fraction and troponin T values. The diagnosis of Kounis syndrome was made in the catheterization laboratory via the complete resolution of angina, along with electrocardiographic changes that took place after intracoronary nitrate therapy and skin prick to prick test positivism with the mushroom. To the best of our knowledge, this is the first case of a type I variant of Kounis syndrome due to Pleurotus ostreatus allergy reported so far.

Spawn viability in edible mushrooms after freezing in liquid nitrogen without a cryoprotectant.

PubMed

Mata, Gerardo; Pérez-Merlo, Rosalía

2003-08-01

Five strains of edible mushrooms (Lentinula boryana, Lentinula edodes, Pleurotus djamor, Pleurotus pulmonarius, and Volvariella volvacea) were studied. Spawn were prepared from sorghum seeds and then incubated for 14 days under optimum conditions for each species. Once covered by mycelia, the sorghum seeds were placed in polycarbonate vials for freezing in liquid nitrogen. The effect of adding a cryoprotective solution before freezing (either 10% glycerol v/v or 5% dimethylsulfoxide v/v) was evaluated as a function of mycelial growth and percent viability. Three main treatments were undertaken: (1) freezing with a glycerol or dimethylsulfoxide cryoprotectant, (2) freezing with water and (3) freezing without cryoprotectant or water. Samples were maintained frozen for a week, after which time they were thawed (10 min at 30 degrees C) and the seeds placed in Petri dishes with a culture medium. A recovery rate of 96.8% was obtained for the total number of samples summed over all strains and treatments. In contrast, 99.2% of the samples frozen without cryoprotectant were recovered. The recovery of frozen mycelia was delayed with respect to a control group, which was not frozen. However, no difference was observed in percent recovery and mycelial diameter when a new series of spawn was prepared from mycelia that had been previously frozen. Results obtained from this experiment demonstrate that an adequate recovery of mycelia can be obtained without using a cryoprotectant. This capacity might enable large quantities of commercial mushroom strains to be handled at reduced production costs. It is suggested that the mycelia survived freezing without cryoprotectants because they were embedded and protected within the sorghum seeds used to elaborate the spawn.

Bio-softening of mature coconut husk for facile coir recovery.

PubMed

Suganya, D S; Pradeep, S; Jayapriya, J; Subramanian, S

2007-06-01

Bio-softening of the mature coconut husk using Basidiomyceteous fungi was attempted to recover the soft and whiter fibers. The process was faster and more efficient in degrading lignin and toxic phenolics. Phanerochaete chrysosporium, Pleurotus eryngii and Ceriporiopsis subvermispora were found to degrade lignin efficiently without any appreciable loss of cellulose, yielding good quality fiber ideal for dyeing.

An evaluation of soil colonisation potential of selected fungi and their production of ligninolytic enzymes for use in soil bioremediation applications.

PubMed

McErlean, Colum; Marchant, Roger; Banat, Ibrahim M

2006-08-01

Initially sixteen fungi were screened for potential ligninolytic activity using decolourisation of a polymeric dye Poly R-478. From this, four fungi were selected, Trametes versicolor, Pleurotus ostreatus, Collybia sp., and an isolate (identified as Rhizoctonia solani) isolated from a grassland soil. Differences in the ligninolytic enzyme profiles of each of the fungi were observed. All of the four fungi tested produced MnP and laccase while the Collybia sp. and R. solani produced LiP in addition. Enzyme activity levels also varied greatly over the 21 days of testing with T. versicolor producing levels of MnP and laccase three to four times greater than the other fungi. The four fungi were then tested for their ability to colonise sand, peat (forest) and basalt and marl mixed till (field) soils through visual measurement and biomass detection in soil microcosms. Trametes versicolor and the Collybia sp. failed to grow in any of the non-sterilised soils whereas the R. solani and P. ostreatus isolates grew satisfactorily. Primers were designed to detect MnP and laccase genes in P. ostreatus and RTPCR was used to detect that these genes are expressed in forest and field soils.

Impact of optimised cooking on the antioxidant activity in edible mushrooms.

PubMed

Ng, Zhi Xiang; Tan, Wan Chein

2017-11-01

This study aimed to investigate the effect of four cooking methods with different durations on the in vitro antioxidant activities of five edible mushrooms, namely Agaricus bisporus , Flammulina velutipes , Lentinula edodes , Pleurotus ostreatus and Pleurotus eryngii. Among the raw samples, A. bisporus showed the highest total antioxidant activity (reducing power and radical scavenging), total flavonoid, ascorbic acid and water soluble phenolic contents. Short-duration steam cooking (3 min) increased the total flavonoid and ascorbic acid while prolonged pressure cooking (15 min) reduced the water soluble phenolic content in the mushrooms. The retention of antioxidant value in the mushrooms varied with the variety of mushroom after the cooking process. The cooking duration significantly affected the ascorbic acid in the mushrooms regardless of cooking method. To achieve the best antioxidant values, steam cooking was preferred for F. velutipes (1.5 min), P. ostreatus (4.5 min) and L. edodes (4.5 min) while microwave cooking for 1.5 min was a better choice for A. bisporus . Pressure cooked P. eryngii showed the best overall antioxidant value among the cooked samples. Optimised cooking method including pressure cooking could increase the antioxidant values in the edible mushrooms.

Non-volatile taste components of several cultivated mushrooms.

PubMed

Li, Wen; Gu, Zhen; Yang, Yan; Zhou, Shuai; Liu, Yanfang; Zhang, Jingsong

2014-01-15

Five species of dried mushrooms are commercially available in China, namely Agrocybe cylindracea, Pleurotus cystidiosus, Agaricus blazei, Pleurotus eryngii, and Coprinus comatus, and their nonvolatile taste components were studied. Trehalose (12.23-301.63mg/g) and mannitol (12.37-152.11mg/g) were considered as the major mushroom sugar/polyol in the five test species. The total free amino acid levels ranged from 4.09 to 22.73mg/g. MSG-like components contents ranged from 0.97 to 4.99mg/g. 5'-Nucleotide levels ranged from 1.68mg/g in P. eryngii to 3.79mg/g in C. comatus. Fumaric acid (96.11mg/g) in P. cystidiosus were significantly higher compared with the other mushrooms, and citric acid (113.13mg/g), as the highest of any organic acid among the five mushrooms, were found in A. blazei. Equivalent umami concentrations values in these five test mushrooms ranged from 11.19 to 88.37g/100g dry weight. A. blazei, C.comatus and A. cylindracea possessed highly strong umami taste. Copyright © 2013 Elsevier Ltd. All rights reserved.

Use of Pleurotus eous Strain P-31 Spent Mushroom Compost (SMC) as Soil Conditioner on the Growth and Yield Performance of Capsicum annuum L. and Solanum lycopersicon L. Seedlings under Greenhouse Conditions in Ghana

PubMed Central

Wiafe-Kwagyan, M; Odamtten, G T

2018-01-01

The objective of this study was to investigate the influence of spent mushroom compost of Pleurotus eous strain P-31 on the growth and yield performance of pepper and tomato seedlings under greenhouse conditions. Sandy loam soil was combined with different percentages of SMC to obtain the following combinations (0, 5, 10, 15, 20, 25 and 30) %. Lower concentrations SMC5, SMC10 and SMC15 promoted vegetative growth (plant height, leaf area, chlorophyll content, number of leaves and axillary branches) of the two test plants. Tomato seedlings grown in SMC10 recorded the highest plant height (50.3 ± 7.2cm); leaf area (378.8 ± 1.2cm2); number of floral buds (51) and flowers (28) whereas SMC5 recorded the highest chlorophyll content 34.1 ± 0.9CCI though SMC15 recorded the highest number of leaves (8). Tomato seedlings grown in SMC30 produced both the maximum number of fruits (8) with corresponding high weight (34.2 ± 7.7g). Pepper seedlings grown in lower concentrations (SMC5–15) recorded the highest plant heights (29.8–30.8cm), chlorophyll content (20.3CCI) and leaf area (53.5–66.2 cm2). Although the different combinations of sandy loam soil and SMC did not significantly (p ≥ 0.05) affect the number of axillary branches developed; different combinations significantly (p ≤ 0.05) affected the number of floral bud, flower and fruit, weight of fruits formed and value of each of these increased with increasing percentage of SMC. Pepper seedlings grown on SMC30 recorded the maximum number of floral buds (32.0 ± 3.6), number of flowers (19.4 ± 1.3), number of fruits (10.8 ± 1.2) and weight of fruits (31.9 ± 3.4g). Tomato seedlings raised on SMC100 (spent mushroom compost only) and soil only did not significantly (p ≥ 0.05) differ from each other however, was statistically significant (p ≤ 0.05) from amended sandy loam soil by all criteria investigated. The study shows that SMC provide favourable soil conditioners for the cultivation of fruits, vegetables

Effect of gamma and electron beam irradiation on the physico-chemical and nutritional properties of mushrooms: a review.

PubMed

Fernandes, Ângela; Antonio, Amilcar L; Oliveira, M Beatriz P P; Martins, Anabela; Ferreira, Isabel C F R

2012-11-15

The short shelf-life of mushrooms is an obstacle to the distribution and marketing of the fresh product. Thus, prolonging postharvest storage, while preserving their quality, would benefit the mushroom industry as well as consumers. There has been extensive research on finding the most appropriate technology for mushrooms preservation. Gamma, electron-beam and UV irradiation have been shown to be potential tools in extending the postharvest shelf-life of fresh mushrooms. Studies evaluating the effects of ionizing radiation are available mainly in cultivated species such as Agaricus bisporus, Lentinus edodes and Pleurotus ostreatus. This review comprises a comprehensive study of the effects of irradiation on physico-chemical parameters (weight, colour, texture and pH), chemical compounds including nutrients (proteins, sugars and vitamins) and non-nutrients (phenolics, flavonoids and flavour compounds), and on biochemical parameters such as enzymatic activity of mushrooms for different species and from different regions of the world. Copyright © 2012 Elsevier Ltd. All rights reserved.

Macro and trace mineral constituents and radionuclides in mushrooms: health benefits and risks.

PubMed

Falandysz, Jerzy; Borovička, Jan

2013-01-01

This article reviews and updates data on macro and trace elements and radionuclides in edible wild-grown and cultivated mushrooms. A huge biodiversity of mushrooms and spread of certain species over different continents makes the study on their multi-element constituents highly challenging. A few edible mushrooms are widely cultivated and efforts are on to employ them (largely Agaricus spp., Pleurotus spp., and Lentinula edodes) in the production of selenium-enriched food (mushrooms) or nutraceuticals (by using mycelia) and less on species used by traditional medicine, e.g., Ganoderma lucidum. There are also attempts to enrich mushrooms with other elements than Se and a good example is enrichment with lithium. Since minerals of nutritional value are common constituents of mushrooms collected from natural habitats, the problem is however their co-occurrence with some hazardous elements including Cd, Pb, Hg, Ag, As, and radionuclides. Discussed is also the problem of erroneous data on mineral compounds determined in mushrooms.

Filamentous fungi as a source of natural antioxidants.

PubMed

Smith, Helen; Doyle, Sean; Murphy, Richard

2015-10-15

Ten species of filamentous fungi grown in submerged flask cultures were investigated for antioxidant capacity. Effective antioxidant activity was demonstrated in terms of β-carotene/linoleic acid bleaching, radical scavenging, reduction of metal ions and chelating abilities against ferrous ions. Different extraction methods affected antioxidant activities through their effect on biologically active compounds produced in fungal mycelia. The methanolic extract of each fungus was typically more effective in antioxidant properties. Phenolic content was established in the range of 0.44-9.33 mg/g, flavonoid contents were in the range of 0.02-3.90 mg/g and condensed tannin contents were in the range of 1.77-18.83 mg/g. Total phenol content of each extract was attributed to overall antioxidant capacity (r ⩾ 0.883-1.000). Submerged cultivation of Grifola frondosa, Monascus purpureus, Pleurotus spp., Lentinula edodes and Trametes versicolor proved to be an effective method for the production of natural antioxidants. Copyright © 2015 Elsevier Ltd. All rights reserved.

Self-Heating Pasteurization of Substrates for Culinary-Medicinal Mushrooms Cultivation in Mexico.

PubMed

Morales, Viviana; Sánchez, Jose E

2017-01-01

The aim of this study was to evaluate a self-heating pasteurization technique in preparing substrates for mushroom production. Seven species were used: Agrocybe aegerita, Auricularia fuscosuccinea, Pleurotus djamor, P. eryngii, P. ostreatus, Lentinula edodes, and Ganoderma lucidum. They were cultivated on grass, corncob, wood shavings, and a mixture thereof. The self-heating technique allowed for pasteurization of 3 of the substrates (grass, corncob, and the mixture). The preheating chamber comprised a drawer placed under the pasteurization crate. With this chamber, it was possible to increase inlet air temperatures by 4--5°C. The evaluated mushroom species responded in different ways to the pasteurization process. P. ostreatus (control) and P. djamor produced basidiomes when cultivated in all pasteurization substrates. A. aegerita and P. eryngii fruited only on corncob and the mixture, whereas A. fuscosuccinea fruited only on the pasteurized corncob. G. lucidum and L. edodes did not fructify on the pasteurized substrates.

Laccase pretreatment for agrofood wastes valorization.

PubMed

Giacobbe, Simona; Pezzella, Cinzia; Lettera, Vincenzo; Sannia, Giovanni; Piscitelli, Alessandra

2018-06-01

Apple pomace, potato peels, and coffee silverskin are attractive agrofood wastes for the production of biofuels and chemicals, due to their abundance and carbohydrate content. As lignocellulosic biomasses, their conversion is challenged by the presence of lignin that prevents hydrolysis of polysaccharides, hence demanding a pretreatment step. In this work, the effectiveness of Pleurotus ostreatus laccases (with and without mediator) to remove lignin, improving the subsequent saccharification, was assessed. Optimized conditions for sequential protocol were set up for all agrofood wastes reaching delignification and detoxification yields correlated with high saccharification. Especially noteworthy were results for apple pomace and coffee silverskin for which 83% of and 73% saccharification yields were observed, by using laccase and laccase mediator system, respectively. The herein developed sequential protocol, saving soluble sugars and reducing the amount of wastewater, can improve the overall process for obtaining chemicals or fuels from agrofood wastes. Copyright © 2018 The Author(s). Published by Elsevier Ltd.. All rights reserved.

Effect of the replacement of aspartic acid/glutamic acid residues with asparagine/glutamine residues in RNase He1 from Hericium erinaceus on inhibition of human leukemia cell line proliferation.

PubMed

Kobayashi, Hiroko; Motoyoshi, Naomi; Itagaki, Tadashi; Suzuki, Mamoru; Inokuchi, Norio

2015-01-01

RNase He1 from Hericium erinaceus, a member of the RNase T1 family, has high identity with RNase Po1 from Pleurotus ostreatus with complete conservation of the catalytic sequence. However, the optimal pH for RNase He1 activity is lower than that of RNase Po1, and the enzyme shows little inhibition of human tumor cell proliferation. Hence, to investigate the potential antitumor activity of recombinant RNase He1 and to possibly enhance its optimum pH, we generated RNase He1 mutants by replacing 12 Asn/Gln residues with Asp/Glu residues; the amino acid sequence of RNase Po1 was taken as reference. These mutants were then expressed in Escherichia coli. Using site-directed mutagenesis, we successfully modified the optimal pH for enzyme activity and generated a recombinant RNase He1 that inhibited the proliferation of cells in the human leukemia cell line. These properties are extremely important in the production of anticancer biologics that are based on RNase activity.

Enzyme activities and substrate degradation during white rot fungi growth on sugar-cane straw in a solid state fermentation.

PubMed

Ortega, G M; Martinez, E O; González, P C; Betancourt, D; Otero, M A

1993-03-01

Two strains of Pleurotus spp., grown in solid state fermentation on sugar-cane straw, degraded the dry matter by 50% after 60 days. The rate of substrate consumption and the dry weight of fruiting bodies decreased in consecutive flushings. Both strains vigorously attacked hemicellulose (80% of total degradation) and lignin (70%). Fruiting bodies were rich in protein and lipids, and had a low content of carbohydrates and ash.

Fungal treatment of humic-rich industrial wastewater: application of white rot fungi in remediation of food-processing wastewater.

PubMed

Zahmatkesh, Mostafa; Spanjers, Henri; van Lier, Jules B

2017-11-01

This paper presents the results of fungal treatment of a real industrial wastewater (WW), providing insight into the main mechanisms involved and clarifying some ambiguities and uncertainties in the previous reports. In this regard, the mycoremediation potentials of four strains of white rot fungi (WRF): Phanerochaete chrysosporium, Trametes versicolor, Pleurotus ostreatus and Pleurotus pulmonarius were tested to remove humic acids (HA) from a real humic-rich industrial treated WW of a food-processing plant. The HA removal was assessed by color measurement and size-exclusion chromatography (SEC) analysis. T. versicolor showed the best decolorization efficiency of 90% and yielded more than 45% degradation of HA, which was the highest among the tested fungal strains. The nitrogen limitation was studied and results showed that it affected the fungal extracellular laccase and manganese peroxidase (MnP) activities. The results of the SEC analysis revealed that the mechanism of HA removal by WRF involves degradation of large HA molecules to smaller molecules, conversion of HA to fulvic acid-like molecules and also biosorption of HA by fungal mycelia. The effect of HS on the growth of WRF was investigated and results showed that the inhibition or stimulation of growth differs among the fungal strains.

Molecular Divergence and Species Delimitation of the Cultivated Oyster Mushrooms: Integration of IGS1 and ITS

PubMed Central

Bhassu, Subha; Tan, Yee Shin; Vikineswary, Sabaratnam

2014-01-01

Identification of edible mushrooms particularly Pleurotus genus has been restricted due to various obstacles. The present study attempted to use the combination of two variable regions of IGS1 and ITS for classifying the economically cultivated Pleurotus species. Integration of the two regions proved a high ability that not only could clearly distinguish the species but also served sufficient intraspecies variation. Phylogenetic tree (IGS1 + ITS) showed seven distinct clades, each clade belonging to a separate species group. Moreover, the species differentiation was tested by AMOVA and the results were reconfirmed by presenting appropriate amounts of divergence (91.82% among and 8.18% within the species). In spite of achieving a proper classification of species by combination of IGS1 and ITS sequences, the phylogenetic tree showed the misclassification of the species of P. nebrodensis and P. eryngii var. ferulae with other strains of P. eryngii. However, the constructed median joining (MJ) network could not only differentiate between these species but also offer a profound perception of the species' evolutionary process. Eventually, due to the sufficient variation among and within species, distinct sequences, simple amplification, and location between ideal conserved ribosomal genes, the integration of IGS1 and ITS sequences is recommended as a desirable DNA barcode. PMID:24587752

Decolorization of salt-alkaline effluent with industrial reactive dyes by laccase-producing Basidiomycetes strains.

PubMed

Moreira-Neto, S L; Mussatto, S I; Machado, K M G; Milagres, A M F

2013-04-01

The discharge of highly coloured synthetic dye effluents into rivers and lakes is harmful to the water bodies, and therefore, intensive researches have been focussed on the decolorization of wastewater by biological, physical or chemical treatments. In the present study, 12 basidiomycetes strains from the genus Pleurotus, Trametes, Lentinus, Peniophora, Pycnoporus, Rigidoporus, Hygrocybe and Psilocybe were evaluated for decolorization of the reactive dyes Cibacron Brilliant Blue H-GR and Cibacron Red FN-2BL, both in solid and liquid media. Among the evaluated fungi, seven showed great ability to decolorize the synthetic textile effluent, both in vivo (74-77%) or in vitro (60-74%), and laccase was the main ligninolytic enzyme involved on dyes decolorization. Pleurotus ostreatus, Trametes villosa and Peniophora cinerea reduced near to 60% of the effluent colour after only 1 h of treatment. The decolorization results were still improved by establishing the nitrogen source and amount to be used during the fungal strains cultivation in synthetic medium previous their action on the textile effluent, with yeast extract being a better nitrogen source than ammonium tartarate. These results contribute for the development of an effective microbiological process for decolorization of dye effluents with reduced time of treatment. © 2013 The Society for Applied Microbiology.

Adsorption characteristics of Copper (Ⅱ), Zinc (Ⅱ) and Mercury (Ⅱ) by four kinds of immobilized fungi residues.

PubMed

Li, Xia; Zhang, Dan; Sheng, Fei; Qing, Hui

2018-01-01

This study investigated the adsorption characteristics of Copper (Ⅱ), Zinc (Ⅱ) and Mercury (Ⅱ) by immobilized Flammulina velutipes, Auricularia polytricha, Pleurotus eryngii and Pleurotus ostreatus residues. Lagergren model, elovich and intraparticle diffusion model were used to present the adsorption kinetics, and it was proved that Langmuir isotherm model and pseudo-second order kinetics are the best suitable model with high correlation coefficient to characterize the adsorption process of Copper (Ⅱ), Zinc (Ⅱ) and Mercury (Ⅱ). The results showed that adsorption process finished in 120min at pH 6.0. The adsorption rate of Cu 2+ , Zn 2+ and Hg 2+ were reached to 53.8-84.1% of total in the initial 60min, and finished in 120min. Ion exchange and complexation of F. velutipes were the main mechanisms for adsorption of metal ions by characterizations of Scanning electron microscopy (SEM) and Fourier transform infrared (FTIR). In addition the functional group of cell walls such as hydroxyl, amide, carbonyl, phosphoric played a critical role in ions adsorption of edible mushroom residues. Cu 2+ , Zn 2+ and Hg 2+ in wastewater could be efficiently removed by F. velutipes residue with removal ratio of 73.11%, 66.67% and 69.35%, respectively. Copyright © 2017 Elsevier Inc. All rights reserved.

Differential proteomic analysis of the secretome of Irpex lacteus and other white-rot fungi during wheat straw pretreatment.

PubMed

Salvachúa, Davinia; Martínez, Angel T; Tien, Ming; López-Lucendo, María F; García, Francisco; de Los Ríos, Vivian; Martínez, María Jesús; Prieto, Alicia

2013-08-10

Identifying new high-performance enzymes or enzyme complexes to enhance biomass degradation is the key for the development of cost-effective processes for ethanol production. Irpex lacteus is an efficient microorganism for wheat straw pretreatment, yielding easily hydrolysable products with high sugar content. Thus, this fungus was selected to investigate the enzymatic system involved in lignocellulose decay, and its secretome was compared to those from Phanerochaete chrysosporium and Pleurotus ostreatus which produced different degradation patterns when growing on wheat straw. Extracellular enzymes were analyzed through 2D-PAGE, nanoLC/MS-MS, and homology searches against public databases. In wheat straw, I. lacteus secreted proteases, dye-decolorizing and manganese-oxidizing peroxidases, and H2O2 producing-enzymes but also a battery of cellulases and xylanases, excluding those implicated in cellulose and hemicellulose degradation to their monosaccharides, making these sugars poorly available for fungal consumption. In contrast, a significant increase of β-glucosidase production was observed when I. lacteus grew in liquid cultures. P. chrysosporium secreted more enzymes implicated in the total hydrolysis of the polysaccharides and P. ostreatus produced, in proportion, more oxidoreductases. The protein pattern secreted during I. lacteus growth in wheat straw plus the differences observed among the different secretomes, justify the fitness of I. lacteus for biopretreatment processes in 2G-ethanol production. Furthermore, all these data give insight into the biological degradation of lignocellulose and suggest new enzyme mixtures interesting for its efficient hydrolysis.

Diversity of endophytic fungal community of cacao (Theobroma cacao L.) and biological control of Crinipellis perniciosa, causal agent of Witches' Broom Disease

PubMed Central

2005-01-01

The basidiomycete fungus Crinipellis perniciosa (Stahel) Singer is the causal agent of Witches' Broom Disease of Cacao (Theobroma cacao L.) which is the main factor limiting cacao production in the Americas. Pod losses of up to 90% are experienced in affected areas as evidenced by the 50% drop in production in Bahia province, Brazil following the arrival of the C. perniciosa in the area in 1989. The disease has proven particularly difficult to control and many farmers in affected areas have given up cacao cultivation. In order to evaluate the potential of endophytes as a biological control agent of this phytopathogen, the endophytic fungal community of resistant and susceptible cacao plants as well as affected branches was studied between 2001 and 2002. The fungal community was identified by morphological traits and rDNA sequencing as belonging to the genera Acremonium, Blastomyces, Botryosphaeria, Cladosporium, Colletotrichum, Cordyceps, Diaporthe, Fusarium, Geotrichum, Gibberella, Gliocladium, Lasiodiplodia, Monilochoetes, Nectria, Pestalotiopsis, Phomopsis, Pleurotus, Pseudofusarium, Rhizopycnis, Syncephalastrum, Trichoderma, Verticillium and Xylaria. These fungi were evaluated both in vitro and in vivo by their ability to inhibit C. perniciosa. Among these, some were identified as potential antagonists, but only one fungus (Gliocladium catenulatum) reduced the incidence of Witches' Broom Disease in cacao seedlings to 70%. PMID:15951847

Diversity of endophytic fungal community of cacao (Theobroma cacao L.) and biological control of Crinipellis perniciosa, causal agent of Witches' Broom Disease.

PubMed

Rubini, Marciano R; Silva-Ribeiro, Rute T; Pomella, Alan W V; Maki, Cristina S; Araújo, Welington L; Dos Santos, Deise R; Azevedo, João L

2005-01-01

The basidiomycete fungus Crinipellis perniciosa (Stahel) Singer is the causal agent of Witches' Broom Disease of Cacao (Theobromacacao L.) which is the main factor limiting cacao production in the Americas. Pod losses of up to 90% are experienced in affected areas as evidenced by the 50% drop in production in Bahia province, Brazil following the arrival of the C. perniciosa in the area in 1989. The disease has proven particularly difficult to control and many farmers in affected areas have given up cacao cultivation. In order to evaluate the potential of endophytes as a biological control agent of this phytopathogen, the endophytic fungal community of resistant and susceptible cacao plants as well as affected branches was studied between 2001 and 2002. The fungal community was identified by morphological traits and rDNA sequencing as belonging to the genera Acremonium, Blastomyces, Botryosphaeria, Cladosporium, Colletotrichum, Cordyceps, Diaporthe, Fusarium, Geotrichum, Gibberella, Gliocladium, Lasiodiplodia, Monilochoetes, Nectria, Pestalotiopsis, Phomopsis, Pleurotus, Pseudofusarium, Rhizopycnis, Syncephalastrum, Trichoderma, Verticillium and Xylaria. These fungi were evaluated both in vitro and in vivo by their ability to inhibit C. perniciosa. Among these, some were identified as potential antagonists, but only one fungus (Gliocladium catenulatum) reduced the incidence of Witches' Broom Disease in cacao seedlings to 70%.

Extracellular lignase: a key to enhanced cellulose utilization

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hira, A.; Barnett, S.M.; Shieh, C.H.

1978-01-01

An alternate approach to the conventional chemical processing of lignin, a potential renewable resource, is enzymic conversion. Biodegradation of wood, a lignin-cellulose complex, is accomplished naturally by various enzymes of microbial origin. Extracellular lignases have been isolated from pure cultures of Polyporus versicolor, Phanerochaete chrysosporium, and Pleurotus ostreatus. The isolated enzyme systems from these organisms have shown substrate specificity for guaiacol and hydroquinone and yielded a positive syringaldazine test. A commercial lignin was degraded by the enzyme system.

Value-added use of mushroom ergothioneine as a colour stabilizer in processed fish meats.

PubMed

Bao, Huynh N D; Osako, Kazufumi; Ohshima, Toshiaki

2010-08-15

Ergothioneine (ESH), a potent antioxidant, has been found in certain edible mushrooms. Our previous research showed that ESH extracted from the edible mushroom Flammulina velutipes has a positive effect on the colour stability of beef and tuna meat. The purpose of the present study was to compare the efficacy and applicability of ESH extracts prepared from different mushroom species as a colour stabilizer in fish meats. Levels of ESH higher than 2.8 mg mL(-1) were found in extracts prepared from the fruiting bodies of F. velutipes, Lentinula edodes, Pleurotus cornucopiae and Pleurotus eryngii and the processing waste of F. velutipes. When 1 mL of each of the extracts was added to 100 g of minced bigeye tuna and yellowtail meats, the bright-red colour remained after 5 and 2 days, respectively, of ice storage. The anti-discoloration efficacy of 1 mL of the extracts prepared from 10 g of the fresh waste portion of F. velutipes was similar to that of its fruiting body or 0.5 g kg(-1) of sodium ascorbate when added to 100 g of minced bigeye tuna meat under ice storage. The results of this study clearly showed that ESH prepared from different mushroom species stabilized the colour of fish meats, and the extract from the F. velutipes was the most effective. Copyright (c) 2010 Society of Chemical Industry.

Occurrence of the (2R,3S)-Isomer of 2-Amino-3,4-dihydroxybutanoic Acid in the Mushroom Hypsizygus marmoreus.

PubMed

Ito, Tomokazu; Yu, Zhuoer; Yoshino, Issei; Hirozawa, Yurina; Yamamoto, Kana; Shinoda, Kiyotugu; Watanabe, Akira; Hemmi, Hisashi; Asada, Yasuhiko; Yoshimura, Tohru

2017-08-02

Here, we report the occurrence of the (2R,3S)-isomer of 2-amino-3,4-dihydroxybutanoic acid (d-ADHB) in the fruiting body of an edible mushroom, Hypsizygus marmoreus. This is an unusual example of the accumulation of a d-amino acid whose enantiomer is not a proteinogenic amino acid. We show that d-ADHB occurs specifically in the mushroom H. marmoreus. Other edible mushrooms examined, including Pholiota microspora, Pleurotus eryngii, Mycena chlorophos, Sparassis crispa, Grifola frondosa, Pleurotus ostreatus, and Flammulina velutipes, do not contain detectable levels of d-ADHB. The concentration of d-ADHB in the fruiting body of H. marmoreus is relatively high (approximately 1.3 mg/g of fruiting body) and is comparable to the concentration of some of the most abundant free proteinogenic amino acids. Quantitative analysis of d-ADHB during fruiting body development demonstrated that the amino acid is synthesized during the fruiting body formation period. The absence of the putative precursors of d-ADHB, the (2S,3S)-isomer of ADHB and 2-oxo-tetronate, and the enzyme activities of d-ADHB racemase (2-epimerase) and transaminase suggested that d-ADHB is synthesized by a unique mechanism in this organism. Our data also suggested that the lack of or low expression of a d-ADHB degradation enzyme is a key determinant of d-ADHB accumulation in H. marmoreus.

Phenolic compound concentration and antioxidant activities of edible and medicinal mushrooms from Korea.

PubMed

Kim, Min-Young; Seguin, Philippe; Ahn, Joung-Kuk; Kim, Jong-Jin; Chun, Se-Chul; Kim, Eun-Hye; Seo, Su-Hyun; Kang, Eun-Young; Kim, Sun-Lim; Park, Yool-Jin; Ro, Hee-Myong; Chung, Ill-Min

2008-08-27

A study was conducted to determine the content of phenolic compounds and the antioxidative activity of five edible and five medicinal mushrooms commonly cultivated in Korea. Phenolic compounds were analyzed using high performance liquid chromatography, and antioxidant activity was evaluated by 1,1-diphenyl-2-picrylhydrazyl radical scavenging activity and superoxide dismutase activity. A total of 28 phenolic compounds were detected in the mushrooms studied. The average total concentration of phenolic compounds was 326 microg/g, the average being of 174 microg/g in edible mushrooms and 477 microg/g in medicinal mushrooms. The average total flavonoids concentration was 49 microg/g, with averages of 22 and 76 microg/g in edible and medicinal mushrooms, respectively. The DPPH radical scavenging activities ranged between 15 (Pleurotus eryngii) and 70% (Ganoderma lucidum) when reaction time was for 1 min. When reaction time was 30 min, the values ranged between 5 (Pleurotus eryngii) and 78% (Agaricus bisporus). The SOD activity averaged 28% among the 10 mushroom species, averages for edible and medicinal mushrooms being comparable. DPPH activities was significantly correlated (p < 0.01) with total content of phenolic compounds in edible mushrooms, while in medicinal mushrooms there was a significant correlation (p < 0.01) between SOD activity and total concentration of phenolic compounds. Numerous significant positive correlations were observed between phenolic compounds detected and antioxidative potential.

Respiratory Tract Infections and the Role of Biologically Active Polysaccharides in Their Management and Prevention.

PubMed

Jesenak, Milos; Urbancikova, Ingrid; Banovcin, Peter

2017-07-20

Respiratory tract infections (RTIs) are the most common form of infections in every age category. Recurrent respiratory tract infections (RRTIs), a specific form of RTIs, represent a typical and common problem associated with early childhood, causing high indirect and direct costs on the healthcare system. They are usually the consequence of immature immunity in children and high exposure to various respiratory pathogens. Their rational management should aim at excluding other severe chronic diseases associated with increased morbidity (e.g., primary immunodeficiency syndromes, cystic fibrosis, and ciliary dyskinesia) and at supporting maturity of the mucosal immune system. However, RRTIs can also be observed in adults (e.g., during exhausting and stressful periods, chronic inflammatory diseases, secondary immunodeficiencies, or in elite athletes) and require greater attention. Biologically active polysaccharides (e.g., β-glucans) are one of the most studied natural immunomodulators with a pluripotent mode of action and biological activity. According to many studies, they possess immunomodulatory, anti-inflammatory, and anti-infectious activities and therefore could be suggested as an effective part of treating and preventing RTIs. Based on published studies, the application of β-glucans was proven as a possible therapeutic and preventive approach in managing and preventing recurrent respiratory tract infections in children (especially β-glucans from Pleurotus ostreatus ), adults (mostly the studies with yeast-derived β-glucans), and in elite athletes (studies with β-glucans from Pleurotus ostreatus or yeast).

Study on vitamin D₂ stability in dried mushrooms during drying and storage.

PubMed

Sławińska, Aneta; Fornal, Emilia; Radzki, Wojciech; Skrzypczak, Katarzyna; Zalewska-Korona, Marta; Michalak-Majewska, Monika; Parfieniuk, Ewa; Stachniuk, Anna

2016-05-15

The main objective of this work was to determine the stability of vitamin D2 in dried mushrooms Agaricus bisporus, Pleurotus ostreatus and Lentinula edodes during storage, as well as to examine the possibility of inducing vitamin D2 production in dried mushrooms by UVB irradiation. After 1.5 year storage of dried mushrooms, the level of vitamin D2 in button mushrooms was found to be 6.90 μg/g dw, which is a 48.32% of initial level of vitamin D2. In the case of dried oyster and shiitake mushrooms there was a decrease to the level of 66.90% and 68.40%, respectively. It was determined that dried mushrooms can produce ergocalciferol under UVB irradiation. The highest content of vitamin D2 was observed in A. bisporus. Freeze-dried A. bisporus contained from 42.08 to 119.21 μg/g dw and hot-air dried mushrooms contained from 21.51 to 81.17 μg/g dw vitamin D2. Copyright © 2015 Elsevier Ltd. All rights reserved.

[Biotechnological cultivation of edible macrofungi: an alternative for obtaining nutraceutics].

PubMed

Suárez Arango, Carolina; Nieto, Ivonne Jeannette

2013-01-03

Macromycetes have been part of the human culture for thousand years, and have been reported as food in the most important civilizations in history. Many nutraceutical properties of macromycetes have been described, such as anti-cancer, anti-tumour, cholesterol lowering, antiviral, antibacterial, or immunomodulatory, among others. Given that production of mushrooms by traditional cultivation and extraction of bioactive metabolites is very difficult in some cases, biotechnology is essential for the development of profitable and productive techniques for obtaining these metabolites. It is the development of this technology, and the ease in which it enables the use of its variables that has allowed mycelium to be cultivated in liquid medium of macrofungi, with a significant reduction in time and an increased production of metabolites. This increased production has led to the study of compounds that have medicinal, nutriceutical and quasi-farmaceutical potential, in the exhausted media and the mycelium. The aim of this review is to provide an overview of the use of liquid-state fermentation as a technological tool for obtaining edible fungi, and the study of these and their metabolites, by describing the different cultivation conditions used in recent years, as well as the results obtained. The relevance of Agaricus, Flammulina, Grifola, Pleurotus and Lentinula genera, will also be discussed, with emphasis on the last one, since Shiitake has been always considered as the ultimate medicinal mushroom. Copyright © 2011 Revista Iberoamericana de Micología. Published by Elsevier España, S.L. All rights reserved.

Respiratory Tract Infections and the Role of Biologically Active Polysaccharides in Their Management and Prevention

PubMed Central

Jesenak, Milos; Urbancikova, Ingrid; Banovcin, Peter

2017-01-01

Respiratory tract infections (RTIs) are the most common form of infections in every age category. Recurrent respiratory tract infections (RRTIs), a specific form of RTIs, represent a typical and common problem associated with early childhood, causing high indirect and direct costs on the healthcare system. They are usually the consequence of immature immunity in children and high exposure to various respiratory pathogens. Their rational management should aim at excluding other severe chronic diseases associated with increased morbidity (e.g., primary immunodeficiency syndromes, cystic fibrosis, and ciliary dyskinesia) and at supporting maturity of the mucosal immune system. However, RRTIs can also be observed in adults (e.g., during exhausting and stressful periods, chronic inflammatory diseases, secondary immunodeficiencies, or in elite athletes) and require greater attention. Biologically active polysaccharides (e.g., β-glucans) are one of the most studied natural immunomodulators with a pluripotent mode of action and biological activity. According to many studies, they possess immunomodulatory, anti-inflammatory, and anti-infectious activities and therefore could be suggested as an effective part of treating and preventing RTIs. Based on published studies, the application of β-glucans was proven as a possible therapeutic and preventive approach in managing and preventing recurrent respiratory tract infections in children (especially β-glucans from Pleurotus ostreatus), adults (mostly the studies with yeast-derived β-glucans), and in elite athletes (studies with β-glucans from Pleurotus ostreatus or yeast). PMID:28726737

Growth and yield performance of Pleurotus ostreatus (Jacq. Fr.) Kumm (oyster mushroom) on different substrates.

PubMed

Girmay, Zenebe; Gorems, Weldesemayat; Birhanu, Getachew; Zewdie, Solomon

2016-12-01

Mushroom cultivation is reported as an economically viable bio-technology process for conversion of various lignocellulosic wastes. Given the lack of technology know-how on the cultivation of mushroom, this study was conducted in Wondo Genet College of Forestry and Natural Resource, with the aim to assess the suitability of selected substrates (agricultural and/or forest wastes) for oyster mushroom cultivation. Accordingly, four substrates (cotton seed, paper waste, wheat straw, and sawdust) were tested for their efficacy in oyster mushroom production. Pure culture of oyster mushroom was obtained from Mycology laboratory, Department of Plant Biology and Biodiversity Management, Addis Ababa University. The pure culture was inoculated on potato dextrose agar for spawn preparation. Then, the spawn containing sorghum was inoculated with the fungal culture for the formation of fruiting bodies on the agricultural wastes. The oyster mushroom cultivation was undertaken under aseptic conditions, and the growth and development of mushroom were monitored daily. Results of the study revealed that oyster mushroom can grow on cotton seed, paper waste, sawdust and wheat straw, with varying growth performances. The highest biological and economic yield, as well as the highest percentage of biological efficiency of oyster mushroom was obtained from cotton seed, while the least was from sawdust. The study recommends cotton seed, followed by paper waste as suitable substrates for the cultivation of oyster mushroom. It also suggests that there is a need for further investigation on various aspects of oyster mushroom cultivation in Ethiopia to promote the industry.

Isolation of pisumin, a novel antifungal protein from legumes of the sugar snap pea Pisum sativum var macrocarpon.

PubMed

Ye, X Y; Ng, T B

2003-02-01

An antifungal protein with a novel N-terminal sequence GVGAAYGCFG and a molecular mass of 31 kDa was isolated from the legumes of the sugar snap pea Pisum sativum var. macrocarpon. The protein, designated pisumin, exhibited antifungal activity against Coprinus comatus and Pleurotus ostreatus and much weaker activity against Fusarium oxysporum and Rhizoctonia solani. Pisumin inhibited cell-free translation in a rabbit reticulocyte lysate system with an IC(50) of 6 microM. Pisumin was similar to other leguminous antifungal proteins in that it was adsorbed on Affi-gel blue gel and CM-Sepharose.

EPR investigation of some desiccated Ascomycota and Basidiomycota gamma-irradiated mushrooms

NASA Astrophysics Data System (ADS)

Bercu, V.; Negut, C. D.; Duliu, O. G.

2010-12-01

The suitability of the EPR spectroscopy for detection of γ-irradiation in five species of dried mushroom, currently used in gastronomy: yellow morel— Morchella esculenta, (L.) Pers. (Phylum Ascomycota), button mushroom— Agaricus bisporus (J.E.Lange), Agaricus haemorrhoidarius Fr., golden chantarelle— Cantharellus cibarius Fr., as well as oyster mushroom— Pleurotus ostreatus (Jacq. ex Fr.) (Phylum Basidiomycota) is presented and discussed. Although after irradiation at doses up to 11 kGy, all specimens presented well defined EPR spectra, only A. bisporus EPR signal was enough stable to make detection possible after 18 months.

Taxonomy of quaternary deep-sea ostracods from the Western North Atlantic ocean

USGS Publications Warehouse

Yasuhara, Moriaki; Okahashi, H.; Cronin, T. M.

2009-01-01

Late Quaternary sediments from Ocean Drilling Program (ODP) Hole 1055B, Carolina Slope, western North Atlantic (32??47.041??? N, 76??17.179??? W; 1798m water depth) were examined for deep-sea ostracod taxonomy. A total of 13933 specimens were picked from 207 samples and c. 120 species were identified. Among them, 87 species were included and illustrated in this paper. Twenty-eight new species are described. The new species are: Ambocythere sturgio, Argilloecia abba, Argilloecia caju, Argilloecia keigwini, Argilloecia robinwhatleyi, Aversovalva carolinensis, Bythoceratina willemvandenboldi, Bythocythere eugeneschornikovi, Chejudocythere tenuis, Cytheropteron aielloi, Cytheropteron demenocali, Cytheropteron didieae, Cytheropteron richarddinglei, Cytheropteron fugu, Cytheropteron guerneti, Cytheropteron richardbensoni, Eucytherura hazeli, Eucytherura mayressi, Eucytherura namericana, Eucytherura spinicorona, Posacythere hunti, Paracytherois bondi, Pedicythere atroposopetasi, Pedicythere kennettopetasi, Pedicythere klothopetasi, Pedicythere lachesisopetasi, Ruggieriella mcmanusi and Xestoleberis oppoae. Taxonomic revisions of several common species were made to reduce taxonomic uncertainty in the literature. This study provides a robust taxonomic baseline for application to palaeoceanographical reconstruction and biodiversity analyses in the deep and intermediate-depth environments of the North Atlantic Ocean. ?? The Palaeontological Association, 2009.

Differential identification of mushrooms sclerotia by IR macro-fingerprint method

NASA Astrophysics Data System (ADS)

Choong, Yew Keong; Lan, Jin; Lee, Han Lim; Chen, Xiang-dong; Wang, Xiao-guang; Yang, Yu-ping

2016-01-01

Many macrofungus sclerotia are well-known medicinal herbs, health food and nutritional supplements. However, the prevalent adulterant commercial products are major hindrances to their incorporation into mainstream medical use in many countries. The mushroom sclerotia of Lignosus rhinocerotis, Poria cocos, Polyporus umbellatus, Pleurotus tuber-regium and Omphalia lapidescens are commonly used in traditional Chinese medicine. In this study, IR macro-fingerprint method was used in the identification of these sclerotia. The results showed that the spectrum of L. rhinocerotis (LR) was comparable with P. cocos with 94.4% correlation, except that the peak at 1543 cm-1 of LR appeared in lower intensity. The spectrum of P. umbellatus and P. tuber-regium was also correlated (91.5%), as both spectra could be clearly discriminated in that P. umbellatus spectrum has small base peaks located at the range of 1680-1500 cm-1. O. lapidescens was not comparable with all the other sclerotia as its spectrum was totally different. Its base peak was broad and derivated equally along the range. The first IR has revealed the dissimilarity among five mushrooms sclerotia. The second derivative and 2DIR further enhanced the identification in detail.

Product Structure, the Heart of Product Definition

NASA Technical Reports Server (NTRS)

DeHoog, C., Jr.

1999-01-01

This paper describes the LMMSS Product Definition System (PDS) philosophy and approach were the use of each item parts document or software can be traced to a specific end item (EI) serial/tail number of the product. It explains why a part-oriented approach to data organization and configuration management is required. The definition of part-oriented is that all appropriate product definition data products will be collected. Referenced and managed by their linkage/relationship to parts/items, The paper will touch upon how LMMSS store/controls product definition information under each project's top product designator in a two tiered approach. One tier for each product end item and another tier which contain/controls listings of drawings, documents. Specifications and standards that are required for hardware item definition.

Bioreactor technology for production of valuable algal products

NASA Astrophysics Data System (ADS)

Liu, Guo-Cai; Cao, Ying

1998-03-01

Bioreactor technology has long been employed for the production of various (mostly cheap) food and pharmaceutical products. More recently, research has been mainly focused on the development of novel bioreactor technology for the production of high—value products. This paper reports the employment of novel bioreactor technology for the production of high-value biomass and metabolites by microalgae. These high-value products include microalgal biomass as health foods, pigments including phycocyanin and carotenoids, and polyunsaturated fatty acids such as eicosapentaenoic acid and docosahexaenoic acid. The processes involved include heterotrophic and mixotrophic cultures using organic substrates as the carbon source. We have demonstrated that these bioreactor cultivation systems are particularly suitable for the production of high-value products from various microalgae. These cultivation systems can be further modified to improve cell densities and productivities by using high cell density techniques such as fed-batch and membrane cell recycle systems. For most of the microalgae investigated, the maximum cell concentrations obtained using these bioreactor systems in our laboratories are much higher than any so far reported in the literature.

Biological production of products from waste gases

DOEpatents

Gaddy, James L.

2002-01-22

A method and apparatus are designed for converting waste gases from industrial processes such as oil refining, and carbon black, coke, ammonia, and methanol production, into useful products. The method includes introducing the waste gases into a bioreactor where they are fermented to various products, such as organic acids, alcohols, hydrogen, single cell protein, and salts of organic acids by anaerobic bacteria within the bioreactor. These valuable end products are then recovered, separated and purified.

"Product on Stopper" in a Lyophilized Drug Product: Cosmetic Defect or a Product Quality Concern?

PubMed

Mehta, Shyam B; Roy, Shouvik; Yang, Han-Chang Cathy

2018-06-01

During manufacturing of a lyophilized drug product, operator errors in product handling during loading of product filled vials onto the lyophilizer can lead to a seemingly cosmetic defect which can impact certain critical quality attributes of finished product. In this study, filling of a formulated monoclonal antibody in vials was performed using a peristaltic pump filling unit, and subsequently, the product was lyophilized. After lyophilization, upon visual inspection, around 40% of vials had cosmetic defect with residual product around stopper of the vial and were categorized as "product on stopper" vials, whereas remaining 60% vials with no cosmetic defect were called "acceptable vials." Both groups of vials from 1 single batch were tested for critical quality attributes including protein concentration (ultraviolet absorbance at 280), residual moisture (Karl Fischer), sterility (membrane filtration), and container closure integrity (CCI) (blue dye ingress). Analysis of protein quality attributes such as aggregation, protein concentration, residual moisture showed no significant difference between vials with "product on stopper" and "acceptable vials." However, CCI of the "product on stopper" vials was compromised due to the presence of product around stopper of the vial. The results from this case study demonstrate the following 2 important findings: (1) that a seemingly cosmetic defect may impact product quality, compromising the integrity of the product and (2) that CCI test method can be used as an orthogonal method to sterility testing to evaluate sterility assurance of the product. The corrective action proposed to mitigate this defect is use of a larger sized vial that can potentially minimize this defect that arises because of product handling errors. Copyright © 2018 American Pharmacists Association®. Published by Elsevier Inc. All rights reserved.

Production and Distribution of Global Products From MODIS

NASA Technical Reports Server (NTRS)

Masuoka, Edward; Smith, David E. (Technical Monitor)

2000-01-01

The Moderate Resolution Imaging Spectroradiometer was launched on the EOS Terra spacecraft in December 1999 and will also fly on EOS Aqua in December 2000. With 36 spectral bands from the visible through thermal infrared and spatial resolution of 250m to 1 kilometer, each MODIS instrument will image the entire Earth surface in 2 days. This paper traces the flow of MODIS data products from the receipt of Level 0 data at the EDOS facility, through the production and quality assurance process to the Distributed Active Archive Centers (DAACs), which ship products to the user community. It describes where to obtain products and plans for reprocessing MODIS products. As most components of the ground system are severely limited in their capacity to distribute MODIS products, it also describes the key characteristics of MODIS products and their metadata that allow a user to optimize their selection of products given anticipate bottlenecks in distribution.

Biocatalytic synthesis of the Green Note trans-2-hexenal in a continuous-flow microreactor.

PubMed

van Schie, Morten M C H; Pedroso de Almeida, Tiago; Laudadio, Gabriele; Tieves, Florian; Fernández-Fueyo, Elena; Noël, Timothy; Arends, Isabel W C E; Hollmann, Frank

2018-01-01

The biocatalytic preparation of trans -hex-2-enal from trans -hex-2-enol using a novel aryl alcohol oxidase from Pleurotus eryngii ( Pe AAOx) is reported. As O 2 -dependent enzyme Pe AAOx-dependent reactions are generally plagued by the poor solubility of O 2 in aqueous media and mass transfer limitations resulting in poor reaction rates. These limitations were efficiently overcome by conducting the reaction in a flow-reactor setup reaching unpreceded catalytic activities for the enzyme in terms of turnover frequency (up to 38 s -1 ) and turnover numbers (more than 300000) pointing towards preparative usefulness of the proposed reaction scheme.

77 FR 25538 - Credit for Renewable Electricity Production, Refined Coal Production, and Indian Coal Production...

Federal Register 2010, 2011, 2012, 2013, 2014

2012-04-30

... DEPARTMENT OF THE TREASURY Internal Revenue Service Credit for Renewable Electricity Production, Refined Coal Production, and Indian Coal Production, and Publication of Inflation Adjustment Factors and... determining the availability of the credit for renewable electricity production. FOR FURTHER INFORMATION...

75 FR 18015 - Credit for Renewable Electricity Production, Refined Coal Production, and Indian Coal Production...

Federal Register 2010, 2011, 2012, 2013, 2014

2010-04-08

... DEPARTMENT OF THE TREASURY Internal Revenue Service Credit for Renewable Electricity Production, Refined Coal Production, and Indian Coal Production, and Publication of Inflation Adjustment Factors and... FR 16576 determining the availability of the credit for renewable electricity production, refined...

Utilization of Biodiesel By-Products for Biogas Production

PubMed Central

Kolesárová, Nina; Hutňan, Miroslav; Bodík, Igor; Špalková, Viera

2011-01-01

This contribution reviews the possibility of using the by-products from biodiesel production as substrates for anaerobic digestion and production of biogas. The process of biodiesel production is predominantly carried out by catalyzed transesterification. Besides desired methylesters, this reaction provides also few other products, including crude glycerol, oil-pressed cakes, and washing water. Crude glycerol or g-phase is heavier separate liquid phase, composed mainly by glycerol. A couple of studies have demonstrated the possibility of biogas production, using g-phase as a single substrate, and it has also shown a great potential as a cosubstrate by anaerobic treatment of different types of organic waste or energy crops. Oil cakes or oil meals are solid residues obtained after oil extraction from the seeds. Another possible by-product is the washing water from raw biodiesel purification, which is an oily and soapy liquid. All of these materials have been suggested as feasible substrates for anaerobic degradation, although some issues and inhibitory factors have to be considered. PMID:21403868

Making Online Products More Tangible: The Effect of Product Presentation Formats on Product Evaluations.

PubMed

Verhagen, Tibert; Vonkeman, Charlotte; van Dolen, Willemijn

2016-07-01

Although several studies have looked at the effects of online product presentations on consumer decision making, no study thus far has considered a potential key factor in online product evaluations: tangibility. The present study aims at filling this gap by developing and testing a model that relates different online product presentation formats to the three-dimensional concept of product tangibility. We test how the three tangibility dimensions influence perceived diagnosticity and, eventually, online purchase intentions. A between-subjects lab experiment (n = 366) was used to test the hypothesized effects of three common online product presentation formats (pictures vs. 360 spin rotation vs. virtual mirror). The results showed that out of these formats, virtual mirrors were superior in providing a sense of product tangibility, followed by the 360-spin rotation format and static pictures. Furthermore, in terms of predictive validity, two of the three tangibility dimensions significantly increased perceived diagnosticity, which, in turn, positively and strongly affected purchase intentions. Overall, our results add to previous works studying the relationships between online product presentation formats and consumer decision making. Also, they hold value for online practitioners by highlighting the potential benefits of applying technologically advanced product presentation formats such as the virtual mirror.

Co-production and time use. Influence on product evaluation.

PubMed

Heide, Morten; Olsen, Svein Ottar

2011-02-01

This study analyses how time use influences consumers' evaluation of a product and their satisfaction with the co-production activity. It also includes hypotheses about how knowledge and perceived convenience are related to the evaluative constructs. The constructs are checked for reliability and validity, before using structural equation modelling in Lisrel to estimate the relationships between the constructs and their measures. The results showed that time use had a negative influence on perceived convenience and a positive effect on satisfaction with co-production, but did not influence the global evaluation of the product. Satisfaction with co-production and perceived convenience had a positive influence on the global evaluation. Knowledge had a negative influence on time use. Finally, knowledge and perceived convenience had a positive relationship with satisfaction with co-production. In total, seven out of nine hypotheses are supported by the data. The study suggests that time use, perceived convenience, and satisfaction with co-production can be an important variables in the understanding of the evaluative outcome of a co-produced product. The dual role of time use can be positioned as something the consumer wants to minimize for convenient reasons or extended in order to be satisfied with the co-production effort. The paper presents new insights into how co-production and time use influence product evaluation. Copyright © 2010 Elsevier Ltd. All rights reserved.

Metabolic Engineering for the Production of Natural Products

PubMed Central

Pickens, Lauren B.; Tang, Yi; Chooi, Yit-Heng

2014-01-01

Natural products and natural product derived compounds play an important role in modern healthcare as frontline treatments for many diseases and as inspiration for chemically synthesized therapeutics. With advances in sequencing and recombinant DNA technology, many of the biosynthetic pathways responsible for the production of these chemically complex and pharmaceutically valuable compounds have been elucidated. With an ever expanding toolkit of biosynthetic components, metabolic engineering is an increasingly powerful method to improve natural product titers and generate novel compounds. Heterologous production platforms have enabled access to pathways from difficult to culture strains; systems biology and metabolic modeling tools have resulted in increasing predictive and analytic capabilities; advances in expression systems and regulation have enabled the fine-tuning of pathways for increased efficiency, and characterization of individual pathway components has facilitated the construction of hybrid pathways for the production of new compounds. These advances in the many aspects of metabolic engineering have not only yielded fascinating scientific discoveries but also make it an increasingly viable approach for the optimization of natural product biosynthesis. PMID:22432617

Swine production.

PubMed

Plain, Ronald L; Lawrence, John D

2003-07-01

The US swine industry is large and growing. The quantity of pork desired by consumers of US pork is growing at the rate of 1.5%/y. New production systems and new technology have enabled production per sow to grow at a rate of 4% annually in recent years. Consequently, the number of sows in the United States is declining. Because productivity growth is outpacing demand growth, the deflated price of hogs and pork is declining. Hog production and prices continue to exhibit strong seasonal and cyclic patterns. Pork production is usually lowest in the summer and highest in the fall. Production and prices tend to follow 4-year patterns. The US swine industry continues to evolve toward fewer and larger producers who rely on contracts for both hog production and marketing. In 2000, over half of the hogs marketed were from approximately 156 firms marketing more than 50,000 head annually. These producers finished 60% of their production in contract facilities. Over 90% of their marketings were under contract or were owned by a packer. These producers expressed a high level of satisfaction with hog production. Both they and their contract growers were satisfied with production contracts. These large producers were satisfied with their marketing contracts and planned to continue them in the future. The hog industry has changed a great deal in the last decade. There is little reason to believe this rapid rate of change will not continue. This swine industry is highly competitive and profit driven. Profit margins are too small to allow producers the luxury of ignoring new technology and innovative production systems. Consequently, hog production will continue its rapid evolution from traditional agriculture to typical industry.

Engineering microbial hosts for production of bacterial natural products.

PubMed

Zhang, Mingzi M; Wang, Yajie; Ang, Ee Lui; Zhao, Huimin

2016-08-27

Covering up to end 2015Microbial fermentation provides an attractive alternative to chemical synthesis for the production of structurally complex natural products. In most cases, however, production titers are low and need to be improved for compound characterization and/or commercial production. Owing to advances in functional genomics and genetic engineering technologies, microbial hosts can be engineered to overproduce a desired natural product, greatly accelerating the traditionally time-consuming strain improvement process. This review covers recent developments and challenges in the engineering of native and heterologous microbial hosts for the production of bacterial natural products, focusing on the genetic tools and strategies for strain improvement. Special emphasis is placed on bioactive secondary metabolites from actinomycetes. The considerations for the choice of host systems will also be discussed in this review.

Productivity Sharing Programs: Can They Contribute to Productivity Improvement?

ERIC Educational Resources Information Center

General Accounting Office, Washington, DC.

Productivity sharing plans were studied to determine how they operate, what benefits result, and whether long-term increases in productivity can be realized through the program. Thirty-six firms were interviewed that had productivity sharing plans. Nine firms that had either rejected adoption of a productivity sharing plan or were still…

Competitiveness, production, and productivity of cocoa in Indonesia

NASA Astrophysics Data System (ADS)

Fahmid, I. M.; Harun, H.; Fahmid, M. M.; Saadah; Busthanul, N.

2018-05-01

Cocoa is one of Indonesia’s five foreign exchange earner, thus cocoa must stay competitive for the export market. Aims of this study are: analyze the cost structure, production and productivity of cocoa farming, the level of competitiveness, and map the types of government policies that affect the competitiveness of cocoa plants. The method used is descriptive qualitative and quantitative. Data analysis is done by using PAM (Policy Analysis Matrix). The results showed, structures are at the cost of production of cocoa farming in Indonesia almost 50 percent for wages, and 31.6 percent for land rental. The big percentage of workers wages indicates that cocoa farming is labor intensive production. In Indonesia total productive cocoa farms only 27.6%, with a productivity level of 655,515 kg per hectare. Cocoa farming in Indonesia is carried out with protective policies, the value of EPC 4.29, indicating the government’s policy towards the inputs and outputs of cocoa has been effective. While the PCR value of 0.51, indicating cocoa farming has a competitive advantage, but it does not have a comparative advantage. In conclusion, productivity, out-put prices, and exchange rates should be raised, and input prices should be lowered, so that cocoa farming can provide higher net transfer values for farmers. To improve the competitiveness of cocoa farming, the islands of Sulawesi and Sumatra are two islands that require special policies, especially on out-put price policy, input prices, and productivity, as well as improvement of other cocoa commodity farming systems, as these two islands contributed more the 80 percent of Indonesia cocoa bean production.

17 CFR 229.1204 - (Item 1204) Oil and gas production, production prices and production costs.

Code of Federal Regulations, 2010 CFR

2010-04-01

... 17 Commodity and Securities Exchanges 2 2010-04-01 2010-04-01 false (Item 1204) Oil and gas production, production prices and production costs. 229.1204 Section 229.1204 Commodity and Securities Exchanges SECURITIES AND EXCHANGE COMMISSION STANDARD INSTRUCTIONS FOR FILING FORMS UNDER SECURITIES ACT OF...

Fungal biodegradation of anthracene-polluted cork: A comparative study.

PubMed

Jové, Patrícia; Olivella, Maria À; Camarero, Susana; Caixach, Josep; Planas, Carles; Cano, Laura; De Las Heras, Francesc X

2016-01-01

The efficiency of cork waste in adsorbing aqueous polycyclic aromatic hydrocarbons (PAHs) has been previously reported. Biodegradation of contaminated cork using filamentous fungi could be a good alternative for detoxifying cork to facilitate its final processing. For this purpose, the degradation efficiency of anthracene by three ligninolytic white-rot fungi (Phanerochaete chrysosporium, Irpex lacteus and Pleurotus ostreatus) and three non-ligninolytic fungi which are found in the cork itself (Aspergillus niger, Penicillium simplicissimum and Mucor racemosus) are compared. Anthracene degradation by all fungi was examined in solid-phase cultures after 0, 16, 30 and 61 days. The degradation products of anthracene by P. simplicissimum and I. lacteus were also identified by GC-MS and a metabolic pathway was proposed for P. simplicissimum. Results show that all the fungi tested degraded anthracene. After 61 days of incubation, approximately 86%, 40%, and 38% of the initial concentration of anthracene (i.e., 100 µM) was degraded by P. simplicissimum, P. chrysosporium and I. lacteus, respectively. The rest of the fungi degraded anthracene to a lesser extent (<30%). As a final remark, the results obtained in this study indicate that P. simplicissimum, a non-ligninolytic fungi characteristic of cork itself, could be used as an efficient degrader of PAH-contaminated cork.

Enzymatic modification of chitosan by cinnamic acids: Antibacterial activity against Ralstonia solanacearum.

PubMed

Yang, Caifeng; Zhou, Yu; Zheng, Yu; Li, Changlong; Sheng, Sheng; Wang, Jun; Wu, Fuan

2016-06-01

This study aimed to identify chitosan polymers that have antibacterial activity against the bacterial wilt pathogen. The chitosan polymers were enzymatically synthesized using chitosan and five cinnamic acids (CADs): caffeic acid (CA), ferulic acid (FA), cinnamic acid (CIA), p-coumaric acid (COA) and chlorogenic acid (CHA), using laccase from Pleurotus ostreatus as a catalyst. The reaction was performed in a phosphate buffered solution under heterogenous reaction conditions. The chitosan derivatives (CTS-g-CADs) were characterized by FT-IR, XRD, TGA and SEM. FT-IR demonstrated that the reaction products bound covalently to the free amino groups or hydroxyl groups of chitosan via band of amide I or ester band. XRD showed a reduced packing density for grafted chitosan comparing to original chitosan. TGA demonstrated that CTS-g-CADs have a higher thermostability than chitosan. Additionally, chitosan and its derivatives showed similar antibacterial activity. However, the IC50 value of the chitosan-caffeic acid derivative (CTS-g-CA) against the mulberry bacterial wilt pathogen RS-5 was 0.23mg/mL, which was two-fifths of the IC50 value of chitosan. Therefore, the enzymatically synthesized chitosan polymers can be used to control plant diseases in biotechnological domains. Copyright © 2016 Elsevier B.V. All rights reserved.

Differential identification of mushrooms sclerotia by IR macro-fingerprint method.

PubMed

Choong, Yew Keong; Lan, Jin; Lee, Han Lim; Chen, Xiang-Dong; Wang, Xiao-Guang; Yang, Yu-Ping

2016-01-05

Many macrofungus sclerotia are well-known medicinal herbs, health food and nutritional supplements. However, the prevalent adulterant commercial products are major hindrances to their incorporation into mainstream medical use in many countries. The mushroom sclerotia of Lignosus rhinocerotis, Poria cocos, Polyporus umbellatus, Pleurotus tuber-regium and Omphalia lapidescens are commonly used in traditional Chinese medicine. In this study, IR macro-fingerprint method was used in the identification of these sclerotia. The results showed that the spectrum of L. rhinocerotis (LR) was comparable with P. cocos with 94.4% correlation, except that the peak at 1543cm(-1) of LR appeared in lower intensity. The spectrum of P. umbellatus and P. tuber-regium was also correlated (91.5%), as both spectra could be clearly discriminated in that P. umbellatus spectrum has small base peaks located at the range of 1680-1500cm(-1). O. lapidescens was not comparable with all the other sclerotia as its spectrum was totally different. Its base peak was broad and derivated equally along the range. The first IR has revealed the dissimilarity among five mushrooms sclerotia. The second derivative and 2DIR further enhanced the identification in detail. Copyright © 2015 Elsevier B.V. All rights reserved.

The ability of white-rot fungi to degrade the endocrine-disrupting compound nonylphenol.

PubMed

Soares, Ana; Jonasson, Karin; Terrazas, Enrique; Guieysse, Benoit; Mattiasson, Bo

2005-03-01

Phanerochaete chrysosporium, Pleurotus ostreatus, Trametes versicolor and Bjerkandera sp. BOL13 were tested for their ability to degrade the endocrine-disrupting compound nonylphenol at an initial concentration of 100 mg l-1. The highest removals were achieved with T. versicolor and Bjerkandera sp. BOL13, which were able to degrade 97 mg l-1 and 99 mg l-1 of nonylphenol in 25 days of incubation, respectively. Nonylphenol removal was associated with the production of laccase by T. versicolor, but the levels of laccase, manganese peroxidase and lignin peroxidase produced by Bjerkandera sp. BOL13 were very low. At 14 degrees C, T. versicolor and Bjerkandera sp. BOL13 sustained the removal of 88 mg l-1 and 79 mg l-1 of nonylphenol, respectively. No pollutant removal was recorded at 4 degrees C, although both fungi could grow at this temperature in the absence of nonylphenol. A microtoxicity assay showed that the fungi produced compounds that were toxic to Vibrio fischerii; and thus a reduction in toxicity could not be correlated with nonylphenol metabolism. T. versicolor and Bjerkandera sp. BOL13 were capable of colonizing soil artificially contaminated with 430 mg kg-1 of nonylphenol. Only 1.3+/-0.1% of nonylphenol remained in the soil after 5 weeks of incubation.

Versatile peroxidase as a valuable tool for generating new biomolecules by homogeneous and heterogeneous cross-linking.

PubMed

Salvachúa, Davinia; Prieto, Alicia; Mattinen, Maija-Liisa; Tamminen, Tarja; Liitiä, Tiina; Lille, Martina; Willför, Stefan; Martínez, Angel T; Martínez, María Jesús; Faulds, Craig B

2013-05-10

The modification and generation of new biomolecules intended to give higher molecular-mass species for biotechnological purposes, can be achieved by enzymatic cross-linking. The versatile peroxidase (VP) from Pleurotus eryngii is a high redox-potential enzyme with oxidative activity on a wide variety of substrates. In this study, VP was successfully used to catalyze the polymerization of low molecular mass compounds, such as lignans and peptides, as well as larger macromolecules, such as protein and complex polysaccharides. Different analytical, spectroscopic, and rheological techniques were used to determine structural changes and/or variations of the physicochemical properties of the reaction products. The lignans secoisolariciresinol and hydroxymatairesinol were condensed by VP forming up to 8 unit polymers in the presence of organic co-solvents and Mn(2+). Moreover, 11 unit of the peptides YIGSR and VYV were homogeneously cross-linked. The heterogeneous cross-linking of one unit of the peptide YIGSR and several lignan units was also achieved. VP could also induce gelation of feruloylated arabinoxylan and the polymerization of β-casein. These results demonstrate the efficacy of VP to catalyze homo- and hetero-condensation reactions, and reveal its potential exploitation for polymerizing different types of compounds. Copyright © 2013 Elsevier Inc. All rights reserved.

Productivity improvement with green approach to palm oil factory productivity

NASA Astrophysics Data System (ADS)

Matondang, N.

2018-02-01

The palm oil factory (POF) processes fresh fruit bunches into crude palm oil (CPO) and palm kernel oil (PKO) by products in the form of liquid and solid waste. One of the solid wastes produced in POF Tanjung Kasau is empty fruit bunches of palm oil (FBPO) which have been burned completely on incinerator tubes so that potentially produces pollutants that pollute the environment. If FBPO waste is managed properly, it will improve the productivity of the company. Therefore, it is necessary to conduct a study to find out how far the increased productivity of the company can reduce their impact on the environment, if FBPO is used as raw material of liquid smoke. The productivity improvement approach is done by Green Productivity concept, by looking at three aspects: environmental, social and economical. Green Productivity aims to protect the environment simultaneously by increasing the productivity of the company. One way is to turn FBPO waste into liquid smoke product is by pyrolysis process. The results showed that turning FBPO solid waste into liquid smoke will increase productivity by 18.18%. Implementation of Green Productivity can improve productivity through the improvement of FBPO waste treatment process which has been done by perfect combustion by pyrolysis process so that waste can be minimized to create environment industry POF clean and friendly environment.

Preparation of different types of miso with mixture of starters and their effects on endogenous antioxidant of liver and kidney of mice.

PubMed

El-Shenawy, N S; Abu Zaid, A; Amin, G A

2012-02-01

The present study was undertaken to evaluate the effects of feeding the male mice with miso that was prepared with a mixture of microbial starters on the level of lipid peroxidation as a marker of oxidative stress, antioxidant power of hepatocytes, the enzymatic and non-enzymatic antioxidant. The starters that were used in the preparation of miso were Aspergillus oryzae and Pleurotus ostreaus or A. oryzae and Bacillus subtilis. The miso that was prepared with A. oryzae and Bacillus subtilis has more effect on suppressing the oxidative stress and enhancement of endogenous antioxidant of hepatocytes and renal tissue of mice. © 2011 Blackwell Verlag GmbH.

Biocatalytic synthesis of the Green Note trans-2-hexenal in a continuous-flow microreactor

PubMed Central

van Schie, Morten M C H; Pedroso de Almeida, Tiago; Laudadio, Gabriele; Tieves, Florian; Fernández-Fueyo, Elena; Arends, Isabel W C E

2018-01-01

The biocatalytic preparation of trans-hex-2-enal from trans-hex-2-enol using a novel aryl alcohol oxidase from Pleurotus eryngii (PeAAOx) is reported. As O2-dependent enzyme PeAAOx-dependent reactions are generally plagued by the poor solubility of O2 in aqueous media and mass transfer limitations resulting in poor reaction rates. These limitations were efficiently overcome by conducting the reaction in a flow-reactor setup reaching unpreceded catalytic activities for the enzyme in terms of turnover frequency (up to 38 s−1) and turnover numbers (more than 300000) pointing towards preparative usefulness of the proposed reaction scheme. PMID:29719567

Productivity of Western forests: a forest products focus.

Treesearch

Constance A. Harrington; Stephen H. Schoenholtz

2005-01-01

In August 20-23, 2004, a conference was held in Kamilche, WA, with the title “Productivity of Western Forests: A Forest Products Focus.” The meeting brought together researchers and practitioners interested in discussing the economic and biological factors influencing wood production and value. One of the underlying assumptions of the meeting organizers was that...

Design for Production Manual. Volume 2. Design/Production Integration

DTIC Science & Technology

1985-12-01

woodworking equipment such as circular saw, cross cut saw, planer / thicknesser and sander. There is considerable use of hand tools in the shop. Joinery inclucies...PROGRAM BY SOCIETY OF NAVAL ARCHITECTS AND MARINE ENGINEERS SHIP PRODUCTION COMMITTEE PANEL SP- 4 DESIGN PRODUCTION INTEGRATION CONTRACT DTMA91-82-C...DEC 1985 2. REPORT TYPE N/A 3. DATES COVERED - 4 . TITLE AND SUBTITLE Design for Production Manual Volume 2 of 3 Design/Production

GPM Data Products, Their Availability, and Production Status

NASA Technical Reports Server (NTRS)

Stocker, Erich Franz; Kelley, Owen; Kwiatkowski, John; Ji, Yimin

2014-01-01

On February 28, 2014, Japan Standard Time, the Global Precipitation Measurement (GPM) mission was launched in a picture-perfect launch activity. On March 4, 2014, the GPM Microwave Imager (GMI) was put into science observation mode. The Dual-Frequency Radar (DPR) was put in science observation mode on March 8, 2014. The Precipitation Processing System (PPS) produced products immediately upon receiving the data. Both regular science products and Near-realtime (NRT) products were produced. These were made immediately available to a group of early adopters. In mid-June 2014, GMI level-1 brightness temperature products were made publicly available. In mid-July 2014, GMI and partner-radiometer precipitation retrievals were made public. GMI public availability was several months ahead of the planned release. The DPR products became publicly available on the planned release date of September 2, 2014. Data continues to be available to any user desiring it.

Information models of software productivity - Limits on productivity growth

NASA Technical Reports Server (NTRS)

Tausworthe, Robert C.

1992-01-01

Research into generalized information-metric models of software process productivity establishes quantifiable behavior and theoretical bounds. The models establish a fundamental mathematical relationship between software productivity and the human capacity for information traffic, the software product yield (system size), information efficiency, and tool and process efficiencies. An upper bound is derived that quantifies average software productivity and the maximum rate at which it may grow. This bound reveals that ultimately, when tools, methodologies, and automated assistants have reached their maximum effective state, further improvement in productivity can only be achieved through increasing software reuse. The reuse advantage is shown not to increase faster than logarithmically in the number of reusable features available. The reuse bound is further shown to be somewhat dependent on the reuse policy: a general 'reuse everything' policy can lead to a somewhat slower productivity growth than a specialized reuse policy.

SaferProducts.gov

MedlinePlus

... Register & Respond Search Recalls & Reports About Questions Welcome Consumers Report your unsafe product on SaferProducts.gov. Tell CPSC. ... Unsafe Product Business Sign In Search Recalls/Repairs & Reports Advanced Search Most ... does not guarantee the accuracy, completeness, or adequacy of the contents of the Publicly Available Consumer Product Safety Information Database on SaferProducts.gov, particularly ...

Hurricane Products

Science.gov Websites

HOME PAGE Image of NCEP Logo WHERE AMERICA'S CLIMATE AND WEATHER SERVICES BEGIN NCEP Products Inventory Image of horizontal rule Hurricane Products Updated: 6/09/2015 Geophysical fluid dynamics laboratory Hurricane Model (GHM) Hurricane Weather Research and Forecast System (HWRF) * Products Information

Applying environmental product design to biomedical products research.

PubMed Central

Messelbeck, J; Sutherland, L

2000-01-01

The principal themes for the Biomedical Research and the Environment Conference Committee on Environmental Economics in Biomedical Research include the following: healthcare delivery companies and biomedical research organizations, both nonprofit and for-profit, need to improve their environmental performance; suppliers of healthcare products will be called upon to support this need; and improving the environmental profile of healthcare products begins in research and development (R&D). The committee report begins with requirements from regulatory authorities (e.g., U.S. Environmental Protection Agency [EPA], the U.S. Food and Drug Administration), and the healthcare delivery sector). The 1998 American Hospital Association and EPA Memorandum of Understanding to reduce solid waste and mercury from healthcare facilities is emblematic of these requirements. The dominant message from the requirements discussion is to ensure that R&D organizations do not ignore customer, environmental, and regulatory requirements in the early stages of product development. Several representatives from healthcare products manufacturers presented their companies' approaches to meeting these requirements. They reported on efforts to ensure that their R&D processes are sensitive to the environmental consequences from manufacturing, distributing, using, and disposing of healthcare products. These reports describe representatives' awareness of requirements and the unique approaches their R&D organizations have taken to meet these requirements. All representatives reported that their R&D organizations have embraced environmental product design because it avoids the potential of returning products to R&D to improve the environmental profile. Additionally, several reports detailed cost savings, sustainability benefits, and improvements in environmental manufacturing or redesign, and increased customer satisfaction. Many companies in healthcare delivery are working to improve environmental

Applying environmental product design to biomedical products research.

PubMed

Messelbeck, J; Sutherland, L

2000-12-01

The principal themes for the Biomedical Research and the Environment Conference Committee on Environmental Economics in Biomedical Research include the following: healthcare delivery companies and biomedical research organizations, both nonprofit and for-profit, need to improve their environmental performance; suppliers of healthcare products will be called upon to support this need; and improving the environmental profile of healthcare products begins in research and development (R&D). The committee report begins with requirements from regulatory authorities (e.g., U.S. Environmental Protection Agency [EPA], the U.S. Food and Drug Administration), and the healthcare delivery sector). The 1998 American Hospital Association and EPA Memorandum of Understanding to reduce solid waste and mercury from healthcare facilities is emblematic of these requirements. The dominant message from the requirements discussion is to ensure that R&D organizations do not ignore customer, environmental, and regulatory requirements in the early stages of product development. Several representatives from healthcare products manufacturers presented their companies' approaches to meeting these requirements. They reported on efforts to ensure that their R&D processes are sensitive to the environmental consequences from manufacturing, distributing, using, and disposing of healthcare products. These reports describe representatives' awareness of requirements and the unique approaches their R&D organizations have taken to meet these requirements. All representatives reported that their R&D organizations have embraced environmental product design because it avoids the potential of returning products to R&D to improve the environmental profile. Additionally, several reports detailed cost savings, sustainability benefits, and improvements in environmental manufacturing or redesign, and increased customer satisfaction. Many companies in healthcare delivery are working to improve environmental

[Service productivity in hospital nursing--conceptual framework of a productivity analysis].

PubMed

Thomas, D; Borchert, M; Brockhaus, N; Jäschke, L; Schmitz, G; Wasem, J

2015-01-01

Decreasing staff numbers compounded by an increasing number of cases is regarded as main challenge in German hospital nursing. These input reductions accompanied by output extensions imply that hospital nursing services have had to achieve a continuous productivity growth in the recent years. Appropriately targeted productivity enhancements require approved and effective methods for productivity acquisition and measurement. However, there is a lack of suitable productivity measurement instruments for hospital nursing services. This deficit is addressed in the present study by the development of an integrated productivity model for hospital nursing services. Conceptually, qualitative as well as quantitative aspects of nursing services productivity are equally taken into consideration. Based on systematic literature reviews different conceptual frameworks of service productivity and the current state of research in hospital nursing services productivity were analysed. On this basis nursing sensitive inputs, processes and outputs were identified and integrated into a productivity model. As an adequate framework for a hospital nursing services productivity model the conceptual approach by Grönroos/Ojasalo was identified. The basic structure of this model was adapted stepwise to our study purpose by integrating theoretical and empirical findings from the research fields of service productivity, nursing productivity as well as national and international nursing research. Special challenges existed concerning the identification of relevant influencing factors as well as the representation of nursing sensitive outputs. The final result is an integrated productivity model, which can be used as an adequate framework for further research in hospital nursing productivity. Research on hospital nursing services productivity is rare, especially in Germany. The conceptual framework developed in this study builds on established knowledge in service productivity research. The

Productive and Re-Productive Thinking in Solving Insight Problems

ERIC Educational Resources Information Center

Cunningham, J. Barton; MacGregor, James N.

2014-01-01

Many innovations in organizations result when people discover insightful solutions to problems. Insightful problem-solving was considered by Gestalt psychologists to be associated with productive, as opposed to re-productive, thinking. Productive thinking is characterized by shifts in perspective which allow the problem solver to consider new,…

Report on Federal Productivity. Volume 2, Productivity Case Studies.

ERIC Educational Resources Information Center

Joint Financial Management Improvement Program, Washington, DC.

Volume 2 contains 15 productivity case studies which illustrate and expand on the causal factors mentioned in volume 1. The cases illustrate many different approaches to productivity measurement improvement. The case studies are: Development of an Output-Productivity Measure for the Air Force Medical Service; Measuring Effectiveness and Efficiency…

NAEFS Products

Science.gov Websites

HOME PAGE Image of NCEP Logo WHERE AMERICA'S CLIMATE AND WEATHER SERVICES BEGIN NCEP Products Inventory Image of horizontal rule North American Ensemble Forecast System (NAEFS) Products Updated: 02/27 /2014 * Products Information about the NAEFS Models CC is the model cycle runtime (i.e. 00, 06, 12, 18

Accounting for Production and Sale of Forest Products

DTIC Science & Technology

1988-01-25

procedures, and assigns responsibilities for DoD reimbursement and for a State’s entitlement to a share in the net proceeds derived from forest products...appropriations incurring obligations for the production and sale of forest products shall be reimbursed from collections made as a result of the sale of such...mainte- nance (00M) and other procurement accounts. The 0&M and other procurement appropriations incur obligations, which are reimbursable , for the

Defining Product Intake Fraction to Quantify and Compare Exposure to Consumer Products.

PubMed

Jolliet, Olivier; Ernstoff, Alexi S; Csiszar, Susan A; Fantke, Peter

2015-08-04

There is a growing consciousness that exposure studies need to better cover near-field exposure associated with products use. To consistently and quantitatively compare human exposure to chemicals in consumer products, we introduce the concept of product intake fraction, as the fraction of a chemical within a product that is eventually taken in by the human population. This metric enables consistent comparison of exposures during consumer product use for different product-chemical combinations, exposure duration, exposure routes and pathways and for other life cycle stages. We present example applications of the product intake fraction concept, for two chemicals in two personal care products and two chemicals encapsulated in two articles, showing how intakes of these chemicals can primarily occur during product use. We demonstrate the utility of the product intake fraction and its application modalities within life cycle assessment and risk assessment contexts. The product intake fraction helps to provide a clear interface between the life cycle inventory and impact assessment phases, to identify best suited sentinel products and to calculate overall exposure to chemicals in consumer products, or back-calculate maximum allowable concentrations of substances inside products.

EPD--environmental product declarations for wood products : an application of life cycle information about forest products

Treesearch

Richard Bergman; Adam Taylor

2011-01-01

Transparent and credible environmental labeling of products is vital for a sustainable future. Ecolabeling shows information on the environmental performance of products, processes, and services. This article focuses on one type of ecolabeling referred to as environmental product declarations (EPDs) that provide environmental impact information based on life cycle...

Managing Productivity.

DTIC Science & Technology

1985-01-01

could be a small construction , management firm, where project managers keep track of all phases and evolutions of contracts by hand. An obvious polution ...overview of productivity measurement. This idea can be expanded much further with the concept of productivity audits . Productivity auditing is a...comprehensive procedure, not unlike traditional audit practices which monitors and evaluates organizational practices to determine whether functional units

One-carbon substrate-based biohydrogen production: microbes, mechanism, and productivity.

PubMed

Rittmann, Simon K-M R; Lee, Hyun Sook; Lim, Jae Kyu; Kim, Tae Wan; Lee, Jung-Hyun; Kang, Sung Gyun

2015-01-01

Among four basic mechanisms for biological hydrogen (H2) production, dark fermentation has been considered to show the highest hydrogen evolution rate (HER). H2 production from one-carbon (C1) compounds such as formate and carbon monoxide (CO) is promising because formate is an efficient H2 carrier, and the utilization of CO-containing syngas or industrial waste gas may render the industrial biohydrogen production process cost-effective. A variety of microbes with the formate hydrogen lyase (FHL) system have been identified from phylogenetically diverse groups of archaea and bacteria, and numerous efforts have been undertaken to improve the HER for formate through strain optimization and bioprocess development. CO-dependent H2 production has been investigated to enhance the H2 productivity of various carboxydotrophs via an increase in CO gas-liquid mass transfer rates and the construction of genetically modified strains. Hydrogenogenic CO-conversion has been applied to syngas and by-product gas of the steel-mill process, and this low-cost feedstock has shown to be promising in the production of biomass and H2. Here, we focus on recent advances in the isolation of novel phylogenetic groups utilizing formate or CO, the remarkable genetic engineering that enhances H2 productivity, and the practical implementation of H2 production from C1 substrates. Copyright © 2014 Elsevier Inc. All rights reserved.

Applying linear programming model to aggregate production planning of coated peanut products

NASA Astrophysics Data System (ADS)

Rohmah, W. G.; Purwaningsih, I.; Santoso, EF S. M.

2018-03-01

The aim of this study was to set the overall production level for each grade of coated peanut product to meet market demands with a minimum production cost. The linear programming model was applied in this study. The proposed model was used to minimize the total production cost based on the limited demand of coated peanuts. The demand values applied to the method was previously forecasted using time series method and production capacity aimed to plan the aggregate production for the next 6 month period. The results indicated that the production planning using the proposed model has resulted a better fitted pattern to the customer demands compared to that of the company policy. The production capacity of product family A, B, and C was relatively stable for the first 3 months of the planning periods, then began to fluctuate over the next 3 months. While, the production capacity of product family D and E was fluctuated over the 6-month planning periods, with the values in the range of 10,864 - 32,580 kg and 255 – 5,069 kg, respectively. The total production cost for all products was 27.06% lower than the production cost calculated using the company’s policy-based method.

Production Function Geometry with "Knightian" Total Product

ERIC Educational Resources Information Center

Truett, Dale B.; Truett, Lila J.

2007-01-01

Authors of principles and price theory textbooks generally illustrate short-run production using a total product curve that displays first increasing and then diminishing marginal returns to employment of the variable input(s). Although it seems reasonable that a temporary range of increasing returns to variable inputs will likely occur as…

Changes in chemical composition and digestibility of three maize stover components digested by white-rot fungi.

PubMed

Lynch, J P; O'Kiely, P; Murphy, R; Doyle, E M

2014-08-01

Maize stover (total stem and leaves) is not considered a ruminant feed of high nutritive value. Therefore, an improvement in its digestibility may increase the viability of total forage maize production systems in marginal growth regions. The objective of this study was to describe the changes in chemical composition during the storage of contrasting components of maize stover (leaf, upper stem and lower stem) treated with either of two lignin degrading white-rot fungi (WRF; Pleurotus ostreatus, Trametes versicolor). Three components of maize stover (leaf, upper stem and lower stem), harvested at a conventional maturity for silage production, were digested with either of two WRF for one of four digestion durations (1-4 months). Samples taken prior to fungal inoculation were used to benchmark the changes that occurred. The degradation of acid detergent lignin was observed in all sample types digested with P. ostreatus; however, the loss of digestible substrate in all samples inoculated with P. ostreatus was high, and therefore, P. ostreatus-digested samples had a lower dry matter digestibility than samples prior to inoculation. Similarly, T. veriscolor-digested leaf underwent a non-selective degradation of the rumen-digestible components of fibre. The changes in chemical composition of leaf, upper stem and lower stem digested with either P. ostreatus or T. veriscolor were not beneficial to the feed value of the forage, and incurred high DM losses. Journal of Animal Physiology and Animal Nutrition © 2013 Blackwell Verlag GmbH.

Singing emotionally: a study of pre-production, production, and post-production facial expressions

PubMed Central

Quinto, Lena R.; Thompson, William F.; Kroos, Christian; Palmer, Caroline

2014-01-01

Singing involves vocal production accompanied by a dynamic and meaningful use of facial expressions, which may serve as ancillary gestures that complement, disambiguate, or reinforce the acoustic signal. In this investigation, we examined the use of facial movements to communicate emotion, focusing on movements arising in three epochs: before vocalization (pre-production), during vocalization (production), and immediately after vocalization (post-production). The stimuli were recordings of seven vocalists' facial movements as they sang short (14 syllable) melodic phrases with the intention of communicating happiness, sadness, irritation, or no emotion. Facial movements were presented as point-light displays to 16 observers who judged the emotion conveyed. Experiment 1 revealed that the accuracy of emotional judgment varied with singer, emotion, and epoch. Accuracy was highest in the production epoch, however, happiness was well communicated in the pre-production epoch. In Experiment 2, observers judged point-light displays of exaggerated movements. The ratings suggested that the extent of facial and head movements was largely perceived as a gauge of emotional arousal. In Experiment 3, observers rated point-light displays of scrambled movements. Configural information was removed in these stimuli but velocity and acceleration were retained. Exaggerated scrambled movements were likely to be associated with happiness or irritation whereas unexaggerated scrambled movements were more likely to be identified as “neutral.” An analysis of singers' facial movements revealed systematic changes as a function of the emotional intentions of singers. The findings confirm the central role of facial expressions in vocal emotional communication, and highlight individual differences between singers in the amount and intelligibility of facial movements made before, during, and after vocalization. PMID:24808868

Iron nutrition, biomass production, and plant product quality.

PubMed

Briat, Jean-François; Dubos, Christian; Gaymard, Frédéric

2015-01-01

One of the grand challenges in modern agriculture is increasing biomass production, while improving plant product quality, in a sustainable way. Of the minerals, iron (Fe) plays a major role in this process because it is essential both for plant productivity and for the quality of their products. Fe homeostasis is an important determinant of photosynthetic efficiency in algae and higher plants, and we review here the impact of Fe limitation or excess on the structure and function of the photosynthetic apparatus. We also discuss the agronomic, plant breeding, and transgenic approaches that are used to remediate Fe deficiency of plants on calcareous soils, and suggest ways to increase the Fe content and bioavailability of the edible parts of crops to improve human diet. Copyright © 2014 Elsevier Ltd. All rights reserved.

Product competitiveness analysis for e-commerce platform of special agricultural products

NASA Astrophysics Data System (ADS)

Wan, Fucheng; Ma, Ning; Yang, Dongwei; Xiong, Zhangyuan

2017-09-01

On the basis of analyzing the influence factors of the product competitiveness of the e-commerce platform of the special agricultural products and the characteristics of the analytical methods for the competitiveness of the special agricultural products, the price, the sales volume, the postage included service, the store reputation, the popularity, etc. were selected in this paper as the dimensionality for analyzing the competitiveness of the agricultural products, and the principal component factor analysis was taken as the competitiveness analysis method. Specifically, the web crawler was adopted to capture the information of various special agricultural products in the e-commerce platform ---- chi.taobao.com. Then, the original data captured thereby were preprocessed and MYSQL database was adopted to establish the information library for the special agricultural products. Then, the principal component factor analysis method was adopted to establish the analysis model for the competitiveness of the special agricultural products, and SPSS was adopted in the principal component factor analysis process to obtain the competitiveness evaluation factor system (support degree factor, price factor, service factor and evaluation factor) of the special agricultural products. Then, the linear regression method was adopted to establish the competitiveness index equation of the special agricultural products for estimating the competitiveness of the special agricultural products.

Productivity and health: best practices for better measures of productivity.

PubMed

Schwartz, Steven M; Riedel, John

2010-09-01

Interest in quantifying the relationship between health status and lost productivity has accelerated among employers, researchers, and benefits advisors. Our objective was to engage a dialogue to highlight important productivity measurement issues for consideration in an overall business strategy. Critical review of selected topical literature. Four functions of productivity measurement are described: 1) the purposes of a measurement initiative, 2) norms and benchmarking, 3) health and productivity cost estimators, and 4) reporting results. Each function is described in detail; challenges are noted; examples are provided. This article supports the Integrated Benefits Institute consensus statements on productivity, underscoring the need to develop a conceptual framework of productivity measurement that guides the maturation of instruments and sets forth recommendations for their application consistent with the descriptive, comparative, and evaluative functions that foster health, well-being, and work performance.

Productivity changes in OECD healthcare systems: bias-corrected Malmquist productivity approach.

PubMed

Kim, Younhee; Oh, Dong-Hyun; Kang, Minah

2016-10-01

This study evaluates productivity changes in the healthcare systems of 30 Organization for Economic Co-operation and Development (OECD) countries over the 2002-2012 periods. The bootstrapped Malmquist approach is used to estimate bias-corrected indices of healthcare performance in productivity, efficiency and technology by modifying the original distance functions. Two inputs (health expenditure and school life expectancy) and two outputs (life expectancy at birth and infant mortality rate) are used to calculate productivity growth. There are no perceptible trends in productivity changes over the 2002-2012 periods, but positive productivity improvement has been noticed for most OECD countries. The result also informs considerable variations in annual productivity scores across the countries. Average annual productivity growth is evenly yielded by efficiency and technical changes, but both changes run somewhat differently across the years. The results of this study assert that policy reforms in OECD countries have improved productivity growth in healthcare systems over the past decade. Countries that lag behind in productivity growth should benchmark peer countries' practices to increase performance by prioritizing an achievable trajectory based on socioeconomic conditions. For example, relatively inefficient countries in this study indicate higher income inequality, corresponding to inequality and health outcomes studies. Although income inequality and globalization are not direct measures to estimate healthcare productivity in this study, these issues could be latent factors to explain cross-country healthcare productivity for future research. Copyright © 2016 John Wiley & Sons, Ltd. Copyright © 2016 John Wiley & Sons, Ltd.

Development of Product Availability Monitoring System In Production Unit In Automotive Component Industry

NASA Astrophysics Data System (ADS)

Hartono, Rachmad; Raharno, Sri; Yuwana Martawirya, Yatna; Arthaya, Bagus

2018-03-01

This paper described a methodology to monitor the availability of products in a production unit in the automotive component industry. Automotive components made are automotive components made through sheet metal working. Raw material coming into production unit in the form of pieces of plates that have a certain size. Raw materials that come stored in the warehouse. Data of raw each material in the warehouse are recorded and stored in a data base system. The material will then undergo several production processes in the production unit. When the material is taken from the warehouse, material data are also recorded and stored in a data base. The data recorded are the amount of material, material type, and date when the material is out of the warehouse. The material coming out of the warehouse is labeled with information related to the production processes that the material must pass. Material out of the warehouse is a product will be made. The products have been completed, are stored in the warehouse products. When the product is entered into the product warehouse, product data is also recorded by scanning the barcode contained on the label. By recording the condition of the product at each stage of production, we can know the availability of the product in a production unit in the form of a raw material, the product being processed and the finished product.

48 CFR 1852.209-70 - Product removal from Qualified Products List.

Code of Federal Regulations, 2010 CFR

2010-10-01

... 48 Federal Acquisition Regulations System 6 2010-10-01 2010-10-01 true Product removal from Qualified Products List. 1852.209-70 Section 1852.209-70 Federal Acquisition Regulations System NATIONAL... Provisions and Clauses 1852.209-70 Product removal from Qualified Products List. As prescribed in 1809.206-71...

Hydrocodone Combination Products

MedlinePlus

Codiclear DH® (as a combination product containing Guaifenesin, Hydrocodone) ... EndaCof XP® (as a combination product containing Guaifenesin, Hydrocodone) ... Entuss® (as a combination product containing Guaifenesin, Hydrocodone)

Microbial protein production: maximizing protein production efficiency in Space habitats

NASA Astrophysics Data System (ADS)

Clauwaert, Peter; Alloul, Abbas; Muys, Maarten; Sui, Yixing; Boon, Nico; Luther, Amanda; Christiaens, Marlies E. R.; Ilgrande, Chiara; Lindeboom, Ralph E. F.; Rabaey, Korneel; Vlaeminck, Siegfried

2016-07-01

On top of the goal of a closed material cycle for Space habitats or deep Space missions with food production, extreme requirements apply to such Life Support Systems (LSS) in terms of mass, volume, crew time, energy consumption and controllability. Although relatively high water recovery efficiencies (~70-90%) can be achieved, all Space missions until now have relied on terrestrial food resupply and thus no nutrient recovery has been achieved so far. Researchers and Space agencies have typically been focussing on the cultivation of higher plants to produce food for crew members for future Space LSS. It can be assumed that the required surface area (50-500 m2 per crew member), plant evaporation rates (~200 kg per crew member per day), power consumption (~65 kW per crew member) and the degree of controllability of a higher plant compartment will have a great impact on the feasibility of realizing a future closed loop LSS in Space for the first time. As the food production density is so critical in a LSS, a combination of higher plant cultivation and microbial protein production might increase the chances of success of future Space LSS's since the production densities are significantly higher. Higher plants in Space LSS's would typically have an average specific protein production rate in the order of 0-4 kg protein m-3 year-1 (calculated from Do, Owens et al. (2016)), whereas bacterial biomass can be produced continuously at a rate up to ~1000 kg protein m-3 year-1. Several routes for microbial food production will be discussed in this presentation, ranging from aerobic heterotrophic production with for instance Candida ingens (Strayer, Finger et al. 1997), photoheterotrophic production with PNSB such as Rhodospirillum rubrum (Hendrickx, De Wever et al. 2006) and hydrogenotrophic production with HOB such as Cupriavidus necator (Matassa, Boon et al. 2015)) and photoautotrophic production of oxygen and microbial food (e.g. Arthrospira sp. (Hendrickx, De Wever et al

Product Review

EPA Pesticide Factsheets

Resources and guidelines to develop and get approved communications products at EPA; including print items, Web content standards, video production and submission, interactive maps, and social media policies.

Report on Federal Productivity. Volume 1, Productivity Trends, FY 1967-1973.

ERIC Educational Resources Information Center

Joint Financial Management Improvement Program, Washington, DC.

Volume 1 reports on Federal productivity and productivity trends for Fiscal Years 1967-1973, and comments on the causes of productivity increases and decreases. The report, prepared to promote improved financial management in individual agencies and on a government-wide scale, includes productivity measurement data supplied by 46 agencies. The…

Mars Observer data production, transfer, and archival: The data production assembly line

NASA Technical Reports Server (NTRS)

Childs, David B.

1993-01-01

This paper describes the data production, transfer, and archival process designed for the Mars Observer Flight Project. It addresses the developmental and operational aspects of the archive collection production process. The developmental aspects cover the design and packaging of data products for archival and distribution to the planetary community. Also discussed is the design and development of a data transfer and volume production process capable of handling the large throughput and complexity of the Mars Observer data products. The operational aspects cover the main functions of the process: creating data and engineering products, collecting the data products and ancillary products in a central repository, producing archive volumes, validating volumes, archiving, and distributing the data to the planetary community.

Comparison of Employer Productivity Metrics to Lost Productivity Estimated by Commonly Used Questionnaires.

PubMed

Gardner, Bethany T; Dale, Ann Marie; Buckner-Petty, Skye; Van Dillen, Linda; Amick, Benjamin C; Evanoff, Bradley

2016-02-01

The aim of the study was to assess construct and discriminant validity of four health-related work productivity loss questionnaires in relation to employer productivity metrics, and to describe variation in economic estimates of productivity loss provided by the questionnaires in healthy workers. Fifty-eight billing office workers completed surveys including health information and four productivity loss questionnaires. Employer productivity metrics and work hours were also obtained. Productivity loss questionnaires were weakly to moderately correlated with employer productivity metrics. Workers with more health complaints reported greater health-related productivity loss than healthier workers, but showed no loss on employer productivity metrics. Economic estimates of productivity loss showed wide variation among questionnaires, yet no loss of actual productivity. Additional studies are needed comparing questionnaires with objective measures in larger samples and other industries, to improve measurement methods for health-related productivity loss.

Comparison of employer productivity metrics to lost productivity estimated by commonly used questionnaires

PubMed Central

Gardner, Bethany T.; Dale, Ann Marie; Buckner-Petty, Skye; Van Dillen, Linda; Amick, Benjamin C.; Evanoff, Bradley

2016-01-01

Objective To assess construct and discriminant validity of four health-related work productivity loss questionnaires in relation to employer productivity metrics, and to describe variation in economic estimates of productivity loss provided by the questionnaires in healthy workers. Methods 58 billing office workers completed surveys including health information and four productivity loss questionnaires. Employer productivity metrics and work hours were also obtained. Results Productivity loss questionnaires were weakly to moderately correlated with employer productivity metrics. Workers with more health complaints reported greater health-related productivity loss than healthier workers, but showed no loss on employer productivity metrics. Economic estimates of productivity loss showed wide variation among questionnaires, yet no loss of actual productivity. Conclusions Additional studies are needed comparing questionnaires with objective measures in larger samples and other industries, to improve measurement methods for health-related productivity loss. PMID:26849261

Assessing the Total Factor Productivity of Cotton Production in Egypt

PubMed Central

Rodríguez, Xosé A.; Elasraag, Yahia H.

2015-01-01

The main objective of this paper is to decompose the productivity growth of Egyptian cotton production. We employ the stochastic frontier approach and decompose the changes in total factor productivity (CTFP) growth into four components: technical progress (TP), changes in scale component (CSC), changes in allocative efficiency (CAE), and changes in technical efficiency (CTE). Considering a situation of scarce statistical information, we propose four alternative empirical models, with the purpose of looking for convergence in the results. The results provide evidence that in this production system total productivity does not increase, which is mainly due to the negative average contributions of CAE and TP. Policy implications are offered in light of the results. PMID:25625318

Assessing the total factor productivity of cotton production in Egypt.

PubMed

Rodríguez, Xosé A; Elasraag, Yahia H

2015-01-01

The main objective of this paper is to decompose the productivity growth of Egyptian cotton production. We employ the stochastic frontier approach and decompose the changes in total factor productivity (CTFP) growth into four components: technical progress (TP), changes in scale component (CSC), changes in allocative efficiency (CAE), and changes in technical efficiency (CTE). Considering a situation of scarce statistical information, we propose four alternative empirical models, with the purpose of looking for convergence in the results. The results provide evidence that in this production system total productivity does not increase, which is mainly due to the negative average contributions of CAE and TP. Policy implications are offered in light of the results.

Determination of Glutathione, Selenium, and Malondialdehyde in Different Edible Mushroom Species.

PubMed

Dogan, Hacer; Coteli, Ebru; Karatas, Fikret

2016-12-01

In this study, the amount of reduced glutathione (GSH), oxidized glutathione (GSSG), and malondialdehyde (MDA) were determined by high performance liquid chromatography (HPLC), and selenium was determined by using the fluorescence spectrophotometer in eight different species of edible mushrooms. Brittlegill mushroom (Russula delica), meadow mushroom (Agaricus campestris), dryad's saddle mushroom (Polyporus squamosus), white button mushroom (Agaricus bisporus), Pleurotus spp., ink mushroom (Coprinus atramentarius), ebekari mushroom (slimy) (Elazığ local) and çaşır mushroom (Pleurotus eryngii) (Tunceli local) were used for analysis. The amounts of GSH, GSSG, Se, and MDA with GSH/GSSG ratio in the eight different species of edible mushrooms were observed in between 269.10 ± 16.94-1554.83 ± 58.12 μg/g; 23.55 ± 1.89-841.90 ± 20.03 μg/g; 15.06 ± 1.56-82.10 ± 3.84 μg/g; 5.46 ± 0.50-27.45 ± 2.58 μg/g wet weight and 0.32-41.35, respectively. There is a weak correlation (R 2  = 0.389) between MDA and Se, on the other hand, the correlation (R 2  = 0.831) between GSH/GSSG ratio and selenium in mushrooms are reasonable well. In a similar manner, there is a weak correlation (R 2  = 0551) between GSH/GSSG and MDA ratios in mushrooms. It was found that these edible mushroom species are good source of glutathione (GSH, GSSG), and selenium (Se) in terms of quantities obtained; therefore, it can be said that mushrooms are a rich source of antioxidants.

A Comprehensive Review of Tropical Milky White Mushroom (Calocybe indica P&C).

PubMed

Subbiah, Krishnamoorthy Akkanna; Balan, Venkatesh

2015-09-01

A compressive description of tropical milky white mushroom (Calocybe indica P&C var. APK2) is provided in this review. This mushroom variety was first identified in the eastern Indian state of West Bengal and can be cultivated on a wide variety of substrates, at a high temperature range (30~38℃). However, no commercial cultivation was made until 1998. Krishnamoorthy 1997 rediscovered the fungus from Tamil Nadu, India and standardized the commercial production techniques for the first time in the world. This edible mushroom has a long shelf life (5~7 days) compared to other commercially available counterparts. A comprehensive and critical review on physiological and nutritional requirements viz., pH, temperature, carbon to nitrogen ratio, best carbon source, best nitrogen source, growth period, growth promoters for mycelia biomass production; substrate preparation; spawn inoculation; different supplementation and casing requirements to increase the yield of mushrooms has been outlined. Innovative and inexpensive methods developed to commercially cultivate milky white mushrooms on different lignocellulosic biomass is also described in this review. The composition profiles of milky white mushroom, its mineral contents and non-enzymatic antioxidants are provided in comparison with button mushroom (Agaricus bisporus) and oyster mushroom (Pleurotus ostreatus). Antioxidant assay results using methanol extract of milky white mushroom has been provided along with the information about the compounds that are responsible for flavor profile both in fresh and dry mushrooms. Milky white mushroom extracts are known to have anti-hyperglycemic effect and anti-lipid peroxidation effect. The advantage of growing at elevated temperature creates newer avenues to explore milky white mushroom cultivation economically around the world, especially, in humid tropical and sub-tropical zones. Because of its incomparable productivity and shelf life to any other cultivated mushrooms in the

Trade-offs between agricultural production and biodiversity for biofuel production

USDA-ARS?s Scientific Manuscript database

Growing energy demands and concerns for climate change have pushed forward the time line for biofuel production. However, the effect of large-scale biofuel production in the U.S. on the agricultural industry, primarily responsible for food production and livestock feed, and biodiversity levels of ma...

Workforce productivity.

PubMed

Williams, Ruth

2012-10-26

Managers who are responsible for delivering the workforce productivity element of the Quality, Innovation, Productivity and Prevention (QIPP) programme can network and share best practice through a dedicated NHS Employers webpage.

Primary forest products industry and industrial roundwood production, Michigan, 1969.

Treesearch

James E. Blyth; Allen H. Boelter

1971-01-01

Michigan loggers cut 173.8 million cubic feet of industrial roundwood products in 1969. Ninety percent was pulpwood and saw logs. Production is shifting from softwoods to hardwoods. The number of active primary wood-using mills declined rapidly from 1954 to 1969, but production per mill has expanded.

Production and Distribution of NASA MODIS Remote Sensing Products

NASA Technical Reports Server (NTRS)

Wolfe, Robert

2007-01-01

The two Moderate Resolution Imaging Spectroradiometer (MODIS) instruments on-board NASA's Earth Observing System (EOS) Terra and Aqua satellites make key measurements for understanding the Earth's terrestrial ecosystems. Global time-series of terrestrial geophysical parameters have been produced from MODIS/Terra for over 7 years and for MODIS/Aqua for more than 4 1/2 years. These well calibrated instruments, a team of scientists and a large data production, archive and distribution systems have allowed for the development of a new suite of high quality product variables at spatial resolutions as fine as 250m in support of global change research and natural resource applications. This talk describes the MODIS Science team's products, with a focus on the terrestrial (land) products, the data processing approach and the process for monitoring and improving the product quality. The original MODIS science team was formed in 1989. The team's primary role is the development and implementation of the geophysical algorithms. In addition, the team provided feedback on the design and pre-launch testing of the instrument and helped guide the development of the data processing system. The key challenges the science team dealt with before launch were the development of algorithms for a new instrument and provide guidance of the large and complex multi-discipline processing system. Land, Ocean and Atmosphere discipline teams drove the processing system requirements, particularly in the area of the processing loads and volumes needed to daily produce geophysical maps of the Earth at resolutions as fine as 250 m. The processing system had to handle a large number of data products, large data volumes and processing loads, and complex processing requirements. Prior to MODIS, daily global maps from heritage instruments, such as Advanced Very High Resolution Radiometer (AVHRR), were not produced at resolutions finer than 5 km. The processing solution evolved into a combination of

Agricultural Production: Task Analysis for Livestock Production. Competency-Based Education.

ERIC Educational Resources Information Center

Henrico County Public Schools, Glen Allen, VA. Virginia Vocational Curriculum Center.

This task analysis guide is intended to help teachers and administrators develop instructional materials and implement competency-based education in the agricultural production program. Section 1 contains a validated task inventory for the livestock production portion of agricultural production IV and V. Tasks are divided into six duty areas:…

Chemical production on Mars using in situ propellant production technology

NASA Technical Reports Server (NTRS)

Ash, Robert L.

1986-01-01

In situ propellant production (ISPP) was examined in terms of its applicability to a manned Mars mission. Production of oxygen from Martian atmosphere was used as the baseline system for ISPP technology assessment. It was concluded that production of oxygen was an important element in a manned Mars mission which could be developed in terrestrial laboratories. Expert system methodology will be required to enable reliable, autonomous production of oxygen. Furthermore, while no major technical breakthroughs are required, this research requires a long lead time to permit its systematic evolution.

9 CFR 319.761 - Potted meat food product and deviled meat food product.

Code of Federal Regulations, 2013 CFR

2013-01-01

... 9 Animals and Animal Products 2 2013-01-01 2013-01-01 false Potted meat food product and deviled meat food product. 319.761 Section 319.761 Animals and Animal Products FOOD SAFETY AND INSPECTION... COMPOSITION Meat Salads and Meat Spreads § 319.761 Potted meat food product and deviled meat food product...

9 CFR 319.761 - Potted meat food product and deviled meat food product.

Code of Federal Regulations, 2011 CFR

2011-01-01

... 9 Animals and Animal Products 2 2011-01-01 2011-01-01 false Potted meat food product and deviled meat food product. 319.761 Section 319.761 Animals and Animal Products FOOD SAFETY AND INSPECTION... COMPOSITION Meat Salads and Meat Spreads § 319.761 Potted meat food product and deviled meat food product...

9 CFR 319.761 - Potted meat food product and deviled meat food product.

Code of Federal Regulations, 2012 CFR

2012-01-01

... 9 Animals and Animal Products 2 2012-01-01 2012-01-01 false Potted meat food product and deviled meat food product. 319.761 Section 319.761 Animals and Animal Products FOOD SAFETY AND INSPECTION... COMPOSITION Meat Salads and Meat Spreads § 319.761 Potted meat food product and deviled meat food product...

9 CFR 319.761 - Potted meat food product and deviled meat food product.

Code of Federal Regulations, 2010 CFR

2010-01-01

... 9 Animals and Animal Products 2 2010-01-01 2010-01-01 false Potted meat food product and deviled meat food product. 319.761 Section 319.761 Animals and Animal Products FOOD SAFETY AND INSPECTION... COMPOSITION Meat Salads and Meat Spreads § 319.761 Potted meat food product and deviled meat food product...

Prediction is Production: The missing link between language production and comprehension.

PubMed

Martin, Clara D; Branzi, Francesca M; Bar, Moshe

2018-01-18

Language comprehension often involves the generation of predictions. It has been hypothesized that such prediction-for-comprehension entails actual language production. Recent studies provided evidence that the production system is recruited during language comprehension, but the link between production and prediction during comprehension remains hypothetical. Here, we tested this hypothesis by comparing prediction during sentence comprehension (primary task) in participants having the production system either available or not (non-verbal versus verbal secondary task). In the primary task, sentences containing an expected or unexpected target noun-phrase were presented during electroencephalography recording. Prediction, measured as the magnitude of the N400 effect elicited by the article (expected versus unexpected), was hindered only when the production system was taxed during sentence context reading. The present study provides the first direct evidence that the availability of the speech production system is necessary for generating lexical prediction during sentence comprehension. Furthermore, these important results provide an explanation for the recruitment of language production during comprehension.

Improving Crop Productions Using the Irrigation & Crop Production Model Under Drought

NASA Astrophysics Data System (ADS)

Shin, Y.; Lee, T.; Lee, S. H.; Kim, J.; Jang, W.; Park, S.

2017-12-01

We aimed to improve crop productions by providing optimal irrigation water amounts (IWAs) for various soils and crops using the Irrigation & Crop Production (ICP) model under various hydro-climatic regions. We selected the Little Washita (LW 13/21) and Bangdong-ri sites in Oklahoma (United States of America) and Chuncheon (Republic of Korea) for the synthetic studies. Our results showed that the ICP model performed well for improving crop productions by providing optimal IWAs during the study period (2000 to 2016). Crop productions were significantly affected by the solar radiation and precipitation, but the maximum and minimum temperature showed less impact on crop productions. When we considerd that the weather variables cannot be adjusted by artifical activities, irrigation might be the only solution for improving crop productions under drought. Also, the presence of shallow ground water (SGW) table depths higlhy influences on crop production. Although certainties exist in the synthetic studies, our results showed the robustness of the ICP model for improving crop productions under the drought condition. Thus, the ICP model can contribute to efficient water management plans under drought in regions at where water availability is limited.

Abuse liability assessment of tobacco products including potential reduced exposure products.

PubMed

Carter, Lawrence P; Stitzer, Maxine L; Henningfield, Jack E; O'Connor, Rich J; Cummings, K Michael; Hatsukami, Dorothy K

2009-12-01

The harm produced by tobacco products is a result of frequent use of a highly toxic product. Reducing the adverse public health impact of tobacco products might be most effectively achieved by reducing the likelihood of their use and the toxicity of the products. Products that retain some characteristics of cigarettes but have been altered with the intention of reducing toxicity have been referred to as modified risk tobacco products or potential reduced exposure products (MRTP/PREP). Evaluation of their content, emission, and toxicity is discussed in other articles in this special issue. Here, we discuss the methodology that has been used to examine the likelihood of abuse or addiction. Abuse liability assessment (ALA) methodology has been used by the Food and Drug Administration (FDA) and other drug regulatory agencies world-wide for decades to assess the risks posed by a wide variety of pharmacologically active substances. ALA is routinely required among other evaluations of safety during the pre-market assessment of new drugs, and is continually adapted to meet the challenges posed by new drug classes and drug formulations. In the 2009 law giving FDA regulation over tobacco products, FDA is now required to evaluate new tobacco products including MRTP/PREPs to determine their risk for abuse and toxicity at the population level. This article describes the traditional tools and methods of ALA that can be used to evaluate new tobacco and nicotine products including MRTP/PREPs. Such ALA data could contribute to the scientific foundation on which future public policy decisions are based.

Household Products

MedlinePlus

The products you use for cleaning, carpentry, auto repair, gardening, and many other household uses can contain ingredients that ... Arts and craft supplies Toxic substances in these products can cause harm if inhaled, swallowed, or absorbed ...

Product plots.

PubMed

Wickham, Hadley; Hofmann, Heike

2011-12-01

We propose a new framework for visualising tables of counts, proportions and probabilities. We call our framework product plots, alluding to the computation of area as a product of height and width, and the statistical concept of generating a joint distribution from the product of conditional and marginal distributions. The framework, with extensions, is sufficient to encompass over 20 visualisations previously described in fields of statistical graphics and infovis, including bar charts, mosaic plots, treemaps, equal area plots and fluctuation diagrams. © 2011 IEEE

Production of carboxylic acid and salt co-products

DOEpatents

Hanchar, Robert J.; Kleff, Susanne; Guettler, Michael V.

2014-09-09

This invention provide processes for producing carboxylic acid product, along with useful salts. The carboxylic acid product that is produced according to this invention is preferably a C.sub.2-C.sub.12 carboxylic acid. Among the salts produced in the process of the invention are ammonium salts.

Extended Producer Responsibility and Product Stewardship for Tobacco Product Waste

PubMed Central

Curtis, Clifton; Collins, Susan; Cunningham, Shea; Stigler, Paula; Novotny, Thomas E

2015-01-01

This paper reviews several environmental principles, including Extended Producer Responsibility (EPR), Product Stewardship (PS), the Polluter Pays Principle (PPP), and the Precautionary Principle, as they may apply to tobacco product waste (TPW). The review addresses specific criteria that apply in deciding whether a particular toxic product should adhere to these principles; presents three case studies of similar approaches to other toxic and/or environmentally harmful products; and describes 10 possible interventions or policy actions that may help prevent, reduce, and mitigate the effects of TPW. EPR promotes total lifecycle environmental improvements, placing economic, physical, and informational responsibilities onto the tobacco industry, while PS complements EPR, but with responsibility shared by all parties involved in the tobacco product lifecycle. Both principles focus on toxic source reduction, post-consumer take-back, and final disposal of consumer products. These principles when applied to TPW have the potential to substantially decrease the environmental and public health harms of cigarette butts and other TPW throughout the world. TPW is the most commonly littered item picked up during environmental, urban, and coastal cleanups globally. PMID:26457262

Sustainable aggregates production : green applications for aggregate by-products.

DOT National Transportation Integrated Search

2015-06-01

Increased emphasis in the construction industry on sustainability and recycling requires production of : aggregate gradations with lower dust (cleaner aggregates) and smaller maximum sizeshence, increased : amount of quarry by-products (QBs). QBs ...

Smart consumer products with a pathfinder product development strategy

NASA Astrophysics Data System (ADS)

Robertson, Alec

1994-09-01

It is generally acknowledged that technologies diffuse through industry and that the rate of diffusion varies both within different industries and according to the circumstances. Innovation is a process involving risk, especially during the adoption and adaptation of a powerful new technology. Central to a consumer products success using new technology is the quality of their designs and the nature of their forms. Form is of prime importance in influencing the purchasing decisions of consumers and it is also influential in determining the relationships between people in its use environment. The acceptance of a new product into the world is often unduly ad hoc. Many failures are created for each success and there are few guidelines to assist the formulation of a strategy for creating an appropriate form. It is suggested below that success of consumer products incorporating 'smart structures' may be determined not only by the function of products and systems, but also by the form they take. The definition of a desirable product form depends entirely on the point of view taken: technological, commercial, ecological, cultural, and social. However any design using new will incorporate the old and the new. The probability of acceptance of a new product is enhanced by maintaining a fine balance between imaginative and creative form and that with which people are familiar and prefer: a new design may be rejected if it is too novel and unfamiliar, or too traditional. The acceptance of a new product and its subsequent development depends on the success designers and engineers have when dealing with the initial forms, particularly using new technology such as 'smart structures'.

Drilling Productivity Report

EIA Publications

2017-01-01

Energy Information Administration’s (EIA) new Drilling Productivity Report (DPR) takes a fresh look at oil and natural gas production, starting with an assessment of how and where drilling for hydrocarbons is taking place. The DPR uses recent data on the total number of drilling rigs in operation along with estimates of drilling productivity and estimated changes in production from existing oil and natural gas wells to provide estimated changes in oil and natural gas production for six key fields. EIA's approach does not distinguish between oil-directed rigs and gas-directed rigs because once a well is completed it may produce both oil and gas; more than half of the wells produce both.

Optimal Product Placement.

PubMed

Hsu, Chia-Ling; Matta, Rafael; Popov, Sergey V; Sogo, Takeharu

2017-01-01

We model a market, such as an online software market, in which an intermediary connects sellers and buyers by displaying sellers' products. With two vertically-differentiated products, an intermediary can place either: (1) one product, not necessarily the better one, on the first page, and the other hidden on the second page; or (2) both products on the first page. We show that it can be optimal for the intermediary to obfuscate a product-possibly the better one-since this weakens price competition and allows the sellers to extract a greater surplus from buyers; however, it is not socially optimal. The choice of which one to obfuscate depends on the distribution of search costs.

Productive Curriculum Time.

ERIC Educational Resources Information Center

Walberg, Herbert J.; And Others

1994-01-01

Discusses productive use of time and its effects on academic success, reviewing research on how students spend their time, describing relationships between allocated, engaged, and productive time and exploring psychological perspectives related to time and curriculum. Curricular and instructional modifications to increase productive time and…

Root production method system

Treesearch

Wayne Lovelace

2002-01-01

The RPM system (Root Production Method) is a multistep production system of container tree production that places primary emphasis on the root system because the root system ultimately determines the tree's survival and performance in its outplanted environment. This particular container production system has been developed to facilitate volume production, in a...

Recent Trends in Water Use and Production for California Oil Production.

PubMed

Tiedeman, Kate; Yeh, Sonia; Scanlon, Bridget R; Teter, Jacob; Mishra, Gouri Shankar

2016-07-19

Recent droughts and concerns about water use for petroleum extraction renew the need to inventory water use for oil production. We quantified water volumes used and produced by conventional oil production and hydraulic fracturing (HF) in California. Despite a 25% decrease in conventional oil production from 1999 to 2012, total water use increased by 30% though much of that increase was derived from reuse of produced water. Produced water volumes increased by 50%, with increasing amounts disposed in unlined evaporation ponds or released to surface water. Overall freshwater use (constituting 1.2% of the state's nonagricultural water consumption) increased by 46% during this period due to increased freshwater-intensive tertiary oil production. HF has been practiced in California for more than 30 years, accounting for 1% of total oil production in 2012 from mostly directional and vertical wells. Water use intensity for HF wells in California averaged at 3.5 vol water/vol oil production in 2012 and 2.4 vol/vol in 2013, higher than the range from literature estimates and net water use intensity of conventional production (1.2 vol/vol in 2012). Increasing water use and disposal for oil production have important implications for water management and have potentially adverse health, environmental, and ecological impacts.

Methods of cracking a crude product to produce additional crude products

DOEpatents

Mo, Weijian [Sugar Land, TX; Roes, Augustinus Wilhelmus Maria [Houston, TX; Nair, Vijay [Katy, TX

2009-09-08

A method for producing a crude product is disclosed. Formation fluid is produced from a subsurface in situ heat treatment process. The formation fluid is separated to produce a liquid stream and a first gas stream. The first gas stream includes olefins. The liquid stream is fractionated to produce one or more crude products. At least one of the crude products has a boiling range distribution from 38.degree. C. and 343.degree. C. as determined by ASTM Method D5307. The crude product having the boiling range distribution from 38.degree. C. and 343.degree. C. is catalytically cracked to produce one or more additional crude products. At least one of the additional crude products is a second gas stream. The second gas stream has a boiling point of at most 38.degree. C. at 0.101 MPa.

Southern pulpwood production, 1986

Treesearch

Dennis M. May

1988-01-01

In 1986, Southern pulpwood production increased 6 percent, to 60.6 million cords; roundwood production increased 9 percent, to 40.4 million cords; and wood residue production increased 2 percent, to 20.1 million cords. Since 1977, roundwood production has been increasing while wood residue production has leveled off. Hardwoods have been capturing a larger proportion...

Enriching step-based product information models to support product life-cycle activities

NASA Astrophysics Data System (ADS)

Sarigecili, Mehmet Ilteris

The representation and management of product information in its life-cycle requires standardized data exchange protocols. Standard for Exchange of Product Model Data (STEP) is such a standard that has been used widely by the industries. Even though STEP-based product models are well defined and syntactically correct, populating product data according to these models is not easy because they are too big and disorganized. Data exchange specifications (DEXs) and templates provide re-organized information models required in data exchange of specific activities for various businesses. DEXs show us it would be possible to organize STEP-based product models in order to support different engineering activities at various stages of product life-cycle. In this study, STEP-based models are enriched and organized to support two engineering activities: materials information declaration and tolerance analysis. Due to new environmental regulations, the substance and materials information in products have to be screened closely by manufacturing industries. This requires a fast, unambiguous and complete product information exchange between the members of a supply chain. Tolerance analysis activity, on the other hand, is used to verify the functional requirements of an assembly considering the worst case (i.e., maximum and minimum) conditions for the part/assembly dimensions. Another issue with STEP-based product models is that the semantics of product data are represented implicitly. Hence, it is difficult to interpret the semantics of data for different product life-cycle phases for various application domains. OntoSTEP, developed at NIST, provides semantically enriched product models in OWL. In this thesis, we would like to present how to interpret the GD & T specifications in STEP for tolerance analysis by utilizing OntoSTEP.

Engineering microbial cell factories for the production of plant natural products: from design principles to industrial-scale production.

PubMed

Liu, Xiaonan; Ding, Wentao; Jiang, Huifeng

2017-07-19

Plant natural products (PNPs) are widely used as pharmaceuticals, nutraceuticals, seasonings, pigments, etc., with a huge commercial value on the global market. However, most of these PNPs are still being extracted from plants. A resource-conserving and environment-friendly synthesis route for PNPs that utilizes microbial cell factories has attracted increasing attention since the 1940s. However, at the present only a handful of PNPs are being produced by microbial cell factories at an industrial scale, and there are still many challenges in their large-scale application. One of the challenges is that most biosynthetic pathways of PNPs are still unknown, which largely limits the number of candidate PNPs for heterologous microbial production. Another challenge is that the metabolic fluxes toward the target products in microbial hosts are often hindered by poor precursor supply, low catalytic activity of enzymes and obstructed product transport. Consequently, despite intensive studies on the metabolic engineering of microbial hosts, the fermentation costs of most heterologously produced PNPs are still too high for industrial-scale production. In this paper, we review several aspects of PNP production in microbial cell factories, including important design principles and recent progress in pathway mining and metabolic engineering. In addition, implemented cases of industrial-scale production of PNPs in microbial cell factories are also highlighted.

Evidence supporting product standards for carcinogens in smokeless tobacco products

PubMed Central

Hatsukami, Dorothy K.; Stepanov, Irina; Severson, Herb; Jensen, Joni A.; Lindgren, Bruce R.; Horn, Kimberly; Khariwala, Samir S.; Martin, Julia; Carmella, Steven G.; Murphy, Sharon E.; Hecht, Stephen S.

2014-01-01

Smokeless tobacco (ST) products sold in the U.S. vary significantly in yields of nicotine and tobacco-specific nitrosamines (TSNA). With the passage of the Family Smoking Prevention and Tobacco Control Act, the Food and Drug Administration now has the authority to establish product standards. However, limited data exist determining the relative roles of pattern of ST use versus constituent levels in the ST product in exposure of users to carcinogens. In this study, ST users of brands varying in nicotine and TSNA content were recruited from three different regions in the U.S. Participants underwent two assessment sessions. During these sessions, demographic and ST use history information along with urine samples to assess biomarkers of exposure and effect were collected. During the time between data collection, ST users recorded the amount and duration of ST use on a daily basis using their diary cards. Results showed that independent of pattern of ST use and nicotine yields, levels of TSNA in ST products played a significant role in carcinogen exposure levels. Product standards for reducing levels of TSNA in ST products are necessary to decrease exposure to these toxicants and potentially to reduce risk for cancer. PMID:25524878

Improving laser system productivity through production line integration

NASA Astrophysics Data System (ADS)

Belforte, David A.

1994-09-01

Thousands of laser systems are employed profitably in a variety of industrial applications. These installations have proved successful for economic and technical reasons. And, in certain applications: ceramic scribing, resistor trimming, sheet metal cutting, and air foil drilling, for example, have become the industry standard. Most of these installations are free standing or, at best, part of an off-line manufacturing cell. Examples of laser systems fully integrated into a production line, where the laser process is synchronized with up and down stream manufacturing operation, are rare. The laser has been under utilized in its potential contribution to production line productivity. Current development in laser beam delivery: multiplexing, beam splitting and other distributed energy concepts make the laser an attractive option for just-in-time manufacturing operations. The reasons for this apparent neglect of the laser's full potential are reviewed in this paper, and suggestions for improvement of this situation are offered. Examples of fully integrated laser systems and their successful implementation are described and a forecast of changes in the way lasers contribute to improved productivity and profitability will be made.

MODIS Snow-Cover Products

NASA Technical Reports Server (NTRS)

Hall, Dorothy K.; Riggs, George A.; Salomonson, Vinvent V.; DiGirolamo, Nicolo; Bayr, Klaus J.; Houser, Paul (Technical Monitor)

2001-01-01

On December 18, 1999, the Terra satellite was launched with a complement of five instruments including the Moderate Resolution Imaging Spectroradiometer (MODIS). Many geophysical products are derived from MODIS data including global snow-cover products. These products have been available through the National Snow and Ice Data Center (NSIDC) Distributed Active Archive Center (DAAC) since September 13, 2000. MODIS snow-cover products represent potential improvement to the currently available operation products mainly because the MODIS products are global and 500-m resolution, and have the capability to separate most snow and clouds. Also the snow-mapping algorithms are automated which means that a consistent data set is generated for long-term climates studies that require snow-cover information. Extensive quality assurance (QA) information is stored with the product. The snow product suite starts with a 500-m resolution swath snow-cover map which is gridded to the Integerized Sinusoidal Grid to produce daily and eight-day composite tile products. The sequence then proceeds to a climate-modeling grid product at 5-km spatial resolution, with both daily and eight-day composite products. A case study from March 6, 2000, involving MODIS data and field and aircraft measurements, is presented. Near-term enhancements include daily snow albedo and fractional snow cover.

Nephrotoxicity of Natural Products.

PubMed

Nauffal, Mary; Gabardi, Steven

2016-01-01

The manufacture and sale of natural products constitute a multi-billion dollar industry. Nearly a third of the American population admit to using some form of complementary or alternative medicine, with many using them in addition to prescription medications. Most patients fail to inform their healthcare providers of their natural product use and physicians rarely inquire. Annually, thousands of natural product-induced adverse events are reported to Poison Control Centers nationwide. Natural product manufacturers are not responsible for proving safety and efficacy, as the FDA does not regulate them. However, concerns exist surrounding the safety of natural products. This review provides details on natural products that have been associated with renal dysfunction. We have focused on products that have been associated with direct renal injury, immune-mediated nephrotoxicity, nephrolithiasis, rhabdomyolysis with acute renal injury, hepatorenal syndrome, and common adulterants or contaminants that are associated with renal dysfunction. The potential for natural products to cause renal dysfunction is justifiable. It is imperative that natural product use be monitored closely in all patients. Healthcare practitioners must play an active role in identifying patients using natural products and provide appropriate patient education. © 2016 S. Karger AG, Basel.

Is past academic productivity predictive of radiology resident academic productivity?

PubMed

Patterson, Stephanie K; Fitzgerald, James T; Boyse, Tedric D; Cohan, Richard H

2002-02-01

The authors performed this study to determine whether academic productivity in college and medical school is predictive of the number of publications produced during radiology residency. The authors reviewed the records of 73 radiology residents who completed their residency from 1990 to 2000. Academic productivity during college, medical school, and radiology residency, other postgraduate degrees, and past careers other than radiology were tabulated. The personal essay attached to the residency application was reviewed for any stated academic interest. Residents were classified as being either previously productive or previously unproductive. Publication rates during residency and immediately after residency were compared for the two groups. For the productive residents, a correlation analysis was used to examine the relationship between past frequency of publication and type of previous activity. Least-squares regression analysis was used to investigate the relationship between preresidency academic productivity, advanced degrees, stated interest in academics, and other careers and radiology residency publications. There was no statistically significant difference in the number of articles published by those residents who were active and those who were not active before residency (P = .21). Only authorship of papers as an undergraduate was weakly predictive of residency publication. These selected measures of academic productivity as an undergraduate and during medical school are not helpful for predicting publication during residency. There was no difference in publication potential between those residents who were academically productive in the past and those who were not.

Economics of stocker production.

PubMed

Peel, Derrell S

2006-07-01

The beef cattle industry, like any industry, is subject to economic signals to increase or decrease production according to short-run and long-run market conditions. Profitable stocker production is the result of careful matching of economic conditions to alternative animal production systems combined with sound animal and business management. The economics of stocker production are driven by the feeder cattle price-weight relation that combines broad market signals about how much production is needed with complex and subtle signals about how that production should be accomplished. The result is a dynamic set of values of gain that direct producers to adjust the level, type, and timing of stocker production according to changing market conditions.

IT product competition Network

NASA Astrophysics Data System (ADS)

Xu, Xiu-Lian; Zhou, Lei; Shi, Jian-Jun; Wang, Yong-Li; Feng, Ai-Xia; He, Da-Ren

2008-03-01

Along with the technical development, the IT product competition becomes increasingly fierce in recent years. The factories, which produce the same IT product, have to improve continuously their own product quality for taking a large piece of cake in the product sale market. We suggest using a complex network description for the IT product competition. In the network the factories are defined as nodes, and two nodes are connected by a link if they produce a common IT product. The edge represents the sale competition relationship. 2121 factories and 265 products have been investigated. Some statistical properties, such as the degree distribution, node strength distribution, assortativity, and node degree correlation have been empirically obtained.

The production function

NASA Astrophysics Data System (ADS)

Fioretti, Guido

2007-02-01

The productions function maps the inputs of a firm or a productive system onto its outputs. This article expounds generalizations of the production function that include state variables, organizational structures and increasing returns to scale. These extensions are needed in order to explain the regularities of the empirical distributions of certain economic variables.

Agricultural Production.

ERIC Educational Resources Information Center

Lehigh County Area Vocational-Technical School, Schnecksville, PA.

This brochure describes the philosophy and scope of a secondary-level course in agricultural production. Addressed in the individual units of the course are the following topics: careers in agriculture and agribusiness, animal science and livestock production, agronomy, agricultural mechanics, supervised occupational experience programs, and the…

Alicyclobacillus Contamination in the Production Line of Kiwi Products in China

PubMed Central

Zhang, Jiangbo; Yue, Tianli; Yuan, Yahong

2013-01-01

Alicyclobacillus are spoilage microbes of many juice products, but contamination of kiwi products by Alicyclobacillus is seldom reported. This study aims to investigate the whole production line of kiwi products in China to assess the potential risk of their contamination. A total of 401 samples from 18 commercial products, 1 processing plant and 16 raw material orchards were tested, and 76 samples were positive, from which 76 strains of microbes were isolated and identified as 4 species of Alicyclobacillus, including Alicyclobacillus acidoterrestris, Alicyclobacillus contaminans, Alicyclobacillus herbarius and Alicyclobacillus cycloheptanicus, and another 9 strains as 3 species of Bacillus by sequencing of their 16S rDNA. Through phylogenetic tree construction and RAPD-PCR amplification, it was found that there exist genotypic diversities to some extent among these isolates. Four test strains (each from one species of the 4 Alicyclobacillus species isolated in this study) could spoil pH adjusted kiwi fruit juice and some commercial kiwi fruit products with producing guaiacol (11–34 ppb). PMID:23844069

Alicyclobacillus contamination in the production line of kiwi products in China.

PubMed

Zhang, Jiangbo; Yue, Tianli; Yuan, Yahong

2013-01-01

Alicyclobacillus are spoilage microbes of many juice products, but contamination of kiwi products by Alicyclobacillus is seldom reported. This study aims to investigate the whole production line of kiwi products in China to assess the potential risk of their contamination. A total of 401 samples from 18 commercial products, 1 processing plant and 16 raw material orchards were tested, and 76 samples were positive, from which 76 strains of microbes were isolated and identified as 4 species of Alicyclobacillus, including Alicyclobacillus acidoterrestris, Alicyclobacillus contaminans, Alicyclobacillus herbarius and Alicyclobacillus cycloheptanicus, and another 9 strains as 3 species of Bacillus by sequencing of their 16S rDNA. Through phylogenetic tree construction and RAPD-PCR amplification, it was found that there exist genotypic diversities to some extent among these isolates. Four test strains (each from one species of the 4 Alicyclobacillus species isolated in this study) could spoil pH adjusted kiwi fruit juice and some commercial kiwi fruit products with producing guaiacol (11-34 ppb).

Banana production systems: identification of alternative systems for more sustainable production.

PubMed

Bellamy, Angelina Sanderson

2013-04-01

Large-scale, monoculture production systems dependent on synthetic fertilizers and pesticides, increase yields, but are costly and have deleterious impacts on human health and the environment. This research investigates variations in banana production practices in Costa Rica, to identify alternative systems that combine high productivity and profitability, with reduced reliance on agrochemicals. Farm workers were observed during daily production activities; 39 banana producers and 8 extension workers/researchers were interviewed; and a review of field experiments conducted by the National Banana Corporation between 1997 and 2002 was made. Correspondence analysis showed that there is no structured variation in large-scale banana producers' practices, but two other banana production systems were identified: a small-scale organic system and a small-scale conventional coffee-banana intercropped system. Field-scale research may reveal ways that these practices can be scaled up to achieve a productive and profitable system producing high-quality export bananas with fewer or no pesticides.

Formulation of a Production Strategy for a Software Product Line

DTIC Science & Technology

2009-08-01

chooses to develop its products) as a series of scenarios • identifying the production factors critical to the success of the organization’s...line approach to achieve its business goals. AGM, a subsidiary of a multinational corporation, produces a series of software-intensive products deli...days from time of request. 2 The core assets mentioned in this example are available at http://www.sei.cmu.edu/productlines/ ppl . 19 | CMU/SEI

IRIS Product Recommendations

NASA Technical Reports Server (NTRS)

Short, David A.

2000-01-01

This report presents the Applied Meteorology Unit's (AMU) evaluation of SIGMET Inc.'s Integrated Radar Information System (IRIS) Product Generator and recommendations for products emphasizing lightning and microburst tools. The IRIS Product Generator processes radar reflectivity data from the Weather Surveillance Radar, model 74C (WSR-74C), located on Patrick Air Force Base. The IRIS System was upgraded from version 6.12 to version 7.05 in late December 1999. A statistical analysis of atmospheric temperature variability over the Cape Canaveral Air Force Station (CCAFS) Weather Station provided guidance for the configuration of radar products that provide information on the mixed-phase (liquid and ice) region of clouds, between 0 C and -20 C. Mixed-phase processes at these temperatures are physically linked to electrification and the genesis of severe weather within convectively generated clouds. Day-to-day variations in the atmospheric temperature profile are of sufficient magnitude to warrant periodic reconfiguration of radar products intended for the interpretation of lightning and microburst potential of convectively generated clouds. The AMU also examined the radar volume-scan strategy to determine the scales of vertical gaps within the altitude range of the 0 C to -20 C isotherms over the Kennedy Space Center (KSC)/CCAFS area. This report present's two objective strategies for designing volume scans and proposes a modified scan strategy that reduces the average vertical gap by 37% as a means for improving radar observations of cloud characteristics in the critical 0 C to -20 C layer. The AMU recommends a total of 18 products, including 11 products that require use of the IRIS programming language and the IRIS User Product Insert feature. Included is a cell trends product and display, modeled after the WSR-88D cell trends display in use by the National Weather Service.

Engineering Escherichia coli coculture systems for the production of biochemical products.

PubMed

Zhang, Haoran; Pereira, Brian; Li, Zhengjun; Stephanopoulos, Gregory

2015-07-07

Engineering microbial consortia to express complex biosynthetic pathways efficiently for the production of valuable compounds is a promising approach for metabolic engineering and synthetic biology. Here, we report the design, optimization, and scale-up of an Escherichia coli-E. coli coculture that successfully overcomes fundamental microbial production limitations, such as high-level intermediate secretion and low-efficiency sugar mixture utilization. For the production of the important chemical cis,cis-muconic acid, we show that the coculture approach achieves a production yield of 0.35 g/g from a glucose/xylose mixture, which is significantly higher than reported in previous reports. By efficiently producing another compound, 4-hydroxybenzoic acid, we also demonstrate that the approach is generally applicable for biosynthesis of other important industrial products.

The Variation of Work Productivity and Muscle Activities at Different Levels of Production Target

NASA Astrophysics Data System (ADS)

Nur, Nurhayati Mohd; Dawal, Siti Zawiah Md; Dahari, Mahidzal; Zuhairah Mahmud Zuhudi, Nurul

2017-10-01

This paper aims to investigate the variation of work productivity and muscle activities among workers performing industrial repetitive tasks at four different levels of production target. The work productivity and muscle activities data were recorded from twenty workers at four levels of production target corresponding to “participative (PS1)”, “normal (PS2)”, “high (PS3)” and “very high (PS4)”. The results showed that worker productivity was found to increase at higher production target and there was a significant change (p < 0.005) in work productivity across the four different production targets. The muscle activities were found to increase at higher production target and correspond to more discomfort and a higher rate of muscle fatigue. The results indicated that working with a higher production target results in higher worker productivity, but could lead to higher risk of WMSDs.

Measuring Net Investment and Productivity in Timber Production

Treesearch

David N. Wear

1994-01-01

An index number approach is developed for measuring changes in inputs, outputs, and total factor productivity in a timber-producing sector. These methods are applied to timber production in the U.S. South for the period 1952 to 1985. Results suggest that development of the sector may be described by an adjustment phase between 1952 and 1962 and a growth phase between...

Evidence supporting product standards for carcinogens in smokeless tobacco products.

PubMed

Hatsukami, Dorothy K; Stepanov, Irina; Severson, Herb; Jensen, Joni A; Lindgren, Bruce R; Horn, Kimberly; Khariwala, Samir S; Martin, Julia; Carmella, Steven G; Murphy, Sharon E; Hecht, Stephen S

2015-01-01

Smokeless tobacco products sold in the United States vary significantly in yields of nicotine and tobacco-specific nitrosamines (TSNA). With the passage of the Family Smoking Prevention and Tobacco Control Act, the Food and Drug Administration now has the authority to establish product standards. However, limited data exist determining the relative roles of pattern of smokeless tobacco use versus constituent levels in the smokeless tobacco product in exposure of users to carcinogens. In this study, smokeless tobacco users of brands varying in nicotine and TSNA content were recruited from three different regions in the U.S. Participants underwent two assessment sessions. During these sessions, demographic and smokeless tobacco use history information along with urine samples to assess biomarkers of exposure and effect were collected. During the time between data collection, smokeless tobacco users recorded the amount and duration of smokeless tobacco use on a daily basis using their diary cards. Results showed that independent of pattern of smokeless tobacco use and nicotine yields, levels of TSNA in smokeless tobacco products played a significant role in carcinogen exposure levels. Product standards for reducing levels of TSNA in smokeless tobacco products are necessary to decrease exposure to these toxicants and potentially to reduce risk for cancer. ©2014 American Association for Cancer Research.

NCEP Data Products

Science.gov Websites

Image of NCEP Logo WHERE AMERICA'S CLIMATE AND WEATHER SERVICES BEGIN Inventory of Data Products on Generated Products Image of horizontal rule Global Forecast System (GFS) GFS Ensemble Forecast System (GEFS of horizontal rule External Products Image of horizontal rule Canadian Ensemble Forecast System

Measuring Clinical Productivity.

PubMed

Hudson, Mark E; Lebovitz, Evan E

2018-06-01

Productivity measurements have been used to evaluate and compare physicians and physician practices. Anesthesiology is unique in that factors outside anesthesiologist control impact opportunity for revenue generation and make comparisons between providers and facilities challenging. This article uses data from the multicenter University of Pittsburgh Physicians Department of Anesthesiology to demonstrate factors influencing productivity opportunity by surgical facility, between department divisions and subspecialties within multispecialty divisions, and by individuals within divisions. The complexities of benchmarking anesthesiology productivity are demonstrated, and the potential value of creating a productivity profile for facilities and groups is illustrated. Copyright © 2018 Elsevier Inc. All rights reserved.

Antioxidant properties of mushroom mycelia obtained by batch cultivation and tocopherol content affected by extraction procedures.

PubMed

Vamanu, Emanuel

2014-01-01

The determination of the antioxidant potential of lyophilized mushroom mycelia from 5 strains of the species Pleurotus ostreatus and Coprinus comatus (obtained by submerged cultivation in batch system) was analyzed as ethanolic extracts by evaluating ABTS and the hydroxyl scavenging activity, FRAP method, the chelating capacity, the inhibition of human erythrocyte hemolysis, and the inhibition of xanthine oxidase activity. The main compounds present in all extracts were determined by HPLC chromatography. Overall, results demonstrated that the biologically active substances content is modulated by the extraction method used. The most beneficial extract, characterized by determining the EC50 value, was that of C. comatus M8102, followed by P. ostreatus PQMZ91109. Significant amount of α-tocopherol (179.51 ± 1.51 mg/100 g extract) was determined as well as flavones such as rutin and apigenin. In the P. ostreatus PQMZ91109 extract, 4.8 ± 0.05 mg/100 g extract of tocopherol acetate known to play a significant role as an antioxidant in skin protection against oxidative stress generated by UV rays was determined. The various correlations (r (2) = 0.7665-0.9426 for tocopherol content) assessed and the composition of extracts in fluidized bed from the mycelia of the tested species depicted a significant pharmacological potential as well as the possibility of usage in the development of new functional products.