Science.gov

Sample records for polymerase iii detects

  1. Recruitment of RNA polymerase III in vivo.

    PubMed

    Kenneth, Niall S; Marshall, Lynne; White, Robert J

    2008-06-01

    RNA polymerase (pol) III contains a dissociable subcomplex that is required for initiation, but not for elongation or termination of transcription. This subcomplex is composed of subunits RPC3, RPC6 and RPC7, and interacts with TFIIIB, a factor that is necessary and sufficient to support accurate pol III transcription in vitro. Direct binding of TFIIIB to RPC6 is believed to recruit pol III to its genetic templates. However, this has never been tested in vivo. Here we combine chromatin immunoprecipitation with RNA interference to demonstrate that the RPC3/6/7 subcomplex is required for pol III recruitment in mammalian cells. Specific knockdown of RPC6 by RNAi results in post-transcriptional depletion of the other components of the subcomplex, RPC3 and RPC7, without destabilizing core pol III subunits or TFIIIB. The resultant core enzyme is defective in associating with TFIIIB and target genes in vivo. Promoter occupancy by pol II is unaffected, despite sharing five subunits with the pol III core. These observations provide evidence for the validity in vivo of the model for pol III recruitment that was built on biochemical data.

  2. RNA polymerase II mediated transcription from the polymerase III promoters in short hairpin RNA expression vector

    SciTech Connect

    Rumi, Mohammad; Ishihara, Shunji . E-mail: si360405@med.shimane-u.ac.jp; Aziz, Monowar; Kazumori, Hideaki; Ishimura, Norihisa; Yuki, Takafumi; Kadota, Chikara; Kadowaki, Yasunori; Kinoshita, Yoshikazu

    2006-01-13

    RNA polymerase III promoters of human ribonuclease P RNA component H1, human U6, and mouse U6 small nuclear RNA genes are commonly used in short hairpin RNA (shRNA) expression vectors due their precise initiation and termination sites. During transient transfection of shRNA vectors, we observed that H1 or U6 promoters also express longer transcripts enough to express several reporter genes including firefly luciferase, green fluorescent protein EGFP, and red fluorescent protein JRed. Expression of such longer transcripts was augmented by upstream RNA polymerase II enhancers and completely inhibited by downstream polyA signal sequences. Moreover, the transcription of firefly luciferase from human H1 promoter was sensitive to RNA polymerase II inhibitor {alpha}-amanitin. Our findings suggest that commonly used polymerase III promoters in shRNA vectors are also prone to RNA polymerase II mediated transcription, which may have negative impacts on their targeted use.

  3. The DNA polymerase III holoenzyme contains γ and is not a trimeric polymerase

    PubMed Central

    Dohrmann, Paul R.; Correa, Raul; Frisch, Ryan L.; Rosenberg, Susan M.; McHenry, Charles S.

    2016-01-01

    There is widespread agreement that the clamp loader of the Escherichia coli replicase has the composition DnaX3δδ’χψ. Two DnaX proteins exist in E. coli, full length τ and a truncated γ that is created by ribosomal frameshifting. τ binds DNA polymerase III tightly; γ does not. There is a controversy as to whether or not DNA polymerase III holoenzyme (Pol III HE) contains γ. A three-τ form of Pol III HE would contain three Pol IIIs. Proponents of the three-τ hypothesis have claimed that γ found in Pol III HE might be a proteolysis product of τ. To resolve this controversy, we constructed a strain that expressed only τ from a mutated chromosomal dnaX. γ containing a C-terminal biotinylation tag (γ-Ctag) was provided in trans at physiological levels from a plasmid. A 2000-fold purification of Pol III* (all Pol III HE subunits except β) from this strain contained one molecule of γ-Ctag per Pol III* assembly, indicating that the dominant form of Pol III* in cells is Pol III2τ2 γδδ’χψ. Revealing a role for γ in cells, mutants that express only τ display sensitivity to ultraviolet light and reduction in DNA Pol IV-dependent mutagenesis associated with double-strand-break repair, and impaired maintenance of an F’ episome. PMID:26786318

  4. Molecular structures of unbound and transcribing RNA polymerase III

    PubMed Central

    Hoffmann, Niklas A.; Jakobi, Arjen J.; Moreno-Morcillo, Maria; Glatt, Sebastian; Kosinski, Jan; Hagen, Wim J. H.; Sachse, Carsten; Müller, Christoph W.

    2015-01-01

    Transcription of genes encoding small structured RNAs such as tRNAs, spliceosomal U6 snRNA and ribosomal 5S RNA is carried out by RNA polymerase III (Pol III), the largest yet structurally least characterized eukaryotic RNA polymerase. The cryo-EM structures of the S. cerevisiae Pol III elongating complex at 3.9 Å resolution and the apo Pol III enzyme in two different conformations at 4.6 and 4.7 Å resolution, respectively, allow for the first time to build a 17-subunit atomic model of Pol III. The reconstructions reveal the precise orientation of the C82/C34/C31 heterotrimer in close proximity to the stalk. The C53/C37 heterodimer positions residues involved in transcription termination close to the non-template DNA strand. In the apo Pol III structures, the stalk adopts different orientations coupled with closed and open conformations of the clamp. Our results provide novel insights into Pol III-specific transcription and the adaptation of Pol III towards its small transcriptional targets. PMID:26605533

  5. Transcription termination by the eukaryotic RNA polymerase III

    PubMed Central

    Arimbasseri, Aneeshkumar G.; Rijal, Keshab; Maraia, Richard J.

    2012-01-01

    RNA polymerase (pol) III transcribes a multitude of tRNA and 5S rRNA genes as well as other small RNA genes distributed through the genome. By being sequence-specific, precise and efficient, transcription termination by pol III not only defines the 3′ end of the nascent RNA which directs subsequent association with the stabilizing La protein, it also prevents transcription into downstream DNA and promotes efficient recycling. Each of the RNA polymerases appears to have evolved unique mechanisms to initiate the process of termination in response to different types of termination signals. However, in eukaryotes much less is known about the final stage of termination, destabilization of the elongation complex with release of the RNA and DNA from the polymerase active center. By comparison to pols I & II, pol III exhibits the most direct coupling of the initial and final stages of termination, both of which occur at a short oligo(dT) tract on the non-template strand (dA on the template) of the DNA. While pol III termination is autonomous involving the core subunits C2 and probably C1, it also involves subunits C11, C37 and C53, which act on the pol III catalytic center and exhibit homology to the pol II elongation factor TFIIS, and TFIIFα/β respectively. Here we compile knowledge of pol III termination and associate mutations that affect this process with structural elements of the polymerase that illustrate the importance of C53/37 both at its docking site on the pol III lobe and in the active center. The models suggest that some of these features may apply to the other eukaryotic pols. PMID:23099421

  6. Comparative overview of RNA polymerase II and III transcription cycles, with focus on RNA polymerase III termination and reinitiation.

    PubMed

    Arimbasseri, Aneeshkumar G; Rijal, Keshab; Maraia, Richard J

    2014-01-01

    In eukaryotes, RNA polymerase (RNAP) III transcribes hundreds of genes for tRNAs and 5S rRNA, among others, which share similar promoters and stable transcription initiation complexes (TIC), which support rapid RNAP III recycling. In contrast, RNAP II transcribes a large number of genes with highly variable promoters and interacting factors, which exert fine regulatory control over TIC lability and modifications of RNAP II at different transitional points in the transcription cycle. We review data that illustrate a relatively smooth continuity of RNAP III initiation-elongation-termination and reinitiation toward its function to produce high levels of tRNAs and other RNAs that support growth and development.

  7. Defining the RNA polymerase III transcriptome: Genome-wide localization of the RNA polymerase III transcription machinery in human cells

    PubMed Central

    Canella, Donatella; Praz, Viviane; Reina, Jaime H.; Cousin, Pascal; Hernandez, Nouria

    2010-01-01

    Our view of the RNA polymerase III (Pol III) transcription machinery in mammalian cells arises mostly from studies of the RN5S (5S) gene, the Ad2 VAI gene, and the RNU6 (U6) gene, as paradigms for genes with type 1, 2, and 3 promoters. Recruitment of Pol III onto these genes requires prior binding of well-characterized transcription factors. Technical limitations in dealing with repeated genomic units, typically found at mammalian Pol III genes, have so far hampered genome-wide studies of the Pol III transcription machinery and transcriptome. We have localized, genome-wide, Pol III and some of its transcription factors. Our results reveal broad usage of the known Pol III transcription machinery and define a minimal Pol III transcriptome in dividing IMR90hTert fibroblasts. This transcriptome consists of some 500 actively transcribed genes including a few dozen candidate novel genes, of which we confirmed nine as Pol III transcription units by additional methods. It does not contain any of the microRNA genes previously described as transcribed by Pol III, but reveals two other microRNA genes, MIR886 (hsa-mir-886) and MIR1975 (RNY5, hY5, hsa-mir-1975), which are genuine Pol III transcription units. PMID:20413673

  8. Retrotransposon profiling of RNA polymerase III initiation sites.

    PubMed

    Qi, Xiaojie; Daily, Kenneth; Nguyen, Kim; Wang, Haoyi; Mayhew, David; Rigor, Paul; Forouzan, Sholeh; Johnston, Mark; Mitra, Robi David; Baldi, Pierre; Sandmeyer, Suzanne

    2012-04-01

    Although retroviruses are relatively promiscuous in choice of integration sites, retrotransposons can display marked integration specificity. In yeast and slime mold, some retrotransposons are associated with tRNA genes (tDNAs). In the Saccharomyces cerevisiae genome, the long terminal repeat retrotransposon Ty3 is found at RNA polymerase III (Pol III) transcription start sites of tDNAs. Ty1, 2, and 4 elements also cluster in the upstream regions of these genes. To determine the extent to which other Pol III-transcribed genes serve as genomic targets for Ty3, a set of 10,000 Ty3 genomic retrotranspositions were mapped using high-throughput DNA sequencing. Integrations occurred at all known tDNAs, two tDNA relics (iYGR033c and ZOD1), and six non-tDNA, Pol III-transcribed types of genes (RDN5, SNR6, SNR52, RPR1, RNA170, and SCR1). Previous work in vitro demonstrated that the Pol III transcription factor (TF) IIIB is important for Ty3 targeting. However, seven loci that bind the TFIIIB loader, TFIIIC, were not targeted, underscoring the unexplained absence of TFIIIB at those sites. Ty3 integrations also occurred in two open reading frames not previously associated with Pol III transcription, suggesting the existence of a small number of additional sites in the yeast genome that interact with Pol III transcription complexes. PMID:22287102

  9. Genetics of eukaryotic RNA polymerases I, II, and III.

    PubMed Central

    Archambault, J; Friesen, J D

    1993-01-01

    The transcription of nucleus-encoded genes in eukaryotes is performed by three distinct RNA polymerases termed I, II, and III, each of which is a complex enzyme composed of more than 10 subunits. The isolation of genes encoding subunits of eukaryotic RNA polymerases from a wide spectrum of organisms has confirmed previous biochemical and immunological data indicating that all three enzymes are closely related in structures that have been conserved in evolution. Each RNA polymerase is an enzyme complex composed of two large subunits that are homologous to the two largest subunits of prokaryotic RNA polymerases and are associated with smaller polypeptides, some of which are common to two or to all three eukaryotic enzymes. This remarkable conservation of structure most probably underlies a conservation of function and emphasizes the likelihood that information gained from the study of RNA polymerases from one organism will be applicable to others. The recent isolation of many mutations affecting the structure and/or function of eukaryotic and prokaryotic RNA polymerases now makes it feasible to begin integrating genetic and biochemical information from various species in order to develop a picture of these enzymes. The picture of eukaryotic RNA polymerases depicted in this article emphasizes the role(s) of different polypeptide regions in interaction with other subunits, cofactors, substrates, inhibitors, or accessory transcription factors, as well as the requirement for these interactions in transcription initiation, elongation, pausing, termination, and/or enzyme assembly. Most mutations described here have been isolated in eukaryotic organisms that have well-developed experimental genetic systems as well as amenable biochemistry, such as Saccharomyces cerevisiae, Drosophila melanogaster, and Caenorhabditis elegans. When relevant, mutations affecting regions of Escherichia coli RNA polymerase that are conserved among eukaryotes and prokaryotes are also presented

  10. Retrotransposon profiling of RNA polymerase III initiation sites

    PubMed Central

    Qi, Xiaojie; Daily, Kenneth; Nguyen, Kim; Wang, Haoyi; Mayhew, David; Rigor, Paul; Forouzan, Sholeh; Johnston, Mark; Mitra, Robi David; Baldi, Pierre; Sandmeyer, Suzanne

    2012-01-01

    Although retroviruses are relatively promiscuous in choice of integration sites, retrotransposons can display marked integration specificity. In yeast and slime mold, some retrotransposons are associated with tRNA genes (tDNAs). In the Saccharomyces cerevisiae genome, the long terminal repeat retrotransposon Ty3 is found at RNA polymerase III (Pol III) transcription start sites of tDNAs. Ty1, 2, and 4 elements also cluster in the upstream regions of these genes. To determine the extent to which other Pol III–transcribed genes serve as genomic targets for Ty3, a set of 10,000 Ty3 genomic retrotranspositions were mapped using high-throughput DNA sequencing. Integrations occurred at all known tDNAs, two tDNA relics (iYGR033c and ZOD1), and six non-tDNA, Pol III–transcribed types of genes (RDN5, SNR6, SNR52, RPR1, RNA170, and SCR1). Previous work in vitro demonstrated that the Pol III transcription factor (TF) IIIB is important for Ty3 targeting. However, seven loci that bind the TFIIIB loader, TFIIIC, were not targeted, underscoring the unexplained absence of TFIIIB at those sites. Ty3 integrations also occurred in two open reading frames not previously associated with Pol III transcription, suggesting the existence of a small number of additional sites in the yeast genome that interact with Pol III transcription complexes. PMID:22287102

  11. A Unique Presentation of Anti-RNA Polymerase III Positive Systemic Sclerosis Sine Scleroderma.

    PubMed

    Lee, Cody M; Girnita, Diana; Sharma, Arundhati; Khanna, Surabhi; Elwing, Jean M

    2016-01-01

    Systemic sclerosis is a rare autoimmune disorder with a wide spectrum of clinical manifestations and a multitude of autoantibodies that are associated with it. In the past several years, advances in serologic testing have led to research indicating important prognostic and phenotypic associations with certain subsets of autoantibodies. In particular, anti-RNA polymerase III (anti-RNAP III) has been associated with diffuse cutaneous disease, scleroderma renal crisis, a temporal relationship with malignancy, myositis, synovitis, joint contractures, and gastric antral vascular ectasia. However, anti-RNAP III has not been associated with systemic sclerosis sine scleroderma. We describe a patient with an atypical presentation of anti-RNAP III positive systemic sclerosis sine scleroderma who presented without the typical features of anti-RNAP III disease. Instead, she presented with critical digital ischemia, pulmonary arterial hypertension, gastroesophageal reflux disease, interstitial lung disease, and no clinically detectable sclerodactyly. PMID:27559487

  12. A Unique Presentation of Anti-RNA Polymerase III Positive Systemic Sclerosis Sine Scleroderma

    PubMed Central

    2016-01-01

    Systemic sclerosis is a rare autoimmune disorder with a wide spectrum of clinical manifestations and a multitude of autoantibodies that are associated with it. In the past several years, advances in serologic testing have led to research indicating important prognostic and phenotypic associations with certain subsets of autoantibodies. In particular, anti-RNA polymerase III (anti-RNAP III) has been associated with diffuse cutaneous disease, scleroderma renal crisis, a temporal relationship with malignancy, myositis, synovitis, joint contractures, and gastric antral vascular ectasia. However, anti-RNAP III has not been associated with systemic sclerosis sine scleroderma. We describe a patient with an atypical presentation of anti-RNAP III positive systemic sclerosis sine scleroderma who presented without the typical features of anti-RNAP III disease. Instead, she presented with critical digital ischemia, pulmonary arterial hypertension, gastroesophageal reflux disease, interstitial lung disease, and no clinically detectable sclerodactyly. PMID:27559487

  13. TRRAP and GCN5 are used by c-Myc to activate RNA polymerase III transcription.

    PubMed

    Kenneth, Niall S; Ramsbottom, Ben A; Gomez-Roman, Natividad; Marshall, Lynne; Cole, Philip A; White, Robert J

    2007-09-18

    Activation of RNA polymerase (pol) II transcription by c-Myc generally involves recruitment of histone acetyltransferases and acetylation of histones H3 and H4. Here, we describe the mechanism used by c-Myc to activate pol III transcription of tRNA and 5S rRNA genes. Within 2 h of its induction, c-Myc appears at these genes along with the histone acetyltransferase GCN5 and the cofactor TRRAP. At the same time, occupancy of the pol III-specific factor TFIIIB increases and histone H3 becomes hyperacetylated, but increased histone H4 acetylation is not detected at these genes. The rapid acetylation of histone H3 and promoter assembly of TFIIIB, c-Myc, GCN5, and TRRAP are followed by recruitment of pol III and transcriptional induction. The selective acetylation of histone H3 distinguishes pol III activation by c-Myc from mechanisms observed in other systems.

  14. Unusual properties of adenovirus E2E transcription by RNA polymerase III.

    PubMed

    Huang, Wenlin; Flint, S J

    2003-04-01

    In adenovirus type 5-infected cells, RNA polymerase III transcription of a gene superimposed on the 5' end of the E2E RNA polymerase II transcription unit produces two small (<100-nucleotide) RNAs that accumulate to low steady-state concentrations (W. Huang, R. Pruzan, and S. J. Flint, Proc. Natl. Acad. Sci. USA 91:1265-1269, 1984). To gain a better understanding of the function of this RNA polymerase III transcription, we have examined the properties of the small E2E RNAs and E2E RNA polymerase III transcription in more detail. The accumulation of cytoplasmic E2E RNAs and the rates of E2E transcription by the two RNA polymerases during the infectious cycle were analyzed by using RNase T(1) protection and run-on transcription assays, respectively. Although the RNA polymerase III transcripts were present at significantly lower concentrations than E2E mRNA throughout the period examined, E2E transcription by RNA polymerase III was found to be at least as efficient as that by RNA polymerase II. The short half-lifes of the small E2E RNAs estimated by using the actinomycin D chase method appear to account for their limited accumulation. The transcription of E2E sequences by RNA polymerase II and III in cells infected by recombinant adenoviruses carrying ectopic E2E-CAT (chloramphenicol transferase) reporter genes with mutations in E2E promoter sequences was also examined. The results of these experiments indicate that recognition of the E2E promoter by the RNA polymerase II transcriptional machinery in infected cells limits transcription by RNA polymerase III, and vice versa. Such transcriptional competition and the properties of E2E RNAs made by RNA polymerase III suggest that the function of this viral RNA polymerase III transcription unit is unusual. PMID:12634361

  15. Regulation of Human RNA Polymerase III Transcription by DNMT1 and DNMT3a DNA Methyltransferases*

    PubMed Central

    Selvakumar, Tharakeswari; Gjidoda, Alison; Hovde, Stacy L.; Henry, R. William

    2012-01-01

    The human small nuclear RNA (snRNA) and small cytoplasmic RNA (scRNA) gene families encode diverse non-coding RNAs that influence cellular growth and division. Many snRNA and scRNA genes are related via their compact and yet powerful promoters that support RNA polymerase III transcription. We have utilized the human U6 snRNA gene family to examine the mechanism for regulated transcription of these potent transcription units. Analysis of nine U6 family members showed enriched CpG density within the promoters of actively transcribed loci relative to inert genes, implying a relationship between gene potency and DNA methylation. Indeed, both pharmacological inhibition of DNA methyltransferase (DNMT) activity and the forced diminution of DNMT-1, DNMT-3a, and DNMT-3b by siRNA targeting resulted in increased U6 levels in asynchronously growing MCF7 adenocarcinoma cells. In vitro transcription assays further showed that template methylation impedes U6 transcription by RNA polymerase III. Both DNMT-1 and DNMT-3a were detected at the U6-1 locus by chromatin immunoprecipitation directly linking these factors to RNA polymerase III regulation. Despite this association, the endogenous U6-1 locus was not substantially methylated in actively growing cells. However, both DNMT occupancy and low frequency methylation were correlated with increased Retinoblastoma tumor suppressor (RB) expression, suggesting that the RB status can influence specific epigenetic marks. PMID:22219193

  16. Centromeric polymerase III transcription units in Chironomus pallidivittatus.

    PubMed Central

    Rovira, C; Edström, J E

    1996-01-01

    Cp1 is a polymorphic short interspersed repeat (SINE) which is distributed over the whole genome of the dipteran Chironomus pallidivittatus, and is particularly abundant in the centromeres. It contains two different sequence modules, one of which, the B module, has a polymerase III internal control region (ICR) typical for tRNA genes (A and B box). Such sequence motifs are common in SINEs and assumed to function in RNA-mediated transposition. In the present case, however, several structural features speak for another role. An investigation of the transcription of the B module shows that it encodes a 99 nt RNA species in vivo, Cp1-RNA, terminating within the module. The transcription unit is likely to have evolved from a pre-tRNA gene and the transcript has sequence similarities to non-processed pre-tRNA. Most of the in vitro transcription is eliminated by deletion or substitution mutation of an upstream TATA box, present within the B module, as well as by changing either the A or B box. The properties of the transcript suggest that it does not have a role in transposition but may have some other function, perhaps in the centromere. PMID:8649983

  17. Protein Affinity Chromatography with Purified Yeast DNA Polymerase α Detects Proteins that Bind to DNA Polymerase

    NASA Astrophysics Data System (ADS)

    Miles, Jeff; Formosa, Tim

    1992-02-01

    We have overexpressed the POL1 gene of the yeast Saccharomyces cerevisiae and purified the resulting DNA polymerase α polypeptide in an apparently intact form. We attached the purified DNA polymerase covalently to an agarose matrix and used this matrix to chromatograph extracts prepared from yeast cells. At least six proteins bound to the yeast DNA polymerase α matrix that did not bind to a control matrix. We speculate that these proteins might be DNA polymerase α accessory proteins. Consistent with this interpretation, one of the binding proteins, which we have named POB1 (polymerase one binding), is required for normal chromosome transmission. Mutations in this gene cause increased chromosome loss and an abnormal cell morphology, phenotypes that also occur in the presence of mutations in the yeast α or δ polymerase genes. These results suggest that the interactions detected by polymerase affinity chromatography are biologically relevant and may help to illuminate the architecture of the eukaryotic DNA replication machinery.

  18. RNA polymerase III in Cajal bodies and lampbrush chromosomes of the Xenopus oocyte nucleus.

    PubMed

    Murphy, Christine; Wang, Zhengxin; Roeder, Robert G; Gall, Joseph G

    2002-10-01

    We used immunofluorescence to study the distribution and targeting of RNA polymerase (pol) III subunits and pol III transcription factors in the Xenopus laevis oocyte nucleus. Antibodies against several of these proteins stained Cajal bodies and approximately 90 specific sites on the lampbrush chromosomes. Some of the chromosomal sites had been identified previously by in situ hybridization as the genes for 5S rRNA. The remaining sites presumably encode tRNAs and other pol III transcripts. Pol III sites were often resolvable as loops similar to the much more abundant pol II loops, but without a matrix detectable by phase contrast or differential interference contrast. This morphology is consistent with the transcription of short repeated sequences. Hemagglutinin-tagged transcripts encoding core subunits and transcription factors were injected into the oocyte cytoplasm, and the distribution of newly translated proteins inside the nucleus was monitored by immunostaining. Cajal bodies were preferentially targeted by these proteins, and in some cases the chromosomal sites were also weakly stained. The existence of pol III subunits and pol III transcription factors in Cajal bodies and their targeting to these organelles are consistent with a model of Cajal bodies as sites for preassembly of the nuclear transcription machinery. PMID:12388750

  19. Contributions of in vitro transcription to the understanding of human RNA polymerase III transcription.

    PubMed

    Dumay-Odelot, Hélène; Durrieu-Gaillard, Stéphanie; El Ayoubi, Leyla; Parrot, Camila; Teichmann, Martin

    2014-01-01

    Human RNA polymerase III transcribes small untranslated RNAs that contribute to the regulation of essential cellular processes, including transcription, RNA processing and translation. Analysis of this transcription system by in vitro transcription techniques has largely contributed to the discovery of its transcription factors and to the understanding of the regulation of human RNA polymerase III transcription. Here we review some of the key steps that led to the identification of transcription factors and to the definition of minimal promoter sequences for human RNA polymerase III transcription. PMID:24406346

  20. Contributions of in vitro transcription to the understanding of human RNA polymerase III transcription

    PubMed Central

    Dumay-Odelot, Hélène; Durrieu-Gaillard, Stéphanie; El Ayoubi, Leyla; Parrot, Camila; Teichmann, Martin

    2014-01-01

    Human RNA polymerase III transcribes small untranslated RNAs that contribute to the regulation of essential cellular processes, including transcription, RNA processing and translation. Analysis of this transcription system by in vitro transcription techniques has largely contributed to the discovery of its transcription factors and to the understanding of the regulation of human RNA polymerase III transcription. Here we review some of the key steps that led to the identification of transcription factors and to the definition of minimal promoter sequences for human RNA polymerase III transcription. PMID:25764111

  1. Contributions of in vitro transcription to the understanding of human RNA polymerase III transcription.

    PubMed

    Dumay-Odelot, Hélène; Durrieu-Gaillard, Stéphanie; El Ayoubi, Leyla; Parrot, Camila; Teichmann, Martin

    2014-01-01

    Human RNA polymerase III transcribes small untranslated RNAs that contribute to the regulation of essential cellular processes, including transcription, RNA processing and translation. Analysis of this transcription system by in vitro transcription techniques has largely contributed to the discovery of its transcription factors and to the understanding of the regulation of human RNA polymerase III transcription. Here we review some of the key steps that led to the identification of transcription factors and to the definition of minimal promoter sequences for human RNA polymerase III transcription. PMID:25764111

  2. Contributions of in vitro transcription to the understanding of human RNA polymerase III transcription.

    PubMed

    Dumay-Odelot, Hélène; Durrieu-Gaillard, Stéphanie; El Ayoubi, Leyla; Parrot, Camila; Teichmann, Martin

    2014-01-01

    Human RNA polymerase III transcribes small untranslated RNAs that contribute to the regulation of essential cellular processes, including transcription, RNA processing and translation. Analysis of this transcription system by in vitro transcription techniques has largely contributed to the discovery of its transcription factors and to the understanding of the regulation of human RNA polymerase III transcription. Here we review some of the key steps that led to the identification of transcription factors and to the definition of minimal promoter sequences for human RNA polymerase III transcription.

  3. Molecular structure of yeast RNA polymerase III: demonstration of the tripartite transcriptive system in lower eukaryotes.

    PubMed Central

    Valenzuela, P; Hager, G L; Weinberg, F; Rutter, W J

    1976-01-01

    Homogeneous RNA polymerase III (RNA nucleotidyltransferase III) has been obtained from yeast. The subunit composition of the enzyme was examined by polyacrylamide gel electrophoresis in the presence of sodium dodecyl sulfate. The enzyme is composed of 12 putative subunits with molecular weights 160,000, 128,000, 82,000, 41,000, 40,500, 37,000, 34,000, 28,000, 24,000, 20,000, 14,500, and 11,000. The high-molecular-weight subunits and several of the smaller subunits of yeast RNA polymerase III are clearly different from those of enzymes I and II, indicating a distinct molecular structure. However, the molecular weights of some of the small subunits (41,000, 28,000, 24,000, and 14,500) appear to be identical to those of polymerases I and II. Thus, it is possible that the three classes of enzymes in yeast have some common subunits. As in other eukaryotes, yeast polymerase II is inhibited by relatively low concentrations of alpha-amanitin; however, contrary to what has been found in higher eukaryotes, yeast polymerase III is resistant (up to 2 mg/ml) to alpha-amanitin, while yeast polymerase I is sensitive to high concentrations of the drug (50% inhibition at 0.3 mg/ml). These results establish the existence of RNA polymerase III in yeast and provide a structural basis for the discrimination of the three functional polymerases in eukaryotes. Images PMID:772675

  4. Intergenic transcriptional interference is blocked by RNA polymerase III transcription factor TFIIIB in Saccharomyces cerevisiae.

    PubMed

    Korde, Asawari; Rosselot, Jessica M; Donze, David

    2014-02-01

    The major function of eukaryotic RNA polymerase III is to transcribe transfer RNA, 5S ribosomal RNA, and other small non-protein-coding RNA molecules. Assembly of the RNA polymerase III complex on chromosomal DNA requires the sequential binding of transcription factor complexes TFIIIC and TFIIIB. Recent evidence has suggested that in addition to producing RNA transcripts, chromatin-assembled RNA polymerase III complexes may mediate additional nuclear functions that include chromatin boundary, nucleosome phasing, and general genome organization activities. This study provides evidence of another such "extratranscriptional" activity of assembled RNA polymerase III complexes, which is the ability to block progression of intergenic RNA polymerase II transcription. We demonstrate that the RNA polymerase III complex bound to the tRNA gene upstream of the Saccharomyces cerevisiae ATG31 gene protects the ATG31 promoter against readthrough transcriptional interference from the upstream noncoding intergenic SUT467 transcription unit. This protection is predominately mediated by binding of the TFIIIB complex. When TFIIIB binding to this tRNA gene is weakened, an extended SUT467-ATG31 readthrough transcript is produced, resulting in compromised ATG31 translation. Since the ATG31 gene product is required for autophagy, strains expressing the readthrough transcript exhibit defective autophagy induction and reduced fitness under autophagy-inducing nitrogen starvation conditions. Given the recent discovery of widespread pervasive transcription in all forms of life, protection of neighboring genes from intergenic transcriptional interference may be a key extratranscriptional function of assembled RNA polymerase III complexes and possibly other DNA binding proteins.

  5. Analysis of unassisted translesion replication by the DNA polymerase III holoenzyme.

    PubMed

    Tomer, G; Livneh, Z

    1999-05-01

    DNA damage-induced mutations are formed when damaged nucleotides present in single-stranded DNA are replicated. We have developed a new method for the preparation of gapped plasmids containing site-specific damaged nucleotides, as model DNA substrates for translesion replication. Using these substrates, we show that the DNA polymerase III holoenzyme from Escherichia coli can bypass a synthetic abasic site analogue with high efficiency (30% bypass in 16 min), unassisted by other proteins. The theta and tau subunits of the polymerase were not essential for bypass. No bypass was observed when the enzyme was assayed on a synthetic 60-mer oligonucleotide carrying the same lesion, and bypass on a linear gapped plasmid was 3-4-fold slower than on a circular gapped plasmid. There was no difference in the bypass when standing-start and running-start replication were compared. A comparison of translesion replication by DNA polymerase I, DNA polymerase II, the DNA polymerase III core, and the DNA polymerase III holoenzyme clearly showed that the DNA polymerase III holoenzyme was by far the most effective in performing translesion replication. This was not only due to the high processivity of the pol III holoenzyme, because increasing the processivity of pol II by adding the gamma complex and beta subunit, did not increase bypass. These results support the model that SOS regulation was imposed on a fundamentally constitutive translesion replication reaction to achieve tight control of mutagenesis.

  6. Mechanism of translesion DNA synthesis by DNA polymerase II. Comparison to DNA polymerases I and III core.

    PubMed

    Paz-Elizur, T; Takeshita, M; Goodman, M; O'Donnell, M; Livneh, Z

    1996-10-01

    Bypass synthesis by DNA polymerase II was studied using a synthetic 40-nucleotide-long gapped duplex DNA containing a site-specific abasic site analog, as a model system for mutagenesis associated with DNA lesions. Bypass synthesis involved a rapid polymerization step terminating opposite the nucleotide preceding the lesion, followed by a slow bypass step. Bypass was found to be dependent on polymerase and dNTP concentrations, on the DNA sequence context, and on the size of the gap. A side-by-side comparison of DNA polymerases I, II, and III core revealed the following. 1) Each of the three DNA polymerases bypassed the abasic site analog unassisted by other proteins. 2) In the presence of physiological-like salt conditions, only DNA polymerase II bypassed the lesion. 3) Bypass by each of the three DNA polymerases increased dramatically in the absence of proofreading. These results support a model (Tomer, G., Cohen-Fix, O. , O'Donnell, M., Goodman, M. and Livneh, Z. (1996) Proc. Natl. Acad. Sci. U. S. A. 93, 1376-1380) by which the RecA, UmuD, and UmuC proteins are accessory factors rather than being absolutely required for the core mutagenic bypass reaction in induced mutagenesis in Escherichia coli.

  7. MYC Regulation of Cell Growth through Control of Transcription by RNA Polymerases I and III

    PubMed Central

    Campbell, Kirsteen J.; White, Robert J.

    2014-01-01

    MYC’s tumorigenic potential involves increased ribosome biogenesis and translational capacity, which supply the cell with protein required for enhanced cell growth and subsequent cell division. In addition to activation of protein-encoding genes transcribed by RNA polymerase II, MYC must stimulate transcription by RNA polymerase I and RNA polymerase III to meet this synthetic demand. In the past decade our knowledge of the mechanisms and importance of MYC regulation of RNA polymerases I and III has flourished. Here we discuss MYC’s influence on transcription by these “odd” RNA polymerases and the physiological impact of this regulation is evaluated with relevance to cancer development and treatment. PMID:24789877

  8. Biogenesis of RNA polymerases II and III requires the conserved GPN small GTPases in Saccharomyces cerevisiae.

    PubMed

    Minaker, Sean W; Filiatrault, Megan C; Ben-Aroya, Shay; Hieter, Philip; Stirling, Peter C

    2013-03-01

    The GPN proteins are a poorly characterized and deeply evolutionarily conserved family of three paralogous small GTPases, Gpn1, 2, and 3. The founding member, GPN1/NPA3/XAB1, is proposed to function in nuclear import of RNA polymerase II along with a recently described protein called Iwr1. Here we show that the previously uncharacterized protein Gpn2 binds both Gpn3 and Npa3/Gpn1 and that temperature-sensitive alleles of Saccharomyces cerevisiae GPN2 and GPN3 exhibit genetic interactions with RNA polymerase II mutants, hypersensitivity to transcription inhibition, and defects in RNA polymerase II nuclear localization. Importantly, we identify previously unrecognized RNA polymerase III localization defects in GPN2, GPN3, and IWR1 mutant backgrounds but find no localization defects of unrelated nuclear proteins or of RNA polymerase I. Previously, it was unclear whether the GPN proteins and Iwr1 had overlapping function in RNA polymerase II assembly or import. In this study, we show that the nuclear import defect of iwr1Δ, but not the GPN2 or GPN3 mutant defects, is partially suppressed by fusion of a nuclear localization signal to the RNA polymerase II subunit Rpb3. These data, combined with strong genetic interactions between GPN2 and IWR1, suggest that the GPN proteins function upstream of Iwr1 in RNA polymerase II and III biogenesis. We propose that the three GPN proteins execute a common, and likely essential, function in RNA polymerase assembly and transport.

  9. Biogenesis of RNA Polymerases II and III Requires the Conserved GPN Small GTPases in Saccharomyces cerevisiae

    PubMed Central

    Minaker, Sean W.; Filiatrault, Megan C.; Ben-Aroya, Shay; Hieter, Philip; Stirling, Peter C.

    2013-01-01

    The GPN proteins are a poorly characterized and deeply evolutionarily conserved family of three paralogous small GTPases, Gpn1, 2, and 3. The founding member, GPN1/NPA3/XAB1, is proposed to function in nuclear import of RNA polymerase II along with a recently described protein called Iwr1. Here we show that the previously uncharacterized protein Gpn2 binds both Gpn3 and Npa3/Gpn1 and that temperature-sensitive alleles of Saccharomyces cerevisiae GPN2 and GPN3 exhibit genetic interactions with RNA polymerase II mutants, hypersensitivity to transcription inhibition, and defects in RNA polymerase II nuclear localization. Importantly, we identify previously unrecognized RNA polymerase III localization defects in GPN2, GPN3, and IWR1 mutant backgrounds but find no localization defects of unrelated nuclear proteins or of RNA polymerase I. Previously, it was unclear whether the GPN proteins and Iwr1 had overlapping function in RNA polymerase II assembly or import. In this study, we show that the nuclear import defect of iwr1Δ, but not the GPN2 or GPN3 mutant defects, is partially suppressed by fusion of a nuclear localization signal to the RNA polymerase II subunit Rpb3. These data, combined with strong genetic interactions between GPN2 and IWR1, suggest that the GPN proteins function upstream of Iwr1 in RNA polymerase II and III biogenesis. We propose that the three GPN proteins execute a common, and likely essential, function in RNA polymerase assembly and transport. PMID:23267056

  10. The Selenocysteine tRNA Gene in Leishmania major Is Transcribed by both RNA Polymerase II and RNA Polymerase III

    PubMed Central

    Padilla-Mejía, Norma E.; Florencio-Martínez, Luis E.; Moreno-Campos, Rodrigo; Vizuet-de-Rueda, Juan C.; Cevallos, Ana M.; Hernández-Rivas, Rosaura; Manning-Cela, Rebeca

    2014-01-01

    Eukaryotic tRNAs, transcribed by RNA polymerase III (Pol III), contain boxes A and B as internal promoter elements. One exception is the selenocysteine (Sec) tRNA (tRNA-Sec), whose transcription is directed by an internal box B and three extragenic sequences in vertebrates. Here we report on the transcriptional analysis of the tRNA-Sec gene in the protozoan parasite Leishmania major. This organism has unusual mechanisms of gene expression, including Pol II polycistronic transcription and maturation of mRNAs by trans splicing, a process that attaches a 39-nucleotide miniexon to the 5′ end of all the mRNAs. In L. major, tRNA-Sec is encoded by a single gene inserted into a Pol II polycistronic unit, in contrast to most tRNAs, which are clustered at the boundaries of polycistronic units. 5′ rapid amplification of cDNA ends and reverse transcription-PCR experiments showed that some tRNA-Sec transcripts contain the miniexon at the 5′ end and a poly(A) tail at the 3′ end, indicating that the tRNA-Sec gene is polycistronically transcribed by Pol II and processed by trans splicing and polyadenylation, as was recently reported for the tRNA-Sec genes in the related parasite Trypanosoma brucei. However, nuclear run-on assays with RNA polymerase inhibitors and with cells that were previously UV irradiated showed that the tRNA-Sec gene in L. major is also transcribed by Pol III. Thus, our results indicate that RNA polymerase specificity in Leishmania is not absolute in vivo, as has recently been found in other eukaryotes. PMID:25548151

  11. Evidence for Moonlighting Functions of the θ Subunit of Escherichia coli DNA Polymerase III

    PubMed Central

    Dietrich, M.; Pedró, L.; García, J.; Pons, M.; Hüttener, M.; Paytubi, S.; Madrid, C.

    2014-01-01

    The holE gene is an enterobacterial ORFan gene (open reading frame [ORF] with no detectable homology to other ORFs in a database). It encodes the θ subunit of the DNA polymerase III core complex. The precise function of the θ subunit within this complex is not well established, and loss of holE does not result in a noticeable phenotype. Paralogs of holE are also present on many conjugative plasmids and on phage P1 (hot gene). In this study, we provide evidence indicating that θ (HolE) exhibits structural and functional similarities to a family of nucleoid-associated regulatory proteins, the Hha/YdgT-like proteins that are also encoded by enterobacterial ORFan genes. Microarray studies comparing the transcriptional profiles of Escherichia coli holE, hha, and ydgT mutants revealed highly similar expression patterns for strains harboring holE and ydgT alleles. Among the genes differentially regulated in both mutants were genes of the tryptophanase (tna) operon. The tna operon consists of a transcribed leader region, tnaL, and two structural genes, tnaA and tnaB. Further experiments with transcriptional lacZ fusions (tnaL::lacZ and tnaA::lacZ) indicate that HolE and YdgT downregulate expression of the tna operon by possibly increasing the level of Rho-dependent transcription termination at the tna operon's leader region. Thus, for the first time, a regulatory function can be attributed to HolE, in addition to its role as structural component of the DNA polymerase III complex. PMID:24375106

  12. Long-Range PCR Amplification of DNA by DNA Polymerase III Holoenzyme from Thermus thermophilus

    PubMed Central

    Kane, Shawn D.; Bullard, James M.

    2015-01-01

    DNA replication in bacteria is accomplished by a multicomponent replicase, the DNA polymerase III holoenzyme (pol III HE). The three essential components of the pol III HE are the α polymerase, the β sliding clamp processivity factor, and the DnaX clamp-loader complex. We report here the assembly of the functional holoenzyme from Thermus thermophilus (Tth), an extreme thermophile. The minimal holoenzyme capable of DNA synthesis consists of α, β and DnaX (τ and γ), δ and δ′ components of the clamp-loader complex. The proteins were each cloned and expressed in a native form. Each component of the system was purified extensively. The minimum holoenzyme from these five purified subunits reassembled is sufficient for rapid and processive DNA synthesis. In an isolated form the α polymerase was found to be unstable at temperatures above 65°C. We were able to increase the thermostability of the pol III HE to 98°C by addition and optimization of various buffers and cosolvents. In the optimized buffer system we show that a replicative polymerase apparatus, Tth pol III HE, is capable of rapid amplification of regions of DNA up to 15,000 base pairs in PCR reactions. PMID:25688300

  13. Identification of proteins associated with RNA polymerase III using a modified tandem chromatin affinity purification.

    PubMed

    Nguyen, Ngoc-Thuy-Trinh; Saguez, Cyril; Conesa, Christine; Lefebvre, Olivier; Acker, Joël

    2015-02-01

    To identify the proteins associated with the RNA polymerase III (Pol III) machinery in exponentially growing yeast cells, we developed our own tandem chromatin affinity purification procedure (TChAP) after in vivo cross-link, allowing a reproducible and good recovery of the protein bait and its associated partners. In contrast to TFIIIA that could only be purified as a free protein, this protocol allows us to capture free Pol III together with Pol III bound on its target genes. Transcription factors, elongation factors, RNA-associated proteins and proteins involved in Pol III biogenesis were identified by mass spectrometry. Interestingly, the presence of all the TFIIIB subunits found associated with Pol III together with the absence of TFIIIC and chromatin factors including histones suggest that DNA-bound Pol III purified using TChAP is mainly engaged in transcription reinitiation.

  14. Structure and sequence of the gene for the largest subunit of trypanosomal RNA polymerase III.

    PubMed Central

    Köck, J; Evers, R; Cornelissen, A W

    1988-01-01

    As the first step in the analysis of the transcription process in the African trypanosome, Trypanosoma brucei, we have started to characterise the trypanosomal RNA polymerases. We have previously described the gene encoding the largest subunit of RNA polymerase II and found that two almost identical RNA polymerase II genes are encoded within the genome of T. brucei. Here we present the identification, cloning and sequence analysis of the gene encoding the largest subunit of RNA polymerase III. This gene contains a single open reading frame encoding a polypeptide with a Mr of 170 kD. In total, eight encoding a polypeptide with a Mr of 170 kD. In total, eight highly conserved regions with significant homology to those previously reported in other eukaryotic RNA polymerase largest subunits were identified. Some of these domains contain functional sites, which are conserved among all eukaryotic largest subunit genes analysed thus far. Since these domains make up a large part of each polypeptide, independent of the RNA polymerase class, these data strongly support the hypothesis that these domains provide a major part of the transcription machinery of the RNA polymerase complex. The additional domains which are uniquely present in the largest subunit of RNA polymerase I and II, respectively, two large hydrophylic insertions and a C-terminal extension, might be a determining factor in specific transcription of the gene classes. Images PMID:3174432

  15. A multiplicity of factors contributes to selective RNA polymerase III occupancy of a subset of RNA polymerase III genes in mouse liver.

    PubMed

    Canella, Donatella; Bernasconi, David; Gilardi, Federica; LeMartelot, Gwendal; Migliavacca, Eugenia; Praz, Viviane; Cousin, Pascal; Delorenzi, Mauro; Hernandez, Nouria

    2012-04-01

    The genomic loci occupied by RNA polymerase (RNAP) III have been characterized in human culture cells by genome-wide chromatin immunoprecipitations, followed by deep sequencing (ChIP-seq). These studies have shown that only ∼40% of the annotated 622 human tRNA genes and pseudogenes are occupied by RNAP-III, and that these genes are often in open chromatin regions rich in active RNAP-II transcription units. We have used ChIP-seq to characterize RNAP-III-occupied loci in a differentiated tissue, the mouse liver. Our studies define the mouse liver RNAP-III-occupied loci including a conserved mammalian interspersed repeat (MIR) as a potential regulator of an RNAP-III subunit-encoding gene. They reveal that synteny relationships can be established between a number of human and mouse RNAP-III genes, and that the expression levels of these genes are significantly linked. They establish that variations within the A and B promoter boxes, as well as the strength of the terminator sequence, can strongly affect RNAP-III occupancy of tRNA genes. They reveal correlations with various genomic features that explain the observed variation of 81% of tRNA scores. In mouse liver, loci represented in the NCBI37/mm9 genome assembly that are clearly occupied by RNAP-III comprise 50 Rn5s (5S RNA) genes, 14 known non-tRNA RNAP-III genes, nine Rn4.5s (4.5S RNA) genes, and 29 SINEs. Moreover, out of the 433 annotated tRNA genes, half are occupied by RNAP-III. Transfer RNA gene expression levels reflect both an underlying genomic organization conserved in dividing human culture cells and resting mouse liver cells, and the particular promoter and terminator strengths of individual genes.

  16. Falling for the dark side of transcription: Nab2 fosters RNA polymerase III transcription

    PubMed Central

    Reuter, L. Maximilian; Sträßer, Katja

    2016-01-01

    ABSTRACT RNA polymerase III (RNAPIII) synthesizes diverse, small, non-coding RNAs with many important roles in the cellular metabolism. One of the open questions of RNAPIII transcription is whether and how additional factors are involved. Recently, Nab2 was identified as the first messenger ribonucleoprotein particle (mRNP) biogenesis factor with a function in RNAPIII transcription. PMID:27049816

  17. New insights into the promoterless transcription of DNA coligo templates by RNA polymerase III.

    PubMed

    Lama, Lodoe; Seidl, Christine I; Ryan, Kevin

    2014-01-01

    Chemically synthesized DNA can carry small RNA sequence information but converting that information into small RNA is generally thought to require large double-stranded promoters in the context of plasmids, viruses and genes. We previously found evidence that circularized oligodeoxynucleotides (coligos) containing certain sequences and secondary structures can template the synthesis of small RNA by RNA polymerase III in vitro and in human cells. By using immunoprecipitated RNA polymerase III we now report corroborating evidence that this enzyme is the sole polymerase responsible for coligo transcription. The immobilized polymerase enabled experiments showing that coligo transcripts can be formed through transcription termination without subsequent 3' end trimming. To better define the determinants of productive transcription, a structure-activity relationship study was performed using over 20 new coligos. The results show that unpaired nucleotides in the coligo stem facilitate circumtranscription, but also that internal loops and bulges should be kept small to avoid secondary transcription initiation sites. A polymerase termination sequence embedded in the double-stranded region of a hairpin-encoding coligo stem can antagonize transcription. Using lessons learned from new and old coligos, we demonstrate how to convert poorly transcribed coligos into productive templates. Our findings support the possibility that coligos may prove useful as chemically synthesized vectors for the ectopic expression of small RNA in human cells.

  18. Polymerase Chain Reaction for Detection of Systemic Plant Pathogens

    Technology Transfer Automated Retrieval System (TEKTRAN)

    This chapter outlines the advances and application of the polymerase chain reaction (PCR) since its development in 1984 and its enhancements and applications to detection of viruses, viroids and phytoplasma in pome and stone fruits. PCR is probably the most rapidly and widely adopted technology eve...

  19. Detection of Listeria monocytogenes by using the polymerase chain reaction

    SciTech Connect

    Bessesen, M.T.; Luo, Q.; Blaser, M.J.; Ellison, R.T. III.; Rotbart. H.A. )

    1990-09-01

    A method was developed for detection of Listeria monocytogens by polymerase chain reaction amplification followed by agarose gel electrophoresis or dot blot analysis with {sup 32}P-labeled internal probe. The technique identified 95 of 95 L. monocytogenes strains, 0 of 12 Listeria strains of other species, and 0 of 12 non-Listeria strains.

  20. Rbs1, a new protein implicated in RNA polymerase III biogenesis in yeast Saccharomyces cerevisiae.

    PubMed

    Cieśla, Małgorzata; Makała, Ewa; Płonka, Marta; Bazan, Rafał; Gewartowski, Kamil; Dziembowski, Andrzej; Boguta, Magdalena

    2015-04-01

    Little is known about the RNA polymerase III (Pol III) complex assembly and its transport to the nucleus. We demonstrate that a missense cold-sensitive mutation, rpc128-1007, in the sequence encoding the C-terminal part of the second largest Pol III subunit, C128, affects the assembly and stability of the enzyme. The cellular levels and nuclear concentration of selected Pol III subunits were decreased in rpc128-1007 cells, and the association between Pol III subunits as evaluated by coimmunoprecipitation was also reduced. To identify the proteins involved in Pol III assembly, we performed a genetic screen for suppressors of the rpc128-1007 mutation and selected the Rbs1 gene, whose overexpression enhanced de novo tRNA transcription in rpc128-1007 cells, which correlated with increased stability, nuclear concentration, and interaction of Pol III subunits. The rpc128-1007 rbs1Δ double mutant shows a synthetic growth defect, indicating that rpc128-1007 and rbs1Δ function in parallel ways to negatively regulate Pol III assembly. Rbs1 physically interacts with a subset of Pol III subunits, AC19, AC40, and ABC27/Rpb5. Additionally, Rbs1 interacts with the Crm1 exportin and shuttles between the cytoplasm and nucleus. We postulate that Rbs1 binds to the Pol III complex or subcomplex and facilitates its translocation to the nucleus.

  1. Hypoxic stress suppresses RNA polymerase III recruitment and tRNA gene transcription in cardiomyocytes

    PubMed Central

    Ernens, Isabelle; Goodfellow, Sarah J.; Innes, Fiona; Kenneth, Niall S.; Derblay, Louise E.; White, Robert J.; Scott, Pamela H.

    2006-01-01

    RNA polymerase (pol) III transcription decreases when primary cultures of rat neonatal cardiomyocytes are exposed to low oxygen tension. Previous studies in fibroblasts have shown that the pol III-specific transcription factor IIIB (TFIIIB) is bound and regulated by the proto-oncogene product c-Myc, the mitogen-activated protein kinase ERK and the retinoblastoma tumour suppressor protein, RB. The principal function of TFIIIB is to recruit pol III to its cognate gene template, an activity that is known to be inhibited by RB and stimulated by ERK. We demonstrate by chromatin immunoprecipitation (ChIP) that c-Myc also stimulates pol III recruitment by TFIIIB. However, hypoxic conditions cause TFIIIB dissociation from c-Myc and ERK, at the same time as increasing its interaction with RB. Consistent with this, ChIP assays indicate that the occupancy of tRNA genes by pol III is significantly reduced, whereas promoter binding by TFIIIB is undiminished. The data suggest that hypoxia can inhibit pol III transcription by altering the interactions between TFIIIB and its regulators and thus compromising its ability to recruit the polymerase. These effects are independent of cell cycle changes. PMID:16407335

  2. Retrotransposons. An RNA polymerase III subunit determines sites of retrotransposon integration.

    PubMed

    Bridier-Nahmias, Antoine; Tchalikian-Cosson, Aurélie; Baller, Joshua A; Menouni, Rachid; Fayol, Hélène; Flores, Amando; Saïb, Ali; Werner, Michel; Voytas, Daniel F; Lesage, Pascale

    2015-05-01

    Mobile genetic elements are ubiquitous. Their integration site influences genome stability and gene expression. The Ty1 retrotransposon of the yeast Saccharomyces cerevisiae integrates upstream of RNA polymerase III (Pol III)-transcribed genes, yet the primary determinant of target specificity has remained elusive. Here we describe an interaction between Ty1 integrase and the AC40 subunit of Pol III and demonstrate that AC40 is the predominant determinant targeting Ty1 integration upstream of Pol III-transcribed genes. Lack of an integrase-AC40 interaction dramatically alters target site choice, leading to a redistribution of Ty1 insertions in the genome, mainly to chromosome ends. The mechanism of target specificity allows Ty1 to proliferate and yet minimizes genetic damage to its host. PMID:25931562

  3. Distinguishing Core and Holoenzyme Mechanisms of Transcription Termination by RNA Polymerase III

    PubMed Central

    Arimbasseri, Aneeshkumar G.

    2013-01-01

    Transcription termination by RNA polymerase (Pol) III serves multiple purposes; it delimits interference with downstream genes, forms 3′ oligo(U) binding sites for the posttranscriptional processing factor, La protein, and resets the polymerase complex for reinitiation. Although an interplay of several Pol III subunits is known to collectively control these activities, how they affect molecular function of the active center during termination is incompletely understood. We have approached this using immobilized Pol III-nucleic acid scaffolds to examine the two major components of termination, transcription pausing and RNA release. This allowed us to distinguish two mechanisms of termination by isolated Saccharomyces cerevisiae Pol III. A core mechanism can operate in the absence of C53/37 and C11 subunits but requires synthesis of 8 or more 3′ U nucleotides, apparently reflecting inherent sensitivity to an oligo(rU·dA) hybrid that is the termination signal proper. The holoenzyme mechanism requires fewer U nucleotides but uses C53/37 and C11 to slow elongation and prevent terminator arrest. N-terminal truncation of C53 or point mutations that disable the cleavage activity of C11 impair their antiarrest activities. The data are consistent with a model in which C53, C37, and C11 activities are functionally integrated with the active center of Pol III during termination. PMID:23401852

  4. Detection of Entamoeba histolytica by Recombinase Polymerase Amplification.

    PubMed

    Nair, Gayatri; Rebolledo, Mauricio; White, A Clinton; Crannell, Zachary; Richards-Kortum, R Rebecca; Pinilla, A Elizabeth; Ramírez, Juan David; López, M Consuelo; Castellanos-Gonzalez, Alejandro

    2015-09-01

    Amebiasis is an important cause of diarrheal disease worldwide and has been associated with childhood malnutrition. Traditional microscopy approaches are neither sensitive nor specific for Entamoeba histolytica. Antigen assays are more specific, but many cases are missed unless tested by molecular methods. Although polymerase chain reaction (PCR) is effective, the need for sophisticated, expensive equipment, infrastructure, and trained personnel limits its usefulness, especially in the resource-limited, endemic areas. Here, we report development of a recombinase polymerase amplification (RPA) method to detect E. histolytica specifically. Using visual detection by lateral flow (LF), the test was highly sensitive and specific and could be performed without additional equipment. The availability of this inexpensive, sensitive, and field-applicable diagnostic test could facilitate rapid diagnosis and treatment of amebiasis in endemic regions.

  5. Detection of Entamoeba histolytica by Recombinase Polymerase Amplification

    PubMed Central

    Nair, Gayatri; Rebolledo, Mauricio; White, A. Clinton; Crannell, Zachary; Richards-Kortum, R. Rebecca; Pinilla, A. Elizabeth; Ramírez, Juan David; López, M. Consuelo; Castellanos-Gonzalez, Alejandro

    2015-01-01

    Amebiasis is an important cause of diarrheal disease worldwide and has been associated with childhood malnutrition. Traditional microscopy approaches are neither sensitive nor specific for Entamoeba histolytica. Antigen assays are more specific, but many cases are missed unless tested by molecular methods. Although polymerase chain reaction (PCR) is effective, the need for sophisticated, expensive equipment, infrastructure, and trained personnel limits its usefulness, especially in the resource-limited, endemic areas. Here, we report development of a recombinase polymerase amplification (RPA) method to detect E. histolytica specifically. Using visual detection by lateral flow (LF), the test was highly sensitive and specific and could be performed without additional equipment. The availability of this inexpensive, sensitive, and field-applicable diagnostic test could facilitate rapid diagnosis and treatment of amebiasis in endemic regions. PMID:26123960

  6. Detection of Entamoeba histolytica by Recombinase Polymerase Amplification.

    PubMed

    Nair, Gayatri; Rebolledo, Mauricio; White, A Clinton; Crannell, Zachary; Richards-Kortum, R Rebecca; Pinilla, A Elizabeth; Ramírez, Juan David; López, M Consuelo; Castellanos-Gonzalez, Alejandro

    2015-09-01

    Amebiasis is an important cause of diarrheal disease worldwide and has been associated with childhood malnutrition. Traditional microscopy approaches are neither sensitive nor specific for Entamoeba histolytica. Antigen assays are more specific, but many cases are missed unless tested by molecular methods. Although polymerase chain reaction (PCR) is effective, the need for sophisticated, expensive equipment, infrastructure, and trained personnel limits its usefulness, especially in the resource-limited, endemic areas. Here, we report development of a recombinase polymerase amplification (RPA) method to detect E. histolytica specifically. Using visual detection by lateral flow (LF), the test was highly sensitive and specific and could be performed without additional equipment. The availability of this inexpensive, sensitive, and field-applicable diagnostic test could facilitate rapid diagnosis and treatment of amebiasis in endemic regions. PMID:26123960

  7. Role of DNA-Dependent RNA Polymerase III in the Transcription of the tRNA and 5S RNA Genes

    PubMed Central

    Weinmann, Roberto; Roeder, Robert G.

    1974-01-01

    Mouse myeloma cells have previously been shown (L. B. Schwartz, V. E. F. Sklar, J. A. Jaehning, R. Weinmann & R. G. Roeder, submitted for publication) to contain two chromatographically distinct forms of RNA polymerase III (designated IIIA and IIIB). The enzymes are unaffected by low α-amanitin concentrations which completely inhibit RNA polymerase II, but they exhibit characteristic inhibition curves (identical for IIIA and IIIB) at higher toxin concentrations. RNA polymerase I was unaffected at all α-amanitin concentrations tested. Myeloma RNA polymerases II, IIIA, and IIIB appear to be inhibited by the same mechanism, since the toxin rapidly blocks chain elongation by each enzyme. The characteristic α-amanitin sensitivity of RNA polymerase III has been employed in studies of the function(s) of the class III RNA polymerases. Isolated myeloma nuclei and nucleoli contińue to synthesize RNA via the endogenous RNA polymerases when incubated in vitro. With nuclei, newly synthesized 4S precursor (pre-4S) and 5S RNA species were detected by electrophoretic analysis either of the total nuclear RNA or of the RNA released into the supernatant during incubation. The synthesis of both pre-4S and 5S RNA species was inhibited by α-amanitin, but only at high concentrations; and the α-amanitin inhibition curves for these RNAs were identical to those obtained for solubilized RNA polymerases IIIA and IIIB. In control experiments it was shown that the endogenous RNA polymerase II activity of isolated nuclei was inhibited by α-amanitin concentrations similar to those required to inhibit purified enzyme II. However, 40-50% of the endogenous activity of nuclei and 100% of the endogenous activity of purified nucleoli was completely resistant to the high α-amanitin concentrations necessary to inhibit the RNA polymerase III activities. These experiments rule out nonspecific inhibitory effects in the endogenous systems. These results unequivocally demonstrate the role of RNA

  8. Role of DNA-Dependent RNA Polymerases II and III in Transcription of the Adenovirus Genome Late in Productive Infection

    PubMed Central

    Weinmann, Roberto; Raskas, Heschel J.; Roeder, Robert G.

    1974-01-01

    DNA-dependent RNA polymerases I, II, and III were isolated and partially purified from KB (human) cells 18 hr after infection with adenovirus 2. As reported previously for the enzymes from other animal cells, RNA polymerase II was completely sensitive to low concentrations of α-amanitin (50% inhibition at 0.02 μg/ml), RNA polymerase III was completely sensitive to high concentrations of α-amanitin (50% inhibition at 20 μg/ml) and RNA polymerase I was totally resistant to concentrations of α-amanitin less than or equal to 200 μg/ml. RNA synthesis by the endogenous RNA polymerase activities in nuclei isolated from infected cells was completely sensitive to α-amanitin, thus suggesting that RNA polymerase I is not involved in viral DNA transcription even though it is present in these cells. The α-amanitin inhibition curve was biphasic and showed inflection points at about 0.02 and 20 μg/ml, suggesting the participation of both RNA polymerases II and III in the synthesis of RNA in these nuclei. Furthermore, at least a large fraction of the synthesis of the nuclear precursors to viral mRNA, monitored by hybridization to viral DNA, showed the same sensitivity to α-amanitin as did RNA polymerase II; and the synthesis of both viral 5.5S RNA and (presumably cellular) 5S RNA in the isolated nuclei exhibited the same sensitivity to α-amanitin as did purified RNA polymerase III. Thus, these data provide strong supporting evidence for previous studies which suggested the involvement of an RNA polymerase II in transcription of the adenovirus genome and demonstrate the role of an RNA polymerase III activity in the synthesis of viral 5.5S RNA and cellular 5S RNA. PMID:4530313

  9. Characterization of new RNA polymerase III and RNA polymerase II transcriptional promoters in the Bovine Leukemia Virus genome.

    PubMed

    Van Driessche, Benoit; Rodari, Anthony; Delacourt, Nadège; Fauquenoy, Sylvain; Vanhulle, Caroline; Burny, Arsène; Rohr, Olivier; Van Lint, Carine

    2016-01-01

    Bovine leukemia virus latency is a viral strategy used to escape from the host immune system and contribute to tumor development. However, a highly expressed BLV micro-RNA cluster has been reported, suggesting that the BLV silencing is not complete. Here, we demonstrate the in vivo recruitment of RNA polymerase III to the BLV miRNA cluster both in BLV-latently infected cell lines and in ovine BLV-infected primary cells, through a canonical type 2 RNAPIII promoter. Moreover, by RPC6-knockdown, we showed a direct functional link between RNAPIII transcription and BLV miRNAs expression. Furthermore, both the tumor- and the quiescent-related isoforms of RPC7 subunits were recruited to the miRNA cluster. We showed that the BLV miRNA cluster was enriched in positive epigenetic marks. Interestingly, we demonstrated the in vivo recruitment of RNAPII at the 3'LTR/host genomic junction, associated with positive epigenetic marks. Functionally, we showed that the BLV LTR exhibited a strong antisense promoter activity and identified cis-acting elements of an RNAPII-dependent promoter. Finally, we provided evidence for an in vivo collision between RNAPIII and RNAPII convergent transcriptions. Our results provide new insights into alternative ways used by BLV to counteract silencing of the viral 5'LTR promoter. PMID:27545598

  10. Characterization of new RNA polymerase III and RNA polymerase II transcriptional promoters in the Bovine Leukemia Virus genome

    PubMed Central

    Van Driessche, Benoit; Rodari, Anthony; Delacourt, Nadège; Fauquenoy, Sylvain; Vanhulle, Caroline; Burny, Arsène; Rohr, Olivier; Van Lint, Carine

    2016-01-01

    Bovine leukemia virus latency is a viral strategy used to escape from the host immune system and contribute to tumor development. However, a highly expressed BLV micro-RNA cluster has been reported, suggesting that the BLV silencing is not complete. Here, we demonstrate the in vivo recruitment of RNA polymerase III to the BLV miRNA cluster both in BLV-latently infected cell lines and in ovine BLV-infected primary cells, through a canonical type 2 RNAPIII promoter. Moreover, by RPC6-knockdown, we showed a direct functional link between RNAPIII transcription and BLV miRNAs expression. Furthermore, both the tumor- and the quiescent-related isoforms of RPC7 subunits were recruited to the miRNA cluster. We showed that the BLV miRNA cluster was enriched in positive epigenetic marks. Interestingly, we demonstrated the in vivo recruitment of RNAPII at the 3′LTR/host genomic junction, associated with positive epigenetic marks. Functionally, we showed that the BLV LTR exhibited a strong antisense promoter activity and identified cis-acting elements of an RNAPII-dependent promoter. Finally, we provided evidence for an in vivo collision between RNAPIII and RNAPII convergent transcriptions. Our results provide new insights into alternative ways used by BLV to counteract silencing of the viral 5′LTR promoter. PMID:27545598

  11. Nested methylation-specific polymerase chain reaction cancer detection method

    DOEpatents

    Belinsky, Steven A.; Palmisano, William A.

    2007-05-08

    A molecular marker-based method for monitoring and detecting cancer in humans. Aberrant methylation of gene promoters is a marker for cancer risk in humans. A two-stage, or "nested" polymerase chain reaction method is disclosed for detecting methylated DNA sequences at sufficiently high levels of sensitivity to permit cancer screening in biological fluid samples, such as sputum, obtained non-invasively. The method is for detecting the aberrant methylation of the p16 gene, O 6-methylguanine-DNA methyltransferase gene, Death-associated protein kinase gene, RAS-associated family 1 gene, or other gene promoters. The method offers a potentially powerful approach to population-based screening for the detection of lung and other cancers.

  12. BRF1, a subunit of RNA polymerase III transcription factor TFIIIB, is essential for cell growth of Trypanosoma brucei.

    PubMed

    Vélez-Ramírez, D E; Florencio-Martínez, L E; Romero-Meza, G; Rojas-Sánchez, S; Moreno-Campos, R; Arroyo, R; Ortega-López, J; Manning-Cela, R; Martínez-Calvillo, S

    2015-11-01

    RNA polymerase III (Pol III) synthesizes small RNA molecules that are essential for cell viability. Accurate initiation of transcription by Pol III requires general transcription factor TFIIIB, which is composed of three subunits: TFIIB-related factor BRF1, TATA-binding protein and BDP1. Here we report the molecular characterization of BRF1 in Trypanosoma brucei (TbBRF1), a parasitic protozoa that shows distinctive transcription characteristics. In silico analysis allowed the detection in TbBRF1 of the three conserved domains located in the N-terminal region of all BRF1 orthologues, namely a zinc ribbon motif and two cyclin repeats. Homology modelling suggested that, similarly to other BRF1 and TFIIB proteins, the TbBRF1 cyclin repeats show the characteristic structure of five α-helices per repeat, connected by a short random-coiled linker. As expected for a transcription factor, TbBRF1 was localized in the nucleus. Knock-down of TbBRF1 by RNA interference (RNAi) showed that this protein is essential for the viability of procyclic forms of T. brucei, since ablation of TbBRF1 led to growth arrest of the parasites. Nuclear run-on and quantitative real-time PCR analyses demonstrated that transcription of all the Pol III-dependent genes analysed was reduced, at different levels, after RNAi induction.

  13. Redox Signaling by the RNA Polymerase III TFIIB-Related Factor Brf2.

    PubMed

    Gouge, Jerome; Satia, Karishma; Guthertz, Nicolas; Widya, Marcella; Thompson, Andrew James; Cousin, Pascal; Dergai, Oleksandr; Hernandez, Nouria; Vannini, Alessandro

    2015-12-01

    TFIIB-related factor 2 (Brf2) is a member of the family of TFIIB-like core transcription factors. Brf2 recruits RNA polymerase (Pol) III to type III gene-external promoters, including the U6 spliceosomal RNA and selenocysteine tRNA genes. Found only in vertebrates, Brf2 has been linked to tumorigenesis but the underlying mechanisms remain elusive. We have solved crystal structures of a human Brf2-TBP complex bound to natural promoters, obtaining a detailed view of the molecular interactions occurring at Brf2-dependent Pol III promoters and highlighting the general structural and functional conservation of human Pol II and Pol III pre-initiation complexes. Surprisingly, our structural and functional studies unravel a Brf2 redox-sensing module capable of specifically regulating Pol III transcriptional output in living cells. Furthermore, we establish Brf2 as a central redox-sensing transcription factor involved in the oxidative stress pathway and provide a mechanistic model for Brf2 genetic activation in lung and breast cancer. PMID:26638071

  14. Widespread occurrence of non-canonical transcription termination by human RNA polymerase III

    PubMed Central

    Orioli, Andrea; Pascali, Chiara; Quartararo, Jade; Diebel, Kevin W.; Praz, Viviane; Romascano, David; Percudani, Riccardo; van Dyk, Linda F.; Hernandez, Nouria; Teichmann, Martin; Dieci, Giorgio

    2011-01-01

    Human RNA polymerase (Pol) III-transcribed genes are thought to share a simple termination signal constituted by four or more consecutive thymidine residues in the coding DNA strand, just downstream of the RNA 3′-end sequence. We found that a large set of human tRNA genes (tDNAs) do not display any T≥4 stretch within 50 bp of 3′-flanking region. In vitro analysis of tDNAs with a distanced T≥4 revealed the existence of non-canonical terminators resembling degenerate T≥5 elements, which ensure significant termination but at the same time allow for the production of Pol III read-through pre-tRNAs with unusually long 3′ trailers. A panel of such non-canonical signals was found to direct transcription termination of unusual Pol III-synthesized viral pre-miRNA transcripts in gammaherpesvirus 68-infected cells. Genome-wide location analysis revealed that human Pol III tends to trespass into the 3′-flanking regions of tDNAs, as expected from extensive terminator read-through. The widespread occurrence of partial termination suggests that the Pol III primary transcriptome in mammals is unexpectedly enriched in 3′-trailer sequences with the potential to contribute novel functional ncRNAs. PMID:21421562

  15. Recombinase Polymerase Amplification Assay for Rapid Detection of Francisella tularensis

    PubMed Central

    Euler, Milena; Wang, Yongjie; Otto, Peter; Tomaso, Herbert; Escudero, Raquel; Anda, Pedro; Hufert, Frank T.

    2012-01-01

    Several real-time PCR approaches to develop field detection for Francisella tularensis, the infectious agent causing tularemia, have been explored. We report the development of a novel qualitative real-time isothermal recombinase polymerase amplification (RPA) assay for use on a small ESEQuant Tube Scanner device. The analytical sensitivity and specificity were tested using a plasmid standard and DNA extracts from infected rabbit tissues. The assay showed a performance comparable to real-time PCR but reduced the assay time to 10 min. The rapid RPA method has great application potential for field use or point-of-care diagnostics. PMID:22518861

  16. Recombinase polymerase amplification assay for rapid detection of Francisella tularensis.

    PubMed

    Euler, Milena; Wang, Yongjie; Otto, Peter; Tomaso, Herbert; Escudero, Raquel; Anda, Pedro; Hufert, Frank T; Weidmann, Manfred

    2012-07-01

    Several real-time PCR approaches to develop field detection for Francisella tularensis, the infectious agent causing tularemia, have been explored. We report the development of a novel qualitative real-time isothermal recombinase polymerase amplification (RPA) assay for use on a small ESEQuant Tube Scanner device. The analytical sensitivity and specificity were tested using a plasmid standard and DNA extracts from infected rabbit tissues. The assay showed a performance comparable to real-time PCR but reduced the assay time to 10 min. The rapid RPA method has great application potential for field use or point-of-care diagnostics.

  17. Use of polymerase chain reaction for detection of Chlamydia trachomatis.

    PubMed

    Ostergaard, L; Birkelund, S; Christiansen, G

    1990-06-01

    A polymerase chain reaction (PCR) assay was developed for detection of Chlamydia trachomatis DNA. From the published sequence of the common C. trachomatis plasmid, two primer sets were selected. Detection of amplified sequences was done by agarose gel electrophoresis of cleaved or uncleaved amplified sequences, Southern hybridization, or dot blot analysis. The PCR assay was optimized and, after 40 cycles of amplification with primer set II, demonstrated a sensitivity of 10(-17) g of DNA, which corresponds to the detection of one copy of the plasmid. Because of the high sensitivity, we developed a closed system in which airborne contamination was minimized. Analysis of 228 clinical samples tested by cell culture, IDEIA enzyme immunosorbent assay (Medico-Nobel, Boots-Celltech Ltd., Berkshire, United Kingdom), and PCR showed a sensitivity of 100%, a specificity of 93% when PCR was compared with cell culture, and a corrected specificity of 99% when PCR was compared with cell culture or IDEIA.

  18. [Recombinase Polymerase Amplification and its Applications in Parasite Detection].

    PubMed

    ZHENG, Wen-bin; WU, Yao-dong; MA, Jian-gang; ZHU, Xing-quan; ZHOU, Dong-hui

    2015-10-01

    Recombinase polymerase amplification (RPA) is a recently -developed isothermal nucleic-acid-amplification technology that is based on the nucleic acid replication mechanism in T4 bacteriophage. With this technique, nucleic-acid templates can be amplified to measurable levels within 20 min at 37-42 °C. The. RPA process has high sensitivity and specificity, and is simple to operate, thus nucleic acids can be detected rapidly in non-laboratory conditions. Since its development in 2006, the RPA technique has been applied in agriculture, food safety, medicine, transgene detection, etc. In this review, we will give an overview on the research progress of RPA and its application in parasite detection.

  19. [Recombinase Polymerase Amplification and its Applications in Parasite Detection].

    PubMed

    ZHENG, Wen-bin; WU, Yao-dong; MA, Jian-gang; ZHU, Xing-quan; ZHOU, Dong-hui

    2015-10-01

    Recombinase polymerase amplification (RPA) is a recently -developed isothermal nucleic-acid-amplification technology that is based on the nucleic acid replication mechanism in T4 bacteriophage. With this technique, nucleic-acid templates can be amplified to measurable levels within 20 min at 37-42 °C. The. RPA process has high sensitivity and specificity, and is simple to operate, thus nucleic acids can be detected rapidly in non-laboratory conditions. Since its development in 2006, the RPA technique has been applied in agriculture, food safety, medicine, transgene detection, etc. In this review, we will give an overview on the research progress of RPA and its application in parasite detection. PMID:26931046

  20. Multiplexed Recombinase Polymerase Amplification Assay To Detect Intestinal Protozoa.

    PubMed

    Crannell, Zachary; Castellanos-Gonzalez, Alejandro; Nair, Gayatri; Mejia, Rojelio; White, A Clinton; Richards-Kortum, Rebecca

    2016-02-01

    This work describes a proof-of-concept multiplex recombinase polymerase amplification (RPA) assay with lateral flow readout that is capable of simultaneously detecting and differentiating DNA from any of the diarrhea-causing protozoa Giardia, Cryptosporidium, and Entamoeba. Together, these parasites contribute significantly to the global burden of diarrheal illness. Differential diagnosis of these parasites is traditionally accomplished via stool microscopy. However, microscopy is insensitive and can miss up to half of all cases. DNA-based diagnostics such as polymerase chain reaction (PCR) are far more sensitive; however, they rely on expensive thermal cycling equipment, limiting their availability to centralized reference laboratories. Isothermal DNA amplification platforms, such as the RPA platform used in this study, alleviate the need for thermal cycling equipment and have the potential to broaden access to more sensitive diagnostics. Until now, multiplex RPA assays have not been developed that are capable of simultaneously detecting and differentiating infections caused by different pathogens. We developed a multiplex RPA assay to detect the presence of DNA from Giardia, Cryptosporidium, and Entamoeba. The multiplex assay was characterized using synthetic DNA, where the limits-of-detection were calculated to be 403, 425, and 368 gene copies per reaction of the synthetic Giardia, Cryptosporidium, and Entamoeba targets, respectively (roughly 1.5 orders of magnitude higher than for the same targets in a singleplex RPA assay). The multiplex assay was also characterized using DNA extracted from live parasites spiked into stool samples where the limits-of-detection were calculated to be 444, 6, and 9 parasites per reaction for Giardia, Cryptosporidium, and Entamoeba parasites, respectively. This proof-of-concept assay may be reconfigured to detect a wide variety of targets by re-designing the primer and probe sequences.

  1. Multiplexed Recombinase Polymerase Amplification Assay To Detect Intestinal Protozoa.

    PubMed

    Crannell, Zachary; Castellanos-Gonzalez, Alejandro; Nair, Gayatri; Mejia, Rojelio; White, A Clinton; Richards-Kortum, Rebecca

    2016-02-01

    This work describes a proof-of-concept multiplex recombinase polymerase amplification (RPA) assay with lateral flow readout that is capable of simultaneously detecting and differentiating DNA from any of the diarrhea-causing protozoa Giardia, Cryptosporidium, and Entamoeba. Together, these parasites contribute significantly to the global burden of diarrheal illness. Differential diagnosis of these parasites is traditionally accomplished via stool microscopy. However, microscopy is insensitive and can miss up to half of all cases. DNA-based diagnostics such as polymerase chain reaction (PCR) are far more sensitive; however, they rely on expensive thermal cycling equipment, limiting their availability to centralized reference laboratories. Isothermal DNA amplification platforms, such as the RPA platform used in this study, alleviate the need for thermal cycling equipment and have the potential to broaden access to more sensitive diagnostics. Until now, multiplex RPA assays have not been developed that are capable of simultaneously detecting and differentiating infections caused by different pathogens. We developed a multiplex RPA assay to detect the presence of DNA from Giardia, Cryptosporidium, and Entamoeba. The multiplex assay was characterized using synthetic DNA, where the limits-of-detection were calculated to be 403, 425, and 368 gene copies per reaction of the synthetic Giardia, Cryptosporidium, and Entamoeba targets, respectively (roughly 1.5 orders of magnitude higher than for the same targets in a singleplex RPA assay). The multiplex assay was also characterized using DNA extracted from live parasites spiked into stool samples where the limits-of-detection were calculated to be 444, 6, and 9 parasites per reaction for Giardia, Cryptosporidium, and Entamoeba parasites, respectively. This proof-of-concept assay may be reconfigured to detect a wide variety of targets by re-designing the primer and probe sequences. PMID:26669715

  2. The beta subunit sliding DNA clamp is responsible for unassisted mutagenic translesion replication by DNA polymerase III holoenzyme.

    PubMed

    Tomer, G; Reuven, N B; Livneh, Z

    1998-11-24

    The replication of damaged nucleotides that have escaped DNA repair leads to the formation of mutations caused by misincorporation opposite the lesion. In Escherichia coli, this process is under tight regulation of the SOS stress response and is carried out by DNA polymerase III in a process that involves also the RecA, UmuD' and UmuC proteins. We have shown that DNA polymerase III holoenzyme is able to replicate, unassisted, through a synthetic abasic site in a gapped duplex plasmid. Here, we show that DNA polymerase III*, a subassembly of DNA polymerase III holoenzyme lacking the beta subunit, is blocked very effectively by the synthetic abasic site in the same DNA substrate. Addition of the beta subunit caused a dramatic increase of at least 28-fold in the ability of the polymerase to perform translesion replication, reaching 52% bypass in 5 min. When the ssDNA region in the gapped plasmid was extended from 22 nucleotides to 350 nucleotides, translesion replication still depended on the beta subunit, but it was reduced by 80%. DNA sequence analysis of translesion replication products revealed mostly -1 frameshifts. This mutation type is changed to base substitution by the addition of UmuD', UmuC, and RecA, as demonstrated in a reconstituted SOS translesion replication reaction. These results indicate that the beta subunit sliding DNA clamp is the major determinant in the ability of DNA polymerase III holoenzyme to perform unassisted translesion replication and that this unassisted bypass produces primarily frameshifts.

  3. Structure of the SSB-DNA polymerase III interface and its role in DNA replication

    SciTech Connect

    Marceau, Aimee H; Bahng, Soon; Massoni, Shawn C; George, Nicholas P; Sandler, Steven J; Marians, Kenneth J; Keck, James L

    2012-05-22

    Interactions between single-stranded DNA-binding proteins (SSBs) and the DNA replication machinery are found in all organisms, but the roles of these contacts remain poorly defined. In Escherichia coli, SSB's association with the χ subunit of the DNA polymerase III holoenzyme has been proposed to confer stability to the replisome and to aid delivery of primers to the lagging-strand DNA polymerase. Here, the SSB-binding site on χ is identified crystallographically and biochemical and cellular studies delineate the consequences of destabilizing the χ/SSB interface. An essential role for the χ/SSB interaction in lagging-strand primer utilization is not supported. However, sequence changes in χ that block complex formation with SSB lead to salt-dependent uncoupling of leading- and lagging-strand DNA synthesis and to a surprising obstruction of the leading-strand DNA polymerase in vitro, pointing to roles for the χ/SSB complex in replisome establishment and maintenance. Destabilization of the χ/SSB complex in vivo produces cells with temperature-dependent cell cycle defects that appear to arise from replisome instability.

  4. Maf1 is involved in coupling carbon metabolism to RNA polymerase III transcription.

    PubMed

    Cieśla, Małgorzata; Towpik, Joanna; Graczyk, Damian; Oficjalska-Pham, Danuta; Harismendy, Olivier; Suleau, Audrey; Balicki, Karol; Conesa, Christine; Lefebvre, Olivier; Boguta, Magdalena

    2007-11-01

    RNA polymerase III (Pol III) produces essential components of the biosynthetic machinery, and therefore its activity is tightly coupled with cell growth and metabolism. In the yeast Saccharomyces cerevisiae, Maf1 is the only known global and direct Pol III transcription repressor which mediates numerous stress signals. Here we demonstrate that transcription regulation by Maf1 is not limited to stress but is important for the switch between fermentation and respiration. Under respiratory conditions, Maf1 is activated by dephosphorylation and imported into the nucleus. The transition from a nonfermentable carbon source to that of glucose induces Maf1 phosphorylation and its relocation to the cytoplasm. The absence of Maf1-mediated control of tRNA synthesis impairs cell viability in nonfermentable carbon sources. The respiratory phenotype of maf1-Delta allowed genetic suppression studies to dissect the mechanism of Maf1 action on the Pol III transcription apparatus. Moreover, in cells grown in a nonfermentable carbon source, Maf1 regulates the levels of different tRNAs to various extents. The differences in regulation may contribute to the physiological role of Maf1.

  5. Architecture of TFIIIC and its role in RNA polymerase III pre-initiation complex assembly

    NASA Astrophysics Data System (ADS)

    Male, Gary; von Appen, Alexander; Glatt, Sebastian; Taylor, Nicholas M. I.; Cristovao, Michele; Groetsch, Helga; Beck, Martin; Müller, Christoph W.

    2015-06-01

    In eukaryotes, RNA Polymerase III (Pol III) is specifically responsible for transcribing genes encoding tRNAs and other short non-coding RNAs. The recruitment of Pol III to tRNA-encoding genes requires the transcription factors (TF) IIIB and IIIC. TFIIIC has been described as a conserved, multi-subunit protein complex composed of two subcomplexes, called τA and τB. How these two subcomplexes are linked and how their interaction affects the formation of the Pol III pre-initiation complex (PIC) is poorly understood. Here we use chemical crosslinking mass spectrometry and determine the molecular architecture of TFIIIC. We further report the crystal structure of the essential TPR array from τA subunit τ131 and characterize its interaction with a central region of τB subunit τ138. The identified τ131-τ138 interacting region is essential in vivo and overlaps with TFIIIB-binding sites, revealing a crucial interaction platform for the regulation of tRNA transcription initiation.

  6. Nutrient/TOR-dependent regulation of RNA polymerase III controls tissue and organismal growth in Drosophila.

    PubMed

    Marshall, Lynne; Rideout, Elizabeth J; Grewal, Savraj S

    2012-04-18

    The nutrient/target-of-rapamycin (TOR) pathway has emerged as a key regulator of tissue and organismal growth in metazoans. The signalling components of the nutrient/TOR pathway are well defined; however, the downstream effectors are less understood. Here, we show that the control of RNA polymerase (Pol) III-dependent transcription is an essential target of TOR in Drosophila. We find that TOR activity controls Pol III in growing larvae via inhibition of the repressor Maf1 and, in part, via the transcription factor Drosophila Myc (dMyc). Moreover, we show that loss of the Pol III factor, Brf, leads to reduced tissue and organismal growth and prevents TOR-induced cellular growth. TOR activity in the larval fat body, a tissue equivalent to vertebrate fat or liver, couples nutrition to insulin release from the brain. Accordingly, we find that fat-specific loss of Brf phenocopies nutrient limitation and TOR inhibition, leading to decreased systemic insulin signalling and reduced organismal growth. Thus, stimulation of Pol III is a key downstream effector of TOR in the control of cellular and systemic growth.

  7. Architecture of TFIIIC and its role in RNA polymerase III pre-initiation complex assembly

    PubMed Central

    Male, Gary; von Appen, Alexander; Glatt, Sebastian; Taylor, Nicholas M. I.; Cristovao, Michele; Groetsch, Helga; Beck, Martin; Müller, Christoph W.

    2015-01-01

    In eukaryotes, RNA Polymerase III (Pol III) is specifically responsible for transcribing genes encoding tRNAs and other short non-coding RNAs. The recruitment of Pol III to tRNA-encoding genes requires the transcription factors (TF) IIIB and IIIC. TFIIIC has been described as a conserved, multi-subunit protein complex composed of two subcomplexes, called τA and τB. How these two subcomplexes are linked and how their interaction affects the formation of the Pol III pre-initiation complex (PIC) is poorly understood. Here we use chemical crosslinking mass spectrometry and determine the molecular architecture of TFIIIC. We further report the crystal structure of the essential TPR array from τA subunit τ131 and characterize its interaction with a central region of τB subunit τ138. The identified τ131–τ138 interacting region is essential in vivo and overlaps with TFIIIB-binding sites, revealing a crucial interaction platform for the regulation of tRNA transcription initiation. PMID:26060179

  8. Rapid detection of Porcine circovirus 2 by recombinase polymerase amplification.

    PubMed

    Wang, Jianchang; Wang, Jinfeng; Liu, Libing; Li, Ruiwen; Yuan, Wanzhe

    2016-09-01

    Porcine circovirus-associated disease, caused primarily by Porcine circovirus 2 (PCV-2), has become endemic in many pig-producing countries and has resulted in significant economic losses to the swine industry worldwide. Tests for PCV-2 infection include PCR, nested PCR, competitive PCR, and real-time PCR (rtPCR). Recombinase polymerase amplification (RPA) has emerged as an isothermal gene amplification technology for the molecular detection of infectious disease agents. RPA is performed at a constant temperature and therefore can be carried out in a water bath. In addition, RPA is completed in ~30 min, much faster than PCR, which usually takes >60 min. We developed a RPA-based method for the detection of PCV-2. The detection limit of RPA was 10(2) copies of PCV-2 genomic DNA. RPA showed the same sensitivity as rtPCR but was 10 times more sensitive than conventional PCR. Successful amplification of PCV-2 DNA, but not other viral templates, demonstrated high specificity of the RPA assay. This method was also validated using clinical samples. The results showed that the RPA assay had a diagnostic agreement rate of 93.7% with conventional PCR and 100% with rtPCR. These findings suggest that the RPA assay is a simple, rapid, and cost-effective method for PCV-2 detection, which could be potentially applied in clinical diagnosis and field surveillance of PCV-2 infection. PMID:27493138

  9. Detection of Francisella tularensis by the polymerase chain reaction.

    PubMed

    Junhui, Z; Ruifu, Y; Jianchun, L; Songle, Z; Meiling, C; Fengxiang, C; Hong, C

    1996-12-01

    Francisella tularensis is the causative agent of tularaemia. Effective antibiotic treatment of tularaemia is now available, but the early diagnosis of tularaemia remains a problem. Four primers (three pairs) were designed to detect F. tularensis by the polymerase chain reaction (PCR), based on the previously published nucleotide sequence of T-cell epitopes of a F. tularensis membrane protein. Amplification of purified F. tularensis chromosomal DNA with the three pairs of primers resulted in three different products with sizes consistent with those predicted from sequence data (211 bp, 347 bp and 568 bp). The specificity of the PCR was confirmed as no amplification was detected with a range of other bacteria. The sensitivity of the PCR was determined with limiting dilution PCR and viable counts. The preliminary application of the PCR to the detection of F. tularensis in aerosols and experimentally infected mice was investigated. Comparison of the results with those from traditional culture indicated that PCR was more sensitive. The animal challenge test showed that, 24 h after inoculation with 15 cfu of F. tularensis, 38 (82.6%) of 46 blood samples were positive by PCR, whereas only 22 (47.8%) were positive by culture. The results showed that PCR is a helpful tool for the detection of F. tularensis in blood, liver and spleen which should enable the rapid confirmation of clinical diagnoses of tularaemia. PMID:8958253

  10. Rapid detection of Porcine circovirus 2 by recombinase polymerase amplification.

    PubMed

    Wang, Jianchang; Wang, Jinfeng; Liu, Libing; Li, Ruiwen; Yuan, Wanzhe

    2016-09-01

    Porcine circovirus-associated disease, caused primarily by Porcine circovirus 2 (PCV-2), has become endemic in many pig-producing countries and has resulted in significant economic losses to the swine industry worldwide. Tests for PCV-2 infection include PCR, nested PCR, competitive PCR, and real-time PCR (rtPCR). Recombinase polymerase amplification (RPA) has emerged as an isothermal gene amplification technology for the molecular detection of infectious disease agents. RPA is performed at a constant temperature and therefore can be carried out in a water bath. In addition, RPA is completed in ~30 min, much faster than PCR, which usually takes >60 min. We developed a RPA-based method for the detection of PCV-2. The detection limit of RPA was 10(2) copies of PCV-2 genomic DNA. RPA showed the same sensitivity as rtPCR but was 10 times more sensitive than conventional PCR. Successful amplification of PCV-2 DNA, but not other viral templates, demonstrated high specificity of the RPA assay. This method was also validated using clinical samples. The results showed that the RPA assay had a diagnostic agreement rate of 93.7% with conventional PCR and 100% with rtPCR. These findings suggest that the RPA assay is a simple, rapid, and cost-effective method for PCV-2 detection, which could be potentially applied in clinical diagnosis and field surveillance of PCV-2 infection.

  11. RNA polymerase III component Rpc9 regulates hematopoietic stem and progenitor cell maintenance in zebrafish.

    PubMed

    Wei, Yonglong; Xu, Jin; Zhang, Wenqing; Wen, Zilong; Liu, Feng

    2016-06-15

    Hematopoietic stem and progenitor cells (HSPCs) are capable of self-renewal and replenishing all lineages of blood cells throughout life and are thus crucial for tissue homeostasis. However, the mechanism regulating HSPC development is still incompletely understood. Here, we isolate a zebrafish mutant with defective T lymphopoiesis and positional cloning identifies that Rpc9, a component of DNA-directed RNA polymerase III (Pol III) complex, is responsible for the mutant phenotype. Further analysis shows that rpc9 deficiency leads to the impairment of HSPCs and their derivatives in zebrafish embryos. Excessive apoptosis is observed in the caudal hematopoietic tissue (CHT; the equivalent of fetal liver in mammals) of rpc9(-/-) embryos and the hematopoietic defects in these embryos can be fully rescued by suppression of p53 Thus, our work illustrates that Rpc9, a component of Pol III, plays an important tissue-specific role in HSPC maintenance during zebrafish embryogenesis and might be conserved across vertebrates, including mammals. PMID:27151951

  12. Recessive mutations in POLR1C cause a leukodystrophy by impairing biogenesis of RNA polymerase III

    PubMed Central

    Thiffault, Isabelle; Wolf, Nicole I.; Forget, Diane; Guerrero, Kether; Tran, Luan T.; Choquet, Karine; Lavallée-Adam, Mathieu; Poitras, Christian; Brais, Bernard; Yoon, Grace; Sztriha, Laszlo; Webster, Richard I.; Timmann, Dagmar; van de Warrenburg, Bart P.; Seeger, Jürgen; Zimmermann, Alíz; Máté, Adrienn; Goizet, Cyril; Fung, Eva; van der Knaap, Marjo S.; Fribourg, Sébastien; Vanderver, Adeline; Simons, Cas; Taft, Ryan J.; Yates III, John R.; Coulombe, Benoit; Bernard, Geneviève

    2015-01-01

    A small proportion of 4H (Hypomyelination, Hypodontia and Hypogonadotropic Hypogonadism) or RNA polymerase III (POLR3)-related leukodystrophy cases are negative for mutations in the previously identified causative genes POLR3A and POLR3B. Here we report eight of these cases carrying recessive mutations in POLR1C, a gene encoding a shared POLR1 and POLR3 subunit, also mutated in some Treacher Collins syndrome (TCS) cases. Using shotgun proteomics and ChIP sequencing, we demonstrate that leukodystrophy-causative mutations, but not TCS mutations, in POLR1C impair assembly and nuclear import of POLR3, but not POLR1, leading to decreased binding to POLR3 target genes. This study is the first to show that distinct mutations in a gene coding for a shared subunit of two RNA polymerases lead to selective modification of the enzymes' availability leading to two different clinical conditions and to shed some light on the pathophysiological mechanism of one of the most common hypomyelinating leukodystrophies, POLR3-related leukodystrophy. PMID:26151409

  13. Global analysis of transcriptionally engaged yeast RNA polymerase III reveals extended tRNA transcripts

    PubMed Central

    Turowski, Tomasz W.; Leśniewska, Ewa; Delan-Forino, Clementine; Sayou, Camille; Boguta, Magdalena; Tollervey, David

    2016-01-01

    RNA polymerase III (RNAPIII) synthesizes a range of highly abundant small stable RNAs, principally pre-tRNAs. Here we report the genome-wide analysis of nascent transcripts attached to RNAPIII under permissive and restrictive growth conditions. This revealed strikingly uneven polymerase distributions across transcription units, generally with a predominant 5′ peak. This peak was higher for more heavily transcribed genes, suggesting that initiation site clearance is rate-limiting during RNAPIII transcription. Down-regulation of RNAPIII transcription under stress conditions was found to be uneven; a subset of tRNA genes showed low response to nutrient shift or loss of the major transcription regulator Maf1, suggesting potential “housekeeping” roles. Many tRNA genes were found to generate long, 3′-extended forms due to read-through of the canonical poly(U) terminators. The degree of read-through was anti-correlated with the density of U-residues in the nascent tRNA, and multiple, functional terminators can be located far downstream. The steady-state levels of 3′-extended pre-tRNA transcripts are low, apparently due to targeting by the nuclear surveillance machinery, especially the RNA binding protein Nab2, cofactors for the nuclear exosome, and the 5′-exonuclease Rat1. PMID:27206856

  14. Characterization of the RNA polymerase II and III complexes in Leishmania major.

    PubMed

    Martínez-Calvillo, Santiago; Saxena, Alka; Green, Amanda; Leland, Aaron; Myler, Peter J

    2007-04-01

    Transcription of protein-coding genes in Leishmania major and other trypanosomatids differs from that in most eukaryotes and bioinformatic analyses have failed to identify several components of the RNA polymerase (RNAP) complexes. To increase our knowledge about this basic cellular process, we used tandem affinity purification (TAP) to identify subunits of RNAP II and III. Mass spectrometric analysis of the complexes co-purified with TAP-tagged LmRPB2 (encoded by LmjF31.0160) identified seven RNAP II subunits: RPB1, RPB2, RPB3, RPB5, RPB7, RPB10 and RPB11. With the exception of RPB10 and RPB11, and the addition of RPB8, these were also identified using TAP-tagged constructs of one (encoded by LmjF34.0890) of the two LmRPB6 orthologues. The latter experiments also identified the RNAP III subunits RPC1 (C160), RPC2 (C128), RPC3 (C82), RPC4 (C53), RPC5 (C37), RPC6 (C34), RPC9 (C17), RPAC1 (AC40) and RPAC2 (AC19). Significantly, the complexes precipitated by TAP-tagged LmRPB6 did not contain any RNAP I-specific subunits, suggesting that, unlike in other eukaryotes, LmRPB6 is not shared by all three polymerases but is restricted to RNAP II and III, while the LmRPB6z (encoded by LmjF25.0140) isoform is limited to RNAP I. Similarly, we identified peptides from only one (encoded by LmjF18.0780) of the two RPB5 orthologues and one (LmjF13.1120) of the two RPB10 orthologues, suggesting that LmRPB5z (LmjF18.0790) and LmRPB10z (LmjF13.1120) are also restricted to RNAP I. In addition to these RNAP subunits, we also identified a number of other proteins that co-purified with the RNAP II and III complexes, including a potential transcription factor, several histones, an ATPase involved in chromosome segregation, an endonuclease, four helicases, RNA splicing factor PTSR-1, at least two RNA binding proteins and several proteins of unknown function. PMID:17275824

  15. Integrated reverse transcription polymerase chain reaction systems for virus detection.

    PubMed

    Lien, Kang-Yi; Lee, Wan-Chi; Lei, Huan-Yao; Lee, Gwo-Bin

    2007-03-15

    The current study reports on an integrated microreverse transcription polymerase chain reaction (RT-PCR) system for molecular diagnosis of microorganisms automatically. By using antibodies-conjugated superparamagnetic beads, the developed system can detect viruses with higher sensitivity and specificity when compared with traditional biological diagnosis methods using a ribonucleic acid (RNA) extraction kit. The target viruses were first captured by the conjugated antibodies on the magnetic beads, and were enriched using a magnetic field generated by micro-electromagnets or permanent magnets. With this approach, the virus can be purified and concentrated first, then the virus RNA was extracted and transcripted to complementary deoxyribonucleic acid (cDNA), followed by a nucleic acid amplification process using a micro-RT-PCR module. The integrated microfluidic chip can perform the whole process automatically with the aid of integrated micropumps and microvalves. This study successfully performs the specific detection of two different types of viruses, Dengue virus serotype 2 and enterovirus (EV) 71 using this developed integrated system. Comparable to a large-scale apparatus, the integrated microsystem can perform mixing, incubation, purification, transportation, and nucleic acid amplification of virus, possibly making it a crucial platform for future diagnosis applications.

  16. Detection of flaviviruses by reverse-transcriptase polymerase chain reaction.

    PubMed

    Eldadah, Z A; Asher, D M; Godec, M S; Pomeroy, K L; Goldfarb, L G; Feinstone, S M; Levitan, H; Gibbs, C J; Gajdusek, D C

    1991-04-01

    RNA sequences of five flaviviruses were detected by a modified polymerase chain reaction (PCR) that incorporated a reverse transcriptase and RNase inhibitor. Oligonucleotide primer pairs were synthesized to amplify sequences from St. Louis encephalitis (SLE), Japanese encephalitis (JBE), yellow fever (YF), dengue 2 (DEN-2), and dengue 4 (DEN-4) viruses. The amplified products were visualized as bands of appropriate size on ethidium bromide-stained agarose gels. The identity of these products was confirmed by restriction endonuclease cleavage to generate fragments of predicted lengths. The reverse-transcriptase PCR (RT-PCR) successfully amplified flavivirus sequences from cell cultures, frozen brain tissue, and formalin-fixed, paraffin-embedded brain tissue. The reactions were highly specific, and the method compared favorably to two conventional assays of viral infectivity. RT-PCR followed by PCR with nesting primers (N-PCR) was 1,000-fold more sensitive in detecting virus than classical infectivity titration by intracerebral inoculation of suckling mice and nearly 1,000-fold more sensitive than amplification of virus in cell culture followed by inoculation of mice.

  17. Subcellular distribution of small interfering RNA: directed delivery through RNA polymerase III expression cassettes and localization by in situ hybridization.

    PubMed

    Paul, Cynthia P

    2005-01-01

    Reduction in the expression of specific genes through small interfering RNAs (siRNAs) is dependent on the colocalization of siRNAs with other components of the RNA interference (RNAi) pathways within the cell. The expression of siRNAs within cells from cassettes that are derived from genes transcribed by RNA polymerase III (pol III) and provide for selective subcellular distribution of their products can be used to direct siRNAs to the cellular pathways. Expression from the human U6 promoter, resulting in siRNA accumulation in the nucleus, is effective in reducing gene expression, whereas cytoplasmic and nucleolar localization of the siRNA when expressed from the 5S or 7 SL promoters is not effective. The distribution of siRNA within the cell is determined by fluorescence in situ hybridization. Although the long uninterrupted duplex of siRNA makes it difficult to detect with DNA oligonucleotide probes, labeled oligonucleotide probes with 2'-O-methyl RNA backbones provide the stability needed for a strong signal. These methods contribute to studies of the interconnected cellular RNAi pathways and are useful in adapting RNAi as a tool to determine gene function and develop RNA-based therapeutics. PMID:15644179

  18. [Detection of bacterial DNA using the polymerase chain reaction (PCR)].

    PubMed

    Höfler, G

    1994-01-01

    Enzymatic amplification of DNA using the polymerase chain reaction (PCR) is a very sensitive and rapid way of detecting specific DNA sequences. Bacterial DNA can be detected in a wide variety of samples provided at least partial sequence information is available. For a great number of bacteria PCR detection methods have been published. Most important for the pathologist are mycobacteriae (M. tuberculosis, avium, etc.). Borellia burgdorferi, Listeria monozytogenes and chlamydiae (Ce. trachomatis, C. psittaci). Fresh or fixed paraffin embedded tissues, exfoliated cells, whole blood, serum, sputum, urine, ascites or pleural fluid etc. can be analyzed. The time needed to perform the analysis varies between 5 hours and 2 days mostly depending on the DNA extraction method. Several potential pitfalls have to be avoided. The most common problem is contamination of reagents with target DNA. Amplification of DNA from biological samples may be prevented by enzyme inhibitors (salts, proteins). This problem can at least partially be avoided by changing the DNA purification method. Several additional problems may arise if bacterial DNA has to be amplified. Bacterial walls may have to be disrupted using heat or detergent for accessibility of target DNA. Positive results have to be judged carefully. Unlike the situation in retroviral infections with the virus sometimes present in the absence of disease, in the majority of bacterial infections the presence of bacteria signals manifest disease. A possible exception may be the finding of mycobacterial DNA in sarcoidosis patients who can be treated with steroids without provoking tuberculosis. PCR is especially useful in situations where rapid results are necessary or only fixed tissue is available.(ABSTRACT TRUNCATED AT 250 WORDS) PMID:7533972

  19. RNA Polymerase III Output Is Functionally Linked to tRNA Dimethyl-G26 Modification.

    PubMed

    Arimbasseri, Aneeshkumar G; Blewett, Nathan H; Iben, James R; Lamichhane, Tek N; Cherkasova, Vera; Hafner, Markus; Maraia, Richard J

    2015-12-01

    Control of the differential abundance or activity of tRNAs can be important determinants of gene regulation. RNA polymerase (RNAP) III synthesizes all tRNAs in eukaryotes and it derepression is associated with cancer. Maf1 is a conserved general repressor of RNAP III under the control of the target of rapamycin (TOR) that acts to integrate transcriptional output and protein synthetic demand toward metabolic economy. Studies in budding yeast have indicated that the global tRNA gene activation that occurs with derepression of RNAP III via maf1-deletion is accompanied by a paradoxical loss of tRNA-mediated nonsense suppressor activity, manifested as an antisuppression phenotype, by an unknown mechanism. We show that maf1-antisuppression also occurs in the fission yeast S. pombe amidst general activation of RNAP III. We used tRNA-HydroSeq to document that little changes occurred in the relative levels of different tRNAs in maf1Δ cells. By contrast, the efficiency of N2,N2-dimethyl G26 (m(2)2G26) modification on certain tRNAs was decreased in response to maf1-deletion and associated with antisuppression, and was validated by other methods. Over-expression of Trm1, which produces m(2)2G26, reversed maf1-antisuppression. A model that emerges is that competition by increased tRNA levels in maf1Δ cells leads to m(2)2G26 hypomodification due to limiting Trm1, reducing the activity of suppressor-tRNASerUCA and accounting for antisuppression. Consistent with this, we show that RNAP III mutations associated with hypomyelinating leukodystrophy decrease tRNA transcription, increase m(2)2G26 efficiency and reverse antisuppression. Extending this more broadly, we show that a decrease in tRNA synthesis by treatment with rapamycin leads to increased m(2)2G26 modification and that this response is conserved among highly divergent yeasts and human cells. PMID:26720005

  20. RNA Polymerase III Output Is Functionally Linked to tRNA Dimethyl-G26 Modification

    PubMed Central

    Arimbasseri, Aneeshkumar G.; Blewett, Nathan H.; Iben, James R.; Lamichhane, Tek N.; Cherkasova, Vera; Hafner, Markus; Maraia, Richard J.

    2015-01-01

    Control of the differential abundance or activity of tRNAs can be important determinants of gene regulation. RNA polymerase (RNAP) III synthesizes all tRNAs in eukaryotes and it derepression is associated with cancer. Maf1 is a conserved general repressor of RNAP III under the control of the target of rapamycin (TOR) that acts to integrate transcriptional output and protein synthetic demand toward metabolic economy. Studies in budding yeast have indicated that the global tRNA gene activation that occurs with derepression of RNAP III via maf1-deletion is accompanied by a paradoxical loss of tRNA-mediated nonsense suppressor activity, manifested as an antisuppression phenotype, by an unknown mechanism. We show that maf1-antisuppression also occurs in the fission yeast S. pombe amidst general activation of RNAP III. We used tRNA-HydroSeq to document that little changes occurred in the relative levels of different tRNAs in maf1Δ cells. By contrast, the efficiency of N2,N2-dimethyl G26 (m2 2G26) modification on certain tRNAs was decreased in response to maf1-deletion and associated with antisuppression, and was validated by other methods. Over-expression of Trm1, which produces m2 2G26, reversed maf1-antisuppression. A model that emerges is that competition by increased tRNA levels in maf1Δ cells leads to m2 2G26 hypomodification due to limiting Trm1, reducing the activity of suppressor-tRNASerUCA and accounting for antisuppression. Consistent with this, we show that RNAP III mutations associated with hypomyelinating leukodystrophy decrease tRNA transcription, increase m2 2G26 efficiency and reverse antisuppression. Extending this more broadly, we show that a decrease in tRNA synthesis by treatment with rapamycin leads to increased m2 2G26 modification and that this response is conserved among highly divergent yeasts and human cells. PMID:26720005

  1. Virus-induced gene silencing of RPC5-like subunit of RNA polymerase III caused pleiotropic effects in Nicotiana benthamiana

    Technology Transfer Automated Retrieval System (TEKTRAN)

    In eukaryotic cells, RNA polymerase III is highly conserved, contains 17 subunits and transcribes housekeeping genes such as ribosomal 50S rRNA, tRNA and other small RNAs. Functional roles of the RPC5 are poorly characterized in the literature. In this work, we report that virus-induced gene silenci...

  2. Rapid detection of Mycobacterium tuberculosis by recombinase polymerase amplification.

    PubMed

    Boyle, David S; McNerney, Ruth; Teng Low, Hwee; Leader, Brandon Troy; Pérez-Osorio, Ailyn C; Meyer, Jessica C; O'Sullivan, Denise M; Brooks, David G; Piepenburg, Olaf; Forrest, Matthew S

    2014-01-01

    Improved access to effective tests for diagnosing tuberculosis (TB) has been designated a public health priority by the World Health Organisation. In high burden TB countries nucleic acid based TB tests have been restricted to centralised laboratories and specialised research settings. Requirements such as a constant electrical supply, air conditioning and skilled, computer literate operators prevent implementation of such tests in many settings. Isothermal DNA amplification technologies permit the use of simpler, less energy intensive detection platforms more suited to low resource settings that allow the accurate diagnosis of a disease within a short timeframe. Recombinase Polymerase Amplification (RPA) is a rapid, low temperature isothermal DNA amplification reaction. We report here RPA-based detection of Mycobacterium tuberculosis complex (MTC) DNA in <20 minutes at 39 °C. Assays for two MTC specific targets were investigated, IS6110 and IS1081. When testing purified MTC genomic DNA, limits of detection of 6.25 fg (IS6110) and 20 fg (IS1081)were consistently achieved. When testing a convenience sample of pulmonary specimens from suspected TB patients, RPA demonstrated superior accuracy to indirect fluorescence microscopy. Compared to culture, sensitivities for the IS1081 RPA and microscopy were 91.4% (95%CI: 85, 97.9) and 86.1% (95%CI: 78.1, 94.1) respectively (n = 71). Specificities were 100% and 88.6% (95% CI: 80.8, 96.1) respectively. For the IS6110 RPA and microscopy sensitivities of 87.5% (95%CI: 81.7, 93.2) and 70.8% (95%CI: 62.9, 78.7) were obtained (n = 90). Specificities were 95.4 (95% CI: 92.3,98.1) and 88% (95% CI: 83.6, 92.4) respectively. The superior specificity of RPA for detecting tuberculosis was due to the reduced ability of fluorescence microscopy to distinguish Mtb complex from other acid fast bacteria. The rapid nature of the RPA assay and its low energy requirement compared to other amplification technologies suggest RPA-based TB assays

  3. Subunit compositions of Arabidopsis RNA polymerases I and III reveal Pol I- and Pol III-specific forms of the AC40 subunit and alternative forms of the C53 subunit

    SciTech Connect

    Ream, Thomas S.; Haag, Jeremy R.; Pontvianne, Frederic; Nicora, Carrie D.; Norbeck, Angela D.; Pasa-Tolic, Ljiljana; Pikaard, Craig S.

    2015-05-02

    Using affinity purification and mass spectrometry, we identified the subunits of Arabidopsis thaliana multisubunit RNA Polymerases I and III (abbreviated as Pol I and Pol III), providing the first description of their physical compositions in plants. AC40 and AC19 subunits are typically common to Pol I (a.k.a. Pol A) and Pol III (a.k.a. Pol C) and are encoded by single genes whose mutation, in humans, is a cause of the craniofacial disorder, Treacher-Collins Syndrome. Surprisingly, A. thaliana, and related species, express two distinct AC40 paralogs, one of which assembles into Pol I and the other of which assembles into Pol III. Changes at eight amino acid positions correlate with this functional divergence of Pol I and Pol III-specific AC40 paralogs. Two genes encode homologs of the yeast C53 subunit, and either variant can assemble into Pol III. By contrast, only one of two potential C17 variants, and one of two potential C31 variants were detected in Pol III. We introduce a new nomenclature system for plant Pol I and Pol III subunits in which the twelve subunits that are structurally and functionally homologous among Pols I through V are assigned equivalent numbers.

  4. Subunit compositions of Arabidopsis RNA polymerases I and III reveal Pol I- and Pol III-specific forms of the AC40 subunit and alternative forms of the C53 subunit

    DOE PAGES

    Ream, Thomas S.; Haag, Jeremy R.; Pontvianne, Frederic; Nicora, Carrie D.; Norbeck, Angela D.; Pasa-Tolic, Ljiljana; Pikaard, Craig S.

    2015-05-02

    Using affinity purification and mass spectrometry, we identified the subunits of Arabidopsis thaliana multisubunit RNA Polymerases I and III (abbreviated as Pol I and Pol III), providing the first description of their physical compositions in plants. AC40 and AC19 subunits are typically common to Pol I (a.k.a. Pol A) and Pol III (a.k.a. Pol C) and are encoded by single genes whose mutation, in humans, is a cause of the craniofacial disorder, Treacher-Collins Syndrome. Surprisingly, A. thaliana, and related species, express two distinct AC40 paralogs, one of which assembles into Pol I and the other of which assembles into Polmore » III. Changes at eight amino acid positions correlate with this functional divergence of Pol I and Pol III-specific AC40 paralogs. Two genes encode homologs of the yeast C53 subunit, and either variant can assemble into Pol III. By contrast, only one of two potential C17 variants, and one of two potential C31 variants were detected in Pol III. We introduce a new nomenclature system for plant Pol I and Pol III subunits in which the twelve subunits that are structurally and functionally homologous among Pols I through V are assigned equivalent numbers.« less

  5. Detection of Chlamydia pneumoniae by polymerase chain reaction.

    PubMed

    Campbell, L A; Perez Melgosa, M; Hamilton, D J; Kuo, C C; Grayston, J T

    1992-02-01

    While criteria for serodiagnosis of Chlamydia pneumoniae infection are well established, isolation of the organism is often difficult. To increase detection of this organism, C. pneumoniae-specific sequences were identified to permit amplification of C. pneumoniae by polymerase chain reaction (PCR). A cloned C. pneumoniae 474-bp PstI fragment was shown by dot blot and Southern hybridization to differentiate C. pneumoniae from the other Chlamydia spp., react with all C. pneumoniae isolates tested, and not recognize DNA from normal throat flora or common respiratory tract agents. This cloned fragment was sequenced and primers for use in PCR were chosen on the bases of GenBank analysis, G + C ratio, and absence of secondary structure. All C. pneumoniae isolates tested were amplified by the HL-1-HR-1 primer pair or the HM-1-HR-1 primer pair, producing the expected 437- and 229-bp amplification products, respectively. None of the Chlamydia trachomatis serovars (B/TW-5/OT, C/TW-3/OT, D/UW-3/Cx, E/UW-5/Cx, F/UW-6/Cx, H/UW-4/Cx, I/UW-12/Ur, and L2/434/Bu), Chlamydia psittaci strains (Mn, 6BC, GPIC, FP, and OA), HeLa cells, or other organisms tested were amplified. Reaction conditions including MgCl2, oligonucleotides, and primer concentrations and temperature were optimized before application to clinical samples. Clinical specimens from patients from whom C. pneumoniae was isolated were also positive by PCR, while samples from patients with known C. trachomatis or C. psittaci infection were not amplified by PCR.

  6. Loss of the RNA polymerase III repressor MAF1 confers obesity resistance

    PubMed Central

    Bonhoure, Nicolas; Byrnes, Ashlee; Moir, Robyn D.; Hodroj, Wassim; Preitner, Frédéric; Praz, Viviane; Marcelin, Genevieve; Chua, Streamson C.; Martinez-Lopez, Nuria; Singh, Rajat; Moullan, Norman; Auwerx, Johan; Willemin, Gilles; Shah, Hardik; Hartil, Kirsten; Vaitheesvaran, Bhavapriya; Kurland, Irwin

    2015-01-01

    MAF1 is a global repressor of RNA polymerase III transcription that regulates the expression of highly abundant noncoding RNAs in response to nutrient availability and cellular stress. Thus, MAF1 function is thought to be important for metabolic economy. Here we show that a whole-body knockout of Maf1 in mice confers resistance to diet-induced obesity and nonalcoholic fatty liver disease by reducing food intake and increasing metabolic inefficiency. Energy expenditure in Maf1−/− mice is increased by several mechanisms. Precursor tRNA synthesis was increased in multiple tissues without significant effects on mature tRNA levels, implying increased turnover in a futile tRNA cycle. Elevated futile cycling of hepatic lipids was also observed. Metabolite profiling of the liver and skeletal muscle revealed elevated levels of many amino acids and spermidine, which links the induction of autophagy in Maf1−/− mice with their extended life span. The increase in spermidine was accompanied by reduced levels of nicotinamide N-methyltransferase, which promotes polyamine synthesis, enables nicotinamide salvage to regenerate NAD+, and is associated with obesity resistance. Consistent with this, NAD+ levels were increased in muscle. The importance of MAF1 for metabolic economy reveals the potential for MAF1 modulators to protect against obesity and its harmful consequences. PMID:25934505

  7. Loss of the RNA polymerase III repressor MAF1 confers obesity resistance.

    PubMed

    Bonhoure, Nicolas; Byrnes, Ashlee; Moir, Robyn D; Hodroj, Wassim; Preitner, Frédéric; Praz, Viviane; Marcelin, Genevieve; Chua, Streamson C; Martinez-Lopez, Nuria; Singh, Rajat; Moullan, Norman; Auwerx, Johan; Willemin, Gilles; Shah, Hardik; Hartil, Kirsten; Vaitheesvaran, Bhavapriya; Kurland, Irwin; Hernandez, Nouria; Willis, Ian M

    2015-05-01

    MAF1 is a global repressor of RNA polymerase III transcription that regulates the expression of highly abundant noncoding RNAs in response to nutrient availability and cellular stress. Thus, MAF1 function is thought to be important for metabolic economy. Here we show that a whole-body knockout of Maf1 in mice confers resistance to diet-induced obesity and nonalcoholic fatty liver disease by reducing food intake and increasing metabolic inefficiency. Energy expenditure in Maf1(-/-) mice is increased by several mechanisms. Precursor tRNA synthesis was increased in multiple tissues without significant effects on mature tRNA levels, implying increased turnover in a futile tRNA cycle. Elevated futile cycling of hepatic lipids was also observed. Metabolite profiling of the liver and skeletal muscle revealed elevated levels of many amino acids and spermidine, which links the induction of autophagy in Maf1(-/-) mice with their extended life span. The increase in spermidine was accompanied by reduced levels of nicotinamide N-methyltransferase, which promotes polyamine synthesis, enables nicotinamide salvage to regenerate NAD(+), and is associated with obesity resistance. Consistent with this, NAD(+) levels were increased in muscle. The importance of MAF1 for metabolic economy reveals the potential for MAF1 modulators to protect against obesity and its harmful consequences. PMID:25934505

  8. Stabilization of the Escherichia coli DNA polymerase III ε subunit by the θ subunit favors in vivo assembly of the Pol III catalytic core.

    PubMed

    Conte, Emanuele; Vincelli, Gabriele; Schaaper, Roel M; Bressanin, Daniela; Stefan, Alessandra; Dal Piaz, Fabrizio; Hochkoeppler, Alejandro

    2012-07-15

    Escherichia coli DNA polymerase III holoenzyme (HE) contains a core polymerase consisting of three subunits: α (polymerase), ε (3'-5' exonuclease), and θ. Genetic experiments suggested that θ subunit stabilizes the intrinsically labile ε subunit and, furthermore, that θ might affect the cellular amounts of Pol III core and HE. Here, we provide biochemical evidence supporting this model by analyzing the amounts of the relevant proteins. First, we show that a ΔholE strain (lacking θ subunit) displays reduced amounts of free ε. We also demonstrate the existence of a dimer of ε, which may be involved in the stabilization of the protein. Second, θ, when overexpressed, dissociates the ε dimer and significantly increases the amount of Pol III core. The stability of ε also depends on cellular chaperones, including DnaK. Here, we report that: (i) temperature shift-up of ΔdnaK strains leads to rapid depletion of ε, and (ii) overproduction of θ overcomes both the depletion of ε and the temperature sensitivity of the strain. Overall, our data suggest that ε is a critical factor in the assembly of Pol III core, and that this is role is strongly influenced by the θ subunit through its prevention of ε degradation.

  9. Ty1 Integrase Interacts with RNA Polymerase III-specific Subcomplexes to Promote Insertion of Ty1 Elements Upstream of Polymerase (Pol) III-transcribed Genes.

    PubMed

    Cheung, Stephanie; Ma, Lina; Chan, Patrick H W; Hu, Hui-Lan; Mayor, Thibault; Chen, Hung-Ta; Measday, Vivien

    2016-03-18

    Retrotransposons are eukaryotic mobile genetic elements that transpose by reverse transcription of an RNA intermediate and are derived from retroviruses. The Ty1 retrotransposon of Saccharomyces cerevisiae belongs to the Ty1/Copia superfamily, which is present in every eukaryotic genome. Insertion of Ty1 elements into the S. cerevisiae genome, which occurs upstream of genes transcribed by RNA Pol III, requires the Ty1 element-encoded integrase (IN) protein. Here, we report that Ty1-IN interacts in vivo and in vitro with RNA Pol III-specific subunits to mediate insertion of Ty1 elements upstream of Pol III-transcribed genes. Purification of Ty1-IN from yeast cells followed by mass spectrometry (MS) analysis identified an enrichment of peptides corresponding to the Rpc82/34/31 and Rpc53/37 Pol III-specific subcomplexes. GFP-Trap purification of multiple GFP-tagged RNA Pol III subunits from yeast extracts revealed that the majority of Pol III subunits co-purify with Ty1-IN but not two other complexes required for Pol III transcription, transcription initiation factors (TF) IIIB and IIIC. In vitro binding studies with bacterially purified RNA Pol III proteins demonstrate that Rpc31, Rpc34, and Rpc53 interact directly with Ty1-IN. Deletion of the N-terminal 280 amino acids of Rpc53 abrogates insertion of Ty1 elements upstream of the hot spot SUF16 tRNA locus and abolishes the interaction of Ty1-IN with Rpc37. The Rpc53/37 complex therefore has an important role in targeting Ty1-IN to insert Ty1 elements upstream of Pol III-transcribed genes. PMID:26797132

  10. Detection of short tandem repeat polymorphisms from human nails using direct polymerase chain reaction method.

    PubMed

    Tie, Jian; Uchigasaki, Seisaku

    2014-11-01

    Human nail is an important forensic material for parental testing and individual identification in large-scale disasters. Detection of STR polymorphism from hard tissues generally requires DNA purification, which is technically complicated and time consuming. In the present study, we attempted to detect STR polymorphisms from untreated human nail samples by direct PCR amplification method using the primer mixture supplied with the GenePrint® SilverSTR® III System or the AmpFℓSTR® Identifiler® PCR Amplification Kit, and Tks Gflex DNA polymerase known to be effective for amplification from crude samples. A nail fragment measuring approximately 1.5 mm in breadth and 0.5 mm in length was placed directly into a PCR tube, and various PCR conditions were tested. The PCR products were analyzed by denaturing acrylamide gel electrophoresis or CE. Multiple STR polymorphisms were detected successfully. This method that detects STR polymorphisms not only from fresh human fingernails, but also from old nail fragments stored at room temperature for up to 10 years is expected to become a novel DNA analytical method in forensic medicine and genetic studies.

  11. Cytosolic DNA triggers mitochondrial apoptosis via DNA damage signaling proteins independently of AIM2 and RNA polymerase III.

    PubMed

    Wenzel, Michael; Wunderlich, Michael; Besch, Robert; Poeck, Hendrik; Willms, Simone; Schwantes, Astrid; Kremer, Melanie; Sutter, Gerd; Endres, Stefan; Schmidt, Andreas; Rothenfusser, Simon

    2012-01-01

    A key host response to limit microbial spread is the induction of cell death when foreign nucleic acids are sensed within infected cells. In mouse macrophages, transfected DNA or infection with modified vaccinia virus Ankara (MVA) can trigger cell death via the absent in melanoma 2 (AIM2) inflammasome. In this article, we show that nonmyeloid human cell types lacking a functional AIM2 inflammasome still die in response to cytosolic delivery of different DNAs or infection with MVA. This cell death induced by foreign DNA is independent of caspase-8 and carries features of mitochondrial apoptosis: dependence on BAX, APAF-1, and caspase-9. Although it does not require the IFN pathway known to be triggered by infection with MVA or transfected DNA via polymerase III and retinoid acid-induced gene I-like helicases, it shows a strong dependence on components of the DNA damage signaling pathway: cytosolic delivery of DNA or infection with MVA leads to phosphorylation of p53 (serines 15 and 46) and autophosphorylation of ataxia telangiectasia mutated (ATM); depleting p53 or ATM with small interfering RNA or inhibiting the ATM/ATM-related kinase family by caffeine strongly reduces apoptosis. Taken together, our findings suggest that a pathway activating DNA damage signaling plays an important independent role in detecting intracellular foreign DNA, thereby complementing the induction of IFN and activation of the AIM2 inflammasome. PMID:22140256

  12. Application of polymerase chain reaction to detect adulteration of sheep's milk with goats' milk.

    PubMed

    López-Calleja, I; González, I; Fajardo, V; Martín, I; Hernández, P E; García, T; Martín, R

    2005-09-01

    The polymerase chain reaction has been applied for the specific detection of goats' milk in sheep's milk using primers targeting the mitochondrial 12S ribosomal RNA gene. The use of goat-specific primers yielded a 122-bp fragment from goats' milk DNA, whereas no amplification signal was obtained in sheep's, cows', and water buffaloes' milk DNA. Polymerase chain reaction analysis of raw and heat-treated milk binary mixtures of sheep/goat enabled the specific detection of goats' milk with a sensitivity threshold of 0.1%. This study demonstrates the usefulness of the proposed polymerase chain reaction assay for authentication of milk products in routine analysis.

  13. Mutations Affecting Potassium Import Restore the Viability of the Escherichia coli DNA Polymerase III holD Mutant

    PubMed Central

    Durand, Adeline

    2016-01-01

    Mutants lacking the ψ (HolD) subunit of the Escherichia coli DNA Polymerase III holoenzyme (Pol III HE) have poor viability, but a residual growth allows the isolation of spontaneous suppressor mutations that restore ΔholD mutant viability. Here we describe the isolation and characterization of two suppressor mutations in the trkA and trkE genes, involved in the main E. coli potassium import system. Viability of ΔholD trk mutants is abolished on media with low or high K+ concentrations, where alternative K+ import systems are activated, and is restored on low K+ concentrations by the inactivation of the alternative Kdp system. These findings show that the ΔholD mutant is rescued by a decrease in K+ import. The effect of trk inactivation is additive with the previously identified ΔholD suppressor mutation lexAind that blocks the SOS response indicating an SOS-independent mechanism of suppression. Accordingly, although lagging-strand synthesis is still perturbed in holD trkA mutants, the trkA mutation allows HolD-less Pol III HE to resist increased levels of the SOS-induced bypass polymerase DinB. trk inactivation is also partially additive with an ssb gene duplication, proposed to stabilize HolD-less Pol III HE by a modification of the single-stranded DNA binding protein (SSB) binding mode. We propose that lowering the intracellular K+ concentration stabilizes HolD-less Pol III HE on DNA by increasing electrostatic interactions between Pol III HE subunits, or between Pol III and DNA, directly or through a modification of the SSB binding mode; these three modes of action are not exclusive and could be additive. To our knowledge, the holD mutant provides the first example of an essential protein-DNA interaction that strongly depends on K+ import in vivo. PMID:27280472

  14. Relevance of GC content to the conservation of DNA polymerase III/mismatch repair system in Gram-positive bacteria

    PubMed Central

    Akashi, Motohiro; Yoshikawa, Hirofumi

    2013-01-01

    The mechanism of DNA replication is one of the driving forces of genome evolution. Bacterial DNA polymerase III, the primary complex of DNA replication, consists of PolC and DnaE. PolC is conserved in Gram-positive bacteria, especially in the Firmicutes with low GC content, whereas DnaE is widely conserved in most Gram-negative and Gram-positive bacteria. PolC contains two domains, the 3′-5′exonuclease domain and the polymerase domain, while DnaE only possesses the polymerase domain. Accordingly, DnaE does not have the proofreading function; in Escherichia coli, another enzyme DnaQ performs this function. In most bacteria, the fidelity of DNA replication is maintained by 3′-5′ exonuclease and a mismatch repair (MMR) system. However, we found that most Actinobacteria (a group of Gram-positive bacteria with high GC content) appear to have lost the MMR system and chromosomes may be replicated by DnaE-type DNA polymerase III with DnaQ-like 3′-5′ exonuclease. We tested the mutation bias of Bacillus subtilis, which belongs to the Firmicutes and found that the wild type strain is AT-biased while the mutS-deletant strain is remarkably GC-biased. If we presume that DnaE tends to make mistakes that increase GC content, these results can be explained by the mutS deletion (i.e., deletion of the MMR system). Thus, we propose that GC content is regulated by DNA polymerase and MMR system, and the absence of polC genes, which participate in the MMR system, may be the reason for the increase of GC content in Gram-positive bacteria such as Actinobacteria. PMID:24062730

  15. Structure-function analysis of hRPC62 provides insights into RNA polymerase III transcription initiation.

    PubMed

    Lefèvre, Stéphane; Dumay-Odelot, Hélène; El-Ayoubi, Leyla; Budd, Aidan; Legrand, Pierre; Pinaud, Noël; Teichmann, Martin; Fribourg, Sébastien

    2011-03-01

    The 17-subunit human RNA polymerase III (hPol III) transcribes small, untranslated RNA genes that are involved in the regulation of transcription, splicing and translation. hPol III subunits hRPC62, hRPC39 and hRPC32 form a stable ternary subcomplex required for promoter-specific transcription initiation by hPol III. Here, we report the crystal structure of hRPC62. This subunit folds as a four-tandem extended winged helix (eWH) protein that is structurally related to the transcription factor TFIIEα N terminus. Through biochemical analyses, we mapped the protein-protein interactions of hRPC62, hRPC32 and hRPC39. In addition, we demonstrated that hRPC62 and hRPC39 bind single-stranded and duplex DNA, respectively, in a sequence-independent manner. Overall, we shed light on structural similarities between the hPol III-specific subunit hRPC62 and TFIIEα and propose specific functions for hRPC39 and hRPC62 in transcription initiation by hPol III. PMID:21358628

  16. A partial loss-of-function mutation in an Arabidopsis RNA polymerase III subunit leads to pleiotropic defects

    PubMed Central

    Johnson, Kaeli C. M.; Yu, Yu; Gao, Lei; Eng, Ryan C.; Wasteneys, Geoffrey O.; Chen, Xuemei; Li, Xin

    2016-01-01

    Plants employ five DNA-dependent RNA polymerases (Pols) in transcription. One of these polymerases, Pol III, has previously been reported to transcribe 5S rRNA, tRNAs, and a number of small RNAs. However, in-depth functional analysis is complicated by the fact that knockout mutations in Pol subunits are typically lethal. Here, we report the characterization of the first known viable Pol III subunit mutant, nrpc7-1. This mutant was originally isolated from a forward genetic screen designed to identify enhancers of the autoimmune mutant snc1, which contains a gain-of-function mutation in a nucleotide-binding leucine-rich repeat (NLR) immune receptor-encoding gene. The nrpc7-1 mutation occurs in an intron–exon splice site and results in intron retention in some NRPC7 transcripts. There is a global disruption in RNA equilibrium in nrpc7-1, exemplified by the altered expression of a number of RNA molecules, some of which are not reported to be transcribed by Pol III. There are developmental defects associated with the mutation, as homozygous mutant plants are dwarf, have stunted roots and siliques, and possess serrated leaves. These defects are possibly due to altered small RNA stability or activity. Additionally, the nrpc7-1 mutation confers an NLR-specific alternative splicing defect that correlates with enhanced disease resistance, highlighting the importance of alternative splicing in regulating NLR activity. Altogether, these results reveal novel roles for Pol III in maintaining RNA homeostasis, adjusting the expression of a diverse suite of genes, and indirectly modulating gene splicing. Future analyses using the nrpc7-1 mutant will be instrumental in examining other unknown Pol III functions. PMID:26865731

  17. Active Center Control of Termination by RNA Polymerase III and tRNA Gene Transcription Levels In Vivo

    PubMed Central

    Rijal, Keshab; Maraia, Richard J.

    2016-01-01

    The ability of RNA polymerase (RNAP) III to efficiently recycle from termination to reinitiation is critical for abundant tRNA production during cellular proliferation, development and cancer. Yet understanding of the unique termination mechanisms used by RNAP III is incomplete, as is its link to high transcription output. We used two tRNA-mediated suppression systems to screen for Rpc1 mutants with gain- and loss- of termination phenotypes in S. pombe. 122 point mutation mutants were mapped to a recently solved 3.9 Å structure of yeast RNAP III elongation complex (EC); they cluster in the active center bridge helix and trigger loop, as well as the pore and funnel, the latter of which indicate involvement of the RNA cleavage domain of the C11 subunit in termination. Purified RNAP III from a readthrough (RT) mutant exhibits increased elongation rate. The data strongly support a kinetic coupling model in which elongation rate is inversely related to termination efficiency. The mutants exhibit good correlations of terminator RT in vitro and in vivo, and surprisingly, amounts of transcription in vivo. Because assessing in vivo transcription can be confounded by various parameters, we used a tRNA reporter with a processing defect and a strong terminator. By ruling out differences in RNA decay rates, the data indicate that mutants with the RT phenotype synthesize more RNA than wild type cells, and than can be accounted for by their increased elongation rate. Finally, increased activity by the mutants appears unrelated to the RNAP III repressor, Maf1. The results show that the mobile elements of the RNAP III active center, including C11, are key determinants of termination, and that some of the mutations activate RNAP III for overall transcription. Similar mutations in spontaneous cancer suggest this as an unforeseen mechanism of RNAP III activation in disease. PMID:27518095

  18. Development of a rapid recombinase polymerase amplification assay for detection of Brucella in blood samples.

    PubMed

    Ren, Hang; Yang, Mingjuan; Zhang, Guoxia; Liu, Shiwei; Wang, Xinhui; Ke, Yuehua; Du, Xinying; Wang, Zhoujia; Huang, Liuyu; Liu, Chao; Chen, Zeliang

    2016-04-01

    A rapid and sensitive recombinase polymerase amplification (RPA) assay, Bruce-RPA, was developed for detection of Brucella. The assay could detect as few as 3 copies of Brucella per reaction within 20 min. Bruce-RPA represents a candidate point-of-care diagnosis assay for human brucellosis.

  19. Development of a rapid recombinase polymerase amplification assay for detection of Brucella in blood samples.

    PubMed

    Ren, Hang; Yang, Mingjuan; Zhang, Guoxia; Liu, Shiwei; Wang, Xinhui; Ke, Yuehua; Du, Xinying; Wang, Zhoujia; Huang, Liuyu; Liu, Chao; Chen, Zeliang

    2016-04-01

    A rapid and sensitive recombinase polymerase amplification (RPA) assay, Bruce-RPA, was developed for detection of Brucella. The assay could detect as few as 3 copies of Brucella per reaction within 20 min. Bruce-RPA represents a candidate point-of-care diagnosis assay for human brucellosis. PMID:26911890

  20. A Specific Qualitative Detection Method for Peanut (Arachis Hypogagea) in Foods Using Polymerase Chain Reaction

    Technology Transfer Automated Retrieval System (TEKTRAN)

    A qualitative method for detection of peanuts in foods using polymerase chain reaction was developed. A universal primer pair CP 03-5 /CP 03-3 was designed to confirm the validity of the DNAs for PCR. The plant-specific amplified fragments were detected from 13 kinds of plants using the universal pr...

  1. A Specific Qualitative Detection Method for Peanut (Arachis Hypogaea) in Foods Using Polymerase Chain Reaction

    Technology Transfer Automated Retrieval System (TEKTRAN)

    We developed a qualitative detection method for peanuts in foods using polymerase chain reaction (PCR). We designed a universal primer pair CP 03-5’/ CP 03-3’ to confirm the validity of the DNAs for PCR. The plant specific amplified fragments were detected from 13 kinds of plants using the universal...

  2. Possible interaction between the bacterial transcription factor ArtA and the eukaryotic RNA polymerase III promoter.

    PubMed

    Matsutani, Sachiko

    2016-06-01

    Eukaryotic RNA polymerase III (RNAP III) transcribes tRNA genes and short interspersed elements that have internal promoters consisting of A- and B-blocks. The B-block binding subunit of the transcription initiation factor TFIIIC binds to the B-block. The mobile bacterial insertion sequence (IS) 1 contains a RNAP III promoter-like sequence, which stimulates bacterial transcription along with the bacterial ArtA protein. Here, the DNA-binding ability of ArtA was examined in vitro using a simple, newly developed method. Various DNA fragments, including RNAP III promoter fragments, were separately incubated with purified ArtA, and then loaded onto a polyacrylamide gel. Since DNAs bound by ArtA remain in the gel wells during electrophoresis, SDS was added into the wells at the electrophoresis halfway point. It was hypothesized that SDS would dissociate the DNA-ArtA complexes in the wells, and then the DNAs would begin to migrate. In fact, new bands appeared in all of the lanes at similar intensities, indicating that ArtA binds nonspecifically to DNA. Therefore, labeled wild-type RNAP III promoter fragments were incubated with either the unlabeled wild-type or mutant fragments and ArtA, and electrophoresed. The B-block(-like) sequences of IS1, a human Alu element, and an anuran tRNA gene were important for binding to ArtA. Additionally, in silico analyses revealed the presence of the RNAP III promoter-like structures in the IS1 isoforms and the IS3 family elements. These results suggest the presence of parts of the RNAP III transcription machinery in bacteria, and might imply that its prototype existed in the common ancestor.

  3. The hepatitis B virus X protein increases the cellular level of TATA-binding protein, which mediates transactivation of RNA polymerase III genes

    SciTech Connect

    Wang, Horng-Dar; Johnson, D.L.; Yuh, Chio-Hwa

    1995-12-01

    This report decribes the mechanism by which the hepatitis B virus X gene product induces RNA polymerase III genes. The RNA pol III transcription system serves as model for understanding the mechanism of X in the transactivation of cellular genes in both Drosophila and rat cell lines. 53 refs., 7 figs., 1 tab.

  4. An HDAC inhibitor enhances cancer therapeutic efficiency of RNA polymerase III promoter-driven IDO shRNA.

    PubMed

    Yen, M-C; Weng, T-Y; Chen, Y-L; Lin, C-C; Chen, C-Y; Wang, C-Y; Chao, H-L; Chen, C-S; Lai, M-D

    2013-06-01

    Histone deacetylase (HDAC) inhibitors are used in treating certain human malignancies. Our laboratories demonstrated their capability in enhancing antitumor effect of DNA vaccine driven by an RNA polymerase II (RNA pol II) promoter. However, it is unknown whether HDAC inhibitors enhance the therapeutic short hairpin RNA (shRNA) expressed by an RNA polymerase III (RNA pol III) promoter. We investigated whether HDAC inhibitors augmented antitumor effect of indoleamine 2,3 dioxygenase (IDO) shRNA. HDAC inhibitor OSU-HDAC42 and suberoylanilide hydroxamic acid enhanced RNA pol III-driven U6 and H1 promoter activity in three different cell types in vitro: 293, NIH3T3 and dendritic cell line DC2.4. Subcutaneous injection of OSU-HDAC42 enhanced U6 and H1 promoter activity on abdominal skin of mice in vivo. Combination of IDO shRNA and OSU-HDAC42 increased antitumor effect of IDO shRNA in MBT-2 murine bladder tumor model. IDO shRNA induced tumor-infiltrating CD8⁺ and CD4⁺ T cells, whereas OSU-HDAC42 treatment induced tumor-infiltrating CD4⁺ T cells. Combination of OSU-HDAC42 and IDO shRNA further induced tumor-infiltrating natural killer cells and enhanced interferon-γ in lymphocytes, but suppressed interleukin (IL)-4 expression of lymphocytes. In addition, OSU-HDAC42 treatment did not alter mRNA expression of IL-12 and tumor necrosis factor-α. In conclusion, HDAC inhibitor OSU-HDAC42 may serve as adjuvant of the therapeutic shRNA expressed by an RNA pol III promoter.

  5. Detection of biological warfare agents using the polymerase chain reaction. Final report, June-August 1991

    SciTech Connect

    Mann, B.J.

    1992-09-01

    The detection of biological warfare agents is an important mission for the U.S. Army. This report explores the feasibility of using the polymerase chain reaction as a means of rapid detection of biological warfare agents. Two levels of detection are proposed. The first level is group specific detection, using primers derived from 16S rDNA sequences, to detect various groups of pathogenic bacteria. The second level is species-specific detection using primers derived from DNA sequences, unique to each pathogenic organism targeted for detection. Specific examples of Vibrio cholerae, Francisella tularensis, Yersinia pestis, Staphylococcus aureus, and Bacillus anthracis are described.

  6. Mechanism of transcription termination by RNA polymerase III utilizes a nontemplate-strand sequence-specific signal element

    PubMed Central

    Arimbasseri, Aneeshkumar G.; Maraia, Richard J.

    2015-01-01

    SUMMARY Understanding the mechanism of transcription termination by a eukaryotic RNA polymerase (RNAP) has been limited by lack of a characterizable intermediate that reflects transition from an elongation complex to a true termination event. While other multisubunit RNAPs require multipartite cis-signals and/or ancillary factors to mediate pausing and release of the nascent transcript from the clutches of these enzymes, RNAP III does so with precision and efficiency on a simple oligo(dT) tract, independent of other cis-elements or trans-factors. We report a RNAP III pre-termination complex that reveals termination mechanisms controlled by sequence-specific elements in the non-template strand. Furthermore, the TFIIF-like, RNAP III subunit, C37 is required for this function of the non-template strand signal. The results reveal the RNAP III terminator as an information-rich control element. While the template strand promotes destabilization via a weak oligo(rU:dA) hybrid, the non-template strand provides distinct sequence-specific destabilizing information through interactions with the C37 subunit. PMID:25959395

  7. Covalent Small Ubiquitin-like Modifier (SUMO) Modification of Maf1 Protein Controls RNA Polymerase III-dependent Transcription Repression*

    PubMed Central

    Rohira, Aarti D.; Chen, Chun-Yuan; Allen, Justin R.; Johnson, Deborah L.

    2013-01-01

    RNA polymerase (pol) III transcribes genes that determine biosynthetic capacity. Induction of these genes is required for oncogenic transformation. The transcriptional repressor, Maf1, plays a central role in the repression of these and other genes that promote oncogenesis. Our studies identify an important new role for SUMOylation in repressing RNA pol III-dependent transcription. We show that a key mechanism by which this occurs is through small ubiquitin-like modifier (SUMO) modification of Maf1 by both SUMO1 and SUMO2. Mutation of each lysine residue revealed that Lys-35 is the major SUMOylation site on Maf1 and that the deSUMOylase, SENP1, is responsible for controlling Maf1K35 SUMOylation. SUMOylation of Maf1 is unaffected by rapamycin inhibition of mammalian target of rapamycin (mTOR) and mTOR-dependent Maf1 phosphorylation. By preventing SUMOylation at Lys-35, Maf1 is impaired in its ability to both repress transcription and suppress colony growth. Although SUMOylation does not alter Maf1 subcellular localization, Maf1K35R is defective in its ability to associate with RNA pol III. This impairs Maf1 recruitment to tRNA gene promoters and its ability to facilitate the dissociation of RNA pol III from these promoters. These studies identify a novel role for SUMOylation in controlling Maf1 and RNA pol III-mediated transcription. Given the emerging roles of SENP1, Maf1, and RNA pol III transcription in oncogenesis, our studies support the idea that deSUMOylation of Maf1 and induction of its gene targets play a critical role in cancer development. PMID:23673667

  8. Virus-induced gene silencing of the RPC5-like subunit of RNA polymerase III caused pleiotropic effects in Nicotiana benthamiana

    PubMed Central

    Nemchinov, Lev G.; Boutanaev, Alexander M.; Postnikova, Olga A.

    2016-01-01

    In eukaryotic cells, RNA polymerase III is highly conserved and transcribes housekeeping genes such as ribosomal 5S rRNA, tRNA and other small RNAs. The RPC5-like subunit is one of the 17 subunits forming RNAPIII and its exact functional roles in the transcription are poorly understood. In this work, we report that virus-induced gene silencing of transcripts encoding a putative RPC5-like subunit of the RNA Polymerase III in a model species Nicotiana benthamiana had pleiotropic effects, including but not limited to severe dwarfing appearance, chlorosis, nearly complete reduction of internodes and abnormal leaf shape. Using transcriptomic analysis, we identified genes and pathways affected by RPC5 silencing and thus presumably related to the cellular roles of the subunit as well as to the downstream cascade of reactions in response to partial loss of RNA Polymerase III function. Our results suggest that silencing of the RPC5L in N. benthamiana disrupted not only functions commonly associated with the core RNA Polymerase III transcripts, but also more diverse cellular processes, including responses to stress. We believe this is the first demonstration that activity of the RPC5 subunit is critical for proper functionality of RNA Polymerase III and normal plant development. PMID:27282827

  9. Real-time isothermal detection of Shiga toxin-producing Escherichia coli using recombinase polymerase amplification

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Shiga toxin (Stx) producing E. coli (STEC) are a major family of foodborne pathogens of immense public health, zoonotic and economic significance in the US and worldwide. To date, there are no published reports on use of recombinase polymerase amplification (RPA) for STEC detection. The primary goal...

  10. An improved polymerase chain reaction assay for the detection of Tritrichomonas foetus in cattle

    PubMed Central

    Nickel, D. Douglas; Olson, Merle E.; Schultz, Gilbert A.

    2002-01-01

    An improved polymerase chain reaction test has been developed to detect Tritrichomonas foetus, the causative agent of trichomoniasis in cattle. The test amplifies a region of the 5.8S ribosomal RNA gene of T. foetus, and it is simple, sensitive, and specific when compared with traditional methods to examine field samples. PMID:11901595

  11. Detection of untreated mycobacteria by using polymerase chain reaction and specific DNA probes.

    PubMed Central

    Fries, J W; Patel, R J; Piessens, W F; Wirth, D F

    1991-01-01

    A method for specific identification of mycobacteria by using the polymerase chain reaction on organisms taken from liquid cultures, frozen suspensions, or colonies grown on Lowenstein-Jensen slants is presented. This direct detection of mycobacterial organisms has important implications for strain typing and diagnosis. Images PMID:1761699

  12. The RNA polymerase III-dependent family of genes in hemiascomycetes: comparative RNomics, decoding strategies, transcription and evolutionary implications

    PubMed Central

    Marck, Christian; Kachouri-Lafond, Rym; Lafontaine, Ingrid; Westhof, Eric; Dujon, Bernard; Grosjean, Henri

    2006-01-01

    We present the first comprehensive analysis of RNA polymerase III (Pol III) transcribed genes in ten yeast genomes. This set includes all tRNA genes (tDNA) and genes coding for SNR6 (U6), SNR52, SCR1 and RPR1 RNA in the nine hemiascomycetes Saccharomyces cerevisiae, Saccharomyces castellii, Candida glabrata, Kluyveromyces waltii, Kluyveromyces lactis, Eremothecium gossypii, Debaryomyces hansenii, Candida albicans, Yarrowia lipolytica and the archiascomycete Schizosaccharomyces pombe. We systematically analysed sequence specificities of tRNA genes, polymorphism, variability of introns, gene redundancy and gene clustering. Analysis of decoding strategies showed that yeasts close to S.cerevisiae use bacterial decoding rules to read the Leu CUN and Arg CGN codons, in contrast to all other known Eukaryotes. In D.hansenii and C.albicans, we identified a novel tDNA-Leu (AAG), reading the Leu CUU/CUC/CUA codons with an unusual G at position 32. A systematic ‘p-distance tree’ using the 60 variable positions of the tRNA molecule revealed that most tDNAs cluster into amino acid-specific sub-trees, suggesting that, within hemiascomycetes, orthologous tDNAs are more closely related than paralogs. We finally determined the bipartite A- and B-box sequences recognized by TFIIIC. These minimal sequences are nearly conserved throughout hemiascomycetes and were satisfactorily retrieved at appropriate locations in other Pol III genes. PMID:16600899

  13. Synthetic RNA Polymerase III Promoters Facilitate High-Efficiency CRISPR-Cas9-Mediated Genome Editing in Yarrowia lipolytica.

    PubMed

    Schwartz, Cory M; Hussain, Murtaza Shabbir; Blenner, Mark; Wheeldon, Ian

    2016-04-15

    The oleaginous yeast Yarrowia lipolytica is a valuable microbial host for chemical production because it has a high capacity to synthesize, modify, and store intracellular lipids; however, rapid strain development has been hampered by the limited availability of genome engineering tools. We address this limitation by adapting the CRISPR-Cas9 system from Streptococcus pyogenes for markerless gene disruption and integration in Y. lipolytica. Single gene disruption efficiencies of 92% and higher were achieved when single guide RNAs (sgRNA) were transcribed with synthetic hybrid promoters that combine native RNA polymerase III (Pol III) promoters with tRNA. The Pol III-tRNA hybrid promoters exploit endogenous tRNA processing to produce mature sgRNA for Cas9 targeting. The highest efficiencies were achieved with a SCR1'-tRNA(Gly) promoter and Y. lipolytica codon-optimized Cas9 expressed from a UAS1B8-TEF promoter. Cotransformation of the Cas9 and sgRNA expressing plasmid with a homologous recombination donor plasmid resulted in markerless homologous recombination efficiency of over 64%. Homologous recombination was observed in 100% of transformants when nonhomologous end joining was disrupted. The end result of these studies was the development of pCRISPRyl, a modular tool for markerless gene disruption and integration in Y. lipolytica.

  14. Detection and genotyping of herpes simplex virus types 1 and 2 by polymerase chain reaction.

    PubMed

    Lucotte, G; Bathelier, C; Lespiaux, V; Bali, C; Champenois, T

    1995-10-01

    A simple and rapid polymerase chain reaction (PCR) procedure was developed for simultaneous detection and typing of herpes simplex virus (HSV) types 1 and 2. It was possible to detect and type HSV using two primers pairs in a simultaneous double PCR reaction, where the type of HSV present was determined on the basis of an ethidium-bromide-stained band after agarose gel electrophoresis. This PCR assay was tested on about 500 clinical specimens.

  15. DNA polymerase III accessory proteins. I. holA and holB encoding delta and delta'.

    PubMed

    Dong, Z; Onrust, R; Skangalis, M; O'Donnell, M

    1993-06-01

    The genes encoding the delta and delta' subunits of the 10-subunit Escherichia coli replicase, DNA polymerase III holoenzyme, have been identified and sequenced. The holA gene encoding delta is located downstream of rlpB at 15.2 min and predicts a 38.7 kda protein. The holB gene encoding delta' is located at 24.3 min and predicts a 36.9-kDa protein. Hence the delta and delta' subunits are unrelated proteins encoded by separate genes. The genes have been used to express and purify delta and delta' in quantity. The predicted amino acid sequence of delta' is homologous to the sequences of the tau and gamma subunits revealing a large amount of structural redundancy within the holoenzyme.

  16. Distinct double- and single-stranded DNA binding of E. coli replicative DNA polymerase III alpha subunit.

    PubMed

    McCauley, Micah J; Shokri, Leila; Sefcikova, Jana; Venclovas, Ceslovas; Beuning, Penny J; Williams, Mark C

    2008-09-19

    The alpha subunit of the replicative DNA polymerase III of Escherichia coli is the active polymerase of the 10-subunit bacterial replicase. The C-terminal region of the alpha subunit is predicted to contain an oligonucleotide binding (OB-fold) domain. In a series of optical tweezers experiments, the alpha subunit is shown to have an affinity for both double- and single-stranded DNA, in distinct subdomains of the protein. The portion of the protein that binds to double-stranded DNA stabilizes the DNA helix, because protein binding must be at least partially disrupted with increasing force to melt DNA. Upon relaxation, the DNA fails to fully reanneal, because bound protein interferes with the reformation of the double helix. In addition, the single-stranded DNA binding component appears to be passive, as the protein does not facilitate melting but instead binds to single-stranded regions already separated by force. From DNA stretching measurements we determine equilibrium association constants for the binding of alpha and several fragments to dsDNA and ssDNA. The results demonstrate that ssDNA binding is localized to the C-terminal region that contains the OB-fold domain, while a tandem helix-hairpin-helix (HhH) 2 motif contributes significantly to dsDNA binding. PMID:18652472

  17. Specific detection of the toxic shock syndrome toxin-1 gene using the polymerase chain reaction.

    PubMed

    Jaulhac, B; Prevost, G; Piemont, Y

    1991-08-01

    A rapid and specific assay for toxic shock syndrome toxin-1 gene (tst gene) detection in Staphylococcus aureus was developed using the polymerase chain reaction. A two-primer set and an oligonucleotide detection probe were synthesized. After 40 cycles of amplification, detection of a 160-bp amplified DNA fragment was carried out by agarose gel electrophoresis and Southern blot hybridization. This assay was sensitive since it was able to detect 1-10 bacteria. It was also specific since no amplification was documented with DNAs from enterotoxigenic S. aureus or Gram-negative bacteria devoid of the tst gene.

  18. Evaluation of Immunomagnetic Separation for the Detection of Salmonella in Surface Waters by Polymerase Chain Reaction

    PubMed Central

    Hsu, Chao-Yu; Hsu, Bing-Mu; Chang, Tien-Yu; Hsu, Tsui-Kang; Shen, Shu-Min; Chiu, Yi-Chou; Wang, Hung-Jen; Ji, Wen-Tsai; Fan, Cheng-Wei; Chen, Jyh-Larng

    2014-01-01

    Salmonella spp. is associated with fecal pollution and capable of surviving for long periods in aquatic environments. Instead of the traditional, time-consuming biochemical detection, polymerase chain reaction (PCR) allows rapid identification of Salmonella directly concentrated from water samples. However, prevalence of Salmonella may be underestimated because of the vulnerability of PCR to various environmental chemicals like humic acid, compounded by the fact that various DNA polymerases have different susceptibility to humic acid. Because immunomagnetic separation (IMS) theoretically could isolate Salmonella from other microbes and facilitate removal of aquatic PCR inhibitors of different sizes, this study aims to compare the efficiency of conventional PCR combined with immunomagnetic separation (IMS) for Salmonella detection within a moderately polluted watershed. In our study, the positive rate was increased from 17.6% to 47% with nearly ten-fold improvement in the detection limit. These results suggest the sensitivity of Salmonella detection could be enhanced by IMS, particularly in low quality surface waters. Due to its effects on clearance of aquatic pollutants, IMS may be suitable for most DNA polymerases for Salmonella detection. PMID:25243887

  19. Rapid and sensitive detection of canine parvovirus type 2 by recombinase polymerase amplification.

    PubMed

    Wang, Jianchang; Liu, Libing; Li, Ruiwen; Wang, Jinfeng; Fu, Qi; Yuan, Wanzhe

    2016-04-01

    A novel recombinase polymerase amplification (RPA)-based method for detection of canine parvovirus type 2 (CPV-2) was developed. Sensitivity analysis showed that the detection limit of RPA was 10 copies of CPV-2 genomic DNA. RPA amplified both CPV-2a and -2b DNA but did not amplify the template of other important dog viruses (CCoV, PRV or CDV), demonstrating high specificity. The method was further validated with 57 canine fecal samples. An outstanding advantage of RPA is that it is an isothermal reaction and can be performed in a water bath, making RPA a potential alternative method for CPV-2 detection in resource-limited settings.

  20. Detection of influenza B virus in throat swabs using the polymerase chain reaction.

    PubMed

    Yamada, A; Imanishi, J

    1992-05-01

    An assay protocol based on exploiting the polymerase chain reaction (PCR) for the direct detection of influenza B virus in throat swabs is described. By the use of PCR with nested primers, it was possible to detect the virus in throat swabs. Dilution experiments showed that as little as 1 plaque forming unit of virus was sufficient for detecting the HA gene by the PCR. All throat swab samples from which influenza B virus had been isolated by conventional methods were also positive by the PCR method.

  1. Specific and sensitive detection of Trichomonas tenax by the polymerase chain reaction.

    PubMed

    Kikuta, N; Yamamoto, A; Fukura, K; Goto, N

    1997-03-01

    A polymerase chain reaction (PCR) protocol was developed for specific detection of Trichomonas tenax by using a pair of primers designed for its 18S rRNA gene. The detection was specific for T. tenax, since no amplification was detected with DNAs from Trichomonas vaginalis, which belongs to the same genus as T. tenax, in addition to various species of oral protists, fungi and bacteria, and human leukocytes. This method had a detection limit of 100 fg for T. tenax genomic DNA and could detect T. tenax cells in dental plaque at a concentration of as low as 5 cells per PCR mixture. Direct detection from clinical dental plaque samples was also possible; therefore, the present PCR procedure could provide a simple and rapid detection method of T. tenax in dental plaque.

  2. A reverse transcription-polymerase chain reaction assay for the detection of avian pneumovirus (Colorado strain).

    PubMed

    Ali, A; Reynolds, D L

    1999-01-01

    A reverse transcription-polymerase chain reaction assay was developed for the detection of avian pneumovirus (Colorado strain) (APV-Col). The specific primers were designed from the published sequence of the matrix protein gene of APV-Col. The primers amplified a product of 631 nucleotides from APV-Col. The assay identified only APV-Col and did not react with Newcastle disease virus and infectious bronchitis virus.

  3. Human MAF1 targets and represses active RNA polymerase III genes by preventing recruitment rather than inducing long-term transcriptional arrest

    PubMed Central

    Orioli, Andrea; Praz, Viviane; Lhôte, Philippe; Hernandez, Nouria

    2016-01-01

    RNA polymerase III (Pol III) is tightly controlled in response to environmental cues, yet a genomic-scale picture of Pol III regulation and the role played by its repressor MAF1 is lacking. Here, we describe genome-wide studies in human fibroblasts that reveal a dynamic and gene-specific adaptation of Pol III recruitment to extracellular signals in an mTORC1-dependent manner. Repression of Pol III recruitment and transcription are tightly linked to MAF1, which selectively localizes at Pol III loci, even under serum-replete conditions, and increasingly targets transcribing Pol III in response to serum starvation. Combining Pol III binding profiles with EU-labeling and high-throughput sequencing of newly synthesized small RNAs, we show that Pol III occupancy closely reflects ongoing transcription. Our results exclude the long-term, unproductive arrest of Pol III on the DNA as a major regulatory mechanism and identify previously uncharacterized, differential coordination in Pol III binding and transcription under different growth conditions. PMID:26941251

  4. A polymerase chain reaction protocol for the detection of various geographical isolates of white spot virus.

    PubMed

    Tapay, L M; Nadala, E C; Loh, P C

    1999-09-01

    Polymerase chain reaction (PCR) primers were designed based on the sequence of a cloned fragment of the white spot virus (WSV) genome and were used to detect at least four geographic isolates of WSV from both experimentally- and naturally-infected shrimp. In addition to high specificity, the one-step and two-step PCR protocols were determined to have sensitivities of 10-100 pg and 100 femtograms respectively. The two-step PCR protocol is recommended as a very sensitive and specific alternative protocol to Western blot assay for the detection of WSV.

  5. Detection of Listeria monocytogenes with a nonisotopic polymerase chain reaction-coupled ligase chain reaction assay.

    PubMed Central

    Wiedmann, M; Barany, F; Batt, C A

    1993-01-01

    A polymerase chain reaction (PCR)-coupled ligase chain reaction (LCR) assay for the specific detection of Listeria monocytogenes (M. Wiedmann, J. Czajka, F. Barany, and C. A. Batt, Appl. Environ. Microbiol. 58:3443-3447, 1992) has been modified for detection of the LCR products with a nonisotopic readout. When a chemiluminescent or a colorimetric substrate for the nonisotopic detection of the LCR products was used, the PCR-coupled LCR gave a sensitivity of 10 CFU of L. monocytogenes. The detection method with the chemiluminescent substrate Lumi-Phos 530 permitted detection of the LCR products in less than 3 h, so that the whole assay can be completed within 10 h. Images PMID:8368859

  6. Detection of influenza viruses in throat swab by using polymerase chain reaction.

    PubMed

    Yamada, A; Imanishi, J; Nakajima, E; Nakajima, K; Nakajima, S

    1991-01-01

    An assay protocol based on exploiting the polymerase chain reaction (PCR) for the direct detection of influenza virus in throat swab is described. By use of the mixture of H1 and H3 primers, it was possible to determine the subtype of the influenza A viruses simultaneously. No visible band was detected after PCR of influenza B or A (H2N2) viruses with a pair of H1 or H3 primers. The dilution experiment showed that the influenza viruses, as few as 1.3-6 plaque-forming units, were sufficient for detecting the HA gene by PCR. All throat swab samples from which influenza viruses had been isolated by conventional method were also positively detected by PCR method.

  7. Rapid and specific detection of Yam mosaic virus by reverse-transcription recombinase polymerase amplification.

    PubMed

    Silva, Gonçalo; Bömer, Moritz; Nkere, Chukwuemeka; Kumar, P Lava; Seal, Susan E

    2015-09-15

    Yam mosaic virus (YMV; genus Potyvirus) is considered to cause the most economically important viral disease of yams (Dioscorea spp.) in West Africa which is the dominant region for yam production globally. Yams are a vegetatively propagated crop and the use of virus-free planting material forms an essential component of disease control. Current serological and PCR-based diagnostic methods for YMV are time consuming involving a succession of target detection steps. In this study, a novel assay for specific YMV detection is described that is based on isothermal reverse transcription-recombinase polymerase amplification (RT-exoRPA). This test has been shown to be reproducible and able to detect as little as 14 pg/μl of purified RNA obtained from an YMV-infected plant, a sensitivity equivalent to that obtained with the reverse transcription-polymerase chain reaction (RT-PCR) in current general use. The RT-exoRPA assay has, however, several advantages over the RT-PCR; positive samples can be detected in less than 30 min, and amplification only requires a single incubation temperature (optimum 37°C). These features make the RT-exoRPA assay a promising candidate for adapting into a field test format to be used by yam breeding programmes or certification laboratories.

  8. Rapid and specific detection of Yam mosaic virus by reverse-transcription recombinase polymerase amplification.

    PubMed

    Silva, Gonçalo; Bömer, Moritz; Nkere, Chukwuemeka; Kumar, P Lava; Seal, Susan E

    2015-09-15

    Yam mosaic virus (YMV; genus Potyvirus) is considered to cause the most economically important viral disease of yams (Dioscorea spp.) in West Africa which is the dominant region for yam production globally. Yams are a vegetatively propagated crop and the use of virus-free planting material forms an essential component of disease control. Current serological and PCR-based diagnostic methods for YMV are time consuming involving a succession of target detection steps. In this study, a novel assay for specific YMV detection is described that is based on isothermal reverse transcription-recombinase polymerase amplification (RT-exoRPA). This test has been shown to be reproducible and able to detect as little as 14 pg/μl of purified RNA obtained from an YMV-infected plant, a sensitivity equivalent to that obtained with the reverse transcription-polymerase chain reaction (RT-PCR) in current general use. The RT-exoRPA assay has, however, several advantages over the RT-PCR; positive samples can be detected in less than 30 min, and amplification only requires a single incubation temperature (optimum 37°C). These features make the RT-exoRPA assay a promising candidate for adapting into a field test format to be used by yam breeding programmes or certification laboratories. PMID:26115609

  9. The β2 clamp in the Mycobacterium tuberculosis DNA polymerase III αβ2ε replicase promotes polymerization and reduces exonuclease activity

    PubMed Central

    Gu, Shoujin; Li, Wenjuan; Zhang, Hongtai; Fleming, Joy; Yang, Weiqiang; Wang, Shihua; Wei, Wenjing; Zhou, Jie; Zhu, Guofeng; Deng, Jiaoyu; Hou, Jian; Zhou, Ying; Lin, Shiqiang; Zhang, Xian-En; Bi, Lijun

    2016-01-01

    DNA polymerase III (DNA pol III) is a multi-subunit replication machine responsible for the accurate and rapid replication of bacterial genomes, however, how it functions in Mycobacterium tuberculosis (Mtb) requires further investigation. We have reconstituted the leading-strand replication process of the Mtb DNA pol III holoenzyme in vitro, and investigated the physical and functional relationships between its key components. We verify the presence of an αβ2ε polymerase-clamp-exonuclease replicase complex by biochemical methods and protein-protein interaction assays in vitro and in vivo and confirm that, in addition to the polymerase activity of its α subunit, Mtb DNA pol III has two potential proofreading subunits; the α and ε subunits. During DNA replication, the presence of the β2 clamp strongly promotes the polymerization of the αβ2ε replicase and reduces its exonuclease activity. Our work provides a foundation for further research on the mechanism by which the replication machinery switches between replication and proofreading and provides an experimental platform for the selection of antimicrobials targeting DNA replication in Mtb. PMID:26822057

  10. Method for detection of Stachybotrys chartarum in pure culture and field samples using quantitative polymerase chain reaction

    DOEpatents

    Cruz-Perez, Patricia; Buttner, Mark P.

    2004-05-11

    A method for detecting the fungus Stachybotrys chartarum includes isolating DNA from a sample suspected of containing the fungus Stachybotrys chartarum. The method further includes subjecting the DNA to polymerase chain reaction amplification utilizing at least one of several primers, the several primers each including one of the base sequences 5'GTTGCTTCGGCGGGAAC3', 5'TTTGCGTTTGCCACTCAGAG3', 5'ACCTATCGTTGCTTCGGCG3', and 5'GCGTTTGCCACTCAGAGAATACT3'. The method additionally includes detecting the fungus Stachybotrys chartarum by visualizing the product of the polymerase chain reaction.

  11. Multiplex polymerase chain reaction tests for detection of pathogens associated with gastroenteritis.

    PubMed

    Zhang, Hongwei; Morrison, Scott; Tang, Yi-Wei

    2015-06-01

    A wide range of enteric pathogens can cause infectious gastroenteritis. Conventional diagnostic algorithms are time-consuming and often lack sensitivity and specificity. Advances in molecular technology have provided new clinical diagnostic tools. Multiplex polymerase chain reaction (PCR)-based testing has been used in gastroenterology diagnostics in recent years. This article presents a review of recent laboratory-developed multiplex PCR tests and current commercial multiplex gastrointestinal pathogen tests. It focuses on two commercial syndromic multiplex tests: Luminex xTAG Gastrointestinal Pathogen Panel and BioFire FilmArray gastrointestinal test. Multiplex PCR tests have shown superior sensitivity to conventional methods for detection of most pathogens.

  12. Ultra sensitive detection of Listeria monocytogenes in milk by the polymerase chain reaction (PCR).

    PubMed

    Starbuck, M A; Hill, P J; Stewart, G S

    1992-12-01

    The polymerase chain reaction (PCR) has been used to detect Listeria monocytogenes in whole milk at a level of 0.1 cfu per 30 ml. This high degree of sensitivity has been achieved following enzymatic digestion, polysulphonone membrane filtration and amplification of a nucleotide sequence within the promoter region of hlyA. Key elements of the procedure are the absence of enrichment culture and a complete solubilization of the membrane filter, ensuring total nucleic acid recovery. The simplicity of the protocol coupled with high sample volumes and exquisite sensitivity extends the relevance of PCR within food and environmental microbiology. PMID:1368996

  13. [Detection of leptospirosis reservoirs in Madagascar using the polymerase chain reaction technique].

    PubMed

    Ralaiarijaona, R L; Bellenger, E; Chanteau, S; Roger, F; Pérolat, P; Rasolofo Razanamparany, V

    2001-01-01

    A polymerase chain reaction (PCR) technique was used for detection of the Leptospira interrogans rrs gene in kidney tissue from 115 rats, 50 zebu cattles and 13 pigs in an attempt to identify a possible animal reservoir of leptospirosis in Madagascar. In addition, serological testing of 105 individuals in close contact with animals was carried out. The PCR analysis was negative for all the samples tested and only one person was found seropositive at a low titer. The findings suggest that leptospirosis, if prevalent in Madagascar, is likely rare.

  14. Detection of Enterococcus faecalis in Necrotic Teeth Root Canals by Culture and Polymerase Chain Reaction Methods

    PubMed Central

    Cogulu, Dilsah; Uzel, Atac; Oncag, Ozant; Aksoy, Semiha C.; Eronat, Cemal

    2007-01-01

    Objectives The aim of this study was to investigate the presence of Enterococcus faecalis in endodontic infections in both deciduous and permanent teeth by culture and polymerase chain reaction (PCR) methods. Methods A total of 145 children aged 5–13 years old were involved in this study. The presence of E. faecalis in necrotic deciduous and permanent teeth root canals was studied using culture and polymerase chain reaction methods. Results Among 145 molar teeth, 57% (n=83) presented necrotic asymptomatic pulp tissues and were included in this study. Culture and PCR methods detected the test species in 18 and 22 of 83 teeth involved, respectively. E. faecalis was cultured from 8 (18%) of 45 necrotic deciduous teeth and from 10 (26%) of 38 necrotic permanent teeth. PCR detection identified the target species in 10 (22%) and 12 (32%) of necrotic deciduous and permanent teeth respectively. Statistically significant difference in the presence of E. faecalis in deciduous and permanent teeth was found by culture and PCR methods (P=0.03 and 0.02, respectively). The difference in the presence of E. faecalis between two different methods was not statistically significant (P>.05). Conclusions The results of the present study confirm that both culture and PCR methods are sensitive to detect E. faecalis in root canals. PMID:19212470

  15. Rapid Detection and Identification of a Pathogen's DNA Using Phi29 DNA Polymerase

    SciTech Connect

    Xu, Y.; Dunn, J.; Gao, S.; Bruno, J. F.; Luft, B. J.

    2008-10-31

    Zoonotic pathogens including those transmitted by insect vectors are some of the most deadly of all infectious diseases known to mankind. A number of these agents have been further weaponized and are widely recognized as being potentially significant biothreat agents. We describe a novel method based on multiply-primed rolling circle in vitro amplification for profiling genomic DNAs to permit rapid, cultivation-free differential detection and identification of circular plasmids in infectious agents. Using Phi29 DNA polymerase and a two-step priming reaction we could reproducibly detect and characterize by DNA sequencing circular DNA from Borrelia burgdorferi B31 in DNA samples containing as little as 25 pg of Borrelia DNA amongst a vast excess of human DNA. This simple technology can ultimately be adapted as a sensitive method to detect specific DNA from both known and unknown pathogens in a wide variety of complex environments.

  16. Rapid and sensitive detection of canine parvovirus type 2 by recombinase polymerase amplification.

    PubMed

    Wang, Jianchang; Liu, Libing; Li, Ruiwen; Wang, Jinfeng; Fu, Qi; Yuan, Wanzhe

    2016-04-01

    A novel recombinase polymerase amplification (RPA)-based method for detection of canine parvovirus type 2 (CPV-2) was developed. Sensitivity analysis showed that the detection limit of RPA was 10 copies of CPV-2 genomic DNA. RPA amplified both CPV-2a and -2b DNA but did not amplify the template of other important dog viruses (CCoV, PRV or CDV), demonstrating high specificity. The method was further validated with 57 canine fecal samples. An outstanding advantage of RPA is that it is an isothermal reaction and can be performed in a water bath, making RPA a potential alternative method for CPV-2 detection in resource-limited settings. PMID:26729477

  17. A Novel Isothermal Assay of Borrelia burgdorferi by Recombinase Polymerase Amplification with Lateral Flow Detection

    PubMed Central

    Liu, Wei; Liu, Hui-Xin; Zhang, Lin; Hou, Xue-Xia; Wan, Kang-Lin; Hao, Qin

    2016-01-01

    A novel isothermal detection for recombinase polymerase amplification with lateral flow (LF-RPA) was established for Borrelia burgdorferi (B. burgdorferi) detection in this study. This assay with high sensitivity and specificity can get a visible result without any additional equipment in 30 min. We designed a pair of primers according to recA gene of B. burgdorferi strains and a methodology evaluation was performed. The results showed that the RPA assay based on the recA gene was successfully applied in B. burgdorferi detection, and its specific amplification was only achieved from the genomic DNA of B. burgdorferi. The detection limit of the new assay was about 25 copies of the B. burgdorferi genomic DNA. Twenty Lyme borreliosis patients’ serum samples were detected by LF-RPA assay, real-time qPCR and nested-PCR. Results showed the LF-RPA assay is more effective than nested-PCR for its shorter reaction time and considerably higher detection rate. This method is of great value in clinical rapid detection for Lyme borreliosis. Using the RPA assay might be a megatrend for DNA detection in clinics and endemic regions. PMID:27527151

  18. A Novel Isothermal Assay of Borrelia burgdorferi by Recombinase Polymerase Amplification with Lateral Flow Detection.

    PubMed

    Liu, Wei; Liu, Hui-Xin; Zhang, Lin; Hou, Xue-Xia; Wan, Kang-Lin; Hao, Qin

    2016-08-03

    A novel isothermal detection for recombinase polymerase amplification with lateral flow (LF-RPA) was established for Borrelia burgdorferi (B. burgdorferi) detection in this study. This assay with high sensitivity and specificity can get a visible result without any additional equipment in 30 min. We designed a pair of primers according to recA gene of B. burgdorferi strains and a methodology evaluation was performed. The results showed that the RPA assay based on the recA gene was successfully applied in B. burgdorferi detection, and its specific amplification was only achieved from the genomic DNA of B. burgdorferi. The detection limit of the new assay was about 25 copies of the B. burgdorferi genomic DNA. Twenty Lyme borreliosis patients' serum samples were detected by LF-RPA assay, real-time qPCR and nested-PCR. Results showed the LF-RPA assay is more effective than nested-PCR for its shorter reaction time and considerably higher detection rate. This method is of great value in clinical rapid detection for Lyme borreliosis. Using the RPA assay might be a megatrend for DNA detection in clinics and endemic regions.

  19. A Novel Isothermal Assay of Borrelia burgdorferi by Recombinase Polymerase Amplification with Lateral Flow Detection.

    PubMed

    Liu, Wei; Liu, Hui-Xin; Zhang, Lin; Hou, Xue-Xia; Wan, Kang-Lin; Hao, Qin

    2016-01-01

    A novel isothermal detection for recombinase polymerase amplification with lateral flow (LF-RPA) was established for Borrelia burgdorferi (B. burgdorferi) detection in this study. This assay with high sensitivity and specificity can get a visible result without any additional equipment in 30 min. We designed a pair of primers according to recA gene of B. burgdorferi strains and a methodology evaluation was performed. The results showed that the RPA assay based on the recA gene was successfully applied in B. burgdorferi detection, and its specific amplification was only achieved from the genomic DNA of B. burgdorferi. The detection limit of the new assay was about 25 copies of the B. burgdorferi genomic DNA. Twenty Lyme borreliosis patients' serum samples were detected by LF-RPA assay, real-time qPCR and nested-PCR. Results showed the LF-RPA assay is more effective than nested-PCR for its shorter reaction time and considerably higher detection rate. This method is of great value in clinical rapid detection for Lyme borreliosis. Using the RPA assay might be a megatrend for DNA detection in clinics and endemic regions. PMID:27527151

  20. Mutations in the alpha-amanitin conserved domain of the largest subunit of yeast RNA polymerase III affect pausing, RNA cleavage and transcriptional transitions.

    PubMed Central

    Thuillier, V; Brun, I; Sentenac, A; Werner, M

    1996-01-01

    The alpha-amanitin domain or domain f of the largest subunit of RNA polymerases is one of the most conserved of these enzymes. We have found that the C-terminal part of domain f can be swapped between yeast RNA polymerase II and III. An extensive mutagenesis of domain f of C160, the largest subunit of RNA polymerase III, was carried out to better define its role and understand the mechanism through which C160 participates in transcription. One mutant enzyme, C160-270, showed much reduced transcription of a non-specific template at low DNA concentrations. Abortive synthesis of trinucleotides in a dinucleotide-primed reaction proceeded at roughly wild-type levels, indicating that the mutation did not affect the formation of the first phosphodiester bond, but rather the transition from abortive initiation to processive elongation. In specific transcription assays, on the SUP4 tRNA gene, pausing was extended but the rate of RNA elongation between pause sites was not affected. Finally, the rate of cleavage of nascent RNA transcripts by halted mutant RNA polymerase was increased approximately 10-fold. We propose that the domain f mutation affects the transition between two transcriptional modes, one being adopted during abortive transcription and at pause sites, the other during elongation between pause sites. Images PMID:8599945

  1. In silico screening for novel inhibitors of DNA polymerase III alpha subunit of Mycobacterium tuberculosis (MtbDnaE2, H37Rv).

    PubMed

    Jadaun, Alka; Sudhakar D, Raja; Subbarao, N; Dixit, Aparna

    2015-01-01

    Tuberculosis, a pandemic disease is caused by Mycobacterium tuberculosis (Mtb). DNA polymerase III encoded by DnaE2 of Mtb is specifically required for its survival in vivo, and hence can be considered to be a potential drug target. Amino acid sequence analysis of the MtbDnaE2 and its human counterpart does not show any significant similarity. Therefore, a 3D model of the MtbDnaE2 was generated using Modeller 9v10 with the template structure of E. Coli DNA polymerase III alpha subunit (2HNH_A). The generated models were validated using a number of programmes such as RAMPAGE/PROCHECK, VERIFY_3D, and ProSA. MtbDnaE2 has few conserved residues and four conserved domains similar to that present in DNA polymerase III of E. coli. In silico screening was performed with bioactive anti-tuberculosis compounds and 6-AU (a known inhibitor of DNA polymerase III of Bacillus subtilis) and its analogues against the modeled MtbDnaE2 structure. Docking was performed using GOLD v5.2 software which resulted in the identification of top ten compounds with high GOLD fitness scores and binding affinity (X-Score). To further evaluate the efficacy of these compounds, in silico ADMET analysis was performed using MedChem Designer v3. Given their high binding affinity to the targeted MtbDnaE2, which is essential for DNA replication in the Mtb and good ADMET properties, these compounds are promising candidates for further evaluation and development as anti-tubercular agents.

  2. In Silico Screening for Novel Inhibitors of DNA Polymerase III Alpha Subunit of Mycobacterium tuberculosis (MtbDnaE2, H37Rv)

    PubMed Central

    Jadaun, Alka; Sudhakar D, Raja; Subbarao, N.; Dixit, Aparna

    2015-01-01

    Tuberculosis, a pandemic disease is caused by Mycobacterium tuberculosis (Mtb). DNA polymerase III encoded by DnaE2 of Mtb is specifically required for its survival in vivo, and hence can be considered to be a potential drug target. Amino acid sequence analysis of the MtbDnaE2 and its human counterpart does not show any significant similarity. Therefore, a 3D model of the MtbDnaE2 was generated using Modeller 9v10 with the template structure of E. Coli DNA polymerase III alpha subunit (2HNH_A). The generated models were validated using a number of programmes such as RAMPAGE/PROCHECK, VERIFY_3D, and ProSA. MtbDnaE2 has few conserved residues and four conserved domains similar to that present in DNA polymerase III of E. coli. In silico screening was performed with bioactive anti-tuberculosis compounds and 6-AU (a known inhibitor of DNA polymerase III of Bacillus subtilis) and its analogues against the modeled MtbDnaE2 structure. Docking was performed using GOLD v5.2 software which resulted in the identification of top ten compounds with high GOLD fitness scores and binding affinity (X-Score). To further evaluate the efficacy of these compounds, in silico ADMET analysis was performed using MedChem Designer v3. Given their high binding affinity to the targeted MtbDnaE2, which is essential for DNA replication in the Mtb and good ADMET properties, these compounds are promising candidates for further evaluation and development as anti-tubercular agents. PMID:25811866

  3. Tyrosinemia Type III detected via neonatal screening: management and outcome.

    PubMed

    Heylen, Evelyne; Scherer, Gerd; Vincent, Marie-Françoise; Marie, Sandrine; Fischer, Judith; Nassogne, Marie-Cécile

    2012-11-01

    Tyrosinemia Type III is caused by the deficiency of 4-hydroxyphenylpyruvate dioxygenase (4-HPPD), an enzyme involved in the catabolic pathway of tyrosine. To our knowledge, only a few patients presenting with this disease have been described in the literature, and the clinical phenotype remains variable and unclear. We report the case of a boy with tyrosinemia Type III detected using neonatal screening, who is homozygous for the splice donor mutation IVS11+1G>A in intron 11 of the HPD gene. At the age of 30 months, the boy's outcome under mild protein restriction was characterized by normal growth and psychomotor development.

  4. Detection of Salmonella invA gene in shrimp enrichment culture by polymerase chain reaction.

    PubMed

    Upadhyay, Bishnu Prasad; Utrarachkij, Fuangfa; Thongshoob, Jarinee; Mahakunkijcharoen, Yuvadee; Wongchinda, Niracha; Suthienkul, Orasa; Khusmith, Srisin

    2010-03-01

    Contamination of seafood with salmonellae is a major public health concern. Detection of Salmonella by standard culture methods is time consuming. In this study, an enrichment culture step prior to polymerase chain reaction (PCR) was applied to detect 284 bp fragment of Salmonella invA in comparison with the conventional culture method in 100 shrimp samples collected from four different shrimp farms and fresh food markets around Bangkok. Samples were pre-enriched in non-selective lactose broth (LB) and selective tetrathionate broth (TTB). PCR detection limit was 10 pg and 10(4) cfu/ml of viable salmonellae with 100% specificity. PCR assay detected 19 different Salmonella serovars belonging to 8 serogroups (B, C1, C2-C3, D1, E1, E4 and K) commonly found in clinical and environmental samples in Thailand. The detection rate of PCR following TTB enrichment (24%) was higher than conventional culture method (19%). PCR following TTB, but not in LB enrichment allowed salmonella detection with 84% sensitivity, 90% specificity and 89% accuracy. Shrimp samples collected from fresh food markets had higher levels of contaminated salmonellae than those from shrimp farms. The results indicated that incorporation of an enrichment step prior to PCR has the potential to be applied for detection of naturally contaminated salmonellae in food, environment and clinical samples.

  5. A suppressor of an RNA polymerase II mutation of Saccharomyces cerevisiae encodes a subunit common to RNA polymerases I, II, and III.

    PubMed Central

    Archambault, J; Schappert, K T; Friesen, J D

    1990-01-01

    RNA polymerase II (RNAPII) is a complex multisubunit enzyme responsible for the synthesis of pre-mRNA in eucaryotes. The enzyme is made of two large subunits associated with at least eight smaller polypeptides, some of which are common to all three RNA polymerase species. We have initiated a genetic analysis of RNAPII by introducing mutations in RPO21, the gene encoding the largest subunit of RNAPII in Saccharomyces cerevisiae. We have used a yeast genomic library to isolate plasmids that can suppress a temperature-sensitive mutation in RPO21 (rpo21-4), with the goal of identifying gene products that interact with the largest subunit of RNAPII. We found that increased expression of wild-type RPO26, a single-copy, essential gene encoding a 155-amino-acid subunit common to RNAPI, RNAPII, and RNAPIII, suppressed the rpo21-4 temperature-sensitive mutation. Mutations were constructed in vitro that resulted in single amino acid changes in the carboxy-terminal portion of the RPO26 gene product. One temperature-sensitive mutation, as well as some mutations that did not by themselves generate a phenotype, were lethal in combination with rpo21-4. These results support the idea that the RPO26 and RPO21 gene products interact. Images PMID:2247052

  6. Specific Polymerase Chain Reaction Primers for the Detection of Plasmodiophora brassicae in Soil and Water.

    PubMed

    Faggian, R; Bulman, S R; Lawrie, A C; Porter, I J

    1999-05-01

    ABSTRACT The development of specific oligonucleotide primers for Plasmodiophora brassicae has led to a nested polymerase chain reaction (PCR) detection method for P. brassicae in soil and water. Initially, the PCR was used to amplify a section of the rDNA repeat. The PCR products were sequenced and the data used to design primers that were directed at the ribosomal RNA genes and internal transcribed spacer regions. Specificity was tested against more than 40 common soil organisms, host plants, and spore suspension contaminants, as well as P. brassicae isolates from around Australia and the world. Sensitivity was determined to be 0.1 fentograms (fg; 10(-15) g) for pure template and as low as 1,000 spores per g of potting mix. In soil, P. brassicae was detected in all soils where the inoculum was sufficient to result in clubroot symptoms. Also outlined is a simple method of DNA extraction from soil. PMID:18944752

  7. Rapid detection of shrimp white spot syndrome virus by real time, isothermal recombinase polymerase amplification assay.

    PubMed

    Xia, Xiaoming; Yu, Yongxin; Weidmann, Manfred; Pan, Yingjie; Yan, Shuling; Wang, Yongjie

    2014-01-01

    White spot syndrome virus (WSSV) causes large economic losses to the shrimp aquaculture industry, and thus far there are no efficient therapeutic treatments available against this lethal virus. In this study, we present the development of a novel real time isothermal recombinase polymerase amplification (RPA) assay for WSSV detection on a small ESEQuant Tube Scanner device. The RPA sensitivity, specificity and rapidity were evaluated by using a plasmid standard as well as viral and shrimp genomic DNAs. Compared with qPCR, the RPA assay revealed more satisfactory performance. It reached a detection limit up to 10 molecules in 95% of cases as determined by probit analysis of 8 independent experiments within 6.41 ± 0.17 min at 39 °C. Consequently, this rapid RPA method has great application potential for field use or point of care diagnostics.

  8. DNA-Dependent RNA Polymerase Detects Hidden Giant Viruses in Published Databanks

    PubMed Central

    Sharma, Vikas; Colson, Philippe; Giorgi, Roch; Pontarotti, Pierre; Raoult, Didier

    2014-01-01

    Environmental metagenomic studies show that there is a “dark matter,” composed of sequences not linked to any known organism, as determined mainly using ribosomal DNA (rDNA) sequences, which therefore ignore giant viruses. DNA-dependent RNA polymerase (RNAP) genes are universal in microbes and conserved in giant viruses and may replace rDNA for identifying microbes. We found while reconstructing RNAP subunit 2 (RNAP2) phylogeny that a giant virus sequenced together with the genome of a large eukaryote, Hydra magnipapillata, has been overlooked. To explore the dark matter, we used viral RNAP2 and reconstructed putative ancestral RNAP2, which were significantly superior in detecting distant clades than current sequences, and we revealed two additional unknown mimiviruses, misclassified as an euryarchaeote and an oomycete plant pathogen, and detected unknown putative viral clades. We suggest using RNAP systematically to decipher the black matter and identify giant viruses. PMID:24929085

  9. Polymerase chain reaction assay for detection of sheep and goat meats.

    PubMed

    K Chikuni; T Tabata; M Kosugiyama; M Monma; M Saito

    1994-01-01

    Polymerase Chain Reaction (PCR) was applied to a qualitative differentiation between sheep, goat and bovine meats. Oligonucleotide primers were designed for the amplification of sheep satellite I DNA sequence. The PCR amplified 374 bp fragments from sheep and goat DNA, but no fragment from bovine, water buffalo, sika deer, pig, horse, rabbit and chicken DNA. Sheep DNA (10 pg) was detected by 4% agarose gel electrophoresis following PCR amplification. Althoug cooking of the sample meats reduced the PCR products, sheep DNA was detected in the meat heated at 120°C. In order to differentiate between sheep and goat meats, nucleotide sequences of the PCR products were determined directly by cycle sequencing. The sequence of PCR products showed 92% of homology between sheep and goat. They were differentiated by ApaI digestion of the PCR products because sheep had one ApaI site and goat had no site in the PCR products.

  10. Rapid Detection of Shrimp White Spot Syndrome Virus by Real Time, Isothermal Recombinase Polymerase Amplification Assay

    PubMed Central

    Xia, Xiaoming; Yu, Yongxin; Weidmann, Manfred; Pan, Yingjie; Yan, Shuling; Wang, Yongjie

    2014-01-01

    White spot syndrome virus (WSSV) causes large economic losses to the shrimp aquaculture industry, and thus far there are no efficient therapeutic treatments available against this lethal virus. In this study, we present the development of a novel real time isothermal recombinase polymerase amplification (RPA) assay for WSSV detection on a small ESEQuant Tube Scanner device. The RPA sensitivity, specificity and rapidity were evaluated by using a plasmid standard as well as viral and shrimp genomic DNAs. Compared with qPCR, the RPA assay revealed more satisfactory performance. It reached a detection limit up to 10 molecules in 95% of cases as determined by probit analysis of 8 independent experiments within 6.41±0.17 min at 39°C. Consequently, this rapid RPA method has great application potential for field use or point of care diagnostics. PMID:25121957

  11. Rapid Detection of Cyprinid Herpesvirus 3 in Latently Infected Koi by Recombinase Polymerase Amplification.

    PubMed

    Prescott, Meagan A; Reed, Aimee N; Jin, Ling; Pastey, Manoj K

    2016-09-01

    Since the emergence of cyprinid herpesvirus 3 (CyHV-3), outbreaks have been devastating to Common Carp Cyprinus carpio and koi (a variant of Common Carp), leading to high economic losses. Current diagnostics for detecting CyHV-3 are limited in sensitivity and are further complicated by latency. Here we describe the detection of CyHV-3 by recombinase polymerase amplification (RPA). The RPA assay can detect as low as 10 copies of the CyHV-3 genome by an isothermal reaction and yields results in approximately 20 min. Using the RPA assay, the CyHV-3 genome can be detected in the total DNA of white blood cells isolated from koi latently infected with CyHV-3, while less than 10% of the latently infected koi can be detected by a real-time PCR assay in the total DNA of white blood cells. In addition, RPA products can be detected in a lateral flow device that is cheap and fast and can be used outside of the diagnostic lab. The RPA assay and lateral flow device provide for the rapid, sensitive, and specific amplification of CyHV-3 that with future modifications for field use and validation could lead to enhanced surveillance and early diagnosis of CyHV-3 in the laboratory and field. Received September 14, 2015; accepted April 9, 2016. PMID:27485254

  12. High sensitivity detection of active botulinum neurotoxin by glyco-quantitative polymerase chain-reaction.

    PubMed

    Kwon, Seok Joon; Jeong, Eun Ji; Yoo, Yung Choon; Cai, Chao; Yang, Gi-Hyeok; Lee, Jae Chul; Dordick, Jonathan S; Linhardt, Robert J; Lee, Kyung Bok

    2014-03-01

    The sensitive detection of highly toxic botulinum neurotoxin (BoNT) from Clostridium botulinum is of critical importance because it causes human illnesses if foodborne or introduced in wounds and as an iatrogenic substance. Moreover, it has been recently considered a possible biological warfare agent. Over the past decade, significant progress has been made in BoNT detection technologies, including mouse lethality assays, enzyme-linked immunosorbent assays, and endopeptidase assays and by mass spectrometry. Critical assay requirements, including rapid assay, active toxin detection, sensitive and accurate detection, still remain challenging. Here, we present a novel method to detect active BoNTs using a Glyco-quantitative polymerase chain-reaction (qPCR) approach. Sialyllactose, which interacts with the binding-domain of BoNTs, is incorporated into a sialyllactose-DNA conjugate as a binding-probe for active BoNT and recovered through BoNT-immunoprecipitation. Glyco-qPCR analysis of the bound sialyllactose-DNA is then used to detect low attomolar concentrations of BoNT and attomolar to femtomolar concentrations of BoNT in honey, the most common foodborne source of infant botulism.

  13. Rapid Detection of Cyprinid Herpesvirus 3 in Latently Infected Koi by Recombinase Polymerase Amplification.

    PubMed

    Prescott, Meagan A; Reed, Aimee N; Jin, Ling; Pastey, Manoj K

    2016-09-01

    Since the emergence of cyprinid herpesvirus 3 (CyHV-3), outbreaks have been devastating to Common Carp Cyprinus carpio and koi (a variant of Common Carp), leading to high economic losses. Current diagnostics for detecting CyHV-3 are limited in sensitivity and are further complicated by latency. Here we describe the detection of CyHV-3 by recombinase polymerase amplification (RPA). The RPA assay can detect as low as 10 copies of the CyHV-3 genome by an isothermal reaction and yields results in approximately 20 min. Using the RPA assay, the CyHV-3 genome can be detected in the total DNA of white blood cells isolated from koi latently infected with CyHV-3, while less than 10% of the latently infected koi can be detected by a real-time PCR assay in the total DNA of white blood cells. In addition, RPA products can be detected in a lateral flow device that is cheap and fast and can be used outside of the diagnostic lab. The RPA assay and lateral flow device provide for the rapid, sensitive, and specific amplification of CyHV-3 that with future modifications for field use and validation could lead to enhanced surveillance and early diagnosis of CyHV-3 in the laboratory and field. Received September 14, 2015; accepted April 9, 2016.

  14. Cross-subtype detection of HIV-1 using reverse transcription and recombinase polymerase amplification.

    PubMed

    Lillis, Lorraine; Lehman, Dara A; Siverson, Joshua B; Weis, Julie; Cantera, Jason; Parker, Mathew; Piepenburg, Olaf; Overbaugh, Julie; Boyle, David S

    2016-04-01

    A low complexity diagnostic test that rapidly and reliably detects HIV infection in infants at the point of care could facilitate early treatment, improving outcomes. However, many infant HIV diagnostics can only be performed in laboratory settings. Recombinase polymerase amplification (RPA) is an isothermal amplification technology that can rapidly amplify proviral DNA from multiple subtypes of HIV-1 in under twenty minutes without complex equipment. In this study we added reverse transcription (RT) to RPA to allow detection of both HIV-1 RNA and DNA. We show that this RT-RPA HIV-1 assay has a limit of detection of 10-30 copies of an exact sequence matched DNA or RNA, respectively. In addition, at 100 copies of RNA or DNA, the assay detected 171 of 175 (97.7%) sequence variants that represent all the major subtypes and recombinant forms of HIV-1 Groups M and O. This data suggests that the application of RT-RPA for the combined detection of HIV-1 viral RNA and proviral DNA may prove a highly sensitive tool for rapid and accurate diagnosis of infant HIV. PMID:26821087

  15. Cross-subtype detection of HIV-1 using reverse transcription and recombinase polymerase amplification.

    PubMed

    Lillis, Lorraine; Lehman, Dara A; Siverson, Joshua B; Weis, Julie; Cantera, Jason; Parker, Mathew; Piepenburg, Olaf; Overbaugh, Julie; Boyle, David S

    2016-04-01

    A low complexity diagnostic test that rapidly and reliably detects HIV infection in infants at the point of care could facilitate early treatment, improving outcomes. However, many infant HIV diagnostics can only be performed in laboratory settings. Recombinase polymerase amplification (RPA) is an isothermal amplification technology that can rapidly amplify proviral DNA from multiple subtypes of HIV-1 in under twenty minutes without complex equipment. In this study we added reverse transcription (RT) to RPA to allow detection of both HIV-1 RNA and DNA. We show that this RT-RPA HIV-1 assay has a limit of detection of 10-30 copies of an exact sequence matched DNA or RNA, respectively. In addition, at 100 copies of RNA or DNA, the assay detected 171 of 175 (97.7%) sequence variants that represent all the major subtypes and recombinant forms of HIV-1 Groups M and O. This data suggests that the application of RT-RPA for the combined detection of HIV-1 viral RNA and proviral DNA may prove a highly sensitive tool for rapid and accurate diagnosis of infant HIV.

  16. Development of a recombinase polymerase amplification assay for the detection of pathogenic Leptospira.

    PubMed

    Ahmed, Ahmed; van der Linden, Hans; Hartskeerl, Rudy A

    2014-05-08

    Detection of leptospires based on DNA amplification techniques is essential for the early diagnosis of leptospirosis when anti-Leptospira antibodies are below the detection limit of most serological tests. In middle and low income countries where leptospirosis is endemic, routine implementation of real-time PCR is financially and technically challenging due to the requirement of expensive thermocycler equipment. In this study we report the development and evaluation of a novel isothermal recombinase polymerase amplification assay (RPA) for detection of pathogenic Leptospira based on TwistAmp chemistry. RPA enabled the detection of less than two genome copies per reaction. Retrospective evaluation revealed a high diagnostic accuracy (sensitivity and specificity of 94.7% and 97.7%, respectively) compared to culturing as the reference standard. RPA presents a powerful tool for the early diagnosis of leptospirosis in humans and in animals. Furthermore, it enables the detection of the causative agent in reservoirs and environment, and as such is a valuable adjunct to current tools for surveillance and early outbreak warning.

  17. Immunohistochemistry and Polymerase Chain Reaction for Detection Human Papilloma Virus in Warts: A Comparative Study

    PubMed Central

    Lee, Hong Sun; Lee, Ji Hyun; Choo, Ji Yoon; Byun, Hee Jin; Jun, Jin Hyun

    2016-01-01

    Background Immunohistochemistry and polymerase chain reaction (PCR) are the most widely used methods for the detection of viruses. PCR is known to be a more sensitive and specific method than the immunohistochemical method at this time, but PCR has the disadvantages of high cost and skilled work to use widely. With the progress of technology, the immunohistochemical methods used in these days has come to be highly sensitive and actively used in the diagnostic fields. Objective To evaluate and compare the usefulness of immunohistochemistry and PCR for detection human papilloma virus (HPV) in wart lesions. Methods Nine biopsy samples of verruca vulgaris and 10 of condyloma accuminatum were examined. Immunohistochemical staining using monoclonal antibody to HPV L1 capsid protein and PCR were done for the samples. DNA sequencing of the PCR products and HPV genotyping were also done. Results HPV detection rate was 78.9% (88.9% in verruca vulgaris, 70.0% in condyloma accuminatum) on immunohistochemistry and 100.0% for PCR. HPV-6 genotype showed a lower positivity rate on immunohistochemistry (50.0%) as compared to that of the other HPV genotypes. Conclusion Immunohistochemistry for HPV L1 capsid protein showed comparable sensitivity for detection HPV. Considering the high cost and great effort needed for the PCR methods, we can use immunohistochemistry for HPV L1 capsid protein with the advantage of lower cost and simple methods for HPV detection. PMID:27489431

  18. Nested reverse transcriptase-polymerase chain reaction for the detection of group A rotaviruses.

    PubMed

    Elschner, M; Prudlo, J; Hotzel, H; Otto, P; Sachse, K

    2002-03-01

    Rotaviruses are important pathogens associated with diarrhoeal diseases in almost all species of mammals. In the present study, a nested reverse transcriptase-polymerase chain reaction (RT-PCR) for the detection of group A rotaviruses was developed, which is based on a target region in gene segment 6. Rotavirus strains of human, bovine, porcine, canine, feline, equine, and ovine origin were examined. Furthermore several faecal specimens, in which rotavirus had already been detected using other methods than PCR, were included in the study. A nested RT-PCR product was formed with all strains and faecal samples tested. The detection limit for virus-containing cell culture supernatant was 3 x 10(-2) [50% tissue culture infective dose (TCID50)] by RT-PCR and 3 x 10(-3) TCID50) by nested amplification. In order to examine the influence of the sample matrix on sensitivity, a rotavirus-negative faecal specimen was spiked with virus-containing cell culture suspension of the porcine rotavirus OSU. The detection limit of the present PCR procedure was approximately 1.6 x 10(2) TCID50 per g faeces and could be increased by one order of magnitude using nested PCR. The present method for detection and identification of group A rotaviruses represents a powerful diagnostic tool and was shown to be applicable to rotaviruses of different origin, including human sources. PMID:12002423

  19. Polymerase chain reaction-gene probe detection system specific for pathogenic strains of Yersinia enterocolitica.

    PubMed

    Ibrahim, A; Liesack, W; Stackebrandt, E

    1992-08-01

    The polymerase chain reaction technique was used to develop a rapid diagnostic assay for detection of pathogenic Yersinia enterocolitica strains. The assay targeted a stretch of 163 bp of the yst gene and could be applied to both pure cultures and crude DNA extracted from feces. The defined primer pair amplified the targeted sequence from only pathogenic strains and fecal samples seeded with the serotype O:3 strain of Y. enterocolitica, whereas neither nonpathogenic strains nor normal stools yielded any amplified fragments. Of the other Yersinia species and non-Yersinia species tested, only two strains of Y. kristensenii yielded the same amplified product. A 20-mer oligonucleotide probe specifically hybridized within the amplified yst fragment of Y. enterocolitica but did not hybridize with the amplified yst fragment of Y. kristensenii by Southern and dot blot hybridizations. This confirms the reliability of this diagnostic assay in both clinical and epidemiological studies. The availability of the extracted DNA for the polymerase chain reaction was checked by simultaneous amplification of a part of the 16S rDNA and the yst gene. The entire diagnostic assay, including a simplified technique for DNA extraction, the amplification process, and gel electrophoresis, could be completed within 1 working day, which is better than the time required for the time-consuming traditional techniques used in clinical laboratories.

  20. Detection of inteins among diverse DNA polymerase genes of uncultivated members of the Phycodnaviridae.

    PubMed

    Culley, Alexander I; Asuncion, Brenda F; Steward, Grieg F

    2009-04-01

    Viruses in the family Phycodnaviridae infect autotrophic protists in aquatic environments. Application of a PCR assay targeting the DNA polymerase of viruses in this family has revealed that phycodnaviruses are quite diverse and appear to be widespread, but a limited number of environments have been examined so far. In this study, we examined the sequence diversity among viral DNA pol genes amplified by PCR from subtropical coastal waters of O'ahu, Hawai'i. A total of 18 novel prasinovirus-like sequences were detected along with two other divergent sequences that differ at the genus-level relative to other sequences in the family. Of the 20 new sequence types reported here, three were serendipitously found to contain protein introns, or inteins. Sequence analysis of the inteins suggested that all three have self-splicing domains and are apparently capable of removing themselves from the translated polymerase protein. Two of the three also appear to be 'active', meaning they encode all the motifs necessary for a complete dodecapeptide homing endonuclease, and are therefore capable of horizontal transfer. A subsequent PCR survey of our samples with intein-specific primers suggested that intein-containing phycodnaviruses are common in this environment. A search for similar sequences in metagenomic data sets from other oceans indicated that viral inteins are also widespread, but how these genetic parasites might be influencing the ecology and evolution of phycodnaviruses remains unclear.

  1. TYPE III EXCITABILITY, SLOPE SENSITIVITY AND COINCIDENCE DETECTION

    PubMed Central

    Meng, Xiangying; Huguet, Gemma; Rinzel, John

    2013-01-01

    Some neurons in the nervous system do not show repetitive firing for steady currents. For time-varying inputs, they fire once if the input rise is fast enough. This property of phasic firing is known as Type III excitability. Type III excitability has been observed in neurons in the auditory brainstem (MSO), which show strong phase-locking and accurate coincidence detection. In this paper, we consider a Hodgkin-Huxley type model (RM03) that is widely-used for phasic MSO neurons and we compare it with a modification of it, showing tonic behavior. We provide insight into the temporal processing of these neuron models by means of developing and analyzing two reduced models that reproduce qualitatively the properties of the exemplar ones. The geometric and mathematical analysis of the reduced models allows us to detect and quantify relevant features for the temporal computation such as nearness to threshold and a temporal integration window. Our results underscore the importance of Type III excitability for precise coincidence detection. PMID:23667306

  2. Novel pyrazolo[3,4-d]pyrimidine-based inhibitors of Staphlococcus aureus DNA polymerase III: design, synthesis, and biological evaluation.

    PubMed

    Ali, Amjad; Taylor, Gayle E; Ellsworth, Ken; Harris, Georgianna; Painter, Ronald; Silver, Lynn L; Young, Katherine

    2003-05-01

    6-Anilinopyrazolo[3,4-d]pyrimidin-4-ones are novel dGTP analogues that inhibit the replication-specific enzyme DNA polymerase III (DNA pol III) of Staphlococcus aureus and other Gram-positive (Gr+) bacteria. To enhance the potential of these inhibitors as antimicrobial agents, a structure-activity relationship was developed involving substitutions at the 2, 4, and pyrazolo NH positions. All of the new inhibitors were tested for their ability to inhibit S. aureus DNA pol III and the growth of several other Gr+ bacteria in culture. 2-Anilino groups with small hydrophobic groups in the meta or para position enhanced both antipolymerase and antimicrobial activity. 2-Benzyl-substituted inhibitors were substantially less active. Substitution in the 4-position by oxygen gave the optimal activity, whereas substitution at the pyrazolo NH was not tolerated. These pyrazolo[3,4-d]pyrimidine derivatives represent a novel class of antimicrobials with promising activities against Gr+ bacteria.

  3. Investigation of polymerase chain reaction assays to improve detection of bacterial involvement in bovine respiratory disease.

    PubMed

    Bell, Colin J; Blackburn, Paul; Elliott, Mark; Patterson, Tony I A P; Ellison, Sean; Lahuerta-Marin, Angela; Ball, Hywel J

    2014-09-01

    Bovine respiratory disease (BRD) causes severe economic losses to the cattle farming industry worldwide. The major bacterial organisms contributing to the BRD complex are Mannheimia haemolytica, Histophilus somni, Mycoplasma bovis, Pasteurella multocida, and Trueperella pyogenes. The postmortem detection of these organisms in pneumonic lung tissue is generally conducted using standard culture-based techniques where the presence of therapeutic antibiotics in the tissue can inhibit bacterial isolation. In the current study, conventional and real-time polymerase chain reaction (PCR) assays were used to assess the prevalence of these 5 organisms in grossly pneumonic lung samples from 150 animals submitted for postmortem examination, and the results were compared with those obtained using culture techniques. Mannheimia haemolytica was detected in 51 cases (34%) by PCR and in 33 cases (22%) by culture, H. somni was detected in 35 cases (23.3%) by PCR and in 6 cases (4%) by culture, Myc. bovis was detected in 53 cases (35.3%) by PCR and in 29 cases (19.3%) by culture, P. multocida was detected in 50 cases (33.3%) by PCR and in 31 cases (20.7%) by culture, and T. pyogenes was detected in 42 cases (28%) by PCR and in 31 cases (20.7%) by culture, with all differences being statistically significant. The PCR assays indicated positive results for 111 cases (74%) whereas 82 cases (54.6%) were culture positive. The PCR assays have demonstrated a significantly higher rate of detection of all 5 organisms in cases of pneumonia in cattle in Northern Ireland than was detected by current standard procedures.

  4. Optimization of competitively differentiated polymerase chain reaction in detection of HBV basal core promoter mutation

    PubMed Central

    Peng, Xiao-Mou; Gu, Lin; Chen, Xue-Juan; Li, Jian-Guo; Huang, Yang-Su; Gao, Zhi-Liang

    2005-01-01

    AIM: To improve competitively differentiated polymerase chain reaction (CD-PCR) in detection of HBV basal core promoter mutation. METHODS: Recombinant plasmid of double point mutation A1762T/G1764A in basal core promoter of HBV constructed by site-directed mutagenesis was used as mutant control. To reveal the deficiency mechanism of CD-PCR, relationship between the circle number of PCR and the increased speed of products of each competitive primer was comparatively studied. Diversified amount of dNTPs and mutual primer of the competitive primers were tried to optimize CD-PCR. Optimized CD-PCR was evaluated by detecting A1762T/G1764A mutation in recombinant plasmids and clinical sera from patients with HBV infection. RESULTS: The deficiency mechanism of CD-PCR was that the products of mismatched competitive primer grew fast when the amplification of matched primer entered into plateau stage, which led to decrease in or disappearance of the difference in the amount of their products. This phenomenon could be eliminated by reducing dNTPs to 10 μmol/L and mutual primer to about 100 nmol/L. Optimized CD-PCR could detect both mutant and wild strain indepe-ndent of the amount of templates and the number of PCR cycles. Its detection limit was 103 copies/mL, about 50 copies/reaction. About 10% of mutant DNAs among wild type DNAs could be detected. A1762T/G1764A mutant was detected in 41.8% (51/122) of patients with HBV infection, but not detected in controls with negative HBsAg. CONCLUSION: Optimized CD-PCR can detect mutation independent of the amount of initial templates and the number of PCR cycles. PMID:15962387

  5. DNA-dependent RNA polymerase III from the fungus Podospora comata. Purification, subunit structure and comparison with the homologous enzyme of a related species.

    PubMed

    Barreau, C; Begueret, J

    1982-12-15

    DNA-dependent RNA polymerase III has been purified to homogeneity from the filamentous fungus Podospora comata. The enzyme was extracted at low ionic strength, separated from the polymerases I and II by DEAE-Sephadex chromatography and purified by heparin-Sepharose and phosphocellulose chromatography; 0.1-0.2 mg highly purified homogeneous enzyme with a specific activity of 220 units/mg could be obtained from 2 kg wet mycelium. The subunit composition of the enzyme was determined after sodium dodecyl sulphate/polyacrylamide gel electrophoresis; thirteen putative subunits of molecular weight 174000 (a), 129000 b), 87000 (c), 50000 (d), 39000 (e), 23500 (f), 21000 (g), 19000 (h), 17000 (i), 16500 (j), 13500 (k), 11000 (l) and 10000 (m) were identified. All of the polypeptide components of the enzyme are present in about integral stoichiometric amounts as judged by dye binding. The presence of subunit Mr = 87000 in a molar ratio 1:1 is necessary to obtain very active enzyme. Thirteen homologous subunits were observed in a preparation of RNA polymerase III from Podospora anserina, which is a related species. Only subunit i is different in the two species. PMID:7151805

  6. Detection of hog cholera virus and differentiation from other pestiviruses by polymerase chain reaction.

    PubMed

    Wirz, B; Tratschin, J D; Müller, H K; Mitchell, D B

    1993-05-01

    Reverse transcription coupled with the polymerase chain reaction (RT-PCR) was used for the detection and differentiation of pestiviruses. For this purpose, one primer pair was selected from a highly conserved region of the genome of pestiviruses. Using these primers (PEST 1-PEST 2), DNA fragments of between 72 and 74 bp could be amplified from all pestivirus isolates tested. In order to differentiate hog cholera virus (HCV) from bovine viral diarrhea virus (BVDV) and border disease virus (BDV), we selected a primer pair from a conserved region in the genome of HCV strains that differed from that sequenced in the genome of BVDV strains. By using these primers (HCV 1-HCV 2), a DNA fragment of 478 bp could be specifically amplified from HCV isolates. By these means, viral RNA was detected in extracts of lymph node, spleen, tonsil, and lung. Such extracts were used directly for RT-PCR without prior RNA isolation. We also performed multiplex PCR by using both the PEST 1-PEST 2 and HCV 1-HCV 2 primer pairs in a single reaction. This allowed the differentiation of HCV from BVDV and BDV in one step. To assess the sensitivity of the method, RT-PCR was compared with virus propagation in tissue culture and subsequent detection by immunofluorescence staining. The results show that RT-PCR is useful for the rapid detection and differentiation of pestiviruses. PMID:8388887

  7. Immunomagnetic separation combined with polymerase chain reaction for the detection of Alicyclobacillus acidoterrestris in apple juice.

    PubMed

    Wang, Zhouli; Wang, Jun; Yue, Tianli; Yuan, Yahong; Cai, Rui; Niu, Chen

    2013-01-01

    A combination of immunomagnetic separation (IMS) and polymerase chain reaction (PCR) was used to detect Alicyclobacillus acidoterrestris (A. acidoterrestris) in apple juice. The optimum technological parameters of the IMS system were investigated. The results indicated that the immunocapture reactions could be finished in 60 min and the quantity of IMPs used for IMS was 2.5 mg/mL. Then the combined IMS-PCR procedure was assessed by detecting A. acidoterrestris in apple juice samples. The agarose gel electrophoresis results of 20 different strains showed that the IMS-PCR procedure presented high specificity to the A. acidoterrestris. The sensitivity of the IMS-PCR was 2×10(1) CFU/mL and the total detection time was 3 to 4 h. Of the 78 naturally contaminated apple juice samples examined, the sensitivity, specificity and accuracy of IMS-PCR compared with the standardized pour plate method were 90.9%, 97.0% and 96.2%, respectively. The results exhibited that the developed IMS-PCR method will be a valuable tool for detecting A. acidoterrestris and improving food quality in juice samples.

  8. Detection and Characterization of Viral Species/Subspecies Using Isothermal Recombinase Polymerase Amplification (RPA) Assays.

    PubMed

    Glais, Laurent; Jacquot, Emmanuel

    2015-01-01

    Numerous molecular-based detection protocols include an amplification step of the targeted nucleic acids. This step is important to reach the expected sensitive detection of pathogens in diagnostic procedures. Amplifications of nucleic acid sequences are generally performed, in the presence of appropriate primers, using thermocyclers. However, the time requested to amplify molecular targets and the cost of the thermocycler machines could impair the use of these methods in routine diagnostics. Recombinase polymerase amplification (RPA) technique allows rapid (short-term incubation of sample and primers in an enzymatic mixture) and simple (isothermal) amplification of molecular targets. RPA protocol requires only basic molecular steps such as extraction procedures and agarose gel electrophoresis. Thus, RPA can be considered as an interesting alternative to standard molecular-based diagnostic tools. In this paper, the complete procedures to set up an RPA assay, applied to detection of RNA (Potato virus Y, Potyvirus) and DNA (Wheat dwarf virus, Mastrevirus) viruses, are described. The proposed procedure allows developing species- or subspecies-specific detection assay.

  9. Rapid detection of HIV-1 proviral DNA for early infant diagnosis using recombinase polymerase amplification.

    PubMed

    Boyle, David S; Lehman, Dara A; Lillis, Lorraine; Peterson, Dylan; Singhal, Mitra; Armes, Niall; Parker, Mathew; Piepenburg, Olaf; Overbaugh, Julie

    2013-04-02

    Early diagnosis and treatment of human immunodeficiency virus type 1 (HIV-1) infection in infants can greatly reduce mortality rates. However, current infant HIV-1 diagnostics cannot reliably be performed at the point of care, often delaying treatment and compromising its efficacy. Recombinase polymerase amplification (RPA) is a novel technology that is ideal for an HIV-1 diagnostic, as it amplifies target DNA in <20 min at a constant temperature, without the need for complex thermocycling equipment. Here we tested 63 HIV-1-specific primer and probe combinations and identified two RPA assays that target distinct regions of the HIV-1 genome (long terminal repeat [LTR] and pol) and can reliably detect 3 copies of proviral DNA by the use of fluorescence detection and lateral-flow strip detection. These pol and LTR primers amplified 98.6% and 93%, respectively, of the diverse HIV-1 variants tested. This is the first example of an isothermal assay that consistently detects all of the major HIV-1 global subtypes.

  10. Detection and Characterization of Viral Species/Subspecies Using Isothermal Recombinase Polymerase Amplification (RPA) Assays.

    PubMed

    Glais, Laurent; Jacquot, Emmanuel

    2015-01-01

    Numerous molecular-based detection protocols include an amplification step of the targeted nucleic acids. This step is important to reach the expected sensitive detection of pathogens in diagnostic procedures. Amplifications of nucleic acid sequences are generally performed, in the presence of appropriate primers, using thermocyclers. However, the time requested to amplify molecular targets and the cost of the thermocycler machines could impair the use of these methods in routine diagnostics. Recombinase polymerase amplification (RPA) technique allows rapid (short-term incubation of sample and primers in an enzymatic mixture) and simple (isothermal) amplification of molecular targets. RPA protocol requires only basic molecular steps such as extraction procedures and agarose gel electrophoresis. Thus, RPA can be considered as an interesting alternative to standard molecular-based diagnostic tools. In this paper, the complete procedures to set up an RPA assay, applied to detection of RNA (Potato virus Y, Potyvirus) and DNA (Wheat dwarf virus, Mastrevirus) viruses, are described. The proposed procedure allows developing species- or subspecies-specific detection assay. PMID:25981257

  11. Separation-Type Multiplex Polymerase Chain Reaction Chip for Detecting Male Infertility

    NASA Astrophysics Data System (ADS)

    Ha, Seung-Mo; Ju, Jin-Kyoung; Ahn, Yoomin; Hwang, Seung Young

    2008-06-01

    A novel polymerase chain reaction (PCR) biochip is presented in this paper. In this PCR chip, the glass substrate integrated with the microheater and microsensor is separable from the reaction chamber where the sample is injected, which now makes repeated reuse of the glass substrate possible. The heat transfer efficiency and target gene amplification of the proposed separable PCR chip was compared with that of the conventional united PCR chip. The results showed that the sex-determining Y chromosome (SRY) gene PCR for detecting male infertility was successfully performed in the separable chip. However, repeated multiplex PCR was successful for only two genes, SPGY1 and SRY, but not for gene SY586. Future work is needed for a multiplex PCR with more than three genes.

  12. Polymerase chain reaction detection of potentially pathogenic free-living amoebae in dental units.

    PubMed

    Leduc, Annie; Gravel, Sabrina; Abikhzer, Jérémie; Roy, Stéphane; Barbeau, Jean

    2012-07-01

    Several genera of amoebae can be found in water from dental units and on the inner surface of waterlines. The presence of bacterial biofilms on these surfaces is thought to favor the proliferation of amoebae. Potentially pathogenic Acanthamoeba and Naegleria spp. may be an infection risk for patients through contact with open surgical sites or aerosolization. A polymerase chain reaction of DNA extracted from pelleted samples showed that Acanthamoeba spp. and Naegleria spp. were present in water from dental units, suction lines, and suction filters at the dental clinic of the Université de Montréal. Acanthamoeba spp. were detected in 24.2% of 66 samples and Naegleria spp. in 3.0%. We discuss the infection risk associated with these results.

  13. Quantitative polymerase chain reaction (PCR) for detection of aquatic animal pathogens in a diagnostic laboratory setting

    USGS Publications Warehouse

    Purcell, Maureen K.; Getchell, Rodman G.; McClure, Carol A.; Weber, S.E.; Garver, Kyle A.

    2011-01-01

    Real-time, or quantitative, polymerase chain reaction (qPCR) is quickly supplanting other molecular methods for detecting the nucleic acids of human and other animal pathogens owing to the speed and robustness of the technology. As the aquatic animal health community moves toward implementing national diagnostic testing schemes, it will need to evaluate how qPCR technology should be employed. This review outlines the basic principles of qPCR technology, considerations for assay development, standards and controls, assay performance, diagnostic validation, implementation in the diagnostic laboratory, and quality assurance and control measures. These factors are fundamental for ensuring the validity of qPCR assay results obtained in the diagnostic laboratory setting.

  14. The use of the polymerase chain reaction for the detection of human papillomavirus type 13.

    PubMed

    Williamson, A L; Dennis, S J

    1991-01-01

    Human papillomavirus type 13 (HPV-13) is associated with oral focal epithelial hyperplasia (FEH). The purpose of this study was to establish conditions for the application of polymerase chain reaction (PCR) to the specific detection and amplification of HPV-13 DNA. To design primers for HPV-13 a part of the HPV-13 genome was sequenced first: the smallest BamHI fragment (597 bp) of HPV-13 was subcloned and sequenced. The sequence was found to be part of a large open reading frame and had significant homology with the L1 gene of other HPVs. HPV-13 specific primers were designed to amplify a 240 bp fragment from the L1 gene by PCR. Conditions for PCR were standardized for this set of primers.

  15. G-quadruplex-generating polymerase chain reaction for visual colorimetric detection of amplicons.

    PubMed

    Bhadra, Sanchita; Codrea, Vlad; Ellington, Andrew D

    2014-01-15

    We have developed a self-reporting polymerase chain reaction (PCR) system for visual colorimetric gene detection and distinction of single nucleotide polymorphisms (SNPs). Amplification is performed using target-specific primers modified with a 5'-end tail that is complementary to a G-quadruplex deoxyribozyme-forming sequence. At end-point, G-quadruplexes are forced to fold from PCR-generated duplex DNA and then are used to colorimetrically report the successful occurrence of PCR by assaying their peroxidase activity using a chromogenic substrate. Furthermore, primer design considerations for the G-quadruplex-generating PCR system have allowed us to visually distinguish SNPs associated with Mycobacterium tuberculosis drug resistance alleles. PMID:24135653

  16. Detection of hepatopancreatic parvovirus (HPV) in wild shrimp from India by nested polymerase chain reaction (PCR).

    PubMed

    Manjanaik, B; Umesha, K R; Karunasagar, Indrani; Karunasagar, Iddya

    2005-02-28

    The prevalence of hepatopancreatic parvovirus (HPV) in wild penaeid shrimp samples from India was studied by nested polymerase chain reaction (PCR) using primers designed in our laboratory. The virus could be detected in 9 out of 119 samples by non-nested PCR. However, by nested PCR 69 out of 119 samples were positive. The PCR results were confirmed by hybridization with digoxigenin-labelled DNA probe. Shrimp species positive by non-nested PCR included Penaeus monodon, Penaeus indicus and Penaeus semisulcatus and by nested PCR Parapenaeopsis stylifera, Penaeus japonicus, Metapenaeus monoceros, M. affinis, M. elegans, M. dobsoni, M. ensis and Solenocera choprai. This is the first report on the prevalence of HPV in captured wild shrimp from India. PMID:15819441

  17. Early detection of dengue virus by use of reverse transcription-recombinase polymerase amplification.

    PubMed

    Teoh, Boon-Teong; Sam, Sing-Sin; Tan, Kim-Kee; Danlami, Mohammed Bashar; Shu, Meng-Hooi; Johari, Jefree; Hooi, Poh-Sim; Brooks, David; Piepenburg, Olaf; Nentwich, Oliver; Wilder-Smith, Annelies; Franco, Leticia; Tenorio, Antonio; AbuBakar, Sazaly

    2015-03-01

    A method for the rapid diagnosis of early dengue virus (DENV) infection is highly needed. Here, a prototype reverse transcription-recombinase polymerase amplification (RT-RPA) assay was developed. The assay detected DENV RNA in <20 min without the need for thermocycling amplification. The assay enabled the detection of as few as 10 copies of DENV RNA. The designed RT-RPA primers and exo probe detected the DENV genome of at least 12 genotypes of DENV circulating globally without cross-reacting with other arboviruses. We assessed the diagnostic performance of the RT-RPA assay for the detection of DENV RNA in 203 serum samples of patients with clinically suspected dengue. The sera were simultaneously tested for DENV using a reverse transcription-loop-mediated isothermal amplification (RT-LAMP) assay, quantitative RT-PCR (qRT-PCR), and IgM- and IgG-capture enzyme-linked immunosorbent assays (ELISA). Acute DENV infection was confirmed in 130 samples and 61 of the samples (46.9%) were classified as viremic with qRT-PCR. The RT-RPA assay showed good concordance (κ of ≥0.723) with the RT-LAMP and qRT-PCR assays in detecting the dengue viremic samples. When used in combination with ELISA, both the RT-RPA and RT-LAMP assays increased the detection of acute DENV infection to ≥95.7% (≥45/47) in samples obtained within 5 days of illness. The results from the study suggest that the RT-RPA assay is the most rapid molecular diagnostic tool available for the detection of DENV. Hence, it is possible to use the RT-RPA assay in a laboratory to complement routine serology testing for dengue.

  18. Real-time isothermal detection of Shiga toxin-producing Escherichia coli using recombinase polymerase amplification.

    PubMed

    Murinda, Shelton E; Ibekwe, A Mark; Zulkaffly, Syaizul; Cruz, Andrew; Park, Stanley; Razak, Nur; Paudzai, Farah Md; Ab Samad, Liana; Baquir, Khairul; Muthaiyah, Kokilah; Santiago, Brenna; Rusli, Amirul; Balkcom, Sean

    2014-07-01

    Shiga toxin-producing Escherichia coli (STEC) are a major family of foodborne pathogens of public health, zoonotic, and economic significance in the United States and worldwide. To date, there are no published reports on use of recombinase polymerase amplification (RPA) for STEC detection. The primary goal of this study was to assess the potential application of RPA in detection of STEC. This study focused on designing and evaluating RPA primers and fluorescent probes for isothermal (39°C) detection of STEC. Compatible sets of candidate primers and probes were designed for detection of Shiga toxin 1 and 2 (Stx1 and 2), respectively. The sets were evaluated for specificity and sensitivity against STEC (n=12) of various stx genotypes (stx1/stx2, stx1, or stx2, respectively), including non-Stx-producing E. coli (n=28) and other genera (n=7). The primers and probes that were designed targeted amplification of the subunit A moiety of stx1 and stx2. The assay detected STEC in real time (within 5-10 min at 39°C) with high sensitivity (93.5% vs. 90%; stx1 vs. stx2), specificity (99.1% vs. 100%; stx1 vs. stx2), and predictive value (97.9% for both stx1 vs. stx2). Limits of detection of ∼ 5-50 colony-forming units/mL were achieved in serially diluted cultures grown in brain heart infusion broth. This study successfully demonstrated for the first time that RPA can be used for isothermal real-time detection of STEC.

  19. Rapid Detection of Candida albicans by Polymerase Spiral Reaction Assay in Clinical Blood Samples.

    PubMed

    Jiang, Xiaoqun; Dong, Derong; Bian, Lihong; Zou, Dayang; He, Xiaoming; Ao, Da; Yang, Zhan; Huang, Simo; Liu, Ningwei; Liu, Wei; Huang, Liuyu

    2016-01-01

    Candida albicans is the most common human yeast pathogen which causes mucosal infections and invasive fungal diseases. Early detection of this pathogen is needed to guide preventative and therapeutic treatment. The aim of this study was to establish a polymerase spiral reaction (PSR) assay that rapidly and accurately detects C. albicans and to assess the clinical applicability of PSR-based diagnostic testing. Internal transcribed spacer 2 (ITS2), a region between 5.8S and 28S fungal ribosomal DNA, was used as the target sequence. Four primers were designed for amplification of ITS2 with the PSR method, which was evaluated using real time turbidity monitoring and visual detection using a pH indicator. Fourteen non-C. albicans yeast strains were negative for detection, which indicated the specificity of PSR assay was 100%. A 10-fold serial dilution of C. albicans genomic DNA was subjected to PSR and conventional polimerase chain reaction (PCR) to compare their sensitivities. The detection limit of PSR was 6.9 pg/μl within 1 h, 10-fold higher than that of PCR (69.0 pg/μl). Blood samples (n = 122) were collected from intensive care unit and hematological patients with proven or suspected C. albicans infection at two hospitals in Beijing, China. Both PSR assay and the culture method were used to analyze the samples. Of the 122 clinical samples, 34 were identified as positive by PSR. The result was consistent with those obtained by the culture method. In conclusion, a novel and effective C. albicans detection assay was developed that has a great potential for clinical screening and point-of-care testing. PMID:27379048

  20. Detection of Copy Number Imbalance in Canine Urothelial Carcinoma With Droplet Digital Polymerase Chain Reaction.

    PubMed

    Mochizuki, H; Shapiro, S G; Breen, M

    2016-07-01

    Urothelial carcinoma (UC) is the most common neoplasm of the canine urinary tract. Clinical presentation of UC is shared with several other, more common urinary tract disorders, and this often delays diagnosis of the UC. Definitive diagnosis of UC requires histopathologic examination of a biopsy specimen, but the cost and invasiveness for these diagnostic tests often result in most diagnoses being made on the basis of clinical findings, diagnostic imaging, and cytologic examination of urine sediment. Regardless of the diagnostic process used, most UCs currently are not diagnosed until they are at an advanced clinical stage and so are associated with poor prognosis. Improved methods for earlier and less invasive detection are needed. In a previous study, the authors demonstrated the presence of highly recurrent DNA copy number aberrations (CNAs) in canine UC and hypothesized that detection of these CNAs in tumor cells can be used as a molecular diagnostic for UC. In this study, a multiplexed droplet digital polymerase chain reaction (ddPCR) assay was detected to detect and quantify CNAs of specific regions of canine chromosomes 8, 13, 19, and 36. The assay was effective at differentiating 31 neoplastic and 25 nonneoplastic bladder tissues based on copy number, with 100% sensitivity and specificity in tissue samples. CNAs were also detected by ddPCR in 67% (12 of 18) of urine DNA specimens derived from UC patients. The findings show that ddPCR is a useful molecular technique to detect CNAs and may be used as a noninvasive molecular diagnostic test for canine UC.

  1. Rapid Detection of Candida albicans by Polymerase Spiral Reaction Assay in Clinical Blood Samples

    PubMed Central

    Jiang, Xiaoqun; Dong, Derong; Bian, Lihong; Zou, Dayang; He, Xiaoming; Ao, Da; Yang, Zhan; Huang, Simo; Liu, Ningwei; Liu, Wei; Huang, Liuyu

    2016-01-01

    Candida albicans is the most common human yeast pathogen which causes mucosal infections and invasive fungal diseases. Early detection of this pathogen is needed to guide preventative and therapeutic treatment. The aim of this study was to establish a polymerase spiral reaction (PSR) assay that rapidly and accurately detects C. albicans and to assess the clinical applicability of PSR-based diagnostic testing. Internal transcribed spacer 2 (ITS2), a region between 5.8S and 28S fungal ribosomal DNA, was used as the target sequence. Four primers were designed for amplification of ITS2 with the PSR method, which was evaluated using real time turbidity monitoring and visual detection using a pH indicator. Fourteen non-C. albicans yeast strains were negative for detection, which indicated the specificity of PSR assay was 100%. A 10-fold serial dilution of C. albicans genomic DNA was subjected to PSR and conventional polimerase chain reaction (PCR) to compare their sensitivities. The detection limit of PSR was 6.9 pg/μl within 1 h, 10-fold higher than that of PCR (69.0 pg/μl). Blood samples (n = 122) were collected from intensive care unit and hematological patients with proven or suspected C. albicans infection at two hospitals in Beijing, China. Both PSR assay and the culture method were used to analyze the samples. Of the 122 clinical samples, 34 were identified as positive by PSR. The result was consistent with those obtained by the culture method. In conclusion, a novel and effective C. albicans detection assay was developed that has a great potential for clinical screening and point-of-care testing. PMID:27379048

  2. Use of pooled samples for the detection of Salmonella in feces by polymerase chain reaction.

    PubMed

    Singer, Randall S; Cooke, Cara L; Maddox, Carol W; Isaacson, Richard E; Wallace, Richard L

    2006-07-01

    Many epidemiological studies of Salmonella rely on conventional bacteriological culture methods to detect Salmonella in fecal samples. These culture-based methods are inefficient for epidemiological studies in populations with a low prevalence of Salmonella. The objective of this study was to optimize a protocol that uses pooled Salmonella enrichment broth cultures of bovine feces and polymerase chain reaction (PCR) for the detection of the invA gene of Salmonella in feces. In one field trial, 196 animals were sampled, and all samples were tested by culture, invA PCR on individual samples, invA PCR on pools of 5 samples, and BAX PCR on individual samples. All assays showed a high agreement on individual samples (kappa > or = 0.75). The invA PCR was run on each of 40 pools and detected 19 of 22 culture-positive pools. In another field trial, 152 samples were taken from 4 dairies, and the invA PCR was performed on pools of 5 samples in addition to bacteriological culture of individual samples. Salmonella was detected in 5 of the 32 pools (7 total positive samples) by both PCR and culture. One pool was PCR-positive but culture-negative. Pooling did not dramatically affect the performance of the invA PCR; most of the culture-positive samples were detected, including all of the samples when there were 4 or more Salmonella colonies on the agar plate. Based on these field trials, invA PCR on pooled samples appears to be an efficient method of Salmonella detection as long as Salmonella loads are not extremely low.

  3. Reverse transcription and polymerase chain reaction amplification of rRNA for detection of Helicobacter species.

    PubMed

    Engstrand, L; Nguyen, A M; Graham, D Y; el-Zaatari, F A

    1992-09-01

    Sequence data on Helicobacter pylori 16S rRNA were used to select two 22-base oligonucleotide primers for use in a polymerase chain reaction (PCR) for detection of H. pylori. H. pylori cells were treated with lysis buffer, boiled, and chloroform extracted. Reverse transcription of rRNA was followed by PCR amplification (RT-PCR) of the synthesized cDNA and 16S rRNA gene. The amplified PCR products were analyzed by agarose gel electrophoresis and Southern blotting. Using ethidium bromide-stained agarose gels, we were able to detect the expected 500-bp DNA fragment from as few as two H. pylori organisms per reaction. The specificity of the RT-PCR assay was tested with 27 clinical isolates and related reference strains; although the number of bacterial cells used per reaction was 10(5)-fold greater than the number of H. pylori organisms used, amplification was detected only with bacteria in the same genus, H. cinaedi and H. mustelae. Ten H. pylori organisms per biopsy specimen were detected on agarose gels when organisms were added to samples prepared from a processed colon biopsy sample. RT-PCR results were consistent with urea breath test and culture results in 14 of 15 gastric biopsy specimens; the specificity was 100%. RT-PCR of rRNA from H. pylori increased the sensitivity of pathogen detection at least 25- to 50-fold compared with that of previous PCR assays. This low level of detection by RT-PCR assay may prove to be well suited for verifying eradication following therapy. PMID:1383268

  4. Detection and quantification of Citrobacter freundii and C. braakii by 5'-nuclease polymerase chain reaction.

    PubMed

    Kaclíková, Eva; Krascsenicsová, Klára; Pangallo, Domenico; Kuchta, Tomás

    2005-10-01

    A new 5'-nuclease polymerase chain reaction (PCR) system for the detection and quantification of Citrobacter freundii and C. braakii was developed with primers and the probe oriented to a specific region of the cfa gene encoding a cyclopropane fatty acid synthase. The qualitative variant of the method consisted of a conventional PCR with end-point fluorimetry or agarose gel electrophoresis, and the quantitative variant used kinetic real-time PCR measurement. The PCR system was specific for C. freundii and C. braakii, detecting neither other Citrobacter spp. nor other enteric bacteria (Escherichia coli, Salmonella enterica, and others). The detection limit of the qualitative variant of the method was 10(3) cfu/mL when the amplification was followed by fluorimetry and 10(4) cfu/mL when the amplification was followed by gel electrophoresis. The real-time PCR variant of the method facilitated quantification over a range of concentrations from 10(2) to 10(8) cfu/mL, with Escherichia coli (10(6) cfu/mL) and Salmonella enterica (10(6) cfu/mL) having no effect on the quantification.

  5. Detection of Salmonella typhi in the blood of patients with typhoid fever by polymerase chain reaction.

    PubMed Central

    Song, J H; Cho, H; Park, M Y; Na, D S; Moon, H B; Pai, C H

    1993-01-01

    A polymerase chain reaction (PCR)-based test was developed for the detection of Salmonella typhi in the blood specimens from patients with typhoid fever. Two pairs of oligonucleotide primers were designed to amplify a 343-bp fragment of the flagellin gene of S. typhi. Amplified products were analyzed by agarose gel electrophoresis and Southern blot hybridization by using a 32P-labeled 40-base probe internal to the amplified DNA. The nested PCR with two pairs of primers could detect 10 organisms of S. typhi as determined by serial dilutions of DNA from S. typhi. The peripheral mononuclear cells from 11 of 12 patients with typhoid fever confirmed by blood culture were positive for DNA fragment of the flagellin gene of S. typhi, whereas 10 blood specimens of patients with other febrile diseases were negative. With the nested PCR, S. typhi DNAs were detected from blood specimens of four patients with suspected typhoid fever on the basis of clinical features but with negative cultures. We suggest that the PCR technique could be used as a novel diagnostic method of typhoid fever, particularly in culture-negative cases. Images PMID:8314983

  6. Detection of Trypanosoma congolense and Trypanosoma brucei subspecies by DNA amplification using the polymerase chain reaction.

    PubMed

    Moser, D R; Cook, G A; Ochs, D E; Bailey, C P; McKane, M R; Donelson, J E

    1989-08-01

    The nuclear DNA of Trypanosoma congolense contains a family of highly conserved 369 base pair (bp) repeats. The sequences of three cloned copies of these repeats were determined. An unrelated family of 177 bp repeats has previously been shown to occur in the nuclear DNA of Trypanosoma brucei brucei (Sloof et al. 1983a). Oligonucleotides were synthesized which prime the specific amplification of each of these repetitive DNAs by the polymerase chain reaction (PCR). Amplification of 10% of the DNA in a single parasite of T. congolense or T. brucei spp. produced sufficient amplified product to be visible as a band in an agarose gel stained with ethidium bromide. This level of detection, which does not depend on the use of radioactivity, is about 100 times more sensitive than previous detection methods based on radioactive DNA probes. The oligonucleotides did not prime the amplification of DNA sequences in other trypanosome species nor in Leishmania, mouse or human DNAs. Amplification of DNA from the blood of animals infected with T. congolense and/or T. brucei spp. permitted the identification of parasite levels far below that detectable by microscopic inspection. Since PCR amplification can be conducted on a large number of samples simultaneously, it is ideally suited for large-scale studies on the prevalence of African trypanosomes in both mammalian blood and insect vectors.

  7. Nested polymerase chain reaction assay for detection of Mycobacterium shottsii and M. pseudoshottsii in striped bass.

    PubMed

    Gauthier, D T; Vogelbein, W K; Rhodes, M W; Reece, K S

    2008-12-01

    Wild striped bass Morone saxatilis in Chesapeake Bay are experiencing a high prevalence of mycobacteriosis, which produces granulomatous lesions of the skin and visceral organs. Culture-based studies have indicated that the newly described species Mycobacterium shottsii and M. pseudoshottsii are the dominant isolates from diseased fish. The classical fish pathogen M. marinum is also found, albeit at much lower frequencies. Both M. shottsii and M. pseudoshottsii are extremely slow-growing on standard selective media, and up to 12 months may be required for isolation and characterization. Epidemiological studies of mycobacteriosis in Chesapeake Bay would therefore benefit from rapid molecular assays with which to detect these species in fish. In this paper, we describe the development of polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) assays capable of detecting M. shottsii, M. pseudoshottsii, and, in most instances, coinfections thereof in striped bass tissues. In addition, PCR-RFLP assays were designed to detect M. marinum and other as-yet-undescribed Mycobacterium spp. present in Chesapeake Bay striped bass. Comparison of these molecular assays with culture-based techniques using splenic tissue from wild striped bass yielded generally concordant results and demonstrated the applicability of these techniques to the study of wild fish.

  8. Detection of Coxiella burnetti by DNA amplification using polymerase chain reaction.

    PubMed Central

    Stein, A; Raoult, D

    1992-01-01

    The polymerase chain reaction (PCR) was used for the detection of Coxiella burnetti, an obligate intracellular bacterium and the etiologic agent of Q fever. A pair of primers derived from the C. burnetii superoxide dismutase gene served to amplify a targeted 257-bp fragment of genomic DNA. These primers were chosen on the basis of GenBank analysis, G + C ratio, and absence of secondary structure. This technique allowed the detection of as few as 10 C. burnetii organisms. C. burnetti was detected in tissue culture and in specimens from patients (heart valves). In all, 8 reference isolates and 22 new isolates of C. burnetii from France were successfully amplified. No amplification products were found when PCR was performed with 25 bacterial species that had been isolated in a clinical laboratory from patients with clinically similar infections. Amplification products of C. burnetii were confirmed by restriction enzyme digestion and dot blot hybridization. The method used here, a combination of PCR and restriction analysis, is a faster and more sensitive assay for C. burnetii than standard culture techniques. Images PMID:1401016

  9. A real-time reverse transcriptase polymerase chain reaction for detection and quantification of Vesiculovirus

    PubMed Central

    Tolardo, Aline Lavado; de Souza, William Marciel; Romeiro, Marilia Farignoli; Vieira, Luiz Carlos; Luna, Luciano Kleber de Souza; Henriques, Dyana Alves; de Araujo, Jansen; Siqueira, Carlos Eduardo Hassegawa; Colombo, Tatiana Elias; Aquino, Victor Hugo; da Fonseca, Benedito Antonio Lopes; Bronzoni, Roberta Vieira de Morais; Nogueira, Maurício Lacerda; Durigon, Edison Luiz; Figueiredo, Luiz Tadeu Moraes

    2016-01-01

    Vesiculoviruses (VSV) are zoonotic viruses that cause vesicular stomatitis disease in cattle, horses and pigs, as well as sporadic human cases of acute febrile illness. Therefore, diagnosis of VSV infections by reliable laboratory techniques is important to allow a proper case management and implementation of strategies for the containment of virus spread. We show here a sensitive and reproducible real-time reverse transcriptase polymerase chain reaction (RT-PCR) for detection and quantification of VSV. The assay was evaluated with arthropods and serum samples obtained from horses, cattle and patients with acute febrile disease. The real-time RT-PCR amplified the Piry, Carajas, Alagoas and Indiana Vesiculovirus at a melting temperature 81.02 ± 0.8ºC, and the sensitivity of assay was estimated in 10 RNA copies/mL to the Piry Vesiculovirus. The viral genome has been detected in samples of horses and cattle, but not detected in human sera or arthropods. Thus, this assay allows a preliminary differential diagnosis of VSV infections. PMID:27276185

  10. Detection of Helicobacter pylori glmM gene in bovine milk using Nested polymerase chain reaction

    PubMed Central

    Osman, Eyman Y.; El-Eragi, A. M. S.; Musa, Abuobeida M.; El-Magboul, Salma B.; A/Rahman, Magdi B.; Abdo, Abdelmounem E.

    2015-01-01

    Aim: The aim was to detect the glmM gene of Helicobacter pylori (H. pylori) in cow’s milk from different dairy farms in Khartoum State using Nested polymerase chain reaction (PCR). Materials and Methods: A total of 50 milk samples were collected from different dairy farms in Khartoum State (13 from Khartoum, 24 Khartoum North, and 13 from Omdurman Provinces). Results: The generated results showed that 11/50 (22%) were harboring the investigated H. pylori glmM gene in Khartoum State (1/13 [7.7%] Khartoum, 9/24 [37.5%] Khartoum North, and 1/13 [7.7%] Omdurman provinces, respectively). Conclusion: To the best of our knowledge, this was the first report on the detection of H. pylori glmM gene in cattle milk in Khartoum State. Nonetheless, the high percentages of H. pylori DNA detection in milk opened new avenues toward exploring the risk of human infection with H. pylori through the consumption of raw milk. PMID:27047175

  11. Detection of enteroviruses in shellfish by fluorogenic polymerase chain reaction integrated with 96-well microplate scanning.

    PubMed

    Shieh, Y Carol; Baric, Ralph S

    2002-01-01

    A one-step procedure was developed to confirm viral targets by using a fluorometric 96-well microplate scanner following polymerase chain reaction (PCR). The fluorogenic PCR, integrated with fluorometric scanning, measured the end point fluorescence of viral PCR amplicon/probe hybrids and permitted the use of nonfluorogenic PCR conditions with addition of a Cy3 fluorophore-labeled linear probe for viruses. This linear probe generated higher ratios of viral signal-to-noise than a comparative beacon probe. Detection efficiency with a Cy3/quencher linear probe was comparable with Southern analysis at the level > or = 0.27 plaque-forming units (PFU) of poliovirus/PCR. For the reaction containing < 0.27 PFU, the fluorometric measurements of the first-round PCR viral amplicon were not as sensitive as Southern analysis; however, equivalent sensitivities were achieved with fluorogenic nested PCR. Concentrates of 11 oyster samples exposed to municipal sewage were tested for enteroviruses; the fluorogenic detection correlated 100% with Southern analysis. This method using fluorometric scanning of viral amplicon is simple; it requires neither continuously monitoring equipment nor redesigning PCR primers; and it accurately detects enteroviruses in oyster sample concentrates in less time than classic spectrophotometry or Southern analysis.

  12. Molecular beacon polymerase chain reaction detection of Escherichia coli O157:H7 in milk.

    PubMed

    McKillip, J L; Drake, M

    2000-07-01

    A fluorescently labeled oligonucleotide probe (molecular beacon) was applied to detect Escherichia coli O157:H7 in artificially contaminated skim milk during polymerase chain reaction (PCR) amplification of extracted DNA. The probe was designed to hybridize with a region of the slt-II gene coding for the A subunit and to fluoresce when the hairpin-stem conformation was linearized upon hybridization to the target sequence. The molecular beacon was incorporated into PCR reactions containing DNA extracted from artificially contaminated skim milk. The degree of fluorescence was monitored in PCR reactions containing 10(3), 10(5), and 10(7) CFU of E. coli O157:H7 per ml and was found to correlate with the amount of template in each reaction. Fluorescence significantly increased above background levels by cycle 8, 14, or 14 in reactions containing DNA from the 10(7)-, 10(5)-, or 10(3)-CFU/ml template, respectively (P < 0.05). Molecular beacon PCR demonstrated positive results more rapidly than traditional agarose gel electrophoresis analysis of PCR products. Use of molecular beacons allows real-time monitoring of PCR reactions, and the closed-tube format allows simultaneous detection and confirmation of target amplicons without the need for agarose gel electrophoresis and/or Southern blotting. This is the first report of a stem-and-loop molecular beacon being applied for direct detection of a pathogen in food.

  13. [Detection of enteric pathogenic bacteria from surface waters by quantitative polymerase chain reaction (QPCR)].

    PubMed

    Liu, Yong-Jun; Zhang, Chong-Miao; Wang, Xiao-Chang; Lü, Ying-Jun; Zuo, Li-Li

    2008-05-01

    A rapid quantitative polymerase chain reaction (QPCR) analysis method with universal primers was developed to detect cell densities of the enteric pathogenic bacteria from 5 surface water of Xi'an City for 4 months continuously. And the detection results by QPCR method were compared with counts of coliforms colony-forming units (CFU) determined by membrane filter (MF) analysis. The results showed that QPCR method had an estimated 94% confidence, and detection limit was 2.7 Escherichia coli cells per sample in undiluted DNA extracts. For five surface waters (N = 60), the geometric mean of pathogenic bacteria concentration determined by QPCR was 2.2-5 times of corresponding coliform CFU determined by MF analysis. Using QPCR analysis, these geometric means of pathogenic bacteria concentration ranged from 25 CCE/100 mL to 67 000 CCE/100 mL. Using MF culture analysis, coliforms ranged from 3 CFU/100 mL to 45 000 CFU/100 mL. Regression analysis showed that there was a significant positive correlation between pathogenic bacteria determined by QPCR method and coliforms determined by MF method, the correlation coefficient (r) was 0.983.

  14. Sensitive and rapid detection of Chlamydia trachomatis by recombinase polymerase amplification directly from urine samples.

    PubMed

    Krõlov, Katrin; Frolova, Jekaterina; Tudoran, Oana; Suhorutsenko, Julia; Lehto, Taavi; Sibul, Hiljar; Mäger, Imre; Laanpere, Made; Tulp, Indrek; Langel, Ülo

    2014-01-01

    Chlamydia trachomatis is the most common sexually transmitted human pathogen. Infection results in minimal to no symptoms in approximately two-thirds of women and therefore often goes undiagnosed. C. trachomatis infections are a major public health concern because of the potential severe long-term consequences, including an increased risk of ectopic pregnancy, chronic pelvic pain, and infertility. To date, several point-of-care tests have been developed for C. trachomatis diagnostics. Although many of them are fast and specific, they lack the required sensitivity for large-scale application. We describe a rapid and sensitive form of detection directly from urine samples. The assay uses recombinase polymerase amplification and has a minimum detection limit of 5 to 12 pathogens per test. Furthermore, it enables detection within 20 minutes directly from urine samples without DNA purification before the amplification reaction. Initial analysis of the assay from clinical patient samples had a specificity of 100% (95% CI, 92%-100%) and a sensitivity of 83% (95% CI, 51%-97%). The whole procedure is fairly simple and does not require specific machinery, making it potentially applicable in point-of-care settings.

  15. Reverse transcription recombinase polymerase amplification assay for the detection of middle East respiratory syndrome coronavirus.

    PubMed

    Abd El Wahed, Ahmed; Patel, Pranav; Heidenreich, Doris; Hufert, Frank T; Weidmann, Manfred

    2013-12-12

    The emergence of Middle East Respiratory Syndrome Coronavirus (MERS-CoV) in the eastern Mediterranean and imported cases to Europe has alerted public health authorities. Currently, detection of MERS-CoV in patient samples is done by real-time RT-PCR. Samples collected from suspected cases are sent to highly-equipped centralized laboratories for screening. A rapid point-of-care test is needed to allow more widespread mobile detection of the virus directly from patient material. In this study, we describe the development of a reverse transcription isothermal Recombinase Polymerase Amplification (RT-RPA) assay for the identification of MERS-CoV. A partial nucleocapsid gene RNA molecular standard of MERS-coronavirus was used to determine the assay sensitivity. The isothermal (42°C) MERS-CoV RT-RPA was as sensitive as real-time RT-PCR (10 RNA molecules), rapid (3-7 minutes) and mobile (using tubescanner weighing 1kg). The MERS-CoV RT-RPA showed cross-detection neither of any of the RNAs of several coronaviruses and respiratory viruses affecting humans nor of the human genome. The developed isothermal real-time RT-RPA is ideal for rapid mobile molecular MERS-CoV monitoring in acute patients and may also facilitate the search for the animal reservoir of MERS-CoV.

  16. [Polymerase chain reaction for rapid detection and serotyping of dengue virus in clinical samples].

    PubMed

    Rosario, D; Alvarez, M; Díaz, J; Contreras, R; Rodríguez, R; Vázquez, S; Guzmán, M G

    1998-07-01

    This study describes the benefits of using reverse transcriptase polymerase chain reaction (RT-PCR) for the rapid detection and typing of dengue virus in clinical samples. Twenty-seven serum specimens from patients with dengue fever and dengue hemorrhagic fever in Colombia, Nicaragua, and Panama were directly subjected to RT-PCR for the detection of dengue virus. The resulting double-stranded DNA product was typed by a second round of PCR amplification (nested PCR) with type-specific primers, viral culture/indirect immunofluorescence (IIF), and enzyme-linked electroimmunoassay for IgM anti-dengue antibodies. The amplified virus genome was detected and typed within 8 hours. Nested RT-PCR, using viral culture and IIF as the gold standard, showed 100% sensitivity; 78% specificity; 69% positive predictive value, and 100% negative predictive value. It is noteworthy that two of the specimens whose results were positive with nested RT-PCR and negative with viral culture showed specific IgM antibodies. The results of the RT-PCR were in close agreement with those obtained through viral culture. This suggests PCR can greatly facilitate the rapid and early diagnosis of dengue infection.

  17. Assessment of cell culture and polymerase chain reaction procedures for the detection of polioviruses in wastewater.

    PubMed

    Grabow, W O; Botma, K L; de Villiers, J C; Clay, C G; Erasmus, B

    1999-01-01

    WHO considers that environmental surveillance for wild-type polioviruses is potentially important for surveillance for acute flaccid paralysis as a means of confirming eradication of poliomyelitis. The present study investigated methods for detecting polioviruses in a variety of water environments in South Africa. Most polioviruses were isolated on L20B mouse cells, which, however, were not selective: 16 reoviruses and 8 enteroviruses, apparently animal strains, were also isolated on these cells. Vaccine strains of polioviruses were isolated from surface waters during and shortly after two rounds of mass vaccination of children in an informal settlement where there was no sewerage. The results demonstrated the feasibility of poliovirus surveillance in such settlements. It was also evident that neither poliovirus vaccine strains nor other viruses were likely to interfere significantly with the detection of wild-type polioviruses. Optimal isolation of polioviruses was accomplished by parallel inoculation of L20B mouse cells and at least the PLC/PRF/5 human liver and buffalo green monkey (BGM) kidney cell lines. Analysis of cell cultures using the polymerase chain reaction revealed that 319 test samples contained at least 263 human enteroviruses that failed to produce a cytopathogenic effect. This type of analysis thus significantly increased the sensitivity of enterovirus detection.

  18. Reverse Transcription Recombinase Polymerase Amplification Assay for the Detection of Middle East Respiratory Syndrome Coronavirus

    PubMed Central

    Abd El Wahed, Ahmed; Patel, Pranav; Heidenreich, Doris; Hufert, Frank T.; Weidmann, Manfred

    2013-01-01

    The emergence of Middle East Respiratory Syndrome Coronavirus (MERS-CoV) in the eastern Mediterranean and imported cases to Europe has alerted public health authorities. Currently, detection of MERS-CoV in patient samples is done by real-time RT-PCR. Samples collected from suspected cases are sent to highly-equipped centralized laboratories for screening. A rapid point-of-care test is needed to allow more widespread mobile detection of the virus directly from patient material. In this study, we describe the development of a reverse transcription isothermal Recombinase Polymerase Amplification (RT-RPA) assay for the identification of MERS-CoV. A partial nucleocapsid gene RNA molecular standard of MERS-coronavirus was used to determine the assay sensitivity. The isothermal (42°C) MERS-CoV RT-RPA was as sensitive as real-time RT-PCR (10 RNA molecules), rapid (3-7 minutes) and mobile (using tubescanner weighing 1kg). The MERS-CoV RT-RPA showed cross-detection neither of any of the RNAs of several coronaviruses and respiratory viruses affecting humans nor of the human genome. The developed isothermal real-time RT-RPA is ideal for rapid mobile molecular MERS-CoV monitoring in acute patients and may also facilitate the search for the animal reservoir of MERS-CoV. PMID:24459611

  19. Rapid detection of genetically modified organisms on a continuous-flow polymerase chain reaction microfluidics.

    PubMed

    Li, Yuyuan; Xing, Da; Zhang, Chunsun

    2009-02-01

    The ability to perform DNA amplification on a microfluidic device is very appealing. In this study, a compact continuous-flow polymerase chain reaction (PCR) microfluidics was developed for rapid analysis of genetically modified organisms (GMOs) in genetically modified soybeans. The device consists of three pieces of copper and a transparent polytetrafluoroethylene capillary tube embedded in the spiral channel fabricated on the copper. On this device, the P35S and Tnos sequences were successfully amplified within 9min, and the limit of detection of the DNA sample was estimated to be 0.005 ng microl(-1). Furthermore, a duplex continuous-flow PCR was also reported for the detection of the P35S and Tnos sequences in GMOs simultaneously. This method was coupled with the intercalating dye SYBR Green I and the melting curve analysis of the amplified products. Using this method, temperature differences were identified by the specific melting temperature values of two sequences, and the limit of detection of the DNA sample was assessed to be 0.01 ng microl(-1). Therefore, our results demonstrated that the continuous-flow PCR assay could discriminate the GMOs in a cost-saving and less time-consuming way.

  20. Assessment of cell culture and polymerase chain reaction procedures for the detection of polioviruses in wastewater.

    PubMed Central

    Grabow, W. O.; Botma, K. L.; de Villiers, J. C.; Clay, C. G.; Erasmus, B.

    1999-01-01

    WHO considers that environmental surveillance for wild-type polioviruses is potentially important for surveillance for acute flaccid paralysis as a means of confirming eradication of poliomyelitis. The present study investigated methods for detecting polioviruses in a variety of water environments in South Africa. Most polioviruses were isolated on L20B mouse cells, which, however, were not selective: 16 reoviruses and 8 enteroviruses, apparently animal strains, were also isolated on these cells. Vaccine strains of polioviruses were isolated from surface waters during and shortly after two rounds of mass vaccination of children in an informal settlement where there was no sewerage. The results demonstrated the feasibility of poliovirus surveillance in such settlements. It was also evident that neither poliovirus vaccine strains nor other viruses were likely to interfere significantly with the detection of wild-type polioviruses. Optimal isolation of polioviruses was accomplished by parallel inoculation of L20B mouse cells and at least the PLC/PRF/5 human liver and buffalo green monkey (BGM) kidney cell lines. Analysis of cell cultures using the polymerase chain reaction revealed that 319 test samples contained at least 263 human enteroviruses that failed to produce a cytopathogenic effect. This type of analysis thus significantly increased the sensitivity of enterovirus detection. PMID:10680244

  1. Rapid detection of Plasmodium falciparum with isothermal recombinase polymerase amplification and lateral flow analysis

    PubMed Central

    2014-01-01

    Background Nucleic acid amplification is the most sensitive and specific method to detect Plasmodium falciparum. However the polymerase chain reaction remains laboratory-based and has to be conducted by trained personnel. Furthermore, the power dependency for the thermocycling process and the costly equipment necessary for the read-out are difficult to cover in resource-limited settings. This study aims to develop and evaluate a combination of isothermal nucleic acid amplification and simple lateral flow dipstick detection of the malaria parasite for point-of-care testing. Methods A specific fragment of the 18S rRNA gene of P. falciparum was amplified in 10 min at a constant 38°C using the isothermal recombinase polymerase amplification (RPA) method. With a unique probe system added to the reaction solution, the amplification product can be visualized on a simple lateral flow strip without further labelling. The combination of these methods was tested for sensitivity and specificity with various Plasmodium and other protozoa/bacterial strains, as well as with human DNA. Additional investigations were conducted to analyse the temperature optimum, reaction speed and robustness of this assay. Results The lateral flow RPA (LF-RPA) assay exhibited a high sensitivity and specificity. Experiments confirmed a detection limit as low as 100 fg of genomic P. falciparum DNA, corresponding to a sensitivity of approximately four parasites per reaction. All investigated P. falciparum strains (n = 77) were positively tested while all of the total 11 non-Plasmodium samples, showed a negative test result. The enzymatic reaction can be conducted under a broad range of conditions from 30-45°C with high inhibitory concentration of known PCR inhibitors. A time to result of 15 min from start of the reaction to read-out was determined. Conclusions Combining the isothermal RPA and the lateral flow detection is an approach to improve molecular diagnostic for P. falciparum in

  2. Colorimetric TMPRSS2-ERG Gene Fusion Detection in Prostate Cancer Urinary Samples via Recombinase Polymerase Amplification.

    PubMed

    Koo, Kevin M; Wee, Eugene J H; Trau, Matt

    2016-01-01

    TMPRSS2 (Exon 1)-ERG (Exon 4) is the most frequent gene fusion event in prostate cancer (PC), and is highly PC-specific unlike the current serum prostate specific antigen (PSA) biomarker. However, TMPRSS2-ERG levels are currently measured with quantitative reverse-transcription PCR (RT-qPCR) which is time-consuming and requires costly equipment, thus limiting its use in clinical diagnostics. Herein, we report a novel rapid, cost-efficient and minimal-equipment assay named "FusBLU" for detecting TMPRSS2-ERG gene fusions from urine. TMPRSS2-ERG mRNA was amplified by isothermal reverse transcription-recombinase polymerase amplification (RT-RPA), magnetically-isolated, and detected through horseradish peroxidase (HRP)-catalyzed colorimetric reaction. FusBLU was specific for TMPRSS2-ERG mRNA with a low visual detection limit of 10(5) copies. We also demonstrated assay readout versatility on 3 potentially useful platforms. The colorimetric readout was detectable by naked eye for a quick yes/no evaluation of gene fusion presence. On the other hand, a more quantitative TMPRSS2-ERG detection was achievable by absorbance/electrochemical measurements. FusBLU was successfully applied to 12 urinary samples and results were validated by gold-standard RT-qPCR. We also showed that sediment RNA was likely the main source of TMPRSS2-ERG mRNA in urinary samples. We believe that our assay is a potential clinical screening tool for PC and could also have wide applications for other disease-related fusion genes. PMID:27375789

  3. On-chip detection of a single nucleotide polymorphism without polymerase amplification

    PubMed Central

    Han, Jinhee; Tan, Matthew; Sudheendra, Lakshmana; Weiss, Robert H.; Kennedy, Ian M.

    2014-01-01

    A nanoparticle-assembled photonic crystal (PC) array was used to detect single nucleotide polymorphism (SNP). The assay platform with PC nanostructure enhanced the fluorescent signal from nanoparticle-hybridized DNA complexes due to phase matching of excitation and emission. Nanoparticles coupled with probe DNA were trapped into nanowells in an array by using an electrophoretic particle entrapment system. The PC/DNA assay platform was able to identify a 1 base pair (bp) difference in synthesized nucleotide sequences that mimicked the mutation seen in a feline model of human autosomal dominant polycystic kidney disease (PKD) with a sensitivity of 0.9 fg/mL (50 aM)-sensitivity, which corresponds to 30 oligos/array. The reliability of the PC/DNA assay platform to detect SNP in a real sample was demonstrated by using genomic DNA (gDNA) extracted from the urine and blood of two PKD− wild type and three PKD positive cats. The standard curves for PKD positive (PKD+) and negative (PKD−) DNA were created using two feline-urine samples. An additional three urine samples were analyzed in a similar fashion and showed satisfactory agreement with the standard curve, confirming the presence of the mutation in affected urine. The limit of detection (LOD) was 0.005 ng/mL which corresponds to 6 fg per array for gDNA in urine and blood. The PC system demonstrated the ability to detect a number of genome equivalents for the PKD SNP that was very similar to the results reported with real time polymerase chain reaction (PCR). The favorable comparison with quantitative PCR suggests that the PC technology may find application well beyond the detection of the PKD SNP, into areas where a simple, cheap and portable nucleic acid analysis is desirable. PMID:25580203

  4. Detection of Xanthomonas campestris pv. citri by the polymerase chain reaction method.

    PubMed Central

    Hartung, J S; Daniel, J F; Pruvost, O P

    1993-01-01

    pFL1 is a pUC9 derivative that contains a 572-bp EcoRI insert cloned from plasmid DNA of Xanthomonas campestris pv. citri XC62. The nucleotide sequence of pFL1 was determined, and the sequence information was used to design primers for application of the polymerase chain reaction (PCR) to the detection of X. campestris pv. citri, the causal agent of citrus bacterial canker disease. Seven 18-bp oligonucleotide primers were designed and tested with DNA from X. campestris pv. citri strains and other strains of X. campestris associated with Citrus spp. as templates in the PCR. Four primer pairs directed the amplification of target DNA from X. campestris pv. citri strains but not from strains of X. campestris associated with a different disease, citrus bacterial spot. Primer pair 2-3 directed the specific amplification of target DNA from pathotype A but not other pathotypes of X. campestris pv. citri. A pH 9.0 buffer that contained 1% Triton X-100 and 0.1% gelatin was absolutely required for the successful amplification of the target DNA, which was 61% G+C. Limits of detection after amplification and gel electrophoresis were 25 pg of purified target DNA and about 10 cells when Southern blots were made after gel electrophoresis and probed with biotinylated pFL1. This level of detection represents an increase in sensitivity of about 100-fold over that of dot blotting with the same hybridization probe. PCR products of the expected sizes were amplified from DNA extracted from 7-month-old lesions from which viable bacteria could not be isolated. These products were confirmed to be specific for X. campestris pv. citri by Southern blotting. This PCR-based detection protocol will be a useful addition to current methods of detection of this pathogen, which is currently the target of international quarantine measures. Images PMID:8476288

  5. Colorimetric TMPRSS2-ERG Gene Fusion Detection in Prostate Cancer Urinary Samples via Recombinase Polymerase Amplification

    PubMed Central

    Koo, Kevin M.; Wee, Eugene J.H.; Trau, Matt

    2016-01-01

    TMPRSS2 (Exon 1)-ERG (Exon 4) is the most frequent gene fusion event in prostate cancer (PC), and is highly PC-specific unlike the current serum prostate specific antigen (PSA) biomarker. However, TMPRSS2-ERG levels are currently measured with quantitative reverse-transcription PCR (RT-qPCR) which is time-consuming and requires costly equipment, thus limiting its use in clinical diagnostics. Herein, we report a novel rapid, cost-efficient and minimal-equipment assay named “FusBLU” for detecting TMPRSS2-ERG gene fusions from urine. TMPRSS2-ERG mRNA was amplified by isothermal reverse transcription-recombinase polymerase amplification (RT-RPA), magnetically-isolated, and detected through horseradish peroxidase (HRP)-catalyzed colorimetric reaction. FusBLU was specific for TMPRSS2-ERG mRNA with a low visual detection limit of 105 copies. We also demonstrated assay readout versatility on 3 potentially useful platforms. The colorimetric readout was detectable by naked eye for a quick yes/no evaluation of gene fusion presence. On the other hand, a more quantitative TMPRSS2-ERG detection was achievable by absorbance/electrochemical measurements. FusBLU was successfully applied to 12 urinary samples and results were validated by gold-standard RT-qPCR. We also showed that sediment RNA was likely the main source of TMPRSS2-ERG mRNA in urinary samples. We believe that our assay is a potential clinical screening tool for PC and could also have wide applications for other disease-related fusion genes. PMID:27375789

  6. Biosynthetic enhancement of the detection of bacteria by the polymerase chain reaction.

    PubMed

    Do, Julie S; Weigel, Kris M; Meschke, John S; Cangelosi, Gerard A

    2014-01-01

    Molecular viability testing (MVT) was previously reported to specifically detect viable bacterial cells in complex samples. In MVT, brief nutritional stimulation induces viable cells, but not non-viable cells, to produce abundant amounts of species-specific ribosomal RNA precursors (pre-rRNA). Quantitative polymerase chain reaction (qPCR) is used to quantify specific pre-rRNAs in a stimulated aliquot relative to a non-stimulated control. In addition to excluding background signal from non-viable cells and from free DNA, we report here that MVT increases the analytical sensitivity of qPCR when detecting viable cells. Side-by-side limit-of-detection comparisons showed that MVT is 5-fold to >10-fold more sensitive than standard (static) DNA-targeted qPCR when detecting diverse bacterial pathogens (Aeromonas hydrophila, Acinetobacter baumannii, Listeria monocytogenes, Mycobacterium avium, and Staphylococcus aureus) in serum, milk, and tap water. Sensitivity enhancement may come from the elevated copy number of pre-rRNA relative to genomic DNA, and also from the ratiometric measurement which reduces ambiguity associated with weak or borderline signals. We also report that MVT eliminates false positive signals from bacteria that have been inactivated by moderately elevated temperatures (pasteurization), a condition that can confound widely-used cellular integrity tests that utilize membrane-impermeant compounds such as propidium iodide (PI) or propidium monoazide (PMA) to differentiate viable from inactivated bacteria. MVT enables the sensitive and specific detection of very small numbers of viable bacteria in complex matrices.

  7. Colorimetric TMPRSS2-ERG Gene Fusion Detection in Prostate Cancer Urinary Samples via Recombinase Polymerase Amplification.

    PubMed

    Koo, Kevin M; Wee, Eugene J H; Trau, Matt

    2016-01-01

    TMPRSS2 (Exon 1)-ERG (Exon 4) is the most frequent gene fusion event in prostate cancer (PC), and is highly PC-specific unlike the current serum prostate specific antigen (PSA) biomarker. However, TMPRSS2-ERG levels are currently measured with quantitative reverse-transcription PCR (RT-qPCR) which is time-consuming and requires costly equipment, thus limiting its use in clinical diagnostics. Herein, we report a novel rapid, cost-efficient and minimal-equipment assay named "FusBLU" for detecting TMPRSS2-ERG gene fusions from urine. TMPRSS2-ERG mRNA was amplified by isothermal reverse transcription-recombinase polymerase amplification (RT-RPA), magnetically-isolated, and detected through horseradish peroxidase (HRP)-catalyzed colorimetric reaction. FusBLU was specific for TMPRSS2-ERG mRNA with a low visual detection limit of 10(5) copies. We also demonstrated assay readout versatility on 3 potentially useful platforms. The colorimetric readout was detectable by naked eye for a quick yes/no evaluation of gene fusion presence. On the other hand, a more quantitative TMPRSS2-ERG detection was achievable by absorbance/electrochemical measurements. FusBLU was successfully applied to 12 urinary samples and results were validated by gold-standard RT-qPCR. We also showed that sediment RNA was likely the main source of TMPRSS2-ERG mRNA in urinary samples. We believe that our assay is a potential clinical screening tool for PC and could also have wide applications for other disease-related fusion genes.

  8. [THE HIGHLY EFFECTIVE DETECTION OF DNA RICKETTSIA USING TECHNIQUE OF POLYMERASE CHAIN REACTION IN REAL-TIME].

    PubMed

    Kartashov, M Yu; Mikryukova, T P; Ternovoi, V A; Moskvitina, N S; Loktev, V B

    2015-12-01

    The article considers development of highly effective technique of detection of genetic material of ricketsia based on polymerase chain reaction in real-time using original primers to the most conservative sites of gene of citrate synthase (gItA). The analytical sensitivity of the developed polymerase chain reaction in real-time test permits to detect from 80 genome equivalents in analyzed sample during three hours. The high specificity of test-system is substantiated by detection of nucleotide sequences of amplificated fragments of gene gltA. The approbation ofthe polymerase chain reaction in real-time test is carried out on collection of 310 ticks of species I. persulcatus, I. pavlovskyi, D. reticulatus. It is demonstrated that the developed alternate ofprimers and probe permits with high degree of sensitivity and specifcity to detect DNA of different species of ricketsia widespread on territory of Russia (R. sibirica, R. raoultii, R. helvetica, R. tarasevichiae). The proposed polymerase chain reaction in real-time test can be appliedfor isolation of fragment of gene gltA with purpose for detecting nucleotide sequence and subsequent genetic typing of ricketsia. The application ofthe proposed technique can facilitate task of monitoring hot spots of ricketsiosis.

  9. Standardisation of polymerase chain reaction for the detection of Salmonella typhi in typhoid fever.

    PubMed Central

    Chaudhry, R; Laxmi, B V; Nisar, N; Ray, K; Kumar, D

    1997-01-01

    To improve the diagnosis of Salmonella typhi infection, a polymerase chain reaction (PCR) assay was developed for the amplification of the dH flagellin gene of S typhi. Primers were designed from dH flagellin gene sequence which will give an amplification product of 486 base pairs. In tests to study the specificity of the assay, no amplification was seen in non-salmonella strains or salmonella strains with flagellar gene other than "d". Sensitivity tests determined that 28 pg of S typhi target DNA or 3 x 10(2) target bacteria could be detected by the PCR assay. Subsequently, the PCR technique was used for detection of S typhi in blood or clot cultures from 84 patients clinically suspected of having typhoid fever, and from 20 healthy control subjects. Twenty five of 84 samples from clinically suspected cases were positive by PCR; four of which were culture negative. No amplification was seen in samples from patients who were culture positive for organisms other than S typhi or from controls. The time taken for each sample for PCR analysis was less than 48 hours compared with three to five days for blood or clot culture. PCR appeared to be a promising diagnostic test for typhoid fever. Images PMID:9215131

  10. Polymerase chain reaction-based analysis to detect terrestrial animal protein in fish meal.

    PubMed

    Bellagamba, Federica; Valfrè, Franco; Panseri, Sara; Moretti, Vittorio M

    2003-04-01

    The recent European bovine spongiform encephalopathy crisis has focused attention on the importance of adopting stringent control measures to avoid the risk of the diffusion of mad cow disease through meat meal-based animal feedstuffs. Potential adulteration of such feedstuffs with bone particles from terrestrial animals is determined by microscopic examination by law before the release of these feedstuffs for free circulation in the European Community. This study describes a DNA monitoring method to examine fish meal for contamination with mammalian and poultry products. A polymerase chain reaction (PCR) method based on the nucleotide sequence variation in the 12S ribosomal RNA gene of mitochondrial DNA was developed and evaluated. Three species-specific primer pairs were designed for the identification of ruminant, pig, and poultry DNA. The specificity of the primers used in the PCR was tested by comparison with DNA samples for several vertebrate species and confirmed. The PCR specifically detected mammalian and poultry adulteration in fish meals containing 0.125% beef, 0.125% sheep, 0.125% pig, 0.125% chicken, and 0.5% goat. A multiplex PCR assay for ruminant and pig adulteration was optimized and had a detection limit of 0.25%. PMID:12696697

  11. Detection of herpesviral sequences in tissues of green turtles with fibropapilloma by polymerase chain reaction.

    PubMed

    Lu, Y; Wang, Y; Yu, Q; Aguirre, A A; Balazs, G H; Nerurkar, V R; Yanagihara, R

    2000-01-01

    An alpha-herpesvirus has been associated recently with green turtle fibropapilloma (FP). To further clarify the role of this newfound green turtle herpesvirus (GTHV) in the pathogenesis of FP, various normal-appearing tissues and organs (including skin, eye, brain, heart, liver, spleen, intestine, lung, kidney, nerve, gonad, tongue, gall bladder, urinary bladder, thyroid and peripheral blood mononuclear cells (PBMC) from blood) and tumor tissues from 19 green turtles (Chelonia mydas) with FP, and tissues from three green turtles without FP, collected during 1997 to 1999 in the Hawaiian Islands, were tested for GTHV sequences by nested polymerase chain reaction (PCR), using GTHV-specific oligonuclotide primers. GTHV sequences were detected in all tumors (51/51) and most tissues (133/167) of tumored turtles. By contrast, such sequences were undetectable in tissues (0/28) of three non-tumored turtles. Analysis of GTHV sequences detected in different tissues and tumors revealed a low degree of genetic diversity (<1%). The wide distribution of this newfound herpesvirus in tumors and tissues of tumored green turtles and its absence in tissues of non-tumored turtles, argues for an etiologic role in FP.

  12. Detection of Salmonella sp. in Dermanyssus gallinae using an FTA filter-based polymerase chain reaction.

    PubMed

    Moro, C Valiente; Desloire, S; Chauve, C; Zenner, L

    2007-06-01

    Salmonella spp. bacteria are responsible for some of the most important zoonoses worldwide. Because Dermanyssus gallinae (DeGeer) (Acari: Dermanyssidae) has been recently reported to be an experimental vector of Salmonella Enteritidis, it would be of benefit to evaluate the presence of this bacterium in mites. A molecular detection tool associating a simple filter-based DNA preparation with a specific 16S rDNA Salmonella sp. polymerase chain reaction (PCR) amplification was described. The limit of detection with this method was 2 x 10(4) bacteria per mite. To adapt this technique for large-scale studies, two sizes of mite pools were tested and a preliminary investigation was carried out on mites from 16 currently or previously contaminated farms. Mites sampled from one farm of each type were positive for Salmonella, suggesting that Dermanyssus could act as a reservoir between flocks. In further investigations, it will be necessary to carry out a large-scale study to assess the role of D. gallinae in the epidemiology of avian salmonellosis.

  13. Development of a panel of recombinase polymerase amplification assays for detection of biothreat agents.

    PubMed

    Euler, Milena; Wang, Yongjie; Heidenreich, Doris; Patel, Pranav; Strohmeier, Oliver; Hakenberg, Sydney; Niedrig, Matthias; Hufert, Frank T; Weidmann, Manfred

    2013-04-01

    Syndromic panels for infectious disease have been suggested to be of value in point-of-care diagnostics for developing countries and for biodefense. To test the performance of isothermal recombinase polymerase amplification (RPA) assays, we developed a panel of 10 RPAs for biothreat agents. The panel included RPAs for Francisella tularensis, Yersinia pestis, Bacillus anthracis, variola virus, and reverse transcriptase RPA (RT-RPA) assays for Rift Valley fever virus, Ebola virus, Sudan virus, and Marburg virus. Their analytical sensitivities ranged from 16 to 21 molecules detected (probit analysis) for the majority of RPA and RT-RPA assays. A magnetic bead-based total nucleic acid extraction method was combined with the RPAs and tested using inactivated whole organisms spiked into plasma. The RPA showed comparable sensitivities to real-time RCR assays in these extracts. The run times of the assays at 42°C ranged from 6 to 10 min, and they showed no cross-detection of any of the target genomes of the panel nor of the human genome. The RPAs therefore seem suitable for the implementation of syndromic panels onto microfluidic platforms.

  14. Detection of Mycobacterium tuberculosis complex by nested polymerase chain reaction in pulmonary and extrapulmonary specimens* ,**

    PubMed Central

    Furini, Adriana Antônia da Cruz; Pedro, Heloisa da Silveira Paro; Rodrigues, Jean Francisco; Montenegro, Lilian Maria Lapa; Machado, Ricardo Luiz Dantas; Franco, Célia; Schindler, Haiana Charifker; Batista, Ida Maria Foschiani Dias; Rossit, Andrea Regina Baptista

    2013-01-01

    OBJECTIVE: To compare the performance of nested polymerase chain reaction (NPCR) with that of cultures in the detection of the Mycobacterium tuberculosis complex in pulmonary and extrapulmonary specimens. METHODS: We analyzed 20 and 78 pulmonary and extrapulmonary specimens, respectively, of 67 hospitalized patients suspected of having tuberculosis. An automated microbial system was used for the identification of Mycobacterium spp. cultures, and M. tuberculosis IS6110 was used as the target sequence in the NPCR. The kappa statistic was used in order to assess the level of agreement among the results. RESULTS: Among the 67 patients, 6 and 5, respectively, were diagnosed with pulmonary and extrapulmonary tuberculosis, and the NPCR was positive in all of the cases. Among the 98 clinical specimens, smear microscopy, culture, and NPCR were positive in 6.00%, 8.16%, and 13.26%, respectively. Comparing the results of NPCR with those of cultures (the gold standard), we found that NPCR had a sensitivity and specificity of 100% and 83%, respectively, in pulmonary specimens, compared with 83% and 96%, respectively, in extrapulmonary specimens, with good concordance between the tests (kappa, 0.50 and 0.6867, respectively). CONCLUSIONS: Although NPCR proved to be a very useful tool for the detection of M. tuberculosis complex, clinical, epidemiological, and other laboratory data should also be considered in the diagnosis and treatment of pulmonary and extrapulmonary tuberculosis. PMID:24473765

  15. Combination of immunosensor detection with viability testing and confirmation using the polymerase chain reaction and culture.

    PubMed

    Johnson-White, Brandy; Lin, Baochuan; Ligler, Frances S

    2007-01-01

    Rapid and accurate differential determination of viable versus nonviable microbes is critical for formulation of an appropriate response after pathogen detection. Sensors for rapid bacterial identification can be used for applications ranging from environmental monitoring and homeland defense to food process monitoring, but few provide viability information. This study combines the rapid screening capability of the array biosensor using an immunoassay format with methods for determination of viability. Additionally, cells captured by the immobilized antibodies can be cultured following fluorescence imaging to further confirm viability and for cell population expansion for further characterization, e.g., strain identification or antibiotic susceptibility testing. Finally, we demonstrate analysis of captured bacteria using the polymerase chain reaction (PCR). PCR results for waveguide-captured cells were 3 orders of magnitude more sensitive than the fluorescence immunoassay and can also provide additional genetic information on the captured microbes. These approaches can be used to rapidly detect and distinguish viable versus nonviable and pathogenic versus nonpathogenic captured organisms, provide culture materials for further analysis on a shorter time scale, and assess the efficacy of decontamination or sterilization procedures. PMID:17194131

  16. Detection of human immunodeficiency virus DNA and RNA in semen by the polymerase chain reaction.

    PubMed

    Mermin, J H; Holodniy, M; Katzenstein, D A; Merigan, T C

    1991-10-01

    Peripheral blood mononuclear cells (PBMC) and semen of 23 men infected with human immunodeficiency virus (HIV) were examined for the presence of HIV DNA and RNA using the polymerase chain reaction (PCR) and a nonisotopic detection assay. None of the men was receiving antiretroviral therapy at the time of collection. Semen samples were separated into cell-free seminal fluid, nonspermatozoal mononuclear cells (NSMC), and spermatozoa. All of the PBMC samples, 17 (74%) of 23 NSMC samples, and none of the spermatozoal samples were positive for HIV gag gene DNA. Of 23 cell-free seminal fluid samples, 15 (65%) were positive for HIV gag gene RNA by PCR. Cell-free HIV RNA was more likely to be present in the semen of men with less than 400 than in those with greater than or equal to 400 cells/mm3 (P less than .04) and was present in all patient with p24 antigen in serum. The presence of HIV DNA in NSMC samples was not related to CD4 cell count, disease status, or the presence of p24 antigen in the serum. This study shows that HIV nucleic acid can be detected by PCR in either the cell-free seminal fluid or NSMC of 87% of semen samples but not in the DNA of spermatozoa from HIV-infected men.

  17. Development of a Panel of Recombinase Polymerase Amplification Assays for Detection of Biothreat Agents

    PubMed Central

    Euler, Milena; Wang, Yongjie; Heidenreich, Doris; Patel, Pranav; Strohmeier, Oliver; Hakenberg, Sydney; Niedrig, Matthias; Hufert, Frank T.

    2013-01-01

    Syndromic panels for infectious disease have been suggested to be of value in point-of-care diagnostics for developing countries and for biodefense. To test the performance of isothermal recombinase polymerase amplification (RPA) assays, we developed a panel of 10 RPAs for biothreat agents. The panel included RPAs for Francisella tularensis, Yersinia pestis, Bacillus anthracis, variola virus, and reverse transcriptase RPA (RT-RPA) assays for Rift Valley fever virus, Ebola virus, Sudan virus, and Marburg virus. Their analytical sensitivities ranged from 16 to 21 molecules detected (probit analysis) for the majority of RPA and RT-RPA assays. A magnetic bead-based total nucleic acid extraction method was combined with the RPAs and tested using inactivated whole organisms spiked into plasma. The RPA showed comparable sensitivities to real-time RCR assays in these extracts. The run times of the assays at 42°C ranged from 6 to 10 min, and they showed no cross-detection of any of the target genomes of the panel nor of the human genome. The RPAs therefore seem suitable for the implementation of syndromic panels onto microfluidic platforms. PMID:23345286

  18. Evaluation of a multiplex real-time polymerase chain reaction assay for the detection of influenza and respiratory syncytial viruses.

    PubMed

    Esposito, Susanna; Scala, Alessia; Tagliabue, Claudia; Zampiero, Alberto; Bianchini, Sonia; Principi, Nicola

    2016-01-01

    Nasopharyngeal swabs from 424 children were used to compare the performances of the new multiplex real-time polymerase chain reaction (RT-PCR) RIDA®GENE Flu & RSV kit and monospecific RT-PCR assays in detecting respiratory syncytial and influenza viruses. The easy-to-use kit was highly sensitive and specific and is recommended for routine practice.

  19. DISCUSSION OF "DETECTION OF CRYPTOSPORIDIUM PARVUM IN SECONDARY EFFLUENTS USING A MOST PROBABLE NUMBER-POLYMERASE CHAIN REACTION ASSAY"

    EPA Science Inventory

    The emphasis of this paper is to show that most probable number-polymerase chain reaction (MPNPCR) assay can be used to detect Cryptosporidium parvum in WWTP effluents as an alternative to immunfluorescent assay (IFA). I am concerned, however, that the paper suggests that all WW...

  20. Development of Recombinase Polymerase Amplification Assays for Detection of Orientia tsutsugamushi or Rickettsia typhi

    PubMed Central

    Chao, Chien-Chung; Belinskaya, Tatyana; Zhang, Zhiwen; Ching, Wei-Mei

    2015-01-01

    Sensitive, specific and rapid diagnostic tests for the detection of Orientia tsutsugamushi (O. tsutsugamushi) and Rickettsia typhi (R. typhi), the causative agents of scrub typhus and murine typhus, respectively, are necessary to accurately and promptly diagnose patients and ensure that they receive proper treatment. Recombinase polymerase amplification (RPA) assays using a lateral flow test (RPA-nfo) and real-time fluorescent detection (RPA-exo) were developed targeting the 47-kDa gene of O. tsutsugamushi or 17 kDa gene of R. typhi. The RPA assay was capable of detecting O. tsutsugamushi or R. typhi at levels comparable to that of the quantitative PCR method. Both the RPA-nfo and RPA-exo methods performed similarly with regards to sensitivity when detecting the 17 kDa gene of R. typhi. On the contrary, RPA-exo performed better than RPA-nfo in detecting the 47 kDa gene of O. tsutsugamushi. The clinical performance of the O. tsutsugamushi RPA assay was evaluated using either human patient samples or infected mouse samples. Eight out of ten PCR confirmed positives were determined positive by RPA, and all PCR confirmed negative samples were negative by RPA. Similar results were obtained for R. typhi spiked patient sera. The assays were able to differentiate O. tsutsugamushi and R. typhi from other phylogenetically related bacteria as well as mouse and human DNA. Furthermore, the RPA-nfo reaction was completed in 20 minutes at 37oC followed by a 10 minute incubation at room temperature for development of an immunochromatographic strip. The RPA-exo reaction was completed in 20 minutes at 39oC. The implementation of a cross contamination proof cassette to detect the RPA-nfo fluorescent amplicons provided an alternative to regular lateral flow detection strips, which are more prone to cross contamination. The RPA assays provide a highly time-efficient, sensitive and specific alternative to other methods for diagnosing scrub typhus or murine typhus. PMID:26161793

  1. Development of Recombinase Polymerase Amplification Assays for Detection of Orientia tsutsugamushi or Rickettsia typhi.

    PubMed

    Chao, Chien-Chung; Belinskaya, Tatyana; Zhang, Zhiwen; Ching, Wei-Mei

    2015-01-01

    Sensitive, specific and rapid diagnostic tests for the detection of Orientia tsutsugamushi (O. tsutsugamushi) and Rickettsia typhi (R. typhi), the causative agents of scrub typhus and murine typhus, respectively, are necessary to accurately and promptly diagnose patients and ensure that they receive proper treatment. Recombinase polymerase amplification (RPA) assays using a lateral flow test (RPA-nfo) and real-time fluorescent detection (RPA-exo) were developed targeting the 47-kDa gene of O. tsutsugamushi or 17 kDa gene of R. typhi. The RPA assay was capable of detecting O. tsutsugamushi or R. typhi at levels comparable to that of the quantitative PCR method. Both the RPA-nfo and RPA-exo methods performed similarly with regards to sensitivity when detecting the 17 kDa gene of R. typhi. On the contrary, RPA-exo performed better than RPA-nfo in detecting the 47 kDa gene of O. tsutsugamushi. The clinical performance of the O. tsutsugamushi RPA assay was evaluated using either human patient samples or infected mouse samples. Eight out of ten PCR confirmed positives were determined positive by RPA, and all PCR confirmed negative samples were negative by RPA. Similar results were obtained for R. typhi spiked patient sera. The assays were able to differentiate O. tsutsugamushi and R. typhi from other phylogenetically related bacteria as well as mouse and human DNA. Furthermore, the RPA-nfo reaction was completed in 20 minutes at 37°C followed by a 10 minute incubation at room temperature for development of an immunochromatographic strip. The RPA-exo reaction was completed in 20 minutes at 39°C. The implementation of a cross contamination proof cassette to detect the RPA-nfo fluorescent amplicons provided an alternative to regular lateral flow detection strips, which are more prone to cross contamination. The RPA assays provide a highly time-efficient, sensitive and specific alternative to other methods for diagnosing scrub typhus or murine typhus.

  2. Development of Recombinase Polymerase Amplification Assays for Detection of Orientia tsutsugamushi or Rickettsia typhi.

    PubMed

    Chao, Chien-Chung; Belinskaya, Tatyana; Zhang, Zhiwen; Ching, Wei-Mei

    2015-01-01

    Sensitive, specific and rapid diagnostic tests for the detection of Orientia tsutsugamushi (O. tsutsugamushi) and Rickettsia typhi (R. typhi), the causative agents of scrub typhus and murine typhus, respectively, are necessary to accurately and promptly diagnose patients and ensure that they receive proper treatment. Recombinase polymerase amplification (RPA) assays using a lateral flow test (RPA-nfo) and real-time fluorescent detection (RPA-exo) were developed targeting the 47-kDa gene of O. tsutsugamushi or 17 kDa gene of R. typhi. The RPA assay was capable of detecting O. tsutsugamushi or R. typhi at levels comparable to that of the quantitative PCR method. Both the RPA-nfo and RPA-exo methods performed similarly with regards to sensitivity when detecting the 17 kDa gene of R. typhi. On the contrary, RPA-exo performed better than RPA-nfo in detecting the 47 kDa gene of O. tsutsugamushi. The clinical performance of the O. tsutsugamushi RPA assay was evaluated using either human patient samples or infected mouse samples. Eight out of ten PCR confirmed positives were determined positive by RPA, and all PCR confirmed negative samples were negative by RPA. Similar results were obtained for R. typhi spiked patient sera. The assays were able to differentiate O. tsutsugamushi and R. typhi from other phylogenetically related bacteria as well as mouse and human DNA. Furthermore, the RPA-nfo reaction was completed in 20 minutes at 37°C followed by a 10 minute incubation at room temperature for development of an immunochromatographic strip. The RPA-exo reaction was completed in 20 minutes at 39°C. The implementation of a cross contamination proof cassette to detect the RPA-nfo fluorescent amplicons provided an alternative to regular lateral flow detection strips, which are more prone to cross contamination. The RPA assays provide a highly time-efficient, sensitive and specific alternative to other methods for diagnosing scrub typhus or murine typhus. PMID:26161793

  3. Disruption of the 5' stem-loop of yeast U6 RNA induces trimethylguanosine capping of this RNA polymerase III transcript in vivo.

    PubMed Central

    Kwan, S; Gerlach, V L; Brow, D A

    2000-01-01

    Primary transcripts made by RNA polymerase II (Pol II), but not Pol I or Pol III, are modified by addition of a 7-methylguanosine (m7G) residue to the triphosphate 5' end shortly after it emerges from the polymerase. The m7G "caps" of small nuclear and small nucleolar RNAs, but not messenger RNAs, are subsequently hypermethylated to a 2,2,7-trimethylguanosine (TMG) residue. U6 RNA, the only small nuclear RNA synthesized by Pol III in most eukaryotes, does not receive a methylguanosine cap. However, human U6 RNA is O-methylated on the 5'-terminal (gamma) phosphate by an enzyme that recognizes the 5' stem-loop of U6. Here we show that variant yeast U6 RNAs truncated or substituted within the 5' stem-loop are TMG capped in vivo. Accumulation of the most efficiently TMG-capped U6 RNA variant is strongly inhibited by a conditional mutation in the largest subunit of Pol III, confirming that it is indeed synthesized by Pol III. Thus, methylguanosine capping and cap hypermethylation are not exclusive to Pol II transcripts in yeast. We propose that TMG capping of variant U6 RNAs occurs posttranscriptionally due to exposure of the 5' triphosphate by disruption of protein binding and/or gamma-methyl phosphate capping. 5' truncation and TMG capping of U6 RNA does not appear to affect its normal function in splicing, suggesting that assembly and action of the spliceosome is not very sensitive to the 5' end structure of U6 RNA. PMID:11142384

  4. Interlaboratory validation data on real-time polymerase chain reaction detection for unauthorized genetically modified papaya line PRSV-YK.

    PubMed

    Nakamura, Kosuke; Kondo, Kazunari; Akiyama, Hiroshi; Ishigaki, Takumi; Noguchi, Akio; Katsumata, Hiroshi; Takasaki, Kazuto; Futo, Satoshi; Sakata, Kozue; Fukuda, Nozomi; Mano, Junichi; Kitta, Kazumi; Tanaka, Hidenori; Akashi, Ryo; Nishimaki-Mogami, Tomoko

    2016-06-01

    This article is referred to research article entitled "Whole genome sequence analysis of unidentified genetically modified papaya for development of a specific detection method" (Nakamura et al., 2016) [1]. Real-time polymerase chain reaction (PCR) detection method for unauthorized genetically modified (GM) papaya (Carica papaya L.) line PRSV-YK (PRSV-YK detection method) was developed using whole genome sequence data (DDBJ Sequenced Read Archive under accession No. PRJDB3976). Interlaboratory validation datasets for PRSV-YK detection method were provided. Data indicating homogeneity of samples prepared for interlaboratory validation were included. Specificity and sensitivity test data for PRSV-YK detection method were also provided.

  5. Interlaboratory validation data on real-time polymerase chain reaction detection for unauthorized genetically modified papaya line PRSV-YK.

    PubMed

    Nakamura, Kosuke; Kondo, Kazunari; Akiyama, Hiroshi; Ishigaki, Takumi; Noguchi, Akio; Katsumata, Hiroshi; Takasaki, Kazuto; Futo, Satoshi; Sakata, Kozue; Fukuda, Nozomi; Mano, Junichi; Kitta, Kazumi; Tanaka, Hidenori; Akashi, Ryo; Nishimaki-Mogami, Tomoko

    2016-06-01

    This article is referred to research article entitled "Whole genome sequence analysis of unidentified genetically modified papaya for development of a specific detection method" (Nakamura et al., 2016) [1]. Real-time polymerase chain reaction (PCR) detection method for unauthorized genetically modified (GM) papaya (Carica papaya L.) line PRSV-YK (PRSV-YK detection method) was developed using whole genome sequence data (DDBJ Sequenced Read Archive under accession No. PRJDB3976). Interlaboratory validation datasets for PRSV-YK detection method were provided. Data indicating homogeneity of samples prepared for interlaboratory validation were included. Specificity and sensitivity test data for PRSV-YK detection method were also provided. PMID:27408919

  6. Subtractive genomics approach to identify putative drug targets and identification of drug-like molecules for beta subunit of DNA polymerase III in Streptococcus species.

    PubMed

    Georrge, John J; Umrania, V V

    2012-07-01

    The prolonged use of the antibiotics over the years has transformed many organisms resistant to multiple drugs. This has made the field of drug discovery of vital importance in curing various infections and diseases. The drugs act by binding to a specific target protein of prime importance for the cell's survival. Streptococcus agalactiae, Streptococcus pneumoniae, and Streptococcus pyogenes are the few gram positive organisms that have developed resistance to drugs. It causes pneumonia, meningitis, pharyngitis, otitis media, sinusitis, bacteremia, pericarditis, and arthritis infections. The present study was carried out to identify potential drug targets and inhibitors for beta subunit of DNA polymerase III in these three Streptococcus species that might facilitate the discovery of novel drugs in near future. Various steps were adopted to find out novel drug targets. And finally 3D structure of DNA polymerase III subunit beta was modeled. The ligand library was generated from various databases to find the most suitable ligands. All the ligands were docked using Molegro Virtual Docker and the lead molecules were investigated for ADME and toxicity. PMID:22415782

  7. Transcription of angiogenin and ribonuclease 4 is regulated by RNA polymerase III elements and a CCCTC binding factor (CTCF)-dependent intragenic chromatin loop.

    PubMed

    Sheng, Jinghao; Luo, Chi; Jiang, Yuxiang; Hinds, Philip W; Xu, Zhengping; Hu, Guo-fu

    2014-05-01

    Angiogenin (ANG) and ribonuclease 4 (RNASE4), two members of the secreted and vertebrate-specific ribonuclease superfamily, play important roles in cancers and neurodegenerative diseases. The ANG and RNASE4 genes share genetic regions with promoter activities, but the structure and regulation of these putative promotes are unknown. We have characterized the promoter regions, defined the transcription start site, and identified a mechanism of transcription regulation that involves both RNA polymerase III (Pol III) elements and CCCTC binding factor (CTCF) sites. We found that two Pol III elements within the promoter region influence ANG and RNASE4 expression in a position- and orientation-dependent manner. We also provide evidence for the presence of an intragenic chromatin loop between the two CTCF binding sites located in two introns flanking the ANG coding exon. We found that formation of this intragenic loop preferentially enhances ANG transcription. These results suggest a multilayer transcriptional regulation of ANG and RNASE4 gene locus. These data also add more direct evidence to the notion that Pol III elements are able to directly influence Pol II gene transcription. Furthermore, our data indicate that a CTCF-dependent chromatin loop is able to differentially regulate transcription of genes that share the same promoters.

  8. Detecting and Number Counting of Single Engineered Nanoparticles by Digital Particle Polymerase Chain Reaction.

    PubMed

    Paunescu, Daniela; Mora, Carlos A; Querci, Lorenzo; Heckel, Reinhard; Puddu, Michela; Hattendorf, Bodo; Günther, Detlef; Grass, Robert N

    2015-10-27

    The concentrations of nanoparticles present in colloidal dispersions are usually measured and given in mass concentration (e.g. mg/mL), and number concentrations can only be obtained by making assumptions about nanoparticle size and morphology. Additionally traditional nanoparticle concentration measures are not very sensitive, and only the presence/absence of millions/billions of particles occurring together can be obtained. Here, we describe a method, which not only intrinsically results in number concentrations, but is also sensitive enough to count individual nanoparticles, one by one. To make this possible, the sensitivity of the polymerase chain reaction (PCR) was combined with a binary (=0/1, yes/no) measurement arrangement, binomial statistics and DNA comprising monodisperse silica nanoparticles. With this method, individual tagged particles in the range of 60-250 nm could be detected and counted in drinking water in absolute number, utilizing a standard qPCR device within 1.5 h of measurement time. For comparison, the method was validated with single particle inductively coupled plasma mass spectrometry (sp-ICPMS).

  9. Rapid and sensitive detection of peste des petits ruminants virus by a polymerase chain reaction assay.

    PubMed

    Couacy-Hymann, E; Roger, F; Hurard, C; Guillou, J P; Libeau, G; Diallo, A

    2002-02-01

    A rapid and specific test was developed for the diagnosis of peste des petits ruminants disease. This assay is based on the rapid purification of RNA on glass beads followed by the reverse transcription-polymerase chain reaction (RT-PCR). To that effect, a set of primers (NP3/NP4) was used to amplify specifically a fragment of about 350 bp in the 3' end of the RNA messenger that encodes the nucleocapsid protein of the peste des petits ruminants virus. The PCR-product was detected by UV illumination after electrophoresis on agarose gel or by hybridisation with a digoxigenin-11-dUTP labelled oligonucleotide probe after a blot transfer. In comparison with the conventional titration technique on Vero cells, this RT-PCR assay was 1000-fold more sensitive. Compared with the popular Chomczynski and Sacchi's method [Anal. Biochem. 162 (1987) 156], the purification of the RNA on the glass beads offers the advantage of being more rapid and also avoiding the use of solvents.

  10. Detection of luciferase gene sequence in nonluminescent Vibrio cholerae by colony hygridization and polymerase chain reaction

    SciTech Connect

    Palmer, L.M.; Colwell, R.R. )

    1991-05-01

    Bioluminescence is a trait observed among approximately 10% of Vibrio cholerae isolates. We have demonstrated that not only do some strains of V. cholerae produce low levels of light, undetectable by the human eye, but the luciferase gene sequence is present in strains of V. cholerae which emit no detectable light, evidenced by hybridization with a luciferase DNA probe. Comparisons of the amino acid sequences of luciferase regions of amino acid identity. The polymerase chain reaction method of DNA amplification with oligonucleotide primers based on these regions was used to isolate a region of the luxA gene from both luminescent and nonluminescent V. cholerae strains. The nucleotide sequence of this region was determined and reveals that nonluminescent V. cholerae have 99.7% nucleotide sequence similarity in this region with the luminescent biovar V. cholerae by albensis as well as significant similarity to other species of bioluminescent bacteria, a finding that is in accord with the hypothesis that these species have a common luminescent ancestor, most probably from the marine environment.

  11. Application of polymerase chain reaction for detection of Legionella pneumophila in serum samples.

    PubMed

    Alexiou-Daniel, S.; Stylianakis, A.; Papoutsi, A.; Zorbas, I.; Papa, A.; Lambropoulos, A.F.; Antoniadis, A.

    1998-03-01

    OBJECTIVE: To apply the polymerase chain reaction (PCR) to serum samples for the rapid diagnosis of Legionnaire's disease using the L5SL9 and L5SR93 primers designed to generate a 104-base-pair (bp) fragment from the 5S RNA gene of Legionella spp. The amplified product was detected by electrophoresis and by hybridization with the L5S-1-specific probe. METHODS: Single specimens of serum obtained from 24 patients with confirmed legionellosis, at different stages of their disease, were tested by PCR. Additionally, 10 serum samples from patients with no clinical symptoms of pneumonia and 10 samples from patients suffering from pneumonia caused by Mycoplasma pneumoniae, Coxiella burnetii or Chlamydia psittaci were also tested as controls in order to determine the specificity of the method. RESULTS: Of the 24 examined serum samples, the amplified products from 12 hybridized with the L5S-1 probe (sensitivity 50%). None of the negative controls was positive after PCR. No correlation was found between the day of illness and the positivity in the test. CONCLUSIONS: The PCR technique could be applied as a diagnostic tool for the rapid diagnosis of legionellosis in serum samples after modification, mainly to improve its sensitivity. PMID:11864308

  12. Detection of canine herpesvirus 1 in a wide range of tissues using the polymerase chain reaction.

    PubMed

    Burr, P D; Campbell, M E; Nicolson, L; Onions, D E

    1996-12-01

    Canine herpesvirus 1 (CHV-1), a member of the alphaherpesvirus sub-family, is known to cause fatal infections in litters of puppies and may also be involved in infertility, abortion, and stillbirths in adult dogs. The purpose of this study was to determine the presence of CHV-1 DNA using the polymerase chain reaction (PCR) in twelve key sites that have been associated with latency for the other herpesviruses. A 605 base pair portion of the viral glycoprotein B (gB) gene was amplified using degenerate primers, cloned, and sequenced. Conventional 20 mer primers were designed using this sequence information to amplify a 120 bp fragment of gB situated between the original degenerate primers. The specificity of amplification was confirmed by Southern Blot hybridisation using an internal oligonucleotide probe. DNA was extracted from tissue samples taken from twelve dogs at post mortem and from twenty-four blood samples. Nine out of twelve dogs showed evidence of infection with CHV-1; the tissues most commonly affected were lumbo-sacral ganglia (5/12 dogs), tonsil (5/12), parotid salivary gland (4/9), and liver (4/9). No positive results were detected within the twenty-four blood samples. These results indicate that exposure to CHV-1 may be much more common than previously suggested. PMID:9008334

  13. Detection of Staphylococcus aureus by polymerase chain reaction amplification of the nuc gene.

    PubMed

    Brakstad, O G; Aasbakk, K; Maeland, J A

    1992-07-01

    Synthetic oligonucleotide primers of 21 and 24 bases, respectively, were used in the polymerase chain reaction (PCR) to amplify a sequence of the nuc gene, which encodes the thermostable nuclease of Staphylococcus aureus. A DNA fragment of approximately 270 bp was amplified from lysed S. aureus cells or isolated DNA. The PCR product was detected by agarose gel electrophoresis or Southern blot analysis by using a 33-mer internal nuc gene hybridization probe. With S. aureus cells the lower detection limit was less than 10 CFU, and with the isolated target the lower detection limit was 0.69 pg of DNA. The primers recognized 90 of 90 reference or clinical S. aureus strains. Amplification was not recorded when 80 strains representing 16 other staphylococcal species were tested or when 20 strains representing 9 different nonstaphylococcal species were tested. Some of the non-S. aureus staphylococci produced thermostable nucleases but were PCR negative. The PCR product was generated when in vitro-cultured S. aureus was used to prepare simulated clinical specimens of blood, urine, cerebrospinal fluid, or synovial fluid. No PCR product was generated when the sterile body fluids were tested. However, the sensitivity of the PCR was reduced when S. aureus in blood or urine was tested in comparison with that when bacteria in saline were tested. With the bacteria in blood, the detection limit of the PCR was 10(3) CFU. A positive PCR result was recorded when a limited number of clinical samples from wounds verified to be infected with S. aureus were tested, while the PCR product was not detected in materials from infections caused by other bacteria. Generation of PCR products was not affected by exposure of S. aureus to bactericidal agents, including cloxacillin and gentamicin, prior to testing, but was affected by exposure to UV radiation. The PCR for amplification of the nuc gene has potential for the rapid diagnosis of S. aureus infections by direct testing of clinical

  14. Detection and characterization of mammalian DNA polymerase beta mutants by functional complementation in Escherichia coli.

    PubMed Central

    Sweasy, J B; Loeb, L A

    1993-01-01

    We have designed and utilized a bacterial complementation system to identify and characterize mammalian DNA polymerase beta mutants. In this complementation system, wild-type rat DNA polymerase beta replaces both the replicative and repair functions of DNA polymerase I in the Escherichia coli recA718 polA12 double mutant; our 263 DNA polymerase beta mutants replace E. coli polymerase I less efficiently or not at all. Of the 10 mutants that have been shown to contain DNA sequence alterations, 2 exhibit a split phenotype with respect to complementation of the growth defect and methylmethanesulfonate sensitivity of the double mutant; one is a null mutant. The mutants possessing a split phenotype contain amino acid residue alterations within a putative nucleotide binding site of DNA polymerase beta. This approach for the isolation and evaluation of mutants of a mammalian DNA polymerase in E. coli may ultimately lead to a better understanding of the mechanism of action of this enzyme and to precisely defining its role in vertebrate cells. Images Fig. 2 PMID:8506308

  15. Reverse transcription-polymerase chain reaction detection of transcribed sequences on human chromosome 21

    SciTech Connect

    Cheng, J.F.; Zhu, Y. )

    1994-03-15

    Seventy-four pairs of oligonucleotides derived from sequence-tagged sites (STSs) on the long arm of human chromosome 21, specifically from bands 21q22.1 to 21q22.3, were used in reverse transcription-polymerase chain reactions (RT-PCR) to detect the presence of expressed sequences in a fetal brain. These STSs included 69 that had not been related to transcribed sequences and 5 that had detected two known genes and three previously isolated cDNA clones. Of the 69 STSs analyzed in RT-PCR, 25 allowed amplification of specific cDNA fragments. The sizes of amplified cDNA fragments match those amplified from either human genomic DNA or somatic hybrid cells containing human chromosome 21. Of the 11 cDNA analyzed in Northern blot hybridizations, 6 hybridized to specific RNA species. The rapid screening for cDNA using previously mapped STSs has provided insight into the distribution of expressed sequences in this region of chromosome 21. Northern blot analysis of the amplified cDNA fragments has revealed interesting candidate genes in two disease loci. The marker D21S267 was previously mapped in the Down syndrome region of chromosome 21, and the marker D21S113 is closely linked to progressive myoclonus epilepsy. The cDNA fragments amplified using the primer sequences derived from D21S267 and D21S113 hybridized to 7- and 6.5-kb transcripts, respectively, which seems to express predominantly in brain. 37 refs., 3 figs., 1 tab.

  16. Detection of MYCN Amplification in Serum DNA Using Conventional Polymerase Chain Reaction.

    PubMed

    Ma, Youngeun; Lee, Ji Won; Park, Soo Jin; Yi, Eun Sang; Choi, Young Bae; Yoo, Keon Hee; Sung, Ki Woong; Koo, Hong Hoe

    2016-09-01

    Neuroblastoma (NB) is the most common extra-cranial solid tumor of childhood and is characterized by a wide range of clinical behaviors. Amplification of MYCN is a well-known poor prognostic factor in NB patients. As the MYCN amplification status is usually tested using tumor specimens, lengthy and invasive procedures are unavoidable. To evaluate the possibility of detecting MYCN amplification without invasive procedure, we performed conventional polymerase chain reaction (PCR) analysis to identify MYCN amplification using the preserved serum DNA. PCR of serum DNA was done in 105 NB patients whose MYCN status had been confirmed by fluorescence in situ hybridization. MYCN amplification was evaluated as the ratio of signal intensities between MYCN and NAGK (M/N ratio). When regarding the tissue FISH results as a reference, 10 patients had MYCN-amplified (MNA) NB, and 95 had non-MNA NB. The M/N ratio of the MNA group (median 2.56, range 1.01-3.58) was significantly higher than that of the non-MNA group (median 0.97, range 0.67-5.18) (P < 0.001). In the receiver operating characteristic curve analysis, the area under the curve was 0.957 (95% confidence interval 0.898-1.000; P < 0.001), and it showed 90.9% sensitivity and 97.9% specificity with the selected cut-off value set as 1.6. The detection of MYCN amplification using conventional PCR analysis of serum samples seems to be a simple and promising method to evaluate the MYCN status of NB patients. Further study with a larger set of patients is needed to confirm the accuracy of this result.

  17. Detection of trypanosomes in suspected sleeping sickness patients in Uganda using the polymerase chain reaction.

    PubMed Central

    Kyambadde, J. W.; Enyaru, J. C.; Matovu, E.; Odiit, M.; Carasco, J. F.

    2000-01-01

    Diagnosis of sleeping sickness (trypanosomiasis) is difficult because of the fluctuating levels of parasitaemia encountered in patients. In the present study we found that the polymerase chain reaction (PCR) demonstrated trypanosome infection in 20 out of 35 (57.1%) blood samples and in 21 out of 34 (61.7%) cerebrospinal fluid (CSF) samples collected from an area endemic for sleeping sickness in north-west Uganda. A total of 14 blood samples and 13 CSF samples that were positive for trypanosomes by double centrifugation were also positive by PCR, demonstrating good concordance between the two methods. However, 6 (28.6%) of the 21 blood samples that were parasitologically negative were positive by PCR, while 8 (38.0%) out of 21 CSF samples that were negative by double centrifugation were positive by PCR. These 14 negative samples could therefore be from sleeping sickness cases even though a positive PCR test is not evidence for the presence of trypanosomes. Furthermore, of these 8 CSF samples, 4 had been designated as early cases, based on the absence of trypanosomes and on a count of < or = 5 white blood cells (WBC) per microliter. This suggests that some late-stage cases could potentially be missed according to the present criteria, and it is therefore important to perform clinical trials to determine whether these cases could be treated successfully with the first-stage drug alone. The remaining four CSF samples had been classified as late-stage cases, based on a count of > 6 WBC per microliter, even though trypanosomes could not be detected in these samples by either double centrifugation or PCR. A cut-off point of 5 WBC per microliter, which is used as a rule of thumb to stage sleeping sickness patients, seems to leave some late-stage cases undetected since trypanosomes were detected in four CSF samples from suspected cases with < 5 WBC per microliter. PMID:10686746

  18. Field-Applicable Recombinase Polymerase Amplification Assay for Rapid Detection of Mycoplasma capricolum subsp. capripneumoniae.

    PubMed

    Liljander, Anne; Yu, Mingyan; O'Brien, Elizabeth; Heller, Martin; Nepper, Julia F; Weibel, Douglas B; Gluecks, Ilona; Younan, Mario; Frey, Joachim; Falquet, Laurent; Jores, Joerg

    2015-09-01

    Contagious caprine pleuropneumonia (CCPP) is a highly contagious disease caused by Mycoplasma capricolum subsp. capripneumoniae that affects goats in Africa and Asia. Current available methods for the diagnosis of Mycoplasma infection, including cultivation, serological assays, and PCR, are time-consuming and require fully equipped stationary laboratories, which make them incompatible with testing in the resource-poor settings that are most relevant to this disease. We report a rapid, specific, and sensitive assay employing isothermal DNA amplification using recombinase polymerase amplification (RPA) for the detection of M. capricolum subsp. capripneumoniae. We developed the assay using a specific target sequence in M. capricolum subsp. capripneumoniae, as found in the genome sequence of the field strain ILRI181 and the type strain F38 and that was further evidenced in 10 field strains from different geographical regions. Detection limits corresponding to 5 × 10(3) and 5 × 10(4) cells/ml were obtained using genomic DNA and bacterial culture from M. capricolum subsp. capripneumoniae strain ILRI181, while no amplification was obtained from 71 related Mycoplasma isolates or from the Acholeplasma or the Pasteurella isolates, demonstrating a high degree of specificity. The assay produces a fluorescent signal within 15 to 20 min and worked well using pleural fluid obtained directly from CCPP-positive animals without prior DNA extraction. We demonstrate that the diagnosis of CCPP can be achieved, with a short sample preparation time and a simple read-out device that can be powered by a car battery, in <45 min in a simulated field setting.

  19. Field-Applicable Recombinase Polymerase Amplification Assay for Rapid Detection of Mycoplasma capricolum subsp. capripneumoniae.

    PubMed

    Liljander, Anne; Yu, Mingyan; O'Brien, Elizabeth; Heller, Martin; Nepper, Julia F; Weibel, Douglas B; Gluecks, Ilona; Younan, Mario; Frey, Joachim; Falquet, Laurent; Jores, Joerg

    2015-09-01

    Contagious caprine pleuropneumonia (CCPP) is a highly contagious disease caused by Mycoplasma capricolum subsp. capripneumoniae that affects goats in Africa and Asia. Current available methods for the diagnosis of Mycoplasma infection, including cultivation, serological assays, and PCR, are time-consuming and require fully equipped stationary laboratories, which make them incompatible with testing in the resource-poor settings that are most relevant to this disease. We report a rapid, specific, and sensitive assay employing isothermal DNA amplification using recombinase polymerase amplification (RPA) for the detection of M. capricolum subsp. capripneumoniae. We developed the assay using a specific target sequence in M. capricolum subsp. capripneumoniae, as found in the genome sequence of the field strain ILRI181 and the type strain F38 and that was further evidenced in 10 field strains from different geographical regions. Detection limits corresponding to 5 × 10(3) and 5 × 10(4) cells/ml were obtained using genomic DNA and bacterial culture from M. capricolum subsp. capripneumoniae strain ILRI181, while no amplification was obtained from 71 related Mycoplasma isolates or from the Acholeplasma or the Pasteurella isolates, demonstrating a high degree of specificity. The assay produces a fluorescent signal within 15 to 20 min and worked well using pleural fluid obtained directly from CCPP-positive animals without prior DNA extraction. We demonstrate that the diagnosis of CCPP can be achieved, with a short sample preparation time and a simple read-out device that can be powered by a car battery, in <45 min in a simulated field setting. PMID:26085615

  20. Polymerase chain reaction-mediated characterization of molds belonging to the Aspergillus flavus group and detection of Aspergillus parasiticus in peanut kernels by a multiplex polymerase chain reaction.

    PubMed

    Chen, Ruey-Shyang; Tsay, Jwu-Guh; Huang, Yu-Fen; Chiou, Robin Y Y

    2002-05-01

    The Aspergillus flavus group covers species of A. flavus and Aspergillus parasiticus as aflatoxin producers and Aspergillus oryzae and Aspergillus sojae as koji molds. Genetic similarity among these species is high, and aflatoxin production of a culture may be affected by cultivation conditions and substrate composition. Therefore, a polymerase chain reaction (PCR)-mediated method of detecting the aflatoxin-synthesizing genes to indicate the degree of risk a genotype has of being a phenotypic producer was demonstrated. In this study, 19 strains of the A. flavus group, including A. flavus, A. parasiticus, A. oryzae, A. sojae, and one Aspergillus niger, were subjected to PCR testing in an attempt to detect four genes, encoding for norsolorinic acid reductase (nor-1), versicolorin A dehydrogenase (ver-1), sterigmatocystin O-methyltransferase (omt-1), and a regulatory protein (apa-2), involved in aflatoxin biosynthesis. Concurrently, the strains were cultivated in yeast-malt (YM) broth for aflatoxin detection. Fifteen strains were shown to possess the four target DNA fragments. With regard to aflatoxigenicity, all seven aflatoxigenic strains possessed the four DNA fragments, and five strains bearing less than the four DNA fragments did not produce aflatoxin. When peanut kernels were artificially contaminated with A. parasiticus and A. niger for 7 days, the contaminant DNA was extractable from a piece of cotyledon (ca. 100 mg), and when subjected to multiplex PCR testing using the four pairs of primers coding for the above genes, they were successfully detected. The target DNA fragments were detected in the kernels infected with A. parasiticus, and none was detected in the sound (uninoculated) kernels or in the kernels infected with A. niger.

  1. Comparison of Nested Polymerase Chain Reaction and Real-Time Polymerase Chain Reaction with Parasitological Methods for Detection of Strongyloides stercoralis in Human Fecal Samples.

    PubMed

    Sharifdini, Meysam; Mirhendi, Hossein; Ashrafi, Keyhan; Hosseini, Mostafa; Mohebali, Mehdi; Khodadadi, Hossein; Kia, Eshrat Beigom

    2015-12-01

    This study was performed to evaluate nested polymerase chain reaction (PCR) and real-time PCR methods for detection of Strongyloides stercoralis in fecal samples compared with parasitological methods. A total of 466 stool samples were examined by conventional parasitological methods (formalin ether concentration [FEC] and agar plate culture [APC]). DNA was extracted using an in-house method, and mitochondrial cytochrome c oxidase subunit 1 and 18S ribosomal genes were amplified by nested PCR and real-time PCR, respectively. Among 466 samples, 12.7% and 18.2% were found infected with S. stercoralis by FEC and APC, respectively. DNA of S. stercoralis was detected in 18.9% and 25.1% of samples by real-time PCR and nested PCR, respectively. Considering parasitological methods as the diagnostic gold standard, the sensitivity and specificity of nested PCR were 100% and 91.6%, respectively, and that of real-time PCR were 84.7% and 95.8%, respectively. However, considering sequence analyzes of the selected nested PCR products, the specificity of nested PCR is increased. In general, molecular methods were superior to parasitological methods. They were more sensitive and more reliable in detection of S. stercoralis in comparison with parasitological methods. Between the two molecular methods, the sensitivity of nested PCR was higher than real-time PCR.

  2. Rapid isothermal detection of Phytophthora species on plant samples using recombinase polymerase amplification

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Recently several isothermal amplification techniques have been developed that are extremely tolerant towards inhibitors present in many plant extracts. Recombinase polymerase amplification (RPA) assays for the genus Phytophthora have been developed which provide a simple and rapid method to macerate...

  3. Novel application of Phi29 DNA polymerase: RNA detection and analysis in vitro and in situ by target RNA-primed RCA

    PubMed Central

    Lagunavicius, Arunas; Merkiene, Egle; Kiveryte, Zivile; Savaneviciute, Agne; Zimbaite-Ruskuliene, Vilma; Radzvilavicius, Tomas; Janulaitis, Arvydas

    2009-01-01

    We present a novel Phi29 DNA polymerase application in RCA-based target RNA detection and analysis. The 3′→5′ RNase activity of Phi29 DNA polymerase converts target RNA into a primer and the polymerase uses this newly generated primer for RCA initiation. Therefore, using target RNA-primed RCA, padlock probes may be targeted to inner RNA sequences and their peculiarities can be analyzed directly. We demonstrate that the exoribonucleolytic activity of Phi29 DNA polymerase can be successfully applied in vitro and in situ. These findings expand the potential for detection and analysis of RNA sequences distanced from 3′-end. PMID:19244362

  4. Early detection of Brucella canis via quantitative polymerase chain reaction analysis.

    PubMed

    Kauffman, L K; Bjork, J K; Gallup, J M; Boggiatto, P M; Bellaire, B H; Petersen, C A

    2014-02-01

    Canine brucellosis is a reportable zoonotic disease that can lead to canine reproductive losses and human infection through contact with infected urine or other genitourinary secretions. Although many locations require testing and euthanasia of positive dogs, current diagnosis is limited by the time required for seroconversion, for example, presence of B. canis-specific antibodies. The goal of this study was to determine the diagnostic ability of Brucella canis-specific quantitative polymerase chain reaction (qPCR) assay to detect B. canis in field samples prior to serological positivity for faster diagnosis and prevention of transmission within kennels or in households. Two kennels, one of which was located in the owner's home, were sampled following observation of suggestive clinical signs and positive serology of at least one dog. Specimens obtained were comparatively analysed via serology and qPCR analysis. 107 dogs were analysed for B. canis infection via qPCR: 105 via whole-blood samples, 65 via vaginal swab, six via urine and seven via genitourinary tract tissue taken at necropsy. Forty-five dogs were found to be infected with canine brucellosis via qPCR, of which 22 (48.89%) were seropositive. A statistically significant number (P = 0.0228) of qPCR-positive dogs, 5/25 (20.00%), seroconverted within a 30-day interval after initial serologic testing. As compared to serology, qPCR analysis of DNA from vaginal swabs had a sensitivity of 92.31% and specificity of 51.92%, and qPCR analysis of DNA from whole-blood samples had a sensitivity of 16.67% and specificity of 100%. B. canis outer membrane protein 25 DNA qPCR from non-invasive vaginal swab and urine samples provided early detection of B. canis infection in dogs prior to detection of antibodies. This assay provides a critical tool to decrease zoonotic spread of canine brucellosis, its associated clinical presentation(s), and emotional and economic repercussions.

  5. Activation of RNA polymerase III transcription of human Alu repetitive elements by adenovirus type 5: requirement for the E1b 58-kilodalton protein and the products of E4 open reading frames 3 and 6.

    PubMed Central

    Panning, B; Smiley, J R

    1993-01-01

    We found that transcription of endogenous human Alu elements by RNA polymerase III was strongly stimulated following infection of HeLa cells with adenovirus type 5, leading to the accumulation of high levels of Alu transcripts initiated from Alu polymerase III promoters. In contrast to previously reported cases of adenovirus-induced activation of polymerase III transcription, induction required the E1b 58-kDa protein and the products of E4 open reading frames 3 and 6 in addition to the 289-residue E1a protein. In addition, E1a function was not required at high multiplicities of infection, suggesting that E1a plays an indirect role in Alu activation. These results suggest previously unsuspected regulatory properties of the adenovirus E1b and E4 gene products and provide a novel approach to the study of the biology of the most abundant class of dispersed repetitive DNA in the human genome. Images PMID:7684492

  6. Detection of Food Hazards in Foods: Comparison of Real Time Polymerase Chain Reaction and Cultural Methods

    PubMed Central

    Bonilauri, Paolo; Bardasi, Lia; Leonelli, Roberto; Ramini, Mattia; Luppi, Andrea; Merialdi, Giuseppe

    2016-01-01

    Foodstuffs should not contain microorganisms or their toxins or metabolites in quantities suggesting an unacceptable risk for human health. The detection of food hazards in foods is performed by several tests that produce results dependent on the analytical method used: an analytical reference method, defined as standard, is associated with each microbiological criterion laid down in Regulation 2073/2005/EC, but, analytical methods other than the reference ones, in particular more rapid methods, could be used. Combined screening methods performed by real time-polymerase chain reaction (RT-PCR) are currently validated as alternative methods according to the ISO 16140:2003 and certified by the Association Française de Normalisation. However, the positive results obtained with these alternative methods, the investigated molecular relations that resulted positive have to be confirmed with cultural methods using the same enrichment media in which the molecular screening was performed. Since it is necessary to assess if these testing schemes provide equivalent guarantees of food safety, the aim of this retrospective study is to analyse the data collected, from 2012 to 2014 by Emilia Romagna Region in the field of Piano Regionale Alimenti (Food Regional Plan) during official controls monitoring food samples of animal and other than animal origin. Records performed by combined methods of molecular screening of Salmonella spp., Listeria monocytogenes and thermophilic Campylobacter and cultural confirmation results were gathered together and the results were compared in order to assess the sensitivity of the methods. A total of 10,604 food samples were considered in this study: the comparison of the data revealed that the RT-PCR method detected Salmonella, L. monocytogenes, and thermophilic Campylobacter in 2.18, 3.85 and 3.73% of the samples, respectively, whereas by using cultural method these pathogens were isolated in 0.43, 1.57 and 1.57% of samples, respectively. In

  7. Reaction mechanism of the epsilon subunit of E. coli DNA polymerase III: insights into active site metal coordination and catalytically significant residues.

    PubMed

    Cisneros, G Andrés; Perera, Lalith; Schaaper, Roel M; Pedersen, Lars C; London, Robert E; Pedersen, Lee G; Darden, Thomas A

    2009-02-01

    The 28 kDa epsilon subunit of Escherichia coli DNA polymerase III is the exonucleotidic proofreader responsible for editing polymerase insertion errors. Here, we study the mechanism by which epsilon carries out the exonuclease activity. We performed quantum mechanics/molecular mechanics calculations on the N-terminal domain containing the exonuclease activity. Both the free-epsilon and a complex epsilon bound to a theta homologue (HOT) were studied. For the epsilon-HOT complex Mg(2+) or Mn(2+) were investigated as the essential divalent metal cofactors, while only Mg(2+) was used for free-epsilon. In all calculations a water molecule bound to the catalytic metal acts as the nucleophile for hydrolysis of the phosphate bond. Initially, a direct proton transfer to H162 is observed. Subsequently, the nucleophilic attack takes place followed by a second proton transfer to E14. Our results show that the reaction catalyzed with Mn(2+) is faster than that with Mg(2+), in agreement with experiment. In addition, the epsilon-HOT complex shows a slightly lower energy barrier compared to free-epsilon. In all cases the catalytic metal is observed to be pentacoordinated. Charge and frontier orbital analyses suggest that charge transfer may stabilize the pentacoordination. Energy decomposition analysis to study the contribution of each residue to catalysis suggests that there are several important residues. Among these, H98, D103, D129, and D146 have been implicated in catalysis by mutagenesis studies. Some of these residues were found to be structurally conserved on human TREX1, the exonuclease domains from E. coli DNA-Pol I, and the DNA polymerase of bacteriophage RB69.

  8. Allele-specific duplex polymerase chain reaction to differentiate Mycobacterium abscessus subspecies and to detect highly clarithromycin-resistant isolates.

    PubMed

    Kim, H Y; Lee, S Y; Kim, B J; Kook, Y H

    2016-01-01

    On the basis of the structural differences of erm, we used a duplex polymerase chain reaction (PCR) to differentiate Mycobacterium abscessus subsp. abscessus and subsp. massiliense isolates and to detect the point mutations of 23S rRNA gene that confer a high level of resistance to clarithromycin. Subsp. massiliense strains occupying almost half of the clinical isolates can be simply identified, and their clarithromycin susceptibility can be rapidly determined. PMID:27514964

  9. [Structural-functional characteristics of the Schizosaccharomyces pombe rpb8+ gene, coding the subunit of RNA polymerase I-III, specific only for eukaryotes].

    PubMed

    Shpakovskiĭ, G V; Proshkin, S A; Kaiushin, A L; Korosteleva, M D; Lebedenko, E N

    1998-02-01

    A full-length cDNA of the rpb8+ gene encoding a common subunit Rpb8 of nuclear RNA polymerases I-III only specific for Eucarya was isolated from an expression library of the fission yeast Schizosaccharomyces pombe. The primary structure of the corresponding fragment of the Sz. pombe genome was also established. The rpb8+ gene contains two short introns, 59 and 48 bp long. Only short segments of homology were found upon comparing the Rpb8 subunit homologs from various eukaryotic species, and substantial differences exist between the corresponding proteins of unicellular and multicellular organisms. Subunit Rpb8 of Sz. pombe proved to be the smallest one among the known related proteins: it lacks the 21-aa fragment corresponding to amino acids residues 68-88 of the central part of the homologous subunit ABC14.5 of Saccharomyces cerevisiae. Accordingly, subunit Rpb8 of the fission yeast was not capable of substituting in vivo subunit ABC14.5 in nuclear RNA polymerases of the baker's yeast. PMID:10335407

  10. The Roles of RNA Polymerase I and III Subunits Polr1c and Polr1d in Craniofacial Development and in Zebrafish Models of Treacher Collins Syndrome.

    PubMed

    Noack Watt, Kristin E; Achilleos, Annita; Neben, Cynthia L; Merrill, Amy E; Trainor, Paul A

    2016-07-01

    Ribosome biogenesis is a global process required for growth and proliferation of all cells, yet perturbation of ribosome biogenesis during human development often leads to tissue-specific defects termed ribosomopathies. Transcription of the ribosomal RNAs (rRNAs) by RNA polymerases (Pol) I and III, is considered a rate limiting step of ribosome biogenesis and mutations in the genes coding for RNA Pol I and III subunits, POLR1C and POLR1D cause Treacher Collins syndrome, a rare congenital craniofacial disorder. Our understanding of the functions of individual RNA polymerase subunits, however, remains poor. We discovered that polr1c and polr1d are dynamically expressed during zebrafish embryonic development, particularly in craniofacial tissues. Consistent with this pattern of activity, polr1c and polr1d homozygous mutant zebrafish exhibit cartilage hypoplasia and cranioskeletal anomalies characteristic of humans with Treacher Collins syndrome. Mechanistically, we discovered that polr1c and polr1d loss-of-function results in deficient ribosome biogenesis, Tp53-dependent neuroepithelial cell death and a deficiency of migrating neural crest cells, which are the primary progenitors of the craniofacial skeleton. More importantly, we show that genetic inhibition of tp53 can suppress neuroepithelial cell death and ameliorate the skeletal anomalies in polr1c and polr1d mutants, providing a potential avenue to prevent the pathogenesis of Treacher Collins syndrome. Our work therefore has uncovered tissue-specific roles for polr1c and polr1d in rRNA transcription, ribosome biogenesis, and neural crest and craniofacial development during embryogenesis. Furthermore, we have established polr1c and polr1d mutant zebrafish as models of Treacher Collins syndrome together with a unifying mechanism underlying its pathogenesis and possible prevention. PMID:27448281

  11. The Roles of RNA Polymerase I and III Subunits Polr1c and Polr1d in Craniofacial Development and in Zebrafish Models of Treacher Collins Syndrome.

    PubMed

    Noack Watt, Kristin E; Achilleos, Annita; Neben, Cynthia L; Merrill, Amy E; Trainor, Paul A

    2016-07-01

    Ribosome biogenesis is a global process required for growth and proliferation of all cells, yet perturbation of ribosome biogenesis during human development often leads to tissue-specific defects termed ribosomopathies. Transcription of the ribosomal RNAs (rRNAs) by RNA polymerases (Pol) I and III, is considered a rate limiting step of ribosome biogenesis and mutations in the genes coding for RNA Pol I and III subunits, POLR1C and POLR1D cause Treacher Collins syndrome, a rare congenital craniofacial disorder. Our understanding of the functions of individual RNA polymerase subunits, however, remains poor. We discovered that polr1c and polr1d are dynamically expressed during zebrafish embryonic development, particularly in craniofacial tissues. Consistent with this pattern of activity, polr1c and polr1d homozygous mutant zebrafish exhibit cartilage hypoplasia and cranioskeletal anomalies characteristic of humans with Treacher Collins syndrome. Mechanistically, we discovered that polr1c and polr1d loss-of-function results in deficient ribosome biogenesis, Tp53-dependent neuroepithelial cell death and a deficiency of migrating neural crest cells, which are the primary progenitors of the craniofacial skeleton. More importantly, we show that genetic inhibition of tp53 can suppress neuroepithelial cell death and ameliorate the skeletal anomalies in polr1c and polr1d mutants, providing a potential avenue to prevent the pathogenesis of Treacher Collins syndrome. Our work therefore has uncovered tissue-specific roles for polr1c and polr1d in rRNA transcription, ribosome biogenesis, and neural crest and craniofacial development during embryogenesis. Furthermore, we have established polr1c and polr1d mutant zebrafish as models of Treacher Collins syndrome together with a unifying mechanism underlying its pathogenesis and possible prevention.

  12. The Roles of RNA Polymerase I and III Subunits Polr1c and Polr1d in Craniofacial Development and in Zebrafish Models of Treacher Collins Syndrome

    PubMed Central

    Achilleos, Annita; Neben, Cynthia L.; Merrill, Amy E.; Trainor, Paul A.

    2016-01-01

    Ribosome biogenesis is a global process required for growth and proliferation of all cells, yet perturbation of ribosome biogenesis during human development often leads to tissue-specific defects termed ribosomopathies. Transcription of the ribosomal RNAs (rRNAs) by RNA polymerases (Pol) I and III, is considered a rate limiting step of ribosome biogenesis and mutations in the genes coding for RNA Pol I and III subunits, POLR1C and POLR1D cause Treacher Collins syndrome, a rare congenital craniofacial disorder. Our understanding of the functions of individual RNA polymerase subunits, however, remains poor. We discovered that polr1c and polr1d are dynamically expressed during zebrafish embryonic development, particularly in craniofacial tissues. Consistent with this pattern of activity, polr1c and polr1d homozygous mutant zebrafish exhibit cartilage hypoplasia and cranioskeletal anomalies characteristic of humans with Treacher Collins syndrome. Mechanistically, we discovered that polr1c and polr1d loss-of-function results in deficient ribosome biogenesis, Tp53-dependent neuroepithelial cell death and a deficiency of migrating neural crest cells, which are the primary progenitors of the craniofacial skeleton. More importantly, we show that genetic inhibition of tp53 can suppress neuroepithelial cell death and ameliorate the skeletal anomalies in polr1c and polr1d mutants, providing a potential avenue to prevent the pathogenesis of Treacher Collins syndrome. Our work therefore has uncovered tissue-specific roles for polr1c and polr1d in rRNA transcription, ribosome biogenesis, and neural crest and craniofacial development during embryogenesis. Furthermore, we have established polr1c and polr1d mutant zebrafish as models of Treacher Collins syndrome together with a unifying mechanism underlying its pathogenesis and possible prevention. PMID:27448281

  13. Detection of Zaire Ebola virus by real-time reverse transcription-polymerase chain reaction, Sierra Leone, 2014.

    PubMed

    Liu, Licheng; Sun, Yang; Kargbo, Brima; Zhang, Chuntao; Feng, Huahua; Lu, Huijun; Liu, Wenseng; Wang, Chengyu; Hu, Yi; Deng, Yongqiang; Jiang, Jiafu; Kang, Xiaoping; Yang, Honglei; Jiang, Yongqiang; Yang, Yinhui; Kargbo, David; Qian, Jun; Chen, Weijun

    2015-09-15

    During the 2014 Ebola virus disease (EVD) outbreak, a real-time quantitative polymerase chain reaction was established to detect and identify the Zaire Ebola virus. We describe the use of this assay to screen 315 clinical samples from EVD suspected person in Sierra Leone. The detection rate in blood samples was 77.81% (207/266), and there were relatively higher detection rate (79.32% and 81.42%, respectively) during the first two weeks after onset of symptoms. In the two weeks that followed, the detection rate declined to 66.67% and 25.00%, respectively. There was the highest virus load at the first week and then decreased. The detection rate in swab samples was 89.79% (44/49). This may be benefit from the included patients. 46 of 49 swab samples were collected from died patients. Taken together, the results presented here indicate that the assay specifically and sensitively detects Zaire Ebola virus.

  14. Detection and analysis of polymerase chain reaction products by mass spectrometry

    SciTech Connect

    Hurst, G.B., Doktycz, M.J., Britt, P.F., Vass, A.A., Buchanan, M.V.

    1997-02-01

    This paper describes recent and ongoing efforts to overcome some of the obstacles to more routine and robust application of MALDI-TOF to analysis of polymerase chain reaction products and other information- bearing nucleic acid molecules. Methods for purifying nucleic acid samples are described, as is the application of delayed extraction TOF mass spectrometry to analysis of short oligonucleotides.

  15. Use of Existing Diagnostic Reverse-Transcription Polymerase Chain Reaction Assays for Detection of Ebola Virus RNA in Semen.

    PubMed

    Pettitt, James; Higgs, Elizabeth S; Adams, Rick D; Jahrling, Peter B; Hensley, Lisa E

    2016-04-15

    Sexual transmission of Ebola virus in Liberia has now been documented and associated with new clusters in regions previously declared Ebola free. Assays that have Emergency Use Authorization (EUA) and are routinely used to detect Ebola virus RNA in whole blood and plasma specimens at the Liberian Institute for Biomedical Research were tested for their suitability in detecting the presence of Ebola virus RNA in semen. Qiagen AVL extraction protocols, as well as the Ebola Zaire Target 1 and major groove binder quantitative reverse-transcription polymerase chain reaction assays, were demonstrably suitable for this purpose and should facilitate epidemiologic investigations, including those involving long-term survivors of Ebola. PMID:26374912

  16. Use of Existing Diagnostic Reverse-Transcription Polymerase Chain Reaction Assays for Detection of Ebola Virus RNA in Semen.

    PubMed

    Pettitt, James; Higgs, Elizabeth S; Adams, Rick D; Jahrling, Peter B; Hensley, Lisa E

    2016-04-15

    Sexual transmission of Ebola virus in Liberia has now been documented and associated with new clusters in regions previously declared Ebola free. Assays that have Emergency Use Authorization (EUA) and are routinely used to detect Ebola virus RNA in whole blood and plasma specimens at the Liberian Institute for Biomedical Research were tested for their suitability in detecting the presence of Ebola virus RNA in semen. Qiagen AVL extraction protocols, as well as the Ebola Zaire Target 1 and major groove binder quantitative reverse-transcription polymerase chain reaction assays, were demonstrably suitable for this purpose and should facilitate epidemiologic investigations, including those involving long-term survivors of Ebola.

  17. Molecular characterization of antithrombin III (ATIII) variants using polymerase chain reaction. Identification of the ATIII Charleville as an Ala 384 Pro mutation.

    PubMed Central

    Molho-Sabatier, P; Aiach, M; Gaillard, I; Fiessinger, J N; Fischer, A M; Chadeuf, G; Clauser, E

    1989-01-01

    The genes of seven structural mutants of antithrombin III (ATIII), presenting either defective serine protease reactivity or abnormal heparin binding, were analyzed. The polymerase chain reaction (PCR) was used to amplify the corresponding gene exon and the mutation was identified by either dot blot analysis using a battery of allele-specific oligonucleotide probes or sequencing. Variants Paris and Paris 2 were identified as Arg 47 Cys mutations, and Clichy, Clichy 2, and Franconville were found to be Pro 41 Leu mutations. All five are heparin binding-site variants. ATIII Avranches is an Arg 393 His mutation and ATIII Charleville is an Ala 384 Pro mutation. These two mutations impair the reactive site of the molecule. ATIII Charleville is a new mutation of the reactive center, as predicted by previous biochemical data. The position of this new mutation, together with the other previously described mutations of the reactive center, sheds light on the molecular function of this site in inhibiting thrombin. Finally, genomic amplification by PCR is a powerful technique for the fast identification of antithrombin III mutations and their homozygous/heterozygous status, and should be useful for predicting thrombotic risk. Images PMID:2794060

  18. Rapid detection of poliovirus by reverse transcription and polymerase chain amplification: application for differentiation between poliovirus and nonpoliovirus enteroviruses.

    PubMed Central

    Abraham, R; Chonmaitree, T; McCombs, J; Prabhakar, B; Lo Verde, P T; Ogra, P L

    1993-01-01

    This report describes a rapid method of detection of poliovirus from viral isolates of clinical specimens using a single set of primers selected from the conserved 5' noncoding region of the poliovirus genome. Of the 144 clinical viral isolates examined, 81 were positive for polioviruses and 50 were positive for nonpoliovirus enteroviruses by tissue culture neutralization and infectivity. All 81 (100%) of the viral isolates identified as poliovirus by tissue culture infectivity were also positive by polymerase chain reaction. Of 50 nonpoliovirus enterovirus isolates found to be negative for poliovirus by tissue culture neutralization and infectivity, 48 were also negative by polymerase chain reaction. The high sensitivity (100%) and specificity (96%) of the primer set indicate that this assay has potential clinical applicability in the diagnosis of nonpoliovirus enterovirus infection. Images PMID:7679404

  19. Direct detection of RNA in vitro and in situ by target-primed RCA: The impact of E. coli RNase III on the detection efficiency of RNA sequences distanced far from the 3′-end

    PubMed Central

    Merkiene, Egle; Gaidamaviciute, Edita; Riauba, Laurynas; Janulaitis, Arvydas; Lagunavicius, Arunas

    2010-01-01

    We improved the target RNA-primed RCA technique for direct detection and analysis of RNA in vitro and in situ. Previously we showed that the 3′ → 5′ single-stranded RNA exonucleolytic activity of Phi29 DNA polymerase converts the target RNA into a primer and uses it for RCA initiation. However, in some cases, the single-stranded RNA exoribonucleolytic activity of the polymerase is hindered by strong double-stranded structures at the 3′-end of target RNAs. We demonstrate that in such hampered cases, the double-stranded RNA-specific Escherichia coli RNase III efficiently assists Phi29 DNA polymerase in converting the target RNA into a primer. These observations extend the target RNA-primed RCA possibilities to test RNA sequences distanced far from the 3′-end and customize this technique for the inner RNA sequence analysis. PMID:20584897

  20. A portable reverse transcription recombinase polymerase amplification assay for rapid detection of foot-and-mouth disease virus.

    PubMed

    Abd El Wahed, Ahmed; El-Deeb, Ayman; El-Tholoth, Mohamed; Abd El Kader, Hanaa; Ahmed, Abeer; Hassan, Sayed; Hoffmann, Bernd; Haas, Bernd; Shalaby, Mohamed A; Hufert, Frank T; Weidmann, Manfred

    2013-01-01

    Foot-and-mouth disease (FMD) is a trans-boundary viral disease of livestock, which causes huge economic losses and constitutes a serious infectious threat for livestock farming worldwide. Early diagnosis of FMD helps to diminish its impact by adequate outbreak management. In this study, we describe the development of a real-time reverse transcription recombinase polymerase amplification (RT-RPA) assay for the detection of FMD virus (FMDV). The FMDV RT-RPA design targeted the 3D gene of FMDV and a 260 nt molecular RNA standard was used for assay validation. The RT-RPA assay was fast (4-10 minutes) and the analytical sensitivity was determined at 1436 RNA molecules detected by probit regression analysis. The FMDV RT-RPA assay detected RNA prepared from all seven FMDV serotypes but did not detect classical swine fever virus or swine vesicular disease virus. The FMDV RT-RPA assay was used in the field during the recent FMD outbreak in Egypt. In clinical samples, reverse transcription polymerase chain reaction (RT-PCR) and RT-RPA showed a diagnostic sensitivity of 100% and 98%, respectively. In conclusion, FMDV RT-RPA was quicker and much easier to handle in the field than real-time RT-PCR. Thus RT-RPA could be easily implemented to perform diagnostics at quarantine stations or farms for rapid spot-of-infection detection. PMID:23977101

  1. Electrochemical detection of point mutation based on surface hybridization assay conjugated allele-specific polymerase chain reaction.

    PubMed

    Huang, Yong; Zhu, Jing; Li, Guiyin; Chen, Zhencheng; Jiang, Jian-Hui; Shen, Guo-Li; Yu, Ru-Qin

    2013-04-15

    In this work, we developed an electrochemical detection method based on allele-specific polymerase chain reaction (AS-PCR) and surface hybridization assay technique for the point mutation detection. A high-fidelity Vent(R)™(exo⁻) DNA polymerase, which eliminated the 3'→5' proofreading exonuclease activity by genetical engineering, was used to discriminate and extend the detection probe that perfectly matched with mutant target DNA and generate a redox-active DNA replica which folded into a molecular beacon structure by intramolecular hybridization. After hybridized with capture probe modified on gold electrode by self-assembly reaction, the redox tags can be closed to electrode, resulting in a substantial current with the maximized sensitivity for point mutation analysis. However, when there is an allele mismatch in the wild target DNA, and so no the redox-active replica DNA can be obtained. In this case, no remarkable current signal can be trigged. The proposed approach has been successfully implemented for the identification of single base mutation at the -28 position in human β-globin gene with a detection limit of 0.5 fM, demonstrating that this method provides a highly specific, sensitive and cost-efficient approach for point mutation detection.

  2. A portable reverse transcription recombinase polymerase amplification assay for rapid detection of foot-and-mouth disease virus.

    PubMed

    Abd El Wahed, Ahmed; El-Deeb, Ayman; El-Tholoth, Mohamed; Abd El Kader, Hanaa; Ahmed, Abeer; Hassan, Sayed; Hoffmann, Bernd; Haas, Bernd; Shalaby, Mohamed A; Hufert, Frank T; Weidmann, Manfred

    2013-01-01

    Foot-and-mouth disease (FMD) is a trans-boundary viral disease of livestock, which causes huge economic losses and constitutes a serious infectious threat for livestock farming worldwide. Early diagnosis of FMD helps to diminish its impact by adequate outbreak management. In this study, we describe the development of a real-time reverse transcription recombinase polymerase amplification (RT-RPA) assay for the detection of FMD virus (FMDV). The FMDV RT-RPA design targeted the 3D gene of FMDV and a 260 nt molecular RNA standard was used for assay validation. The RT-RPA assay was fast (4-10 minutes) and the analytical sensitivity was determined at 1436 RNA molecules detected by probit regression analysis. The FMDV RT-RPA assay detected RNA prepared from all seven FMDV serotypes but did not detect classical swine fever virus or swine vesicular disease virus. The FMDV RT-RPA assay was used in the field during the recent FMD outbreak in Egypt. In clinical samples, reverse transcription polymerase chain reaction (RT-PCR) and RT-RPA showed a diagnostic sensitivity of 100% and 98%, respectively. In conclusion, FMDV RT-RPA was quicker and much easier to handle in the field than real-time RT-PCR. Thus RT-RPA could be easily implemented to perform diagnostics at quarantine stations or farms for rapid spot-of-infection detection.

  3. Polymerase chain reaction detection of Leishmania DNA in skin biopsy samples in Sri Lanka where the causative agent of cutaneous leishmaniasis is Leishmania donovani.

    PubMed

    Ranasinghe, Shalindra; Wickremasinghe, Renu; Hulangamuwa, Sanjeeva; Sirimanna, Ganga; Opathella, Nandimithra; Maingon, Rhaiza D C; Chandrasekharan, Vishvanath

    2015-12-01

    Leishmania donovani is the known causative agent of both cutaneous (CL) and visceral leishmaniasis in Sri Lanka. CL is considered to be under-reported partly due to relatively poor sensitivity and specificity of microscopic diagnosis. We compared robustness of three previously described polymerase chain reaction (PCR) based methods to detect Leishmania DNA in 38 punch biopsy samples from patients presented with suspected lesions in 2010. Both, Leishmania genus-specific JW11/JW12 KDNA and LITSR/L5.8S internal transcribed spacer (ITS)1 PCR assays detected 92% (35/38) of the samples whereas a KDNA assay specific forL. donovani (LdF/LdR) detected only 71% (27/38) of samples. All positive samples showed a L. donovani banding pattern upon HaeIII ITS1 PCR-restriction fragment length polymorphism analysis. PCR assay specificity was evaluated in samples containing Mycobacterium tuberculosis, Mycobacterium leprae, and human DNA, and there was no cross-amplification in JW11/JW12 and LITSR/L5.8S PCR assays. The LdF/LdR PCR assay did not amplify M. leprae or human DNA although 500 bp and 700 bp bands were observed in M. tuberculosis samples. In conclusion, it was successfully shown in this study that it is possible to diagnose Sri Lankan CL with high accuracy, to genus and species identification, using Leishmania DNA PCR assays.

  4. Detection of COL III in parchment by amino acid analysis.

    PubMed

    Sommer, Dorte V P; Larsen, René

    2016-01-01

    Cultural heritage parchments made from the reticular dermis of animals have been subject to studies of deterioration and conservation by amino acid analysis. The reticular dermis contains a varying mixture of collagen I and III (COL I and III). When dealing with the results of the amino acid analyses, till now the COL III content has not been taken into account. Based on the available amino acid sequences, we present a method for determining the amount of COL III in the reticular dermis of new and historical parchments calculated from the ratio of Ile/Val. We find COL III contents between 7 and 32 % in new parchments and between 0.2 and 40 % in the historical parchments. This is consistent with results in the literature. The varying content of COL III has a significant influence on the uncertainty of the amino acid analysis. Although we have not found a simple correlation between the COL III content and the degree of deterioration, our results show that this question must be taken into consideration in future studies of the chemical and physical deterioration of parchment measured by amino acid analysis and other analytical methods.

  5. Detection of Clostridium botulinum type C cells in the gastrointestinal tracts of Mozambique tilapia (Oreochromis mossambicus) by polymerase chain reaction

    USGS Publications Warehouse

    Nol, P.; Williamson, J.L.; Rocke, T.E.; Yuill, Thomas M.

    2004-01-01

    We established a method of directly detecting Clostridium botulinum type C cells, while minimizing spore detection, in the intestinal contents of Mozambique tilapia (Oreochromis mossambicus). This technique involved extraction of predominantly cellular DNA from tilapia intestinal tracts and used a polymerase chain reaction assay to detect presence of type C1 toxin gene. We consistently detected C. botulinum type C cells in tilapia gastrointestinal contents at a level of 7.5 ?? 10 4 cells per 0.25 g material or 1.9 ?? 10 3 cells. This technique is useful for determining prevalence of the potentially active organisms within a given population of fish and may be adapted to other types of C. botulinum and vertebrate populations as well. ?? Wildlife Disease Association 2004.

  6. A METHOD TO REMOVE ENVIRONMENTAL INHIBITORS PRIOR TO THE DETECTION OF WATERBORNE ENTERIC VIRUSES BY REVERSE TRANSCRIPTION-POLYMERASE CHAIN REACTION

    EPA Science Inventory

    A method was developed to remove environmental inhibitors from sample concentrates prior to detection of human enteric viruses using the reverse transcription-polymerase chain reaction (RT-PCR).Environmental inhibitors, concentrated along with viruses during water sample processi...

  7. Development of reverse transcription recombinase polymerase amplification assay for avian influenza H5N1 HA gene detection.

    PubMed

    Yehia, Nahed; Arafa, Abdel-Satar; Abd El Wahed, Ahmed; El-Sanousi, Ahmed A; Weidmann, Manfred; Shalaby, Mohamed A

    2015-10-01

    The 2006 outbreaks of H5N1 avian influenza in Egypt interrupted poultry production and caused staggering economic damage. In addition, H5N1 avian influenza viruses represent a significant threat to public health. Therefore, the rapid detection of H5 viruses is very important in order to control the disease. In this study, a qualitative reverse transcription recombinase polymerase amplification (RT-RPA) assay for the detection of hemagglutinin gene of H5 subtype influenza viruses was developed. The results were compared to the real-time reverse transcription polymerase chain reaction (RT-PCR). An in vitro transcribed RNA standard of 970 nucleotides of the hemagglutinin gene was developed and used to determine the assay sensitivity. The developed H5 RT-RPA assay was able to detect one RNA molecule within 7 min, while in real-time RT-PCR, at least 90 min was required. H5 RT-RPA assay did not detect nucleic acid extracted from H5 negative samples or from other pathogens producing respiratory manifestation in poultry. The clinical performance of the H5 RT-RPA assay was tested in 30 samples collected between 2014 and 2015; the sensitivity of H5 RT-RPA and real-time RT-PCR was 100%. In conclusion, H5 RT-RPA was faster than real-time RT-PCR and easily operable in a portable device. Moreover, it had an equivalent sensitivity and specificity.

  8. Development of reverse transcription recombinase polymerase amplification assay for avian influenza H5N1 HA gene detection.

    PubMed

    Yehia, Nahed; Arafa, Abdel-Satar; Abd El Wahed, Ahmed; El-Sanousi, Ahmed A; Weidmann, Manfred; Shalaby, Mohamed A

    2015-10-01

    The 2006 outbreaks of H5N1 avian influenza in Egypt interrupted poultry production and caused staggering economic damage. In addition, H5N1 avian influenza viruses represent a significant threat to public health. Therefore, the rapid detection of H5 viruses is very important in order to control the disease. In this study, a qualitative reverse transcription recombinase polymerase amplification (RT-RPA) assay for the detection of hemagglutinin gene of H5 subtype influenza viruses was developed. The results were compared to the real-time reverse transcription polymerase chain reaction (RT-PCR). An in vitro transcribed RNA standard of 970 nucleotides of the hemagglutinin gene was developed and used to determine the assay sensitivity. The developed H5 RT-RPA assay was able to detect one RNA molecule within 7 min, while in real-time RT-PCR, at least 90 min was required. H5 RT-RPA assay did not detect nucleic acid extracted from H5 negative samples or from other pathogens producing respiratory manifestation in poultry. The clinical performance of the H5 RT-RPA assay was tested in 30 samples collected between 2014 and 2015; the sensitivity of H5 RT-RPA and real-time RT-PCR was 100%. In conclusion, H5 RT-RPA was faster than real-time RT-PCR and easily operable in a portable device. Moreover, it had an equivalent sensitivity and specificity. PMID:26225482

  9. [Detection of the genetically modified organisms in genetically modified soybean and maize by polymerase chain reaction method].

    PubMed

    Mao, Deqian; Mu, Weipeng; Yang, Xiaoguang

    2002-06-01

    A method for the detection of the (genetically modified organism GMOs) in genetically modified soybean (Round-up Ready soybean, RR soybean) and maize(Bt-176 maize) is described. The polymerase chain reaction (PCR) method is discussed with the genetically modified soybean and maize whose contents are known. The detection limit can be 0.1%, that is to say, we can detect the GMO in the food whose content is only 0.1%, the detection method is just a screening method. The procedure includes: (1) extraction of genomic DNA of maize and soybean, (2) amplification of the inserted genes, CaMV35S promoter and the NOS terminator inserted by means of the polymerase chain reaction (PCR) method, (3) amplification of the specific genes of maize and soybean in order to determine that the samples are maize and soybean, (4) characterization and confirmation of the PCR products by restriction enzyme analysis and the electrophoresis on agarose gel. The RR soybean contains CaMV35S promoter and NOS terminator, and the Bt-176 maize contains only CaMV35S promoter. Due to the high content of the starch in maize, the effect of the electrophororesis is not so good as of the soybean's.

  10. Automatic polymerase chain reaction product detection system for food safety monitoring using zinc finger protein fused to luciferase.

    PubMed

    Yoshida, Wataru; Kezuka, Aki; Murakami, Yoshiyuki; Lee, Jinhee; Abe, Koichi; Motoki, Hiroaki; Matsuo, Takafumi; Shimura, Nobuaki; Noda, Mamoru; Igimi, Shizunobu; Ikebukuro, Kazunori

    2013-11-01

    An automatic polymerase chain reaction (PCR) product detection system for food safety monitoring using zinc finger (ZF) protein fused to luciferase was developed. ZF protein fused to luciferase specifically binds to target double stranded DNA sequence and has luciferase enzymatic activity. Therefore, PCR products that comprise ZF protein recognition sequence can be detected by measuring the luciferase activity of the fusion protein. We previously reported that PCR products from Legionella pneumophila and Escherichia coli (E. coli) O157 genomic DNA were detected by Zif268, a natural ZF protein, fused to luciferase. In this study, Zif268-luciferase was applied to detect the presence of Salmonella and coliforms. Moreover, an artificial zinc finger protein (B2) fused to luciferase was constructed for a Norovirus detection system. In the luciferase activity detection assay, several bound/free separation process is required. Therefore, an analyzer that automatically performed the bound/free separation process was developed to detect PCR products using the ZF-luciferase fusion protein. By means of the automatic analyzer with ZF-luciferase fusion protein, target pathogenic genomes were specifically detected in the presence of other pathogenic genomes. Moreover, we succeeded in the detection of 10 copies of E. coli BL21 without extraction of genomic DNA by the automatic analyzer and E. coli was detected with a logarithmic dependency in the range of 1.0×10 to 1.0×10(6) copies.

  11. Genotyping of Pseudomonas aeruginosa Type III Secretion System Using Magnetic Enrichment Multiplex Polymerase Chain Reaction and Chemiluminescence.

    PubMed

    Tang, Yongjun; Li, Bo; Dai, Jianguo; Dai, Jianfang; Wang, Xinhui; Si, Jing; Ali, Zeeshan; Li, Taotao; He, Nongyue

    2016-04-01

    The pathologic characteristics and toxicity mechanism of Pseudomonas aeruginosa are different in strains with different Type III secretion system (T3SS) genes. The T3SS gene based genotyping of P. aeruginosa strains is important to understand its virulence and predict the clinical outcomes. In this study, a rapid and automatable method for T3SS genotyping was developed using magnetic enrichment multiplex PCR and chemiluminescence. Three P. aeruginosa standard strains were analyzed using this method. The results showed that the chemiluminescent intensity of exoT, exoY, and exoS of these strains were 10 times greater than that of the control, and that their Q values were greater than 2.1. These results were consistent with the regular PCR and electrophoresis results, indicating that the method was reliable. Out of the 22 clinical isolates tested using this method, 100%, 72.7%, 95.5%, and 4.5% of the isolates contained exoT, exoY, exoS, and exoU genes, respectively. The isolates harbored either exoS or exoU gene, but not both. All genotyping results of the isolates were consistent with the information obtained using regular PCR and electrophoresis. PMID:27301202

  12. [Preparation and detection of anti-influenza A virus polymerase basic protein 1 polyclonal antibody].

    PubMed

    Qin, Yujie; Zhang, Tinghong; Ye, Xin

    2016-01-01

    Influenza A virus is an enveloped virus that belongs to the Orthomyxoviridae family. It has 8 negative RNA segments that encode 16 viral proteins. The viral polymerase consists of 3 proteins (PB 1, PB2 and PA) which plays an important role in the transcription and replication of the influenza A virus. Polymerase basic protein 1 (PB 1) is a critical member of viral polymerase complex. In order to further study the function of PB1, we need to prepare the PB1 antibody with good quality. Therefore, we amplified PB1 conserved region (nt1648-2265) by PCR and cloned it into pET-30a vector, and transformed into Escherichia coli BL2 1. The expression of His tagged PB 1 protein was induced by IPTG, and His-PB 1 proteins were purified by Ni-NTA resin. For preparation of PB 1 protein antiserum, rabbits were immunized with His-PB 1 fusion protein 3 times. Then the titer of PB 1 polyclonal antibody was measured by indirect ELISA. The antibody was purified by membrane affinity purification and subjected to immunoblotting analysis. Data showed that PB1 antibody can recognize PB 1 protein from WSN virus infected or pCMV FLAG-PB 1 transfected cells. Meanwhile, PB 1 antibody can also recognize specifically other subtype strains of influenza A virus such as H9N2 and H3N2. PB 1 polyclonal antibody we generated will be a useful tool to study the biological function of PB1. PMID:27363203

  13. Detection of cashew nut DNA in spiked baked goods using a real-time polymerase chain reaction method.

    PubMed

    Brzezinski, Jennifer L

    2006-01-01

    The detection of potentially allergenic foods, such as tree nuts, in food products is a major concern for the food processing industry. A real-time polymerase chain reaction (PCR) method was designed to determine the presence of cashew DNA in food products. The PCR amplifies a 67 bp fragment of the cashew 2S albumin gene, which is detected with a cashew-specific, dual-labeled TaqMan probe. This reaction will not amplify DNA derived from other tree nut species, such as almond, Brazil nut, hazelnut, and walnut, as well as 4 varieties of peanut. This assay was sensitive enough to detect 5 pg purified cashew DNA as well as cashew DNA in a spiked chocolate cookie sample containing 0.01% (100 mg/kg) cashew.

  14. Detection of Listeria monocytogenes in ready-to-eat food by Step One real-time polymerase chain reaction.

    PubMed

    Pochop, Jaroslav; Kačániová, Miroslava; Hleba, Lukáš; Lopasovský, L'ubomír; Bobková, Alica; Zeleňáková, Lucia; Stričík, Michal

    2012-01-01

    The aim of this study was to follow contamination of ready-to-eat food with Listeria monocytogenes by using the Step One real time polymerase chain reaction (PCR). We used the PrepSEQ Rapid Spin Sample Preparation Kit for isolation of DNA and MicroSEQ® Listeria monocytogenes Detection Kit for the real-time PCR performance. In 30 samples of ready-to-eat milk and meat products without incubation we detected strains of Listeria monocytogenes in five samples (swabs). Internal positive control (IPC) was positive in all samples. Our results indicated that the real-time PCR assay developed in this study could sensitively detect Listeria monocytogenes in ready-to-eat food without incubation.

  15. Multiplex polymerase chain reaction assay for the detection of minute virus of mice and mouse parvovirus infections in laboratory mice.

    PubMed

    Wang, K W; Chueh, L L; Wang, M H; Huang, Y T; Fang, B H; Chang, C Y; Fang, M C; Chou, J Y; Hsieh, S C; Wan, C H

    2013-04-01

    Mouse parvoviruses are among the most prevalent infectious pathogens in contemporary mouse colonies. To improve the efficiency of routine screening for mouse parvovirus infections, a multiplex polymerase chain reaction (PCR) assay targeting the VP gene was developed. The assay detected minute virus of mice (MVM), mouse parvovirus (MPV) and a mouse housekeeping gene (α-actin) and was able to specifically detect MVM and MPV at levels as low as 50 copies. Co-infection with the two viruses with up to 200-fold differences in viral concentrations can easily be detected. The multiplex PCR assay developed here could be a useful tool for monitoring mouse health and the viral contamination of biological materials.

  16. Comparison of culture with the polymerase chain reaction for detection of Ureaplasma urealyticum in endotracheal aspirates of preterm infants.

    PubMed

    Cunliffe, N A; Fergusson, S; Davidson, F; Lyon, A; Ross, P W

    1996-07-01

    Polymerase chain reaction (PCR) amplification of the urease genes of Ureaplasma urealyticum was compared with culture for detection of the organism in 100 endotracheal aspirates from 54 ventilated preterm infants. Ninety specimens gave negative results by both culture and PCR and three specimens gave positive results by both culture and PCR. Six specimens were negative by culture but positive by PCR. The one specimen positive by culture and negative by PCR was interpreted as a false-positive culture result. Overall agreement between results obtained by culture and PCR was 93%. PCR is a sensitive and reliable method for the detection of U. urealyticum in neonatal endotracheal secretions. Detection by PCR (1-2 days) is more rapid than culture (2-5 days) and this will be important if early therapeutic intervention is shown to be effective.

  17. Rapid detection of infectious hypodermal and hematopoietic necrosis virus (IHHNV) by real-time, isothermal recombinase polymerase amplification assay.

    PubMed

    Xia, Xiaoming; Yu, Yongxin; Hu, Linghao; Weidmann, Manfred; Pan, Yingjie; Yan, Shuling; Wang, Yongjie

    2015-04-01

    Infectious hypodermal and hematopoietic necrosis virus (IHHNV) causes mortality or runt deformity syndrome in penaeid shrimps and is responsible for significant economic losses in the shrimp aquaculture industry. Here, we describe a novel real-time isothermal recombinase polymerase amplification (RPA) assay developed for IHHNV detection. Using IHHNV plasmid standards and DNA samples from a variety of organisms, we evaluated the ability of the IHHNV-RPA assay to detect IHHNV based on analysis of its sensitivity, specificity, rapidity, and reproducibility. Probit analysis of eight independent experimental replicates indicated satisfactory performance of the RPA assay, which is sufficiently sensitive to detect as few as 4 copies of the IHHNV genome within 7 min at 39 °C with 95 % reliability. Therefore, this rapid RPA method has great potential for applications, either in field use or as a point of care diagnostic technique.

  18. Real-Time Polymerase Chain Reaction Detection of Angiostrongylus cantonensis DNA in Cerebrospinal Fluid from Patients with Eosinophilic Meningitis.

    PubMed

    Qvarnstrom, Yvonne; Xayavong, Maniphet; da Silva, Ana Cristina Aramburu; Park, Sarah Y; Whelen, A Christian; Calimlim, Precilia S; Sciulli, Rebecca H; Honda, Stacey A A; Higa, Karen; Kitsutani, Paul; Chea, Nora; Heng, Seng; Johnson, Stuart; Graeff-Teixeira, Carlos; Fox, LeAnne M; da Silva, Alexandre J

    2016-01-01

    Angiostrongylus cantonensis is the most common infectious cause of eosinophilic meningitis. Timely diagnosis of these infections is difficult, partly because reliable laboratory diagnostic methods are unavailable. The aim of this study was to evaluate the usefulness of a real-time polymerase chain reaction (PCR) assay for the detection of A. cantonensis DNA in human cerebrospinal fluid (CSF) specimens. A total of 49 CSF specimens from 33 patients with eosinophilic meningitis were included: A. cantonensis DNA was detected in 32 CSF specimens, from 22 patients. Four patients had intermittently positive and negative real-time PCR results on subsequent samples, indicating that the level of A. cantonensis DNA present in CSF may fluctuate during the course of the illness. Immunodiagnosis and/or supplemental PCR testing supported the real-time PCR findings for 30 patients. On the basis of these observations, this real-time PCR assay can be useful to detect A. cantonensis in the CSF from patients with eosinophilic meningitis.

  19. Structural Basis for Recognition and Sequestration of UUUOH 3 ' Temini of Nascent RNA Polymerase III Transcripts by La, a Rheumatic Disease Autoantigen

    SciTech Connect

    Teplova,M.; Yuan, Y.; Phan, A.; Malinina, L.; Ilin, S.; Teplov, A.; Patel, D.

    2006-01-01

    The nuclear phosphoprotein La was identified as an autoantigen in patients with systemic lupus erythematosus and Sjogren's syndrome. La binds to and protects the UUUOH 3' terminii of nascent RNA polymerase III transcripts from exonuclease digestion. We report the 1.85 Angstroms crystal structure of the N-terminal domain of human La, consisting of La and RRM1 motifs, bound to r(U1-G2-C3-U4-G5-U6-U7-U8-U9OH). The U7-U8-U9OH 3' end, in a splayed-apart orientation, is sequestered within a basic and aromatic amino acid-lined cleft between the La and RRM1 motifs. The specificity-determining U8 residue bridges both motifs, in part through unprecedented targeting of the {beta} sheet edge, rather than the anticipated face, of the RRM1 motif. Our structural observations, supported by mutation studies of both La and RNA components, illustrate the principles behind RNA sequestration by a rheumatic disease autoantigen, whereby the UUUOH 3' ends of nascent RNA transcripts are protected during downstream processing and maturation events.

  20. Structural Basis for Recognition and Sequestration of UUUOH 3′ Temini of Nascent RNA Polymerase III Transcripts by La, a Rheumatic Disease Autoantigen

    PubMed Central

    Teplova, Marianna; Yuan, Yu-Ren; Phan, Anh Tuân; Malinina, Lucy; Ilin, Serge; Teplov, Alexei; Patel, Dinshaw J.

    2015-01-01

    Summary The nuclear phosphoprotein La was identified as an autoantigen in patients with systemic lupus erythematosus and Sjogren’s syndrome. La binds to and protects the UUUOH 3′ terminii of nascent RNA polymerase III transcripts from exonuclease digestion. We report the 1.85 Å crystal structure of the N-terminal domain of human La, consisting of La and RRM1 motifs,bound to r(U1-G2-C3-U4-G5-U6-U7-U8-U9OH).The U7-U8-U9OH 3′ end, in a splayed-apart orientation, is sequestered within a basic and aromatic amino acid-lined cleft between the La and RRM1 motifs. The specificity-determining U8 residue bridges both motifs, in part through unprecedented targeting of the β sheet edge, rather than the anticipated face, of the RRM1 motif. Our structural observations, supported by mutation studies of both La and RNA components, illustrate the principles behind RNA sequestration by a rheumatic disease autoantigen, whereby the UUUOH 3′ ends of nascent RNA transcripts are protected during downstream processing and maturation events. PMID:16387655

  1. Polymerase Chain Reaction (PCR) Versus Bacterial Culture in Detection of Organisms in Otitis Media with Effusion (OME) in Children.

    PubMed

    Aly, Balegh H; Hamad, Mostafa S; Mohey, Mervat; Amen, Sameh

    2012-03-01

    The aim of this study was to compare between polymerase chain reaction (PCR) and bacterial culture in detection of Streptococcus Pneumonia and M. Catarrhalis in otitis media with effusion (OME) in children. Fifty patients having OME were included in this study between 2003 and 2008. Myringotomy and tympanostomy tube insertion were done in every patient and the middle ear effusion samples were aspirated. The samples were subjected to bacteriological study in the form of culture and molecular study in the form of PCR using JM201/202-204 primer probe set for both S. pneumonia and M. catarrhalis. The results of Bacterial cultures are as follows: five cases (10%) were culture positive for S. pneumonia. Six cases (12%) were culture positive for M. catarrhalis. Only one case (2%) showed positively for both S. pneumonia and M. catarrhalis. Polymerase chain reaction test shows that 18 cases (36%) were positive for S. pneumonia, 22 cases (44%) were positive for M. catarrhalis, 6 cases (12%) were positive for both organism and 4 cases (8%) were negative. The difference between the proportion of culture positive and PCR positive specimens for both organisms individually and collectively was significant (P < 0.001). From our study we can conclude that PCR is more accurate than bacterial culture in detection of organisms in middle ear fluid in OME and that M. catarrhalis plays a significant rule in OME as it is the sole organism identified more than the other one by PCR.

  2. Segmented continuous-flow multiplex polymerase chain reaction microfluidics for high-throughput and rapid foodborne pathogen detection.

    PubMed

    Shu, Bowen; Zhang, Chunsun; Xing, Da

    2014-05-15

    High-throughput and rapid identification of multiple foodborne bacterial pathogens is vital in global public health and food industry. To fulfill this need, we propose a segmented continuous-flow multiplex polymerase chain reaction (SCF-MPCR) on a spiral-channel microfluidic device. The device consists of a disposable polytetrafluoroethylene (PTFE) capillary microchannel coiled on three isothermal blocks. Within the channel, n segmented flow regimes are sequentially generated, and m-plex PCR is individually performed in each regime when each mixture is driven to pass three temperature zones, thus providing a rapid analysis throughput of m×n. To characterize the performance of the microfluidic device, continuous-flow multiplex PCR in a single segmented flow has been evaluated by investigating the effect of key reaction parameters, including annealing temperatures, flow rates, polymerase concentration and amount of input DNA. With the optimized parameters, the genomic DNAs from Salmonella enterica, Listeria monocytogenes, Escherichia coli O157:H7 and Staphylococcus aureus could be amplified simultaneously in 19min, and the limit of detection was low, down to 10(2) copiesμL(-1). As proof of principle, the spiral-channel SCF-MPCR was applied to sequentially amplify four different bacterial pathogens from banana, milk, and sausage, displaying a throughput of 4×3 with no detectable cross-contamination.

  3. Segmented continuous-flow multiplex polymerase chain reaction microfluidics for high-throughput and rapid foodborne pathogen detection.

    PubMed

    Shu, Bowen; Zhang, Chunsun; Xing, Da

    2014-05-15

    High-throughput and rapid identification of multiple foodborne bacterial pathogens is vital in global public health and food industry. To fulfill this need, we propose a segmented continuous-flow multiplex polymerase chain reaction (SCF-MPCR) on a spiral-channel microfluidic device. The device consists of a disposable polytetrafluoroethylene (PTFE) capillary microchannel coiled on three isothermal blocks. Within the channel, n segmented flow regimes are sequentially generated, and m-plex PCR is individually performed in each regime when each mixture is driven to pass three temperature zones, thus providing a rapid analysis throughput of m×n. To characterize the performance of the microfluidic device, continuous-flow multiplex PCR in a single segmented flow has been evaluated by investigating the effect of key reaction parameters, including annealing temperatures, flow rates, polymerase concentration and amount of input DNA. With the optimized parameters, the genomic DNAs from Salmonella enterica, Listeria monocytogenes, Escherichia coli O157:H7 and Staphylococcus aureus could be amplified simultaneously in 19min, and the limit of detection was low, down to 10(2) copiesμL(-1). As proof of principle, the spiral-channel SCF-MPCR was applied to sequentially amplify four different bacterial pathogens from banana, milk, and sausage, displaying a throughput of 4×3 with no detectable cross-contamination. PMID:24793853

  4. N-butylamine functionalized graphene oxide for detection of iron(III) by photoluminescence quenching.

    PubMed

    Gholami, Javad; Manteghian, Mehrdad; Badiei, Alireza; Ueda, Hiroshi; Javanbakht, Mehran

    2016-02-01

    An N-butylamine functionalized graphene oxide nanolayer was synthesized and characterized by ultraviolet (UV)-visible spectrometry, Fourier transform infrared spectroscopy, X-ray photoelectron spectroscopy, and transmission electron microscopy. Detection of iron(III) based on photoluminescence spectroscopy was investigated. The N-butylamine functionalized graphene oxide was shown to specifically interact with iron (III), compared with other cationic trace elements including potassium (I), sodium (I), calcium (II), chromium (III), zinc (II), cobalt (II), copper (II), magnesium (II), manganese (II), and molybdenum (VI). The quenching effect of iron (III) on the luminescence emission of N-butylamine functionalized graphene oxide layer was used to detect iron (III). The limit of detection (2.8 × 10(-6)  M) and limit of quantitation (2.9 × 10(-5)  M) were obtained under optimal conditions.

  5. N-butylamine functionalized graphene oxide for detection of iron(III) by photoluminescence quenching.

    PubMed

    Gholami, Javad; Manteghian, Mehrdad; Badiei, Alireza; Ueda, Hiroshi; Javanbakht, Mehran

    2016-02-01

    An N-butylamine functionalized graphene oxide nanolayer was synthesized and characterized by ultraviolet (UV)-visible spectrometry, Fourier transform infrared spectroscopy, X-ray photoelectron spectroscopy, and transmission electron microscopy. Detection of iron(III) based on photoluminescence spectroscopy was investigated. The N-butylamine functionalized graphene oxide was shown to specifically interact with iron (III), compared with other cationic trace elements including potassium (I), sodium (I), calcium (II), chromium (III), zinc (II), cobalt (II), copper (II), magnesium (II), manganese (II), and molybdenum (VI). The quenching effect of iron (III) on the luminescence emission of N-butylamine functionalized graphene oxide layer was used to detect iron (III). The limit of detection (2.8 × 10(-6)  M) and limit of quantitation (2.9 × 10(-5)  M) were obtained under optimal conditions. PMID:26016610

  6. An electrochemical peptide cleavage-based biosensor for matrix metalloproteinase-2 detection with exonuclease III-assisted cycling signal amplification.

    PubMed

    Wang, Ding; Yuan, Yali; Zheng, Yingning; Chai, Yaqin; Yuan, Ruo

    2016-05-01

    In this work, an electrochemical peptide biosensor was developed for matrix metalloproteinase-2 (MMP-2) detection by conversion of a peptide cleavage event into DNA detection with exonuclease III (Exo III)-assisted cycling signal amplification.

  7. Real-time reverse-transcriptase polymerase chain reaction for the rapid detection of Salmonella using invA primers.

    PubMed

    D'Souza, Doris H; Critzer, Faith J; Golden, David A

    2009-11-01

    Recent outbreaks of Salmonella linked to fresh produce emphasize the need for rapid detection methods to help control the spread of disease. Reverse-transcriptase polymerase chain reaction (RT-PCR) can detect the presence of mRNA (shorter half-life than DNA) with greater potential for detecting viable pathogens. The chromosomally located invA gene required for host invasion by Salmonella is widely used for detection of this pathogen by PCR. Detection of Salmonella was undertaken by real-time RT-PCR (rt-RT-PCR) using newly designed invA gene primers to develop a sensitive and specific assay. Salmonella serovars Typhimurium and Enteritidis were grown (7.68 log(10) CFU/mL) in Luria-Bertani broth overnight at 37 degrees C, and RNA was extracted, followed by rt-RT-PCR with and without SYBR green I and agarose gel electrophoresis. All experiments were replicated at least thrice. Detection for both serovars using traditional RT-PCR was lower ( approximately 10(5) CFU/mL) than rt-RT-PCR (10(3) CFU/mL) by gel electrophoresis. Melt curve analysis showed melt temperatures at 87.5 degrees C with Ct values from 12 to 15 for up to 10(3) CFU/mL and improved to 10(2) CFU/mL after further optimization. Further, addition of RNA internal amplification control constructed using in vitro transcription with a T7 RNA polymerase promoter, to the RT-PCR assay also gave detection limits of 10(2) CFU/mL. Cross-reactivity was not observed against a panel of 21 non-Salmonella bacteria. Heat-inactivated (autoclaved) Salmonella showed faint or no detection by rt-RT-PCR or gel electrophoresis. This method has potential to be applied for the detection of Salmonella serovars in fresh produce and the simultaneous detection of foodborne viral (RNA viruses) and bacterial pathogens in a multiplex format.

  8. Detection of human astrovirus serotype 1 by the polymerase chain reaction.

    PubMed

    Jonassen, T O; Kjeldsberg, E; Grinde, B

    1993-09-01

    Astroviruses are small, plus-strand RNA viruses associated with diarrhoea, mostly in children. The diagnostic method commonly used is electron microscopy. We have designed a nested polymerase chain reaction (PCR) based on the recently reported nucleotide sequence of the 3' end of the genome of a human astrovirus serotype 1, the most common form. The PCR was positive for the ten serotype 1 samples tested, while being negative for all other viruses tested, including astrovirus type 2, 3, 4 and 5, calicivirus, rotavirus and picornaviruses. Fecal extracts from patients with diarrhoea were analysed directly or after isolation of RNA, the former method being at least as sensitive. Titration of fecal extracts by PCR indicated the presence of up to 10(11) viral particles per ml in feces.

  9. Detection of BCR-ABL using one step reverse transcriptase- polymerase chain reaction and microchip electrophoresis.

    PubMed

    Lin, Xuexia; Wu, Jing; Liu, Wu; Li, Haifang; Wang, Zhihua; Lin, Jin-Ming

    2013-12-15

    One-step reverse transcriptase polymerase chain reaction (RT-PCR) coupled with microchip electrophoresis (MCE) was established to analyze BCR-ABL fusion gene. The use of one-step RT-PCR could simplify the RT-PCR procedure and thus reduced the risk of contamination and sample consumption. This method also enhanced the sensitivity for amplified target DNA and dramatically shorted the analysis time. Moreover, this assay can simultaneously identify b2a2 and b3a2. Orthogonal array design, which can investigated mutual effects of PCR parameters, was used to optimize the reaction system. This approach was highly effective, reproducible and sensitive, and would be suitable for the determination of BCR-ABL in clinic diagnosis.

  10. Detection of flaviviruses by reverse transcriptase-polymerase chain reaction with the universal primer set.

    PubMed

    Meiyu, F; Huosheng, C; Cuihua, C; Xiaodong, T; Lianhua, J; Yifei, P; Weijun, C; Huiyu, G

    1997-01-01

    Using a universal primer set designed to match the sequence of the NS1 gene of flaviviruses, the virus RNA of dengue (DEN), Japanese encephalitis (JEV), powassan and langat of Flaviviridae were successfully amplified by polymerase chain reaction (PCR) via cDNA; and with different internal primers, the serotypes of the dengue viruses were identified. Of the 78 clinically diagnosed dengue fever patients, 18 patients were positive for DEN 1, 48 patients for DEN 2 and 8 patients concurrently infected with DEN 4. Of the 52 patients admitted with Japanese encephalitis (JE), 45 were determined to be JEV infections. By nested PCR, we completed the identification of flaviviruses within 2 days. The results show that seven primers have a potential value for rapid clinical diagnosis of flavivirus infections.

  11. The occurrence of antibiotic resistance genes in Taq polymerases and a decontamination method applied to the detection of genetically modified crops.

    PubMed

    Perron, André; Raymond, Philippe; Simard, Robin

    2006-03-01

    Different antibiotic resistance (AR) genes, such as Bla, Tet and NPTII, contaminate commercially available Taq polymerases. The specificity of the AR gene PCR can be increased when using a restriction enzyme-based decontamination of polymerase. The elimination of Taq polymerase contamination allows the use of PCR tests to screen seeds (corn) and processed food for the presence of genetically modified organisms (GMO) based on the detection of AR genes. Without a decontamination procedure for AR genes, PCR screening tests should be interpreted with caution. PMID:16614919

  12. The occurrence of antibiotic resistance genes in Taq polymerases and a decontamination method applied to the detection of genetically modified crops.

    PubMed

    Perron, André; Raymond, Philippe; Simard, Robin

    2006-03-01

    Different antibiotic resistance (AR) genes, such as Bla, Tet and NPTII, contaminate commercially available Taq polymerases. The specificity of the AR gene PCR can be increased when using a restriction enzyme-based decontamination of polymerase. The elimination of Taq polymerase contamination allows the use of PCR tests to screen seeds (corn) and processed food for the presence of genetically modified organisms (GMO) based on the detection of AR genes. Without a decontamination procedure for AR genes, PCR screening tests should be interpreted with caution.

  13. One-step multiplex reverse transcription-polymerase chain reaction for the simultaneous detection of three rice viruses.

    PubMed

    Cho, Sang-Yun; Jeong, Rae-Dong; Yoon, Young-Nam; Lee, Su-Heon; Shin, Dong Bum; Kang, Hang-Won; Lee, Bong Choon

    2013-11-01

    Rice stripe virus (RSV), Rice black-streaked dwarf virus (RBSDV), and Rice dwarf virus (RDV) are major rice-infecting viruses in Korea that can cause serious crop losses. A one-step multiplex reverse transcription-polymerase chain reaction (mRT-PCR) was developed for the simultaneous detection of these rice viruses. Three sets of specific primers targeted to the capsid protein coding genes of RSV, RBSDV, and RDV were used to amplify fragments that were 703 bp, 485 bp, and 252 bp, respectively. The one-step mRT-PCR assay proved to be a sensitive and rapid method for detecting the three rice viruses. This method could be used to facilitate better control of rice viruses.

  14. Detection of parvalbumin, a common fish allergen gene in food, by real-time polymerase chain reaction.

    PubMed

    Sun, Min; Liang, Chengzhu; Gao, Hongwei; Lin, Chao; Deng, Mingjun

    2009-01-01

    Fish, as one of the most common causes of IgE-mediated food hypersensitivity, has recently received increasing attention from the food industry and legislative and regulatory agencies. A real-time polymerase chain reaction assay based on TaqMan-MGB probe technology was developed for the detection of parvalbumin, a major fish allergen gene. The assay had a sensitivity up to 5 pg purified fish DNA and had no cross-reaction with other species, such as cattle, sheep, swine, chicken, shrimp, lobster, crab, squid, clam, rice, soybean, maize, and potato. The coefficient of variation for both intra- and interexperimental variability demonstrated high reproducibility and accuracy. The assay proved to be a potential tool for the detection and label management of fish allergens in food.

  15. Clinical validation of a real-time polymerase chain reaction assay for rapid detection of Acinetobacter baumannii colonization.

    PubMed

    Blanco-Lobo, P; González-Galán, V; García-Quintanilla, M; Valencia, R; Cazalla, A; Martín, C; Alonso, I; Pérez-Romero, P; Cisneros, J M; Aznar, J; McConnell, M J

    2016-09-01

    Real-time polymerase chain reaction (PCR)-based approaches have not been assessed in terms of their ability to detect patients colonized by Acinetobacter baumannii during active surveillance. This prospective, double-blind study demonstrated that a real-time PCR assay had high sensitivity (100%) and specificity (91.2%) compared with conventional culture for detecting A. baumannii in 397 active surveillance samples, and provided results within 3h. Receiver-operator curve analyses demonstrated that the technique has diagnostic accuracy of 97.7% (95% confidence interval 96.0-99.3%). This method could facilitate the rapid implementation of infection control measures for preventing the transmission of A. baumannii. PMID:27206968

  16. Construction of an electrode modified with gallium(III) for voltammetric detection of ovalbumin.

    PubMed

    Sugawara, Kazuharu; Okusawa, Makoto; Takano, Yusaku; Kadoya, Toshihiko

    2014-01-01

    Electrodes modified with gallium(III) complexes were constructed to detect ovalbumin (OVA). For immobilization of a gallium(III)-nitrilotriacetate (NTA) complex, the electrode was first covered with collagen film. After the amino groups of the film had reacted with isothiocyanobenzyl-NTA, the gallium(III) was then able to combine with the NTA moieties. Another design featured an electrode cast with a gallium(III)-acetylacetonate (AA) complex. The amount of gallium(III) in the NTA complex was equivalent to one-quarter of the gallium(III) that could be utilized from an AA complex. However, the calibration curves of OVA using gallium(III)-NTA and gallium(III)-AA complexes were linear in the ranges of 7.0 × 10(-11) - 3.0 × 10(-9) M and 5.0 × 10(-10) - 8.0 × 10(-9) M, respectively. The gallium(III) on the electrode with NTA complex had high flexibility due to the existence of a spacer between the NTA and the collagen film, and, therefore, the reactivity of the gallium(III) to OVA was superior to that of the gallium(III)-AA complex with no spacer.

  17. Viral detection using a multiplex polymerase chain reaction-based assay in outpatients with upper respiratory infection.

    PubMed

    Leekha, Surbhi; Irish, Cole L; Schneider, Susan K; Fernholz, Emily C; Espy, Mark J; Cunningham, Scott A; Patel, Robin; Juhn, Young J; Pritt, Bobbi; Smith, Thomas F; Sampathkumar, Priya

    2013-02-01

    We evaluated a commercial multiplex polymerase chain reaction (PCR) assay in a cross-sectional study among 81 adult and pediatric outpatients-40 cases with upper respiratory infection symptoms and 41 asymptomatic controls-from February to April 2008. Two specimens (throat swab and nasal swab) from each participant were tested using the EraGen MultiCode-PLx Respiratory Virus Panel that detects 17 viral targets. Throat swabs were also tested for Group A Streptococcus (GAS) by PCR. Respiratory viruses were detected in 22/40 (55%) cases and in 3/41 (7%) controls (P < 0.001). GAS was detected in 10 (25%) cases; GAS and respiratory virus co-infection was found in 4 (10%). Agreement between nasal and throat swabs for viral detection was 69% in cases and 95% in controls. Of 22 cases with a detectable virus, 12 (54%) were picked up by only 1 (throat or nasal) specimen, and the detection rate was increased by combining results of nasal and throat swab testing. PMID:23182565

  18. Molecular Detection of Methicillin-Resistant Staphylococcus aureus by Non-Protein Coding RNA-Mediated Monoplex Polymerase Chain Reaction

    PubMed Central

    Soo Yean, Cheryl Yeap; Selva Raju, Kishanraj; Xavier, Rathinam; Subramaniam, Sreeramanan; Gopinath, Subash C. B.; Chinni, Suresh V.

    2016-01-01

    Non-protein coding RNA (npcRNA) is a functional RNA molecule that is not translated into a protein. Bacterial npcRNAs are structurally diversified molecules, typically 50–200 nucleotides in length. They play a crucial physiological role in cellular networking, including stress responses, replication and bacterial virulence. In this study, by using an identified npcRNA gene (Sau-02) in Methicillin-resistant Staphylococcus aureus (MRSA), we identified the Gram-positive bacteria S. aureus. A Sau-02-mediated monoplex Polymerase Chain Reaction (PCR) assay was designed that displayed high sensitivity and specificity. Fourteen different bacteria and 18 S. aureus strains were tested, and the results showed that the Sau-02 gene is specific to S. aureus. The detection limit was tested against genomic DNA from MRSA and was found to be ~10 genome copies. Further, the detection was extended to whole-cell MRSA detection, and we reached the detection limit with two bacteria. The monoplex PCR assay demonstrated in this study is a novel detection method that can replicate other npcRNA-mediated detection assays. PMID:27367909

  19. DNA polymerase profiling.

    PubMed

    Summerer, Daniel

    2008-01-01

    We report a simple homogeneous fluorescence assay for quantification of DNA polymerase function in high throughput. The fluorescence signal is generated by the DNA polymerase triggering opening of a molecular beacon extension of the template strand. A resulting distance alteration is reported by fluorescence resonance energy transfer between two dyes introduced into the molecular beacon stem. We describe real-time reaction profiling of two model DNA polymerases. We demonstrate kinetic characterization, rapid optimization of reaction conditions, and inhibitor profiling using the presented assay. Furthermore, to supersede purification steps in screening procedures of DNA polymerase mutant libraries, detection of enzymatic activity in bacterial expression lysates is described.

  20. A Field-Deployable Reverse Transcription Recombinase Polymerase Amplification Assay for Rapid Detection of the Chikungunya Virus

    PubMed Central

    Faye, Oumar; Prüger, Pauline; Kaiser, Marco; Thaloengsok, Sasikanya; Ubol, Sukathida; Sakuntabhai, Anavaj; Leparc-Goffart, Isabelle; Hufert, Frank T.; Sall, Amadou A.; Weidmann, Manfred; Niedrig, Matthias

    2016-01-01

    Background Chikungunya virus (CHIKV) is a mosquito-borne virus currently transmitted in about 60 countries. CHIKV causes acute flu-like symptoms and in many cases prolonged musculoskeletal and joint pain. Detection of the infection is mostly done using RT-RCR or ELISA, which are not suitable for point-of-care diagnosis. Methodology/Principal Findings In this study, a reverse transcription recombinase polymerase amplification (RT-RPA) assay for the detection of the CHIKV was developed. The assay sensitivity, specificity, and cross-reactivity were tested. CHIKV RT-RPA assay detected down to 80 genome copies/reaction in a maximum of 15 minutes. It successfully identified 18 isolates representing the three CHIKV genotypes. No cross-reactivity was detected to other alphaviruses and arboviruses except O'nyong'nyong virus, which could be differentiated by a modified RPA primer pair. Seventy-eight samples were screened both by RT-RPA and real-time RT-PCR. The diagnostic sensitivity and specificity of the CHIKV RT-RPA assay were determined at 100%. Conclusions/Significance The developed RT-RPA assay represents a promising method for the molecular detection of CHIKV at point of need. PMID:27685649

  1. Detection of nonauthorized genetically modified organisms using differential quantitative polymerase chain reaction: application to 35S in maize.

    PubMed

    Cankar, Katarina; Chauvensy-Ancel, Valérie; Fortabat, Marie-Noelle; Gruden, Kristina; Kobilinsky, André; Zel, Jana; Bertheau, Yves

    2008-05-15

    Detection of nonauthorized genetically modified organisms (GMOs) has always presented an analytical challenge because the complete sequence data needed to detect them are generally unavailable although sequence similarity to known GMOs can be expected. A new approach, differential quantitative polymerase chain reaction (PCR), for detection of nonauthorized GMOs is presented here. This method is based on the presence of several common elements (e.g., promoter, genes of interest) in different GMOs. A statistical model was developed to study the difference between the number of molecules of such a common sequence and the number of molecules identifying the approved GMO (as determined by border-fragment-based PCR) and the donor organism of the common sequence. When this difference differs statistically from zero, the presence of a nonauthorized GMO can be inferred. The interest and scope of such an approach were tested on a case study of different proportions of genetically modified maize events, with the P35S promoter as the Cauliflower Mosaic Virus common sequence. The presence of a nonauthorized GMO was successfully detected in the mixtures analyzed and in the presence of (donor organism of P35S promoter). This method could be easily transposed to other common GMO sequences and other species and is applicable to other detection areas such as microbiology.

  2. Detection of nonauthorized genetically modified organisms using differential quantitative polymerase chain reaction: application to 35S in maize.

    PubMed

    Cankar, Katarina; Chauvensy-Ancel, Valérie; Fortabat, Marie-Noelle; Gruden, Kristina; Kobilinsky, André; Zel, Jana; Bertheau, Yves

    2008-05-15

    Detection of nonauthorized genetically modified organisms (GMOs) has always presented an analytical challenge because the complete sequence data needed to detect them are generally unavailable although sequence similarity to known GMOs can be expected. A new approach, differential quantitative polymerase chain reaction (PCR), for detection of nonauthorized GMOs is presented here. This method is based on the presence of several common elements (e.g., promoter, genes of interest) in different GMOs. A statistical model was developed to study the difference between the number of molecules of such a common sequence and the number of molecules identifying the approved GMO (as determined by border-fragment-based PCR) and the donor organism of the common sequence. When this difference differs statistically from zero, the presence of a nonauthorized GMO can be inferred. The interest and scope of such an approach were tested on a case study of different proportions of genetically modified maize events, with the P35S promoter as the Cauliflower Mosaic Virus common sequence. The presence of a nonauthorized GMO was successfully detected in the mixtures analyzed and in the presence of (donor organism of P35S promoter). This method could be easily transposed to other common GMO sequences and other species and is applicable to other detection areas such as microbiology. PMID:18346452

  3. [Adaptation of a sensitive DNA extraction method for detection of Entamoeba histolytica by real-time polymerase chain reaction].

    PubMed

    Pınar, Ahmet; Akyön, Yakut; Alp, Alpaslan; Ergüven, Sibel

    2010-07-01

    This study was aimed to adapt a sensitive DNA extraction protocol in stool samples for real-time polymerase chain reaction (PCR) detection of Entamoeba histolytica which causes important morbidity and mortality worldwide. Stool extraction is a problematic step and has direct effects on PCR sensitivity. In order to improve the sensitivity of E.histolytica detection by real-time PCR, "QIAamp DNA stool minikit (Qiagen, Germany)" was modified by adding an overnight incubation step with proteinase K and sodium dodecyl sulfate (SDS) in this study. Three different extraction methods [(1) original method, (2) cetyltrimethyl-ammonium bromide (CTAB) method, (3) modified method] were evaluated for effects on sensitivity in real-time quantitative PCR (Artus RealArt TM E.histolytica RG PCR Kit, Qiagen Diagnostics, Germany). For this purpose, several concentrations of standard E.histolytica DNA were spiked in parasite-free stool samples and three different extraction protocols were performed. Detection sensitivities of "QIAamp DNA stool minikit" was found 5000 copies/ml and of CTAB method was found 500 copies/ml. Detection sensitivity of the extraction was improved to 5 copies/mL by modified "QIAamp DNA stool minikit" protocol. Since detection sensitivities of nucleic acid extraction protocols from stool samples directly affect the sensitivity of PCR amplification, different extraction protocols for different microorganisms should be evaluated.

  4. Recombinase polymerase and enzyme-linked immunosorbent assay as a DNA amplification-detection strategy for food analysis.

    PubMed

    Santiago-Felipe, S; Tortajada-Genaro, L A; Puchades, R; Maquieira, A

    2014-02-01

    Polymerase chain reaction in conjunction with enzyme-linked immunosorbent assay (PCR-ELISA) is a well-established technique that provides a suitable rapid, sensitive, and selective method for a broad range of applications. However, the need for precise rapid temperature cycling of PCR is an important drawback that can be overcome by employing isothermal amplification reactions such as recombinase polymerase amplification (RPA). The RPA-ELISA combination is proposed for amplification at a low, constant temperature (40°C) in a short time (40 min), for the hybridisation of labelled products to specific 5'-biotinylated probes/streptavidin in coated microtiter plates at room temperature, and for detection by colorimetric immunoassay. RPA-ELISA was applied to screen common safety threats in foodstuffs, such as allergens (hazelnut, peanut, soybean, tomato, and maize), genetically modified organisms (P35S and TNOS), pathogenic bacteria (Salmonella sp. and Cronobacter sp.), and fungi (Fusarium sp.). Satisfactory sensitivity and reproducibility results were achieved for all the targets. The RPA-ELISA technique does away with thermocycling and provides a suitable sensitive, specific, and cost-effective method for routine applications, and proves particularly useful for resource-limited settings. PMID:24456598

  5. Detection of Escherichia coli Enteropathogens by Multiplex Polymerase Chain Reaction from Children's Diarrheal Stools in Two Caribbean–Colombian Cities

    PubMed Central

    Arzuza, Octavio; Urbina, Delfina; Bai, Jing; Guerra, Julio; Montes, Oscar; Puello, Marta; Mendoza, Ketty; Castro, Gregorio Y.

    2010-01-01

    Abstract Acute diarrheal disease is a leading cause of childhood morbidity and mortality in the developing world and Escherichia coli intestinal pathogens are important causative agents. Information on the epidemiology of E. coli intestinal pathogens and their association with diarrheal disease is limited because no diagnostic testing is available in countries with limited resources. To evaluate the prevalence of E. coli intestinal pathogens in a Caribbean–Colombian region, E. coli clinical isolates from children with diarrhea were analyzed by a recently reported two-reaction multiplex polymerase chain reaction (Gomez-Duarte et al., Diagn Microbiol Infect Dis 2009;63:1–9). The phylogenetic group from all E. coli isolates was also typed by a single-reaction multiplex polymerase chain reaction. We found that among 139 E. coli strains analyzed, 20 (14.4%) corresponded to E. coli diarrheagenic pathotypes. Enterotoxigenic, shiga-toxin–producing, enteroaggregative, diffuse adherent, and enteropathogenic E. coli pathotypes were detected, and most of them belonged to the phylogenetic groups A and B1, known to be associated with intestinal pathogens. This is the first report on the molecular characterization of E. coli diarrheogenic isolates in Colombia and the first report on the potential role of E. coli in childhood diarrhea in this geographic area. PMID:19839760

  6. Recombinase polymerase and enzyme-linked immunosorbent assay as a DNA amplification-detection strategy for food analysis.

    PubMed

    Santiago-Felipe, S; Tortajada-Genaro, L A; Puchades, R; Maquieira, A

    2014-02-01

    Polymerase chain reaction in conjunction with enzyme-linked immunosorbent assay (PCR-ELISA) is a well-established technique that provides a suitable rapid, sensitive, and selective method for a broad range of applications. However, the need for precise rapid temperature cycling of PCR is an important drawback that can be overcome by employing isothermal amplification reactions such as recombinase polymerase amplification (RPA). The RPA-ELISA combination is proposed for amplification at a low, constant temperature (40°C) in a short time (40 min), for the hybridisation of labelled products to specific 5'-biotinylated probes/streptavidin in coated microtiter plates at room temperature, and for detection by colorimetric immunoassay. RPA-ELISA was applied to screen common safety threats in foodstuffs, such as allergens (hazelnut, peanut, soybean, tomato, and maize), genetically modified organisms (P35S and TNOS), pathogenic bacteria (Salmonella sp. and Cronobacter sp.), and fungi (Fusarium sp.). Satisfactory sensitivity and reproducibility results were achieved for all the targets. The RPA-ELISA technique does away with thermocycling and provides a suitable sensitive, specific, and cost-effective method for routine applications, and proves particularly useful for resource-limited settings.

  7. Performance of transport and selective media for swine Bordetella bronchiseptica recovery and it comparison to polymerase chain reaction detection

    PubMed Central

    Coutinho, Tania Alen; Bernardi, Mari Lourdes; de Itapema Cardoso, Marisa Ribeiro; Borowski, Sandra Maria; Moreno, Andrea Micke; de Barcellos, David Emilio Santos Neves

    2009-01-01

    Three comparative assays were performed seeking to improve the sensitivity of the diagnosis of Bordetella bronchiseptica infection analyzing swine nasal swabs. An initial assay compared the recovery of B. bronchiseptica from swabs simultaneously inoculated with B. bronchiseptica and some interfering bacteria, immersed into three transport formulations (Amies with charcoal, trypticase soy broth and phosphate buffer according to Soerensen supplemented with 5% of bovine fetal serum) and submitted to different temperatures (10°C and 27°C) and periods of incubation (24, 72 and 120 hours). A subsequent assay compared three selective media (MacConkey agar, modified selective medium G20G and a ceftiofur medium) for their recovery capabilities from clinical specimens. One last assay compared the polymerase chain reaction to the three selective media. In the first assay, the recovery of B. bronchiseptica from transport systems was better at 27°C and the three formulations had good performances at this temperature, but the collection of qualitative and quantitative analysis indicated the advantage of Amies medium for nasal swabs transportation. The second assay indicated that MacConkey agar and modified G20G had similar results and were superior to the ceftiofur medium. In the final assay, polymerase chain reaction presented superior capability of B. bronchiseptica detection to culture procedures. PMID:24031390

  8. Rapid detection of S. mutans surface antigen I/II using a sensitive monoclonal anti-Ag I/II antibody by ELISA.

    PubMed

    Kim, Mi-Ah; Jeon, Hyun-Soon; Shin, Se-Young; Baik, Byeong-Ju; Yang, Yeon-Mi; Lee, Kyung-Yeol; Kim, Jae-Gon

    2013-10-01

    The cell-surface protein antigen I/II (Ag I/II) is expressed in oral streptococci, which are known as the causative agent of a number of diseases including dental caries, endocarditis, gingivitis, and periodontal disease. Consequently, monoclonal antibodies (MAb) capable of recognizing the streptococcal Ag I/II protein could be a useful tool for the diagnosis and cure of these diseases. In this study, a previously generated monoclonal anti-Ag I/II antibody, ckAg I/II, was used to detect a small amount of Streptococcus mutans (S. mutans) surface antigen Ag I/II. The ckAg I/II was proved to be very sensitive and able to detect as little as 1 ng of recombinant Ag I/II protein within 5 min and Ag I/II in saliva within 10 min, as well as native Ag I/II in 20 μL of culture supernatant by ELISA. These results suggest that ckAg I/II can be used as a fast and efficient diagnostic tool to detect Ag I/II. PMID:24111865

  9. Colorimetric detection of lagomorphs' calicivirus genomic sequences by polymerase chain reaction incorporating digoxigenin dUTP.

    PubMed

    Psikal, I; Smíd, B; Kubalíková, R; Valícek, L; Rodák, L; Kosinová, E

    1997-06-30

    A method of reverse transcription followed by polymerase chain reaction (RT-PCR) has been implemented for the demonstration of the rabbit haemorrhagic disease virus (RHDV) genome in organ suspensions, leukocytes and excretions of infected rabbits. RT-PCR has been tested with 10 RHDV strains isolated at various geographic sites and times using a pair of primers coming from the gene region coding for the capsid protein VP60. The same primers were effective in the amplification of 4 of 5 European brown hare syndrome (EBHS) virus isolates. Non-radioactive labelling of PCR products with digoxigenin during the amplification and a system of colorimetric assessment of hybridization reactions between a biotin-labelled RHDV capture probe and the chains of labelled amplicons (PCR ELISA) were used for specific analyses of nucleic acid synthesis. The sensitivity of the alternative procedure of analysis of the dig-labelled PCR products with PCR ELISA was two logs10 higher than that of conventional electrophoresis in agarose gel stained with ethidium bromide. The results of the hybridization reactions, carried out under various stringency conditions, have confirmed the presumption that the genomic similarity between the amplified and the probed areas of the capsid protein VP60 gene was not uniform within all the tested caliciviruses. A higher degree of heterogeneity was observed between the isolates of EBHSV and RHDV.

  10. Quantitative detection of Clostridium difficile in hospital environmental samples by real-time polymerase chain reaction.

    PubMed

    Mutters, R; Nonnenmacher, C; Susin, C; Albrecht, U; Kropatsch, R; Schumacher, S

    2009-01-01

    C. difficile-associated diarrhoea occurs commonly in hospitals and is a significant cause of morbidity and mortality. Hospital surfaces are often contaminated with nosocomial pathogens and may be responsible for cross-transmission, especially if hardy Gram-positive and spore-forming organisms are involved. The aim of this study was to quantify C. difficile in the hospital environment near C. difficile-positive and -negative patients using a quantitative real-time polymerase chain reaction. A total of 531 samples was collected from the clinical environment and classified into three groups according to patient and ward status for C. difficile. As expected, there were significantly higher counts of C. difficile on the floor and in the near environment of C. difficile patients. However, a significant correlation was found between C. difficile counts on the floor and on the hands of patients and healthcare workers (HCWs) in wards without evidence of C. difficile. This suggests that asymptomatic carriage among patients and HCWs can also contribute towards C. difficile transmission in hospitals. In conclusion, C. difficile can be transmitted via personal contact or via contaminated areas of the hospital environment.

  11. Use of polymerase chain reaction to detect Brucella abortus biovar 1 in infected goats.

    PubMed

    Leal-Klevezas, D S; Martínez-Vázquez, I O; García-Cantú, J; López-Merino, A; Martínez-Soriano, J P

    2000-07-01

    The polymerase chain reaction (PCR) was used to diagnose goat brucellosis and compare its sensitivity against some of the most commonly used serological and bacteriological techniques. Twenty two female and one male out of 300 clinically healthy, mixed-breed goats were randomly chosen from a ranch located at Marín, Nuevo León, Mexico. Milk and blood samples were taken from each animal and used to obtain both microbiological cultures and DNA of the pathogen, and sera was tested against Rose Bengal antigen (RBT). Results showed that 86% of the blood samples were positive on the PCR test, while 60% were positive on the serological test. The pathogen was isolated from only one blood culture. Sixty four percent of the milk samples were positive on PCR tests, but failed to yield bacteria in culture. Biochemical and PCR specific assay demonstrated that Brucella abortus biovar 1 was associated with the infection. This study demonstrates the higher sensitivity of PCR over RBT and blood culture and its potential towards a rapid identification of Brucella strains.

  12. Genotyping by multiplex polymerase chain reaction for detection of endemic hepatitis B virus transmission.

    PubMed Central

    Repp, R; Rhiel, S; Heermann, K H; Schaefer, S; Keller, C; Ndumbe, P; Lampert, F; Gerlich, W H

    1993-01-01

    A nested polymerase chain reaction (PCR) protocol was developed for rapid genotyping of hepatitis B virus (HBV). During the first PCR round, a universal HBV primer pair was used to amplify the entire pre-S region of the HBV genome. Within the pre-S region, many nucleotide exchanges are observed. These are partly correlated to the serological hepatitis B surface antigen subtypes. Five additional subtype-specific primers were selected from that region which, together with two universal non-group-specific primers, generated specific combinations of two to four DNA fragments of defined sizes. By this approach, 55 hepatitis B surface antigen-positive patients from a pediatric oncology unit in Germany were analyzed. Fifty-four patients who had been infected within 2 years had an identical pattern in the multiplex PCR, suggesting a common source of infection and person-to-person transmission within the unit. One child who was infected 5 years later had a different PCR pattern and, therefore, must have been infected from a different source. Furthermore, 109 serum samples taken from pregnant Cameroonian women and 25 serum samples from their babies taken 6 months after birth were analyzed. In one case, mother-to-infant transmission of the virus was demonstrated. Apart from its role in epidemiological studies on HBV, multiplex PCR may also be a useful tool for rapid genetic analysis in other fields if there is a moderate degree of sequence variation which enables the design of specific primers. Images PMID:8501209

  13. Molecular probes and the polymerase chain reaction for detection and typing of Leishmania species in Mexico.

    PubMed

    Monroy-Ostria, Amalia; Sanchez-Tejeda, Gustavo

    2002-04-01

    Leishmaniasis in Mexico is a public health problem because all the clinical forms have been recorded in most Mexican states. We studied patients showing clinical symptoms of any form of leishmaniasis, from several endemic areas. Bone marrow samples, aspirates or skin biopsies were taken and deoxyribonucleic acid (DNA) was extracted and amplified by the polymerase chain reaction (PCR) with universal primers AJS1 and DeB8, specific for the Leishmania subgenus Leishmania. The PCR products were then hybridized by dot- or Southern blotting and probed with probe 9.2, specific for the L. mexicana complex. If hybridization did not occur, the DNA was amplified with primers D1 and D2, specific for members of the L. donovani complex, and PCR products were hybridized with probe B4Rsa, also specific for the L. donovani complex. DNA was also amplified with primers B1 and B2, specific for the subgenus Viannia, and the PCR products were hybridized with probe B18, specific for the L. braziliensis complex. It was found that in Tabasco and Veracruz, Mexico, localized cutaneous leishmaniasis (LCL) is caused by infection with members of the L. mexicana complex, whereas in the states of Nayarit and Campeche it was due to infection with the L. mexicana and/or L. braziliensis complexes. Visceral leishmaniasis was caused by L. (L.) chagasi, mainly in the states of Chiapas and Guerrero, and by L. (L.) mexicana in one immunocompromised patient from Tabasco.

  14. Rapid detection of sacbrood virus in honeybee using ultra-rapid real-time polymerase chain reaction.

    PubMed

    Yoo, Mi-Sun; Thi, Kim Cuc Nguyen; Van Nguyen, Phu; Han, Sang-Hoon; Kwon, Soon-Hwan; Yoon, Byoung-Su

    2012-01-01

    A real-time reverse transcription-polymerase chain reaction (qRT-PCR) assay was developed for the fast and highly sensitive detection of the sacbrood virus (SBV) genome and applied to honeybee samples. Using plasmid DNA containing a partial SBV genome and diluted serially, as few as 1×10(2)copies/μl (correlation co-efficiency >0.99) were detected by the qRT-PCR assay, whereas 1×10(3)copies/μl were detected by the conventional RT-PCR assay. As a rapid detection method, ultra-rapid real-time PCR (URRT-PCR) was carried out with a GenSpector TMC-1000 silicon-glass chip-based thermal cycler, which has a 6μl micro-chamber volume and a fast outstandingly heating/cooling rate. Using this method, 10(3)copies of pBX-SBV3.8 clone were detected within 17 min after 40 PCR cycles, including melting point analysis. To reduce the detection time for SBV, synthesis of the cDNA of the SBV genome from a honeybee sample was attempted for different reaction times and the cDNA was used as the template for URRT-PCR assays. The results indicated that a 5 min reaction time was sufficient to synthesize cDNA as the template for the SBV URRT-PCR assay. This study described a novel PCR-based method that is able to detect an RNA virus in environmental samples within 22 min, including reverse transcription, PCR detection and melting point analysis in real-time. PMID:22079620

  15. Improved method for preparation of samples for the polymerase chain reaction for detection of Coxiella burnetii in milk using immunomagnetic separation.

    PubMed

    Muramatsu, Y; Maruyama, M; Yanase, T; Ueno, H; Morita, C

    1996-07-01

    Immunomagnetic separation (IMS) improved the detection of Coxiella burnetii in cow's milk by the polymerase chain reaction (PCR). IMS represents a novel approach to the isolation of microorganism from milk. The combination of IMS and PCR analysis has an adequate sensitivity for detection of C. burnetii.

  16. Disposable biosensor for detection of iron (III) in wines.

    PubMed

    Cámara-Martos, Fernando; da Costa, João; Justino, Celine I L; Cardoso, Susana; Duarte, Armando C; Rocha-Santos, Teresa

    2016-07-01

    This paper reports the tuning of a fast, disposable, and label-free biosensor for quantification of iron (III) in food liquid samples such as wine. The biosensor is based on a field effect transistor(FET) where a net work of single-walled carbonnanotubes (SWCNTs) acts as the conductor channel, constituting carbonnanotubes field effect transistors (CNTFETs). An antibody such as transferrin with two specific high-affinity iron (III) binding sites, directly adsorbed to SWCNTs, was used as immunoreaction. Several individual CNTFETs were tested showing a linear range between 0.05 and 2ngmL(-1) and a limit of quantification below 0.05ngmL(-1), much lower than previously reported analytical techniques. The mean coefficient of variation was 0.13% showing a low variability of the analytical response. On the other hand, it was not observed interference effect of zinc (II) ion at least until 1:4 iron-zinc ratio. Finally, recovery percentages of spiked wine samples were around 100%, showing the high accuracy of method. The main advantages of the devices developed are their speed, convenience (it is an economical method), and the avoidance excessive handling samples since they do not require further pre-treatment of samples. PMID:27154651

  17. Development of a real-time reverse transcription polymerase chain reaction assay for detection of marine caliciviruses (genus Vesivirus).

    PubMed

    Reid, Scott M; King, Donald P; Shaw, Andrew E; Knowles, Nick J; Hutchings, Geoffrey H; Cooper, Emily J; Smith, Alvin W; Ferris, Nigel P

    2007-03-01

    Marine caliciviruses form a distinct lineage within the genus Vesivirus (family Caliciviridae). This group includes vesicular exanthema of swine virus (VESV) and San Miguel sea lion virus (SMSV) and other related viruses which have been proposed to be marine in origin isolated from a variety of terrestrial and marine animals. Rapid and reliable detection of marine caliciviruses is important as these viruses appear to be widespread and can cause vesicular disease in a wide variety of susceptible hosts including pigs and experimentally infected cattle where clinical signs cannot be easily distinguished from foot-and-mouth disease (FMD), swine vesicular disease (SVD) and vesicular stomatitis (VS). A real-time RT-PCR assay targeting conserved nucleotide sequences in the RNA-dependent RNA polymerase (3D) region of the genome successfully detected cell culture-grown virus preparations of more than thirty marine calicivirus serotypes. Only the atypical SMSV serotypes 8 and 12 failed to be detected, which provided further indication of genetic divergence between these and the other calicivirus serotypes said to be marine in origin. The real-time RT-PCR assay also specifically amplified RNA from samples collected following experimental inoculation of pigs with VESV. No cross-reactivity was demonstrated when the assay was tested with RNA prepared from representative viruses of FMD, SVD and VS. The real-time RT-PCR assay described is a sensitive and specific tool for detection and differential diagnosis of these viruses from other vesicular-disease causing viruses. PMID:17187870

  18. Evaluation of RealStar Reverse Transcription–Polymerase Chain Reaction Kits for Filovirus Detection in the Laboratory and Field

    PubMed Central

    Rieger, Toni; Kerber, Romy; El Halas, Hussein; Pallasch, Elisa; Duraffour, Sophie; Günther, Stephan; Ölschläger, Stephan

    2016-01-01

    Background. Diagnosis of Ebola virus (EBOV) disease (EVD) requires laboratory testing. Methods. The RealStar Filovirus Screen reverse transcription–polymerase chain reaction (RT-PCR) kit and the derived RealStar Zaire Ebolavirus RT-PCR kit were validated using in vitro transcripts, supernatant of infected cell cultures, and clinical specimens from patients with EVD. Results. The Filovirus Screen kit detected EBOV, Sudan virus, Taï Forest virus, Bundibugyo virus, Reston virus, and Marburg virus and differentiated between the genera Ebolavirus and Marburgvirus. The amount of filovirus RNA that could be detected with a probability of 95% ranged from 11 to 67 RNA copies/reaction on a LightCycler 480 II. The Zaire Ebolavirus kit is based on the Filovirus Screen kit but was optimized for detection of EBOV. It has an improved signal-to-noise ratio at low EBOV RNA concentrations and is somewhat more sensitive than the Filovirus kit. Both kits show significantly lower analytical sensitivity on a SmartCycler II. Clinical evaluation revealed that the SmartCycler II, compared with other real-time PCR platforms, decreases the clinical sensitivity of the Filovirus Screen kit to diagnose EVD at an early stage. Conclusions. The Filovirus Screen kit detects all human-pathogenic filoviruses with good analytical sensitivity if performed on an appropriate real-time PCR platform. High analytical sensitivity is important for early diagnosis of EVD. PMID:27549586

  19. Quantitative fucK gene polymerase chain reaction on sputum and nasopharyngeal secretions to detect Haemophilus influenzae pneumonia.

    PubMed

    Abdeldaim, Guma M K; Strålin, Kristoffer; Olcén, Per; Blomberg, Jonas; Mölling, Paula; Herrmann, Björn

    2013-06-01

    A quantitative polymerase chain reaction (PCR) for the fucK gene was developed for specific detection of Haemophilus influenzae. The method was tested on sputum and nasopharyngeal aspirate (NPA) from 78 patients with community-acquired pneumonia (CAP). With a reference standard of sputum culture and/or serology against the patient's own nasopharyngeal isolate, H. influenzae etiology was detected in 20 patients. Compared with the reference standard, fucK PCR (using the detection limit 10(5) DNA copies/mL) on sputum and NPA showed a sensitivity of 95.0% (19/20) in both cases, and specificities of 87.9% (51/58) and 89.5% (52/58), respectively. In a receiver operating characteristic curve analysis, sputum fucK PCR was found to be significantly superior to sputum P6 PCR for detection of H. influenzae CAP. NPA fucK PCR was positive in 3 of 54 adult controls without respiratory symptoms. In conclusion, quantitative fucK real-time PCR provides a sensitive and specific identification of H. influenzae in respiratory secretions. PMID:23541117

  20. Development of a nested polymerase chain reaction method to detect oncogenic Marek's disease virus from feather tips.

    PubMed

    Murata, Shiro; Chang, Kyung-Soo; Lee, Sung-Il; Konnai, Satoru; Onuma, Misao; Ohashi, Kazuhiko

    2007-09-01

    For the easy survey of Marek's disease virus (MDV), feather tip-derived DNA from MDV-infected chickens can be used because feather tips are easy to collect and feather follicle epithelium is known to be the only site of productive replication of cell-free MDV. To develop a diagnostic method to differentiate highly virulent strains of MDV from the attenuated MDV vaccine strain, CVI988, which is widely used, nested polymerase chain reaction (PCR) was performed to detect a segment of the meq gene in feather tip samples of chickens experimentally infected with MDV. In chickens infected with Md5, a strain of oncogenic MDV, the meq gene was consistently detected, whereas the L-meq gene, in which a 180-base pair (180-bp) sequence is inserted into the meq gene, was detected in CVI988-infected chickens. Moreover, the meq gene was mainly detected even in chickens co-infected with both Md5 and CVI988. These results suggest that this method is appropriate for the surveillance of the highly virulent MDV infection in the field.

  1. A novel strategy for human papillomavirus detection and genotyping with SybrGreen and molecular beacon polymerase chain reaction.

    PubMed

    Szuhai, K; Sandhaus, E; Kolkman-Uljee, S M; Lemaître, M; Truffert, J C; Dirks, R W; Tanke, H J; Fleuren, G J; Schuuring, E; Raap, A K

    2001-11-01

    Human papillomaviruses (HPVs) play an important role in the pathogenesis of cervical cancer. For identification of the large number of different HPV types found in (pre)malignant lesions, a robust methodology is needed that combines general HPV detection with HPV genotyping. We have developed for formaldehyde-fixed samples a strategy that, in a homogeneous, real-time fluorescence polymerase chain reaction (PCR)-based assay, accomplishes general HPV detection by SybrGreen reporting of HPV-DNA amplicons, and genotyping of seven prevalent HPV types (HPV-6, -11, -16, -18, -31, -33, -45) by real-time molecular beacon PCR. The false-positive rate of the HPV SybrGreen-PCR was 4%, making it well suited as a prescreening, general HPV detection technology. The type specificity of the seven selected HPV molecular beacons was 100% and double infections were readily identified. The multiplexing capacity of the HPV molecular beacon PCR was analyzed and up to three differently labeled molecular beacons could be used in one PCR reaction without observing cross talk. The inherent quantitation capacities of real-time fluorescence PCR allowed the determination of average HPV copy number per cell. We conclude that the HPV SybrGreen-PCR in combination with the HPV molecular beacon PCR provides a robust, sensitive, and quantitative general HPV detection and genotyping methodology.

  2. Detection and Typing of Human Papilloma Viruses by Nested Multiplex Polymerase Chain Reaction Assay in Cervical Cancer

    PubMed Central

    Jalal Kiani, Seyed; Shatizadeh Malekshahi, Somayeh; Yousefi Ghalejoogh, Zohreh; Ghavvami, Nastaran; Shafiei Jandaghi, Nazanin Zahra; Shahsiah, Reza; Jahanzad, Isa; Yavarian, Jila

    2015-01-01

    Background: Cervical cancer is the leading cause of death from cancer in under-developed countries. Human papilloma virus (HPV) 16 and 18 are the most prevalent types associated with carcinogenesis in the cervix. Conventional Polymerase Chain Reaction (PCR), type-specific and consensus primer-based PCR followed by sequencing, Restriction Fragment Length Polymorphism (RFLP) or hybridization by specific probes are common methods for HPV detection and typing. In addition, some researchers have developed a multiplex PCR for simultaneous detection and typing of different HPVs. Objectives: The aim of the present study was to investigate the prevalence of HPV infection and its types in cervical Squamous Cell Carcinoma (SCC) using the Nested Multiplex PCR (NMPCR) assay. Patients and Methods: Sixty-six samples with histologically confirmed SCC were evaluated. Total DNA was isolated by phenol–chloroform extraction and ethanol precipitation. Nested multiplex PCR was performed with first-round PCR by GP-E6/E7 consensus primers for amplification of the genomic DNA of all known mucosal HPV genotypes and second-round PCR by type-specific multiplex PCR primer cocktails. Results: Human papilloma virus infection was detected in 78.8% of samples, with the highest prevalence of HPV 16 (60.6%) while concurrent infections with two types was detected in 10.6%. Conclusions: The NMPCR assay is more convenient and easy for analysis of results, which is important for fast diagnosis and patient management, in a type-specific manner. PMID:26865940

  3. Genetically modified organisms in food-screening and specific detection by polymerase chain reaction.

    PubMed

    Vollenhofer, S; Burg, K; Schmidt, J; Kroath, H

    1999-12-01

    PCR methods for the detection of genetically modified organisms (GMOs) were developed that can be used for screening purposes and for specific detection of glyphosate-tolerant soybean and insect-resistant maize in food. Primers were designed to amplify parts of the 35S promoter derived from Cauliflower Mosaic Virus, the NOS terminator derived from Agrobacterium tumefaciens and the antibiotic marker gene NPTII (neomycin-phosphotransferase II), to allow for general screening of foods. PCR/hybridization protocols were established for the detection of glyphosate-tolerant RoundUp Ready soybean and insect-resistant Bt-maize. Besides hybridization, confirmation of the results using restriction analysis was also possible. The described methods enabled a highly sensitive and specific detection of GMOs and thus provide a useful tool for routine analysis of raw and processed food products.

  4. Type C oncornavirus isolation studies in systemic lupus erythematosus. II. Attempted detection by viral RNA-dependent DNA polymerase assay.

    PubMed Central

    Phillips, P E; Hargrave-Granda, R

    1978-01-01

    Isolation of type C oncornavirus was attempted from 20 tissues and cell cultures of patients with systemic lupus erythematosus. Chemical inducers, cocultivation and fusion with cells from multiple other species, prolonged subculturing, and the RNA-dependent DNA polymerase assay for virus detection were used. A type C virus was isolated, but was shown to be the endogenous rat virus. Thus the methods, although generally appropriate, were not specifically permissive for replication of a human type C virus. This agrees with the failure of other investigators to isolate a virus of undisputed human origin. Combining available evidence, a fundamental role for type C viruses in lupus erythematosus remains an attractive hypothesis. Images PMID:80159

  5. Polymerase chain reaction assay targeting cytochrome b gene for the detection of dog meat adulteration in meatball formulation.

    PubMed

    Rahman, Md Mahfujur; Ali, Md Eaqub; Hamid, Sharifah Bee Abd; Mustafa, Shuhaimi; Hashim, Uda; Hanapi, Ummi Kalthum

    2014-08-01

    A polymerase chain reaction (PCR) assay for the assessment of dog meat adulteration in meatballs was developed. The assay selectively amplified a 100-bp region of canine mitochondrial cytochrome b gene from pure, raw, processed and mixed backgrounds. The specificity of the assay was tested against 11 animals and 3 plants species, commonly available for meatball formulation. The stability of the assay was proven under extensively autoclaving conditions that breakdown target DNA. A blind test from ready to eat chicken and beef meatballs showed that the assay can repeatedly detect 0.2% canine meat tissues under complex matrices using 0.04 ng of dog DNA extracted from differentially treated meatballs. The simplicity, stability and sensitivity of the assay suggested that it could be used in halal food industry for the authentication of canine derivatives in processed foods.

  6. Biofunctionalization of Polyoxometalates with DNA Primers, Their Use in the Polymerase Chain Reaction (PCR) and Electrochemical Detection of PCR Products.

    PubMed

    Debela, Ahmed M; Ortiz, Mayreli; Beni, Valerio; Thorimbert, Serge; Lesage, Denis; Cole, Richard B; O'Sullivan, Ciara K; Hasenknopf, Bernold

    2015-12-01

    The bioconjugation of polyoxometalates (POMs), which are inorganic metal oxido clusters, to DNA strands to obtain functional labeled DNA primers and their potential use in electrochemical detection have been investigated. Activated monooxoacylated polyoxotungstates [SiW11 O39 {Sn(CH2 )2 CO}](8-) and [P2 W17 O61 {Sn(CH2 )2 CO}](6-) have been used to link to a 5'-NH2 terminated 21-mer DNA forward primer through amide coupling. The functionalized primer was characterized by using a battery of techniques, including electrophoresis, mass spectrometry, as well as IR and Raman spectroscopy. The functionality of the POM-labeled primers was demonstrated through hybridization with a surface-immobilized probe. Finally, the labeled primers were successfully used in the polymerase chain reaction (PCR) and the PCR products were characterized by using electrophoresis.

  7. Detection of Leptospira spp. in wildlife reservoir hosts in Ontario through comparison of immunohistochemical and polymerase chain reaction genotyping methods.

    PubMed

    Shearer, Karen E; Harte, Michael J; Ojkic, Davor; Delay, Josepha; Campbell, Douglas

    2014-03-01

    A total of 460 kidney samples from wildlife (beavers, coyotes, deer, foxes, opossums, otters, raccoons, skunks) were obtained from road-kill and hunter/trapper donations in Ontario between January 2010 and November 2012. The objectives of the study were to detect Leptospira spp. by immunohistochemistry and polymerase chain reaction (PCR), to map presence of leptospires in wildlife relative to livestock and human populations, and to characterize positive samples by sequencing and comparison to leptospires known to affect domestic animals and humans. The proportion of samples that tested positive ranged from 0% to 42%, with the highest rates in skunks and raccoons. Leptospira spp. were present in kidneys of wildlife across Ontario, particularly in areas of high human density, and areas in which livestock populations are abundant. The PCR was too weak in most samples to permit genotyping and examination of the relationship between the leptospires found in this study and those affecting domestic animals and humans.

  8. Detection of Mycobacterium tuberculosis with nested polymerase chain reaction analysis in enucleated eye ball in Eales' disease.

    PubMed

    Verma, Aditya; Biswas, Jyotirmay; Dhanurekha, L; Gayathri, R; Lily Therese, K

    2016-06-01

    Nested polymerase chain reaction (nPCR) was performed on enucleated eyeball for detection of Mycobacterium tuberculosis (M. tb) genome in a patient with Eales' disease. PCR analysis in all previous studies has been done mainly using aqueous, vitreous and epiretinal membranes from these patients. Paraffin wax embedded tissue section of the enucleated eyeball was analyzed by histopathology and nPCR targeting MPB64 gene and IS6110 region of M. tb genome. Lymphocytic infiltration was seen in the vitreous, iris and the retinal tissue. Ziehl Neelsen stain was negative for acid fast bacilli. Caseation necrosis was not seen in any section. Agarose gel electrophoretogram showed positive results with 200 bp specific amplified product targeting MPB64 gene, whereas nPCR targeting IS6110 region was negative. Since biopsy proven M. tb is extremely difficult in ocular tissues due to extensive necrosis, the nPCR technique aided in the diagnosis.

  9. Detection of Leptospira spp. in wildlife reservoir hosts in Ontario through comparison of immunohistochemical and polymerase chain reaction genotyping methods

    PubMed Central

    Shearer, Karen E.; Harte, Michael J.; Ojkic, Davor; DeLay, Josepha; Campbell, Douglas

    2014-01-01

    A total of 460 kidney samples from wildlife (beavers, coyotes, deer, foxes, opossums, otters, raccoons, skunks) were obtained from road-kill and hunter/trapper donations in Ontario between January 2010 and November 2012. The objectives of the study were to detect Leptospira spp. by immunohistochemistry and polymerase chain reaction (PCR), to map presence of leptospires in wildlife relative to livestock and human populations, and to characterize positive samples by sequencing and comparison to leptospires known to affect domestic animals and humans. The proportion of samples that tested positive ranged from 0% to 42%, with the highest rates in skunks and raccoons. Leptospira spp. were present in kidneys of wildlife across Ontario, particularly in areas of high human density, and areas in which livestock populations are abundant. The PCR was too weak in most samples to permit genotyping and examination of the relationship between the leptospires found in this study and those affecting domestic animals and humans. PMID:24587507

  10. Case Report of Focal Epithelial Hyperplasia (Heck's Disease) with Polymerase Chain Reaction Detection of Human Papillomavirus 13.

    PubMed

    Brehm, Mary A; Gordon, Katie; Firan, Miahil; Rady, Peter; Agim, Nnenna

    2016-05-01

    Focal epithelial hyperplasia (FEH), or Heck's disease, is an uncommon benign proliferation of oral mucosa caused by the human papillomavirus (HPV), particularly subtypes 13 and 32. The disease typically presents in young Native American patients and is characterized by multiple asymptomatic papules and nodules on the oral mucosa, lips, tongue, and gingiva. The factors that determine susceptibility to FEH are unknown, but the ethnic and geographic distribution of FEH suggests that genetic predisposition, particularly having the human lymphocytic antigen DR4 type, may be involved in pathogenesis. We report a case of FEH with polymerase chain reaction detection of HPV13 in a healthy 11-year-old Hispanic girl and discuss the current understanding of disease pathogenesis, susceptibility, and treatment.

  11. Detection of Mycobacterium tuberculosis with nested polymerase chain reaction analysis in enucleated eye ball in Eales' disease.

    PubMed

    Verma, Aditya; Biswas, Jyotirmay; Dhanurekha, L; Gayathri, R; Lily Therese, K

    2016-06-01

    Nested polymerase chain reaction (nPCR) was performed on enucleated eyeball for detection of Mycobacterium tuberculosis (M. tb) genome in a patient with Eales' disease. PCR analysis in all previous studies has been done mainly using aqueous, vitreous and epiretinal membranes from these patients. Paraffin wax embedded tissue section of the enucleated eyeball was analyzed by histopathology and nPCR targeting MPB64 gene and IS6110 region of M. tb genome. Lymphocytic infiltration was seen in the vitreous, iris and the retinal tissue. Ziehl Neelsen stain was negative for acid fast bacilli. Caseation necrosis was not seen in any section. Agarose gel electrophoretogram showed positive results with 200 bp specific amplified product targeting MPB64 gene, whereas nPCR targeting IS6110 region was negative. Since biopsy proven M. tb is extremely difficult in ocular tissues due to extensive necrosis, the nPCR technique aided in the diagnosis. PMID:26499903

  12. Detection of variable DNA repeats in diverse eukaryotic microorganisms by a single set of polymerase chain reaction primers.

    PubMed

    Riley, D E; Samadpour, M; Krieger, J N

    1991-12-01

    We cloned and sequenced a variable DNA repeat from Trichomonas vaginalis, a flagellated protozoan parasite. Targeting of this repeat in the polymerase chain reaction resulted in complex and intense product patterns for a wide variety of eukaryotic microorganisms, including the pathogenic protozoan parasites T. vaginalis, Giardia lamblia, Leishmania donovani, three species of Trypanosoma, and four species of Acanthamoeba; the nonpathogenic protozoans, Paramecium tetraurelia and Tetrahymena thermophilia; and a yeast, Saccharomyces cerevisiae. Each microorganism exhibited a distinctive pattern of repeats. For example, a characteristic pattern was exhibited by six clinical T. vaginalis isolates. Eight G. lamblia isolates exhibited either one of two characteristic pattern types. There was no reaction with human DNA or DNA from the prokaryotes Ureaplasma urealyticum and Mycoplasma hominis. This approach may facilitate detection of a wide variety of eukaryotic microorganisms by use of a single primer set and holds promise for the development of typing schemes for both T. vaginalis and G. lamblia. PMID:1757544

  13. Evaluation of a commercial real-time polymerase chain reaction assay for detection of environmental contamination with Clostridium difficile.

    PubMed

    Deshpande, A; Kundrapu, S; Sunkesula, V C K; Cadnum, J L; Fertelli, D; Donskey, C J

    2013-09-01

    Contaminated environmental surfaces are an important source for transmission of Clostridium difficile. However, there are no efficient and easy methods to assess contamination. The performance of a commercial real-time polymerase chain reaction (PCR) assay was evaluated for detection of environmental toxigenic C. difficile in comparison with anaerobic culture followed by toxin testing of isolates. For 66 sites sampled, PCR had a sensitivity of 17.39%, specificity 100%, positive predictive value 100% and negative predictive value 69.35%. Increasing the PCR cycle threshold (CT) value to 45 increased sensitivity to 52% without decreasing specificity. The commercial PCR assay is not sufficiently sensitive for environmental monitoring, but improved sensitivity might be possible through CT value modification.

  14. Case Report of Focal Epithelial Hyperplasia (Heck's Disease) with Polymerase Chain Reaction Detection of Human Papillomavirus 13.

    PubMed

    Brehm, Mary A; Gordon, Katie; Firan, Miahil; Rady, Peter; Agim, Nnenna

    2016-05-01

    Focal epithelial hyperplasia (FEH), or Heck's disease, is an uncommon benign proliferation of oral mucosa caused by the human papillomavirus (HPV), particularly subtypes 13 and 32. The disease typically presents in young Native American patients and is characterized by multiple asymptomatic papules and nodules on the oral mucosa, lips, tongue, and gingiva. The factors that determine susceptibility to FEH are unknown, but the ethnic and geographic distribution of FEH suggests that genetic predisposition, particularly having the human lymphocytic antigen DR4 type, may be involved in pathogenesis. We report a case of FEH with polymerase chain reaction detection of HPV13 in a healthy 11-year-old Hispanic girl and discuss the current understanding of disease pathogenesis, susceptibility, and treatment. PMID:27072123

  15. Detection of deoxyribonucleic acid (DNA) targets using polymerase chain reaction (PCR) and paper surface-enhanced Raman spectroscopy (SERS) chromatography.

    PubMed

    Hoppmann, Eric P; Yu, Wei W; White, Ian M

    2014-01-01

    Surface-enhanced Raman spectroscopy (SERS) enables multiplex detection of analytes using simple, portable equipment consisting of a single excitation source and detector. Thus, in theory, SERS is ideally suited to replace fluorescence in assays that screen for numerous deoxyribonucleic acid (DNA) targets, but in practice, SERS-based assays have suffered from complexity and elaborate processing steps. Here, we report an assay in which a simple inkjet-fabricated plasmonic paper device enables SERS-based detection of multiple DNA targets within a single polymerase chain reaction (PCR). In prior work, we demonstrated the principles of chromatographic separation and SERS-based detection on inkjet-fabricated plasmonic paper. The present work extends that capability for post-PCR gene sequence detection. In this design, hydrolysis DNA probes with 5' Raman labels are utilized; if the target is present, the probe is hydrolyzed during PCR, freeing the reporter. After applying the PCR sample to a paper SERS device, an on-device chromatographic separation and concentration is conducted to discriminate between hydrolyzed and intact probes. SERS is then used to detect the reporter released by the hydrolyzed probes. This simple separation and detection on paper eliminates the need for complex sample processing steps. In this work, we simultaneously detect the methicillin-resistant Staphylococcus aureus genes mecA and femB to illustrate the concept. We envision that this approach could contribute to the development of multiplex DNA diagnostic tests enabling screening for several target sequences within a single reaction, which is necessary for cases in which sample volume and resources are limited.

  16. Specific detection of potentially allergenic kiwifruit in foods using polymerase chain reaction.

    PubMed

    Taguchi, Hiromu; Watanabe, Satoshi; Hirao, Takashi; Akiyama, Hiroshi; Sakai, Shinobu; Watanabe, Takahiro; Matsuda, Rieko; Urisu, Atsuo; Maitani, Tamio

    2007-03-01

    Kiwifruit (Actinidia deliciosa and Actinidia chinensis) is allergenic to sensitive patients, and, under Japanese regulations, it is one of the food items that are recommended to be declared on food labeling as much as possible. To develop PCR-based methods for the detection of trace amounts of kiwifruit in foods, two primer pairs targeting the ITS-1 region of the Actinidia spp. were designed using PCR simulation software. On the basis of the known distribution of a major kiwifruit allergen (actinidin) within the Actinidia spp., as well as of reports on clinical and immunological cross-reactivities, one of the primer pairs was designed to detect all Actinidia spp. and the other to detect commercially grown Actinidia spp. (i.e., kiwifruit, Actinidia arguta, and their interspecific hybrids) except for Actinidia polygama. The specificity of the developed methods using the designed primer pairs was verified by performing PCR experiments on 8 Actinidia spp. and 26 other plants including fruits. The methods were considered to be specific enough to yield target-size products only from the target Actinidia spp. and to detect no target-size products from nontarget species. The methods were sensitive enough to detect 5-50 fg of Actinidia spp. DNA spiked in 50 ng of salmon testis DNA used as a carrier (1-10 ppm of kiwifruit DNA) and 1700 ppm (w/w) of fresh kiwifruit puree spiked in a commercial plain yogurt (corresponding to ca. 10 ppm of kiwifruit protein). These methods would be expected to be useful in the detection of hidden kiwifruit and its related species in processed foods.

  17. Method for the detection of specific nucleic acid sequences by polymerase nucleotide incorporation

    DOEpatents

    Castro, Alonso

    2004-06-01

    A method for rapid and efficient detection of a target DNA or RNA sequence is provided. A primer having a 3'-hydroxyl group at one end and having a sequence of nucleotides sufficiently homologous with an identifying sequence of nucleotides in the target DNA is selected. The primer is hybridized to the identifying sequence of nucleotides on the DNA or RNA sequence and a reporter molecule is synthesized on the target sequence by progressively binding complementary nucleotides to the primer, where the complementary nucleotides include nucleotides labeled with a fluorophore. Fluorescence emitted by fluorophores on single reporter molecules is detected to identify the target DNA or RNA sequence.

  18. Detection of Avian bornavirus in multiple tissues of infected psittacine birds using real-time reverse transcription polymerase chain reaction.

    PubMed

    Delnatte, Pauline; Mak, Matthew; Ojkic, Davor; Raghav, Raj; DeLay, Josepha; Smith, Dale A

    2014-03-01

    Avian bornavirus (ABV), the cause of proventricular dilation disease in psittacine birds, has been detected in multiple tissues of infected birds using immunohistochemical staining (IHC) and reverse transcription polymerase chain reaction (RT-PCR). In the current study, real-time RT-PCR, using primers targeting the ABV matrix gene, was used to detect ABV in 146 tissues from 7 ABV-infected psittacine birds. Eighty-six percent of the samples tested positive, with crossing point values ranging from 13.82 to 37.82 and a mean of 22.3. These results were compared to the findings of a previous study using gel-based RT-PCR and IHC on the same samples. The agreement between the 2 RT-PCR techniques was 91%; when tests disagreed it was because samples were negative using gel-based RT-PCR but positive on real-time RT-PCR. Agreement with IHC was 77%; 16 out of 74 samples were negative using IHC but positive on real-time RT-PCR. The results suggest that real-time RT-PCR is a more sensitive technique than gel-based RT-PCR and IHC to detect ABV in tissues. The tissues that were ranked most frequently as having a high amount of viral RNA were proventriculus, kidney, colon, cerebrum, and cerebellum. Skeletal muscle, on the other hand, was found to have a consistently low amount of viral RNA.

  19. Real-Time Polymerase Chain Reaction for Detecting Bacterial DNA Directly from Blood of Neonates Being Evaluated for Sepsis

    PubMed Central

    Jordan, Jeanne A.; Durso, Mary Beth

    2005-01-01

    Speed is of the essence when evaluating an infant with symptoms consistent with sepsis. Because of the high morbidity and mortality associated with neonatal sepsis, infants receive multiple, broad-spectrum antibiotics before receiving finalized blood culture results. Incorporating an additional, reliable, yet rapid assay to detect bacteria directly from blood would facilitate timely diagnosis and appropriate care. To this end, we designed a real-time polymerase chain reaction (PCR) assay targeting the highly conserved 380 bases of 16S rDNA. DNA was extracted from whole-blood samples using a Qiagen column. The limit of detection for the TaqMan-based assay, using a Smartcycler instrument, was 40, 50, or 2000 colony-forming units per milliliter of blood (CFU/ml) of Escherichia coli, group B Streptococcus, and Listeria monocytogenes, respectively, when white blood cell counts were below 39,000/μl. Implementing this approach requires less than 4 hours for both sample preparation and real-time PCR compared with 1 to 2 days to detect growth in culture or 5 days to finalize no-growth culture results. There was an overall agreement between the results of culture and real-time PCR of 94.1% (80 of 85) in this study. These results suggest that molecular techniques can augment culture-based methods for diagnosing neonatal sepsis, especially in infants whose mothers have received intrapartum antibiotic prophylaxis. PMID:16258155

  20. Rapid detection of mecA and nuc genes in staphylococci by real-time multiplex polymerase chain reaction.

    PubMed

    Costa, Anna-Maria; Kay, Ian; Palladino, Silvano

    2005-01-01

    A multiplex real-time polymerase chain reaction (RT-PCR) targeting the mecA and nuc genes was developed for the detection of methicillin resistance and identification of Staphylococcus aureus. Novel mecA and nuc primers and fluorescence resonance energy transfer hybridization probes specific for the mecA and nuc genes were evaluated. The assay was performed using the LightCycler system (Roche Molecular Biochemicals, Mannheim, Germany) and evaluated against the traditional gel-based multiplex PCR (PCR-gel) method currently used at Royal Perth Hospital. Clinical isolates (n = 222) and isolates from a culture collection library (n = 206) were tested by both assays in parallel. The RT-PCR assay was 100% sensitive and specific for the detection of methicillin resistance and for the identification of S. aureus when compared with the PCR-gel assay. Results from the RT-PCR assay showed 5 isolates with lower efficiency fluorescence curves for the nuc gene PCR fragment. DNA sequencing showed mutations within the region of the probe-binding sites compared with the reference strain. The results of the RT-PCR assay were available within 2 h. This rapid mecA/nuc RT-PCR assay is a suitable and practical tool for the routine detection of methicillin resistance and identification of S. aureus, which can be easily incorporated into the diagnostic molecular microbiology laboratory work flow.

  1. Real-time fluorogenic reverse transcription polymerase chain reaction assay for the specific detection of Bagaza virus.

    PubMed

    Buitrago, Dolores; Rocha, Ana; Tena-Tomás, Cristina; Vigo, Marta; Agüero, Montserrat; Jiménez-Clavero, Miguel Angel

    2012-09-01

    In September 2010, an outbreak of disease in 2 wild bird species (red-legged partridge, Alectoris rufa; ring-necked pheasant, Phasianus colchicus) occurred in southern Spain. Bagaza virus (BAGV) was identified as the etiological agent of the outbreak. BAGV had only been reported before in Western Africa (Central African Republic, Senegal) and in India. The first occurrence of BAGV in Spain stimulated a demand for rapid, reliable, and efficacious diagnostic methods to facilitate the surveillance of this disease in the field. This report describes a real-time reverse transcription polymerase chain reaction (RT-PCR) method based on a commercial 5'-Taq nuclease-3' minor groove binder DNA probe and primers targeting the Bagaza NS5 gene. The method allowed the detection of BAGV with a high sensitivity, whereas other closely related flaviviruses (Usutu virus, West Nile virus, and Japanese encephalitis virus) were not detected. The assay was evaluated using field samples of red-legged partridges dead during the outbreak (n = 11), as well as samples collected from partridges during surveillance programs (n = 81). The results were compared to those obtained with a pan-flaviviral hemi-nested RT-PCR followed by nucleotide sequencing, which was employed originally to identify the virus involved in the outbreak. The results obtained with both techniques were 100% matching, indicating that the newly developed real-time RT-PCR is a valid technique for BAGV genome detection, useful in both diagnosis and surveillance studies.

  2. Detection and quantification of circulating tumor cells in patients with esophageal cancer by real-time polymerase chain reaction.

    PubMed

    Ito, H; Kanda, T; Nishimaki, T; Sato, H; Nakagawa, S; Hatakeyama, K

    2004-09-01

    Polymerase chain reaction (PCR) amplification was used for detecting circulating tumor cells. However, PCR was so sensitive that it detected a very low level of mRNA with no relevance to tumor cells. We analyzed the degree of micro-tumor spread in esophageal cancer patients using quantitative PCR. Samples were collected from 28 patients and 35 controls. Real-time quantitative PCR (LightCycler) was employed for the detection of carcinoembryonic antigen (CEA) and cytokeratin 20 (CK-20). In the CEA and CK-20 mRNA assays, 7 and 3 out of 28 patients, respectively, showed higher mRNA levels in peripheral blood than the normal range based on values of controls (mean+/-2SD). Eleven out of 19, 4 out of 14, and 2 out of 5 patients showed higher CEA mRNA levels in the samples from tumor drainage vein, costal bone marrow, and thoracic duct lymph, respectively. One of the 7 patients who showed higher CEA mRNA levels in pretreatment peripheral blood is currently free from disease. These findings reveal that quantitative PCR can discriminate high levels of cancer-specific expression from low levels of illegitimate expression in blood. They also suggest that the identification of circulating tumor cells by the CEA mRNA assay is a reliable means of predicting early recurrence.

  3. Development of a SYBR Green quantitative polymerase chain reaction assay for rapid detection and quantification of infectious laryngotracheitis virus.

    PubMed

    Mahmoudian, Alireza; Kirkpatrick, Naomi C; Coppo, Mauricio; Lee, Sang-Won; Devlin, Joanne M; Markham, Philip F; Browning, Glenn F; Noormohammadi, Amir H

    2011-06-01

    Infectious laryngotracheitis is an acute viral respiratory disease of chickens with a worldwide distribution. Sensitive detection of the causative herpesvirus is particularly important because it can persist in the host at a very low copy number and be transmitted to other birds. Quantification of viral genome copy number is also useful for clinical investigations and experimental studies. In the study presented here, a quantitative polymerase chain reaction (qPCR) assay was developed using SYBR Green chemistry and the viral gene UL15a to detect and quantify infectious laryngotracheitis virus (ILTV) in ILTV-inoculated chicken embryos or naturally infected birds. The specificity of the assay was confirmed using a panel of viral and bacterial pathogens of poultry. The sensitivity of the assay was compared with two conventional PCR assays, virus titration and an antigen-detecting enzyme-linked immunosorbent assay. The qPCR developed in this study was highly sensitive and specific, and has potential for quantification of ILTV in tissues from naturally and experimentally infected birds and embryos.

  4. Detection and quantification of Renibacterium salmoninarum DNA in salmonid tissues by real-time quantitative polymerase chain reaction analysis

    USGS Publications Warehouse

    Chase, D.M.; Elliott, D.G.; Pascho, R.J.

    2006-01-01

    Renibacterium salmoninarum is an important salmonid pathogen that is difficult to culture. We developed and assessed a real-time, quantitative, polymerase chain reaction (qPCR) assay for the detection and enumeration of R. salmoninarum. The qPCR is based on TaqMan technology and amplifies a 69-base pair (bp) region of the gene encoding the major soluble antigen (MSA) of R. salmoninarum. The qPCR assay consistently detected as few as 5 R. salmoninarum cells per reaction in kidney tissue. The specificity of the qPCR was confirmed by testing the DNA extracts from a panel of microorganisms that were either common fish pathogens or reported to cause false-positive reactions in the enzyme-linked immunosorbent assay (ELISA). Kidney samples from 38 juvenile Chinook salmon (Oncorhynchus tshawytscha) in a naturally infected population were examined by real-time qPCR, a nested PCR, and ELISA, and prevalences of R. salmoninarum detected were 71, 66, and 71%, respectively. The qPCR should be a valuable tool for evaluating the R. salmoninarum infection status of salmonids.

  5. Combining RNA-DNA swapping and quantitative polymerase chain reaction for the detection of influenza A nucleoprotein.

    PubMed

    Morin, Isabelle; Schaeffer, Patrick M

    2012-01-15

    The detection of proteinaceous antigens generally relies on traditional immunoassays and, more recently, on immuno-PCR (polymerase chain reaction) assays and their derivatives, which do not take advantage of the intrinsic function or binding property of a protein. The RNA-binding nucleoprotein has been shown to be an excellent target for the development of various influenza A diagnostics due to its high antigenicity and the presence of large numbers in the virus. It binds nonspecifically to the sugar-phosphate backbone of RNA as well as to single-stranded DNA (ssDNA) in vitro. We decided to take advantage of this property to develop an ssDNA probe for the detection of nucleoprotein by quantitative PCR (qPCR). We found that recombinant influenza A nucleoprotein from avian H5N1 subtype binds strongest to a 74-base-long ssDNA. Two systems, one comprising an antibody-based nucleoprotein capture surface and the other based on direct nucleoprotein adsorption under denaturing conditions, were developed combining the replacement of RNA bound to nucleoprotein by a discrete ssDNA probe and a qPCR for the detection of nucleoprotein in the low picomolar (pM) range.

  6. Detection and Enumeration of Streptococcus agalactiae from Bovine Milk Samples by Real-Time Polymerase Chain Reaction.

    PubMed

    de Carvalho, Nara Ladeira; Gonçalves, Juliano Leonel; Botaro, Bruno Garcia; Silva, Luis Felipe de Prada E; dos Santos, Marcos Veiga

    2015-09-01

    The aim of this study was to evaluate the use of real-time polymerase chain reaction (qPCR) combined with DNA extraction directly from composite milk and bulk tank samples for detection and enumeration of Streptococcus agalactiae (SAG) causing subclinical mastitis. Dilutions of sterile reconstituted skim milk inoculated with SAG ATCC 13813 were used to establish a standard curve (cfu/mL) for the qPCR assay targeting SAG. The analytical sensitivity and repeatability of the qPCR assay were determined. Bulk tank (BTM; n = 38) and composite milk samples (CM; n = 26) collected from lactating cows with positive isolation of SAG were submitted to the qPCR protocol and SAG plate counting, with results from both methods compared. Amplification of DNA was not possible in two out of 64 samples, indicating that qPCR was able to detect SAG in 96 and 97% of BTM and CM samples, respectively. The inter-assay coefficient of variation was <5%, showing that the technique had adequate repeatability. The qPCR protocol can be a high-throughput and rapid diagnostic assay to accurately detect SAG from BTM and CM samples compared with conventional microbiological culture method. However, the evaluated qPCR protocol is not accurate for enumerating SAG in milk samples, probably due to quantification of DNA of non-viable cells.

  7. Development and use of a real-time polymerase chain reaction assay for the detection of Ophidiomyces ophiodiicola in snakes.

    PubMed

    Allender, Matthew C; Bunick, David; Dzhaman, Elena; Burrus, Lucienne; Maddox, Carol

    2015-03-01

    Fungal pathogens threatening the conservation of wildlife are becoming increasingly common. Since 2008, free-ranging snakes across North America have been experiencing a marked increase in the prevalence of snake fungal disease associated with Ophidiomyces ophiodiicola. Diagnosis has historically relied on histology, microbiology, and conventional polymerase chain reaction (PCR). More sensitive methods are needed to adequately characterize the epidemiology. The current study describes the development of a real-time PCR (qPCR) assay for detecting a segment of the internal transcribed spacer 1 region between the 18S and 5.8S ribosomal RNA gene. The assay was able to detect as few as 1.05 × 10(1) gene copies per reaction. An additional 4 positive cases were detected when comparing a conventional PCR (n = 3) and the qPCR (n = 7) when used on swab samples from 47 eastern massasauga rattlesnakes. The newly developed assay is a sensitive and specific tool for surveillance and monitoring in the conservation of free-ranging snakes.

  8. Detection of spirorchiid trematodes in gastropod tissues by polymerase chain reaction: preliminary identification of an intermediate host of Learedius learedi.

    PubMed

    Stacy, Brian A; Frankovich, Thomas; Greiner, Ellis; Alleman, A Rick; Herbst, Lawrence H; Klein, Paul; Bolten, Alan; McIntosh, Antoinette; Jacobson, Elliott R

    2010-08-01

    Marine spirorchiid trematodes are associated with morbidity and mortality in sea turtles worldwide. The intermediate hosts remain unknown, and discovery efforts are hindered by the large number and great diversity of potential hosts within sea turtle habitats, as well the potential for low prevalence and overdispersion. A high-throughput DNA extraction and polymerase chain reaction-based method was developed to detect the internal transcribed spacer 2 (ITS2) region of the ribosomal gene of 2 spirorchiid genera, Learedius and Hapalotrema , within pooled samples of gastropod tissues. A model system consisting of freshwater snail ( Pomacea bridgesii ) tissues and DNA extracts spiked with adult Learedius learedi and known quantities of spirorchiid DNA was used to develop and test the technique. Threshold of detection was found to be equivalent to an early prepatent infection within 1.5 g of gastropod tissue. This technique was used to screen approximately 25 species of marine gastropods at a captive facility where green turtles ( Chelonia mydas ) become infected by L. learedi . The parasite was detected in a sample of knobby keyhole limpet ( Fissurella nodosa ), thus providing the first evidence of an intermediate host for a marine spirorchiid trematode. This technique has many potential applications in trematode life cycle discovery studies.

  9. Comparison of procedures for the detection of enteroviruses in murine heart samples by in situ polymerase chain reaction.

    PubMed

    Berger, M M; See, D M; Redl, B; Aymard, M; Lina, B

    1997-01-01

    A protocol for the in situ polymerase chain reaction (IS-PCR) detection of viral nucleic acid in the heart tissue of four-to-five-week-old CD1 mice infected with coxsackievirus B3 (CBV3) Nancy strain is described. To compare the effects of formalin concentration on the IS-PCR process, two different concentrations (10 and 37%) were employed. Using 37% formalin, 25 PCR cycles were sufficient and a permeabilization step could be omitted. However, postfixation of tissues with 4% paraformaldehyde and 100% ethanol after the deparaffinization, reverse transcriptase and amplification steps was required in order to minimize artefacts. When the tissues were fixed in 10% formalin, postfixation with 4% paraformaldehyde was not required, but a permeabilization step had to be employed and 40 cycles of PCR amplification were needed. To detect the PCR product in the 10% formalin-fixed samples, incubation with 0.3 U/ml of an anti-digoxigenin antibody conjugated to alkaline phosphatase was performed for 90 min. When 37% formalin-fixed samples were used, the concentration of the antibody conjugate had to be increased to 3 U/ml and the exposure time was decreased to 30 min. Enterovirus (EV) nucleic acid was detected in the cytoplasm of myocytes. Thus, IS-PCR was successful in localizing EV nucleic acid in the cytoplasm of myocytes in mice infected with a cardiotropic strain of CBV3. Using this technique, 10% formalin-fixed tissues gave better results than 37% formalin-fixed tissues.

  10. Development of a multiplex polymerase chain reaction method for simultaneous detection of eight events of genetically modified maize.

    PubMed

    Onishi, Mari; Matsuoka, Takeshi; Kodama, Takashi; Kashiwaba, Koichi; Futo, Satoshi; Akiyama, Hiroshi; Maitani, Tamio; Furui, Satoshi; Oguchi, Taichi; Hino, Akihiro

    2005-12-14

    In this study, we developed a novel multiplex polymerase chain reaction (PCR) method for simultaneous detection of up to eight events of genetically modified (GM) maize within a single reaction. The eight detection primer pairs designed to be construct specific for eight respective GM events (i.e., Bt11, Event176, GA21, MON810, MON863, NK603, T25, and TC1507) and a primer pair for an endogenous reference gene, ssIIb, were included in the nonaplex(9plex) PCR system, and its amplified products could be distinguished by agarose gel and capillary electrophoreses based on their different lengths. The optimal condition enabled us to reliably amplify two fragments corresponding to a construct specific sequence and a taxon specific ssIIb in each of the eight events of GM maize and all of nine fragments in a simulated GM mixture containing as little as 0.25% (w/w) each of eight events of GM maize. These results indicate that this multiplex PCR method could be an effective qualitative detection method for screening GM maize. PMID:16332120

  11. Detection and Enumeration of Streptococcus agalactiae from Bovine Milk Samples by Real-Time Polymerase Chain Reaction.

    PubMed

    de Carvalho, Nara Ladeira; Gonçalves, Juliano Leonel; Botaro, Bruno Garcia; Silva, Luis Felipe de Prada E; dos Santos, Marcos Veiga

    2015-09-01

    The aim of this study was to evaluate the use of real-time polymerase chain reaction (qPCR) combined with DNA extraction directly from composite milk and bulk tank samples for detection and enumeration of Streptococcus agalactiae (SAG) causing subclinical mastitis. Dilutions of sterile reconstituted skim milk inoculated with SAG ATCC 13813 were used to establish a standard curve (cfu/mL) for the qPCR assay targeting SAG. The analytical sensitivity and repeatability of the qPCR assay were determined. Bulk tank (BTM; n = 38) and composite milk samples (CM; n = 26) collected from lactating cows with positive isolation of SAG were submitted to the qPCR protocol and SAG plate counting, with results from both methods compared. Amplification of DNA was not possible in two out of 64 samples, indicating that qPCR was able to detect SAG in 96 and 97% of BTM and CM samples, respectively. The inter-assay coefficient of variation was <5%, showing that the technique had adequate repeatability. The qPCR protocol can be a high-throughput and rapid diagnostic assay to accurately detect SAG from BTM and CM samples compared with conventional microbiological culture method. However, the evaluated qPCR protocol is not accurate for enumerating SAG in milk samples, probably due to quantification of DNA of non-viable cells. PMID:26134534

  12. Real-Time Polymerase Chain Reaction Detection of Angiostrongylus cantonensis DNA in Cerebrospinal Fluid from Patients with Eosinophilic Meningitis.

    PubMed

    Qvarnstrom, Yvonne; Xayavong, Maniphet; da Silva, Ana Cristina Aramburu; Park, Sarah Y; Whelen, A Christian; Calimlim, Precilia S; Sciulli, Rebecca H; Honda, Stacey A A; Higa, Karen; Kitsutani, Paul; Chea, Nora; Heng, Seng; Johnson, Stuart; Graeff-Teixeira, Carlos; Fox, LeAnne M; da Silva, Alexandre J

    2016-01-01

    Angiostrongylus cantonensis is the most common infectious cause of eosinophilic meningitis. Timely diagnosis of these infections is difficult, partly because reliable laboratory diagnostic methods are unavailable. The aim of this study was to evaluate the usefulness of a real-time polymerase chain reaction (PCR) assay for the detection of A. cantonensis DNA in human cerebrospinal fluid (CSF) specimens. A total of 49 CSF specimens from 33 patients with eosinophilic meningitis were included: A. cantonensis DNA was detected in 32 CSF specimens, from 22 patients. Four patients had intermittently positive and negative real-time PCR results on subsequent samples, indicating that the level of A. cantonensis DNA present in CSF may fluctuate during the course of the illness. Immunodiagnosis and/or supplemental PCR testing supported the real-time PCR findings for 30 patients. On the basis of these observations, this real-time PCR assay can be useful to detect A. cantonensis in the CSF from patients with eosinophilic meningitis. PMID:26526920

  13. Detection of Salmonella enterica serovar Dublin by polymerase chain reaction in multiplex format.

    PubMed

    Zhai, Ligong; Kong, Xiaohan; Lu, Zhaoxin; Lv, Fengxia; Zhang, Chong; Bie, Xiaomei

    2014-05-01

    S. Dublin has caused widespread concerns in cattle produce. Using a comparative genomic method, two specific targets like SeD_A1118 and SeD_A2283 for S. Dublin identification were firstly obtained. An efficient multiplex PCR for S. Dublin detection based on the two novel specific genes and invA was therefore developed.

  14. Bordetella pertussis detection by spectrofluorometry using polymerase chain reaction (PCR) and a molecular beacon probe.

    PubMed

    Poddar, S K; Le, C T

    2001-06-01

    Bordetella pertussis was detected by spectrofluorometry following PCR incorporating a molecular beacon probe in the reaction. A DNA fragment from the tandem repeat sequence region (IS 481) of the genome of B. pertussis was amplified in presence of the probe complementary to an internal segment of the amplified DNA fragment. Fluorescein (FAM) and DABCYL were used as the fluorophore and quencher in the probe. The probe was characterized for its signal to noise ratio by homogeneous solution hybridization with a complementary oligonucleotide. Measurement of fluorescent signal at the emission maxima of FAM, immediately after a PCR was used to detect the B. pertussis target, with no additional steps. Presence of B. pertussis in a sample was also examined by agarose gel electrophoresis of the PCR product. A serial diluted stock of B. pertussis (ATCC strain #9797) and fourteen clinical isolates of B. pertussis were examined. The sensitivity of detection by fluorescent measurement was found to be at least in the range of 0.01-0.1 CFU per 10 microl of the sample and was equal to or better than that detected by agarose gel analysis.

  15. DOUBLE COMPACT OBJECTS. III. GRAVITATIONAL-WAVE DETECTION RATES

    SciTech Connect

    Dominik, Michal; Belczynski, Krzysztof; Bulik, Tomasz; Berti, Emanuele; O’Shaughnessy, Richard; Mandel, Ilya; Fryer, Christopher; Holz, Daniel E.; Pannarale, Francesco

    2015-06-20

    The unprecedented range of second-generation gravitational-wave (GW) observatories calls for refining the predictions of potential sources and detection rates. The coalescence of double compact objects (DCOs)—i.e., neutron star–neutron star (NS–NS), black hole–neutron star (BH–NS), and black hole–black hole (BH–BH) binary systems—is the most promising source of GWs for these detectors. We compute detection rates of coalescing DCOs in second-generation GW detectors using the latest models for their cosmological evolution, and implementing inspiral-merger-ringdown gravitational waveform models in our signal-to-noise ratio calculations. We find that (1) the inclusion of the merger/ringdown portion of the signal does not significantly affect rates for NS–NS and BH–NS systems, but it boosts rates by a factor of ∼1.5 for BH–BH systems; (2) in almost all of our models BH–BH systems yield by far the largest rates, followed by NS–NS and BH–NS systems, respectively; and (3) a majority of the detectable BH–BH systems were formed in the early universe in low-metallicity environments. We make predictions for the distributions of detected binaries and discuss what the first GW detections will teach us about the astrophysics underlying binary formation and evolution.

  16. Autonomous detection of aerosolized biological agents by multiplexed immunoassay with polymerase chain reaction confirmation.

    PubMed

    Hindson, Benjamin J; McBride, Mary T; Makarewicz, Anthony J; Henderer, Bruce D; Setlur, Ujwal S; Smith, Sally M; Gutierrez, Dora M; Metz, Thomas R; Nasarabadi, Shanavaz L; Venkateswaran, Kodumudi S; Farrow, Stephen W; Colston, Bill W; Dzenitis, John M

    2005-01-01

    The autonomous pathogen detection system (APDS) is an automated, podium-sized instrument that continuously monitors the air for biological threat agents (bacteria, viruses, and toxins). The system has been developed to warn of a biological attack in critical or high-traffic facilities and at special events. The APDS performs continuous aerosol collection, sample preparation, and detection using multiplexed immunoassay followed by confirmatory PCR using real-time TaqMan assays. We have integrated completely reusable flow-through devices that perform DNA extraction and PCR amplification. The fully integrated system was challenged with aerosolized Bacillus anthracis, Yersinia pestis, Bacillus globigii, and botulinum toxoid. By coupling highly selective antibody- and DNA-based assays, the probability of an APDS reporting a false positive is extremely low. PMID:15623307

  17. Detection of human tumor cells by amplicon fusion site polymerase chain reaction (AFS-PCR)

    PubMed Central

    Weber, Axel; Taube, Sylvia; Starke, Sven; Bergmann, Eckhard; Christiansen, Nina Merete; Christiansen, Holger

    2011-01-01

    Reliable diagnostic strategies for individuals with cancer demand practical methods for highly sensitive and specific detection of tumor cells. Amplification of genomic regions that include putative oncogenes is common in tumor cells of various types. Genomic array platforms offer the opportunity to identify and precisely map amplified genomic regions (ampGRs). The stable existence of these tumor cell–specific genomic aberrations during and after therapy, in theory, make ampGRs optimal targets for cancer diagnostics. In this study, we mapped ampGRs around the proto-oncogene MYCN of human neuroblastomas using a high-resolution tiling array (HR-TA). Based on the HR-TA data, we were able to precisely describe the telomeric and centromeric borders of the ampGRs and deduce virtual fusion sites of the joined ampGRs (amplicon fusion sites [AFSs]). These AFSs served as blueprints for the subsequent design of AFS bridging PCR assays (AFS-PCRs). Strikingly, these assays were absolutely tumor cell specific and capable of detecting 1 tumor cell in 1 × 106 to 8 × 106 control cells. We successfully proved the in vivo practicability of AFS-PCR by detecting and quantifying the specific AFS DNA of human MYCN-amplified neuroblastomas in the patients’ corresponding peripheral blood and bone marrow samples. Thus, we believe AFS-PCR could become a powerful and nevertheless feasible personalized diagnostic tool applicable to a large number of cancer patients, including children with MYCN-amplified neuroblastomas. PMID:21293059

  18. Detection of human tumor cells by amplicon fusion site polymerase chain reaction (AFS-PCR).

    PubMed

    Weber, Axel; Taube, Sylvia; Starke, Sven; Bergmann, Eckhard; Christiansen, Nina Merete; Christiansen, Holger

    2011-02-01

    Reliable diagnostic strategies for individuals with cancer demand practical methods for highly sensitive and specific detection of tumor cells. Amplification of genomic regions that include putative oncogenes is common in tumor cells of various types. Genomic array platforms offer the opportunity to identify and precisely map amplified genomic regions (ampGRs). The stable existence of these tumor cell–specific genomic aberrations during and after therapy, in theory, make ampGRs optimal targets for cancer diagnostics. In this study, we mapped ampGRs around the proto-oncogene MYCN of human neuroblastomas using a high-resolution tiling array (HR-TA). Based on the HR-TA data, we were able to precisely describe the telomeric and centromeric borders of the ampGRs and deduce virtual fusion sites of the joined ampGRs (amplicon fusion sites [AFSs]). These AFSs served as blueprints for the subsequent design of AFS bridging PCR assays (AFS-PCRs). Strikingly, these assays were absolutely tumor cell specific and capable of detecting 1 tumor cell in 1 × 10(6) to 8 × 10(6) control cells. We successfully proved the in vivo practicability of AFS-PCR by detecting and quantifying the specific AFS DNA of human MYCN-amplified neuroblastomas in the patients’ corresponding peripheral blood and bone marrow samples. Thus, we believe AFS-PCR could become a powerful and nevertheless feasible personalized diagnostic tool applicable to a large number of cancer patients, including children with MYCN-amplified neuroblastomas.

  19. Differential detection of shrimp and crab for food labeling using polymerase chain reaction.

    PubMed

    Taguchi, Hiromu; Watanabe, Satoshi; Temmei, Yusuke; Hirao, Takashi; Akiyama, Hiroshi; Sakai, Shinobu; Adachi, Reiko; Sakata, Kozue; Urisu, Atsuo; Teshima, Reiko

    2011-04-27

    Shrimp and crab are well-known as allergenic ingredients. According to Japanese food allergy labeling regulations, shrimp species (including prawns, crayfishes, and lobsters) and crab species must be differentially declared when ≥10 ppm (total protein) of an allergenic ingredient is present. However, the commercial ELISA tests for the detection of crustacean proteins cannot differentiate between shrimp and crab. Therefore, two methods were developed to discriminate shrimp and crab: a shrimp-PCR method with postamplification digestion and a crab-PCR method that specifically amplifies a fragment of the 16S rRNA gene. The sensitivity and specificity of both PCR methods were verified by experiments using DNA extracted from 15 shrimp species, 13 crab species, krill, mysid, mantis shrimp, other food samples (cephalopod, shellfish, and fish), incurred foods, and commercial food products. Both PCR methods could detect 5 pg of DNA extracted from target species and 50 ng of genomic DNA extracted from incurred foods containing 10 ppm (μg/g) total protein of shrimp or crab. The two PCR methods were considered to be specific enough to separately detect species belonging to shrimp and crab. Although false-positive and false-negative results were obtained from some nontarget crustacean species, the proposed PCR methods, when used in conjunction with ELISA tests, would be a useful tool for confirmation of the validity of food allergy labeling and management of processed food safety for allergic patients. PMID:21395255

  20. Detection of Torque teno virus DNA in exhaled breath by polymerase chain reaction.

    PubMed

    Chikasue, Kumiko; Kimura, Miyuki; Ikeda, Kazuyuki; Ohnishi, Takuma; Kawanishi, Satoshi; Iio, Tomoe; Kataoka, Mikio; Arao, Yujiro

    2012-01-01

    To determine whether exhaled breath contains Torque teno virus (TTV) or not, we tested exhaled breath condensate (EBC) samples by semi-nested PCR assay. We detected TTV DNA in 35% (7/20) of EBC samples collected from the mouth of one of the authors, demonstrating that TTV DNA is excreted in exhaled breath with moderate frequency. TTV DNA was detected also in oral EBC samples from 4 of 6 other authors, indicating that TTV DNA excretion in exhaled breath is not an exception but rather a common phenomenon. Furthermore, the same assay could amplify TTV DNA from room air condensate (RAC) samples collected at distances of 20 and 40cm from a human face with 40 (8/20) and 35% (7/20) positive rates, respectively. TTV transmission has been reported to occur during infancy. These distances seem equivalent to that between an infant and its household members while caring for the infant. Taken together, it seems that exhaled breath is one of the possible transmission routes of TTV. We also detected TTV DNA in 25% (10/40) of RAC samples collected at a distance of more than 180cm from any human face, suggesting the risk of airborne infection with TTV in a room. PMID:23093057

  1. Avian haemosporidian parasites (Haemosporida): A comparative analysis of different polymerase chain reaction assays in detection of mixed infections.

    PubMed

    Bernotienė, Rasa; Palinauskas, Vaidas; Iezhova, Tatjana; Murauskaitė, Dovilė; Valkiūnas, Gediminas

    2016-04-01

    Mixed infections of different species and genetic lineages of haemosporidian parasites (Haemosporida) predominate in wildlife, and such infections are particularly virulent. However, currently used polymerase chain reaction (PCR)-based detection methods often do not read mixed infections. Sensitivity of different PCR assays in detection of mixed infections has been insufficiently tested, but this knowledge is essential in studies addressing parasite diversity in wildlife. Here, we applied five different PCR assays, which are broadly used in wildlife avian haemosporidian research, and compared their sensitivity in detection of experimentally designed mixed infections of Haemoproteus and Plasmodium parasites. Three of these PCR assays use primer sets that amplify fragments of cytochrome b gene (cyt b), one of cytochrome oxidase subunit I (COI) gene, and one target apicoplast genome. We collected blood from wild-caught birds and, using microscopic and PCR-based methods applied in parallel, identified single infections of ten haemosporidian species with similar parasitemia. Then, we prepared 15 experimental mixes of different haemosporidian parasites, which often are present simultaneously in wild birds. Similar concentration of total DNA was used in each parasite lineage during preparation of mixes. Positive amplifications were sequenced, and the presence of mixed infections was reported by visualising double-base calling in sequence electropherograms. This study shows that the use of each single PCR assay markedly underestimates biodiversity of haemosporidian parasites. The application of at least 3 PCR assays in parallel detected the majority, but still not all lineages present in mixed infections. We determined preferences of different primers in detection of parasites belonging to different genera of haemosporidians during mixed infections.

  2. Comparison of RNA isolation and associated methods for extracellular RNA detection by high-throughput quantitative polymerase chain reaction.

    PubMed

    Tanriverdi, Kahraman; Kucukural, Alper; Mikhalev, Ekaterina; Tanriverdi, Selim E; Lee, Rosalind; Ambros, Victor R; Freedman, Jane E

    2016-05-15

    MicroRNAs (miRNAs) are small noncoding RNA molecules that function in RNA silencing and posttranscriptional regulation of gene expression. miRNAs in biofluids are being used for clinical diagnosis as well as disease prediction. Efficient and reproducible isolation methods are crucial for extracellular RNA detection. To determine the best methodologies for miRNA detection from plasma, the performance of four RNA extraction kits, including an in-house kit, were determined with miScript miRNA assay technology; all were measured using a high-throughput quantitative polymerase chain reaction (qPCR) platform (BioMark System) with 90 human miRNA assays. In addition, the performances of complementary DNA (cDNA) and preamplification kits for TaqMan miRNA assays and miScript miRNA assays were compared using the same 90 miRNAs on the BioMark System. There were significant quantification cycle (Cq) value differences for the detection of miRNA targets between isolation kits. cDNA, preamplification, and qPCR performances were also varied. In summary, this study demonstrates differences among RNA isolation methods as measured by reverse transcription (RT)-qPCR. Importantly, differences were also noted in cDNA and preamplification performance using TaqMan and miScript. The in-house kit performed better than the other three kits. These findings demonstrate significant variability between isolation and detection methods for low-abundant miRNA detection from biofluids. PMID:26969789

  3. Detection of HLA-DRB1 microchimerism using nested polymerase chain reaction and single-strand conformation polymorphism analysis.

    PubMed

    Song, Eun Young; Chung, Hye Yoon; Joo, Shin Young; Roh, Eun Youn; Seong, Moon-Woo; Shin, Yunsu; Park, Myoung Hee

    2012-03-01

    For the detection of microchimerism, molecular methods detecting donor-specific HLA-DRB1 alleles in the recipient are most commonly used. Nested polymerase chain reaction sequence specific primer (nested PCR-SSP) methods widely used to increase the sensitivity of detection have been reported to give frequent false-positive reactions. We have developed a new method combining nested PCR with single-strand conformation polymorphism analysis (nested PCR-SSCP) and tested the 1 to 0.00001% level of microchimerism for 27 different HLA-DRB1 alleles. For most (26/27) of the HLA-DRB1 alleles tested, this method could detect 0.01 to 0.001% of microchimerism and its sensitivity was equal to or better than that of nested PCR-SSP tested in parallel. Its specificity was verified by visualizing particular DRB1-specific SSCP bands under test. Nested PCR-SSP indicated frequent false-positive reactions, mainly caused by nonspecific amplification of DRB3/B4/B5 alleles present in the major (recipient) DNAs. We have compared a real-time quantitative PCR for non-human leukocyte antigen (HLA) target (insertion/deletion marker) using a commercial kit (AlleleSEQR Chimerism assay), and its microchimerism detection sensitivity (around 0.1%) was 1 step (10 times) lower than that of nested PCR-SSP or -SSCP methods for HLA-DRB1 alleles. We validated that the newly designed nested PCR-SSCP affords good sensitivity and specificity and may be useful for studying microchimerism in clinical settings.

  4. Detection of hemophilia a carriers in Azeri Turkish population of Iran: usefulness of HindIII and BclI markers.

    PubMed

    Moharrami, Tamouchin; Derakhshan, Sima Mansoori; Pourfeizi, Abbas Ali H; Khaniani, Mahmoud Shekari

    2015-11-01

    Hemophilia A (HA) is an inherited X-linked coagulation disorder caused by the deficiency of factor VIII (FVIII). Linkage analysis is a common indirect method for the detection of female carriers in families with HA. In the current study, 173 patients from 30 unrelated families with HA were recruited from the Azeri Turkish population of northwest Iran and analyzed for BclI and HindIII markers by polymerase chain reaction-restriction fragment length polymorphism. We investigated the potential of using these markers for the detection of mutation in carriers through linkage analysis, which would be of tremendous use in prenatal diagnosis. Among the tested women, 47% and 35% were found to be heterozygous for BclI and HindIII polymorphic markers, respectively. The BclI and HindIII markers were informative for the detection of 63% and 17% potential carriers, respectively, demonstrating the effectiveness of the BclI marker for the detection of HA carriers among the Azeri Turkish population.

  5. Replication Fidelity of Escherichia Coli DNA Polymerase III Holoenzyme in Vitro and Repair of Heteroduplex DNA with Multibase Loops in Vivo.

    NASA Astrophysics Data System (ADS)

    Carraway, Margaretha Bernardina Maria

    The genetic integrity of an organism is maintained by accurate replication and correction of asymmetry in the DNA. To study replication fidelity, single-stranded plasmid DNA containing the mnt gene, was replicated in vitro with DNA polymerase III holoenzyme by extension of a complimentary annealed primer. On this plasmid the mnt region is fused to a promoterless tet gene. Accurate replication of mnt generates a tetracycline sensitive phenotype, errors in replication are identified by mutation to tetracycline resistance. Mismatch repair deficient mutH cells were transformed to ampicillin-resistance by replicated circles. The mutations in mnt were identified by replica plating and selecting for tetracycline resistant cells. The mutation rate was 1 in 100,000. DNA sequence analysis of 65 isolates identified 33 single base changes, 20 deletions and 12 concurrent deletions and insertions. Except for the deletions and substitutions, identical mutations were isolated in vivo in mismatch repair deficient cells. Therefore, in vitro replication errors resemble those isolated in vivo. Heteroduplexes with loops occur as a result of replication or recombination. To examine if E. coli converts these molecules to a homoduplex via DNA repair, plasmid heteroduplexes with loops of 5, 7, 9, 192, 410 or 514 bases in mnt were constructed. Conversion was examined by tranforming the plasmid heteroduplexes into E. coli lysogens which had a non-functional mnt gene fused to a promoterless lac gene. Repair of the heteroduplex to wild type yields white/tetracycline sensitive colonies; repair to the mutant yields red/tetracycline resistant colonies and no repair results in red-white (mixed)/tetracycline resistant colonies. No significant change in colony color distribution was observed when the heteroduplexes were transformed into wild type and the following mutant strains: pcnB, mutS, recA, recD, recBC sbcBC, recF, recJ, recR, recN, recO, recG ruvC, ruvB, lexA3, lexA51, uvrA, recBC sbcBC rec

  6. Detection and serogroup determination of Neisseria meningitidis in CSF by polymerase chain reaction (PCR).

    PubMed

    Porritt, R J; Mercer, J L; Munro, R

    2000-02-01

    A PCR protocol for the detection and serogroup determination of Neisseria meningitidis in CSF from 85 cases of suspected meningitis was evaluated. Screening assays for both IS1106 and the ctrA gene were used to detect meningococcal DNA, and a further two assays using the siaD gene were performed to determine the serogroup. PCR results were compared with results of bacteriological culture and discrepant results resolved by analysis of clinical data and further laboratory test results. The resolved sensitivity and specificity of the PCR screening assay were 89 and 100%, and those of bacteriological culture were 37 and 100%, respectively. The siaD B/C PCR assay was able to determine a serogroup in 85% of cases positive by the PCR screening assay compared with 50% of cases where a serogroup was determined by traditional methods. PCR is a useful tool for diagnosis of meningococcal meningitis when Gram stain and culture tests are negative, a situation that may arise when antibiotic treatment has commenced prior to lumbar puncture.

  7. Fluorescence detection test by black printed circuit board based microfluidic channel for polymerase chain reaction.

    PubMed

    Hwang, Ji-Soo; Kim, Yu-Seop; Song, Hye-Jeong; Kim, Jong-Dae; Park, Chan-Young

    2015-01-01

    This paper proposes the optimal structure of a PCB-based micro PCR chip constructed on a PCB substrate using commercial adhesive tapes and plastic covers. The solder mask of the PCB substrate was coated black, and the area where the reaction chamber is attached was legend printed with white silk to minimize the noise during fluorescence detection. The performance of the PCR and fluorescence detection was compared using 6 types of reaction chambers, each made with different double-sided tapes. Three of the chambers were unsuccessful in completing the PCR. The performance of the other three chambers that successfully amplified DNA was compared using Taqman probe for Chlamydia Trachomatis DNA. The amplified product was illuminated diagonally with a blue LED to excite the product just before imaging, and the LED was turned off when the image was captured to prevent quenching of the probe. The images were taken 10 seconds prior to the last extension step for each cycle using a DSLR camera. The experiments were run as a quartet for each three chambers made with different double-sided tape. The results showed that there were significant difference between the three tapes. PMID:26409548

  8. Detection and differentiation of the six Brucella species by polymerase chain reaction.

    PubMed Central

    Sifuentes-Rincón, A. M.; Revol, A.; Barrera-Saldaña, H. A.

    1997-01-01

    BACKGROUND: Brucelosis is a severe acute febrile disease caused by bacteria of the genus Brucella. Its current diagnosis is based on clinical observations that may be complemented by serology and microbiological culture tests; however, the former is limited in sensitivity and specificity, the latter is time consuming. To improve brucelosis diagnosis we developed a test which is specific and sensitive and is capable of differentiating the six species of Brucella. MATERIALS AND METHODS: Four primers were designed from B. abortus sequences at the well-conserved Omp2 locus that are able to amplify the DNAs of all six species of Brucella. RESULTS: Our test detected all six species of Brucella. Their differentiation resulted directly from differences in the amplification patterns or was achieved indirectly using a RFLP present in one of the PCR products. The sensitivity and specificity of the new test were then determined; it was applied successfully in confirming the diagnosis of a patient whose clinical history and serology indicated infection with Brucella. CONCLUSIONS: The results make possible the use of a PCR test for Brucella detection and differentiation without relying on the measurement of the antibodies or microorganism culture. Our first results showed that the PCR test can confirm the presence of Brucella in blood samples of infected patients. Images FIG. 2 FIG. 3 FIG. 4 FIG. 5 PMID:9407549

  9. Polymerase chain reaction detection of naturally occurring Campylobacter in commercial broiler chicken embryos.

    PubMed

    Hiett, K L; Cox, N A; Rothrock, M J

    2013-04-01

    Campylobacter, a foodborne pathogen closely associated with poultry, is recognized as a leading bacterial etiologic agent of human gastroenteritis in the United States. In this investigation, 2 trials were performed where tissues from 7-, 14/15-, and 19-d-old commercial broiler chicken embryos were tested for the presence of Campylobacter using both culturing methodology and PCR. Conventional culturing methods failed to detect Campylobacter from any samples tested during this investigation. Using a set of primers specific for the Campylobacter flagellinA short variable region (flaA SVR), Campylobacter DNA was amplified in 100, 80, and 100% of gastrointestinal tracts from 7-, 15-, and 19-d-old embryos, respectively, in the first trial. Similarly, Campylobacter DNA was detected in 100, 70, and 60% of gastrointestinal tracts of 7-, 14-, and 18-d-old embryos, respectively, in the second trial. In both trials, yolk sac, albumin, and liver/gallbladder samples from 19-d-old embryos all failed to produce amplicons indicative of Campylobacter DNA. Subsequent DNA sequence analyses of the flaA SVR PCR products were consistent with the amplicon arising from Campylobacter. Although a determination of whether the Campylobacter was living or dead within the embryos could not be made, these results demonstrate that Campylobacter-specific DNA is present within the gastrointestinal tract of broiler chicken embryos; however, the means by which it is present and the relative contribution to subsequent Campylobacter contamination of poultry flocks requires further investigation.

  10. Rapid detection of vesicular stomatitis virus New Jersey serotype in clinical samples by using polymerase chain reaction.

    PubMed Central

    Rodriguez, L L; Letchworth, G J; Spiropoulou, C F; Nichol, S T

    1993-01-01

    Vesicular stomatitis virus of the New Jersey serotype (VSV-NJ) causes vesicular disease in cattle, pigs, and horses throughout the Americas. Vesicular disease is clinically indistinguishable from foot-and-mouth disease (FMD). Therefore, outbreaks of vesicular disease in FMD-free areas must be rapidly diagnosed by laboratory methods and affected farms must be quarantined until laboratory results confirm the absence of FMD. Diagnosis is currently performed in high-containment (biosafety level 3) laboratories by using complement fixation and virus isolation in tissue culture. We describe here an alternative method for the detection of VSV-NJ RNA in clinical samples. This method includes a rapid acid guanidine-phenol RNA extraction procedure coupled with a one-tube polymerase chain reaction (PCR) using reverse transcriptase. By using this test, we were able to detect the largest number of positive samples (53 of 58), followed by complement (48 of 58) and isolation in tissue culture (43 of 58). The primers chosen for this assay amplify a 642-nucleotide region of the phosphoprotein gene of VSV-NJ but not of VSV-IN. Sequencing of the PCR product enables genetic typing of virus isolates and epidemiological studies. Since no infectious materials are necessary to perform this test and any infectious virus in clinical samples is destroyed by acid guanidine-phenol treatment, diagnosis can be safely performed in regular diagnostic laboratories. Images PMID:8396584

  11. Rapid detection of HLA-B*51 by real-time polymerase chain reaction and high-resolution melting analysis.

    PubMed

    Imperiali, C; Alía-Ramos, P; Padró-Miquel, A

    2015-08-01

    HLA-B*51, a class I human leukocyte antigen (HLA) molecule, is the strongest known genetic risk factor for Behçet disease. However, there are only few articles reporting methods to determine the presence or absence of HLA-B51. For this reason, we designed and developed an easy, fast, and inexpensive real-time high-resolution melting (HRM) assay to detect HLA-B*51. We genotyped 61 samples by our HRM assay and by conventional polymerase chain reaction, and no discrepancies were found between results. Besides, a subgroup of 25 samples was also genotyped in a different laboratory, and another subgroup of 16 samples was obtained from the International Histocompatibility Working Group DNA Bank, and a full concordance of results was observed with those obtained by HRM. Regarding the identifying system evaluated, we obtained 100% of specificity, sensibility, and repeatability, and 0% of false positive and false negative rates. Therefore, this HRM analysis is easily applicable to the rapid detection of HLA-B*51, exhibits a high speed, and requires a very low budget. PMID:26176813

  12. Vaginal micropapillary lesions are not related to human papillomavirus infection: in situ hybridization and polymerase chain reaction detection techniques.

    PubMed

    Garzetti, G G; Ciavattini, A; Goteri, G; Menzo, S; De Nictolis, M; Clementi, M; Brugia, M; Romanini, C

    1994-01-01

    The objective of this study was to assess the human papillomavirus DNA presence in vaginal papillary lesions, with particular regard to micropapillomatosis to better define their clinical significance. Prospective study: the study population was composed of 62 women who were recruited consecutively from the Colposcopy Centre of the Ancona University, Department of Obstetrics and Gynecology, on the grounds of vaginal papillomatosis or/and typical acuminata warts. Biopsies for routine histology, and for human papillomavirus (HPV) DNA detection by means of in situ hybridization and polymerase chain reaction (PCR) were taken from the papillary lesions and from 24 healthy women, who were selected as controls. Macroscopically, vaginal micropapillomatosis was ascertained in 51 cases (82.3%), while in 11 cases (17.7%) the colposcopic diagnosis was condyloma acuminatum. During in situ hybridization, HPV DNA positivity was observed in 8 (9.4%) out of 85 samples of squamous papillae and in 11 (64.7%) out of 17 samples of condylomata; in control specimens, HPV DNA was detected in 2 (8.3%) out of 24 bioptic samples. The correspondence between in situ hybridization and PCR was 96.1%, with 17.4% more diagnosis obtained by PCR. Vaginal micropapillomatosis may be regarded as a variation in the normal anatomy of the lower genital tract without any significant relationship with HPV infection, and as a lesion easily distinguishable from condylomata acuminata by clinical examination alone. PMID:7959342

  13. Field-deployable real-time polymerase chain reaction detection of bluetongue and epizootic haemorrhagic disease viral ribonucleic acid.

    PubMed

    Wilson, W C; Stallknecht, D E; Mecham, J O

    2004-01-01

    Nucleic acid sequence information from molecular evolution studies of bluetongue virus (BTV) and related epizootic haemorrhagic disease virus (EHDV) strains has resulted in a large database of genomic information. Published sequence data and sequence data from our laboratory were used to design real-time field-deployable reverse transcriptase-polymerase chain reaction assays for the detection of BTV or EHDV viral RNA. The assays used standard RNA extraction and TaqMan chemistries and the entire process was completed in detection and the ability to monitor disease outbreaks.

  14. Rapid detection of HLA-B*51 by real-time polymerase chain reaction and high-resolution melting analysis.

    PubMed

    Imperiali, C; Alía-Ramos, P; Padró-Miquel, A

    2015-08-01

    HLA-B*51, a class I human leukocyte antigen (HLA) molecule, is the strongest known genetic risk factor for Behçet disease. However, there are only few articles reporting methods to determine the presence or absence of HLA-B51. For this reason, we designed and developed an easy, fast, and inexpensive real-time high-resolution melting (HRM) assay to detect HLA-B*51. We genotyped 61 samples by our HRM assay and by conventional polymerase chain reaction, and no discrepancies were found between results. Besides, a subgroup of 25 samples was also genotyped in a different laboratory, and another subgroup of 16 samples was obtained from the International Histocompatibility Working Group DNA Bank, and a full concordance of results was observed with those obtained by HRM. Regarding the identifying system evaluated, we obtained 100% of specificity, sensibility, and repeatability, and 0% of false positive and false negative rates. Therefore, this HRM analysis is easily applicable to the rapid detection of HLA-B*51, exhibits a high speed, and requires a very low budget.

  15. Comparison between Culture and a Multiplex Quantitative Real-Time Polymerase Chain Reaction Assay Detecting Ureaplasma urealyticum and U. parvum

    PubMed Central

    Frølund, Maria; Björnelius, Eva; Lidbrink, Peter; Ahrens, Peter; Jensen, Jørgen Skov

    2014-01-01

    A novel multiplex quantitative real-time polymerase chain reaction (qPCR) for simultaneous detection of U. urealyticum and U. parvum was developed and compared with quantitative culture in Shepard's 10 C medium for ureaplasmas in urethral swabs from 129 men and 66 women, and cervical swabs from 61 women. Using culture as the gold standard, the sensitivity of the qPCR was 96% and 95% for female urethral and cervical swabs, respectively. In male urethral swabs the sensitivity was 89%. The corresponding specificities were 100%, 87% and 99%. The qPCR showed a linear increasing DNA copy number with increasing colour-changing units. Although slightly less sensitive than culture, this multiplex qPCR assay detecting U. urealyticum and U. parvum constitutes a simple and fast alternative to the traditional methods for identification of ureaplasmas and allows simultaneous species differentiation and quantitation in clinical samples. Furthermore, specimens overgrown by other bacteria using the culture method can be evaluated in the qPCR. PMID:25047036

  16. Development of a new duplex real-time polymerase chain reaction assay for detection of dicer in G. gallus.

    PubMed

    Ji, Xiaolin; Wang, Qi; Gao, Yulong; Wang, Yongqiang; Qin, Liting; Qi, Xiaole; Gao, Honglei; Wang, Xiaomei

    2013-05-01

    Recently, there has been a growing body of evidence showing that cellular microRNAs (miRNAs) are involved in virus-host interactions. Numerous studies have focused on analyses of the expression profiles of cellular miRNAs, but the expression patterns of Dicer, which is responsible for the generation of miRNAs, have only rarely been explored in Gallus gallus. We developed a duplex realtime reverse transcriptase polymerase chain reaction (RTPCR) assay for the relative quantification of the mRNAs of Dicer and beta-actin in G. gallus. To apply this method, the expression of Dicer in avian cells after infection with avian leukosis virus subgroup J (ALV-J) was detected using our established duplex real-time RT-PCR. The duplex realtime RT-PCR assay is sufficiently sensitive, specific, accurate, reproducible, and cost-effective for the detection of Dicer in G. gallus. Furthermore, this study, for the first time, demonstrated that ALV-J can induce differential expression of Dicer mRNA in the ALV-J-infected cells.

  17. Development of melting temperature-based SYBR Green I polymerase chain reaction methods for multiplex genetically modified organism detection.

    PubMed

    Hernández, Marta; Rodríguez-Lázaro, David; Esteve, Teresa; Prat, Salomé; Pla, Maria

    2003-12-15

    Commercialization of several genetically modified crops has been approved worldwide to date. Uniplex polymerase chain reaction (PCR)-based methods to identify these different insertion events have been developed, but their use in the analysis of all commercially available genetically modified organisms (GMOs) is becoming progressively insufficient. These methods require a large number of assays to detect all possible GMOs present in the sample and thereby the development of multiplex PCR systems using combined probes and primers targeted to sequences specific to various GMOs is needed for detection of this increasing number of GMOs. Here we report on the development of a multiplex real-time PCR suitable for multiple GMO identification, based on the intercalating dye SYBR Green I and the analysis of the melting curves of the amplified products. Using this method, different amplification products specific for Maximizer 176, Bt11, MON810, and GA21 maize and for GTS 40-3-2 soybean were obtained and identified by their specific Tm. We have combined amplification of these products in a number of multiplex reactions and show the suitability of the methods for identification of GMOs with a sensitivity of 0.1% in duplex reactions. The described methods offer an economic and simple alternative to real-time PCR systems based on sequence-specific probes (i.e., TaqMan chemistry). These methods can be used as selection tests and further optimized for uniplex GMO quantification.

  18. Cationic polyelectrolyte functionalized magnetic particles assisted highly sensitive pathogens detection in combination with polymerase chain reaction and capillary electrophoresis.

    PubMed

    Chen, Jia; Lin, Yuexin; Wang, Yu; Jia, Li

    2015-06-01

    Pathogenic bacteria cause significant morbidity and mortality to humans. There is a pressing need to establish a simple and reliable method to detect them. Herein, we show that magnetic particles (MPs) can be functionalized by poly(diallyl dimethylammonium chloride) (PDDA), and the particles (PDDA-MPs) can be utilized as adsorbents for capture of pathogenic bacteria from aqueous solution based on electrostatic interaction. The as-prepared PDDA-MPs were characterized by Fourier-transform infrared spectroscopy, zeta potential, vibrating sample magnetometry, X-ray diffraction spectrometry, scanning electron microscopy, and transmission electron microscopy. The adsorption equilibrium time can be achieved in 3min. According to the Langmuir adsorption isotherm, the maximum adsorption capacities for E. coli O157:H7 (Gram-negative bacteria) and L. monocytogenes (Gram-positive bacteria) were calculated to be 1.8×10(9) and 3.1×10(9)cfumg(-1), respectively. The bacteria in spiked mineral water (1000mL) can be completely captured when applying 50mg of PDDA-MPs and an adsorption time of 5min. In addition, PDDA-MPs-based magnetic separation method in combination with polymerase chain reaction and capillary electrophoresis allows for rapid detection of 10(1)cfumL(-1) bacteria.

  19. Use of dried blood spot specimens in the detection of human immunodeficiency virus type 1 by the polymerase chain reaction.

    PubMed Central

    Cassol, S; Salas, T; Arella, M; Neumann, P; Schechter, M T; O'Shaughnessy, M

    1991-01-01

    Dried blood spots (DBSs) constitute a potentially valuable source of material for human immunodeficiency virus (HIV) serologic and molecular testing. To facilitate molecular testing, we have adapted the polymerase chain reaction (PCR) to the detection of HIV proviral DNA in DBS samples. The method is highly reproducible, with 75 microliters of whole dried blood providing sufficient DNA for duplicate testing with three primer sets. By using DBS PCR, 66 of 69 (95.6%) seropositive at-risk individuals tested positive by at least two primer sets and 85 of 85 (100%) low-risk seronegative blood donors tested negative by all three sets of primers. The frequency of HIV DNA detection in seronegative at-risk individuals was low, with only 1 of 58 (1.7%) individuals testing positive. These results show that in a clinical environment, HIV PCR analysis of DBS specimens is specific and sensitive. The method is cost effective and presents a useful alternative to the isolation of HIV from seropositive babies with an undefined infection status. Images PMID:1890166

  20. A multiplex quantitative real-time polymerase chain reaction panel for detecting neurologic pathogens in dogs with meningoencephalitis.

    PubMed

    Han, Jae-Ik; Chang, Dong-Woo; Na, Ki-Jeong

    2015-01-01

    Meningoencephalitis (ME) is a common inflammatory disorder of the central nervous system in dogs. Clinically, ME has both infectious and non-infectious causes. In the present study, a multiplex quantitative real-time polymerase chain reaction (mqPCR) panel was optimized for the detection of eight canine neurologic pathogens (Blastomyces dermatitidis, Cryptococcus spp., Neospora caninum, Borrelia burgdorferi, Bartonella spp., Toxoplasma gondii, Ehrlichia canis, and canine distemper virus [CDV]). The mqPCR panel was subsequently applied to 53 cerebrospinal fluid (CSF) samples collected from dogs with ME. The analytic sensitivity (i.e., limit of detection, expressed as molecules per 1 mL of recombinant vector) was 3.8 for CDV, 3.7 for Ehrlichia canis, 3.7 for Bartonella spp., 3.8 for Borrelia burgdorferi, 3.7 for Blastomyces dermatitidis, 3.7 for Cryptococcus spp., 38 for Neospora caninum, and 3.7 for Toxoplasma gondii. Among the tested CSF samples, seven (15%) were positive for the following pathogens in decreasing order of frequency: Cryptococcus spp. (3/7), Blastomyces dermatitidis (2/7), and Borrelia burgdorferi (2/7). In summary, use of an mqPCR panel with high analytic sensitivity as an initial screen for infectious agents in dogs with ME could facilitate the selection of early treatment strategies and improve outcomes. PMID:26040611

  1. Electrochemical Branched-DNA Assay for Polymerase Chain Reaction-Free Detection and Quantification of Oncogenes in Messenger RNA

    SciTech Connect

    Lee, Ai Cheng; Dai, Ziyu; Chen, Baowei; Wu, Hong; Wang, Jun; Zhang, Aiguo; Zhang, Lurong; Lim, Tit-Meng; Lin, Yuehe

    2008-12-01

    We describe a novel electrochemical branched-DNA (bDNA) assay for polymerase chain reaction (PCR)-free detection and quantification of p185 BCR-ABL leukemia fusion transcript in the population of messenger RNA (mRNA) extracted from cell lines. The bDNA amplifier carrying high loading of alkaline phosphatase (ALP) tracers was used to amplify targets signal. The targets were captured on microplate well surfaces through cooperative sandwich hybridization prior to the labeling of bDNA. The activity of captured ALP was monitored by square-wave voltammetric (SWV) analysis of the electroactive enzymatic product in the presence of 1-napthyl-phosphate. The specificity and sensitivity of assay enabled direct detection of target transcript in as little as 4.6 ng mRNA without PCR amplification. In combination with the use of a well-quantified standard, the electrochemical bDNA assay was capable of direct use for a PCR-free quantitative analysis of target transcript in total mRNA population. The approach thus provides a simple, sensitive, accurate and quantitative tool alternate to the RQ-PCR for early disease diagnosis.

  2. Development of a rapid and sensitive polymerase chain reaction assay for detection of bovine herpesvirus type 1 in bovine semen.

    PubMed Central

    van Engelenburg, F A; Maes, R K; van Oirschot, J T; Rijsewijk, F A

    1993-01-01

    We developed a polymerase chain reaction (PCR) assay to detect bovine herpesvirus type 1 (BHV-1) in bovine semen. Since bovine semen contains components that inhibit PCR amplification, a protocol was developed to purify BHV-1 DNA from bovine semen. To identify failures of PCR amplification, we used an internal control template that was coamplified by the same PCR primers. When separated fractions of BHV-1-contaminated semen were analyzed by the PCR, we found that more than 90% of the BHV-1 DNA was present in a pooled fraction consisting of seminal fluid, nonsperm cells, and virus adsorbed to spermatozoa. By using this fraction, three to five molecules of BHV-1 DNA in 50 microliters of bovine semen could be detected. A pilot study to compare this PCR assay with the routinely used virus isolation method showed that this PCR assay is 2- to 100-fold more sensitive. In addition, the results of the PCR assay are available in 1 day, whereas the virus isolation method takes 7 days. Therefore, the PCR assay may be a good alternative to the virus isolation method. Images PMID:8308103

  3. [Detection of human papillomavirus types 16, 18 and 33 in exfoliated cervical cells by polymerase chain reaction].

    PubMed

    Takahashi, Y; Onoe, T; Chiba, T; Nakamura, T; Hayashi, Y; Hirose, M; Wakuda, K; Yamade, I; Yamamoto, Y; Ishiguro, T

    1991-12-01

    Human papillomavirus (HPV) types 16, 18 and 33 were identified by means of the polymerase chain reaction using exfoliated cells from the uterine cervix in 361 patients. Of 261 patients without cervical lesions, 10(3.8%) patients had HPV DNA whereas 7(70.0%) of 10 patients with invasive cervical carcinomas had HPV DNA. The younger patients' group (29 year-old or less) without cervical lesions had a 6.5% HPV positive rate which was distinctly higher than the older patients' groups. No menopausal patient without cervical lesions had HPV DNA. In the cervical dysplasia group, the HPV DNA positive rate tended to be higher in the older patients. Type 16 was detected more often than types 18 or 33. However, the detectable incidence of type 16 in the follow up group was lower than in the cervical carcinoma groups. The younger patients without cervical lesions had a higher incidence of type 16 than the older patients. The younger patients with cervical neoplastic lesions had a lower incidence of type 16 than the older patients. These results suggest that type 16 has a higher frequency of cervical HPV infections than types 18 and 33. In addition, human papillomavirus is not the only causative factor in cervical carcinomas. PMID:1660508

  4. Bluetongue virus detection: a safer reverse-transcriptase polymerase chain reaction for prediction of viremia in sheep.

    PubMed

    Shad, G; Wilson, W C; Mecham, J O; Evermann, J F

    1997-04-01

    A reversible target capture viral RNA extraction procedure was combined with a reverse-transcriptase nested polymerase chain reaction (PCR) to develop a capture PCR assay providing a rapid and safe prediction method for circulating bluetongue virus in infected ruminants. This new assay was compared with virus isolation and a recently developed antigen-capture enzyme-linked immunosorbent assay (ELISA) for the detection of bluetongue virus. Eight Warhill crossbred sheep were inoculated subcutaneously with bluetongue virus serotype 10, and blood samples were taken sequentially over a period of 28 days. The capture PCR detected the peak of viremia, as determined by virus isolation and antigen-capture ELISA, from day 5 to day 14 after challenge. The results indicate that the rapid-capture bluetongue virus PCR provides a rapid indicator of samples in which virus can be isolated. In addition, this capture bluetongue virus PCR procedure does not require a lengthy phenol extraction or the use of the highly toxic methyl mercury hydroxide denaturant.

  5. A multiplex quantitative real-time polymerase chain reaction panel for detecting neurologic pathogens in dogs with meningoencephalitis

    PubMed Central

    Han, Jae-Ik; Chang, Dong-Woo

    2015-01-01

    Meningoencephalitis (ME) is a common inflammatory disorder of the central nervous system in dogs. Clinically, ME has both infectious and non-infectious causes. In the present study, a multiplex quantitative real-time polymerase chain reaction (mqPCR) panel was optimized for the detection of eight canine neurologic pathogens (Blastomyces dermatitidis, Cryptococcus spp., Neospora caninum, Borrelia burgdorferi, Bartonella spp., Toxoplasma gondii, Ehrlichia canis, and canine distemper virus [CDV]). The mqPCR panel was subsequently applied to 53 cerebrospinal fluid (CSF) samples collected from dogs with ME. The analytic sensitivity (i.e., limit of detection, expressed as molecules per 1 µL of recombinant vector) was 3.8 for CDV, 3.7 for Ehrlichia canis, 3.7 for Bartonella spp., 3.8 for Borrelia burgdorferi, 3.7 for Blastomyces dermatitidis, 3.7 for Cryptococcus spp., 38 for Neospora caninum, and 3.7 for Toxoplasma gondii. Among the tested CSF samples, seven (15%) were positive for the following pathogens in decreasing order of frequency: Cryptococcus spp. (3/7), Blastomyces dermatitidis (2/7), and Borrelia burgdorferi (2/7). In summary, use of an mqPCR panel with high analytic sensitivity as an initial screen for infectious agents in dogs with ME could facilitate the selection of early treatment strategies and improve outcomes. PMID:26040611

  6. Development and deployment of a rapid recombinase polymerase amplification Ebola virus detection assay in Guinea in 2015.

    PubMed

    Faye, Oumar; Faye, Ousmane; Soropogui, Barré; Patel, Pranav; El Wahed, Ahmed Abd; Loucoubar, Cheikh; Fall, Gamou; Kiory, Davy; Magassouba, N'Faly; Keita, Sakoba; Kondé, Mandy Kader; Diallo, Alpha Amadou; Koivogui, Lamine; Karlberg, Helen; Mirazimi, Ali; Nentwich, Oliver; Piepenburg, Olaf; Niedrig, Matthias; Weidmann, Manfred; Sall, Amadou Alpha

    2015-01-01

    In the absence of a vaccine or specific treatments for Ebola virus disease (EVD), early identification of cases is crucial for the control of EVD epidemics. We evaluated a new extraction kit (SpeedXtract (SE), Qiagen) on sera and swabs in combination with an improved diagnostic reverse transcription recombinase polymerase amplification assay for the detection of Ebola virus (EBOV-RT-RPA). The performance of combined extraction and detection was best for swabs. Sensitivity and specificity of the combined SE and EBOV-RT-RPA were tested in a mobile laboratory consisting of a mobile glovebox and a Diagnostics-in-a-Suitcase powered by a battery and solar panel, deployed to Matoto Conakry, Guinea as part of the reinforced surveillance strategy in April 2015 to reach the goal of zero cases. The EBOV-RT-RPA was evaluated in comparison to two real-time PCR assays. Of 928 post-mortem swabs, 120 tested positive, and the combined SE and EBOV-RT-RPA yielded a sensitivity and specificity of 100% in reference to one real-time RT-PCR assay. Another widely used real-time RT-PCR was much less sensitive than expected. Results were provided very fast within 30 to 60 min, and the field deployment of the mobile laboratory helped improve burial management and community engagement.

  7. Rapid and sensitive detection of Little cherry virus 2 using isothermal reverse transcription-recombinase polymerase amplification.

    PubMed

    Mekuria, Tefera A; Zhang, Shulu; Eastwell, Kenneth C

    2014-09-01

    Little cherry virus 2 (LChV2) (genus Ampelovirus) is the primary causal agent of little cherry disease (LCD) in sweet cherry (Prunus avium) in North America and other parts of the world. This mealybug-transmitted virus does not induce significant foliar symptoms in most sweet cherry cultivars, but does cause virus-infected trees to yield unevenly ripened small fruits with poor flavor. Most fruits from infected trees are unmarketable. In the present study, an isothermal reverse transcription-recombinase polymerase amplification (RT-RPA) technique was developed using LChV2 coat protein specific primers and probe. Detection of terminally labeled amplicons was achieved with a high affinity lateral flow strip. The RT-RPA is confirmed to be simple, fast, and specific. In comparison, although it retains the sensitivity of RT-PCR, it is a more cost-effective procedure. RT-RPA will be a very useful tool for detecting LChV2 from crude extracts in any growth stage of sweet cherry from field samples.

  8. Development and deployment of a rapid recombinase polymerase amplification Ebola virus detection assay in Guinea in 2015.

    PubMed

    Faye, Oumar; Faye, Ousmane; Soropogui, Barré; Patel, Pranav; El Wahed, Ahmed Abd; Loucoubar, Cheikh; Fall, Gamou; Kiory, Davy; Magassouba, N'Faly; Keita, Sakoba; Kondé, Mandy Kader; Diallo, Alpha Amadou; Koivogui, Lamine; Karlberg, Helen; Mirazimi, Ali; Nentwich, Oliver; Piepenburg, Olaf; Niedrig, Matthias; Weidmann, Manfred; Sall, Amadou Alpha

    2015-01-01

    In the absence of a vaccine or specific treatments for Ebola virus disease (EVD), early identification of cases is crucial for the control of EVD epidemics. We evaluated a new extraction kit (SpeedXtract (SE), Qiagen) on sera and swabs in combination with an improved diagnostic reverse transcription recombinase polymerase amplification assay for the detection of Ebola virus (EBOV-RT-RPA). The performance of combined extraction and detection was best for swabs. Sensitivity and specificity of the combined SE and EBOV-RT-RPA were tested in a mobile laboratory consisting of a mobile glovebox and a Diagnostics-in-a-Suitcase powered by a battery and solar panel, deployed to Matoto Conakry, Guinea as part of the reinforced surveillance strategy in April 2015 to reach the goal of zero cases. The EBOV-RT-RPA was evaluated in comparison to two real-time PCR assays. Of 928 post-mortem swabs, 120 tested positive, and the combined SE and EBOV-RT-RPA yielded a sensitivity and specificity of 100% in reference to one real-time RT-PCR assay. Another widely used real-time RT-PCR was much less sensitive than expected. Results were provided very fast within 30 to 60 min, and the field deployment of the mobile laboratory helped improve burial management and community engagement. PMID:26558690

  9. Real-time polymerase chain reaction method for detecting contamination of beef by material from genetically engineered cattle.

    PubMed

    Nakajima, Osamu; Akiyama, Hiroshi; Teshima, Reiko

    2009-08-01

    Prion protein knockout (PRNP(-/-)) cattle have been developed and may be used to produce bovine material such as serum, collagen, and gelatin. However, genetically engineered animals (GE animals) must not be imported or made commercially available in Japan, because they are not authorized for food use in Japan. We used real-time polymerase chain reaction (real-time PCR) to develop method of detection for neomycin- and the puromycin-resistance genes in beef samples. Plasmids containing the neomycin-resistance gene and the puromycin-resistance gene were used as standard reference molecules. The results clearly showed that the method we developed is capable of quantitatively detecting the neomycin- and the puromycin-resistance genes in the plasmids in the presence of genomic DNA extracted from a beef sample. We also applied the method to testing of beef samples imported from the United States (U.S.). This method will make it possible to monitor beef for contamination by material from GE cattle to assure food safety.

  10. Simultaneous detection of major blackleg and soft rot bacterial pathogens in potato by multiplex polymerase chain reaction‡

    PubMed Central

    Potrykus, M; Sledz, W; Golanowska, M; Slawiak, M; Binek, A; Motyka, A; Zoledowska, S; Czajkowski, R; Lojkowska, E

    2014-01-01

    A multiplex polymerase chain reaction (PCR) assay for simultaneous, fast and reliable detection of the main soft rot and blackleg potato pathogens in Europe has been developed. It utilises three pairs of primers and enables detection of three groups of pectinolytic bacteria frequently found in potato, namely: Pectobacterium atrosepticum, Pectobacterium carotovorum subsp. carotovorum together with Pectobacterium wasabiae and Dickeya spp. in a multiplex PCR assay. In studies with axenic cultures of bacteria, the multiplex assay was specific as it gave positive results only with strains of the target species and negative results with 18 non-target species of bacteria that can possibly coexist with pectinolytic bacteria in a potato ecosystem. The developed assay could detect as little as 0.01 ng µL–1 of Dickeya sp. genomic DNA, and down to 0.1 ng µL–1 of P. atrosepticum and P. carotovorum subsp. carotovorum genomic DNA in vitro. In the presence of competitor genomic DNA, isolated from Pseudomonas fluorescens cells, the sensitivity of the multiplex PCR decreased tenfold for P. atrosepticum and Dickeya sp., while no change was observed for P. carotovorum subsp. carotovorum and P. wasabiae. In spiked potato haulm and tuber samples, the threshold level for target bacteria was 101 cfu mL–1 plant extract (102 cfu g–1 plant tissue), 102 cfu mL–1 plant extract (103 cfu g–1 plant tissue), 103 cfu mL–1 plant extract (104 cfu g–1 plant tissue), for Dickeya spp., P. atrosepticum and P. carotovorum subsp. carotovorum/P. wasabiae, respectively. Most of all, this assay allowed reliable detection and identification of soft rot and blackleg pathogens in naturally infected symptomatic and asymptomatic potato stem and progeny tuber samples collected from potato fields all over Poland. PMID:25506085

  11. Comparison of bacterial culture and polymerase chain reaction (PCR) for the detection of F. tularensis subsp. holarctica in wild animals.

    PubMed

    Sting, Reinhard; Runge, Martin; Eisenberg, Tobias; Braune, Silke; Müller, Wolfgang; Otto, Peter

    2013-01-01

    Detection of the zoonotic pathogen Francisella tularensis subsp. holarctica (EF tularensis) in wild animals with culture techniques as well as polymerase chain reaction were compared and discussed on the basis of the investigation of 60 animals. The samples originated from 55 European brown hares (Lepus europaeus), two red foxes (Vulpes vulpes) and one each from a wild rabbit (Oryctolagus cuniculus), a European beaver (Castor fiber), and a lemur (Lemur catta). When comparing the growth of 28 F. tularensis isolates on the cysteine blood agar and the modified Martin-Lewis-agar used in this study, cultivation was successful for 26 isolates on both media, but for two isolates only on the cysteine blood agar. Out of 43 carcasses 19 tested positive in bacteriological culture and PCR. Two culture positive samples of tonsils originating from foxes could not be confirmed by PCR, although PCR was positive in 22 samples that missed growth of F. tularensis. Comparative studies on cultural detection of E. tularensis were performed on samples of 16 hares from lung, spleen, liver and gut and in one case with a peritoneal swab. In at least one of these localizations cultivation of the pathogen was successful. Detection rate was reduced to 94% (15 of 16 hares) considering only the results of the cultures of the lungs and spleens. For a sensitive and rapid detection of F. tularensis subsp. holarctica, the PCR is a suitable method thereby avoiding hazardous multiplying of the pathogen. However, cultivation of F. tularensis is often a prerequisite for further studies on antibiotic resistance patterns of the pathogen, molecular epidemiological and pathological analyses of tularaemia.

  12. A simple and rapid method for detection of Trypanosoma evansi in the dromedary camel using a nested polymerase chain reaction

    PubMed Central

    Aradaib, Imadeldin E; Majid, Ali A

    2006-01-01

    A nested polymerase chain reaction (nPCR)-based assay, was developed and evaluated for rapid detection of Trypanosoma evansi in experimentally infected mice and naturally infected camels (Camelus dromedarius). Four oligonucleotide primers (TE1, TE2, TE3 and TE4), selected from nuclear repetitive gene of T. evansi, were designed and used for PCR amplifications. The first amplification, using a pair of outer primers TE1 and TE2, produced a 821-bp primary PCR product from T. evansi DNA. The second amplification, using nested (internal) pair of primers TE3 and TE4, produced a 270-bp PCR product. T. evansi DNAs extracted from blood samples of experimentally infected mice and naturally infected Sudanese breed of dromedary camels were detected by this nested PCR-based assay. The nested primers TE3 and TE4 increased the sensitivity of the PCR assay and as little as 10 fg of T. evansi DNA (equivalent to a single copy of the putative gene of the parasite) was amplified and visualized onto ethidium bromide-stained agarose gels. Amplification products were not detected when the PCR-based assay was applied to DNA from other blood parasites including Thieleria annulata, Babesia bigemina or nucleic acid free samples. Application of this nPCR-based assay to clinical samples resulted in direct detection of T. evansi from a variety of tissue samples collected from experimentally infected mice and blood from naturally infected camels. The described nPCR-based assay provides a valuable tool to study the epidemiology of T. evansi infection in camels and other susceptible animal populations. PMID:16712737

  13. Adenovirus 12 E1A gene detection by polymerase chain reaction in both the normal and coeliac duodenum.

    PubMed Central

    Lawler, M; Humphries, P; O'Farrelly, C; Hoey, H; Sheils, O; Jeffers, M; O'Briain, D S; Kelleher, D

    1994-01-01

    A 12 amino acid sequence from the adenovirus 12 E1B protein is homologous at the protein level with a similar 12-mer derived from the wheat protein A-gliadin. It has been suggested that exposure to Ad 12 could sensitise individuals to gliadins with resultant gluten sensitive enteropathy. In this study, the polymerase chain reaction (PCR) was used to analyse duodenal biopsy tissue from patients with coeliac disease for the presence of Ad 12. The sensitivity of the assay system was at least 1 in 10(5) cells and specificity was confirmed both by probing with an internal oligonucleotide and by direct sequencing. Ad 12 sequences were detected in three of 17 patients with adult coeliac disease and in five of 16 adult controls with normal duodenal biopsies. Since exposure to the virus would be predicted to occur in infancy we also studied patients with childhood coeliac disease diagnosed at less than 1 year of age. Ad 12 was positive in three of 10 childhood coeliac patients and one of seven controls. In addition, we studied a cohort of patients who presented with a diarrhoeal illness and associated anti alpha gliadin antibodies in 1983. These patients had duodenal biopsies performed at this time. One of three patients with abnormal histology had detectable Ad 12 while two of 14 with normal findings were positive for Ad 12. Finally, the potential oncogenic nature of Ad 12 prompted examination of a group of patients with intestinal tumours. Ad 12 DNA was, however, in only two of 19 tumour samples tested. These data indicate that Ad 12 can be successfully detected using PCR on paraffin embedded tissue. Furthermore, Ad 12 was detected at a relatively high level in normal duodenum. The results do not, however, support the hypothesis that prior exposure to Ad 12 is implicated in the pathogenesis of coeliac disease. Images Figure 2 Figure 3 Figure 4 Figure 5 PMID:7959228

  14. Aphids preserved in propylene glycol can be used for reverse transcription-polymerase chain reaction detection of Potato virus Y.

    PubMed

    Nie, Xianzhou; Pelletier, Yvan; Mason, Nicola; Dilworth, Andrea; Giguère, Marie-Andrée

    2011-08-01

    The effectiveness of propylene glycol on the retention of RNA target of Potato virus Y (PVY), an aphid stylet-borne virus, in Myzus persicae was investigated in comparison to ethanol and liquid nitrogen/-80°C. Reverse transcription-polymerase chain reaction (RT-PCR) was used to detect the PVY targets from the propylene glycol/ethanol/liquid nitrogen preserved single aphids after a 5min acquisition period from infected potato plants. In the liquid nitrogen/-80°C and 70% ethanol treatments, 55.6% and 38.8% aphids tested PVY-positive, respectively. In the 0-75% propylene glycol treatments, 12.2-44.7% aphids tested PVY-positive. The lowest detection rate was in the 0% (positive rate, 15.2%) and the 10% propylene glycol (positive rate, 12.2%). As the propylene glycol concentration increased to 25%, 29.8% aphids tested positive. A high PVY-positive rate was also found in 35-75% propylene glycol treatments at 44.7% (35% propylene glycol), 36.7% (50% propylene glycol) and 34.8% (75% propylene glycol), which is comparable to the rate shown in 70% ethanol. No significant difference in the positive detection rate was observed in aphids preserved in 50% propylene glycol at room temperature for 2, 4 and 10 days. These results demonstrate that propylene glycol at 25-75% can retain PVY targets effectively in aphids for an extended time period, and thus can be used in aphid traps to preserve viruliferous aphids for later RT-PCR detection of PVY.

  15. Polymerase chain reaction detection of Kingella kingae in children with culture-negative septic arthritis in eastern Ontario

    PubMed Central

    Slinger, Robert; Moldovan, Ioana; Bowes, Jennifer; Chan, Francis

    2016-01-01

    BACKGROUND: The bacterium Kingella kingae may be an under-recognized cause of septic arthritis in Canadian children because it is difficult to grow in culture and best detected using molecular methods. OBJECTIVES: To determine whether K kingae is present in culture-negative joint fluid specimens from children in eastern Ontario using polymerase chain reaction (PCR) detection methods. METHODS: K kingae PCR testing was performed using residual bacterial culture-negative joint fluid collected from 2010 to 2013 at a children’s hospital in Ottawa, Ontario. The clinical features of children with infections caused by K kingae were compared with those of children with infections caused by the ‘typical’ septic arthritis bacteria, Staphylococcus aureus and Streptococcus pyogenes. RESULTS: A total of 50 joint fluid specimens were submitted over the study period. Ten were culture-positive, eight for S aureus and two for S pyogenes. Residual joint fluid was available for 27 of the 40 culture-negative specimens and K kingae was detected using PCR in seven (25.93%) of these samples. Children with K kingae were significantly younger (median age 1.7 versus 11.3 years; P=0.01) and had lower C-reactive protein levels (median 23.8 mg/L versus 117.6. mg/L; P=0.01) than those infected with other bacteria. CONCLUSIONS: K kingae was frequently detected using PCR in culture-negative joint fluid specimens from children in eastern Ontario. K kingae PCR testing of culture-negative joint samples in children appears to be warranted. PMID:27095882

  16. Detection of Aeromonas caviae in the common housefly Musca domestica by culture and polymerase chain reaction.

    PubMed

    Nayduch, D; Honko, A; Noblet, G P; Stutzenberger, F

    2001-12-01

    Aeromonas caviae has been implicated in diarrhoeal disease of livestock and humans. The potential role of houseflies in the epidemiology of this pathogen was investigated by examining the prevalence of A. caviae in houseflies collected from two South Carolina farms and one restaurant. Isolation was accomplished by culture of flies in alkaline peptone water followed by identification with Aeromonas-specific PCR using novel primers (APW-PCR). All isolates cultured from houseflies were identified as A. caviae by biochemical characteristics and direct sequencing approximately 800 bp of the 16S rRNA gene. Aeromonas caviae was detected in 78% (272/349) dairy farm flies, 55% (54/99) pig farm flies and 39% (77/200) restaurant flies. Faeces from cows and pigs at the farms also were positive for A. caviae (58% and 100%, respectively). The APW PCR method provided a rapid, convenient way to identify A. caviae from faeces and houseflies that contained hundreds of bacterial species.

  17. Development of a rapid diagnostic assay for the detection of tomato chlorotic dwarf viroid based on isothermal reverse-transcription-recombinase polymerase amplification

    Technology Transfer Automated Retrieval System (TEKTRAN)

    A molecular diagnostic assay utilizing reverse transcription-recombinase polymerase amplification (RT-RPA) at an isothermal constant temperature of 39 °C and target-specific primers and probe were developed for the rapid, sensitive, and specific detection of tomato chlorotic dwarf viroid (TCDVd) in ...

  18. Comparison of automated BAX polymerase chain reaction and standard culture methods for detection of Listeria monocyogenes in blue crab meat (Callinectus sapidus) and blue crab processing plants

    Technology Transfer Automated Retrieval System (TEKTRAN)

    This study compared the BAX Polymerase Chain Reaction method (BAX PCR) with the Standard Culture Method (SCM) for detection of L. monocytogenes in blue crab meat and crab processing plants. The aim of this study was to address this data gap. Raw crabs, finished products and environmental sponge samp...

  19. Detection of Newcastle disease virus RNA by reverse transcription polymerase chain reaction using formalin-fixed, paraffin-embedded tissue and comparison with immunohistochemistry and in situ hybridization

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The usefulness of reverse transcription polymerase chain reaction (RT-PCR) from formalin-fixed, paraffin-embedded (FFPE) tissues was examined and compared to the immunohistochemistry (IHC) and in situ hybridization (ISH) assays for detection of Newcastle disease virus (NDV). Spleen and lung tissues...

  20. Innovative use of platinum compounds to selectively detect live microorganisms by polymerase chain reaction.

    PubMed

    Soejima, Takashi; Minami, Jun-Ichi; Xiao, Jin-Zhong; Abe, Fumiaki

    2016-02-01

    PCR cannot distinguish live microorganisms from dead ones. To circumvent this disadvantage, ethidium/propidium-monoazide (EMA/PMA) and psoralen to discriminate live from dead bacteria have been used for 2 decades. These methods require the use of numerous laborious procedures. We introduce an innovative method that uses platinum compounds, which are primarily used as catalysts in organic chemistry and partly used as anti-cancer drugs. Microorganisms are briefly exposed to platinum compounds in vivo, and these compounds penetrate dead (compromised) microorganisms but not live ones and are chelated by chromosomal DNA. The use of platinum compounds permits clear discrimination between live and dead microorganisms in water and milk (including Cronobacter sakazakii and Escherichia coli) via PCR compared with typically used PMA. This platinum-PCR method could enable the specific detection of viable coliforms in milk at a concentration of 5-10 CFU mL(-1) specified by EU/USA regulations after a 4-h process. For sample components, environmental water contains lower levels of PCR inhibitors than milk does, and milk is similar to infant formula, skim milk and blood; thus, the use of the platinum-PCR method could also prevent food poisoning due to the presence of C. sakazakii in dairy products. This method could provide outstanding rapidity for use in environmental/food/clinical tests. Platinum-PCR could also be a substitute for the typical culture-based methods currently used.

  1. Electrochemical detection of Francisella tularensis genomic DNA using solid-phase recombinase polymerase amplification.

    PubMed

    del Río, Jonathan Sabaté; Yehia Adly, Nouran; Acero-Sánchez, Josep Lluis; Henry, Olivier Y F; O'Sullivan, Ciara K

    2014-04-15

    Solid-phase isothermal DNA amplification was performed exploiting the homology protein recombinase A (recA). The system was primarily tested on maleimide activated microtitre plates as a proof-of-concept and later translated to an electrochemical platform. In both cases, forward primer for Francisella tularensis holarctica genomic DNA was surface immobilised via a thiol or an amino moiety and then elongated during the recA mediated amplification, carried out in the presence of specific target sequence and reverse primers. The formation of the subsequent surface tethered amplicons was either colorimetrically or electrochemically monitored using a horseradish peroxidase (HRP)-labelled DNA secondary probe complementary to the elongated strand. The amplification time was optimised to amplify even low amounts of DNA copies in less than an hour at a constant temperature of 37°C, achieving a limit of detection of 1.3×10(-13) M (4×10(6) copies in 50 μL) for the colorimetric assay and 3.3×10(-14) M (2×10(5) copies in 10 μL) for the chronoamperometric assay. The system was demonstrated to be highly specific with negligible cross-reactivity with non-complementary targets or primers.

  2. Electrical detection of dsDNA and polymerase chain reaction amplification.

    PubMed

    Salm, Eric; Liu, Yi-Shao; Marchwiany, Daniel; Morisette, Dallas; He, Yiping; Razouk, Laila; Bhunia, Arun K; Bashir, Rashid

    2011-12-01

    Food-borne pathogens and food safety-related outbreaks have come to the forefront over recent years. Estimates on the annual cost of sicknesses, hospitalizations, and deaths run into the billions of dollars. There is a large body of research on detection of food-borne pathogens; however, the widely accepted current systems are limited by costly reagents, lengthy time to completion, and expensive equipment. Our aim is to develop a label-free method for determining a change in DNA concentration after a PCR assay. We first used impedance spectroscopy to characterize the change in concentration of purified DNA in deionized water within a microfluidic biochip. To adequately measure the change in DNA concentration in PCR solution, it was necessary to go through a purification and precipitation step to minimize the effects of primers, PCR reagents, and excess salts. It was then shown that the purification and precipitation of the fully amplified PCR reaction showed results similar to the control tests performed with DNA in deionized water. We believe that this work has brought label free electrical biosensors for PCR amplification one step closer to reality.

  3. Electrical detection of dsDNA and polymerase chain reaction amplification.

    PubMed

    Salm, Eric; Liu, Yi-Shao; Marchwiany, Daniel; Morisette, Dallas; He, Yiping; Razouk, Laila; Bhunia, Arun K; Bashir, Rashid

    2011-12-01

    Food-borne pathogens and food safety-related outbreaks have come to the forefront over recent years. Estimates on the annual cost of sicknesses, hospitalizations, and deaths run into the billions of dollars. There is a large body of research on detection of food-borne pathogens; however, the widely accepted current systems are limited by costly reagents, lengthy time to completion, and expensive equipment. Our aim is to develop a label-free method for determining a change in DNA concentration after a PCR assay. We first used impedance spectroscopy to characterize the change in concentration of purified DNA in deionized water within a microfluidic biochip. To adequately measure the change in DNA concentration in PCR solution, it was necessary to go through a purification and precipitation step to minimize the effects of primers, PCR reagents, and excess salts. It was then shown that the purification and precipitation of the fully amplified PCR reaction showed results similar to the control tests performed with DNA in deionized water. We believe that this work has brought label free electrical biosensors for PCR amplification one step closer to reality. PMID:21789549

  4. Detection of equine herpesvirus type 1 using a real-time polymerase chain reaction.

    PubMed

    Diallo, Ibrahim S; Hewitson, Glen; Wright, Lucia; Rodwell, Barry J; Corney, Bruce G

    2006-01-01

    Equid herpesvirus 1 (EHV1) is a major disease of equids worldwide causing considerable losses to the horse industry. A variety of techniques, including PCR have been used to diagnose EHV1. Some of these PCRs were used in combination with other techniques such as restriction enzyme analysis (REA) or hybridisation, making them cumbersome for routine diagnostic testing and increasing the chances of cross-contamination. Furthermore, they involve the use of suspected carcinogens such as ethidium bromide and ultraviolet light. In this paper, we describe a real-time PCR, which uses minor groove-binding probe (MGB) technology for the diagnosis of EHV1. This technique does not require post-PCR manipulations thereby reducing the risk of cross-contamination. Most importantly, the technique is specific; it was able to differentiate EHV1 from the closely related member of the Alphaherpesvirinae, equid herpesvirus 4 (EHV4). It was not reactive with common opportunistic pathogens such as Escherichia coli, Klebsiella oxytoca, Pseudomonas aeruginosa and Enterobacter agglomerans often involved in abortion. Similarly, it did not react with equine pathogens such as Streptococcus equi, Streptococcus equisimilis, Streptococcus zooepidemicus, Taylorella equigenitalis and Rhodococcus equi, which also cause abortion. The results obtained with this technique agreed with results from published PCR methods. The assay was sensitive enough to detect EHV1 sequences in paraffin-embedded tissues and clinical samples. When compared to virus isolation, the test was more sensitive. This test will be useful for the routine diagnosis of EHV1 based on its specificity, sensitivity, ease of performance and rapidity. PMID:16137772

  5. Development and Control of Mine Detection Robot COMET-II and COMET-III

    NASA Astrophysics Data System (ADS)

    Nonami, Kenzo; Huang, Qingjiu; Komizo, Daisuke; Fukao, Yoichiro; Asai, Yoshitomo; Shiraishi, Yoshinori; Fujimoto, Masaki; Ikedo, Yosuke

    In this paper, we elucidate the development and the multitask cooperative control of humanitarian demining assistance robots. In particular, the aim in this paper is to propose the first platform robots for humanitarian demining as a global pioneering project. Here we propose two kinds of mine detection robots which consists of six-legged walking robots with two manipulators for added stability, mobility, and functionality. One of the proposed mine detection robots is the COMET-II which is a 120kg class robot driven by electric power. The other robot is the full autonomous mine detection robot the COMET-III which is a 1 ton class robot driven by hydraulic power with a gasoline engine. The COMET-III has a crawler and six legs and it can continue a mine detection operation for four hours. An improved version of this kind of robot will be engaged for mine detection operation in actual mine fields in the near future.

  6. Detection and identification of Legionella species in hospital water supplies through Polymerase Chain Reaction (16S rRNA)

    PubMed Central

    2014-01-01

    Legionella spp. are important waterborne pathogens that are normally transmitted through aerosols. The present work was conducted to investigate the presence of Legionella spp. and its common species in hospital water supplies. Considering the limitations of culture method, polymerase chain reaction (PCR) assays were developed to detect the gene 16S rRNA irrespective of the bacterial serotype. Four well-established DNA extraction protocols (freeze & thaw and phenol-chloroform as two manual protocols and two commercial kits) were tested and evaluated to release DNA from bacterial cells. A total of 45 samples were collected from seven distinct hospitals’ sites during a period of 10 months. The PCR assay was used to amplify a 654-bp fragment of the 16S rRNA gene. Legionella were detected in 13 samples (28.9%) by all of the methods applied for DNA extraction. Significant differences were noted in the yield of extracted nucleic acids. Legionella were not detected in any of the samples when DNA extraction by freeze & thaw was used. Excluding this method and comparing manual protocol with commercial kits, Kappa coefficient was calculated as 0.619 with p < 0.05. Although no meaningful differences were found between the kits, DNA extraction with Bioneer kit exhibited a higher sensitivity than classical Qiagen. Showerheads and cold-water taps were the most and least contaminated sources with 55.5 and 9 percent positive samples, respectively. Moreover two positive samples were identified for species by DNA sequencing and submitted to the Gene Bank database with accession Nos. FJ480932 and FJ480933. The results obtained showed that despite the advantages of molecular assays in Legionella tracing in environmental sources, the use of optimised DNA extraction methods is critical. PMID:24860661

  7. Comparison of different methods of RNA isolation for plum pox virus detection by reverse transcription-polymerase chain reaction.

    PubMed

    Faggioli, F; Pasquini, G; Barba, M

    1998-09-01

    The diagnosis of plum pox virus (PPV) is still considered one of the most important aspects of the "sharka" problem. In fact, different studies demonstrated an uneven distribution of the virus in infected trees due to a high variability in virus concentration. These aspects complicate the PPV diagnosis. To date, biological, serological and molecular assays have been successively developed in order to obtain sensitive and efficient PPV detection techniques. In particular, the polymerase chain reaction (PCR) technique seems to be promising and can be considered the most sensitive and reliable one. Preparation of viral RNA is still a fundamental step in reverse transcription-PCR (RT-PCR) technique, especially when applied to large scale testing, i.e., for certification purposes. In order to find the most rapid and efficient procedure, we have compared three different procedures of extraction of viral RNA to be processed RT-PCR. Their common characteristics is their capacity to extract the RNA from a small amount of plant tissue without organic solvents in the extraction fluid. The procedures were as follows: an immuno-capture (IC) method using a specific antiserum, a silica-capture (SC) method using a non-specific matrix, and a simple and rapid RNA extraction (RE) method. They all were followed by one-tube RT-PCR. The obtained results show that all the three techniques allowed a successful amplification and detection of PPV in tested samples except the SC-PCR method which proved less effective. In fact, the IC-PCR and RE-PCR methods amplified and detected PPV in all isolates tested, while the SC-PCR method was able to reveal the presence of the virus in apricot and infected control samples only.

  8. Detection and identification of Legionella species in hospital water supplies through Polymerase Chain Reaction (16S rRNA).

    PubMed

    Rafiee, Mohammad; Jahangiri-Rad, Mahsa; Hajjaran, Homa; Mesdaghinia, Alireza; Hajaghazadeh, Mohammad

    2014-01-01

    Legionella spp. are important waterborne pathogens that are normally transmitted through aerosols. The present work was conducted to investigate the presence of Legionella spp. and its common species in hospital water supplies. Considering the limitations of culture method, polymerase chain reaction (PCR) assays were developed to detect the gene 16S rRNA irrespective of the bacterial serotype. Four well-established DNA extraction protocols (freeze & thaw and phenol-chloroform as two manual protocols and two commercial kits) were tested and evaluated to release DNA from bacterial cells. A total of 45 samples were collected from seven distinct hospitals' sites during a period of 10 months. The PCR assay was used to amplify a 654-bp fragment of the 16S rRNA gene. Legionella were detected in 13 samples (28.9%) by all of the methods applied for DNA extraction. Significant differences were noted in the yield of extracted nucleic acids. Legionella were not detected in any of the samples when DNA extraction by freeze & thaw was used. Excluding this method and comparing manual protocol with commercial kits, Kappa coefficient was calculated as 0.619 with p < 0.05. Although no meaningful differences were found between the kits, DNA extraction with Bioneer kit exhibited a higher sensitivity than classical Qiagen. Showerheads and cold-water taps were the most and least contaminated sources with 55.5 and 9 percent positive samples, respectively. Moreover two positive samples were identified for species by DNA sequencing and submitted to the Gene Bank database with accession Nos. FJ480932 and FJ480933. The results obtained showed that despite the advantages of molecular assays in Legionella tracing in environmental sources, the use of optimised DNA extraction methods is critical. PMID:24860661

  9. Rapid detection of clarithromycin resistant Helicobacter pylori strains in Spanish patients by polymerase chain reaction-restriction fragment length polymorphism

    PubMed Central

    Agudo, Sonia; Pérez-Pérez, Guillermo; Alarcón, Teresa; López-Brea, Manuel

    2014-01-01

    Introduction The aim of this study was to characterize the mutations types present in the 23S rRNA gene related to H. pylori clarithromycin-resistance strains in Spain and evaluate a novel PCR-RFLP method for detection of the most frequent point mutation in our population. Methods Gastric biopsies were obtained by endoscopy from patients with gastric symptoms. H. pylori was cultured according to standard microbiological procedures and clarithromycin resistance was determined by E-test. DNA extraction was performed by NucliSens platform with the NucliSens magnetic extraction reagents (bioMérieux) according to the manufacturer instructions. Analyses for point mutations in 23S rRNA gene strains were performed by sequence analysis of amplified polymerase chain reaction products. Restriction fragment length polymorphism was performed using BsaI enzyme to detect restriction sites that correspond to the mutation (A2143G). Result We found 42 out of 118 (35.6%) strains resistant to clarithromycin by E-test. E-test results were confirmed for the presence of point mutation in 34 (88.1%) of these strains. Mutation A2143G was found in 85.3% of the strains. Analyses with the restriction enzyme BsaI was able to confirm the presence of A2143G mutation. There were 8 H. pylori strains resistant to clarithromycin by E-test but without any point mutation in the 23 rRNA gene. Conclusion We conclude that PCR-RFLP is a reliable method to detect clarithromycin-resistance H. pylori strains in countries with a high prevalence of clarithromycin-resistance as Spain It may be useful before choosing regimens of H. pylori eradication. PMID:21412667

  10. Fast, ultra-trace detection of juvenile hormone III from mosquitoes using mass spectrometry.

    PubMed

    Ramirez, Cesar E; Nouzova, Marcela; Benigni, Paolo; Quirke, J Martin E; Noriega, Fernando G; Fernandez-Lima, Francisco

    2016-10-01

    In the present work, a new protocol for fast separation and quantification of JH III from biological samples using liquid chromatography coupled to electrospray tandem mass spectrometry is described. In particular, the proposed protocol improves existing methodologies by combining a limited number of sample preparation steps with fast LC-MS/MS detection, providing lower limits of detection and demonstrated matrix effect control, together with high inter and intraday reproducibility. A limit of detection of 8pg/mL (0.32pg on column) was achieved, representing a 15-fold gain in sensitivity with respect to previous LC-MS based protocols. The performance of the LC-MS/MS protocol is comparable to previously described JH III quantitation protocol based on fluorescence detection, with the added advantage that quantification is independent of the availability of fluorescent tags that are often unavailable or show quite diverse responses on a batch-to-batch basis. Additionally, a detailed description of the JH III fragmentation pathway is provided for the first time, based on isolation of the molecular ion and their intermediate fragments using in-source MS/MS, MS/MS(n) and FT-ICR MS/MS measurements. The JH III workflow was evaluated as a function of developmental changes, sugar feeding and farnesoic acid stimulation in mosquitoes and can be applied to the detection of other juvenile hormones.

  11. Global real-time quantification/reverse transcription-polymerase chain reaction for detecting proto-oncogenes associated with 14q32 chromosomal translocation in multiple myeloma.

    PubMed

    Tajima, Emi; Uranishi, Miyuki; Iida, Shinsuke; Komatsu, Hirokazu; Nitta, Masakazu; Ueda, Ryuzo

    2005-04-01

    A global real-time quantitative/reverse transcription-polymerase chain reaction technique for detecting the expression of six 14q32 chromosomal translocation-associated proto-oncogenes in marrow plasma cells was established and applied to myeloma specimens. This technique is an alternative method of detecting 14q32 rearrangements and allows investigation of the relationship between proto-oncogene expression and clinical features.

  12. Detection of Haemophilus influenzae in respiratory secretions from pneumonia patients by quantitative real-time polymerase chain reaction.

    PubMed

    Abdeldaim, Guma M K; Strålin, Kristoffer; Kirsebom, Leif A; Olcén, Per; Blomberg, Jonas; Herrmann, Björn

    2009-08-01

    A quantitative real-time polymerase chain reaction (PCR) based on the omp P6 gene was developed to detect Haemophilus influenzae. Its specificity was determined by analysis of 29 strains of 11 different Haemophilus spp. and was compared with PCR assays having other target genes: rnpB, 16S rRNA, and bexA. The method was evaluated on nasopharyngeal aspirates from 166 adult patients with community-acquired pneumonia. When 10(4) DNA copies/mL was used as cutoff limit for the method, P6 PCR had a sensitivity of 97.5% and a specificity of 96.0% compared with the culture. Of 20 culture-negative but P6 PCR-positive cases, 18 were confirmed by fucK PCR as H. influenzae. Five (5.9%) of 84 nasopharyngeal aspirates from adult controls tested PCR positive. We conclude that the P6 real-time PCR is both sensitive and specific for identification of H. influenzae in respiratory secretions. Quantification facilitates discrimination between disease-causing H. influenzae strains and commensal colonization. PMID:19446978

  13. Detection of novel organisms associated with salpingitis, by use of 16S rDNA polymerase chain reaction.

    PubMed

    Hebb, Jennifer K; Cohen, Craig R; Astete, Sabina G; Bukusi, Elizabeth A; Totten, Patricia A

    2004-12-15

    Although Chlamydia trachomatis and Neisseria gonorrhoeae are established causes of salpingitis, the majority of cases have no known etiology. We used broad-range 16S rDNA polymerase chain reaction to identify novel, possibly uncultivable, bacteria associated with salpingitis and identified bacterial 16S sequences in Fallopian-tube specimens from 11 (24%) of 45 consecutive women with laparoscopically confirmed acute salpingitis (the case patients) and from 0 of 44 women seeking tubal ligations (the control subjects) at Kenyatta National Hospital, Nairobi, Kenya. Bacterial phylotypes most closely related to Leptotrichia spp. were detected as the sole phylotypes in 1, and mixed with other bacterial phylotypes in 2, specimens. Novel bacterial phylotypes and those associated with bacterial vaginosis, including Atopobium vaginae, were identified in 3 specimens. N. gonorrhoeae and Streptococcus pyogenes were identified in 2 and 1 specimens, respectively. The finding of novel phylotypes associated with salpingitis has important implications for the etiology, pathogenesis, and treatment of this important reproductive-tract disease syndrome. PMID:15551209

  14. Processing of long-stored archival cervical smears for human papillomavirus detection by the polymerase chain reaction.

    PubMed

    de Roda Husman, A M; Snijders, P J; Stel, H V; van den Brule, A J; Meijer, C J; Walboomers, J M

    1995-08-01

    The efficiency of a freeze-thaw method, a proteinase K/Tween 20 lysis method and a guanidinium isothiocyanate/silica beads method for DNA extraction from fixed and Papanicolaou-stained cells from the cervical cancer cell line Siha was measured by beta-globin polymerase chain reaction (PCR). The GTC/silica beads method, which appeared superior, revealed a human papillomavirus (HPV) general primer-mediated PCR sensitivity of 50-500 copies of HPV 16 per sample using dilutions of fixed and stained Siha cells. Application to archival cervical smears (n = 116) revealed that the yield and size of amplifiable DNA decreases with storage time. The longer the storage time, the more repetitions of the whole procedure, including the lysis step, were required to extract sufficient amplifiable DNA. In this way, an overall beta-globin PCR positivity for 98% of the smears was reached. Further analysis revealed that a maximum size of 200 bp could be amplified from smears stored for up to 9 years. The method was validated by demonstrating by PCR the same HPV types in archival smears and corresponding cervical biopsies of cervical cancer patients. In conclusion, the GTC/silica beads method appears suitable to process archival cervical smears for HPV detection by PCR. provided that stepwise adjustments are made until beta-globin PCR positivity is obtained and primers are chosen which amplify a maximum of about 200 bp.

  15. Detection of target site resistance to pyrethroids and organophosphates in the horn fly using multiplex polymerase chain reaction.

    PubMed

    Foil, L D; Guerrero, F D; Bendele, K G

    2010-09-01

    The horn fly, Haematobia irritans L., is an obligate blood-feeding fly and the primary insect pest parasitizing cattle in the United States. Pesticide resistance has become a substantial problem for cattle producers, and although several mechanisms of resistance are possible, target site resistance is the most important mechanism preventing control of this fly in the United States and possibly other countries. We developed a multiplex polymerase chain reaction assay to detect the known target site, pyrethroid resistance-associated mutation in the horn fly and a recently reported G262A mutation in the horn fly acetylcholinesterase, the target site for organophosphates. As expected, the pyrethroid resistance target site mutation was found in fly populations from Texas, Louisiana, Washington, Georgia, Mexico, and Brazil. This mutation was found to have a gender bias as it was more prevalent in females than males. The G262A acetylcholinesterase mutation was found in Texas, Louisiana, Washington, Georgia, and Mexico, but not Brazil. There was no gender bias in the occurrence of this mutation, and there was no correlation between the occurrence of the kdr and the G262A mutations. Unlike the case with the pyrethroid target site mutation, the presence of G262A did not appear to exclusively provide the level of resistance required to account for bioassay results. It is likely an additional mutation(s) occurs in the target site and/or a metabolic resistance mechanism exists in organophosphate-resistant horn fly populations.

  16. Voltammetric detection of As(III) with Porphyridium cruentum based modified carbon paste electrode biosensor.

    PubMed

    Zaib, M; Saeed, A; Hussain, I; Athar, M M; Iqbal, M

    2014-12-15

    A novel biosensor based on carbon paste electrode modified with Porphyridium cruentum biomass was developed for the determination of As(III) in contaminated water. As(III) was first biosorbed-accumulated on the electrode surface at open circuit potential and then stripped off by applying anodic scan range of -0.8 to +0.8 V using differential pulse anodic stripping voltammetric technique. The best result was obtained at pH 6.0 with 0.1M HNO3 solution as stripping medium, allowing biosorption-accumulation time of 8 min using 5% P. cruentum biomass in graphite-mineral oil paste. Linear range for As(III) detection with the modified electrode-biosensor was observed between 2.5 and 20 µg L(-1). The FTIR spectrum of P. cruentum biomass confirmed the presence of active functional groups that participate in the binding of As(III). Scanning Electron Microscopy (SEM) indulged the surface morphology of modified electrode-biosensor before and after As(III) adsorption. Similarly, Atomic Force Microscopy (AFM) showed that the average roughness of the modified electrode decreased indicating the successful incorporation of P. cruentum biomass. Efficiency of the biosensor in the presence of different interfering metal (Na(+), K(+), Ca(2+), and Mg(2+)) ions were also evaluated. The application of P. cruentum modified biosensor was successfully used for the detection of As(III) in the binary metal (Fe(3+), Mn(2+), Cd(2+), Cu(2+), Ni(2+), Hg(2+), and Pb(2+)) contaminated system. The accuracy of application of biosorption based biosensor for the detection of As(III) is as low as 2.5 µg L(-1).

  17. Detection of Pathogenic Yersinia Enterocolitica in Slaughtered Pigs by Cultural Methods and Real-Time Polymerase Chain Reaction

    PubMed Central

    Fois, Federica; Consolati, Simonetta Gianna; Salza, Sara; Tedde, Tiziana; Soro, Paolo; Collu, Carlo; Ladu, Daniela; Virgilio, Sebastiano; Piras, Francesca

    2015-01-01

    Healthy pigs carrying pathogenic to human Yersinia enterocolitica strains are the main source of entry into slaughterhouse, where cross-contamination of carcasses can happen. The aim of this work was to determine Y. enterocolitica prevalence in slaughtered pigs, investigating the presence of carriers in relation to carcass contamination. A total of 132 pig samples (tonsils, mesenteric lymph nodes, colon content, carcass surface) were collected from 4 Sardinian slaughterhouses. All the samples were examined by the ISO 10273:2003 method, and the prevalence was also determined by direct plating on CIN Agar. Moreover, to detect the ail positive Y. enterocolitica strains in enrichment broths and isolates a real-time polymerase chain reaction (PCR) was applied. Y. enterocolitica prevalence was 19% with direct plating and 12% with enrichment methods. Carcass surfaces and tonsils prevalence was 5.30% by direct plating, and 5.3% and 2.2%, respectively, by enrichment method. Tonsil samples showed an average contamination level of 3.2×103 CFU/g, while the mean value on carcass was 8.7×102 CFU/g. An overall prevalence of 9.8% of ail positive Y. enterocolitica broths was detected by RT-PCR, that found a higher prevalence in tonsils (7.5%) with respect to cultural methods, confirming the greater sensitivity of this technique when applied for tonsils and faeces samples. The results show a relatively low pathogenic Y. enterocolitica prevalence in pigs slaughtered in Sardinia. Good hygiene measures should be applied at slaughterhouse in order to prevent the entry of carriers and control carcass contamination. PMID:27800392

  18. A signal processing approach for enriched region detection in RNA polymerase II ChIP-seq data

    PubMed Central

    2012-01-01

    Background RNA polymerase II (PolII) is essential in gene transcription and ChIP-seq experiments have been used to study PolII binding patterns over the entire genome. However, since PolII enriched regions in the genome can be very long, existing peak finding algorithms for ChIP-seq data are not adequate for identifying such long regions. Methods Here we propose an enriched region detection method for ChIP-seq data to identify long enriched regions by combining a signal denoising algorithm with a false discovery rate (FDR) approach. The binned ChIP-seq data for PolII are first processed using a non-local means (NL-means) algorithm for purposes of denoising. Then, a FDR approach is developed to determine the threshold for marking enriched regions in the binned histogram. Results We first test our method using a public PolII ChIP-seq dataset and compare our results with published results obtained using the published algorithm HPeak. Our results show a high consistency with the published results (80-100%). Then, we apply our proposed method on PolII ChIP-seq data generated in our own study on the effects of hormone on the breast cancer cell line MCF7. The results demonstrate that our method can effectively identify long enriched regions in ChIP-seq datasets. Specifically, pertaining to MCF7 control samples we identified 5,911 segments with length of at least 4 Kbp (maximum 233,000 bp); and in MCF7 treated with E2 samples, we identified 6,200 such segments (maximum 325,000 bp). Conclusions We demonstrated the effectiveness of this method in studying binding patterns of PolII in cancer cells which enables further deep analysis in transcription regulation and epigenetics. Our method complements existing peak detection algorithms for ChIP-seq experiments. PMID:22536865

  19. Decapitation improves detection of Wolbachia pipientis (Rickettsiales: Anaplasmataceae) in Culex pipiens (Diptera: Culicidae) mosquitoes by the polymerase chain reaction.

    PubMed

    Beckmann, J F; Fallon, A M

    2012-09-01

    Polymerase chain reaction (PCR) is often used to detect microorganisms, pathogens, or both, including the reproductive parasite Wolbachia pipientis (Rickettsiales: Anaplasmataceae), in mosquitoes. Natural populations of Culex pipiens L. (Diptera: Culicidae) mosquitoes are infected with one or more strains of W. pipientis, and crosses between mosquitoes harboring different Wolbachia strains provide one of the best-known examples of cytoplasmic incompatibililty (CI). When we used PCR to monitor Wolbachia in the Buckeye strain of Culex pipiens, and in a Wolbachia-cured sister colony obtained by tetracycline treatment, we noted false negative PCR reactions with DNA samples from infected mosquitoes; these results were inconsistent with direct microscopic observation of Wolbachia-like particles in gonads dissected from mosquitoes in the same population. Assays with diluted template often improved detection of positive samples, suggesting that DNA prepared from whole mosquitoes contained an inhibitor of the PCR reaction. We reconciled discrepancies between PCR and microscopy by systematic measurement of the PCR reaction in the presence of an internal standard. Mosquito decapitation before DNA extraction restored the reliability of the PCR reaction, allowing accurate determination of Wolbachia infection status in infected and tetracycline-cured mosquito populations, consistent with microscopic examination. Using PCR primers based on the Tr1 gene, we confirmed that the Wolbachia infection in the Buckeye strain of Culex pipiens belongs to the genotype designated wPip1. Finally, to explore more widely the distribution of PCR inhibitors, we demonstrated that DNA isolated from the cricket, Acheta domesticus (L.); the beetle, Tenebrio molitor L.; the honey bee, Apis mellifera L.; and the mosquito, Anopheles punctipennis Say also contained PCR inhibitors. These results underscore the importance of measuring the presence of inhibitors in PCR templates by using a known positive

  20. Prevalence, correlates and clinical usefulness of antibodies to RNA polymerase III in systemic sclerosis: a cross-sectional analysis of data from an Australian cohort

    PubMed Central

    2011-01-01

    Introduction The prevalence of antibodies to RNA polymerase III (anti-RNAP) differs among systemic sclerosis (SSc) cohorts worldwide. Previously reported associations of anti-RNAP include diffuse cutaneous disease, tendon friction rubs and renal crisis, with recent reports suggesting a close temporal association between malignancy and SSc disease onset among patients with anti-RNAP. Methods Patients with SSc were tested for the presence of anti-RNAP at recruitment into the Australian Scleroderma Cohort Study. We used univariate and multivariable methods to identify and quantify clinical and laboratory correlates of anti-RNAP in SSc. Diagnostic testing procedures were used to determine the usefulness of these antibodies in estimating the likelihood of clinically important outcomes. Results There were 451 patients with mean ± standard deviation age and disease duration at recruitment of 58.1 ± 12.4 and 11.6 ± 10.0 years, respectively; 151 (33.5%) patients were recruited within 5 years of diagnosis of SSc. Overall, 69 (15.3%) patients had anti-RNAP. Univariate associations of anti-RNAP were diffuse disease (75.4% vs. 20.9%, P < 0.0001), joint contractures (73.9% vs. 30.1%, P < 0.0001), greater highest-recorded modified Rodnan skin score (20.6 ± 12.4 vs. 10.1 ± 7.9, P < 0.0001), synovitis (31.9% vs. 19.9%, P = 0.03), myositis (2.9% vs. 0.5%, P = 0.05), systemic hypertension (59.4% vs. 39.7%, P = 0.002), renal crisis (24.6% vs. 1.8%, P < 0.0001) and malignancy diagnosed within 5 years of onset of SSc skin disease (13.3% vs. 3.9%, P = 0.01). In multiple regression analysis, after adjustment for other covariates, anti-RNAP were independently associated with renal crisis (odds ratio (OR) 3.8, 95% confidence interval (CI) 1.2 to 11.5, P = 0.02; positive predictive value (PPV) 24.6%, negative predictive value (NPV) 98.2%), diffuse disease (OR 6.4, 95% CI 2.9 to 13.8, P < 0.0001; PPV 75.4%, NPV 20.9%), joint contractures (OR 2.5, 95% CI 1.2 to 5.3, P = 0.02; PPV 73

  1. Two-step, PCR-free telomerase detection by using exonuclease III-aided target recycling.

    PubMed

    Zuo, Xiaolei; Xia, Fan; Patterson, Adriana; Soh, H Tom; Xiao, Yi; Plaxco, Kevin W

    2011-12-16

    We report the sensitive detection of telomerase activity by using exonuclease III-aided target recycling to amplify the signal produced by a chimeric LNA-DNA molecular beacon. We demonstrate the specific detection of as few as 30 telomerase-positive breast cancer cells in a single-measurement fluorescence assay that avoids the problematic PCR and gel analysis of the current "gold-standard" assay.

  2. Detection and genotyping of vancomycin-resistant Enterococcus spp. by multiplex polymerase chain reaction in Korean aquatic environmental samples.

    PubMed

    Nam, Sehee; Kim, Min-jeong; Park, Chulmin; Park, Jong-Geun; Maeng, Pil Jae; Lee, Gyu-Cheol

    2013-07-01

    The distribution characteristics of Enterococcus spp., which are indicators of fecal pollution, were investigated at 33 sites within the 3 major water systems of Korea. Enterococci were detected at concentrations ranging from 1 to 37 CFU/100mL in 41 of 132 samples (31.1%) from the 3 major water systems. The overall average detected concentration was 1.2 CFU/100mL, while the average concentration for all detection sites was 5.3 CFU/100mL. After optimized multiplex polymerase chain reaction (PCR) was performed with newly developed VanA, VanB, VanC-1, and VanC-2/3 primers, concentrations of vancomycin-resistant Enterococcus spp. (VRE) ranging from 1 to 23 CFU/100mL were detected in 17 of 132 samples (12.9%). Of 216 individual enterococcal colonies, 64 (29.6%) displayed the VanC genotype. The results of a susceptibility test to vancomycin showed that the range of the minimal inhibitory concentration (MIC), an indicator of bacterial resistance, was 4 to 24μg/mL, with the average MIC at 9.2±4.5μg/mL. Of the bacterial isolates, 1 colony with the VanC-1 genotype was identified as E. gallinarum by 16S rDNA sequencing, whereas the other 63 colonies had the VanC-2/3 genotype and were identified as E. casseliflavus. Although these results imply that the major head bays of Korea are not contaminated with the highly vancomycin-resistant VanA- or VanB-type VREs, the misuse of antibiotics should be prohibited to minimize the presence of VREs and to maintain a safe water supply for protecting the health of the general population. Based on the study results, we also recommend the implementation of a continuous, broad-spectrum inspection program for Enterococcus spp. and VRE contamination in the major head bays. Furthermore, the multiplex PCR method described in this study can be used effectively for this purpose.

  3. Detection and characterization of cry1Ac transgene construct in Bt cotton: multiple polymerase chain reaction approach.

    PubMed

    Singh, Chandra K; Ojha, Abhishek; Kachru, Devendra N

    2007-01-01

    To comply with international labeling regulations for genetically modified (GM) crops and food, and to enable proper identification of GM organisms (GMOs), effective methodologies and reliable approaches are needed. The spurious and unapproved GM planting has contributed to crop failures and commercial losses. To ensure effective and genuine GM cultivation, a methodology is needed to detect and identify the trait of interest and concurrently evaluate the structural and functional stability of the transgene insert. A multiple polymerase chain reaction (PCR) approach was developed for detection, identification, and gene stability confirmation of cry1Ac transgene construct in Bt cotton. As many as 9 samples of Bt cotton hybrid seeds comprising 3 approved Bt hybrids, MECH-12Bt, MECH-162Bt, MECH-184Bt, and a batch of 6 nonapproved Bt hybrids were tested. Initially, single standard PCR assays were run to amplify predominant GM DNA sequences (CaMV 35S promoter, nos terminator, and npt-II marker gene); a housekeeping gene, Gossypium hirsutum fiber-specific acyl carrier protein gene (acp1); a trait-specific transgene (cry1Ac); and a sequence of 7S 3' transcription terminator which specifically borders with 3' region of cry1Ac transgene cassette. The concurrent amplification of all sequences of the entire cassette was performed by 3 assays, duplex, triplex, and quadruplex multiplex PCR assays, under common assay conditions. The identity of amplicons was reconfirmed by restriction endonuclease digestion profile. The 2 distinct transgene cassettes, cry1Ac and npt-II, of the Bt cotton were amplified using the respective forward primer of promoter and reverse primer of terminator. The resultant amplicons were excised, eluted, and purified. The purified amplicons served as template for nested PCR assays. The nested PCR runs confirmed the transgene construct orientation and identity. The limit of detection as established by our assay for GM trait (cry1Ac) was 0.1%. This approach

  4. Identification of carriers among individuals recruited in the typhoid registry in Malaysia using stool culture, polymerase chain reaction, and dot enzyme immunoassay as detection tools.

    PubMed

    Chua, Ang Lim; Aziah, Ismail; Balaram, Prabha; Bhuvanendran, Saatheeyavaane; Anthony, Amy Amilda; Mohmad, Siti Norazura; Nasir, Norhafiza M; Hassan, Haslizai; Naim, Rochman; Meran, Lila P; Hussin, Hani M; Ismail, Asma

    2015-03-01

    Chronic carriers of Salmonella Typhi act as reservoirs for the organism and become the agents of typhoid outbreaks in a community. In this study, chronic carriers in Kelantan, Malaysia were first identified using the culture and polymerase chain reaction method. Then, a novel serological tool, designated Typhidot-C, was evaluated in retrospect using the detected individuals as control positives. Chronic carriage positive by the culture and polymerase chain reaction method was recorded at 3.6% (4 out of 110) among individuals who previously had acute typhoid fever and a 9.4% (10 out of 106) carriage rate was observed among food handlers screened during outbreaks. The Typhidot-C assay was able to detect all these positive carriers showing its potential as a viable carrier screening tool and can be used for efficient detection of typhoid carriers in an endemic area. These findings were used to establish the first carrier registry for S Typhi carriers in Malaysia.

  5. Identification of carriers among individuals recruited in the typhoid registry in Malaysia using stool culture, polymerase chain reaction, and dot enzyme immunoassay as detection tools.

    PubMed

    Chua, Ang Lim; Aziah, Ismail; Balaram, Prabha; Bhuvanendran, Saatheeyavaane; Anthony, Amy Amilda; Mohmad, Siti Norazura; Nasir, Norhafiza M; Hassan, Haslizai; Naim, Rochman; Meran, Lila P; Hussin, Hani M; Ismail, Asma

    2015-03-01

    Chronic carriers of Salmonella Typhi act as reservoirs for the organism and become the agents of typhoid outbreaks in a community. In this study, chronic carriers in Kelantan, Malaysia were first identified using the culture and polymerase chain reaction method. Then, a novel serological tool, designated Typhidot-C, was evaluated in retrospect using the detected individuals as control positives. Chronic carriage positive by the culture and polymerase chain reaction method was recorded at 3.6% (4 out of 110) among individuals who previously had acute typhoid fever and a 9.4% (10 out of 106) carriage rate was observed among food handlers screened during outbreaks. The Typhidot-C assay was able to detect all these positive carriers showing its potential as a viable carrier screening tool and can be used for efficient detection of typhoid carriers in an endemic area. These findings were used to establish the first carrier registry for S Typhi carriers in Malaysia. PMID:23000800

  6. Optimization of the elution buffer and concentration method for detecting hepatitis E virus in swine liver using a nested reverse transcription-polymerase chain reaction and real-time reverse transcription-polymerase chain reaction.

    PubMed

    Son, Na Ry; Seo, Dong Joo; Lee, Min Hwa; Seo, Sheungwoo; Wang, Xiaoyu; Lee, Bog-Hieu; Lee, Jeong-Su; Joo, In-Sun; Hwang, In-Gyun; Choi, Changsun

    2014-09-01

    The aim of this study was to develop an optimal technique for detecting hepatitis E virus (HEV) in swine livers. Here, three elution buffers and two concentration methods were compared with respect to enhancing recovery of HEV from swine liver samples. Real-time reverse transcription-polymerase chain reaction (RT-PCR) and nested RT-PCR were performed to detect HEV RNA. When phosphate-buffered saline (PBS, pH 7.4) was used to concentrate HEV in swine liver samples using ultrafiltration, real-time RT-PCR detected HEV in 6 of the 26 samples. When threonine buffer was used to concentrate HEV using polyethylene glycol (PEG) precipitation and ultrafiltration, real-time RT-PCR detected HEV in 1 and 3 of the 26 samples, respectively. When glycine buffer was used to concentrate HEV using ultrafiltration and PEG precipitation, real-time RT-PCR detected HEV in 1 and 3 samples of the 26 samples, respectively. When nested RT-PCR was used to detect HEV, all samples tested negative regardless of the type of elution buffer or concentration method used. Therefore, the combination of real-time RT-PCR and ultrafiltration with PBS buffer was the most sensitive and reliable method for detecting HEV in swine livers.

  7. Detection of DNA damage by thiazole orange fluorescence probe assisted with exonuclease III.

    PubMed

    Lu, Qian; Zhou, Zhenxian; Mei, Yuan; Wei, Wei; Liu, Songqin

    2013-11-15

    This work reports a fluorescent dye insertion approach for detection of DNA damage. The capture DNA with overhanging 3'-terminus was immobilized on silicon surface to hybridize with target DNA. The intercalation of cyanine dye of thiazole orange (TO) to the double helix structure of DNA (dsDNA) allowed intense enhancement of fluorescence signal. The DNA damage with chemicals led to poor intercalation of TO into double helix structure, resulting in the decrease of the fluorescence signal. This signal decrease could be further enhanced by exonuclease III (Exo III). With this approach, the target DNA could be detected down to 47 fM. Seven chemicals were chosen as models to monitor DNA damage. The results suggested that the present strategy could be developed to detect DNA damage, to classify the damaging mechanism with chemicals and to estimate the toxic effect of chemicals.

  8. Clinical spectrum, diagnostic criteria, and polymerase chain reaction of aqueous humor in viral and toxoplasma detection in Fuchs’ uveitis syndrome

    PubMed Central

    Sabhapandit, Swapnali; Murthy, Somasheila I; Balne, Praveen K; Sangwan, Virender Singh; Sumanth, V; Reddy, Ashok K

    2016-01-01

    Aim: The aim of this study is to describe the clinical features and diagnostic criteria of Fuchs’ uveitis (FU) and to determine whether it has an association with virus and toxoplasma in the aqueous humor during cataract surgery. Setting and Design: This is a prospective, case–control study. Materials and Methods: Patients with FU (n = 25), anterior uveitis (n = 15), and no uveitis (normal) (n = 50) were included based on predefined inclusion and exclusion criteria for all three groups. Polymerase chain reaction (PCR) of aqueous humor and serum for rubella, herpes simplex virus (HSV), cytomegalovirus (CMV), varicella-zoster virus (VZV), and toxoplasma was done using conventional uniplex PCR. Statistical Analysis: It was done using SPSS software using Chi-square test for categorical variables, and P < 0.05 was considered statistically significant. Results: Ninety patients were enrolled in the study in three groups, comparable for age, gender, and laterality of ocular involvement. All patients had diffuse keratic precipitates in FU group (P = 0001) with none having posterior synechiae (P = 0.046) which was statistically significant when compared to anterior uveitis patients. Iris nodules were noted in one case in both groups. Serum and aqueous PCR was negative for detection of VZV, CMV, toxoplasma, and rubella in all groups. PCR for HSV was positive in one patient in “normal” group but was not statistically significant. Conclusion: Our study shows that diagnosis of FU is mainly clinical. There appears to be no role of aqueous humor testing for viruses by PCR to aid in etiological diagnosis. PMID:27688274

  9. Estimation and Preparation of the Hypervariable Regions I/II Templates for Mitochondrial DNA Typing From Human Bones and Teeth Remains Using Singleplex Quantitative Polymerase Chain Reaction.

    PubMed

    Le, Thien Ngoc; Van Phan, Hieu; Dang, Anh Tuan Mai; Nguyen, Vy Thuy

    2016-09-01

    A method was designed for estimating and sequencing of mitochondrial DNA (mtDNA) that effectively and more quickly provides a complete mtDNA profile. In this context, we have developed this novel strategy for typing mtDNA from 10 bones and teeth remains (3 months to 44 years). The quantification of mtDNA was achieved by singleplex real-time polymerase chain reaction of the hypervariable region I fragment (445 bp) and hypervariable region II fragment (617 bp). Combined with the melting curve analysis, we have determined as little as 10 pg of mtDNA template that is suitable for sequence analysis. Furthermore, quantitative polymerase chain reaction products were directly used for following step of mtDNA typing by Sanger sequencing. This method allows the profile to be completely provided for faster human identification. PMID:27356010

  10. A novel molecular beacon-based method for isothermal detection of sequence-specific DNA via T7 RNA polymerase-aided target regeneration.

    PubMed

    Yin, Bin-Cheng; Wu, Shan; Ma, Jin-Liang; Ye, Bang-Ce

    2015-06-15

    Developing molecular beacon (MB)-based method for DNA detection has been of great interest to many researchers because of its intrinsic advantages of simplicity, rapidity, and specificity. In this work, we have developed a novel MB-based method for isothermal detection of sequence-specific DNA via T7 RNA polymerase-aided target regeneration strategy. The proposed method involves three primary processes of target-mediated ligation by T4 DNA ligase, transcription reaction by T7 RNA polymerase, and MB switch for signal output. Upon the hybridization with DNA target, a rationally designed MB and a pair of primers encoded with T7 promoter sequence were ligated via the formation of a phosphodiester bond by T4 DNA ligase. The resultant joint fragment acted as template to initiate T7 RNA polymerase-mediated transcription reaction. Correspondingly, a great amount of RNA strands complementary to MB and partial primers were transcribed to initiate new cyclic reactions of MB switch, ligation, and transcription. With such signal amplification strategy of the regeneration of target-like RNA fragments, our proposed assay achieved a detection limit as low as ∼10 pM, which was ∼3 orders of magnitude lower than the traditional MB-based method with a recognition mechanism in 1:1 stoichiometric ratio between MB and target molecule.

  11. Rapid detection of virulence-associated genes in avian pathogenic Escherichia coli by multiplex polymerase chain reaction.

    PubMed

    Ewers, Christa; Janssen, Traute; Kiessling, Sabine; Philipp, Hans-C; Wieler, Lothar H

    2005-06-01

    Based on recently published prevalence data of virulence-associated factors in avian pathogenic Escherichia coli (APEC) and their roles in the pathogenesis of colibacillosis, we developed a multiplex polymerase chain reaction (PCR) as a molecular tool supplementing current diagnostic schemes that mainly rely on serological examination of strains isolated from diseased birds. Multiple isolates of E. coli from clinical cases of colibacillosis known to possess different combinations of eight genes were used as sources of template DNA to develop the multiplex PCR protocol, targeting genes for P-fimbriae (papC), aerobactin (iucD), iron-repressible protein (irp2), temperature-sensitive hemagglutinin (tsh), vacuolating autotransporter toxin (vat), enteroaggregative toxin (astA), increased serum survival protein (iss), and colicin V plasmid operon genes (cva/cvi). In order to verify the usefulness of this diagnostic tool, E. coli strains isolated from fecal samples of clinically healthy chickens were also included in this study, as were uropathogenic (UPEC), necrotoxigenic, and diarrhegenic E. coli strains. The application of the multiplex PCR protocol to 14 E. coli strains isolated from septicemic poultry showed that these strains harbored four to eight of the genes mentioned above. In contrast, those isolates that have been shown to be nonpathogenic for 5-wk-old chickens possessed either none or, at most, three of these genes. We found only one enterohemorrhagic (EHEC), one enteropathogenic (EPEC), and two enterotoxic (ETEC) E. coli strains positive for irp2, and another two ETEC strains positive for astA. As expected, UPEC isolates yielded different combinations of the genes iss, papC, iucD, irp2, and a sequence similar to vat. However, neither the colicin V operon genes cva/cvi nor tsh were amplified in UPEC isolates. The multiplex PCR results were compared with those obtained by DNA-DNA-hybridization analyses to validate the specificity of oligonucleotide primers, and

  12. Polymerase Chain Reaction (PCR)-based methods for detection and identification of mycotoxigenic Penicillium species using conserved genes

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Polymerase chain reaction amplification of conserved genes and sequence analysis provides a very powerful tool for the identification of toxigenic as well as non-toxigenic Penicillium species. Sequences are obtained by amplification of the gene fragment, sequencing via capillary electrophoresis of d...

  13. Detection and differentiation of wild-type and vaccine strains of canine distemper virus by a duplex reverse transcription polymerase chain reaction.

    PubMed

    Dong, X Y; Li, W H; Zhu, J L; Liu, W J; Zhao, M Q; Luo, Y W; Chen, J D

    2015-01-01

    Canine distemper virus (CDV) is the cause of canine distemper (CD) which is a severe and highly contagious disease in dogs. In the present study, a duplex reverse transcription polymerase chain reaction (RT-PCR) method was developed for the detection and differentiation of wild-type and vaccine strains of CDV. Four primers were designed to detect and discriminate the two viruses by generating 638- and 781-bp cDNA products, respectively. Furthermore, the duplex RT-PCR method was used to detect 67 field samples suspected of CD from Guangdong province in China. Results showed that, 33 samples were to be wild-type-like. The duplex RT-PCR method exhibited high specificity and sensitivity which could be used to effectively detect and differentiate wild-type and vaccine CDV, indicating its use for clinical detection and epidemiological surveillance. PMID:27175171

  14. Detection and differentiation of wild-type and vaccine strains of canine distemper virus by a duplex reverse transcription polymerase chain reaction

    PubMed Central

    Dong, X. Y.; Li, W. H.; Zhu, J. L.; Liu, W. J.; Zhao, M. Q.; Luo, Y. W.; Chen, J. D.

    2015-01-01

    Canine distemper virus (CDV) is the cause of canine distemper (CD) which is a severe and highly contagious disease in dogs. In the present study, a duplex reverse transcription polymerase chain reaction (RT-PCR) method was developed for the detection and differentiation of wild-type and vaccine strains of CDV. Four primers were designed to detect and discriminate the two viruses by generating 638- and 781-bp cDNA products, respectively. Furthermore, the duplex RT-PCR method was used to detect 67 field samples suspected of CD from Guangdong province in China. Results showed that, 33 samples were to be wild-type-like. The duplex RT-PCR method exhibited high specificity and sensitivity which could be used to effectively detect and differentiate wild-type and vaccine CDV, indicating its use for clinical detection and epidemiological surveillance. PMID:27175171

  15. Polymerase chain reaction system

    DOEpatents

    Benett, William J.; Richards, James B.; Stratton, Paul L.; Hadley, Dean R.; Milanovich, Fred P.; Belgrader, Phil; Meyer, Peter L.

    2004-03-02

    A portable polymerase chain reaction DNA amplification and detection system includes one or more chamber modules. Each module supports a duplex assay of a biological sample. Each module has two parallel interrogation ports with a linear optical system. The system is capable of being handheld.

  16. The OGLE-III planet detection efficiency from six years of microlensing observations (2003-2008)

    NASA Astrophysics Data System (ADS)

    Tsapras, Y.; Hundertmark, M.; Wyrzykowski, Ł.; Horne, K.; Udalski, A.; Snodgrass, C.; Street, R.; Bramich, D. M.; Dominik, M.; Bozza, V.; Figuera Jaimes, R.; Kains, N.; Skowron, J.; Szymański, M. K.; Pietrzyński, G.; Soszyński, I.; Ulaczyk, K.; Kozłowski, S.; Pietrukowicz, P.; Poleski, R.

    2016-04-01

    We use six years (2003-2008) of Optical Gravitational Lensing Experiment-III microlensing observations to derive the survey detection efficiency for a range of planetary masses and projected distances from the host star. We perform an independent analysis of the microlensing light curves to extract the event parameters and compute the planet detection probability given the data. 2433 light curves satisfy our quality selection criteria and are retained for further processing. The aggregate of the detection probabilities over the range explored yields the expected number of microlensing planet detections. We employ a Galactic model to convert this distribution from dimensionless to physical units, α/au and M⊕. The survey sensitivity to small planets is highest in the range 1-4 au, shifting to slightly larger separations for more massive ones.

  17. Elimination of contaminating DNA within polymerase chain reaction reagents: implications for a general approach to detection of uncultured pathogens.

    PubMed Central

    Meier, A; Persing, D H; Finken, M; Böttger, E C

    1993-01-01

    Analysis based on comparisons of 16S rRNA sequences provides a rapid and reliable approach to identifying human pathogens. By directing oligonucleotide primers at sequences conserved throughout the eubacterial kingdom, bacterial 16S ribosomal DNA sequences of virtually any member of the eubacterial kingdom can be amplified by polymerase chain reaction and subsequently analyzed by sequence determination. Indeed, automated systems for broad-range amplification, sequencing, and data analysis are now feasible and may form the basis of the next generation of automated microbial identification systems. However, identification of pathogens by this strategy is hampered by the frequent contamination of reagents used for the amplification reaction, in particular Taq polymerase, with exogenous bacterial DNA. Here, we describe detailed investigations on the use of 8-methoxypsoralen and long-wave UV light to eliminate contaminating DNA in polymerase chain reaction reagents. The clinical utility of the developed procedure was demonstrated in a case of paucibacillary osteomyelitis, for which no specific bacterial agent had been cultured. Images PMID:8458958

  18. Giardia and Cryptosporidium spp. dissemination during wastewater treatment and comparative detection via immunofluorescence assay (IFA), nested polymerase chain reaction (nested PCR) and loop mediated isothermal amplification (LAMP).

    PubMed

    Gallas-Lindemann, Carmen; Sotiriadou, Isaia; Plutzer, Judit; Noack, Michael J; Mahmoudi, Mohammad Reza; Karanis, Panagiotis

    2016-06-01

    Environmental water samples from the Lower Rhine area in Germany were investigated via immunofluorescence assays (IFAs), nested polymerase chain reaction (nested PCR) and loop-mediated isothermal amplification (LAMP) to detect the presence of Giardia spp. (n=185) and Cryptosporidium spp. (n=227). The samples were concentrated through filtration or flocculation, and oocysts were purified via centrifugation through a sucrose density gradient. For all samples, IFA was performed first, followed by DNA extraction for the nested PCR and LAMP assays. Giardia cysts were detected in 105 samples (56.8%) by IFA, 62 samples (33.5%) by nested PCR and 79 samples (42.7%) by LAMP. Cryptosporidium spp. were detected in 69 samples (30.4%) by IFA, 95 samples (41.9%) by nested PCR and 99 samples (43.6%) by LAMP. According to these results, the three detection methods are complementary for monitoring Giardia and Cryptosporidium in environmental waters.

  19. Development of Conventional and Real-Time Reverse Transcription Polymerase Chain Reaction Assays to Detect Tembusu Virus in Culex tarsalis Mosquitoes

    PubMed Central

    Petz, Lawrence N.; Turell, Michael J.; Padilla, Susana; Long, Lewis S.; Reinbold-Wasson, Drew D.; Smith, Darci R.; O'Guinn, Monica L.; Melanson, Vanessa R.; Lee, John S.

    2014-01-01

    Tembusu virus (TMUV) is an important emerging arthropod-borne virus that may cause encephalitis in humans and has been isolated in regions of southeast Asia, including Malaysia, Thailand, and China. Currently, detection and identification of TMUV are limited to research laboratories, because quantitative rapid diagnostic assays for the virus do not exist. We describe the development of sensitive and specific conventional and real-time quantitative reverse transcription polymerase chain reaction assays for detecting TMUV RNA in infected cell culture supernatant and Culex tarsalis mosquitoes. We used this assay to document the replication of TMUV in Cx. tarsalis, where titers increased 1,000-fold 5 days after inoculation. These assays resulted in the detection of virus-specific RNA in the presence of copurified mosquito nucleic acids. The use of these rapid diagnostic assays may have future applications for field pathogen surveillance and may assist in early detection, diagnosis, and control of the associated arthropod-borne pathogens. PMID:25114013

  20. Development of conventional and real-time reverse transcription polymerase chain reaction assays to detect Tembusu virus in Culex tarsalis mosquitoes.

    PubMed

    Petz, Lawrence N; Turell, Michael J; Padilla, Susana; Long, Lewis S; Reinbold-Wasson, Drew D; Smith, Darci R; O'Guinn, Monica L; Melanson, Vanessa R; Lee, John S

    2014-10-01

    Tembusu virus (TMUV) is an important emerging arthropod-borne virus that may cause encephalitis in humans and has been isolated in regions of southeast Asia, including Malaysia, Thailand, and China. Currently, detection and identification of TMUV are limited to research laboratories, because quantitative rapid diagnostic assays for the virus do not exist. We describe the development of sensitive and specific conventional and real-time quantitative reverse transcription polymerase chain reaction assays for detecting TMUV RNA in infected cell culture supernatant and Culex tarsalis mosquitoes. We used this assay to document the replication of TMUV in Cx. tarsalis, where titers increased 1,000-fold 5 days after inoculation. These assays resulted in the detection of virus-specific RNA in the presence of copurified mosquito nucleic acids. The use of these rapid diagnostic assays may have future applications for field pathogen surveillance and may assist in early detection, diagnosis, and control of the associated arthropod-borne pathogens.

  1. Development of a locked nucleic acid real-time polymerase chain reaction assay for the detection of Pinus armandii in mixed species pine nut samples associated with dysgeusia.

    PubMed

    Handy, Sara M; Timme, Ruth E; Jacob, Salena M; Deeds, Jonathan R

    2013-02-01

    Recent work has shown that the presence of the species Pinus armandii , even when occurring as species mixtures of pine nuts, is correlated with taste disturbance (dysgeusia), also referred to as "pine mouth". Because of this known possibility of pine nut mixtures, a need was identified for a rapid streamlined assay to detect the presence of this species in the presence of other types of pine nuts. A locked nucleic acid probe was employed in a real-time polymerase chain reaction (RT-PCR) format to detect a single nucleotide polymorphism (SNP) unique to this species. This assay was able to detect P. armandii in homogenates down to ∼1% concentration (the lowest level tested) in the presence of several commonly co-occurring and closely related species of pine and should prove to be a useful tool for the detection of this species in food products.

  2. Archaeal TFEα/β is a hybrid of TFIIE and the RNA polymerase III subcomplex hRPC62/39

    PubMed Central

    Blombach, Fabian; Salvadori, Enrico; Fouqueau, Thomas; Yan, Jun; Reimann, Julia; Sheppard, Carol; Smollett, Katherine L; Albers, Sonja V; Kay, Christopher WM; Thalassinos, Konstantinos; Werner, Finn

    2015-01-01

    Transcription initiation of archaeal RNA polymerase (RNAP) and eukaryotic RNAPII is assisted by conserved basal transcription factors. The eukaryotic transcription factor TFIIE consists of α and β subunits. Here we have identified and characterised the function of the TFIIEβ homologue in archaea that on the primary sequence level is related to the RNAPIII subunit hRPC39. Both archaeal TFEβ and hRPC39 harbour a cubane 4Fe-4S cluster, which is crucial for heterodimerization of TFEα/β and its engagement with the RNAP clamp. TFEα/β stabilises the preinitiation complex, enhances DNA melting, and stimulates abortive and productive transcription. These activities are strictly dependent on the β subunit and the promoter sequence. Our results suggest that archaeal TFEα/β is likely to represent the evolutionary ancestor of TFIIE-like factors in extant eukaryotes. DOI: http://dx.doi.org/10.7554/eLife.08378.001 PMID:26067235

  3. Recombinase polymerase amplification (RPA) combined with lateral flow (LF) strip for equipment-free detection of Cryptosporidium spp. oocysts in dairy cattle feces.

    PubMed

    Wu, Yao-Dong; Zhou, Dong-Hui; Zhang, Long-Xian; Zheng, Wen-Bin; Ma, Jian-Gang; Wang, Meng; Zhu, Xing-Quan; Xu, Min-Jun

    2016-09-01

    Cryptosporidium is a widespread protozoan parasite that infects a large number of vertebrate animals, resulting in varying degrees of diarrhea or even death. As dairy cattle feces is an important source of Cryptosporidium spp. infection, development of a handy and accurate detection method via its oocysts in dairy cattle feces would be interesting and necessary. We herein developed a quick detecting method using recombinase polymerase amplification (RPA) combined with lateral flow (LF) strip to detect DNA of Cryptosporidium oocysts in dairy cattle feces. The DNA was released by boiled water with 0.1 % N-lauroylsarcosine sodium salt (LSS). The established method was proven to be of higher sensitivity than normal polymerase chain reaction (PCR) amplification with the lowest detection of 0.5 oocyst per reaction, and specificity with no cross reactivity to other common protozoan species in the intestine of dairy cattle. The diagnostic method established herein is simple, rapid, and cost-effective, and has potential for further development as a diagnostic kit for the diagnosis of cryptosporidiosis of dairy cattle.

  4. Recombinase polymerase amplification (RPA) combined with lateral flow (LF) strip for equipment-free detection of Cryptosporidium spp. oocysts in dairy cattle feces.

    PubMed

    Wu, Yao-Dong; Zhou, Dong-Hui; Zhang, Long-Xian; Zheng, Wen-Bin; Ma, Jian-Gang; Wang, Meng; Zhu, Xing-Quan; Xu, Min-Jun

    2016-09-01

    Cryptosporidium is a widespread protozoan parasite that infects a large number of vertebrate animals, resulting in varying degrees of diarrhea or even death. As dairy cattle feces is an important source of Cryptosporidium spp. infection, development of a handy and accurate detection method via its oocysts in dairy cattle feces would be interesting and necessary. We herein developed a quick detecting method using recombinase polymerase amplification (RPA) combined with lateral flow (LF) strip to detect DNA of Cryptosporidium oocysts in dairy cattle feces. The DNA was released by boiled water with 0.1 % N-lauroylsarcosine sodium salt (LSS). The established method was proven to be of higher sensitivity than normal polymerase chain reaction (PCR) amplification with the lowest detection of 0.5 oocyst per reaction, and specificity with no cross reactivity to other common protozoan species in the intestine of dairy cattle. The diagnostic method established herein is simple, rapid, and cost-effective, and has potential for further development as a diagnostic kit for the diagnosis of cryptosporidiosis of dairy cattle. PMID:27174027

  5. Cutting edge: Mouse NAIP1 detects the type III secretion system needle protein.

    PubMed

    Rayamajhi, Manira; Zak, Daniel E; Chavarria-Smith, Joseph; Vance, Russell E; Miao, Edward A

    2013-10-15

    The NAIP/NLRC4 inflammasomes activate caspase-1 in response to bacterial type III secretion systems (T3SSs). Inadvertent injection of the T3SS rod protein and flagellin into the cytosol is detected through murine NAIP2 and NAIP5/6, respectively. In this study, we identify the agonist for the orphan murine NAIP1 receptor as the T3SS needle protein. NAIP1 is poorly expressed in resting mouse bone marrow-derived macrophages; however, priming with polyinosinic-polycytidylic acid induces it and confers needle protein sensitivity. Further, overexpression of NAIP1 in immortalized bone marrow-derived macrophages by retroviral transduction enabled needle detection. In contrast, peritoneal cavity macrophages basally express NAIP1 and respond to needle protein robustly, independent of priming. Human macrophages are known to express only one NAIP gene, which detects the needle protein, but not rod or flagellin. Thus, murine NAIP1 is functionally analogous to human NAIP. PMID:24043898

  6. Sensitivity of polymerase chain reaction for detection of bovine viral diarrhea virus in pooled serum samples and use of pooled polymerase chain reaction to determine prevalence of bovine viral diarrhea virus in auction market cattle.

    PubMed

    Smith, Rebecca L; Sanderson, Michael W; Walz, Paul H; Givens, M Daniel

    2008-01-01

    Two reverse transcription-nested polymerase chain reaction tests, 1 quantitative (qRT-nPCR) and 1 standard (RT-nPCR), were evaluated to assess sensitivity for detection of bovine viral diarrhea virus (BVDV) of a single positive serum sample in a pool of 30. The RT-nPCR and qRT-nPCR each detected 95 of 100 known positives. The RT-nPCR was used to estimate the prevalence of BVDV in adult beef cows. Serum samples were obtained from the US Department of Agriculture brucellosis testing laboratories in 3 Midwestern states. Samples originated from auction markets and private treaty sales throughout the 3 states. A total of 2,990 serum samples were collected and randomly pooled into 100 pools for testing. Two of the 100 pools of field samples were positive, and each positive pool had a single positive individual sample upon confirmation. The estimate of BVDV prevalence in adult cows in this study was 0.07%. This study estimates the diagnostic sensitivity of RT-nPCR for BVDV and confirms that it is a useful diagnostic tool for pools of 30 serum samples and that prevalence of BVDV in adult cattle from auction markets is low.

  7. Multiplex real-time PCR SYBR Green for detection and typing of group III Clostridium botulinum.

    PubMed

    Anniballi, Fabrizio; Auricchio, Bruna; Delibato, Elisabetta; Antonacci, Monia; De Medici, Dario; Fenicia, Lucia

    2012-01-27

    Clostridium botulinum type C and type D belonging to the group III organisms, are mainly responsible for animal botulism outbreaks. Clinical signs alone are often insufficient to make a diagnosis of botulism and a laboratory confirmation is required. Laboratory confirmation can be performed by demonstrating the presence of botulinum neurotoxins in serum, gastrointestinal contents, liver, wound of sick or dead animals, or by demonstrating the presence of C. botulinum in gastrointestinal contents, liver, and wound. Demonstration of spores in gastrointestinal contents or tissue of animals with clinical signs indicative of botulism reinforces the clinical diagnosis. With the aim of detecting and typing C. botulinum group III organisms, a multiplex real-time PCR SYBR Green was developed and in-house validated. Selectivity, limit of detection, relative accuracy, relative specificity, relative sensitivity, and repeatability of the method were investigated. The multiplex real-time PCR SYBR green used showed a 100% selectivity, 100% relative accuracy, 100% relative specificity, 100% relative sensitivity and a limit of detection of 277 and 580 DNA copies for C. botulinum type C and C. botulinum type D, respectively. The method reported here represents a suitable tool for laboratory diagnosis of type C and D botulism and for testing a large number of samples collected during the animal botulism surveillance and prevention activities.

  8. Fluorescent single-stranded DNA-based assay for detecting unchelated Gadolinium(III) ions in aqueous solution.

    PubMed

    Edogun, Osafanmwen; Nguyen, Nghia Huu; Halim, Marlin

    2016-06-01

    The main concern pertaining to the safety of Gadolinium(III)-based contrast agents (GBCAs) is the toxicity caused by the unchelated ion, which may be inadvertently present in the solution due most commonly to excess unreacted starting material or dissociation of the complexes. Detecting the aqueous free ion during the synthesis and preparation of GBCA solutions is therefore instrumental in ensuring the safety of the agents. This paper reports the development of a sensitive fluorogenic sensor for aqueous unchelated Gadolinium(III) (Gd(III)). Our design utilizes single-stranded oligodeoxynucleotides with a specific sequence of 44 bases as the targeting moiety. The fluorescence-based assay may be run at ambient pH with very small amounts of samples in 384-well plates. The sensor is able to detect nanomolar concentration of Gd(III), and is relatively unresponsive toward a range of biologically relevant ions and the chelated Gd(III). Although some cross-reactivity with other trivalent lanthanide ions, such as Europium(III) and Terbium(III), is observed, these are not commonly found in biological systems and contrast agents. This convenient and rapid method may be useful in ascertaining a high purity of GBCA solutions. Graphical abstract Fluorescent aptamer-based assay for detecting unchelated Ln(III) ions in aqueous solution. PMID:27071762

  9. Allele-specific polymerase chain reaction for detection of a mutation in the relax circular DNA and the covalently closed circular DNA of hepatitis B virus.

    PubMed

    Pan, Wan-Long; Hu, Jie-Li; Fang, Yan; Luo, Qiang; Xu, Ge; Xu, Lei; Jing, Zhou-Hong; Shan, Xue-Feng; Zhu, Yan-Ling; Huang, Ai-Long

    2013-12-01

    The relax circle DNA (rcDNA) sequence and the covalently closed circle DNA (cccDNA) sequence in hepatitis B virus (HBV) are crucial regions for HBV infections. To analyze mutations in rcDNA and cccDNA, DNA sequencing is often used, although it is time-consuming and expensive. Herein, we report a simple, economic, albeit accurate allele-specific polymerase chain reaction (AS-PCR) to detect mutations in these regions of HBV. This method can be extensively used to screen for mutations at specific positions of HBV genome.

  10. [The detection of minimal residual disease in patients with chronic B-cell lymphatic leukemia using patient-specified polymerase chain reaction].

    PubMed

    Sidorova, Iu V; Sorokina, T V; Biderman, B V; Nikulina, E E; Kisilichina, D G; Naumova, E V; Pochtar', M E; Lugovskaia, S A; Ivanova, V L; Kovaleva, L G; Ptushkin, V V; Nikitin, E A; Sudarikov, A B

    2011-12-01

    The new effective protocols of treatment of chronic B-cell lymphatic leukemia, including purine analogs and monoclonal antibodies, provide robust remissions under this disease. Accordingly, the requirements to remission quality assessment are changed too. In particular the assessment of minimal residual disease is obligatory. To assess minimal residual disease in terms of quantity in case of chronic B-cell lymphatic leukemia the technique of polymerase chain reaction was applied in real time with patient-specific primers from the area of V-D-J combinations of genes of heavy chain of immunoglobulin. The study included samples from 60 patients suffering of chronic B-cell lymphatic leukemia. In 15 of them (25%), it was impossible to apply neither the sequence analysis of genes of heavy chain of immunoglobulin nor the fitting of patient-specific primer. The results of quantitative determination of minimal residual disease were obtained in 45 patients (55 tests). The minimal residual disease was detected in 30 of 55 samples (54.5%) and was not detected in 25 of 55 samples (45.5%). At the same time, the quantitative determination of minimal residual disease was implemented in regard to the initial level of neoplastic cells. The method sensitivity qualified by serial dilutions, consisted 10(-5) or 1 neoplastic cell to 100 000 normal cells. The comparative analysis was applied to the results of determination of minimal residual disease using two methods -polymerase chain reaction in real time using patient-specified primers and four-color flow cytofluometry. The determination of minimal residual disease with both methods was implemented in 37 patients (45 tests). The results of both methods matched in 93.3% (42 tests out of 45) with maximal disparity of one degree. Then Spearman factor consisted 0.87 (p < 0.0001). In 3 out of 45 tests (6.7%) neoplastic cells were detected with only one method. In the first case, it was the method of four-color flow cytofluometry and in

  11. Gamma-ray burst radio afterglows from Population III stars: simulation methods and detection prospects with SKA precursors

    NASA Astrophysics Data System (ADS)

    Macpherson, D.; Coward, D.

    2015-10-01

    We investigate the prospects of detecting radio afterglows from long Gamma-Ray Bursts (GRBs) from Population III (Pop III) progenitors using the Square Kilometre Array (SKA) precursor instruments MWA (Murchison Widefield Array) and ASKAP (Australian SKA Pathfinder). We derive a realistic model of GRB afterglows that encompasses the widest range of plausible physical parameters and observation angles. We define the best case scenario of Pop III GRB energy and redshift distributions. Using probability distribution functions fitted to the observed microphysical parameters of long GRBs, we simulate a large number of Pop III GRB afterglows to find the global probability of detection. We find that ASKAP may be able to detect 35 per cent of Pop III GRB afterglows in the optimistic case, and 27 per cent in the pessimistic case. A negligible number will be detectable by MWA in either case. Detections per image for ASKAP, found by incorporating intrinsic rates with detectable time-scales, are as high as ˜6000 and as low as ˜11, which shows the optimistic case is unrealistic. We track how the afterglow flux density changes over various time intervals and find that, because of their very slow variability, the cadence for blind searches of these afterglows should be as long as possible. We also find Pop III GRBs at high redshift have radio afterglow light curves that are indistinguishable from those of regular long GRBs in the more local Universe.

  12. The potential for detecting gamma-ray burst afterglows from population III stars with the next generation of infrared telescopes

    SciTech Connect

    Macpherson, D.; Coward, D. M.; Zadnik, M. G.

    2013-12-10

    We investigate the detectability of a proposed population of gamma-ray bursts (GRBs) from the collapse of Population III (Pop III) stars. The James Webb Space Telescope (JWST) and Space Infrared Telescope for Cosmology and Astrophysics (SPICA) will be able to observe the late time infrared afterglows. We have developed a new method to calculate their detectability, which takes into account the fundamental initial mass function and formation rates of Pop III stars, from which we find the temporal variability of the afterglows and ultimately the length of time JWST and SPICA can detect them. In the range of plausible Pop III GRB parameters, the afterglows are always detectable by these instruments during the isotropic emission, for a minimum of 55 days and a maximum of 3.7 yr. The average number of detectable afterglows will be 2.96× 10{sup –5} per SPICA field of view (FOV) and 2.78× 10{sup –6} per JWST FOV. These are lower limits, using a pessimistic estimate of Pop III star formation. An optimal observing strategy with SPICA could identify a candidate orphan afterglow in ∼1.3 yr, with a 90% probability of confirmation with further detailed observations. A beamed GRB will align with the FOV of the planned GRB detector Energetic X-ray Imaging Survey Telescope once every 9 yr. Pop III GRBs will be more easily detected by their isotropic emissions (i.e., orphan afterglows) rather than by their prompt emissions.

  13. The Potential for Detecting Gamma-Ray Burst Afterglows from Population III Stars with the Next Generation of Infrared Telescopes

    NASA Astrophysics Data System (ADS)

    Macpherson, D.; Coward, D. M.; Zadnik, M. G.

    2013-12-01

    We investigate the detectability of a proposed population of gamma-ray bursts (GRBs) from the collapse of Population III (Pop III) stars. The James Webb Space Telescope (JWST) and Space Infrared Telescope for Cosmology and Astrophysics (SPICA) will be able to observe the late time infrared afterglows. We have developed a new method to calculate their detectability, which takes into account the fundamental initial mass function and formation rates of Pop III stars, from which we find the temporal variability of the afterglows and ultimately the length of time JWST and SPICA can detect them. In the range of plausible Pop III GRB parameters, the afterglows are always detectable by these instruments during the isotropic emission, for a minimum of 55 days and a maximum of 3.7 yr. The average number of detectable afterglows will be 2.96× 10-5 per SPICA field of view (FOV) and 2.78× 10-6 per JWST FOV. These are lower limits, using a pessimistic estimate of Pop III star formation. An optimal observing strategy with SPICA could identify a candidate orphan afterglow in ~1.3 yr, with a 90% probability of confirmation with further detailed observations. A beamed GRB will align with the FOV of the planned GRB detector Energetic X-ray Imaging Survey Telescope once every 9 yr. Pop III GRBs will be more easily detected by their isotropic emissions (i.e., orphan afterglows) rather than by their prompt emissions.

  14. Rapid detection of health-care-associated bloodstream infection in critical care using multipathogen real-time polymerase chain reaction technology: a diagnostic accuracy study and systematic review.

    PubMed Central

    Warhurst, Geoffrey; Dunn, Graham; Chadwick, Paul; Blackwood, Bronagh; McAuley, Daniel; Perkins, Gavin D; McMullan, Ronan; Gates, Simon; Bentley, Andrew; Young, Duncan; Carlson, Gordon L; Dark, Paul

    2015-01-01

    BACKGROUND There is growing interest in the potential utility of real-time polymerase chain reaction (PCR) in diagnosing bloodstream infection by detecting pathogen deoxyribonucleic acid (DNA) in blood samples within a few hours. SeptiFast (Roche Diagnostics GmBH, Mannheim, Germany) is a multipathogen probe-based system targeting ribosomal DNA sequences of bacteria and fungi. It detects and identifies the commonest pathogens causing bloodstream infection. As background to this study, we report a systematic review of Phase III diagnostic accuracy studies of SeptiFast, which reveals uncertainty about its likely clinical utility based on widespread evidence of deficiencies in study design and reporting with a high risk of bias. OBJECTIVE Determine the accuracy of SeptiFast real-time PCR for the detection of health-care-associated bloodstream infection, against standard microbiological culture. DESIGN Prospective multicentre Phase III clinical diagnostic accuracy study using the standards for the reporting of diagnostic accuracy studies criteria. SETTING Critical care departments within NHS hospitals in the north-west of England. PARTICIPANTS Adult patients requiring blood culture (BC) when developing new signs of systemic inflammation. MAIN OUTCOME MEASURES SeptiFast real-time PCR results at species/genus level compared with microbiological culture in association with independent adjudication of infection. Metrics of diagnostic accuracy were derived including sensitivity, specificity, likelihood ratios and predictive values, with their 95% confidence intervals (CIs). Latent class analysis was used to explore the diagnostic performance of culture as a reference standard. RESULTS Of 1006 new patient episodes of systemic inflammation in 853 patients, 922 (92%) met the inclusion criteria and provided sufficient information for analysis. Index test assay failure occurred on 69 (7%) occasions. Adult patients had been exposed to a median of 8 days (interquartile range 4

  15. Development of a new real-time polymerase chain reaction assay to detect Duck adenovirus A DNA and application to samples from Swiss poultry flocks.

    PubMed

    Schybli, Martina; Sigrist, Brigitte; Hess, Michael; van Leerdam, Bart; Hoop, Richard K; Vögtlin, Andrea

    2014-03-01

    Between 2008 and 2012, commercial Swiss layer and layer breeder flocks experiencing problems in laying performance were sampled and tested for infection with Duck adenovirus A (DAdV-A; previously known as Egg drop syndrome 1976 virus). Organ samples from birds sent for necropsy as well as blood samples from living animals originating from the same flocks were analyzed. To detect virus-specific DNA, a newly developed quantitative real-time polymerase chain reaction method was applied, and the presence of antibodies against DAdV-A was tested using a commercially available enzyme-linked immunosorbent assay. In 5 out of 7 investigated flocks, viral DNA was detected in tissues. In addition, antibodies against DAdV-A were detected in all of the flocks. PMID:24590667

  16. Development of Multiplex Real-Time Polymerase Chain Reaction for Detection of Entamoeba histolytica, Entamoeba dispar, and Entamoeba moshkovskii in Clinical Specimens

    PubMed Central

    Hamzah, Zulhainan; Petmitr, Songsak; Mungthin, Mathirut; Leelayoova, Saovanee; Chavalitshewinkoon-Petmitr, Porntip

    2010-01-01

    Multiplex real-time polymerase chain reaction (PCR) was developed for differential detection of Entamoeba histolytica, Entamoeba dispar, and Entamoeba moshkovskii. Specific primers were designed for all three species, and then differentiation of E. histolytica and E. dispar was achieved simultaneously using a hybridization probe and melting curve analysis, whereas E. moshkovskii was detected with a separate probe under the same condition. This assay detected as little as 0.2 pg of E. histolytica DNA and 2 pg each for E. dispar and E. moshkovskii DNA. Thirty-five clinical samples suspected to be E. histolytica infection by microscopy were tested. The results showed 32 positive samples; four samples were E. histolytica and 28 samples were E. dispar. Interestingly, one E. dispar positive sample showed a mixed infection with E. moshkovskii. This is the first report of E. moshkovskii infection from Thailand and this assay is currently the most rapid and sensitive method to differentiate these human amoebas. PMID:20889890

  17. Development of multiplex real-time polymerase chain reaction for detection of Entamoeba histolytica, Entamoeba dispar, and Entamoeba moshkovskii in clinical specimens.

    PubMed

    Hamzah, Zulhainan; Petmitr, Songsak; Mungthin, Mathirut; Leelayoova, Saovanee; Chavalitshewinkoon-Petmitr, Porntip

    2010-10-01

    Multiplex real-time polymerase chain reaction (PCR) was developed for differential detection of Entamoeba histolytica, Entamoeba dispar, and Entamoeba moshkovskii. Specific primers were designed for all three species, and then differentiation of E. histolytica and E. dispar was achieved simultaneously using a hybridization probe and melting curve analysis, whereas E. moshkovskii was detected with a separate probe under the same condition. This assay detected as little as 0.2 pg of E. histolytica DNA and 2 pg each for E. dispar and E. moshkovskii DNA. Thirty-five clinical samples suspected to be E. histolytica infection by microscopy were tested. The results showed 32 positive samples; four samples were E. histolytica and 28 samples were E. dispar. Interestingly, one E. dispar positive sample showed a mixed infection with E. moshkovskii. This is the first report of E. moshkovskii infection from Thailand and this assay is currently the most rapid and sensitive method to differentiate these human amoebas.

  18. Development of field-based real-time reverse transcription-polymerase chain reaction assays for detection of Chikungunya and O'nyong-nyong viruses in mosquitoes.

    PubMed

    Smith, Darci R; Lee, John S; Jahrling, Jordan; Kulesh, David A; Turell, Michael J; Groebner, Jennifer L; O'Guinn, Monica L

    2009-10-01

    Chikungunya (CHIK) and O'nyong-nyong (ONN) are important emerging arthropod-borne diseases. Molecular diagnosis of these two viruses in mosquitoes has not been evaluated, and the effects of extraneous mosquito tissue on assay performance have not been tested. Additionally, no real-time reverse transcription-polymerase chain reaction (RT-PCR) assay exists for detecting ONN virus (ONNV) RNA. We describe the development of sensitive and specific real-time RT-PCR assays for detecting CHIK and ONN viral RNA in mosquitoes, which have application for field use. In addition, we compared three methods for primer/probe design for assay development by evaluating their sensitivity and specificity. This comparison resulted in development of virus-specific assays that could detect less than one plaque-forming unit equivalent of each of the viruses in mosquitoes. The use of these assays will aid in arthropod-borne disease surveillance and in the control of the associated diseases.

  19. Temporal ChIP-on-Chip of RNA-Polymerase-II to detect novel gene activation events during photoreceptor maturation

    PubMed Central

    Tummala, Padmaja; Mali, Raghuveer S.; Guzman, Eduardo; Zhang, Xiao

    2010-01-01

    Purpose During retinal development, post-mitotic neural progenitor cells must activate thousands of genes to complete synaptogenesis and terminal maturation. While many of these genes are known, others remain beyond the sensitivity of expression microarray analysis. Some of these elusive gene activation events can be detected by mapping changes in RNA polymerase-II (Pol-II) association around transcription start sites. Methods High-resolution (35 bp) chromatin immunoprecipitation (ChIP)-on-chip was used to map changes in Pol-II binding surrounding 26,000 gene transcription start sites during photoreceptor maturation of the mouse neural retina, comparing postnatal age 25 (P25) to P2. Coverage was 10–12 kb per transcription start site, including 2.5 kb downstream. Pol-II-active regions were mapped to the mouse genomic DNA sequence by using computational methods (Tiling Analysis Software-TAS program), and the ratio of maximum Pol-II binding (P25/P2) was calculated for each gene. A validation set of 36 genes (3%), representing a full range of Pol-II signal ratios (P25/P2), were examined with quantitative ChIP assays for transcriptionally active Pol-II. Gene expression assays were also performed for 19 genes of the validation set, again on independent samples. FLT-3 Interacting Zinc-finger-1 (FIZ1), a zinc-finger protein that associates with active promoter complexes of photoreceptor-specific genes, provided an additional ChIP marker to highlight genes activated in the mature neural retina. To demonstrate the use of ChIP-on-chip predictions to find novel gene activation events, four additional genes were selected for quantitative PCR analysis (qRT–PCR analysis); these four genes have human homologs located in unidentified retinal disease regions: Solute carrier family 25 member 33 (Slc25a33), Lysophosphatidylcholine acyltransferase 1 (Lpcat1), Coiled-coil domain-containing 126 (Ccdc126), and ADP-ribosylation factor-like 4D (Arl4d). Results ChIP-on-chip Pol-II peak

  20. Development of a TaqMan Probe-Based Insulated Isothermal Polymerase Chain Reaction (iiPCR) Assay for Detection of Fusarium oxysporum f. sp. cubense Race 4.

    PubMed

    Lin, Ying-Hong; Lin, Yi-Jia; Chang, Tsai-De; Hong, Li-Ling; Chen, Tzu-Yu; Chang, Pi-Fang Linda

    2016-01-01

    This study developed a novel and inexpensive detection method based on a TaqMan probe-based insulated isothermal polymerase chain reaction (iiPCR) method for the rapid detection of Panama disease caused by Fusarium oxysporum f. sp. cubense (Foc) race 4, which is currently among the most serious fungal vascular diseases worldwide. By using the portable POCKIT™ device with the novel primer set iiFoc-1/iiFoc-2, the Foc race 4 iiPCR assay (including DNA amplification and signal monitoring) could be completed within one hour. The developed Foc race 4 iiPCR assay is thus a user-friendly and efficient platform designed specifically for the detection of Foc race 4. The detection limit of this optimized Foc iiPCR system was estimated to be 1 copy of the target standard DNA as well as 1 fg of the Foc genomic DNA. This approach can serve as a rapid detection method for in planta detection of Foc race 4 in field-infected banana. It was concluded that this molecular detection procedure based on iiPCR has good potential for use as an efficient detection method. PMID:27448242

  1. Development of a TaqMan Probe-Based Insulated Isothermal Polymerase Chain Reaction (iiPCR) Assay for Detection of Fusarium oxysporum f. sp. cubense Race 4

    PubMed Central

    Lin, Yi-Jia; Chang, Tsai-De; Hong, Li-Ling; Chen, Tzu-Yu; Chang, Pi-Fang Linda

    2016-01-01

    This study developed a novel and inexpensive detection method based on a TaqMan probe-based insulated isothermal polymerase chain reaction (iiPCR) method for the rapid detection of Panama disease caused by Fusarium oxysporum f. sp. cubense (Foc) race 4, which is currently among the most serious fungal vascular diseases worldwide. By using the portable POCKIT™ device with the novel primer set iiFoc-1/iiFoc-2, the Foc race 4 iiPCR assay (including DNA amplification and signal monitoring) could be completed within one hour. The developed Foc race 4 iiPCR assay is thus a user-friendly and efficient platform designed specifically for the detection of Foc race 4. The detection limit of this optimized Foc iiPCR system was estimated to be 1 copy of the target standard DNA as well as 1 fg of the Foc genomic DNA. This approach can serve as a rapid detection method for in planta detection of Foc race 4 in field-infected banana. It was concluded that this molecular detection procedure based on iiPCR has good potential for use as an efficient detection method. PMID:27448242

  2. Effect of the Concentration Difference between Magnesium Ions and Total Ribonucleotide Triphosphates in Governing the Specificity of T7 RNA Polymerase-Based Rolling Circle Transcription for Quantitative Detection.

    PubMed

    Li, Zhiyan; Lau, Choiwan; Lu, Jianzhong

    2016-06-01

    T7 RNA polymerase-based rolling circle transcription (RCT) is a more powerful tool than universal runoff transcription and traditional DNA polymerase-based rolling circle amplification (RCA). However, RCT is rarely employed in quantitative detection due to its poor specificity for small single-stranded DNA (ssDNA), which can be transcribed efficiently by T7 RNA polymerase even without a promoter. Herein we show that the concentration difference between Mg(2+) and total ribonucleotide triphosphates (rNTPs) radically governs the specificity of T7 RNA polymerase. Only when the total rNTP concentration is 9 mM greater than the Mg(2+) concentration can T7 RNA polymerase transcribe ssDNA specifically and efficiently. This knowledge improves our traditional understanding of T7 RNA polymerase and makes convenient application of RCT in quantitative detection possible. Subsequently, an RCT-based label-free chemiluminescence method for microRNA detection was designed to test the capability of this sensing platform. Using this simple method, microRNA as low as 20 amol could be quantitatively detected. The results reveal that the developed sensing platform holds great potential for further applications in the quantitative detection of a variety of targets. PMID:27167591

  3. Highly sensitive detection of chromium (III) ions by resonance Rayleigh scattering enhanced by gold nanoparticles

    NASA Astrophysics Data System (ADS)

    Chen, Min; Cai, Huai-Hong; Yang, Fen; Lin, Dewen; Yang, Pei-Hui; Cai, Jiye

    2014-01-01

    Simple and sensitive determination of chromium (III) ions (Cr3+) has potential applications for detecting trace contamination in environment. Here, the assay is based on the enhancement of resonance Rayleigh scattering (RRS) by Cr3+-induced aggregation of citrate-capped gold nanoparticles (AuNPs). Transmission electron microscopy (TEM) and UV-vis absorption spectroscopy were employed to characterize the nanostructures and spectroscopic properties of the Cr3+-AuNP system. The experiment conditions, such as reaction time, pH value, salt concentration and interfering ions, were investigated. The combination of signal amplification of Cr3+-citrate chelation with high sensitivity of RRS technique allow a selective assay of Cr3+ ions with a detection limit of up to 1.0 pM. The overall assay can be carried out at room temperature within only twenty minutes, making it suitable for high-throughput routine applications in environment and food samples.

  4. Sensitive and selective amplified fluorescence DNA detection based on exonuclease III-aided target recycling.

    PubMed

    Zuo, Xiaolei; Xia, Fan; Xiao, Yi; Plaxco, Kevin W

    2010-02-17

    A limitation of many traditional approaches to the detection of specific oligonucleotide sequences, such as molecular beacons, is that each target strand hybridizes with (and thus activates) only a single copy of the relevant probe sequence. This 1:1 hybridization ratio limits the gain of most approaches and thus their sensitivity. Here we demonstrate a nuclease-amplified DNA detection scheme in which exonuclease III is used to "recycle" target molecules, thus leading to greatly improved sensitivity relative to, for example, traditional molecular beacons without any significant restriction in the choice of target sequences. The exonuclease-amplified assay can detect target DNA at concentrations as low as 10 pM when performed at 37 degrees C, which represents a significant improvement over the equivalent molecular beacon alone. Moreover, at 4 degrees C we can obtain a detection limit as low as 20 aM, albeit at the cost of a 24 h incubation period. Finally, our assay can be easily interrogated with the naked eye and is thus amenable to deployment in the developing world, where fluorometric detection is more problematic.

  5. Innate immune detection of the type III secretion apparatus through the NLRC4 inflammasome

    PubMed Central

    Miao, Edward A.; Mao, Dat P.; Yudkovsky, Natalya; Bonneau, Richard; Lorang, Cynthia G.; Warren, Sarah E.; Leaf, Irina A.; Aderem, Alan

    2010-01-01

    The mammalian innate immune system uses Toll-like receptors (TLRs) and Nod-LRRs (NLRs) to detect microbial components during infection. Often these molecules work in concert; for example, the TLRs can stimulate the production of the proforms of the cytokines IL-1β and IL-18, whereas certain NLRs trigger their subsequent proteolytic processing via caspase 1. Gram-negative bacteria use type III secretion systems (T3SS) to deliver virulence factors to the cytosol of host cells, where they modulate cell physiology to favor the pathogen. We show here that NLRC4/Ipaf detects the basal body rod component of the T3SS apparatus (rod protein) from S. typhimurium (PrgJ), Burkholderia pseudomallei (BsaK), Escherichia coli (EprJ and EscI), Shigella flexneri (MxiI), and Pseudomonas aeruginosa (PscI). These rod proteins share a sequence motif that is essential for detection by NLRC4; a similar motif is found in flagellin that is also detected by NLRC4. S. typhimurium has two T3SS: Salmonella pathogenicity island-1 (SPI1), which encodes the rod protein PrgJ, and SPI2, which encodes the rod protein SsaI. Although PrgJ is detected by NLRC4, SsaI is not, and this evasion is required for virulence in mice. The detection of a conserved component of the T3SS apparatus enables innate immune responses to virulent bacteria through a single pathway, a strategy that is divergent from that used by plants in which multiple NB-LRR proteins are used to detect T3SS effectors or their effects on cells. Furthermore, the specific detection of the virulence machinery permits the discrimination between pathogenic and nonpathogenic bacteria. PMID:20133635

  6. Recombinase Polymerase Amplification (RPA) of CaMV-35S Promoter and nos Terminator for Rapid Detection of Genetically Modified Crops

    PubMed Central

    Xu, Chao; Li, Liang; Jin, Wujun; Wan, Yusong

    2014-01-01

    Recombinase polymerase amplification (RPA) is a novel isothermal DNA amplification and detection technology that enables the amplification of DNA within 30 min at a constant temperature of 37–42 °C by simulating in vivo DNA recombination. In this study, based on the regulatory sequence of the cauliflower mosaic virus 35S (CaMV-35S) promoter and the Agrobacterium tumefaciens nopaline synthase gene (nos) terminator, which are widely incorporated in genetically modified (GM) crops, we designed two sets of RPA primers and established a real-time RPA detection method for GM crop screening and detection. This method could reliably detect as few as 100 copies of the target molecule in a sample within 15–25 min. Furthermore, the real-time RPA detection method was successfully used to amplify and detect DNA from samples of four major GM crops (maize, rice, cotton, and soybean). With this novel amplification method, the test time was significantly shortened and the reaction process was simplified; thus, this method represents an effective approach to the rapid detection of GM crops. PMID:25310647

  7. Recombinase polymerase amplification (RPA) of CaMV-35S promoter and nos terminator for rapid detection of genetically modified crops.

    PubMed

    Xu, Chao; Li, Liang; Jin, Wujun; Wan, Yusong

    2014-10-10

    Recombinase polymerase amplification (RPA) is a novel isothermal DNA amplification and detection technology that enables the amplification of DNA within 30 min at a constant temperature of 37-42 °C by simulating in vivo DNA recombination. In this study, based on the regulatory sequence of the cauliflower mosaic virus 35S (CaMV-35S) promoter and the Agrobacterium tumefaciens nopaline synthase gene (nos) terminator, which are widely incorporated in genetically modified (GM) crops, we designed two sets of RPA primers and established a real-time RPA detection method for GM crop screening and detection. This method could reliably detect as few as 100 copies of the target molecule in a sample within 15-25 min. Furthermore, the real-time RPA detection method was successfully used to amplify and detect DNA from samples of four major GM crops (maize, rice, cotton, and soybean). With this novel amplification method, the test time was significantly shortened and the reaction process was simplified; thus, this method represents an effective approach to the rapid detection of GM crops.

  8. Mitochondrial DNA variation in chinook salmon and chum salmon detected by restriction enzyme analysis of polymerase chain reaction products

    USGS Publications Warehouse

    Cronin, M.; Spearman, R.; Wilmot, R.; Patton, J.; Bickman, J.

    1993-01-01

    We analyze intraspecific mitochondrial DNA variation in chinook salmon from drainages in the Yukon River, the Kenai River, and Oregon and California rivers; and chum salmon from the Yukon River and vancouver Island, and Washington rivers. For each species, three different portions of the mtDNA molecule were amplified seperately using the polymerase chain reaction and then digested with at least 19 restrictions enzymes. Intraspecific sequence divergences between haplotypes were less than 0.01 base subsitution per nucleotide. Nine chum salmon haplotypes were identified. Yukon River chum salmon stocks displayed more haplotypes (8) occurred in all areas. Seven chinook salmon haplotypes were identified. Four haplotypes occurred in the Yukon and Kenai rviers and four occured in the Oregon/California, with only one haplotype shared between the regions. Sample sizes were too small to quantify the degree of stock seperation among drainages, but the patterns of variation that we observed suggest utility of the technique in genetic stock identification.

  9. Polymerase chain reaction assay to detect Clostridium difficile tcdC variants is valuable in characterizing hospital epidemiology.

    PubMed

    Wilmer, A; Lloyd-Smith, E; Leung, V; Wong, T; Ritchie, G; Hoang, L; Champagne, S; Romney, M G

    2013-07-01

    The epidemiology of nosocomial Clostridium difficile infection (CDI), acquired at two hospitals in Vancouver over a one-year period, was reviewed. Cases were analysed by tcdC polymerase chain reaction, with tcdC variants (18 base pair deletion) highly associated with the NAP1 strain. Of the 214 cases identified, 51.9% were caused by these tcdC variants; these cases occurred more frequently in older patients admitted to the community hospital where the strain was endemic. Overall, at least five out of 24 cases classified as recurrences by surveillance definitions were reinfections. Molecular testing allowed identification of major epidemiological differences between the hospitals studied and provided more accurate classification of CDI cases. PMID:23702278

  10. Simultaneous detection of seven sexually transmitted agents in human immunodeficiency virus-infected Brazilian women by multiplex polymerase chain reaction.

    PubMed

    Souza, Raquel P; de Abreu, André L P; Ferreira, Érika C; Rocha-Brischiliari, Sheila C; de B Carvalho, Maria D; Pelloso, Sandra M; Bonini, Marcelo G; Gimenes, Fabrícia; Consolaro, Marcia E L

    2013-12-01

    We determined the prevalence of seven clinically important pathogens that cause sexually transmitted infections (STIs) (Chlamydia trachomatis, Neisseria gonorrhoeae, Mycoplasma genitalium, Trichomonas vaginalis, herpes simplex virus 1 [HSV-1], HSV-2, and Treponema pallidum), by using a multiplex polymerase chain reaction (M-PCR) in samples from Brazilian woman infected with human immunodeficiency virus 1 (HIV-1) and uninfected Brazilian women (controls). The M-PCR assay identified all STIs tested for and surprisingly, occurred association between the control and STIs. This association was probably caused by excellent HIV infection control and regular monitoring in these women established by public health strategies in Brazil to combat HIV/acquired immunodeficiency syndrome. Studies using this M-PCR in different populations may help to better elucidate the roles of STIs in several conditions.

  11. Simultaneous detection of seven sexually transmitted agents in human immunodeficiency virus-infected Brazilian women by multiplex polymerase chain reaction.

    PubMed

    Souza, Raquel P; de Abreu, André L P; Ferreira, Érika C; Rocha-Brischiliari, Sheila C; de B Carvalho, Maria D; Pelloso, Sandra M; Bonini, Marcelo G; Gimenes, Fabrícia; Consolaro, Marcia E L

    2013-12-01

    We determined the prevalence of seven clinically important pathogens that cause sexually transmitted infections (STIs) (Chlamydia trachomatis, Neisseria gonorrhoeae, Mycoplasma genitalium, Trichomonas vaginalis, herpes simplex virus 1 [HSV-1], HSV-2, and Treponema pallidum), by using a multiplex polymerase chain reaction (M-PCR) in samples from Brazilian woman infected with human immunodeficiency virus 1 (HIV-1) and uninfected Brazilian women (controls). The M-PCR assay identified all STIs tested for and surprisingly, occurred association between the control and STIs. This association was probably caused by excellent HIV infection control and regular monitoring in these women established by public health strategies in Brazil to combat HIV/acquired immunodeficiency syndrome. Studies using this M-PCR in different populations may help to better elucidate the roles of STIs in several conditions. PMID:24080632

  12. Novel method for detection of small amounts of RNA based on the semi-nested polymerase chain reaction.

    PubMed

    Sanders, S; Thomas, G A

    1997-04-01

    A technique for the amplification of very small quantities of cDNA based on a semi-nested polymerase chain reaction system has been developed. The technique uses an additional blocking oligonucleotide "primer" in the second round nest which is complementary to one of the first round primers. This prevents amplification of first round product or of any other unwanted products dependent on that primer, but allows amplification of second round product, using first round product as the template. The second round primers are added through the oil layer, eliminating the possibility of introducing first round product aerosol into the atmosphere, as would be the case in a fully nested system. Contamination is therefore minimised, while amplification of the desired product is maximised. PMID:9231160

  13. Short report: application of a polymerase chain reaction to detect Burkholderia pseudomallei in clinical specimens from patients with suspected melioidosis.

    PubMed

    Gal, Daniel; Mayo, Mark; Spencer, Emma; Cheng, Allen C; Currie, Bart J

    2005-12-01

    The diagnostic potential of a Burkholderia pseudomallei type three secretion system (TTS1) polymerase chain reaction (PCR) was examined on clinical specimens from 27 patients with sepsis in the Northern Territory of Australia, a region endemic for melioidosis. The TTS1 PCR was conducted on DNA extracted from a range of clinical specimens (blood, sputum, urine, joint, pericardial and pleural fluid, and swabs from skin lesions, throat, nose, and rectum). The PCR sensitivity in culture-positive clinical specimens from the nine confirmed patients with melioidosis was 65% and the specificity was 100%, with no PCR-positive results in specimens from 18 patients without melioidosis. The PCR based on the B. pseudomallei TTS1 has the potential to substantially improve the timeliness of diagnosis of melioidosis.

  14. Short report: the use of a polymerase chain reaction to detect Echinococcus granulosus (G1 strain) eggs in soil samples.

    PubMed

    Shaikenov, B S; Rysmukhambetova, A T; Massenov, B; Deplazes, P; Mathis, A; Torgerson, P R

    2004-10-01

    Cystic echinococcosis is a re-emerging disease in central Asia. A total of 120 soil samples taken from 30 gardens of rural homesteads in southern Kazakhstan were analyzed for the presence of taeniid eggs using a concentration technique. Of these, 21 (17.5%) were shown to be contaminated with taeniid eggs. These isolated taeniid eggs were further analyzed using a polymerase chain reaction specific for the G1 (sheep) strain of the tapeworm Echinococcus granulosus, and five samples were shown to be positive. This study demonstrates the widespread contamination of the environment with E. granulosus eggs in an Echinococcus-endemic area and thus the potential for indirect transmission of E. granulosus to humans from such sources.

  15. Event-specific qualitative and quantitative polymerase chain reaction methods for detection of genetically modified rapeseed Ms8xRf3 based on the right border junctions.

    PubMed

    Wu, Gang; Wu, Yuhua; Xiao, Ling; Lu, Changming

    2008-01-01

    Ms8xRf3 is a genetically modified rapeseed hybrid which is widely cultivated in Canada and exported to some other countries for production of foodstuffs or fodder. In this study, the genomic sequences flanking the right borders of the integrated transgenic sequences in the Ms8xRf3 genome were characterized and showed high similarities with the bacterial artificial chromosome clone of Chinese cabbage. Event-specific qualitative polymerase chain reaction (PCR) methods were established with the primers and probes targeting the junction regions to produce a 123 base pair (bp) product for the Ms8 event and 92 bp for the Rf3 event. The absolute detection limit of qualitative PCR was 2.5 initial template copies for the Ms8 event and 50 copies for the Rf3 event. Quantitiative detection methods were established, with the absolute quantification limit being approximately 25 initial template copies.

  16. Detection of human cytomegalovirus DNA in paraffin sections of human brain by polymerase chain reaction and the occurrence of false negative results.

    PubMed Central

    Gass, P; Kiessling, M; Schäfer, P; Mester, C; Schmitt, H P; Kühn, J E

    1993-01-01

    Paraffin-embedded necropsy material from 6 patients with human cytomegalovirus encephalitis (HCMVE) corroborated by immunocytochemistry and 11 control cases were examined for the presence of human cytomegalovirus (HCMV) DNA by a nested polymerase chain reaction (nPCR). A characteristic 183 base pair (bp) fragment of the HCMV genome could readily be amplified in 4 cases of HCMVE. In 2 cases of HCMVE, viral DNA could be demonstrated only sporadically by PCR, due most likely to inefficient DNA extraction or DNA degradation. All control cases remained negative. The nPCR provides a specific method for detecting HCMV DNA in routinely processed biopsy and necropsy material and may be used in archival tissues for the diagnosis of infection. Fixation of samples and DNA extraction are, however, crucial steps and require careful control if PCR is used for detection of HCMV, to avoid false negative results. Images PMID:8382271

  17. Simultaneous detection of Chlamydia spp., Coxiella burnetii, and Neospora caninum in abortion material of ruminants by multiplex real-time polymerase chain reaction.

    PubMed

    Reisberg, Kerstin; Selim, Abdelfattah M; Gaede, Wolfgang

    2013-09-01

    Chlamydia spp., Coxiella burnetii, and Neospora caninum are responsible for reproductive diseases and are closely linked with high abortion rates in ruminants. Furthermore, C. burnetii and Chlamydia spp. have zoonotic potential. A real-time polymerase chain reaction (PCR) assay was developed for the simultaneous detection of Chlamydia spp., C. burnetii, and N. caninum. The detection of beta-actin as internal control in the same PCR reaction provides additional information about sample quality by detecting the presence of PCR inhibitors. The multiplex real-time PCR developed in the current study shows a greater sensitivity compared to previously used single-target PCR reactions with a reproducible detection limit of 0.13 plasmid copies per PCR for each target. Additional parallel amplification of all detectable pathogens did not adversely impact sensitivity. This new multiplex PCR allows the highly sensitive, cost-effective, and rapid detection of 3 important pathogens and has the potential to be a useful time-saving tool in the routine diagnosis of abortion cases in ruminants.

  18. Rapid diagnostic detection of plum pox virus in Prunus plants by isothermal AmplifyRP(®) using reverse transcription-recombinase polymerase amplification.

    PubMed

    Zhang, Shulu; Ravelonandro, Michel; Russell, Paul; McOwen, Nathan; Briard, Pascal; Bohannon, Seven; Vrient, Albert

    2014-10-01

    Plum pox virus (PPV) causes the most destructive viral disease known as plum pox or Sharka disease in stone fruit trees. As an important regulated pathogen, detection of PPV is thus of critical importance to quarantine and eradication of the spreading disease. In this study, the innovative development of two AmplifyRP(®) tests is reported for a rapid isothermal detection of PPV using reverse transcription-recombinase polymerase amplification. In an AmplifyRP(®) test, all specific recombination and amplification reactions occur at a constant temperature without thermal cycling and the test results are either recorded in real-time with a portable fluorescence reader or displayed using a lateral flow strip contained inside an amplicon detection chamber. The major improvement of this assay is that the entire test from sample preparation to result can be completed in as little as 20min and can be performed easily both in laboratories and in the field. The results from this study demonstrated the ability of the AmplifyRP(®) technique to detect all nine PPV strains (An, C, CR, D, EA, M, Rec, T, or W). Among the economic benefits to pathogen surveys is the higher sensitivity of the AmplifyRP(®) to detect PPV when compared to the conventional ELISA and ImmunoStrip(®) assays. This is the first report describing the use of such an innovative technique to detect rapidly plant viruses affecting perennial crops.

  19. Sensitive detection of microRNA in complex biological samples via enzymatic signal amplification using DNA polymerase coupled with nicking endonuclease.

    PubMed

    Yin, Bin-Cheng; Liu, Yu-Qiang; Ye, Bang-Ce

    2013-12-01

    MicroRNA (miRNA) has become an ideal biomarker candidate for cancer diagnosis, prognosis, and therapy. In this study, we have developed a novel one-step method for sensitive and specific miRNA detection via enzymatic signal amplification and demonstrated its practical application in biological samples. The proposed signal amplification strategy is an integrated "biological circuit" designed to initiate a cascade of enzymatic polymerization reactions in order to detect, amplify, and measure a specific miRNA sequence by using the isothermal strand-displacement property of a mesophilic DNA polymerase together with the nicking activity of a restriction endonuclease. The circuit is composed of two molecular switches operating in series: the nicking endonuclease-assisted isothermal polymerization reaction activated by a specific miRNA and the strand-displacement polymerization reaction designed to initiate molecular beacon-assisted amplification and signal transduction. The hsa-miR-141 (miR-141) was chosen as a target miRNA because its level specifically elevates in prostate cancer. The proposed method allowed quantitative sequence-specific detection of miR-141 in a dynamic range from 1 fM to 100 nM, with an excellent ability to discriminate differences among miR-200 family members. Moreover, the detection assay was applied to quantify miR-141 in cancerous cell lysates. The results are in excellent agreement with those from the reverse transcription polymerase chain reaction method. On the basis of these findings, we believe that this proposed sensitive and specific assay has great potential as a miRNA quantification method for use in biomedical research and clinical diagnosis.

  20. A new turn-off fluorescence probe based on graphene quantum dots for detection of Au(III) ion

    NASA Astrophysics Data System (ADS)

    Amjadi, Mohammad; Shokri, Roghayeh; Hallaj, Tooba

    2016-01-01

    In this work, a new turn-off fluorescence probe based on the graphene quantum dots (GQDs) was designed for detection and quantification of Au(III) ion. GQDs were prepared by two simple carbonization methods using glucose (g-GQDs) and citric acid (c-GQDs) as carbon sources. The effect of some metal ions on the fluorescence intensity of the prepared GQDs was studied. It was found that the fluorescence of both GQDs is significantly quenched by Au(III) ions but the sensitivity and analytical performances are different for two prepared GQDs. Using g-GQDs, a new analytical method was developed for the determination of Au(III) in the concentration range of 1.0-80 μM, with a detection limit of 0.5 μM. The developed method was applied to the determination of Au(III) in water and plasma samples with satisfactory results.

  1. Study of Cobalt(III) Corrole as the Neutral Ionophore for Nitrite and Nitrate Detection via Polymeric Membrane Electrodes.

    PubMed

    Yang, Si; Meyerhoff, Mark E

    2013-12-01

    Cobalt(III) 5, 10, 15-tris(4-tert-butylphenyl) corrole was synthesized and incorporated into plasticized poly(vinyl chloride) membranes and studied as a neutral carrier ionophore via potentiometry. This cobalt(III) complex has binding affinity to nitrite, and the resulting membrane electrode yields reversible and Nernstian response toward nitrite. Enhanced nitrite selectivity is observed over other anions, including lipophilic anions such as thiocyanate and perchlorate when an appropriate amount of lipophilic cationic sites are added to the membrane phase. Detection limit to nitrite is ca. 5 µM. Using tributylphosphate as the plasticizer with the cobalt(III) corrole species yields electrodes with enhanced nitrate selectivity.

  2. High-throughput, low-cost, and event-specific polymerase chain reaction detection of herbicide tolerance in genetically modified soybean A2704-12.

    PubMed

    Ma, H; Li, H; Li, J; Wang, X F; Wei, P C; Li, L; Yang, J B

    2014-01-01

    The aim of this study was to develop an event-specific qualitative and real-time quantitative polymerase chain reaction (PCR) method for detection of herbicide-tolerance genetically modified (GM) soybean A2704-12. The event-specific PCR primers were designed, based on the 5'-flanking integration sequence in the soybean genome, to amplify the 239-bp target fragment. Employing the same event-specific primers, qualitative PCR and real-time quantitative PCR detection methods were successfully developed. The results showed that the A2704-12 event could be specifically distinguished from other GM soybean events. In the qualitative PCR assay, the limit of detection was 0.05%, and in the real-time quantitative PCR assay, the limit of detection was less than 0.01%. Moreover, our genomic DNA (gDNA) extraction protocol is high-throughput, safe, and low-cost. The event-specific PCR assay system is cost-efficient by using SYBR Green I in real-time PCR, and by using the same primers in both the qualitative and quantitative PCR assays. We therefore developed a high-throughput, low-cost, and event-specific qualitative and quantitative PCR detection method for GM soybean A2704-12. The method would be useful for market supervision and management of GM soybean A2704-12 due to its high specificity and sensitivity. PMID:24615034

  3. Development of TaqMan real-time reverse transcription-polymerase chain reaction for the detection and quantitation of porcine kobuvirus.

    PubMed

    Zhu, Xiangdong; Wang, Yufei; Chen, Jianfei; Zhang, Xin; Shi, Hongyan; Shi, Da; Gao, Jing; Feng, Li

    2016-08-01

    Porcine kobuvirus (PKV) is a newly emerging virus that has been detected in diarrheic pigs. Presently, reverse transcription-polymerase chain reaction (RT-PCR) and RT-loop-mediated amplification are the only methods that can be used to detect PKV. To develop a TaqMan real-time RT-PCR for the rapid detection and quantitation of PKV nucleic acid in fecal samples, a pair of primers and a probe were designed to amplify the conserved 3D region of the PKV genome. After optimization, the TaqMan real-time RT-PCR was highly specific and ∼1000 times more sensitive than conventional RT-PCR, and the detection limit was as low as 30 DNA copies. Among the 148 intestinal samples from piglets with diarrhea, 136 and 118 were positive based on the TaqMan and conventional RT-PCR methods, respectively, indicating that the TaqMan RT-PCR was more sensitive than conventional RT-PCR, and the total concordance of the two methods was approximately 87.84%. Thus, the TaqMan real-time RT-PCR should be a useful tool for the early detection and quantitation of PKV. PMID:26912233

  4. Evaluation of Antigen Detection Tests, Microscopy, and Polymerase Chain Reaction for Diagnosis of Malaria in Peripheral Blood in Asymptomatic Pregnant Women in Nanoro, Burkina Faso

    PubMed Central

    Kattenberg, Johanna H.; Tahita, Christian M.; Versteeg, Inge A. J.; Tinto, Halidou; Traoré/Coulibaly, Maminata; D'Alessandro, Umberto; Schallig, Henk D. F. H.; Mens, Petra F.

    2012-01-01

    Rapid diagnostics tests (RDTs) detect malaria specific antigen(s) in the circulation, even when parasites are sequestered in the placenta and not visible by microscopy. However, research on their diagnostic accuracy during pregnancy is limited. Pregnant women (n = 418) were screened for malaria during routine antenatal care by using two RDTs that detect histidine-rich protein 2 (HRP2) or Plasmodium lactate dehydrogenase, and enzyme-linked immunosorbent assays with antibodies that detect dihydrofolate reductase–thymidylate synthase or heme-detoxification protein, and compared with real-time polymerase chain reaction (RT-PCR) and microscopy for evaluation of their diagnostic accuracy. Prevalence of malaria infection was high (53% by PCR). The RT-PCR and the HRP2 RDT detected most cases of malaria during pregnancy, whereas microscopy, the Plasmodium lactate dehydrogenase RDT, and enzyme-linked immunosorbent assays for dihydrofolate reductase–thymidylate synthase and heme-detoxification protein antibodies did not detect several low-density infections. Therefore, the HRP2 RDT could be a useful tool in high-transmission areas for diagnosis of malaria in asymptomatic pregnant women. PMID:22859362

  5. Babesia infection in naturally exposed pet dogs from a north-eastern state (Assam) of India: detection by microscopy and polymerase chain reaction.

    PubMed

    Laha, R; Bhattacharjee, K; Sarmah, P C; Das, M; Goswami, A; Sarma, D; Sen, A

    2014-12-01

    The objective of the study was to detect Babesia infections in pet dogs of a north-eastern state of India. The diagnostic efficacy of Babesia infection by polymerase chain reaction (PCR) technique has been compared with microscopy examination. For this, a total of 111 blood samples of pet dogs presented at clinical complex of the College of Veterinary Science, Guwahati, Assam with clinical signs suspected for Babesia infection subjected to the study. A total of 44 (39.63 %) dogs were diagnosed as positive for Babesia infections after microscopic examination. Among these, Babesia canis infection was diagnosed in 5 dogs (4.50 %) and B. gibsoni infection in 39 (35.13 %) dogs microscopically in Giemsa stained blood smears. Molecular diagnosis using PCR detected 63 (56.75 %) dogs positive for Babesia infection. Single infection with B. canis was found in 9 (8.10 %) dogs while B. gibsoni alone was detected in 3 (2.70 %) dogs. Mixed infections by both these species were detected in 51 (45.94 %) dogs. Overall, PCR detected 54 (48.64 %) dogs as B. gibsoni and 60 (54.05 %) dogs as B. canis positive. PMID:25320489

  6. Development of a diagnostic real-time polymerase chain reaction assay for the detection of invasive Haemophilus influenzae in clinical samples.

    PubMed

    Meyler, Kenneth L; Meehan, Mary; Bennett, Desiree; Cunney, Robert; Cafferkey, Mary

    2012-12-01

    Since the introduction of the Haemophilus influenzae serotype b vaccine, invasive H. influenzae disease has become dominated by nontypeable (NT) strains. Several widely used molecular diagnostic methods have been shown to lack sensitivity or specificity in the detection of some of these strains. Novel real-time assays targeting the fucK, licA, and ompP2 genes were developed and evaluated. The fucK assay detected all strains of H. influenzae tested (n = 116) and had an analytical sensitivity of 10 genome copies/polymerase chain reaction (PCR). This assay detected both serotype b and NT H. influenzae in 12 previously positive specimens (culture and/or bexA PCR) and also detected H. influenzae in a further 5 of 883 culture-negative blood and cerebrospinal fluid (CSF) samples. The fucK assay has excellent potential as a diagnostic test for detection of typeable and nontypeable strains of invasive H. influenzae in clinical samples of blood and CSF. PMID:23017260

  7. Multiplex polymerase chain reaction-capillary gel electrophoresis: a promising tool for GMO screening--assay for simultaneous detection of five genetically modified cotton events and species.

    PubMed

    Nadal, Anna; Esteve, Teresa; Pla, Maria

    2009-01-01

    A multiplex polymerase chain reaction assay coupled to capillary gel electrophoresis for amplicon identification by size and color (multiplex PCR-CGE-SC) was developed for simultaneous detection of cotton species and 5 events of genetically modified (GM) cotton. Validated real-time-PCR reactions targeting Bollgard, Bollgard II, Roundup Ready, 3006-210-23, and 281-24-236 junction sequences, and the cotton reference gene acp1 were adapted to detect more than half of the European Union-approved individual or stacked GM cotton events in one reaction. The assay was fully specific (<1.7% of false classification rate), with limit of detection values of 0.1% for each event, which were also achieved with simulated mixtures at different relative percentages of targets. The assay was further combined with a second multiplex PCR-CGE-SC assay to allow simultaneous detection of 6 cotton and 5 maize targets (two endogenous genes and 9 GM events) in two multiplex PCRs and a single CGE, making the approach more economic. Besides allowing simultaneous detection of many targets with adequate specificity and sensitivity, the multiplex PCR-CGE-SC approach has high throughput and automation capabilities, while keeping a very simple protocol, e.g., amplification and labeling in one step. Thus, it is an easy and inexpensive tool for initial screening, to be complemented with quantitative assays if necessary.

  8. Multiplex polymerase chain reaction-capillary gel electrophoresis: a promising tool for GMO screening--assay for simultaneous detection of five genetically modified cotton events and species.

    PubMed

    Nadal, Anna; Esteve, Teresa; Pla, Maria

    2009-01-01

    A multiplex polymerase chain reaction assay coupled to capillary gel electrophoresis for amplicon identification by size and color (multiplex PCR-CGE-SC) was developed for simultaneous detection of cotton species and 5 events of genetically modified (GM) cotton. Validated real-time-PCR reactions targeting Bollgard, Bollgard II, Roundup Ready, 3006-210-23, and 281-24-236 junction sequences, and the cotton reference gene acp1 were adapted to detect more than half of the European Union-approved individual or stacked GM cotton events in one reaction. The assay was fully specific (<1.7% of false classification rate), with limit of detection values of 0.1% for each event, which were also achieved with simulated mixtures at different relative percentages of targets. The assay was further combined with a second multiplex PCR-CGE-SC assay to allow simultaneous detection of 6 cotton and 5 maize targets (two endogenous genes and 9 GM events) in two multiplex PCRs and a single CGE, making the approach more economic. Besides allowing simultaneous detection of many targets with adequate specificity and sensitivity, the multiplex PCR-CGE-SC approach has high throughput and automation capabilities, while keeping a very simple protocol, e.g., amplification and labeling in one step. Thus, it is an easy and inexpensive tool for initial screening, to be complemented with quantitative assays if necessary. PMID:19610365

  9. Development and evaluation of a real-time polymerase chain reaction assay targeting iap for the detection of Listeria monocytogenes in select food matrices.

    PubMed

    Chen, Yi; Kumar, Nishant; Siddique, Nusrat

    2011-10-01

    Listeria monocytogenes is an intracellular foodborne pathogen that has been associated with severe human illnesses. Various rapid detection methods have been developed for the specific detection of this pathogen. In the present study, a real-time quantitative polymerase chain reaction (PCR) assay targeting iap, a gene encoding extracellular protein p60, was developed for L. monocytogenes. The PCR efficiency is above 85% and the limit of detection (LOD) is 30 copies of genome per reaction for all strains tested. The assay exhibited 100% inclusivity and exclusivity rates. The detection of L. monocytogenes in five food matrices, whole milk, soft cheese, turkey deli meat, smoked salmon, and alfalfa sprouts, was evaluated with and without enrichment. Without enrichment, the LOD for all food matrices were 4×10(3) CFU/mL food enrichment mix for whole milk and 4×10(4) CFU/mL for all other foods. With 24 h incubation in Buffered Listeria Enrichment Broth, the LOD was 3 CFU/25 g food for whole milk, turkey deli meat, and smoked salmon and 9 CFU/25 g food for soft cheese and alfalfa sprouts. With 48 h incubation, the LOD was 3 CFU/25 g food for all matrices. This quantitative PCR appears to be a promising alternative for rapid detection of L. monocytogenes in select foods.

  10. Detection of Citrus leprosis virus C using specific primers and TaqMan probe in one-step real-time reverse-transcription polymerase chain reaction assays.

    PubMed

    Choudhary, Nandlal; Wei, G; Govindarajulu, A; Roy, Avijit; Li, Wenbin; Picton, Deric D; Nakhla, M K; Levy, L; Brlansky, R H

    2015-11-01

    Citrus leprosis virus C (CiLV-C), a causal agent of the leprosis disease in citrus, is mostly present in the South and Central America and spreading toward the North America. To enable better diagnosis and inhibit the further spread of this re-emerging virus a quantitative (q) real-time reverse transcription polymerase chain reaction (qRT-PCR) assay is needed for early detection of CiLV-C when the virus is present in low titer in citrus leprosis samples. Using the genomic sequence of CiLV-C, specific primers and probe were designed and synthesized to amplify a 73 nt amplicon from the movement protein (MP) gene. A standard curve of the 73 nt amplicon MP gene was developed using known 10(10)-10(1) copies of in vitro synthesized RNA transcript to estimate the copy number of RNA transcript in the citrus leprosis samples. The one-step qRT-PCR detection assays for CiLV-C were determined to be 1000 times more sensitive when compared to the one-step conventional reverse transcription polymerase chain reaction (RT-PCR) CiLV-C detection method. To evaluate the quality of the total RNA extracts, NADH dehydrogenase gene specific primers (nad5) and probe were included in reactions as an internal control. The one-step qRT-PCR specificity was successfully validated by testing for the presence of CiLV-C in the total RNA extracts of the citrus leprosis samples collected from Belize, Costa Rica, Mexico and Panama. Implementation of the one-step qRT-PCR assays for CiLV-C diagnosis should assist regulatory agencies in surveillance activities to monitor the distribution pattern of CiLV-C in countries where it is present and to prevent further dissemination into citrus growing countries where there is no report of CiLV-C presence. PMID:26341059

  11. An aptamer-based bio-barcode assay with isothermal recombinase polymerase amplification for cytochrome-c detection and anti-cancer drug screening.

    PubMed

    Loo, Jacky F C; Lau, P M; Ho, H P; Kong, S K

    2013-10-15

    Based on a recently reported ultra-sensitive bio-barcode (BBC) assay, we have developed an aptamer-based bio-barcode (ABC) alternative to detect a cell death marker cytochrome-c (Cyto-c) and its subsequent application to screen anti-cancer drugs. Aptamer is a short single-stranded DNA selected from a synthetic DNA library by virtue of its high binding affinity and specificity to its target based on its unique 3D structure from the nucleotide sequence after folding. In the BBC assay, an antigen (Ag) in analytes is captured by a micro-magnetic particle (MMP) coated with capturing antibodies (Abs). Gold nanoparticles (NPs) with another recognition Ab against the same target and hundreds of identical DNA molecules of known sequence are subsequently added to allow the formation of sandwich structures ([MMP-Ab1]-Ag-[Ab2-NP-DNA]). After isolating the sandwiches by a magnetic field, the DNAs hybridized to their complementary DNAs covalently bound on the NPs are released from the sandwiches after heating. Acting as an Ag identification tag, these bio-barcode DNAs with known DNA sequence are then amplified by polymerase chain reaction (PCR) and detected by fluorescence. In our ABC assay, we employed a Cyto-c-specific aptamer to substitute both the recognition Ab and barcode DNAs on the NPs in the BBC assay; and a novel isothermal recombinase polymerase amplification for the time-consuming PCR. The detection limit of our ABC assay for the Cyto-c was found to be 10 ng/mL and this new assay can be completed within 3h. Several potential anti-cancer drugs have been tested in vitro for their efficacy to kill liver cancer with or without multi-drug resistance.

  12. Detection of Citrus leprosis virus C using specific primers and TaqMan probe in one-step real-time reverse-transcription polymerase chain reaction assays.

    PubMed

    Choudhary, Nandlal; Wei, G; Govindarajulu, A; Roy, Avijit; Li, Wenbin; Picton, Deric D; Nakhla, M K; Levy, L; Brlansky, R H

    2015-11-01

    Citrus leprosis virus C (CiLV-C), a causal agent of the leprosis disease in citrus, is mostly present in the South and Central America and spreading toward the North America. To enable better diagnosis and inhibit the further spread of this re-emerging virus a quantitative (q) real-time reverse transcription polymerase chain reaction (qRT-PCR) assay is needed for early detection of CiLV-C when the virus is present in low titer in citrus leprosis samples. Using the genomic sequence of CiLV-C, specific primers and probe were designed and synthesized to amplify a 73 nt amplicon from the movement protein (MP) gene. A standard curve of the 73 nt amplicon MP gene was developed using known 10(10)-10(1) copies of in vitro synthesized RNA transcript to estimate the copy number of RNA transcript in the citrus leprosis samples. The one-step qRT-PCR detection assays for CiLV-C were determined to be 1000 times more sensitive when compared to the one-step conventional reverse transcription polymerase chain reaction (RT-PCR) CiLV-C detection method. To evaluate the quality of the total RNA extracts, NADH dehydrogenase gene specific primers (nad5) and probe were included in reactions as an internal control. The one-step qRT-PCR specificity was successfully validated by testing for the presence of CiLV-C in the total RNA extracts of the citrus leprosis samples collected from Belize, Costa Rica, Mexico and Panama. Implementation of the one-step qRT-PCR assays for CiLV-C diagnosis should assist regulatory agencies in surveillance activities to monitor the distribution pattern of CiLV-C in countries where it is present and to prevent further dissemination into citrus growing countries where there is no report of CiLV-C presence.

  13. Using the WMS-III to detect malingering: empirical validation of the rarely missed index (RMI).

    PubMed

    Killgore, W D; DellaPietra, L

    2000-12-01

    To detect malingering during memory assessment, we evaluated item response biases to the Logical Memory Delayed Recognition (LMDR) subtest of the WMS-III. In a sample of 50 healthy volunteers who were completely naïve to the content of the Logical Memory stories, 6 LMDR items were correctly endorsed above chance probabilities. These 6 rarely missed items significantly discriminated 51 patients with neurological impairment from 36 volunteers who attempted to feign head injury and poor cognitive performance. A weighted combination of the 6 items was summed to form a single Rarely Missed Index (RMI). The RMI accurately classified over 98% of participants and demonstrated high sensitivity (97%) and specificity (100%) in discriminating between analog malingerers and patients. Because the RMI is calculated directly from the LMDR items, it has the advantage of requiring no additional administration time or materials, and thus may serve as a quick screen for dissimulation that can be obtained without additional testing.

  14. Development of a polymerase chain reaction (PCR) test for the detection of virulent forms of Vibrio parahaemolyticus.

    PubMed

    Kadhim, H M; Miah, A; Munn, C B; Gilpin, M L

    2012-04-01

    Vibrio parahaemolyticus is a marine bacterium and some strains cause gastroenteritis in humans. Clinical isolates are thought to possess virulence factors that are absent from the majority of environmental isolates. Use of randomly amplified polymorphic DNA (RAPD)-PCR produced a unique 600 bp amplicon (band Y) in the majority of clinical isolates and rarely in environmental isolates tested. The DNA from band Y was cloned and sequenced and found to code for an outer membrane protein (OMP). Two polymerase chain reaction (PCR) primers were designed to specifically amplify a 200 bp unique sequence from presumptive virulent strains (PCR-OMP). The virulence of 23 clinical and 32 environmental isolates was assessed in cytotoxicity tests by treatment of Caco-2 cells with extracellular products (ECPs). All but two of the clinical isolates (91%) were positive for the 200 bp PCR-OMP and their ECPs produced a significantly higher (p < 0.05) lactate dehydrogenase (LDH) release (mean 72.88%) than the ECPs of environmental isolates (mean 15.3%) with the exception of one environmental isolate that produced the 200 bp amplicon. A positive 200 bp PCR-OMP is strongly correlated with virulence, as determined by the cytotoxicity assay, and identified virulent forms better than current PCR tests for tdh, trh or T3SS2.

  15. Detection of congenital cytomegalovirus infection by real-time polymerase chain reaction analysis of saliva or urine specimens.

    PubMed

    Ross, Shannon A; Ahmed, Amina; Palmer, April L; Michaels, Marian G; Sánchez, Pablo J; Bernstein, David I; Tolan, Robert W; Novak, Zdenek; Chowdhury, Nazma; Fowler, Karen B; Boppana, Suresh B

    2014-11-01

    Viral culture of urine or saliva has been the gold standard technique for the diagnosis of congenital cytomegalovirus (CMV) infection. Results of rapid culture and polymerase chain reaction (PCR) analysis of urine and saliva specimens from 80 children were compared to determine the clinical utility of a real-time PCR assay for diagnosis of congenital CMV infection. Results of urine PCR were positive in 98.8% of specimens. Three PCR-positive urine samples were culture negative. Results of saliva PCR and culture were concordant in 78 specimens (97.5%). Two PCR-positive saliva samples were culture negative. These findings demonstrate that PCR performs as well as rapid culture of urine or saliva specimens for diagnosing congenital CMV infection and saliva specimens are easier to collect. Because PCR also offers more rapid turnaround, is unlikely to be affected by storage and transport conditions, has lower cost, and may be adapted to high-throughput situations, it is well suited for targeted testing and large-scale screening for CMV.

  16. Eukaryote-Made Thermostable DNA Polymerase Enables Rapid PCR-Based Detection of Mycoplasma, Ureaplasma and Other Bacteria in the Amniotic Fluid of Preterm Labor Cases

    PubMed Central

    Yoneda, Noriko; Yoneda, Satoshi; Mori, Masashi; Tabata, Homare; Minami, Hiroshi; Saito, Shigeru; Kitajima, Isao

    2015-01-01

    Background Intra-amniotic infection has long been recognized as the leading cause of preterm delivery. Microbial culture is the gold standard for the detection of intra-amniotic infection, but several days are required, and many bacterial species in the amniotic fluid are difficult to cultivate. Methods We developed a novel nested-PCR-based assay for detecting Mycoplasma, Ureaplasma, other bacteria and fungi in amniotic fluid samples within three hours of sample collection. To detect prokaryotes, eukaryote-made thermostable DNA polymerase, which is free from bacterial DNA contamination, is used in combination with bacterial universal primers. In contrast, to detect eukaryotes, conventional bacterially-made thermostable DNA polymerase is used in combination with fungal universal primers. To assess the validity of the PCR assay, we compared the PCR and conventional culture results using 300 amniotic fluid samples. Results Based on the detection level (positive and negative), 93.3% (280/300) of Mycoplasma, 94.3% (283/300) of Ureaplasma, 89.3% (268/300) of other bacteria and 99.7% (299/300) of fungi matched the culture results. Meanwhile, concerning the detection of bacteria other than Mycoplasma and Ureaplasma, 228 samples were negative according to the PCR method, 98.2% (224/228) of which were also negative based on the culture method. Employing the devised primer sets, mixed amniotic fluid infections of Mycoplasma, Ureaplasma and/or other bacteria could be clearly distinguished. In addition, we also attempted to compare the relative abundance in 28 amniotic fluid samples with mixed infection, and judged dominance by comparing the Ct values of quantitative real-time PCR. Conclusions We developed a novel PCR assay for the rapid detection of Mycoplasma, Ureaplasma, other bacteria and fungi in amniotic fluid samples. This assay can also be applied to accurately diagnose the absence of bacteria in samples. We believe that this assay will positively contribute to the

  17. Comparison of Four Polymerase Chain Reaction Methods for the Rapid Detection of Human Fecal Pollution in Marine and Inland Waters

    PubMed Central

    Bachoon, Dave S.; Miller, Cortney M.; Green, Christen P.; Otero, Ernesto

    2010-01-01

    We compared the effectiveness of three PCR protocols for the detection of Bifidobacterium adolescentis and one PCR protocol for detecting Bacteroidales as indicators of human fecal pollution in environmental samples. Quantitative PCR indicated that a higher concentration of B. adolescentis DNA was recovered from sewage samples on the 0.2 μm filters compared to the 0.45 μm filters, and there was no evidence of qPCR inhibitors in the DNA extracts. With the Matsuki method (1999), B. adolescentis was detected only in undiluted sewage samples. The King method (2007) performed well and detected B. adolescentis in all of the sewage dilutions (from undiluted to 10−4). In contrast, the Bonjoch approach (2004) was effective at detecting B. adolescentis at lower dilutions (10−3) of sewage samples and it gave false positive results with some (3/8) pig fecal samples. Human-specific Bacteroidales (HuBacs) were detected in the lower diluents of sewage samples but was positive in pig (6/8) and cattle fecal samples. PCR detection of B. adolescentis in marine samples from Puerto Rico and freshwater samples from Georgia indicated that the PCR method of King et al. (2007) and the modified Layton method for HuBac were in agreement in detecting human fecal pollution in most sites. PMID:20811614

  18. Droplet digital polymerase chain reaction (PCR) outperforms real-time PCR in the detection of environmental DNA from an invasive fish species.

    PubMed

    Doi, Hideyuki; Takahara, Teruhiko; Minamoto, Toshifumi; Matsuhashi, Saeko; Uchii, Kimiko; Yamanaka, Hiroki

    2015-05-01

    Environmental DNA (eDNA) has been used to investigate species distributions in aquatic ecosystems. Most of these studies use real-time polymerase chain reaction (PCR) to detect eDNA in water; however, PCR amplification is often inhibited by the presence of organic and inorganic matter. In droplet digital PCR (ddPCR), the sample is partitioned into thousands of nanoliter droplets, and PCR inhibition may be reduced by the detection of the end-point of PCR amplification in each droplet, independent of the amplification efficiency. In addition, real-time PCR reagents can affect PCR amplification and consequently alter detection rates. We compared the effectiveness of ddPCR and real-time PCR using two different PCR reagents for the detection of the eDNA from invasive bluegill sunfish, Lepomis macrochirus, in ponds. We found that ddPCR had higher detection rates of bluegill eDNA in pond water than real-time PCR with either of the PCR reagents, especially at low DNA concentrations. Limits of DNA detection, which were tested by spiking the bluegill DNA to DNA extracts from the ponds containing natural inhibitors, found that ddPCR had higher detection rate than real-time PCR. Our results suggest that ddPCR is more resistant to the presence of PCR inhibitors in field samples than real-time PCR. Thus, ddPCR outperforms real-time PCR methods for detecting eDNA to document species distributions in natural habitats, especially in habitats with high concentrations of PCR inhibitors.

  19. Reverse transcriptase-polymerase chain reaction fails to detect peripheral-blood hepatitis C RNA in formalin-fixed liver tissue.

    PubMed

    Guerrero, R B; Batts, K P; Germer, J J; Perez, R G; Wiesner, R H; Persing, D H

    1998-11-01

    Currently, one of the major indications for liver transplantation is infection with hepatitis C virus (HCV). Many studies have suggested that recurrent infection with HCV is universal after transplantation. Fastidious techniques, such as reverse transcriptase-polymerase chain reaction (RT-PCR), have proved to be highly sensitive for detecting HCV RNA in serum and in fresh-frozen and formalin-fixed paraffin-embedded (FFPE) liver tissue. In this study, we wanted to determine whether the identification of HCV RNA in liver tissue by RT-PCR might reflect the detection of circulating HCV RNA in blood within the tissue, rather than implying true tissue infection. We performed RT-PCR for HCV RNA in FFPE liver biopsy specimens taken from 14 donor allografts shortly before and immediately after implantation into recipients. The recipients were known to have HCV RNA in serum and explanted liver tissue, as determined by RT-PCR. We were unable to detect HCV RNA in any of the study samples, either before or after transplantation. In a related study, qualitative and quantitative HCV RNA analyses were performed by RT-PCR and branched DNA (bDNA) amplification, respectively, on serum samples collected pretransplantation and immediately posttransplantation from 10 other patients who underwent transplantation for hepatitis C. HCV RNA was detected in all serum samples before and after transplantation by RT-PCR; however, the bDNA assay detected HCV RNA in only 6 of 10 samples pre-orthotopic liver transplantation (OLT) and in none of the immediately post-OLT samples. In our system, despite the RT-PCR detection of HCV RNA in serum before and after the transplantation, HCV RNA is not detectable in the peripheral blood that accompanies formalin-fixed liver tissue. This implies that RT-PCR detection of HCV RNA in tissue reflects true liver infection, rather than contamination by HCV RNA in accompanying peripheral blood.

  20. A multiplex real-time polymerase chain reaction assay with two internal controls for the detection of Brucella species in tissues, blood, and feces from marine mammals.

    PubMed

    Sidor, Inga F; Dunn, J Lawrence; Tsongalis, Gregory J; Carlson, Jolene; Frasca, Salvatore

    2013-01-01

    Brucellosis has emerged as a disease of concern in marine mammals in the last 2 decades. Molecular detection techniques have the potential to address limitations of other methods for detecting infection with Brucella in these species. Presented herein is a real-time polymerase chain reaction (PCR) method targeting the Brucella genus-specific bcsp31 gene. The method also includes a target to a conserved region of the eukaryotic mitochondrial 16S ribosomal RNA gene to assess suitability of extracted DNA and a plasmid-based internal control to detect failure of PCR due to inhibition. This method was optimized and validated to detect Brucella spp. in multiple sample matrices, including fresh or frozen tissue, blood, and feces. The analytical limit of detection was low, with 95% amplification at 24 fg, or an estimated 7 bacterial genomic copies. When Brucella spp. were experimentally added to tissue or fecal homogenates, the assay detected an estimated 1-5 bacteria/µl. An experiment simulating tissue autolysis showed relative persistence of bacterial DNA compared to host mitochondrial DNA. When used to screen 1,658 field-collected marine mammal tissues in comparison to microbial culture, diagnostic sensitivity and specificity were 70.4% and 98.3%, respectively. In addition to amplification in fresh and frozen tissues, Brucella spp. were detected in feces and formalin-fixed, paraffin-embedded tissues from culture-positive animals. Results indicate the utility of this real-time PCR for the detection of Brucella spp. in marine species, which may have applications in surveillance or epidemiologic investigations. PMID:23345271