Science.gov

Sample records for polymerase iii detects

  1. Transcription by RNA polymerases I and III

    PubMed Central

    Paule, Marvin R.; White, Robert J.

    2000-01-01

    The task of transcribing nuclear genes is shared between three RNA polymerases in eukaryotes: RNA polymerase (pol) I synthesises the large rRNA, pol II synthesises mRNA and pol III synthesises tRNA and 5S rRNA. Although pol II has received most attention, pol I and pol III are together responsible for the bulk of transcriptional activity. This survey will summarise what is known about the process of transcription by pol I and pol III, how it happens and the proteins involved. Attention will be drawn to the similarities between the three nuclear RNA polymerase systems and also to their differences. PMID:10684922

  2. Deoxyribonucleic acid polymerase III of Escherichia coli. Purification and properties.

    PubMed

    Livingston, D M; Hinkle, D C; Richardson, C C

    1975-01-25

    DNA polymerase III has been purified 4,500-fold from the Escherichis coli mutant, HMS83, which lacks DNA polymerases I and II. When subjected to disc gel electrophoresis, the most purified fraction exhibits a single major protein band from which enzymatic activity may be recovered. Polyacrylamide gel electrophoresis under denaturing conditions produces two protein bands with molecular weights of 140,000 and 40,000. The sedimentation coefficient of the enzyme is 7.0 S, and the Stokes radius is 62 A. Taken together these tow parameters indicate a native molecular weight of 180,000. Purified DNA polymerase III catalyzes the polymerization of nucleotides into DNA when provided with both a DNA template and a complementary primer strand. The newly synthesized DNA is covalently attached to the 3' terminus of the primer strand. Because the extent of polymerization is only 10 to 100 nucleotides, the best substrates are native DNA molecules with small single-stranded regions. The most purified enzyme preparation is devoid of endonuclease activities. In addition to the two exonuclease activities described in the accompanying paper, purified polymerase III also catalyzes pyrophosphorolysis and the exchange of pyrophosphate into deoxynucleoside triphosphates. DNA polymerase III has also been isolated from wild type E. coli containing the other two known DNA polymerases. Futhermore, the enzyme purified from three different polC mutants exhibits altered polymerase III activity, confirming that polC is the structural gene for DNA polymerase III (Gefter, M., Hirota, Y., Kornberb, T., Wechsler, J., and Barnoux, C. (1971) Proc. Natl. Acad. Sci. U. S. A. 68, 3150-3153).

  3. Interplay between polymerase II- and polymerase III-assisted expression of overlapping genes.

    PubMed

    Lukoszek, Radoslaw; Mueller-Roeber, Bernd; Ignatova, Zoya

    2013-11-15

    Up to 15% of the genes in different genomes overlap. This architecture, although beneficial for the genome size, represents an obstacle for simultaneous transcription of both genes. Here we analyze the interference between RNA-polymerase II (Pol II) and RNA-polymerase III (Pol III) when transcribing their target genes encoded on opposing strands within the same DNA fragment in Arabidopsis thaliana. The expression of a Pol II-dependent protein-coding gene negatively correlated with the transcription of a Pol III-dependent, tRNA-coding gene set. We suggest that the architecture of the overlapping genes introduces an additional layer of control of gene expression.

  4. Comparative overview of RNA polymerase II and III transcription cycles, with focus on RNA polymerase III termination and reinitiation.

    PubMed

    Arimbasseri, Aneeshkumar G; Rijal, Keshab; Maraia, Richard J

    2014-01-01

    In eukaryotes, RNA polymerase (RNAP) III transcribes hundreds of genes for tRNAs and 5S rRNA, among others, which share similar promoters and stable transcription initiation complexes (TIC), which support rapid RNAP III recycling. In contrast, RNAP II transcribes a large number of genes with highly variable promoters and interacting factors, which exert fine regulatory control over TIC lability and modifications of RNAP II at different transitional points in the transcription cycle. We review data that illustrate a relatively smooth continuity of RNAP III initiation-elongation-termination and reinitiation toward its function to produce high levels of tRNAs and other RNAs that support growth and development.

  5. Nucleosome Positioning and NDR Structure at RNA Polymerase III Promoters

    PubMed Central

    Helbo, Alexandra Søgaard; Lay, Fides D.; Jones, Peter A.; Liang, Gangning; Grønbæk, Kirsten

    2017-01-01

    Chromatin is structurally involved in the transcriptional regulation of all genes. While the nucleosome positioning at RNA polymerase II (pol II) promoters has been extensively studied, less is known about the chromatin structure at pol III promoters in human cells. We use a high-resolution analysis to show substantial differences in chromatin structure of pol II and pol III promoters, and between subtypes of pol III genes. Notably, the nucleosome depleted region at the transcription start site of pol III genes extends past the termination sequences, resulting in nucleosome free gene bodies. The +1 nucleosome is located further downstream than at pol II genes and furthermore displays weak positioning. The variable position of the +1 location is seen not only within individual cell populations and between cell types, but also between different pol III promoter subtypes, suggesting that the +1 nucleosome may be involved in the transcriptional regulation of pol III genes. We find that expression and DNA methylation patterns correlate with distinct accessibility patterns, where DNA methylation associates with the silencing and inaccessibility at promoters. Taken together, this study provides the first high-resolution map of nucleosome positioning and occupancy at human pol III promoters at specific loci and genome wide. PMID:28176797

  6. Nucleosome Positioning and NDR Structure at RNA Polymerase III Promoters

    NASA Astrophysics Data System (ADS)

    Helbo, Alexandra Søgaard; Lay, Fides D.; Jones, Peter A.; Liang, Gangning; Grønbæk, Kirsten

    2017-02-01

    Chromatin is structurally involved in the transcriptional regulation of all genes. While the nucleosome positioning at RNA polymerase II (pol II) promoters has been extensively studied, less is known about the chromatin structure at pol III promoters in human cells. We use a high-resolution analysis to show substantial differences in chromatin structure of pol II and pol III promoters, and between subtypes of pol III genes. Notably, the nucleosome depleted region at the transcription start site of pol III genes extends past the termination sequences, resulting in nucleosome free gene bodies. The +1 nucleosome is located further downstream than at pol II genes and furthermore displays weak positioning. The variable position of the +1 location is seen not only within individual cell populations and between cell types, but also between different pol III promoter subtypes, suggesting that the +1 nucleosome may be involved in the transcriptional regulation of pol III genes. We find that expression and DNA methylation patterns correlate with distinct accessibility patterns, where DNA methylation associates with the silencing and inaccessibility at promoters. Taken together, this study provides the first high-resolution map of nucleosome positioning and occupancy at human pol III promoters at specific loci and genome wide.

  7. Transcription by RNA polymerase III: insights into mechanism and regulation

    PubMed Central

    Turowski, Tomasz W.; Tollervey, David

    2016-01-01

    The highly abundant, small stable RNAs that are synthesized by RNA polymerase III (RNAPIII) have key functional roles, particularly in the protein synthesis apparatus. Their expression is metabolically demanding, and is therefore coupled to changing demands for protein synthesis during cell growth and division. Here, we review the regulatory mechanisms that control the levels of RNAPIII transcripts and discuss their potential physiological relevance. Recent analyses have revealed differential regulation of tRNA expression at all steps on its biogenesis, with significant deregulation of mature tRNAs in cancer cells. PMID:27911719

  8. Close Temporal Relationship Between Onset of Cancer and Scleroderma in Patients with RNA Polymerase I/III Antibodies

    PubMed Central

    Shah, Ami A.; Rosen, Antony; Hummers, Laura; Wigley, Fredrick; Casciola-Rosen, Livia

    2010-01-01

    Objective We examined the temporal relationship between scleroderma development and malignancy, and evaluated whether this differed by autoantibody status among affected patients. Methods Participants had a diagnosis of scleroderma, cancer, an available serum sample, and a cancer pathology specimen. Sera were tested for autoantibodies against topoisomerase I, centromere, and RNA polymerase I/III by immunoprecipitation and/or ELISA. Clinical and demographic characteristics were compared across autoantibody categories. Expression of RNA polymerases I and III was evaluated by immunohistochemistry using cancerous tissue from patients with anti-RNA polymerase antibodies. Results Twenty three subjects were enrolled. Six subjects tested positive for anti-RNA polymerase I/III (Pol), 5 for anti-topoisomerase I (Topo), 8 for anti-centromere (CENP), and 4 recognized none of these antigens (Negative). The median duration of scleroderma at cancer diagnosis differed significantly between groups: −1.2 years (Pol), +13.4 years (Topo), +11.1 years (CENP), and +2.3 years (Negative) (p=0.027). RNA polymerase III demonstrated a robust nucleolar staining pattern in 4 of 5 available tumors from patients with antibodies to RNA polymerase I/III. In contrast, nucleolar RNA polymerase III staining was not detected in any of 4 examined tumors in the RNA polymerase antibody-negative group (p=0.048). Conclusions There is a close temporal relationship between onset of cancer and scleroderma in patients with antibodies to RNA polymerase I/III, which is distinct from scleroderma patients with other autoantibody specificities. In this study, autoantibody response and tumor antigen expression are associated. We propose that malignancy may initiate the scleroderma-specific immune response and drive disease in a subset of scleroderma patients. PMID:20506513

  9. Novel layers of RNA polymerase III control affecting tRNA gene transcription in eukaryotes

    PubMed Central

    Leśniewska, Ewa

    2017-01-01

    RNA polymerase III (Pol III) transcribes a limited set of short genes in eukaryotes producing abundant small RNAs, mostly tRNA. The originally defined yeast Pol III transcriptome appears to be expanding owing to the application of new methods. Also, several factors required for assembly and nuclear import of Pol III complex have been identified recently. Models of Pol III based on cryo-electron microscopy reconstructions of distinct Pol III conformations reveal unique features distinguishing Pol III from other polymerases. Novel concepts concerning Pol III functioning involve recruitment of general Pol III-specific transcription factors and distinctive mechanisms of transcription initiation, elongation and termination. Despite the short length of Pol III transcription units, mapping of transcriptionally active Pol III with nucleotide resolution has revealed strikingly uneven polymerase distribution along all genes. This may be related, at least in part, to the transcription factors bound at the internal promoter regions. Pol III uses also a specific negative regulator, Maf1, which binds to polymerase under stress conditions; however, a subset of Pol III genes is not controlled by Maf1. Among other RNA polymerases, Pol III machinery represents unique features related to a short transcript length and high transcription efficiency. PMID:28228471

  10. Novel layers of RNA polymerase III control affecting tRNA gene transcription in eukaryotes.

    PubMed

    Leśniewska, Ewa; Boguta, Magdalena

    2017-02-01

    RNA polymerase III (Pol III) transcribes a limited set of short genes in eukaryotes producing abundant small RNAs, mostly tRNA. The originally defined yeast Pol III transcriptome appears to be expanding owing to the application of new methods. Also, several factors required for assembly and nuclear import of Pol III complex have been identified recently. Models of Pol III based on cryo-electron microscopy reconstructions of distinct Pol III conformations reveal unique features distinguishing Pol III from other polymerases. Novel concepts concerning Pol III functioning involve recruitment of general Pol III-specific transcription factors and distinctive mechanisms of transcription initiation, elongation and termination. Despite the short length of Pol III transcription units, mapping of transcriptionally active Pol III with nucleotide resolution has revealed strikingly uneven polymerase distribution along all genes. This may be related, at least in part, to the transcription factors bound at the internal promoter regions. Pol III uses also a specific negative regulator, Maf1, which binds to polymerase under stress conditions; however, a subset of Pol III genes is not controlled by Maf1. Among other RNA polymerases, Pol III machinery represents unique features related to a short transcript length and high transcription efficiency.

  11. DNA polymerase III requirement for repair of DNA damage caused by methyl methanesulfonate and hydrogen peroxide

    SciTech Connect

    Hagensee, M.E.; Bryan, S.K.; Moses, R.E.

    1987-10-01

    The pcbA1 mutation allows DNA replication dependent on DNA polymerase I at the restrictive temperature in polC(Ts) strains. Cells which carry pcbA1, a functional DNA polymerase I, and a temperature-sensitive DNA polymerase III gene were used to study the role of DNA polymerase III in DNA repair. At the restrictive temperature for DNA polymerase III, these strains were more sensitive to the alkylating agent methyl methanesulfonate (MMS) and hydrogen peroxide than normal cells. The same strains showed no increase in sensitivity to bleomycin, UV light, or psoralen at the restrictive temperature. The sensitivity of these strains to MMS and hydrogen peroxide was not due to the pcbAl allele, and normal sensitivity was restored by the introduction of a chromosomal or cloned DNA polymerase III gene, verifying that the sensitivity was due to loss of DNA polymerase III alpha-subunit activity. A functional DNA polymerase III is required for the reformation of high-molecular-weight DNA after treatment of cells with MMS or hydrogen peroxide, as demonstrated by alkaline sucrose sedimentation results. Thus, it appears that a functional DNA polymerase III is required for the optimal repair of DNA damage by MMS or hydrogen peroxide.

  12. Actinobaculum suis Detection Using Polymerase Chain Reaction

    PubMed Central

    Amigo, Cristina Román; de Gobbi, Debora Dirani Sena; Gomes, Vasco Túlio de Moura; Perina, Danilo do Prado; Nogueira de Lima Filsner, Pedro Henrique; Costa, Barbara Letícia Pereira; Spindola, Maria Garcia; Ferreira, Thais Sebastiana Porfida; Brandão, Paulo Eduardo; Moreno, Andrea Micke

    2012-01-01

    Actinobaculum suis is an important agent related to urinary infection in swine females. Due to its fastidious growth characteristics, the isolation of this anaerobic bacterium is difficult, thus impairing the estimation of its prevalence. The purpose of this study was to develop and test a polymerase chain reaction (PCR) for the detection and identification of A. suis and then compare these results with traditional isolation methods. Bacterial isolation and PCR were performed on one hundred and ninety-two urine samples from sows and forty-five preputial swabs from boars. The results indicate that this PCR was specific for A. suis, presenting a detection limit between 1.0 × 101 CFU/mL and 1.0 × 102 CFU/mL. A. suis frequencies, as measured by PCR, were 8.9% (17/192) in sow urine samples and 82.2% (37/45) in preputial swabs. Assessed using conventional culturing techniques, none of the urine samples were positive for A. suis; however, A. suis was detected in 31.1% (14/45) of the swabs. This PCR technique was shown to be an efficient method for the detection of A. suis in urine and preputial swabs. PMID:23346017

  13. Protein Affinity Chromatography with Purified Yeast DNA Polymerase α Detects Proteins that Bind to DNA Polymerase

    NASA Astrophysics Data System (ADS)

    Miles, Jeff; Formosa, Tim

    1992-02-01

    We have overexpressed the POL1 gene of the yeast Saccharomyces cerevisiae and purified the resulting DNA polymerase α polypeptide in an apparently intact form. We attached the purified DNA polymerase covalently to an agarose matrix and used this matrix to chromatograph extracts prepared from yeast cells. At least six proteins bound to the yeast DNA polymerase α matrix that did not bind to a control matrix. We speculate that these proteins might be DNA polymerase α accessory proteins. Consistent with this interpretation, one of the binding proteins, which we have named POB1 (polymerase one binding), is required for normal chromosome transmission. Mutations in this gene cause increased chromosome loss and an abnormal cell morphology, phenotypes that also occur in the presence of mutations in the yeast α or δ polymerase genes. These results suggest that the interactions detected by polymerase affinity chromatography are biologically relevant and may help to illuminate the architecture of the eukaryotic DNA replication machinery.

  14. RNA Polymerase III in Cajal Bodies and Lampbrush Chromosomes of the Xenopus Oocyte Nucleus

    PubMed Central

    Murphy, Christine; Wang, Zhengxin; Roeder, Robert G.; Gall, Joseph G.

    2002-01-01

    We used immunofluorescence to study the distribution and targeting of RNA polymerase (pol) III subunits and pol III transcription factors in the Xenopus laevis oocyte nucleus. Antibodies against several of these proteins stained Cajal bodies and ∼90 specific sites on the lampbrush chromosomes. Some of the chromosomal sites had been identified previously by in situ hybridization as the genes for 5S rRNA. The remaining sites presumably encode tRNAs and other pol III transcripts. Pol III sites were often resolvable as loops similar to the much more abundant pol II loops, but without a matrix detectable by phase contrast or differential interference contrast. This morphology is consistent with the transcription of short repeated sequences. Hemagglutinin-tagged transcripts encoding core subunits and transcription factors were injected into the oocyte cytoplasm, and the distribution of newly translated proteins inside the nucleus was monitored by immunostaining. Cajal bodies were preferentially targeted by these proteins, and in some cases the chromosomal sites were also weakly stained. The existence of pol III subunits and pol III transcription factors in Cajal bodies and their targeting to these organelles are consistent with a model of Cajal bodies as sites for preassembly of the nuclear transcription machinery. PMID:12388750

  15. TATA elements direct bi-directional transcription by RNA polymerases II and III.

    PubMed Central

    Huang, W; Wong, J M; Bateman, E

    1996-01-01

    Eukaryotic promoter elements specify the direction and efficiency of transcription, as well as the type of RNA polymerase to be used. One such element, the TATA box, is thought to participate in determining the direction of transcription and can function within promoters for RNA polymerase II or III, depending on the sequence context. In this report the ability of four different TATA boxes to support transcription in vitro was determined. It was found that TATA elements are not directional. However, they support transcription by RNA polymerases II and III. An upstream activating sequence was found to stimulate downstream transcription by RNA polymerase II and to inhibit upstream transcription by RNA polymerases II and III. Thus a promoter necessarily consists of a TATA element and upstream sequences in order to specify the direction of transcription and the type of polymerase to be used. PMID:8604352

  16. Contributions of in vitro transcription to the understanding of human RNA polymerase III transcription.

    PubMed

    Dumay-Odelot, Hélène; Durrieu-Gaillard, Stéphanie; El Ayoubi, Leyla; Parrot, Camila; Teichmann, Martin

    2014-01-01

    Human RNA polymerase III transcribes small untranslated RNAs that contribute to the regulation of essential cellular processes, including transcription, RNA processing and translation. Analysis of this transcription system by in vitro transcription techniques has largely contributed to the discovery of its transcription factors and to the understanding of the regulation of human RNA polymerase III transcription. Here we review some of the key steps that led to the identification of transcription factors and to the definition of minimal promoter sequences for human RNA polymerase III transcription.

  17. Molecular structure of yeast RNA polymerase III: demonstration of the tripartite transcriptive system in lower eukaryotes.

    PubMed Central

    Valenzuela, P; Hager, G L; Weinberg, F; Rutter, W J

    1976-01-01

    Homogeneous RNA polymerase III (RNA nucleotidyltransferase III) has been obtained from yeast. The subunit composition of the enzyme was examined by polyacrylamide gel electrophoresis in the presence of sodium dodecyl sulfate. The enzyme is composed of 12 putative subunits with molecular weights 160,000, 128,000, 82,000, 41,000, 40,500, 37,000, 34,000, 28,000, 24,000, 20,000, 14,500, and 11,000. The high-molecular-weight subunits and several of the smaller subunits of yeast RNA polymerase III are clearly different from those of enzymes I and II, indicating a distinct molecular structure. However, the molecular weights of some of the small subunits (41,000, 28,000, 24,000, and 14,500) appear to be identical to those of polymerases I and II. Thus, it is possible that the three classes of enzymes in yeast have some common subunits. As in other eukaryotes, yeast polymerase II is inhibited by relatively low concentrations of alpha-amanitin; however, contrary to what has been found in higher eukaryotes, yeast polymerase III is resistant (up to 2 mg/ml) to alpha-amanitin, while yeast polymerase I is sensitive to high concentrations of the drug (50% inhibition at 0.3 mg/ml). These results establish the existence of RNA polymerase III in yeast and provide a structural basis for the discrimination of the three functional polymerases in eukaryotes. Images PMID:772675

  18. Purification and Subunit Structure of DNA-dependent RNA Polymerase III from Wheat Germ 1

    PubMed Central

    Jendrisak, Jerry

    1981-01-01

    A rapid and simple, large-scale method for the purification of DNA-dependent RNA polymerase III (EC 2.7.7.6) from wheat germ is presented. The method involves enzyme extraction at low ionic strength, polyethyleneimine fractionation, (NH4)2SO4 precipitation, and chromatography on DEAE-Sepharose CL-6B, DEAE-cellulose, and heparin agarose. Milligram quantities of highly purified enzyme can be obtained from kilogram quantities of starting material in 2 to 3 days. Sodium dodecyl sulfate-polyacrylamide gel electrophoresis indicates that RNA polymerase III contains 14 subunits with molecular weights of: 150,000; 130,000; 94,000; 55,000; 38,000; 30,000; 28,000; 25,000; 24,500; 20,500; 20,000; 19,500; 17,800; and 17,000. Subunit structure comparison of wheat germ RNA polymerases I, II, and III indicates that all three enzymes may contain common subunits with molecular weights 20,000, 17,800, and 17,000. In addition, RNA polymerases II and III may contain a common subunit with a molecular weight of 25,000, and RNA polymerases I and III may contain a common subunit with a molecular weight of 38,000. Images PMID:16661690

  19. Exchange between Escherichia coli polymerases II and III on a processivity clamp

    PubMed Central

    Kath, James E.; Chang, Seungwoo; Scotland, Michelle K.; Wilbertz, Johannes H.; Jergic, Slobodan; Dixon, Nicholas E.; Sutton, Mark D.; Loparo, Joseph J.

    2016-01-01

    Escherichia coli has three DNA polymerases implicated in the bypass of DNA damage, a process called translesion synthesis (TLS) that alleviates replication stalling. Although these polymerases are specialized for different DNA lesions, it is unclear if they interact differently with the replication machinery. Of the three, DNA polymerase (Pol) II remains the most enigmatic. Here we report a stable ternary complex of Pol II, the replicative polymerase Pol III core complex and the dimeric processivity clamp, β. Single-molecule experiments reveal that the interactions of Pol II and Pol III with β allow for rapid exchange during DNA synthesis. As with another TLS polymerase, Pol IV, increasing concentrations of Pol II displace the Pol III core during DNA synthesis in a minimal reconstitution of primer extension. However, in contrast to Pol IV, Pol II is inefficient at disrupting rolling-circle synthesis by the fully reconstituted Pol III replisome. Together, these data suggest a β-mediated mechanism of exchange between Pol II and Pol III that occurs outside the replication fork. PMID:26657641

  20. Epigenetic regulation of noncoding RNA transcription by mammalian RNA polymerase III.

    PubMed

    Park, Jong-Lyul; Lee, Yeon-Su; Kunkeaw, Nawapol; Kim, Seon-Young; Kim, In-Hoo; Lee, Yong Sun

    2017-02-01

    RNA polymerase III (Pol III) synthesizes a range of medium-sized noncoding RNAs (collectively 'Pol III genes') whose early established biological roles were so essential that they were considered 'housekeeping genes'. Besides these fundamental functions, diverse unconventional roles of mammalian Pol III genes have recently been recognized and their expression must be exquisitely controlled. In this review, we summarize the epigenetic regulation of Pol III genes by chromatin structure, histone modification and CpG DNA methylation. We also recapitulate the association between dysregulation of Pol III genes and diseases such as cancer and neurological disorders. Additionally, we will discuss why in-depth molecular studies of Pol III genes have not been attempted and how nc886, a Pol III gene, may resolve this issue.

  1. Transcriptional interference by RNA polymerase III affects expression of the Polr3e gene

    PubMed Central

    Yeganeh, Meghdad; Praz, Viviane; Cousin, Pascal; Hernandez, Nouria

    2017-01-01

    Overlapping gene arrangements can potentially contribute to gene expression regulation. A mammalian interspersed repeat (MIR) nested in antisense orientation within the first intron of the Polr3e gene, encoding an RNA polymerase III (Pol III) subunit, is conserved in mammals and highly occupied by Pol III. Using a fluorescence assay, CRISPR/Cas9-mediated deletion of the MIR in mouse embryonic stem cells, and chromatin immunoprecipitation assays, we show that the MIR affects Polr3e expression through transcriptional interference. Our study reveals a mechanism by which a Pol II gene can be regulated at the transcription elongation level by transcription of an embedded antisense Pol III gene. PMID:28289142

  2. Transcriptional interference by RNA polymerase III affects expression of the Polr3e gene.

    PubMed

    Yeganeh, Meghdad; Praz, Viviane; Cousin, Pascal; Hernandez, Nouria

    2017-02-15

    Overlapping gene arrangements can potentially contribute to gene expression regulation. A mammalian interspersed repeat (MIR) nested in antisense orientation within the first intron of the Polr3e gene, encoding an RNA polymerase III (Pol III) subunit, is conserved in mammals and highly occupied by Pol III. Using a fluorescence assay, CRISPR/Cas9-mediated deletion of the MIR in mouse embryonic stem cells, and chromatin immunoprecipitation assays, we show that the MIR affects Polr3e expression through transcriptional interference. Our study reveals a mechanism by which a Pol II gene can be regulated at the transcription elongation level by transcription of an embedded antisense Pol III gene.

  3. Identification of proteins associated with RNA polymerase III using a modified tandem chromatin affinity purification.

    PubMed

    Nguyen, Ngoc-Thuy-Trinh; Saguez, Cyril; Conesa, Christine; Lefebvre, Olivier; Acker, Joël

    2015-02-01

    To identify the proteins associated with the RNA polymerase III (Pol III) machinery in exponentially growing yeast cells, we developed our own tandem chromatin affinity purification procedure (TChAP) after in vivo cross-link, allowing a reproducible and good recovery of the protein bait and its associated partners. In contrast to TFIIIA that could only be purified as a free protein, this protocol allows us to capture free Pol III together with Pol III bound on its target genes. Transcription factors, elongation factors, RNA-associated proteins and proteins involved in Pol III biogenesis were identified by mass spectrometry. Interestingly, the presence of all the TFIIIB subunits found associated with Pol III together with the absence of TFIIIC and chromatin factors including histones suggest that DNA-bound Pol III purified using TChAP is mainly engaged in transcription reinitiation.

  4. Long-Range PCR Amplification of DNA by DNA Polymerase III Holoenzyme from Thermus thermophilus

    PubMed Central

    Kane, Shawn D.; Bullard, James M.

    2015-01-01

    DNA replication in bacteria is accomplished by a multicomponent replicase, the DNA polymerase III holoenzyme (pol III HE). The three essential components of the pol III HE are the α polymerase, the β sliding clamp processivity factor, and the DnaX clamp-loader complex. We report here the assembly of the functional holoenzyme from Thermus thermophilus (Tth), an extreme thermophile. The minimal holoenzyme capable of DNA synthesis consists of α, β and DnaX (τ and γ), δ and δ′ components of the clamp-loader complex. The proteins were each cloned and expressed in a native form. Each component of the system was purified extensively. The minimum holoenzyme from these five purified subunits reassembled is sufficient for rapid and processive DNA synthesis. In an isolated form the α polymerase was found to be unstable at temperatures above 65°C. We were able to increase the thermostability of the pol III HE to 98°C by addition and optimization of various buffers and cosolvents. In the optimized buffer system we show that a replicative polymerase apparatus, Tth pol III HE, is capable of rapid amplification of regions of DNA up to 15,000 base pairs in PCR reactions. PMID:25688300

  5. Proteolysis of the proofreading subunit controls the assembly of Escherichia coli DNA polymerase III catalytic core.

    PubMed

    Bressanin, Daniela; Stefan, Alessandra; Piaz, Fabrizio Dal; Cianchetta, Stefano; Reggiani, Luca; Hochkoeppler, Alejandro

    2009-11-01

    The C-terminal region of the proofreading subunit (epsilon) of Escherichia coli DNA polymerase III is shown here to be labile and to contain the residues (identified between F187 and R213) responsible for association with the polymerase subunit (alpha). We also identify two alpha-helices of the polymerase subunit (comprising the residues E311-M335 and G339-D353, respectively) as the determinants of binding to epsilon. The C-terminal region of epsilon is degraded by the ClpP protease assisted by the GroL molecular chaperone, while other factors control the overall concentration in vivo of epsilon. Among these factors, the chaperone DnaK is of primary importance for preserving the integrity of epsilon. Remarkably, inactivation of DnaK confers to Escherichia coli inviable phenotype at 42 degrees C, and viability can be restored over-expressing epsilon. Altogether, our observations indicate that the association between epsilon and alpha subunits of DNA polymerase III depends on small portions of both proteins, the association of which is controlled by proteolysis of epsilon. Accordingly, the factors catalysing (ClpP, GroL) or preventing (DnaK) this proteolysis exert a crucial checkpoint of the assembly of Escherichia coli DNA polymerase III core.

  6. Falling for the dark side of transcription: Nab2 fosters RNA polymerase III transcription

    PubMed Central

    Reuter, L. Maximilian; Sträßer, Katja

    2016-01-01

    ABSTRACT RNA polymerase III (RNAPIII) synthesizes diverse, small, non-coding RNAs with many important roles in the cellular metabolism. One of the open questions of RNAPIII transcription is whether and how additional factors are involved. Recently, Nab2 was identified as the first messenger ribonucleoprotein particle (mRNP) biogenesis factor with a function in RNAPIII transcription. PMID:27049816

  7. Chromatin-dependent regulation of RNA polymerases II and III activity throughout the transcription cycle.

    PubMed

    Jordán-Pla, Antonio; Gupta, Ishaan; de Miguel-Jiménez, Lola; Steinmetz, Lars M; Chávez, Sebastián; Pelechano, Vicent; Pérez-Ortín, José E

    2015-01-01

    The particular behaviour of eukaryotic RNA polymerases along different gene regions and amongst distinct gene functional groups is not totally understood. To cast light onto the alternative active or backtracking states of RNA polymerase II, we have quantitatively mapped active RNA polymerases at a high resolution following a new biotin-based genomic run-on (BioGRO) technique. Compared with conventional profiling with chromatin immunoprecipitation, the analysis of the BioGRO profiles in Saccharomyces cerevisiae shows that RNA polymerase II has unique activity profiles at both gene ends, which are highly dependent on positioned nucleosomes. This is the first demonstration of the in vivo influence of positioned nucleosomes on transcription elongation. The particular features at the 5' end and around the polyadenylation site indicate that this polymerase undergoes extensive specific-activity regulation in the initial and final transcription elongation phases. The genes encoding for ribosomal proteins show distinctive features at both ends. BioGRO also provides the first nascentome analysis for RNA polymerase III, which indicates that transcription of tRNA genes is poorly regulated at the individual copy level. The present study provides a novel perspective of the transcription cycle that incorporates inactivation/reactivation as an important aspect of RNA polymerase dynamics.

  8. New insights into the promoterless transcription of DNA coligo templates by RNA polymerase III.

    PubMed

    Lama, Lodoe; Seidl, Christine I; Ryan, Kevin

    2014-01-01

    Chemically synthesized DNA can carry small RNA sequence information but converting that information into small RNA is generally thought to require large double-stranded promoters in the context of plasmids, viruses and genes. We previously found evidence that circularized oligodeoxynucleotides (coligos) containing certain sequences and secondary structures can template the synthesis of small RNA by RNA polymerase III in vitro and in human cells. By using immunoprecipitated RNA polymerase III we now report corroborating evidence that this enzyme is the sole polymerase responsible for coligo transcription. The immobilized polymerase enabled experiments showing that coligo transcripts can be formed through transcription termination without subsequent 3' end trimming. To better define the determinants of productive transcription, a structure-activity relationship study was performed using over 20 new coligos. The results show that unpaired nucleotides in the coligo stem facilitate circumtranscription, but also that internal loops and bulges should be kept small to avoid secondary transcription initiation sites. A polymerase termination sequence embedded in the double-stranded region of a hairpin-encoding coligo stem can antagonize transcription. Using lessons learned from new and old coligos, we demonstrate how to convert poorly transcribed coligos into productive templates. Our findings support the possibility that coligos may prove useful as chemically synthesized vectors for the ectopic expression of small RNA in human cells.

  9. Detection of Listeria monocytogenes by using the polymerase chain reaction

    SciTech Connect

    Bessesen, M.T.; Luo, Q.; Blaser, M.J.; Ellison, R.T. III.; Rotbart. H.A. )

    1990-09-01

    A method was developed for detection of Listeria monocytogens by polymerase chain reaction amplification followed by agarose gel electrophoresis or dot blot analysis with {sup 32}P-labeled internal probe. The technique identified 95 of 95 L. monocytogenes strains, 0 of 12 Listeria strains of other species, and 0 of 12 non-Listeria strains.

  10. Polymerase Chain Reaction for Detection of Systemic Plant Pathogens

    Technology Transfer Automated Retrieval System (TEKTRAN)

    This chapter outlines the advances and application of the polymerase chain reaction (PCR) since its development in 1984 and its enhancements and applications to detection of viruses, viroids and phytoplasma in pome and stone fruits. PCR is probably the most rapidly and widely adopted technology eve...

  11. SINE transcription by RNA polymerase III is suppressed by histone methylation but not by DNA methylation

    PubMed Central

    Varshney, Dhaval; Vavrova-Anderson, Jana; Oler, Andrew J.; Cowling, Victoria H.; Cairns, Bradley R.; White, Robert J.

    2015-01-01

    Short interspersed nuclear elements (SINEs), such as Alu, spread by retrotransposition, which requires their transcripts to be copied into DNA and then inserted into new chromosomal sites. This can lead to genetic damage through insertional mutagenesis and chromosomal rearrangements between non-allelic SINEs at distinct loci. SINE DNA is heavily methylated and this was thought to suppress its accessibility and transcription, thereby protecting against retrotransposition. Here we provide several lines of evidence that methylated SINE DNA is occupied by RNA polymerase III, including the use of high-throughput bisulphite sequencing of ChIP DNA. We find that loss of DNA methylation has little effect on accessibility of SINEs to transcription machinery or their expression in vivo. In contrast, a histone methyltransferase inhibitor selectively promotes SINE expression and occupancy by RNA polymerase III. The data suggest that methylation of histones rather than DNA plays a dominant role in suppressing SINE transcription. PMID:25798578

  12. A protein-protein interaction map of yeast RNA polymerase III.

    PubMed

    Flores, A; Briand, J F; Gadal, O; Andrau, J C; Rubbi, L; Van Mullem, V; Boschiero, C; Goussot, M; Marck, C; Carles, C; Thuriaux, P; Sentenac, A; Werner, M

    1999-07-06

    The structure of the yeast RNA polymerase (pol) III was investigated by exhaustive two-hybrid screening using a library of random genomic fragments fused to the Gal4 activation domain. This procedure allowed us to identify contacts between individual polypeptides, localize the contact domains, and deduce a protein-protein interaction map of the multisubunit enzyme. In all but one case, pol III subunits were able to interact in vivo with one or sometimes two partner subunits of the enzyme or with subunits of TFIIIC. Four subunits that are common to pol I, II, and III (ABC27, ABC14.5, ABC10alpha, and ABC10beta), two that are common to pol I and III (AC40 and AC19), and one pol III-specific subunit (C11) can associate with defined regions of the two large subunits. These regions overlapped with highly conserved domains. C53, a pol III-specific subunit, interacted with a 37-kDa polypeptide that copurifies with the enzyme and therefore appears to be a unique pol III subunit (C37). Together with parallel interaction studies based on dosage-dependent suppression of conditional mutants, our data suggest a model of the pol III preinitiation complex.

  13. Detection of Entamoeba histolytica by Recombinase Polymerase Amplification.

    PubMed

    Nair, Gayatri; Rebolledo, Mauricio; White, A Clinton; Crannell, Zachary; Richards-Kortum, R Rebecca; Pinilla, A Elizabeth; Ramírez, Juan David; López, M Consuelo; Castellanos-Gonzalez, Alejandro

    2015-09-01

    Amebiasis is an important cause of diarrheal disease worldwide and has been associated with childhood malnutrition. Traditional microscopy approaches are neither sensitive nor specific for Entamoeba histolytica. Antigen assays are more specific, but many cases are missed unless tested by molecular methods. Although polymerase chain reaction (PCR) is effective, the need for sophisticated, expensive equipment, infrastructure, and trained personnel limits its usefulness, especially in the resource-limited, endemic areas. Here, we report development of a recombinase polymerase amplification (RPA) method to detect E. histolytica specifically. Using visual detection by lateral flow (LF), the test was highly sensitive and specific and could be performed without additional equipment. The availability of this inexpensive, sensitive, and field-applicable diagnostic test could facilitate rapid diagnosis and treatment of amebiasis in endemic regions.

  14. Detection of Entamoeba histolytica by Recombinase Polymerase Amplification

    PubMed Central

    Nair, Gayatri; Rebolledo, Mauricio; White, A. Clinton; Crannell, Zachary; Richards-Kortum, R. Rebecca; Pinilla, A. Elizabeth; Ramírez, Juan David; López, M. Consuelo; Castellanos-Gonzalez, Alejandro

    2015-01-01

    Amebiasis is an important cause of diarrheal disease worldwide and has been associated with childhood malnutrition. Traditional microscopy approaches are neither sensitive nor specific for Entamoeba histolytica. Antigen assays are more specific, but many cases are missed unless tested by molecular methods. Although polymerase chain reaction (PCR) is effective, the need for sophisticated, expensive equipment, infrastructure, and trained personnel limits its usefulness, especially in the resource-limited, endemic areas. Here, we report development of a recombinase polymerase amplification (RPA) method to detect E. histolytica specifically. Using visual detection by lateral flow (LF), the test was highly sensitive and specific and could be performed without additional equipment. The availability of this inexpensive, sensitive, and field-applicable diagnostic test could facilitate rapid diagnosis and treatment of amebiasis in endemic regions. PMID:26123960

  15. Characterization of new RNA polymerase III and RNA polymerase II transcriptional promoters in the Bovine Leukemia Virus genome

    PubMed Central

    Van Driessche, Benoit; Rodari, Anthony; Delacourt, Nadège; Fauquenoy, Sylvain; Vanhulle, Caroline; Burny, Arsène; Rohr, Olivier; Van Lint, Carine

    2016-01-01

    Bovine leukemia virus latency is a viral strategy used to escape from the host immune system and contribute to tumor development. However, a highly expressed BLV micro-RNA cluster has been reported, suggesting that the BLV silencing is not complete. Here, we demonstrate the in vivo recruitment of RNA polymerase III to the BLV miRNA cluster both in BLV-latently infected cell lines and in ovine BLV-infected primary cells, through a canonical type 2 RNAPIII promoter. Moreover, by RPC6-knockdown, we showed a direct functional link between RNAPIII transcription and BLV miRNAs expression. Furthermore, both the tumor- and the quiescent-related isoforms of RPC7 subunits were recruited to the miRNA cluster. We showed that the BLV miRNA cluster was enriched in positive epigenetic marks. Interestingly, we demonstrated the in vivo recruitment of RNAPII at the 3′LTR/host genomic junction, associated with positive epigenetic marks. Functionally, we showed that the BLV LTR exhibited a strong antisense promoter activity and identified cis-acting elements of an RNAPII-dependent promoter. Finally, we provided evidence for an in vivo collision between RNAPIII and RNAPII convergent transcriptions. Our results provide new insights into alternative ways used by BLV to counteract silencing of the viral 5′LTR promoter. PMID:27545598

  16. Distinct transcriptional responses of RNA polymerases I, II and III to aptamers that bind TBP

    PubMed Central

    Fan, Xiaochun; Shi, Hua; Lis, John T.

    2005-01-01

    The TATA-binding protein (TBP) is a general factor that is involved in transcription by all three types of nuclear RNA polymerase. To delineate the roles played by the DNA-binding surface of TBP in these transcription reactions, we used a set of RNA aptamers directed against TBP and examined their ability to perturb transcription in vitro by the different RNA polymerases. Distinct responses to the TBP aptamers were observed for transcription by different types of polymerase at either the initiation, reinitiation or both stages of the transcription cycle. We further probed the TBP interactions in the TFIIIB•DNA complex to elucidate the mechanism for the different sensitivity of Pol III dependent transcription before and after preinitiation complex (PIC) formation. Lastly, the aptamers were employed to measure the time required for Pol III PIC formation in vitro. This approach can be generalized to define the involvement of a particular region on the surface of a protein at particular stages in a biological process. PMID:15701755

  17. Nested methylation-specific polymerase chain reaction cancer detection method

    DOEpatents

    Belinsky, Steven A.; Palmisano, William A.

    2007-05-08

    A molecular marker-based method for monitoring and detecting cancer in humans. Aberrant methylation of gene promoters is a marker for cancer risk in humans. A two-stage, or "nested" polymerase chain reaction method is disclosed for detecting methylated DNA sequences at sufficiently high levels of sensitivity to permit cancer screening in biological fluid samples, such as sputum, obtained non-invasively. The method is for detecting the aberrant methylation of the p16 gene, O 6-methylguanine-DNA methyltransferase gene, Death-associated protein kinase gene, RAS-associated family 1 gene, or other gene promoters. The method offers a potentially powerful approach to population-based screening for the detection of lung and other cancers.

  18. Detection of Mycoplasma pneumoniae by using the polymerase chain reaction.

    PubMed Central

    Bernet, C; Garret, M; de Barbeyrac, B; Bebear, C; Bonnet, J

    1989-01-01

    The polymerase chain reaction (PCR) technique was used to detect Mycoplasma pneumoniae. A specific DNA sequence for M. pneumoniae was selected from a genomic library, and two oligonucleotides were chosen in this sequence to give an amplified fragment of 144 base pairs. We show that DNA from different M. pneumoniae strains can be detected by PCR, with DNA from other Mycoplasma species giving negative results. Analysis of biological samples (throat swabs) obtained from hamsters that were experimentally infected with M. pneumoniae showed that PCR was more sensitive and reliable than conventional culture techniques for the detection of M. pneumoniae. Initial experiments on artificially seeded human bronchoalveolar lavages showed that PCR can be used to detect 10(2) to 10(3) organisms. Images PMID:2509513

  19. BC1 RNA: transcriptional analysis of a neural cell-specific RNA polymerase III transcript.

    PubMed Central

    Martignetti, J A; Brosius, J

    1995-01-01

    Rodent BC1 RNA represents the first example of a neural cell-specific RNA polymerase III (Pol III) transcription product. By developing a rat brain in vitro system capable of supporting Pol III-directed transcription, we showed that the rat BC1 RNA intragenic promoter elements, comprising an A box element and a variant B box element, as well as its upstream region, containing octamer-binding consensus sequences and functional TATA and proximal sequence element sites, are necessary for transcription. The BC1 B box, lacking the invariant A residue found in the consensus B boxes of tRNAs, represents a functionally related and possibly distinct promoter element. The transcriptional activity of the BC1 B box element is greatly increased, in both a BC1 RNA and a chimeric tRNA(Leu) gene construct, when the BC1 5' flanking region is present and is appropriately spaced. Moreover, a tRNA consensus B-box sequence can efficiently replace the BC1 B box only if the BC1 upstream region is removed. These interactions, identified only in a homologous in vitro system, between upstream Pol II and intragenic Pol III promoters suggest a mechanism by which the tissue-specific BC1 RNA gene and possibly other Pol III-transcribed genes can be regulated. PMID:7862155

  20. Recombinase Polymerase Amplification Assay for Rapid Detection of Francisella tularensis

    PubMed Central

    Euler, Milena; Wang, Yongjie; Otto, Peter; Tomaso, Herbert; Escudero, Raquel; Anda, Pedro; Hufert, Frank T.

    2012-01-01

    Several real-time PCR approaches to develop field detection for Francisella tularensis, the infectious agent causing tularemia, have been explored. We report the development of a novel qualitative real-time isothermal recombinase polymerase amplification (RPA) assay for use on a small ESEQuant Tube Scanner device. The analytical sensitivity and specificity were tested using a plasmid standard and DNA extracts from infected rabbit tissues. The assay showed a performance comparable to real-time PCR but reduced the assay time to 10 min. The rapid RPA method has great application potential for field use or point-of-care diagnostics. PMID:22518861

  1. Recombinase polymerase amplification assay for rapid detection of Francisella tularensis.

    PubMed

    Euler, Milena; Wang, Yongjie; Otto, Peter; Tomaso, Herbert; Escudero, Raquel; Anda, Pedro; Hufert, Frank T; Weidmann, Manfred

    2012-07-01

    Several real-time PCR approaches to develop field detection for Francisella tularensis, the infectious agent causing tularemia, have been explored. We report the development of a novel qualitative real-time isothermal recombinase polymerase amplification (RPA) assay for use on a small ESEQuant Tube Scanner device. The analytical sensitivity and specificity were tested using a plasmid standard and DNA extracts from infected rabbit tissues. The assay showed a performance comparable to real-time PCR but reduced the assay time to 10 min. The rapid RPA method has great application potential for field use or point-of-care diagnostics.

  2. Detection of Clostridium septicum hemolysin gene by polymerase chain reaction.

    PubMed

    Takeuchi, S; Hashizume, N; Kinoshita, T; Kaidoh, T; Tamura, Y

    1997-09-01

    A polymerase chain reaction (PCR) was developed for the detection of the hemolysin (alpha toxin) gene of Clostridium septicum. The PCR primers were designed from the sequence of the hemolysin gene and synthesized. A DNA fragment of 270 bp was amplified from 10 strains of C. septicum, but was not from strains of C. chauvoei, C. perfringens, C. novyi, or C. haemolyticum. When the PCR product was digested with Sau3AI, two DNA fragments of the expected 148 bp and 122 bp were recognized. The lowest detectable threshold of PCR for the hemolysin gene was 3.8 x 10(3) cells/ml. The PCR technique may be useful for rapid detection or identification of C. septicum associated with malignant edema.

  3. [Recombinase Polymerase Amplification and its Applications in Parasite Detection].

    PubMed

    ZHENG, Wen-bin; WU, Yao-dong; MA, Jian-gang; ZHU, Xing-quan; ZHOU, Dong-hui

    2015-10-01

    Recombinase polymerase amplification (RPA) is a recently -developed isothermal nucleic-acid-amplification technology that is based on the nucleic acid replication mechanism in T4 bacteriophage. With this technique, nucleic-acid templates can be amplified to measurable levels within 20 min at 37-42 °C. The. RPA process has high sensitivity and specificity, and is simple to operate, thus nucleic acids can be detected rapidly in non-laboratory conditions. Since its development in 2006, the RPA technique has been applied in agriculture, food safety, medicine, transgene detection, etc. In this review, we will give an overview on the research progress of RPA and its application in parasite detection.

  4. Multiplexed Recombinase Polymerase Amplification Assay To Detect Intestinal Protozoa.

    PubMed

    Crannell, Zachary; Castellanos-Gonzalez, Alejandro; Nair, Gayatri; Mejia, Rojelio; White, A Clinton; Richards-Kortum, Rebecca

    2016-02-02

    This work describes a proof-of-concept multiplex recombinase polymerase amplification (RPA) assay with lateral flow readout that is capable of simultaneously detecting and differentiating DNA from any of the diarrhea-causing protozoa Giardia, Cryptosporidium, and Entamoeba. Together, these parasites contribute significantly to the global burden of diarrheal illness. Differential diagnosis of these parasites is traditionally accomplished via stool microscopy. However, microscopy is insensitive and can miss up to half of all cases. DNA-based diagnostics such as polymerase chain reaction (PCR) are far more sensitive; however, they rely on expensive thermal cycling equipment, limiting their availability to centralized reference laboratories. Isothermal DNA amplification platforms, such as the RPA platform used in this study, alleviate the need for thermal cycling equipment and have the potential to broaden access to more sensitive diagnostics. Until now, multiplex RPA assays have not been developed that are capable of simultaneously detecting and differentiating infections caused by different pathogens. We developed a multiplex RPA assay to detect the presence of DNA from Giardia, Cryptosporidium, and Entamoeba. The multiplex assay was characterized using synthetic DNA, where the limits-of-detection were calculated to be 403, 425, and 368 gene copies per reaction of the synthetic Giardia, Cryptosporidium, and Entamoeba targets, respectively (roughly 1.5 orders of magnitude higher than for the same targets in a singleplex RPA assay). The multiplex assay was also characterized using DNA extracted from live parasites spiked into stool samples where the limits-of-detection were calculated to be 444, 6, and 9 parasites per reaction for Giardia, Cryptosporidium, and Entamoeba parasites, respectively. This proof-of-concept assay may be reconfigured to detect a wide variety of targets by re-designing the primer and probe sequences.

  5. RNA Polymerase III transcription in higher plants: Annual performance report, December 20, 1986 through December 15, 1987

    SciTech Connect

    Hall, B.D.

    1987-01-01

    tDNA-dependent Pol III transcription is not observed directly in extracts of wheat embryo cells or nuclei. This project seeks to purify wheat germ RNA Polymerase III, purify wheat factor TFIIIC based upon tDNA binding activity, and by using the two above components plus a specific cloned tDNA template, to screen extracts for the one missing component.

  6. Structure of the SSB-DNA polymerase III interface and its role in DNA replication

    SciTech Connect

    Marceau, Aimee H; Bahng, Soon; Massoni, Shawn C; George, Nicholas P; Sandler, Steven J; Marians, Kenneth J; Keck, James L

    2012-05-22

    Interactions between single-stranded DNA-binding proteins (SSBs) and the DNA replication machinery are found in all organisms, but the roles of these contacts remain poorly defined. In Escherichia coli, SSB's association with the χ subunit of the DNA polymerase III holoenzyme has been proposed to confer stability to the replisome and to aid delivery of primers to the lagging-strand DNA polymerase. Here, the SSB-binding site on χ is identified crystallographically and biochemical and cellular studies delineate the consequences of destabilizing the χ/SSB interface. An essential role for the χ/SSB interaction in lagging-strand primer utilization is not supported. However, sequence changes in χ that block complex formation with SSB lead to salt-dependent uncoupling of leading- and lagging-strand DNA synthesis and to a surprising obstruction of the leading-strand DNA polymerase in vitro, pointing to roles for the χ/SSB complex in replisome establishment and maintenance. Destabilization of the χ/SSB complex in vivo produces cells with temperature-dependent cell cycle defects that appear to arise from replisome instability.

  7. RNA polymerase III transcription in higher plants: (Annual) performance report, May 1, 1986 through December 20, 1986

    SciTech Connect

    Hall, B.D.

    1986-01-01

    From wheat germ, we have isolated and partially purified the RNA polymerase III. We have shown it to be functional for tRNA synthesis in combination with yeast transcription factors tau (TFIIIC) and B. In addition, by the test of specific DNA binding, we have isolated a putative wheat TFIIIC. Several critical tests have been made, using human (HeLa cell) RNA polymerase III and its factors as a model system, to see whether complementation of an incomplete yeast Pol III system with factors of heterologous origin is likely to be successful. 5 refs.

  8. Nutrient/TOR-dependent regulation of RNA polymerase III controls tissue and organismal growth in Drosophila.

    PubMed

    Marshall, Lynne; Rideout, Elizabeth J; Grewal, Savraj S

    2012-04-18

    The nutrient/target-of-rapamycin (TOR) pathway has emerged as a key regulator of tissue and organismal growth in metazoans. The signalling components of the nutrient/TOR pathway are well defined; however, the downstream effectors are less understood. Here, we show that the control of RNA polymerase (Pol) III-dependent transcription is an essential target of TOR in Drosophila. We find that TOR activity controls Pol III in growing larvae via inhibition of the repressor Maf1 and, in part, via the transcription factor Drosophila Myc (dMyc). Moreover, we show that loss of the Pol III factor, Brf, leads to reduced tissue and organismal growth and prevents TOR-induced cellular growth. TOR activity in the larval fat body, a tissue equivalent to vertebrate fat or liver, couples nutrition to insulin release from the brain. Accordingly, we find that fat-specific loss of Brf phenocopies nutrient limitation and TOR inhibition, leading to decreased systemic insulin signalling and reduced organismal growth. Thus, stimulation of Pol III is a key downstream effector of TOR in the control of cellular and systemic growth.

  9. A high density of cis-information terminates RNA Polymerase III on a 2-rail track

    PubMed Central

    Arimbasseri, Aneeshkumar G.; Maraia, Richard J.

    2016-01-01

    ABSTRACT Transcription termination delineates the 3′ ends of transcripts, prevents otherwise runaway RNA polymerase (RNAP) from intruding into downstream genes and regulatory elements, and enables release of the RNAP for recycling. While other eukaryotic RNAPs require complex cis-signals and/or accessory factors to achieve these activities, RNAP III does so autonomously with high efficiency and precision at a simple oligo(dT) stretch of 5–6 bp. A basis for this high density cis-information is that both template and nontemplate strands of the RNAP III terminator carry distinct signals for different stages of termination. High-density cis-information is a feature of the RNAP III system that is also reflected by dual functionalities of the tRNA promoters as both DNA and RNA elements. We review emerging developments in RNAP III termination and single strand nontemplate DNA use by other RNAPs. Use of nontemplate signals by RNAPs and associated transcription factors may be prevalent in gene regulation. PMID:26636900

  10. Architecture of TFIIIC and its role in RNA polymerase III pre-initiation complex assembly

    NASA Astrophysics Data System (ADS)

    Male, Gary; von Appen, Alexander; Glatt, Sebastian; Taylor, Nicholas M. I.; Cristovao, Michele; Groetsch, Helga; Beck, Martin; Müller, Christoph W.

    2015-06-01

    In eukaryotes, RNA Polymerase III (Pol III) is specifically responsible for transcribing genes encoding tRNAs and other short non-coding RNAs. The recruitment of Pol III to tRNA-encoding genes requires the transcription factors (TF) IIIB and IIIC. TFIIIC has been described as a conserved, multi-subunit protein complex composed of two subcomplexes, called τA and τB. How these two subcomplexes are linked and how their interaction affects the formation of the Pol III pre-initiation complex (PIC) is poorly understood. Here we use chemical crosslinking mass spectrometry and determine the molecular architecture of TFIIIC. We further report the crystal structure of the essential TPR array from τA subunit τ131 and characterize its interaction with a central region of τB subunit τ138. The identified τ131-τ138 interacting region is essential in vivo and overlaps with TFIIIB-binding sites, revealing a crucial interaction platform for the regulation of tRNA transcription initiation.

  11. A novel interaction between DNA ligase III and DNA polymerase gamma plays an essential role in mitochondrial DNA stability.

    PubMed

    De, Ananya; Campbell, Colin

    2007-02-15

    The data in the present study show that DNA polymerase gamma and DNA ligase III interact in mitochondrial protein extracts from cultured HT1080 cells. An interaction was also observed between the two recombinant proteins in vitro. Expression of catalytically inert versions of DNA ligase III that bind DNA polymerase gamma was associated with reduced mitochondrial DNA copy number and integrity. In contrast, overexpression of wild-type DNA ligase III had no effect on mitochondrial DNA copy number or integrity. Experiments revealed that wild-type DNA ligase III facilitates the interaction of DNA polymerase gamma with a nicked DNA substrate in vitro, and that the zinc finger domain of DNA ligase III is required for this activity. Mitochondrial protein extracts prepared from cells overexpressing a DNA ligase III protein that lacked the zinc finger domain had reduced base excision repair activity compared with extracts from cells overexpressing the wild-type protein. These data support the interpretation that the interaction of DNA ligase III and DNA polymerase gamma is required for proper maintenance of the mammalian mitochondrial genome.

  12. Identification of RNA polymerase III-transcribed Alu loci by computational screening of RNA-Seq data.

    PubMed

    Conti, Anastasia; Carnevali, Davide; Bollati, Valentina; Fustinoni, Silvia; Pellegrini, Matteo; Dieci, Giorgio

    2015-01-01

    Of the ∼ 1.3 million Alu elements in the human genome, only a tiny number are estimated to be active in transcription by RNA polymerase (Pol) III. Tracing the individual loci from which Alu transcripts originate is complicated by their highly repetitive nature. By exploiting RNA-Seq data sets and unique Alu DNA sequences, we devised a bioinformatic pipeline allowing us to identify Pol III-dependent transcripts of individual Alu elements. When applied to ENCODE transcriptomes of seven human cell lines, this search strategy identified ∼ 1300 Alu loci corresponding to detectable transcripts, with ∼ 120 of them expressed in at least three cell lines. In vitro transcription of selected Alus did not reflect their in vivo expression properties, and required the native 5'-flanking region in addition to internal promoter. We also identified a cluster of expressed AluYa5-derived transcription units, juxtaposed to snaR genes on chromosome 19, formed by a promoter-containing left monomer fused to an Alu-unrelated downstream moiety. Autonomous Pol III transcription was also revealed for Alus nested within Pol II-transcribed genes. The ability to investigate Alu transcriptomes at single-locus resolution will facilitate both the identification of novel biologically relevant Alu RNAs and the assessment of Alu expression alteration under pathological conditions.

  13. Identification of RNA polymerase III-transcribed Alu loci by computational screening of RNA-Seq data

    PubMed Central

    Conti, Anastasia; Carnevali, Davide; Bollati, Valentina; Fustinoni, Silvia; Pellegrini, Matteo; Dieci, Giorgio

    2015-01-01

    Of the ∼1.3 million Alu elements in the human genome, only a tiny number are estimated to be active in transcription by RNA polymerase (Pol) III. Tracing the individual loci from which Alu transcripts originate is complicated by their highly repetitive nature. By exploiting RNA-Seq data sets and unique Alu DNA sequences, we devised a bioinformatic pipeline allowing us to identify Pol III-dependent transcripts of individual Alu elements. When applied to ENCODE transcriptomes of seven human cell lines, this search strategy identified ∼1300 Alu loci corresponding to detectable transcripts, with ∼120 of them expressed in at least three cell lines. In vitro transcription of selected Alus did not reflect their in vivo expression properties, and required the native 5′-flanking region in addition to internal promoter. We also identified a cluster of expressed AluYa5-derived transcription units, juxtaposed to snaR genes on chromosome 19, formed by a promoter-containing left monomer fused to an Alu-unrelated downstream moiety. Autonomous Pol III transcription was also revealed for Alus nested within Pol II-transcribed genes. The ability to investigate Alu transcriptomes at single-locus resolution will facilitate both the identification of novel biologically relevant Alu RNAs and the assessment of Alu expression alteration under pathological conditions. PMID:25550429

  14. Enhanced solid-phase recombinase polymerase amplification and electrochemical detection.

    PubMed

    Del Río, Jonathan Sabaté; Lobato, Ivan Magriñà; Mayboroda, Olena; Katakis, Ioanis; O'Sullivan, Ciara K

    2017-03-02

    Recombinase polymerase amplification (RPA) is an elegant method for the rapid, isothermal amplification of nucleic acids. Here, we elucidate the optimal surface chemistry for rapid and efficient solid-phase RPA, which was fine-tuned in order to obtain a maximum signal-to-noise ratio, defining the optimal DNA probe density, probe-to-lateral spacer ratio (1:0, 1:1, 1:10 and 1:100) and length of a vertical spacer of the probe as well as investigating the effect of different types of lateral spacers. The use of different labelling strategies was also examined in order to reduce the number of steps required for the analysis, using biotin or horseradish peroxidase-labelled reverse primers. Optimisation of the amplification temperature used and the use of surface blocking agents were also pursued. The combination of these changes facilitated a significantly more rapid amplification and detection protocol, with a lowered limit of detection (LOD) of 1 · 10(-15) M. The optimised protocol was applied to the detection of Francisella tularensis in real samples from hares and a clear correlation with PCR and qPCR results observed and the solid-phase RPA demonstrated to be capable of detecting 500 fM target DNA in real samples. Graphical abstract Relative size of thiolated lateral spacers tested versus the primer and the uvsx recombinase protein.

  15. Rapid detection of Porcine circovirus 2 by recombinase polymerase amplification.

    PubMed

    Wang, Jianchang; Wang, Jinfeng; Liu, Libing; Li, Ruiwen; Yuan, Wanzhe

    2016-09-01

    Porcine circovirus-associated disease, caused primarily by Porcine circovirus 2 (PCV-2), has become endemic in many pig-producing countries and has resulted in significant economic losses to the swine industry worldwide. Tests for PCV-2 infection include PCR, nested PCR, competitive PCR, and real-time PCR (rtPCR). Recombinase polymerase amplification (RPA) has emerged as an isothermal gene amplification technology for the molecular detection of infectious disease agents. RPA is performed at a constant temperature and therefore can be carried out in a water bath. In addition, RPA is completed in ~30 min, much faster than PCR, which usually takes >60 min. We developed a RPA-based method for the detection of PCV-2. The detection limit of RPA was 10(2) copies of PCV-2 genomic DNA. RPA showed the same sensitivity as rtPCR but was 10 times more sensitive than conventional PCR. Successful amplification of PCV-2 DNA, but not other viral templates, demonstrated high specificity of the RPA assay. This method was also validated using clinical samples. The results showed that the RPA assay had a diagnostic agreement rate of 93.7% with conventional PCR and 100% with rtPCR. These findings suggest that the RPA assay is a simple, rapid, and cost-effective method for PCV-2 detection, which could be potentially applied in clinical diagnosis and field surveillance of PCV-2 infection.

  16. Global analysis of transcriptionally engaged yeast RNA polymerase III reveals extended tRNA transcripts

    PubMed Central

    Turowski, Tomasz W.; Leśniewska, Ewa; Delan-Forino, Clementine; Sayou, Camille; Boguta, Magdalena; Tollervey, David

    2016-01-01

    RNA polymerase III (RNAPIII) synthesizes a range of highly abundant small stable RNAs, principally pre-tRNAs. Here we report the genome-wide analysis of nascent transcripts attached to RNAPIII under permissive and restrictive growth conditions. This revealed strikingly uneven polymerase distributions across transcription units, generally with a predominant 5′ peak. This peak was higher for more heavily transcribed genes, suggesting that initiation site clearance is rate-limiting during RNAPIII transcription. Down-regulation of RNAPIII transcription under stress conditions was found to be uneven; a subset of tRNA genes showed low response to nutrient shift or loss of the major transcription regulator Maf1, suggesting potential “housekeeping” roles. Many tRNA genes were found to generate long, 3′-extended forms due to read-through of the canonical poly(U) terminators. The degree of read-through was anti-correlated with the density of U-residues in the nascent tRNA, and multiple, functional terminators can be located far downstream. The steady-state levels of 3′-extended pre-tRNA transcripts are low, apparently due to targeting by the nuclear surveillance machinery, especially the RNA binding protein Nab2, cofactors for the nuclear exosome, and the 5′-exonuclease Rat1. PMID:27206856

  17. Recessive mutations in POLR1C cause a leukodystrophy by impairing biogenesis of RNA polymerase III

    PubMed Central

    Thiffault, Isabelle; Wolf, Nicole I.; Forget, Diane; Guerrero, Kether; Tran, Luan T.; Choquet, Karine; Lavallée-Adam, Mathieu; Poitras, Christian; Brais, Bernard; Yoon, Grace; Sztriha, Laszlo; Webster, Richard I.; Timmann, Dagmar; van de Warrenburg, Bart P.; Seeger, Jürgen; Zimmermann, Alíz; Máté, Adrienn; Goizet, Cyril; Fung, Eva; van der Knaap, Marjo S.; Fribourg, Sébastien; Vanderver, Adeline; Simons, Cas; Taft, Ryan J.; Yates III, John R.; Coulombe, Benoit; Bernard, Geneviève

    2015-01-01

    A small proportion of 4H (Hypomyelination, Hypodontia and Hypogonadotropic Hypogonadism) or RNA polymerase III (POLR3)-related leukodystrophy cases are negative for mutations in the previously identified causative genes POLR3A and POLR3B. Here we report eight of these cases carrying recessive mutations in POLR1C, a gene encoding a shared POLR1 and POLR3 subunit, also mutated in some Treacher Collins syndrome (TCS) cases. Using shotgun proteomics and ChIP sequencing, we demonstrate that leukodystrophy-causative mutations, but not TCS mutations, in POLR1C impair assembly and nuclear import of POLR3, but not POLR1, leading to decreased binding to POLR3 target genes. This study is the first to show that distinct mutations in a gene coding for a shared subunit of two RNA polymerases lead to selective modification of the enzymes' availability leading to two different clinical conditions and to shed some light on the pathophysiological mechanism of one of the most common hypomyelinating leukodystrophies, POLR3-related leukodystrophy. PMID:26151409

  18. Inhibition of host cell RNA polymerase III-mediated transcription by poliovirus: Inactivation of specific transcription factors

    SciTech Connect

    Fradkin, L.G.; Yoshinaga, S.K.; Berk, A.J.; Dasgupta, A.

    1987-11-01

    The inhibition of transcription by RNA polymerase III in poliovirus-infected cells was studied. Experiments utilizing two different cell lines showed that the initiation step of transcription by RNA polymerase III was impaired by infection of these cells with the virus. The observed inhibition of transcription was not due to shut-off of host cell protein synthesis by poliovirus. Among four distinct components required for accurate transcription in vitro from cloned DNA templates, activities of RNA polymerase III and transcription factor TFIIIA were not significantly affected by virus infection. The activity of transcription factor TFIIIC, the limiting component required for transcription of RNA polymerase III genes, was severely inhibited in infected cells, whereas that of transcription factor TFIIIB was inhibited to a lesser extent. The sequence-specific DNA-binding of TFIIIC to the adenovirus VA1 gene internal promoted, however, was not altered by infection of cells with the virus. The authors conclude that (i) at least two transcription factors, TFIIIB and TFIIIC, are inhibited by infection of cells with poliovirtus, (ii) inactivation of TFIIIC does not involve destruction of its DNA-binding domain, and (iii) sequence-specific DNA binding by TFIIIC may be necessary but is not sufficient for the formation of productive transcription complexes.

  19. Detection of Penicillium expansum by polymerase chain reaction.

    PubMed

    Marek, Patrick; Annamalai, Thirunavukkarasu; Venkitanarayanan, Kumar

    2003-12-31

    Penicillium expansum is a major causative agent of postharvest decay in a variety of fruits, including apples, peaches, nectarines, and cherries. It causes significant economic losses to the fruit industry and is also of potential public health significance, since it produces patulin, a mycotoxin known to cause harmful effects in animals. Rapid and specific detection of P. expansum is important for ensuring microbiological quality and safety of fruits and fruit juices. The traditional methods for identification of P. expansum are time-consuming and labor-intensive. In this study, we report a polymerase chain reaction utilizing primers based on the polygalacturonase gene of P. expansum. The PCR amplified a 404-bp DNA product from all the P. expansum isolates tested, but not in other common foodborne Penicillium species and Escherichia coli. Experiments to determine the sensitivity of the PCR indicated that it can detect the DNA equivalent from as low as 25 spores of P. expansum. The PCR could potentially be used as a rapid tool for screening fruits for the presence of P. expansum.

  20. Detection of Aspergillus fumigatus by polymerase chain reaction.

    PubMed Central

    Spreadbury, C; Holden, D; Aufauvre-Brown, A; Bainbridge, B; Cohen, J

    1993-01-01

    Aspergillus fumigatus is an opportunistic nosocomial pathogen causing an often fatal pneumonia, invasive aspergillosis (IA), in immunosuppressed patients. Oligonucleotide primers were used to amplify a 401-bp fragment spanning the 26S/intergenic spacer region of the rDNA complex of A. fumigatus by the polymerase chain reaction (PCR). The primers were highly sensitive and specific: as little as 1 pg of A. fumigatus genomic DNA could be detected, and the primers only amplified DNA from A. fumigatus and not any other fungal, bacterial, viral, or human DNA tested. Using the PCR, we were able to detect A. fumigatus DNA in lung homogenates from immunosuppressed mice experimentally infected with A. fumigatus but not from immunosuppressed uninfected controls. There was 93% correlation between the culture results and the PCR results. In a retrospective clinical study, the sensitivity of the PCR for the detection of A. fumigatus in clinical samples was confirmed by positive amplification in three of three culture-positive respiratory samples from confirmed cases of IA. Because isolation of Aspergillus spp. may reflect contamination and colonization without infection, the feasibility of using the PCR was evaluated by analyzing culture-negative samples from both immunosuppressed patients at high risk for IA and immunocompetent patients with other lung infections. Only 2 of 10 patients were culture negative and PCR positive in the high-risk group, and 2 of 7 patients were culture negative and PCR positive in the immunocompetent group. The results indicate that PCR detection might be a valuable adjunct to current laboratory methods to diagnose IA. Images PMID:8458955

  1. Virus-induced gene silencing of RPC5-like subunit of RNA polymerase III caused pleiotropic effects in Nicotiana benthamiana

    Technology Transfer Automated Retrieval System (TEKTRAN)

    In eukaryotic cells, RNA polymerase III is highly conserved, contains 17 subunits and transcribes housekeeping genes such as ribosomal 50S rRNA, tRNA and other small RNAs. Functional roles of the RPC5 are poorly characterized in the literature. In this work, we report that virus-induced gene silenci...

  2. Polymerase chain reaction based detection of fungi in infected corneas

    PubMed Central

    Gaudio, P A; Gopinathan, U; Sangwan, V; Hughes, T E

    2002-01-01

    Aims: To evaluate a polymerase chain reaction (PCR) based assay to detect fungi in scrapings from infected corneas. Methods: A PCR assay was developed to amplify a portion of the fungal 18S ribosome gene. Corneal scrapings from 30 patients with presumed infectious keratitis were evaluated using this assay, as well as by standard microbiological techniques, and the results were compared. Conjunctival swabs from each patient's healthy, fellow eye were also evaluated by PCR. Results: PCR and fungal culture results matched (were both positive or both negative for fungi) in 22 (74%) of 30 scrapings from infected corneas. Three (10%) of 30 samples were PCR positive but fungal culture negative; two of these appeared clinically to represent fungal infections, and the third was clinically indeterminate. Four (13%) scrapings were positive by PCR but also by bacterial and not fungal culture. One specimen (3%) was PCR negative but fungal culture positive. Of the conjunctival swabs from each patient's healthy fellow eye, five (17%) of 30 were positive by PCR, and the opposite, infected eye of all five of these harboured a fungal infection. Conclusions: PCR is promising as a means to diagnose fungal keratitis and offers some advantages over culture methods, including rapid analysis and the ability to analyse specimens far from where they are collected. PMID:12084744

  3. Rapid detection of Mycobacterium tuberculosis by recombinase polymerase amplification.

    PubMed

    Boyle, David S; McNerney, Ruth; Teng Low, Hwee; Leader, Brandon Troy; Pérez-Osorio, Ailyn C; Meyer, Jessica C; O'Sullivan, Denise M; Brooks, David G; Piepenburg, Olaf; Forrest, Matthew S

    2014-01-01

    Improved access to effective tests for diagnosing tuberculosis (TB) has been designated a public health priority by the World Health Organisation. In high burden TB countries nucleic acid based TB tests have been restricted to centralised laboratories and specialised research settings. Requirements such as a constant electrical supply, air conditioning and skilled, computer literate operators prevent implementation of such tests in many settings. Isothermal DNA amplification technologies permit the use of simpler, less energy intensive detection platforms more suited to low resource settings that allow the accurate diagnosis of a disease within a short timeframe. Recombinase Polymerase Amplification (RPA) is a rapid, low temperature isothermal DNA amplification reaction. We report here RPA-based detection of Mycobacterium tuberculosis complex (MTC) DNA in <20 minutes at 39 °C. Assays for two MTC specific targets were investigated, IS6110 and IS1081. When testing purified MTC genomic DNA, limits of detection of 6.25 fg (IS6110) and 20 fg (IS1081)were consistently achieved. When testing a convenience sample of pulmonary specimens from suspected TB patients, RPA demonstrated superior accuracy to indirect fluorescence microscopy. Compared to culture, sensitivities for the IS1081 RPA and microscopy were 91.4% (95%CI: 85, 97.9) and 86.1% (95%CI: 78.1, 94.1) respectively (n = 71). Specificities were 100% and 88.6% (95% CI: 80.8, 96.1) respectively. For the IS6110 RPA and microscopy sensitivities of 87.5% (95%CI: 81.7, 93.2) and 70.8% (95%CI: 62.9, 78.7) were obtained (n = 90). Specificities were 95.4 (95% CI: 92.3,98.1) and 88% (95% CI: 83.6, 92.4) respectively. The superior specificity of RPA for detecting tuberculosis was due to the reduced ability of fluorescence microscopy to distinguish Mtb complex from other acid fast bacteria. The rapid nature of the RPA assay and its low energy requirement compared to other amplification technologies suggest RPA-based TB assays

  4. Subunit compositions of Arabidopsis RNA polymerases I and III reveal Pol I- and Pol III-specific forms of the AC40 subunit and alternative forms of the C53 subunit

    SciTech Connect

    Ream, Thomas S.; Haag, Jeremy R.; Pontvianne, Frederic; Nicora, Carrie D.; Norbeck, Angela D.; Pasa-Tolic, Ljiljana; Pikaard, Craig S.

    2015-05-02

    Using affinity purification and mass spectrometry, we identified the subunits of Arabidopsis thaliana multisubunit RNA Polymerases I and III (abbreviated as Pol I and Pol III), providing the first description of their physical compositions in plants. AC40 and AC19 subunits are typically common to Pol I (a.k.a. Pol A) and Pol III (a.k.a. Pol C) and are encoded by single genes whose mutation, in humans, is a cause of the craniofacial disorder, Treacher-Collins Syndrome. Surprisingly, A. thaliana, and related species, express two distinct AC40 paralogs, one of which assembles into Pol I and the other of which assembles into Pol III. Changes at eight amino acid positions correlate with this functional divergence of Pol I and Pol III-specific AC40 paralogs. Two genes encode homologs of the yeast C53 subunit, and either variant can assemble into Pol III. By contrast, only one of two potential C17 variants, and one of two potential C31 variants were detected in Pol III. We introduce a new nomenclature system for plant Pol I and Pol III subunits in which the twelve subunits that are structurally and functionally homologous among Pols I through V are assigned equivalent numbers.

  5. Subunit compositions of Arabidopsis RNA polymerases I and III reveal Pol I- and Pol III-specific forms of the AC40 subunit and alternative forms of the C53 subunit

    DOE PAGES

    Ream, Thomas S.; Haag, Jeremy R.; Pontvianne, Frederic; ...

    2015-05-02

    Using affinity purification and mass spectrometry, we identified the subunits of Arabidopsis thaliana multisubunit RNA Polymerases I and III (abbreviated as Pol I and Pol III), providing the first description of their physical compositions in plants. AC40 and AC19 subunits are typically common to Pol I (a.k.a. Pol A) and Pol III (a.k.a. Pol C) and are encoded by single genes whose mutation, in humans, is a cause of the craniofacial disorder, Treacher-Collins Syndrome. Surprisingly, A. thaliana, and related species, express two distinct AC40 paralogs, one of which assembles into Pol I and the other of which assembles into Polmore » III. Changes at eight amino acid positions correlate with this functional divergence of Pol I and Pol III-specific AC40 paralogs. Two genes encode homologs of the yeast C53 subunit, and either variant can assemble into Pol III. By contrast, only one of two potential C17 variants, and one of two potential C31 variants were detected in Pol III. We introduce a new nomenclature system for plant Pol I and Pol III subunits in which the twelve subunits that are structurally and functionally homologous among Pols I through V are assigned equivalent numbers.« less

  6. TORC1-dependent sumoylation of Rpc82 promotes RNA polymerase III assembly and activity

    PubMed Central

    Chymkowitch, Pierre; Nguéa P, Aurélie; Aanes, Håvard; Robertson, Joseph; Klungland, Arne; Enserink, Jorrit M.

    2017-01-01

    Maintaining cellular homeostasis under changing nutrient conditions is essential for the growth and development of all organisms. The mechanisms that maintain homeostasis upon loss of nutrient supply are not well understood. By mapping the SUMO proteome in Saccharomyces cerevisiae, we discovered a specific set of differentially sumoylated proteins mainly involved in transcription. RNA polymerase III (RNAPIII) components, including Rpc53, Rpc82, and Ret1, are particularly prominent nutrient-dependent SUMO targets. Nitrogen starvation, as well as direct inhibition of the master nutrient response regulator target of rapamycin complex 1 (TORC1), results in rapid desumoylation of these proteins, which is reflected by loss of SUMO at tRNA genes. TORC1-dependent sumoylation of Rpc82 in particular is required for robust tRNA transcription. Mechanistically, sumoylation of Rpc82 is important for assembly of the RNAPIII holoenzyme and recruitment of Rpc82 to tRNA genes. In conclusion, our data show that TORC1-dependent sumoylation of Rpc82 bolsters the transcriptional capacity of RNAPIII under optimal growth conditions. PMID:28096404

  7. Identification of an RNA Polymerase III Regulator Linked to Disease-Associated Protein Aggregation.

    PubMed

    Sin, Olga; de Jong, Tristan; Mata-Cabana, Alejandro; Kudron, Michelle; Zaini, Mohamad Amr; Aprile, Francesco A; Seinstra, Renée I; Stroo, Esther; Prins, Roméo Willinge; Martineau, Céline N; Wang, Hai Hui; Hogewerf, Wytse; Steinhof, Anne; Wanker, Erich E; Vendruscolo, Michele; Calkhoven, Cornelis F; Reinke, Valerie; Guryev, Victor; Nollen, Ellen A A

    2017-03-16

    Protein aggregation is associated with age-related neurodegenerative disorders, such as Alzheimer's and polyglutamine diseases. As a causal relationship between protein aggregation and neurodegeneration remains elusive, understanding the cellular mechanisms regulating protein aggregation will help develop future treatments. To identify such mechanisms, we conducted a forward genetic screen in a C. elegans model of polyglutamine aggregation and identified the protein MOAG-2/LIR-3 as a driver of protein aggregation. In the absence of polyglutamine, MOAG-2/LIR-3 regulates the RNA polymerase III-associated transcription of small non-coding RNAs. This regulation is lost in the presence of polyglutamine, which mislocalizes MOAG-2/LIR-3 from the nucleus to the cytosol. We then show biochemically that MOAG-2/LIR-3 can also catalyze the aggregation of polyglutamine-expanded huntingtin. These results suggest that polyglutamine can induce an aggregation-promoting activity of MOAG-2/LIR-3 in the cytosol. The concept that certain aggregation-prone proteins can convert other endogenous proteins into drivers of aggregation and toxicity adds to the understanding of how cellular homeostasis can be deteriorated in protein misfolding diseases.

  8. p53 inhibits RNA polymerase III-directed transcription in a promoter-dependent manner.

    PubMed Central

    Chesnokov, I; Chu, W M; Botchan, M R; Schmid, C W

    1996-01-01

    Wild-type p53 represses Alu template activity in vitro and in vivo. However, upstream activating sequence elements from both the 7SL RNA gene and an Alu source gene relieve p53-mediated repression. p53 also represses the template activity of the U6 RNA gene both in vitro and in vivo but has no effect on in vitro transcription of genes encoding 5S RNA, 7SL RNA, adenovirus VAI RNA, and tRNA. The N-terminal activation domain of p53, which binds TATA-binding protein (TBP), is sufficient for repressing Alu transcription in vitro, and mutation of positions 22 and 23 in this region impairs p53-mediated repression of an Alu template both in vitro and in vivo. p53's N-terminal domain binds TFIIIB, presumably through its known interaction with TBP, and mutation of positions 22 and 23 interferes with TFIIIB binding. These results extend p53's transcriptional role to RNA polymerase III-directed templates and identify an additional level of Alu transcriptional regulation. PMID:8943363

  9. Stabilization of the Escherichia coli DNA polymerase III ε subunit by the θ subunit favors in vivo assembly of the Pol III catalytic core

    PubMed Central

    Conte, Emanuele; Vincelli, Gabriele; Schaaper, Roel M.; Bressanin, Daniela; Stefan, Alessandra; Dal Piaz, Fabrizio; Hochkoeppler, Alejandro

    2012-01-01

    Escherichia coli DNA polymerase III holoenzyme (HE) contains a core polymerase consisting of three subunits: α(polymerase), ε(3′-5′ exonuclease), and θ. Genetic experiments suggested that θ subunit stabilizes the intrinsically labile ε subunit and, furthermore, that θ might affect the cellular amounts of Pol III core and HE. Here, we provide biochemical evidence supporting this model by analyzing the amounts of the relevant proteins. First, we show that a ΔholE strain (lacking θ subunit) displays reduced amounts of free ε. We also demonstrate the existence of a dimer of ε, which may be involved in the stabilization of the protein. Second, θ, when overexpressed, dissociates the ε dimer and significantly increases the amount of Pol III core. The stability of ε also depends on cellular chaperones, including DnaK. Here, we report that: (i) temperature shift-up of ΔdnaK strains leads to rapid depletion of ε, and (ii) overproduction of θ overcomes both the depletion of ε and the temperature sensitivity of the strain. Overall, our data suggest that ε is a critical factor in the assembly of Pol III core, and that this is role is strongly influenced by the θ subunit through its prevention of ε degradation. PMID:22546509

  10. Characterization of the χψ subcomplex of Pseudomonas aeruginosa DNA polymerase III

    PubMed Central

    2011-01-01

    Background DNA polymerase III, the main enzyme responsible for bacterial DNA replication, is composed of three sub-assemblies: the polymerase core, the β-sliding clamp, and the clamp loader. During replication, single-stranded DNA-binding protein (SSB) coats and protects single-stranded DNA (ssDNA) and also interacts with the χψ heterodimer, a sub-complex of the clamp loader. Whereas the χ subunits of Escherichia coli and Pseudomonas aeruginosa are about 40% homologous, P. aeruginosa ψ is twice as large as its E. coli counterpart, and contains additional sequences. It was shown that P. aeruginosa χψ together with SSB increases the activity of its cognate clamp loader 25-fold at low salt. The E. coli clamp loader, however, is insensitive to the addition of its cognate χψ under similar conditions. In order to find out distinguishing properties within P. aeruginosa χψ which account for this higher stimulatory effect, we characterized P. aeruginosa χψ by a detailed structural and functional comparison with its E. coli counterpart. Results Using small-angle X-ray scattering, analytical ultracentrifugation, and homology-based modeling, we found the N-terminus of P. aeruginosa ψ to be unstructured. Under high salt conditions, the affinity of the χψ complexes from both organisms to their cognate SSB was similar. Under low salt conditions, P. aeruginosa χψ, contrary to E. coli χψ, binds to ssDNA via the N-terminus of ψ. Whereas it is also able to bind to double-stranded DNA, the affinity is somewhat reduced. Conclusions The binding to DNA, otherwise never reported for any other ψ protein, enhances the affinity of P. aeruginosa χψ towards the SSB/ssDNA complex and very likely contributes to the higher stimulatory effect of P. aeruginosa χψ on the clamp loader. We also observed DNA-binding activity for P. putida χψ, making this activity most probably a characteristic of the ψ proteins from the Pseudomonadaceae. PMID:21955458

  11. TATA-box DNA binding activity and subunit composition for RNA polymerase III transcription factor IIIB from Xenopus laevis.

    PubMed Central

    McBryant, S J; Meier, E; Leresche, A; Sharp, S J; Wolf, V J; Gottesfeld, J M

    1996-01-01

    The RNA polymerase III transcription initiation factor TFIIIB contains the TATA-box-binding protein (TBP) and polymerase III-specific TBP-associated factors (TAFs). Previous studies have shown that DNA oligonucleotides containing the consensus TATA-box sequence inhibit polymerase III transcription, implying that the DNA binding domain of TBP is exposed in TFIIIB. We have investigated the TATA-box DNA binding activity of Xenopus TFIIIB, using transcription inhibition assays and a gel mobility shift assay. Gel shift competition assays with mutant and nonspecific DNAs demonstrate the specificity of the TFIIIB-TATA box DNA complex. The apparent dissociation constant for this protein-DNA interaction is approximately 0.4 nM, similar to the affinity of yeast TBP for the same sequence. TFIIIB transcriptional activity and TATA-box binding activity cofractionate during a series of four ion-exchange chromatographic steps, and reconstituted transcription reactions demonstrate that the TATA-box DNA-protein complex contains TFIIIB TAF activity. Polypeptides with apparent molecular masses of 75 and 92 kDa are associated with TBP in this complex. These polypeptides were renatured after elution from sodium dodecyl sulfate-gels and tested individually and in combination for TFIIIB TAF activity. Recombinant TBP along with protein fractions containing the 75- and 92-kDa polypeptides were sufficient to reconstitute TFIIIB transcriptional activity and DNA binding activity, suggesting that Xenopus TFIIIB is composed of TBP along with these polypeptides. PMID:8756620

  12. Incorporation of gemcitabine and cytarabine into DNA by DNA polymerase beta and ligase III/XRCC1.

    PubMed

    Prakasha Gowda, A S; Polizzi, Joanna M; Eckert, Kristin A; Spratt, Thomas E

    2010-06-15

    1-Beta-D-arabinofuranosylcytosine (cytarabine, araC) and 2',2'-difluoro-2'-deoxycytidine (gemcitabine, dFdC), are effective cancer chemotherapeutic agents due to their ability to become incorporated into DNA and then subsequently inhibit DNA synthesis by replicative DNA polymerases. However, the impact of these 3'-modified nucleotides on the activity of specialized DNA polymerases has not been investigated. The role of polymerase beta and base excision repair may be of particular importance due to the increased oxidative stress in tumors, increased oxidative stress caused by chemotherapy treatment, and the variable amounts of polymerase beta in tumors. Here we directly investigate the incorporation of the 5'-triphosphorylated form of araC, dFdC, 2'-fluoro-2'-deoxycytidine (FdC), and cytidine into two nicked DNA substrates and the subsequent ligation. Opposite template dG, the relative k(pol)/K(d) for incorporation was dCTP > araCTP, dFdCTP > rCTP. The relative k(pol)/K(d) for FdCTP depended on sequence. The effect on k(pol)/K(d) was due largely to changes in k(pol) with no differences in the affinity of the nucleoside triphosphates to the polymerase. Ligation efficiency by T4 ligase and ligase III/XRCC1 was largely unaffected by the nucleotide analogues. Our results show that BER is capable of incorporating araC and dFdC into the genome.

  13. Mutations Affecting Potassium Import Restore the Viability of the Escherichia coli DNA Polymerase III holD Mutant

    PubMed Central

    Durand, Adeline

    2016-01-01

    Mutants lacking the ψ (HolD) subunit of the Escherichia coli DNA Polymerase III holoenzyme (Pol III HE) have poor viability, but a residual growth allows the isolation of spontaneous suppressor mutations that restore ΔholD mutant viability. Here we describe the isolation and characterization of two suppressor mutations in the trkA and trkE genes, involved in the main E. coli potassium import system. Viability of ΔholD trk mutants is abolished on media with low or high K+ concentrations, where alternative K+ import systems are activated, and is restored on low K+ concentrations by the inactivation of the alternative Kdp system. These findings show that the ΔholD mutant is rescued by a decrease in K+ import. The effect of trk inactivation is additive with the previously identified ΔholD suppressor mutation lexAind that blocks the SOS response indicating an SOS-independent mechanism of suppression. Accordingly, although lagging-strand synthesis is still perturbed in holD trkA mutants, the trkA mutation allows HolD-less Pol III HE to resist increased levels of the SOS-induced bypass polymerase DinB. trk inactivation is also partially additive with an ssb gene duplication, proposed to stabilize HolD-less Pol III HE by a modification of the single-stranded DNA binding protein (SSB) binding mode. We propose that lowering the intracellular K+ concentration stabilizes HolD-less Pol III HE on DNA by increasing electrostatic interactions between Pol III HE subunits, or between Pol III and DNA, directly or through a modification of the SSB binding mode; these three modes of action are not exclusive and could be additive. To our knowledge, the holD mutant provides the first example of an essential protein-DNA interaction that strongly depends on K+ import in vivo. PMID:27280472

  14. Accuracy and Significance of Polymerase Chain Reaction Detection of Sentinel Node Metastases in Breast Cancer Patients

    DTIC Science & Technology

    2000-10-01

    specific reverse-transcriptase polymerase chain reaction markers in the detection of metastases in the lymph nodes... chain reaction detection of cytokeratin-19 mRNA in bone marrow and blood of breast cancer patients. J Cancer Res Clin Oncol 1996; 122: 679-86. (43...directly drain a tumor and are most likely to harbor occult cells . Reverse transcriptase- polymerase chain reaction (RT-PCR) is a sensitive

  15. Relevance of GC content to the conservation of DNA polymerase III/mismatch repair system in Gram-positive bacteria

    PubMed Central

    Akashi, Motohiro; Yoshikawa, Hirofumi

    2013-01-01

    The mechanism of DNA replication is one of the driving forces of genome evolution. Bacterial DNA polymerase III, the primary complex of DNA replication, consists of PolC and DnaE. PolC is conserved in Gram-positive bacteria, especially in the Firmicutes with low GC content, whereas DnaE is widely conserved in most Gram-negative and Gram-positive bacteria. PolC contains two domains, the 3′-5′exonuclease domain and the polymerase domain, while DnaE only possesses the polymerase domain. Accordingly, DnaE does not have the proofreading function; in Escherichia coli, another enzyme DnaQ performs this function. In most bacteria, the fidelity of DNA replication is maintained by 3′-5′ exonuclease and a mismatch repair (MMR) system. However, we found that most Actinobacteria (a group of Gram-positive bacteria with high GC content) appear to have lost the MMR system and chromosomes may be replicated by DnaE-type DNA polymerase III with DnaQ-like 3′-5′ exonuclease. We tested the mutation bias of Bacillus subtilis, which belongs to the Firmicutes and found that the wild type strain is AT-biased while the mutS-deletant strain is remarkably GC-biased. If we presume that DnaE tends to make mistakes that increase GC content, these results can be explained by the mutS deletion (i.e., deletion of the MMR system). Thus, we propose that GC content is regulated by DNA polymerase and MMR system, and the absence of polC genes, which participate in the MMR system, may be the reason for the increase of GC content in Gram-positive bacteria such as Actinobacteria. PMID:24062730

  16. Specific Detection of Campylobacter Jejuni and Campylobacter Coli by Using Polymerase Chain Reaction

    DTIC Science & Technology

    1992-10-01

    polymerase descriptions and proposal of Arcobacter gen. nov. Int. J. Syst. chain reaction for the detection of Mycobacterium leprae . 1. Bacteriol. 41:451-455...with Campylobacter spp. Infect. Immun. 59:2259-2264. detection of Mycobacterium tuberculosis in clinical specimens 29. Rashtchian, A. 1985. Detection

  17. The dnaN gene codes for the beta subunit of DNA polymerase III holoenzyme of escherichia coli.

    PubMed Central

    Burgers, P M; Kornberg, A; Sakakibara, Y

    1981-01-01

    An Escherichia coli mutant, dnaN59, stops DNA synthesis promptly upon a shift to a high temperature; the wild-type dnaN gene carried in a transducing phage encodes a polypeptide of about 41,000 daltons [Sakakibara, Y. & Mizukami, T. (1980) Mol. Gen. Genet. 178, 541-553; Yuasa, S. & Sakakibara, Y. (1980) Mol. Gen. Genet. 180, 267-273]. We now find that the product of dnaN gene is the beta subunit of DNA polymerase III holoenzyme, the principal DNA synthetic multipolypeptide complex in E. coli. The conclusion is based on the following observations: (i) Extracts from dnaN59 cells were defective in phage phi X174 and G4 DNA synthesis after the mutant cells had been exposed to the increased temperature. (ii) The enzymatic defect was overcome by addition of purified beta subunit but not by other subunits of DNA polymerase III holoenzyme or by other replication proteins required for phi X174 DNA synthesis. (iii) Partially purified beta subunit from the dnaN mutant, unlike that from the wild type, was inactive in reconstituting the holoenzyme when mixed with the other purified subunits. (iv) Increased dosage of the dnaN gene provided by a plasmid carrying the gene raised cellular levels of the beta subunit 5- to 6-fold. PMID:6458041

  18. The dnaN gene codes for the beta subunit of DNA polymerase III holoenzyme of escherichia coli.

    PubMed

    Burgers, P M; Kornberg, A; Sakakibara, Y

    1981-09-01

    An Escherichia coli mutant, dnaN59, stops DNA synthesis promptly upon a shift to a high temperature; the wild-type dnaN gene carried in a transducing phage encodes a polypeptide of about 41,000 daltons [Sakakibara, Y. & Mizukami, T. (1980) Mol. Gen. Genet. 178, 541-553; Yuasa, S. & Sakakibara, Y. (1980) Mol. Gen. Genet. 180, 267-273]. We now find that the product of dnaN gene is the beta subunit of DNA polymerase III holoenzyme, the principal DNA synthetic multipolypeptide complex in E. coli. The conclusion is based on the following observations: (i) Extracts from dnaN59 cells were defective in phage phi X174 and G4 DNA synthesis after the mutant cells had been exposed to the increased temperature. (ii) The enzymatic defect was overcome by addition of purified beta subunit but not by other subunits of DNA polymerase III holoenzyme or by other replication proteins required for phi X174 DNA synthesis. (iii) Partially purified beta subunit from the dnaN mutant, unlike that from the wild type, was inactive in reconstituting the holoenzyme when mixed with the other purified subunits. (iv) Increased dosage of the dnaN gene provided by a plasmid carrying the gene raised cellular levels of the beta subunit 5- to 6-fold.

  19. Active Center Control of Termination by RNA Polymerase III and tRNA Gene Transcription Levels In Vivo

    PubMed Central

    Rijal, Keshab; Maraia, Richard J.

    2016-01-01

    The ability of RNA polymerase (RNAP) III to efficiently recycle from termination to reinitiation is critical for abundant tRNA production during cellular proliferation, development and cancer. Yet understanding of the unique termination mechanisms used by RNAP III is incomplete, as is its link to high transcription output. We used two tRNA-mediated suppression systems to screen for Rpc1 mutants with gain- and loss- of termination phenotypes in S. pombe. 122 point mutation mutants were mapped to a recently solved 3.9 Å structure of yeast RNAP III elongation complex (EC); they cluster in the active center bridge helix and trigger loop, as well as the pore and funnel, the latter of which indicate involvement of the RNA cleavage domain of the C11 subunit in termination. Purified RNAP III from a readthrough (RT) mutant exhibits increased elongation rate. The data strongly support a kinetic coupling model in which elongation rate is inversely related to termination efficiency. The mutants exhibit good correlations of terminator RT in vitro and in vivo, and surprisingly, amounts of transcription in vivo. Because assessing in vivo transcription can be confounded by various parameters, we used a tRNA reporter with a processing defect and a strong terminator. By ruling out differences in RNA decay rates, the data indicate that mutants with the RT phenotype synthesize more RNA than wild type cells, and than can be accounted for by their increased elongation rate. Finally, increased activity by the mutants appears unrelated to the RNAP III repressor, Maf1. The results show that the mobile elements of the RNAP III active center, including C11, are key determinants of termination, and that some of the mutations activate RNAP III for overall transcription. Similar mutations in spontaneous cancer suggest this as an unforeseen mechanism of RNAP III activation in disease. PMID:27518095

  20. An Rpb4/Rpb7-like complex in yeast RNA polymerase III contains the orthologue of mammalian CGRP-RCP.

    PubMed

    Siaut, Magali; Zaros, Cécile; Levivier, Emilie; Ferri, Maria-Laura; Court, Magali; Werner, Michel; Callebaut, Isabelle; Thuriaux, Pierre; Sentenac, André; Conesa, Christine

    2003-01-01

    The essential C17 subunit of yeast RNA polymerase (Pol) III interacts with Brf1, a component of TFIIIB, suggesting a role for C17 in the initiation step of transcription. The protein sequence of C17 (encoded by RPC17) is conserved from yeasts to humans. However, mammalian homologues of C17 (named CGRP-RCP) are known to be involved in a signal transduction pathway related to G protein-coupled receptors, not in transcription. In the present work, we first establish that human CGRP-RCP is the genuine orthologue of C17. CGRP-RCP was found to functionally replace C17 in Deltarpc17 yeast cells; the purified mutant Pol III contained CGRP-RCP and had a decreased specific activity but initiated faithfully. Furthermore, CGRP-RCP was identified by mass spectrometry in a highly purified human Pol III preparation. These results suggest that CGRP-RCP has a dual function in mammals. Next, we demonstrate by genetic and biochemical approaches that C17 forms with C25 (encoded by RPC25) a heterodimer akin to Rpb4/Rpb7 in Pol II. C17 and C25 were found to interact genetically in suppression screens and physically in coimmunopurification and two-hybrid experiments. Sequence analysis and molecular modeling indicated that the C17/C25 heterodimer likely adopts a structure similar to that of the archaeal RpoE/RpoF counterpart of the Rpb4/Rpb7 complex. These RNA polymerase subunits appear to have evolved to meet the distinct requirements of the multiple forms of RNA polymerases.

  1. High-resolution RNA allelotyping along the inactive X chromosome: evidence of RNA polymerase III in regulating chromatin configuration

    PubMed Central

    Hong, Ru; Lin, Bingqing; Lu, Xinyi; Lai, Lan-Tian; Chen, Xin; Sanyal, Amartya; Ng, Huck-Hui; Zhang, Kun; Zhang, Li-Feng

    2017-01-01

    We carried out padlock capture, a high-resolution RNA allelotyping method, to study X chromosome inactivation (XCI). We examined the gene reactivation pattern along the inactive X (Xi), after Xist (X-inactive specific transcript), a prototype long non-coding RNA essential for establishing X chromosome inactivation (XCI) in early embryos, is conditionally deleted from Xi in somatic cells (Xi∆Xist). We also monitored the behaviors of X-linked non-coding transcripts before and after XCI. In each mutant cell line, gene reactivation occurs to ~6% genes along Xi∆Xist in a recognizable pattern. Genes with upstream regions enriched for SINEs are prone to be reactivated. SINE is a class of retrotransposon transcribed by RNA polymerase III (Pol III). Intriguingly, a significant fraction of Pol III transcription from non-coding regions is not subjected to Xist-mediated transcriptional silencing. Pol III inhibition affects gene reactivation status along Xi∆Xist, alters chromatin configuration and interferes with the establishment XCI during in vitro differentiation of ES cells. These results suggest that Pol III transcription is involved in chromatin structure re-organization during the onset of XCI and functions as a general mechanism regulating chromatin configuration in mammalian cells. PMID:28368037

  2. High-resolution RNA allelotyping along the inactive X chromosome: evidence of RNA polymerase III in regulating chromatin configuration.

    PubMed

    Hong, Ru; Lin, Bingqing; Lu, Xinyi; Lai, Lan-Tian; Chen, Xin; Sanyal, Amartya; Ng, Huck-Hui; Zhang, Kun; Zhang, Li-Feng

    2017-04-03

    We carried out padlock capture, a high-resolution RNA allelotyping method, to study X chromosome inactivation (XCI). We examined the gene reactivation pattern along the inactive X (Xi), after Xist (X-inactive specific transcript), a prototype long non-coding RNA essential for establishing X chromosome inactivation (XCI) in early embryos, is conditionally deleted from Xi in somatic cells (Xi(∆Xist)). We also monitored the behaviors of X-linked non-coding transcripts before and after XCI. In each mutant cell line, gene reactivation occurs to ~6% genes along Xi(∆Xist) in a recognizable pattern. Genes with upstream regions enriched for SINEs are prone to be reactivated. SINE is a class of retrotransposon transcribed by RNA polymerase III (Pol III). Intriguingly, a significant fraction of Pol III transcription from non-coding regions is not subjected to Xist-mediated transcriptional silencing. Pol III inhibition affects gene reactivation status along Xi(∆Xist), alters chromatin configuration and interferes with the establishment XCI during in vitro differentiation of ES cells. These results suggest that Pol III transcription is involved in chromatin structure re-organization during the onset of XCI and functions as a general mechanism regulating chromatin configuration in mammalian cells.

  3. Possible interaction between the bacterial transcription factor ArtA and the eukaryotic RNA polymerase III promoter.

    PubMed

    Matsutani, Sachiko

    2016-06-01

    Eukaryotic RNA polymerase III (RNAP III) transcribes tRNA genes and short interspersed elements that have internal promoters consisting of A- and B-blocks. The B-block binding subunit of the transcription initiation factor TFIIIC binds to the B-block. The mobile bacterial insertion sequence (IS) 1 contains a RNAP III promoter-like sequence, which stimulates bacterial transcription along with the bacterial ArtA protein. Here, the DNA-binding ability of ArtA was examined in vitro using a simple, newly developed method. Various DNA fragments, including RNAP III promoter fragments, were separately incubated with purified ArtA, and then loaded onto a polyacrylamide gel. Since DNAs bound by ArtA remain in the gel wells during electrophoresis, SDS was added into the wells at the electrophoresis halfway point. It was hypothesized that SDS would dissociate the DNA-ArtA complexes in the wells, and then the DNAs would begin to migrate. In fact, new bands appeared in all of the lanes at similar intensities, indicating that ArtA binds nonspecifically to DNA. Therefore, labeled wild-type RNAP III promoter fragments were incubated with either the unlabeled wild-type or mutant fragments and ArtA, and electrophoresed. The B-block(-like) sequences of IS1, a human Alu element, and an anuran tRNA gene were important for binding to ArtA. Additionally, in silico analyses revealed the presence of the RNAP III promoter-like structures in the IS1 isoforms and the IS3 family elements. These results suggest the presence of parts of the RNAP III transcription machinery in bacteria, and might imply that its prototype existed in the common ancestor.

  4. Sub1 and Maf1, two effectors of RNA polymerase III, are involved in the yeast quiescence cycle.

    PubMed

    Acker, Joël; Nguyen, Ngoc-Thuy-Trinh; Vandamme, Marie; Tavenet, Arounie; Briand-Suleau, Audrey; Conesa, Christine

    2014-01-01

    Sub1 and Maf1 exert an opposite effect on RNA polymerase III transcription interfering with different steps of the transcription cycle. In this study, we present evidence that Sub1 and Maf1 also exhibit an opposite role on yeast chronological life span. First, cells lacking Sub1 need more time than wild type to exit from resting and this lag in re-proliferation is correlated with a delay in transcriptional reactivation. Second, our data show that the capacity of the cells to properly establish a quiescent state is impaired in the absence of Sub1 resulting in a premature death that is dependent on the Ras/PKA and Tor1/Sch9 signalling pathways. On the other hand, we show that maf1Δ cells are long-lived mutant suggesting a connection between Pol III transcription and yeast longevity.

  5. Single Multiplex Polymerase Chain Reaction To Detect Diverse Loci Associated with Diarrheagenic Escherichia coli

    PubMed Central

    López-Saucedo, Catalina; Cerna, Jorge F.; Villegas-Sepulveda, Nicolas; Thompson, Rocío; Velazquez, F. Raul; Torres, Javier; Tarr, Phillip I.

    2003-01-01

    We developed and tested a single multiplex polymerase chain reaction (PCR) that detects enterotoxigenic, enteropathogenic, enteroinvasive, and Shiga-toxin–producing Escherichia coli. This PCR is specific, sensitive, and rapid in detecting target isolates in stool and food. Because of its simplicity, economy, and efficiency, this protocol warrants further evaluation in large, prospective studies of polymicrobial substances. PMID:12533296

  6. Development of a rapid recombinase polymerase amplification assay for detection of Brucella in blood samples.

    PubMed

    Ren, Hang; Yang, Mingjuan; Zhang, Guoxia; Liu, Shiwei; Wang, Xinhui; Ke, Yuehua; Du, Xinying; Wang, Zhoujia; Huang, Liuyu; Liu, Chao; Chen, Zeliang

    2016-04-01

    A rapid and sensitive recombinase polymerase amplification (RPA) assay, Bruce-RPA, was developed for detection of Brucella. The assay could detect as few as 3 copies of Brucella per reaction within 20 min. Bruce-RPA represents a candidate point-of-care diagnosis assay for human brucellosis.

  7. Identification of an ortholog of the eukaryotic RNA polymerase III subunit RPC34 in Crenarchaeota and Thaumarchaeota suggests specialization of RNA polymerases for coding and non-coding RNAs in Archaea

    PubMed Central

    Blombach, Fabian; Makarova, Kira S; Marrero, Jeannette; Siebers, Bettina; Koonin, Eugene V; Oost, John van der

    2009-01-01

    One of the hallmarks of eukaryotic information processing is the co-existence of 3 distinct, multi-subunit RNA polymerase complexes that are dedicated to the transcription of specific classes of coding or non-coding RNAs. Archaea encode only one RNA polymerase that resembles the eukaryotic RNA polymerase II with respect to the subunit composition. Here we identify archaeal orthologs of the eukaryotic RNA polymerase III subunit RPC34. Genome context analysis supports a function of this archaeal protein in the transcription of non-coding RNAs. These findings suggest that functional separation of RNA polymerases for protein-coding genes and non-coding RNAs might predate the origin of the Eukaryotes. Reviewers: This article was reviewed by Andrei Osterman and Patrick Forterre (nominated by Purificación López-García) PMID:19828044

  8. Identification of an ortholog of the eukaryotic RNA polymerase III subunit RPC34 in Crenarchaeota and Thaumarchaeota suggests specialization of RNA polymerases for coding and non-coding RNAs in Archaea.

    PubMed

    Blombach, Fabian; Makarova, Kira S; Marrero, Jeannette; Siebers, Bettina; Koonin, Eugene V; van der Oost, John

    2009-10-14

    One of the hallmarks of eukaryotic information processing is the co-existence of 3 distinct, multi-subunit RNA polymerase complexes that are dedicated to the transcription of specific classes of coding or non-coding RNAs. Archaea encode only one RNA polymerase that resembles the eukaryotic RNA polymerase II with respect to the subunit composition. Here we identify archaeal orthologs of the eukaryotic RNA polymerase III subunit RPC34. Genome context analysis supports a function of this archaeal protein in the transcription of non-coding RNAs. These findings suggest that functional separation of RNA polymerases for protein-coding genes and non-coding RNAs might predate the origin of the Eukaryotes.

  9. The hepatitis B virus X protein increases the cellular level of TATA-binding protein, which mediates transactivation of RNA polymerase III genes

    SciTech Connect

    Wang, Horng-Dar; Johnson, D.L.; Yuh, Chio-Hwa

    1995-12-01

    This report decribes the mechanism by which the hepatitis B virus X gene product induces RNA polymerase III genes. The RNA pol III transcription system serves as model for understanding the mechanism of X in the transactivation of cellular genes in both Drosophila and rat cell lines. 53 refs., 7 figs., 1 tab.

  10. The 3'-5' exonuclease site of DNA polymerase III from gram-positive bacteria: definition of a novel motif structure.

    PubMed

    Barnes, M H; Spacciapoli, P; Li, D H; Brown, N C

    1995-11-07

    The primary structure of the 3'-5' exonuclease (Exo) site of the Gram+ bacterial DNA polymerase III (Pol III) was examined by site-directed mutagenesis of Bacillus subtilis Pol III (BsPol III). It was found to differ significantly from the conventional three-motif substructure established for the Exo site of DNA polymerase I of Escherichia coli (EcPol I) and the majority of other DNA polymerase-exonucleases. Motifs I and II were conventionally organized and anchored functionally by the predicted carboxylate residues. However, the conventional downstream motif, motif III, was replaced by motif III epsilon, a novel 55-amino-acid (aa) segment incorporating three essential aa (His565, Asp533 and Asp570) which are strictly conserved in three Gram+ Pol III and in the Ec Exo epsilon (epsilon). Despite its unique substructure, the Gram+ Pol III-specific Exo site was conventionally independent of Pol, the site of 2'-deoxyribonucleoside 5-triphosphate (dNTP) binding and polymerization. The entire Exo site, including motif III epsilon, could be deleted without profoundly affecting the enzyme's capacity to polymerize dNTPs. Conversely, Pol and all other sequences downstream of the Exo site could be deleted with little apparent effect on Exo activity. Whether the three essential aa within the unique motif III epsilon substructure participate in the conventional two-metal-ion mechanism elucidated for the model Exo site of EcPol I, remains to be established.

  11. Effects of mutations in the Exo III motif of the herpes simplex virus DNA polymerase gene on enzyme activities, viral replication, and replication fidelity.

    PubMed Central

    Hwang, Y T; Liu, B Y; Coen, D M; Hwang, C B

    1997-01-01

    The herpes simplex virus DNA polymerase catalytic subunit, which has intrinsic polymerase and 3'-5' exonuclease activities, contains sequence motifs that are homologous to those important for 3'-5' exonuclease activity in other polymerases. The role of one such motif, Exo III, was examined in this study. Mutated polymerases containing either a single tyrosine-to-histidine change at residue 577 or this change plus an aspartic acid-to-alanine at residue 581 in the Exo III motif exhibited defective or undetectable exonuclease activity, respectively, yet retained substantial polymerase activity. Despite the defects in exonuclease activity, the mutant polymerases were able to support viral replication in transient complementation assays, albeit inefficiently. Viruses replicated via the action of these mutant polymerases exhibited substantially increased frequencies of mutants resistant to ganciclovir. Furthermore, when the Exo III mutations were incorporated into the viral genome, the resulting mutant viruses displayed only modestly defect in replication in Vero cells and exhibited substantially increased mutation frequencies. The results suggest that herpes simplex virus can replicate despite severely impaired exonuclease activity and that the 3'-5' exonuclease contributes substantially to the fidelity of viral DNA replication. PMID:9311864

  12. B2 RNA and 7SK RNA, RNA polymerase III transcripts, have a cap-like structure at their 5' end.

    PubMed Central

    Shumyatsky, G P; Tillib, S V; Kramerov, D A

    1990-01-01

    We found that hydrolysates of poly(A)+ RNA from Ehrlich ascites carcinoma cells which were transcribed by RNA polymerase III contained an unusual component designated as X. It was part of B2 RNA representing a transcript of B2 retroposon, typical of rodents. The component X possesses a cap-like structure, xppp5'G, where x has a non-nucleotide structure. About half of all B2 RNAs contained this group at the 5' end. Previously, Epstein et al. (1) detected a similar structure at the 5' end of small nuclear U6 RNA. Later, Singh and Reddy (2) showed methyl to be the blocking group in the component x of U6 RNA. Besides B2 RNA, we found 5' ends containing methyl groups in 7SK RNA. Images PMID:1700854

  13. Virus-induced gene silencing of the RPC5-like subunit of RNA polymerase III caused pleiotropic effects in Nicotiana benthamiana

    PubMed Central

    Nemchinov, Lev G.; Boutanaev, Alexander M.; Postnikova, Olga A.

    2016-01-01

    In eukaryotic cells, RNA polymerase III is highly conserved and transcribes housekeeping genes such as ribosomal 5S rRNA, tRNA and other small RNAs. The RPC5-like subunit is one of the 17 subunits forming RNAPIII and its exact functional roles in the transcription are poorly understood. In this work, we report that virus-induced gene silencing of transcripts encoding a putative RPC5-like subunit of the RNA Polymerase III in a model species Nicotiana benthamiana had pleiotropic effects, including but not limited to severe dwarfing appearance, chlorosis, nearly complete reduction of internodes and abnormal leaf shape. Using transcriptomic analysis, we identified genes and pathways affected by RPC5 silencing and thus presumably related to the cellular roles of the subunit as well as to the downstream cascade of reactions in response to partial loss of RNA Polymerase III function. Our results suggest that silencing of the RPC5L in N. benthamiana disrupted not only functions commonly associated with the core RNA Polymerase III transcripts, but also more diverse cellular processes, including responses to stress. We believe this is the first demonstration that activity of the RPC5 subunit is critical for proper functionality of RNA Polymerase III and normal plant development. PMID:27282827

  14. The RNA polymerase III-dependent family of genes in hemiascomycetes: comparative RNomics, decoding strategies, transcription and evolutionary implications

    PubMed Central

    Marck, Christian; Kachouri-Lafond, Rym; Lafontaine, Ingrid; Westhof, Eric; Dujon, Bernard; Grosjean, Henri

    2006-01-01

    We present the first comprehensive analysis of RNA polymerase III (Pol III) transcribed genes in ten yeast genomes. This set includes all tRNA genes (tDNA) and genes coding for SNR6 (U6), SNR52, SCR1 and RPR1 RNA in the nine hemiascomycetes Saccharomyces cerevisiae, Saccharomyces castellii, Candida glabrata, Kluyveromyces waltii, Kluyveromyces lactis, Eremothecium gossypii, Debaryomyces hansenii, Candida albicans, Yarrowia lipolytica and the archiascomycete Schizosaccharomyces pombe. We systematically analysed sequence specificities of tRNA genes, polymorphism, variability of introns, gene redundancy and gene clustering. Analysis of decoding strategies showed that yeasts close to S.cerevisiae use bacterial decoding rules to read the Leu CUN and Arg CGN codons, in contrast to all other known Eukaryotes. In D.hansenii and C.albicans, we identified a novel tDNA-Leu (AAG), reading the Leu CUU/CUC/CUA codons with an unusual G at position 32. A systematic ‘p-distance tree’ using the 60 variable positions of the tRNA molecule revealed that most tDNAs cluster into amino acid-specific sub-trees, suggesting that, within hemiascomycetes, orthologous tDNAs are more closely related than paralogs. We finally determined the bipartite A- and B-box sequences recognized by TFIIIC. These minimal sequences are nearly conserved throughout hemiascomycetes and were satisfactorily retrieved at appropriate locations in other Pol III genes. PMID:16600899

  15. Haemophilus ducreyi detection by polymerase chain reaction in oesophageal lesions of HIV patients.

    PubMed

    Borges, M C; Colares, J K B; Lima, D M; Fonseca, B A L

    2009-04-01

    HIV patients frequently have opportunistic oesophageal infections. We report Haemophilus ducreyi genetic material detected by polymerase chain reaction in biopsies of oesophageal lesions in three HIV-1-infected patients. This finding may be an indication of its aetiopathological role in oesophageal lesions of HIV patients.

  16. Real-time isothermal detection of Shiga toxin-producing Escherichia coli using recombinase polymerase amplification

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Shiga toxin (Stx) producing E. coli (STEC) are a major family of foodborne pathogens of immense public health, zoonotic and economic significance in the US and worldwide. To date, there are no published reports on use of recombinase polymerase amplification (RPA) for STEC detection. The primary goal...

  17. Detection of enteric viruses in oysters by using the polymerase chain reaction.

    PubMed Central

    Atmar, R L; Metcalf, T G; Neill, F H; Estes, M K

    1993-01-01

    A procedure for the detection of enteric viral nucleic acid in oysters by the polymerase chain reaction was developed. Known quantities of poliovirus type 1 were seeded into oysters. Virus was extracted and concentrated by using organic flocculation and polyethylene glycol precipitation. Inhibitors of reverse transcription-polymerase chain reaction were present in the oyster extracts, preventing amplification of target viral nucleic acid. The use of cetyltrimethylammonium bromide precipitation sufficiently removed inhibitors to allow detection of as few as 10 PFU of poliovirus. Norwalk virus also could be detected after being seeded into oysters. This methodology may be useful for the detection of these and other shellfish-borne viral pathogens. Images PMID:8382024

  18. DNA polymerase III accessory proteins. I. holA and holB encoding delta and delta'.

    PubMed

    Dong, Z; Onrust, R; Skangalis, M; O'Donnell, M

    1993-06-05

    The genes encoding the delta and delta' subunits of the 10-subunit Escherichia coli replicase, DNA polymerase III holoenzyme, have been identified and sequenced. The holA gene encoding delta is located downstream of rlpB at 15.2 min and predicts a 38.7 kda protein. The holB gene encoding delta' is located at 24.3 min and predicts a 36.9-kDa protein. Hence the delta and delta' subunits are unrelated proteins encoded by separate genes. The genes have been used to express and purify delta and delta' in quantity. The predicted amino acid sequence of delta' is homologous to the sequences of the tau and gamma subunits revealing a large amount of structural redundancy within the holoenzyme.

  19. Rapid detection of waterborne viruses using the polymerase chain reaction and a gene probe.

    PubMed

    Jothikumar, N; Khanna, P; Kamatchiammal, S; Murugan, R P

    1992-01-01

    We describe a membrane-filter-based urea-arginine phosphate buffer method for concentrating waterborne viruses from large volumes of water to microlitre volumes, and their subsequent detection by the polymerase chain reaction (PCR). The detection step involves the extraction of RNA, synthesis of complementary DNA, amplification by PCR of target DNA with specific primers, and confirmation through nucleic acid hybridization with a radiolabelled oligonucleotide probe. The PCR technique detected the presence of enteroviruses in spiked as well as in contaminated water samples. The technique is sensitive and detects as few as 120 waterborne viral particles. PCR is simple, rapid, sensitive, specific and adaptable for water quality surveillance in less developed countries.

  20. Detecting population III galaxies with HST and JWST

    NASA Astrophysics Data System (ADS)

    Zackrisson, E.

    2012-09-01

    A small fraction of the atomic-cooling halos assembling at z < 15 may form out of minihalos that never experienced any prior star formation, and could in principle host small galaxies of chemically unenriched stars. Since the prospects of detecting isolated population III stars appear bleak even with the upcoming James Webb Space Telescope (JWST), these population III galaxies may offer one of the best probes of population III stars in the foreseeable future. By projecting the results from population III galaxy simulations through cluster magnification maps, we predict the fluxes and surface number densities of pop III galaxy galaxies as a function of their typical star formation efficiency. We argue that a small number of lensed population III galaxies in principle could turn up at z ~ 7-10 in the ongoing Hubble Space Telecope survey CLASH, which covers a total of 25 low-redshift galaxy clusters.

  1. Rapid and sensitive detection of canine parvovirus type 2 by recombinase polymerase amplification.

    PubMed

    Wang, Jianchang; Liu, Libing; Li, Ruiwen; Wang, Jinfeng; Fu, Qi; Yuan, Wanzhe

    2016-04-01

    A novel recombinase polymerase amplification (RPA)-based method for detection of canine parvovirus type 2 (CPV-2) was developed. Sensitivity analysis showed that the detection limit of RPA was 10 copies of CPV-2 genomic DNA. RPA amplified both CPV-2a and -2b DNA but did not amplify the template of other important dog viruses (CCoV, PRV or CDV), demonstrating high specificity. The method was further validated with 57 canine fecal samples. An outstanding advantage of RPA is that it is an isothermal reaction and can be performed in a water bath, making RPA a potential alternative method for CPV-2 detection in resource-limited settings.

  2. Development of an isothermal recombinase polymerase amplification assay for rapid detection of pseudorabies virus.

    PubMed

    Yang, Yang; Qin, Xiaodong; Zhang, Wei; Li, Zhiyong; Zhang, Shuaijun; Li, Yanmin; Zhang, Zhidong

    2017-03-22

    Recombinase polymerase amplification assays using real-time fluorescent detection (real-time RPA assay) and lateral flow dipstick (RPA LFD assay) were developed targeting the gD gene of pseudorabies virus (PRV). Both assays were performed at 39 °C within 20 min. The sensitivity of the real-time RPA assay and the RPA LFD assay was 100 copies per reaction and 160 copies per reaction, respectively. Both assays did not detect DNAs from other virus or PRV negative samples. Therefore, the developed RPA assays provide a rapid, simple, sensitive and specific alternative tool for detection of PRV.

  3. Detection of Murine Typhus Infection in Fleas by Using the Polymerase Chain Reaction

    DTIC Science & Technology

    1990-03-01

    spotted fever ( Rickettsia group-specific primers and probes for the diagnosis of rick- rickettsii ), epidemic typhus ( Rickettsia prowazekii), murine...Polymerase chain reaction, Xenops.yl~j.Lopsis;" Rickettsia typhi,- Enz me-linked immunosorbent assay ’ A amplificatin6 fProu)t 19. ABSTRACT (Continue on...olymerase chain reaction (PCR) amplification of CDNA was used to detect the etiologic agent of murine typhus, Rickettsia typhi, in experimentally infected

  4. The epsilon subunit of DNA polymerase III Is involved in the nalidixic acid-induced SOS response in Escherichia coli.

    PubMed

    Pohlhaus, Jennifer Reineke; Long, David T; O'Reilly, Erin; Kreuzer, Kenneth N

    2008-08-01

    Quinolone antibacterial drugs such as nalidixic acid target DNA gyrase in Escherichia coli. These inhibitors bind to and stabilize a normally transient covalent protein-DNA intermediate in the gyrase reaction cycle, referred to as the cleavage complex. Stabilization of the cleavage complex is necessary but not sufficient for cell killing--cytotoxicity apparently results from the conversion of cleavage complexes into overt DNA breaks by an as-yet-unknown mechanism(s). Quinolone treatment induces the bacterial SOS response in a RecBC-dependent manner, arguing that cleavage complexes are somehow converted into double-stranded breaks. However, the only proteins known to be required for SOS induction by nalidixic acid are RecA and RecBC. In hopes of identifying additional proteins involved in the cytotoxic response to nalidixic acid, we screened for E. coli mutants specifically deficient in SOS induction upon nalidixic acid treatment by using a dinD::lacZ reporter construct. From a collection of SOS partially constitutive mutants with disruptions of 47 different genes, we found that dnaQ insertion mutants are specifically deficient in the SOS response to nalidixic acid. dnaQ encodes DNA polymerase III epsilon subunit, the proofreading subunit of the replicative polymerase. The deficient response to nalidixic acid was rescued by the presence of the wild-type dnaQ gene, confirming involvement of the epsilon subunit. To further characterize the SOS deficiency of dnaQ mutants, we analyzed the expression of several additional SOS genes in response to nalidixic acid using real-time PCR. A subset of SOS genes lost their response to nalidixic acid in the dnaQ mutant strain, while two tested SOS genes (recA and recN) continued to exhibit induction. These results argue that the replication complex plays a role in modulating the SOS response to nalidixic acid and that the response is more complex than a simple on/off switch.

  5. Rapid detection of bovine viral diarrhea virus by polymerase chain reaction.

    PubMed Central

    Lopez, O J; Osorio, F A; Donis, R O

    1991-01-01

    The polymerase chain reaction was used to detect genomic sequences of the positive-stranded RNA of bovine viral diarrhea virus (BVDV), a member of the family Togaviridae. Using a set of 20-bp primers located within the conserved 3' region of the BVDV genome, we were able to consistently amplify a 205-bp target sequence from BVDV cDNA. BVDV RNAs from cell culture-propagated BVDV reference strains, diverse unrelated cytopathic and noncytopathic field isolates, and clinical serum samples were transcribed to cDNA by using avian myeloblastosis virus reverse transcriptase and further specifically amplified by using the polymerase chain reaction assay. The amplification assay was sensitive enough to detect one molecule of cloned BVDV cDNA. Reconstitution experiments conducted by adding decreasing amounts of BVDV (NADL strain) to BVDV-free serum indicated that the threshold of sensitivity of the assay was less than or equal to 1 50% tissue culture infective dose. These results show that the polymerase chain reaction may be used for the rapid detection of diverse strains of BVDV in cell cultures, biological products, and clinical specimens from cattle. Images PMID:1709950

  6. Human MAF1 targets and represses active RNA polymerase III genes by preventing recruitment rather than inducing long-term transcriptional arrest

    PubMed Central

    Orioli, Andrea; Praz, Viviane; Lhôte, Philippe; Hernandez, Nouria

    2016-01-01

    RNA polymerase III (Pol III) is tightly controlled in response to environmental cues, yet a genomic-scale picture of Pol III regulation and the role played by its repressor MAF1 is lacking. Here, we describe genome-wide studies in human fibroblasts that reveal a dynamic and gene-specific adaptation of Pol III recruitment to extracellular signals in an mTORC1-dependent manner. Repression of Pol III recruitment and transcription are tightly linked to MAF1, which selectively localizes at Pol III loci, even under serum-replete conditions, and increasingly targets transcribing Pol III in response to serum starvation. Combining Pol III binding profiles with EU-labeling and high-throughput sequencing of newly synthesized small RNAs, we show that Pol III occupancy closely reflects ongoing transcription. Our results exclude the long-term, unproductive arrest of Pol III on the DNA as a major regulatory mechanism and identify previously uncharacterized, differential coordination in Pol III binding and transcription under different growth conditions. PMID:26941251

  7. Detection of Listeria monocytogenes with a nonisotopic polymerase chain reaction-coupled ligase chain reaction assay.

    PubMed Central

    Wiedmann, M; Barany, F; Batt, C A

    1993-01-01

    A polymerase chain reaction (PCR)-coupled ligase chain reaction (LCR) assay for the specific detection of Listeria monocytogenes (M. Wiedmann, J. Czajka, F. Barany, and C. A. Batt, Appl. Environ. Microbiol. 58:3443-3447, 1992) has been modified for detection of the LCR products with a nonisotopic readout. When a chemiluminescent or a colorimetric substrate for the nonisotopic detection of the LCR products was used, the PCR-coupled LCR gave a sensitivity of 10 CFU of L. monocytogenes. The detection method with the chemiluminescent substrate Lumi-Phos 530 permitted detection of the LCR products in less than 3 h, so that the whole assay can be completed within 10 h. Images PMID:8368859

  8. Detection of Leishmania siamensis DNA in Saliva by Polymerase Chain Reaction

    PubMed Central

    Phumee, Atchara; Kraivichian, Kanyarat; Chusri, Sarunyou; Noppakun, Nopadon; Vibhagool, Asda; Sanprasert, Vivornpun; Tampanya, Vich; Wilde, Henry; Siriyasatien, Padet

    2013-01-01

    Polymerase chain reaction was used to detect Leishmania siamensis DNA from clinical samples collected from six leishmaniasis patients during 2011–2012. The samples used in this study came from bone marrow, blood, buffy coat, saliva, urine, and tissue biopsy specimens. Saliva was a good source for L. siamensis DNA by polymerase chain reaction. L. siamensis DNA was also found in saliva of an asymptomatic case-patient. Levels of L. siamensis DNA in saliva decreased until being undetectable after treatment. These levels could be used as a marker to evaluate efficacy of the treatment. A larger study is needed to evaluate this method as a screening and survey tool to study the silent background of Leishmania infection among the at-risk population. PMID:24062485

  9. Positive and negative functional interactions between promoter elements from different classes of RNA polymerase III-transcribed genes.

    PubMed Central

    Parry, H D; Mattaj, I W

    1990-01-01

    Consensus tRNA gene promoter elements, A and B boxes, were introduced into the coding sequence of a Xenopus U6 gene. Combinations in which A and B boxes were coupled to wild-type or mutant U6 promoters were made. In this way information about both the functions of individual promoter elements and functional relationships between different classes of RNA polymerase III promoter element were obtained. Mutants in which the U6 PSE was non-functional were rescued by the presence of a B box, indicating a degree of functional relationship between these two elements. Moreover, the B box acted to increase the transcriptional activity and competitive strength of the wild-type U6 promoter. In contrast, no evidence was obtained to suggest that a tRNA A box can interact productively with U6 promoter elements in the absence of a B box. Data obtained suggest that the U6 PSE functions as an 'adaptor', being necessary to enable the basal U6 promoter to respond to upstream enhancement. Certain combinations of U6 and tRNA promoter elements are shown to be mutually antagonistic by a mechanism which is likely to involve blockage of transcription initiation. In summary, the U6 and tRNA promoters are shown to consist of functionally related, but distinct, promoter elements whose interactions shed new light on their normal roles in transcription. Images Fig. 1. Fig. 2. Fig. 3. Fig. 4. Fig. 5. Fig. 6. Fig. 7. Fig. 8. PMID:2323333

  10. Direct and sensitive detection of a pathogenic protozoan, Toxoplasma gondii, by polymerase chain reaction.

    PubMed Central

    Burg, J L; Grover, C M; Pouletty, P; Boothroyd, J C

    1989-01-01

    We applied the polymerase chain reaction to detection of the pathogenic protozoan Toxoplasma gondii based on our identification of a 35-fold-repetitive gene (the B1 gene) as a target. Using this procedure, we were able to amplify and detect the DNA of a single organism directly from a crude cell lysate. This level of sensitivity also allowed us to detect the B1 gene from purified DNA samples containing as few as 10 parasites in the presence of 100,000 human leukocytes. This is representative of the maximal cellular infiltration (10(5)/ml) in 1 ml of cerebrospinal fluid obtained from patients with toxoplasmic encephalitis. The B1 gene is present and conserved in all six T. gondii strains tested to date, including two isolates from patients with acquired immunodeficiency syndrome. No signal was detected by using this assay and DNAs from a variety of other organisms, including several which might be found in the central nervous system of an immunocompromised host. This combination of sensitivity and specificity should make detection of the B1 gene based on polymerase chain reaction amplification a very useful method for diagnosis of toxoplasmosis both in immunocompromised hosts and in congenitally infected fetuses. Images PMID:2768467

  11. Multiplex polymerase chain reaction method to detect Cyclospora, Cystoisospora, and Microsporidia in stool samples.

    PubMed

    Taniuchi, Mami; Verweij, Jaco J; Sethabutr, Orntipa; Bodhidatta, Ladaporn; Garcia, Lynne; Maro, Athanasia; Kumburu, Happiness; Gratz, Jean; Kibiki, Gibson; Houpt, Eric R

    2011-12-01

    Cyclospora, Cystoisospora, and Microsporidia are eukaryotic enteropathogens that are difficult to detect in stool samples because they require special stains and microscopy. We developed a multiplex polymerase chain reaction (PCR) reaction with 4 primer sets to amplify Cyclospora cayetanensis, Cystoisospora belli, Enterocytozoon bieneusi, and Encephalitozoon intestinalis. Detection of the amplicon is through specific probes coupled to Luminex beads. Sensitivity of the assay was evaluated using Encephalitozoon intestinalis spores and revealed detection of 10(1) spores spiked into stool. No cross-reactivity was observed. We evaluated the assay on diarrheal specimens from Thailand, Tanzania, Indonesia, and the Netherlands that had been previously tested by microscopy, and the assay yielded 87-100% sensitivity and 88-100% specificity. Microscopy-negative/PCR-positive samples had lower Luminex values, suggesting they were true but with lower burden infections. In summary, this is a convenient single PCR reaction that can detect Cyclospora, Cystoisospora, and Microsporidia without the need for cumbersome microscopic analysis.

  12. The β2 clamp in the Mycobacterium tuberculosis DNA polymerase III αβ2ε replicase promotes polymerization and reduces exonuclease activity

    PubMed Central

    Gu, Shoujin; Li, Wenjuan; Zhang, Hongtai; Fleming, Joy; Yang, Weiqiang; Wang, Shihua; Wei, Wenjing; Zhou, Jie; Zhu, Guofeng; Deng, Jiaoyu; Hou, Jian; Zhou, Ying; Lin, Shiqiang; Zhang, Xian-En; Bi, Lijun

    2016-01-01

    DNA polymerase III (DNA pol III) is a multi-subunit replication machine responsible for the accurate and rapid replication of bacterial genomes, however, how it functions in Mycobacterium tuberculosis (Mtb) requires further investigation. We have reconstituted the leading-strand replication process of the Mtb DNA pol III holoenzyme in vitro, and investigated the physical and functional relationships between its key components. We verify the presence of an αβ2ε polymerase-clamp-exonuclease replicase complex by biochemical methods and protein-protein interaction assays in vitro and in vivo and confirm that, in addition to the polymerase activity of its α subunit, Mtb DNA pol III has two potential proofreading subunits; the α and ε subunits. During DNA replication, the presence of the β2 clamp strongly promotes the polymerization of the αβ2ε replicase and reduces its exonuclease activity. Our work provides a foundation for further research on the mechanism by which the replication machinery switches between replication and proofreading and provides an experimental platform for the selection of antimicrobials targeting DNA replication in Mtb. PMID:26822057

  13. Rapid and specific detection of Yam mosaic virus by reverse-transcription recombinase polymerase amplification.

    PubMed

    Silva, Gonçalo; Bömer, Moritz; Nkere, Chukwuemeka; Kumar, P Lava; Seal, Susan E

    2015-09-15

    Yam mosaic virus (YMV; genus Potyvirus) is considered to cause the most economically important viral disease of yams (Dioscorea spp.) in West Africa which is the dominant region for yam production globally. Yams are a vegetatively propagated crop and the use of virus-free planting material forms an essential component of disease control. Current serological and PCR-based diagnostic methods for YMV are time consuming involving a succession of target detection steps. In this study, a novel assay for specific YMV detection is described that is based on isothermal reverse transcription-recombinase polymerase amplification (RT-exoRPA). This test has been shown to be reproducible and able to detect as little as 14 pg/μl of purified RNA obtained from an YMV-infected plant, a sensitivity equivalent to that obtained with the reverse transcription-polymerase chain reaction (RT-PCR) in current general use. The RT-exoRPA assay has, however, several advantages over the RT-PCR; positive samples can be detected in less than 30 min, and amplification only requires a single incubation temperature (optimum 37°C). These features make the RT-exoRPA assay a promising candidate for adapting into a field test format to be used by yam breeding programmes or certification laboratories.

  14. Method for detection of Stachybotrys chartarum in pure culture and field samples using quantitative polymerase chain reaction

    DOEpatents

    Cruz-Perez, Patricia; Buttner, Mark P.

    2004-05-11

    A method for detecting the fungus Stachybotrys chartarum includes isolating DNA from a sample suspected of containing the fungus Stachybotrys chartarum. The method further includes subjecting the DNA to polymerase chain reaction amplification utilizing at least one of several primers, the several primers each including one of the base sequences 5'GTTGCTTCGGCGGGAAC3', 5'TTTGCGTTTGCCACTCAGAG3', 5'ACCTATCGTTGCTTCGGCG3', and 5'GCGTTTGCCACTCAGAGAATACT3'. The method additionally includes detecting the fungus Stachybotrys chartarum by visualizing the product of the polymerase chain reaction.

  15. Development and evaluation of a rapid recombinase polymerase amplification assay for detection of coxsackievirus A6.

    PubMed

    Wang, Kaifeng; Wu, Yue; Yin, Dan; Tang, Shixing; Hu, Guifang; He, Yaqing

    2017-01-01

    Coxsackievirus A6 (CV-A6) is an important pathogen causing hand, foot and mouth disease (HFMD). The aim of this study was to develop and evaluate a rapid real-time reverse transcription recombinase polymerase amplification (RT-RPA) assay for detection of CV-A6. The sensitivity of this assay was 202 copies/reaction, with 100 % specificity. Furthermore, this assay yielded consistent results comparable with a commercial qRT-PCR diagnostic kit. This assay is therefore potentially useful for surveillance of CV-A6 infections and outbreak control.

  16. Routine application of the polymerase chain reaction for detection of Mycobacterium tuberculosis in clinical samples.

    PubMed Central

    Noordhoek, G T; Kaan, J A; Mulder, S; Wilke, H; Kolk, A H

    1995-01-01

    AIM--To investigate the use of the polymerase chain reaction (PCR) in the routine laboratory for the detection of Mycobacterium tuberculosis in clinical samples. METHODS--Samples were divided and processed separately for the detection of M tuberculosis by microscopy, culture and PCR. After DNA extraction, PCR was performed with primers specific for the insertion element IS6110 and the product was analysed by agarose gel electrophoresis, Southern blotting or dot blotting and hybridisation with a digoxigenin labelled internal probe. Each sample was tested for inhibitors of Taq polymerase with the aid of an internal control. Multiple negative and positive controls were used to monitor each step of the procedure. RESULTS--The data from two laboratories, using the same operating procedures, were combined. Of 1957 specimens, 79 (4%) were culture and PCR positive, while 1839 (93.9%) were negative in both tests. Thirty specimens (1.5%) were PCR positive only and nine (0.5%) were culture positive but PCR negative. CONCLUSION--Using culture and clinical history as the gold standard, sensitivity and specificity for PCR were 92.1% and 99.8%, respectively. With elaborate precautions, PCR is a suitable and reliable method for the detection of M tuberculosis in clinical samples in a routine microbiology laboratory. Images PMID:7490312

  17. Detection of rodent coronaviruses in tissues and cell cultures by using polymerase chain reaction.

    PubMed Central

    Homberger, F R; Smith, A L; Barthold, S W

    1991-01-01

    A polymerase chain reaction (PCR) method was developed for the detection of rodent coronaviruses in biological material by using reverse transcriptase and two primers which flanked an M gene sequence of 375 bp. PCR detected all of 11 different strains of mouse hepatitis virus (MHV) as well as rat sialodacryoadenitis virus but not bovine coronavirus or human coronavirus strains OC43 and 229E. The M gene sequences of bovine coronavirus and human coronavirus OC43 are homologous to that of MHV, but minor differences exist in the primer regions, preventing annealing of the primers. For detecting MHV-Y in tissue samples, PCR was faster than and at least as sensitive as either of the two bioassays (infant mouse bioassay and mouse antibody production test) currently used for MHV diagnostic purposes. Images PMID:1661745

  18. Fast real-time polymerase chain reaction for quantitative detection of Lactobacillus delbrueckii bacteriophages in milk.

    PubMed

    Martín, Maria Cruz; del Rio, Beatriz; Martínez, Noelia; Magadán, Alfonso H; Alvarez, Miguel A

    2008-12-01

    One of the main microbiological problems of the dairy industry is the susceptibility of starter bacteria to virus infections. Lactobacillus delbrueckii, a component of thermophilic starter cultures used in the manufacture of several fermented dairy products, including yogurt, is also sensitive to bacteriophage attacks. To avoid the problems associated with these viruses, quick and sensitive detection methods are necessary. In the present study, a fast real-time quantitative polymerase chain reaction assay for the direct detection and quantification of L. delbrueckii phages in milk was developed. A set of primers and a TaqMan MGB probe was designed, based on the lysin gene sequence of different L. delbrueckii phages. The results show the proposed method to be a rapid (total processing time 30 min), specific and highly sensitive technique for detecting L. delbrueckii phages in milk.

  19. Rapid Detection and Identification of a Pathogen's DNA Using Phi29 DNA Polymerase

    SciTech Connect

    Xu, Y.; Dunn, J.; Gao, S.; Bruno, J. F.; Luft, B. J.

    2008-10-31

    Zoonotic pathogens including those transmitted by insect vectors are some of the most deadly of all infectious diseases known to mankind. A number of these agents have been further weaponized and are widely recognized as being potentially significant biothreat agents. We describe a novel method based on multiply-primed rolling circle in vitro amplification for profiling genomic DNAs to permit rapid, cultivation-free differential detection and identification of circular plasmids in infectious agents. Using Phi29 DNA polymerase and a two-step priming reaction we could reproducibly detect and characterize by DNA sequencing circular DNA from Borrelia burgdorferi B31 in DNA samples containing as little as 25 pg of Borrelia DNA amongst a vast excess of human DNA. This simple technology can ultimately be adapted as a sensitive method to detect specific DNA from both known and unknown pathogens in a wide variety of complex environments.

  20. Development of a Recombinase Polymerase Amplification Assay for Detection of Epidemic Human Noroviruses.

    PubMed

    Moore, Matthew D; Jaykus, Lee-Ann

    2017-01-09

    Human norovirus is a leading cause of viral gastroenteritis worldwide. Rapid detection could facilitate control, however widespread point-of-care testing is infrequently done due to the lack of robust and portable methods. Recombinase polymerase amplification (RPA) is a novel isothermal method which rapidly amplifies and detects nucleic acids using a simple device in near real-time. An RT-RPA assay targeting a recent epidemic human norovirus strain (GII.4 New Orleans) was developed and evaluated in this study. The assay successfully detected purified norovirus RNA from multiple patient outbreak isolates and had a limit of detection of 3.40 ± 0.20 log10 genomic copies (LGC), which is comparable to most other reported isothermal norovirus amplification methods. The assay also detected norovirus in directly boiled stool, and displayed better resistance to inhibitors than a commonly used RT-qPCR assay. The assay was specific, as it did not amplify genomes from 9 non-related enteric viruses and bacteria. The assay detected norovirus in some samples in as little as 6 min, and the entire detection process can be performed in less than 30 min. The reported RT-RPA method shows promise for sensitive point-of-care detection of epidemic human norovirus, and is the fastest human norovirus amplification method to date.

  1. Development of a Recombinase Polymerase Amplification Assay for Detection of Epidemic Human Noroviruses

    PubMed Central

    Moore, Matthew D.; Jaykus, Lee-Ann

    2017-01-01

    Human norovirus is a leading cause of viral gastroenteritis worldwide. Rapid detection could facilitate control, however widespread point-of-care testing is infrequently done due to the lack of robust and portable methods. Recombinase polymerase amplification (RPA) is a novel isothermal method which rapidly amplifies and detects nucleic acids using a simple device in near real-time. An RT-RPA assay targeting a recent epidemic human norovirus strain (GII.4 New Orleans) was developed and evaluated in this study. The assay successfully detected purified norovirus RNA from multiple patient outbreak isolates and had a limit of detection of 3.40 ± 0.20 log10 genomic copies (LGC), which is comparable to most other reported isothermal norovirus amplification methods. The assay also detected norovirus in directly boiled stool, and displayed better resistance to inhibitors than a commonly used RT-qPCR assay. The assay was specific, as it did not amplify genomes from 9 non-related enteric viruses and bacteria. The assay detected norovirus in some samples in as little as 6 min, and the entire detection process can be performed in less than 30 min. The reported RT-RPA method shows promise for sensitive point-of-care detection of epidemic human norovirus, and is the fastest human norovirus amplification method to date. PMID:28067278

  2. A Novel Isothermal Assay of Borrelia burgdorferi by Recombinase Polymerase Amplification with Lateral Flow Detection.

    PubMed

    Liu, Wei; Liu, Hui-Xin; Zhang, Lin; Hou, Xue-Xia; Wan, Kang-Lin; Hao, Qin

    2016-08-03

    A novel isothermal detection for recombinase polymerase amplification with lateral flow (LF-RPA) was established for Borrelia burgdorferi (B. burgdorferi) detection in this study. This assay with high sensitivity and specificity can get a visible result without any additional equipment in 30 min. We designed a pair of primers according to recA gene of B. burgdorferi strains and a methodology evaluation was performed. The results showed that the RPA assay based on the recA gene was successfully applied in B. burgdorferi detection, and its specific amplification was only achieved from the genomic DNA of B. burgdorferi. The detection limit of the new assay was about 25 copies of the B. burgdorferi genomic DNA. Twenty Lyme borreliosis patients' serum samples were detected by LF-RPA assay, real-time qPCR and nested-PCR. Results showed the LF-RPA assay is more effective than nested-PCR for its shorter reaction time and considerably higher detection rate. This method is of great value in clinical rapid detection for Lyme borreliosis. Using the RPA assay might be a megatrend for DNA detection in clinics and endemic regions.

  3. Diurnal regulation of RNA polymerase III transcription is under the control of both the feeding-fasting response and the circadian clock.

    PubMed

    Mange, François; Praz, Viviane; Migliavacca, Eugenia; Willis, Ian M; Schütz, Frédéric; Hernandez, Nouria

    2017-03-24

    RNA polymerase III (pol III) synthesizes short non-coding RNAs, many of which are essential for translation. Accordingly, pol III activity is tightly regulated with cell growth and proliferation by factors such as MYC, RB1, TRP53, and MAF1. MAF1 is a repressor of pol III transcription whose activity is controlled by phosphorylation; in particular, it is inactivated through phosphorylation by the TORC1 kinase complex, a sensor of nutrient availability. Pol III regulation is thus sensitive to environmental cues, yet a diurnal profile of pol III transcription activity is so far lacking. Here we first use gene expression arrays to measure mRNA accumulation during the diurnal cycle in the livers of (i) wild-type mice, (ii) arrhythmic Arntl knockout mice, (iii) mice fed at regular intervals during both night and day, and (iv) mice lacking the Maf1 gene, and so provide a comprehensive view of the changes in cyclic mRNA accumulation occurring in these different systems. We then show that pol III occupancy of its target genes rises before the onset of the night, stays high during the night, when mice normally ingest food and when translation is known to be increased, and decreases in daytime. Whereas higher pol III occupancy during the night reflects a MAF1-dependent response to feeding, the rise of pol III occupancy before the onset of the night reflects a circadian clock-dependent response. Thus, pol III transcription during the diurnal cycle is regulated both in response to nutrients and by the circadian clock, which allows anticipatory pol III transcription.

  4. Role of RNA Polymerase III Transcription Factors in the Selection of Integration Sites by the Dictyostelium Non-Long Terminal Repeat Retrotransposon TRE5-A▿

    PubMed Central

    Siol, Oliver; Boutliliss, Moustapha; Chung, Thanh; Glöckner, Gernot; Dingermann, Theodor; Winckler, Thomas

    2006-01-01

    In the compact Dictyostelium discoideum genome, non-long terminal repeat (non-LTR) retrotransposons known as TREs avoid accidental integration-mediated gene disruption by targeting the vicinity of tRNA genes. In this study we provide the first evidence that proteins of a non-LTR retrotransposon interact with a target-specific transcription factor to direct its integration. We applied an in vivo selection system that allows for the isolation of natural TRE5-A integrations into a known genomic location upstream of tRNA genes. TRE5-A frequently modified the integration site in a way characteristic of other non-LTR retrotransposons by adding nontemplated extra nucleotides and generating small and extended target site deletions. Mutations within the B-box promoter of the targeted tRNA genes interfered with both the in vitro binding of RNA polymerase III transcription factor TFIIIC and the ability of TRE5-A to target these genes. An isolated B box was sufficient to enhance TRE5-A integration in the absence of a surrounding tRNA gene. The RNA polymerase III-transcribed ribosomal 5S gene recruits TFIIIC in a B-box-independent manner, yet it was readily targeted by TRE5-A in our assay. These results suggest a direct role of an RNA polymerase III transcription factor in the targeting process. PMID:16982688

  5. Presence of human immunodeficiency virus nucleic acids in wastewater and their detection by polymerase chain reaction.

    PubMed Central

    Ansari, S A; Farrah, S R; Chaudhry, G R

    1992-01-01

    The human immunodeficiency virus type 1 (HIV-1) released by infected individuals or present in human and hospital wastes can potentially cause contamination problems. The presence of HIV-1 was investigated in 16 environmental samples, including raw wastewater, sludge, final effluent, soil, and pond water, collected from different locations. A method was developed to extract total nucleic acids in intact form directly from the raw samples or from the viral concentrates of the raw samples. The isolated nucleic acids were analyzed for the presence of HIV-1 by using in vitro amplification of the target sequences by the polymerase chain reaction (PCR) method. HIV-1-specific proviral DNA and viral RNA were detected in the extracted nucleic acids obtained from three wastewater samples by this method. The specificity of the PCR-amplified products was determined by Southern blot hybridization with an HIV-1-specific oligonucleotide probe, SK19. The isolated nucleic acids from wastewater samples were also screened for the presence of poliovirus type 1, representing a commonly found enteric virus, and simian immunodeficiency virus, representing, presumably, rare viruses. While poliovirus type 1 viral RNA was found in all of the wastewater samples, none of the samples yielded a simian immunodeficiency virus-specific product. No PCR-amplified product was yielded when wastewater samples were directly used for the detection of HIV-1 and poliovirus type 1. The wastewater constituents appeared to be inhibitory to the enzymes reverse transcriptase and DNA polymerase.(ABSTRACT TRUNCATED AT 250 WORDS) Images PMID:1476440

  6. [The application of the polymerase chain reaction technic for the detection of human papillomavirus sequences].

    PubMed

    Soto, Y; Muné, M; Goicolea, A; Morales, E; Santoyo, J M; Valdés, O; Ramírez, R; Pimentel, T

    1998-01-01

    The polymerase chain reaction technique was applied to detect sequences of human Papillomavirus (HPV) by controls of cellular lines of cervical cancer and of tissues obtained through biopsy with a HPV-positive clinical diagnosis. A set of consensus oligonucleotides, which are complementary to a highly conserved region within the open reading frame E1 of the viral genome of HPV affecting the cervical mucosa, was used. With these primers it was possible to amplify DNA sequences corresponding to HPV 6 and 11, considered in the low risk group, and to HPV 16, 18, 31 and 33, included in the high risk group. The study of the sensitivity of the amplification technique showed a level of detection of 3,5 viral particles per each cellular diploid genome.

  7. Glyco-seek: Ultrasensitive Detection of Protein-Specific Glycosylation by Proximity Ligation Polymerase Chain Reaction.

    PubMed

    Robinson, Peter V; Tsai, Cheng-Ting; de Groot, Amber E; McKechnie, Julia L; Bertozzi, Carolyn R

    2016-08-31

    We report a non-destructive biochemical technique, termed "Glyco-seek", for analysis of O-GlcNAcylated proteins. Glyco-seek combines chemoenzymatic labeling, proximity ligation, and quantitative polymerase chain reaction to detect O-GlcNAcylated proteins with ultrahigh sensitivity. Our glycan-specific assay can be paired with traditional proximity ligation assays to simultaneously determine the change in total protein levels. We show that Glyco-seek detects attomoles of glycoproteins of interest from cell lysates, with sensitivity several orders of magnitude higher than that of current techniques. We used the method to directly assay the O-GlcNAcylation status of a low-abundance transcription factor from cell lysates without need for isolation or enrichment.

  8. Discrepancies between Antigen and Polymerase Chain Reaction Tests for the Detection of Rotavirus and Norovirus.

    PubMed

    Kim, Hyun Soo; Kim, Jae-Seok

    2016-05-01

    We compared the results of an antigen test (ELISA) with those of polymerase chain reaction (PCR) for the detection of rotavirus and norovirus in stool specimens. Rotavirus and norovirus antigen-positive stool specimens were collected, and rotavirus and norovirus PCRs were performed on these specimens. Of the 325 rotavirus antigen-positive specimens, 200 were positive for both assays and 125 were PCR negative. Of 286 norovirus antigen-positive specimens, 51 were PCR negative. Comparison of the lower limit of detection showed that rotavirus PCR was 16 times more sensitive and norovirus PCR was over 4,000 times more sensitive than the ELISA. Discrepant results between ELISA and PCR were common, and the possibility of false-positive and false-negative results should be considered with rotavirus and norovirus assays.

  9. Detection of Mycoplasma Contamination Directly from Culture Supernatant Using Polymerase Chain Reaction.

    PubMed

    Pisal, R V; Hrebíková, H; Chvátalová, J; Kunke, D; Filip, S; Mokrý, J

    2016-01-01

    Ensuring mycoplasma-free cell culture is of prime importance as they severely affect cellular characteristics leading to experimental artefacts and spurious results. Various methods persist for mycoplasma detection; out of the whole array of methods polymerase chain reaction (PCR) is the most favoured one because it is highly sensitive, specific and quick. The PCR-based detection procedure involves three steps: cell culture supernatant collection, DNA isolation, and PCR. We have modified this procedure so that cell culture supernatant can directly be used for PCR without the need for DNA extraction. This modification makes the procedure quicker and more sensitive because loss of mycoplasma DNA is prevented and this loss becomes more significant when the level of mycoplasma contamination is very low.

  10. DNA-dependent RNA polymerase detects hidden giant viruses in published databanks.

    PubMed

    Sharma, Vikas; Colson, Philippe; Giorgi, Roch; Pontarotti, Pierre; Raoult, Didier

    2014-06-13

    Environmental metagenomic studies show that there is a "dark matter," composed of sequences not linked to any known organism, as determined mainly using ribosomal DNA (rDNA) sequences, which therefore ignore giant viruses. DNA-dependent RNA polymerase (RNAP) genes are universal in microbes and conserved in giant viruses and may replace rDNA for identifying microbes. We found while reconstructing RNAP subunit 2 (RNAP2) phylogeny that a giant virus sequenced together with the genome of a large eukaryote, Hydra magnipapillata, has been overlooked. To explore the dark matter, we used viral RNAP2 and reconstructed putative ancestral RNAP2, which were significantly superior in detecting distant clades than current sequences, and we revealed two additional unknown mimiviruses, misclassified as an euryarchaeote and an oomycete plant pathogen, and detected unknown putative viral clades. We suggest using RNAP systematically to decipher the black matter and identify giant viruses.

  11. Rapid detection of pathogenic leptospires by lyophilized reagent-based polymerase chain reaction.

    PubMed

    Lee, S V; Tai, E S; Mutalib, A R; Khairani-Bejo, S; Bahaman, A R

    2011-12-01

    A simple and reliable tool for the early diagnosis of leptospirosis is urgently needed. We report the development of a lyophilized reagent-based polymerase chain reaction (PCR) assay targeting lipL32 gene, which is present only in pathogenic leptospires. To determine the effectiveness of the newly developed assay in the early diagnosis of leptospirosis, the sensitivity and specificity was evaluated. In simulated clinical samples, the assay was able to detect 10² and 10³ leptospires/ml in spiked urine and blood samples, respectively. In experimentally infected animals, leptospiral DNA could be detected in blood and lung samples as early as Day 1 post infection. This assay was also shown to be stable and remained sensitive for up to five months at ambient temperature. Hence, this lyophilized reagent-based PCR assay with high specificity, sensitivity and stability would provide a simple, rapid and reliable method in diagnosing acute leptospirosis, especially in the field of veterinary medicine.

  12. Rapid detection for rabbit-derived dermatophytes using microsatellite-primed polymerase chain reaction.

    PubMed

    Miao, Zengmin; Li, Song; Li, Daijun; Cai, Chunmei; Cai, Yumei

    2014-01-01

    A method exhibiting high sensitivity, specificity and rapidity to detect pathogenic dermatophytes was developed using microsatellite-primed polymerase chain reaction (PCR) in combination with a clustering method. The DNA fragments of Trichophyton mentagrophyton, Microsporum gypseum and Microsporum canis were amplified by using the primer (GACA)4 to detect the DNA polymorphism fingerprints. Twenty-one clinical strains identified as T. mentagrophyton, M. gypseum or M. canis by morphological methods were distinguished according to the differences of standard stains' bands combined with NTSYS-pc2.10 software. The results showed that there were obvious and direct differences in the bands of the three pathogenic dermatophytes, and the similarity of isolated strains and standard strains were above 90%, in line with the results of morphological identification. The method is more accurate, rapid and simple, which is meaningful for the clinical diagnosis and epidemic research of the dermatophytes.

  13. Rapid detection of shrimp white spot syndrome virus by real time, isothermal recombinase polymerase amplification assay.

    PubMed

    Xia, Xiaoming; Yu, Yongxin; Weidmann, Manfred; Pan, Yingjie; Yan, Shuling; Wang, Yongjie

    2014-01-01

    White spot syndrome virus (WSSV) causes large economic losses to the shrimp aquaculture industry, and thus far there are no efficient therapeutic treatments available against this lethal virus. In this study, we present the development of a novel real time isothermal recombinase polymerase amplification (RPA) assay for WSSV detection on a small ESEQuant Tube Scanner device. The RPA sensitivity, specificity and rapidity were evaluated by using a plasmid standard as well as viral and shrimp genomic DNAs. Compared with qPCR, the RPA assay revealed more satisfactory performance. It reached a detection limit up to 10 molecules in 95% of cases as determined by probit analysis of 8 independent experiments within 6.41 ± 0.17 min at 39 °C. Consequently, this rapid RPA method has great application potential for field use or point of care diagnostics.

  14. Detection of Rickettsia rickettsii DNA in clinical specimens by using polymerase chain reaction technology.

    PubMed Central

    Tzianabos, T; Anderson, B E; McDade, J E

    1989-01-01

    A polymerase chain reaction (PCR) procedure for detecting rickettsial DNA was developed and shown to be specific for Rickettsia rickettsii and R. conorii, the etiologic agents of Rocky Mountain spotted fever (RMSF) and Boutonneuse fever, respectively. Blood clots were obtained from nine confirmed RMSF patients and six controls and analyzed for the presence of rickettsial DNA by the PCR method. A defined region of the rickettsial genome was successfully amplified from seven of the nine clinical specimens tested; all six control specimens gave negative results. These findings indicate that R. rickettsii can be detected early after the onset of RMSF, possibly facilitating the decision regarding appropriate antibiotic therapy for some patients. Further refinement of PCR technology could make this procedure a mainstay in the clinical laboratory. Images PMID:2512328

  15. Use of touch-down polymerase chain reaction to enhance the sensitivity of Mycobacterium bovis detection.

    PubMed

    Zumárraga, Martín J; Meikle, Virginia; Bernardelli, Amelia; Abdala, Alejandro; Tarabla, Hector; Romano, María I; Cataldi, Angel

    2005-05-01

    The confirmatory diagnosis of Mycobacterium bovis (M. bovis) in animal samples is carried out by culture in Stonebrink media. However, culture is very slow because of the extremely long duplication time of the bacillus and difficult because of the scarcity of bacilli in diagnostic samples. This study describes the development of a single-tube touch-down polymerase chain reaction (PCR) protocol for the detection of M. bovis using primers that target the IS6110 element. Spiked water and milk as well as routine diagnostic samples (milk and nasal swabs) from M. bovis-positive cattle were tested. This protocol allows the rapid and sensitive detection of M. bovis in bovine samples by enhancing the sensitivity of standard PCR amplification.

  16. Detection of schistosomes polymerase chain reaction amplified DNA by oligochromatographic dipstick.

    PubMed

    Akinwale, O P; Laurent, T; Mertens, P; Leclipteux, T; Rollinson, D; Kane, R; Emery, A; Ajayi, M B; Akande, D O; Fesobi, T W

    2008-08-01

    The applications of highly specific and sensitive molecular techniques based on polymerase chain reaction (PCR) have constituted a valuable tool for the diagnosis of schistosomiasis and also for the detection of schistosome infections in the snail intermediate hosts. The common method of detecting PCR amplicons is gel electrophoresis in the presence of ethidium bromide, a carcinogen, which is followed by UV transillumination. Other methods, which are available for detecting PCR products, are real-time PCR, PCR-enzyme-linked immunosorbent assay (PCR-ELIZA) and mass spectrometry but they are cumbersome while they are sometimes complex and expensive. Therefore, a simple method of PCR product detection would be a welcome idea and a most valuable tool particularly in disease endemic countries with limited research facilities and resources. In this study, we applied a simple and rapid method for the detection of Schistosoma haematobium and Schistosoma mansoni PCR amplified DNA products using oligochromatographic (OC) dipstick. The amplicons are visualized by hybridization with a gold conjugated probe, while a control for the chromatographic migration is incorporated in the assay. The lower detection limit observed was 10fg of genomic DNA from each of the two species, while the dipstick was also specific for each of the species used in this study.

  17. Development of a Recombinase Polymerase Amplification Assay for Rapid Detection of the Mycobacterium avium subsp. paratuberculosis

    PubMed Central

    Hansen, Sören; Schäfer, Jenny; Fechner, Kim; Czerny, Claus-Peter; Abd El Wahed, Ahmed

    2016-01-01

    Background The detection of Mycobacterium avium subsp. paratuberculosis (MAP) infections in ruminants is crucial to control spread among animals and to humans. Cultivation of MAP is seen as the gold standard for detection, although it is very time consuming and labour intensive. In addition, several PCR assays have been developed to detect MAP in around 90 minutes, but these assays required highly sophisticated equipment as well as lengthy and complicated procedure. Methodology/Principal Findings In this study, we have developed a rapid assay for the detection of MAP based on the recombinase polymerase amplification (RPA) assay targeting a MAP specific region, the IS900 gene. The detection limit was 16 DNA molecules in 15 minutes as determined by the probit analysis on eight runs of the plasmid standard. Cross reactivity with other mycobacterial and environmentally associated bacterial strains was not observed. The clinical performance of the MAP RPA assay was tested using 48 MAP-positive and 20 MAP-negative blood, sperm, faecal and tissue samples. All results were compared with reads of a highly sensitive real-time PCR assay. The specificity of the MAP RPA assay was 100%, while the sensitivity was 89.5%. Conclusions/Significance The RPA assay is quicker and much easier to handle than real-time PCR. All RPA reagents were cold-chain independent. Moreover, combining RPA assay with a simple extraction protocol will maximize its use at point of need for rapid detection of MAP. PMID:27992571

  18. Rapid Detection of Cyprinid Herpesvirus 3 in Latently Infected Koi by Recombinase Polymerase Amplification.

    PubMed

    Prescott, Meagan A; Reed, Aimee N; Jin, Ling; Pastey, Manoj K

    2016-09-01

    Since the emergence of cyprinid herpesvirus 3 (CyHV-3), outbreaks have been devastating to Common Carp Cyprinus carpio and koi (a variant of Common Carp), leading to high economic losses. Current diagnostics for detecting CyHV-3 are limited in sensitivity and are further complicated by latency. Here we describe the detection of CyHV-3 by recombinase polymerase amplification (RPA). The RPA assay can detect as low as 10 copies of the CyHV-3 genome by an isothermal reaction and yields results in approximately 20 min. Using the RPA assay, the CyHV-3 genome can be detected in the total DNA of white blood cells isolated from koi latently infected with CyHV-3, while less than 10% of the latently infected koi can be detected by a real-time PCR assay in the total DNA of white blood cells. In addition, RPA products can be detected in a lateral flow device that is cheap and fast and can be used outside of the diagnostic lab. The RPA assay and lateral flow device provide for the rapid, sensitive, and specific amplification of CyHV-3 that with future modifications for field use and validation could lead to enhanced surveillance and early diagnosis of CyHV-3 in the laboratory and field. Received September 14, 2015; accepted April 9, 2016.

  19. Recombinase Polymerase Amplification Compared to Real-Time Polymerase Chain Reaction Test for the Detection of Fasciola hepatica in Human Stool.

    PubMed

    Cabada, Miguel M; Malaga, Jose L; Castellanos-Gonzalez, Alejandro; Bagwell, Kelli A; Naeger, Patrick A; Rogers, Hayley K; Maharsi, Safa; Mbaka, Maryann; White, A Clinton

    2017-02-08

    Fasciola hepatica is the most widely distributed trematode infection in the world. Control efforts may be hindered by the lack of diagnostic capacity especially in remote endemic areas. Polymerase chain reaction (PCR)-based methods offer high sensitivity and specificity but require expensive technology. However, the recombinase polymerase amplification (RPA) is an efficient isothermal method that eliminates the need for a thermal cycler and has a high deployment potential to resource-limited settings. We report on the characterization of RPA and PCR tests to detect Fasciola infection in clinical stool samples with low egg burdens. The sensitivity of the RPA and PCR were 87% and 66%, respectively. Both tests were 100% specific showing no cross-reactivity with trematode, cestode, or nematode parasites. In addition, RPA and PCR were able to detect 47% and 26% of infections not detected by microscopy, respectively. The RPA adapted to a lateral flow platform was more sensitive than gel-based detection of the reaction products. In conclusion, the Fasciola RPA is a highly sensitive and specific test to diagnose chronic infection using stool samples. The Fasciola RPA lateral flow has the potential for deployment to endemic areas after further characterization.

  20. TYPE III EXCITABILITY, SLOPE SENSITIVITY AND COINCIDENCE DETECTION

    PubMed Central

    Meng, Xiangying; Huguet, Gemma; Rinzel, John

    2013-01-01

    Some neurons in the nervous system do not show repetitive firing for steady currents. For time-varying inputs, they fire once if the input rise is fast enough. This property of phasic firing is known as Type III excitability. Type III excitability has been observed in neurons in the auditory brainstem (MSO), which show strong phase-locking and accurate coincidence detection. In this paper, we consider a Hodgkin-Huxley type model (RM03) that is widely-used for phasic MSO neurons and we compare it with a modification of it, showing tonic behavior. We provide insight into the temporal processing of these neuron models by means of developing and analyzing two reduced models that reproduce qualitatively the properties of the exemplar ones. The geometric and mathematical analysis of the reduced models allows us to detect and quantify relevant features for the temporal computation such as nearness to threshold and a temporal integration window. Our results underscore the importance of Type III excitability for precise coincidence detection. PMID:23667306

  1. Detection of Giardia cysts by using the polymerase chain reaction and distinguishing live from dead cysts.

    PubMed Central

    Mahbubani, M H; Bej, A K; Perlin, M; Schaefer, F W; Jakubowski, W; Atlas, R M

    1991-01-01

    A method was developed for the detection of Giardia cysts by using the polymerase chain reaction (PCR) and the giardin gene as the target. DNA amplification by PCR, using giardin DNA as the target, resulted in detection of both live and dead cysts. When giardin mRNA was used as the target, the ability to amplify cDNA by PCR depended on the mode of killing. Cysts killed by freezing were not detected by PCR when giardin mRNA was the target. Cysts killed by heating or exposure to monochloramine, however, gave positive detection signals for both DNA and giardin mRNA targets. The amount of giardin mRNA and total RNA was significantly increased in live cysts following the induction of excystation. Cysts killed by freezing, heating, or exposure to monochloramine did not show a change in RNA content. The detection of the giardin gene by PCR permits a sensitive and specific diagnosis for Giardia spp. Discrimination between live and dead cysts can be made by measuring the amounts of RNA or PCR-amplified product from the giardin mRNA target before and after the induction of excystation. Images PMID:1785923

  2. Development of a recombinase polymerase amplification assay for the detection of pathogenic Leptospira.

    PubMed

    Ahmed, Ahmed; van der Linden, Hans; Hartskeerl, Rudy A

    2014-05-08

    Detection of leptospires based on DNA amplification techniques is essential for the early diagnosis of leptospirosis when anti-Leptospira antibodies are below the detection limit of most serological tests. In middle and low income countries where leptospirosis is endemic, routine implementation of real-time PCR is financially and technically challenging due to the requirement of expensive thermocycler equipment. In this study we report the development and evaluation of a novel isothermal recombinase polymerase amplification assay (RPA) for detection of pathogenic Leptospira based on TwistAmp chemistry. RPA enabled the detection of less than two genome copies per reaction. Retrospective evaluation revealed a high diagnostic accuracy (sensitivity and specificity of 94.7% and 97.7%, respectively) compared to culturing as the reference standard. RPA presents a powerful tool for the early diagnosis of leptospirosis in humans and in animals. Furthermore, it enables the detection of the causative agent in reservoirs and environment, and as such is a valuable adjunct to current tools for surveillance and early outbreak warning.

  3. Cross-subtype detection of HIV-1 using reverse transcription and recombinase polymerase amplification.

    PubMed

    Lillis, Lorraine; Lehman, Dara A; Siverson, Joshua B; Weis, Julie; Cantera, Jason; Parker, Mathew; Piepenburg, Olaf; Overbaugh, Julie; Boyle, David S

    2016-04-01

    A low complexity diagnostic test that rapidly and reliably detects HIV infection in infants at the point of care could facilitate early treatment, improving outcomes. However, many infant HIV diagnostics can only be performed in laboratory settings. Recombinase polymerase amplification (RPA) is an isothermal amplification technology that can rapidly amplify proviral DNA from multiple subtypes of HIV-1 in under twenty minutes without complex equipment. In this study we added reverse transcription (RT) to RPA to allow detection of both HIV-1 RNA and DNA. We show that this RT-RPA HIV-1 assay has a limit of detection of 10-30 copies of an exact sequence matched DNA or RNA, respectively. In addition, at 100 copies of RNA or DNA, the assay detected 171 of 175 (97.7%) sequence variants that represent all the major subtypes and recombinant forms of HIV-1 Groups M and O. This data suggests that the application of RT-RPA for the combined detection of HIV-1 viral RNA and proviral DNA may prove a highly sensitive tool for rapid and accurate diagnosis of infant HIV.

  4. Detection of Listeria monocytogenes in cheese with the magnetic immuno-polymerase chain reaction assay.

    PubMed

    Fluit, A C; Torensma, R; Visser, M J; Aarsman, C J; Poppelier, M J; Keller, B H; Klapwijk, P; Verhoef, J

    1993-05-01

    A new detection system, the magnetic immuno-polymerase chain reaction (PCR) assay (MIPA) has been developed to detect Listeria monocytogenes in food. This method separates Listeria cells from PCR-inhibitory factors present in enrichment broths containing food samples by using magnetic beads coated with specific monoclonal antibodies (MAbs). The separated bacteria were lysed, and the supernatant containing the bacterial DNA was subjected to the PCR. Detection of L. monocytogenes in three naturally contaminated cheese samples with two different MAbs and PCR primers specific for the gene encoding the delayed-hypersensitivity factor showed that with MAb 55 all three samples were positive whereas with MAb A two samples were positive. A further improvement of the method was obtained by using a PCR step based on the listeriolysin O gene. A MIPA employing MAb 55 and the listeriolysin O gene primer set detected L. monocytogenes after 24 h of culture in Listeria Enrichment Broth samples from Port Salut artificially contaminated with 40 CFU/25 g. We could detect 1 CFU of L. monocytogenes per g of cheese after a second enrichment for 24 h in Fraser broth. The analysis time including both enrichments is approximately 55 h.

  5. Detection of hepatitis C virus RNA by a combined reverse transcription-polymerase chain reaction assay.

    PubMed Central

    Young, K K; Resnick, R M; Myers, T W

    1993-01-01

    Amplification of RNA by the polymerase chain reaction (PCR) is normally a two-step process requiring separate enzymes and buffer conditions. We describe a combined reverse transcription-PCR (RT-PCR) assay for hepatitis C virus (HCV) RNA amplification in which a single enzyme and buffer condition are used. In this assay, both the RT and PCR steps are carried out with the thermoactive DNA polymerase of Thermus thermophilus. A transcription vector containing HCV sequences has also been constructed to generate quantifiable HCV RNA templates that can be used to optimize reaction conditions and to assess the efficiency of amplification. Amplification from < or = 100 copies of RNA was detected reproducibly by gel electrophoresis. The assay sensitivity was increased to 10 RNA copies by hybridization to a probe. The patterns of viremia in three individuals infected with HCV were examined by amplification of HCV RNA from plasma samples collected serially over a period of 1 year. These results were correlated with the times of seroconversion and the onset of rise in levels of alanine aminotransferase in serum. In all three subjects, HCV RNA was detected prior to seroconversion and the initial rise in levels of alanine aminotransferase in serum. Upon seroconversion, HCV RNA fell to a level below the detection limit of the assay. This pattern of transient viremia appears to be characteristic of acute, resolving HCV infections. The combined RT-PCR assay is a sensitive method which circumvents the problems associated with PCR amplification of RNA. Using this assay, we demonstrated that three donors infected by the same index case all have similar patterns of viremia. Images PMID:8385151

  6. Eradication of polymerase chain reaction-detectable chronic lymphocytic leukemia cells is associated with improved outcome after bone marrow transplantation.

    PubMed

    Provan, D; Bartlett-Pandite, L; Zwicky, C; Neuberg, D; Maddocks, A; Corradini, P; Soiffer, R; Ritz, J; Nadler, L M; Gribben, J G

    1996-09-15

    In chronic lymphocytic leukemia (CLL), clonal rearrangement of the immunoglobulin heavy chain locus (IgH) provides a useful marker for the detection of minimal residual disease (MRD) after treatment. At the time of initial presentation, DNA from patients with CLL was polymerase chain reaction (PCR)-amplified using consensus Variable (VH) and Joining (JH) region primers using complementarity determining region III consensus region primers or a panel of VH family-specific framework region 1 (FR1) primers. The clonal product was directly sequenced and patient-specific probes constructed using N region nucleotide sequences. We amplified and sequenced the CDRIII region and designed patient specific oligonucleotide probes for the detection of MRD in 55 of 66 patients (84%, 90% Confidence Intervals (CI): 74% to 90%) with poor prognosis CLL referred for autologous and allogeneic bone marrow transplantation (BMT). To determine the clinical utility of this technique, PCR amplification was performed on patient samples at the time of and following autologous (21 patients) and allogeneic (10 patients) BMT in whom serial bone marrow samples obtained after BMT were available for analysis. We show that the persistence of MRD after BMT is associated with increased probability of relapse. In all cases that have relapsed to date, the IgH CDRII region was identical at the time of initial presentation and at relapse suggesting that clonal evolution of the IgH locus is unusual in this disease. The finding that a significant number of patients remain disease free and with no evidence of PCR-detectable MRD after BMT suggests that high-dose therapy may contribute to improved outcome in selected patients with CLL.

  7. Specific detection of Flt3 point mutations by highly sensitive real-time polymerase chain reaction in acute myeloid leukemia.

    PubMed

    Scholl, Sebastian; Krause, Claudia; Loncarevic, Ivan F; Müller, Rouven; Kunert, Christa; Wedding, Ulrich; Sayer, Herbert G; Clement, Joachim H; Höffken, Klaus

    2005-06-01

    Among activating class III receptor tyrosine kinase (Flt3) mutations, internal tandem duplications of Flt3 (Flt3-ITD) are detected in about 25% of patients with acute myeloid leukemia (AML). In contrast, mutations within the tyrosine kinase domain of Flt3 (Flt3-TKD mutations) are less frequent (approximately 7%), and there are only limited data on the frequency of recently demonstrated activating Flt3 point mutation at codon 592 (Flt3-V592A mutation). We evaluated a new approach for rapid screening of Flt3-TKD and Flt3-V592A mutations using the fluorescence resonance energy transfer (FRET) principle in a group of 122 patients. Based on individual Flt3-TKD mutations, we designed patient-specific primers to perform a highly sensitive polymerase chain reaction (PCR) assay for rapid detection of minimal residual disease (MRD). We also used a model system with MonoMac-6 cells carrying the Flt3-V592A mutation to establish a mutation-specific real-time PCR approach also for this molecular aberration. We identified 9 cases (8%) of Flt3-TKD mutations (5 cases of mutation D835Y, 3 cases of mutation D835H, and 1 case of mutation Del836), and no cases of Flt3-V592A mutation. Screening for Flt3-TKD mutations with fluorescent probes is equivalent to conventional screening using standard PCR followed by EcoRV restriction. We present a real-time PCR protocol that can be used for MRD analyses based on individual Flt3-TKD mutations. Examples of MRD analyses are presented for all 3 subtypes of Flt3-TKD mutation identified in this study. In summary, we demonstrate new methodological approaches for rapid screening of Flt3 point mutations and for detection of MRD based on patient-specific Flt3-TKD mutations.

  8. Investigation of polymerase chain reaction assays to improve detection of bacterial involvement in bovine respiratory disease.

    PubMed

    Bell, Colin J; Blackburn, Paul; Elliott, Mark; Patterson, Tony I A P; Ellison, Sean; Lahuerta-Marin, Angela; Ball, Hywel J

    2014-09-01

    Bovine respiratory disease (BRD) causes severe economic losses to the cattle farming industry worldwide. The major bacterial organisms contributing to the BRD complex are Mannheimia haemolytica, Histophilus somni, Mycoplasma bovis, Pasteurella multocida, and Trueperella pyogenes. The postmortem detection of these organisms in pneumonic lung tissue is generally conducted using standard culture-based techniques where the presence of therapeutic antibiotics in the tissue can inhibit bacterial isolation. In the current study, conventional and real-time polymerase chain reaction (PCR) assays were used to assess the prevalence of these 5 organisms in grossly pneumonic lung samples from 150 animals submitted for postmortem examination, and the results were compared with those obtained using culture techniques. Mannheimia haemolytica was detected in 51 cases (34%) by PCR and in 33 cases (22%) by culture, H. somni was detected in 35 cases (23.3%) by PCR and in 6 cases (4%) by culture, Myc. bovis was detected in 53 cases (35.3%) by PCR and in 29 cases (19.3%) by culture, P. multocida was detected in 50 cases (33.3%) by PCR and in 31 cases (20.7%) by culture, and T. pyogenes was detected in 42 cases (28%) by PCR and in 31 cases (20.7%) by culture, with all differences being statistically significant. The PCR assays indicated positive results for 111 cases (74%) whereas 82 cases (54.6%) were culture positive. The PCR assays have demonstrated a significantly higher rate of detection of all 5 organisms in cases of pneumonia in cattle in Northern Ireland than was detected by current standard procedures.

  9. Intragenic promoter adaptation and facilitated RNA polymerase III recycling in the transcription of SCR1, the 7SL RNA gene of Saccharomyces cerevisiae.

    PubMed

    Dieci, Giorgio; Giuliodori, Silvia; Catellani, Manuela; Percudani, Riccardo; Ottonello, Simone

    2002-03-01

    The SCR1 gene, coding for the 7SL RNA of the signal recognition particle, is the last known class III gene of Saccharomyces cerevisiae that remains to be characterized with respect to its mode of transcription and promoter organization. We show here that SCR1 represents a unique case of a non-tRNA class III gene in which intragenic promoter elements (the TFIIIC-binding A- and B-blocks), corresponding to the D and TpsiC arms of mature tRNAs, have been adapted to a structurally different small RNA without losing their transcriptional function. In fact, despite the presence of an upstream canonical TATA box, SCR1 transcription strictly depends on the presence of functional, albeit quite unusual, A- and B-blocks and requires all the basal components of the RNA polymerase III transcription apparatus, including TFIIIC. Accordingly, TFIIIC was found to protect from DNase I digestion an 80-bp region comprising the A- and B-blocks. B-block inactivation completely compromised TFIIIC binding and transcription capacity in vitro and in vivo. An inactivating mutation in the A-block selectively affected TFIIIC binding to this promoter element but resulted in much more dramatic impairment of in vivo than in vitro transcription. Transcriptional competition and nucleosome disruption experiments showed that this stronger in vivo defect is due to a reduced ability of A-block-mutated SCR1 to compete with other genes for TFIIIC binding and to counteract the assembly of repressive chromatin structures through TFIIIC recruitment. A kinetic analysis further revealed that facilitated RNA polymerase III recycling, far from being restricted to typical small sized class III templates, also takes place on the 522-bp-long SCR1 gene, the longest known class III transcriptional unit.

  10. Multiplex-microsphere-quantitative polymerase chain reaction: nucleic acid amplification and detection on microspheres.

    PubMed

    Liang, Fang; Lai, Richard; Arora, Neetika; Zhang, Kang Liang; Yeh, Che-Cheng; Barnett, Graeme R; Voigt, Paul; Corrie, Simon R; Barnard, Ross T

    2013-01-01

    We report the development of a new system to monitor the amplification of nucleic acids on microspheres. This was realized by the design of (i) a "universal" oligonucleotide "tagged" polymerase chain reaction (PCR) forward primer, (ii) a sensor sequence complementary to the universal sequence on the forward PCR primer modified with a fluorescent dye, and (iii) a universal oligonucleotide coupled to Luminex microspheres. The PCR takes place with the microspheres present in the reaction tube. With the consumption of the universal oligonucleotide tagged forward primer, the fluorescently labeled sequences can bind to the universal oligonucleotide on the microspheres. We tested the microsphere quantitative PCR system with up to three different target genes (Neisseria meningitides porA and ctrA and influenza A M gene segment) as templates in a single PCR tube. The analytical sensitivity of this quantitative PCR system was tested and compared with the TaqMan system. The multiplex-microsphere-quantitative PCR system does not require design of unique internal probes for each target and has potential for a high degree of multiplexing, greater than the limited multiplexing achievable with current real-time protocols.

  11. Utility of Real-Time Quantitative Polymerase Chain Reaction in Detecting Mycobacterium tuberculosis

    PubMed Central

    Zhang, Mingxin; Zhang, Hui

    2017-01-01

    This study aimed to assess the value of real-time quantitative polymerase chain reaction (RT-qPCR) for the detection of Mycobacterium tuberculosis (MTB). Samples from 192 patients with suspected MTB were examined by RT-qPCR and an improved Löwenstein–Jensen (L-J) culture method. To evaluate the diagnostic usefulness of RT-qPCR in detecting MTB, a receiver operating characteristic (ROC) curve for RT-qPCR was generated, and the area under the curve (AUC) as well as a cutoff value was calculated. Using the L-J culture method as the gold standard, accuracy of the RT-qPCR method for detecting MTB was 92.7%, with sensitivity and specificity of 62.5% and 97.02%, respectively. In comparison with the improved L-J culture method, the AUC of RT-qPCR ROC curve was 0.957, which was statistically significant (p < 0.001). The Youden Index reached the maximum value (0.88) for gene copy number of 794.5 IU/mL, which was used as the cutoff value. RT-qPCR detection of MTB yielded results consistent with those of the improved L-J culture method, with high accuracy. RT-qPCR may be used as an auxiliary method for etiological diagnosis of tuberculosis. PMID:28168192

  12. Molecular detection of plant pathogenic bacteria using polymerase chain reaction single-strand conformation polymorphism.

    PubMed

    Srinivasa, Chandrashekar; Sharanaiah, Umesha; Shivamallu, Chandan

    2012-03-01

    The application of polymerase chain reaction (PCR) technology to molecular diagnostics holds great promise for the early identification of agriculturally important plant pathogens. Ralstonia solanacearum, Xanthomoans axonopodis pv. vesicatoria, and Xanthomonas oryzae pv. oryzae are phytopathogenic bacteria, which can infect vegetables, cause severe yield loss. PCR-single-strand conformation polymorphism (PCR-SSCP) is a simple and powerful technique for identifying sequence changes in amplified DNA. The technique of PCR-SSCP is being exploited so far, only to detect and diagnose human bacterial pathogens in addition to plant pathogenic fungi. Selective media and serology are the commonly used methods for the detection of plant pathogens in infected plant materials. In this study, we developed PCR-SSCP technique to identify phytopathogenic bacteria. The PCR product was denatured and separated on a non-denaturing polyacrylamide gel. SSCP banding patterns were detected by silver staining of nucleic acids. We tested over 56 isolates of R. solanacearum, 44 isolates of X. axonopodis pv. vesicatoria, and 20 isolates of X. oryzae pv. oryzae. With the use of universal primer 16S rRNA, we could discriminate such species at the genus and species levels. Species-specific patterns were obtained for bacteria R. solanacearum, X. axonopodis pv. vesicatoria, and X. oryzae pv. oryzae. The potential use of PCR-SSCP technique for the detection and diagnosis of phytobacterial pathogens is discussed in the present paper.

  13. Detection and Characterization of Viral Species/Subspecies Using Isothermal Recombinase Polymerase Amplification (RPA) Assays.

    PubMed

    Glais, Laurent; Jacquot, Emmanuel

    2015-01-01

    Numerous molecular-based detection protocols include an amplification step of the targeted nucleic acids. This step is important to reach the expected sensitive detection of pathogens in diagnostic procedures. Amplifications of nucleic acid sequences are generally performed, in the presence of appropriate primers, using thermocyclers. However, the time requested to amplify molecular targets and the cost of the thermocycler machines could impair the use of these methods in routine diagnostics. Recombinase polymerase amplification (RPA) technique allows rapid (short-term incubation of sample and primers in an enzymatic mixture) and simple (isothermal) amplification of molecular targets. RPA protocol requires only basic molecular steps such as extraction procedures and agarose gel electrophoresis. Thus, RPA can be considered as an interesting alternative to standard molecular-based diagnostic tools. In this paper, the complete procedures to set up an RPA assay, applied to detection of RNA (Potato virus Y, Potyvirus) and DNA (Wheat dwarf virus, Mastrevirus) viruses, are described. The proposed procedure allows developing species- or subspecies-specific detection assay.

  14. Rapid detection of HIV-1 proviral DNA for early infant diagnosis using recombinase polymerase amplification.

    PubMed

    Boyle, David S; Lehman, Dara A; Lillis, Lorraine; Peterson, Dylan; Singhal, Mitra; Armes, Niall; Parker, Mathew; Piepenburg, Olaf; Overbaugh, Julie

    2013-04-02

    Early diagnosis and treatment of human immunodeficiency virus type 1 (HIV-1) infection in infants can greatly reduce mortality rates. However, current infant HIV-1 diagnostics cannot reliably be performed at the point of care, often delaying treatment and compromising its efficacy. Recombinase polymerase amplification (RPA) is a novel technology that is ideal for an HIV-1 diagnostic, as it amplifies target DNA in <20 min at a constant temperature, without the need for complex thermocycling equipment. Here we tested 63 HIV-1-specific primer and probe combinations and identified two RPA assays that target distinct regions of the HIV-1 genome (long terminal repeat [LTR] and pol) and can reliably detect 3 copies of proviral DNA by the use of fluorescence detection and lateral-flow strip detection. These pol and LTR primers amplified 98.6% and 93%, respectively, of the diverse HIV-1 variants tested. This is the first example of an isothermal assay that consistently detects all of the major HIV-1 global subtypes.

  15. Rapid and specific detection of porcine parvovirus by isothermal recombinase polymerase amplification assays.

    PubMed

    Yang, Yang; Qin, Xiaodong; Zhang, Wei; Li, Yanmin; Zhang, Zhidong

    2016-10-01

    Porcine parvovirus (PPV) is a major cause of swine reproductive failure and reported in many countries worldwide. Recombinase polymerase amplification (RPA) assays using a real-time fluorescent detection (PPV real-time RPA assay) and a lateral flow dipstick (PPV RPA LFD assay) were developed targeting PPV NS1 gene. The detection limit of PPV real-time RPA assay was 300 copies per reaction within 9 min at 38 °C, while the RPA LFD assay has a detection limit of 400 copies per reaction in less than 20 min at 38 °C. In both assays, there were no cross-reactions with porcine circovirus type 2, pseudorabies virus, porcine reproductive and respiratory syndrome virus, classical swine fever virus, and foot-and-mouth disease virus. Based on a total of 128 clinical samples examined, the sensitivity and the specificity of the developed RPA assays for identification of PPV was 94.4% and 100%, respectively, when compared to real-time (qPCR) assay. Therefore, the RPA assay provides a rapid, sensitive and specific alternative for PPV detection.

  16. [Species-specific detection of Proteus vulgaris and Proteus mirabilis by the polymerase chain reaction].

    PubMed

    Limanskiĭ, A; Minukhin, V; Limanskaia, O; Pavlenko, N; Mishina, M; Tsygenenko, A

    2005-01-01

    Sets of primers for the species-specific detection of P. mirabilis and P. vulgaris by the polymerase chain reaction (PCR) were developed. As targets for these primers beta-lactamase and 16S rRNA gene fragments were chosen on the basis of the multiple leveling of the sequences of the DNA of all known P. mirabilis and P. vulgaris isolates. For differential detection oligonucleotides were selected in such a way that primers, specific for P. vulgaris, contained the non-paired nucleotide for P. mirabilis isolate at the 3'-end, and all other nucleotides were complementary to the beta-lactamase gene fragment. Primers, specific for gene 16S rRNA of P. mirabilis, contained the non-paired nucleotide for P. vulgaris isolates at the 3'-end. Standard PCR was carried out for 6 P. mirabilis and P. vulgaris strains. The use of PCR species-specific primers to P. vulgaris DNA made it possible to amplify the DNA fragment of the expected length only for P. vulgaris isolates, while the result of PCR for P. mirabilis was negative. PCR with primers specific to P. mirabilis permitted the detection of amplicon sized 101 nucleotides pairs only for P. mirabilis strains. These primers were optimized so as to use them in the specific differentiation of closely related P. mirabilis and P. vulgaris species by multiplex PCR. Genus-specific primers permitted the detection of bacterial gyrB gene of the genus Proteus were developed also.

  17. Quantitative polymerase chain reaction (PCR) for detection of aquatic animal pathogens in a diagnostic laboratory setting

    USGS Publications Warehouse

    Purcell, Maureen K.; Getchell, Rodman G.; McClure, Carol A.; Weber, S.E.; Garver, Kyle A.

    2011-01-01

    Real-time, or quantitative, polymerase chain reaction (qPCR) is quickly supplanting other molecular methods for detecting the nucleic acids of human and other animal pathogens owing to the speed and robustness of the technology. As the aquatic animal health community moves toward implementing national diagnostic testing schemes, it will need to evaluate how qPCR technology should be employed. This review outlines the basic principles of qPCR technology, considerations for assay development, standards and controls, assay performance, diagnostic validation, implementation in the diagnostic laboratory, and quality assurance and control measures. These factors are fundamental for ensuring the validity of qPCR assay results obtained in the diagnostic laboratory setting.

  18. Polymerase chain reaction detection of potentially pathogenic free-living amoebae in dental units.

    PubMed

    Leduc, Annie; Gravel, Sabrina; Abikhzer, Jérémie; Roy, Stéphane; Barbeau, Jean

    2012-07-01

    Several genera of amoebae can be found in water from dental units and on the inner surface of waterlines. The presence of bacterial biofilms on these surfaces is thought to favor the proliferation of amoebae. Potentially pathogenic Acanthamoeba and Naegleria spp. may be an infection risk for patients through contact with open surgical sites or aerosolization. A polymerase chain reaction of DNA extracted from pelleted samples showed that Acanthamoeba spp. and Naegleria spp. were present in water from dental units, suction lines, and suction filters at the dental clinic of the Université de Montréal. Acanthamoeba spp. were detected in 24.2% of 66 samples and Naegleria spp. in 3.0%. We discuss the infection risk associated with these results.

  19. Separation-Type Multiplex Polymerase Chain Reaction Chip for Detecting Male Infertility

    NASA Astrophysics Data System (ADS)

    Ha, Seung-Mo; Ju, Jin-Kyoung; Ahn, Yoomin; Hwang, Seung Young

    2008-06-01

    A novel polymerase chain reaction (PCR) biochip is presented in this paper. In this PCR chip, the glass substrate integrated with the microheater and microsensor is separable from the reaction chamber where the sample is injected, which now makes repeated reuse of the glass substrate possible. The heat transfer efficiency and target gene amplification of the proposed separable PCR chip was compared with that of the conventional united PCR chip. The results showed that the sex-determining Y chromosome (SRY) gene PCR for detecting male infertility was successfully performed in the separable chip. However, repeated multiplex PCR was successful for only two genes, SPGY1 and SRY, but not for gene SY586. Future work is needed for a multiplex PCR with more than three genes.

  20. Quantitative polymerase chain reaction (PCR) for detection of aquatic animal pathogens in a diagnostic laboratory setting.

    PubMed

    Purcell, Maureen K; Getchell, Rodman G; McClure, Carol A; Garver, Kyle A

    2011-09-01

    Real-time, or quantitative, polymerase chain reaction (qPCR) is quickly supplanting other molecular methods for detecting the nucleic acids of human and other animal pathogens owing to the speed and robustness of the technology. As the aquatic animal health community moves toward implementing national diagnostic testing schemes, it will need to evaluate how qPCR technology should be employed. This review outlines the basic principles of qPCR technology, considerations for assay development, standards and controls, assay performance, diagnostic validation, implementation in the diagnostic laboratory, and quality assurance and control measures. These factors are fundamental for ensuring the validity of qPCR assay results obtained in the diagnostic laboratory setting.

  1. Detection of human papillomavirus types 45 and 51 by type-specific polymerase chain reaction.

    PubMed

    Weyn, Christine; Boulenouar, Selma; Mathys, Vanessa; Vanhoolandt, Julie; Bernis, Aurore; Fontaine, Véronique

    2007-12-01

    Human papillomavirus (HPV) types 45 and 51 are both considered as high risk types for the development of human cervical cancer. To optimize the detection of these two types in clinical samples, HPV-45 and HPV-51 specific primers were designed to amplify respectively a 141bp and a 266bp fragment from the L1 gene by polymerase chain reaction (PCR). The sensitivity and the specificity of these two PCR reactions were determined using varying amounts of HPV DNA containing plasmids and negative and positive controls. Overall, the sensitivity for the HPV-45 plasmid DNA is 10fg, while for HPV-51 the sensitivity is 1fg. This is equivalent to approximately 100 and 10 HPV genome copies per PCR reaction, respectively.

  2. Detection of DNA sequence polymorphisms in carcinogen metabolism genes by polymerase chain reaction

    SciTech Connect

    Bell, D.A. )

    1991-01-01

    The glutathione transferase mu gene (GST1) and the debrisoquine hydroxylase gene (CYP2D6) are known to be polymorphic in the human population and have been associated with increased susceptibility to cancer. Smokers with low lymphocyte GST mu activity are at higher risk for lung cancer, while low debrisoquine hydroxylase activity has been correlated with lower risk for lung and bladder cancer. Phenotypic characterization of these polymorphisms by lymphocyte enzyme activity (GST) and urine metabolite ratios (debrisoquine) is cumbersome for population studies. Recent cloning and sequencing of the mutant alleles of these genes has allowed genotyping via the polymerase chain reaction (PCR). Advantages of PCR approaches are speed, technical simplicity, and minimal sample requirements. This article reviews the PCR-based methods for detection of genetic polymorphisms in human cancer susceptibility genes.

  3. Early detection of dengue virus by use of reverse transcription-recombinase polymerase amplification.

    PubMed

    Teoh, Boon-Teong; Sam, Sing-Sin; Tan, Kim-Kee; Danlami, Mohammed Bashar; Shu, Meng-Hooi; Johari, Jefree; Hooi, Poh-Sim; Brooks, David; Piepenburg, Olaf; Nentwich, Oliver; Wilder-Smith, Annelies; Franco, Leticia; Tenorio, Antonio; AbuBakar, Sazaly

    2015-03-01

    A method for the rapid diagnosis of early dengue virus (DENV) infection is highly needed. Here, a prototype reverse transcription-recombinase polymerase amplification (RT-RPA) assay was developed. The assay detected DENV RNA in <20 min without the need for thermocycling amplification. The assay enabled the detection of as few as 10 copies of DENV RNA. The designed RT-RPA primers and exo probe detected the DENV genome of at least 12 genotypes of DENV circulating globally without cross-reacting with other arboviruses. We assessed the diagnostic performance of the RT-RPA assay for the detection of DENV RNA in 203 serum samples of patients with clinically suspected dengue. The sera were simultaneously tested for DENV using a reverse transcription-loop-mediated isothermal amplification (RT-LAMP) assay, quantitative RT-PCR (qRT-PCR), and IgM- and IgG-capture enzyme-linked immunosorbent assays (ELISA). Acute DENV infection was confirmed in 130 samples and 61 of the samples (46.9%) were classified as viremic with qRT-PCR. The RT-RPA assay showed good concordance (κ of ≥0.723) with the RT-LAMP and qRT-PCR assays in detecting the dengue viremic samples. When used in combination with ELISA, both the RT-RPA and RT-LAMP assays increased the detection of acute DENV infection to ≥95.7% (≥45/47) in samples obtained within 5 days of illness. The results from the study suggest that the RT-RPA assay is the most rapid molecular diagnostic tool available for the detection of DENV. Hence, it is possible to use the RT-RPA assay in a laboratory to complement routine serology testing for dengue.

  4. Real-time isothermal detection of Shiga toxin-producing Escherichia coli using recombinase polymerase amplification.

    PubMed

    Murinda, Shelton E; Ibekwe, A Mark; Zulkaffly, Syaizul; Cruz, Andrew; Park, Stanley; Razak, Nur; Paudzai, Farah Md; Ab Samad, Liana; Baquir, Khairul; Muthaiyah, Kokilah; Santiago, Brenna; Rusli, Amirul; Balkcom, Sean

    2014-07-01

    Shiga toxin-producing Escherichia coli (STEC) are a major family of foodborne pathogens of public health, zoonotic, and economic significance in the United States and worldwide. To date, there are no published reports on use of recombinase polymerase amplification (RPA) for STEC detection. The primary goal of this study was to assess the potential application of RPA in detection of STEC. This study focused on designing and evaluating RPA primers and fluorescent probes for isothermal (39°C) detection of STEC. Compatible sets of candidate primers and probes were designed for detection of Shiga toxin 1 and 2 (Stx1 and 2), respectively. The sets were evaluated for specificity and sensitivity against STEC (n=12) of various stx genotypes (stx1/stx2, stx1, or stx2, respectively), including non-Stx-producing E. coli (n=28) and other genera (n=7). The primers and probes that were designed targeted amplification of the subunit A moiety of stx1 and stx2. The assay detected STEC in real time (within 5-10 min at 39°C) with high sensitivity (93.5% vs. 90%; stx1 vs. stx2), specificity (99.1% vs. 100%; stx1 vs. stx2), and predictive value (97.9% for both stx1 vs. stx2). Limits of detection of ∼ 5-50 colony-forming units/mL were achieved in serially diluted cultures grown in brain heart infusion broth. This study successfully demonstrated for the first time that RPA can be used for isothermal real-time detection of STEC.

  5. Rapid Detection of Candida albicans by Polymerase Spiral Reaction Assay in Clinical Blood Samples

    PubMed Central

    Jiang, Xiaoqun; Dong, Derong; Bian, Lihong; Zou, Dayang; He, Xiaoming; Ao, Da; Yang, Zhan; Huang, Simo; Liu, Ningwei; Liu, Wei; Huang, Liuyu

    2016-01-01

    Candida albicans is the most common human yeast pathogen which causes mucosal infections and invasive fungal diseases. Early detection of this pathogen is needed to guide preventative and therapeutic treatment. The aim of this study was to establish a polymerase spiral reaction (PSR) assay that rapidly and accurately detects C. albicans and to assess the clinical applicability of PSR-based diagnostic testing. Internal transcribed spacer 2 (ITS2), a region between 5.8S and 28S fungal ribosomal DNA, was used as the target sequence. Four primers were designed for amplification of ITS2 with the PSR method, which was evaluated using real time turbidity monitoring and visual detection using a pH indicator. Fourteen non-C. albicans yeast strains were negative for detection, which indicated the specificity of PSR assay was 100%. A 10-fold serial dilution of C. albicans genomic DNA was subjected to PSR and conventional polimerase chain reaction (PCR) to compare their sensitivities. The detection limit of PSR was 6.9 pg/μl within 1 h, 10-fold higher than that of PCR (69.0 pg/μl). Blood samples (n = 122) were collected from intensive care unit and hematological patients with proven or suspected C. albicans infection at two hospitals in Beijing, China. Both PSR assay and the culture method were used to analyze the samples. Of the 122 clinical samples, 34 were identified as positive by PSR. The result was consistent with those obtained by the culture method. In conclusion, a novel and effective C. albicans detection assay was developed that has a great potential for clinical screening and point-of-care testing. PMID:27379048

  6. Polymerase chain reaction-assisted papillomavirus detection in cervicovaginal smears: stratification by clinical risk and cytology reports.

    PubMed

    Kühler-Obbarius, C; Milde-Langosch, K; Helling-Giese, G; Salfelder, A; Peimann, C; Löning, T

    1994-01-01

    Seven hundred and twelve patients from cancer screening, pregnancy care, outpatient clinics for patients at risk for cervical dysplasia and human immunodeficiency virus (HIV) infection were tested simultaneously for cytological aberrations and human papillomavirus (HPV). Classification of these cases, and of all cytology records throughout 1991 and 1992 was performed according to the "Münchner Nomenklatur" and the Bethesda classification. HPV-directed polymerase chain reaction analysis was carried out with general primers, patients at risk for cervical dysplasia were tested by subsequent hybridization with HPV 16 and 18 probes. Patients from cancer screening and pregnancy care showed similar HPV prevalences ranging between 19.4%-24.6%. In contrast, patients from dysplasia and HIV units were infected in 56.2%-62.3% and 75.0%-76.9% respectively in centre of disease control stage III-IV, HPV detection rates in patients from dysplasia and HIV units increased gradually from 40.1%-52.9% in non-suspicious smears to 80.8%-100% in atypical smears. High risk HPV 16 and 18 infections were detected in 64% of smears with cytological evidence of HPV infection (koilocytosis) to 84.2% in severe dysplasia. Following the Bethesda guidelines, 2.9%-14.7% of all smears initially reported as Pap 2 K (suggestive of HPV infection) would be qualified as risk lesions (low grade squamous intraepithelial lesions), although they tested HPV negative in more than a third of cases. Thus, when using the Bethesda system, HPV analysis is needed to prevent overclassification and overtreatment. The "Münchner Nomenklatur" avoids this dilemma by not mixing morphological statements on infection, atypia and cancer risk.

  7. Direct detection of Bacillus anthracis DNA in animals by polymerase chain reaction.

    PubMed Central

    Makino, S I; Iinuma-Okada, Y; Maruyama, T; Ezaki, T; Sasakawa, C; Yoshikawa, M

    1993-01-01

    Bacillus anthracis is a soil pathogen capable of causing anthrax. To establish a method for specifically detecting B. anthracis for practical applications, such as for the inspection of slaughterhouses, the cap region, which is essential for encapsulation in B. anthracis, was used in a DNA hybridization study by polymerase chain reaction (PCR). Oligonucleotide primers were designed to amplify a 288-bp DNA fragment within the capA gene by PCR. The amplified DNA sequence specifically hybridized to the DNA of B. anthracis but not to that of other bacterial strains tested. Since this PCR-based method efficiently and specifically detected the capA sequence of bacteria in blood and spleen samples of mice within 8 h after the administration of live B. anthracis, this PCR system could be used for practical applications. By using lysis methods in preparing the samples for PCR, it was possible to amplify the 288-bp DNA segment from samples containing very few bacteria, as few as only 1 sporeforming unit, indicating that the PCR detection method developed in this study will permit the monitoring of B. anthracis contamination in the environment. Images PMID:8458949

  8. Detection of Helicobacter pylori glmM gene in bovine milk using Nested polymerase chain reaction

    PubMed Central

    Osman, Eyman Y.; El-Eragi, A. M. S.; Musa, Abuobeida M.; El-Magboul, Salma B.; A/Rahman, Magdi B.; Abdo, Abdelmounem E.

    2015-01-01

    Aim: The aim was to detect the glmM gene of Helicobacter pylori (H. pylori) in cow’s milk from different dairy farms in Khartoum State using Nested polymerase chain reaction (PCR). Materials and Methods: A total of 50 milk samples were collected from different dairy farms in Khartoum State (13 from Khartoum, 24 Khartoum North, and 13 from Omdurman Provinces). Results: The generated results showed that 11/50 (22%) were harboring the investigated H. pylori glmM gene in Khartoum State (1/13 [7.7%] Khartoum, 9/24 [37.5%] Khartoum North, and 1/13 [7.7%] Omdurman provinces, respectively). Conclusion: To the best of our knowledge, this was the first report on the detection of H. pylori glmM gene in cattle milk in Khartoum State. Nonetheless, the high percentages of H. pylori DNA detection in milk opened new avenues toward exploring the risk of human infection with H. pylori through the consumption of raw milk. PMID:27047175

  9. A real-time reverse transcriptase polymerase chain reaction for detection and quantification of Vesiculovirus

    PubMed Central

    Tolardo, Aline Lavado; de Souza, William Marciel; Romeiro, Marilia Farignoli; Vieira, Luiz Carlos; Luna, Luciano Kleber de Souza; Henriques, Dyana Alves; de Araujo, Jansen; Siqueira, Carlos Eduardo Hassegawa; Colombo, Tatiana Elias; Aquino, Victor Hugo; da Fonseca, Benedito Antonio Lopes; Bronzoni, Roberta Vieira de Morais; Nogueira, Maurício Lacerda; Durigon, Edison Luiz; Figueiredo, Luiz Tadeu Moraes

    2016-01-01

    Vesiculoviruses (VSV) are zoonotic viruses that cause vesicular stomatitis disease in cattle, horses and pigs, as well as sporadic human cases of acute febrile illness. Therefore, diagnosis of VSV infections by reliable laboratory techniques is important to allow a proper case management and implementation of strategies for the containment of virus spread. We show here a sensitive and reproducible real-time reverse transcriptase polymerase chain reaction (RT-PCR) for detection and quantification of VSV. The assay was evaluated with arthropods and serum samples obtained from horses, cattle and patients with acute febrile disease. The real-time RT-PCR amplified the Piry, Carajas, Alagoas and Indiana Vesiculovirus at a melting temperature 81.02 ± 0.8ºC, and the sensitivity of assay was estimated in 10 RNA copies/mL to the Piry Vesiculovirus. The viral genome has been detected in samples of horses and cattle, but not detected in human sera or arthropods. Thus, this assay allows a preliminary differential diagnosis of VSV infections. PMID:27276185

  10. Multiplex Polymerase Chain Reaction for Detection of Gastrointestinal Pathogens in Migrant Workers in Qatar.

    PubMed

    Humphrey, John M; Ranbhise, Sanjay; Ibrahim, Emad; Al-Romaihi, Hamad E; Farag, Elmoubasher; Abu-Raddad, Laith J; Glesby, Marshall J

    2016-12-07

    The causes of infectious diarrhea among the migrant worker population in Qatar are not well understood. We conducted a prospective observational study to understand the demographic and clinical characteristics and infectious causes of diarrhea among migrant workers in Doha, Qatar. A total of 126 male workers presenting to the Qatar Red Crescent Worker's Health Center outpatient clinic or emergency department were studied over a 5-month period in 2015-2016. Epidemiologic surveys were administered to all subjects and the prevalence of 22 different stool pathogens was determined using multiplex polymerase chain reaction (PCR) (FilmArray(®) Gastrointestinal PCR). A target pathogen was identified in 62.7% of subjects. Enteropathogenic Escherichia coli was the most prevalent pathogen and was detected in 24.6% of subjects, followed by Salmonella (22.2%), enteroaggregative E. coli (15.1%), Giardia lamblia (9.5%), and enterotoxigenic E. coli (8.7%). Multiple pathogens were identified in 49.3% of positive stool samples. In a multivariable analysis, the presence of a heart rate ≥ 90 (adjusted odds ratio [OR] = 3.7, 95% confidence interval [CI] = 1.4-10.0) and > 5 fecal leukocytes/high-power field (adjusted OR = 2.8, 95% CI = 1.2-7.0) were significant predictors of detecting an acute inflammatory pathogen by PCR. Use of multiplex PCR enabled the detection of gastrointestinal pathogens in a high proportion of cases, illustrating the utility of this diagnostic tool in epidemiologic studies of infectious diarrhea.

  11. Rapid detection of genetically modified organisms on a continuous-flow polymerase chain reaction microfluidics.

    PubMed

    Li, Yuyuan; Xing, Da; Zhang, Chunsun

    2009-02-01

    The ability to perform DNA amplification on a microfluidic device is very appealing. In this study, a compact continuous-flow polymerase chain reaction (PCR) microfluidics was developed for rapid analysis of genetically modified organisms (GMOs) in genetically modified soybeans. The device consists of three pieces of copper and a transparent polytetrafluoroethylene capillary tube embedded in the spiral channel fabricated on the copper. On this device, the P35S and Tnos sequences were successfully amplified within 9min, and the limit of detection of the DNA sample was estimated to be 0.005 ng microl(-1). Furthermore, a duplex continuous-flow PCR was also reported for the detection of the P35S and Tnos sequences in GMOs simultaneously. This method was coupled with the intercalating dye SYBR Green I and the melting curve analysis of the amplified products. Using this method, temperature differences were identified by the specific melting temperature values of two sequences, and the limit of detection of the DNA sample was assessed to be 0.01 ng microl(-1). Therefore, our results demonstrated that the continuous-flow PCR assay could discriminate the GMOs in a cost-saving and less time-consuming way.

  12. Nanostructured biochip for label-free and real-time optical detection of polymerase chain reaction.

    PubMed

    Hiep, Ha Minh; Kerman, Kagan; Endo, Tatsuro; Saito, Masato; Tamiya, Eiichi

    2010-02-19

    In this report, Au-coated nanostructured biochip with functionalized thiolated primers on its surface is developed for label-free and real-time optical detection of polymerase chain reaction (PCR). A PCR chamber of 150 microm in thickness containing Au-coated nanostructured substrate in the bottom layer was bordered with SU-8 100 walls. After immobilization of 5'-thiolated primers on the surface, simultaneous DNA amplification and detection were performed without any labeled molecules via the relative reflected intensity (RRI) of Au-coated nanostructured substrate. When human genomic DNA at several concentrations of 0.2, 0.5 and 1 ng microL(-1) was included in the initial DNA samples, the increases in the RRI peak values were clearly observed with the increasing PCR cycle numbers. We found that the starting point of the optical signal, which was divergent from the background in our PCR biochip, was around 3-4 cycles, much lower than that of the fluorescent real-time PCR analysis (around 23-25 cycles). Our proposed PCR device using Au-coated nanostructured substrate holds noteworthy promise for rapid, label-free and real-time DNA detection for point-of-care testing (POCT) applications.

  13. Sensitive and species-specific detection of Erwinia amylovora by polymerase chain reaction analysis.

    PubMed Central

    Bereswill, S; Pahl, A; Bellemann, P; Zeller, W; Geider, K

    1992-01-01

    Detection and identification of the fire blight pathogen, Erwinia amylovora, can be accurately done by polymerase chain reaction (PCR) analysis in less than 6 h. Two oligomers derived from a 29-kb plasmid which is common to all strains of E. amylovora were used to amplify a 0.9-kb fragment of the plasmid. By separation of the PCR products on agarose gel, this fragment wa specifically detected when E. amylovora DNA was present in the amplification assay. It was not found when DNA from other plant-pathogenic bacteria was used for the assay. A visible band specific to the 0.9-kb fragment was produced with DNA from fewer than 100 E. amylovora cells. A signal of similar strength was also obtained from E. amylovora cell lysates in the presence of the mild detergent Tween 20. Signals were weaker when bacteria were added to the PCR mixture without the detergent. As with results obtained from hybridization experiments using pEA29 DNA< the PCR signal was obtained with E. amylovora isolates from various geographic regions. This technique could also be used for detection of the fire blight pathogen in extracts of tissue obtained from infected plant material. Images PMID:1482178

  14. Specific detection of Pacific oyster (Crassostrea gigas) larvae in plankton samples using nested polymerase chain reaction.

    PubMed

    Patil, Jawahar G; Gunasekera, Rasanthi M; Deagle, Bruce E; Bax, Nicholas J

    2005-01-01

    Management of sustainable Pacific oyster fisheries would be assisted by an early, rapid, and accurate means of detecting their planktonic larvae. Reported here is an approach, based on polymerase chain reaction (PCR), for the detection of Pacific oyster larvae in plankton samples. Species-specific primers were designed by comparing partial mitochondrial cytochrome oxidase subunit I (COI) sequences from Crassostrea gigas, with other members of the family Ostreidae including those of Crassostrea angulata. Assay specificity was empirically validated through screening DNA samples obtained from several species of oysters. The assay was specific as only C. gigas samples returned PCR-positive results. A nested PCR approach could consistently detect 5 or more D-hinge-stage larvae spiked into a background of about 146 mg of plankton. The assay does not require prior sorting of larvae. We conclude that the assay could be used to screen environmental and ballast water samples, although further specificity testing against local bivalve species is recommended in new locations.

  15. A reverse transcriptase-polymerase chain reaction assay for detecting Highlands J virus.

    PubMed

    Whitehouse, C A; Guibeau, A; McGuire, D; Takeda, T; Mather, T N

    2001-01-01

    Highlands J (HJ) virus is an arbovirus frequently recovered at high rates in mosquitoes collected in the eastern United States. HJ virus is primarily a veterinary pathogen causing disease in domestic birds including turkeys, chickens, and partridges. It has an enzootic cycle similar to eastern equine encephalitis (EEE) virus and is often used as an indicator species in EEE surveillance programs. Current immunologic techniques to identify HJ virus are often inefficient and can involve cross-reactivity of antibodies. Therefore, we developed a molecular-based assay by a reverse transcriptase (RT)-polymerase chain reaction (PCR) technique. Primers were constructed from conserved sequences of the E1 coding region from 19 strains of HJ virus. PCR amplifications from serial dilutions of HJ virus-infected Vero cell culture supernatants indicated that this assay could detect viral RNA at concentrations of 10 plaque-forming units per reaction. Extracted RNAs from western equine encephalitis, EEE, LaCrosse, and Jamestown Canyon viruses were not detected with this assay. RNA extracted directly from the brain tissue of a dead house sparrow and from a pool of Culiseta mosquitoes yielded a PCR product of the expected size. The RT-PCR technique developed was both sensitive and specific for detecting HJ virus from infected cell culture supernatants, bird brain tissues, and mosquitoes. This new assay will permit rapid and accurate diagnosis of HJ virus, both enhancing surveillance activities for EEE transmission risk and monitoring infections in domestic poultry and wild birds.

  16. Ultrasensitive and rapid detection of β-conglutin combining aptamers and isothermal recombinase polymerase amplification.

    PubMed

    Jauset-Rubio, Miriam; Sabaté Del Río, Jonathan; Mairal, Teresa; Svobodová, Markéta; El-Shahawi, Mohammad S; Bashammakh, Abdulaziz S; Alyoubi, Abdulrahman O; O'Sullivan, Ciara K

    2017-01-01

    Lupin is increasingly being used in a variety of food products due to its nutritional, functional and nutraceutical properties. However, several examples of severe and even fatal food-associated anaphylaxis due to lupin inhalation or ingestion have been reported, resulting in the lupin subunit β-conglutin, being defined as the Lup an 1 allergen by the International Union of Immunological Societies (IUIS) in 2008. Here, we report an innovative method termed aptamer-recombinase polymerase amplification (Apta-RPA) exploiting the affinity and specificity of a DNA aptamer selected against the anaphylactic β-conglutin allergen termed β-conglutin binding aptamer II (β-CBA II), facilitating ultrasensitive detection via isothermal amplification. Combining magnetic beads as the solid phase with Apta-RPA detection, the total assay time was reduced from 210 min to just 25 min, with a limit of detection of 3.5 × 10(-11) M, demonstrating a rapid and ultrasensitive generic methodology that can be used with any aptamer. Future work will focus on further simplification of the assay to a lateral flow format. Graphical Abstract Schematic representation of the rapid and novel bead-based Apta-RPA assay.

  17. Sensitive and rapid detection of Chlamydia trachomatis by recombinase polymerase amplification directly from urine samples.

    PubMed

    Krõlov, Katrin; Frolova, Jekaterina; Tudoran, Oana; Suhorutsenko, Julia; Lehto, Taavi; Sibul, Hiljar; Mäger, Imre; Laanpere, Made; Tulp, Indrek; Langel, Ülo

    2014-01-01

    Chlamydia trachomatis is the most common sexually transmitted human pathogen. Infection results in minimal to no symptoms in approximately two-thirds of women and therefore often goes undiagnosed. C. trachomatis infections are a major public health concern because of the potential severe long-term consequences, including an increased risk of ectopic pregnancy, chronic pelvic pain, and infertility. To date, several point-of-care tests have been developed for C. trachomatis diagnostics. Although many of them are fast and specific, they lack the required sensitivity for large-scale application. We describe a rapid and sensitive form of detection directly from urine samples. The assay uses recombinase polymerase amplification and has a minimum detection limit of 5 to 12 pathogens per test. Furthermore, it enables detection within 20 minutes directly from urine samples without DNA purification before the amplification reaction. Initial analysis of the assay from clinical patient samples had a specificity of 100% (95% CI, 92%-100%) and a sensitivity of 83% (95% CI, 51%-97%). The whole procedure is fairly simple and does not require specific machinery, making it potentially applicable in point-of-care settings.

  18. Reverse transcription recombinase polymerase amplification assay for the detection of middle East respiratory syndrome coronavirus.

    PubMed

    Abd El Wahed, Ahmed; Patel, Pranav; Heidenreich, Doris; Hufert, Frank T; Weidmann, Manfred

    2013-12-12

    The emergence of Middle East Respiratory Syndrome Coronavirus (MERS-CoV) in the eastern Mediterranean and imported cases to Europe has alerted public health authorities. Currently, detection of MERS-CoV in patient samples is done by real-time RT-PCR. Samples collected from suspected cases are sent to highly-equipped centralized laboratories for screening. A rapid point-of-care test is needed to allow more widespread mobile detection of the virus directly from patient material. In this study, we describe the development of a reverse transcription isothermal Recombinase Polymerase Amplification (RT-RPA) assay for the identification of MERS-CoV. A partial nucleocapsid gene RNA molecular standard of MERS-coronavirus was used to determine the assay sensitivity. The isothermal (42°C) MERS-CoV RT-RPA was as sensitive as real-time RT-PCR (10 RNA molecules), rapid (3-7 minutes) and mobile (using tubescanner weighing 1kg). The MERS-CoV RT-RPA showed cross-detection neither of any of the RNAs of several coronaviruses and respiratory viruses affecting humans nor of the human genome. The developed isothermal real-time RT-RPA is ideal for rapid mobile molecular MERS-CoV monitoring in acute patients and may also facilitate the search for the animal reservoir of MERS-CoV.

  19. Nested polymerase chain reaction assay for detection of Mycobacterium shottsii and M. pseudoshottsii in striped bass.

    PubMed

    Gauthier, D T; Vogelbein, W K; Rhodes, M W; Reece, K S

    2008-12-01

    Wild striped bass Morone saxatilis in Chesapeake Bay are experiencing a high prevalence of mycobacteriosis, which produces granulomatous lesions of the skin and visceral organs. Culture-based studies have indicated that the newly described species Mycobacterium shottsii and M. pseudoshottsii are the dominant isolates from diseased fish. The classical fish pathogen M. marinum is also found, albeit at much lower frequencies. Both M. shottsii and M. pseudoshottsii are extremely slow-growing on standard selective media, and up to 12 months may be required for isolation and characterization. Epidemiological studies of mycobacteriosis in Chesapeake Bay would therefore benefit from rapid molecular assays with which to detect these species in fish. In this paper, we describe the development of polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) assays capable of detecting M. shottsii, M. pseudoshottsii, and, in most instances, coinfections thereof in striped bass tissues. In addition, PCR-RFLP assays were designed to detect M. marinum and other as-yet-undescribed Mycobacterium spp. present in Chesapeake Bay striped bass. Comparison of these molecular assays with culture-based techniques using splenic tissue from wild striped bass yielded generally concordant results and demonstrated the applicability of these techniques to the study of wild fish.

  20. Assessment of cell culture and polymerase chain reaction procedures for the detection of polioviruses in wastewater.

    PubMed Central

    Grabow, W. O.; Botma, K. L.; de Villiers, J. C.; Clay, C. G.; Erasmus, B.

    1999-01-01

    WHO considers that environmental surveillance for wild-type polioviruses is potentially important for surveillance for acute flaccid paralysis as a means of confirming eradication of poliomyelitis. The present study investigated methods for detecting polioviruses in a variety of water environments in South Africa. Most polioviruses were isolated on L20B mouse cells, which, however, were not selective: 16 reoviruses and 8 enteroviruses, apparently animal strains, were also isolated on these cells. Vaccine strains of polioviruses were isolated from surface waters during and shortly after two rounds of mass vaccination of children in an informal settlement where there was no sewerage. The results demonstrated the feasibility of poliovirus surveillance in such settlements. It was also evident that neither poliovirus vaccine strains nor other viruses were likely to interfere significantly with the detection of wild-type polioviruses. Optimal isolation of polioviruses was accomplished by parallel inoculation of L20B mouse cells and at least the PLC/PRF/5 human liver and buffalo green monkey (BGM) kidney cell lines. Analysis of cell cultures using the polymerase chain reaction revealed that 319 test samples contained at least 263 human enteroviruses that failed to produce a cytopathogenic effect. This type of analysis thus significantly increased the sensitivity of enterovirus detection. PMID:10680244

  1. Rapid detection of Plasmodium falciparum with isothermal recombinase polymerase amplification and lateral flow analysis

    PubMed Central

    2014-01-01

    Background Nucleic acid amplification is the most sensitive and specific method to detect Plasmodium falciparum. However the polymerase chain reaction remains laboratory-based and has to be conducted by trained personnel. Furthermore, the power dependency for the thermocycling process and the costly equipment necessary for the read-out are difficult to cover in resource-limited settings. This study aims to develop and evaluate a combination of isothermal nucleic acid amplification and simple lateral flow dipstick detection of the malaria parasite for point-of-care testing. Methods A specific fragment of the 18S rRNA gene of P. falciparum was amplified in 10 min at a constant 38°C using the isothermal recombinase polymerase amplification (RPA) method. With a unique probe system added to the reaction solution, the amplification product can be visualized on a simple lateral flow strip without further labelling. The combination of these methods was tested for sensitivity and specificity with various Plasmodium and other protozoa/bacterial strains, as well as with human DNA. Additional investigations were conducted to analyse the temperature optimum, reaction speed and robustness of this assay. Results The lateral flow RPA (LF-RPA) assay exhibited a high sensitivity and specificity. Experiments confirmed a detection limit as low as 100 fg of genomic P. falciparum DNA, corresponding to a sensitivity of approximately four parasites per reaction. All investigated P. falciparum strains (n = 77) were positively tested while all of the total 11 non-Plasmodium samples, showed a negative test result. The enzymatic reaction can be conducted under a broad range of conditions from 30-45°C with high inhibitory concentration of known PCR inhibitors. A time to result of 15 min from start of the reaction to read-out was determined. Conclusions Combining the isothermal RPA and the lateral flow detection is an approach to improve molecular diagnostic for P. falciparum in

  2. On-chip detection of a single nucleotide polymorphism without polymerase amplification

    PubMed Central

    Han, Jinhee; Tan, Matthew; Sudheendra, Lakshmana; Weiss, Robert H.; Kennedy, Ian M.

    2014-01-01

    A nanoparticle-assembled photonic crystal (PC) array was used to detect single nucleotide polymorphism (SNP). The assay platform with PC nanostructure enhanced the fluorescent signal from nanoparticle-hybridized DNA complexes due to phase matching of excitation and emission. Nanoparticles coupled with probe DNA were trapped into nanowells in an array by using an electrophoretic particle entrapment system. The PC/DNA assay platform was able to identify a 1 base pair (bp) difference in synthesized nucleotide sequences that mimicked the mutation seen in a feline model of human autosomal dominant polycystic kidney disease (PKD) with a sensitivity of 0.9 fg/mL (50 aM)-sensitivity, which corresponds to 30 oligos/array. The reliability of the PC/DNA assay platform to detect SNP in a real sample was demonstrated by using genomic DNA (gDNA) extracted from the urine and blood of two PKD− wild type and three PKD positive cats. The standard curves for PKD positive (PKD+) and negative (PKD−) DNA were created using two feline-urine samples. An additional three urine samples were analyzed in a similar fashion and showed satisfactory agreement with the standard curve, confirming the presence of the mutation in affected urine. The limit of detection (LOD) was 0.005 ng/mL which corresponds to 6 fg per array for gDNA in urine and blood. The PC system demonstrated the ability to detect a number of genome equivalents for the PKD SNP that was very similar to the results reported with real time polymerase chain reaction (PCR). The favorable comparison with quantitative PCR suggests that the PC technology may find application well beyond the detection of the PKD SNP, into areas where a simple, cheap and portable nucleic acid analysis is desirable. PMID:25580203

  3. Colorimetric TMPRSS2-ERG Gene Fusion Detection in Prostate Cancer Urinary Samples via Recombinase Polymerase Amplification.

    PubMed

    Koo, Kevin M; Wee, Eugene J H; Trau, Matt

    2016-01-01

    TMPRSS2 (Exon 1)-ERG (Exon 4) is the most frequent gene fusion event in prostate cancer (PC), and is highly PC-specific unlike the current serum prostate specific antigen (PSA) biomarker. However, TMPRSS2-ERG levels are currently measured with quantitative reverse-transcription PCR (RT-qPCR) which is time-consuming and requires costly equipment, thus limiting its use in clinical diagnostics. Herein, we report a novel rapid, cost-efficient and minimal-equipment assay named "FusBLU" for detecting TMPRSS2-ERG gene fusions from urine. TMPRSS2-ERG mRNA was amplified by isothermal reverse transcription-recombinase polymerase amplification (RT-RPA), magnetically-isolated, and detected through horseradish peroxidase (HRP)-catalyzed colorimetric reaction. FusBLU was specific for TMPRSS2-ERG mRNA with a low visual detection limit of 10(5) copies. We also demonstrated assay readout versatility on 3 potentially useful platforms. The colorimetric readout was detectable by naked eye for a quick yes/no evaluation of gene fusion presence. On the other hand, a more quantitative TMPRSS2-ERG detection was achievable by absorbance/electrochemical measurements. FusBLU was successfully applied to 12 urinary samples and results were validated by gold-standard RT-qPCR. We also showed that sediment RNA was likely the main source of TMPRSS2-ERG mRNA in urinary samples. We believe that our assay is a potential clinical screening tool for PC and could also have wide applications for other disease-related fusion genes.

  4. Colorimetric TMPRSS2-ERG Gene Fusion Detection in Prostate Cancer Urinary Samples via Recombinase Polymerase Amplification

    PubMed Central

    Koo, Kevin M.; Wee, Eugene J.H.; Trau, Matt

    2016-01-01

    TMPRSS2 (Exon 1)-ERG (Exon 4) is the most frequent gene fusion event in prostate cancer (PC), and is highly PC-specific unlike the current serum prostate specific antigen (PSA) biomarker. However, TMPRSS2-ERG levels are currently measured with quantitative reverse-transcription PCR (RT-qPCR) which is time-consuming and requires costly equipment, thus limiting its use in clinical diagnostics. Herein, we report a novel rapid, cost-efficient and minimal-equipment assay named “FusBLU” for detecting TMPRSS2-ERG gene fusions from urine. TMPRSS2-ERG mRNA was amplified by isothermal reverse transcription-recombinase polymerase amplification (RT-RPA), magnetically-isolated, and detected through horseradish peroxidase (HRP)-catalyzed colorimetric reaction. FusBLU was specific for TMPRSS2-ERG mRNA with a low visual detection limit of 105 copies. We also demonstrated assay readout versatility on 3 potentially useful platforms. The colorimetric readout was detectable by naked eye for a quick yes/no evaluation of gene fusion presence. On the other hand, a more quantitative TMPRSS2-ERG detection was achievable by absorbance/electrochemical measurements. FusBLU was successfully applied to 12 urinary samples and results were validated by gold-standard RT-qPCR. We also showed that sediment RNA was likely the main source of TMPRSS2-ERG mRNA in urinary samples. We believe that our assay is a potential clinical screening tool for PC and could also have wide applications for other disease-related fusion genes. PMID:27375789

  5. [THE HIGHLY EFFECTIVE DETECTION OF DNA RICKETTSIA USING TECHNIQUE OF POLYMERASE CHAIN REACTION IN REAL-TIME].

    PubMed

    Kartashov, M Yu; Mikryukova, T P; Ternovoi, V A; Moskvitina, N S; Loktev, V B

    2015-12-01

    The article considers development of highly effective technique of detection of genetic material of ricketsia based on polymerase chain reaction in real-time using original primers to the most conservative sites of gene of citrate synthase (gItA). The analytical sensitivity of the developed polymerase chain reaction in real-time test permits to detect from 80 genome equivalents in analyzed sample during three hours. The high specificity of test-system is substantiated by detection of nucleotide sequences of amplificated fragments of gene gltA. The approbation ofthe polymerase chain reaction in real-time test is carried out on collection of 310 ticks of species I. persulcatus, I. pavlovskyi, D. reticulatus. It is demonstrated that the developed alternate ofprimers and probe permits with high degree of sensitivity and specifcity to detect DNA of different species of ricketsia widespread on territory of Russia (R. sibirica, R. raoultii, R. helvetica, R. tarasevichiae). The proposed polymerase chain reaction in real-time test can be appliedfor isolation of fragment of gene gltA with purpose for detecting nucleotide sequence and subsequent genetic typing of ricketsia. The application ofthe proposed technique can facilitate task of monitoring hot spots of ricketsiosis.

  6. Detection of fastidious mycobacteria in human intestines by the polymerase chain reaction.

    PubMed

    Dumonceau, J M; Van Gossum, A; Adler, M; Van Vooren, J P; Fonteyne, P A; De Beenhouwer, H; Portaels, F

    1997-05-01

    The aim of this study was to determine whether difficult-to-grow mycobacteria are present in human intestines. Intestinal tissue samples were subjected to both mycobacterial culture and a polymerase chain reaction (PCR) assay. After detection by PCR, species identity was determined by hybridizing the amplified 16S rRNA gene fragments with species-specific oligonucleotides. Intestinal biopsies from 63 patients with noninflammatory bowel diseases (n = 22), Crohn's disease (n = 31), or ulcerative colitis (n = 10) were analyzed. Culture and PCR revealed mycobacteria in four (6%) and 25 (40%) samples, respectively. Samples positive by PCR were negative with all probes specific to nine common cultivable species but were positive with Mycobacterium genavense-specific probe in 68% of cases. Mycobacterial isolates were identified as Mycobacterium gordonae and Mycobacterium chelonae. Findings were similar in Crohn's disease samples compared to non-Chron's disease samples. This study shows that difficult-to-grow mycobacteria can be detected by PCR in large and similar proportions of inflamed intestinal tissue from patients with inflammatory bowel disease and intestinal tissue that appears normal from patients with noninflammatory bowel disease.

  7. Detection of helicobacter pylori in benign laryngeal lesions by polymerase chain reaction: a cross sectional study

    PubMed Central

    2012-01-01

    Background Although Helicobacter Pylori (HP) was detected in some cases of chronic laryngitis, the results were not confirmed by polymerase chain reaction (PCR). By this time, it has not been found in laryngeal lesions by in house PCR, the most sensitive method for detecting the genome tracks. Regarding the previous results and also few numbers of studies about the presence of HP in benign laryngeal lesions, specifically by PCR, we aimed to investigate the presence of HP in benign laryngeal lesions by in-house PCR. Methods The samples were taken from 55 patients with benign laryngeal lesions and frozen in −20°C. One milliliter (ml) of lysis buffer was added to 100 mg (mg) of each sample and the tube was placed in 56°C overnight. Then DNA extraction was carried out. Results To find HP DNA, in-house PCR was performed that revealed 5 positive results among 55 patients with benign laryngeal lesions. Of them, 3 were polyp, 1 was nodule and 1 was papilloma. Conclusion Although the number of positive results was not a lot in this study, it was in contrast with previous studies which could not find any HP tracks in benign laryngeal lesions by other methods. More studies about the prevalence of HP in benign laryngeal lesions improve judging about the effect of this infection on benign laryngeal lesions. PMID:22515206

  8. Detection of the genes encoding botulinum neurotoxin types A to E by the polymerase chain reaction.

    PubMed Central

    Szabo, E A; Pemberton, J M; Desmarchelier, P M

    1993-01-01

    The polymerase chain reaction (PCR) was used as the basis for the development of highly sensitive and specific diagnostic tests for organisms harboring botulinum neurotoxin type A through E genes. Synthetic DNA primers were selected from nucleic acid sequence data for Clostridium botulinum neurotoxins. Individual components of the PCR for each serotype (serotypes A through E) were adjusted for optimal amplification of the target fragment. Each PCR assay was tested with organisms expressing each of the botulinum neurotoxin types (types A through G), Clostridium tetani, genetically related nontoxigenic organisms, and unrelated strains. Each assay was specific for the intended target. The PCR reliably identified multiple strains having the same neurotoxin type. The sensitivity of the test was determined with different concentrations of genomic DNA from strains producing each toxin type. As little as 10 fg of DNA (approximately three clostridial cells) was detected. C. botulinum neurotoxin types A, B, and E, which are most commonly associated with human botulism, could be amplified from crude DNA extracts, from vegetative cells, and from spore preparations. This suggests that there is great potential for the PCR in the identification and detection of botulinum neurotoxin-producing strains. Images PMID:8215372

  9. A specific oligonucleotide primer for the rapid detection of Lactobacillus lindneri by polymerase chain reaction.

    PubMed

    Yasui, T; Okamoto, T; Taguchi, H

    1997-02-01

    A polymerase chain reaction (PCR) method was developed for the rapid detection of the beer-spoilage heterofermentative lactic acid bacterium Lactobacillus lindneri. Three strains, the Chinese brewery isolate DA1, the Japanese commercial beer isolate BG2, and the Japanese brewery isolate SE3, which were serologically classified as belonging to L. lindneri, were used in this study. After sequencing the 16S rDNA of the isolates DA1 and BG2 and the typical beer-spoilage heterofermentative Lactobacillus brevis L63, these sequences were compared with published data. A L. lindneri specific PCR primer, DA-40, was then constructed based on the V1 variable region of 16S rDNA. The specificity of PCR using the L. lindneri specific primer DA-40 and the universal primer 907r was examined using five L. lidneri strains: the three isolates described above and two strains from culture collection, DSM 20690 and DSM 20692. A variety of beer-spoilage lactic acid bacteria, including 71 Lactobacillus strains and 13 Pediococcus strains, were also included in this examination. No PCR product was obtained from any DNA with the exception of the five L. lindneri strains, indicating that the L. lindneri specific primer DA-40 was highly specific. The detection limit for L. lindneri in beer was 63 CFU/100 mL of beer.

  10. Sensitive Detection of Thirteen Bacterial Vaginosis-Associated Agents Using Multiplex Polymerase Chain Reaction

    PubMed Central

    Malaguti, Natália; Bahls, Larissa Danielle; Uchimura, Nelson Shozo; Gimenes, Fabrícia; Consolaro, Marcia Edilaine Lopes

    2015-01-01

    Bacterial vaginosis (BV) is characterized by a polymicrobial proliferation of anaerobic bacteria and depletion of lactobacilli, which are components of natural vaginal microbiota. Currently, there are limited conventional methods for BV diagnosis, and these methods are time-consuming, expensive, and rarely allow for the detection of more than one agent simultaneously. Therefore, we conceived and validated a multiplex polymerase chain reaction (M-PCR) assay for the simultaneous screening of thirteen bacterial vaginosis-associated agents (BV-AAs) related to symptomatic BV: Gardnerella vaginalis, Mobiluncus curtisii, Mobiluncus mulieris, Bacteroides fragilis, Mycoplasma hominis, Atopobium vaginae, Ureaplasma urealyticum, Megasphaera type I, Clostridia-like bacteria vaginosis-associated bacteria (BVABs) 1, 2, and 3, Sneathia sanguinegens, and Mycoplasma genitalium. The overall validation parameters of M-PCR compared to single PCR (sPCR) were extremely high, including agreement of 99.1% and sensitivity, specificity, and positive predictive values of 100.0%, negative predictive value of 97.0%, accuracy of 99.3%, and agreement with Nugent results of 100.0%. The prevalence of BV-AAs was very high (72.6%), and simultaneous agents were detected in 53.0%, which demonstrates the effectiveness of the M-PCR assay. Therefore, the M-PCR assay has great potential to impact BV diagnostic methods in vaginal samples and diminish associated complications in the near future. PMID:26078959

  11. Sensitive Detection of Thirteen Bacterial Vaginosis-Associated Agents Using Multiplex Polymerase Chain Reaction.

    PubMed

    Malaguti, Natália; Bahls, Larissa Danielle; Uchimura, Nelson Shozo; Gimenes, Fabrícia; Consolaro, Marcia Edilaine Lopes

    2015-01-01

    Bacterial vaginosis (BV) is characterized by a polymicrobial proliferation of anaerobic bacteria and depletion of lactobacilli, which are components of natural vaginal microbiota. Currently, there are limited conventional methods for BV diagnosis, and these methods are time-consuming, expensive, and rarely allow for the detection of more than one agent simultaneously. Therefore, we conceived and validated a multiplex polymerase chain reaction (M-PCR) assay for the simultaneous screening of thirteen bacterial vaginosis-associated agents (BV-AAs) related to symptomatic BV: Gardnerella vaginalis, Mobiluncus curtisii, Mobiluncus mulieris, Bacteroides fragilis, Mycoplasma hominis, Atopobium vaginae, Ureaplasma urealyticum, Megasphaera type I, Clostridia-like bacteria vaginosis-associated bacteria (BVABs) 1, 2, and 3, Sneathia sanguinegens, and Mycoplasma genitalium. The overall validation parameters of M-PCR compared to single PCR (sPCR) were extremely high, including agreement of 99.1% and sensitivity, specificity, and positive predictive values of 100.0%, negative predictive value of 97.0%, accuracy of 99.3%, and agreement with Nugent results of 100.0%. The prevalence of BV-AAs was very high (72.6%), and simultaneous agents were detected in 53.0%, which demonstrates the effectiveness of the M-PCR assay. Therefore, the M-PCR assay has great potential to impact BV diagnostic methods in vaginal samples and diminish associated complications in the near future.

  12. Detection of Salmonella sp. in Dermanyssus gallinae using an FTA filter-based polymerase chain reaction.

    PubMed

    Moro, C Valiente; Desloire, S; Chauve, C; Zenner, L

    2007-06-01

    Salmonella spp. bacteria are responsible for some of the most important zoonoses worldwide. Because Dermanyssus gallinae (DeGeer) (Acari: Dermanyssidae) has been recently reported to be an experimental vector of Salmonella Enteritidis, it would be of benefit to evaluate the presence of this bacterium in mites. A molecular detection tool associating a simple filter-based DNA preparation with a specific 16S rDNA Salmonella sp. polymerase chain reaction (PCR) amplification was described. The limit of detection with this method was 2 x 10(4) bacteria per mite. To adapt this technique for large-scale studies, two sizes of mite pools were tested and a preliminary investigation was carried out on mites from 16 currently or previously contaminated farms. Mites sampled from one farm of each type were positive for Salmonella, suggesting that Dermanyssus could act as a reservoir between flocks. In further investigations, it will be necessary to carry out a large-scale study to assess the role of D. gallinae in the epidemiology of avian salmonellosis.

  13. Detection of Mycobacterium tuberculosis complex by nested polymerase chain reaction in pulmonary and extrapulmonary specimens* ,**

    PubMed Central

    Furini, Adriana Antônia da Cruz; Pedro, Heloisa da Silveira Paro; Rodrigues, Jean Francisco; Montenegro, Lilian Maria Lapa; Machado, Ricardo Luiz Dantas; Franco, Célia; Schindler, Haiana Charifker; Batista, Ida Maria Foschiani Dias; Rossit, Andrea Regina Baptista

    2013-01-01

    OBJECTIVE: To compare the performance of nested polymerase chain reaction (NPCR) with that of cultures in the detection of the Mycobacterium tuberculosis complex in pulmonary and extrapulmonary specimens. METHODS: We analyzed 20 and 78 pulmonary and extrapulmonary specimens, respectively, of 67 hospitalized patients suspected of having tuberculosis. An automated microbial system was used for the identification of Mycobacterium spp. cultures, and M. tuberculosis IS6110 was used as the target sequence in the NPCR. The kappa statistic was used in order to assess the level of agreement among the results. RESULTS: Among the 67 patients, 6 and 5, respectively, were diagnosed with pulmonary and extrapulmonary tuberculosis, and the NPCR was positive in all of the cases. Among the 98 clinical specimens, smear microscopy, culture, and NPCR were positive in 6.00%, 8.16%, and 13.26%, respectively. Comparing the results of NPCR with those of cultures (the gold standard), we found that NPCR had a sensitivity and specificity of 100% and 83%, respectively, in pulmonary specimens, compared with 83% and 96%, respectively, in extrapulmonary specimens, with good concordance between the tests (kappa, 0.50 and 0.6867, respectively). CONCLUSIONS: Although NPCR proved to be a very useful tool for the detection of M. tuberculosis complex, clinical, epidemiological, and other laboratory data should also be considered in the diagnosis and treatment of pulmonary and extrapulmonary tuberculosis. PMID:24473765

  14. Development of a panel of recombinase polymerase amplification assays for detection of biothreat agents.

    PubMed

    Euler, Milena; Wang, Yongjie; Heidenreich, Doris; Patel, Pranav; Strohmeier, Oliver; Hakenberg, Sydney; Niedrig, Matthias; Hufert, Frank T; Weidmann, Manfred

    2013-04-01

    Syndromic panels for infectious disease have been suggested to be of value in point-of-care diagnostics for developing countries and for biodefense. To test the performance of isothermal recombinase polymerase amplification (RPA) assays, we developed a panel of 10 RPAs for biothreat agents. The panel included RPAs for Francisella tularensis, Yersinia pestis, Bacillus anthracis, variola virus, and reverse transcriptase RPA (RT-RPA) assays for Rift Valley fever virus, Ebola virus, Sudan virus, and Marburg virus. Their analytical sensitivities ranged from 16 to 21 molecules detected (probit analysis) for the majority of RPA and RT-RPA assays. A magnetic bead-based total nucleic acid extraction method was combined with the RPAs and tested using inactivated whole organisms spiked into plasma. The RPA showed comparable sensitivities to real-time RCR assays in these extracts. The run times of the assays at 42°C ranged from 6 to 10 min, and they showed no cross-detection of any of the target genomes of the panel nor of the human genome. The RPAs therefore seem suitable for the implementation of syndromic panels onto microfluidic platforms.

  15. A polymerase chain reaction-based methodology to detect gene doping.

    PubMed

    Carter, Adam; Flueck, Martin

    2012-04-01

    The non-therapeutic use of genes to enhance athletic performance (gene doping) is a novel threat to the world of sports. Skeletal muscle is a prime target of gene therapy and we asked whether we can develop a test system to produce and detect gene doping. Towards this end, we introduced a plasmid (pCMV-FAK, 3.8 kb, 50 μg) for constitutive expression of the chicken homologue for the regulator of muscle growth, focal adhesion kinase (FAK), via gene electro transfer in the anti-gravitational muscle, m. soleus, or gastrocnemius medialis of rats. Activation of hypertrophy signalling was monitored by assessing the ribosomal kinase p70S6K and muscle fibre cross section. Detectability of the introduced plasmid was monitored with polymerase chain reaction in deoxyribonucleic acids (DNA) from transfected muscle and serum. Muscle transfection with pCMV-FAK elevated FAK expression 7- and 73-fold, respectively, and increased mean cross section by 52 and 16% in targeted muscle fibres of soleus and gastrocnemius muscle 7 days after gene electro transfer. Concomitantly p70S6K content was increased in transfected soleus muscle (+110%). Detection of the exogenous plasmid sequence was possible in DNA and cDNA of muscle until 7 days after transfection, but not in serum except close to the site of plasmid deposition, 1 h after injection and surgery. The findings suggest that the reliable detection of gene doping in the immoral athlete is not possible unless a change in the current practice of tissue sampling is applied involving the collection of muscle biopsy close to the site of gene injection.

  16. ZSCAN5B and primate-specific paralogs bind RNA polymerase III genes and extra-TFIIIC (ETC) sites to modulate mitotic progression

    PubMed Central

    Sun, Younguk; Zhang, Huimin; Kazemian, Majid; Troy, Joseph M.; Seward, Christopher; Lu, Xiaochen; Stubbs, Lisa

    2016-01-01

    Mammalian genomes contain hundreds of genes transcribed by RNA Polymerase III (Pol III), encoding noncoding RNAs and especially the tRNAs specialized to carry specific amino acids to the ribosome for protein synthesis. In addition to this well-known function, tRNAs and their genes (tDNAs) serve a variety of other critical cellular functions. For example, tRNAs and other Pol III transcripts can be cleaved to yield small RNAs with potent regulatory activities. Furthermore, from yeast to mammals, active tDNAs and related “extra-TFIIIC” (ETC) loci provide the DNA scaffolds for the most ancient known mechanism of three-dimensional chromatin architecture. Here we identify the ZSCAN5 TF family - including mammalian ZSCAN5B and its primate-specific paralogs - as proteins that occupy mammalian Pol III promoters and ETC sites. We show that ZSCAN5B binds with high specificity to a conserved subset of Pol III genes in human and mouse. Furthermore, primate-specific ZSCAN5A and ZSCAN5D also bind Pol III genes, although ZSCAN5D preferentially localizes to MIR SINE- and LINE2-associated ETC sites. ZSCAN5 genes are expressed in proliferating cell populations and are cell-cycle regulated, and siRNA knockdown experiments suggested a cooperative role in regulation of mitotic progression. Consistent with this prediction, ZSCAN5A knockdown led to increasing numbers of cells in mitosis and the appearance of cells. Together, these data implicate the role of ZSCAN5 genes in regulation of Pol III genes and nearby Pol II loci, ultimately influencing cell cycle progression and differentiation in a variety of tissues. PMID:27732952

  17. Development of Recombinase Polymerase Amplification Assays for Detection of Orientia tsutsugamushi or Rickettsia typhi

    PubMed Central

    Chao, Chien-Chung; Belinskaya, Tatyana; Zhang, Zhiwen; Ching, Wei-Mei

    2015-01-01

    Sensitive, specific and rapid diagnostic tests for the detection of Orientia tsutsugamushi (O. tsutsugamushi) and Rickettsia typhi (R. typhi), the causative agents of scrub typhus and murine typhus, respectively, are necessary to accurately and promptly diagnose patients and ensure that they receive proper treatment. Recombinase polymerase amplification (RPA) assays using a lateral flow test (RPA-nfo) and real-time fluorescent detection (RPA-exo) were developed targeting the 47-kDa gene of O. tsutsugamushi or 17 kDa gene of R. typhi. The RPA assay was capable of detecting O. tsutsugamushi or R. typhi at levels comparable to that of the quantitative PCR method. Both the RPA-nfo and RPA-exo methods performed similarly with regards to sensitivity when detecting the 17 kDa gene of R. typhi. On the contrary, RPA-exo performed better than RPA-nfo in detecting the 47 kDa gene of O. tsutsugamushi. The clinical performance of the O. tsutsugamushi RPA assay was evaluated using either human patient samples or infected mouse samples. Eight out of ten PCR confirmed positives were determined positive by RPA, and all PCR confirmed negative samples were negative by RPA. Similar results were obtained for R. typhi spiked patient sera. The assays were able to differentiate O. tsutsugamushi and R. typhi from other phylogenetically related bacteria as well as mouse and human DNA. Furthermore, the RPA-nfo reaction was completed in 20 minutes at 37oC followed by a 10 minute incubation at room temperature for development of an immunochromatographic strip. The RPA-exo reaction was completed in 20 minutes at 39oC. The implementation of a cross contamination proof cassette to detect the RPA-nfo fluorescent amplicons provided an alternative to regular lateral flow detection strips, which are more prone to cross contamination. The RPA assays provide a highly time-efficient, sensitive and specific alternative to other methods for diagnosing scrub typhus or murine typhus. PMID:26161793

  18. Development of Recombinase Polymerase Amplification Assays for Detection of Orientia tsutsugamushi or Rickettsia typhi.

    PubMed

    Chao, Chien-Chung; Belinskaya, Tatyana; Zhang, Zhiwen; Ching, Wei-Mei

    2015-01-01

    Sensitive, specific and rapid diagnostic tests for the detection of Orientia tsutsugamushi (O. tsutsugamushi) and Rickettsia typhi (R. typhi), the causative agents of scrub typhus and murine typhus, respectively, are necessary to accurately and promptly diagnose patients and ensure that they receive proper treatment. Recombinase polymerase amplification (RPA) assays using a lateral flow test (RPA-nfo) and real-time fluorescent detection (RPA-exo) were developed targeting the 47-kDa gene of O. tsutsugamushi or 17 kDa gene of R. typhi. The RPA assay was capable of detecting O. tsutsugamushi or R. typhi at levels comparable to that of the quantitative PCR method. Both the RPA-nfo and RPA-exo methods performed similarly with regards to sensitivity when detecting the 17 kDa gene of R. typhi. On the contrary, RPA-exo performed better than RPA-nfo in detecting the 47 kDa gene of O. tsutsugamushi. The clinical performance of the O. tsutsugamushi RPA assay was evaluated using either human patient samples or infected mouse samples. Eight out of ten PCR confirmed positives were determined positive by RPA, and all PCR confirmed negative samples were negative by RPA. Similar results were obtained for R. typhi spiked patient sera. The assays were able to differentiate O. tsutsugamushi and R. typhi from other phylogenetically related bacteria as well as mouse and human DNA. Furthermore, the RPA-nfo reaction was completed in 20 minutes at 37°C followed by a 10 minute incubation at room temperature for development of an immunochromatographic strip. The RPA-exo reaction was completed in 20 minutes at 39°C. The implementation of a cross contamination proof cassette to detect the RPA-nfo fluorescent amplicons provided an alternative to regular lateral flow detection strips, which are more prone to cross contamination. The RPA assays provide a highly time-efficient, sensitive and specific alternative to other methods for diagnosing scrub typhus or murine typhus.

  19. Detection of enteroviral RNA by polymerase chain reaction in cerebrospinal fluid from patients with aseptic meningitis.

    PubMed

    Glimåker, M; Johansson, B; Olcén, P; Ehrnst, A; Forsgren, M

    1993-01-01

    An assay based on a 2-step (semi-nested) polymerase chain reaction (PCR) was developed and evaluated for detection of enterovirus-specific RNA in cerebrospinal fluid (CSF) from patients with aseptic meningitis of different etiology. The limit of detectability of enteroviral RNA was equivalent to about 0.25 tissue culture infective doses 50%. In samples, stored at -70 degrees C, analyzed without repeated thawing, enteroviral RNA was demonstrable in 21/22 CSF specimens from which an enterovirus had been isolated. Enteroviral RNA was shown to be degraded during freeze-thawing of the samples. In repeatedly freeze-thawed samples from 134 consecutive patients with aseptic meningitis, a lower sensitivity (34/48 = 0.71) was observed. In the latest phase of the study, comprising 35 consecutive patients, the PCR was performed in CSF stored at -20 degrees C without thawing. In this material, the PCR yielded positive results in 19 patients, whereas enteroviruses were isolated from 6 cases only. In the total clinical material of 169 patients, 67 (40%) were found positive by PCR, whereas an enterovirus was isolated from CSF in 54 (32%) cases. All the 13 isolated enterovirus serotypes found in the study were demonstrable by PCR, indicating that the assay is broad-reacting within the enterovirus group. The specificity appeared to be high, since all of 21 patients with non-enteroviral diagnoses were negative by the PCR test, except 1 with an Epstein-Barr virus infection. As serological evidence of enteroviral etiology was found in this patient, a dual infection seemed probable. This study indicates that enteroviral RNA can be detected in CSF by a 2-step PCR in meningitis caused by enterovirus and that the technique has the potential to become a screening method for routine diagnosis of enteroviral meningitis.

  20. Detection of Yersinia ruckeri in rainbow trout blood by use of the polymerase chain reaction.

    PubMed

    Altinok, I; Grizzle, J M; Liu, Z

    2001-01-26

    We evaluated a polymerase chain reaction (PCR) method for detecting Yersinia ruckeri, the bacterial pathogen causing enteric redmouth disease (ERM), in blood of rainbow trout Oncorhynchus mykiss. Identification of the PCR product was confirmed by Southern blot hybridization with a 32P-labeled oligonucleotide probe matching a sequence within the small subunit ribosomal RNA gene of Y. ruckeri. Following a 1 h immersion of rainbow trout in water with 4.5 x 10(6) colony-forming units of Y. ruckeri l(-1), the PCR was positive for all blood samples from 1 h (first sample) to 5 d and was negative from 9 to 30 d (last sample). Fish in this experiment did not show signs of disease, probably because they had been vaccinated against Y. ruckeri. To test this method with naturally infected fish, 42 rainbow trout from hatcheries were examined. Four of these fish had clinical signs of ERM and were infected with Y. ruckeri based on bacteriological culture. The PCR method detected Y. ruckeri in blood, intestine, liver, and trunk kidney from the 4 fish with ERM and from 5 additional rainbow trout that were bacteriologically negative for Y. ruckeri. Three of 5 rainbow trout from streams receiving effluent from hatcheries were positive for Y. ruckeri when tested with PCR, although there was no growth of Y. ruckeri on culture plates inoculated with the same samples. Samples were successfully stored for 1 wk in lysis buffer at 25 degrees C. This study demonstrated that a non-lethal blood sample can be used with PCR to detect Y. ruckeri.

  1. Polymerase chain reaction-free detection of hepatitis B virus DNA using a nanostructured impedance biosensor.

    PubMed

    Chen, Chun-Cheng; Lai, Zi-Lun; Wang, Gou-Jen; Wu, Chun-Ying

    2016-03-15

    A polymerase chain reaction (PCR)-free technique for the effective detection of genomic length hepatitis B virus (HBV) DNA is described in this study. The honeycomb-like barrier layer of an anodic aluminum oxide (AAO) film having a uniform nanohemisphere array was used as the substrate of the sensing electrode. A 30-nm gold film was sputtered onto the AAO barrier layer surface as the electrode, followed by electrochemical deposition of gold nanoparticles (GNPs) on the hemisphere surface. A specially designed single-strand 96-mer gene fragment of the target genomic DNA of HBV based on the genome sequences of HBV was immobilized on the nanostructured electrode as the capture probe. Target HBV DNA obtained from clinical samples was hybridized to the sensing probes. Detection results illustrate two dynamic linear ranges, 10(2)-10(3) and 10(3)-10(5.1) copies/mL, having R(2) values of 0.801 and 0.996 could be obtained, respectively. The detection limit of the proposed sending scheme was measured to be 111 copies/mL. The total of 45 target samples, including 20 samples with HBV concentration being lower than 10(2) copies/mL and 25 samples with HBV concentration being in the range of 10(3)-10(5.1) copies/mL, were used for real test. The concentration of these 45 HBV DNA samples was measured by the COBAS Ampliprep system. Comparing the measured results of the COBAS Ampliprep and our system, it was illustrated that the HBV DNA concentrations measured by the proposed method in this study had a high linear correlation with the COBAS Ampliprep, having R(2) values of 0.983. The proposed sensing scheme is highly feasible for future clinical applications.

  2. Multiplex Polymerase Chain Reaction for Detection of Gastrointestinal Pathogens in Migrant Workers in Qatar

    PubMed Central

    Humphrey, John M.; Ranbhise, Sanjay; Ibrahim, Emad; Al-Romaihi, Hamad E.; Farag, Elmoubasher; Abu-Raddad, Laith J.; Glesby, Marshall J.

    2016-01-01

    The causes of infectious diarrhea among the migrant worker population in Qatar are not well understood. We conducted a prospective observational study to understand the demographic and clinical characteristics and infectious causes of diarrhea among migrant workers in Doha, Qatar. A total of 126 male workers presenting to the Qatar Red Crescent Worker's Health Center outpatient clinic or emergency department were studied over a 5-month period in 2015–2016. Epidemiologic surveys were administered to all subjects and the prevalence of 22 different stool pathogens was determined using multiplex polymerase chain reaction (PCR) (FilmArray® Gastrointestinal PCR). A target pathogen was identified in 62.7% of subjects. Enteropathogenic Escherichia coli was the most prevalent pathogen and was detected in 24.6% of subjects, followed by Salmonella (22.2%), enteroaggregative E. coli (15.1%), Giardia lamblia (9.5%), and enterotoxigenic E. coli (8.7%). Multiple pathogens were identified in 49.3% of positive stool samples. In a multivariable analysis, the presence of a heart rate ≥ 90 (adjusted odds ratio [OR] = 3.7, 95% confidence interval [CI] = 1.4–10.0) and > 5 fecal leukocytes/high-power field (adjusted OR = 2.8, 95% CI = 1.2–7.0) were significant predictors of detecting an acute inflammatory pathogen by PCR. Use of multiplex PCR enabled the detection of gastrointestinal pathogens in a high proportion of cases, illustrating the utility of this diagnostic tool in epidemiologic studies of infectious diarrhea. PMID:27928081

  3. Use of the polymerase chain reaction to detect Mycobacterium leprae in urine.

    PubMed

    Caleffi, K R; Hirata, R D C; Hirata, M H; Caleffi, E R; Siqueira, V L D; Cardoso, R F

    2012-02-01

    Leprosy is an infectious disease caused by Mycobacterium leprae. The polymerase chain reaction (PCR) has been applied to detect M. leprae in different clinical samples and urine seems to be attractive for this purpose. PCR was used to improve the sensitivity for diagnosing leprosy by amplifying a 151-bp PCR fragment of the M. leprae pra gene (PCR-Pra) in urine samples. Seventy-three leprosy patients (39 males and 34 females, 14 to 78 years old) were selected for leprosy diagnosis at a reference laboratory in Maringá, PR, Brazil. Of these, 36 were under anti-leprosy multidrug therapy with dapsone and rifampicin for tuberculoid (TT) and dapsone, rifampicin and clofazimine for borderline (BB) and lepromatous (LL) forms. The control group contained 50 healthy individuals without any clinical history of leprosy. DNA isolated from leprosy patients' urine samples was successfully amplified by PCR-Pra in 46.6% (34/73) of the cases. The positivity of PCR-Pra for patients with the TT form was 75% for both patients under treatment and non-treated patients (P = 0.1306). In patients with the LL form, PCR-Pra positivity was 52 and 30% for patients under treatment and non-treated patients, respectively (P = 0.2386). PCR-Pra showed a statistically significant difference in detecting M. leprae between the TT and LL forms of leprosy in patients under treatment (P = 0.0033). Although the current study showed that the proposed PCR-Pra has some limitations in the detection of M. leprae, this method has the potential to be a useful tool for leprosy diagnosis mainly in TT leprosy where the AFB slit-skin smear is always negative.

  4. Interlaboratory validation data on real-time polymerase chain reaction detection for unauthorized genetically modified papaya line PRSV-YK.

    PubMed

    Nakamura, Kosuke; Kondo, Kazunari; Akiyama, Hiroshi; Ishigaki, Takumi; Noguchi, Akio; Katsumata, Hiroshi; Takasaki, Kazuto; Futo, Satoshi; Sakata, Kozue; Fukuda, Nozomi; Mano, Junichi; Kitta, Kazumi; Tanaka, Hidenori; Akashi, Ryo; Nishimaki-Mogami, Tomoko

    2016-06-01

    This article is referred to research article entitled "Whole genome sequence analysis of unidentified genetically modified papaya for development of a specific detection method" (Nakamura et al., 2016) [1]. Real-time polymerase chain reaction (PCR) detection method for unauthorized genetically modified (GM) papaya (Carica papaya L.) line PRSV-YK (PRSV-YK detection method) was developed using whole genome sequence data (DDBJ Sequenced Read Archive under accession No. PRJDB3976). Interlaboratory validation datasets for PRSV-YK detection method were provided. Data indicating homogeneity of samples prepared for interlaboratory validation were included. Specificity and sensitivity test data for PRSV-YK detection method were also provided.

  5. Transcriptional activation of RNA polymerase III-dependent genes by the human T-cell leukemia virus type 1 tax protein.

    PubMed Central

    Gottesfeld, J M; Johnson, D L; Nyborg, J K

    1996-01-01

    The human T-cell leukemia virus-encoded tax protein is a potent activator of many viral and cellular genes transcribed by RNA polymerase II. We find that both chromatin and cell extracts derived from human T-cell leukemia virus type 1-infected human T lymphocytes support higher levels of 5S rRNA and tRNA gene transcription than chromatin or extracts from uninfected T lymphocytes. The viral protein Tax was likely responsible for this higher level of class II gene transcription, as purified Tax was found to stimulate both genes when added to the uninfected cell extract or in reconstituted systems. Both limiting-component transcription assays and DNA binding assays identified the class III gene transcription factor TFIIIB as the principle target of Tax activity. Surprisingly, we find that Tax increases the effective concentration of active TFIIIB molecules. These data suggest that Tax stimulates RNA polymerase III-dependent gene expression by accelerating the rate and/or extent of transcription initiation complex assembly. PMID:8657153

  6. Dynamic optimization of on-chip polymerase chain reaction by monitoring intracycle fluorescence using fast synchronous detection

    NASA Astrophysics Data System (ADS)

    Mondal, Sudip; Paul, Debjani; Venkataraman, V.

    2007-01-01

    The authors report on-chip dynamic optimization of polymerase chain reaction (PCR) based on a feedback technique utilizing synchronous detection of intracycle fluorescence every 500ms. From a direct measurement of polymerase activity, the authors determine the optimum extension temperature. The authors dynamically optimize PCR in an inductively heated microchip by sensing the saturation of extension in each cycle and applying the feedback. They demonstrate that, even with fast ramp rates, dynamic optimization leads to faster reactions compared to fixed-duration extension protocols for long DNA (>500bp). This optimization scheme uses a fairly universal dye Sybr Green I and can be applied to most PCRs.

  7. Direct polymerase chain reaction for detection of toxigenic Corynebacterium diphtheriae strains from the Republic of Georgia after prolonged storage.

    PubMed

    Kobaidze, K; Popovic, T; Nakao, H; Quick, L

    2000-02-01

    A total of 226 paired nose and throat swab specimens from 113 clinical diphtheria cases from the republic of Georgia were analyzed by direct polymerase chain reaction targeting both A and B subunits of the diphtheria toxin gene, tox. Even after prolonged transport and extensive storage (7-14 months) of the clinical specimens in silica gel packages, direct polymerase chain reaction detected the diphtheria tox gene in 54% of the specimens. Specimens obtained by throat swab were three times more likely than those obtained by nose swab to be positive for Corynebacterium diphtheriae.

  8. Detecting and Number Counting of Single Engineered Nanoparticles by Digital Particle Polymerase Chain Reaction.

    PubMed

    Paunescu, Daniela; Mora, Carlos A; Querci, Lorenzo; Heckel, Reinhard; Puddu, Michela; Hattendorf, Bodo; Günther, Detlef; Grass, Robert N

    2015-10-27

    The concentrations of nanoparticles present in colloidal dispersions are usually measured and given in mass concentration (e.g. mg/mL), and number concentrations can only be obtained by making assumptions about nanoparticle size and morphology. Additionally traditional nanoparticle concentration measures are not very sensitive, and only the presence/absence of millions/billions of particles occurring together can be obtained. Here, we describe a method, which not only intrinsically results in number concentrations, but is also sensitive enough to count individual nanoparticles, one by one. To make this possible, the sensitivity of the polymerase chain reaction (PCR) was combined with a binary (=0/1, yes/no) measurement arrangement, binomial statistics and DNA comprising monodisperse silica nanoparticles. With this method, individual tagged particles in the range of 60-250 nm could be detected and counted in drinking water in absolute number, utilizing a standard qPCR device within 1.5 h of measurement time. For comparison, the method was validated with single particle inductively coupled plasma mass spectrometry (sp-ICPMS).

  9. Quantitative detection of human enteric adenoviruses in river water by microfluidic digital polymerase chain reaction.

    PubMed

    Kishida, Naohiro; Noda, Naohiro; Haramoto, Eiji; Kawaharasaki, Mamoru; Akiba, Michihiro; Sekiguchi, Yuji

    2014-01-01

    We describe an assay for simple and accurate quantification of human enteric adenoviruses (EAdVs) in water samples using a recently developed quantification method named microfluidic digital polymerase chain reaction (dPCR). The assay is based on automatic distribution of reaction mixture into a large number of nanolitre-volume reaction chambers and absolute copy number quantification from the number of chambers containing amplification products on the basis of Poisson statistics. This assay allows absolute quantification of target genes without the use of standard DNA. Concentrations of EAdVs in Japanese river water samples were successfully quantified by the developed dPCR assay. The EAdVs were detected in seven of the 10 samples (1 L each), and the concentration ranged from 420 to 2,700 copies/L. The quantified values closely resemble those by most probable number (MPN)-PCR and real-time PCR when standard DNA was validated by dPCR whereas they varied substantially when the standard was not validated. Accuracy and sensitivity of the dPCR was higher than those of real-time PCR and MPN-PCR. To our knowledge, this is the first study that has successfully quantified enteric viruses in river water using dPCR. This method will contribute to better understanding of existence of viruses in water.

  10. Detection of luciferase gene sequence in nonluminescent Vibrio cholerae by colony hygridization and polymerase chain reaction

    SciTech Connect

    Palmer, L.M.; Colwell, R.R. )

    1991-05-01

    Bioluminescence is a trait observed among approximately 10% of Vibrio cholerae isolates. We have demonstrated that not only do some strains of V. cholerae produce low levels of light, undetectable by the human eye, but the luciferase gene sequence is present in strains of V. cholerae which emit no detectable light, evidenced by hybridization with a luciferase DNA probe. Comparisons of the amino acid sequences of luciferase regions of amino acid identity. The polymerase chain reaction method of DNA amplification with oligonucleotide primers based on these regions was used to isolate a region of the luxA gene from both luminescent and nonluminescent V. cholerae strains. The nucleotide sequence of this region was determined and reveals that nonluminescent V. cholerae have 99.7% nucleotide sequence similarity in this region with the luminescent biovar V. cholerae by albensis as well as significant similarity to other species of bioluminescent bacteria, a finding that is in accord with the hypothesis that these species have a common luminescent ancestor, most probably from the marine environment.

  11. Detection of hepatitis E virus in raw and treated wastewater with the polymerase chain reaction.

    PubMed Central

    Jothikumar, N; Aparna, K; Kamatchiammal, S; Paulmurugan, R; Saravanadevi, S; Khanna, P

    1993-01-01

    The main objective of this study was to determine the applicability of the polymerase chain reaction (PCR) to detection of hepatitis E virus (HEV) in sewage treatment plants and establishment of the prevalence of hepatitis viral diseases in a population. Epidemics of HEV infection because of inadequate public sanitation have been reported in several developing countries. A procedure for concentration of HEV in sewage samples through adsorption to membrane filters, elution with urea-arginine phosphate buffer, and subsequent reconcentration with magnesium chloride enabled us to concentrate HEV to volumes in the microliter range. HEV-specific cDNA was prepared by reverse transcription of the total RNA extracted from samples. Specific DNA amplification by PCR in combination with slot blot hybridization was used to demonstrate the presence of HEV in sewage samples from the inlets and outlets of three sewage treatment plants. The assay was specific for HEV, and a 240-bp amplified product was visualized by ethidium bromide fluorescence. Sewage samples adjusted to pH 5.0 for adsorption of viruses to membrane filters were PCR positive, while samples adjusted to pH 3.5 were PCR negative. Images PMID:8368844

  12. Development of a polymerase chain reaction assay for the detection of pseudorabies virus in clinical samples

    PubMed Central

    Pérez, Lester J.; de Arce, Heidy Díaz

    2009-01-01

    Aujeszky’s disease, also known as pseudorabies causes severe economic losses in swine industry and affects the pig husbandry all over the world. The conventional diagnostic procedure is time-consuming and false-negative results may occur in submissions from latently infected animals. The development, optimization and evaluation of a polymerase chain reaction (PCR) assay are presented for the diagnosis of pseudorabies infection. This assay was based on the amplification of a highly conserved viral gD gene fragment. PCR products of the expected size were obtained from PRV strains. Non-specific reactions were not observed when a related herpesvirus, other porcine DNA genome viruses and uninfected cells were used to assess PCR. The analytical sensitivity of the test was estimated to be 1.34 TCID50/ 50 uL. The analysis of tissue homogenate samples from naturally infected animals proved the potential usefulness of the method for a rapid disease diagnosis from field cases. A rapid, sensitive and specific PCR-based diagnostic assay to detect pseudorabies virus in clinical samples is provided. PMID:24031383

  13. Development of a polymerase chain reaction assay for the detection of pseudorabies virus in clinical samples.

    PubMed

    Pérez, Lester J; de Arce, Heidy Díaz

    2009-07-01

    Aujeszky's disease, also known as pseudorabies causes severe economic losses in swine industry and affects the pig husbandry all over the world. The conventional diagnostic procedure is time-consuming and false-negative results may occur in submissions from latently infected animals. The development, optimization and evaluation of a polymerase chain reaction (PCR) assay are presented for the diagnosis of pseudorabies infection. This assay was based on the amplification of a highly conserved viral gD gene fragment. PCR products of the expected size were obtained from PRV strains. Non-specific reactions were not observed when a related herpesvirus, other porcine DNA genome viruses and uninfected cells were used to assess PCR. The analytical sensitivity of the test was estimated to be 1.34 TCID50/ 50 uL. The analysis of tissue homogenate samples from naturally infected animals proved the potential usefulness of the method for a rapid disease diagnosis from field cases. A rapid, sensitive and specific PCR-based diagnostic assay to detect pseudorabies virus in clinical samples is provided.

  14. Keratin gene expression in non-epithelial tissues. Detection with polymerase chain reaction.

    PubMed Central

    Traweek, S. T.; Liu, J.; Battifora, H.

    1993-01-01

    Keratin filament are characteristically present in epithelial cells and tumors, but have also been detected in many normal and neoplastic non-epithelial cell types using immunohistochemical techniques. To investigate the validity of this seemingly aberrant protein expression, we applied the highly sensitive polymerase chain reaction (PCR) technique to study keratin gene expression in a variety of non-epithelial tissues. Total RNA was extracted from nine samples of leiomyosarcoma, four non-Hodgkin's lymphoma, seven normal bone marrows, normal lymph node, normal peripheral blood cells, freshly isolated and cultured endothelial cells, cultured skin fibroblasts, and the myeloid leukemia cell line HL-60. Amplification primers and probes for the three most primitive keratin types (8, 18, and 19) were synthesized using published gene sequences. RNA from the breast carcinoma cell line MCF-7, known to be rich in all three keratins, was used as positive control. Concurrently run actin primers were used to confirm RNA integrity. After an initial cycle with reverse transcriptase, PCR amplification was performed for 30 cycles. Southern blots of the PCR products showed variably intense bands corresponding to keratin 8 and 18 gene products in all samples, offering conclusive evidence of keratin gene expression in cells of both stromal and hematopoietic derivation. However, keratin 19 gene transcription was not nearly so ubiquitous, being detected in normal fibroblasts and endothelial cells, two of four non-Hodgkin's lymphoma and four of nine leiomyosarcoma, but not in normal lymph node, peripheral blood cells, HL-60 cells, or any of the seven normal bone marrows examined. Dilutional experiments showed PCR to be highly sensitive in the detection of keratin 19 gene expression, capable of registering one MCF-7 cell in 10(6) HL-60 cells. These studies show that variable levels of keratin 8 and 18 gene expression may be detected by PCR in a wide variety of non-epithelial tissues

  15. Detection of MYCN Amplification in Serum DNA Using Conventional Polymerase Chain Reaction

    PubMed Central

    2016-01-01

    Neuroblastoma (NB) is the most common extra-cranial solid tumor of childhood and is characterized by a wide range of clinical behaviors. Amplification of MYCN is a well-known poor prognostic factor in NB patients. As the MYCN amplification status is usually tested using tumor specimens, lengthy and invasive procedures are unavoidable. To evaluate the possibility of detecting MYCN amplification without invasive procedure, we performed conventional polymerase chain reaction (PCR) analysis to identify MYCN amplification using the preserved serum DNA. PCR of serum DNA was done in 105 NB patients whose MYCN status had been confirmed by fluorescence in situ hybridization. MYCN amplification was evaluated as the ratio of signal intensities between MYCN and NAGK (M/N ratio). When regarding the tissue FISH results as a reference, 10 patients had MYCN-amplified (MNA) NB, and 95 had non-MNA NB. The M/N ratio of the MNA group (median 2.56, range 1.01-3.58) was significantly higher than that of the non-MNA group (median 0.97, range 0.67-5.18) (P < 0.001). In the receiver operating characteristic curve analysis, the area under the curve was 0.957 (95% confidence interval 0.898–1.000; P < 0.001), and it showed 90.9% sensitivity and 97.9% specificity with the selected cut-off value set as 1.6. The detection of MYCN amplification using conventional PCR analysis of serum samples seems to be a simple and promising method to evaluate the MYCN status of NB patients. Further study with a larger set of patients is needed to confirm the accuracy of this result. PMID:27510381

  16. Detection of trypanosomes in suspected sleeping sickness patients in Uganda using the polymerase chain reaction.

    PubMed Central

    Kyambadde, J. W.; Enyaru, J. C.; Matovu, E.; Odiit, M.; Carasco, J. F.

    2000-01-01

    Diagnosis of sleeping sickness (trypanosomiasis) is difficult because of the fluctuating levels of parasitaemia encountered in patients. In the present study we found that the polymerase chain reaction (PCR) demonstrated trypanosome infection in 20 out of 35 (57.1%) blood samples and in 21 out of 34 (61.7%) cerebrospinal fluid (CSF) samples collected from an area endemic for sleeping sickness in north-west Uganda. A total of 14 blood samples and 13 CSF samples that were positive for trypanosomes by double centrifugation were also positive by PCR, demonstrating good concordance between the two methods. However, 6 (28.6%) of the 21 blood samples that were parasitologically negative were positive by PCR, while 8 (38.0%) out of 21 CSF samples that were negative by double centrifugation were positive by PCR. These 14 negative samples could therefore be from sleeping sickness cases even though a positive PCR test is not evidence for the presence of trypanosomes. Furthermore, of these 8 CSF samples, 4 had been designated as early cases, based on the absence of trypanosomes and on a count of < or = 5 white blood cells (WBC) per microliter. This suggests that some late-stage cases could potentially be missed according to the present criteria, and it is therefore important to perform clinical trials to determine whether these cases could be treated successfully with the first-stage drug alone. The remaining four CSF samples had been classified as late-stage cases, based on a count of > 6 WBC per microliter, even though trypanosomes could not be detected in these samples by either double centrifugation or PCR. A cut-off point of 5 WBC per microliter, which is used as a rule of thumb to stage sleeping sickness patients, seems to leave some late-stage cases undetected since trypanosomes were detected in four CSF samples from suspected cases with < 5 WBC per microliter. PMID:10686746

  17. Reverse transcription-polymerase chain reaction detection of transcribed sequences on human chromosome 21

    SciTech Connect

    Cheng, J.F.; Zhu, Y. )

    1994-03-15

    Seventy-four pairs of oligonucleotides derived from sequence-tagged sites (STSs) on the long arm of human chromosome 21, specifically from bands 21q22.1 to 21q22.3, were used in reverse transcription-polymerase chain reactions (RT-PCR) to detect the presence of expressed sequences in a fetal brain. These STSs included 69 that had not been related to transcribed sequences and 5 that had detected two known genes and three previously isolated cDNA clones. Of the 69 STSs analyzed in RT-PCR, 25 allowed amplification of specific cDNA fragments. The sizes of amplified cDNA fragments match those amplified from either human genomic DNA or somatic hybrid cells containing human chromosome 21. Of the 11 cDNA analyzed in Northern blot hybridizations, 6 hybridized to specific RNA species. The rapid screening for cDNA using previously mapped STSs has provided insight into the distribution of expressed sequences in this region of chromosome 21. Northern blot analysis of the amplified cDNA fragments has revealed interesting candidate genes in two disease loci. The marker D21S267 was previously mapped in the Down syndrome region of chromosome 21, and the marker D21S113 is closely linked to progressive myoclonus epilepsy. The cDNA fragments amplified using the primer sequences derived from D21S267 and D21S113 hybridized to 7- and 6.5-kb transcripts, respectively, which seems to express predominantly in brain. 37 refs., 3 figs., 1 tab.

  18. Field-Applicable Recombinase Polymerase Amplification Assay for Rapid Detection of Mycoplasma capricolum subsp. capripneumoniae.

    PubMed

    Liljander, Anne; Yu, Mingyan; O'Brien, Elizabeth; Heller, Martin; Nepper, Julia F; Weibel, Douglas B; Gluecks, Ilona; Younan, Mario; Frey, Joachim; Falquet, Laurent; Jores, Joerg

    2015-09-01

    Contagious caprine pleuropneumonia (CCPP) is a highly contagious disease caused by Mycoplasma capricolum subsp. capripneumoniae that affects goats in Africa and Asia. Current available methods for the diagnosis of Mycoplasma infection, including cultivation, serological assays, and PCR, are time-consuming and require fully equipped stationary laboratories, which make them incompatible with testing in the resource-poor settings that are most relevant to this disease. We report a rapid, specific, and sensitive assay employing isothermal DNA amplification using recombinase polymerase amplification (RPA) for the detection of M. capricolum subsp. capripneumoniae. We developed the assay using a specific target sequence in M. capricolum subsp. capripneumoniae, as found in the genome sequence of the field strain ILRI181 and the type strain F38 and that was further evidenced in 10 field strains from different geographical regions. Detection limits corresponding to 5 × 10(3) and 5 × 10(4) cells/ml were obtained using genomic DNA and bacterial culture from M. capricolum subsp. capripneumoniae strain ILRI181, while no amplification was obtained from 71 related Mycoplasma isolates or from the Acholeplasma or the Pasteurella isolates, demonstrating a high degree of specificity. The assay produces a fluorescent signal within 15 to 20 min and worked well using pleural fluid obtained directly from CCPP-positive animals without prior DNA extraction. We demonstrate that the diagnosis of CCPP can be achieved, with a short sample preparation time and a simple read-out device that can be powered by a car battery, in <45 min in a simulated field setting.

  19. Detection of trypanosomes in suspected sleeping sickness patients in Uganda using the polymerase chain reaction.

    PubMed

    Kyambadde, J W; Enyaru, J C; Matovu, E; Odiit, M; Carasco, J F

    2000-01-01

    Diagnosis of sleeping sickness (trypanosomiasis) is difficult because of the fluctuating levels of parasitaemia encountered in patients. In the present study we found that the polymerase chain reaction (PCR) demonstrated trypanosome infection in 20 out of 35 (57.1%) blood samples and in 21 out of 34 (61.7%) cerebrospinal fluid (CSF) samples collected from an area endemic for sleeping sickness in north-west Uganda. A total of 14 blood samples and 13 CSF samples that were positive for trypanosomes by double centrifugation were also positive by PCR, demonstrating good concordance between the two methods. However, 6 (28.6%) of the 21 blood samples that were parasitologically negative were positive by PCR, while 8 (38.0%) out of 21 CSF samples that were negative by double centrifugation were positive by PCR. These 14 negative samples could therefore be from sleeping sickness cases even though a positive PCR test is not evidence for the presence of trypanosomes. Furthermore, of these 8 CSF samples, 4 had been designated as early cases, based on the absence of trypanosomes and on a count of < or = 5 white blood cells (WBC) per microliter. This suggests that some late-stage cases could potentially be missed according to the present criteria, and it is therefore important to perform clinical trials to determine whether these cases could be treated successfully with the first-stage drug alone. The remaining four CSF samples had been classified as late-stage cases, based on a count of > 6 WBC per microliter, even though trypanosomes could not be detected in these samples by either double centrifugation or PCR. A cut-off point of 5 WBC per microliter, which is used as a rule of thumb to stage sleeping sickness patients, seems to leave some late-stage cases undetected since trypanosomes were detected in four CSF samples from suspected cases with < 5 WBC per microliter.

  20. Comparison of Nested Polymerase Chain Reaction and Real-Time Polymerase Chain Reaction with Parasitological Methods for Detection of Strongyloides stercoralis in Human Fecal Samples

    PubMed Central

    Sharifdini, Meysam; Mirhendi, Hossein; Ashrafi, Keyhan; Hosseini, Mostafa; Mohebali, Mehdi; Khodadadi, Hossein; Kia, Eshrat Beigom

    2015-01-01

    This study was performed to evaluate nested polymerase chain reaction (PCR) and real-time PCR methods for detection of Strongyloides stercoralis in fecal samples compared with parasitological methods. A total of 466 stool samples were examined by conventional parasitological methods (formalin ether concentration [FEC] and agar plate culture [APC]). DNA was extracted using an in-house method, and mitochondrial cytochrome c oxidase subunit 1 and 18S ribosomal genes were amplified by nested PCR and real-time PCR, respectively. Among 466 samples, 12.7% and 18.2% were found infected with S. stercoralis by FEC and APC, respectively. DNA of S. stercoralis was detected in 18.9% and 25.1% of samples by real-time PCR and nested PCR, respectively. Considering parasitological methods as the diagnostic gold standard, the sensitivity and specificity of nested PCR were 100% and 91.6%, respectively, and that of real-time PCR were 84.7% and 95.8%, respectively. However, considering sequence analyzes of the selected nested PCR products, the specificity of nested PCR is increased. In general, molecular methods were superior to parasitological methods. They were more sensitive and more reliable in detection of S. stercoralis in comparison with parasitological methods. Between the two molecular methods, the sensitivity of nested PCR was higher than real-time PCR. PMID:26350449

  1. Comparison of Nested Polymerase Chain Reaction and Real-Time Polymerase Chain Reaction with Parasitological Methods for Detection of Strongyloides stercoralis in Human Fecal Samples.

    PubMed

    Sharifdini, Meysam; Mirhendi, Hossein; Ashrafi, Keyhan; Hosseini, Mostafa; Mohebali, Mehdi; Khodadadi, Hossein; Kia, Eshrat Beigom

    2015-12-01

    This study was performed to evaluate nested polymerase chain reaction (PCR) and real-time PCR methods for detection of Strongyloides stercoralis in fecal samples compared with parasitological methods. A total of 466 stool samples were examined by conventional parasitological methods (formalin ether concentration [FEC] and agar plate culture [APC]). DNA was extracted using an in-house method, and mitochondrial cytochrome c oxidase subunit 1 and 18S ribosomal genes were amplified by nested PCR and real-time PCR, respectively. Among 466 samples, 12.7% and 18.2% were found infected with S. stercoralis by FEC and APC, respectively. DNA of S. stercoralis was detected in 18.9% and 25.1% of samples by real-time PCR and nested PCR, respectively. Considering parasitological methods as the diagnostic gold standard, the sensitivity and specificity of nested PCR were 100% and 91.6%, respectively, and that of real-time PCR were 84.7% and 95.8%, respectively. However, considering sequence analyzes of the selected nested PCR products, the specificity of nested PCR is increased. In general, molecular methods were superior to parasitological methods. They were more sensitive and more reliable in detection of S. stercoralis in comparison with parasitological methods. Between the two molecular methods, the sensitivity of nested PCR was higher than real-time PCR.

  2. Sequence-specific detection of individual DNA polymerase complexes in real time using a nanopore

    NASA Astrophysics Data System (ADS)

    Benner, Seico; Chen, Roger J. A.; Wilson, Noah A.; Abu-Shumays, Robin; Hurt, Nicholas; Lieberman, Kate R.; Deamer, David W.; Dunbar, William B.; Akeson, Mark

    2007-11-01

    Nanoscale pores have potential to be used as biosensors and are an established tool for analysing the structure and composition of single DNA or RNA molecules. Recently, nanopores have been used to measure the binding of enzymes to their DNA substrates. In this technique, a polynucleotide bound to an enzyme is drawn into the nanopore by an applied voltage. The force exerted on the charged backbone of the polynucleotide by the electric field is used to examine the enzyme-polynucleotide interactions. Here we show that a nanopore sensor can accurately identify DNA templates bound in the catalytic site of individual DNA polymerase molecules. Discrimination among unbound DNA, binary DNA/polymerase complexes, and ternary DNA/polymerase/deoxynucleotide triphosphate complexes was achieved in real time using finite state machine logic. This technique is applicable to numerous enzymes that bind or modify DNA or RNA including exonucleases, kinases and other polymerases.

  3. Rapid isothermal detection of Phytophthora species on plant samples using recombinase polymerase amplification

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Recently several isothermal amplification techniques have been developed that are extremely tolerant towards inhibitors present in many plant extracts. Recombinase polymerase amplification (RPA) assays for the genus Phytophthora have been developed which provide a simple and rapid method to macerate...

  4. Novel application of Phi29 DNA polymerase: RNA detection and analysis in vitro and in situ by target RNA-primed RCA

    PubMed Central

    Lagunavicius, Arunas; Merkiene, Egle; Kiveryte, Zivile; Savaneviciute, Agne; Zimbaite-Ruskuliene, Vilma; Radzvilavicius, Tomas; Janulaitis, Arvydas

    2009-01-01

    We present a novel Phi29 DNA polymerase application in RCA-based target RNA detection and analysis. The 3′→5′ RNase activity of Phi29 DNA polymerase converts target RNA into a primer and the polymerase uses this newly generated primer for RCA initiation. Therefore, using target RNA-primed RCA, padlock probes may be targeted to inner RNA sequences and their peculiarities can be analyzed directly. We demonstrate that the exoribonucleolytic activity of Phi29 DNA polymerase can be successfully applied in vitro and in situ. These findings expand the potential for detection and analysis of RNA sequences distanced from 3′-end. PMID:19244362

  5. Detection of submicroscopic lymph node metastases with polymerase chain reaction in patients with malignant melanoma.

    PubMed Central

    Wang, X; Heller, R; VanVoorhis, N; Cruse, C W; Glass, F; Fenske, N; Berman, C; Leo-Messina, J; Rappaport, D; Wells, K

    1994-01-01

    BACKGROUND. The presence or absence of lymph node metastases in patients with malignant melanoma is the most powerful prognostic factor for predicting survival. If regional nodal metastases are found, the 5-year survival for the patient decreases approximately 50%. If the presence or absence of regional nodal metastases will determine which patients receive formal dissections or which patients enter adjuvant trials, then a technique is needed to accurately screen lymph node samples for occult disease. Routine histopathologic examination routinely underestimates the number of patients with metastases. This study was initiated to develop a highly sensitive clinically applicable method to detect micrometastases by examining lymph nodes for the presence of tyrosinase messenger RNA (mRNA). The hypothesis was that if mRNA for tyrosinase is found in the lymph node preparation, that finding is good evidence that metastatic melanoma cells are present. METHODS. The assay is accomplished using the combination of reverse transcription and double-round polymerase chain reaction (RT-PCR). The amplified samples are examined on a 2% agarose gel and tyrosinase cDNA is seen as a 207 base pair fragment. Lymph node preparations from 29 patients who were clinically stage I and II and undergoing elective node dissections were analyzed both by standard pathologic staining and RT-PCR. RESULTS. Eleven of 29 lymph node (38%) samples from 29 patients with intermediate thickness melanoma were pathologically positive. Nineteen of the 29 lymph node preparations (66%) were RT-PCR-positive, and these included all of the pathologically positive samples, so that the false-negative rate was 0. In a spiking experiment, one SK-Mel-28 melanoma cell in a background of one million normal lymphocytes could be detected, thus indicating the sensitivity of this method. In addition, analysis by restriction enzyme mapping showed that the amplified 207-bp PCR product produced is part of the tyrosinase gene

  6. Detection of Babesia bigemina-infected carriers by polymerase chain reaction amplification.

    PubMed Central

    Figueroa, J V; Chieves, L P; Johnson, G S; Buening, G M

    1992-01-01

    A SpeI-AvaI fragment (0.3 kbp) from pBbi16 (a pBR322 derivative containing a 6.3-kbp Babesia bigemina DNA insert) was subcloned into the pBluescript phagemid vector and was sequenced by the dideoxy-mediated chain termination method. Two sets of primers were designed for the polymerase chain reaction (PCR) assay. Primer set IA-IB was used to amplify a 278-bp DNA fragment, and primer set IAN-IBN was used to prepare a probe directed to a site within the PCR-amplified target DNA. Digoxigenin-dUTP was incorporated into the probe during the amplification reaction. PCR amplification of target DNA obtained from in vitro-cultured B. bigemina and nucleic acid hybridization of amplified product with the nonradioactive DNA probe showed that a 278-bp fragment could be detected when as little as 100 fg of parasite genomic DNA was used in the assay. A fragment of similar size was amplified from genomic DNAs from several B. bigemina isolates but not from DNAs from Babesia bovis, Anaplasma marginale, or six species of bacteria or bovine leukocytes. Similarly, the PCR product could be detected in DNA samples purified from 200 microliters of blood with a parasitemia of as low as 1 in 10(8) cells and which contained an estimated 30 B. bigemina-infected erythrocytes. By a direct PCR method, B. bigemina DNA was amplified from 20 microliters of packed erythrocytes with a calculated parasitemia of 1 in 10(9) cells. With the analytical sensitivity level of the PCR-DNA probe assay, six cattle with inapparent, 11-month chronic B. bigemina infection were found to be positive. No PCR product was observed in bovine blood samples collected from a splenectomized, A. marginale-infected bovine, a 4-year chronic B. bovis-infected animal, or 20 uninfected cattle from Missouri which were subjected to amplification. The PCR-DNA probe assay was shown to be sensitive in detecting latently infected cattle. The specificity and high analytical sensitivity of the test provide valuable tools for performing

  7. Early detection of Brucella canis via quantitative polymerase chain reaction analysis.

    PubMed

    Kauffman, L K; Bjork, J K; Gallup, J M; Boggiatto, P M; Bellaire, B H; Petersen, C A

    2014-02-01

    Canine brucellosis is a reportable zoonotic disease that can lead to canine reproductive losses and human infection through contact with infected urine or other genitourinary secretions. Although many locations require testing and euthanasia of positive dogs, current diagnosis is limited by the time required for seroconversion, for example, presence of B. canis-specific antibodies. The goal of this study was to determine the diagnostic ability of Brucella canis-specific quantitative polymerase chain reaction (qPCR) assay to detect B. canis in field samples prior to serological positivity for faster diagnosis and prevention of transmission within kennels or in households. Two kennels, one of which was located in the owner's home, were sampled following observation of suggestive clinical signs and positive serology of at least one dog. Specimens obtained were comparatively analysed via serology and qPCR analysis. 107 dogs were analysed for B. canis infection via qPCR: 105 via whole-blood samples, 65 via vaginal swab, six via urine and seven via genitourinary tract tissue taken at necropsy. Forty-five dogs were found to be infected with canine brucellosis via qPCR, of which 22 (48.89%) were seropositive. A statistically significant number (P = 0.0228) of qPCR-positive dogs, 5/25 (20.00%), seroconverted within a 30-day interval after initial serologic testing. As compared to serology, qPCR analysis of DNA from vaginal swabs had a sensitivity of 92.31% and specificity of 51.92%, and qPCR analysis of DNA from whole-blood samples had a sensitivity of 16.67% and specificity of 100%. B. canis outer membrane protein 25 DNA qPCR from non-invasive vaginal swab and urine samples provided early detection of B. canis infection in dogs prior to detection of antibodies. This assay provides a critical tool to decrease zoonotic spread of canine brucellosis, its associated clinical presentation(s), and emotional and economic repercussions.

  8. Maf1-mediated regulation of yeast RNA polymerase III is correlated with CCA addition at the 3' end of tRNA precursors.

    PubMed

    Foretek, Dominika; Nuc, Przemysław; Żywicki, Marek; Karlowski, Wojciech M; Kudla, Grzegorz; Boguta, Magdalena

    2016-08-27

    In eukaryotic cells tRNA synthesis is negatively regulated by the protein Maf1, conserved from yeast to humans. Maf1 from yeast Saccharomyces cerevisiae mediates repression of trna transcription when cells are transferred from medium with glucose to medium with glycerol, a non-fermentable carbon source. The strain with deleted gene encoding Maf1 (maf1Δ) is viable but accumulates tRNA precursors. In this study tRNA precursors were analysed by RNA-Seq and Northern hybridization in wild type strain and maf1Δ mutant grown in glucose medium or upon shift to repressive conditions. A negative effect of maf1Δ mutant on the addition of the auxiliary CCA nucleotides to the 3' end of pre-tRNAs was observed in cells shifted to unfavourable growth conditions. This effect was reduced by overexpression of the yeast CCA1 gene encoding ATP(CTP):tRNA nucleotidyltransferase. The CCA sequence at the 3' end is important for export of tRNA precursors from the nucleus and essential for tRNA charging with amino acids. Data presented here indicate that CCA-addition to intron-containing end-processed tRNA precursors is a limiting step in tRNA maturation when there is no Maf1 mediated RNA polymerase III (Pol III) repression. The correlation between CCA synthesis and Pol III regulation by Maf1 could be important in coordination of tRNA transcription, processing and regulation of translation.

  9. Detection of Food Hazards in Foods: Comparison of Real Time Polymerase Chain Reaction and Cultural Methods

    PubMed Central

    Bonilauri, Paolo; Bardasi, Lia; Leonelli, Roberto; Ramini, Mattia; Luppi, Andrea; Merialdi, Giuseppe

    2016-01-01

    Foodstuffs should not contain microorganisms or their toxins or metabolites in quantities suggesting an unacceptable risk for human health. The detection of food hazards in foods is performed by several tests that produce results dependent on the analytical method used: an analytical reference method, defined as standard, is associated with each microbiological criterion laid down in Regulation 2073/2005/EC, but, analytical methods other than the reference ones, in particular more rapid methods, could be used. Combined screening methods performed by real time-polymerase chain reaction (RT-PCR) are currently validated as alternative methods according to the ISO 16140:2003 and certified by the Association Française de Normalisation. However, the positive results obtained with these alternative methods, the investigated molecular relations that resulted positive have to be confirmed with cultural methods using the same enrichment media in which the molecular screening was performed. Since it is necessary to assess if these testing schemes provide equivalent guarantees of food safety, the aim of this retrospective study is to analyse the data collected, from 2012 to 2014 by Emilia Romagna Region in the field of Piano Regionale Alimenti (Food Regional Plan) during official controls monitoring food samples of animal and other than animal origin. Records performed by combined methods of molecular screening of Salmonella spp., Listeria monocytogenes and thermophilic Campylobacter and cultural confirmation results were gathered together and the results were compared in order to assess the sensitivity of the methods. A total of 10,604 food samples were considered in this study: the comparison of the data revealed that the RT-PCR method detected Salmonella, L. monocytogenes, and thermophilic Campylobacter in 2.18, 3.85 and 3.73% of the samples, respectively, whereas by using cultural method these pathogens were isolated in 0.43, 1.57 and 1.57% of samples, respectively. In

  10. Detection of Food Hazards in Foods: Comparison of Real Time Polymerase Chain Reaction and Cultural Methods.

    PubMed

    Bonilauri, Paolo; Bardasi, Lia; Leonelli, Roberto; Ramini, Mattia; Luppi, Andrea; Giacometti, Federica; Merialdi, Giuseppe

    2016-01-18

    Foodstuffs should not contain microorganisms or their toxins or metabolites in quantities suggesting an unacceptable risk for human health. The detection of food hazards in foods is performed by several tests that produce results dependent on the analytical method used: an analytical reference method, defined as standard, is associated with each microbiological criterion laid down in Regulation 2073/2005/EC, but, analytical methods other than the reference ones, in particular more rapid methods, could be used. Combined screening methods performed by real time-polymerase chain reaction (RT-PCR) are currently validated as alternative methods according to the ISO 16140:2003 and certified by the Association Française de Normalisation. However, the positive results obtained with these alternative methods, the investigated molecular relations that resulted positive have to be confirmed with cultural methods using the same enrichment media in which the molecular screening was performed. Since it is necessary to assess if these testing schemes provide equivalent guarantees of food safety, the aim of this retrospective study is to analyse the data collected, from 2012 to 2014 by Emilia Romagna Region in the field of Piano Regionale Alimenti (Food Regional Plan) during official controls monitoring food samples of animal and other than animal origin. Records performed by combined methods of molecular screening of Salmonella spp., Listeria monocytogenes and thermophilic Campylobacter and cultural confirmation results were gathered together and the results were compared in order to assess the sensitivity of the methods. A total of 10,604 food samples were considered in this study: the comparison of the data revealed that the RT-PCR method detected Salmonella, L. monocytogenes, and thermophilic Campylobacter in 2.18, 3.85 and 3.73% of the samples, respectively, whereas by using cultural method these pathogens were isolated in 0.43, 1.57 and 1.57% of samples, respectively. In

  11. Widespread Use of TATA Elements in the Core Promoters for RNA Polymerases III, II, and I in Fission Yeast

    PubMed Central

    Hamada, Mitsuhiro; Huang, Ying; Lowe, Todd M.; Maraia, Richard J.

    2001-01-01

    In addition to directing transcription initiation, core promoters integrate input from distal regulatory elements. Except for rare exceptions, it has been generally found that eukaryotic tRNA and rRNA genes do not contain TATA promoter elements and instead use protein-protein interactions to bring the TATA-binding protein (TBP), to the core promoter. Genomewide analysis revealed TATA elements in the core promoters of tRNA and 5S rRNA (Pol III), U1 to U5 snRNA (Pol II), and 37S rRNA (Pol I) genes in Schizosaccharomyces pombe. Using tRNA-dependent suppression and other in vivo assays, as well as in vitro transcription, we demonstrated an obligatory requirement for upstream TATA elements for tRNA and 5S rRNA expression in S. pombe. The Pol III initiation factor Brf is found in complexes with TFIIIC and Pol III in S. pombe, while TBP is not, consistent with independent recruitment of TBP by TATA. Template commitment assays are consistent with this and confirm that the mechanisms of transcription complex assembly and initiation by Pol III in S. pombe differ substantially from those in other model organisms. The results were extended to large-rRNA synthesis, as mutation of the TATA element in the Pol I promoter also abolishes rRNA expression in fission yeast. A survey of other organisms' genomes reveals that a substantial number of eukaryotes may use widespread TATAs for transcription. These results indicate the presence of TATA-unified transcription systems in contemporary eukaryotes and provide insight into the residual need for TBP by all three Pols in other eukaryotes despite a lack of TATA elements in their promoters. PMID:11564871

  12. RPC53 encodes a subunit of Saccharomyces cerevisiae RNA polymerase C (III) whose inactivation leads to a predominantly G1 arrest.

    PubMed Central

    Mann, C; Micouin, J Y; Chiannilkulchai, N; Treich, I; Buhler, J M; Sentenac, A

    1992-01-01

    RPC53 is shown to be an essential gene encoding the C53 subunit specifically associated with yeast RNA polymerase C (III). Temperature-sensitive rpc53 mutants were generated and showed a rapid inhibition of tRNA synthesis after transfer to the restrictive temperature. Unexpectedly, the rpc53 mutants preferentially arrested their cell division in the G1 phase as large, round, unbudded cells. The RPC53 DNA sequence is predicted to code for a hydrophilic M(r)-46,916 protein enriched in charged amino acid residues. The carboxy-terminal 136 amino acids of C53 are significantly similar (25% identical amino acid residues) to the same region of the human BN51 protein. The BN51 cDNA was originally isolated by its ability to complement a temperature-sensitive hamster cell mutant that undergoes a G1 cell division arrest, as is true for the rpc53 mutants. Images PMID:1406624

  13. Devoted to the lagging strand-the subunit of DNA polymerase III holoenzyme contacts SSB to promote processive elongation and sliding clamp assembly.

    PubMed Central

    Kelman, Z; Yuzhakov, A; Andjelkovic, J; O'Donnell, M

    1998-01-01

    Escherichia coli DNA polymerase III holoenzyme contains 10 different subunits which assort into three functional components: a core catalytic unit containing DNA polymerase activity, the beta sliding clamp that encircles DNA for processive replication, and a multisubunit clamp loader apparatus called gamma complex that uses ATP to assemble the beta clamp onto DNA. We examine here the function of the psi subunit of the gamma complex clamp loader. Omission of psi from the holoenzyme prevents contact with single-stranded DNA-binding protein (SSB) and lowers the efficiency of clamp loading and chain elongation under conditions of elevated salt. We also show that the product of a classic point mutant of SSB, SSB-113, lacks strong affinity for psi and is defective in promoting clamp loading and processive replication at elevated ionic strength. SSB-113 carries a single amino acid replacement at the penultimate residue of the C-terminus, indicating the C-terminus as a site of interaction with psi. Indeed, a peptide of the 15 C-terminal residues of SSB is sufficient to bind to psi. These results establish a role for the psi subunit in contacting SSB, thus enhancing the clamp loading and processivity of synthesis of the holoenzyme, presumably by helping to localize the holoenzyme to sites of SSB-coated ssDNA. PMID:9545254

  14. The Roles of RNA Polymerase I and III Subunits Polr1c and Polr1d in Craniofacial Development and in Zebrafish Models of Treacher Collins Syndrome

    PubMed Central

    Achilleos, Annita; Neben, Cynthia L.; Merrill, Amy E.; Trainor, Paul A.

    2016-01-01

    Ribosome biogenesis is a global process required for growth and proliferation of all cells, yet perturbation of ribosome biogenesis during human development often leads to tissue-specific defects termed ribosomopathies. Transcription of the ribosomal RNAs (rRNAs) by RNA polymerases (Pol) I and III, is considered a rate limiting step of ribosome biogenesis and mutations in the genes coding for RNA Pol I and III subunits, POLR1C and POLR1D cause Treacher Collins syndrome, a rare congenital craniofacial disorder. Our understanding of the functions of individual RNA polymerase subunits, however, remains poor. We discovered that polr1c and polr1d are dynamically expressed during zebrafish embryonic development, particularly in craniofacial tissues. Consistent with this pattern of activity, polr1c and polr1d homozygous mutant zebrafish exhibit cartilage hypoplasia and cranioskeletal anomalies characteristic of humans with Treacher Collins syndrome. Mechanistically, we discovered that polr1c and polr1d loss-of-function results in deficient ribosome biogenesis, Tp53-dependent neuroepithelial cell death and a deficiency of migrating neural crest cells, which are the primary progenitors of the craniofacial skeleton. More importantly, we show that genetic inhibition of tp53 can suppress neuroepithelial cell death and ameliorate the skeletal anomalies in polr1c and polr1d mutants, providing a potential avenue to prevent the pathogenesis of Treacher Collins syndrome. Our work therefore has uncovered tissue-specific roles for polr1c and polr1d in rRNA transcription, ribosome biogenesis, and neural crest and craniofacial development during embryogenesis. Furthermore, we have established polr1c and polr1d mutant zebrafish as models of Treacher Collins syndrome together with a unifying mechanism underlying its pathogenesis and possible prevention. PMID:27448281

  15. Prenatal detection of trisomy 21 and 18 from amniotic fluid by quantitative fluorescent polymerase chain reaction.

    PubMed Central

    Tóth, T; Findlay, I; Papp, C; Tóth-Pál, E; Marton, T; Nagy, B; Quirke, P; Papp, Z

    1998-01-01

    Prenatal diagnosis of fetal trisomies is usually performed by cytogenetic analysis on amniotic fluid. This requires lengthy laboratory procedures and high costs, and is unsuitable for large scale screening of pregnant women. An alternative method, which is both rapid and inexpensive and suitable for diagnosing trisomies even from single fetal cells, is the fluorescent polymerase chain reaction using polymorphic small tandem repeats (STRs). In this paper we present the preliminary results of a larger study comparing parallel prenatal diagnoses of trisomies 21 and 18 using cytogenetics with quantitative fluorescent polymerase chain reaction using STR markers. The results obtained by the two techniques were concordant in all cases. This is the first study reporting significant numbers of prenatal diagnoses using the quantitative fluorescent polymerase chain reaction. We believe that further studies on greater numbers of samples will determine the absolute reliability of this technique. These results also provide a model for diagnosis of trisomy from single fetal cells isolated from maternal blood. PMID:9507392

  16. TRE5-A retrotransposition profiling reveals putative RNA polymerase III transcription complex binding sites on the Dictyostelium extrachromosomal rDNA element.

    PubMed

    Spaller, Thomas; Groth, Marco; Glöckner, Gernot; Winckler, Thomas

    2017-01-01

    The amoeba Dictyostelium discoideum has a haploid genome in which two thirds of the DNA encodes proteins. Consequently, the space available for selfish mobile elements to expand without excess damage to the host genome is limited. The non-long terminal repeat retrotransposon TRE5-A maintains an active population in the D. discoideum genome and apparently adapted to this gene-dense environment by targeting positions ~47 bp upstream of tRNA genes that are devoid of protein-coding regions. Because only ~24% of tRNA genes are associated with a TRE5-A element in the reference genome, we evaluated whether TRE5-A retrotransposition is limited to this subset of tRNA genes. We determined that a tagged TRE5-A element (TRE5-Absr) integrated at 384 of 405 tRNA genes, suggesting that expansion of the current natural TRE5-A population is not limited by the availability of targets. We further observed that TRE5-Absr targets the ribosomal 5S gene on the multicopy extrachromosomal DNA element that carries the ribosomal RNA genes, indicating that TRE5-A integration may extend to the entire RNA polymerase III (Pol III) transcriptome. We determined that both natural TRE5-A and cloned TRE5-Absr retrotranspose to locations on the extrachromosomal rDNA element that contain tRNA gene-typical A/B box promoter motifs without displaying any other tRNA gene context. Based on previous data suggesting that TRE5-A targets tRNA genes by locating Pol III transcription complexes, we propose that A/B box loci reflect Pol III transcription complex assembly sites that possess a function in the biology of the extrachromosomal rDNA element.

  17. Reverse Transcription Polymerase Chain Reaction-based System for Simultaneous Detection of Multiple Lily-infecting Viruses

    PubMed Central

    Kwon, Ji Yeon; Ryu, Ki Hyun; Choi, Sun Hee

    2013-01-01

    A detection system based on a multiplex reverse transcription (RT) polymerase chain reaction (PCR) was developed to simultaneously identify multiple viruses in the lily plant. The most common viruses infecting lily plants are the cucumber mosaic virus (CMV), lily mottle virus (LMoV), lily symptomless virus (LSV). Leaf samples were collected at lily-cultivation facilities located in the Kangwon province of Korea and used to evaluate the detection system. Simplex and multiplex RT-PCR were performed using virus-specific primers to detect single-or mixed viral infections in lily plants. Our results demonstrate the selective detection of 3 different viruses (CMV, LMoV and LSV) by using specific primers as well as the potential of simultaneously detecting 2 or 3 different viruses in lily plants with mixed infections. Three sets of primers for each target virus, and one set of internal control primers were used to evaluate the detection system for efficiency, reliability, and reproducibility. PMID:25288961

  18. Detection of Zaire Ebola virus by real-time reverse transcription-polymerase chain reaction, Sierra Leone, 2014.

    PubMed

    Liu, Licheng; Sun, Yang; Kargbo, Brima; Zhang, Chuntao; Feng, Huahua; Lu, Huijun; Liu, Wenseng; Wang, Chengyu; Hu, Yi; Deng, Yongqiang; Jiang, Jiafu; Kang, Xiaoping; Yang, Honglei; Jiang, Yongqiang; Yang, Yinhui; Kargbo, David; Qian, Jun; Chen, Weijun

    2015-09-15

    During the 2014 Ebola virus disease (EVD) outbreak, a real-time quantitative polymerase chain reaction was established to detect and identify the Zaire Ebola virus. We describe the use of this assay to screen 315 clinical samples from EVD suspected person in Sierra Leone. The detection rate in blood samples was 77.81% (207/266), and there were relatively higher detection rate (79.32% and 81.42%, respectively) during the first two weeks after onset of symptoms. In the two weeks that followed, the detection rate declined to 66.67% and 25.00%, respectively. There was the highest virus load at the first week and then decreased. The detection rate in swab samples was 89.79% (44/49). This may be benefit from the included patients. 46 of 49 swab samples were collected from died patients. Taken together, the results presented here indicate that the assay specifically and sensitively detects Zaire Ebola virus.

  19. Detection of clonality by polymerase chain reaction in childhood B-lineage acute lymphoblastic leukemia.

    PubMed

    Januszkiewicz, D A; Nowak, J S

    1994-09-01

    DNA-based PCR with various sets of primers for TCR gamma/delta, and Ig heavy chain (IgH) genes were used to study clonality in childhood B-lineage acute lymphoblastic leukemia. Amplification of the IgH CDR-III was observed in 75 of 120 analyzed cases (62.5%). From all analyzed groups, the IgH gene rearrangement was most often observed in pre-B ALL (85.7%) and was rather rare in null-ALL (34.5%). TCR delta gene rearrangement was the most common, and was observed in 77 patients (64.2%). The typical pattern of rearrangements was defined as an incomplete V delta 2 to D delta 3, V delta 2 to D delta 2, or D delta 3 to D delta 2 recombination product. Rearrangements of TCR gamma gene we observed in 61 cases (50.8%). TCR gamma gene rearrangements were detected predominantly in null-ALL and early B-ALL (55.2% and 60%, respectively) and were rather rare in other groups. Of all eight V segments of V gamma I group, the most frequent gene usage concerns regions V gamma 2, V gamma 4, and psi V gamma 7. We have confirmed that IgH gene amplification, together with TCR gamma and delta gene amplification, provides a rapid, sensitive approach to assessing clonality in ALL almost in 100% of cases.

  20. Detection and analysis of polymerase chain reaction products by mass spectrometry

    SciTech Connect

    Hurst, G.B., Doktycz, M.J., Britt, P.F., Vass, A.A., Buchanan, M.V.

    1997-02-01

    This paper describes recent and ongoing efforts to overcome some of the obstacles to more routine and robust application of MALDI-TOF to analysis of polymerase chain reaction products and other information- bearing nucleic acid molecules. Methods for purifying nucleic acid samples are described, as is the application of delayed extraction TOF mass spectrometry to analysis of short oligonucleotides.

  1. PrimRglo: a multiplexable quantitative real-time polymerase chain reaction system for nucleic acid detection.

    PubMed

    Lai, Richard; Liang, Fang; Pearson, Darnley; Barnett, Graeme; Whiley, David; Sloots, Theo; Barnard, Ross T; Corrie, Simon R

    2012-03-15

    We report the development of a new real-time polymerase chain reaction (PCR) detection system that uses oligonucleotide "tagged" PCR primers, a fluorophore-labeled "universal" detection oligonucleotides, and a complementary quenching oligonucleotide. The fluorescence signal decreases as PCR product accumulates due to the increase in detection/quencher hybrid formation as the tagged primer is consumed. We use plasmids containing the influenza A matrix gene and the porA and ctrA genes of Neisseria meningitidis as targets for developing the system. Cycle threshold (Ct) values were generated, and the sensitivity of the new system (dubbed "PrimRglo") compared favorably with the commonly used SYBR green and Taqman detection systems and, unlike the latter system, does not require the design of a new dual-labeled detection oligonucleotide for each new target sequence.

  2. Enhanced detection of RNA by MMLV reverse transcriptase coupled with thermostable DNA polymerase and DNA/RNA helicase.

    PubMed

    Okano, Hiroyuki; Katano, Yuta; Baba, Misato; Fujiwara, Ayako; Hidese, Ryota; Fujiwara, Shinsuke; Yanagihara, Itaru; Hayashi, Tsukasa; Kojima, Kenji; Takita, Teisuke; Yasukawa, Kiyoshi

    2017-01-01

    Detection of mRNA is a valuable method for monitoring the specific gene expression. In this study, we devised a novel cDNA synthesis method using three enzymes, the genetically engineered thermostable variant of reverse transcriptase (RT), MM4 (E286R/E302K/L435R/D524A) from Moloney murine leukemia virus (MMLV), the genetically engineered variant of family A DNA polymerase with RT activity, K4polL329A from thermophilic Thermotoga petrophila K4, and the DNA/RNA helicase Tk-EshA from a hyperthermophilic archaeon Thermococcus kodakarensis. By optimizing assay conditions for three enzymes using Taguchi's method, 100 to 1000-fold higher sensitivity was achieved for cDNA synthesis than conventional assay condition using only RT. Our results suggest that DNA polymerase with RT activity and DNA/RNA helicase are useful to increase the sensitivity of cDNA synthesis.

  3. A portable reverse transcription recombinase polymerase amplification assay for rapid detection of foot-and-mouth disease virus.

    PubMed

    Abd El Wahed, Ahmed; El-Deeb, Ayman; El-Tholoth, Mohamed; Abd El Kader, Hanaa; Ahmed, Abeer; Hassan, Sayed; Hoffmann, Bernd; Haas, Bernd; Shalaby, Mohamed A; Hufert, Frank T; Weidmann, Manfred

    2013-01-01

    Foot-and-mouth disease (FMD) is a trans-boundary viral disease of livestock, which causes huge economic losses and constitutes a serious infectious threat for livestock farming worldwide. Early diagnosis of FMD helps to diminish its impact by adequate outbreak management. In this study, we describe the development of a real-time reverse transcription recombinase polymerase amplification (RT-RPA) assay for the detection of FMD virus (FMDV). The FMDV RT-RPA design targeted the 3D gene of FMDV and a 260 nt molecular RNA standard was used for assay validation. The RT-RPA assay was fast (4-10 minutes) and the analytical sensitivity was determined at 1436 RNA molecules detected by probit regression analysis. The FMDV RT-RPA assay detected RNA prepared from all seven FMDV serotypes but did not detect classical swine fever virus or swine vesicular disease virus. The FMDV RT-RPA assay was used in the field during the recent FMD outbreak in Egypt. In clinical samples, reverse transcription polymerase chain reaction (RT-PCR) and RT-RPA showed a diagnostic sensitivity of 100% and 98%, respectively. In conclusion, FMDV RT-RPA was quicker and much easier to handle in the field than real-time RT-PCR. Thus RT-RPA could be easily implemented to perform diagnostics at quarantine stations or farms for rapid spot-of-infection detection.

  4. Polymerase chain reaction detection of Leishmania DNA in skin biopsy samples in Sri Lanka where the causative agent of cutaneous leishmaniasis is Leishmania donovani.

    PubMed

    Ranasinghe, Shalindra; Wickremasinghe, Renu; Hulangamuwa, Sanjeeva; Sirimanna, Ganga; Opathella, Nandimithra; Maingon, Rhaiza D C; Chandrasekharan, Vishvanath

    2015-12-01

    Leishmania donovani is the known causative agent of both cutaneous (CL) and visceral leishmaniasis in Sri Lanka. CL is considered to be under-reported partly due to relatively poor sensitivity and specificity of microscopic diagnosis. We compared robustness of three previously described polymerase chain reaction (PCR) based methods to detect Leishmania DNA in 38 punch biopsy samples from patients presented with suspected lesions in 2010. Both, Leishmania genus-specific JW11/JW12 KDNA and LITSR/L5.8S internal transcribed spacer (ITS)1 PCR assays detected 92% (35/38) of the samples whereas a KDNA assay specific forL. donovani (LdF/LdR) detected only 71% (27/38) of samples. All positive samples showed a L. donovani banding pattern upon HaeIII ITS1 PCR-restriction fragment length polymorphism analysis. PCR assay specificity was evaluated in samples containing Mycobacterium tuberculosis, Mycobacterium leprae, and human DNA, and there was no cross-amplification in JW11/JW12 and LITSR/L5.8S PCR assays. The LdF/LdR PCR assay did not amplify M. leprae or human DNA although 500 bp and 700 bp bands were observed in M. tuberculosis samples. In conclusion, it was successfully shown in this study that it is possible to diagnose Sri Lankan CL with high accuracy, to genus and species identification, using Leishmania DNA PCR assays.

  5. Direct detection of RNA in vitro and in situ by target-primed RCA: The impact of E. coli RNase III on the detection efficiency of RNA sequences distanced far from the 3′-end

    PubMed Central

    Merkiene, Egle; Gaidamaviciute, Edita; Riauba, Laurynas; Janulaitis, Arvydas; Lagunavicius, Arunas

    2010-01-01

    We improved the target RNA-primed RCA technique for direct detection and analysis of RNA in vitro and in situ. Previously we showed that the 3′ → 5′ single-stranded RNA exonucleolytic activity of Phi29 DNA polymerase converts the target RNA into a primer and uses it for RCA initiation. However, in some cases, the single-stranded RNA exoribonucleolytic activity of the polymerase is hindered by strong double-stranded structures at the 3′-end of target RNAs. We demonstrate that in such hampered cases, the double-stranded RNA-specific Escherichia coli RNase III efficiently assists Phi29 DNA polymerase in converting the target RNA into a primer. These observations extend the target RNA-primed RCA possibilities to test RNA sequences distanced far from the 3′-end and customize this technique for the inner RNA sequence analysis. PMID:20584897

  6. Hepatitis B virus X protein induces RNA polymerase III-dependent gene transcription and increases cellular TATA-binding protein by activating the Ras signaling pathway.

    PubMed

    Wang, H D; Trivedi, A; Johnson, D L

    1997-12-01

    Our previous studies have shown that the hepatitis B virus protein, X, activates all three classes of RNA polymerase III (pol III)-dependent promoters by increasing the cellular level of TATA-binding protein (TBP) (H.-D. Wang et al., Mol. Cell. Biol. 15:6720-6728, 1995), a limiting transcription component (A. Trivedi et al., Mol. Cell. Biol. 16:6909-6916, 1996). We have investigated whether these X-mediated events are dependent on the activation of the Ras/Raf-1 signaling pathway. Transient expression of a dominant-negative mutant Ras gene (Ras-ala15) in a Drosophila S-2 stable cell line expressing X (X-S2), or incubation of the cells with a Ras farnesylation inhibitor, specifically blocked both the X-dependent activation of a cotransfected tRNA gene and the increase in cellular TBP levels. Transient expression of a constitutively activated form of Ras (Ras-val12) in control S2 cells produced both an increase in tRNA gene transcription and an increase in cellular TBP levels. These events are not cell type specific since X-mediated gene induction was also shown to be dependent on Ras activation in a stable rat 1A cell line expressing X. Furthermore, increases in RNA pol III-dependent gene activity and TBP levels could be restored in X-S2 cells expressing Ras-ala15 by coexpressing a constitutively activated form of Raf-1. These events are serum dependent, and when the cells are serum deprived, the X-mediated effects are augmented. Together, these results demonstrate that the X-mediated induction of RNA pol III-dependent genes and increase in TBP are both dependent on the activation of the Ras/Raf-1 signaling cascade. In addition, these studies define two new and important consequences mediated by the activation of the Ras signal transduction pathway: an increase in the central transcription factor, TBP, and the induction of RNA pol III-dependent gene activity.

  7. Detection of Clostridium botulinum type C cells in the gastrointestinal tracts of Mozambique tilapia (Oreochromis mossambicus) by polymerase chain reaction

    USGS Publications Warehouse

    Nol, P.; Williamson, J.L.; Rocke, T.E.; Yuill, Thomas M.

    2004-01-01

    We established a method of directly detecting Clostridium botulinum type C cells, while minimizing spore detection, in the intestinal contents of Mozambique tilapia (Oreochromis mossambicus). This technique involved extraction of predominantly cellular DNA from tilapia intestinal tracts and used a polymerase chain reaction assay to detect presence of type C1 toxin gene. We consistently detected C. botulinum type C cells in tilapia gastrointestinal contents at a level of 7.5×104 cells per 0.25 g material or 1.9×103 cells. This technique is useful for determining prevalence of the potentially active organisms within a given population of fish and may be adapted to other types of C. botulinum and vertebrate populations as well.

  8. Detection of Clostridium botulinum type C cells in the gastrointestinal tracts of Mozambique Tilapia (Oreochromis mossambicus) by polymerase chain reaction.

    PubMed

    Nol, P; Williamson, J L; Rocke, T E; Yuill, T M

    2004-10-01

    We established a method of directly detecting Clostridium botulinum type C cells, while minimizing spore detection, in the intestinal contents of Mozambique tilapia (Oreochromis mossambicus). This technique involved extraction of predominantly cellular DNA from tilapia intestinal tracts and used a polymerase chain reaction assay to detect presence of type C1 toxin gene. We consistently detected C. botulinum type C cells in tilapia gastrointestinal contents at a level of 7.5 x 104 cells per 0.25 g material or 1.9 x 103 cells. This technique is useful for determining prevalence of the potentially active organisms within a given population of fish and may be adapted to other types of C. botulinum and vertebrate populations as well.

  9. [Detection of mycobacterial DNA with polymerase chain reaction in eye discharge and gastric juices in a case of scleritis].

    PubMed

    Tanemoto, K; Ishikawa, H; Kigasawa, K; Obazawa, H; Fusegawa, H; Miyachi, H; Ando, Y

    1997-01-01

    We report a case of mycobacterial scleritis in which prompt diagnosis was made by the detection of mycobacterial DNA with polymerase chain reaction (PCR) in eye discharge and gastric juices, when conventional tests were negative. A 77-year-old woman who had a past history of pulmonary tuberculosis visited the outpatient clinic of Tokai University Hospital complaining of pain in her right eye. She was diagnosed as having scleritis and uveitis. There were no indications of active tuberculosis. We examined the gastric juices, sputum, and eye discharge by microscopy, culture, and PCR for detection of mycobacterium. The results of microscopy and culture were negative, but with PCR we detected atypical mycobacterium in eye discharge and gastric juices. After oral treatment with antituberculosis agents, the patient's eye symptoms disappeared. Detecting mycobacterial DNA with PCR could be useful for early diagnosis of mycobacterial scleritis, so that treatment with antituberculosis agents could be started.

  10. Rapid Molecular Detection of Zika Virus in Acute-Phase Urine Samples Using the Recombinase Polymerase Amplification Assay

    PubMed Central

    Abd El Wahed, Ahmed; Sanabani, Sabri Saeed; Faye, Oumar; Pessôa, Rodrigo; Patriota, João Veras; Giorgi, Ricardo Rodrigues; Patel, Pranav; Böhlken-Fascher, Susanne; Landt, Olfert; Niedrig, Matthias; Zanotto, Paolo Marinho de Andrade; Czerny, Claus Peter; Sall, Amadou A.; Weidmann, Manfred

    2017-01-01

    Background: Currently the detection of Zika virus (ZIKV) in patient samples is done by real-time RT-PCR. Samples collected from rural area are sent to highly equipped laboratories for screening. A rapid point-of-care test is needed to detect the virus, especially at low resource settings. Methodology/Principal Findings: In this report, we describe the development of a reverse transcription isothermal recombinase polymerase amplification (RT-RPA) assay for the identification of ZIKV. RT-RPA assay was portable, sensitive (21 RNA molecules), and rapid (3-15 minutes). No cross-reactivity was detected to other flaviviruses, alphaviruses and arboviruses. Compared to real-time RT-PCR, the diagnostic sensitivity was 92%, while the specificity was 100%. Conclusions/Significance: The developed assay is a promising platform for rapid point of need detection of ZIKV in low resource settings and elsewhere (e.g. during mass gathering). PMID:28239513

  11. [Rapid detection of influenza virus A (AH1, AH3) and B by nested-polymerase chain reaction].

    PubMed

    Shimizu, H; Watanabe, S; Imai, M

    1997-06-01

    We applied the Nested-polymerase chain reaction (PCR) for laboratory diagnosis of influenza virus infection. We used three primer sets for detection of influenza virus A (AH1, AH3) and B. The primer sets for each type (AH1, AH3, B) was able to detect specifically each type of influenza. We measured the sensitivity for detection of vaccine strains. The PCR method was able to detect 0.9 PFU/assey of AH1 type, 1.0 PFU/assey of AH3 type and 1.8 PFU/assey of B type. Out of 46 isolation negative but antibody positive cases, 38 cases were positive for PCR (82.6%). This method is sensitive and useful for rapid diagnosis of influenza virus infection.

  12. Development of reverse transcription recombinase polymerase amplification assay for avian influenza H5N1 HA gene detection.

    PubMed

    Yehia, Nahed; Arafa, Abdel-Satar; Abd El Wahed, Ahmed; El-Sanousi, Ahmed A; Weidmann, Manfred; Shalaby, Mohamed A

    2015-10-01

    The 2006 outbreaks of H5N1 avian influenza in Egypt interrupted poultry production and caused staggering economic damage. In addition, H5N1 avian influenza viruses represent a significant threat to public health. Therefore, the rapid detection of H5 viruses is very important in order to control the disease. In this study, a qualitative reverse transcription recombinase polymerase amplification (RT-RPA) assay for the detection of hemagglutinin gene of H5 subtype influenza viruses was developed. The results were compared to the real-time reverse transcription polymerase chain reaction (RT-PCR). An in vitro transcribed RNA standard of 970 nucleotides of the hemagglutinin gene was developed and used to determine the assay sensitivity. The developed H5 RT-RPA assay was able to detect one RNA molecule within 7 min, while in real-time RT-PCR, at least 90 min was required. H5 RT-RPA assay did not detect nucleic acid extracted from H5 negative samples or from other pathogens producing respiratory manifestation in poultry. The clinical performance of the H5 RT-RPA assay was tested in 30 samples collected between 2014 and 2015; the sensitivity of H5 RT-RPA and real-time RT-PCR was 100%. In conclusion, H5 RT-RPA was faster than real-time RT-PCR and easily operable in a portable device. Moreover, it had an equivalent sensitivity and specificity.

  13. A METHOD TO REMOVE ENVIRONMENTAL INHIBITORS PRIOR TO THE DETECTION OF WATERBORNE ENTERIC VIRUSES BY REVERSE TRANSCRIPTION-POLYMERASE CHAIN REACTION

    EPA Science Inventory

    A method was developed to remove environmental inhibitors from sample concentrates prior to detection of human enteric viruses using the reverse transcription-polymerase chain reaction (RT-PCR).Environmental inhibitors, concentrated along with viruses during water sample processi...

  14. Automatic polymerase chain reaction product detection system for food safety monitoring using zinc finger protein fused to luciferase.

    PubMed

    Yoshida, Wataru; Kezuka, Aki; Murakami, Yoshiyuki; Lee, Jinhee; Abe, Koichi; Motoki, Hiroaki; Matsuo, Takafumi; Shimura, Nobuaki; Noda, Mamoru; Igimi, Shizunobu; Ikebukuro, Kazunori

    2013-11-01

    An automatic polymerase chain reaction (PCR) product detection system for food safety monitoring using zinc finger (ZF) protein fused to luciferase was developed. ZF protein fused to luciferase specifically binds to target double stranded DNA sequence and has luciferase enzymatic activity. Therefore, PCR products that comprise ZF protein recognition sequence can be detected by measuring the luciferase activity of the fusion protein. We previously reported that PCR products from Legionella pneumophila and Escherichia coli (E. coli) O157 genomic DNA were detected by Zif268, a natural ZF protein, fused to luciferase. In this study, Zif268-luciferase was applied to detect the presence of Salmonella and coliforms. Moreover, an artificial zinc finger protein (B2) fused to luciferase was constructed for a Norovirus detection system. In the luciferase activity detection assay, several bound/free separation process is required. Therefore, an analyzer that automatically performed the bound/free separation process was developed to detect PCR products using the ZF-luciferase fusion protein. By means of the automatic analyzer with ZF-luciferase fusion protein, target pathogenic genomes were specifically detected in the presence of other pathogenic genomes. Moreover, we succeeded in the detection of 10 copies of E. coli BL21 without extraction of genomic DNA by the automatic analyzer and E. coli was detected with a logarithmic dependency in the range of 1.0×10 to 1.0×10(6) copies.

  15. TATA box-binding protein (TBP) is a constituent of the polymerase I-specific transcription initiation factor TIF-IB (SL1) bound to the rRNA promoter and shows differential sensitivity to TBP-directed reagents in polymerase I, II, and III transcription factors.

    PubMed Central

    Radebaugh, C A; Matthews, J L; Geiss, G K; Liu, F; Wong, J M; Bateman, E; Camier, S; Sentenac, A; Paule, M R

    1994-01-01

    The role of the Acanthamoeba castellanii TATA-binding protein (TBP) in transcription was examined. Specific antibodies against the nonconserved N-terminal domain of TBP were used to verify the presence of TBP in the fundamental transcription initiation factor for RNA polymerase I, TIF-IB, and to demonstrate that TBP is part of the committed initiation complex on the rRNA promoter. The same antibodies inhibit transcription in all three polymerase systems, but they do so differentially. Oligonucleotide competitors were used to evaluate the accessibility of the TATA-binding site in TIF-IB, TFIID, and TFIIIB. The results suggest that insertion of TBP into the polymerase II and III factors is more similar than insertion into the polymerase I factor. Images PMID:8264628

  16. TATA box-binding protein (TBP) is a constituent of the polymerase I-specific transcription initiation factor TIF-IB (SL1) bound to the rRNA promoter and shows differential sensitivity to TBP-directed reagents in polymerase I, II, and III transcription factors.

    PubMed

    Radebaugh, C A; Matthews, J L; Geiss, G K; Liu, F; Wong, J M; Bateman, E; Camier, S; Sentenac, A; Paule, M R

    1994-01-01

    The role of the Acanthamoeba castellanii TATA-binding protein (TBP) in transcription was examined. Specific antibodies against the nonconserved N-terminal domain of TBP were used to verify the presence of TBP in the fundamental transcription initiation factor for RNA polymerase I, TIF-IB, and to demonstrate that TBP is part of the committed initiation complex on the rRNA promoter. The same antibodies inhibit transcription in all three polymerase systems, but they do so differentially. Oligonucleotide competitors were used to evaluate the accessibility of the TATA-binding site in TIF-IB, TFIID, and TFIIIB. The results suggest that insertion of TBP into the polymerase II and III factors is more similar than insertion into the polymerase I factor.

  17. Real-Time Fluorescent Polymerase Chain Reaction Detection of Phytophthora ramorum and Phytophthora pseudosyringae Using Mitochondrial Gene Regions.

    PubMed

    Tooley, Paul W; Martin, Frank N; Carras, Marie M; Frederick, Reid D

    2006-04-01

    ABSTRACT A real-time fluorescent polymerase chain reaction (PCR) detection method for the sudden oak death pathogen Phytophthora ramorum was developed based on mitochondrial DNA sequence with an ABI Prism 7700 (TaqMan) Sequence Detection System. Primers and probes were also developed for detecting P. pseudosyringae, a newly described species that causes symptoms similar to P. ramorum on certain hosts. The species-specific primer-probe systems were combined in a multiplex assay with a plant primer-probe system to allow plant DNA present in extracted samples to serve as a positive control in each reaction. The lower limit of detection of P. ramorum DNA was 1 fg of genomic DNA, lower than for many other described PCR procedures for detecting Phytophthora species. The assay was also used in a three-way multiplex format to simultaneously detect P. ramorum, P. pseudosyringae, and plant DNA in a single tube. P. ramorum was detected down to a 10(-5) dilution of extracted tissue of artificially infected rhododendron 'Cunningham's White', and the amount of pathogen DNA present in the infected tissue was estimated using a standard curve. The multiplex assay was also used to detect P. ramorum in infected California field samples from several hosts determined to contain the pathogen by other methods. The real-time PCR assay we describe is highly sensitive and specific, and has several advantages over conventional PCR assays used for P. ramorum detection to confirm positive P. ramorum finds in nurseries and elsewhere.

  18. Detection of Norwalk virus in stool specimens by reverse transcriptase-polymerase chain reaction and nonradioactive oligoprobes.

    PubMed Central

    De Leon, R; Matsui, S M; Baric, R S; Herrmann, J E; Blacklow, N R; Greenberg, H B; Sobsey, M D

    1992-01-01

    A reverse transcriptase (RT)-polymerase chain reaction (PCR)-oligoprobe (OP), or RT-PCR-OP, method was developed for the detection of the Norwalk virus, which causes acute, epidemic gastroenteritis, in stool specimens. The Norwalk virus genome regions encoding the following two proteins were amplified by RT-PCR: the RNA polymerase (260-bp product) and a putative immunogenic protein (224-bp product). The resulting DNA fragments (amplicons) were hybridized to a digoxigenin-labeled internal OP specific to each amplicon. The detection limit of Norwalk virus, as determined by the endpoint of RT-PCR amplification for serially diluted, positive stool specimens, was similar to the actual virion titer as estimated by electron microscopy and at least 100-fold greater than the titer determined by radioimmunoassay (RIA). The RT-PCR-OP assay was specific for Norwalk virus and negative for other enteric viruses, including human and animal caliciviruses, hepatitis E virus, Snow Mountain agent, astroviruses, 16 human enteroviruses, and 5 human rotaviruses. Components of fecal specimens that interfere with RT-PCR were removed successfully by Sephadex G-200 gel chromatography. Of 20 stool specimens from human volunteers that were positive for Norwalk virus by RIA, a specific RT-PCR-OP result was obtained in 95% (19 of 20) of the samples by using the immunogenic protein primers and 75% (15 of 20) by using the polymerase primers. Twenty-six stool specimens from asymptomatic children and adults were negative by the Norwalk virus RT-PCR-OP. RT-PCR-OP detected Norwalk virus in the 4 of 21 coded fecal specimens that were also positive by enzyme immunoassay. Two samples that were positive by RIA or enzyme immunoassay were negative by RT-PCR, perhaps because viral RNA was not present or RT-PCR inhibitors were not adequately removed. Images PMID:1280649

  19. [Preparation and detection of anti-influenza A virus polymerase basic protein 1 polyclonal antibody].

    PubMed

    Qin, Yujie; Zhang, Tinghong; Ye, Xin

    2016-01-01

    Influenza A virus is an enveloped virus that belongs to the Orthomyxoviridae family. It has 8 negative RNA segments that encode 16 viral proteins. The viral polymerase consists of 3 proteins (PB 1, PB2 and PA) which plays an important role in the transcription and replication of the influenza A virus. Polymerase basic protein 1 (PB 1) is a critical member of viral polymerase complex. In order to further study the function of PB1, we need to prepare the PB1 antibody with good quality. Therefore, we amplified PB1 conserved region (nt1648-2265) by PCR and cloned it into pET-30a vector, and transformed into Escherichia coli BL2 1. The expression of His tagged PB 1 protein was induced by IPTG, and His-PB 1 proteins were purified by Ni-NTA resin. For preparation of PB 1 protein antiserum, rabbits were immunized with His-PB 1 fusion protein 3 times. Then the titer of PB 1 polyclonal antibody was measured by indirect ELISA. The antibody was purified by membrane affinity purification and subjected to immunoblotting analysis. Data showed that PB1 antibody can recognize PB 1 protein from WSN virus infected or pCMV FLAG-PB 1 transfected cells. Meanwhile, PB 1 antibody can also recognize specifically other subtype strains of influenza A virus such as H9N2 and H3N2. PB 1 polyclonal antibody we generated will be a useful tool to study the biological function of PB1.

  20. Polymerase chain reaction based detection of Mycobacterium tuberculosis complex in lupus vulgaris: a case report.

    PubMed

    Baylan, O; Arca, E; Ozcan, A; Kisa, O; Albay, A; Doganci, L

    2004-09-01

    Lupus vulgaris (LV), the commonest of all forms of cutaneous tuberculosis, can affect the earlobes. Authors present a 20-year-old male patient with LV of the left earlobe initially misdiagnosed as pyoderma and treated superfluously with antibiotics at different intervals over the last 4 years in another hospital. Mycobacteria could not be seen or isolated by stained smears or conventional or radiometric culture methods from the skin biopsy specimens. Suspected clinical diagnosis of our patient was LV. This was supported by positive polymerase chain reaction assay and histological findings. The lesion was treated successfully with anti-tuberculosis chemotherapy, further confirming the diagnosis of LV.

  1. Real-Time Polymerase Chain Reaction Detection of Angiostrongylus cantonensis DNA in Cerebrospinal Fluid from Patients with Eosinophilic Meningitis.

    PubMed

    Qvarnstrom, Yvonne; Xayavong, Maniphet; da Silva, Ana Cristina Aramburu; Park, Sarah Y; Whelen, A Christian; Calimlim, Precilia S; Sciulli, Rebecca H; Honda, Stacey A A; Higa, Karen; Kitsutani, Paul; Chea, Nora; Heng, Seng; Johnson, Stuart; Graeff-Teixeira, Carlos; Fox, LeAnne M; da Silva, Alexandre J

    2016-01-01

    Angiostrongylus cantonensis is the most common infectious cause of eosinophilic meningitis. Timely diagnosis of these infections is difficult, partly because reliable laboratory diagnostic methods are unavailable. The aim of this study was to evaluate the usefulness of a real-time polymerase chain reaction (PCR) assay for the detection of A. cantonensis DNA in human cerebrospinal fluid (CSF) specimens. A total of 49 CSF specimens from 33 patients with eosinophilic meningitis were included: A. cantonensis DNA was detected in 32 CSF specimens, from 22 patients. Four patients had intermittently positive and negative real-time PCR results on subsequent samples, indicating that the level of A. cantonensis DNA present in CSF may fluctuate during the course of the illness. Immunodiagnosis and/or supplemental PCR testing supported the real-time PCR findings for 30 patients. On the basis of these observations, this real-time PCR assay can be useful to detect A. cantonensis in the CSF from patients with eosinophilic meningitis.

  2. Multiplex polymerase chain reaction assay for the detection of minute virus of mice and mouse parvovirus infections in laboratory mice.

    PubMed

    Wang, K W; Chueh, L L; Wang, M H; Huang, Y T; Fang, B H; Chang, C Y; Fang, M C; Chou, J Y; Hsieh, S C; Wan, C H

    2013-04-01

    Mouse parvoviruses are among the most prevalent infectious pathogens in contemporary mouse colonies. To improve the efficiency of routine screening for mouse parvovirus infections, a multiplex polymerase chain reaction (PCR) assay targeting the VP gene was developed. The assay detected minute virus of mice (MVM), mouse parvovirus (MPV) and a mouse housekeeping gene (α-actin) and was able to specifically detect MVM and MPV at levels as low as 50 copies. Co-infection with the two viruses with up to 200-fold differences in viral concentrations can easily be detected. The multiplex PCR assay developed here could be a useful tool for monitoring mouse health and the viral contamination of biological materials.

  3. Detection of loss of heterozygosity in formalin-fixed paraffin-embedded tumor specimens by the polymerase chain reaction.

    PubMed Central

    Bianchi, A. B.; Navone, N. M.; Conti, C. J.

    1991-01-01

    A polymerase chain reaction-based procedure was used for the detection of DNA length polymorphisms generated by naturally occurring genetic deletions or insertions of known sequence. This method consists of a simple one-step assay that does not require any restriction enzyme analysis or Southern blot hybridization, allowing identification in ethidium bromide-stained gels. The procedure described here was used to detect loss of heterozygosity at various loci, including the Hbb beta-globin gene cluster, in chemically induced mouse skin tumors, using a variety of tissue preparations, including microdissection of formalin-fixed, paraffin-embedded specimens, short-term cultures, and fluorescence-activated cell sorting of epithelial populations. This approach may be useful in detecting tumor-specific reduction to homozygosity at polymorphic chromosomal loci, allowing the mapping of putative tumor-suppressor loci involved in carcinogenesis. Images Figure 2 Figure 3 Figure 4 Figure 5 PMID:1992758

  4. Detection of cashew nut DNA in spiked baked goods using a real-time polymerase chain reaction method.

    PubMed

    Brzezinski, Jennifer L

    2006-01-01

    The detection of potentially allergenic foods, such as tree nuts, in food products is a major concern for the food processing industry. A real-time polymerase chain reaction (PCR) method was designed to determine the presence of cashew DNA in food products. The PCR amplifies a 67 bp fragment of the cashew 2S albumin gene, which is detected with a cashew-specific, dual-labeled TaqMan probe. This reaction will not amplify DNA derived from other tree nut species, such as almond, Brazil nut, hazelnut, and walnut, as well as 4 varieties of peanut. This assay was sensitive enough to detect 5 pg purified cashew DNA as well as cashew DNA in a spiked chocolate cookie sample containing 0.01% (100 mg/kg) cashew.

  5. Rapid detection of infectious hypodermal and hematopoietic necrosis virus (IHHNV) by real-time, isothermal recombinase polymerase amplification assay.

    PubMed

    Xia, Xiaoming; Yu, Yongxin; Hu, Linghao; Weidmann, Manfred; Pan, Yingjie; Yan, Shuling; Wang, Yongjie

    2015-04-01

    Infectious hypodermal and hematopoietic necrosis virus (IHHNV) causes mortality or runt deformity syndrome in penaeid shrimps and is responsible for significant economic losses in the shrimp aquaculture industry. Here, we describe a novel real-time isothermal recombinase polymerase amplification (RPA) assay developed for IHHNV detection. Using IHHNV plasmid standards and DNA samples from a variety of organisms, we evaluated the ability of the IHHNV-RPA assay to detect IHHNV based on analysis of its sensitivity, specificity, rapidity, and reproducibility. Probit analysis of eight independent experimental replicates indicated satisfactory performance of the RPA assay, which is sufficiently sensitive to detect as few as 4 copies of the IHHNV genome within 7 min at 39 °C with 95 % reliability. Therefore, this rapid RPA method has great potential for applications, either in field use or as a point of care diagnostic technique.

  6. A new, multiplex, quantitative real-time polymerase chain reaction system for nucleic acid detection and quantification.

    PubMed

    Liang, Fang; Arora, Neetika; Zhang, Kang Liang; Yeh, David Che Cheng; Lai, Richard; Pearson, Darnley; Barnett, Graeme; Whiley, David; Sloots, Theo; Corrie, Simon R; Barnard, Ross T

    2013-01-01

    Quantitative real-time polymerase chain reaction (qPCR) has emerged as a powerful investigative and diagnostic tool with potential to generate accurate and reproducible results. qPCR can be designed to fulfil the four key aspects required for the detection of nucleic acids: simplicity, speed, sensitivity, and specificity. This chapter reports the development of a novel real-time multiplex quantitative PCR technology, dubbed PrimRglo™, with a potential for high-degree multiplexing. It combines the capacity to simultaneously detect many viruses, bacteria, or nucleic acids, in a single reaction tube, with the ability to quantitate viral or bacterial load. The system utilizes oligonucleotide-tagged PCR primers, along with complementary fluorophore-labelled and quencher-labelled oligonucleotides. The analytic sensitivity of PrimRglo technology was compared with the widely used Taqman(®) and SYBR green detection systems.

  7. Sensitive Detection of Polyalanine Expansions in PHOX2B by Polymerase Chain Reaction Using Bisulfite-Converted DNA

    PubMed Central

    Horiuchi, Hidekazu; Sasaki, Ayako; Osawa, Motoki; Kijima, Kazuki; Ino, Yukiko; Matoba, Ryoji; Hayasaka, Kiyoshi

    2005-01-01

    Congenital central hypoventilation syndrome, also known as Ondine’s curse, is characterized by idiopathic abnormal control of respiration during sleep. Recent studies indicate that a polyalanine expansion of PHOX2B is relevant to the pathogenesis of this disorder. However, it is difficult to detect the repeated tract because its high GC content inhibits conventional polymerase chain reaction (PCR) amplification. Here, we describe a bisulfite treatment for DNA in which uracil is obtained by deamination of unmethylated cytosine residues. Deamination of DNA permitted direct PCR amplification that yielded a product of 123 bp for the common 20-residue repetitive tract with replacement of C with T by sequencing. It settled allele dropouts accompanied by insufficient amplification of expanded alleles. The defined procedure dramatically improved detection of expansions to 9 of 10 congenital central hypoventilation syndrome patients examined in a previous study. The chemical conversion of DNA before PCR amplification facilitates effective detection of GC-rich polyalanine tracts. PMID:16258163

  8. Rapid and sensitive electrochemiluminescence detection of rotavirus by magnetic primer based reverse transcription-polymerase chain reaction.

    PubMed

    Zhan, Fangfang; Zhou, Xiaoming; Xing, Da

    2013-01-25

    A novel method for detection of rotavirus has been developed by integrating magnetic primer based reverse transcription-polymerase chain reaction (RT-PCR) with electrochemiluminescence (ECL) detection. This is realized by accomplishing RT of rotavirus RNA in traditional way and performing PCR of the resulting cDNA fragment on the surface of magnetic particles (MPs). In order to implement PCR on MPs and achieve rapid ECL detection, forward and reverse primers are bounded to MPs and tris-(2,2'-bipyridyl) ruthenium (TBR), respectively. After RT-PCR amplification, the TBR labels are directly enriched onto the surface of MPs. Then the MPs-TBR complexes can be loaded on the electrode surface and analyzed by magnetic ECL platform without any post-modification or post-incubation process. So some laborious manual operations can be avoided to achieve rapid yet sensitive detection. In this study, rotavirus in fecal specimens was successfully detected within 1.5 h. Experimental results showed that the detection limit of the assay was 0.2 pg μL(-1) of rotavirus. The ECL intensity was linearly with the concentration from 0.2 pg μL(-1) to 400 pg μL(-1). What's more, the specificity of this method was confirmed by detecting other fecal specimens of patients with nonrotavirus-associated gastroenteritis. We anticipate that the proposed magnetic primer based RT-PCR with ECL detection strategy will find numerous applications in food safety field and clinical diagnosis.

  9. Structural Basis for Recognition and Sequestration of UUUOH 3 ' Temini of Nascent RNA Polymerase III Transcripts by La, a Rheumatic Disease Autoantigen

    SciTech Connect

    Teplova,M.; Yuan, Y.; Phan, A.; Malinina, L.; Ilin, S.; Teplov, A.; Patel, D.

    2006-01-01

    The nuclear phosphoprotein La was identified as an autoantigen in patients with systemic lupus erythematosus and Sjogren's syndrome. La binds to and protects the UUUOH 3' terminii of nascent RNA polymerase III transcripts from exonuclease digestion. We report the 1.85 Angstroms crystal structure of the N-terminal domain of human La, consisting of La and RRM1 motifs, bound to r(U1-G2-C3-U4-G5-U6-U7-U8-U9OH). The U7-U8-U9OH 3' end, in a splayed-apart orientation, is sequestered within a basic and aromatic amino acid-lined cleft between the La and RRM1 motifs. The specificity-determining U8 residue bridges both motifs, in part through unprecedented targeting of the {beta} sheet edge, rather than the anticipated face, of the RRM1 motif. Our structural observations, supported by mutation studies of both La and RNA components, illustrate the principles behind RNA sequestration by a rheumatic disease autoantigen, whereby the UUUOH 3' ends of nascent RNA transcripts are protected during downstream processing and maturation events.

  10. N-butylamine functionalized graphene oxide for detection of iron(III) by photoluminescence quenching.

    PubMed

    Gholami, Javad; Manteghian, Mehrdad; Badiei, Alireza; Ueda, Hiroshi; Javanbakht, Mehran

    2016-02-01

    An N-butylamine functionalized graphene oxide nanolayer was synthesized and characterized by ultraviolet (UV)-visible spectrometry, Fourier transform infrared spectroscopy, X-ray photoelectron spectroscopy, and transmission electron microscopy. Detection of iron(III) based on photoluminescence spectroscopy was investigated. The N-butylamine functionalized graphene oxide was shown to specifically interact with iron (III), compared with other cationic trace elements including potassium (I), sodium (I), calcium (II), chromium (III), zinc (II), cobalt (II), copper (II), magnesium (II), manganese (II), and molybdenum (VI). The quenching effect of iron (III) on the luminescence emission of N-butylamine functionalized graphene oxide layer was used to detect iron (III). The limit of detection (2.8 × 10(-6)  M) and limit of quantitation (2.9 × 10(-5)  M) were obtained under optimal conditions.

  11. Electrochemical biosensor for microRNA detection based on poly(U) polymerase mediated isothermal signal amplification.

    PubMed

    Zhou, Yunlei; Yin, Huanshun; Li, Jie; Li, Bingchen; Li, Xue; Ai, Shiyun; Zhang, Xiansheng

    2016-05-15

    MicroRNAs play crucial role in post-transcriptional regulation for gene expression in animals, plants, and viruses. For the better understanding of microRNA and its functions, it is very important to develop effectively analytical method for microRNA detection. Herein, a novel electrochemical biosensor was fabricated for sensitive and selective detection of microRNA based on poly(U) polymerase mediated isothermal signal amplification, where poly(U) polymerase can catalyze the template independent addition of UMP from UTP to the 3' end of RNA. Using this activity, the target microRNA can be successfully labeled with biotin conjugated UMPs at its 3'-end using biotin conjugated UTP (biotin-UTP) as donor. Then, the avidin conjugated alkaline phosphatase can be further captured to the 3'-end of the target microRNA based on the specific interaction between biotin and avidin. Finally, under the catalytic activity of alkaline phosphatase, the substrate of p-nitrophenyl phosphate disodium salt hexahydrate can be hydrolyzed to produce 4-nitrophenol. According to the relationship between the electrochemical signal of p-nitrophenol and the concentration of microRNA-319a, the content of microRNA-319a can be detected. This signal amplification method is simple and sensitive. The developed method can detect as low as 1.7 fM microRNA and produce precise and accurate linear dynamic range from 10 to 1000 fM. The fabricated biosensor was further applied to detect the expression level change of microRNA-319a in rice seedlings after incubation with five kinds of different phytohormones.

  12. Segmented continuous-flow multiplex polymerase chain reaction microfluidics for high-throughput and rapid foodborne pathogen detection.

    PubMed

    Shu, Bowen; Zhang, Chunsun; Xing, Da

    2014-05-15

    High-throughput and rapid identification of multiple foodborne bacterial pathogens is vital in global public health and food industry. To fulfill this need, we propose a segmented continuous-flow multiplex polymerase chain reaction (SCF-MPCR) on a spiral-channel microfluidic device. The device consists of a disposable polytetrafluoroethylene (PTFE) capillary microchannel coiled on three isothermal blocks. Within the channel, n segmented flow regimes are sequentially generated, and m-plex PCR is individually performed in each regime when each mixture is driven to pass three temperature zones, thus providing a rapid analysis throughput of m×n. To characterize the performance of the microfluidic device, continuous-flow multiplex PCR in a single segmented flow has been evaluated by investigating the effect of key reaction parameters, including annealing temperatures, flow rates, polymerase concentration and amount of input DNA. With the optimized parameters, the genomic DNAs from Salmonella enterica, Listeria monocytogenes, Escherichia coli O157:H7 and Staphylococcus aureus could be amplified simultaneously in 19min, and the limit of detection was low, down to 10(2) copiesμL(-1). As proof of principle, the spiral-channel SCF-MPCR was applied to sequentially amplify four different bacterial pathogens from banana, milk, and sausage, displaying a throughput of 4×3 with no detectable cross-contamination.

  13. Detection of flaviviruses by reverse transcriptase-polymerase chain reaction with the universal primer set.

    PubMed

    Meiyu, F; Huosheng, C; Cuihua, C; Xiaodong, T; Lianhua, J; Yifei, P; Weijun, C; Huiyu, G

    1997-01-01

    Using a universal primer set designed to match the sequence of the NS1 gene of flaviviruses, the virus RNA of dengue (DEN), Japanese encephalitis (JEV), powassan and langat of Flaviviridae were successfully amplified by polymerase chain reaction (PCR) via cDNA; and with different internal primers, the serotypes of the dengue viruses were identified. Of the 78 clinically diagnosed dengue fever patients, 18 patients were positive for DEN 1, 48 patients for DEN 2 and 8 patients concurrently infected with DEN 4. Of the 52 patients admitted with Japanese encephalitis (JE), 45 were determined to be JEV infections. By nested PCR, we completed the identification of flaviviruses within 2 days. The results show that seven primers have a potential value for rapid clinical diagnosis of flavivirus infections.

  14. Real-time reverse-transcriptase polymerase chain reaction for the rapid detection of Salmonella using invA primers.

    PubMed

    D'Souza, Doris H; Critzer, Faith J; Golden, David A

    2009-11-01

    Recent outbreaks of Salmonella linked to fresh produce emphasize the need for rapid detection methods to help control the spread of disease. Reverse-transcriptase polymerase chain reaction (RT-PCR) can detect the presence of mRNA (shorter half-life than DNA) with greater potential for detecting viable pathogens. The chromosomally located invA gene required for host invasion by Salmonella is widely used for detection of this pathogen by PCR. Detection of Salmonella was undertaken by real-time RT-PCR (rt-RT-PCR) using newly designed invA gene primers to develop a sensitive and specific assay. Salmonella serovars Typhimurium and Enteritidis were grown (7.68 log(10) CFU/mL) in Luria-Bertani broth overnight at 37 degrees C, and RNA was extracted, followed by rt-RT-PCR with and without SYBR green I and agarose gel electrophoresis. All experiments were replicated at least thrice. Detection for both serovars using traditional RT-PCR was lower ( approximately 10(5) CFU/mL) than rt-RT-PCR (10(3) CFU/mL) by gel electrophoresis. Melt curve analysis showed melt temperatures at 87.5 degrees C with Ct values from 12 to 15 for up to 10(3) CFU/mL and improved to 10(2) CFU/mL after further optimization. Further, addition of RNA internal amplification control constructed using in vitro transcription with a T7 RNA polymerase promoter, to the RT-PCR assay also gave detection limits of 10(2) CFU/mL. Cross-reactivity was not observed against a panel of 21 non-Salmonella bacteria. Heat-inactivated (autoclaved) Salmonella showed faint or no detection by rt-RT-PCR or gel electrophoresis. This method has potential to be applied for the detection of Salmonella serovars in fresh produce and the simultaneous detection of foodborne viral (RNA viruses) and bacterial pathogens in a multiplex format.

  15. A rapid assay for detection of Rose rosette virus using reverse transcription-recombinase polymerase amplification using multiple gene targets.

    PubMed

    Babu, Binoy; Washburn, Brian K; Miller, Steven H; Poduch, Kristina; Sarigul, Tulin; Knox, Gary W; Ochoa-Corona, Francisco M; Paret, Mathews L

    2017-02-01

    Rose rosette disease caused by Rose rosette virus (RRV; genus Emaravirus) is the most economically relevant disease of Knock Out(®) series roses in the U.S. As there are no effective chemical control options for the disease, the most critical disease management strategies include the use of virus free clean plants for propagation and early detection and destruction of infected plants. The current diagnostic techniques for RRV including end-point reverse transcription-polymerase chain reaction (RT-PCR) and real-time PCR (RT-qPCR) are highly sensitive, but limited to diagnostic labs with the equipment and expertise; and is time consuming. To address this limitation, an isothermal reverse transcription-recombinase polymerase amplification (RT-RPA) assay based on multiple gene targets for specific detection of RRV was developed. The assay is highly specific and did not cross react with other viruses belonging to the inclusive and exclusive genus. Dilution assays using the in vitro transcripts showed that the primer sets designed (RPA-267, RPA-131, and RPA-321) are highly sensitive, consistently detecting RRV with a detection limit of 1fg/μL. Testing of the infected plants using the primer sets indicated that the virus could be detected from leaves, stems and petals of roses. The primer pair RPA-267 produced 100% positive detection of the virus from infected leaf tissues, while primer set RPA-131 produced 100% detection from stems and petals. The primer set RPA-321 produced 83%, 87.5% and 75% positive detection from leaves, petals and stem tissues, respectively. In addition, the assay has been efficiently used in the detection of RRV infecting Knock Out(®) roses, collected from different states in the U.S. The assay can be completed in 20min as compared to the end-point RT-PCR assay (3-4h) and RT-qPCR (1.5h). The RT-RPA assay is reliable, rapid, highly sensitive, and can be easily used in diagnostic laboratories for detection of RRV with no need for any special

  16. Construction of an electrode modified with gallium(III) for voltammetric detection of ovalbumin.

    PubMed

    Sugawara, Kazuharu; Okusawa, Makoto; Takano, Yusaku; Kadoya, Toshihiko

    2014-01-01

    Electrodes modified with gallium(III) complexes were constructed to detect ovalbumin (OVA). For immobilization of a gallium(III)-nitrilotriacetate (NTA) complex, the electrode was first covered with collagen film. After the amino groups of the film had reacted with isothiocyanobenzyl-NTA, the gallium(III) was then able to combine with the NTA moieties. Another design featured an electrode cast with a gallium(III)-acetylacetonate (AA) complex. The amount of gallium(III) in the NTA complex was equivalent to one-quarter of the gallium(III) that could be utilized from an AA complex. However, the calibration curves of OVA using gallium(III)-NTA and gallium(III)-AA complexes were linear in the ranges of 7.0 × 10(-11) - 3.0 × 10(-9) M and 5.0 × 10(-10) - 8.0 × 10(-9) M, respectively. The gallium(III) on the electrode with NTA complex had high flexibility due to the existence of a spacer between the NTA and the collagen film, and, therefore, the reactivity of the gallium(III) to OVA was superior to that of the gallium(III)-AA complex with no spacer.

  17. Clinical validation of a real-time polymerase chain reaction assay for rapid detection of Acinetobacter baumannii colonization.

    PubMed

    Blanco-Lobo, P; González-Galán, V; García-Quintanilla, M; Valencia, R; Cazalla, A; Martín, C; Alonso, I; Pérez-Romero, P; Cisneros, J M; Aznar, J; McConnell, M J

    2016-09-01

    Real-time polymerase chain reaction (PCR)-based approaches have not been assessed in terms of their ability to detect patients colonized by Acinetobacter baumannii during active surveillance. This prospective, double-blind study demonstrated that a real-time PCR assay had high sensitivity (100%) and specificity (91.2%) compared with conventional culture for detecting A. baumannii in 397 active surveillance samples, and provided results within 3h. Receiver-operator curve analyses demonstrated that the technique has diagnostic accuracy of 97.7% (95% confidence interval 96.0-99.3%). This method could facilitate the rapid implementation of infection control measures for preventing the transmission of A. baumannii.

  18. Detection of parvalbumin, a common fish allergen gene in food, by real-time polymerase chain reaction.

    PubMed

    Sun, Min; Liang, Chengzhu; Gao, Hongwei; Lin, Chao; Deng, Mingjun

    2009-01-01

    Fish, as one of the most common causes of IgE-mediated food hypersensitivity, has recently received increasing attention from the food industry and legislative and regulatory agencies. A real-time polymerase chain reaction assay based on TaqMan-MGB probe technology was developed for the detection of parvalbumin, a major fish allergen gene. The assay had a sensitivity up to 5 pg purified fish DNA and had no cross-reaction with other species, such as cattle, sheep, swine, chicken, shrimp, lobster, crab, squid, clam, rice, soybean, maize, and potato. The coefficient of variation for both intra- and interexperimental variability demonstrated high reproducibility and accuracy. The assay proved to be a potential tool for the detection and label management of fish allergens in food.

  19. Reverse transcription polymerase chain reaction-based method for selectively detecting vegetative cells of toxigenic Clostridium difficile.

    PubMed

    Senoh, Mitsutoshi; Kato, Haru; Murase, Tomoko; Hagiya, Hideharu; Tagashira, Yasuaki; Fukuda, Tadashi; Iwaki, Masaaki; Yamamoto, Akihiko; Shibayama, Keigo

    2014-11-01

    The laboratory diagnostic methods for Clostridium difficile infection (CDI) include toxigenic culture, enzyme immunoassays (EIAs) to detect the toxins of C. difficile, and nucleic acid amplification tests (NAATs) to detect C. difficile toxin genes, but each of these methods has disadvantages; toxigenic cultures require a long time to produce results, EIAs have low sensitivity, and NAATs that target DNA cannot distinguish vegetative cells from spores and dead cells. Here we report a new detection method that uses reverse transcription polymerase chain reaction to target the toxin-gene transcripts. This method was able to specifically detect the vegetative cells of toxigenic C. difficile in fecal samples in spike tests, with a minimum detection limit of 5 × 10(2) colony-forming units per 100 mg of stool specimen. The performance of this method was also demonstrated in a pilot scale evaluation using clinical fecal specimens, which showed that this method may be more sensitive than EIA and requires a shorter time than toxigenic culture. This method could potentially be applied in the clinical laboratory to detect C. difficile in fecal specimens. The ability of this method to discriminate the presence of vegetative cells from spores and dead cells could help to further the understanding of CDI.

  20. Reverse transcription recombinase polymerase amplification assay for the rapid detection of type 2 porcine reproductive and respiratory syndrome virus.

    PubMed

    Wang, Jian-Chang; Yuan, Wan-Zhe; Han, Qing-An; Wang, Jin-Feng; Liu, Li-Bing

    2017-05-01

    Porcine reproductive and respiratory syndrome virus (PRRSV) is one of the most important pathogens in pigs, and has tremendous negative economic impact on the swine industry worldwide. PRRSV is classified into the two distinct genotypes: type 1 and type 2, and most of the described PRRSV isolates in China are type 2. Rapid and sensitive detection of PRRSV is of great importance for the disease control and regional eradication programs. Recombinase polymerase amplification (RPA) has emerged as a novel isothermal amplification technology for the molecular diagnosis of infectious diseases. In this study, a fluorescence reverse transcription RPA (RT-RPA) assay was developed to detect the type 2 PRRSV using primers and exo probe specific for the viral nucleocapsid gene. The reaction was performed at 40°C within 20min. The RT-RPA assay could detect both the classical (C-PRRSV) and highly pathogenic PRRSV (HP-PRRSV), but there was no cross-reaction to other pathogens. Using the in vitro transcribed PRRSV RNA as template, the analytical sensitivity of RT-RPA was 690 copies. The assay performance was evaluated by testing 60 field samples and compared to real-time RT-PCR. The detection rate of RT-RPA was 86.6% (52/60), while the detection rate of real-time RT-PCR was 83.3% (50/60). This simple, rapid and reliable method could be potentially applied for rapid detection of PRRSV in point-of-care and rural areas.

  1. Molecular Detection of Methicillin-Resistant Staphylococcus aureus by Non-Protein Coding RNA-Mediated Monoplex Polymerase Chain Reaction

    PubMed Central

    Soo Yean, Cheryl Yeap; Selva Raju, Kishanraj; Xavier, Rathinam; Subramaniam, Sreeramanan; Gopinath, Subash C. B.; Chinni, Suresh V.

    2016-01-01

    Non-protein coding RNA (npcRNA) is a functional RNA molecule that is not translated into a protein. Bacterial npcRNAs are structurally diversified molecules, typically 50–200 nucleotides in length. They play a crucial physiological role in cellular networking, including stress responses, replication and bacterial virulence. In this study, by using an identified npcRNA gene (Sau-02) in Methicillin-resistant Staphylococcus aureus (MRSA), we identified the Gram-positive bacteria S. aureus. A Sau-02-mediated monoplex Polymerase Chain Reaction (PCR) assay was designed that displayed high sensitivity and specificity. Fourteen different bacteria and 18 S. aureus strains were tested, and the results showed that the Sau-02 gene is specific to S. aureus. The detection limit was tested against genomic DNA from MRSA and was found to be ~10 genome copies. Further, the detection was extended to whole-cell MRSA detection, and we reached the detection limit with two bacteria. The monoplex PCR assay demonstrated in this study is a novel detection method that can replicate other npcRNA-mediated detection assays. PMID:27367909

  2. The occurrence of antibiotic resistance genes in Taq polymerases and a decontamination method applied to the detection of genetically modified crops.

    PubMed

    Perron, André; Raymond, Philippe; Simard, Robin

    2006-03-01

    Different antibiotic resistance (AR) genes, such as Bla, Tet and NPTII, contaminate commercially available Taq polymerases. The specificity of the AR gene PCR can be increased when using a restriction enzyme-based decontamination of polymerase. The elimination of Taq polymerase contamination allows the use of PCR tests to screen seeds (corn) and processed food for the presence of genetically modified organisms (GMO) based on the detection of AR genes. Without a decontamination procedure for AR genes, PCR screening tests should be interpreted with caution.

  3. Ultrasensitive fluorescence polarization DNA detection by target assisted exonuclease III-catalyzed signal amplification.

    PubMed

    Zhang, Min; Guan, Yi-Meng; Ye, Bang-Ce

    2011-03-28

    Single stranded DNA sequences can be detected by target assisted exonuclease III-catalyzed signal amplification fluorescence polarization (TAECA-FP). The method offers an impressive detection limit of 83 aM within one hour for DNA detection and exhibits high discrimination ability even against a single base mismatch.

  4. Detection of nonauthorized genetically modified organisms using differential quantitative polymerase chain reaction: application to 35S in maize.

    PubMed

    Cankar, Katarina; Chauvensy-Ancel, Valérie; Fortabat, Marie-Noelle; Gruden, Kristina; Kobilinsky, André; Zel, Jana; Bertheau, Yves

    2008-05-15

    Detection of nonauthorized genetically modified organisms (GMOs) has always presented an analytical challenge because the complete sequence data needed to detect them are generally unavailable although sequence similarity to known GMOs can be expected. A new approach, differential quantitative polymerase chain reaction (PCR), for detection of nonauthorized GMOs is presented here. This method is based on the presence of several common elements (e.g., promoter, genes of interest) in different GMOs. A statistical model was developed to study the difference between the number of molecules of such a common sequence and the number of molecules identifying the approved GMO (as determined by border-fragment-based PCR) and the donor organism of the common sequence. When this difference differs statistically from zero, the presence of a nonauthorized GMO can be inferred. The interest and scope of such an approach were tested on a case study of different proportions of genetically modified maize events, with the P35S promoter as the Cauliflower Mosaic Virus common sequence. The presence of a nonauthorized GMO was successfully detected in the mixtures analyzed and in the presence of (donor organism of P35S promoter). This method could be easily transposed to other common GMO sequences and other species and is applicable to other detection areas such as microbiology.

  5. [Adaptation of a sensitive DNA extraction method for detection of Entamoeba histolytica by real-time polymerase chain reaction].

    PubMed

    Pınar, Ahmet; Akyön, Yakut; Alp, Alpaslan; Ergüven, Sibel

    2010-07-01

    This study was aimed to adapt a sensitive DNA extraction protocol in stool samples for real-time polymerase chain reaction (PCR) detection of Entamoeba histolytica which causes important morbidity and mortality worldwide. Stool extraction is a problematic step and has direct effects on PCR sensitivity. In order to improve the sensitivity of E.histolytica detection by real-time PCR, "QIAamp DNA stool minikit (Qiagen, Germany)" was modified by adding an overnight incubation step with proteinase K and sodium dodecyl sulfate (SDS) in this study. Three different extraction methods [(1) original method, (2) cetyltrimethyl-ammonium bromide (CTAB) method, (3) modified method] were evaluated for effects on sensitivity in real-time quantitative PCR (Artus RealArt TM E.histolytica RG PCR Kit, Qiagen Diagnostics, Germany). For this purpose, several concentrations of standard E.histolytica DNA were spiked in parasite-free stool samples and three different extraction protocols were performed. Detection sensitivities of "QIAamp DNA stool minikit" was found 5000 copies/ml and of CTAB method was found 500 copies/ml. Detection sensitivity of the extraction was improved to 5 copies/mL by modified "QIAamp DNA stool minikit" protocol. Since detection sensitivities of nucleic acid extraction protocols from stool samples directly affect the sensitivity of PCR amplification, different extraction protocols for different microorganisms should be evaluated.

  6. Measurement of Microbial DNA Polymerase Activity Enables Detection and Growth Monitoring of Microbes from Clinical Blood Cultures

    PubMed Central

    Zweitzig, Daniel R.; Riccardello, Nichol M.; Morrison, John; Rubino, Jason; Axelband, Jennifer; Jeanmonod, Rebecca; Sodowich, Bruce I.; Kopnitsky, Mark J.; O’Hara, S. Mark

    2013-01-01

    Surveillance of bloodstream infections (BSI) is a high priority within the hospital setting. Broth-based blood cultures are the current gold standard for detecting BSI, however they can require lengthy incubation periods prior to detection of positive samples. We set out to demonstrate the feasibility of using enzymatic template generation and amplification (ETGA)-mediated measurement of DNA polymerase activity to detect microbes from clinical blood cultures. In addition to routine-collected hospital blood cultures, one parallel aerobic blood culture was collected and immediately refrigerated until being transported for ETGA analysis. After refrigeration holding and transport, parallel-collected cultures were placed into a BACTEC incubator and ETGA time-course analysis was performed. Of the 308 clinical blood cultures received, 22 were BACTEC positive, and thus were initially selected for ETGA time course analysis. The ETGA assay detected microbial growth in all 22 parallel-positive blood cultures in less time than a BACTEC incubator and also yielded genomic DNA for qPCR-based organism identification. In summary, feasibility of detecting microbes from clinical blood culture samples using the ETGA blood culture assay was demonstrated. Additional studies are being considered towards development of clinically beneficial versions of this methodology. PMID:24155986

  7. A Field-Deployable Reverse Transcription Recombinase Polymerase Amplification Assay for Rapid Detection of the Chikungunya Virus

    PubMed Central

    Faye, Oumar; Prüger, Pauline; Kaiser, Marco; Thaloengsok, Sasikanya; Ubol, Sukathida; Sakuntabhai, Anavaj; Leparc-Goffart, Isabelle; Hufert, Frank T.; Sall, Amadou A.; Weidmann, Manfred; Niedrig, Matthias

    2016-01-01

    Background Chikungunya virus (CHIKV) is a mosquito-borne virus currently transmitted in about 60 countries. CHIKV causes acute flu-like symptoms and in many cases prolonged musculoskeletal and joint pain. Detection of the infection is mostly done using RT-RCR or ELISA, which are not suitable for point-of-care diagnosis. Methodology/Principal Findings In this study, a reverse transcription recombinase polymerase amplification (RT-RPA) assay for the detection of the CHIKV was developed. The assay sensitivity, specificity, and cross-reactivity were tested. CHIKV RT-RPA assay detected down to 80 genome copies/reaction in a maximum of 15 minutes. It successfully identified 18 isolates representing the three CHIKV genotypes. No cross-reactivity was detected to other alphaviruses and arboviruses except O'nyong'nyong virus, which could be differentiated by a modified RPA primer pair. Seventy-eight samples were screened both by RT-RPA and real-time RT-PCR. The diagnostic sensitivity and specificity of the CHIKV RT-RPA assay were determined at 100%. Conclusions/Significance The developed RT-RPA assay represents a promising method for the molecular detection of CHIKV at point of need. PMID:27685649

  8. Detection of human papillomavirus in juvenile laryngeal papillomatosis using polymerase chain reaction.

    PubMed

    Gómez, M A; Drut, R; Lojo, M M; Drut, R M

    1995-01-01

    We examined the presence and subtypes of human papillomavirus (HPV) in 20 paraffin-embedded samples (from 12 patients) of juvenile laryngeal papillomatosis using the polymerase chain reaction (PCR). The biopsies had been stored for months to 12 years. Due to the great genetic variability of HPV, we selected a conservative sequence of the viral genome (L1 region) to identify the vast majority of the subtypes. Positive results were obtained by one-step PCR amplification with the MY09-11 consensus primers (L1 region) in only 10 of the cases. After a two-step amplification (nested-PCR) with GP5-6 primers the 20 samples proved to be positive demonstrating the higher sensitivity of this method. In order to amplify a highly variable region of the genome (E6), specific primers for HPV types 6 and 11 (H6/11 L1-R2) were used. 7/12 patients were positive for this subtype. Since more that one subtype has been reported in the same sample, the presence of HPV 6-11 sequences does not exclude that other subtypes might be involved. The results of this study show that: 1) HPV is present in JLP. 2) The most frequent HPV subtype involved was from the 6-11 group. 3) PCR can be successfully used in archived tissue routinely processed in a laboratory of pathology.

  9. Detecting cooperative sequences in the binding of RNA Polymerase-II

    NASA Astrophysics Data System (ADS)

    Glass, Kimberly; Rozenberg, Julian; Girvan, Michelle; Losert, Wolfgang; Ott, Ed; Vinson, Charles

    2008-03-01

    Regulation of the expression level of genes is a key biological process controlled largely by the 1000 base pair (bp) sequence preceding each gene (the promoter region). Within that region transcription factor binding sites (TFBS), 5-10 bp long sequences, act individually or cooperate together in the recruitment of, and therefore subsequent gene transcription by, RNA Polymerase-II (RNAP). We have measured the binding of RNAP to promoters on a genome-wide basis using Chromatin Immunoprecipitation (ChIP-on-Chip) microarray assays. Using all 8-base pair long sequences as a test set, we have identified the DNA sequences that are enriched in promoters with high RNAP binding values. We are able to demonstrate that virtually all sequences enriched in such promoters contain a CpG dinucleotide, indicating that TFBS that contain the CpG dinucleotide are involved in RNAP binding to promoters. Further analysis shows that the presence of pairs of CpG containing sequences cooperate to enhance the binding of RNAP to the promoter.

  10. Use of polymerase chain reaction to detect Brucella abortus biovar 1 in infected goats.

    PubMed

    Leal-Klevezas, D S; Martínez-Vázquez, I O; García-Cantú, J; López-Merino, A; Martínez-Soriano, J P

    2000-07-03

    The polymerase chain reaction (PCR) was used to diagnose goat brucellosis and compare its sensitivity against some of the most commonly used serological and bacteriological techniques. Twenty two female and one male out of 300 clinically healthy, mixed-breed goats were randomly chosen from a ranch located at Marín, Nuevo León, Mexico. Milk and blood samples were taken from each animal and used to obtain both microbiological cultures and DNA of the pathogen, and sera was tested against Rose Bengal antigen (RBT). Results showed that 86% of the blood samples were positive on the PCR test, while 60% were positive on the serological test. The pathogen was isolated from only one blood culture. Sixty four percent of the milk samples were positive on PCR tests, but failed to yield bacteria in culture. Biochemical and PCR specific assay demonstrated that Brucella abortus biovar 1 was associated with the infection. This study demonstrates the higher sensitivity of PCR over RBT and blood culture and its potential towards a rapid identification of Brucella strains.

  11. Detection of feline immunodeficiency virus in saliva and plasma by cultivation and polymerase chain reaction.

    PubMed

    Matteucci, D; Baldinotti, F; Mazzetti, P; Pistello, M; Bandecchi, P; Ghilarducci, R; Poli, A; Tozzini, F; Bendinelli, M

    1993-03-01

    The rates of feline immunodeficiency virus (FIV) isolation from saliva, plasma, and peripheral blood mononuclear cells (PBMC) of infected cats were compared; isolation rates were 18, 14, and 81%, respectively, in naturally infected cats and 25, 57, and 100%, respectively, in experimentally infected animals. There was no obvious relationship between isolation rate and clinical stage or between isolation rate and the titer of neutralizing antibody in serum. Virus could be isolated from one salivary gland as early as 1 week postinfection and, on a more regular basis, starting at 3 weeks postinfection, when, however, most other tissues were also positive. Polymerase chain reaction analysis showed that FIV genomes are present in saliva and plasma more frequently than expected on the basis of isolation data. Saliva was also found to contain viral DNA, indicating that it may harbor virus-infected cells as well as free virus. The addition of plasma but not of saliva to PBMC cultures delayed FIV growth. Isolation from plasma may be hampered by FIV neutralizing antibody and by the cytotoxic activity of this fluid for the PBMC used as a cell substrate.

  12. Performance of transport and selective media for swine Bordetella bronchiseptica recovery and it comparison to polymerase chain reaction detection

    PubMed Central

    Coutinho, Tania Alen; Bernardi, Mari Lourdes; de Itapema Cardoso, Marisa Ribeiro; Borowski, Sandra Maria; Moreno, Andrea Micke; de Barcellos, David Emilio Santos Neves

    2009-01-01

    Three comparative assays were performed seeking to improve the sensitivity of the diagnosis of Bordetella bronchiseptica infection analyzing swine nasal swabs. An initial assay compared the recovery of B. bronchiseptica from swabs simultaneously inoculated with B. bronchiseptica and some interfering bacteria, immersed into three transport formulations (Amies with charcoal, trypticase soy broth and phosphate buffer according to Soerensen supplemented with 5% of bovine fetal serum) and submitted to different temperatures (10°C and 27°C) and periods of incubation (24, 72 and 120 hours). A subsequent assay compared three selective media (MacConkey agar, modified selective medium G20G and a ceftiofur medium) for their recovery capabilities from clinical specimens. One last assay compared the polymerase chain reaction to the three selective media. In the first assay, the recovery of B. bronchiseptica from transport systems was better at 27°C and the three formulations had good performances at this temperature, but the collection of qualitative and quantitative analysis indicated the advantage of Amies medium for nasal swabs transportation. The second assay indicated that MacConkey agar and modified G20G had similar results and were superior to the ceftiofur medium. In the final assay, polymerase chain reaction presented superior capability of B. bronchiseptica detection to culture procedures. PMID:24031390

  13. Detection of Escherichia coli Enteropathogens by Multiplex Polymerase Chain Reaction from Children's Diarrheal Stools in Two Caribbean–Colombian Cities

    PubMed Central

    Arzuza, Octavio; Urbina, Delfina; Bai, Jing; Guerra, Julio; Montes, Oscar; Puello, Marta; Mendoza, Ketty; Castro, Gregorio Y.

    2010-01-01

    Abstract Acute diarrheal disease is a leading cause of childhood morbidity and mortality in the developing world and Escherichia coli intestinal pathogens are important causative agents. Information on the epidemiology of E. coli intestinal pathogens and their association with diarrheal disease is limited because no diagnostic testing is available in countries with limited resources. To evaluate the prevalence of E. coli intestinal pathogens in a Caribbean–Colombian region, E. coli clinical isolates from children with diarrhea were analyzed by a recently reported two-reaction multiplex polymerase chain reaction (Gomez-Duarte et al., Diagn Microbiol Infect Dis 2009;63:1–9). The phylogenetic group from all E. coli isolates was also typed by a single-reaction multiplex polymerase chain reaction. We found that among 139 E. coli strains analyzed, 20 (14.4%) corresponded to E. coli diarrheagenic pathotypes. Enterotoxigenic, shiga-toxin–producing, enteroaggregative, diffuse adherent, and enteropathogenic E. coli pathotypes were detected, and most of them belonged to the phylogenetic groups A and B1, known to be associated with intestinal pathogens. This is the first report on the molecular characterization of E. coli diarrheogenic isolates in Colombia and the first report on the potential role of E. coli in childhood diarrhea in this geographic area. PMID:19839760

  14. Detection of Escherichia coli enteropathogens by multiplex polymerase chain reaction from children's diarrheal stools in two Caribbean-Colombian cities.

    PubMed

    Gómez-Duarte, Oscar G; Arzuza, Octavio; Urbina, Delfina; Bai, Jing; Guerra, Julio; Montes, Oscar; Puello, Marta; Mendoza, Ketty; Castro, Gregorio Y

    2010-02-01

    Acute diarrheal disease is a leading cause of childhood morbidity and mortality in the developing world and Escherichia coli intestinal pathogens are important causative agents. Information on the epidemiology of E. coli intestinal pathogens and their association with diarrheal disease is limited because no diagnostic testing is available in countries with limited resources. To evaluate the prevalence of E. coli intestinal pathogens in a Caribbean-Colombian region, E. coli clinical isolates from children with diarrhea were analyzed by a recently reported two-reaction multiplex polymerase chain reaction (Gomez-Duarte et al., Diagn Microbiol Infect Dis 2009;63:1-9). The phylogenetic group from all E. coli isolates was also typed by a single-reaction multiplex polymerase chain reaction. We found that among 139 E. coli strains analyzed, 20 (14.4%) corresponded to E. coli diarrheagenic pathotypes. Enterotoxigenic, shiga-toxin-producing, enteroaggregative, diffuse adherent, and enteropathogenic E. coli pathotypes were detected, and most of them belonged to the phylogenetic groups A and B1, known to be associated with intestinal pathogens. This is the first report on the molecular characterization of E. coli diarrheogenic isolates in Colombia and the first report on the potential role of E. coli in childhood diarrhea in this geographic area.

  15. Recombinase polymerase and enzyme-linked immunosorbent assay as a DNA amplification-detection strategy for food analysis.

    PubMed

    Santiago-Felipe, S; Tortajada-Genaro, L A; Puchades, R; Maquieira, A

    2014-02-06

    Polymerase chain reaction in conjunction with enzyme-linked immunosorbent assay (PCR-ELISA) is a well-established technique that provides a suitable rapid, sensitive, and selective method for a broad range of applications. However, the need for precise rapid temperature cycling of PCR is an important drawback that can be overcome by employing isothermal amplification reactions such as recombinase polymerase amplification (RPA). The RPA-ELISA combination is proposed for amplification at a low, constant temperature (40°C) in a short time (40 min), for the hybridisation of labelled products to specific 5'-biotinylated probes/streptavidin in coated microtiter plates at room temperature, and for detection by colorimetric immunoassay. RPA-ELISA was applied to screen common safety threats in foodstuffs, such as allergens (hazelnut, peanut, soybean, tomato, and maize), genetically modified organisms (P35S and TNOS), pathogenic bacteria (Salmonella sp. and Cronobacter sp.), and fungi (Fusarium sp.). Satisfactory sensitivity and reproducibility results were achieved for all the targets. The RPA-ELISA technique does away with thermocycling and provides a suitable sensitive, specific, and cost-effective method for routine applications, and proves particularly useful for resource-limited settings.

  16. Rapid detection of sacbrood virus in honeybee using ultra-rapid real-time polymerase chain reaction.

    PubMed

    Yoo, Mi-Sun; Thi, Kim Cuc Nguyen; Van Nguyen, Phu; Han, Sang-Hoon; Kwon, Soon-Hwan; Yoon, Byoung-Su

    2012-01-01

    A real-time reverse transcription-polymerase chain reaction (qRT-PCR) assay was developed for the fast and highly sensitive detection of the sacbrood virus (SBV) genome and applied to honeybee samples. Using plasmid DNA containing a partial SBV genome and diluted serially, as few as 1×10(2)copies/μl (correlation co-efficiency >0.99) were detected by the qRT-PCR assay, whereas 1×10(3)copies/μl were detected by the conventional RT-PCR assay. As a rapid detection method, ultra-rapid real-time PCR (URRT-PCR) was carried out with a GenSpector TMC-1000 silicon-glass chip-based thermal cycler, which has a 6μl micro-chamber volume and a fast outstandingly heating/cooling rate. Using this method, 10(3)copies of pBX-SBV3.8 clone were detected within 17 min after 40 PCR cycles, including melting point analysis. To reduce the detection time for SBV, synthesis of the cDNA of the SBV genome from a honeybee sample was attempted for different reaction times and the cDNA was used as the template for URRT-PCR assays. The results indicated that a 5 min reaction time was sufficient to synthesize cDNA as the template for the SBV URRT-PCR assay. This study described a novel PCR-based method that is able to detect an RNA virus in environmental samples within 22 min, including reverse transcription, PCR detection and melting point analysis in real-time.

  17. Quantitative fucK gene polymerase chain reaction on sputum and nasopharyngeal secretions to detect Haemophilus influenzae pneumonia.

    PubMed

    Abdeldaim, Guma M K; Strålin, Kristoffer; Olcén, Per; Blomberg, Jonas; Mölling, Paula; Herrmann, Björn

    2013-06-01

    A quantitative polymerase chain reaction (PCR) for the fucK gene was developed for specific detection of Haemophilus influenzae. The method was tested on sputum and nasopharyngeal aspirate (NPA) from 78 patients with community-acquired pneumonia (CAP). With a reference standard of sputum culture and/or serology against the patient's own nasopharyngeal isolate, H. influenzae etiology was detected in 20 patients. Compared with the reference standard, fucK PCR (using the detection limit 10(5) DNA copies/mL) on sputum and NPA showed a sensitivity of 95.0% (19/20) in both cases, and specificities of 87.9% (51/58) and 89.5% (52/58), respectively. In a receiver operating characteristic curve analysis, sputum fucK PCR was found to be significantly superior to sputum P6 PCR for detection of H. influenzae CAP. NPA fucK PCR was positive in 3 of 54 adult controls without respiratory symptoms. In conclusion, quantitative fucK real-time PCR provides a sensitive and specific identification of H. influenzae in respiratory secretions.

  18. Polymerase Chain Reaction Detection of Leishmania kDNA from the Urine of Peruvian Patients with Cutaneous and Mucocutaneous Leishmaniasis

    PubMed Central

    Veland, Nicolas; Espinosa, Diego; Valencia, Braulio Mark; Ramos, Ana Pilar; Calderon, Flor; Arevalo, Jorge; Low, Donald E.; Llanos-Cuentas, Alejandro; Boggild, Andrea K.

    2011-01-01

    We hypothesized that Leishmania kDNA may be present in urine of patients with cutaneous leishmaniasis (CL). Urine samples and standard diagnostic specimens were collected from patients with skin lesions. kDNA polymerase chain reaction (PCR) was performed on samples from patients and 10 healthy volunteers from non-endemic areas. Eighty-six of 108 patients were diagnosed with CL and 18 (21%) had detectable Leishmania Viannia kDNA in the urine. Sensitivity and specificity were 20.9% (95% confidence interval [CI] 12.3–29.5%) and 100%. Six of 8 patients with mucocutaneous involvement had detectable kDNA in urine versus 12 of 78 patients with isolated cutaneous disease (P < 0.001). L. (V.) braziliensis (N = 3), L. (V.) guyanensis (N = 6), and L. (V.) peruviana (N = 3) were identified from urine. No healthy volunteer or patient with an alternate diagnosis had detectable kDNA in urine. Sensitivity of urine PCR is sub-optimal for diagnosis. On the basis of these preliminary data in a small number of patients, detectable kDNA in urine may identify less localized forms of infection and inform treatment decisions. PMID:21460009

  19. Evaluation of RealStar Reverse Transcription–Polymerase Chain Reaction Kits for Filovirus Detection in the Laboratory and Field

    PubMed Central

    Rieger, Toni; Kerber, Romy; El Halas, Hussein; Pallasch, Elisa; Duraffour, Sophie; Günther, Stephan; Ölschläger, Stephan

    2016-01-01

    Background. Diagnosis of Ebola virus (EBOV) disease (EVD) requires laboratory testing. Methods. The RealStar Filovirus Screen reverse transcription–polymerase chain reaction (RT-PCR) kit and the derived RealStar Zaire Ebolavirus RT-PCR kit were validated using in vitro transcripts, supernatant of infected cell cultures, and clinical specimens from patients with EVD. Results. The Filovirus Screen kit detected EBOV, Sudan virus, Taï Forest virus, Bundibugyo virus, Reston virus, and Marburg virus and differentiated between the genera Ebolavirus and Marburgvirus. The amount of filovirus RNA that could be detected with a probability of 95% ranged from 11 to 67 RNA copies/reaction on a LightCycler 480 II. The Zaire Ebolavirus kit is based on the Filovirus Screen kit but was optimized for detection of EBOV. It has an improved signal-to-noise ratio at low EBOV RNA concentrations and is somewhat more sensitive than the Filovirus kit. Both kits show significantly lower analytical sensitivity on a SmartCycler II. Clinical evaluation revealed that the SmartCycler II, compared with other real-time PCR platforms, decreases the clinical sensitivity of the Filovirus Screen kit to diagnose EVD at an early stage. Conclusions. The Filovirus Screen kit detects all human-pathogenic filoviruses with good analytical sensitivity if performed on an appropriate real-time PCR platform. High analytical sensitivity is important for early diagnosis of EVD. PMID:27549586

  20. Detection of Cryptosporidium parvum in secondary effluents using a most probable number-polymerase chain reaction assay.

    PubMed

    Tsuchihashi, Ryujiro; Loge, Frank J; Darby, Jeannie L

    2003-01-01

    Polymerase chain reaction (PCR) was used to detect Cryptosporidium parvum oocysts in secondary effluent samples collected from activated-sludge facilities. Serial dilutions of the purified nucleic acid extracts from the samples were made and PCR was conducted to estimate the C. parvum oocyst concentration via a Poisson distribution-based most probable number (MPN). The degree of oocysts associated with wastewater particles was also evaluated. The sensitivity of the MPN-PCR assay was 20 oocysts/PCR unit. The detection limit of the concentration, extraction, and purification protocols in phosphate buffer saline spiked with a known concentration of oocysts ranged from 1.1 to 4.6 oocysts/L; the detection limit for the wastewater samples ranged from 11 to 4200 oocysts/L depending on the extent of inhibition in each sample. The recovery efficiency of the oocysts ranged from 48 to 59% in most samples. Oocysts were found in two out of seven samples with concentrations of 203 and 308 oocysts/L, as estimated by the MPN-PCR method. The oocysts were found only in the filtrate of the grab samples; particle-associated oocysts were not detected. Association of spiked C. parvum oocysts with particles in secondary effluent drawn from wastewater plants with varying operating conditions indicated a weak correlation between the degree of association and the mean cell residence time of the system.

  1. Detection of genetically modified corn (Bt176) in spiked cow blood samples by polymerase chain reaction and immunoassay methods.

    PubMed

    Petit, Laetitia; Baraige, Fabienne; Bertheau, Yves; Brunschwig, Philippe; Diolez, Annick; Duhem, Koenraad; Duplan, Marie-Noëlle; Fach, Patrick; Kobilinsky, André; Lamart, Stephen; Schattner, Alexandra; Martin, Patrice

    2005-01-01

    The fate of DNA and protein transgenic sequences in products derived from animals fed transgenic crops has recently raised public interest. Sensitive molecular tests targeting the Bt176 genetic construct and the transgenic Cry1Ab protein were developed to determine whether plant sequences, especially transgenic sequences, are present in animal products. A protocol for total DNA extraction and purification from cow whole blood samples was first drawn up and assessed by spiking with known amounts of DNA from Bt176 maize. The limit of detection for transgenic sequences (35S promoter and Bt176-specific junction sequence) was determined by both the polymerase chain reaction-enzyme-linked immunosorbent assay (PCR-ELISA) and the 5'-nuclease PCR assay. Four additional PCR systems were built to substantiate the results. The first detects a mono-copy maize-specific sequence (ADH promoter). Two others target multi-copy sequences from plant nucleus (26S rRNA gene) and chloroplast (psaB gene). The last one, used as a positive control, targets a mono-copy animal sequence (alpha(s1)-casein gene). Both methods detected a minimum spiking at 25 copies of Bt176 maize/mL in 10 mL whole blood samples. The sandwich ELISA kit used detected down to 1 ng transgenic Cry1Ab protein/mL spiked whole blood.

  2. Detection of Porphyromonas gingivalis and Treponema denticola in chronic and aggressive periodontitis patients: A comparative polymerase chain reaction study

    PubMed Central

    Kumawat, Ramniwas M.; Ganvir, Sindhu M.; Hazarey, Vinay K.; Qureshi, Asifa; Purohit, Hemant J.

    2016-01-01

    Background: The detection frequency of Porphyromonas gingivalis and Treponema denticola in chronic periodontitis (CP) and aggressive periodontitis (AgP) is not explored well in Indian population. Aim: The study was undertaken to detect P. gingivalis and T. denticola in CP as well as in AgP patients using polymerase chain reaction (PCR), and to determine the relationship between the frequency of these two microorganisms and the severity of clinical periodontal parameters. Materials and Methods: Subgingival plaque samples were collected from ninety participants (thirty CP patients, thirty AgP patients, and thirty healthy participants) and the aforementioned two microorganisms were detected using PCR. Results: However, when CP and AgP were compared for the detection frequency of two microorganisms, no statistically significant difference was noted. A statistically significant increase in the number of bacteria-positive sites increased as the score of plaque index (PI), gingival index (GI), and clinical attachment level of CP and AgP patients increased. Coexistence of P. gingivalis and T. denticola was frequently observed in deep periodontal pockets. Conclusions: Study findings suggest that P. gingivalis and T. denticola are significantly associated with the severity of periodontal tissue destruction. Statistically significant association exists between clinical periodontal parameters such as PI, GI, periodontal pocket depth (PPD), and clinical attachment loss and presence of both the microorganisms. PMID:27994415

  3. Integrated Acoustic Separation, Enrichment, and Microchip Polymerase Chain Reaction Detection of Bacteria from Blood for Rapid Sepsis Diagnostics.

    PubMed

    Ohlsson, Pelle; Evander, Mikael; Petersson, Klara; Mellhammar, Lisa; Lehmusvuori, Ari; Karhunen, Ulla; Soikkeli, Minna; Seppä, Titta; Tuunainen, Emilia; Spangar, Anni; von Lode, Piia; Rantakokko-Jalava, Kaisu; Otto, Gisela; Scheding, Stefan; Soukka, Tero; Wittfooth, Saara; Laurell, Thomas

    2016-10-04

    This paper describes an integrated microsystem for rapid separation, enrichment, and detection of bacteria from blood, addressing the unmet clinical need for rapid sepsis diagnostics. The blood sample is first processed in an acoustophoresis chip, where red blood cells are focused to the center of the channel by an acoustic standing wave and sequentially removed. The bacteria-containing plasma proceeds to a glass capillary with a localized acoustic standing wave field where the bacteria are trapped onto suspended polystyrene particles. The trapped bacteria are subsequently washed while held in the acoustic trap and released into a polymer microchip containing dried polymerase chain reaction (PCR) reagents, followed by thermocycling for target sequence amplification. The entire process is completed in less than 2 h. Testing with Pseudomonas putida spiked into whole blood revealed a detection limit of 1000 bacteria/mL for this first-generation analysis system. In samples from septic patients, the system was able to detect Escherichia coli in half of the cases identified by blood culture. This indicates that the current system detects bacteria in patient samples in the upper part of the of clinically relevant bacteria concentration range and that a further developed acoustic sample preparation system may open the door for a new and faster automated method to diagnose sepsis.

  4. Direct detection of infectious bursal disease virus from clinical samples by in situ reverse transcriptase-linked polymerase chain reaction.

    PubMed

    Cardoso, Tereza C; Rosa, Ana C G; Astolphi, Rafael D; Vincente, Rafael M; Novais, Juliana B; Hirata, Karina Y; Luvizotto, Maria Cecilia R

    2008-08-01

    The presence of the very virulent (vv) Brazilian strain of infectious bursal disease virus (IBDV) was determined in the bursa of Fabricius, thymus and liver of 2-week-old broilers from a flock with a higher than expected mortality. For this purpose, a direct in situ reverse transcriptase (RT)-linked polymerase chain reaction (PCR) method was developed using specific primers for vvIBDV. Unlabelled forward and reverse biotinylated oligonucleotides were used for RT-PCR in a one-step method and the respective products were revealed by a direct enzymatic reaction. The results were compared with those obtained by standard RT-PCR using general primers for IBDV and virus isolation. The virus isolation, RT-PCR and in situ RT-PCR revealed positive results on the bursa of Fabricius in 86%, 80% and 100%, respectively. The in situ RT-PCR detected vvIBDV in all tested thymus and liver samples, whereas the standard RT-PCR detected virus in 80% and 90% of the samples, respectively. After three consecutive passages on chicken embryonated eggs, IBDV was isolated from 64% of the thymus samples and 30% of the liver samples. In the present study, no classical or antigenic variants of IBDV were detected. The developed in situ RT-PCR assay was able to detect the very virulent strain of IBDV with a higher sensitivity than the conventional RT-PCR and virus isolation.

  5. Electrochemical detection of Piscirickettsia salmonis genomic DNA from salmon samples using solid-phase recombinase polymerase amplification.

    PubMed

    Del Río, Jonathan Sabaté; Svobodova, Marketa; Bustos, Paulina; Conejeros, Pablo; O'Sullivan, Ciara K

    2016-12-01

    Electrochemical detection of solid-phase isothermal recombinase polymerase amplification (RPA) of Piscirickettsia salmonis in salmon genomic DNA is reported. The electrochemical biosensor was constructed by surface functionalization of gold electrodes with a thiolated forward primer specific to the genomic region of interest. Solid-phase RPA and primer elongation were achieved in the presence of the specific target sequence and biotinylated reverse primers. The formation of the subsequent surface-tethered duplex amplicons was electrochemically monitored via addition of streptavidin-linked HRP upon completion of solid-phase RPA. Successful quantitative amplification and detection were achieved in less than 1 h at 37 °C, calibrating with PCR-amplified genomic DNA standards and achieving a limit of detection of 5 · 10(-8) μg ml(-1) (3 · 10(3) copies in 10 μl). The presented system was applied to the analysis of eight real salmon samples, and the method was also compared to qPCR analysis, observing an excellent degree of correlation. Graphical abstract Schematic of use of electrochemical RPA for detection of Psiricketessia salmonis in salmon liver.

  6. Detection of Leptospira spp. in wildlife reservoir hosts in Ontario through comparison of immunohistochemical and polymerase chain reaction genotyping methods

    PubMed Central

    Shearer, Karen E.; Harte, Michael J.; Ojkic, Davor; DeLay, Josepha; Campbell, Douglas

    2014-01-01

    A total of 460 kidney samples from wildlife (beavers, coyotes, deer, foxes, opossums, otters, raccoons, skunks) were obtained from road-kill and hunter/trapper donations in Ontario between January 2010 and November 2012. The objectives of the study were to detect Leptospira spp. by immunohistochemistry and polymerase chain reaction (PCR), to map presence of leptospires in wildlife relative to livestock and human populations, and to characterize positive samples by sequencing and comparison to leptospires known to affect domestic animals and humans. The proportion of samples that tested positive ranged from 0% to 42%, with the highest rates in skunks and raccoons. Leptospira spp. were present in kidneys of wildlife across Ontario, particularly in areas of high human density, and areas in which livestock populations are abundant. The PCR was too weak in most samples to permit genotyping and examination of the relationship between the leptospires found in this study and those affecting domestic animals and humans. PMID:24587507

  7. Case Report of Focal Epithelial Hyperplasia (Heck's Disease) with Polymerase Chain Reaction Detection of Human Papillomavirus 13.

    PubMed

    Brehm, Mary A; Gordon, Katie; Firan, Miahil; Rady, Peter; Agim, Nnenna

    2016-05-01

    Focal epithelial hyperplasia (FEH), or Heck's disease, is an uncommon benign proliferation of oral mucosa caused by the human papillomavirus (HPV), particularly subtypes 13 and 32. The disease typically presents in young Native American patients and is characterized by multiple asymptomatic papules and nodules on the oral mucosa, lips, tongue, and gingiva. The factors that determine susceptibility to FEH are unknown, but the ethnic and geographic distribution of FEH suggests that genetic predisposition, particularly having the human lymphocytic antigen DR4 type, may be involved in pathogenesis. We report a case of FEH with polymerase chain reaction detection of HPV13 in a healthy 11-year-old Hispanic girl and discuss the current understanding of disease pathogenesis, susceptibility, and treatment.

  8. Biofunctionalization of Polyoxometalates with DNA Primers, Their Use in the Polymerase Chain Reaction (PCR) and Electrochemical Detection of PCR Products.

    PubMed

    Debela, Ahmed M; Ortiz, Mayreli; Beni, Valerio; Thorimbert, Serge; Lesage, Denis; Cole, Richard B; O'Sullivan, Ciara K; Hasenknopf, Bernold

    2015-12-01

    The bioconjugation of polyoxometalates (POMs), which are inorganic metal oxido clusters, to DNA strands to obtain functional labeled DNA primers and their potential use in electrochemical detection have been investigated. Activated monooxoacylated polyoxotungstates [SiW11 O39 {Sn(CH2 )2 CO}](8-) and [P2 W17 O61 {Sn(CH2 )2 CO}](6-) have been used to link to a 5'-NH2 terminated 21-mer DNA forward primer through amide coupling. The functionalized primer was characterized by using a battery of techniques, including electrophoresis, mass spectrometry, as well as IR and Raman spectroscopy. The functionality of the POM-labeled primers was demonstrated through hybridization with a surface-immobilized probe. Finally, the labeled primers were successfully used in the polymerase chain reaction (PCR) and the PCR products were characterized by using electrophoresis.

  9. Nested polymerase chain reaction for detection of Theileria annulata and comparison with conventional diagnostic techniques: its use in epidemiology studies.

    PubMed

    Martín-Sánchez, J; Viseras, J; Adroher, F J; García-Fernández, P

    1999-03-01

    In this work we studied the ability of a nested polymerase chain reaction (PCR) to detect Theileria annulata, the causative agent of Mediterranean theileriosis, in blood samples obtained from cattle on farms in different Spanish regions and its possible use in epidemiology studies. Of the 214 samples analyzed, 78.04%, 69.86%, and 62.26% were found to be positive by nested PCR, indirect immunofluorescent antibody test, and optical microscopy of Giemsa-stained smears, respectively. The three techniques were in agreement in 68.6% of the results. The observation that the prevalence of Mediterranean theileriosis estimated using nested PCR alone (70.3%) and that obtained using all three diagnostic techniques together (80.4%) did not significantly differ verifies the utility of this technique in epidemiology studies.

  10. Polymerase chain reaction assay targeting cytochrome b gene for the detection of dog meat adulteration in meatball formulation.

    PubMed

    Rahman, Md Mahfujur; Ali, Md Eaqub; Hamid, Sharifah Bee Abd; Mustafa, Shuhaimi; Hashim, Uda; Hanapi, Ummi Kalthum

    2014-08-01

    A polymerase chain reaction (PCR) assay for the assessment of dog meat adulteration in meatballs was developed. The assay selectively amplified a 100-bp region of canine mitochondrial cytochrome b gene from pure, raw, processed and mixed backgrounds. The specificity of the assay was tested against 11 animals and 3 plants species, commonly available for meatball formulation. The stability of the assay was proven under extensively autoclaving conditions that breakdown target DNA. A blind test from ready to eat chicken and beef meatballs showed that the assay can repeatedly detect 0.2% canine meat tissues under complex matrices using 0.04 ng of dog DNA extracted from differentially treated meatballs. The simplicity, stability and sensitivity of the assay suggested that it could be used in halal food industry for the authentication of canine derivatives in processed foods.

  11. Detection of deoxyribonucleic acid (DNA) targets using polymerase chain reaction (PCR) and paper surface-enhanced Raman spectroscopy (SERS) chromatography.

    PubMed

    Hoppmann, Eric P; Yu, Wei W; White, Ian M

    2014-01-01

    Surface-enhanced Raman spectroscopy (SERS) enables multiplex detection of analytes using simple, portable equipment consisting of a single excitation source and detector. Thus, in theory, SERS is ideally suited to replace fluorescence in assays that screen for numerous deoxyribonucleic acid (DNA) targets, but in practice, SERS-based assays have suffered from complexity and elaborate processing steps. Here, we report an assay in which a simple inkjet-fabricated plasmonic paper device enables SERS-based detection of multiple DNA targets within a single polymerase chain reaction (PCR). In prior work, we demonstrated the principles of chromatographic separation and SERS-based detection on inkjet-fabricated plasmonic paper. The present work extends that capability for post-PCR gene sequence detection. In this design, hydrolysis DNA probes with 5' Raman labels are utilized; if the target is present, the probe is hydrolyzed during PCR, freeing the reporter. After applying the PCR sample to a paper SERS device, an on-device chromatographic separation and concentration is conducted to discriminate between hydrolyzed and intact probes. SERS is then used to detect the reporter released by the hydrolyzed probes. This simple separation and detection on paper eliminates the need for complex sample processing steps. In this work, we simultaneously detect the methicillin-resistant Staphylococcus aureus genes mecA and femB to illustrate the concept. We envision that this approach could contribute to the development of multiplex DNA diagnostic tests enabling screening for several target sequences within a single reaction, which is necessary for cases in which sample volume and resources are limited.

  12. Development of a rapid detection method to detect tdh gene in Vibrio parahaemolyticus using 2-step ultrarapid real-time polymerase chain reaction.

    PubMed

    Kang, Min-Hee; Kim, Il-Wook; Lee, Dong-Woo; Yoo, Mi-Sun; Han, Sang-Hoon; Yoon, Byoung-Su

    2011-01-01

    Thermostable direct hemolysin encoded by tdh gene has been considered an important virulence factor in pathogenic Vibrio parahaemolyticus. Two-step ultrarapid real-time polymerase chain reaction (URRT PCR) with a microchip was devised to detect V. parahaemolyticus carrying tdh gene. This novel method has a 6-μL reaction volume and extremely reduces running time since one cycle can be completed in 10 s or less. Consequently, 35 cycles of URRT PCR was successfully able to detect up to 100 fg (18 copies) of genomic DNA from pathogenic V. parahaemolyticus carrying tdh gene in 6 min. These results indicate that this method is at present the most rapid detection method for tdh gene and pathogenic V. parahaemolyticus.

  13. Specific detection of RT activity in culture supernantants of retrovirus-producing cells, using synthetic DNA as competitor in polymerase enhanced reverse transcriptase assay.

    PubMed

    Voisset, C; Tönjes, R R; Breyton, P; Mandrand, B; Paranhos-Baccalà, G

    2001-05-01

    The polymerase enhanced reverse transcriptase (PERT) assay is a highly sensitive assay for the detection of reverse transcriptase (RT) activity in culture supernatants of retrovirus-producing cells. However, some cellular DNA-dependent DNA polymerases exhibit RT-like activities in this assay. A synthetic DNA competitor which suppresses the RT-like activities of cellular DNA-dependent DNA polymerases was used in a modified PERT assay technique for specific detection of RT activity in culture supernatants of retrovirus-producing cells. We determined the optimum condition of the assay and evaluated its specificity. This improved PERT assay is easy to perform and is able to detect minute amounts of purified RT, as well as RT in crude cell lysates and concentrated culture supernatants.

  14. Specific detection of potentially allergenic kiwifruit in foods using polymerase chain reaction.

    PubMed

    Taguchi, Hiromu; Watanabe, Satoshi; Hirao, Takashi; Akiyama, Hiroshi; Sakai, Shinobu; Watanabe, Takahiro; Matsuda, Rieko; Urisu, Atsuo; Maitani, Tamio

    2007-03-07

    Kiwifruit (Actinidia deliciosa and Actinidia chinensis) is allergenic to sensitive patients, and, under Japanese regulations, it is one of the food items that are recommended to be declared on food labeling as much as possible. To develop PCR-based methods for the detection of trace amounts of kiwifruit in foods, two primer pairs targeting the ITS-1 region of the Actinidia spp. were designed using PCR simulation software. On the basis of the known distribution of a major kiwifruit allergen (actinidin) within the Actinidia spp., as well as of reports on clinical and immunological cross-reactivities, one of the primer pairs was designed to detect all Actinidia spp. and the other to detect commercially grown Actinidia spp. (i.e., kiwifruit, Actinidia arguta, and their interspecific hybrids) except for Actinidia polygama. The specificity of the developed methods using the designed primer pairs was verified by performing PCR experiments on 8 Actinidia spp. and 26 other plants including fruits. The methods were considered to be specific enough to yield target-size products only from the target Actinidia spp. and to detect no target-size products from nontarget species. The methods were sensitive enough to detect 5-50 fg of Actinidia spp. DNA spiked in 50 ng of salmon testis DNA used as a carrier (1-10 ppm of kiwifruit DNA) and 1700 ppm (w/w) of fresh kiwifruit puree spiked in a commercial plain yogurt (corresponding to ca. 10 ppm of kiwifruit protein). These methods would be expected to be useful in the detection of hidden kiwifruit and its related species in processed foods.

  15. Method for the detection of specific nucleic acid sequences by polymerase nucleotide incorporation

    DOEpatents

    Castro, Alonso

    2004-06-01

    A method for rapid and efficient detection of a target DNA or RNA sequence is provided. A primer having a 3'-hydroxyl group at one end and having a sequence of nucleotides sufficiently homologous with an identifying sequence of nucleotides in the target DNA is selected. The primer is hybridized to the identifying sequence of nucleotides on the DNA or RNA sequence and a reporter molecule is synthesized on the target sequence by progressively binding complementary nucleotides to the primer, where the complementary nucleotides include nucleotides labeled with a fluorophore. Fluorescence emitted by fluorophores on single reporter molecules is detected to identify the target DNA or RNA sequence.

  16. Comparison of three DNA extraction methods for detection of Erysipelothrix rhusiopathiae in chicken blood by polymerase chain reaction.

    PubMed

    Harada, Kazuki; Uchiyama, Mariko; Hoshi, Teruyuki; Takahashi, Toshio

    2009-05-01

    A previously reported Erysipelothrix-specific polymerase chain reaction (PCR) was used to detect Erysipelothrix bacteremia in chickens. The sensitivity of PCR using 3 DNA extraction methods (boiling method, commercial gene matrix, and DNA extractor kit) was compared by using a serial 10-fold dilution of a chicken isolate of Erysipelothrix rhusiopathiae strain in chicken blood. Of the techniques used, the DNA extractor kit, followed by PCR, provided the most sensitive method for the detection of the E. rhusiopathiae strain in chicken blood (approximately 10(0) CFU/0.1 ml of blood). Two E. rhusiopathiae infection experiments were then attempted. In a total of 10 inoculated chickens, bacteremia developed in 9 chickens, consisting of all 5 chickens used in the first trial (ranging from 5.1 x 10(1) to 2.0 x 10(3) CFU/0.1 ml of blood) and 4 of the 5 chickens used in the second trial (ranging from 1.0 x 10(0) to 3.3 x 10(2) CFU/0.1 ml of blood). In the second trial, the 3 detection techniques were applied to the chickens with bacteremia, and the organism could be detected by using the DNA extractor kit in blood specimens from the 3 chickens exhibiting bacteremia of > or =4.2 x 10(1) CFU/0.1 ml of blood. This observation suggests that most E. rhusiopathiae-infected chickens develop more critical bacteremia than the detectable level by PCR with the DNA extractor kit, and the PCR detection method can be used as a first-line screening of avian erysipelas.

  17. DOUBLE COMPACT OBJECTS. III. GRAVITATIONAL-WAVE DETECTION RATES

    SciTech Connect

    Dominik, Michal; Belczynski, Krzysztof; Bulik, Tomasz; Berti, Emanuele; O’Shaughnessy, Richard; Mandel, Ilya; Fryer, Christopher; Holz, Daniel E.; Pannarale, Francesco

    2015-06-20

    The unprecedented range of second-generation gravitational-wave (GW) observatories calls for refining the predictions of potential sources and detection rates. The coalescence of double compact objects (DCOs)—i.e., neutron star–neutron star (NS–NS), black hole–neutron star (BH–NS), and black hole–black hole (BH–BH) binary systems—is the most promising source of GWs for these detectors. We compute detection rates of coalescing DCOs in second-generation GW detectors using the latest models for their cosmological evolution, and implementing inspiral-merger-ringdown gravitational waveform models in our signal-to-noise ratio calculations. We find that (1) the inclusion of the merger/ringdown portion of the signal does not significantly affect rates for NS–NS and BH–NS systems, but it boosts rates by a factor of ∼1.5 for BH–BH systems; (2) in almost all of our models BH–BH systems yield by far the largest rates, followed by NS–NS and BH–NS systems, respectively; and (3) a majority of the detectable BH–BH systems were formed in the early universe in low-metallicity environments. We make predictions for the distributions of detected binaries and discuss what the first GW detections will teach us about the astrophysics underlying binary formation and evolution.

  18. Gd(III)-induced Supramolecular Hydrogelation with Enhanced Magnetic Resonance Performance for Enzyme Detection

    PubMed Central

    Hua, Yongquan; Pu, Guojuan; Ou, Caiwen; Zhang, Xiaoli; Wang, Ling; Sun, Jiangtao; Yang, Zhimou; Chen, Minsheng

    2017-01-01

    Here we report a supramolecular hydrogel based on Gd(III)-peptide complexes with dramatically enhanced magnetic resonance (MR) performance. The hydrogelations were formed by adding Gd(III) ion to the nanofiber dispersion of self-assembling peptides naphthalene-Gly-Phe-Phe-Tyr-Gly-Arg-Gly-Asp (Nap-GFFYGRGD) or naphthalene-Gly-Phe-Phe-Tyr-Gly-Arg-Gly-Glu (Nap-GFFYGRGE). We further showed that, by adjusting the molar ratio between Gd(III) and the corresponding peptide, the mechanical property of resulting gels could be fine-tuned. The longitudinal relaxivity (r1) of the Nap-GFFYGRGE-Gd(III) was 58.9 mM−1 S−1, which to our knowledge is the highest value for such peptide-Gd(III) complexes so far. Such an enhancement of r1 value could be applied for enzyme detection in aqueous solutions and cell lysates. PMID:28074904

  19. Gd(III)-induced Supramolecular Hydrogelation with Enhanced Magnetic Resonance Performance for Enzyme Detection

    NASA Astrophysics Data System (ADS)

    Hua, Yongquan; Pu, Guojuan; Ou, Caiwen; Zhang, Xiaoli; Wang, Ling; Sun, Jiangtao; Yang, Zhimou; Chen, Minsheng

    2017-01-01

    Here we report a supramolecular hydrogel based on Gd(III)-peptide complexes with dramatically enhanced magnetic resonance (MR) performance. The hydrogelations were formed by adding Gd(III) ion to the nanofiber dispersion of self-assembling peptides naphthalene-Gly-Phe-Phe-Tyr-Gly-Arg-Gly-Asp (Nap-GFFYGRGD) or naphthalene-Gly-Phe-Phe-Tyr-Gly-Arg-Gly-Glu (Nap-GFFYGRGE). We further showed that, by adjusting the molar ratio between Gd(III) and the corresponding peptide, the mechanical property of resulting gels could be fine-tuned. The longitudinal relaxivity (r1) of the Nap-GFFYGRGE-Gd(III) was 58.9 mM‑1 S‑1, which to our knowledge is the highest value for such peptide-Gd(III) complexes so far. Such an enhancement of r1 value could be applied for enzyme detection in aqueous solutions and cell lysates.

  20. Detection and quantification of Renibacterium salmoninarum DNA in salmonid tissues by real-time quantitative polymerase chain reaction analysis

    USGS Publications Warehouse

    Chase, D.M.; Elliott, D.G.; Pascho, R.J.

    2006-01-01

    Renibacterium salmoninarum is an important salmonid pathogen that is difficult to culture. We developed and assessed a real-time, quantitative, polymerase chain reaction (qPCR) assay for the detection and enumeration of R. salmoninarum. The qPCR is based on TaqMan technology and amplifies a 69-base pair (bp) region of the gene encoding the major soluble antigen (MSA) of R. salmoninarum. The qPCR assay consistently detected as few as 5 R. salmoninarum cells per reaction in kidney tissue. The specificity of the qPCR was confirmed by testing the DNA extracts from a panel of microorganisms that were either common fish pathogens or reported to cause false-positive reactions in the enzyme-linked immunosorbent assay (ELISA). Kidney samples from 38 juvenile Chinook salmon (Oncorhynchus tshawytscha) in a naturally infected population were examined by real-time qPCR, a nested PCR, and ELISA, and prevalences of R. salmoninarum detected were 71, 66, and 71%, respectively. The qPCR should be a valuable tool for evaluating the R. salmoninarum infection status of salmonids.

  1. A quantitative reverse transcriptase polymerase chain reaction-based assay to detect carcinoma cells in peripheral blood.

    PubMed Central

    Helfrich, W.; ten Poele, R.; Meersma, G. J.; Mulder, N. H.; de Vries, E. G.; de Leij, L.; Smit, E. F.

    1997-01-01

    The presence of tumour cells in the circulation may predict disease recurrence and metastasis. To improve on existing methods of cytological or immunocytological detection, we have developed a sensitive and quantitative technique for the detection of carcinoma cells in blood, using the reverse transcriptase polymerase chain reaction (RT-PCR) identifying transcripts of the pancarcinoma-associated tumour marker EGP-2 (KSA or 17-1A antigen). The amount of EGP2 mRNA was quantified using an internal recombinant competitor RNA standard with known concentration and which is both reversely transcribed and co-amplified in the same reaction, allowing for a reliable assessment of the initial amount of EGP2 mRNA in the sample. Calibration studies, seeding blood with MCF-7 breast carcinoma cells, showed that the assay can detect ten tumour cells among 1.0 x 10(6) leucocytes. The PCR assay revealed that normal bone marrow expresses low levels of EGP2 mRNA, although immunocytochemistry with the anti-EGP2 MAb MOC31 could not identify any positively stained cell. Analyses using this RT-PCR assay may prove to have applications to the assessment of circulating tumour cells in clinical samples. Images Figure 3 Figure 4 PMID:9218728

  2. KRAS detection on archival cytological smears by the novel fully automated polymerase chain reaction-based Idylla mutation test

    PubMed Central

    De Luca, Caterina; Vigliar, Elena; d’Anna, Melania; Pisapia, Pasquale; Bellevicine, Claudio; Malapelle, Umberto; Troncone, Giancarlo

    2017-01-01

    Background: Molecular techniques are relevant to modern cytopathology, but their implementation is difficult without molecular expertise and infrastructure. The assessment of KRAS mutational status on cytological preparations may be useful either to refine uncertain diagnoses on pancreatic aspirates or to yield predictive information to plan targeted treatment of metastatic colorectal cancer (mCRC). The novel test Idylla™ enables fully automated KRAS genotyping in approximately 2 h, even in less experienced hands. Materials and Methods: This study aims to validate this methodology to detect KRAS mutations on archival cytological preparations of pancreatic cancer (n = 9) and mCRC (n = 9) by comparing the Idylla™ performance to that of standard real-time polymerase chain reaction. Results: The same 11 mutations (n = 4: p.G12D; n = 2: p.G12V; n = 2: p.A59E/G/T; n = 1: p.G12R; n = 1: p.G13D; n = 1: p.Q61H) were detected by both techniques. Conclusion: Even in less experienced laboratories, a cytopathologist may easily integrate morphological diagnostic report with accurate KRAS mutation detection, which is relevant for diagnostic and treatment decisions. PMID:28331530

  3. Detection of Leishmania braziliensis in human paraffin-embedded tissues from Tucumán, Argentina by polymerase chain reaction.

    PubMed

    Lanús, Elizabeth Córdoba; Piñero, José Enrique; González, Ana Cristina; Valladares, Basilio; de Grosso, Mercedes Lizarralde; Salomón, Oscar Daniel

    2005-04-01

    American cutaneous leishmaniasis (ACL) is an endemic disease in Northern Argentina. We applied the polymerase chain reaction (PCR) followed by a hybridization labelled probe to 21 paraffin embedded human skin biopsies, already analyzed histologically, from leishmaniasis endemic areas in the province of Tucumán, Argentina. We used primers previously designed to detect a Leishmania-specific 120-base-pair fragment of kinetoplast DNA minicircle, other two primer pairs that amplify kDNA minicircles belonging to the L. braziliensis and L. mexicana complexes respectively, and specific oligonucleotide primers to detect L. (V.) braziliensis which amplify the sequence of the ribosomal protein L-14 of this species. The PCR-hybridization showed a sensitivity of 90.5% when compared to the histopathology test which was 61.9%. Five of the total samples analyzed were positive for the L. braziliensis complex whilst none was positive for the L. mexicana complex. The specific primers for L. (V.) braziliensis detected the parasite in four samples. These results are consistent with those reported for close endemic areas and demonstrate that the causative agent of human leishmaniasis in the analyzed cases was L. (V.) braziliensis. PCR should be used as a diagnostic tool for tegumentary leishmaniasis, especially in the mucosal form, and as a valuable technique for the identification of the Leishmania species that causes the disease in certain areas.

  4. Comprehensive polymerase chain reaction assay for detection of pathogenic DNA in lymphoproliferative disorders of the ocular adnexa

    PubMed Central

    Usui, Yoshihiko; Rao, Narsing A.; Takase, Hiroshi; Tsubota, Kinya; Umazume, Kazuhiko; Diaz-Aguilar, Daniel; Kezuka, Takeshi; Mochizuki, Manabu; Goto, Hiroshi; Sugita, Sunao

    2016-01-01

    Infectious agents have been identified as a major cause of specific types of human cancers worldwide. Several microorganisms have been identified as potential aggravators of ocular adnexal neoplasms; however, given the rarity of these neoplasms, large epidemiological studies are difficult to coordinate. This study aimed to conduct an exhaustive search for pathogenic DNA in lymphoproliferative disorders (LPD) of the ocular adnexa in a total of 70 patients who were diagnosed with LPD of the ocular adnexa between 2008 and 2013. Specimens were screened for bacterial, viral, fungal, and parasitic DNA by multiplex polymerase chain reaction (PCR) and quantitative real-time PCR. Among cases of conjunctival mucosa-associated lymphoid tissue lymphoma, human herpes virus (HHV)-6, HHV-7, chlamydia, Epstein-Barr virus (EBV) and bacterial 16S ribosomal DNA were detected. In cases of IgG4-related ocular disease, similar pathogens were detected but in a larger number of patients. Our PCR assays detected DNAs of various infectious agents in tumor specimens, especially HHV6, HHV7, and EBV, with different positive rates in various types of LPD. Chronic inflammatory stimulation or activation of oncogenes from these infectious agents might be involved in the pathogenesis of LPD of the ocular adnexa. PMID:27830722

  5. Optimization of polymerase chain reaction for detection of Clostridium botulinum type C and D in bovine samples.

    PubMed

    Prévot, V; Tweepenninckx, F; Van Nerom, E; Linden, A; Content, J; Kimpe, A

    2007-01-01

    Botulism is a rare but serious paralytic illness caused by a nerve toxin that is produced by the bacterium Clostridium botulinum. The economic, medical and alimentary consequences can be catastrophic in case of an epizooty. A polymerase chain reaction (PCR)-based assay was developed for the detection of C. botulinum toxigenic strains type C and D in bovine samples. This assay has proved to be less expensive, faster and simpler to use than the mouse bioassay, the current reference method for diagnosis of C. botulinum toxigenic strains. Three pairs of primers were designed, one for global detection of C. botulinum types C and D (primer pair Y), and two strain-specific pairs specifically designed for types C (primer pair VC) and D (primer pair VD). The PCR amplification conditions were optimized and evaluated on 13 bovine and two duck samples that had been previously tested by the mouse bioassay. In order to assess the impact of sample treatment, both DNA extracted from crude samples and three different enrichment broths (TYG, CMM, CMM followed by TYG) were tested. A 100% sensitivity was observed when samples were enriched for 5 days in CMM followed by 1 day in TYG broth. False-negative results were encountered when C. botulinum was screened for in crude samples. These findings indicate that the current PCR is a reliable method for the detection of C. botulinum toxigenic strains type C and D in bovine samples but only after proper enrichment in CMM and TYG broth.

  6. Real-Time Polymerase Chain Reaction Detection of Angiostrongylus cantonensis DNA in Cerebrospinal Fluid from Patients with Eosinophilic Meningitis

    PubMed Central

    Qvarnstrom, Yvonne; Xayavong, Maniphet; da Silva, Ana Cristina Aramburu; Park, Sarah Y.; Whelen, A. Christian; Calimlim, Precilia S.; Sciulli, Rebecca H.; Honda, Stacey A. A.; Higa, Karen; Kitsutani, Paul; Chea, Nora; Heng, Seng; Johnson, Stuart; Graeff-Teixeira, Carlos; Fox, LeAnne M.; da Silva, Alexandre J.

    2016-01-01

    Angiostrongylus cantonensis is the most common infectious cause of eosinophilic meningitis. Timely diagnosis of these infections is difficult, partly because reliable laboratory diagnostic methods are unavailable. The aim of this study was to evaluate the usefulness of a real-time polymerase chain reaction (PCR) assay for the detection of A. cantonensis DNA in human cerebrospinal fluid (CSF) specimens. A total of 49 CSF specimens from 33 patients with eosinophilic meningitis were included: A. cantonensis DNA was detected in 32 CSF specimens, from 22 patients. Four patients had intermittently positive and negative real-time PCR results on subsequent samples, indicating that the level of A. cantonensis DNA present in CSF may fluctuate during the course of the illness. Immunodiagnosis and/or supplemental PCR testing supported the real-time PCR findings for 30 patients. On the basis of these observations, this real-time PCR assay can be useful to detect A. cantonensis in the CSF from patients with eosinophilic meningitis. PMID:26526920

  7. Detection of Avian bornavirus in multiple tissues of infected psittacine birds using real-time reverse transcription polymerase chain reaction.

    PubMed

    Delnatte, Pauline; Mak, Matthew; Ojkic, Davor; Raghav, Raj; DeLay, Josepha; Smith, Dale A

    2014-03-01

    Avian bornavirus (ABV), the cause of proventricular dilation disease in psittacine birds, has been detected in multiple tissues of infected birds using immunohistochemical staining (IHC) and reverse transcription polymerase chain reaction (RT-PCR). In the current study, real-time RT-PCR, using primers targeting the ABV matrix gene, was used to detect ABV in 146 tissues from 7 ABV-infected psittacine birds. Eighty-six percent of the samples tested positive, with crossing point values ranging from 13.82 to 37.82 and a mean of 22.3. These results were compared to the findings of a previous study using gel-based RT-PCR and IHC on the same samples. The agreement between the 2 RT-PCR techniques was 91%; when tests disagreed it was because samples were negative using gel-based RT-PCR but positive on real-time RT-PCR. Agreement with IHC was 77%; 16 out of 74 samples were negative using IHC but positive on real-time RT-PCR. The results suggest that real-time RT-PCR is a more sensitive technique than gel-based RT-PCR and IHC to detect ABV in tissues. The tissues that were ranked most frequently as having a high amount of viral RNA were proventriculus, kidney, colon, cerebrum, and cerebellum. Skeletal muscle, on the other hand, was found to have a consistently low amount of viral RNA.

  8. Real-time fluorogenic reverse transcription polymerase chain reaction assay for the specific detection of Bagaza virus.

    PubMed

    Buitrago, Dolores; Rocha, Ana; Tena-Tomás, Cristina; Vigo, Marta; Agüero, Montserrat; Jiménez-Clavero, Miguel Angel

    2012-09-01

    In September 2010, an outbreak of disease in 2 wild bird species (red-legged partridge, Alectoris rufa; ring-necked pheasant, Phasianus colchicus) occurred in southern Spain. Bagaza virus (BAGV) was identified as the etiological agent of the outbreak. BAGV had only been reported before in Western Africa (Central African Republic, Senegal) and in India. The first occurrence of BAGV in Spain stimulated a demand for rapid, reliable, and efficacious diagnostic methods to facilitate the surveillance of this disease in the field. This report describes a real-time reverse transcription polymerase chain reaction (RT-PCR) method based on a commercial 5'-Taq nuclease-3' minor groove binder DNA probe and primers targeting the Bagaza NS5 gene. The method allowed the detection of BAGV with a high sensitivity, whereas other closely related flaviviruses (Usutu virus, West Nile virus, and Japanese encephalitis virus) were not detected. The assay was evaluated using field samples of red-legged partridges dead during the outbreak (n = 11), as well as samples collected from partridges during surveillance programs (n = 81). The results were compared to those obtained with a pan-flaviviral hemi-nested RT-PCR followed by nucleotide sequencing, which was employed originally to identify the virus involved in the outbreak. The results obtained with both techniques were 100% matching, indicating that the newly developed real-time RT-PCR is a valid technique for BAGV genome detection, useful in both diagnosis and surveillance studies.

  9. Detection of multiple strains of Pasteurella multocida in fowl cholera outbreaks by polymerase chain reaction-based typing.

    PubMed

    Shivachandra, S B; Kumar, A A; Gautam, R; Saxena, M K; Chaudhuri, P; Srivastava, S K

    2005-12-01

    Applicability of molecular methods for the detection and differentiation of Pasteurella multocida strains involved in two separate fowl cholera outbreaks in a single poultry farm was investigated. A total of 12 and 18 strains of P. multocida obtained from two separate outbreaks were subjected to phenotypic and genotypic characterization. Phenotypically, all strains were similar; however, DNA-based techniques by employing polymerase chain reaction (PCR) assays were found to be highly specific and sensitive for rapid detection and differentiation of strains. All 30 strains gave amplicons of approximately 460 bp and approximately 1,044 bp specific for P. multocida and capsular serogroup A in the Multiplex Capsular PCR typing system. Molecular typing techniques such as repetitive extragenic palindromic PCR, enterobacterial repetitive intergenic consensus PCR and single primer PCR differentiated all 30 strains into different profiles. However, similar patterns of genome fragments were observed among all strains following restriction endonuclease analysis using the enzyme HpaII. The current investigation revealed involvement of the same and multiple strains of P. multocida in two outbreaks. The results also indicated that molecular methods of detection and typing are rapid in comparison with conventional methods for epidemiological investigations of fowl cholera outbreaks.

  10. Aptamer Lateral Flow Assays for Ultrasensitive Detection of β-Conglutin Combining Recombinase Polymerase Amplification and Tailed Primers.

    PubMed

    Jauset-Rubio, Miriam; Svobodová, Markéta; Mairal, Teresa; McNeil, Calum; Keegan, Neil; El-Shahawi, Mohammad S; Bashammakh, Abdulaziz S; Alyoubi, Abdulrahman O; O'Sullivan, Ciara K

    2016-11-01

    In this work, different methodologies were evaluated in search of robust, simple, rapid, ultrasensitive, and user-friendly lateral flow aptamer assays. In one approach, we developed a competitive based lateral flow aptamer assay, in which β-conglutin immobilized on the test line of a nitrocellulose membrane and β-conglutin in the test sample compete for binding to AuNP labeled aptamer. The control line exploits an immobilized DNA probe complementary to the labeled aptamer, forcing displacement of the aptamer from the β-conglutin-aptamer complex. In a second approach, the competition for aptamer binding takes place off-strip, and following competition, aptamer bound to the immobilized β-conglutin is eluted and used as a template for isothermal recombinase polymerase amplification, exploiting tailed primers, resulting in an amplicon of a duplex flanked by single stranded DNA tails. The amplicon is rapidly and quantitatively detected using a nucleic acid lateral flow with an immobilized capture probe and a gold nanoparticle labeled reporter probe. The competitive lateral flow is completed in just 5 min, achieving a detection limit of 55 pM (1.1 fmol), and the combined competitive-amplification lateral flow requires just 30 min, with a detection limit of 9 fM (0.17 amol).

  11. Development and use of a real-time polymerase chain reaction assay for the detection of Ophidiomyces ophiodiicola in snakes.

    PubMed

    Allender, Matthew C; Bunick, David; Dzhaman, Elena; Burrus, Lucienne; Maddox, Carol

    2015-03-01

    Fungal pathogens threatening the conservation of wildlife are becoming increasingly common. Since 2008, free-ranging snakes across North America have been experiencing a marked increase in the prevalence of snake fungal disease associated with Ophidiomyces ophiodiicola. Diagnosis has historically relied on histology, microbiology, and conventional polymerase chain reaction (PCR). More sensitive methods are needed to adequately characterize the epidemiology. The current study describes the development of a real-time PCR (qPCR) assay for detecting a segment of the internal transcribed spacer 1 region between the 18S and 5.8S ribosomal RNA gene. The assay was able to detect as few as 1.05 × 10(1) gene copies per reaction. An additional 4 positive cases were detected when comparing a conventional PCR (n = 3) and the qPCR (n = 7) when used on swab samples from 47 eastern massasauga rattlesnakes. The newly developed assay is a sensitive and specific tool for surveillance and monitoring in the conservation of free-ranging snakes.

  12. Simultaneous Detection of Three Bacterial Seed-Borne Diseases in Rice Using Multiplex Polymerase Chain Reaction

    PubMed Central

    Kang, In Jeong; Kang, Mi-Hyung; Noh, Tae-Hwan; Shim, Hyeong Kwon; Shin, Dong Bum; Heu, Suggi

    2016-01-01

    Burkholderia glumae (bacterial grain rot), Xanthomonas oryzae pv. oryzae (bacterial leaf blight), and Acidovorax avenae subsp. avenae (bacterial brown stripe) are major seedborne pathogens of rice. Based on the 16S and 23S rDNA sequences for A. avenae subsp. avenae and B. glumae, and transposase A gene sequence for X. oryzae pv. oryzae, three sets of primers had been designed to produce 402 bp for B. glumae, 490 bp for X. oryzae, and 290 bp for A. avenae subsp. avenae with the 63°C as an optimum annealing temperature. Samples collected from naturally infected fields were detected with two bacteria, B. glumae and A. avenae subsp. avenae but X. oryzae pv. oryzae was not detected. This assay can be used to identify pathogens directly from infected seeds, and will be an effective tool for the identification of the three pathogens in rice plants. PMID:27904465

  13. Detection of human papillomaviruses by polymerase chain reaction and ligation reaction on universal microarray.

    PubMed

    Ritari, Jarmo; Hultman, Jenni; Fingerroos, Rita; Tarkkanen, Jussi; Pullat, Janne; Paulin, Lars; Kivi, Niina; Auvinen, Petri; Auvinen, Eeva

    2012-01-01

    Sensitive and specific detection of human papillomaviruses (HPV) in cervical samples is a useful tool for the early diagnosis of epithelial neoplasia and anogenital lesions. Recent studies support the feasibility of HPV DNA testing instead of cytology (Pap smear) as a primary test in population screening for cervical cancer. This is likely to be an option in the near future in many countries, and it would increase the efficiency of screening for cervical abnormalities. We present here a microarray test for the detection and typing of 15 most important high-risk HPV types and two low risk types. The method is based on type specific multiplex PCR amplification of the L1 viral genomic region followed by ligation detection reaction where two specific ssDNA probes, one containing a fluorescent label and the other a flanking ZipCode sequence, are joined by enzymatic ligation in the presence of the correct HPV PCR product. Human beta-globin is amplified in the same reaction to control for sample quality and adequacy. The genotyping capacity of our approach was evaluated against Linear Array test using cervical samples collected in transport medium. Altogether 14 out of 15 valid samples (93%) gave concordant results between our test and Linear Array. One sample was HPV56 positive in our test and high-risk positive in Hybrid Capture 2 but remained negative in Linear Array. The preliminary results suggest that our test has accurate multiple HPV genotyping capability with the additional advantages of generic detection format, and potential for high-throughput screening.

  14. Detection of Rickettsiae in Arthropod Vectors by DNA Amplification Using the Polymerase Chain Reaction

    DTIC Science & Technology

    1990-01-01

    Rickettsia rickettsii 17-kDa-antigen gene sequence. 6- we synthe- sized two oligonucleotides 20 bases in length that are complementary to two aThis study was...ntigen’detection, indirect immunofluorescence, rickettsiae , artht’opod vectorE Rikettsia rickettsii , 17-KDa-antigen gene selqti’ence, typhus group rickettsiae ...stored in tubes contain- ing 0.5 ml brain heart infusion broth (BHI) at -70°C. Rickettsia rickettsii -infected Dermacentor variabilis was kindly provided

  15. Differential detection of shrimp and crab for food labeling using polymerase chain reaction.

    PubMed

    Taguchi, Hiromu; Watanabe, Satoshi; Temmei, Yusuke; Hirao, Takashi; Akiyama, Hiroshi; Sakai, Shinobu; Adachi, Reiko; Sakata, Kozue; Urisu, Atsuo; Teshima, Reiko

    2011-04-27

    Shrimp and crab are well-known as allergenic ingredients. According to Japanese food allergy labeling regulations, shrimp species (including prawns, crayfishes, and lobsters) and crab species must be differentially declared when ≥10 ppm (total protein) of an allergenic ingredient is present. However, the commercial ELISA tests for the detection of crustacean proteins cannot differentiate between shrimp and crab. Therefore, two methods were developed to discriminate shrimp and crab: a shrimp-PCR method with postamplification digestion and a crab-PCR method that specifically amplifies a fragment of the 16S rRNA gene. The sensitivity and specificity of both PCR methods were verified by experiments using DNA extracted from 15 shrimp species, 13 crab species, krill, mysid, mantis shrimp, other food samples (cephalopod, shellfish, and fish), incurred foods, and commercial food products. Both PCR methods could detect 5 pg of DNA extracted from target species and 50 ng of genomic DNA extracted from incurred foods containing 10 ppm (μg/g) total protein of shrimp or crab. The two PCR methods were considered to be specific enough to separately detect species belonging to shrimp and crab. Although false-positive and false-negative results were obtained from some nontarget crustacean species, the proposed PCR methods, when used in conjunction with ELISA tests, would be a useful tool for confirmation of the validity of food allergy labeling and management of processed food safety for allergic patients.

  16. Construction and Evaluation of Cytomegalovirus DNA Quantification System with Real-Time Detection Polymerase Chain Reaction

    PubMed Central

    Hatayama, Yuki; Hashimoto, Yuki; Hara, Ayako; Motokura, Toru

    2016-01-01

    Background For patients with reactivation of human cytomegalovirus (CMV), a highly sensitive and accurate CMV quantification system is essential to monitor viral load. Methods We constructed a real-time detection PCR (RTD-PCR) system for CMV DNA and evaluated its linearity, lower detection limit, dynamic range and accuracy using two CMV standards. We used 219 clinical samples derived from 101 patients to compare the system with the pp65 antigen test. Results The 95% detection limit was determined to be 556 IU/mL (95% CI, 440–797 IU/mL), and the quantification range was between 102 and 106 copies or IU/mL (r = 0.996, 0.999, respectively). The coefficients of variation of inter-assay reproducibility assessed in each three different runs were 2.5% at 1,000 IU/mL and 1.6% at 10,000 IU/mL. The coefficients of variation of intra-assay variability by testing the same samples three times in a single run were 1.8–3.6% and 0.4–1.9%, respectively. The concordance between antigenemia and plasma or serum CMV DNA levels was a good correlation (r = 0.695, P < 0.01). Conclusion We constructed the RTD-PCR system which enables accurate evaluation of CMV reactivation by monitoring of viral load in immunosuppressed or immunocompromised patients. PMID:27708537

  17. Detection of HLA-DRB1 microchimerism using nested polymerase chain reaction and single-strand conformation polymorphism analysis.

    PubMed

    Song, Eun Young; Chung, Hye Yoon; Joo, Shin Young; Roh, Eun Youn; Seong, Moon-Woo; Shin, Yunsu; Park, Myoung Hee

    2012-03-01

    For the detection of microchimerism, molecular methods detecting donor-specific HLA-DRB1 alleles in the recipient are most commonly used. Nested polymerase chain reaction sequence specific primer (nested PCR-SSP) methods widely used to increase the sensitivity of detection have been reported to give frequent false-positive reactions. We have developed a new method combining nested PCR with single-strand conformation polymorphism analysis (nested PCR-SSCP) and tested the 1 to 0.00001% level of microchimerism for 27 different HLA-DRB1 alleles. For most (26/27) of the HLA-DRB1 alleles tested, this method could detect 0.01 to 0.001% of microchimerism and its sensitivity was equal to or better than that of nested PCR-SSP tested in parallel. Its specificity was verified by visualizing particular DRB1-specific SSCP bands under test. Nested PCR-SSP indicated frequent false-positive reactions, mainly caused by nonspecific amplification of DRB3/B4/B5 alleles present in the major (recipient) DNAs. We have compared a real-time quantitative PCR for non-human leukocyte antigen (HLA) target (insertion/deletion marker) using a commercial kit (AlleleSEQR Chimerism assay), and its microchimerism detection sensitivity (around 0.1%) was 1 step (10 times) lower than that of nested PCR-SSP or -SSCP methods for HLA-DRB1 alleles. We validated that the newly designed nested PCR-SSCP affords good sensitivity and specificity and may be useful for studying microchimerism in clinical settings.

  18. Avian haemosporidian parasites (Haemosporida): A comparative analysis of different polymerase chain reaction assays in detection of mixed infections.

    PubMed

    Bernotienė, Rasa; Palinauskas, Vaidas; Iezhova, Tatjana; Murauskaitė, Dovilė; Valkiūnas, Gediminas

    2016-04-01

    Mixed infections of different species and genetic lineages of haemosporidian parasites (Haemosporida) predominate in wildlife, and such infections are particularly virulent. However, currently used polymerase chain reaction (PCR)-based detection methods often do not read mixed infections. Sensitivity of different PCR assays in detection of mixed infections has been insufficiently tested, but this knowledge is essential in studies addressing parasite diversity in wildlife. Here, we applied five different PCR assays, which are broadly used in wildlife avian haemosporidian research, and compared their sensitivity in detection of experimentally designed mixed infections of Haemoproteus and Plasmodium parasites. Three of these PCR assays use primer sets that amplify fragments of cytochrome b gene (cyt b), one of cytochrome oxidase subunit I (COI) gene, and one target apicoplast genome. We collected blood from wild-caught birds and, using microscopic and PCR-based methods applied in parallel, identified single infections of ten haemosporidian species with similar parasitemia. Then, we prepared 15 experimental mixes of different haemosporidian parasites, which often are present simultaneously in wild birds. Similar concentration of total DNA was used in each parasite lineage during preparation of mixes. Positive amplifications were sequenced, and the presence of mixed infections was reported by visualising double-base calling in sequence electropherograms. This study shows that the use of each single PCR assay markedly underestimates biodiversity of haemosporidian parasites. The application of at least 3 PCR assays in parallel detected the majority, but still not all lineages present in mixed infections. We determined preferences of different primers in detection of parasites belonging to different genera of haemosporidians during mixed infections.

  19. Detection of hemophilia a carriers in Azeri Turkish population of Iran: usefulness of HindIII and BclI markers.

    PubMed

    Moharrami, Tamouchin; Derakhshan, Sima Mansoori; Pourfeizi, Abbas Ali H; Khaniani, Mahmoud Shekari

    2015-11-01

    Hemophilia A (HA) is an inherited X-linked coagulation disorder caused by the deficiency of factor VIII (FVIII). Linkage analysis is a common indirect method for the detection of female carriers in families with HA. In the current study, 173 patients from 30 unrelated families with HA were recruited from the Azeri Turkish population of northwest Iran and analyzed for BclI and HindIII markers by polymerase chain reaction-restriction fragment length polymorphism. We investigated the potential of using these markers for the detection of mutation in carriers through linkage analysis, which would be of tremendous use in prenatal diagnosis. Among the tested women, 47% and 35% were found to be heterozygous for BclI and HindIII polymorphic markers, respectively. The BclI and HindIII markers were informative for the detection of 63% and 17% potential carriers, respectively, demonstrating the effectiveness of the BclI marker for the detection of HA carriers among the Azeri Turkish population.

  20. Rapid detection of bovine herpesvirus 1 in the semen of infected bulls by a nested polymerase chain reaction assay.

    PubMed Central

    Masri, S A; Olson, W; Nguyen, P T; Prins, S; Deregt, D

    1996-01-01

    A nested polymerase chain reaction (PCR) assay was developed for the detection of bovine herpesvirus 1 (BHV-1) in bovine semen and compared with the virus isolation method. When extended semen, commonly used in the bovine artificial insemination industry, was inoculated with BHV-1, the PCR assay detected BHV-1 DNA in semen inoculated at 0.25-2.5 TCID50 per 0.5 mL. In contrast, the lower limit of detection for virus isolation was 250 TCID50 of BHV-1 inoculated in 0.5 mL of extended semen. These methods were also used to detect BHV-1 in the semen of four bulls which were experimentally infected with BHV-1. All infected bulls demonstrated balanitis at 3 d post-inoculation (DPI) and severe balanoposthitis at 4 DPI. BHV-1 was detected in raw semen by virus isolation and PCR at 2 DPI, before balanitis was evident. For virus isolation, the last day that BHV-1 was detected during primary infection was 7 DPI for two bulls and 9 and 11 DPI for the other two bulls. In contrast, PCR detected BHV-1 in the bulls' semen until 14 or 18 DPI. For individual animals, PCR detected BHV-1 during primary infection for at least 1-10 d longer than virus isolation. Reactivation of BHV-1 from latency without the presence of visible lesions was promoted twice by two series of 5 d dexamethasone injections. For the first series of dexamethasone treatments, a positive virus isolation result was obtained on the 5th d of treatment for only one bull. In contrast, two bulls demonstrated evidence of viral reactivation on this day by PCR. All bulls shed BHV-1 in semen on d 4 after dexamethasone treatment, as evidenced by positive virus isolation and PCR results. One bull was still PCR positive 13 d later. For the second series of dexamethasone treatments, a small amount of virus was isolated from semen collected on d 3 or 4 after treatment for two bulls but not from the other two bulls. In contrast, semen samples from all bulls were PCR positive for either or both of these 2 d. In total, from 80 semen

  1. A polymerase chain reaction for detection of Brucella canis in vaginal swabs of naturally infected bitches.

    PubMed

    Keid, L B; Soares, R M; Vasconcellos, S A; Chiebao, D P; Salgado, V R; Megid, J; Richtzenhain, L J

    2007-12-01

    A PCR assay for the detection of Brucella canis in canine vaginal swab samples was evaluated, comparing its performance with that of bacterial isolation, serological tests, and a blood PCR assay. One hundred and forty-four female dogs were clinically examined to detect reproductive problems and they were tested by the rapid slide agglutination test, with and without 2-mercaptoethanol (2ME-RSAT and RSAT, respectively). In addition, microbiological culture and PCR were performed on blood and vaginal swab samples. The results of the vaginal swab PCR were compared to those of the other tests using the Kappa coefficient and McNemar test. Of the 144 females that were examined, 66 (45.8%) were RSAT positive, 23 (15.9%) were 2ME-RSAT positive, 49 (34.02%) were blood culture positive, 6 (4.1%) were vaginal swab culture positive, 54 (37.5%) were blood PCR positive, 52 (36.2%) were vaginal swab PCR positive, and 50.69% (73/144) were positive by the combined PCR. The PCR was able to detect as few as 3.8 fg of B. canis DNA experimentally diluted in 54 ng of canine DNA, extracted from vaginal swab samples of non-infected bitches. In addition, the PCR assay amplified B. canis genetic sequences from vaginal swab samples containing 1.0 x 10(0) cfu/mL. In conclusion, vaginal swab PCR was a good candidate as a confirmatory test for brucellosis diagnosis in bitches suspected to be infected, especially those negative on blood culture or blood PCR; these animals may be important reservoirs of infection and could complicate attempts to eradicate the disease in confined populations.

  2. Real-time polymerase chain reaction detection of fishmeal in feedstuffs.

    PubMed

    Martín, Irene; García, Teresa; Rojas, Maria; Pegels, Nicolette; Pavón, Miguel Angel; Hernández, Pablo E; González, Isabel; Martín, Rosario

    2010-01-01

    A SYBR Green PCR system was developed for detection of fishmeal in feedstuffs. The real-time PCR method combines the use of fish-specific primers that amplify an 87 base pair (bp) fragment of the mitochondrial 12S ribosomal RNA gene from fish species, and a positive control primer pair that amplifies a 99 bp fragment of the nuclear 18S ribosomal RNA gene in all eukaryotic organisms. The specificity of the primers was tested against 52 animal species and six plant species. Reference feedstuff samples were successfully tested for the presence of fishmeal, demonstrating the applicability of the assay to feedstuffs.

  3. Detection of group 1 coronaviruses in bats using universal coronavirus reverse transcription polymerase chain reactions.

    PubMed

    Poon, Leo L M; Peiris, J S Malik

    2008-01-01

    The zoonotic transmission of SARS coronavirus from animals to humans revealed the potential impact of coronaviruses on mankind. This incident also triggered several surveillance programs to hunt for novel coronaviruses in human and wildlife populations. Using classical RT-PCR assays that target a highly conserved sequence among coronaviruses, we identified the first coronaviruses in bats. These assays and the cloning and sequencing of the PCR products are described in this chapter. Using the same approach in our subsequent studies, we further detected several novel coronaviruses in bats. These findings highlighted the fact that bats are important reservoirs for coronaviruses.

  4. Detection of human herpesvirus 8 by quantitative polymerase chain reaction: development and standardisation of methods

    PubMed Central

    2012-01-01

    Background Human herpesvirus 8 (HHV-8), the aetiological agent of Kaposi’s sarcoma (KS), multicentric Castleman’s disease (MCD), and primary effusion lymphoma (PEL) is rare in Australia, but endemic in Sub-Saharan Africa, parts of South-east Asia and Oceania. While the treatment of external KS lesions can be monitored by clinical observation, the internal lesions of KS, MCD and PEL require extensive and expensive internal imaging, or autopsy. In patients with MCD and PEL, if HHV-8 viraemia is not reduced quickly, ~50% die within 24 months. HHV-8 qPCR is a valuable tool for monitoring HHV-8 viraemia, but is not available in many parts of the world, including those with high prevalence of KS and HHV-8. Methods A new molecular facility with stringent three-phase workflow was established, adhering to NPAAC and CLSI guidelines. Three fully validated quantitative assays were developed: two for detection and quantification of HHV-8; one for GAPDH, necessary for normalisation of viral loads in tissue and peripheral blood. Results The HHV-8 ORF73 and ORF26 qPCR assays were 100% specific. All qPCR assays, displayed a broad dynamic range (102 to 1010 copies/μL TE Buffer) with a limit of detection of 4.85x103, 5.61x102, and 2.59x102 copies/μL TE Buffer and a limit of quantification of 4.85x103, 3.01x102, and 1.38x102 copies/μL TE Buffer for HHV-8 ORF73, HHV-8 ORF26, and GAPDH respectively. The assays were tested on a panel of 35 KS biopsies from Queensland. All were HHV-8 qPCR positive with average viral load of 2.96x105 HHV-8 copies/μL DNA extract (range: 4.37x103 to 1.47x106 copies/μL DNA extract): When normalised these equate to an average viral load of 2.44x104 HHV-8 copies/103 cells (range: 2.20x102 to 7.38x105 HHV-8 copies/103 cells). Conclusions These are the first fully optimised, validated and MIQE compliant HHV-8 qPCR assays established in Australia. They worked well for qualitative detection of HHV-8 in archival tissue, and are well-suited for

  5. Replication Fidelity of Escherichia Coli DNA Polymerase III Holoenzyme in Vitro and Repair of Heteroduplex DNA with Multibase Loops in Vivo.

    NASA Astrophysics Data System (ADS)

    Carraway, Margaretha Bernardina Maria

    The genetic integrity of an organism is maintained by accurate replication and correction of asymmetry in the DNA. To study replication fidelity, single-stranded plasmid DNA containing the mnt gene, was replicated in vitro with DNA polymerase III holoenzyme by extension of a complimentary annealed primer. On this plasmid the mnt region is fused to a promoterless tet gene. Accurate replication of mnt generates a tetracycline sensitive phenotype, errors in replication are identified by mutation to tetracycline resistance. Mismatch repair deficient mutH cells were transformed to ampicillin-resistance by replicated circles. The mutations in mnt were identified by replica plating and selecting for tetracycline resistant cells. The mutation rate was 1 in 100,000. DNA sequence analysis of 65 isolates identified 33 single base changes, 20 deletions and 12 concurrent deletions and insertions. Except for the deletions and substitutions, identical mutations were isolated in vivo in mismatch repair deficient cells. Therefore, in vitro replication errors resemble those isolated in vivo. Heteroduplexes with loops occur as a result of replication or recombination. To examine if E. coli converts these molecules to a homoduplex via DNA repair, plasmid heteroduplexes with loops of 5, 7, 9, 192, 410 or 514 bases in mnt were constructed. Conversion was examined by tranforming the plasmid heteroduplexes into E. coli lysogens which had a non-functional mnt gene fused to a promoterless lac gene. Repair of the heteroduplex to wild type yields white/tetracycline sensitive colonies; repair to the mutant yields red/tetracycline resistant colonies and no repair results in red-white (mixed)/tetracycline resistant colonies. No significant change in colony color distribution was observed when the heteroduplexes were transformed into wild type and the following mutant strains: pcnB, mutS, recA, recD, recBC sbcBC, recF, recJ, recR, recN, recO, recG ruvC, ruvB, lexA3, lexA51, uvrA, recBC sbcBC rec

  6. A species-specific polymerase chain reaction assay for rapid and sensitive detection of Colletotrichum capsici.

    PubMed

    Torres-Calzada, C; Tapia-Tussell, R; Quijano-Ramayo, A; Martin-Mex, R; Rojas-Herrera, R; Higuera-Ciapara, I; Perez-Brito, D

    2011-09-01

    Colletotrichum capsici is an important fungal species that causes anthracnose in many genera of plants causing severe economic losses worldwide. A primer set was designed based on the sequences of the ribosomal internal transcribed spacer (ITS1 and ITS2) regions for use in a conventional PCR assay. The primer set (CcapF/CcapR) amplified a single product of 394 bp with DNA extracted from 20 Mexican isolates of C. capsici. The specificity of primers was confirmed by the absence of amplified product with DNA of four other Colletotrichum species and eleven different fungal genera. This primer set is capable of amplifying only C. capsici from different contaminated tissues or fungal structures, thereby facilitating rapid diagnoses as there is no need to isolate and cultivate the fungus in order to identify it. The sensitivity of detection with this PCR method was 10 pg of genomic DNA from the pathogen. This is the first report of a C. capsici-specific primer set. It allows rapid pathogen detection and provides growers with a powerful tool for a rational selection of fungicides to control anthracnose in different crops and in the post-harvest stage.

  7. Fluorescence detection test by black printed circuit board based microfluidic channel for polymerase chain reaction.

    PubMed

    Hwang, Ji-Soo; Kim, Yu-Seop; Song, Hye-Jeong; Kim, Jong-Dae; Park, Chan-Young

    2015-01-01

    This paper proposes the optimal structure of a PCB-based micro PCR chip constructed on a PCB substrate using commercial adhesive tapes and plastic covers. The solder mask of the PCB substrate was coated black, and the area where the reaction chamber is attached was legend printed with white silk to minimize the noise during fluorescence detection. The performance of the PCR and fluorescence detection was compared using 6 types of reaction chambers, each made with different double-sided tapes. Three of the chambers were unsuccessful in completing the PCR. The performance of the other three chambers that successfully amplified DNA was compared using Taqman probe for Chlamydia Trachomatis DNA. The amplified product was illuminated diagonally with a blue LED to excite the product just before imaging, and the LED was turned off when the image was captured to prevent quenching of the probe. The images were taken 10 seconds prior to the last extension step for each cycle using a DSLR camera. The experiments were run as a quartet for each three chambers made with different double-sided tape. The results showed that there were significant difference between the three tapes.

  8. High-Throughput Multiplex Quantitative Polymerase Chain Reaction Method for Giardia lamblia and Cryptosporidium Species Detection in Stool Samples

    PubMed Central

    Nurminen, Noora; Juuti, Rosa; Oikarinen, Sami; Fan, Yue-Mei; Lehto, Kirsi-Maarit; Mangani, Charles; Maleta, Kenneth; Ashorn, Per; Hyöty, Heikki

    2015-01-01

    Giardia lamblia and Cryptosporidium species belong to a complex group of pathogens that cause diseases hampering development and socioeconomic improvements in the developing countries. Both pathogens are recognized as significant causes of diarrhea and nutritional disorders. However, further studies are needed to clarify the role of parasitic infections, especially asymptomatic infections in malnutrition and stunting. We developed a high-throughput multiplex quantitative polymerase chain reaction (qPCR) method for G. lamblia and Cryptosporidium spp. detection in stool samples. The sensitivity and specificity of the method were ensured by analyzing confirmed positive samples acquired from diagnostics laboratories and participating in an external quality control round. Its capability to detect asymptomatic G. lamblia and Cryptosporidium spp. infections was confirmed by analyzing stool samples collected from 44 asymptomatic 6-month-old infants living in an endemic region in Malawi. Of these, five samples were found to be positive for G. lamblia and two for Cryptosporidium spp. In conclusion, the developed method is suitable for large-scale studies evaluating the occurrence of G. lamblia and Cryptosporidium spp. in endemic regions and for clinical diagnostics of these infections. PMID:25918202

  9. Detection of HTLV-1 by polymerase chain reaction in situ hybridization in adult T-cell leukemia/lymphoma.

    PubMed

    Setoyama, M; Kerdel, F A; Elgart, G; Kanzaki, T; Byrnes, J J

    1998-03-01

    A method for nonradioactive polymerase chain reaction in situ hybridization was developed and used to determine the distribution of human T-lymphotropic virus type I (HTLV-I) proviral DNA in paraffin-embedded surgical specimens of adult T-cell leukemia/lymphoma (ATLL). As controls, we used biopsy samples of five cases of mycosis fungoides, cells of an HTLV-I-infected cell line (MT2), as well as HTLV-1-negative cells (YAS). We successfully detected the amplicon of the HTLV-1 tax sequence in the nuclei of the cutaneous infiltrating lymphoid cells in 90% (9/10) of ATLL cases. Studies also revealed the existence of HTLV-1 provirus DNA in nuclei of sweat gland epithelial cells and vascular endothelial cells as well as lymphoid cells in ATLL patients. Mycosis fungoides and YAS cells were negative for the HTLV-I tax sequence, but MT2 cells were strongly positive. The results indicated that this technique was more sensitive in detecting intracellular amplicons than was the previous in situ hybridization method. Through its use, we were able to easily determine the distribution of HTLV-I-positive cells among the various cells and tissues of paraffin-embedded archival materials.

  10. Development of melting temperature-based SYBR Green I polymerase chain reaction methods for multiplex genetically modified organism detection.

    PubMed

    Hernández, Marta; Rodríguez-Lázaro, David; Esteve, Teresa; Prat, Salomé; Pla, Maria

    2003-12-15

    Commercialization of several genetically modified crops has been approved worldwide to date. Uniplex polymerase chain reaction (PCR)-based methods to identify these different insertion events have been developed, but their use in the analysis of all commercially available genetically modified organisms (GMOs) is becoming progressively insufficient. These methods require a large number of assays to detect all possible GMOs present in the sample and thereby the development of multiplex PCR systems using combined probes and primers targeted to sequences specific to various GMOs is needed for detection of this increasing number of GMOs. Here we report on the development of a multiplex real-time PCR suitable for multiple GMO identification, based on the intercalating dye SYBR Green I and the analysis of the melting curves of the amplified products. Using this method, different amplification products specific for Maximizer 176, Bt11, MON810, and GA21 maize and for GTS 40-3-2 soybean were obtained and identified by their specific Tm. We have combined amplification of these products in a number of multiplex reactions and show the suitability of the methods for identification of GMOs with a sensitivity of 0.1% in duplex reactions. The described methods offer an economic and simple alternative to real-time PCR systems based on sequence-specific probes (i.e., TaqMan chemistry). These methods can be used as selection tests and further optimized for uniplex GMO quantification.

  11. Hepatitis A virus detection in oysters (Crassostrea gigas) in Santa Catarina State, Brazil, by reverse transcription-polymerase chain reaction.

    PubMed

    Coelho, C; Heinert, A P; Simões, C M O; Barardi, C R M

    2003-03-01

    Shellfish are readily contaminated with viruses present in water containing sewage because of the concentration effect of filter feeding. Hepatitis A virus (HAV) is the main cause of acute hepatitis worldwide and may lead to severe illness or even death. It is transmitted through fecal and oral routes and causes widespread endemic and asymptomatic infections in young children. Here we describe a method for the detection of HAV RNA in shellfish involving the extraction of total RNA from oyster meat followed by reverse transcription-polymerase chain reaction (RT-PCR). Virus recovery from oyster extracts artificially seeded with HAV strain HM 175 was examined by RT-PCR. The minimum detection limit was 3.3 focus-forming units of HAV, and the recovery rate was 75.7%. This method was used to assess the viral contamination of four shellfish beds in Santa Catarina State, Brazil, over a 1-year period. Six (22%) of 27 samples collected in autumn and winter from one shellfish bed tested positive for HAV.

  12. High-throughput multiplex quantitative polymerase chain reaction method for Giardia lamblia and Cryptosporidium species detection in stool samples.

    PubMed

    Nurminen, Noora; Juuti, Rosa; Oikarinen, Sami; Fan, Yue-Mei; Lehto, Kirsi-Maarit; Mangani, Charles; Maleta, Kenneth; Ashorn, Per; Hyöty, Heikki

    2015-06-01

    Giardia lamblia and Cryptosporidium species belong to a complex group of pathogens that cause diseases hampering development and socioeconomic improvements in the developing countries. Both pathogens are recognized as significant causes of diarrhea and nutritional disorders. However, further studies are needed to clarify the role of parasitic infections, especially asymptomatic infections in malnutrition and stunting. We developed a high-throughput multiplex quantitative polymerase chain reaction (qPCR) method for G. lamblia and Cryptosporidium spp. detection in stool samples. The sensitivity and specificity of the method were ensured by analyzing confirmed positive samples acquired from diagnostics laboratories and participating in an external quality control round. Its capability to detect asymptomatic G. lamblia and Cryptosporidium spp. infections was confirmed by analyzing stool samples collected from 44 asymptomatic 6-month-old infants living in an endemic region in Malawi. Of these, five samples were found to be positive for G. lamblia and two for Cryptosporidium spp. In conclusion, the developed method is suitable for large-scale studies evaluating the occurrence of G. lamblia and Cryptosporidium spp. in endemic regions and for clinical diagnostics of these infections.

  13. Comparison between Culture and a Multiplex Quantitative Real-Time Polymerase Chain Reaction Assay Detecting Ureaplasma urealyticum and U. parvum

    PubMed Central

    Frølund, Maria; Björnelius, Eva; Lidbrink, Peter; Ahrens, Peter; Jensen, Jørgen Skov

    2014-01-01

    A novel multiplex quantitative real-time polymerase chain reaction (qPCR) for simultaneous detection of U. urealyticum and U. parvum was developed and compared with quantitative culture in Shepard's 10 C medium for ureaplasmas in urethral swabs from 129 men and 66 women, and cervical swabs from 61 women. Using culture as the gold standard, the sensitivity of the qPCR was 96% and 95% for female urethral and cervical swabs, respectively. In male urethral swabs the sensitivity was 89%. The corresponding specificities were 100%, 87% and 99%. The qPCR showed a linear increasing DNA copy number with increasing colour-changing units. Although slightly less sensitive than culture, this multiplex qPCR assay detecting U. urealyticum and U. parvum constitutes a simple and fast alternative to the traditional methods for identification of ureaplasmas and allows simultaneous species differentiation and quantitation in clinical samples. Furthermore, specimens overgrown by other bacteria using the culture method can be evaluated in the qPCR. PMID:25047036

  14. Detection and characterization of human pathogenic viruses circulating in community wastewater using multi target microarrays and polymerase chain reaction.

    PubMed

    Wong, Mark V M; Hashsham, Syed A; Gulari, Erdogan; Rouillard, Jean-Marie; Aw, Tiong Gim; Rose, Joan B

    2013-12-01

    Sewage pollution remains the most significant source of human waterborne pathogens. This study describes the detection and characterization of human enteric viruses in community wastewaters using cell culture coupled with multiple target microarrays (with a total of 780 unique probes targeting 27 different groups of both DNA and RNA viruses) and polymerase chain reaction (PCR) assays. Over a 13-month sampling period, RNA viruses (astroviruses and enteroviruses) were more frequently detected compared to DNA viruses (adenoviruses, particularly type 41 and BK polyomavirus). Overall, many more viruses were shed during the winter months (December-February) compared to the summer months. Exploration of the multiple types of enteric viruses particularly in winter months identified much more significant prevalence of key viral pathogens associated with sewage pollution of the water environment than previously realized and seasonal disinfection used in some parts of the world may lead to a seeding of ambient waters. Molecular characterization of pathogenic viruses in community wastewater will improve the understanding of the potential risk of waterborne disease transmission of viral pathogens.

  15. Real-time polymerase chain reaction method for detecting contamination of beef by material from genetically engineered cattle.

    PubMed

    Nakajima, Osamu; Akiyama, Hiroshi; Teshima, Reiko

    2009-08-01

    Prion protein knockout (PRNP(-/-)) cattle have been developed and may be used to produce bovine material such as serum, collagen, and gelatin. However, genetically engineered animals (GE animals) must not be imported or made commercially available in Japan, because they are not authorized for food use in Japan. We used real-time polymerase chain reaction (real-time PCR) to develop method of detection for neomycin- and the puromycin-resistance genes in beef samples. Plasmids containing the neomycin-resistance gene and the puromycin-resistance gene were used as standard reference molecules. The results clearly showed that the method we developed is capable of quantitatively detecting the neomycin- and the puromycin-resistance genes in the plasmids in the presence of genomic DNA extracted from a beef sample. We also applied the method to testing of beef samples imported from the United States (U.S.). This method will make it possible to monitor beef for contamination by material from GE cattle to assure food safety.

  16. Rapid detection of HLA-B*51 by real-time polymerase chain reaction and high-resolution melting analysis.

    PubMed

    Imperiali, C; Alía-Ramos, P; Padró-Miquel, A

    2015-08-01

    HLA-B*51, a class I human leukocyte antigen (HLA) molecule, is the strongest known genetic risk factor for Behçet disease. However, there are only few articles reporting methods to determine the presence or absence of HLA-B51. For this reason, we designed and developed an easy, fast, and inexpensive real-time high-resolution melting (HRM) assay to detect HLA-B*51. We genotyped 61 samples by our HRM assay and by conventional polymerase chain reaction, and no discrepancies were found between results. Besides, a subgroup of 25 samples was also genotyped in a different laboratory, and another subgroup of 16 samples was obtained from the International Histocompatibility Working Group DNA Bank, and a full concordance of results was observed with those obtained by HRM. Regarding the identifying system evaluated, we obtained 100% of specificity, sensibility, and repeatability, and 0% of false positive and false negative rates. Therefore, this HRM analysis is easily applicable to the rapid detection of HLA-B*51, exhibits a high speed, and requires a very low budget.

  17. Detection of Natural Toxoplasma gondii Infection in Chicken in Thika Region of Kenya Using Nested Polymerase Chain Reaction

    PubMed Central

    Karanja, Simon Muturi; Ngotho, Maina; Kamau, David Muchina; Njuguna, Adele Nyambura

    2016-01-01

    The detection of Toxoplasma gondii in free-range chickens is a good indicator of possible risk to human beings. The aim of this study was to investigate the occurrence of T. gondii in free-range chicken using polymerase chain reaction (PCR). Brain samples from 105 free-range chickens from three administrative areas in Thika region, Kenya, were collected, DNA-extracted, and analyzed using PCR to detect presence of T. gondii. The overall prevalence of T. gondii in all the three areas was 79.0% (95% CI: 70.0–86.4%) and the prevalence across the three areas was not significantly different (P = 0.5088; χ2 = 1.354). Female chickens had higher (79.4%) prevalence than males (78.6%), although the difference was not significant (P = 0.922, χ2 = 0.01). However, chickens that were more than 2 years old had significantly (P = 0.003; χ2 = 11.87) higher prevalence compared to younger ones. The study indicates that there was a high occurrence of T. gondii infection in free-range chickens from Thika region and that the infection rate is age dependent. Further studies should be carried out to determine the possible role of roaming chickens in the epidemiology of the disease among humans in the area. PMID:27981052

  18. Detection and quantification of roundup ready soy in foods by conventional and real-time polymerase chain reaction.

    PubMed

    Rott, Michael E; Lawrence, Tracy S; Wall, Erika M; Green, Margaret J

    2004-08-11

    Transgenic soybean line GTS-40-3-2, marketed under the trade name Roundup Ready (RR) soy, was developed by Monsanto (USA) to allow for the use of glyphosate, the active ingredient of the herbicide Roundup, as a weed control agent. RR soy was first approved in Canada for environmental release and for feed products in 1995 and later for food products in 1996 and is widely grown in Canada. Consumer concern issues have resulted in proposed labeling regulations in Canada for foods derived from genetically engineered crops. One requirement for labeling is the ability to detect and accurately quantify the amount of transgenic material present in foods. Two assays were evaluated. A conventional qualitative Polymerase Chain Reaction (PCR) assay to detect the presence of soy and RR soy and a real-time PCR to quantify the amount of RR soy present in samples that tested positive in the first assay. PCR controls consisted of certified RR soy reference material, single transgenic soybeans, and a processed food sample containing a known amount of RR soy. To test real-world applicability, a number of common grocery store food items that contain soy-based products were tested. For some samples, significant differences in amplification efficiencies during the quantitative PCR assays were observed compared to the controls, resulting in potentially large errors in quantification. A correction factor was used to try to compensate for these differences.

  19. Electrochemical Branched-DNA Assay for Polymerase Chain Reaction-Free Detection and Quantification of Oncogenes in Messenger RNA

    SciTech Connect

    Lee, Ai Cheng; Dai, Ziyu; Chen, Baowei; Wu, Hong; Wang, Jun; Zhang, Aiguo; Zhang, Lurong; Lim, Tit-Meng; Lin, Yuehe

    2008-12-01

    We describe a novel electrochemical branched-DNA (bDNA) assay for polymerase chain reaction (PCR)-free detection and quantification of p185 BCR-ABL leukemia fusion transcript in the population of messenger RNA (mRNA) extracted from cell lines. The bDNA amplifier carrying high loading of alkaline phosphatase (ALP) tracers was used to amplify targets signal. The targets were captured on microplate well surfaces through cooperative sandwich hybridization prior to the labeling of bDNA. The activity of captured ALP was monitored by square-wave voltammetric (SWV) analysis of the electroactive enzymatic product in the presence of 1-napthyl-phosphate. The specificity and sensitivity of assay enabled direct detection of target transcript in as little as 4.6 ng mRNA without PCR amplification. In combination with the use of a well-quantified standard, the electrochemical bDNA assay was capable of direct use for a PCR-free quantitative analysis of target transcript in total mRNA population. The approach thus provides a simple, sensitive, accurate and quantitative tool alternate to the RQ-PCR for early disease diagnosis.

  20. Rapid and sensitive detection of Little cherry virus 2 using isothermal reverse transcription-recombinase polymerase amplification.

    PubMed

    Mekuria, Tefera A; Zhang, Shulu; Eastwell, Kenneth C

    2014-09-01

    Little cherry virus 2 (LChV2) (genus Ampelovirus) is the primary causal agent of little cherry disease (LCD) in sweet cherry (Prunus avium) in North America and other parts of the world. This mealybug-transmitted virus does not induce significant foliar symptoms in most sweet cherry cultivars, but does cause virus-infected trees to yield unevenly ripened small fruits with poor flavor. Most fruits from infected trees are unmarketable. In the present study, an isothermal reverse transcription-recombinase polymerase amplification (RT-RPA) technique was developed using LChV2 coat protein specific primers and probe. Detection of terminally labeled amplicons was achieved with a high affinity lateral flow strip. The RT-RPA is confirmed to be simple, fast, and specific. In comparison, although it retains the sensitivity of RT-PCR, it is a more cost-effective procedure. RT-RPA will be a very useful tool for detecting LChV2 from crude extracts in any growth stage of sweet cherry from field samples.

  1. Development and deployment of a rapid recombinase polymerase amplification Ebola virus detection assay in Guinea in 2015.

    PubMed

    Faye, Oumar; Faye, Ousmane; Soropogui, Barré; Patel, Pranav; El Wahed, Ahmed Abd; Loucoubar, Cheikh; Fall, Gamou; Kiory, Davy; Magassouba, N'Faly; Keita, Sakoba; Kondé, Mandy Kader; Diallo, Alpha Amadou; Koivogui, Lamine; Karlberg, Helen; Mirazimi, Ali; Nentwich, Oliver; Piepenburg, Olaf; Niedrig, Matthias; Weidmann, Manfred; Sall, Amadou Alpha

    2015-01-01

    In the absence of a vaccine or specific treatments for Ebola virus disease (EVD), early identification of cases is crucial for the control of EVD epidemics. We evaluated a new extraction kit (SpeedXtract (SE), Qiagen) on sera and swabs in combination with an improved diagnostic reverse transcription recombinase polymerase amplification assay for the detection of Ebola virus (EBOV-RT-RPA). The performance of combined extraction and detection was best for swabs. Sensitivity and specificity of the combined SE and EBOV-RT-RPA were tested in a mobile laboratory consisting of a mobile glovebox and a Diagnostics-in-a-Suitcase powered by a battery and solar panel, deployed to Matoto Conakry, Guinea as part of the reinforced surveillance strategy in April 2015 to reach the goal of zero cases. The EBOV-RT-RPA was evaluated in comparison to two real-time PCR assays. Of 928 post-mortem swabs, 120 tested positive, and the combined SE and EBOV-RT-RPA yielded a sensitivity and specificity of 100% in reference to one real-time RT-PCR assay. Another widely used real-time RT-PCR was much less sensitive than expected. Results were provided very fast within 30 to 60 min, and the field deployment of the mobile laboratory helped improve burial management and community engagement.

  2. A multiplex quantitative real-time polymerase chain reaction panel for detecting neurologic pathogens in dogs with meningoencephalitis

    PubMed Central

    Han, Jae-Ik; Chang, Dong-Woo

    2015-01-01

    Meningoencephalitis (ME) is a common inflammatory disorder of the central nervous system in dogs. Clinically, ME has both infectious and non-infectious causes. In the present study, a multiplex quantitative real-time polymerase chain reaction (mqPCR) panel was optimized for the detection of eight canine neurologic pathogens (Blastomyces dermatitidis, Cryptococcus spp., Neospora caninum, Borrelia burgdorferi, Bartonella spp., Toxoplasma gondii, Ehrlichia canis, and canine distemper virus [CDV]). The mqPCR panel was subsequently applied to 53 cerebrospinal fluid (CSF) samples collected from dogs with ME. The analytic sensitivity (i.e., limit of detection, expressed as molecules per 1 µL of recombinant vector) was 3.8 for CDV, 3.7 for Ehrlichia canis, 3.7 for Bartonella spp., 3.8 for Borrelia burgdorferi, 3.7 for Blastomyces dermatitidis, 3.7 for Cryptococcus spp., 38 for Neospora caninum, and 3.7 for Toxoplasma gondii. Among the tested CSF samples, seven (15%) were positive for the following pathogens in decreasing order of frequency: Cryptococcus spp. (3/7), Blastomyces dermatitidis (2/7), and Borrelia burgdorferi (2/7). In summary, use of an mqPCR panel with high analytic sensitivity as an initial screen for infectious agents in dogs with ME could facilitate the selection of early treatment strategies and improve outcomes. PMID:26040611

  3. A multiplex quantitative real-time polymerase chain reaction panel for detecting neurologic pathogens in dogs with meningoencephalitis.

    PubMed

    Han, Jae-Ik; Chang, Dong-Woo; Na, Ki-Jeong

    2015-01-01

    Meningoencephalitis (ME) is a common inflammatory disorder of the central nervous system in dogs. Clinically, ME has both infectious and non-infectious causes. In the present study, a multiplex quantitative real-time polymerase chain reaction (mqPCR) panel was optimized for the detection of eight canine neurologic pathogens (Blastomyces dermatitidis, Cryptococcus spp., Neospora caninum, Borrelia burgdorferi, Bartonella spp., Toxoplasma gondii, Ehrlichia canis, and canine distemper virus [CDV]). The mqPCR panel was subsequently applied to 53 cerebrospinal fluid (CSF) samples collected from dogs with ME. The analytic sensitivity (i.e., limit of detection, expressed as molecules per 1 mL of recombinant vector) was 3.8 for CDV, 3.7 for Ehrlichia canis, 3.7 for Bartonella spp., 3.8 for Borrelia burgdorferi, 3.7 for Blastomyces dermatitidis, 3.7 for Cryptococcus spp., 38 for Neospora caninum, and 3.7 for Toxoplasma gondii. Among the tested CSF samples, seven (15%) were positive for the following pathogens in decreasing order of frequency: Cryptococcus spp. (3/7), Blastomyces dermatitidis (2/7), and Borrelia burgdorferi (2/7). In summary, use of an mqPCR panel with high analytic sensitivity as an initial screen for infectious agents in dogs with ME could facilitate the selection of early treatment strategies and improve outcomes.

  4. Sensitivity and specificity of a nested polymerase chain reaction for detection of lentivirus infection in lions (Panthera leo).

    PubMed

    Adams, Hayley; van Vuuren, Moritz; Kania, Stephen; Bosman, Anna-Mari; Keet, Dewald; New, John; Kennedy, Melissa

    2010-12-01

    Feline immunodeficiency virus (FIV) is a lentivirus in the Retroviridae family that causes lifelong infection in domestic cats. The lentivirus of African lions (Panthera leo), referred to as FIVple, is endemic in certain lion populations in eastern and southern Africa. Lentivirus infection leads to immunologic dysfunction and immunosuppressive disease in domestic cats; however, little is known about the pathogenic effects of infection in lions, nor about the epidemiologic impact on free-ranging and captive populations. Whole blood and serum samples were collected opportunistically from free-ranging lions in Kruger National Park, Republic of South Africa (RSA). Whole blood and serum samples were also collected from captive wild lions in the RSA. A nested polymerase chain reaction (PCR) assay for detection of FIV was performed on all whole blood samples. In addition, serum samples were tested for cross-reactive antibodies to domestic feline lentivirus antigens and puma lentivirus synthetic envelope peptide antigen. The PCR assay successfully amplified the lion lentivirus from African lions. The relative sensitivity and relative specificity were 79% and 100%, respectively, and the positive and negative predictive values were 100% and 67%, respectively. This research represents the first study to compare genetic material with antibody-based methods of lentivirus detection on lions in RSA. Using PCR as an additional diagnostic test for FIV in lions will increase screening sensitivity and will allow viral characterization among circulating isolates and monitoring of changes in the viral epidemiology within geographic regions and populations over time.

  5. In situ detection of specific p53 mutations in cultured cells using the amplification refractory mutation system polymerase chain reaction.

    PubMed

    Low, E O; Gibbins, J R; Walker, D M

    2000-12-01

    Accurate molecular detection of genetic mutations involved in tumorigenesis has been based predominantly on analysis of extracted DNA, but this does not provide detailed information on the location, number, type or clonal distribution of mutated cells and their precise anatomic location and clonal distribution. This study has used a sensitive and specific application of the amplification refractory mutation system (ARMS)-polymerase chain reaction (PCR) in situ, combined with in situ hybridization to localize and identify cells with defined p53 mutations. The ARMS-PCR was performed in situ in SW480 cells in suspension and in cells either cultured or cytospun onto glass slides. Amplified mutant DNA PCR products were detected in SW480 cells using digoxigenin-labeled probes, visually identifying cells harboring specific mutations in the p53 gene. In situ hybridization alone of the mutant cells without the amplification step was negative. Normal human fibroblasts or endothelial cells were refractory to in situ amplification. This reaction was mutation-specific as CEM cells with different p53 mutations reacted negatively. Mutant messenger RNA (mRNA) in tumor cells was also selectively amplified in situ by ARMS-PCR following reverse transcription (RT). This study demonstrates the potential of in situ ARMS-PCR or RT-ARMS-PCR for mutation analysis in situ and could have useful clinical applications.

  6. Detection of circulating solid tumor cells by reverse transcriptase polymerase chain reaction.

    PubMed

    Burchill, S A

    1998-01-01

    Despite advances in cancer treatment, disseminating disease continues to pose a major problem in clinical management. The dissemination of cancer cells around the body, or metastasis, involves multiple tumor-host interactions. The relatronship between circulating tumor cells and development of secondary disease is not fully understood, though for cells to metastasize they must be capable of entering and surviving in peripheral blood or bone marrow. Although it is thought less than 0.01% of cnculating tumor cells will successfully establish metastatic colonies (1) detect small numbers of such cells will allow evaluation of their role in the disease process. This may provide the clinician with a powerful tool to predict recurrence and relapse. In the longterm this may lead to improved clinical outcome by additional treament of persistent disease following conventional therapy or early intervention in patients with micrometastatic disease and preclinical relapse.

  7. Rapid Polymerase Chain Reaction Assay to Detect Herpes Simplex Virus in the Genital Tract of Women in Labor

    PubMed Central

    Gardella, Carolyn; Huang, Meei-Li; Wald, Anna; Magaret, Amalia; Selke, Stacy; Morrow, Rhoda; Corey, Lawrence

    2011-01-01

    Objective To develop a rapid quantitative real-time polymerase chain reaction (PCR) to detect herpes simplex virus (HSV) in the genital secretions of women that may be used in labor. Methods Samples of genital secretions from women in labor, swabs of active genital lesions, and swabs of buffer solution were analyzed using a newly developed rapid HSV PCR assay to detect HSV glycoprotein B gene and quantitate virion copy number. A previously validated TaqMan PCR to detect HSV glycoprotein B gene was performed as the comparator gold standard. Positivity determination that optimized sensitivity and specificity was determined with receiver operating characteristic (ROC) curves. Results The median time to result for rapid HSV PCR was 2 hours (range 1.5–3.5 hours). A positivity determination rule that required both wells of the rapid test to detect 150 copies or greater of HSV per ml maximized specificity (96.7%) without appreciable loss of sensitivity (99.6%). Among positive samples, the correlation between the rapid test and TaqMan for the quantity of HSV isolated was excellent (R=0.96, p<.001). The rapid test had a positive predictive value of 96.7% and a negative predictive value of 99.6% in a population with HSV shedding prevalence of 10.8%, based on the prevalence of genital HSV previously found among HSV-2 seropositive women in labor. Conclusion Rapid HSV PCR provides results with excellent sensitivity and specificity within a timeframe that could inform clinical decision making for identifying infants at risk of neonatal HSV infection. PMID:20502292

  8. Polymerase chain reaction detection of Kingella kingae in children with culture-negative septic arthritis in eastern Ontario

    PubMed Central

    Slinger, Robert; Moldovan, Ioana; Bowes, Jennifer; Chan, Francis

    2016-01-01

    BACKGROUND: The bacterium Kingella kingae may be an under-recognized cause of septic arthritis in Canadian children because it is difficult to grow in culture and best detected using molecular methods. OBJECTIVES: To determine whether K kingae is present in culture-negative joint fluid specimens from children in eastern Ontario using polymerase chain reaction (PCR) detection methods. METHODS: K kingae PCR testing was performed using residual bacterial culture-negative joint fluid collected from 2010 to 2013 at a children’s hospital in Ottawa, Ontario. The clinical features of children with infections caused by K kingae were compared with those of children with infections caused by the ‘typical’ septic arthritis bacteria, Staphylococcus aureus and Streptococcus pyogenes. RESULTS: A total of 50 joint fluid specimens were submitted over the study period. Ten were culture-positive, eight for S aureus and two for S pyogenes. Residual joint fluid was available for 27 of the 40 culture-negative specimens and K kingae was detected using PCR in seven (25.93%) of these samples. Children with K kingae were significantly younger (median age 1.7 versus 11.3 years; P=0.01) and had lower C-reactive protein levels (median 23.8 mg/L versus 117.6. mg/L; P=0.01) than those infected with other bacteria. CONCLUSIONS: K kingae was frequently detected using PCR in culture-negative joint fluid specimens from children in eastern Ontario. K kingae PCR testing of culture-negative joint samples in children appears to be warranted. PMID:27095882

  9. Simultaneous detection of major blackleg and soft rot bacterial pathogens in potato by multiplex polymerase chain reaction‡

    PubMed Central

    Potrykus, M; Sledz, W; Golanowska, M; Slawiak, M; Binek, A; Motyka, A; Zoledowska, S; Czajkowski, R; Lojkowska, E

    2014-01-01

    A multiplex polymerase chain reaction (PCR) assay for simultaneous, fast and reliable detection of the main soft rot and blackleg potato pathogens in Europe has been developed. It utilises three pairs of primers and enables detection of three groups of pectinolytic bacteria frequently found in potato, namely: Pectobacterium atrosepticum, Pectobacterium carotovorum subsp. carotovorum together with Pectobacterium wasabiae and Dickeya spp. in a multiplex PCR assay. In studies with axenic cultures of bacteria, the multiplex assay was specific as it gave positive results only with strains of the target species and negative results with 18 non-target species of bacteria that can possibly coexist with pectinolytic bacteria in a potato ecosystem. The developed assay could detect as little as 0.01 ng µL–1 of Dickeya sp. genomic DNA, and down to 0.1 ng µL–1 of P. atrosepticum and P. carotovorum subsp. carotovorum genomic DNA in vitro. In the presence of competitor genomic DNA, isolated from Pseudomonas fluorescens cells, the sensitivity of the multiplex PCR decreased tenfold for P. atrosepticum and Dickeya sp., while no change was observed for P. carotovorum subsp. carotovorum and P. wasabiae. In spiked potato haulm and tuber samples, the threshold level for target bacteria was 101 cfu mL–1 plant extract (102 cfu g–1 plant tissue), 102 cfu mL–1 plant extract (103 cfu g–1 plant tissue), 103 cfu mL–1 plant extract (104 cfu g–1 plant tissue), for Dickeya spp., P. atrosepticum and P. carotovorum subsp. carotovorum/P. wasabiae, respectively. Most of all, this assay allowed reliable detection and identification of soft rot and blackleg pathogens in naturally infected symptomatic and asymptomatic potato stem and progeny tuber samples collected from potato fields all over Poland. PMID:25506085

  10. Overcoming RNA inhibition in the fluorescent polymerase chain reaction assay to enhance detection of bovine DNA in cattle feeds.

    PubMed

    Sawyer, Mary; Rensen, Gabriel; Smith, Wayne; Yee, Melanie; Wong, Alice; Osburn, Bennie; Cullor, James

    2004-01-01

    The practice of incorporating mammalian protein in ruminant feeds was banned in the United States in 1997 as a measure to avoid transmission of bovine spongiform encephalopathy (BSE). A sensitive means of identifying the banned additives in feeds would be by detection of species-specific DNA using the polymerase chain reaction (PCR). However, problems may arise in the PCR due to the presence of inhibitory substances. Using human DNA as an internal PCR control, inhibitory substances were evident in the DNA extraction products of cattle feeds. The results of heating experiments excluded enzymes as a cause of inhibition, and spectrophotometric calculations suggested the possibility of RNA contamination. Co-electrophoresis of untreated and RNAse digested extracts confirmed the presence of RNA in the undigested product. Seven cattle feeds were spiked with predetermined amounts of bovine meat and bone meal (BMBM). The DNA extracted products were treated with RNAse and the bovine specific mitochondrial DNA (B-mtDNA) was amplified by PCR. The minimum level of detection of B-mtDNA was influenced by RNAse treatment and feed composition. RNAse treatment decreased false-negative results overall by 75%. False-negative results were decreased 100% in the higher BMBM concentrations and 50% in the lower BMBM concentrations. Also, each cattle feed was spiked to attain a 2% wt/wt concentration with each swine, fish, sheep, or poultry product, or cattle dried blood. Amplification of B-mtDNA occurred only with the cattle dried blood and only in three feeds in which B-mtDNA was detected at the only level tested (2%). A commercial immunochromotographic assay (Neogen) detected the spiked BMBM in only one of the seven feeds and only at the upper concentration (1%).

  11. Comparison of bacterial culture and polymerase chain reaction (PCR) for the detection of F. tularensis subsp. holarctica in wild animals.

    PubMed

    Sting, Reinhard; Runge, Martin; Eisenberg, Tobias; Braune, Silke; Müller, Wolfgang; Otto, Peter

    2013-01-01

    Detection of the zoonotic pathogen Francisella tularensis subsp. holarctica (EF tularensis) in wild animals with culture techniques as well as polymerase chain reaction were compared and discussed on the basis of the investigation of 60 animals. The samples originated from 55 European brown hares (Lepus europaeus), two red foxes (Vulpes vulpes) and one each from a wild rabbit (Oryctolagus cuniculus), a European beaver (Castor fiber), and a lemur (Lemur catta). When comparing the growth of 28 F. tularensis isolates on the cysteine blood agar and the modified Martin-Lewis-agar used in this study, cultivation was successful for 26 isolates on both media, but for two isolates only on the cysteine blood agar. Out of 43 carcasses 19 tested positive in bacteriological culture and PCR. Two culture positive samples of tonsils originating from foxes could not be confirmed by PCR, although PCR was positive in 22 samples that missed growth of F. tularensis. Comparative studies on cultural detection of E. tularensis were performed on samples of 16 hares from lung, spleen, liver and gut and in one case with a peritoneal swab. In at least one of these localizations cultivation of the pathogen was successful. Detection rate was reduced to 94% (15 of 16 hares) considering only the results of the cultures of the lungs and spleens. For a sensitive and rapid detection of F. tularensis subsp. holarctica, the PCR is a suitable method thereby avoiding hazardous multiplying of the pathogen. However, cultivation of F. tularensis is often a prerequisite for further studies on antibiotic resistance patterns of the pathogen, molecular epidemiological and pathological analyses of tularaemia.

  12. Detection of Erysiphe necator in Air Samples Using the Polymerase Chain Reaction and Species-Specific Primers.

    PubMed

    Falacy, Jennifer S; Grove, Gary G; Mahaffee, Walter F; Galloway, Heather; Glawe, Dean A; Larsen, Richard C; Vandemark, George J

    2007-10-01

    ABSTRACT A polymerase chain reaction (PCR) assay employing species-specific primers was developed to differentiate Erysiphe necator from other powdery mildews common in the northwest United States. DNA was extracted from mycelia, conidia, and/or chasmothecia that were collected from grape leaves with a Burkard cyclonic surface sampler. To differentiate E. necator from other erysiphaeceous fungi, primer pairs Uncin144 and Uncin511 were developed to select unique sequences of the internal transcribed spacer regions of E. necator. Using these primers in PCR amplifications, a 367-bp amplicon specific to E. necator was generated, but no amplicons were generated from other erysiphaceous species collected from 48 disparate hosts representing 26 vascular plant families. The PCR limit of detection was one to five conidia of E. necator placed directly into reaction mixtures or 100 to 250 conidia placed on glass rods coated with silicon grease. During field studies, this PCR assay facilitated the detection of E. necator inoculum in air samples within hours of sample rod collection and prior to disease onset. Amplification of E. necator DNA did not occur when the PCR assay was conducted on vineyard air samples collected while grapes were dormant or during periods when vine growth occurred but E. necator remained dormant. The initial PCR detection of E. necator of the season occurred during seasonal ascospore releases caused by precipitation events between bud burst and the prebloom period during the 3 years of the study. Detection ceased for 7 to 11 days following ascospore release and then resumed several days prior to the observance of microscopic symptoms and signs of powdery mildew in the field. Results of this study represent the initial step toward the goal of incorporating an inoculum availability component into current and future grapevine powdery mildew risk assessment models.

  13. Aphids preserved in propylene glycol can be used for reverse transcription-polymerase chain reaction detection of Potato virus Y.

    PubMed

    Nie, Xianzhou; Pelletier, Yvan; Mason, Nicola; Dilworth, Andrea; Giguère, Marie-Andrée

    2011-08-01

    The effectiveness of propylene glycol on the retention of RNA target of Potato virus Y (PVY), an aphid stylet-borne virus, in Myzus persicae was investigated in comparison to ethanol and liquid nitrogen/-80°C. Reverse transcription-polymerase chain reaction (RT-PCR) was used to detect the PVY targets from the propylene glycol/ethanol/liquid nitrogen preserved single aphids after a 5min acquisition period from infected potato plants. In the liquid nitrogen/-80°C and 70% ethanol treatments, 55.6% and 38.8% aphids tested PVY-positive, respectively. In the 0-75% propylene glycol treatments, 12.2-44.7% aphids tested PVY-positive. The lowest detection rate was in the 0% (positive rate, 15.2%) and the 10% propylene glycol (positive rate, 12.2%). As the propylene glycol concentration increased to 25%, 29.8% aphids tested positive. A high PVY-positive rate was also found in 35-75% propylene glycol treatments at 44.7% (35% propylene glycol), 36.7% (50% propylene glycol) and 34.8% (75% propylene glycol), which is comparable to the rate shown in 70% ethanol. No significant difference in the positive detection rate was observed in aphids preserved in 50% propylene glycol at room temperature for 2, 4 and 10 days. These results demonstrate that propylene glycol at 25-75% can retain PVY targets effectively in aphids for an extended time period, and thus can be used in aphid traps to preserve viruliferous aphids for later RT-PCR detection of PVY.

  14. Two-step polymerase chain reactions and restriction endonuclease analyses detect and differentiate ompA DNA of Chlamydia spp.

    PubMed Central

    Kaltenboeck, B; Kousoulas, K G; Storz, J

    1992-01-01

    Specific and sensitive amplification of major outer membrane protein (MOMP) gene (ompA) DNA sequences of Chlamydia species with various MOMP genotypes was achieved by a two-step polymerase chain reaction (PCR). Degenerate, inosine-containing oligonucleotide primers homologous to the 5' and 3' ends of the translated regions of all chlamydial MOMP genes were used in a PCR to amplify a DNA fragment of approximately 1,120 bp. A portion of this DNA fragment was amplified in a second genus-specific reaction that yielded a DNA fragment of approximately 930 bp. A pair of degenerate oligonucleotide primers homologous to internal sequences of the primary DNA fragment was used in this PCR. This method detected three cognate chlamydial genomes in a background of 1 microgram of unrelated DNA. MOMP genes of 13 representative chlamydial MOMP genotypes of the species C. trachomatis, C. pneumoniae, and C. psittaci were amplified. In a secondary PCR, group-specific detection was achieved by the simultaneous use of one genus-specific primer and three primers derived from different fingerprint regions of three major groups of chlamydiae. This multiplex PCR differentiated the groups by the length of the amplified DNA fragments and detected the simultaneous presence of DNA sequences of the Chlamydia spp. with different MOMP genotypes. Further differentiation as ompA restriction fragment length polymorphism types among all chlamydial strains with the various MOMP genotypes analyzed here was achieved by restriction endonuclease analysis of the secondary PCR products. DNA sequences corresponding to the ompA restriction fragment length polymorphism type B577 of C. psittaci were detected in two of seven milk samples from cases of bovine mastitis. Images PMID:1349899

  15. Simultaneous detection of major blackleg and soft rot bacterial pathogens in potato by multiplex polymerase chain reaction.

    PubMed

    Potrykus, M; Sledz, W; Golanowska, M; Slawiak, M; Binek, A; Motyka, A; Zoledowska, S; Czajkowski, R; Lojkowska, E

    2014-11-01

    A multiplex polymerase chain reaction (PCR) assay for simultaneous, fast and reliable detection of the main soft rot and blackleg potato pathogens in Europe has been developed. It utilises three pairs of primers and enables detection of three groups of pectinolytic bacteria frequently found in potato, namely: Pectobacterium atrosepticum, Pectobacterium carotovorum subsp. carotovorum together with Pectobacterium wasabiae and Dickeya spp. in a multiplex PCR assay. In studies with axenic cultures of bacteria, the multiplex assay was specific as it gave positive results only with strains of the target species and negative results with 18 non-target species of bacteria that can possibly coexist with pectinolytic bacteria in a potato ecosystem. The developed assay could detect as little as 0.01 ng µL(-1) of Dickeya sp. genomic DNA, and down to 0.1 ng µL(-1) of P. atrosepticum and P. carotovorum subsp. carotovorum genomic DNA in vitro. In the presence of competitor genomic DNA, isolated from Pseudomonas fluorescens cells, the sensitivity of the multiplex PCR decreased tenfold for P. atrosepticum and Dickeya sp., while no change was observed for P. carotovorum subsp. carotovorum and P. wasabiae. In spiked potato haulm and tuber samples, the threshold level for target bacteria was 10(1) cfu mL(-1) plant extract (10(2) cfu g(-1) plant tissue), 10(2) cfu mL(-1) plant extract (10(3) cfu g(-1) plant tissue), 10(3) cfu mL(-1) plant extract (10(4) cfu g(-1) plant tissue), for Dickeya spp., P. atrosepticum and P. carotovorum subsp. carotovorum/P. wasabiae, respectively. Most of all, this assay allowed reliable detection and identification of soft rot and blackleg pathogens in naturally infected symptomatic and asymptomatic potato stem and progeny tuber samples collected from potato fields all over Poland.

  16. Nested polymerase chain reaction technique for the detection of Gpc3 and Afp mRNA in liver cancer micrometastases.

    PubMed

    Luo, J; Yang, K; Wen, Y G

    2017-02-08

    The incidence of liver cancer has gradually risen to a high level in China, and tumor metastasis occurs via multiple pathways. Alpha fetal protein (AFP) is the main biomarker of liver cancer micrometastases. A recent study showed that glypican-3 (GPC3), which is abundant in hepatoma cells, has promising specificity and could be used to determine the presence of malignant cells. The nested polymerase chain reaction (PCR) technique is superior in experimental sensitivity. Using rat models of liver cancer in the current study, we utilized nested PCR to detect Gpc3 and Afp mRNA to determine their relationship with liver cancer micrometastases. The aim was to provide an experimental basis for clinical examination. We randomly assigned male Sprague-Dawley rats to sham and experimental groups. The experimental group constituted a liver cancer model induced by diethylnitrosamine, whereas the sham group was administered with an equivalent volume of normal saline. Gpc3 and Afp mRNA was detected using nested PCR. Analysis was performed to determine statistical significance. Compared with the sham group, the rates of occurrence of Gpc3 and Afp mRNA were significantly higher in the experimental group (P < 0.05). Compared with the total positive ratio of hepatoma cells examined by joint detection, the rates of occurrence of Gpc3 and Afp mRNA increased significantly in the four subgroups of the experimental group (P < 0.05). The use of nested PCR significantly improved sensitivity for the detection of Gpc3 and Afp mRNA in liver cancer micrometastases.

  17. A universal polymerase chain reaction for the detection of psittacine beak and feather disease virus.

    PubMed

    Ypelaar, I; Bassami, M R; Wilcox, G E; Raidal, S R

    1999-08-16

    A universal PCR assay was designed that consistently detected psittacine beak and feather disease virus (BFDV) in psittacine birds affected with psittacine beak and feather disease (PBFD) from different geographic regions across Australia. Primers within open reading frame 1 (ORF1) of the BFDV genome consistently amplified a 717 bp product from blood and/or feathers of 32 birds with PBFD lesions. The PCR did not amplify a product from the feathers or blood from 7 clinically normal psittacine birds. Primers based on regions outside of ORF1 did not consistently produce a PCR product, suggesting there was some genomic variation outside ORF1. The amplified ORF1 PCR products of 10 BFDV isolates, from different psittacine species and from various regions around Australia, were cloned and comparative DNA sequence analysis demonstrated 88-99% of the ORF1 fragments. The derived amino acid sequences of the amplified ORF1 fragments demonstrated similar identity between all 10 isolates. Within ORF1, there was complete conservation of the putative nucleotide binding site and marked conservation of 2 other motifs previously identified as essential components of the replication-associated proteins of other circoviruses and geminiviruses.

  18. Electrochemical detection of Francisella tularensis genomic DNA using solid-phase recombinase polymerase amplification.

    PubMed

    del Río, Jonathan Sabaté; Yehia Adly, Nouran; Acero-Sánchez, Josep Lluis; Henry, Olivier Y F; O'Sullivan, Ciara K

    2014-04-15

    Solid-phase isothermal DNA amplification was performed exploiting the homology protein recombinase A (recA). The system was primarily tested on maleimide activated microtitre plates as a proof-of-concept and later translated to an electrochemical platform. In both cases, forward primer for Francisella tularensis holarctica genomic DNA was surface immobilised via a thiol or an amino moiety and then elongated during the recA mediated amplification, carried out in the presence of specific target sequence and reverse primers. The formation of the subsequent surface tethered amplicons was either colorimetrically or electrochemically monitored using a horseradish peroxidase (HRP)-labelled DNA secondary probe complementary to the elongated strand. The amplification time was optimised to amplify even low amounts of DNA copies in less than an hour at a constant temperature of 37°C, achieving a limit of detection of 1.3×10(-13) M (4×10(6) copies in 50 μL) for the colorimetric assay and 3.3×10(-14) M (2×10(5) copies in 10 μL) for the chronoamperometric assay. The system was demonstrated to be highly specific with negligible cross-reactivity with non-complementary targets or primers.

  19. Innovative use of platinum compounds to selectively detect live microorganisms by polymerase chain reaction.

    PubMed

    Soejima, Takashi; Minami, Jun-Ichi; Xiao, Jin-Zhong; Abe, Fumiaki

    2016-02-01

    PCR cannot distinguish live microorganisms from dead ones. To circumvent this disadvantage, ethidium/propidium-monoazide (EMA/PMA) and psoralen to discriminate live from dead bacteria have been used for 2 decades. These methods require the use of numerous laborious procedures. We introduce an innovative method that uses platinum compounds, which are primarily used as catalysts in organic chemistry and partly used as anti-cancer drugs. Microorganisms are briefly exposed to platinum compounds in vivo, and these compounds penetrate dead (compromised) microorganisms but not live ones and are chelated by chromosomal DNA. The use of platinum compounds permits clear discrimination between live and dead microorganisms in water and milk (including Cronobacter sakazakii and Escherichia coli) via PCR compared with typically used PMA. This platinum-PCR method could enable the specific detection of viable coliforms in milk at a concentration of 5-10 CFU mL(-1) specified by EU/USA regulations after a 4-h process. For sample components, environmental water contains lower levels of PCR inhibitors than milk does, and milk is similar to infant formula, skim milk and blood; thus, the use of the platinum-PCR method could also prevent food poisoning due to the presence of C. sakazakii in dairy products. This method could provide outstanding rapidity for use in environmental/food/clinical tests. Platinum-PCR could also be a substitute for the typical culture-based methods currently used.

  20. Detection in vivo of a new gene product (gene III) of cauliflower mosaic virus

    PubMed Central

    Xiong, C.; Lebeurier, G.; Hirth, L.

    1984-01-01

    Cauliflower mosaic virus DNA contains six major open reading frames (ORFs). As only the mRNA corresponding to the transcription of gene VI and its translation product have been isolated, the identification in infected plants of products corresponding to the five other putative genes remains to be established. The present paper reports the detection of an ORF III product by means of antibodies raised against an NH2-terminal synthetic peptide of 19 amino acids corresponding to a sequence predicted from the nucleotide sequence of ORF III. The detection of this gene product raises the question of the mechanism of its expression. Images PMID:16593524

  1. Development of a rapid diagnostic assay for the detection of tomato chlorotic dwarf viroid based on isothermal reverse-transcription-recombinase polymerase amplification

    Technology Transfer Automated Retrieval System (TEKTRAN)

    A molecular diagnostic assay utilizing reverse transcription-recombinase polymerase amplification (RT-RPA) at an isothermal constant temperature of 39 °C and target-specific primers and probe were developed for the rapid, sensitive, and specific detection of tomato chlorotic dwarf viroid (TCDVd) in ...

  2. Comparison of automated BAX polymerase chain reaction and standard culture methods for detection of Listeria monocyogenes in blue crab meat (Callinectus sapidus) and blue crab processing plants

    Technology Transfer Automated Retrieval System (TEKTRAN)

    This study compared the BAX Polymerase Chain Reaction method (BAX PCR) with the Standard Culture Method (SCM) for detection of L. monocytogenes in blue crab meat and crab processing plants. The aim of this study was to address this data gap. Raw crabs, finished products and environmental sponge samp...

  3. Immunomagnetic separation significantly improves the sensitivity of polymerase chain reaction in detecting Giardia duodenalis and Cryptosporidium spp. in dairy cattle.

    PubMed

    Coklin, Tatjana; Farber, Jeffrey M; Parrington, Lorna J; Bin Kingombe, Cesar I; Ross, William H; Dixon, Brent R

    2011-03-01

    The effectiveness of molecular methods for the detection of species of Giardia and Cryptosporidium in fecal samples is often reduced by low or intermittent cyst and oocyst shedding, and/or the presence of polymerase chain reaction (PCR) inhibitors. The present study investigates the use of immunomagnetic separation (IMS) as an additional concentration step before PCR in the detection of these common protozoan parasites in dairy cattle. The IMS-PCR assays were optimized for amplifying fragments of the 16S ribosomal RNA (rRNA), β-giardin, and glutamate dehydrogenase (GDH) genes of Giardia duodenalis, as well as fragments of the 18S rRNA, heat shock protein (HSP)-70, and Cryptosporidium oocyst wall protein (COWP) genes of Cryptosporidium spp. In all cases, IMS-PCR was more sensitive than PCR alone. A significantly greater number of Giardia-positive samples were identified using IMS-PCR of the 16S rRNA gene (P < 0.01) and of the GDH gene (P < 0.01), as compared with PCR without any additional concentration step. In the case of Cryptosporidium, IMS-PCR of the COWP gene (P  =  0.02) resulted in a significantly greater number of positives than did PCR without the IMS concentration step. The greatest number of positives, however, was obtained using IMS-PCR to amplify a portion of the 16S rRNA gene of Giardia and a portion of the HSP-70 gene of Cryptosporidium. A further comparison of the optimized IMS-PCR assays to immunofluorescence microscopy suggested that the IMS-PCR assays were considerably more sensitive than microscopy was in the detection of Giardia cysts and Cryptosporidium oocysts in fecal samples.

  4. Evaluation of a new multiplex polymerase chain reaction assay STDFinder for the simultaneous detection of 7 sexually transmitted disease pathogens.

    PubMed

    Muvunyi, Claude Mambo; Dhont, Nathalie; Verhelst, Rita; Crucitti, Tania; Reijans, Martin; Mulders, Brit; Simons, Guus; Temmerman, Marleen; Claeys, Geert; Padalko, Elizaveta

    2011-09-01

    We evaluated a new multiplex polymerase chain reaction (mPCR), "STDFinder assay", a novel multiplex ligation-dependent probe amplification (MLPA) assay for the simultaneous detection of 7 clinically relevant pathogens of STDs, i.e., Neisseria gonorrhoeae, Chlamydia trachomatis, Trichomonas vaginalis, Mycoplasma genitalium, Treponema pallidum, and herpes simplex virus type 1 and 2 (HSV-1 and HSV-2). An internal amplification control was included in the mPCR reaction. The limits of detection for the STDFinder assay varied among the 7 target organisms from 1 to 20 copies per MLPA assay. There were no cross-reactions among any of the probes. Two hundred and forty-two vaginal swabs and an additional 80 specimens with known results for N. gonorrhoeae and C. trachomatis, obtained from infertile women seen at an infertility research clinic at the Kigali Teaching Hospital in Rwanda, were tested by STDFinder assay and the results were confirmed by single real-time PCR using different species-specific targets. Compared to the reference standard, the STDFinder assay showed specificities and sensitivities of 100% and 100%, respectively, for N. gonorrhoeae, C. trachomatis, and M. genitalium; 90.2% and 100%, respectively, for Trichomonas vaginalis; and 96.1% and 100%, respectively, for HSV-2. No specimen was found to be positive for HSV-1 by either the STDFinder assay or the comparator method. Similarly, the sensitivity for Treponema pallidum could not be calculated due to the absence of any Treponema pallidum-positive samples. In conclusion, the STDFinder assays have comparable clinical sensitivity to the conventional mono and duplex real-time PCR assay and are suitable for the routine detection of a broad spectrum of these STDs at relatively low cost due to multiplexing.

  5. Comparison of different methods of RNA isolation for plum pox virus detection by reverse transcription-polymerase chain reaction.

    PubMed

    Faggioli, F; Pasquini, G; Barba, M

    1998-09-01

    The diagnosis of plum pox virus (PPV) is still considered one of the most important aspects of the "sharka" problem. In fact, different studies demonstrated an uneven distribution of the virus in infected trees due to a high variability in virus concentration. These aspects complicate the PPV diagnosis. To date, biological, serological and molecular assays have been successively developed in order to obtain sensitive and efficient PPV detection techniques. In particular, the polymerase chain reaction (PCR) technique seems to be promising and can be considered the most sensitive and reliable one. Preparation of viral RNA is still a fundamental step in reverse transcription-PCR (RT-PCR) technique, especially when applied to large scale testing, i.e., for certification purposes. In order to find the most rapid and efficient procedure, we have compared three different procedures of extraction of viral RNA to be processed RT-PCR. Their common characteristics is their capacity to extract the RNA from a small amount of plant tissue without organic solvents in the extraction fluid. The procedures were as follows: an immuno-capture (IC) method using a specific antiserum, a silica-capture (SC) method using a non-specific matrix, and a simple and rapid RNA extraction (RE) method. They all were followed by one-tube RT-PCR. The obtained results show that all the three techniques allowed a successful amplification and detection of PPV in tested samples except the SC-PCR method which proved less effective. In fact, the IC-PCR and RE-PCR methods amplified and detected PPV in all isolates tested, while the SC-PCR method was able to reveal the presence of the virus in apricot and infected control samples only.

  6. Voltammetric detection of As(III) with Porphyridium cruentum based modified carbon paste electrode biosensor.

    PubMed

    Zaib, M; Saeed, A; Hussain, I; Athar, M M; Iqbal, M

    2014-12-15

    A novel biosensor based on carbon paste electrode modified with Porphyridium cruentum biomass was developed for the determination of As(III) in contaminated water. As(III) was first biosorbed-accumulated on the electrode surface at open circuit potential and then stripped off by applying anodic scan range of -0.8 to +0.8 V using differential pulse anodic stripping voltammetric technique. The best result was obtained at pH 6.0 with 0.1M HNO3 solution as stripping medium, allowing biosorption-accumulation time of 8 min using 5% P. cruentum biomass in graphite-mineral oil paste. Linear range for As(III) detection with the modified electrode-biosensor was observed between 2.5 and 20 µg L(-1). The FTIR spectrum of P. cruentum biomass confirmed the presence of active functional groups that participate in the binding of As(III). Scanning Electron Microscopy (SEM) indulged the surface morphology of modified electrode-biosensor before and after As(III) adsorption. Similarly, Atomic Force Microscopy (AFM) showed that the average roughness of the modified electrode decreased indicating the successful incorporation of P. cruentum biomass. Efficiency of the biosensor in the presence of different interfering metal (Na(+), K(+), Ca(2+), and Mg(2+)) ions were also evaluated. The application of P. cruentum modified biosensor was successfully used for the detection of As(III) in the binary metal (Fe(3+), Mn(2+), Cd(2+), Cu(2+), Ni(2+), Hg(2+), and Pb(2+)) contaminated system. The accuracy of application of biosorption based biosensor for the detection of As(III) is as low as 2.5 µg L(-1).

  7. Detection of Haemophilus influenzae in respiratory secretions from pneumonia patients by quantitative real-time polymerase chain reaction.

    PubMed

    Abdeldaim, Guma M K; Strålin, Kristoffer; Kirsebom, Leif A; Olcén, Per; Blomberg, Jonas; Herrmann, Björn

    2009-08-01

    A quantitative real-time polymerase chain reaction (PCR) based on the omp P6 gene was developed to detect Haemophilus influenzae. Its specificity was determined by analysis of 29 strains of 11 different Haemophilus spp. and was compared with PCR assays having other target genes: rnpB, 16S rRNA, and bexA. The method was evaluated on nasopharyngeal aspirates from 166 adult patients with community-acquired pneumonia. When 10(4) DNA copies/mL was used as cutoff limit for the method, P6 PCR had a sensitivity of 97.5% and a specificity of 96.0% compared with the culture. Of 20 culture-negative but P6 PCR-positive cases, 18 were confirmed by fucK PCR as H. influenzae. Five (5.9%) of 84 nasopharyngeal aspirates from adult controls tested PCR positive. We conclude that the P6 real-time PCR is both sensitive and specific for identification of H. influenzae in respiratory secretions. Quantification facilitates discrimination between disease-causing H. influenzae strains and commensal colonization.

  8. Use of Fluorescence Quantitative Polymerase Chain Reaction (PCR) for the Detection of Escherichia coli Adhesion to Pig Intestinal Epithelial Cells.

    PubMed

    Dai, C H; Gan, L N; Qin, W U; Zi, C; Zhu, G Q; Wu, S L; Bao, W B

    2016-09-01

    An efficient and accurate method to test Escherichia coli (E. coli) adhesion to intestinal epithelial cells will contribute to the study of bacterial pathogenesis and the function of genes that encode receptors related to adhesion. This study used the quantitative real-time polymerase chain reaction (qPCR) method. qPCR primers were designed from the PILIN gene of E. coli F18ab, F18ac, and K88ac, and the pig β-ACTIN gene. Total deoxyribonucleic acid (DNA) from E. coli and intestinal epithelial cells (IPEC-J2 cells) were used as templates for qPCR. The 2-ΔΔCt formula was used to calculate the relative number of bacteria in cultures of different areas. We found that the relative numbers of F18ab, F18ac, and K88ac that adhered to IPEC-J2 cells did not differ significantly in 6-, 12-, and 24-well culture plates. This finding indicated that there was no relationship between the relative adhesion number of E. coli and the area of cells, so the method of qPCR could accurately test the relative number of E. coli. This study provided a convenient and reliable testing method for experiments involving E. coli adhesion, and also provided innovative ideas for similar detection methods.

  9. Detection of Wuchereria bancrofti DNA in paired serum and urine samples using polymerase chain reaction-based systems.

    PubMed

    Ximenes, Camila; Brandão, Eduardo; Oliveira, Paula; Rocha, Abraham; Rego, Tamisa; Medeiros, Rafael; Aguiar-Santos, Ana; Ferraz, João; Reis, Christian; Araujo, Paulo; Carvalho, Luiz; Melo, Fabio L

    2014-12-01

    The Global Program for the Elimination of Lymphatic Filariasis (GPELF) aims to eliminate this disease by the year 2020. However, the development of more specific and sensitive tests is important for the success of the GPELF. The present study aimed to standardise polymerase chain reaction (PCR)-based systems for the diagnosis of filariasis in serum and urine. Twenty paired biological urine and serum samples from individuals already known to be positive for Wuchereria bancrofti were collected during the day. Conventional PCR and semi-nested PCR assays were optimised. The detection limit of the technique for purified W. bancrofti DNA extracted from adult worms was 10 fg for the internal systems (WbF/Wb2) and 0.1 fg by using semi-nested PCR. The specificity of the primers was confirmed experimentally by amplification of 1 ng of purified genomic DNA from other species of parasites. Evaluation of the paired urine and serum samples by the semi-nested PCR technique indicated only two of the 20 tested individuals were positive, whereas the simple internal PCR system (WbF/Wb2), which has highly promising performance, revealed that all the patients were positive using both samples. This study successfully demonstrated the possibility of using the PCR technique on urine for the diagnosis of W. bancrofti infection.

  10. Validation of a polymerase chain reaction-oligochromatography test for detection of influenza A (H1N1) 2009 virus.

    PubMed

    Fuenzalida, Loreto; Prat, Cristina; Blanco, Silvia; Bas, Albert; Domínguez, M J; Hernández, M Ángeles; Rodrigo, Carlos; Ausina, Vicente

    2012-02-01

    The outbreak of pandemic influenza A (H1N1) 2009 virus caused the first influenza pandemic disease of the 21st century. In August 2010, the pandemic moved into the post-pandemic period. However, localized outbreaks of various magnitudes continued with a higher rate of disease severity. The aim of this study was to assess a new polymerase chain reaction (PCR)-oligochromatographic assay (Speed-Oligo) in the diagnosis of novel influenza A (H1N1) 2009. A total of 405 nasopharyngeal aspirate specimens from 400 pediatric and adults patients with suspected infection of pandemic influenza A (H1N1) 2009 were analyzed. The sensitivity and specificity values of the Speed-Oligo assay in comparison to reverse transcriptase-PCR assay developed by the Centers for Disease Control and Prevention were 86.5% and 92.2%, respectively. The new assay is simple, rapid, and provides a good sensitivity for detection of influenza A (H1N1) 2009. This assay might be a good alternative to real-time PCR assays for laboratories not equipped with real-time PCR instruments.

  11. Single nucleotide polymorphisms in the ovine casein genes detected by polymerase chain reaction-single strand conformation polymorphism.

    PubMed

    Ceriotti, G; Chessa, S; Bolla, P; Budelli, E; Bianchi, L; Duranti, E; Caroli, A

    2004-08-01

    Casein genetic polymorphisms are important and well known due to their effects on quantitative traits and technological properties of milk. At the DNA level, polymerase chain reaction (PCR)-single-strand conformation polymorphism (SSCP) allows for the simultaneous typing of several alleles at casein loci, as well as the detection of unknown polymorphisms. Here we describe the usefulness of the PCR-SSCP technique for casein typing in sheep. In particular, three single-nucleotide polymorphisms (SNP) are described at CSN1S1, CSN2, and CSN3, all resulting in amino acid exchanges. At CSN1S1, a transition T-->C was found, resulting in the deduced amino acid exchange Ile186-->Thr186. A transition A-->G resulting in the deduced amino acid exchange Met183-->Val183 was identified at CSN2. The 2 SNP showed a rather high frequency (ranging from 0.12 to 0.26) in 3 Italian breeds (Sarda, Comisana, Sopravissana). Another transition C-->T (Ser104-->Leu104) was found at CSN3 in one heterozygous animal.

  12. Detection of Leptospira spp. in semen and vaginal fluids of goats and sheep by polymerase chain reaction.

    PubMed

    Lilenbaum, W; Varges, R; Brandão, F Z; Cortez, A; de Souza, S O; Brandão, P E; Richtzenhain, L J; Vasconcellos, S A

    2008-04-15

    Thirteen goat herds and seven sheep flocks in the state of Rio de Janeiro, Brazil were screened for leptospirosis. From the three herds and three flocks with greatest seroreactivity, 19 goats (16 females and three bucks) and 40 sheep (26 ewes and 14 rams) that were seropositive (specific anti-Leptospira titres > or =400, based on a microscopic agglutination test), were selected for more detailed studies. From those animals, samples of vaginal fluids or semen were collected for bacteriological and molecular assays. For both species of animals, the most prevalent reactions were to serovars Hardjo, Shermani, and Grippotyphosa. Although leptospires were detected by darkfield microscopy in three vaginal fluid samples (from two goats and one ewe), pure isolates were not obtained by bacteriological culture of vaginal fluids or semen. However, seven vaginal fluid samples (from four goats and three ewes) and six semen samples (all from rams) were positive on polymerase chain reaction (PCR). Based on these findings, in addition to analogous findings in cattle, we inferred that there is potential for venereal transmission of leptospirosis in small ruminants.

  13. Detection and differentiation of filarial parasites by universal primers and polymerase chain reaction-restriction fragment length polymorphism analysis.

    PubMed

    Nuchprayoon, Surang; Junpee, Alisa; Poovorawan, Yong; Scott, Alan L

    2005-11-01

    Filarial nematode parasites are a serious cause of morbidity in humans and animals. Identification of filarial infection using traditional morphologic criteria can be difficult and lead to misdiagnosis. We report on a polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP)-based method to detect and differentiate a broad range of filarial species in a single PCR. The first internal transcribed spacer 1 (ITS1) along with the flanking 18S and 5.8S ribosomal DNA (rDNA) were isolated and cloned from Wuchereria bancrofti, Brugia malayi, and Brugia pahangi. Sequence analysis identified conserved sites in the 18S and 5.8S rDNA sequence that could be used as universal priming sites to generate ITS1-distinctive PCR products that were useful for distinguishing filariae at the genus level. The addition of a digestion of the ITS1 PCR product with the restriction endonuclease Ase I generated a fragment profile that allowed differentiation down to the species level for W. bancrofti, B. malayi, B. pahangi, Dirofilaria immitis, and D. repens. The PCR-RFLP of ITS1 rDNA will be useful in diagnosing and differentiating filarial parasites in human, animal reservoir hosts, and mosquito vectors in disease-endemic areas.

  14. Development of Conventional and Real-Time Reverse Transcription Polymerase Chain Reaction Assays to Detect Tembusu Virus in Culex tarsalis Mosquitoes

    DTIC Science & Technology

    2014-08-11

    specific conventional and real-time quantitative reverse transcription polymerase chain reaction assays for detecting TMUV RNA in infected cell...fold 5 days after inoculation. These assays resulted in the detection of virus-specific RNA in the presence of copurified mosquito nucleic acids. The use...flaviviruses, TMUV is a linear, positive-sense, single-stranded RNA virus with a genome size of approximately 11 kb. Its RNA encodes 10 proteins, including

  15. Real-time polymerase chain reaction for detection of encapsulated Haemophilus influenzae using degenerate primers to target the capsule transport gene bexA.

    PubMed

    Law, Dennis K S; Tsang, Raymond S W

    2013-05-01

    A real-time polymerase chain reaction assay that uses degenerate primers and a dual-labelled probe was developed to detect the bexA gene of Haemophilus influenzae, including those belonging to non-b serotypes as well as clonal division II strains. This assay is sensitive and specific, detecting 20 copies of the gene, but negative with a variety of bacteria associated with meningitis and bacteremia or septicemia.

  16. Detection of Pathogenic Yersinia Enterocolitica in Slaughtered Pigs by Cultural Methods and Real-Time Polymerase Chain Reaction

    PubMed Central

    Fois, Federica; Consolati, Simonetta Gianna; Salza, Sara; Tedde, Tiziana; Soro, Paolo; Collu, Carlo; Ladu, Daniela; Virgilio, Sebastiano; Piras, Francesca

    2015-01-01

    Healthy pigs carrying pathogenic to human Yersinia enterocolitica strains are the main source of entry into slaughterhouse, where cross-contamination of carcasses can happen. The aim of this work was to determine Y. enterocolitica prevalence in slaughtered pigs, investigating the presence of carriers in relation to carcass contamination. A total of 132 pig samples (tonsils, mesenteric lymph nodes, colon content, carcass surface) were collected from 4 Sardinian slaughterhouses. All the samples were examined by the ISO 10273:2003 method, and the prevalence was also determined by direct plating on CIN Agar. Moreover, to detect the ail positive Y. enterocolitica strains in enrichment broths and isolates a real-time polymerase chain reaction (PCR) was applied. Y. enterocolitica prevalence was 19% with direct plating and 12% with enrichment methods. Carcass surfaces and tonsils prevalence was 5.30% by direct plating, and 5.3% and 2.2%, respectively, by enrichment method. Tonsil samples showed an average contamination level of 3.2×103 CFU/g, while the mean value on carcass was 8.7×102 CFU/g. An overall prevalence of 9.8% of ail positive Y. enterocolitica broths was detected by RT-PCR, that found a higher prevalence in tonsils (7.5%) with respect to cultural methods, confirming the greater sensitivity of this technique when applied for tonsils and faeces samples. The results show a relatively low pathogenic Y. enterocolitica prevalence in pigs slaughtered in Sardinia. Good hygiene measures should be applied at slaughterhouse in order to prevent the entry of carriers and control carcass contamination. PMID:27800392

  17. Detection of low numbers of Salmonella in environmental water, sewage and food samples by a nested polymerase chain reaction assay.

    PubMed

    Waage, A S; Vardund, T; Lund, V; Kapperud, G

    1999-09-01

    A polymerase chain reaction (PCR) assay with two nested pairs of primers selected from conserved sequences within a 2.3 kb randomly cloned DNA fragment from the Salmonella typhimurium chromosome was developed. The nested PCR assay correctly identified 128 of a total of 129 Salmonella strains belonging to subspecies I, II, IIIb and IV. One strain of Salm. arizona (ssp. IIIa) tested negative. No PCR products were obtained from any of the 31 non-Salmonella strains examined. The sensitivity of the assay was 2 cfu, as determined by analysis of proteinase K-treated boiled lysates of Salm. typhimurium. The performance of the assay was evaluated for environmental water, sewage and food samples spiked with Salm. typhimurium. Water and sewage samples were filtered and filters were enriched overnight in a non-selective medium. Prior to PCR, the broth cultures were subjected to a rapid and simple preparation procedure consisting of centrifugation, proteinase K treatment and boiling. This assay enabled detection of 10 cfu 100 ml(-1) water with background levels of up to 8700 heterotrophic organisms ml(-1) and 10000 cfu of coliform organisms 100 ml(-1) water. Spiked food samples were analysed with and without overnight enrichment in a non-selective medium using the same assay as above. Nested PCR performed on enriched broths enabled detection of <10 cfu g(-1) food. Variable results were obtained for food samples examined without prior enrichment and most results were negative. This rapid and simple assay provides a sensitive and specific means of screening drinking water or environmental water samples, as well as food samples, for the presence of Salmonella spp.

  18. Polymerase cross-linking spiral reaction (PCLSR) for detection of African swine fever virus (ASFV) in pigs and wild boars.

    PubMed

    Woźniakowski, Grzegorz; Frączyk, Magdalena; Kowalczyk, Andrzej; Pomorska-Mól, Małgorzata; Niemczuk, Krzysztof; Pejsak, Zygmunt

    2017-02-15

    The study reports the development of a polymerase cross-linking spiral reaction (PCLSR) for the detection of African swine fever virus (ASFV) DNA in blood collected from infected pigs and wild boars. The method uses 3 specifically designed primers. Two outer-spiral primers comprising of 3' sequences complementary to ASFV p72 gene sequence and 5'end sequences complementary to exogenous gene of black widow alpha-latrotoxin as well as additional ASFV specific cross-linking primer. The method is specific exclusively to ASFV DNA without cross-reactions with cDNA of classical swine fever virus (CSFV), porcine reproductive respiratory syndrome (PRRSV) or porcine epidemic diarrhea virus (PEDV). The sensitivity of this technique reached 7.2 × 10(2) copies per μl(-1) of plasmid containing p72 gene. The PCLSR was conducted at 65 °C creating cross-linked complex structures. The results of PCLSR were visualized using SYBR Green I dye, gel electrophoresis while the reaction progress was traced using real-time PCR system that resulted in registration of fluorescent curves and melting peaks at 85.3 °C. The developed PCLSR was examined using blood or tissue samples collected from selected 17 ASF cases from infected wild boars and 3 outbreaks in pigs. Further tests have been also conducted using 55 tissue samples from 23 outbreaks and 22 cases. These results showed that PCLSR might be further used for preliminary and cost-effective detection and surveillance of ASFV.

  19. Decapitation Improves Detection of Wolbachia pipientis (Rickettsiales: Anaplasmataceae) in Culex pipiens (Diptera: Culicidae) Mosquitoes by the Polymerase Chain Reaction

    PubMed Central

    BECKMANN, J. F.; FALLON, A. M.

    2013-01-01

    Polymerase chain reaction (PCR) is often used to detect microorganisms, pathogens, or both, including the reproductive parasite Wolbachia pipientis (Rickettsiales: Anaplasmataceae), in mosquitoes. Natural populations of Culex pipiens L. (Diptera: Culicidae) mosquitoes are infected with one or more strains of W. pipientis, and crosses between mosquitoes harboring different Wolbachia strains provide one of the best-known examples of cytoplasmic incompatibililty (CI). When we used PCR to monitor Wolbachia in the Buckeye strain of Culex pipiens, and in a Wolbachia-cured sister colony obtained by tetracycline treatment, we noted false negative PCR reactions with DNA samples from infected mosquitoes; these results were inconsistent with direct microscopic observation of Wolbachia-like particles in gonads dissected from mosquitoes in the same population. Assays with diluted template often improved detection of positive samples, suggesting that DNA prepared from whole mosquitoes contained an inhibitor of the PCR reaction. We reconciled discrepancies between PCR and microscopy by systematic measurement of the PCR reaction in the presence of an internal standard. Mosquito decapitation before DNA extraction restored the reliability of the PCR reaction, allowing accurate determination of Wolbachia infection status in infected and tetracycline-cured mosquito populations, consistent with microscopic examination. Using PCR primers based on the Tr1 gene, we confirmed that the Wolbachia infection in the Buckeye strain of Culex pipiens belongs to the genotype designated wPip1. Finally, to explore more widely the distribution of PCR inhibitors, we demonstrated that DNA isolated from the cricket, Acheta domesticus (L.); the beetle, Tenebrio molitor L.; the honey bee, Apis mellifera L.; and the mosquito, Anopheles punctipennis Say also contained PCR inhibitors. These results underscore the importance of measuring the presence of inhibitors in PCR templates by using a known positive

  20. Quantitative analysis of gene expression by reverse transcription polymerase chain reaction and capillary electrophoresis with laser-induced fluorescence detection.

    PubMed

    Richards, Mark P; Poch, Stephen M

    2002-05-01

    There has been a dramatic expansion of DNA sequence information compiled over the past several years for a variety of eukaryotic and prokaryotic genomes. Accompanying this increase in knowledge of genomic structure and organization has been a growing interest in studying the function of individual genes including regulation of their expression. A number of methods such as Northern blotting, ribonuclease protection assay, and hybridization arrays have been developed to analyze gene expression at the transcriptional (mRNA) level. Although quantitative estimates of mRNA transcripts can be obtained from each of these methods, oftentimes they lack sufficient sensitivity or the methodology is too costly or too labor-intensive to be applied to the analysis of a large number of samples. The most sensitive method for analyzing gene expression at the mRNA level involves the combination of reverse transcription and polymerase chain reaction (RT-PCR). However, in order to provide accurate quantitative estimates of gene expression, a rapid and efficient method is required for separation and detection of the double-stranded DNA (dsDNA) products of RT-PCR. Recent advances in capillary electrophoresis with laser-induced fluorescence detection (CE/LIF) have made this method suitable for the automated analysis of large numbers of RT-PCR samples. An overview of the application of CE/LIF to quantitative analysis of gene expression by RT-PCR is presented along with selected protocols and examples. Both relative-quantitative (RQ) and quantitative-competitive (QC) approaches to RT-PCR are discussed in conjunction with the use of CE/LIF for rapid and accurate quantitative analysis of PCR products.

  1. Polymerase cross-linking spiral reaction (PCLSR) for detection of African swine fever virus (ASFV) in pigs and wild boars

    PubMed Central

    Woźniakowski, Grzegorz; Frączyk, Magdalena; Kowalczyk, Andrzej; Pomorska-Mól, Małgorzata; Niemczuk, Krzysztof; Pejsak, Zygmunt

    2017-01-01

    The study reports the development of a polymerase cross-linking spiral reaction (PCLSR) for the detection of African swine fever virus (ASFV) DNA in blood collected from infected pigs and wild boars. The method uses 3 specifically designed primers. Two outer-spiral primers comprising of 3′ sequences complementary to ASFV p72 gene sequence and 5′end sequences complementary to exogenous gene of black widow alpha-latrotoxin as well as additional ASFV specific cross-linking primer. The method is specific exclusively to ASFV DNA without cross-reactions with cDNA of classical swine fever virus (CSFV), porcine reproductive respiratory syndrome (PRRSV) or porcine epidemic diarrhea virus (PEDV). The sensitivity of this technique reached 7.2 × 102 copies per μl−1 of plasmid containing p72 gene. The PCLSR was conducted at 65 °C creating cross-linked complex structures. The results of PCLSR were visualized using SYBR Green I dye, gel electrophoresis while the reaction progress was traced using real-time PCR system that resulted in registration of fluorescent curves and melting peaks at 85.3 °C. The developed PCLSR was examined using blood or tissue samples collected from selected 17 ASF cases from infected wild boars and 3 outbreaks in pigs. Further tests have been also conducted using 55 tissue samples from 23 outbreaks and 22 cases. These results showed that PCLSR might be further used for preliminary and cost-effective detection and surveillance of ASFV. PMID:28198455

  2. Polymerase Chain Reaction–Electrospray–Time-of-Flight Mass Spectrometry Versus Culture for Bacterial Detection in Septic Arthritis and Osteoarthritis

    PubMed Central

    Palmer, Michael P.; Melton-Kreft, Rachael; Nistico, Laura; Hiller, N. Louisa; Kim, Leon H.J.; Altman, Gregory T.; Altman, Daniel T.; Sotereanos, Nicholas G.; Hu, Fen Z.

    2016-01-01

    Background: Preliminary studies have identified known bacterial pathogens in the knees of patients with osteoarthritis (OA) before arthroplasty. Aims: The current study was designed to determine the incidence and types of bacteria present in the synovial fluid of native knee joints from adult patients with diagnoses of septic arthritis and OA. Patients and Methods: Patients were enrolled between October 2010 and January 2013. Synovial fluid samples from the affected knee were collected and evaluated with both traditional microbial culture and polymerase chain reaction–electrospray ionization–time-of-flight mass spectrometry (molecular diagnostics [MDx]) to prospectively characterize the microbial content. Patients were grouped by diagnosis into one of two cohorts, those with clinical suspicion of septic arthritis (n = 44) and those undergoing primary arthroplasty of the knee for OA (n = 21). In all cases where discrepant culture and MDx results were obtained, we performed species-specific 16S rRNA fluorescence in situ hybridization (FISH) as a confirmatory test. Results: MDx testing identified bacteria in 50% of the suspected septic arthritis cases and 29% of the arthroplasty cases, whereas culture detected bacteria in only 16% of the former and 0% of the latter group. The overall difference in detection rates for culture and MDx was very highly significant, p-value = 2.384 × 10−7. All of the culture-positive cases were typed as Staphylococcus aureus. Two of the septic arthritis cases were polymicrobial as was one of the OA cases by MDx. FISH testing of the specimens with discordant results supported the MDx findings in 91% (19/21) of the cases, including one case where culture detected S. aureus and MDx detected Streptococcus agalactiae. Conclusions: MDx were more sensitive than culture, as confirmed by FISH. FISH only identifies bacteria that are embedded or infiltrated within the tissue and is thus not susceptible to contamination. Not all

  3. Detection of AU(III) ions using a poly(N,N-dimethylacrylamide)-coated QCM sensor.

    PubMed

    Tokuyama, Hideaki; Kitamura, Eri; Seida, Yoshimi

    2016-01-01

    A polymer-coated quartz crystal microbalance (QCM) sensor has been developed for the detection of Au(III) ions in a HCl aqueous solution. Poly(N,N-dimethylacrylamide) (poly(DMAA)) gel was used as a sensing material. The poly(DMAA) gel adsorbs Au(III) ions in the HCl aqueous solution, whereas it is inactive toward most other metal ions. The equilibrium adsorption of Au(III) ions onto the poly(DMAA) gel can be expressed by the Henry-type isotherm. The oscillation behavior of the poly(DMAA)-coated QCM sensor was investigated, and linear relationships between the resonance frequency shift and the concentration of Au(III) ions were obtained for concentrations of less than 0.032 mol/m(3) (6.3 mg/m(3)) in the single and multicomponent metal systems. The poly(DMAA)-coated QCM sensor detects Au(III) ions successfully with high selectivity and sensitivity even in the presence of other metal ions and organic compounds.

  4. Optimization of the elution buffer and concentration method for detecting hepatitis E virus in swine liver using a nested reverse transcription-polymerase chain reaction and real-time reverse transcription-polymerase chain reaction.

    PubMed

    Son, Na Ry; Seo, Dong Joo; Lee, Min Hwa; Seo, Sheungwoo; Wang, Xiaoyu; Lee, Bog-Hieu; Lee, Jeong-Su; Joo, In-Sun; Hwang, In-Gyun; Choi, Changsun

    2014-09-01

    The aim of this study was to develop an optimal technique for detecting hepatitis E virus (HEV) in swine livers. Here, three elution buffers and two concentration methods were compared with respect to enhancing recovery of HEV from swine liver samples. Real-time reverse transcription-polymerase chain reaction (RT-PCR) and nested RT-PCR were performed to detect HEV RNA. When phosphate-buffered saline (PBS, pH 7.4) was used to concentrate HEV in swine liver samples using ultrafiltration, real-time RT-PCR detected HEV in 6 of the 26 samples. When threonine buffer was used to concentrate HEV using polyethylene glycol (PEG) precipitation and ultrafiltration, real-time RT-PCR detected HEV in 1 and 3 of the 26 samples, respectively. When glycine buffer was used to concentrate HEV using ultrafiltration and PEG precipitation, real-time RT-PCR detected HEV in 1 and 3 samples of the 26 samples, respectively. When nested RT-PCR was used to detect HEV, all samples tested negative regardless of the type of elution buffer or concentration method used. Therefore, the combination of real-time RT-PCR and ultrafiltration with PBS buffer was the most sensitive and reliable method for detecting HEV in swine livers.

  5. Clinical spectrum, diagnostic criteria, and polymerase chain reaction of aqueous humor in viral and toxoplasma detection in Fuchs’ uveitis syndrome

    PubMed Central

    Sabhapandit, Swapnali; Murthy, Somasheila I; Balne, Praveen K; Sangwan, Virender Singh; Sumanth, V; Reddy, Ashok K

    2016-01-01

    Aim: The aim of this study is to describe the clinical features and diagnostic criteria of Fuchs’ uveitis (FU) and to determine whether it has an association with virus and toxoplasma in the aqueous humor during cataract surgery. Setting and Design: This is a prospective, case–control study. Materials and Methods: Patients with FU (n = 25), anterior uveitis (n = 15), and no uveitis (normal) (n = 50) were included based on predefined inclusion and exclusion criteria for all three groups. Polymerase chain reaction (PCR) of aqueous humor and serum for rubella, herpes simplex virus (HSV), cytomegalovirus (CMV), varicella-zoster virus (VZV), and toxoplasma was done using conventional uniplex PCR. Statistical Analysis: It was done using SPSS software using Chi-square test for categorical variables, and P < 0.05 was considered statistically significant. Results: Ninety patients were enrolled in the study in three groups, comparable for age, gender, and laterality of ocular involvement. All patients had diffuse keratic precipitates in FU group (P = 0001) with none having posterior synechiae (P = 0.046) which was statistically significant when compared to anterior uveitis patients. Iris nodules were noted in one case in both groups. Serum and aqueous PCR was negative for detection of VZV, CMV, toxoplasma, and rubella in all groups. PCR for HSV was positive in one patient in “normal” group but was not statistically significant. Conclusion: Our study shows that diagnosis of FU is mainly clinical. There appears to be no role of aqueous humor testing for viruses by PCR to aid in etiological diagnosis. PMID:27688274

  6. Detection of DNA from Leishmania (Viannia): Accuracy of Polymerase Chain Reaction for the Diagnosis of Cutaneous Leishmaniasis

    PubMed Central

    Neitzke-Abreu, Herintha Coeto; Venazzi, Mateus Sabaini; Bernal, Marcos Vinicius Zandonadi; Reinhold-Castro, Kárin Rosi; Vagetti, Fernanda; Mota, Camila Alves; Silva, Naielly Rodrigues; Aristides, Sandra Mara Alessi; Silveira, Thaís Gomes Verzignassi; Lonardoni, Maria Valdrinez Campana

    2013-01-01

    Cutaneous leishmaniasis (CL) can occur in skin and mucosa, causing disfiguring lesions. The laboratory diagnosis of CL involves immunological methods and optical detection of the parasite, al of which have limitations. There is a need for more effective diagnostic methods for CL which wil allow treatment to be initiated more promptly in order to help prevent the development of severe forms of mucosal disease, and to estimate the prognosis of the infection. The polymerase chain reaction (PCR) has been widely used to diagnose CL, because of its higher sensitivity. This study estimated the accuracy and compared PCRs of samples from lesion scarification (PCR-L) and blood sample-enriched leukocytes (PCR-B) with three conventional diagnostic techniques: parasite direct search (DS), Montenegro skin test (MST), and indirect immunofluorescence reaction (IIF). The study included 276 patients under suspicion of CL. We conducted a cross-sectional study, in which patients were selected by convenience sampling. We used MP3H/MP1L primers to generate a Leishmania (Viannia) (minicircle kDNA) fragment of 70-bp. Of 106 patients with CL, 83.87%, 51.67%, 64.52%, 85.71%, or 96.10% tested positive by PCR-L, PCR-B, DS, IIF, or MST, respectively. Five patients tested positive only by PCR-L, and two other patients only by PCR-B. PCR-L is indicated for use in patients with chronic lesions or Leishmania reinfection, which may progress to mucosal lesion. PCR-B is indicated for use in patients with negative results in conventional tests or for patients with no apparent lesion. PCR is not only useful in diagnosing CL but also helps to identify the infecting species. PMID:23976920

  7. Rapid detection of apolipoprotein E genotypes in Alzheimer's disease using polymerase chain reaction-single strand conformation polymorphism.

    PubMed

    Kamruecha, Worawan; Chansirikarnjana, Sirintorn; Nimkulrat, Ekapot; Udommongkol, Chesda; Wongmek, Wanna; Thangnipon, Wipawan

    2006-07-01

    Apolipoprotein E (APOE) gene on chromosome 19q13.2 is encoded by three common alleles designated as epsilon2, epsilon3 and epsilon4. In Alzheimer's disease (AD) the epsilon4 allele is over-represented and is considered to be a major genetic risk factor. Several methods have been developed to determine APOE genotypes. Among them, polymerase chain reaction-single strand conformation polymorphism (PCR-SSCP) appears to be highly reliable. In this study, we improved the nonisotopic PCR-SSCP method for determining APOE genotypes in 42 cases of AD patients, 40 cases of non-AD dementia patients, and 49 cases of age-matched controls. DNA from the target sequence on APOE was amplified by PCR from peripheral blood genomic DNA. PCR products were electrophoresed in a non-denaturing polyacrylamide gel and visualized by silver staining. We found that the epsilon4 allele had a significantly high frequency of occurrence in AD patients (33.3%) compared with age-matched controls (13.3%) (chi(2) = 10.43, p = 0.001) and non-AD dementia (10%) (chi(2) = 13.02, p<0.001) whereas the epsilon3 allele was of high frequency in non-AD dementia (90%) compared with age-matched controls (85.7%) and AD patients (66.7%). APOE epsilon4 homozygotes were found only in AD groups. On the other hand, the epsilon2 allele was found only in an age-matched control. This study confirmed that the APOE psilon4 allele is a risk factor in Thai AD subjects and that the PCR-SSCP method is a rapid and useful means of detecting the APOE genotype in AD.

  8. Polymerase spiral reaction (PSR): a novel, visual isothermal amplification method for detection of canine parvovirus 2 genomic DNA.

    PubMed

    Gupta, Vikas; Chakravarti, Soumendu; Chander, Vishal; Majumder, Saurabh; Bhat, Shabir Ahmad; Gupta, Vivek Kumar; Nandi, Sukdeb

    2017-03-27

    Canine parvovirus-2 (CPV-2), which is ubiquitously distributed worldwide, causes severe and often fatal gastroenteritis in dogs. Accurate, differential and rapid diagnosis of canine parvoviral enteritis remains a challenge for clinicians. A recently developed isothermal amplification technique, polymerase spiral reaction (PSR), was optimized for the first time for a viral pathogen with reference recombinant plasmid standards from different CPV-2 antigenic variants (CPV-2, CPV-2a, CPV-2b and CPV-2c) and subsequently validated using clinical samples. Addition of chromogenic substrate SYBR Green I after the completion of the reaction resulted in bright green fluorescence in positive samples, while negative samples and a no-template control remained orange. These results were further substantiated through visualization of a laddering pattern of the PSR-amplified product in an agarose gel in positive cases and the absence of this pattern in no-template control and negative samples. The PSR assay was found to be highly specific, as it did not react with other putative canine pathogens (canine adenovirus 1 and canine distemper virus). The sensitivity of the newly developed PSR technique was compared with that of conventional PCR, real-time PCR and LAMP, using a serial tenfold dilution of canine parvovirus DNA. The detection limit of PSR was found to be at the femtogram level, which is comparable with that of real-time PCR and LAMP, which are ten times more sensitive than conventional PCR. The assay was validated using 90 clinical samples, of which 54 were found positive, while only 45 samples were positive in conventional PCR. This novel assay, which is fully compliant with the 'ASSURED' concept for disease diagnosis, provides a simple, rapid, specific, sensitive and cost-effective method for diagnosis of canine parvoviral enteritis in veterinary clinics.

  9. Exonuclease III-assisted graphene oxide amplified fluorescence anisotropy strategy for ricin detection.

    PubMed

    Xiao, Xue; Tao, Jing; Zhang, Hong Zhi; Huang, Cheng Zhi; Zhen, Shu Jun

    2016-11-15

    Graphene oxide (GO) is an excellent fluorescence anisotropy (FA) amplifier. However, in the conventional GO amplified FA strategy, one target can only induce the FA change of one fluorophore on probe, which limits the detection sensitivity. Herein, we developed an exonuclease III (Exo III) aided GO amplified FA strategy by using aptamer as an recognition element and ricin B-chain as a proof-of-concept target. The aptamer was hybridized with a blocker sequence and linked onto the surface of magnetic beads (MBs). Upon the addition of ricin B-chain, blocker was released from the surface of MBs and hybridized with the dye-modified probe DNA on the surface of GO through the toehold-mediated strand exchange reaction. The formed blocker-probe DNA duplex triggered the Exo III-assisted cyclic signal amplification by repeating the hybridization and digestion of probe DNA, liberating the fluorophore with several nucleotides (low FA value). Thus, ricin B-chain could be sensitively detected by the significantly decreased FA. The linear range was from 1.0μg/mL to 13.3μg/mL and the limit of detection (LOD) was 400ng/mL. This method improved the sensitivity of FA assay and it could be generalized to any kind of target detection based on the use of an appropriate aptamer.

  10. Procalcitonin as a marker of Candida species detection by blood culture and polymerase chain reaction in septic patients

    PubMed Central

    2014-01-01

    Background The aim of our study is to test procalcitonin (PCT) as surrogate marker of identification of Candida spp. by blood culture (BC) and real-time-polymerase chain reaction (PCR), whether alone or in association with bacteria, in septic patients. Methods We performed a single-centre retrospective study. We reviewed the clinical charts of patients with a diagnosis of severe sepsis or septic shock treated at our general intensive care unit from March 2009 to March 2013. We analysed all diagnostic episodes consisting of BC, real-time PCR assay and dosage of PCT. We registered age, sex, white blood count, sequential organ failure assessment score and type of admission between medical or surgical. When inclusion criteria were met more than once, we registered the new diagnostic episode as subsequent diagnostic episode. The diagnostic performance of PCT to predict Candida spp. identification alone or in mixed infections by either BC or PCR was tested using the receiver-operative characteristic curve. Logistic regression was constructed using presence of Candida spp. as the dependent variable. Results A total of 260 diagnostic episodes met the inclusion criteria. According to BC results classification, a significantly lower value of PCT was observed in Candida spp. BSI (0.99 ng/ml, 0.86 - 1.34) than in BSI caused by bacteria (16.7 ng/ml, 7.65 - 50.2) or in mixed infections (4.76 ng/ml, 2.98 - 6.08). Similar findings were observed considering PCR results. A cut-off of ≤ 6.08 ng/ml for PCT yielded a sensitivity of 86.8%, a specificity of 87.4%, a positive predictive value of 63.9%, a negative predictive value (NPV) of 96.3% and an area under the curve of 0.93 for Candida spp. identification by BC. A similar high NPV for a cut-off ≤ 6.78 ng/ml was observed considering the classification of diagnostic episodes according to PCR results, with an AUC of 0.85. A subsequent diagnostic episode was independently associated with Candida spp. detection either by

  11. [Analysis of protein-on-DNA binding profiles, detected with chIP-seq method, reveals possible interaction of specific transcription factors with RNA polymerase II in the process of transcription elongation].

    PubMed

    Belostotskiĭ, A A

    2012-01-01

    It is thought that in the course of mRNA transcription almost all transcription factors stay on a promoter while RNA polymerase II "clears" the promoter and "proceeds" to elongation. However, analysis of some specific transcription factors and RNA polymerase II binding profiles on DNA, detected with ChIP-seq method, revealed the possibility of interaction between transcription factors and RNA polymerase II in the process of transcription elongation.

  12. A novel molecular beacon-based method for isothermal detection of sequence-specific DNA via T7 RNA polymerase-aided target regeneration.

    PubMed

    Yin, Bin-Cheng; Wu, Shan; Ma, Jin-Liang; Ye, Bang-Ce

    2015-06-15

    Developing molecular beacon (MB)-based method for DNA detection has been of great interest to many researchers because of its intrinsic advantages of simplicity, rapidity, and specificity. In this work, we have developed a novel MB-based method for isothermal detection of sequence-specific DNA via T7 RNA polymerase-aided target regeneration strategy. The proposed method involves three primary processes of target-mediated ligation by T4 DNA ligase, transcription reaction by T7 RNA polymerase, and MB switch for signal output. Upon the hybridization with DNA target, a rationally designed MB and a pair of primers encoded with T7 promoter sequence were ligated via the formation of a phosphodiester bond by T4 DNA ligase. The resultant joint fragment acted as template to initiate T7 RNA polymerase-mediated transcription reaction. Correspondingly, a great amount of RNA strands complementary to MB and partial primers were transcribed to initiate new cyclic reactions of MB switch, ligation, and transcription. With such signal amplification strategy of the regeneration of target-like RNA fragments, our proposed assay achieved a detection limit as low as ∼10 pM, which was ∼3 orders of magnitude lower than the traditional MB-based method with a recognition mechanism in 1:1 stoichiometric ratio between MB and target molecule.

  13. Optimization of PCR in application of hot start Taq DNA polymerase for detection of Erwinia amylovora with primers FER1-F and FER1-R.

    PubMed

    Obradovic, D; Kevresan, S

    2010-01-01

    There are two approaches in detection of bacterium Erwinia amylovora by PCR. One is based on detection of plasmid pEA29 and the other is based on detection of a chromosomal DNA sequence, specific for E. amylovora, in a sample. Since pathogenic strains without pEA29 have been isolated from the environment, methods based on this plasmid have been compromised and PCR methods based on chromosomal DNA species specific sequences became only reliable methods. PCR method with chromosomal primers FER1-F and FER1-R is currently the most reliable method due to its high sensitivity and specificity. The goal of this research is to make a significant improvement of the method by optimization of PCR in application of hot start DNA Taq polymerase, instead of wax, to obtain a hot start reaction. This enzyme, which is currently widely applied, can provide simpler achievement of hot start, saving labor and time and decreasing possibility of cross contamination of samples. Experiments showed that simple replacement of a regular recombinant Taq DNA polymerase by a hot start Taq DNA polymerase leads to complete failure of the reaction. Many optimization experiments had to be carried out to obtain an operational and reliable PCR which simultaneously has high sensitivity and specificity. Content of the reaction mixture, as well as temperature and time parameters of PCR, were significantly changed to achieve proper optimization.

  14. Pyrosequencing-based validation of a simple cell-suspension polymerase chain reaction assay for Campylobacter with application of high-processivity polymerase and novel internal amplification controls for rapid and specific detection.

    PubMed

    Oakley, Brian B; Line, J Eric; Berrang, Mark E; Johnson, Jessica M; Buhr, R Jeff; Cox, Nelson A; Hiett, Kelli L; Seal, Bruce S

    2012-02-01

    Although Campylobacter is an important food-borne human pathogen, there remains a lack of molecular diagnostic assays that are simple to use, cost-effective, and provide rapid results in research, clinical, or regulatory laboratories. Of the numerous Campylobacter assays that do exist, to our knowledge none has been empirically tested for specificity using high-throughput sequencing. Here we demonstrate the power of next-generation sequencing to determine the specificity of a widely cited Campylobacter-specific polymerase chain reaction (PCR) assay and describe a rapid method for direct cell suspension PCR to quickly and easily screen samples for Campylobacter. We present a specific protocol which eliminates the need for time-consuming and expensive genomic DNA extractions and, using a high-processivity polymerase, demonstrate conclusive screening of samples in <1 h. Pyrosequencing results show the assay to be extremely (>99%) sensitive, and spike-back experiments demonstrated a detection threshold of <10(2) CFU mL(-1). Additionally, we present 2 newly designed broad-range bacterial primer sets targeting the 23S rRNA gene that have wide applicability as internal amplification controls. Empirical testing of putative taxon-specific assays using high-throughput sequencing is an important validation step that is now financially feasible for research, regulatory, or clinical applications.

  15. Development of a polymerase chain reaction and capillary gel electrophoresis method for the detection of chicken or turkey meat in heat-treated pork meat mixtures.

    PubMed

    Hernández-Chávez, Juan F; González-Córdova, Aarón F; Rodríguez-Ramírez, Roberto; Vallejo-Cordoba, Belinda

    2011-12-05

    A polymerase chain reaction and capillary gel electrophoresis (PCR-CGE) method with ultraviolet (UV) or laser induced fluorescence detection (LIF) was established for the detection of chicken or turkey in heat-treated pork meat mixtures. Mitochondrial DNA samples extracted from heat treated meat were amplified with their corresponding specific primers yielding PCR products between 200 and 300 bp. LIF detection was superior than UV detection in terms of precision and sensitivity for the study of DNA fragments. The CGE-LIF method was highly reproducible and accurate for determining DNA fragment size. The PCR-CGE-LIF was sensitive since a significant fluorescent signal was obtained at the minimum admixture level employed of 1% in meat mixtures. Thus, the PCR-CGE-LIF method established was useful for the detection of chicken or turkey in heat treated meat mixtures and may prove to be useful for the detection of poultry meat in pork processed products.

  16. Electrochemical detection of arsenic(III) using iridium-implanted boron-doped diamond electrodes.

    PubMed

    Ivandini, Tribidasari A; Sato, Rika; Makide, Yoshihiro; Fujishima, Akira; Einaga, Yasuaki

    2006-09-15

    Iridium-modified, boron-doped diamond electrodes fabricated by an ion implantation method have been developed for electrochemical detection of arsenite (As(III)). Ir+ ions were implanted with an energy of 800 keV and a dose of 10(15) ion cm(-2). An annealing treatment at 850 degrees C for 45 min in H2 plasma (80 Torr) was required to rearrange metastable diamond produced by an implantation process. Characterization was investigated by SEM, AFM, Raman, and X-ray photoelectron spectroscopy. Cyclic voltammetry and flow injection analysis with amperometric detection were used to study the electrochemical reaction. The electrodes exhibited high catalytic activity toward As(III) oxidation with the detection limit (S/N = 3), sensitivity, and linearity of 20 nM (1.5 ppb), 93 nA microM(-1) cm(-2), and 0.999, respectively. The precision for 10 replicate determinations of 50 microM As(III) was 4.56% relative standard deviation. The advantageous properties of the electrodes were its inherent stability with a very low background current. The electrode was applicable for analysis of spiked arsenic in tap water containing a significant amount of various ion elements. The results indicate that the metal-implanted method could be promising for controlling the electrochemical properties of diamond electrodes.

  17. Comparison of polymerase chain reaction and Warthin-Starry techniques to detect Leptospira spp. in kidneys of slaughtered cattle.

    PubMed

    Azizi, Shahrzad; Kheirandish, Reza; Rahimi, Elham

    2014-11-12

    Leptospirosis is a worldwide zoonotic disease that is caused by Gram-negative spirochaetes, Leptospira species. Affected animals excrete the organism in the urine into the environment and act as a source of infection. Cattle are maintenance hosts for some serovars of leptospirosis and are important in the transmission of the infection to humans. At post mortem examination, affected cattle show white spots in their kidneys but these are not specific for leptospirosis. Sometimes it is necessary that leptospirosis be diagnosed in the carcass. Different direct methods, including polymerase chain reaction (PCR), Warthin-Starry silver stain (WS), immunofluorescence (IF) and immunohistochemistry (IHC) can be used in order to diagnose leptospirosis in the affected tissues, such as kidney. The main advantage of the WS technique is direct visualisation of the bacteria in the tissue samples. Silver staining is useful for retrospective studies on formalin-fixed and paraffin-embedded samples but little information is available on the sensitivity and specificity of the technique. The present study aimed to find a simple and inexpensive method that can be used in any laboratory and that also, if clinical samples are not available, can detect Leptospira in tissue samples post mortem. This study was performed on 19 paraffin-embedded kidneys of slaughtered cows that grossly had focal to multifocal white spots. Leptospirosis was confirmed in these samples with PCR based on the LipL32 gene. Out of 19 PCR positive kidneys, Leptospira was identified in 13 stained samples by WS. The kidneys revealed different grades of interstitial nephritis. No relationship was found between severity of lesions and presence of leptospires in the kidneys. The PCR results on the urine and blood were consistent with matching WS stained kidneys. Out of 13 kidneys that were positive with silver staining, 7 matching blood and 10 matching urine samples were confirmed positive for leptospirosis with PCR. In

  18. Polymerase Chain Reaction (PCR)-based methods for detection and identification of mycotoxigenic Penicillium species using conserved genes

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Polymerase chain reaction amplification of conserved genes and sequence analysis provides a very powerful tool for the identification of toxigenic as well as non-toxigenic Penicillium species. Sequences are obtained by amplification of the gene fragment, sequencing via capillary electrophoresis of d...

  19. [The validation of kit of reagents for quantitative detection of DNA of human cytomegalovirus in biological material using polymerase chain reaction technique in real time operation mode].

    PubMed

    Sil'veĭstrova, O Iu; Domonova, É A; Shipulina, O Iu

    2014-04-01

    The validation of kit of reagents destined to detection and quantitative evaluation of DNA of human cytomegalovirus in biological material using polymerase chain reaction technique in real time operation mode was implemented. The comparison was made against international WHO standard--The first WHO international standard for human cytomegalovirus to implement measures the kit of reagents "AmpliSens CMV-screen/monitor-FL" and standard sample of enterprise DNA HCMV (The central research institute of epidemiology of Rospotrebnadzor) was applied. The fivefold dilution of international WHO standard and standard sample of enterprise were carried out in concentrations of DNA HCMV from 106 to 102. The arrangement of polymerase chain reaction and analysis of results were implemented using programed amplifier with system of detection of fluorescent signal in real-time mode "Rotor-Gene Q" ("Qiagen", Germany). In the total of three series of experiments, all stages of polymerase chain reaction study included, the coefficient of translation of quantitative evaluation of DNA HCMV from copy/ml to ME/ml equal to 0.6 was introduced for this kit of reagents.

  20. Detection and differentiation of wild-type and vaccine strains of canine distemper virus by a duplex reverse transcription polymerase chain reaction

    PubMed Central

    Dong, X. Y.; Li, W. H.; Zhu, J. L.; Liu, W. J.; Zhao, M. Q.; Luo, Y. W.; Chen, J. D.

    2015-01-01

    Canine distemper virus (CDV) is the cause of canine distemper (CD) which is a severe and highly contagious disease in dogs. In the present study, a duplex reverse transcription polymerase chain reaction (RT-PCR) method was developed for the detection and differentiation of wild-type and vaccine strains of CDV. Four primers were designed to detect and discriminate the two viruses by generating 638- and 781-bp cDNA products, respectively. Furthermore, the duplex RT-PCR method was used to detect 67 field samples suspected of CD from Guangdong province in China. Results showed that, 33 samples were to be wild-type-like. The duplex RT-PCR method exhibited high specificity and sensitivity which could be used to effectively detect and differentiate wild-type and vaccine CDV, indicating its use for clinical detection and epidemiological surveillance. PMID:27175171

  1. Stimulation of mitotic recombination upon transcription from the yeast GAL1 promoter but not from other RNA polymerase I, II and III promoters.

    PubMed

    Bratty, J; Ferbeyre, G; Molinaro, C; Cedergren, R

    1996-11-01

    Homologous recombination in Saccharomyces cerevisiae and other organisms can be stimulated by transcription. Consistent with this, we find that recombination of a chromosomal ade1 allele with a plasmid-borne ADE1 ORF under the control of the GAL1 promoter increased from 6.1x10(-6) to 1.7x10(-4) when transcription of the plasmid locus was induced by growing the cells in the presence of galactose. Recombination could also be stimulated by over-expressing the Gal4 transcription factor in the presence of the GAL1-ADE1 plasmid, while culturing the cells in dextrose medium. However, when transcription of the same ORF was driven from the highly active promoters of the rDNA (RNA polymerase I), and ADH1 (RNA polymerase II) genes, only background levels of recombination (5-10x10(-6)) were observed, irrespective of the carbon source. Recombination was found to involve integration of the whole plasmid and to depend on RAD51, RAD52 and RAD54. The results indicate that increased accessibility of transcriptionally active chromatin is not sufficient to cause increased rates of this kind of reciprocal exchange.

  2. Immunochemical method for detection of antibody against HTLV-III core protein based upon recombinant HTLV-III gag gene encoded protein

    SciTech Connect

    Chang, N.T.; Ghrayeb, J.

    1989-02-28

    A method is described of detecting antibody against HTLV-III core protein in a biological fluid, comprising the steps of: a. providing an antigen immunoadsorbent comprising a solid phase to which is attached a HTLV-III core antigen which is a chimeric antigen comprising an amino acid sequence beginning at amino acid number 1 through 99, and extending to amino acid number 228, the chimeric antigen being immunoreactive with antibody against HTLV-III core protein; b. incubating the immunoadsorbent with a sample of the biological fluid to be tested under conditions which allow antibody in the sample to complex with the antigen immunoadsorbent; c. separating the immmunoadsorbent from the sample; and d. determining antibody bound to the iuumoadsorbent as an indication of antibody against HTLV-III core protein in the sample.

  3. Polymerase chain reaction system

    DOEpatents

    Benett, William J.; Richards, James B.; Stratton, Paul L.; Hadley, Dean R.; Milanovich, Fred P.; Belgrader, Phil; Meyer, Peter L.

    2004-03-02

    A portable polymerase chain reaction DNA amplification and detection system includes one or more chamber modules. Each module supports a duplex assay of a biological sample. Each module has two parallel interrogation ports with a linear optical system. The system is capable of being handheld.

  4. The polymerase chain reaction.

    PubMed

    Welch, Hazel M

    2012-01-01

    The polymerase chain reaction (PCR) has had a significant impact on all aspects of the molecular biosciences, from cancer research to forensic science. The sensitivity and specificity inherent in the technique allow minute quantities of genetic material to be detected while the unique properties of thermostable DNA polymerase ensure that abundant copies are reliably reproduced to levels that can be visualized and/or used for further applications. This chapter describes applications of PCR and PCR-RT to investigate primary cancer and metastatic disease at both the DNA and mRNA expression levels.

  5. Archaeal TFEα/β is a hybrid of TFIIE and the RNA polymerase III subcomplex hRPC62/39

    PubMed Central

    Blombach, Fabian; Salvadori, Enrico; Fouqueau, Thomas; Yan, Jun; Reimann, Julia; Sheppard, Carol; Smollett, Katherine L; Albers, Sonja V; Kay, Christopher WM; Thalassinos, Konstantinos; Werner, Finn

    2015-01-01

    Transcription initiation of archaeal RNA polymerase (RNAP) and eukaryotic RNAPII is assisted by conserved basal transcription factors. The eukaryotic transcription factor TFIIE consists of α and β subunits. Here we have identified and characterised the function of the TFIIEβ homologue in archaea that on the primary sequence level is related to the RNAPIII subunit hRPC39. Both archaeal TFEβ and hRPC39 harbour a cubane 4Fe-4S cluster, which is crucial for heterodimerization of TFEα/β and its engagement with the RNAP clamp. TFEα/β stabilises the preinitiation complex, enhances DNA melting, and stimulates abortive and productive transcription. These activities are strictly dependent on the β subunit and the promoter sequence. Our results suggest that archaeal TFEα/β is likely to represent the evolutionary ancestor of TFIIE-like factors in extant eukaryotes. DOI: http://dx.doi.org/10.7554/eLife.08378.001 PMID:26067235

  6. Elimination of contaminating DNA within polymerase chain reaction reagents: implications for a general approach to detection of uncultured pathogens.

    PubMed Central

    Meier, A; Persing, D H; Finken, M; Böttger, E C

    1993-01-01

    Analysis based on comparisons of 16S rRNA sequences provides a rapid and reliable approach to identifying human pathogens. By directing oligonucleotide primers at sequences conserved throughout the eubacterial kingdom, bacterial 16S ribosomal DNA sequences of virtually any member of the eubacterial kingdom can be amplified by polymerase chain reaction and subsequently analyzed by sequence determination. Indeed, automated systems for broad-range amplification, sequencing, and data analysis are now feasible and may form the basis of the next generation of automated microbial identification systems. However, identification of pathogens by this strategy is hampered by the frequent contamination of reagents used for the amplification reaction, in particular Taq polymerase, with exogenous bacterial DNA. Here, we describe detailed investigations on the use of 8-methoxypsoralen and long-wave UV light to eliminate contaminating DNA in polymerase chain reaction reagents. The clinical utility of the developed procedure was demonstrated in a case of paucibacillary osteomyelitis, for which no specific bacterial agent had been cultured. Images PMID:8458958

  7. Giardia and Cryptosporidium spp. dissemination during wastewater treatment and comparative detection via immunofluorescence assay (IFA), nested polymerase chain reaction (nested PCR) and loop mediated isothermal amplification (LAMP).

    PubMed

    Gallas-Lindemann, Carmen; Sotiriadou, Isaia; Plutzer, Judit; Noack, Michael J; Mahmoudi, Mohammad Reza; Karanis, Panagiotis

    2016-06-01

    Environmental water samples from the Lower Rhine area in Germany were investigated via immunofluorescence assays (IFAs), nested polymerase chain reaction (nested PCR) and loop-mediated isothermal amplification (LAMP) to detect the presence of Giardia spp. (n=185) and Cryptosporidium spp. (n=227). The samples were concentrated through filtration or flocculation, and oocysts were purified via centrifugation through a sucrose density gradient. For all samples, IFA was performed first, followed by DNA extraction for the nested PCR and LAMP assays. Giardia cysts were detected in 105 samples (56.8%) by IFA, 62 samples (33.5%) by nested PCR and 79 samples (42.7%) by LAMP. Cryptosporidium spp. were detected in 69 samples (30.4%) by IFA, 95 samples (41.9%) by nested PCR and 99 samples (43.6%) by LAMP. According to these results, the three detection methods are complementary for monitoring Giardia and Cryptosporidium in environmental waters.

  8. [The reagents kit to detect Metyorchis biis, Opisthorchis viverrini and Clonorchis sinensis, Opisthorchis felineus--agents of opisthorchiasis using technique of polymerase chain reaction in real-time].

    PubMed

    Seredina, T A; Petrenko, V A; Tronin, A V; Sazonov, A Iu; Sapugol'tseva, O B; Katokhin, A V; Odintsova, E S

    2014-08-01

    The helminths Opisthorchis felineus, Opisthorchis viverrini, Clonorchis sinensis, Metorchis bilis are the agents of opisthorchiasis. The actual diagnostic of parasitic diseases based on microscope analysis of samples of human feces to detect presence of ova of parasites suffers of many shortcomings, in particular low sensitivity especially at earlier stages. The purpose of this study was to compare results of detection of parasites using both classical technique and technique of specific differentiation based on extraction of nucleic acids from samples of human feces and implementation of reaction of amplification of the chosen fragment of DNA with detection of products of polymerase chain reaction in the real time. The study detected 150 out of 165 positive samples and also 6 out of 37 negative samples both validated by coproovoscopy.

  9. Rapid detection of highly pathogenic porcine reproductive and respiratory syndrome virus by a fluorescent probe-based isothermal recombinase polymerase amplification assay.

    PubMed

    Yang, Yang; Qin, Xiaodong; Sun, Yingjun; Chen, Ting; Zhang, Zhidong

    2016-12-01

    A novel fluorescent probe-based real-time reverse transcription recombinase polymerase amplification (real-time RT-RPA) assay was developed for rapid detection of highly pathogenic type 2 porcine reproductive and respiratory syndrome virus (HP-PRRSV). The sensitivity analysis showed that the detection limit of RPA was 70 copies of HP-PRRSV RNA/reaction. The real-time RT-RPA highly specific amplified HP-PRRSV with no cross-reaction with classic PRRSV, classic swine fever virus, pseudorabies virus, and foot-and-mouth disease virus. Assessment with 125 clinical samples showed that the developed real-time RT-RPA assay was well correlated with real-time RT-qPCR assays for detection of HP-PRRSV. These results suggest that the developed real-time RT-RPA assay is suitable for rapid detection of HP-PRRSV.

  10. The DnaE polymerase from Deinococcus radiodurans features RecA-dependent DNA polymerase activity

    PubMed Central

    Randi, Lorenzo; Perrone, Alessandro; Maturi, Mirko; Dal Piaz, Fabrizio; Camerani, Michela; Hochkoeppler, Alejandro

    2016-01-01

    We report in the present study on the catalytic properties of the Deinococcus radiodurans DNA polymerase III α subunit (αDr). The αDr enzyme was overexpressed in Escherichia coli, both in soluble form and as inclusion bodies. When purified from soluble protein extracts, αDr was found to be tightly associated with E. coli RNA polymerase, from which αDr could not be dissociated. On the contrary, when refolded from inclusion bodies, αDr was devoid of E. coli RNA polymerase and was purified to homogeneity. When assayed with different DNA substrates, αDr featured slower DNA extension rates when compared with the corresponding enzyme from E. coli (E. coli DNA Pol III, αEc), unless under high ionic strength conditions or in the presence of manganese. Further assays were performed using a ssDNA and a dsDNA, whose recombination yields a DNA substrate. Surprisingly, αDr was found to be incapable of recombination-dependent DNA polymerase activity, whereas αEc was competent in this action. However, in the presence of the RecA recombinase, αDr was able to efficiently extend the DNA substrate produced by recombination. Upon comparing the rates of RecA-dependent and RecA-independent DNA polymerase activities, we detected a significant activation of αDr by the recombinase. Conversely, the activity of αEc was found maximal under non-recombination conditions. Overall, our observations indicate a sharp contrast between the catalytic actions of αDr and αEc, with αDr more performing under recombination conditions, and αEc preferring DNA substrates whose extension does not require recombination events. PMID:27789781

  11. Recombinase polymerase amplification (RPA) combined with lateral flow (LF) strip for equipment-free detection of Cryptosporidium spp. oocysts in dairy cattle feces.

    PubMed

    Wu, Yao-Dong; Zhou, Dong-Hui; Zhang, Long-Xian; Zheng, Wen-Bin; Ma, Jian-Gang; Wang, Meng; Zhu, Xing-Quan; Xu, Min-Jun

    2016-09-01

    Cryptosporidium is a widespread protozoan parasite that infects a large number of vertebrate animals, resulting in varying degrees of diarrhea or even death. As dairy cattle feces is an important source of Cryptosporidium spp. infection, development of a handy and accurate detection method via its oocysts in dairy cattle feces would be interesting and necessary. We herein developed a quick detecting method using recombinase polymerase amplification (RPA) combined with lateral flow (LF) strip to detect DNA of Cryptosporidium oocysts in dairy cattle feces. The DNA was released by boiled water with 0.1 % N-lauroylsarcosine sodium salt (LSS). The established method was proven to be of higher sensitivity than normal polymerase chain reaction (PCR) amplification with the lowest detection of 0.5 oocyst per reaction, and specificity with no cross reactivity to other common protozoan species in the intestine of dairy cattle. The diagnostic method established herein is simple, rapid, and cost-effective, and has potential for further development as a diagnostic kit for the diagnosis of cryptosporidiosis of dairy cattle.

  12. Multiplex real-time PCR SYBR Green for detection and typing of group III Clostridium botulinum.

    PubMed

    Anniballi, Fabrizio; Auricchio, Bruna; Delibato, Elisabetta; Antonacci, Monia; De Medici, Dario; Fenicia, Lucia

    2012-01-27

    Clostridium botulinum type C and type D belonging to the group III organisms, are mainly responsible for animal botulism outbreaks. Clinical signs alone are often insufficient to make a diagnosis of botulism and a laboratory confirmation is required. Laboratory confirmation can be performed by demonstrating the presence of botulinum neurotoxins in serum, gastrointestinal contents, liver, wound of sick or dead animals, or by demonstrating the presence of C. botulinum in gastrointestinal contents, liver, and wound. Demonstration of spores in gastrointestinal contents or tissue of animals with clinical signs indicative of botulism reinforces the clinical diagnosis. With the aim of detecting and typing C. botulinum group III organisms, a multiplex real-time PCR SYBR Green was developed and in-house validated. Selectivity, limit of detection, relative accuracy, relative specificity, relative sensitivity, and repeatability of the method were investigated. The multiplex real-time PCR SYBR green used showed a 100% selectivity, 100% relative accuracy, 100% relative specificity, 100% relative sensitivity and a limit of detection of 277 and 580 DNA copies for C. botulinum type C and C. botulinum type D, respectively. The method reported here represents a suitable tool for laboratory diagnosis of type C and D botulism and for testing a large number of samples collected during the animal botulism surveillance and prevention activities.

  13. Sensitivity of polymerase chain reaction for detection of bovine viral diarrhea virus in pooled serum samples and use of pooled polymerase chain reaction to determine prevalence of bovine viral diarrhea virus in auction market cattle.

    PubMed

    Smith, Rebecca L; Sanderson, Michael W; Walz, Paul H; Givens, M Daniel

    2008-01-01

    Two reverse transcription-nested polymerase chain reaction tests, 1 quantitative (qRT-nPCR) and 1 standard (RT-nPCR), were evaluated to assess sensitivity for detection of bovine viral diarrhea virus (BVDV) of a single positive serum sample in a pool of 30. The RT-nPCR and qRT-nPCR each detected 95 of 100 known positives. The RT-nPCR was used to estimate the prevalence of BVDV in adult beef cows. Serum samples were obtained from the US Department of Agriculture brucellosis testing laboratories in 3 Midwestern states. Samples originated from auction markets and private treaty sales throughout the 3 states. A total of 2,990 serum samples were collected and randomly pooled into 100 pools for testing. Two of the 100 pools of field samples were positive, and each positive pool had a single positive individual sample upon confirmation. The estimate of BVDV prevalence in adult cows in this study was 0.07%. This study estimates the diagnostic sensitivity of RT-nPCR for BVDV and confirms that it is a useful diagnostic tool for pools of 30 serum samples and that prevalence of BVDV in adult cattle from auction markets is low.

  14. [The detection of minimal residual disease in patients with chronic B-cell lymphatic leukemia using patient-specified polymerase chain reaction].

    PubMed

    Sidorova, Iu V; Sorokina, T V; Biderman, B V; Nikulina, E E; Kisilichina, D G; Naumova, E V; Pochtar', M E; Lugovskaia, S A; Ivanova, V L; Kovaleva, L G; Ptushkin, V V; Nikitin, E A; Sudarikov, A B

    2011-12-01

    The new effective protocols of treatment of chronic B-cell lymphatic leukemia, including purine analogs and monoclonal antibodies, provide robust remissions under this disease. Accordingly, the requirements to remission quality assessment are changed too. In particular the assessment of minimal residual disease is obligatory. To assess minimal residual disease in terms of quantity in case of chronic B-cell lymphatic leukemia the technique of polymerase chain reaction was applied in real time with patient-specific primers from the area of V-D-J combinations of genes of heavy chain of immunoglobulin. The study included samples from 60 patients suffering of chronic B-cell lymphatic leukemia. In 15 of them (25%), it was impossible to apply neither the sequence analysis of genes of heavy chain of immunoglobulin nor the fitting of patient-specific primer. The results of quantitative determination of minimal residual disease were obtained in 45 patients (55 tests). The minimal residual disease was detected in 30 of 55 samples (54.5%) and was not detected in 25 of 55 samples (45.5%). At the same time, the quantitative determination of minimal residual disease was implemented in regard to the initial level of neoplastic cells. The method sensitivity qualified by serial dilutions, consisted 10(-5) or 1 neoplastic cell to 100 000 normal cells. The comparative analysis was applied to the results of determination of minimal residual disease using two methods -polymerase chain reaction in real time using patient-specified primers and four-color flow cytofluometry. The determination of minimal residual disease with both methods was implemented in 37 patients (45 tests). The results of both methods matched in 93.3% (42 tests out of 45) with maximal disparity of one degree. Then Spearman factor consisted 0.87 (p < 0.0001). In 3 out of 45 tests (6.7%) neoplastic cells were detected with only one method. In the first case, it was the method of four-color flow cytofluometry and in

  15. Allele-specific polymerase chain reaction for detection of a mutation in the relax circular DNA and the covalently closed circular DNA of hepatitis B virus.

    PubMed

    Pan, Wan-Long; Hu, Jie-Li; Fang, Yan; Luo, Qiang; Xu, Ge; Xu, Lei; Jing, Zhou-Hong; Shan, Xue-Feng; Zhu, Yan-Ling; Huang, Ai-Long

    2013-12-01

    The relax circle DNA (rcDNA) sequence and the covalently closed circle DNA (cccDNA) sequence in hepatitis B virus (HBV) are crucial regions for HBV infections. To analyze mutations in rcDNA and cccDNA, DNA sequencing is often used, although it is time-consuming and expensive. Herein, we report a simple, economic, albeit accurate allele-specific polymerase chain reaction (AS-PCR) to detect mutations in these regions of HBV. This method can be extensively used to screen for mutations at specific positions of HBV genome.

  16. Temporal ChIP-on-Chip of RNA-Polymerase-II to detect novel gene activation events during photoreceptor maturation

    PubMed Central

    Tummala, Padmaja; Mali, Raghuveer S.; Guzman, Eduardo; Zhang, Xiao

    2010-01-01

    Purpose During retinal development, post-mitotic neural progenitor cells must activate thousands of genes to complete synaptogenesis and terminal maturation. While many of these genes are known, others remain beyond the sensitivity of expression microarray analysis. Some of these elusive gene activation events can be detected by mapping changes in RNA polymerase-II (Pol-II) association around transcription start sites. Methods High-resolution (35 bp) chromatin immunoprecipitation (ChIP)-on-chip was used to map changes in Pol-II binding surrounding 26,000 gene transcription start sites during photoreceptor maturation of the mouse neural retina, comparing postnatal age 25 (P25) to P2. Coverage was 10–12 kb per transcription start site, including 2.5 kb downstream. Pol-II-active regions were mapped to the mouse genomic DNA sequence by using computational methods (Tiling Analysis Software-TAS program), and the ratio of maximum Pol-II binding (P25/P2) was calculated for each gene. A validation set of 36 genes (3%), representing a full range of Pol-II signal ratios (P25/P2), were examined with quantitative ChIP assays for transcriptionally active Pol-II. Gene expression assays were also performed for 19 genes of the validation set, again on independent samples. FLT-3 Interacting Zinc-finger-1 (FIZ1), a zinc-finger protein that associates with active promoter complexes of photoreceptor-specific genes, provided an additional ChIP marker to highlight genes activated in the mature neural retina. To demonstrate the use of ChIP-on-chip predictions to find novel gene activation events, four additional genes were selected for quantitative PCR analysis (qRT–PCR analysis); these four genes have human homologs located in unidentified retinal disease regions: Solute carrier family 25 member 33 (Slc25a33), Lysophosphatidylcholine acyltransferase 1 (Lpcat1), Coiled-coil domain-containing 126 (Ccdc126), and ADP-ribosylation factor-like 4D (Arl4d). Results ChIP-on-chip Pol-II peak

  17. [Universal or broad-range polymerase chain reaction (PCR): a contribution to the detection and identification of bacteria and fungi in clinical practice].

    PubMed

    Poggi M, Helena; Guzmán D, Ana María; García C, Patricia; Lagos L, Marcela

    2009-08-01

    The use of techniques for the detection of nucleic acids such as the polymerase chain reaction (PCR) has had a major impact on microbiological analysis, playing an important role in the clinical laboratory. Most of the techniques currently used are designed for specific detection of a particular microorganism. However, infectious agents can also be identified even if genus or species are unknown, using universal primers to amplify bacterial or fungal DNA and then identify the species by sequence (universal or wide spectrum PCR). This methodology is applied in cultures that are difficult to identify using phenotypic techniques, and more recently it is also being used directly in clinical samples, where the detection and identification of the infectious agent by traditional techniques is difficult or not possible.

  18. Development of multiplex real-time polymerase chain reaction for detection of Entamoeba histolytica, Entamoeba dispar, and Entamoeba moshkovskii in clinical specimens.

    PubMed

    Hamzah, Zulhainan; Petmitr, Songsak; Mungthin, Mathirut; Leelayoova, Saovanee; Chavalitshewinkoon-Petmitr, Porntip

    2010-10-01

    Multiplex real-time polymerase chain reaction (PCR) was developed for differential detection of Entamoeba histolytica, Entamoeba dispar, and Entamoeba moshkovskii. Specific primers were designed for all three species, and then differentiation of E. histolytica and E. dispar was achieved simultaneously using a hybridization probe and melting curve analysis, whereas E. moshkovskii was detected with a separate probe under the same condition. This assay detected as little as 0.2 pg of E. histolytica DNA and 2 pg each for E. dispar and E. moshkovskii DNA. Thirty-five clinical samples suspected to be E. histolytica infection by microscopy were tested. The results showed 32 positive samples; four samples were E. histolytica and 28 samples were E. dispar. Interestingly, one E. dispar positive sample showed a mixed infection with E. moshkovskii. This is the first report of E. moshkovskii infection from Thailand and this assay is currently the most rapid and sensitive method to differentiate these human amoebas.

  19. A new high-speed droplet-real-time polymerase chain reaction method can detect bovine respiratory syncytial virus in less than 10 min.

    PubMed

    Uehara, Masayuki; Matsuda, Kazuyuki; Sugano, Mitsutoshi; Honda, Takayuki

    2014-03-01

    The polymerase chain reaction (PCR) has been widely used for diagnosis of infectious diseases of domestic animals. Rapid detection of respiratory pathogens of cattle is useful for making therapeutic decisions. Therefore, we developed a new genetic-based method called droplet-real-time PCR, which can detect bovine respiratory syncytial virus (BRSV) within 10 min. Our droplet-real-time PCR markedly reduced the reaction time of reverse transcription-PCR while maintaining the same sensitivity as conventional real-time PCR, and it can be used as a rapid assay for detection of BRSV. Furthermore, our method is potentially applicable for rapid diagnosis of almost all infectious diseases, including highly pathogenic avian influenza virus.

  20. Single step detection of HIV-1 proviral DNA and housekeeping β-actin gene from dried blood spots by a monoplex polymerase chain reaction.

    PubMed

    Choudhary, Ipsita; Chimanpure, Vaishali; Patil, Ajit; Mukhopadhyaya, Robin; Paranjape, Ramesh; Bhattacharya, Jayanta

    2013-01-01

    There is a growing need for developing a simple, rapid, reliable and cost effective method for detection of HIV-1 for early diagnosis of the infection especially in developing countries and in resource limited settings. A method for simultaneous detection of the HIV-1 p17 gene and the house keeping human β-actin gene from dried blood spots (DBS) by a monoplex polymerase chain reaction (PCR) is described. Genomic DNA was extracted from 40 HIV-1 positive and 40 HIV-1 negative DBS and used as templates to amplify both the HIV-1 p17 and β-actin genes simultaneously under the same cycling condition by a single round PCR. This method of detection of HIV-1 may provide a simple, rapid and cost effective alternative in resource limited settings; however, it would require testing a larger number of samples before widespread use.

  1. Detection of cariogenic bacteria genes by a combination of allele-specific polymerase chain reactions and a novel bioluminescent pyrophosphate assay.

    PubMed

    Arakawa, Hidetoshi; Karasawa, Koji; Igarashi, Takeshi; Suzuki, Shigeya; Goto, Nobuichi; Maeda, Masako

    2004-10-15

    We developed a novel bioluminescent assay for detection of pyrophosphate in polymerase chain reaction (PCR) product. The principle of this method is as follows: pyrophosphate released by PCR is converted to adenosine 5'-triphosphate (ATP) by pyruvate phosphate dikinase in the presence of the substrate pyruvate phosphate and the coenzyme adenosine 5'-monophosphate; subsequently, ATP concentration is determined by firefly luciferase reaction. The detection limit of pyrophosphate is 1.56 x 10(-15)mol/assay. Additionally, luminescent intensity reached a maximum at approximately 100 s and remained elevated beyond 10 min. This approach is applicable to the detection of cariogenic bacteria in dental plaque. Thus, the allele-specific PCR products of Streptococcus mutans and Streptococcus sobrinus developed in this study were measured via the proposed bioluminescent assay. This protocol, which does not require expensive equipment, can be utilized to rapidly monitor cariogenic bacteria in dental plaque.

  2. Detection and identification of vegetative insecticidal proteins vip3 genes of Bacillus thuringiensis strains using polymerase chain reaction-high resolution melt analysis.

    PubMed

    Li, Haitao; Shu, Changlong; He, Xiaoming; Gao, JiGuo; Liu, Rongmei; Huang, Dafang

    2012-05-01

    In this study, vegetative insecticidal proteins vip3 genes from Bacillus thuringiensis strains were detected based on polymerase chain reaction-high resolution melt (PCR-HRM) analysis. A pair of primers was designed according to the conservative sequences in 150 bp region of the known vip3 subfamily. The 150 bp regions of difference vip3 genes have only a few nucleotide difference vip3 genes were detected in 8 of 11 standard B. thuringiensis strains, and vip3Aa genes, vip3Af genes and vip3Ba gene can be distinguished as different melting curves by this method. The results demonstrate the utility of the HRM assay for mutant screening using vip3 gene. The PCR-HRM method may be a valuable and reliable tool for specific detection and identification of vip3 genes.

  3. Development of a multiplex real-time polymerase chain reaction for the detection of influenza virus type A including H5 and H9 subtypes.

    PubMed

    Li, Pei-Qiong; Zhang, Jun; Muller, Claude P; Chen, Jing-Xian; Yang, Zi-Feng; Zhang, Ren; Li, Juan; He, Yun-Shao

    2008-06-01

    Avian influenza viruses (AIVs) are endemic in wild birds and, if transmitted to poultry, can cause serious economic losses. The aim of this study was to develop a multiplex real-time reverse transcriptase polymerase chain reaction (RT-PCR) for rapid detection of influenza virus type A, including H5 and H9 subtypes. The selected primers and various labeled TaqMan reporter probes corresponding to matrix, H5, and H9 genes were used in a multiplex real-time RT-PCR to simultaneously detect triple fluorescent signals. The results showed that the multiplex real-time RT-PCR assay can be applied to detect RNA of influenza virus type A including H5 and H9 subtypes with a high specificity and a sensitivity of 10 copies per reaction. As a result of its short turnaround times and a high specificity and sensitivity, the assay is very suitable for large-scale screening during AIV outbreaks.

  4. Rapid detection of highly pathogenic avian influenza H5N1 virus by TaqMan reverse transcriptase-polymerase chain reaction.

    PubMed

    Heine, H G; Trinidad, L; Selleck, P; Lowther, S

    2007-03-01

    Highly pathogenic avian influenza (AI) H5N1 viruses have been spreading from Asia since late 2003. Early detection and classification are paramount for control of the disease because these viruses are lethal to birds and have caused fatalities in humans. Here, we described TaqMan reverse transcriptase-polymerase chain reaction assays for rapid detection of all AI viruses (influenza type A) and for identification of H5N1 of the Eurasian lineage. The assays were sensitive and quantitative over a 10(5)-10(6) linear range, detected all of the tested AI viruses, and enabled differentiation between H5 and H7 subtypes. These tests allow definitive confirmation of an AI virus as H5 within hours, which is crucial for rapid implementation of control measures in the event of an outbreak.

  5. Development of a TaqMan Probe-Based Insulated Isothermal Polymerase Chain Reaction (iiPCR) Assay for Detection of Fusarium oxysporum f. sp. cubense Race 4

    PubMed Central

    Lin, Yi-Jia; Chang, Tsai-De; Hong, Li-Ling; Chen, Tzu-Yu; Chang, Pi-Fang Linda

    2016-01-01

    This study developed a novel and inexpensive detection method based on a TaqMan probe-based insulated isothermal polymerase chain reaction (iiPCR) method for the rapid detection of Panama disease caused by Fusarium oxysporum f. sp. cubense (Foc) race 4, which is currently among the most serious fungal vascular diseases worldwide. By using the portable POCKIT™ device with the novel primer set iiFoc-1/iiFoc-2, the Foc race 4 iiPCR assay (including DNA amplification and signal monitoring) could be completed within one hour. The developed Foc race 4 iiPCR assay is thus a user-friendly and efficient platform designed specifically for the detection of Foc race 4. The detection limit of this optimized Foc iiPCR system was estimated to be 1 copy of the target standard DNA as well as 1 fg of the Foc genomic DNA. This approach can serve as a rapid detection method for in planta detection of Foc race 4 in field-infected banana. It was concluded that this molecular detection procedure based on iiPCR has good potential for use as an efficient detection method. PMID:27448242

  6. Recombinase Polymerase Amplification (RPA) of CaMV-35S Promoter and nos Terminator for Rapid Detection of Genetically Modified Crops

    PubMed Central

    Xu, Chao; Li, Liang; Jin, Wujun; Wan, Yusong

    2014-01-01

    Recombinase polymerase amplification (RPA) is a novel isothermal DNA amplification and detection technology that enables the amplification of DNA within 30 min at a constant temperature of 37–42 °C by simulating in vivo DNA recombination. In this study, based on the regulatory sequence of the cauliflower mosaic virus 35S (CaMV-35S) promoter and the Agrobacterium tumefaciens nopaline synthase gene (nos) terminator, which are widely incorporated in genetically modified (GM) crops, we designed two sets of RPA primers and established a real-time RPA detection method for GM crop screening and detection. This method could reliably detect as few as 100 copies of the target molecule in a sample within 15–25 min. Furthermore, the real-time RPA detection method was successfully used to amplify and detect DNA from samples of four major GM crops (maize, rice, cotton, and soybean). With this novel amplification method, the test time was significantly shortened and the reaction process was simplified; thus, this method represents an effective approach to the rapid detection of GM crops. PMID:25310647

  7. Recombinase polymerase amplification (RPA) of CaMV-35S promoter and nos terminator for rapid detection of genetically modified crops.

    PubMed

    Xu, Chao; Li, Liang; Jin, Wujun; Wan, Yusong

    2014-10-10

    Recombinase polymerase amplification (RPA) is a novel isothermal DNA amplification and detection technology that enables the amplification of DNA within 30 min at a constant temperature of 37-42 °C by simulating in vivo DNA recombination. In this study, based on the regulatory sequence of the cauliflower mosaic virus 35S (CaMV-35S) promoter and the Agrobacterium tumefaciens nopaline synthase gene (nos) terminator, which are widely incorporated in genetically modified (GM) crops, we designed two sets of RPA primers and established a real-time RPA detection method for GM crop screening and detection. This method could reliably detect as few as 100 copies of the target molecule in a sample within 15-25 min. Furthermore, the real-time RPA detection method was successfully used to amplify and detect DNA from samples of four major GM crops (maize, rice, cotton, and soybean). With this novel amplification method, the test time was significantly shortened and the reaction process was simplified; thus, this method represents an effective approach to the rapid detection of GM crops.

  8. High throughput detection of bluetongue virus by a new real-time fluorogenic reverse transcription-polymerase chain reaction: application on clinical samples from current Mediterranean outbreaks.

    PubMed

    Jiménez-Clavero, Miguel Angel; Agüero, Montserrat; San Miguel, Elena; Mayoral, Tomás; López, Maria Cruz; Ruano, María José; Romero, Esther; Monaco, Federica; Polci, Andrea; Savini, Giovanni; Gómez-Tejedor, Concepción

    2006-01-01

    A real-time reverse transcription-polymerase chain reaction (RT-PCR) assay was developed for the detection of bluetongue virus (BTV) in blood samples. A combination of primers specific for a highly conserved region in RNA segment 5 (based on Mediterranean BTV sequences) and a DNA probe bound to 5'-Taq nuclease-3' minor groove binder (TaqMan MGB) was used to detect a range of isolates. This real-time RT-PCR assay could detect 5.4 x 10(-3) tissue culture infectious doses (TCID50) of virus per milliliter of sample, which was comparable to our current BTV diagnostic nested RT-PCR assay. The assay detected all recent Mediterranean isolates (including serotypes 2, 4, and 16), BTV vaccine strains for serotypes 2 and 4, and 15 out of the 24 BTV reference strains available (all serotypes), but did not detect the related orbiviruses epizootic hemorrhagic disease and African horse sickness viruses. Following assay evaluation, the ability of this assay to identify BTV in recent isolates (2003, 2004) from ovine and bovine samples from an epizootic outbreak in Spain was also tested. Minor nucleotide changes (detected by sequencing viral genomes) within the probe-binding region were found to have a profound effect on virus detection. This assay has the benefits of being fast and simple, and the 96-well format enables large-scale epidemiological screening for BTV, especially when combined with a high-throughput nucleic acid extraction method.

  9. Direct detection of Helicobacter pylori resistance to macrolides by a polymerase chain reaction/DNA enzyme immunoassay in gastric biopsy specimens

    PubMed Central

    Marais, A; Monteiro, L; Occhialini, A; Pina, M; Lamouliatte, H; Megraud, F

    1999-01-01

    BACKGROUND—The increasing use of macrolides especially in the treatment of Helicobacter pylori infection has led to an increase in resistant strains. The resistance of H pylori to macrolides, especially clarithromycin, is one of the major causes of eradication failure. In H pylori, clarithromycin resistance is due to point mutations localised in domain V of 23S rRNA. 
AIM—To develop a molecular technique based on amplification of a relevant fragment of the 23S rRNA and colorimetric hybridisation in liquid phase to detect directly in biopsy specimens the type of mutation associated with resistance of H pylori to clarithromycin. 
METHODS—Gastric biopsy samples from 61 patients were submitted to this test. The results were compared with standard methods (determination of minimal inhibition concentration, polymerase chain reaction/restriction fragment length polymorphism, and/or DNA sequencing) in order to evaluate the test and to define the cut off values, specificity, and sensitivity. 
RESULTS—The 14 biopsy samples in which H pylori was not detected did not give a positive result in any assay, and the 14 samples harbouring strains susceptible to clarithromycin gave a positive result with the wild type probe as expected. The 33 biopsy specimens containing resistant strains always gave a positive signal with one of the probes detecting resistant organisms, but in eight cases they also reacted with the wild type probe, indicating that a mixture of resistant and susceptible organisms was present. 
CONCLUSION—The importance of this new assay is that it allows the detection of multiple genotypes corresponding to either heterogeneous genotypes or mixed infections. Moreover, it allows in a single step not only the detection of H pylori but also the determination of its susceptibility to clarithromycin directly in biopsy specimens without the need for culture. 

 Keywords: Helicobacter pylori; resistance; clarithromycin; macrolide; polymerase chain

  10. Quencher-Free Fluorescence Method for the Detection of Mercury(II) Based on Polymerase-Aided Photoinduced Electron Transfer Strategy

    PubMed Central

    Liu, Haisheng; Ma, Linbin; Ma, Changbei; Du, Junyan; Wang, Meilan; Wang, Kemin

    2016-01-01

    A new quencher-free Hg2+ ion assay method was developed based on polymerase-assisted photoinduced electron transfer (PIET). In this approach, a probe is designed with a mercury ion recognition sequence (MRS) that is composed of two T-rich functional areas separated by a spacer of random bases at the 3′-end, and a sequence of stacked cytosines at the 5′-end, to which a fluorescein (FAM) is attached. Upon addition of Hg2+ ions into this sensing system, the MRS folds into a hairpin structure at the 3′-end with Hg2+-mediated base pairs. In the presence of DNA polymerase, it will catalyze the extension reaction, resulting in the formation of stacked guanines, which will instantly quench the fluorescence of FAM through PIET. Under optimal conditions, the limit of detection for Hg2+ ions was estimated to be 5 nM which is higher than the US Environmental Protection Agency (EPA) standard limit. In addition, no labeling with a quencher was requiring, and the present method is fairly simple, fast and low cost. It is expected that this cost-effective fluorescence method might hold considerable potential in the detection of Hg2+ ions in real biological and environmental samples. PMID:27869723

  11. Potential of the polymerase chain reaction in the diagnosis of active Toxoplasma infection by detection of parasite in blood.

    PubMed

    Guy, E C; Joynson, D H

    1995-07-01

    Blood samples from 54 patients presenting with acute toxoplasmic lymphadenopathy were tested for the presence of Toxoplasma gondii DNA using a nested polymerase chain reaction (PCR). PCR test results of a single blood sample obtained 2-23 weeks after onset of illness were positive for 19 (35%) of the 54 patients. Nine (53%) of 17 patients were positive by PCR when the initial blood sample was collected within the first 5 weeks of illness. In 7 of the 19 patients found positive, further blood samples were available, and subsequent clearance of T. gondii DNA from the blood was demonstrated. On the basis of positive findings among patients with acute toxoplasmosis and the absence of positive findings among 10 uninfected persons and 43 with past Toxoplasma infection, a positive PCR result appears to be a helpful indicator of active disease. However, since only 53% of patients with lymphadenopathy persisting < or = 5 weeks were positive, a negative PCR result does not exclude recent infection.

  12. Mitochondrial DNA variation in chinook salmon and chum salmon detected by restriction enzyme analysis of polymerase chain reaction products

    USGS Publications Warehouse

    Cronin, M.; Spearman, R.; Wilmot, R.; Patton, J.; Bickman, J.

    1993-01-01

    We analyze intraspecific mitochondrial DNA variation in chinook salmon from drainages in the Yukon River, the Kenai River, and Oregon and California rivers; and chum salmon from the Yukon River and vancouver Island, and Washington rivers. For each species, three different portions of the mtDNA molecule were amplified seperately using the polymerase chain reaction and then digested with at least 19 restrictions enzymes. Intraspecific sequence divergences between haplotypes were less than 0.01 base subsitution per nucleotide. Nine chum salmon haplotypes were identified. Yukon River chum salmon stocks displayed more haplotypes (8) occurred in all areas. Seven chinook salmon haplotypes were identified. Four haplotypes occurred in the Yukon and Kenai rviers and four occured in the Oregon/California, with only one haplotype shared between the regions. Sample sizes were too small to quantify the degree of stock seperation among drainages, but the patterns of variation that we observed suggest utility of the technique in genetic stock identification.

  13. Molecular detection of field isolates of Turkey Eimeria by polymerase chain reaction amplification of the cytochrome c oxidase I gene.

    PubMed

    Rathinam, T; Gadde, U; Chapman, H D

    2015-07-01

    Oocysts of Eimeria spp. were isolated from litter samples obtained from 30 commercial turkey farms. Genomic DNA was extracted from clean oocysts, and polymerase chain amplification of the species-specific cytochrome c oxidase subunit I (COI) gene was performed for five species of turkey Eimeria. The species tested were Eimeria adenoeides, Eimeria meleagrimitis, Eimeria meleagridis, Eimeria dispersa, and Eimeria gallopavonis. All DNA samples were positive for E. meleagrimitis, nine were positive for E. adenoeides, two were positive for E. dispersa, and none for E. meleagridis and E. gallopavonis. E. meleagrimitis occurred as a single species in 21 (70 %) of the farms while 9 (30 %) farms had a mixed species with E. meleagrimitis and E. adenoeides and 2 (7 %) were triple positive with E. meleagrimitis, E. adenoeides, and E. dispersa. This is the first account of the field prevalence of turkey Eimeria species using molecular methods.

  14. Development of a Lightcycler-based reverse transcription polymerase chain reaction for the detection of foot-and-mouth disease virus.

    PubMed

    Oem, Jae Ku; Kye, Soo Jeong; Lee, Kwang Nyeong; Kim, Yong Joo; Park, Jee Yong; Park, Jong Hyeon; Joo, Yi Seok; Song, Hee Jong

    2005-09-01

    One step TaqMan real-time reverse transcription polymerase chain reaction (R/T RT-PCR) using a set of primers/probes was developed for the detection of foot-and-mouth disease (FMD) virus. The gene-specific probes labeled fluorogen for the internal ribosomal entry site, Leader sequence and 2B regions were used to detect FMD virus (FMDV). This assay specifically detected FMDV both in cell culture preparations and clinical samples, and was capable of distinguishing FMD from other viral diseases similar to clinical signs (swine vesicular disease, vesicular stomatitis and bovine viral diarrhea). This assay was shown to be 1000-fold more sensitive than the conventional RT-PCR method. The detection limits of this assay was 1 TCID(50)/ml of the FMDV RNA concentration. Quantification was obtained by a standard curves plotting threshold cycle values versus known infectivity titer. The assay was sensitive, specific and rapid enough to detect FMDV RNA genome in probang samples. As such, the described method is reliable and provides faster disease diagnostics than the conventional RT-PCR procedure to detect FMDV.

  15. Rapid diagnostic detection of plum pox virus in Prunus plants by isothermal AmplifyRP(®) using reverse transcription-recombinase polymerase amplification.

    PubMed

    Zhang, Shulu; Ravelonandro, Michel; Russell, Paul; McOwen, Nathan; Briard, Pascal; Bohannon, Seven; Vrient, Albert

    2014-10-01

    Plum pox virus (PPV) causes the most destructive viral disease known as plum pox or Sharka disease in stone fruit trees. As an important regulated pathogen, detection of PPV is thus of critical importance to quarantine and eradication of the spreading disease. In this study, the innovative development of two AmplifyRP(®) tests is reported for a rapid isothermal detection of PPV using reverse transcription-recombinase polymerase amplification. In an AmplifyRP(®) test, all specific recombination and amplification reactions occur at a constant temperature without thermal cycling and the test results are either recorded in real-time with a portable fluorescence reader or displayed using a lateral flow strip contained inside an amplicon detection chamber. The major improvement of this assay is that the entire test from sample preparation to result can be completed in as little as 20min and can be performed easily both in laboratories and in the field. The results from this study demonstrated the ability of the AmplifyRP(®) technique to detect all nine PPV strains (An, C, CR, D, EA, M, Rec, T, or W). Among the economic benefits to pathogen surveys is the higher sensitivity of the AmplifyRP(®) to detect PPV when compared to the conventional ELISA and ImmunoStrip(®) assays. This is the first report describing the use of such an innovative technique to detect rapidly plant viruses affecting perennial crops.

  16. Simultaneous detection of Chlamydia spp., Coxiella burnetii, and Neospora caninum in abortion material of ruminants by multiplex real-time polymerase chain reaction.

    PubMed

    Reisberg, Kerstin; Selim, Abdelfattah M; Gaede, Wolfgang

    2013-09-01

    Chlamydia spp., Coxiella burnetii, and Neospora caninum are responsible for reproductive diseases and are closely linked with high abortion rates in ruminants. Furthermore, C. burnetii and Chlamydia spp. have zoonotic potential. A real-time polymerase chain reaction (PCR) assay was developed for the simultaneous detection of Chlamydia spp., C. burnetii, and N. caninum. The detection of beta-actin as internal control in the same PCR reaction provides additional information about sample quality by detecting the presence of PCR inhibitors. The multiplex real-time PCR developed in the current study shows a greater sensitivity compared to previously used single-target PCR reactions with a reproducible detection limit of 0.13 plasmid copies per PCR for each target. Additional parallel amplification of all detectable pathogens did not adversely impact sensitivity. This new multiplex PCR allows the highly sensitive, cost-effective, and rapid detection of 3 important pathogens and has the potential to be a useful time-saving tool in the routine diagnosis of abortion cases in ruminants.

  17. Recombinase Polymerase Amplification Assay—A Simple, Fast and Cost-Effective Alternative to Real Time PCR for Specific Detection of Feline Herpesvirus-1

    PubMed Central

    Wang, Jianchang; Liu, Libing; Wang, Jinfeng; Sun, Xiaoxia; Yuan, Wanzhe

    2017-01-01

    Feline herpesvirus 1 (FHV-1), an enveloped dsDNA virus, is one of the major pathogens of feline upper respiratory tract disease (URTD) and ocular disease. Currently, polymerase chain reaction (PCR) remains the gold standard diagnostic tool for FHV-1 infection but is relatively expensive, requires well-equipped laboratories and is not suitable for field tests. Recombinase polymerase amplification (RPA), an isothermal gene amplification technology, has been explored for the molecular diagnosis of infectious diseases. In this study, an exo-RPA assay for FHV-1 detection was developed and validated. Primers targeting specifically the thymidine kinase (TK) gene of FHV-1 were designed. The RPA reaction was performed successfully at 39°C and the results were obtained within 20 min. Using different copy numbers of recombinant plasmid DNA that contains the TK gene as template, we showed the detection limit of exo-RPA was 102 copies DNA/reaction, the same as that of real time PCR. The exo-RPA assay did not cross-detect feline panleukopenia virus, feline calicivirus, bovine herpesvirus-1, pseudorabies virus or chlamydia psittaci, a panel of pathogens important in feline URTD or other viruses in Alphaherpesvirinae, demonstrating high specificity. The assay was validated by testing 120 nasal and ocular conjunctival swabs of cats, and the results were compared with those obtained with real-time PCR. Both assays provided the same testing results in the clinical samples. Compared with real time PCR, the exo-RPA assay uses less-complex equipment that is portable and the reaction is completed much faster. Additionally, commercial RPA reagents in vacuum-sealed pouches can tolerate temperatures up to room temperature for days without loss of activity, suitable for shipment and storage for field tests. Taken together, the exo-RPA assay is a simple, fast and cost-effective alternative to real time PCR, suitable for use in less advanced laboratories and for field detection of FHV-1

  18. Recombinase Polymerase Amplification Assay-A Simple, Fast and Cost-Effective Alternative to Real Time PCR for Specific Detection of Feline Herpesvirus-1.

    PubMed

    Wang, Jianchang; Liu, Libing; Wang, Jinfeng; Sun, Xiaoxia; Yuan, Wanzhe

    2017-01-01

    Feline herpesvirus 1 (FHV-1), an enveloped dsDNA virus, is one of the major pathogens of feline upper respiratory tract disease (URTD) and ocular disease. Currently, polymerase chain reaction (PCR) remains the gold standard diagnostic tool for FHV-1 infection but is relatively expensive, requires well-equipped laboratories and is not suitable for field tests. Recombinase polymerase amplification (RPA), an isothermal gene amplification technology, has been explored for the molecular diagnosis of infectious diseases. In this study, an exo-RPA assay for FHV-1 detection was developed and validated. Primers targeting specifically the thymidine kinase (TK) gene of FHV-1 were designed. The RPA reaction was performed successfully at 39°C and the results were obtained within 20 min. Using different copy numbers of recombinant plasmid DNA that contains the TK gene as template, we showed the detection limit of exo-RPA was 102 copies DNA/reaction, the same as that of real time PCR. The exo-RPA assay did not cross-detect feline panleukopenia virus, feline calicivirus, bovine herpesvirus-1, pseudorabies virus or chlamydia psittaci, a panel of pathogens important in feline URTD or other viruses in Alphaherpesvirinae, demonstrating high specificity. The assay was validated by testing 120 nasal and ocular conjunctival swabs of cats, and the results were compared with those obtained with real-time PCR. Both assays provided the same testing results in the clinical samples. Compared with real time PCR, the exo-RPA assay uses less-complex equipment that is portable and the reaction is completed much faster. Additionally, commercial RPA reagents in vacuum-sealed pouches can tolerate temperatures up to room temperature for days without loss of activity, suitable for shipment and storage for field tests. Taken together, the exo-RPA assay is a simple, fast and cost-effective alternative to real time PCR, suitable for use in less advanced laboratories and for field detection of FHV-1

  19. Cytochrome oxidase subunit III from Arbacia lixula: detection of functional constraints by comparison with homologous sequences.

    PubMed

    De Giorgi, C; Martiradonna, A; Saccone, C

    1993-01-01

    In this paper we report the comparison of the sequences of the cytochrome oxidase subunit III from three different sea urchin species. Both nucleotide and amino acid sequences have been analyzed. The nucleotide sequence analysis reveals that the sea urchin sequences obey some rules already found in mammals. The base substitution analysis carried out on the sequences of the three species pairs, shows that the evolutionary dynamics of the first and the second codon positions are so slow that do not allow a quantitative measurement of their genetic distances, thus demonstrating that also in these species the COIII gene is strongly conserved during evolution. Changes occurring at the third codon positions indicate that the three species evolved from a common ancestor under different directional mutational pressure. The multi-alignment of the sea urchin proteins indicates the existence of the amino acid sequence motif N R T that represents a possible glycosylation site. Another glycosylation site has been detected in the mammalian cytochrome oxidase subunit III, in a position slightly different. Such an analysis revealed, for the first time, a new functional aspect of this sequence.

  20. Siderophore-based detection of Fe(III) and microbial pathogens.

    PubMed

    Zheng, Tengfei; Nolan, Elizabeth M

    2012-08-01

    Siderophores are low-molecular-weight iron chelators that are produced and exported by bacteria, fungi and plants during periods of nutrient deprivation. The structures, biosynthetic logic, and coordination chemistry of these molecules have fascinated chemists for decades. Studies of such fundamental phenomena guide the use of siderophores and siderophore conjugates in a variety of medicinal applications that include iron-chelation therapies and drug delivery. Sensing applications constitute another important facet of siderophore-based technologies. The high affinities of siderophores for both ferric ions and siderophore receptors, proteins expressed on the cell surface that are required for ferric siderophore import, indicate that these small molecules may be employed for the selective capture of metal ions, proteins, and live bacteria. This minireview summaries progress in methods that utilize native bacterial and fungal siderophore scaffolds for the detection of Fe(III) or microbial pathogens.

  1. Development and evaluation of a real-time polymerase chain reaction assay targeting iap for the detection of Listeria monocytogenes in select food matrices.

    PubMed

    Chen, Yi; Kumar, Nishant; Siddique, Nusrat

    2011-10-01

    Listeria monocytogenes is an intracellular foodborne pathogen that has been associated with severe human illnesses. Various rapid detection methods have been developed for the specific detection of this pathogen. In the present study, a real-time quantitative polymerase chain reaction (PCR) assay targeting iap, a gene encoding extracellular protein p60, was developed for L. monocytogenes. The PCR efficiency is above 85% and the limit of detection (LOD) is 30 copies of genome per reaction for all strains tested. The assay exhibited 100% inclusivity and exclusivity rates. The detection of L. monocytogenes in five food matrices, whole milk, soft cheese, turkey deli meat, smoked salmon, and alfalfa sprouts, was evaluated with and without enrichment. Without enrichment, the LOD for all food matrices were 4×10(3) CFU/mL food enrichment mix for whole milk and 4×10(4) CFU/mL for all other foods. With 24 h incubation in Buffered Listeria Enrichment Broth, the LOD was 3 CFU/25 g food for whole milk, turkey deli meat, and smoked salmon and 9 CFU/25 g food for soft cheese and alfalfa sprouts. With 48 h incubation, the LOD was 3 CFU/25 g food for all matrices. This quantitative PCR appears to be a promising alternative for rapid detection of L. monocytogenes in select foods.

  2. Detection of genetically modified crops using multiplex asymmetric polymerase chain reaction and asymmetric hyperbranched rolling circle amplification coupled with reverse dot blot.

    PubMed

    Wang, Xiumin; Teng, Da; Guan, Qingfeng; Tian, Fang; Wang, Jianhua

    2015-04-15

    To meet the ever-increasing demand for detection of genetically modified crops (GMCs), low-cost, high-throughput and high-accuracy detection assays are needed. The new multiplex asymmetric polymerase chain reaction and asymmetric hyper-branched rolling circle amplification coupled with reverse dot blot (RDB) systems were developed to detect GMCs. Thirteen oligonucleotide probes were designed to identify endogenous targets (Lec1, Hmg and Sad1), event-specific targets (RRS-5C, RRS-3C, Bt176-3C and MON810-3C), screening targets (35S promoter and NOS terminator), and control targets (18S and PLX). Optimised conditions were as follows: tailed hybridization probes (1-2 pmol/l) were immobilized on a membrane by baking for 2h, and a 10:1 ratio of forward to reverse primers was used. The detection limits were 0.1 μg/l of 2% RRS and 0.5 ng/l of DNA from genetically modified (GM) soybean. These results indicate that the RDB assay could be used to detect multiplex target genes of GMCs rapidly and inexpensively.

  3. Development of a diagnostic real-time polymerase chain reaction assay for the detection of invasive Haemophilus influenzae in clinical samples.

    PubMed

    Meyler, Kenneth L; Meehan, Mary; Bennett, Desiree; Cunney, Robert; Cafferkey, Mary

    2012-12-01

    Since the introduction of the Haemophilus influenzae serotype b vaccine, invasive H. influenzae disease has become dominated by nontypeable (NT) strains. Several widely used molecular diagnostic methods have been shown to lack sensitivity or specificity in the detection of some of these strains. Novel real-time assays targeting the fucK, licA, and ompP2 genes were developed and evaluated. The fucK assay detected all strains of H. influenzae tested (n = 116) and had an analytical sensitivity of 10 genome copies/polymerase chain reaction (PCR). This assay detected both serotype b and NT H. influenzae in 12 previously positive specimens (culture and/or bexA PCR) and also detected H. influenzae in a further 5 of 883 culture-negative blood and cerebrospinal fluid (CSF) samples. The fucK assay has excellent potential as a diagnostic test for detection of typeable and nontypeable strains of invasive H. influenzae in clinical samples of blood and CSF.

  4. Evaluation of loop-mediated isothermal amplification for detection of Toxoplasma gondii in water samples and comparative findings by polymerase chain reaction and immunofluorescence test (IFT).

    PubMed

    Sotiriadou, Isaia; Karanis, Panagiotis

    2008-12-01

    The development and evaluation of a 1-step single-tube accelerated loop-mediated isothermal amplification (LAMP) assay for the rapid detection of Toxoplasma in water samples is described. The method has been evaluated based on the amplification of B1 and TgOWP Toxoplasma genes, and it demonstrated a sensitivity detection limit of 0.1 tachyzoites' DNA for both genes. LAMP detection was evaluated and compared with nested polymerase chain reaction (PCR) in 26 water sample pellets spiked with known numbers of Toxoplasma oocysts. After DNA extraction, the detection sensitivity in spiked pellets was 100% by LAMP and 53.8% by PCR. Subsequently, 52 natural water samples of different origin were directly investigated by 3 assays: LAMP, PCR, and immunofluorescence test (IFT). Twenty-five (48%) of 52 have been found positive for Toxoplasma DNA by LAMP, whereas nested PCR products were generated in 7 of 52 (13.5%) water samples. All 52 water samples were negative for Toxoplasma by IFT. These data clearly indicate LAMP as a rapid, specific, and sensitive tool for the detection of Toxoplasma contamination in water samples.

  5. Multiplex polymerase chain reaction-capillary gel electrophoresis: a promising tool for GMO screening--assay for simultaneous detection of five genetically modified cotton events and species.

    PubMed

    Nadal, Anna; Esteve, Teresa; Pla, Maria

    2009-01-01

    A multiplex polymerase chain reaction assay coupled to capillary gel electrophoresis for amplicon identification by size and color (multiplex PCR-CGE-SC) was developed for simultaneous detection of cotton species and 5 events of genetically modified (GM) cotton. Validated real-time-PCR reactions targeting Bollgard, Bollgard II, Roundup Ready, 3006-210-23, and 281-24-236 junction sequences, and the cotton reference gene acp1 were adapted to detect more than half of the European Union-approved individual or stacked GM cotton events in one reaction. The assay was fully specific (<1.7% of false classification rate), with limit of detection values of 0.1% for each event, which were also achieved with simulated mixtures at different relative percentages of targets. The assay was further combined with a second multiplex PCR-CGE-SC assay to allow simultaneous detection of 6 cotton and 5 maize targets (two endogenous genes and 9 GM events) in two multiplex PCRs and a single CGE, making the approach more economic. Besides allowing simultaneous detection of many targets with adequate specificity and sensitivity, the multiplex PCR-CGE-SC approach has high throughput and automation capabilities, while keeping a very simple protocol, e.g., amplification and labeling in one step. Thus, it is an easy and inexpensive tool for initial screening, to be complemented with quantitative assays if necessary.

  6. Rapid and sensitive detection of Mycoplasma synoviae by an insulated isothermal polymerase chain reaction-based assay on a field-deployable device

    PubMed Central

    Kuo, Hung-Chih; Lo, Dan-Yuan; Chen, Chiou-Lin; Tsai, Yun-Long; Ping, Jia-Fong; Lee, Chien-Hsien; Lee, Pei-Yu Alison; Chang, Hsiao-Fen Grace

    2016-01-01

    Mycoplasma synoviae (MS), causing respiratory diseases, arthritis, and eggshell apex abnormalities in avian species, is an important pathogen in the poultry industry. Implementation of a biosecurity plan is important in MS infection management. Working on a field-deployable POCKIT™ device, an insulated isothermal polymerase chain reaction (iiPCR) assay has a potential for timely MS detection on the farm. The MS iiPCR assay had limit of detection 95% of about 9 genome equivalents by testing serial dilutions of a standard DNA. The detection endpoint of the assay for detection of MS genomic DNA was comparable to a reference real-time PCR. The assay did not crossreact with other important avian pathogens, including avian reovirus, Mycoplasma gallisepticum, Staphylococcus aureus, Escherichia coli, Pasteurella multocida, and Salmonella Pullorum. When 92 synovial fluid and respiratory tract swab samples collected from chickens, turkeys, and geese suspected of MS infection were tested, the clinical performance of the MS iiPCR had 97.8% agreement (Cohen's kappa value, 0.95) with that of the reference real-time PCR. In conclusion, the MS iiPCR/POCKIT™ system, working with field-deployable manual or automatic nucleic acid extraction methods, has potential to serve as a rapid and sensitive on-site tool to facilitate timely detection of MS. PMID:27389062

  7. Evaluation of Antigen Detection Tests, Microscopy, and Polymerase Chain Reaction for Diagnosis of Malaria in Peripheral Blood in Asymptomatic Pregnant Women in Nanoro, Burkina Faso

    PubMed Central

    Kattenberg, Johanna H.; Tahita, Christian M.; Versteeg, Inge A. J.; Tinto, Halidou; Traoré/Coulibaly, Maminata; D'Alessandro, Umberto; Schallig, Henk D. F. H.; Mens, Petra F.

    2012-01-01

    Rapid diagnostics tests (RDTs) detect malaria specific antigen(s) in the circulation, even when parasites are sequestered in the placenta and not visible by microscopy. However, research on their diagnostic accuracy during pregnancy is limited. Pregnant women (n = 418) were screened for malaria during routine antenatal care by using two RDTs that detect histidine-rich protein 2 (HRP2) or Plasmodium lactate dehydrogenase, and enzyme-linked immunosorbent assays with antibodies that detect dihydrofolate reductase–thymidylate synthase or heme-detoxification protein, and compared with real-time polymerase chain reaction (RT-PCR) and microscopy for evaluation of their diagnostic accuracy. Prevalence of malaria infection was high (53% by PCR). The RT-PCR and the HRP2 RDT detected most cases of malaria during pregnancy, whereas microscopy, the Plasmodium lactate dehydrogenase RDT, and enzyme-linked immunosorbent assays for dihydrofolate reductase–thymidylate synthase and heme-detoxification protein antibodies did not detect several low-density infections. Therefore, the HRP2 RDT could be a useful tool in high-transmission areas for diagnosis of malaria in asymptomatic pregnant women. PMID:22859362

  8. Application of a qualitative and quantitative real-time polymerase chain reaction method for detecting genetically modified papaya line 55-1 in papaya products.

    PubMed

    Nakamura, Kosuke; Akiyama, Hiroshi; Takahashi, Yuki; Kobayashi, Tomoko; Noguchi, Akio; Ohmori, Kiyomi; Kasahara, Masaki; Kitta, Kazumi; Nakazawa, Hiroyuki; Kondo, Kazunari; Teshima, Reiko

    2013-01-15

    Genetically modified (GM) papaya (Carica papaya L.) line 55-1 (55-1), which is resistant to papaya ringspot virus infection, has been marketed internationally. Many countries have mandatory labeling regulations for GM foods, and there is a need for specific methods for detecting 55-1. Here, an event- and construct-specific real-time polymerase chain reaction (PCR) method was developed for detecting 55-1 in papaya products. Quantitative detection was possible for fresh papaya fruit up to dilutions of 0.001% and 0.01% (weight per weight [w/w]) for homozygous SunUp and heterozygous Rainbow cultivars, respectively, in non-GM papaya. The limit of detection and quantification was as low as 250 copies of the haploid genome according to a standard reference plasmid. The method was applicable to qualitative detection of 55-1 in eight types of processed products (canned papaya, pickled papaya, dried fruit, papaya-leaf tea, jam, puree, juice, and frozen dessert) containing papaya as a main ingredient.

  9. Development of TaqMan real-time reverse transcription-polymerase chain reaction for the detection and quantitation of porcine kobuvirus.

    PubMed

    Zhu, Xiangdong; Wang, Yufei; Chen, Jianfei; Zhang, Xin; Shi, Hongyan; Shi, Da; Gao, Jing; Feng, Li

    2016-08-01

    Porcine kobuvirus (PKV) is a newly emerging virus that has been detected in diarrheic pigs. Presently, reverse transcription-polymerase chain reaction (RT-PCR) and RT-loop-mediated amplification are the only methods that can be used to detect PKV. To develop a TaqMan real-time RT-PCR for the rapid detection and quantitation of PKV nucleic acid in fecal samples, a pair of primers and a probe were designed to amplify the conserved 3D region of the PKV genome. After optimization, the TaqMan real-time RT-PCR was highly specific and ∼1000 times more sensitive than conventional RT-PCR, and the detection limit was as low as 30 DNA copies. Among the 148 intestinal samples from piglets with diarrhea, 136 and 118 were positive based on the TaqMan and conventional RT-PCR methods, respectively, indicating that the TaqMan RT-PCR was more sensitive than conventional RT-PCR, and the total concordance of the two methods was approximately 87.84%. Thus, the TaqMan real-time RT-PCR should be a useful tool for the early detection and quantitation of PKV.

  10. C-myc proto-oncogene amplification detected by polymerase chain reaction in archival human ovarian carcinomas.

    PubMed Central

    Schreiber, G.; Dubeau, L.

    1990-01-01

    Polymerase chain reaction (PCR) technology was used to examine the state of amplification of the proto-oncogene c-myc in archival ovarian carcinomas. Sequences from the c-myc gene and from a control gene were amplified simultaneously by PCR and the ratios of the two products measured. The results provided an accurate measurement of the relative number of copies of the two genes in each tumor genome if the control and test sequences amplified by PCR were of equal lengths. The results were not affected by the number of PCR cycles used. This technique should facilitate gene amplification studies in clinical medicine. Increased c-myc copy number was found in 17% of the 30 cases examined when a control from the same chromosome as c-myc was used, but in 37% of cases if a control from another chromosome was used. This underlines the importance of the genetic location of the selected control genes for such studies. Images Figure 2 PMID:2205100

  11. Analytical variables of reverse transcription-polymerase chain reaction-based detection of disseminated prostate cancer cells.

    PubMed

    Zippelius, A; Lutterbüse, R; Riethmüller, G; Pantel, K

    2000-07-01

    Early systemic spread of occult tumor cells that may develop into founders of incurable distant metastasis has been identified in prostate cancer patients by reverse transcription-PCR (RT-PCR) amplification of prostate-specific antigen (PSA) mRNA. Nevertheless, the introduction of this new staging tool into the clinical setting has been hampered by the disparate and contradictory data on the sensitivity and specificity of RT-PCR methods reported recently. We used PSA RT-PCR to examine the influence of analytical variables such as priming and enzyme of reverse transcriptase reaction, temperature and time of primer annealing, primer extension and denaturation, as well as the concentrations of magnesium chloride, Taq polymerase, deoxynucleotide triphosphate, primers and BSA on the amplification process. By systematically varying these chemical and physical components, we could demonstrate a significant increase in amplification yield and in stringency of primer annealing. This may explain the wide variety of published findings on molecular staging of prostate cancer, which currently impedes the clinical introduction of PSA RT-PCR assays in prostate cancer. Methodological analyses are needed for standardization and quality assurance to achieve reproducible molecular methods that can be used in clinical practice.

  12. Detection of congenital cytomegalovirus infection by real-time polymerase chain reaction analysis of saliva or urine specimens.

    PubMed

    Ross, Shannon A; Ahmed, Amina; Palmer, April L; Michaels, Marian G; Sánchez, Pablo J; Bernstein, David I; Tolan, Robert W; Novak, Zdenek; Chowdhury, Nazma; Fowler, Karen B; Boppana, Suresh B

    2014-11-01

    Viral culture of urine or saliva has been the gold standard technique for the diagnosis of congenital cytomegalovirus (CMV) infection. Results of rapid culture and polymerase chain reaction (PCR) analysis of urine and saliva specimens from 80 children were compared to determine the clinical utility of a real-time PCR assay for diagnosis of congenital CMV infection. Results of urine PCR were positive in 98.8% of specimens. Three PCR-positive urine samples were culture negative. Results of saliva PCR and culture were concordant in 78 specimens (97.5%). Two PCR-positive saliva samples were culture negative. These findings demonstrate that PCR performs as well as rapid culture of urine or saliva specimens for diagnosing congenital CMV infection and saliva specimens are easier to collect. Because PCR also offers more rapid turnaround, is unlikely to be affected by storage and transport conditions, has lower cost, and may be adapted to high-throughput situations, it is well suited for targeted testing and large-scale screening for CMV.

  13. Specific detection of Neospora caninum oocysts in fecal samples from experimentally-infected dogs using the polymerase chain reaction.

    PubMed

    Hill, D E; Liddell, S; Jenkins, M C; Dubey, J P

    2001-04-01

    Neospora caninum oocysts, passed in the feces of a definitive host (dog), were isolated, and genomic DNA was extracted. A polymerase cahin reaction (PCR) targeting the N. caninum-specific Nc 5 genomic sequence was performed using the isolated DNA. A synthesized competitor molecule containing part of the Nc 5 sequence was included in the assay as a check against false-negative PCR results and to quantify N. caninum oocyst DNA in fecal samples. A standard curve of the ratio of fluorescence intensity of PCR-amplified competitor to that of oocyst DNA was constructed to compare oocyst equivalents from fecal samples containing unknown numbers of N. caninum oocysts and to assess the sensitivity of the assay. The specificity of the assay was determined using the Nc 5-specific primers in PCR assays against other parasites likely to be found in canine feces. Genomic DNA sequences from the canine coccidians Hammondia heydorni, Cryptosporidium parvum, Sarcocystis cruzi, S. tenella, and Isospora ohioensis and the canine helminth parasites Strongyloides stercoralis, Toxocara canis, Dipylidium caninum, and Ancylostoma caninum were not amplified. In addition, genomic DNA sequences from oocysts of coccidian parasites that might contaminate dog feces, such as Hammondia hammondi, Toxoplasma gondii, or Eimeria tenella, were not amplified in the PCR assay. The assay should be useful in epidemiological surveys of both domestic and wild canine hosts and in investigations of oocyst biology in experimental infections.

  14. Detection of Citrus leprosis virus C using specific primers and TaqMan probe in one-step real-time reverse-transcription polymerase chain reaction assays.

    PubMed

    Choudhary, Nandlal; Wei, G; Govindarajulu, A; Roy, Avijit; Li, Wenbin; Picton, Deric D; Nakhla, M K; Levy, L; Brlansky, R H

    2015-11-01

    Citrus leprosis virus C (CiLV-C), a causal agent of the leprosis disease in citrus, is mostly present in the South and Central America and spreading toward the North America. To enable better diagnosis and inhibit the further spread of this re-emerging virus a quantitative (q) real-time reverse transcription polymerase chain reaction (qRT-PCR) assay is needed for early detection of CiLV-C when the virus is present in low titer in citrus leprosis samples. Using the genomic sequence of CiLV-C, specific primers and probe were designed and synthesized to amplify a 73 nt amplicon from the movement protein (MP) gene. A standard curve of the 73 nt amplicon MP gene was developed using known 10(10)-10(1) copies of in vitro synthesized RNA transcript to estimate the copy number of RNA transcript in the citrus leprosis samples. The one-step qRT-PCR detection assays for CiLV-C were determined to be 1000 times more sensitive when compared to the one-step conventional reverse transcription polymerase chain reaction (RT-PCR) CiLV-C detection method. To evaluate the quality of the total RNA extracts, NADH dehydrogenase gene specific primers (nad5) and probe were included in reactions as an internal control. The one-step qRT-PCR specificity was successfully validated by testing for the presence of CiLV-C in the total RNA extracts of the citrus leprosis samples collected from Belize, Costa Rica, Mexico and Panama. Implementation of the one-step qRT-PCR assays for CiLV-C diagnosis should assist regulatory agencies in surveillance activities to monitor the distribution pattern of CiLV-C in countries where it is present and to prevent further dissemination into citrus growing countries where there is no report of CiLV-C presence.

  15. An aptamer-based bio-barcode assay with isothermal recombinase polymerase amplification for cytochrome-c detection and anti-cancer drug screening.

    PubMed

    Loo, Jacky F C; Lau, P M; Ho, H P; Kong, S K

    2013-10-15

    Based on a recently reported ultra-sensitive bio-barcode (BBC) assay, we have developed an aptamer-based bio-barcode (ABC) alternative to detect a cell death marker cytochrome-c (Cyto-c) and its subsequent application to screen anti-cancer drugs. Aptamer is a short single-stranded DNA selected from a synthetic DNA library by virtue of its high binding affinity and specificity to its target based on its unique 3D structure from the nucleotide sequence after folding. In the BBC assay, an antigen (Ag) in analytes is captured by a micro-magnetic particle (MMP) coated with capturing antibodies (Abs). Gold nanoparticles (NPs) with another recognition Ab against the same target and hundreds of identical DNA molecules of known sequence are subsequently added to allow the formation of sandwich structures ([MMP-Ab1]-Ag-[Ab2-NP-DNA]). After isolating the sandwiches by a magnetic field, the DNAs hybridized to their complementary DNAs covalently bound on the NPs are released from the sandwiches after heating. Acting as an Ag identification tag, these bio-barcode DNAs with known DNA sequence are then amplified by polymerase chain reaction (PCR) and detected by fluorescence. In our ABC assay, we employed a Cyto-c-specific aptamer to substitute both the recognition Ab and barcode DNAs on the NPs in the BBC assay; and a novel isothermal recombinase polymerase amplification for the time-consuming PCR. The detection limit of our ABC assay for the Cyto-c was found to be 10 ng/mL and this new assay can be completed within 3h. Several potential anti-cancer drugs have been tested in vitro for their efficacy to kill liver cancer with or without multi-drug resistance.

  16. Eukaryote-Made Thermostable DNA Polymerase Enables Rapid PCR-Based Detection of Mycoplasma, Ureaplasma and Other Bacteria in the Amniotic Fluid of Preterm Labor Cases

    PubMed Central

    Yoneda, Noriko; Yoneda, Satoshi; Mori, Masashi; Tabata, Homare; Minami, Hiroshi; Saito, Shigeru; Kitajima, Isao

    2015-01-01

    Background Intra-amniotic infection has long been recognized as the leading cause of preterm delivery. Microbial culture is the gold standard for the detection of intra-amniotic infection, but several days are required, and many bacterial species in the amniotic fluid are difficult to cultivate. Methods We developed a novel nested-PCR-based assay for detecting Mycoplasma, Ureaplasma, other bacteria and fungi in amniotic fluid samples within three hours of sample collection. To detect prokaryotes, eukaryote-made thermostable DNA polymerase, which is free from bacterial DNA contamination, is used in combination with bacterial universal primers. In contrast, to detect eukaryotes, conventional bacterially-made thermostable DNA polymerase is used in combination with fungal universal primers. To assess the validity of the PCR assay, we compared the PCR and conventional culture results using 300 amniotic fluid samples. Results Based on the detection level (positive and negative), 93.3% (280/300) of Mycoplasma, 94.3% (283/300) of Ureaplasma, 89.3% (268/300) of other bacteria and 99.7% (299/300) of fungi matched the culture results. Meanwhile, concerning the detection of bacteria other than Mycoplasma and Ureaplasma, 228 samples were negative according to the PCR method, 98.2% (224/228) of which were also negative based on the culture method. Employing the devised primer sets, mixed amniotic fluid infections of Mycoplasma, Ureaplasma and/or other bacteria could be clearly distinguished. In addition, we also attempted to compare the relative abundance in 28 amniotic fluid samples with mixed infection, and judged dominance by comparing the Ct values of quantitative real-time PCR. Conclusions We developed a novel PCR assay for the rapid detection of Mycoplasma, Ureaplasma, other bacteria and fungi in amniotic fluid samples. This assay can also be applied to accurately diagnose the absence of bacteria in samples. We believe that this assay will positively contribute to the

  17. A highly sensitive and selective fluorescent sensor for detection of Al(3+) using a europium(III) quinolinecarboxylate.

    PubMed

    Xu, Wentao; Zhou, Youfu; Huang, Decai; Su, Mingyi; Wang, Kun; Hong, Maochun

    2014-07-07

    Eu2PQC6 has been developed to detect Al(3+) by monitoring the quenching of the europium-based emission, with the lowest detection limit of ∼32 pM and the quantitative detection range to 150 μM. Eu2PQC6 is the first ever example that the europium(III) complex serves as an Al(3+) fluorescent sensor based on "competition-displacement" mode.

  18. Event specific qualitative and quantitative polymerase chain reaction detection of genetically modified MON863 maize based on the 5'-transgene integration sequence.

    PubMed

    Yang, Litao; Xu, Songci; Pan, Aihu; Yin, Changsong; Zhang, Kewei; Wang, Zhenying; Zhou, Zhigang; Zhang, Dabing

    2005-11-30

    Because of the genetically modified organisms (GMOs) labeling policies issued in many countries and areas, polymerase chain reaction (PCR) methods were developed for the execution of GMO labeling policies, such as screening, gene specific, construct specific, and event specific PCR detection methods, which have become a mainstay of GMOs detection. The event specific PCR detection method is the primary trend in GMOs detection because of its high specificity based on the flanking sequence of the exogenous integrant. This genetically modified maize, MON863, contains a Cry3Bb1 coding sequence that produces a protein with enhanced insecticidal activity against the coleopteran pest, corn rootworm. In this study, the 5'-integration junction sequence between the host plant DNA and the integrated gene construct of the genetically modified maize MON863 was revealed by means of thermal asymmetric interlaced-PCR, and the specific PCR primers and TaqMan probe were designed based upon the revealed 5'-integration junction sequence; the conventional qualitative PCR and quantitative TaqMan real-time PCR detection methods employing these primers and probes were successfully developed. In conventional qualitative PCR assay, the limit of detection (LOD) was 0.1% for MON863 in 100 ng of maize genomic DNA for one reaction. In the quantitative TaqMan real-time PCR assay, the LOD and the limit of quantification were eight and 80 haploid genome copies, respectively. In addition, three mixed maize samples with known MON863 contents were detected using the established real-time PCR systems, and the ideal results indicated that the established event specific real-time PCR detection systems were reliable, sensitive, and accurate.

  19. Droplet digital polymerase chain reaction (PCR) outperforms real-time PCR in the detection of environmental DNA from an invasive fish species.

    PubMed

    Doi, Hideyuki; Takahara, Teruhiko; Minamoto, Toshifumi; Matsuhashi, Saeko; Uchii, Kimiko; Yamanaka, Hiroki

    2015-05-05

    Environmental DNA (eDNA) has been used to investigate species distributions in aquatic ecosystems. Most of these studies use real-time polymerase chain reaction (PCR) to detect eDNA in water; however, PCR amplification is often inhibited by the presence of organic and inorganic matter. In droplet digital PCR (ddPCR), the sample is partitioned into thousands of nanoliter droplets, and PCR inhibition may be reduced by the detection of the end-point of PCR amplification in each droplet, independent of the amplification efficiency. In addition, real-time PCR reagents can affect PCR amplification and consequently alter detection rates. We compared the effectiveness of ddPCR and real-time PCR using two different PCR reagents for the detection of the eDNA from invasive bluegill sunfish, Lepomis macrochirus, in ponds. We found that ddPCR had higher detection rates of bluegill eDNA in pond water than real-time PCR with either of the PCR reagents, especially at low DNA concentrations. Limits of DNA detection, which were tested by spiking the bluegill DNA to DNA extracts from the ponds containing natural inhibitors, found that ddPCR had higher detection rate than real-time PCR. Our results suggest that ddPCR is more resistant to the presence of PCR inhibitors in field samples than real-time PCR. Thus, ddPCR outperforms real-time PCR methods for detecting eDNA to document species distributions in natural habitats, especially in habitats with high concentrations of PCR inhibitors.

  20. Polymerase chain reaction for the detection of Pseudomonas aeruginosa, Stenotrophomonas maltophilia and Burkholderia cepacia in sputum of patients with cystic fibrosis.

    PubMed

    Karpati, F; Jonasson, J

    1996-12-01

    Occurrence of Pseudomonas aeruginosa, Stenotrophomonas (Xanthomonas) maltophilia and Burkholderia (Pseudomonas) cepacia in sputum of cystic fibrosis (CF) patients was demonstrated with a simple and rapid polymerase chain reaction (PCR) technique. The PCR was performed with a set of three primer pairs based on 16S rRNA sequences after sputum preparation with dithiothreitol and NaOH lysis. All three pathogens could be individually detected by the use of this technique. To prevent carry-over contamination, dUTP and uracil-N-glycosylase were included in the reaction. The amplicons were visualized by agarose gel electrophoresis. Sputum culture was performed on all samples. Ninety specimens from CF patients were analysed. The sensitivity for the detection of P. aeruginosa was 37/40 (93%) compared to culture. Bacterial growth of P. aeruginosa was found in three cases, where PCR amplicons were not detected, while PCR was positive in five cases, where culture did not reveal the presence of this bacterium. For this reason, the specificity was 45/50 (90%). For S. maltophilia, the PCR was less sensitive than culture (positive in three of six cases). In our series, B. cepacia was detected by culture in one case and this was also detected by PCR. There were no false-positive PCR results regarding S. maltophilia or B. cepacia. Thus, combined PCR-based detection of these three clinically relevant bacteria in sputum samples from CF patients can be performed by a reliable technique in a relatively simple manner. The present data indicate a high sensitivity and specificity for P. aeruginosa. The lower sensitivity observed for the detection of S. maltophilia in sputum and B. cepacia, as estimated from laboratory strains, may depend on PCR conditions and genetic heterogeneity, respectively. The greatest gains with this method can be made when it is used for the early detection of P. aeruginosa in sputum-producing CF patients.

  1. A multiplex real-time polymerase chain reaction assay with two internal controls for the detection of Brucella species in tissues, blood, and feces from marine mammals.

    PubMed

    Sidor, Inga F; Dunn, J Lawrence; Tsongalis, Gregory J; Carlson, Jolene; Frasca, Salvatore

    2013-01-01

    Brucellosis has emerged as a disease of concern in marine mammals in the last 2 decades. Molecular detection techniques have the potential to address limitations of other methods for detecting infection with Brucella in these species. Presented herein is a real-time polymerase chain reaction (PCR) method targeting the Brucella genus-specific bcsp31 gene. The method also includes a target to a conserved region of the eukaryotic mitochondrial 16S ribosomal RNA gene to assess suitability of extracted DNA and a plasmid-based internal control to detect failure of PCR due to inhibition. This method was optimized and validated to detect Brucella spp. in multiple sample matrices, including fresh or frozen tissue, blood, and feces. The analytical limit of detection was low, with 95% amplification at 24 fg, or an estimated 7 bacterial genomic copies. When Brucella spp. were experimentally added to tissue or fecal homogenates, the assay detected an estimated 1-5 bacteria/µl. An experiment simulating tissue autolysis showed relative persistence of bacterial DNA compared to host mitochondrial DNA. When used to screen 1,658 field-collected marine mammal tissues in comparison to microbial culture, diagnostic sensitivity and specificity were 70.4% and 98.3%, respectively. In addition to amplification in fresh and frozen tissues, Brucella spp. were detected in feces and formalin-fixed, paraffin-embedded tissues from culture-positive animals. Results indicate the utility of this real-time PCR for the detection of Brucella spp. in marine species, which may have applications in surveillance or epidemiologic investigations.

  2. Comparison of real-time polymerase chain reaction assay methods for detection of RHD gene in amniotic fluid

    PubMed Central

    Gunel, Tuba; Kalelıoglu, Ibrahim; Surmelı, Yusuf; Turken, Basak; Ermıs, Hayri; Aydınlı, Kılıç

    2011-01-01

    Hemolytic disease of the newborn is the clinical condition in which Rh blood group antigens in couples are incompatible with each other and mother is negative for the antigen, whereas father is positive. Although RHD antigen encoded by RHD gene that is localized on chromosome 1 determines person's Rh genotyping, this incompatibility can lead to delivery as anemia, jaundiced, or dead in mother's uterus. In recent years, improvements have occurred in the prenatal diagnosis of Rh incompatibility. Quantitative real-time polymerase chain reaction (Real-time PCR) has been improved and determining rapidly, reliably, and sensitively has been possible. In this study, the determination of RHD genotyping was investigated using fetal DNA obtained from amniotic fluid and SYBR Green I and TaqMan probe methods were compared, and reliability in prenatal diagnosis of these methods was determined. We studied 35 pregnant women in the second trimester of pregnancy. “SYBR Green I” and “TaqMan” probes results for RHD gene of genomic DNA extracted from total 35 different amniotic fluid samples acquired from 10 RHD (-) and 25 pregnant women randomly were analyzed. DNA extracted from amniotic fluid was analyzed for RHD gene with real-time PCR and the results were then compared with the RHD fetal genotype determined on RHD phenotype of the red blood cells of the infants at birth. The results of RHD TaqMan probes PCR analysis of amniotic fluid DNA were completely concordant with the fetal blood group analysis after birth. Real-time PCR using the TaqMan probes has proven to be more sensitive, accurate, and specific for RHD gene than SYBR Green I method. PMID:22346235

  3. Development of TaqMan real-time polymerase chain reaction for the detection and identification of Penicillium marneffei.

    PubMed

    Pornprasert, Sakorn; Praparattanapan, Jutarat; Khamwan, Chantana; Pawichai, Sudjai; Pimsarn, Parichat; Samleerat, Tanawan; Leechanachai, Pranee; Supparatpinyo, Khunchai

    2009-11-01

    Penicillium marneffei is a dimorphic fungus, which is endemic in Southeast Asia and responsible for emerging opportunistic infections. Diagnosis of penicilliosis may be difficult when few yeast cells are present, while a gold standard diagnosis technique requires long-term culture. In order to provide a more rapid and accurate diagnosis, we developed a TaqMan real-time PCR to detect and identify P. marneffei DNA coding for 5.8S rRNA in purified yeast DNA and clinical samples. All P. marneffei DNA preparations could be detected using specific primers and TaqMan probe. The assay has a sensitivity to detect at least 10 yeast cells in seeded blood. Moreover, it can detect P. marneffei DNA in peripheral blood samples and blood-culture bottles. Therefore, the real-time PCR assay may represent a potential tool for early diagnosis of penicilliosis marneffei.

  4. Polymeric Optical Sensors for Selective and Sensitive Nitrite Detection Using Cobalt(III) Corrole and Rh(III) Porphyrin as Ionophores

    PubMed Central

    Yang, Si; Wo, Yaqi; Meyerhoff, Mark E.

    2014-01-01

    Cobalt(III) 5, 10, 15-tris(4-tert-butylphenyl) corrole with a triphenylphosphine axial ligand and rhodium(III) 5,10,15,20-tetra(p-tert-butylphenyl)porphyrin are incorporated into plasticized poly(vinyl chloride) films to fabricate nitrite-selective bulk optodes via absorbance measurements. The resulting films yield sensitive, fast and fully reversible response toward nitrite with significantly enhanced nitrite selectivity over other anions including lipophilic anions such as thiocyanate and perchlorate. The selectivity patterns differ greatly from the Hofmeister series based on anion lipophilicity and are consistent with selectivity obtained with potentiometric sensors based on the same ionophores. The optical nitrite sensors are shown to be useful for detecting rates of emission of nitric oxide (NO) from NO releasing polymers containing S-nitroso-N-acetyl-penicillamine. PMID:25150700

  5. Clinical validation of 3 commercial real-time reverse transcriptase polymerase chain reaction assays for the detection of Middle East respiratory syndrome coronavirus from upper respiratory tract specimens.

    PubMed

    Mohamed, Deqa H; AlHetheel, AbdulKarim F; Mohamud, Hanat S; Aldosari, Kamel; Alzamil, Fahad A; Somily, Ali M

    2017-04-01

    Since discovery of Middle East respiratory syndrome coronavirus (MERS-CoV), a novel betacoronavirus first isolated and characterized in 2012, MERS-CoV real-time reverse transcriptase polymerase chain reaction (rRT-PCR) assays represent one of the most rapidly expanding commercial tests. However, in the absence of extensive evaluations of these assays on positive clinical material of different sources, evaluating their diagnostic effectiveness remains challenging. We describe the diagnostic performance evaluation of 3 common commercial MERS-CoV rRT-PCR assays on a large panel (n = 234) of upper respiratory tract specimens collected during an outbreak episode in Saudi Arabia. Assays were compared to the RealStar® MERS-CoV RT-PCR (Alton Diagnostics, Hamburg, Germany) assay as the gold standard. Results showed i) the TIB MolBiol® LightMix UpE and Orf1a assays (TIB MolBiol, Berlin, Germany) to be the most sensitive, followed by ii) the Anyplex™ Seegene MERS-CoV assay (Seegene, Seoul, Korea), and finally iii) the PrimerDesign™ Genesig® HCoV_2012 assay (PrimerDesign, England, United Kingdom). We also evaluate a modified protocol for the PrimerDesign™ Genesig® HCoV_2012 assay.

  6. Comparison of the membrane-filtration fluorescent antibody test, the enzyme-linked immunosorbent assay, and the polymerase chain reaction to detect Renibacterium salmoninarum in salmon ovarian fluid

    USGS Publications Warehouse

    Pascho, Ronald J.; Chase, Dorothy M.; McKibben, Constance L.

    1998-01-01

    Ovarian fluid samples from naturally infected chinook salmon (Oncorhynchus tshawytscha) were examined for the presence of Renibacterium salmoninarum by the membrane-filtration fluorescent antibody test (MF-FAT), an antigen capture enzyme-linked immunosorbent assay (ELISA), and a nested polymerase chain reaction (PCR). On the basis of the MF-FAT, 64% (66/103) samples contained detectable levels of R. salmoninarum cells. Among the positive fish, the R. salmoninarum concentrations ranged from 25 cells/ml to 4.3 × 109cells/ml. A soluble antigenic fraction of R. salmoninarum was detected in 39% of the fish (40/103) by the ELISA. The ELISA is considered one of the most sensitive detection methods for bacterial kidney disease in tissues, yet it did not detect R. salmoninarum antigen consistently at bacterial cell concentrations below about 1.3 × 104cells/ml according to the MF-FAT counts. When total DNA was extracted and tested in a nested PCR designed to amplify a 320-base-pair region of the gene encoding a soluble 57-kD protein of R. salmoninarum, 100% of the 100 samples tested were positive. The results provided strong evidence that R. salmoninarum may be present in ovarian fluids thought to be free of the bacterium on the basis of standard diagnostic methods.

  7. Most probable number method combined with nested polymerase chain reaction for detection and enumeration of enterotoxigenic Clostridium perfringens in intestinal contents of cattle, pig and chicken.

    PubMed

    Miwa, N; Nishina, T; Kubo, S; Atsumi, M

    1997-02-01

    The most probable number (MPN) method combined with a nested polymerase chain reaction (nested PCR) for the detection and enumeration of enterotoxigenic Clostridium perfringens in the intestinal contents of cattle, pig and chicken was examined. Ten-fold serial dilutions of samples were added to three tubes of enrichment medium, which were incubated at 37 degrees C for 20-24 hr, and the C. perfringens enterotoxin gene was detected by nested PCR from the enrichment culture without isolating the organism. The results obtained by this method with artificially contaminated intestinal contents were significantly correlated with those obtained by a plate count method. When the method was applied to the detection and enumeration of indigenous enterotoxigenic C. perfringens, the organism was found in two, two and three samples of 10 intestinal contents of cattle, pig and chicken, respectively. Most of the positive samples contained fewer than 10 MPN/g of enterotoxigenic C. perfringens, except one sample of chicken, which contained 1.5 x 10(2) MPN/g. The MPN method combined with nested PCR is easy to perform and may be a useful tool for the detection and enumeration of enterotoxigenic C. perfringens in intestinal contents.

  8. Sensitive detection of the c-KIT c.1430G>T mutation by mutant-specific polymerase chain reaction in feline mast cell tumours.

    PubMed

    Takanosu, M; Sato, M; Kagawa, Y

    2014-06-01

    Here, we describe the establishment of mutant-specific polymerase chain reaction (PCR) for detection of a c-KIT c.1430G>T mutation in feline mast cell tumours. Several mutations in feline c-KIT have been identified, with the c.1430G>T mutation accounting for a significant portion of feline mast cell tumour mutations. The c.1430G>T mutation in c-KIT exon 9 was detected in 15.7% (11 of 70) of samples by mutant-specific PCR but in only 7.1% (5 of 70) by PCR-restriction fragment length polymorphism (RFLP) in the genomic DNA isolated from 70 formalin-fixed paraffin-embedded sections or cells collected by fine needle aspiration. Mutant-specific PCR showed remarkably higher detection rate than did PCR-RFLP. DNA sequence analysis did not always yield identical results to those of mutant-specific PCR, suggesting heterogeneity of tumour cells. Mutant-specific PCR is a valid and efficient screening tool for detection of the c-KIT c.1430G>T point mutation in feline mast cell tumours compared with PCR-RFLP and sequencing analysis.

  9. Development of a rapid diagnostic assay for the detection of tomato chlorotic dwarf viroid based on isothermal reverse-transcription-recombinase polymerase amplification.

    PubMed

    Hammond, Rosemarie W; Zhang, Shulu

    2016-10-01

    A molecular diagnostic assay utilizing reverse transcription-recombinase polymerase amplification (RT-RPA) at an isothermal constant temperature of 39°C and target-specific primers and probe were developed for the rapid, sensitive, and specific detection of tomato chlorotic dwarf viroid (TCDVd) in infected leaf and seed tissues. The performance of the AmplifyRP(®) Acceler8™ RT-RPA diagnostic assay, utilizing a lateral flow strip contained within an amplicon detection chamber, was evaluated and the results were compared with a standard RT-PCR assay. The AmplifyRP(®) Acceler8™ assay was specific for TCDVd in leaf and seed tissues, its sensitivity was comparable to conventional RT-PCR in leaf tissues, and it does not require extensive sample purification, specialized equipment, or technical expertise. This is the first report utilizing an RT-RPA assay to detect viroids and the assay can be used both in the laboratory and in the field for TCDVd detection.

  10. Real-time and multiplex real-time polymerase chain reactions for the detection of Bartonella henselae within cat flea, Ctenocephalides felis, samples.

    PubMed

    Robinson, M T; Morgan, E R; Woods, D; Shaw, S E

    2010-12-01

    Bartonella henselae (Rhizobiales: Bartonellacae), the agent of cat-scratch disease, is an emerging bacterial pathogen which can be transmitted via infective faecal material of Ctenocephalides felis Bouché (Siphonaptera: Pulicidae). Worldwide, B. henselae has been identified in 1-53% of felines and 2.9-17.4% of fleas. Although culture is the routine method for detection, the procedure is time-consuming and is rarely used for isolation directly from flea vectors. The current study reports the development of a quantitative real-time polymerase chain reaction (qPCR) to detect and quantify B. henselae organisms from vector samples. The qPCR is specific and detects as few as 2.5 genome copies. To enable direct quantification of Bartonella organisms in different vector samples, we developed a qPCR to detect C. felis DNA that also acts as an extraction control. Combining both PCRs into a multiplex format validates B. henselae results when sampling flea populations, although there is a reduction in sensitivity. This reduction might be counteracted by a different combination of probe fluorophores.

  11. Development of two real-time polymerase chain reaction assays to detect Actinobacillus pleuropneumoniae serovars 1-9-11 and serovar 2.

    PubMed

    Marois-Créhan, Corinne; Lacouture, Sonia; Jacques, Mario; Fittipaldi, Nahuel; Kobisch, Marylène; Gottschalk, Marcelo

    2014-01-01

    Two real-time, or quantitative, polymerase chain reaction (qPCR) assays were developed to detect Actinobacillus pleuropneumoniae serovars 1-9-11 (highly related serovars with similar virulence potential) and serovar 2, respectively. The specificity of these assays was verified on a collection of 294 strains, which included all 16 reference A. pleuropneumoniae strains (including serovars 5a and 5b), 263 A. pleuropneumoniae field strains isolated between 1992 and 2009 in different countries, and 15 bacterial strains other than A. pleuropneumoniae. The detection levels of both qPCR tests were evaluated using 10-fold dilutions of chromosomal DNA from reference strains of A. pleuropneumoniae serovars 1 and 2, and the detection limit for both assays was 50 fg per assay. The analytical sensitivities of the qPCR tests were also estimated by using pure cultures and tonsils experimentally spiked with A. pleuropneumoniae. The detection threshold was 2.5 × 10(4) colony forming units (CFU)/ml and 2.9 × 10(5) CFU/0.1 g of tonsil, respectively, for both assays. These specific and sensitive tests can be used for the serotyping of A. pleuropneumoniae in diagnostic laboratories to control porcine pleuropneumonia.

  12. A sensitive, specific and reproducible real-time polymerase chain reaction method for detection of Plasmodium vivax and Plasmodium falciparum infection in field-collected anophelines.

    PubMed

    Bickersmith, Sara A; Lainhart, William; Moreno, Marta; Chu, Virginia M; Vinetz, Joseph M; Conn, Jan E

    2015-06-01

    We describe a simple method for detection of Plasmodium vivax and Plasmodium falciparum infection in anophelines using a triplex TaqMan real-time polymerase chain reaction (PCR) assay (18S rRNA). We tested the assay on Anopheles darlingi and Anopheles stephensi colony mosquitoes fed with Plasmodium-infected blood meals and in duplicate on field collected An. darlingi. We compared the real-time PCR results of colony-infected and field collected An. darlingi, separately, to a conventional PCR method. We determined that a cytochrome b-PCR method was only 3.33% as sensitive and 93.38% as specific as our real-time PCR assay with field-collected samples. We demonstrate that this assay is sensitive, specific and reproducible.

  13. Application of real-time quantitative polymerase chain reaction assay to detect Legionella pneumophila in patients of community-acquired pneumonia in a tertiary care hospital.

    PubMed

    Angrup, A; Chaudhry, R; Sharma, S; Valavane, A; Passi, K; Padmaja, K; Javed, S; Dey, A B; Dhawan, B; Kabra, S K

    2016-01-01

    Legionella pneumophila is one of the important pathogen responsible for community -acquired pneumonia attributing for 1-5% of cases. Since early and accurate therapy reduces mortality, rapid and reliable diagnostic methods are needed. A total of 134 samples of blood, urine and respiratory tract fluids were collected. Blood was tested for IgG, IgM and IgA antibodies using commercially available kits. A total of 8 (6%) samples were found to be positive for L. pneumophila by quantitative reverse transcription polymerase chain reaction (qRT-PCR), compared to conventional PCR where 6 (4.4%) samples were positive. Serology was positive in a total of 32 (23%) cases though only 3 (2.2%) of the PCR-positive cases were positive by serology as well. These results suggest that real-time PCR can detect Legionella infection early in the course of the disease before serological response develops.

  14. Simultaneous detection of hemagglutinin and neuraminidase genes of novel influenza A (H7N9) by duplex real-time reverse transcription polymerase chain reaction.

    PubMed

    Li, Yan; Wu, Tao; Qi, Xian; Ge, Yiyue; Guo, Xiling; Wu, Bin; Yu, Huiyan; Zhu, Yefei; Shi, Zhiyang; Wang, Hua; Cui, Lunbiao; Zhou, Minghao

    2013-12-01

    A novel reassortant influenza A (H7N9) virus emerged recently in China. In this study, a duplex real-time reverse transcription polymerase chain reaction (rRT-PCR) assay was developed for the simultaneous detection of hemagglutinin (HA) and neuraminidase (NA) genes of H7N9 influenza viruses. The sensitivity of the assay was determined to be 10 RNA copies per reaction for both HA and NA genes. No cross-reactivity was observed with other influenza virus subtypes or respiratory tract viruses. One hundred and forty-six clinical and environmental specimens were tested and compared with reference methods and were found to be consistent. The assay is suitable for large-scale screening due to short turnaround times and high specificity, sensitivity, and reproducibility.

  15. Real-time reverse-transcriptase--polymerase chain reaction for Salmonella enterica detection from jalapeño and serrano peppers.

    PubMed

    Miller, Nathan D; Draughon, Frances Ann; D'Souza, Doris H

    2010-04-01

    Outbreaks of Salmonella linked to fresh produce emphasize the need for rapid detection methods to curb the spread of foodborne pathogens. Reverse-transcriptase-polymerase chain reaction (RT-PCR) detects the presence of mRNA (shorter half-life than DNA), with greater potential of detecting viable pathogens. Real-time RT-PCR eliminates the need for gel electrophoresis and significantly enhances the speed of detection (<1 day) compared with traditional methods (>5 days). The objectives of this research were to apply real-time SYBR Green I-based RT-PCR to detect Salmonella from jalapeño and serrano peppers spiked with low and high inocula of Salmonella. Inoculated and uninoculated peppers were rinsed with water and dried under ultraviolet light for 10 min. Approximately 25 g peppers was inoculated with 10(8) to 10(1) colony forming units (CFU) of Salmonella enterica serovar Typhimurium in a stomacher bag and hand massaged in sterile 0.05 M glycine-0.14 M saline buffer (0.05% Tween, 3% beef extract) for optimal recovery of bacteria. A short preenrichment step of 6 h in buffered peptone water was needed for the detection of low inocula (10(4) CFU/25 g). One-milliliter portions of the extracts were serially diluted, plated on XLT4 agar, and used for RNA extraction with the Qiagen RNeasy Mini Kit. RT-PCR was carried out using SYBR Green I one-step RT-PCR with previously described invA gene primers and an internal amplification control. Detection limits were 10(4) CFU/25 g (approximately 10(2) CFU/g) and 10(7) CFU/25 g (approximately 10(5) CFU/g) Salmonella from enriched and unenriched inoculated peppers, respectively. Even though this method included a 6-h incubation period, the results were still obtainable in 1 day. This method shows promise for applications in routine surveillance and during outbreaks.

  16. Neutron detection of the Triga Mark III reactor, using nuclear track methodology

    SciTech Connect

    Espinosa, G. Golzarri, J. I.; Raya-Arredondo, R.; Cruz-Galindo, S.; Sajo-Bohus, L.

    2015-07-23

    Nuclear Track Methodology (NTM), based on the neutron-proton interaction is one often employed alternative for neutron detection. In this paper we apply NTM to determine the Triga Mark III reactor operating power and neutron flux. The facility nuclear core, loaded with 85 Highly Enriched Uranium as fuel with control rods in a demineralized water pool, provide a neutron flux around 2 × 10{sup 12} n cm{sup −2} s{sup −1}, at the irradiation channel TO-2. The neutron field is measured at this channel, using Landauer{sup ®} PADC as neutron detection material, covered by 3 mm Plexiglas{sup ®} as converter. After exposure, plastic detectors were chemically etched to make observable the formed latent tracks induced by proton recoils. The track density was determined by a custom made Digital Image Analysis System. The resulting average nuclear track density shows a direct proportionality response for reactor power in the range 0.1-7 kW. We indicate several advantages of the technique including the possibility to calibrate the neutron flux density measured at low reactor power.

  17. Characterization and evaluation of an arbitrary primed Polymerase Chain Reaction (PCR) product for the specific detection of Brucella species.

    PubMed

    Qasem, Jafar A; AlMomin, Sabah; Al-Mouqati, Salwa A; Kumar, Vinod

    2015-03-01

    Laboratory detection of Brucella is based largely on bacterial isolation and phenotypic characterization. These methods are lengthy and labor-intensive and have been associated with a heightened risk of laboratory-acquired infection. Antibody based indirect detection methods also suffer from limitations in proper diagnosis of the organism. To overcome these problems, nucleic acid amplification has been explored for rapid detection and confirmation of the presence of Brucella spp. PCR-based diagnostics is useful for screening large populations of livestock to identify infected individuals and confirms the presence of the pathogen. Random Amplification of Polymorphic DNA (RAPD) was performed and identified a 1.3 kb PCR fragment specifically amplifiable from DNA isolated from Brucella. A BLAST search revealed no significant homology with the reported sequences from species other than the members of Brucella. The isolated fragment seems to be a part of d-alanine-d-alanine ligase gene in Brucella sp. Translational BLAST revealed certain degree of homology of this sequence with orthologs of this gene reported from other microbial species at the deduced amino acid level. The sequence information was used to develop PCR based assays to detect Brucella sp. from various samples. The minimum detection limit of Brucella from blood and milk samples spiked with Brucella DNA was found to be 1 ng/ml and 10 ng/ml, respectively. In conclusion, we demonstrated that the PCR based detection protocol was successfully used for the detection of Brucella from various organs and spiked samples of diseased sheep. Diagnosis of Brucellosis by PCR based method reported in this study is relatively rapid, specific and simple.

  18. Detection of DNA polymerase λ activity during seed germination and enhancement after salinity stress and dehydration in the plumules of indica rice (Oryza sativa L.

    PubMed

    Sihi, Sayantani; Bakshi, Sankar; Sengupta, Dibyendu Narayan

    2015-02-01

    DNA polymerase λ (DNA pol λ) is the only reported X-family DNA polymerases in plants and has been shown to play a significant role in dry quiescent seeds, growth, development and nuclear DNA repair. cDNA for DNA pol λ has been reported in Arabidopsis and japonica rice cultivar and has been characterized from E. coli expressed protein, but very little is known about its activity at protein level in plants. The enzymatic activity of DNA pol λ was studied in dry, imbibed and during different germination stages of indica rice IR-8 (salt sensitive) by in-gel activity assay to determine its physiological role in important stages of growth and development. The upstream sequence was also analyzed using plantCARE database and was found to contain several cis-acting elements, including light responsive elements, dehydration responsive elements, Myb binding sites, etc. Hence, 4-day-old germinating seedlings of IR29, a salt-sensitive, but high yielding indica rice cultivar and Nonabokra, a salt-tolerant, but low yielding cultivar were treated with water (control) or 250 mM NaCl or 20% polyethyleneglycol-6000 for 4 and 8 h. The protein was analyzed by in vitro DNA pol λ activity assay, in-gel activity assay and Western blot analysis. DNA pol λ was not detected in dry seeds, but enhanced after imbibition and detectable from low level to high level during subsequent germination steps. Both salinity and dehydration stress led to the enhancement of the activity and protein level of DNA pol λ, as compared to control tissues. This is the first evidence of the salinity or dehydration stress induced enhancement of DNA pol λ activity in the plumules of rice (Oryza sativa L.) cultivars.

  19. Novel real-time polymerase chain reaction assay for simultaneous detection of recurrent fusion genes in acute myeloid leukemia.

    PubMed

    Dolz, Sandra; Barragán, Eva; Fuster, Óscar; Llop, Marta; Cervera, José; Such, Esperanza; De Juan, Inmaculada; Pa