polymerase iii detects: Topics by Science.gov

Sample records for polymerase iii detects

Polymerase III transcription factor B activity is reduced in extracts of growth-restricted cells.

PubMed Central

Tower, J; Sollner-Webb, B

1988-01-01

Extracts of cells that are down-regulated for transcription by RNA polymerase I and RNA polymerase III exhibit a reduced in vitro transcriptional capacity. We have recently demonstrated that the down-regulation of polymerase I transcription in extracts of cycloheximide-treated and stationary-phase cells results from a lack of an activated subform of RNA polymerase I which is essential for rDNA transcription. To examine whether polymerase III transcriptional down-regulation occurs by a similar mechanism, the polymerase III transcription factors were isolated and added singly and in pairs to control cell extracts and to extracts of cells that had reduced polymerase III transcriptional activity due to cycloheximide treatment or growth into stationary phase. These down-regulations result from a specific reduction in TFIIIB; TFIIIC and polymerase III activities remain relatively constant. Thus, although transcription by both polymerase III and polymerase I is substantially decreased in extracts of growth-arrested cells, this regulation is brought about by reduction of different kinds of activities: a component of the polymerase III stable transcription complex in the former case and the activated subform of RNA polymerase I in the latter. Images PMID:3352599
DNA Polymerase III Star Requires ATP to Start Synthesis on a Primed DNA†

PubMed Central

Wickner, William; Kornberg, Arthur

1973-01-01

DNA polymerase III star replicates a ϕX174 single-stranded, circular DNA primed with a fragment of RNA. This reaction proceeds in two stages. In stage I, a complex is formed requiring DNA polymerase III star, ATP, spermidine, copolymerase III*, and RNA-primed ϕX174 single-stranded, circular DNA. The complex, isolated by gel filtration, contains ADP and inorganic phosphate (the products of a specific ATP cleavage) as well as spermidine, polymerase III star, and copolymerase III star. In stage II, the chain grows upon addition of deoxynucleoside triphosphates; ADP and inorganic phosphate are discharged and chain elongation is resistant to antibody to copolymerase III star. Thus ATP and copolymerase III star are required to initiate chain growth but not to sustain it. Images PMID:4519657
Regional specialization in human nuclei: visualization of discrete sites of transcription by RNA polymerase III.

PubMed Central

Pombo, A; Jackson, D A; Hollinshead, M; Wang, Z; Roeder, R G; Cook, P R

1999-01-01

Mammalian nuclei contain three different RNA polymerases defined by their characteristic locations and drug sensitivities; polymerase I is found in nucleoli, and polymerases II and III in the nucleoplasm. As nascent transcripts made by polymerases I and II are concentrated in discrete sites, the locations of those made by polymerase III were investigated. HeLa cells were lysed with saponin in an improved 'physiological' buffer that preserves transcriptional activity and nuclear ultrastructure; then, engaged polymerases were allowed to extend nascent transcripts in Br-UTP, before the resulting Br-RNA was immunolabelled indirectly with fluorochromes or gold particles. Biochemical analysis showed that approximately 10 000 transcripts were being made by polymerase III at the moment of lysis, while confocal and electron microscopy showed that these transcripts were concentrated in only approximately 2000 sites (diameter approximately 40 nm). Therefore, each site contains approximately five active polymerases. These sites contain specific subunits of polymerase III, but not the hyperphosphorylated form of the largest subunit of polymerase II. The results indicate that the active forms of all three nuclear polymerases are concentrated in their own dedicated transcription sites or 'factories', suggesting that different regions of the nucleus specialize in the transcription of different types of gene. PMID:10205177
A structural role for the PHP domain in E. coli DNA polymerase III

PubMed Central

2013-01-01

Background In addition to the core catalytic machinery, bacterial replicative DNA polymerases contain a Polymerase and Histidinol Phosphatase (PHP) domain whose function is not entirely understood. The PHP domains of some bacterial replicases are active metal-dependent nucleases that may play a role in proofreading. In E. coli DNA polymerase III, however, the PHP domain has lost several metal-coordinating residues and is likely to be catalytically inactive. Results Genomic searches show that the loss of metal-coordinating residues in polymerase PHP domains is likely to have coevolved with the presence of a separate proofreading exonuclease that works with the polymerase. Although the E. coli Pol III PHP domain has lost metal-coordinating residues, the structure of the domain has been conserved to a remarkable degree when compared to that of metal-binding PHP domains. This is demonstrated by our ability to restore metal binding with only three point mutations, as confirmed by the metal-bound crystal structure of this mutant determined at 2.9 Å resolution. We also show that Pol III, a large multi-domain protein, unfolds cooperatively and that mutations in the degenerate metal-binding site of the PHP domain decrease the overall stability of Pol III and reduce its activity. Conclusions While the presence of a PHP domain in replicative bacterial polymerases is strictly conserved, its ability to coordinate metals and to perform proofreading exonuclease activity is not, suggesting additional non-enzymatic roles for the domain. Our results show that the PHP domain is a major structural element in Pol III and its integrity modulates both the stability and activity of the polymerase. PMID:23672456
A structural role for the PHP domain in E. coli DNA polymerase III.

PubMed

Barros, Tiago; Guenther, Joel; Kelch, Brian; Anaya, Jordan; Prabhakar, Arjun; O'Donnell, Mike; Kuriyan, John; Lamers, Meindert H

2013-05-14

In addition to the core catalytic machinery, bacterial replicative DNA polymerases contain a Polymerase and Histidinol Phosphatase (PHP) domain whose function is not entirely understood. The PHP domains of some bacterial replicases are active metal-dependent nucleases that may play a role in proofreading. In E. coli DNA polymerase III, however, the PHP domain has lost several metal-coordinating residues and is likely to be catalytically inactive. Genomic searches show that the loss of metal-coordinating residues in polymerase PHP domains is likely to have coevolved with the presence of a separate proofreading exonuclease that works with the polymerase. Although the E. coli Pol III PHP domain has lost metal-coordinating residues, the structure of the domain has been conserved to a remarkable degree when compared to that of metal-binding PHP domains. This is demonstrated by our ability to restore metal binding with only three point mutations, as confirmed by the metal-bound crystal structure of this mutant determined at 2.9 Å resolution. We also show that Pol III, a large multi-domain protein, unfolds cooperatively and that mutations in the degenerate metal-binding site of the PHP domain decrease the overall stability of Pol III and reduce its activity. While the presence of a PHP domain in replicative bacterial polymerases is strictly conserved, its ability to coordinate metals and to perform proofreading exonuclease activity is not, suggesting additional non-enzymatic roles for the domain. Our results show that the PHP domain is a major structural element in Pol III and its integrity modulates both the stability and activity of the polymerase.
Contributions of in vitro transcription to the understanding of human RNA polymerase III transcription

PubMed Central

Dumay-Odelot, Hélène; Durrieu-Gaillard, Stéphanie; El Ayoubi, Leyla; Parrot, Camila; Teichmann, Martin

2014-01-01

Human RNA polymerase III transcribes small untranslated RNAs that contribute to the regulation of essential cellular processes, including transcription, RNA processing and translation. Analysis of this transcription system by in vitro transcription techniques has largely contributed to the discovery of its transcription factors and to the understanding of the regulation of human RNA polymerase III transcription. Here we review some of the key steps that led to the identification of transcription factors and to the definition of minimal promoter sequences for human RNA polymerase III transcription. PMID:25764111
Intergenic Transcriptional Interference Is Blocked by RNA Polymerase III Transcription Factor TFIIIB in Saccharomyces cerevisiae

PubMed Central

Korde, Asawari; Rosselot, Jessica M.; Donze, David

2014-01-01

The major function of eukaryotic RNA polymerase III is to transcribe transfer RNA, 5S ribosomal RNA, and other small non-protein-coding RNA molecules. Assembly of the RNA polymerase III complex on chromosomal DNA requires the sequential binding of transcription factor complexes TFIIIC and TFIIIB. Recent evidence has suggested that in addition to producing RNA transcripts, chromatin-assembled RNA polymerase III complexes may mediate additional nuclear functions that include chromatin boundary, nucleosome phasing, and general genome organization activities. This study provides evidence of another such “extratranscriptional” activity of assembled RNA polymerase III complexes, which is the ability to block progression of intergenic RNA polymerase II transcription. We demonstrate that the RNA polymerase III complex bound to the tRNA gene upstream of the Saccharomyces cerevisiae ATG31 gene protects the ATG31 promoter against readthrough transcriptional interference from the upstream noncoding intergenic SUT467 transcription unit. This protection is predominately mediated by binding of the TFIIIB complex. When TFIIIB binding to this tRNA gene is weakened, an extended SUT467–ATG31 readthrough transcript is produced, resulting in compromised ATG31 translation. Since the ATG31 gene product is required for autophagy, strains expressing the readthrough transcript exhibit defective autophagy induction and reduced fitness under autophagy-inducing nitrogen starvation conditions. Given the recent discovery of widespread pervasive transcription in all forms of life, protection of neighboring genes from intergenic transcriptional interference may be a key extratranscriptional function of assembled RNA polymerase III complexes and possibly other DNA binding proteins. PMID:24336746
U6 small nuclear RNA is transcribed by RNA polymerase III.

PubMed Central

Kunkel, G R; Maser, R L; Calvet, J P; Pederson, T

1986-01-01

A DNA fragment homologous to U6 small nuclear RNA was isolated from a human genomic library and sequenced. The immediate 5'-flanking region of the U6 DNA clone had significant homology with a potential mouse U6 gene, including a "TATA box" at a position 26-29 nucleotides upstream from the transcription start site. Although this sequence element is characteristic of RNA polymerase II promoters, the U6 gene also contained a polymerase III "box A" intragenic control region and a typical run of five thymines at the 3' terminus (noncoding strand). The human U6 DNA clone was accurately transcribed in a HeLa cell S100 extract lacking polymerase II activity. U6 RNA transcription in the S100 extract was resistant to alpha-amanitin at 1 microgram/ml but was completely inhibited at 200 micrograms/ml. A comparison of fingerprints of the in vitro transcript and of U6 RNA synthesized in vivo revealed sequence congruence. U6 RNA synthesis in isolated HeLa cell nuclei also displayed low sensitivity to alpha-amanitin, in contrast to U1 and U2 RNA transcription, which was inhibited greater than 90% at 1 microgram/ml. In addition, U6 RNA synthesized in isolated nuclei was efficiently immunoprecipitated by an antibody against the La antigen, a protein known to bind most other RNA polymerase III transcripts. These results establish that, in contrast to the polymerase II-directed transcription of mammalian genes for U1-U5 small nuclear RNAs, human U6 RNA is transcribed by RNA polymerase III. Images PMID:3464970
Fructose bisphosphate aldolase is involved in the control of RNA polymerase III-directed transcription.

PubMed

Cieśla, Małgorzata; Mierzejewska, Jolanta; Adamczyk, Małgorzata; Farrants, Ann-Kristin Östlund; Boguta, Magdalena

2014-06-01

Yeast Fba1 (fructose 1,6-bisphosphate aldolase) is a glycolytic enzyme essential for viability. The overproduction of Fba1 enables overcoming of a severe growth defect caused by a missense mutation rpc128-1007 in a gene encoding the C128 protein, the second largest subunit of the RNA polymerase III complex. The suppression of the growth phenotype by Fba1 is accompanied by enhanced de novo tRNA transcription in rpc128-1007 cells. We inactivated residues critical for the catalytic activity of Fba1. Overproduction of inactive aldolase still suppressed the rpc128-1007 phenotype, indicating that the function of this glycolytic enzyme in RNA polymerase III transcription is independent of its catalytic activity. Yeast Fba1 was determined to interact with the RNA polymerase III complex by coimmunoprecipitation. Additionally, a role of aldolase in control of tRNA transcription was confirmed by ChIP experiments. The results indicate a novel direct relationship between RNA polymerase III transcription and aldolase. Copyright © 2014 Elsevier B.V. All rights reserved.
A recombinase polymerase amplification-based assay for rapid detection of African swine fever virus.

PubMed

Wang, Jianchang; Wang, Jinfeng; Geng, Yunyun; Yuan, Wanzhe

2017-10-01

A recombinase polymerase amplification (RPA)-based method was developed for rapid and specific detection of African swine fever virus (ASFV), the etiologic agent of African swine fever, a devastating disease of swine. Primers and the exo probe targeting the conserved region of the P72 gene of ASFV were designed and the reaction was run on the Genie III scanner device. Using recombinant plasmid DNA containing the P72 gene as template, we showed that the amplified product could be detected in less than 10 min and that the detection limit was 10 2 copies DNA/reaction [same detection limit as real-time polymerase chain reaction (PCR)]. The RPA assay did not cross-detect CSFV, PCV-2, PRV, PRRSV, or FMDV, common viruses seen in pigs. Tests of recombinant plasmid-spiked serum samples revealed that RPA and real-time PCR had the same diagnostic rate. The RPA assay, which is simple, cost-effective, and fast, is a promising alternative to real-time PCR for ASFV detection.
A recombinase polymerase amplification-based assay for rapid detection of African swine fever virus

PubMed Central

Wang, Jianchang; Wang, Jinfeng; Geng, Yunyun; Yuan, Wanzhe

2017-01-01

A recombinase polymerase amplification (RPA)-based method was developed for rapid and specific detection of African swine fever virus (ASFV), the etiologic agent of African swine fever, a devastating disease of swine. Primers and the exo probe targeting the conserved region of the P72 gene of ASFV were designed and the reaction was run on the Genie III scanner device. Using recombinant plasmid DNA containing the P72 gene as template, we showed that the amplified product could be detected in less than 10 min and that the detection limit was 102 copies DNA/reaction [same detection limit as real-time polymerase chain reaction (PCR)]. The RPA assay did not cross-detect CSFV, PCV-2, PRV, PRRSV, or FMDV, common viruses seen in pigs. Tests of recombinant plasmid-spiked serum samples revealed that RPA and real-time PCR had the same diagnostic rate. The RPA assay, which is simple, cost-effective, and fast, is a promising alternative to real-time PCR for ASFV detection. PMID:29081590
Retrotransposon profiling of RNA polymerase III initiation sites.

PubMed

Qi, Xiaojie; Daily, Kenneth; Nguyen, Kim; Wang, Haoyi; Mayhew, David; Rigor, Paul; Forouzan, Sholeh; Johnston, Mark; Mitra, Robi David; Baldi, Pierre; Sandmeyer, Suzanne

2012-04-01

Although retroviruses are relatively promiscuous in choice of integration sites, retrotransposons can display marked integration specificity. In yeast and slime mold, some retrotransposons are associated with tRNA genes (tDNAs). In the Saccharomyces cerevisiae genome, the long terminal repeat retrotransposon Ty3 is found at RNA polymerase III (Pol III) transcription start sites of tDNAs. Ty1, 2, and 4 elements also cluster in the upstream regions of these genes. To determine the extent to which other Pol III-transcribed genes serve as genomic targets for Ty3, a set of 10,000 Ty3 genomic retrotranspositions were mapped using high-throughput DNA sequencing. Integrations occurred at all known tDNAs, two tDNA relics (iYGR033c and ZOD1), and six non-tDNA, Pol III-transcribed types of genes (RDN5, SNR6, SNR52, RPR1, RNA170, and SCR1). Previous work in vitro demonstrated that the Pol III transcription factor (TF) IIIB is important for Ty3 targeting. However, seven loci that bind the TFIIIB loader, TFIIIC, were not targeted, underscoring the unexplained absence of TFIIIB at those sites. Ty3 integrations also occurred in two open reading frames not previously associated with Pol III transcription, suggesting the existence of a small number of additional sites in the yeast genome that interact with Pol III transcription complexes.
Inhibition of host cell RNA polymerase III-mediated transcription by poliovirus: Inactivation of specific transcription factors

DOE Office of Scientific and Technical Information (OSTI.GOV)

Fradkin, L.G.; Yoshinaga, S.K.; Berk, A.J.

1987-11-01

The inhibition of transcription by RNA polymerase III in poliovirus-infected cells was studied. Experiments utilizing two different cell lines showed that the initiation step of transcription by RNA polymerase III was impaired by infection of these cells with the virus. The observed inhibition of transcription was not due to shut-off of host cell protein synthesis by poliovirus. Among four distinct components required for accurate transcription in vitro from cloned DNA templates, activities of RNA polymerase III and transcription factor TFIIIA were not significantly affected by virus infection. The activity of transcription factor TFIIIC, the limiting component required for transcription ofmore » RNA polymerase III genes, was severely inhibited in infected cells, whereas that of transcription factor TFIIIB was inhibited to a lesser extent. The sequence-specific DNA-binding of TFIIIC to the adenovirus VA1 gene internal promoted, however, was not altered by infection of cells with the virus. The authors conclude that (i) at least two transcription factors, TFIIIB and TFIIIC, are inhibited by infection of cells with poliovirtus, (ii) inactivation of TFIIIC does not involve destruction of its DNA-binding domain, and (iii) sequence-specific DNA binding by TFIIIC may be necessary but is not sufficient for the formation of productive transcription complexes.« less
Selective repression of SINE transcription by RNA polymerase III.

PubMed

Varshney, Dhaval; Vavrova-Anderson, Jana; Oler, Andrew J; Cairns, Bradley R; White, Robert J

2015-01-01

A million copies of the Alu short interspersed nuclear element (SINE) are scattered throughout the human genome, providing ∼11% of our total DNA. SINEs spread by retrotransposition, using a transcript generated by RNA polymerase (pol) III from an internal promoter. Levels of these pol III-dependent Alu transcripts are far lower than might be expected from the abundance of the template. This was believed to reflect transcriptional suppression through DNA methylation, denying pol III access to most SINEs through chromatin-mediated effects. Contrary to expectations, our recent study found no evidence that methylation of SINE DNA reduces its occupancy or expression by pol III. However, histone H3 associated with SINEs is prominently methylated on lysine 9, a mark that correlates with transcriptional silencing. The SUV39 methyltransferases that deposit this mark can be found at many SINEs. Furthermore, a selective inhibitor of SUV39 stimulates pol III recruitment to these loci, as well as SINE expression. These data suggest that methylation of histone H3 rather than DNA may mediate repression of SINE transcription by pol III, at least under the conditions we studied.
Distinguishing Core and Holoenzyme Mechanisms of Transcription Termination by RNA Polymerase III

PubMed Central

Arimbasseri, Aneeshkumar G.

2013-01-01

Transcription termination by RNA polymerase (Pol) III serves multiple purposes; it delimits interference with downstream genes, forms 3′ oligo(U) binding sites for the posttranscriptional processing factor, La protein, and resets the polymerase complex for reinitiation. Although an interplay of several Pol III subunits is known to collectively control these activities, how they affect molecular function of the active center during termination is incompletely understood. We have approached this using immobilized Pol III-nucleic acid scaffolds to examine the two major components of termination, transcription pausing and RNA release. This allowed us to distinguish two mechanisms of termination by isolated Saccharomyces cerevisiae Pol III. A core mechanism can operate in the absence of C53/37 and C11 subunits but requires synthesis of 8 or more 3′ U nucleotides, apparently reflecting inherent sensitivity to an oligo(rU·dA) hybrid that is the termination signal proper. The holoenzyme mechanism requires fewer U nucleotides but uses C53/37 and C11 to slow elongation and prevent terminator arrest. N-terminal truncation of C53 or point mutations that disable the cleavage activity of C11 impair their antiarrest activities. The data are consistent with a model in which C53, C37, and C11 activities are functionally integrated with the active center of Pol III during termination. PMID:23401852
A multiplicity of factors contributes to selective RNA polymerase III occupancy of a subset of RNA polymerase III genes in mouse liver

PubMed Central

Canella, Donatella; Bernasconi, David; Gilardi, Federica; LeMartelot, Gwendal; Migliavacca, Eugenia; Praz, Viviane; Cousin, Pascal; Delorenzi, Mauro; Hernandez, Nouria; Hernandez, Nouria; Delorenzi, Mauro; Deplancke, Bart; Desvergne, Béatrice; Guex, Nicolas; Herr, Winship; Naef, Felix; Rougemont, Jacques; Schibler, Ueli; Deplancke, Bart; Guex, Nicolas; Herr, Winship; Guex, Nicolas; Andersin, Teemu; Cousin, Pascal; Gilardi, Federica; Gos, Pascal; Le Martelot, Gwendal; Lammers, Fabienne; Canella, Donatella; Gilardi, Federica; Raghav, Sunil; Fabbretti, Roberto; Fortier, Arnaud; Long, Li; Vlegel, Volker; Xenarios, Ioannis; Migliavacca, Eugenia; Praz, Viviane; Guex, Nicolas; Naef, Felix; Rougemont, Jacques; David, Fabrice; Jarosz, Yohan; Kuznetsov, Dmitry; Liechti, Robin; Martin, Olivier; Ross, Frederick; Sinclair, Lucas; Cajan, Julia; Krier, Irina; Leleu, Marion; Migliavacca, Eugenia; Molina, Nacho; Naldi, Aurélien; Rey, Guillaume; Symul, Laura; Guex, Nicolas; Naef, Felix; Rougemont, Jacques; Bernasconi, David; Delorenzi, Mauro; Andersin, Teemu; Canella, Donatella; Gilardi, Federica; Le Martelot, Gwendal; Lammers, Fabienne; Raghav, Sunil

2012-01-01

The genomic loci occupied by RNA polymerase (RNAP) III have been characterized in human culture cells by genome-wide chromatin immunoprecipitations, followed by deep sequencing (ChIP-seq). These studies have shown that only ∼40% of the annotated 622 human tRNA genes and pseudogenes are occupied by RNAP-III, and that these genes are often in open chromatin regions rich in active RNAP-II transcription units. We have used ChIP-seq to characterize RNAP-III-occupied loci in a differentiated tissue, the mouse liver. Our studies define the mouse liver RNAP-III-occupied loci including a conserved mammalian interspersed repeat (MIR) as a potential regulator of an RNAP-III subunit-encoding gene. They reveal that synteny relationships can be established between a number of human and mouse RNAP-III genes, and that the expression levels of these genes are significantly linked. They establish that variations within the A and B promoter boxes, as well as the strength of the terminator sequence, can strongly affect RNAP-III occupancy of tRNA genes. They reveal correlations with various genomic features that explain the observed variation of 81% of tRNA scores. In mouse liver, loci represented in the NCBI37/mm9 genome assembly that are clearly occupied by RNAP-III comprise 50 Rn5s (5S RNA) genes, 14 known non-tRNA RNAP-III genes, nine Rn4.5s (4.5S RNA) genes, and 29 SINEs. Moreover, out of the 433 annotated tRNA genes, half are occupied by RNAP-III. Transfer RNA gene expression levels reflect both an underlying genomic organization conserved in dividing human culture cells and resting mouse liver cells, and the particular promoter and terminator strengths of individual genes. PMID:22287103
New insights into the promoterless transcription of DNA coligo templates by RNA polymerase III.

PubMed

Lama, Lodoe; Seidl, Christine I; Ryan, Kevin

2014-01-01

Chemically synthesized DNA can carry small RNA sequence information but converting that information into small RNA is generally thought to require large double-stranded promoters in the context of plasmids, viruses and genes. We previously found evidence that circularized oligodeoxynucleotides (coligos) containing certain sequences and secondary structures can template the synthesis of small RNA by RNA polymerase III in vitro and in human cells. By using immunoprecipitated RNA polymerase III we now report corroborating evidence that this enzyme is the sole polymerase responsible for coligo transcription. The immobilized polymerase enabled experiments showing that coligo transcripts can be formed through transcription termination without subsequent 3' end trimming. To better define the determinants of productive transcription, a structure-activity relationship study was performed using over 20 new coligos. The results show that unpaired nucleotides in the coligo stem facilitate circumtranscription, but also that internal loops and bulges should be kept small to avoid secondary transcription initiation sites. A polymerase termination sequence embedded in the double-stranded region of a hairpin-encoding coligo stem can antagonize transcription. Using lessons learned from new and old coligos, we demonstrate how to convert poorly transcribed coligos into productive templates. Our findings support the possibility that coligos may prove useful as chemically synthesized vectors for the ectopic expression of small RNA in human cells.
New insights into the promoterless transcription of DNA coligo templates by RNA polymerase III

PubMed Central

Lama, Lodoe; Seidl, Christine I; Ryan, Kevin

2014-01-01

Chemically synthesized DNA can carry small RNA sequence information but converting that information into small RNA is generally thought to require large double-stranded promoters in the context of plasmids, viruses and genes. We previously found evidence that circularized oligodeoxynucleotides (coligos) containing certain sequences and secondary structures can template the synthesis of small RNA by RNA polymerase III in vitro and in human cells. By using immunoprecipitated RNA polymerase III we now report corroborating evidence that this enzyme is the sole polymerase responsible for coligo transcription. The immobilized polymerase enabled experiments showing that coligo transcripts can be formed through transcription termination without subsequent 3′ end trimming. To better define the determinants of productive transcription, a structure-activity relationship study was performed using over 20 new coligos. The results show that unpaired nucleotides in the coligo stem facilitate circumtranscription, but also that internal loops and bulges should be kept small to avoid secondary transcription initiation sites. A polymerase termination sequence embedded in the double-stranded region of a hairpin-encoding coligo stem can antagonize transcription. Using lessons learned from new and old coligos, we demonstrate how to convert poorly transcribed coligos into productive templates. Our findings support the possibility that coligos may prove useful as chemically synthesized vectors for the ectopic expression of small RNA in human cells. PMID:25764216
Upstream regulatory elements are necessary and sufficient for transcription of a U6 RNA gene by RNA polymerase III.

PubMed Central

Das, G; Henning, D; Wright, D; Reddy, R

1988-01-01

Whereas the genes coding for trimethyl guanosine-capped snRNAs are transcribed by RNA polymerase II, the U6 RNA genes are transcribed by RNA polymerase III. In this study, we have analyzed the cis-regulatory elements involved in the transcription of a mouse U6 snRNA gene in vitro and in frog oocytes. Transcriptional analysis of mutant U6 gene constructs showed that, unlike most known cases of polymerase III transcription, intragenic sequences except the initiation nucleotide are dispensable for efficient and accurate transcription of U6 gene in vitro. Transcription of 5' deletion mutants in vitro and in frog oocytes showed that the upstream region, within 79 bp from the initiation nucleotide, contains elements necessary for U6 gene transcription. Transcription studies were carried out in frog oocytes with U6 genes containing 5' distal sequence; these studies revealed that the distal element acts as an orientation-dependent enhancer when present upstream to the gene, while it is orientation-independent but distance-dependent enhancer when placed down-stream to the U6 gene. Analysis of 3' deletion mutants showed that the transcription termination of U6 RNA is dependent on a T cluster present on the 3' end of the gene, thus providing further support to other lines of evidence that U6 genes are transcribed by RNA polymerase III. These observations suggest the involvement of a composite of components of RNA polymerase II and III transcription machineries in the transcription of U6 genes by RNA polymerase III. Images PMID:3366121
Nucleosome Positioning and NDR Structure at RNA Polymerase III Promoters

NASA Astrophysics Data System (ADS)

Helbo, Alexandra Søgaard; Lay, Fides D.; Jones, Peter A.; Liang, Gangning; Grønbæk, Kirsten

2017-02-01

Chromatin is structurally involved in the transcriptional regulation of all genes. While the nucleosome positioning at RNA polymerase II (pol II) promoters has been extensively studied, less is known about the chromatin structure at pol III promoters in human cells. We use a high-resolution analysis to show substantial differences in chromatin structure of pol II and pol III promoters, and between subtypes of pol III genes. Notably, the nucleosome depleted region at the transcription start site of pol III genes extends past the termination sequences, resulting in nucleosome free gene bodies. The +1 nucleosome is located further downstream than at pol II genes and furthermore displays weak positioning. The variable position of the +1 location is seen not only within individual cell populations and between cell types, but also between different pol III promoter subtypes, suggesting that the +1 nucleosome may be involved in the transcriptional regulation of pol III genes. We find that expression and DNA methylation patterns correlate with distinct accessibility patterns, where DNA methylation associates with the silencing and inaccessibility at promoters. Taken together, this study provides the first high-resolution map of nucleosome positioning and occupancy at human pol III promoters at specific loci and genome wide.

Effect of single DNA lesions on in vitro replication with DNA polymerase III holoenzyme. Comparison with other polymerases.

PubMed

Belguise-Valladier, P; Maki, H; Sekiguchi, M; Fuchs, R P

1994-02-11

In the present work, we have studied in vitro replication of N-2-acetylaminofluorene (AAF) or cis-diamminedichloroplatinum II (cis-DDP) single modified DNA templates. We used the holoenzyme (pol III HE) or the alpha subunit of DNA polymerase III, which is involved in SOS mutagenesis, and other DNA polymerases in order to compare enzymes having different biological roles and properties. Single-stranded oligonucleotides (63-mer) bearing a single AAF adduct at one of the different guanine residues of the NarI sequence (-G1G2CG3CC-) have been used in primer extension assays. Site-specifically platinated 5'd(ApG) or 5'd(GpG) oligonucleotides were constructed and similarly used in primer extension assays. In all cases, irrespective of both the chemical nature of the lesion (i.e. AAF or cis-DDP) and its local sequence context (i.e. the 3 different sites for AAF adducts within the NarI site) replication by pol III HE and pol I Klenow fragment (pol I Kf) stops one base prior to the adduct site. Removal of the 3'-->5' proofreading activity alone was not sufficient to trigger bypass of DNA lesions. Indeed, when proofreading activity of pol I is inactivated by a point mutation (pol I Kf (exo-)), the major replication product corresponds to the position opposite the adduct site showing that incorporation across from the AAF adduct is possible. These results suggest that a polymerase with proofreading activity is actually found to stop one nucleotide before the adduct not because it is unable to insert a nucleotide opposite the adduct but most likely because elongation past the adduct is strongly impaired, giving thus an increased time frame for the proofreading exonuclease to remove the base inserted across from the adduct. These results are discussed in terms of their implications for error-free and error-prone bypass in vivo.
Evidence for Moonlighting Functions of the θ Subunit of Escherichia coli DNA Polymerase III

PubMed Central

Dietrich, M.; Pedró, L.; García, J.; Pons, M.; Hüttener, M.; Paytubi, S.; Madrid, C.

2014-01-01

The holE gene is an enterobacterial ORFan gene (open reading frame [ORF] with no detectable homology to other ORFs in a database). It encodes the θ subunit of the DNA polymerase III core complex. The precise function of the θ subunit within this complex is not well established, and loss of holE does not result in a noticeable phenotype. Paralogs of holE are also present on many conjugative plasmids and on phage P1 (hot gene). In this study, we provide evidence indicating that θ (HolE) exhibits structural and functional similarities to a family of nucleoid-associated regulatory proteins, the Hha/YdgT-like proteins that are also encoded by enterobacterial ORFan genes. Microarray studies comparing the transcriptional profiles of Escherichia coli holE, hha, and ydgT mutants revealed highly similar expression patterns for strains harboring holE and ydgT alleles. Among the genes differentially regulated in both mutants were genes of the tryptophanase (tna) operon. The tna operon consists of a transcribed leader region, tnaL, and two structural genes, tnaA and tnaB. Further experiments with transcriptional lacZ fusions (tnaL::lacZ and tnaA::lacZ) indicate that HolE and YdgT downregulate expression of the tna operon by possibly increasing the level of Rho-dependent transcription termination at the tna operon's leader region. Thus, for the first time, a regulatory function can be attributed to HolE, in addition to its role as structural component of the DNA polymerase III complex. PMID:24375106
Facilitated recycling protects human RNA polymerase III from repression by Maf1 in vitro.

PubMed

Cabart, Pavel; Lee, JaeHoon; Willis, Ian M

2008-12-26

Yeast cells synthesize approximately 3-6 million molecules of tRNA every cell cycle at a rate of approximately 2-4 transcripts/gene/s. This high rate of transcription is achieved through many rounds of reinitiation by RNA polymerase (pol) III on stable DNA-bound complexes of the initiation factor TFIIIB. Studies in yeast have shown that the rate of reinitiation is increased by facilitated recycling, a process that involves the repeated reloading of the polymerase on the same transcription unit. However, when nutrients become limiting or stress conditions are encountered, RNA pol III transcription is rapidly repressed through the action of the conserved Maf1 protein. Here we examine the relationship between Maf1-mediated repression and facilitated recycling in a human RNA pol III in vitro system. Using an immobilized template transcription assay, we demonstrate that facilitated recycling is conserved from yeast to humans. We assessed the ability of recombinant human Maf1 to inhibit different steps in transcription before and after preinitiation complex assembly. We show that recombinant Maf1 can inhibit the recruitment of TFIIIB and RNA pol III to immobilized templates. However, RNA pol III bound to preinitiation complexes or in elongation complexes is protected from repression by Maf1 and can undergo several rounds of initiation. This indicates that recombinant Maf1 is unable to inhibit facilitated recycling. The data suggest that additional biochemical steps may be necessary for rapid Maf1-dependent repression of RNA pol III transcription.
Protein Affinity Chromatography with Purified Yeast DNA Polymerase α Detects Proteins that Bind to DNA Polymerase

NASA Astrophysics Data System (ADS)

Miles, Jeff; Formosa, Tim

1992-02-01

We have overexpressed the POL1 gene of the yeast Saccharomyces cerevisiae and purified the resulting DNA polymerase α polypeptide in an apparently intact form. We attached the purified DNA polymerase covalently to an agarose matrix and used this matrix to chromatograph extracts prepared from yeast cells. At least six proteins bound to the yeast DNA polymerase α matrix that did not bind to a control matrix. We speculate that these proteins might be DNA polymerase α accessory proteins. Consistent with this interpretation, one of the binding proteins, which we have named POB1 (polymerase one binding), is required for normal chromosome transmission. Mutations in this gene cause increased chromosome loss and an abnormal cell morphology, phenotypes that also occur in the presence of mutations in the yeast α or δ polymerase genes. These results suggest that the interactions detected by polymerase affinity chromatography are biologically relevant and may help to illuminate the architecture of the eukaryotic DNA replication machinery.
Subunit compositions of Arabidopsis RNA polymerases I and III reveal Pol I- and Pol III-specific forms of the AC40 subunit and alternative forms of the C53 subunit

PubMed Central

Ream, Thomas S.; Haag, Jeremy R.; Pontvianne, Frederic; Nicora, Carrie D.; Norbeck, Angela D.; Paša-Tolić, Ljiljana; Pikaard, Craig S.

2015-01-01

Using affinity purification and mass spectrometry, we identified the subunits of Arabidopsis thaliana multisubunit RNA polymerases I and III (abbreviated as Pol I and Pol III), the first analysis of their physical compositions in plants. In all eukaryotes examined to date, AC40 and AC19 subunits are common to Pol I (a.k.a. Pol A) and Pol III (a.k.a. Pol C) and are encoded by single genes. Surprisingly, A. thaliana and related species express two distinct AC40 paralogs, one of which assembles into Pol I and the other of which assembles into Pol III. Changes at eight amino acid positions correlate with the functional divergence of Pol I- and Pol III-specific AC40 paralogs. Two genes encode homologs of the yeast C53 subunit and either protein can assemble into Pol III. By contrast, only one of two potential C17 variants, and one of two potential C31 variants were detected in Pol III. We introduce a new nomenclature system for plant Pol I and Pol III subunits in which the 12 subunits that are structurally and functionally homologous among Pols I through V are assigned equivalent numbers. PMID:25813043
Comprehensive analysis of DNA polymerase III α subunits and their homologs in bacterial genomes

PubMed Central

Timinskas, Kęstutis; Balvočiūtė, Monika; Timinskas, Albertas; Venclovas, Česlovas

2014-01-01

The analysis of ∼2000 bacterial genomes revealed that they all, without a single exception, encode one or more DNA polymerase III α-subunit (PolIIIα) homologs. Classified into C-family of DNA polymerases they come in two major forms, PolC and DnaE, related by ancient duplication. While PolC represents an evolutionary compact group, DnaE can be further subdivided into at least three groups (DnaE1-3). We performed an extensive analysis of various sequence, structure and surface properties of all four polymerase groups. Our analysis suggests a specific evolutionary pathway leading to PolC and DnaE from the last common ancestor and reveals important differences between extant polymerase groups. Among them, DnaE1 and PolC show the highest conservation of the analyzed properties. DnaE3 polymerases apparently represent an ‘impaired’ version of DnaE1. Nonessential DnaE2 polymerases, typical for oxygen-using bacteria with large GC-rich genomes, have a number of features in common with DnaE3 polymerases. The analysis of polymerase distribution in genomes revealed three major combinations: DnaE1 either alone or accompanied by one or more DnaE2s, PolC + DnaE3 and PolC + DnaE1. The first two combinations are present in Escherichia coli and Bacillus subtilis, respectively. The third one (PolC + DnaE1), found in Clostridia, represents a novel, so far experimentally uncharacterized, set. PMID:24106089
Genomic Binding Profiles of Functionally Distinct RNA Polymerase III Transcription Complexes in Human Cells

PubMed Central

Moqtaderi, Zarmik; Wang, Jie; Raha, Debasish; White, Robert J.; Snyder, Michael; Weng, Zhiping; Struhl, Kevin

2012-01-01

Genome-wide occupancy profiles of five components of the RNA Polymerase III (Pol III) machinery in human cells identified the expected tRNA and non-coding RNA targets and revealed many additional Pol III-associated loci, mostly near SINEs. Several genes are targets of an alternative TFIIIB containing Brf2 instead of Brf1 and have extremely low levels of TFIIIC. Strikingly, expressed Pol III genes, unlike non-expressed Pol III genes, are situated in regions with a pattern of histone modifications associated with functional Pol II promoters. TFIIIC alone associates with numerous ETC loci, via the B box or a novel motif. ETCs are often near CTCF binding sites, suggesting a potential role in chromosome organization. Our results suggest that human Pol III complexes associate preferentially with regions near functional Pol II promoters and that TFIIIC-mediated recruitment of TFIIIB is regulated in a locus-specific manner. PMID:20418883
Genomic binding profiles of functionally distinct RNA polymerase III transcription complexes in human cells.

PubMed

Moqtaderi, Zarmik; Wang, Jie; Raha, Debasish; White, Robert J; Snyder, Michael; Weng, Zhiping; Struhl, Kevin

2010-05-01

Genome-wide occupancy profiles of five components of the RNA polymerase III (Pol III) machinery in human cells identified the expected tRNA and noncoding RNA targets and revealed many additional Pol III-associated loci, mostly near short interspersed elements (SINEs). Several genes are targets of an alternative transcription factor IIIB (TFIIIB) containing Brf2 instead of Brf1 and have extremely low levels of TFIIIC. Strikingly, expressed Pol III genes, unlike nonexpressed Pol III genes, are situated in regions with a pattern of histone modifications associated with functional Pol II promoters. TFIIIC alone associates with numerous ETC loci, via the B box or a novel motif. ETCs are often near CTCF binding sites, suggesting a potential role in chromosome organization. Our results suggest that human Pol III complexes associate preferentially with regions near functional Pol II promoters and that TFIIIC-mediated recruitment of TFIIIB is regulated in a locus-specific manner.
Subunit compositions of Arabidopsis RNA polymerases I and III reveal Pol I- and Pol III-specific forms of the AC40 subunit and alternative forms of the C53 subunit

DOE PAGES

Ream, Thomas S.; Haag, Jeremy R.; Pontvianne, Frederic; ...

2015-05-02

Using affinity purification and mass spectrometry, we identified the subunits of Arabidopsis thaliana multisubunit RNA Polymerases I and III (abbreviated as Pol I and Pol III), providing the first description of their physical compositions in plants. AC40 and AC19 subunits are typically common to Pol I (a.k.a. Pol A) and Pol III (a.k.a. Pol C) and are encoded by single genes whose mutation, in humans, is a cause of the craniofacial disorder, Treacher-Collins Syndrome. Surprisingly, A. thaliana, and related species, express two distinct AC40 paralogs, one of which assembles into Pol I and the other of which assembles into Polmore » III. Changes at eight amino acid positions correlate with this functional divergence of Pol I and Pol III-specific AC40 paralogs. Two genes encode homologs of the yeast C53 subunit, and either variant can assemble into Pol III. By contrast, only one of two potential C17 variants, and one of two potential C31 variants were detected in Pol III. We introduce a new nomenclature system for plant Pol I and Pol III subunits in which the twelve subunits that are structurally and functionally homologous among Pols I through V are assigned equivalent numbers.« less
Subunit compositions of Arabidopsis RNA polymerases I and III reveal Pol I- and Pol III-specific forms of the AC40 subunit and alternative forms of the C53 subunit

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ream, Thomas S.; Haag, Jeremy R.; Pontvianne, Frederic

Using affinity purification and mass spectrometry, we identified the subunits of Arabidopsis thaliana multisubunit RNA Polymerases I and III (abbreviated as Pol I and Pol III), providing the first description of their physical compositions in plants. AC40 and AC19 subunits are typically common to Pol I (a.k.a. Pol A) and Pol III (a.k.a. Pol C) and are encoded by single genes whose mutation, in humans, is a cause of the craniofacial disorder, Treacher-Collins Syndrome. Surprisingly, A. thaliana, and related species, express two distinct AC40 paralogs, one of which assembles into Pol I and the other of which assembles into Polmore » III. Changes at eight amino acid positions correlate with this functional divergence of Pol I and Pol III-specific AC40 paralogs. Two genes encode homologs of the yeast C53 subunit, and either variant can assemble into Pol III. By contrast, only one of two potential C17 variants, and one of two potential C31 variants were detected in Pol III. We introduce a new nomenclature system for plant Pol I and Pol III subunits in which the twelve subunits that are structurally and functionally homologous among Pols I through V are assigned equivalent numbers.« less
Polyadenylation of RNA transcribed from mammalian SINEs by RNA polymerase III: Complex requirements for nucleotide sequences.

PubMed

Borodulina, Olga R; Golubchikova, Julia S; Ustyantsev, Ilia G; Kramerov, Dmitri A

2016-02-01

It is generally accepted that only transcripts synthesized by RNA polymerase II (e.g., mRNA) were subject to AAUAAA-dependent polyadenylation. However, we previously showed that RNA transcribed by RNA polymerase III (pol III) from mouse B2 SINE could be polyadenylated in an AAUAAA-dependent manner. Many species of mammalian SINEs end with the pol III transcriptional terminator (TTTTT) and contain hexamers AATAAA in their A-rich tail. Such SINEs were united into Class T(+), whereas SINEs lacking the terminator and AATAAA sequences were classified as T(-). Here we studied the structural features of SINE pol III transcripts that are necessary for their polyadenylation. Eight and six SINE families from classes T(+) and T(-), respectively, were analyzed. The replacement of AATAAA with AACAAA in T(+) SINEs abolished the RNA polyadenylation. Interestingly, insertion of the polyadenylation signal (AATAAA) and pol III transcription terminator in T(-) SINEs did not result in polyadenylation. The detailed analysis of three T(+) SINEs (B2, DIP, and VES) revealed areas important for the polyadenylation of their pol III transcripts: the polyadenylation signal and terminator in A-rich tail, β region positioned immediately downstream of the box B of pol III promoter, and τ region located upstream of the tail. In DIP and VES (but not in B2), the τ region is a polypyrimidine motif which is also characteristic of many other T(+) SINEs. Most likely, SINEs of different mammals acquired these structural features independently as a result of parallel evolution. Copyright © 2015 Elsevier B.V. All rights reserved.
RNA polymerase III transcription - regulated by chromatin structure and regulator of nuclear chromatin organization.

PubMed

Pascali, Chiara; Teichmann, Martin

2013-01-01

RNA polymerase III (Pol III) transcription is regulated by modifications of the chromatin. DNA methylation and post-translational modifications of histones, such as acetylation, phosphorylation and methylation have been linked to Pol III transcriptional activity. In addition to being regulated by modifications of DNA and histones, Pol III genes and its transcription factors have been implicated in the organization of nuclear chromatin in several organisms. In yeast, the ability of the Pol III transcription system to contribute to nuclear organization seems to be dependent on direct interactions of Pol III genes and/or its transcription factors TFIIIC and TFIIIB with the structural maintenance of chromatin (SMC) protein-containing complexes cohesin and condensin. In human cells, Pol III genes and transcription factors have also been shown to colocalize with cohesin and the transcription regulator and genome organizer CCCTC-binding factor (CTCF). Furthermore, chromosomal sites have been identified in yeast and humans that are bound by partial Pol III machineries (extra TFIIIC sites - ETC; chromosome organizing clamps - COC). These ETCs/COC as well as Pol III genes possess the ability to act as boundary elements that restrict spreading of heterochromatin.
Direct regulation of RNA polymerase III transcription by RB, p53 and c-Myc.

PubMed

Felton-Edkins, Zoë A; Kenneth, Niall S; Brown, Timothy R P; Daly, Nicole L; Gomez-Roman, Natividad; Grandori, Carla; Eisenman, Robert N; White, Robert J

2003-01-01

The synthesis of tRNA and 5S rRNA by RNA polymerase (pol) III is cell cycle regulated in higher organisms. Overexpression of pol III products is a general feature of transformed cells. These observations may be explained by the fact that a pol III-specific transcription factor, TFIIIB, is strongly regulated by the tumor suppressors RB and p53, as well as the proto-oncogene product c-Myc. RB and p53 repress TFIIIB, but this restraint can be lost in tumors through a variety of mechanisms. In contrast, c-Myc binds and activates TFIIIB, causing potent induction of pol III transcription. Using chromatin immunoprecipitation and RNA interference, we show that c-Myc interacts with tRNA and 5S rRNA genes in transformed cervical cells, stimulating their expression. Availability of pol III products may be an important determinant of a cell's capacity to grow. The ability to regulate pol III output may therefore be integral to the growth control functions of RB, p53 and c-Myc.
Detection of Entamoeba histolytica by Recombinase Polymerase Amplification

PubMed Central

Nair, Gayatri; Rebolledo, Mauricio; White, A. Clinton; Crannell, Zachary; Richards-Kortum, R. Rebecca; Pinilla, A. Elizabeth; Ramírez, Juan David; López, M. Consuelo; Castellanos-Gonzalez, Alejandro

2015-01-01

Amebiasis is an important cause of diarrheal disease worldwide and has been associated with childhood malnutrition. Traditional microscopy approaches are neither sensitive nor specific for Entamoeba histolytica. Antigen assays are more specific, but many cases are missed unless tested by molecular methods. Although polymerase chain reaction (PCR) is effective, the need for sophisticated, expensive equipment, infrastructure, and trained personnel limits its usefulness, especially in the resource-limited, endemic areas. Here, we report development of a recombinase polymerase amplification (RPA) method to detect E. histolytica specifically. Using visual detection by lateral flow (LF), the test was highly sensitive and specific and could be performed without additional equipment. The availability of this inexpensive, sensitive, and field-applicable diagnostic test could facilitate rapid diagnosis and treatment of amebiasis in endemic regions. PMID:26123960
The β2 clamp in the Mycobacterium tuberculosis DNA polymerase III αβ2ε replicase promotes polymerization and reduces exonuclease activity

PubMed Central

Gu, Shoujin; Li, Wenjuan; Zhang, Hongtai; Fleming, Joy; Yang, Weiqiang; Wang, Shihua; Wei, Wenjing; Zhou, Jie; Zhu, Guofeng; Deng, Jiaoyu; Hou, Jian; Zhou, Ying; Lin, Shiqiang; Zhang, Xian-En; Bi, Lijun

2016-01-01

DNA polymerase III (DNA pol III) is a multi-subunit replication machine responsible for the accurate and rapid replication of bacterial genomes, however, how it functions in Mycobacterium tuberculosis (Mtb) requires further investigation. We have reconstituted the leading-strand replication process of the Mtb DNA pol III holoenzyme in vitro, and investigated the physical and functional relationships between its key components. We verify the presence of an αβ2ε polymerase-clamp-exonuclease replicase complex by biochemical methods and protein-protein interaction assays in vitro and in vivo and confirm that, in addition to the polymerase activity of its α subunit, Mtb DNA pol III has two potential proofreading subunits; the α and ε subunits. During DNA replication, the presence of the β2 clamp strongly promotes the polymerization of the αβ2ε replicase and reduces its exonuclease activity. Our work provides a foundation for further research on the mechanism by which the replication machinery switches between replication and proofreading and provides an experimental platform for the selection of antimicrobials targeting DNA replication in Mtb. PMID:26822057
Detection of Entamoeba histolytica by Recombinase Polymerase Amplification.

PubMed

Nair, Gayatri; Rebolledo, Mauricio; White, A Clinton; Crannell, Zachary; Richards-Kortum, R Rebecca; Pinilla, A Elizabeth; Ramírez, Juan David; López, M Consuelo; Castellanos-Gonzalez, Alejandro

2015-09-01

Amebiasis is an important cause of diarrheal disease worldwide and has been associated with childhood malnutrition. Traditional microscopy approaches are neither sensitive nor specific for Entamoeba histolytica. Antigen assays are more specific, but many cases are missed unless tested by molecular methods. Although polymerase chain reaction (PCR) is effective, the need for sophisticated, expensive equipment, infrastructure, and trained personnel limits its usefulness, especially in the resource-limited, endemic areas. Here, we report development of a recombinase polymerase amplification (RPA) method to detect E. histolytica specifically. Using visual detection by lateral flow (LF), the test was highly sensitive and specific and could be performed without additional equipment. The availability of this inexpensive, sensitive, and field-applicable diagnostic test could facilitate rapid diagnosis and treatment of amebiasis in endemic regions. © The American Society of Tropical Medicine and Hygiene.
SINE transcription by RNA polymerase III is suppressed by histone methylation but not by DNA methylation

PubMed Central

Varshney, Dhaval; Vavrova-Anderson, Jana; Oler, Andrew J.; Cowling, Victoria H.; Cairns, Bradley R.; White, Robert J.

2015-01-01

Short interspersed nuclear elements (SINEs), such as Alu, spread by retrotransposition, which requires their transcripts to be copied into DNA and then inserted into new chromosomal sites. This can lead to genetic damage through insertional mutagenesis and chromosomal rearrangements between non-allelic SINEs at distinct loci. SINE DNA is heavily methylated and this was thought to suppress its accessibility and transcription, thereby protecting against retrotransposition. Here we provide several lines of evidence that methylated SINE DNA is occupied by RNA polymerase III, including the use of high-throughput bisulphite sequencing of ChIP DNA. We find that loss of DNA methylation has little effect on accessibility of SINEs to transcription machinery or their expression in vivo. In contrast, a histone methyltransferase inhibitor selectively promotes SINE expression and occupancy by RNA polymerase III. The data suggest that methylation of histones rather than DNA plays a dominant role in suppressing SINE transcription. PMID:25798578
RNA Polymerase III promoter screen uncovers a novel noncoding RNA family conserved in Caenorhabditis and other clade V nematodes.

PubMed

Gruber, Andreas R

2014-07-10

RNA Polymerase III is a highly specialized enzyme complex responsible for the transcription of a very distinct set of housekeeping noncoding RNAs including tRNAs, 7SK snRNA, Y RNAs, U6 snRNA, and the RNA components of RNaseP and RNaseMRP. In this work we have utilized the conserved promoter structure of known RNA Polymerase III transcripts consisting of characteristic sequence elements termed proximal sequence elements (PSE) A and B and a TATA-box to uncover a novel RNA Polymerase III-transcribed, noncoding RNA family found to be conserved in Caenorhabditis as well as other clade V nematode species. Homology search in combination with detailed sequence and secondary structure analysis revealed that members of this novel ncRNA family evolve rapidly, and only maintain a potentially functional small stem structure that links the 5' end to the very 3' end of the transcript and a small hairpin structure at the 3' end. This is most likely required for efficient transcription termination. In addition, our study revealed evidence that canonical C/D box snoRNAs are also transcribed from a PSE A-PSE B-TATA-box promoter in Caenorhabditis elegans. Copyright © 2014 Elsevier B.V. All rights reserved.
Activation of RNA Polymerase III Transcription in Cells Transformed by Simian Virus 40

PubMed Central

Larminie, Christopher G. C.; Sutcliffe, Josephine E.; Tosh, Kerrie; Winter, Andrew G.; Felton-Edkins, Zoe A.; White, Robert J.

1999-01-01

RNA polymerase (Pol) III transcription is abnormally active in fibroblasts that have been transformed by simian virus 40 (SV40). This report presents evidence that two separate components of the general Pol III transcription apparatus, TFIIIB and TFIIIC2, are deregulated following SV40 transformation. TFIIIC2 subunits are expressed at abnormally high levels in SV40-transformed cells, an effect which is observed at both protein and mRNA levels. In untransformed fibroblasts, TFIIIB is subject to repression through association with the retinoblastoma protein RB. The interaction between RB and TFIIIB is compromised following SV40 transformation. Furthermore, the large T antigen of SV40 is shown to relieve repression by RB. The E7 oncoprotein of human papillomavirus can also activate Pol III transcription, an effect that is dependent on its ability to bind to RB. The data provide evidence that both TFIIIB and TFIIIC2 are targets for activation by DNA tumor viruses. PMID:10373542
Strand displacement by DNA polymerase III occurs through a tau-psi-chi link to single-stranded DNA-binding protein coating the lagging strand template.

PubMed

Yuan, Quan; McHenry, Charles S

2009-11-13

In addition to the well characterized processive replication reaction catalyzed by the DNA polymerase III holoenzyme on single-stranded DNA templates, the enzyme possesses an intrinsic strand displacement activity on flapped templates. The strand displacement activity is distinguished from the single-stranded DNA-templated reaction by a high dependence upon single-stranded DNA binding protein and an inability of gamma-complex to support the reaction in the absence of tau. However, if gamma-complex is present to load beta(2), a truncated tau protein containing only domains III-V will suffice. This truncated protein is sufficient to bind both the alpha subunit of DNA polymerase (Pol) III and chipsi. This is reminiscent of the minimal requirements for Pol III to replicate short single-stranded DNA-binding protein (SSB)-coated templates where tau is only required to serve as a scaffold to hold Pol III and chi in the same complex (Glover, B., and McHenry, C. (1998) J. Biol. Chem. 273, 23476-23484). We propose a model in which strand displacement by DNA polymerase III holoenzyme depends upon a Pol III-tau-psi-chi-SSB binding network, where SSB is bound to the displaced strand, stabilizing the Pol III-template interaction. The same interaction network is probably important for stabilizing the leading strand polymerase interactions with authentic replication forks. The specificity constant (k(cat)/K(m)) for the strand displacement reaction is approximately 300-fold less favorable than reactions on single-stranded templates and proceeds with a slower rate (150 nucleotides/s) and only moderate processivity (approximately 300 nucleotides). PriA, the initiator of replication restart on collapsed or misassembled replication forks, blocks the strand displacement reaction, even if added to an ongoing reaction.

Mutations in POLR3A and POLR3B Encoding RNA Polymerase III Subunits Cause an Autosomal-Recessive Hypomyelinating Leukoencephalopathy

PubMed Central

Saitsu, Hirotomo; Osaka, Hitoshi; Sasaki, Masayuki; Takanashi, Jun-ichi; Hamada, Keisuke; Yamashita, Akio; Shibayama, Hidehiro; Shiina, Masaaki; Kondo, Yukiko; Nishiyama, Kiyomi; Tsurusaki, Yoshinori; Miyake, Noriko; Doi, Hiroshi; Ogata, Kazuhiro; Inoue, Ken; Matsumoto, Naomichi

2011-01-01

Congenital hypomyelinating disorders are a heterogeneous group of inherited leukoencephalopathies characterized by abnormal myelin formation. We have recently reported a hypomyelinating syndrome characterized by diffuse cerebral hypomyelination with cerebellar atrophy and hypoplasia of the corpus callosum (HCAHC). We performed whole-exome sequencing of three unrelated individuals with HCAHC and identified compound heterozygous mutations in POLR3B in two individuals. The mutations include a nonsense mutation, a splice-site mutation, and two missense mutations at evolutionally conserved amino acids. Using reverse transcription-PCR and sequencing, we demonstrated that the splice-site mutation caused deletion of exon 18 from POLR3B mRNA and that the transcript harboring the nonsense mutation underwent nonsense-mediated mRNA decay. We also identified compound heterozygous missense mutations in POLR3A in the remaining individual. POLR3A and POLR3B encode the largest and second largest subunits of RNA Polymerase III (Pol III), RPC1 and RPC2, respectively. RPC1 and RPC2 together form the active center of the polymerase and contribute to the catalytic activity of the polymerase. Pol III is involved in the transcription of small noncoding RNAs, such as 5S ribosomal RNA and all transfer RNAs (tRNA). We hypothesize that perturbation of Pol III target transcription, especially of tRNAs, could be a common pathological mechanism underlying POLR3A and POLR3B mutations. PMID:22036171
Treacher Collins syndrome mutations in Saccharomyces cerevisiae destabilize RNA polymerase I and III complex integrity.

PubMed

Walker-Kopp, Nancy; Jackobel, Ashleigh J; Pannafino, Gianno N; Morocho, Paola A; Xu, Xia; Knutson, Bruce A

2017-11-01

Treacher Collins syndrome (TCS) is a craniofacial disorder that is characterized by the malformation of the facial bones. Mutations in three genes (TCOF1, POLR1C and POLR1D) involved in RNA polymerase I (Pol I) transcription account for more than 90% of disease cases. Two of these TCS-associated genes, POLR1C and POLR1D, encode for essential Pol I/III subunits that form a heterodimer necessary for Pol I/III assembly, and many TCS mutations lie along their evolutionarily conserved dimerization interface. Here we elucidate the molecular basis of TCS mutations in Saccharomyces cerevisiae, and present a new model for how TCS mutations may disrupt Pol I and III complex integrity. © The Author 2017. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.
Rbs1, a new protein implicated in RNA polymerase III biogenesis in yeast Saccharomyces cerevisiae.

PubMed

Cieśla, Małgorzata; Makała, Ewa; Płonka, Marta; Bazan, Rafał; Gewartowski, Kamil; Dziembowski, Andrzej; Boguta, Magdalena

2015-04-01

Little is known about the RNA polymerase III (Pol III) complex assembly and its transport to the nucleus. We demonstrate that a missense cold-sensitive mutation, rpc128-1007, in the sequence encoding the C-terminal part of the second largest Pol III subunit, C128, affects the assembly and stability of the enzyme. The cellular levels and nuclear concentration of selected Pol III subunits were decreased in rpc128-1007 cells, and the association between Pol III subunits as evaluated by coimmunoprecipitation was also reduced. To identify the proteins involved in Pol III assembly, we performed a genetic screen for suppressors of the rpc128-1007 mutation and selected the Rbs1 gene, whose overexpression enhanced de novo tRNA transcription in rpc128-1007 cells, which correlated with increased stability, nuclear concentration, and interaction of Pol III subunits. The rpc128-1007 rbs1Δ double mutant shows a synthetic growth defect, indicating that rpc128-1007 and rbs1Δ function in parallel ways to negatively regulate Pol III assembly. Rbs1 physically interacts with a subset of Pol III subunits, AC19, AC40, and ABC27/Rpb5. Additionally, Rbs1 interacts with the Crm1 exportin and shuttles between the cytoplasm and nucleus. We postulate that Rbs1 binds to the Pol III complex or subcomplex and facilitates its translocation to the nucleus. Copyright © 2015, American Society for Microbiology. All Rights Reserved.
Direct detection of Streptococcus mutans in human dental plaque by polymerase chain reaction.

PubMed

Igarashi, T; Yamamoto, A; Goto, N

1996-10-01

Streptococcus mutans is an etiological agent in human dental caries. A method for the detection of S. mutans directly from human dental plaque by polymerase chain reaction has been developed. Oligonucleotide primers specific for a portion of the dextranase gene (dexA) of S. mutans Ingbritt (serotype c) were designed to amplify a 1272-bp DNA fragment by polymerase chain reaction. The present method specifically detected S. mutans (serotypes c, e and f), but none of the other mutans streptococci: S. cricetus (serotype a), S. rattus (serotype b), S. sobrinus (serotypes d and g), and S. downei (serotype h), other gram-positive bacteria (16 strains of 12 species of cocci and 18 strains of 12 species of bacilli) nor gram-negative bacteria (1 strain of 1 species of cocci and 20 strains of 18 species of bacilli). The method was capable of detecting 1 pg of the chromosomal DNA purified from S. mutans Ingbritt and as few as 12 colony-forming units of S. mutans cells. The S. mutans cells in human dental plaque were also directly detected. Seventy clinical isolates of S. mutans isolated from the dental plaque of 8 patients were all positive by the polymerase chain reaction. These results suggest that the dexA polymerase chain reaction is suitable for the specific detection and identification of S. mutans.
Nutrient/TOR-dependent regulation of RNA polymerase III controls tissue and organismal growth in Drosophila

PubMed Central

Marshall, Lynne; Rideout, Elizabeth J; Grewal, Savraj S

2012-01-01

The nutrient/target-of-rapamycin (TOR) pathway has emerged as a key regulator of tissue and organismal growth in metazoans. The signalling components of the nutrient/TOR pathway are well defined; however, the downstream effectors are less understood. Here, we show that the control of RNA polymerase (Pol) III-dependent transcription is an essential target of TOR in Drosophila. We find that TOR activity controls Pol III in growing larvae via inhibition of the repressor Maf1 and, in part, via the transcription factor Drosophila Myc (dMyc). Moreover, we show that loss of the Pol III factor, Brf, leads to reduced tissue and organismal growth and prevents TOR-induced cellular growth. TOR activity in the larval fat body, a tissue equivalent to vertebrate fat or liver, couples nutrition to insulin release from the brain. Accordingly, we find that fat-specific loss of Brf phenocopies nutrient limitation and TOR inhibition, leading to decreased systemic insulin signalling and reduced organismal growth. Thus, stimulation of Pol III is a key downstream effector of TOR in the control of cellular and systemic growth. PMID:22367393
Polymerase Chain Reaction for Detection of Systemic Plant Pathogens

USDA-ARS?s Scientific Manuscript database

This chapter outlines the advances and application of the polymerase chain reaction (PCR) since its development in 1984 and its enhancements and applications to detection of viruses, viroids and phytoplasma in pome and stone fruits. PCR is probably the most rapidly and widely adopted technology eve...
The role of polymerase III in conjugation between E. coli K12 donor and recipient strains carrying dnaE ts mutation.

PubMed

Blinkowa, A

1976-01-01

The possible role of DNA polimerase III in conjugation was studied in a series of mutants temperature-sensitive for DNA polymerase III synthesis. The temperature-sensitive DNA mutation called dnaE 486 (ts) prohibits vegetative DNA replication at 41-45 degrees. Transfer of episome and chromosome from temperature-sensitive donor, carrying dnaE mutation to wild-type recipient strains, revertants and dnaE recipients was investigated. In the first two cases the number of Lac+ sexductants being even slightly higher at 43 degrees. Conjugational synthesis accompanying transfer involving the combination of dnaE (ts) thymine dependent and thymine independent donor and recipient strains measured by incorporation of 14C thymine was observed at the restrictive temperature. In the case of conjugation with temperaturesensitive recipient strains a drop of Lac+ sexductants and Pro+ recombinants may be as a result of disturbances in the synthesis of complementary strand in recipient, known to be dependent on pol III. However, the episome investigated by centrifugation in neutral CsC1 gradient after its transfer to the recipient with faulty polymerase III was double stranded (replicated) at the restrictive temperature.
Modulation of yeast genome expression in response to defective RNA polymerase III-dependent transcription.

PubMed

Conesa, Christine; Ruotolo, Roberta; Soularue, Pascal; Simms, Tiffany A; Donze, David; Sentenac, André; Dieci, Giorgio

2005-10-01

We used genome-wide expression analysis in Saccharomyces cerevisiae to explore whether and how the expression of protein-coding, RNA polymerase (Pol) II-transcribed genes is influenced by a decrease in RNA Pol III-dependent transcription. The Pol II transcriptome was characterized in four thermosensitive, slow-growth mutants affected in different components of the RNA Pol III transcription machinery. Unexpectedly, we found only a modest correlation between altered expression of Pol II-transcribed genes and their proximity to class III genes, a result also confirmed by the analysis of single tRNA gene deletants. Instead, the transcriptome of all of the four mutants was characterized by increased expression of genes known to be under the control of the Gcn4p transcriptional activator. Indeed, GCN4 was found to be translationally induced in the mutants, and deleting the GCN4 gene eliminated the response. The Gcn4p-dependent expression changes did not require the Gcn2 protein kinase and could be specifically counteracted by an increased gene dosage of initiator tRNA(Met). Initiator tRNA(Met) depletion thus triggers a GCN4-dependent reprogramming of genome expression in response to decreased Pol III transcription. Such an effect might represent a key element in the coordinated transcriptional response of yeast cells to environmental changes.
Mechanism of transcription termination by RNA polymerase III utilizes a nontemplate-strand sequence-specific signal element

PubMed Central

Arimbasseri, Aneeshkumar G.; Maraia, Richard J.

2015-01-01

SUMMARY Understanding the mechanism of transcription termination by a eukaryotic RNA polymerase (RNAP) has been limited by lack of a characterizable intermediate that reflects transition from an elongation complex to a true termination event. While other multisubunit RNAPs require multipartite cis-signals and/or ancillary factors to mediate pausing and release of the nascent transcript from the clutches of these enzymes, RNAP III does so with precision and efficiency on a simple oligo(dT) tract, independent of other cis-elements or trans-factors. We report a RNAP III pre-termination complex that reveals termination mechanisms controlled by sequence-specific elements in the non-template strand. Furthermore, the TFIIF-like, RNAP III subunit, C37 is required for this function of the non-template strand signal. The results reveal the RNAP III terminator as an information-rich control element. While the template strand promotes destabilization via a weak oligo(rU:dA) hybrid, the non-template strand provides distinct sequence-specific destabilizing information through interactions with the C37 subunit. PMID:25959395
Nested methylation-specific polymerase chain reaction cancer detection method

DOEpatents

Belinsky, Steven A [Albuquerque, NM; Palmisano, William A [Edgewood, NM

2007-05-08

A molecular marker-based method for monitoring and detecting cancer in humans. Aberrant methylation of gene promoters is a marker for cancer risk in humans. A two-stage, or "nested" polymerase chain reaction method is disclosed for detecting methylated DNA sequences at sufficiently high levels of sensitivity to permit cancer screening in biological fluid samples, such as sputum, obtained non-invasively. The method is for detecting the aberrant methylation of the p16 gene, O 6-methylguanine-DNA methyltransferase gene, Death-associated protein kinase gene, RAS-associated family 1 gene, or other gene promoters. The method offers a potentially powerful approach to population-based screening for the detection of lung and other cancers.
Comparison of histopathology and real-time polymerase chain reaction (RT-PCR) for detection of Mycobacterium tuberculosis in fistula-in-ano.

PubMed

Garg, Pankaj

2017-07-01

Histopathology is commonly used to diagnose tuberculosis in fistula-in-ano. The aim was to compare the sensitivity of polymerase chain reaction and histopathology in detecting tuberculosis in fistula-in-ano. The histopathology and polymerase chain-reaction of tissue (fistula tract) was done in all the consecutive operated cases. When pus sample was also available, polymerase chain reaction-pus was also done RESULTS: Three hundred forty seven samples (179 patients) were tested over 2 years (median 6.5 months). The mean age was 38.8 ± 10.7 years, and male/female was 170/9. Histopathology and polymerase chain reaction of tissue (fistula tract) was done in 152 and 165 patients, respectively. Polymerase chain reaction (pus) could be done in 30 patients. Overall, tuberculosis was detected in 20/179 (11.2%) patients. Of these, tuberculosis was detected by histopathology (tissue) in 1/152 (0.7%) and by polymerase chain reaction (tissue) in 14/165 (8.5%) patients. In pus, polymerase chain reaction detected tuberculosis in 6/30 (20%) patients. Both polymerase chain reaction of tissue and pus were positive in one patient. Polymerase chain reaction (tissue) and polymerase chain reaction (pus) were significantly more sensitive than histopathology (tissue) for detecting tuberculosis [histopathology 1/152 vs. polymerase chain reaction (tissue) 14/165, p = 0.0009] [histopathology 1/152 vs. polymerase chain reaction (pus) 6/30, p < 0.0001]. In 20 patients detected to have tuberculosis, four drug anti-tubercular therapy was recommended for 6 months. The therapy was completed in 13 patients and 12/13 (92.3%) were cured. The therapy is continuing in 3/20 patients. Four patients did not take the therapy. None of them was cured. Polymerase chain reaction was significantly more sensitive than histopathology in detecting tuberculosis in fistula-in-ano. Histopathology might be missing out tuberculosis in many patients leading to recurrence of the fistula.
[Recombinase Polymerase Amplification and its Applications in Parasite Detection].

PubMed

ZHENG, Wen-bin; WU, Yao-dong; MA, Jian-gang; ZHU, Xing-quan; ZHOU, Dong-hui

2015-10-01

Recombinase polymerase amplification (RPA) is a recently -developed isothermal nucleic-acid-amplification technology that is based on the nucleic acid replication mechanism in T4 bacteriophage. With this technique, nucleic-acid templates can be amplified to measurable levels within 20 min at 37-42 °C. The. RPA process has high sensitivity and specificity, and is simple to operate, thus nucleic acids can be detected rapidly in non-laboratory conditions. Since its development in 2006, the RPA technique has been applied in agriculture, food safety, medicine, transgene detection, etc. In this review, we will give an overview on the research progress of RPA and its application in parasite detection.
Reconstitution of the yeast RNA polymerase III transcription system with all recombinant factors.

PubMed

Ducrot, Cécile; Lefebvre, Olivier; Landrieux, Emilie; Guirouilh-Barbat, Josée; Sentenac, André; Acker, Joel

2006-04-28

Transcription factor TFIIIC is a multisubunit complex required for promoter recognition and transcriptional activation of class III genes. We describe here the reconstitution of complete recombinant yeast TFIIIC and the molecular characterization of its two DNA-binding domains, tauA and tauB, using the baculovirus expression system. The B block-binding module, rtauB, was reconstituted with rtau138, rtau91, and rtau60 subunits. rtau131, rtau95, and rtau55 formed also a stable complex, rtauA, that displayed nonspecific DNA binding activity. Recombinant rTFIIIC was functionally equivalent to purified yeast TFIIIC, suggesting that the six recombinant subunits are necessary and sufficient to reconstitute a transcriptionally active TFIIIC complex. The formation and the properties of rTFIIIC-DNA complexes were affected by dephosphorylation treatments. The combination of complete recombinant rTFIIIC and rTFIIIB directed a low level of basal transcription, much weaker than with the crude B'' fraction, suggesting the existence of auxiliary factors that could modulate the yeast RNA polymerase III transcription system.
Mutations in RNA Polymerase III genes and defective DNA sensing in adults with varicella-zoster virus CNS infection.

PubMed

Carter-Timofte, Madalina E; Hansen, Anders F; Christiansen, Mette; Paludan, Søren R; Mogensen, Trine H

2018-05-01

Recently, deficiency in the cytosolic DNA sensor RNA Polymerase III was described in children with severe primary varicella-zoster virus (VZV) infection in the CNS and lungs. In the present study we examined adult patients with VZV CNS infection caused by viral reactivation. By whole exome sequencing we identified mutations in POL III genes in two of eight patients. These mutations were located in the coding regions of the subunits POLR3A and POLR3E. In functional assays, we found impaired expression of antiviral and inflammatory cytokines in response to the POL III agonist Poly(dA:dT) as well as increased viral replication in patient cells compared to controls. Altogether, this study provides significant extension on the current knowledge on susceptibility to VZV infection by demonstrating mutations in POL III genes associated with impaired immunological sensing of AT-rich DNA in adult patients with VZV CNS infection.
Influence of 5'-flanking sequence on 4.5SI RNA gene transcription by RNA polymerase III.

PubMed

Gogolevskaya, Irina K; Stasenko, Danil V; Tatosyan, Karina A; Kramerov, Dmitri A

2018-05-01

Short nuclear 4.5SI RNA can be found in three related rodent families. Its function remains unknown. The genes of 4.5SI RNA contain an internal promoter of RNA polymerase III composed of the boxes A and B. Here, the effect of the sequence immediately upstream of the mouse 4.5SI RNA gene on its transcription was studied. The gene with deletions and substitutions in the 5'-flanking sequence was used to transfect HeLa cells and its transcriptional activity was evaluated from the cellular level of 4.5SI RNA. Single-nucleotide substitutions in the region adjacent to the transcription start site (positions -2 to -8) decreased the expression activity of the gene down to 40%-60% of the control. The substitution of the conserved pentanucleotide AGAAT (positions -14 to -18) could either decrease (43%-56%) or increase (134%) the gene expression. A TATA-like box (TACATGA) was found at positions -24 to -30 of the 4.5SI RNA gene. Its replacement with a polylinker fragment of the vector did not decrease the transcription level, while its replacement with a GC-rich sequence almost completely (down to 2%-5%) suppressed the transcription of the 4.5SI RNA gene. The effect of plasmid sequences bordering the gene on its transcription by RNA polymerase III is discussed.
Isothermal recombinase polymerase amplification assay applied to the detection of group B streptococci in vaginal/anal samples.

PubMed

Daher, Rana K; Stewart, Gale; Boissinot, Maurice; Bergeron, Michel G

2014-04-01

Group B streptococcal infections are the leading cause of sepsis and meningitis in newborns. A rapid and reliable method for the detection of this pathogen at the time of delivery is needed for the early treatment of neonates. Isothermal amplification techniques such as recombinase polymerase amplification have advantages relative to PCR in terms of the speed of reaction and simplicity. We studied the clinical performance of recombinase polymerase amplification for the screening of group B streptococci in vaginal/anal samples from 50 pregnant women. We also compared the limit of detection and the analytical specificity of this isothermal assay to real-time PCR (RT-PCR). Compared to RT-PCR, the recombinase polymerase amplification assay showed a clinical sensitivity of 96% and a clinical specificity of 100%. The limit of detection was 98 genome copies and the analytical specificity was 100% for a panel of 15 bacterial and/or fungal strains naturally found in the vaginal/anal flora. Time-to-result for the recombinase polymerase amplification assay was <20 min compared to 45 min for the RT-PCR assay; a positive sample could be detected as early as 8 min. We demonstrate the potential of isothermal recombinase polymerase amplification assay as a clinically useful molecular diagnostic tool that is simple and faster than PCR/RT-PCR. Recombinase polymerase amplification offers great potential for nucleic acid-based diagnostics at the point of care.
Recombinase Polymerase Amplification Compared to Real-Time Polymerase Chain Reaction Test for the Detection of Fasciola hepatica in Human Stool

PubMed Central

Cabada, Miguel M.; Malaga, Jose L.; Castellanos-Gonzalez, Alejandro; Bagwell, Kelli A.; Naeger, Patrick A.; Rogers, Hayley K.; Maharsi, Safa; Mbaka, Maryann; White, A. Clinton

2017-01-01

Fasciola hepatica is the most widely distributed trematode infection in the world. Control efforts may be hindered by the lack of diagnostic capacity especially in remote endemic areas. Polymerase chain reaction (PCR)–based methods offer high sensitivity and specificity but require expensive technology. However, the recombinase polymerase amplification (RPA) is an efficient isothermal method that eliminates the need for a thermal cycler and has a high deployment potential to resource-limited settings. We report on the characterization of RPA and PCR tests to detect Fasciola infection in clinical stool samples with low egg burdens. The sensitivity of the RPA and PCR were 87% and 66%, respectively. Both tests were 100% specific showing no cross-reactivity with trematode, cestode, or nematode parasites. In addition, RPA and PCR were able to detect 47% and 26% of infections not detected by microscopy, respectively. The RPA adapted to a lateral flow platform was more sensitive than gel-based detection of the reaction products. In conclusion, the Fasciola RPA is a highly sensitive and specific test to diagnose chronic infection using stool samples. The Fasciola RPA lateral flow has the potential for deployment to endemic areas after further characterization. PMID:27821691
Mechanism of selective recruitment of RNA polymerases II and III to snRNA gene promoters.

PubMed

Dergai, Oleksandr; Cousin, Pascal; Gouge, Jerome; Satia, Karishma; Praz, Viviane; Kuhlman, Tracy; Lhôte, Philippe; Vannini, Alessandro; Hernandez, Nouria

2018-05-01

RNA polymerase II (Pol II) small nuclear RNA (snRNA) promoters and type 3 Pol III promoters have highly similar structures; both contain an interchangeable enhancer and "proximal sequence element" (PSE), which recruits the SNAP complex (SNAPc). The main distinguishing feature is the presence, in the type 3 promoters only, of a TATA box, which determines Pol III specificity. To understand the mechanism by which the absence or presence of a TATA box results in specific Pol recruitment, we examined how SNAPc and general transcription factors required for Pol II or Pol III transcription of SNAPc-dependent genes (i.e., TATA-box-binding protein [TBP], TFIIB, and TFIIA for Pol II transcription and TBP and BRF2 for Pol III transcription) assemble to ensure specific Pol recruitment. TFIIB and BRF2 could each, in a mutually exclusive fashion, be recruited to SNAPc. In contrast, TBP-TFIIB and TBP-BRF2 complexes were not recruited unless a TATA box was present, which allowed selective and efficient recruitment of the TBP-BRF2 complex. Thus, TBP both prevented BRF2 recruitment to Pol II promoters and enhanced BRF2 recruitment to Pol III promoters. On Pol II promoters, TBP recruitment was separate from TFIIB recruitment and enhanced by TFIIA. Our results provide a model for specific Pol recruitment at SNAPc-dependent promoters. © 2018 Dergai et al.; Published by Cold Spring Harbor Laboratory Press.
Detection of Listeria monocytogenes by using the polymerase chain reaction

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bessesen, M.T.; Luo, Q.; Blaser, M.J.

1990-09-01

A method was developed for detection of Listeria monocytogens by polymerase chain reaction amplification followed by agarose gel electrophoresis or dot blot analysis with {sup 32}P-labeled internal probe. The technique identified 95 of 95 L. monocytogenes strains, 0 of 12 Listeria strains of other species, and 0 of 12 non-Listeria strains.
Regulation of RNA polymerase III transcription during transformation of human IMR90 fibroblasts with defined genetic elements.

PubMed

Durrieu-Gaillard, Stéphanie; Dumay-Odelot, Hélène; Boldina, Galina; Tourasse, Nicolas J; Allard, Delphine; André, Fabrice; Macari, Françoise; Choquet, Armelle; Lagarde, Pauline; Drutel, Guillaume; Leste-Lasserre, Thierry; Petitet, Marion; Lesluyes, Tom; Lartigue-Faustin, Lydia; Dupuy, Jean-William; Chibon, Frédéric; Roeder, Robert G; Joubert, Dominique; Vagner, Stéphan; Teichmann, Martin

2018-01-01

RNA polymerase (Pol) III transcribes small untranslated RNAs that are essential for cellular homeostasis and growth. Its activity is regulated by inactivation of tumor suppressor proteins and overexpression of the oncogene c-MYC, but the concerted action of these tumor-promoting factors on Pol III transcription has not yet been assessed. In order to comprehensively analyse the regulation of Pol III transcription during tumorigenesis we employ a model system that relies on the expression of five genetic elements to achieve cellular transformation. Expression of these elements in six distinct transformation intermediate cell lines leads to the inactivation of TP53, RB1, and protein phosphatase 2A, as well as the activation of RAS and the protection of telomeres by TERT, thereby conducting to full tumoral transformation of IMR90 fibroblasts. Transformation is accompanied by moderately enhanced levels of a subset of Pol III-transcribed RNAs (7SK; MRP; H1). In addition, mRNA and/or protein levels of several Pol III subunits and transcription factors are upregulated, including increased protein levels of TFIIIB and TFIIIC subunits, of SNAPC1 and of Pol III subunits. Strikingly, the expression of POLR3G and of SNAPC1 is strongly enhanced during transformation in this cellular transformation model. Collectively, our data indicate that increased expression of several components of the Pol III transcription system accompanied by a 2-fold increase in steady state levels of a subset of Pol III RNAs is sufficient for sustaining tumor formation.

Detection of Trypanosoma cruzi by Polymerase Chain Reaction.

PubMed

Márquez, María Elizabeth; Concepción, Juan Luis; González-Marcano, Eglys; Mondolfi, Alberto Paniz

2016-01-01

American Trypanosomiasis (Chagas disease) is an infectious disease caused by the hemoflagellate parasite Trypanosoma cruzi which is transmitted by reduviid bugs. T. cruzi infection occurs in a broad spectrum of reservoir animals throughout North, Central, and South America and usually evolves into an asymptomatic chronic clinical stage of the disease in which diagnosis is often challenging. This chapter describes the application of polymerase chain reaction (PCR) for the detection of Trypanosoma cruzi DNA including protocols for sample preparation, DNA extraction, and target amplification methods.
Direct detection of RNA in vitro and in situ by target-primed RCA: The impact of E. coli RNase III on the detection efficiency of RNA sequences distanced far from the 3'-end.

PubMed

Merkiene, Egle; Gaidamaviciute, Edita; Riauba, Laurynas; Janulaitis, Arvydas; Lagunavicius, Arunas

2010-08-01

We improved the target RNA-primed RCA technique for direct detection and analysis of RNA in vitro and in situ. Previously we showed that the 3' --> 5' single-stranded RNA exonucleolytic activity of Phi29 DNA polymerase converts the target RNA into a primer and uses it for RCA initiation. However, in some cases, the single-stranded RNA exoribonucleolytic activity of the polymerase is hindered by strong double-stranded structures at the 3'-end of target RNAs. We demonstrate that in such hampered cases, the double-stranded RNA-specific Escherichia coli RNase III efficiently assists Phi29 DNA polymerase in converting the target RNA into a primer. These observations extend the target RNA-primed RCA possibilities to test RNA sequences distanced far from the 3'-end and customize this technique for the inner RNA sequence analysis.
Role of Human DNA Polymerase and Its Accessory Proteins in Breast Cancer

DTIC Science & Technology

2000-09-01

10, 13, 15, and 19 are abnormal and indicate mutants in POLD1 gene . Determination of NIRCA detected mutations by DNA sequencing NIRCA detected...CAGCAA; GnGln) in codon 461. Table III. Summary of mutation identified in the Exo motif of POLD1 Gene from breast cancer. Patient/Cell line Nucleotide...the gene for human DNA polymerase 8 catalytic p125 (POLDI) and p50 ( POLD2 ) subunits (Chang et al., 1995, Perez et al., 2000).. Normal and breast
Evaluation of immunomagnetic separation for the detection of Salmonella in surface waters by polymerase chain reaction.

PubMed

Hsu, Chao-Yu; Hsu, Bing-Mu; Chang, Tien-Yu; Hsu, Tsui-Kang; Shen, Shu-Min; Chiu, Yi-Chou; Wang, Hung-Jen; Ji, Wen-Tsai; Fan, Cheng-Wei; Chen, Jyh-Larng

2014-09-19

Salmonella spp. is associated with fecal pollution and capable of surviving for long periods in aquatic environments. Instead of the traditional, time-consuming biochemical detection, polymerase chain reaction (PCR) allows rapid identification of Salmonella directly concentrated from water samples. However, prevalence of Salmonella may be underestimated because of the vulnerability of PCR to various environmental chemicals like humic acid, compounded by the fact that various DNA polymerases have different susceptibility to humic acid. Because immunomagnetic separation (IMS) theoretically could isolate Salmonella from other microbes and facilitate removal of aquatic PCR inhibitors of different sizes, this study aims to compare the efficiency of conventional PCR combined with immunomagnetic separation (IMS) for Salmonella detection within a moderately polluted watershed. In our study, the positive rate was increased from 17.6% to 47% with nearly ten-fold improvement in the detection limit. These results suggest the sensitivity of Salmonella detection could be enhanced by IMS, particularly in low quality surface waters. Due to its effects on clearance of aquatic pollutants, IMS may be suitable for most DNA polymerases for Salmonella detection.
Differential utilization of TATA box-binding protein (TBP) and TBP-related factor 1 (TRF1) at different classes of RNA polymerase III promoters.

PubMed

Verma, Neha; Hung, Ko-Hsuan; Kang, Jin Joo; Barakat, Nermeen H; Stumph, William E

2013-09-20

In the fruit fly Drosophila melanogaster, RNA polymerase III transcription was found to be dependent not upon the canonical TATA box-binding protein (TBP) but instead upon the TBP-related factor 1 (TRF1) (Takada, S., Lis, J. T., Zhou, S., and Tjian, R. (2000) Cell 101, 459-469). Here we confirm that transcription of fly tRNA genes requires TRF1. However, we unexpectedly find that U6 snRNA gene promoters are occupied primarily by TBP in cells and that knockdown of TBP, but not TRF1, inhibits U6 transcription in cells. Moreover, U6 transcription in vitro effectively utilizes TBP, whereas TBP cannot substitute for TRF1 to promote tRNA transcription in vitro. Thus, in fruit flies, different classes of RNA polymerase III promoters differentially utilize TBP and TRF1 for the initiation of transcription.
TATA box-binding protein (TBP) is a constituent of the polymerase I-specific transcription initiation factor TIF-IB (SL1) bound to the rRNA promoter and shows differential sensitivity to TBP-directed reagents in polymerase I, II, and III transcription factors.

PubMed

Radebaugh, C A; Matthews, J L; Geiss, G K; Liu, F; Wong, J M; Bateman, E; Camier, S; Sentenac, A; Paule, M R

1994-01-01

The role of the Acanthamoeba castellanii TATA-binding protein (TBP) in transcription was examined. Specific antibodies against the nonconserved N-terminal domain of TBP were used to verify the presence of TBP in the fundamental transcription initiation factor for RNA polymerase I, TIF-IB, and to demonstrate that TBP is part of the committed initiation complex on the rRNA promoter. The same antibodies inhibit transcription in all three polymerase systems, but they do so differentially. Oligonucleotide competitors were used to evaluate the accessibility of the TATA-binding site in TIF-IB, TFIID, and TFIIIB. The results suggest that insertion of TBP into the polymerase II and III factors is more similar than insertion into the polymerase I factor.
Simian Virus 40 Large T Antigen Interacts with Human TFIIB-Related Factor and Small Nuclear RNA-Activating Protein Complex for Transcriptional Activation of TATA-Containing Polymerase III Promoters

PubMed Central

Damania, Blossom; Mital, Renu; Alwine, James C.

1998-01-01

The TATA-binding protein (TBP) is common to the basal transcription factors of all three RNA polymerases, being associated with polymerase-specific TBP-associated factors (TAFs). Simian virus 40 large T antigen has previously been shown to interact with the TBP-TAFII complexes, TFIID (B. Damania and J. C. Alwine, Genes Dev. 10:1369–1381, 1996), and the TBP-TAFI complex, SL1 (W. Zhai, J. Tuan, and L. Comai, Genes Dev. 11:1605–1617, 1997), and in both cases these interactions are critical for transcriptional activation. We show a similar mechanism for activation of the class 3 polymerase III (pol III) promoter for the U6 RNA gene. Large T antigen can activate this promoter, which contains a TATA box and an upstream proximal sequence element but cannot activate the TATA-less, intragenic VAI promoter (a class 2, pol III promoter). Mutants of large T antigen that cannot activate pol II promoters also fail to activate the U6 promoter. We provide evidence that large T antigen can interact with the TBP-containing pol III transcription factor human TFIIB-related factor (hBRF), as well as with at least two of the three TAFs in the pol III-specific small nuclear RNA-activating protein complex (SNAPc). In addition, we demonstrate that large T antigen can cofractionate and coimmunoprecipitate with the hBRF-containing complex TFIIIB derived from HeLa cells infected with a recombinant adenovirus which expresses large T antigen. Hence, similar to its function with pol I and pol II promoters, large T antigen interacts with TBP-containing, basal pol III transcription factors and appears to perform a TAF-like function. PMID:9488448
Polymerase chain reaction-based detection of B-cell monoclonality in cytologic specimens.

PubMed

Chen, Y T; Mercer, G O; Chen, Y

1993-11-01

Thirty-seven cytologic cell blocks were evaluated for B-cell monoclonality by polymerase chain reaction (PCR), 16 of them cytologically positive for lymphoma, and 21 suspicious for lymphoma but morphologically nondiagnostic. Of 37 specimens, 13 (35%) showed B-cell monoclonality, including six of 16 cytologically positive samples and seven of 21 cytologically suspicious ones. Of these 13 positive samples, seven were positive using crude lysates as substrates, and six additional positive samples were identified only when DNAs were purified and concentrated. Analysis of the DNAs further revealed poor polymerase chain reaction amplifiability and low DNA yield in many samples, indicating that cell block materials are suboptimal for this assay. We concluded that B-cell monoclonality can be detected in ethanol-fixed cytologic samples, and usage of unembedded material will likely improve the sensitivity. In specimens cytologically suspicious for lymphoma, polymerase chain reaction-based identification of monoclonal B-cell population supports the diagnosis of B-cell lymphoma and is a potentially useful test in solving this diagnostic dilemma.
Transcription in Yeast: Separation and Properties of Multiple RNA Polymerases

PubMed Central

Adman, Ray; Schultz, Loren D.; Hall, Benjamin D.

1972-01-01

Four peaks of DNA-directed RNA polymerase activity are resolved by salt gradient elution of a sonicated yeast cell extract on DEAE-Sephadex. The enzymes, which are named IA, IB, II, and III in order of elution, all appear to come from cell nuclei. Only enzyme II is sensitive to α-amanitin. All enzymes are more active with Mn++ than with Mg++ as divalent ion. Enzymes IB and II have salt optima in the range 0.05-0.10 M (NH4)2SO4, whereas enzyme III is maximally active at 0.20-0.25 M (NH4)2SO4. With optimal salt concentration and saturating DNA, the template preference ratio, activity on native calfthymus DNA divided by activity on denatured calf-thymus DNA, is 2.2 for IB, 0.4 for II, and 3.5 for III. None of the yeast polymerases was inhibited by rifamycin SV. Rifamycin AF/013 effectively inhibited polymerases IB, II, and III. PMID:4558656
Active Center Control of Termination by RNA Polymerase III and tRNA Gene Transcription Levels In Vivo

PubMed Central

Rijal, Keshab; Maraia, Richard J.

2016-01-01

The ability of RNA polymerase (RNAP) III to efficiently recycle from termination to reinitiation is critical for abundant tRNA production during cellular proliferation, development and cancer. Yet understanding of the unique termination mechanisms used by RNAP III is incomplete, as is its link to high transcription output. We used two tRNA-mediated suppression systems to screen for Rpc1 mutants with gain- and loss- of termination phenotypes in S. pombe. 122 point mutation mutants were mapped to a recently solved 3.9 Å structure of yeast RNAP III elongation complex (EC); they cluster in the active center bridge helix and trigger loop, as well as the pore and funnel, the latter of which indicate involvement of the RNA cleavage domain of the C11 subunit in termination. Purified RNAP III from a readthrough (RT) mutant exhibits increased elongation rate. The data strongly support a kinetic coupling model in which elongation rate is inversely related to termination efficiency. The mutants exhibit good correlations of terminator RT in vitro and in vivo, and surprisingly, amounts of transcription in vivo. Because assessing in vivo transcription can be confounded by various parameters, we used a tRNA reporter with a processing defect and a strong terminator. By ruling out differences in RNA decay rates, the data indicate that mutants with the RT phenotype synthesize more RNA than wild type cells, and than can be accounted for by their increased elongation rate. Finally, increased activity by the mutants appears unrelated to the RNAP III repressor, Maf1. The results show that the mobile elements of the RNAP III active center, including C11, are key determinants of termination, and that some of the mutations activate RNAP III for overall transcription. Similar mutations in spontaneous cancer suggest this as an unforeseen mechanism of RNAP III activation in disease. PMID:27518095
Decoding the principles underlying the frequency of association with nucleoli for RNA polymerase III-transcribed genes in budding yeast.

PubMed

Belagal, Praveen; Normand, Christophe; Shukla, Ashutosh; Wang, Renjie; Léger-Silvestre, Isabelle; Dez, Christophe; Bhargava, Purnima; Gadal, Olivier

2016-10-15

The association of RNA polymerase III (Pol III)-transcribed genes with nucleoli seems to be an evolutionarily conserved property of the spatial organization of eukaryotic genomes. However, recent studies of global chromosome architecture in budding yeast have challenged this view. We used live-cell imaging to determine the intranuclear positions of 13 Pol III-transcribed genes. The frequency of association with nucleolus and nuclear periphery depends on linear genomic distance from the tethering elements-centromeres or telomeres. Releasing the hold of the tethering elements by inactivating centromere attachment to the spindle pole body or changing the position of ribosomal DNA arrays resulted in the association of Pol III-transcribed genes with nucleoli. Conversely, ectopic insertion of a Pol III-transcribed gene in the vicinity of a centromere prevented its association with nucleolus. Pol III-dependent transcription was independent of the intranuclear position of the gene, but the nucleolar recruitment of Pol III-transcribed genes required active transcription. We conclude that the association of Pol III-transcribed genes with the nucleolus, when permitted by global chromosome architecture, provides nucleolar and/or nuclear peripheral anchoring points contributing locally to intranuclear chromosome organization. © 2016 Belagal et al. This article is distributed by The American Society for Cell Biology under license from the author(s). Two months after publication it is available to the public under an Attribution–Noncommercial–Share Alike 3.0 Unported Creative Commons License (http://creativecommons.org/licenses/by-nc-sa/3.0).
NDM29, a RNA polymerase III-dependent non coding RNA, promotes amyloidogenic processing of APP and amyloid β secretion.

PubMed

Massone, Sara; Ciarlo, Eleonora; Vella, Serena; Nizzari, Mario; Florio, Tullio; Russo, Claudio; Cancedda, Ranieri; Pagano, Aldo

2012-07-01

Neuroblastoma Differentiation Marker 29 (NDM29) is a RNA polymerase (pol) III-transcribed non-coding (nc) RNA whose synthesis drives neuroblastoma (NB) cell differentiation to a nonmalignant neuron-like phenotype. Since in this process a complex pattern of molecular changes is associated to plasma membrane protein repertoire we hypothesized that the expression of NDM29 might influence also key players of neurodegenerative pathways. In this work we show that the NDM29-dependent cell maturation induces amyloid precursor protein (APP) synthesis, leading to the increase of amyloid β peptide (Aβ) secretion and the concomitant increment of Aβ x-42/Aβ x-40 ratio. We also demonstrate that the expression of NDM29 RNA, and the consequent increase of Aβ formation, can be promoted by inflammatory stimuli (and repressed by anti-inflammatory drugs). Moreover, NDM29 expression was detected in normal human brains although an abnormal increased synthesis of this ncRNA is induced in patients affected by neurodegenerative diseases. Therefore, the complex of events triggered by NDM29 expression induces a condition that favors the formation of Aβ peptides in the extracellular space, as it may occur in Alzheimer's Disease (AD). In addition, these data unexpectedly show that a pol III-dependent small RNA can act as key regulator of brain physiology and/or pathology suggesting that a better knowledge of this portion of the human transcriptome might provide hints for neurodegeneration studies. Copyright © 2012 Elsevier B.V. All rights reserved.
RNA Polymerase III Output Is Functionally Linked to tRNA Dimethyl-G26 Modification

PubMed Central

Arimbasseri, Aneeshkumar G.; Blewett, Nathan H.; Iben, James R.; Lamichhane, Tek N.; Cherkasova, Vera; Hafner, Markus; Maraia, Richard J.

2015-01-01

Control of the differential abundance or activity of tRNAs can be important determinants of gene regulation. RNA polymerase (RNAP) III synthesizes all tRNAs in eukaryotes and it derepression is associated with cancer. Maf1 is a conserved general repressor of RNAP III under the control of the target of rapamycin (TOR) that acts to integrate transcriptional output and protein synthetic demand toward metabolic economy. Studies in budding yeast have indicated that the global tRNA gene activation that occurs with derepression of RNAP III via maf1-deletion is accompanied by a paradoxical loss of tRNA-mediated nonsense suppressor activity, manifested as an antisuppression phenotype, by an unknown mechanism. We show that maf1-antisuppression also occurs in the fission yeast S. pombe amidst general activation of RNAP III. We used tRNA-HydroSeq to document that little changes occurred in the relative levels of different tRNAs in maf1Δ cells. By contrast, the efficiency of N2,N2-dimethyl G26 (m2 2G26) modification on certain tRNAs was decreased in response to maf1-deletion and associated with antisuppression, and was validated by other methods. Over-expression of Trm1, which produces m2 2G26, reversed maf1-antisuppression. A model that emerges is that competition by increased tRNA levels in maf1Δ cells leads to m2 2G26 hypomodification due to limiting Trm1, reducing the activity of suppressor-tRNASerUCA and accounting for antisuppression. Consistent with this, we show that RNAP III mutations associated with hypomyelinating leukodystrophy decrease tRNA transcription, increase m2 2G26 efficiency and reverse antisuppression. Extending this more broadly, we show that a decrease in tRNA synthesis by treatment with rapamycin leads to increased m2 2G26 modification and that this response is conserved among highly divergent yeasts and human cells. PMID:26720005
Maf1 Protein, Repressor of RNA Polymerase III, Indirectly Affects tRNA Processing*

PubMed Central

Karkusiewicz, Iwona; Turowski, Tomasz W.; Graczyk, Damian; Towpik, Joanna; Dhungel, Nripesh; Hopper, Anita K.; Boguta, Magdalena

2011-01-01

Maf1 is negative regulator of RNA polymerase III in yeast. We observed high levels of both primary transcript and end-matured, intron-containing pre-tRNAs in the maf1Δ strain. This pre-tRNA accumulation could be overcome by transcription inhibition, arguing against a direct role of Maf1 in tRNA maturation and suggesting saturation of processing machinery by the increased amounts of primary transcripts. Saturation of the tRNA exportin, Los1, is one reason why end-matured intron-containing pre-tRNAs accumulate in maf1Δ cells. However, it is likely possible that other components of the processing pathway are also limiting when tRNA transcription is increased. According to our model, Maf1-mediated transcription control and nuclear export by Los1 are two major stages of tRNA biosynthesis that are regulated by environmental conditions in a coordinated manner. PMID:21940626
Maf1 protein, repressor of RNA polymerase III, indirectly affects tRNA processing.

PubMed

Karkusiewicz, Iwona; Turowski, Tomasz W; Graczyk, Damian; Towpik, Joanna; Dhungel, Nripesh; Hopper, Anita K; Boguta, Magdalena

2011-11-11

Maf1 is negative regulator of RNA polymerase III in yeast. We observed high levels of both primary transcript and end-matured, intron-containing pre-tRNAs in the maf1Δ strain. This pre-tRNA accumulation could be overcome by transcription inhibition, arguing against a direct role of Maf1 in tRNA maturation and suggesting saturation of processing machinery by the increased amounts of primary transcripts. Saturation of the tRNA exportin, Los1, is one reason why end-matured intron-containing pre-tRNAs accumulate in maf1Δ cells. However, it is likely possible that other components of the processing pathway are also limiting when tRNA transcription is increased. According to our model, Maf1-mediated transcription control and nuclear export by Los1 are two major stages of tRNA biosynthesis that are regulated by environmental conditions in a coordinated manner.
Method for detection of Stachybotrys chartarum in pure culture and field samples using quantitative polymerase chain reaction

DOEpatents

Cruz-Perez, Patricia; Buttner, Mark P.

2004-05-11

A method for detecting the fungus Stachybotrys chartarum includes isolating DNA from a sample suspected of containing the fungus Stachybotrys chartarum. The method further includes subjecting the DNA to polymerase chain reaction amplification utilizing at least one of several primers, the several primers each including one of the base sequences 5'GTTGCTTCGGCGGGAAC3', 5'TTTGCGTTTGCCACTCAGAG3', 5'ACCTATCGTTGCTTCGGCG3', and 5'GCGTTTGCCACTCAGAGAATACT3'. The method additionally includes detecting the fungus Stachybotrys chartarum by visualizing the product of the polymerase chain reaction.
Recombinase polymerase amplification assay for rapid detection of lumpy skin disease virus.

PubMed

Shalaby, Mohamed A; El-Deeb, Ayman; El-Tholoth, Mohamed; Hoffmann, Donata; Czerny, Claus-Peter; Hufert, Frank T; Weidmann, Manfred; Abd El Wahed, Ahmed

2016-11-02

Lumpy skin disease virus (LSDV) is a Capripoxvirus infecting cattle and Buffalos. Lumpy skin disease (LSD) leads to significant economic losses due to hide damage, reduction of milk production, mastitis, infertility and mortalities (10 %). Early detection of the virus is crucial to start appropriate outbreak control measures. Veterinarians rely on the presence of the characteristic clinical signs of LSD. Laboratory diagnostics including virus isolation, sequencing and real-time polymerase chain reaction (PCR) are performed at well-equipped laboratories. In this study, a portable, simple, and rapid recombinase polymerase amplification (RPA) assay for the detection of LSDV-genome for the use on farms was developed. The LSDV RPA assay was performed at 42 °C and detected down to 179 DNA copies/reaction in a maximum of 15 min. Unspecific amplification was observed with neither LSDV-negative samples (n = 12) nor nucleic acid preparations from orf virus, bovine papular stomatitis virus, cowpoxvirus, Peste des petits ruminants and Blue tongue virus (serotypes 1, 6 and 8). The clinical sensitivity of the LSDV RPA assay matched 100 % (n = 22) to real-time PCR results. In addition, the LSDV RPA assay detected sheep and goat poxviruses. The LSDV RPA assay is a rapid and sensitive test that could be implemented in field or at quarantine stations for the identification of LSDV infected case.
Head and Neck Squamous Cell Carcinomas Do Not Express EGFRvIII

DOE Office of Scientific and Technical Information (OSTI.GOV)

Melchers, Lieuwe J., E-mail: l.j.melchers@umcg.nl; Department of Pathology, University Medical Center Groningen, University of Groningen, Groningen; Clausen, Martijn J.A.M.

2014-10-01

Purpose: To assess the prevalence of EGFRvIII, a specific variant of EGFR (epidermal growth factor receptor), in 3 well-defined cohorts of head and neck squamous cell carcinoma (HNSCC). Methods and Materials: Immunohistochemistry for the specific detection of EGFRvIII using the L8A4 antibody was optimized on formalin-fixed, paraffin-embedded tissue using glioblastoma tissue. It was compared with EGFR and EGFRvIII RNA expression using a specific reverse transcription–polymerase chain reaction also optimized for formalin-fixed, paraffin-embedded tissue. Tissue microarrays including 531 HNSCCs of various stages with complete clinicopathologic and follow-up data were tested for the presence of EGFRvIII. Results: None of the 531 casesmore » showed EGFRvIII protein expression. Using an immunohistochemistry protocol reported by others revealed cytoplasmic staining in 8% of cases. Reverse transcription–polymerase chain reaction for the EGFRvIII transcript of the 28 highest cytoplasmic staining cases, as well as 69 negative cases, did not show expression in any of the tested cases, suggesting aspecific staining by a nonoptimal protocol. Conclusions: The EGFRvIII mutation is not present in HNSCC. Therefore, EGFRvIII does not influence treatment response in HNSCC and is not a usable clinical prognostic marker.« less
RNA polymerase III mutants in TFIIFα-like C37 that cause terminator readthrough with no decrease in transcription output.

PubMed

Rijal, Keshab; Maraia, Richard J

2013-01-07

How eukaryotic RNA polymerases switch from elongation to termination is unknown. Pol III subunits Rpc53 and Rpc37 (C53/37) form a heterodimer homologous to TFIIFβ/α. C53/37 promotes efficient termination and together with C11 also mediates pol III recycling in vitro. We previously developed Schizosaccharomyces pombe strains that report on two pol III termination activities: RNA oligo(U) 3'-end cleavage, and terminator readthrough. We randomly mutagenized C53 and C37 and isolated many C37 mutants with terminator readthrough but no comparable C53 mutants. The majority of C37 mutants have strong phenotypes with up to 40% readthrough and map to a C-terminal tract previously localized near Rpc2p in the pol III active center while a minority represent a distinct class with weaker phenotype, less readthrough and 3'-oligo(U) lengthening. Nascent pre-tRNAs released from a terminator by C37 mutants have shorter 3'-oligo(U) tracts than in cleavage-deficient C11 double mutants indicating RNA 3'-end cleavage during termination. We asked whether termination deficiency affects transcription output in the mutants in vivo both by monitoring intron-containing nascent transcript levels and (14)C-uridine incorporation. Surprisingly, multiple termination mutants have no decrease in transcript output relative to controls. These data are discussed in context of current models of pol III transcription.
Development of a rapid recombinase polymerase amplification assay for detection of Brucella in blood samples.

PubMed

Ren, Hang; Yang, Mingjuan; Zhang, Guoxia; Liu, Shiwei; Wang, Xinhui; Ke, Yuehua; Du, Xinying; Wang, Zhoujia; Huang, Liuyu; Liu, Chao; Chen, Zeliang

2016-04-01

A rapid and sensitive recombinase polymerase amplification (RPA) assay, Bruce-RPA, was developed for detection of Brucella. The assay could detect as few as 3 copies of Brucella per reaction within 20 min. Bruce-RPA represents a candidate point-of-care diagnosis assay for human brucellosis. Copyright © 2016 Elsevier Ltd. All rights reserved.

Highly Reproducible Label Free Quantitative Proteomic Analysis of RNA Polymerase Complexes*

PubMed Central

Mosley, Amber L.; Sardiu, Mihaela E.; Pattenden, Samantha G.; Workman, Jerry L.; Florens, Laurence; Washburn, Michael P.

2011-01-01

The use of quantitative proteomics methods to study protein complexes has the potential to provide in-depth information on the abundance of different protein components as well as their modification state in various cellular conditions. To interrogate protein complex quantitation using shotgun proteomic methods, we have focused on the analysis of protein complexes using label-free multidimensional protein identification technology and studied the reproducibility of biological replicates. For these studies, we focused on three highly related and essential multi-protein enzymes, RNA polymerase I, II, and III from Saccharomyces cerevisiae. We found that label-free quantitation using spectral counting is highly reproducible at the protein and peptide level when analyzing RNA polymerase I, II, and III. In addition, we show that peptide sampling does not follow a random sampling model, and we show the need for advanced computational models to predict peptide detection probabilities. In order to address these issues, we used the APEX protocol to model the expected peptide detectability based on whole cell lysate acquired using the same multidimensional protein identification technology analysis used for the protein complexes. Neither method was able to predict the peptide sampling levels that we observed using replicate multidimensional protein identification technology analyses. In addition to the analysis of the RNA polymerase complexes, our analysis provides quantitative information about several RNAP associated proteins including the RNAPII elongation factor complexes DSIF and TFIIF. Our data shows that DSIF and TFIIF are the most highly enriched RNAP accessory factors in Rpb3-TAP purifications and demonstrate our ability to measure low level associated protein abundance across biological replicates. In addition, our quantitative data supports a model in which DSIF and TFIIF interact with RNAPII in a dynamic fashion in agreement with previously published reports. PMID
A possible role for chromium(III) in genotoxicity.

PubMed

Snow, E T

1991-05-01

Chromium is found in the environment in two major forms: reduced CrIII and CrVI, or chromate. Chromate, the most biologically active species, is readily taken up by living cells and reduced intracellularly, via reactive intermediates, to stable CrIII species. CrIII, the most abundant form of chromium in the environment, does not readily cross cell membranes and is relatively inactive in vivo. However, intracellular CrIII can react slowly with both nucleic acids and proteins and can be genotoxic. We have investigated the genotoxicity of CrIII in vitro using a DNA replication assay and in vivo by CaCl2-mediated transfection of chromium-treated DNA into Escherichia coli. When DNA replication was measured on a CrIII-treated template using purified DNA polymerases (either bacterial or mammalian), both the rate of DNA replication and the amount of incorporation per polymerase binding event (processivity) were greatly increased relative to controls. When transfected into E. coli, CrIII-treated M13mp2 bacteriophage DNA showed a dose-dependent increase in mutation frequency. These results suggest that CrIII alters the interaction between the DNA template and the polymerase such that the binding strength of the DNA polymerase is increased and the fidelity of DNA replication is decreased. These interactions may contribute to the mutagenicity of chromium ions in vivo and suggest that CrIII can contribute to chromium-mediated carcinogenesis.
Activation of RNA polymerase III transcription of human Alu repetitive elements by adenovirus type 5: requirement for the E1b 58-kilodalton protein and the products of E4 open reading frames 3 and 6.

PubMed Central

Panning, B; Smiley, J R

1993-01-01

We found that transcription of endogenous human Alu elements by RNA polymerase III was strongly stimulated following infection of HeLa cells with adenovirus type 5, leading to the accumulation of high levels of Alu transcripts initiated from Alu polymerase III promoters. In contrast to previously reported cases of adenovirus-induced activation of polymerase III transcription, induction required the E1b 58-kDa protein and the products of E4 open reading frames 3 and 6 in addition to the 289-residue E1a protein. In addition, E1a function was not required at high multiplicities of infection, suggesting that E1a plays an indirect role in Alu activation. These results suggest previously unsuspected regulatory properties of the adenovirus E1b and E4 gene products and provide a novel approach to the study of the biology of the most abundant class of dispersed repetitive DNA in the human genome. Images PMID:7684492
Real-time isothermal detection of Shiga toxin-producing Escherichia coli using recombinase polymerase amplification

USDA-ARS?s Scientific Manuscript database

Shiga toxin (Stx) producing E. coli (STEC) are a major family of foodborne pathogens of immense public health, zoonotic and economic significance in the US and worldwide. To date, there are no published reports on use of recombinase polymerase amplification (RPA) for STEC detection. The primary goal...
RNA polymerase III mutants in TFIIFα-like C37 that cause terminator readthrough with no decrease in transcription output

PubMed Central

Rijal, Keshab; Maraia, Richard J.

2013-01-01

How eukaryotic RNA polymerases switch from elongation to termination is unknown. Pol III subunits Rpc53 and Rpc37 (C53/37) form a heterodimer homologous to TFIIFβ/α. C53/37 promotes efficient termination and together with C11 also mediates pol III recycling in vitro. We previously developed Schizosaccharomyces pombe strains that report on two pol III termination activities: RNA oligo(U) 3′-end cleavage, and terminator readthrough. We randomly mutagenized C53 and C37 and isolated many C37 mutants with terminator readthrough but no comparable C53 mutants. The majority of C37 mutants have strong phenotypes with up to 40% readthrough and map to a C-terminal tract previously localized near Rpc2p in the pol III active center while a minority represent a distinct class with weaker phenotype, less readthrough and 3′-oligo(U) lengthening. Nascent pre-tRNAs released from a terminator by C37 mutants have shorter 3′-oligo(U) tracts than in cleavage-deficient C11 double mutants indicating RNA 3′-end cleavage during termination. We asked whether termination deficiency affects transcription output in the mutants in vivo both by monitoring intron-containing nascent transcript levels and 14C-uridine incorporation. Surprisingly, multiple termination mutants have no decrease in transcript output relative to controls. These data are discussed in context of current models of pol III transcription. PMID:23093604
Recombinase polymerase amplification applied to plant virus detection and potential implications.

PubMed

Babu, Binoy; Ochoa-Corona, Francisco M; Paret, Mathews L

2018-04-01

Several isothermal techniques for the detection of plant pathogens have been developed with the advent of molecular techniques. Among them, Recombinase Polymerase Amplification (RPA) is becoming an important technique for the rapid, sensitive and cost-effective detection of plant viruses. The RPA technology has the advantage to be implemented in field-based scenarios because the method requires a minimal sample preparation, and is performed at constant low temperature (37-42 °C). The RPA technique is rapidly becoming a promising tool for use in rapid detection and further diagnostics in plant clinics and monitoring quarantine services. This paper presents a review of studies conducted using RPA for detection/diagnosis of plant viruses with either DNA genomes (Banana bunchy top virus, Bean golden yellow mosaic virus, Tomato mottle virus, Tomato yellow leaf curl virus) or RNA genomes (Little Cherry virus 2, Plum pox virus and Rose rosette virus). Copyright © 2018 Elsevier Inc. All rights reserved.
Rapid and sensitive detection of canine parvovirus type 2 by recombinase polymerase amplification.

PubMed

Wang, Jianchang; Liu, Libing; Li, Ruiwen; Wang, Jinfeng; Fu, Qi; Yuan, Wanzhe

2016-04-01

A novel recombinase polymerase amplification (RPA)-based method for detection of canine parvovirus type 2 (CPV-2) was developed. Sensitivity analysis showed that the detection limit of RPA was 10 copies of CPV-2 genomic DNA. RPA amplified both CPV-2a and -2b DNA but did not amplify the template of other important dog viruses (CCoV, PRV or CDV), demonstrating high specificity. The method was further validated with 57 canine fecal samples. An outstanding advantage of RPA is that it is an isothermal reaction and can be performed in a water bath, making RPA a potential alternative method for CPV-2 detection in resource-limited settings.
Enhanced solid-phase recombinase polymerase amplification and electrochemical detection.

PubMed

Del Río, Jonathan Sabaté; Lobato, Ivan Magriñà; Mayboroda, Olena; Katakis, Ioanis; O'Sullivan, Ciara K

2017-05-01

Recombinase polymerase amplification (RPA) is an elegant method for the rapid, isothermal amplification of nucleic acids. Here, we elucidate the optimal surface chemistry for rapid and efficient solid-phase RPA, which was fine-tuned in order to obtain a maximum signal-to-noise ratio, defining the optimal DNA probe density, probe-to-lateral spacer ratio (1:0, 1:1, 1:10 and 1:100) and length of a vertical spacer of the probe as well as investigating the effect of different types of lateral spacers. The use of different labelling strategies was also examined in order to reduce the number of steps required for the analysis, using biotin or horseradish peroxidase-labelled reverse primers. Optimisation of the amplification temperature used and the use of surface blocking agents were also pursued. The combination of these changes facilitated a significantly more rapid amplification and detection protocol, with a lowered limit of detection (LOD) of 1 · 10 -15 M. The optimised protocol was applied to the detection of Francisella tularensis in real samples from hares and a clear correlation with PCR and qPCR results observed and the solid-phase RPA demonstrated to be capable of detecting 500 fM target DNA in real samples. Graphical abstract Relative size of thiolated lateral spacers tested versus the primer and the uvsx recombinase protein.
Electrochemical product detection of an asymmetric convective polymerase chain reaction.

PubMed

Duwensee, Heiko; Mix, Maren; Stubbe, Marco; Gimsa, Jan; Adler, Marcel; Flechsig, Gerd-Uwe

2009-10-15

For the first time, we describe the application of heated microwires for an asymmetric convective polymerase chain reaction (PCR) in a modified PCR tube in a small volume. The partly single-stranded product was labeled with the electrochemically active compound osmium tetroxide bipyridine using a partially complementary protective strand with five mismatches compared to the single-stranded product. The labeled product could be successfully detected at a gold electrode modified with a complementary single-stranded capture probe immobilized via a thiol-linker. Our simple thermo-convective PCR yielded electrochemically detectable products after only 5-10 min. A significant discrimination between complementary and non-complementary target was possible using different immobilized capture probes. The total product yield was approx. half the amount of the classical thermocycler PCR. Numerical simulations describing the thermally driven convective PCR explain the received data. Discrimination between complementary capture probes and non-complementary capture probes was performed using square-wave voltammetry. The coupling of asymmetric thermo-convective PCR with electrochemical detection is very promising for future compact DNA sensor devices.
Rapid and specific detection of Yam mosaic virus by reverse-transcription recombinase polymerase amplification.

PubMed

Silva, Gonçalo; Bömer, Moritz; Nkere, Chukwuemeka; Kumar, P Lava; Seal, Susan E

2015-09-15

Yam mosaic virus (YMV; genus Potyvirus) is considered to cause the most economically important viral disease of yams (Dioscorea spp.) in West Africa which is the dominant region for yam production globally. Yams are a vegetatively propagated crop and the use of virus-free planting material forms an essential component of disease control. Current serological and PCR-based diagnostic methods for YMV are time consuming involving a succession of target detection steps. In this study, a novel assay for specific YMV detection is described that is based on isothermal reverse transcription-recombinase polymerase amplification (RT-exoRPA). This test has been shown to be reproducible and able to detect as little as 14 pg/μl of purified RNA obtained from an YMV-infected plant, a sensitivity equivalent to that obtained with the reverse transcription-polymerase chain reaction (RT-PCR) in current general use. The RT-exoRPA assay has, however, several advantages over the RT-PCR; positive samples can be detected in less than 30 min, and amplification only requires a single incubation temperature (optimum 37°C). These features make the RT-exoRPA assay a promising candidate for adapting into a field test format to be used by yam breeding programmes or certification laboratories. Copyright © 2015 Elsevier B.V. All rights reserved.
Genetics Home Reference: Pol III-related leukodystrophy

MedlinePlus

... two largest parts (subunits) of an enzyme called RNA polymerase III. This enzyme is involved in the production (synthesis) of ribonucleic acid (RNA), a chemical cousin of DNA. The RNA polymerase ...
Colorimetric Detection of Specific DNA Segments Amplified by Polymerase Chain Reactions

NASA Astrophysics Data System (ADS)

Kemp, David J.; Smith, Donald B.; Foote, Simon J.; Samaras, N.; Peterson, M. Gregory

1989-04-01

The polymerase chain reaction (PCR) procedure has many potential applications in mass screening. We describe here a general assay for colorimetric detection of amplified DNA. The target DNA is first amplified by PCR, and then a second set of oligonucleotides, nested between the first two, is incorporated by three or more PCR cycles. These oligonucleotides bear ligands: for example, one can be biotinylated and the other can contain a site for a double-stranded DNA-binding protein. After linkage to an immobilized affinity reagent (such as a cloned DNA-binding protein, which we describe here) and labeling with a second affinity reagent (for example, avidin) linked to horseradish peroxidase, reaction with a chromogenic substrate allows detection of the amplified DNA. This amplified DNA assay (ADA) is rapid, is readily applicable to mass screening, and uses routine equipment. We show here that it can be used to detect human immunodeficiency virus sequences specifically against a background of human DNA.
Inhibiting poly(ADP-ribose) polymerase: a potential therapy against oligodendrocyte death

PubMed Central

Veto, Sara; Acs, Peter; Bauer, Jan; Lassmann, Hans; Berente, Zoltan; Setalo, Gyorgy; Borgulya, Gabor; Sumegi, Balazs; Komoly, Samuel; Gallyas, Ferenc; Illes, Zsolt

2010-01-01

Oligodendrocyte loss and demyelination are major pathological hallmarks of multiple sclerosis. In pattern III lesions, inflammation is minor in the early stages, and oligodendrocyte apoptosis prevails, which appears to be mediated at least in part through mitochondrial injury. Here, we demonstrate poly(ADP-ribose) polymerase activation and apoptosis inducing factor nuclear translocation within apoptotic oligodendrocytes in such multiple sclerosis lesions. The same morphological and molecular pathology was observed in an experimental model of primary demyelination, induced by the mitochondrial toxin cuprizone. Inhibition of poly(ADP-ribose) polymerase in this model attenuated oligodendrocyte depletion and decreased demyelination. Poly(ADP-ribose) polymerase inhibition suppressed c-Jun N-terminal kinase and p38 mitogen-activated protein kinase phosphorylation, increased the activation of the cytoprotective phosphatidylinositol-3 kinase-Akt pathway and prevented caspase-independent apoptosis inducing factor-mediated apoptosis. Our data indicate that poly(ADP-ribose) polymerase activation plays a crucial role in the pathogenesis of pattern III multiple sclerosis lesions. Since poly(ADP-ribose) polymerase inhibition was also effective in the inflammatory model of multiple sclerosis, it may target all subtypes of multiple sclerosis, either by preventing oligodendrocyte death or attenuating inflammation. PMID:20157013
The RNA polymerase III-dependent family of genes in hemiascomycetes: comparative RNomics, decoding strategies, transcription and evolutionary implications

PubMed Central

Marck, Christian; Kachouri-Lafond, Rym; Lafontaine, Ingrid; Westhof, Eric; Dujon, Bernard; Grosjean, Henri

2006-01-01

We present the first comprehensive analysis of RNA polymerase III (Pol III) transcribed genes in ten yeast genomes. This set includes all tRNA genes (tDNA) and genes coding for SNR6 (U6), SNR52, SCR1 and RPR1 RNA in the nine hemiascomycetes Saccharomyces cerevisiae, Saccharomyces castellii, Candida glabrata, Kluyveromyces waltii, Kluyveromyces lactis, Eremothecium gossypii, Debaryomyces hansenii, Candida albicans, Yarrowia lipolytica and the archiascomycete Schizosaccharomyces pombe. We systematically analysed sequence specificities of tRNA genes, polymorphism, variability of introns, gene redundancy and gene clustering. Analysis of decoding strategies showed that yeasts close to S.cerevisiae use bacterial decoding rules to read the Leu CUN and Arg CGN codons, in contrast to all other known Eukaryotes. In D.hansenii and C.albicans, we identified a novel tDNA-Leu (AAG), reading the Leu CUU/CUC/CUA codons with an unusual G at position 32. A systematic ‘p-distance tree’ using the 60 variable positions of the tRNA molecule revealed that most tDNAs cluster into amino acid-specific sub-trees, suggesting that, within hemiascomycetes, orthologous tDNAs are more closely related than paralogs. We finally determined the bipartite A- and B-box sequences recognized by TFIIIC. These minimal sequences are nearly conserved throughout hemiascomycetes and were satisfactorily retrieved at appropriate locations in other Pol III genes. PMID:16600899
Low RNA Polymerase III activity results in up regulation of HXT2 glucose transporter independently of glucose signaling and despite changing environment

PubMed Central

Szatkowska, Roza

2017-01-01

Background Saccharomyces cerevisiae responds to glucose availability in the environment, inducing the expression of the low-affinity transporters and high-affinity transporters in a concentration dependent manner. This cellular decision making is controlled through finely tuned communication between multiple glucose sensing pathways including the Snf1-Mig1, Snf3/Rgt2-Rgt1 (SRR) and cAMP-PKA pathways. Results We demonstrate the first evidence that RNA Polymerase III (RNAP III) activity affects the expression of the glucose transporter HXT2 (RNA Polymerase II dependent—RNAP II) at the level of transcription. Down-regulation of RNAP III activity in an rpc128-1007 mutant results in a significant increase in HXT2 mRNA, which is considered to respond only to low extracellular glucose concentrations. HXT2 expression is induced in the mutant regardless of the growth conditions either at high glucose concentration or in the presence of a non-fermentable carbon source such as glycerol. Using chromatin immunoprecipitation (ChIP), we found an increased association of Rgt1 and Tup1 transcription factors with the highly activated HXT2 promoter in the rpc128-1007 strain. Furthermore, by measuring cellular abundance of Mth1 corepressor, we found that in rpc128-1007, HXT2 gene expression was independent from Snf3/Rgt2-Rgt1 (SRR) signaling. The Snf1 protein kinase complex, which needs to be active for the release from glucose repression, also did not appear perturbed in the mutated strain. Conclusions/Significance These findings suggest that the general activity of RNAP III can indirectly affect the RNAP II transcriptional machinery on the HXT2 promoter when cellular perception transduced via the major signaling pathways, broadly recognized as on/off switch essential to either positive or negative HXT gene regulation, remain entirely intact. Further, Rgt1/Ssn6-Tup1 complex, which has a dual function in gene transcription as a repressor-activator complex, contributes to HXT2
Development of a recombinase polymerase amplification assay for Vibrio parahaemolyticus detection with an internal amplification control.

PubMed

Yang, Huan-Lan; Wei, Shuang; Gooneratne, Ravi; Mutukumira, Anthony N; Ma, Xue-Jun; Tang, Shu-Ze; Wu, Xi-Yang

2018-04-01

A novel RPA-IAC assay using recombinase polymerase and an internal amplification control (IAC) for Vibrio parahaemolyticus detection was developed. Specific primers were designed based on the coding sequence for the toxR gene in V. parahaemolyticus. The recombinase polymerase amplification (RPA) reaction was conducted at a constant low temperature of 37 °C for 20 min. Assay specificity was validated by using 63 Vibrio strains and 10 non-Vibrio bacterial species. In addition, a competitive IAC was employed to avoid false-negative results, which co-amplified simultaneously with the target sequence. The sensitivity of the assay was determined as 3 × 10 3 CFU/mL, which is decidedly more sensitive than the established PCR method. This method was then used to test seafood samples that were collected from local markets. Seven out of 53 different raw seafoods were detected as V. parahaemolyticus-positive, which were consistent with those obtained using traditional culturing method and biochemical assay. This novel RPA-IAC assay provides a rapid, specific, sensitive, and more convenient detection method for V. parahaemolyticus.
Development of an isothermal recombinase polymerase amplification assay for rapid detection of pseudorabies virus.

PubMed

Yang, Yang; Qin, Xiaodong; Zhang, Wei; Li, Zhiyong; Zhang, Shuaijun; Li, Yanmin; Zhang, Zhidong

2017-06-01

Recombinase polymerase amplification assays using real-time fluorescent detection (real-time RPA assay) and lateral flow dipstick (RPA LFD assay) were developed targeting the gD gene of pseudorabies virus (PRV). Both assays were performed at 39 °C within 20 min. The sensitivity of the real-time RPA assay and the RPA LFD assay was 100 copies per reaction and 160 copies per reaction, respectively. Both assays did not detect DNAs from other virus or PRV negative samples. Therefore, the developed RPA assays provide a rapid, simple, sensitive and specific alternative tool for detection of PRV. Copyright © 2017. Published by Elsevier Ltd.
Recombinase Polymerase Amplification Combined with Lateral Flow Strip for Listeria monocytogenes Detection in Food.

PubMed

Du, Xin-Jun; Zang, Yu-Xuan; Liu, Hai-Bin; Li, Ping; Wang, Shuo

2018-04-01

Listeria monocytogenes is an important food-borne pathogenic bacterium that causes human disease, resulting in economic losses worldwide. The current detection methods for L. monocytogenes are not well suited for direct field testing because they involve complicated, time-consuming operations. A simple, efficient method is vital for L. monocytogenes detection. In this study, we combined isothermal recombinase polymerase amplification (RPA) with a lateral flow (LF) strip to rapidly and reliably detect L. monocytogenes. In the presence of biotin- and digoxin-modified primers, RPA produced numerous digoxin- and biotin-attached duplex DNA products. These products were detected on an LF strip via dual immunoreactions (digoxin on the duplex DNA reacted with the anti-digoxin antibody on the gold nanoparticle (Au-NP) and the biotin on the duplex DNA captured by the streptavidin on the LF test zone). The accumulation of Au-NPs produced characteristic bands, enabling the visual detection of L. monocytogenes without instrumentation. This assay could be used to detect L. monocytogenes within 15 min, including DNA amplification with RPA for 10 min at 39 °C and visualization of the amplicons by LF strips for 5 min. Experiments confirmed a detection limit as low as 300 fg of DNA and 1.5 × 10 1 CFU in pure cultures. Furthermore, RPA-LF exhibited no cross-reactions with pathogens. Evaluation of the method with food samples indicated that the detection limit was substantially improved to 1.5 × 10° CFU for the original bacterial content in 25 g/mL samples after enrichment for 6 hr. RPA-LF can be used as a sensitive and rapid detection technique for L. monocytogenes. Recombinase polymerase amplification (RPA) can amplify target DNA at 37 to 42 °C without a thermal cycler. Lateral flow (LF) strips are portable, cheap and easy to operate. RPA combined with LF strips to detect Listeria monocytogenes can be widely used in remote areas. © 2018 Institute of Food Technologists®.
Loss of the RNA polymerase III repressor MAF1 confers obesity resistance.

PubMed

Bonhoure, Nicolas; Byrnes, Ashlee; Moir, Robyn D; Hodroj, Wassim; Preitner, Frédéric; Praz, Viviane; Marcelin, Genevieve; Chua, Streamson C; Martinez-Lopez, Nuria; Singh, Rajat; Moullan, Norman; Auwerx, Johan; Willemin, Gilles; Shah, Hardik; Hartil, Kirsten; Vaitheesvaran, Bhavapriya; Kurland, Irwin; Hernandez, Nouria; Willis, Ian M

2015-05-01

MAF1 is a global repressor of RNA polymerase III transcription that regulates the expression of highly abundant noncoding RNAs in response to nutrient availability and cellular stress. Thus, MAF1 function is thought to be important for metabolic economy. Here we show that a whole-body knockout of Maf1 in mice confers resistance to diet-induced obesity and nonalcoholic fatty liver disease by reducing food intake and increasing metabolic inefficiency. Energy expenditure in Maf1(-/-) mice is increased by several mechanisms. Precursor tRNA synthesis was increased in multiple tissues without significant effects on mature tRNA levels, implying increased turnover in a futile tRNA cycle. Elevated futile cycling of hepatic lipids was also observed. Metabolite profiling of the liver and skeletal muscle revealed elevated levels of many amino acids and spermidine, which links the induction of autophagy in Maf1(-/-) mice with their extended life span. The increase in spermidine was accompanied by reduced levels of nicotinamide N-methyltransferase, which promotes polyamine synthesis, enables nicotinamide salvage to regenerate NAD(+), and is associated with obesity resistance. Consistent with this, NAD(+) levels were increased in muscle. The importance of MAF1 for metabolic economy reveals the potential for MAF1 modulators to protect against obesity and its harmful consequences. © 2015 Bonhoure et al.; Published by Cold Spring Harbor Laboratory Press.
Loss of the RNA polymerase III repressor MAF1 confers obesity resistance

PubMed Central

Bonhoure, Nicolas; Byrnes, Ashlee; Moir, Robyn D.; Hodroj, Wassim; Preitner, Frédéric; Praz, Viviane; Marcelin, Genevieve; Chua, Streamson C.; Martinez-Lopez, Nuria; Singh, Rajat; Moullan, Norman; Auwerx, Johan; Willemin, Gilles; Shah, Hardik; Hartil, Kirsten; Vaitheesvaran, Bhavapriya; Kurland, Irwin

2015-01-01

MAF1 is a global repressor of RNA polymerase III transcription that regulates the expression of highly abundant noncoding RNAs in response to nutrient availability and cellular stress. Thus, MAF1 function is thought to be important for metabolic economy. Here we show that a whole-body knockout of Maf1 in mice confers resistance to diet-induced obesity and nonalcoholic fatty liver disease by reducing food intake and increasing metabolic inefficiency. Energy expenditure in Maf1−/− mice is increased by several mechanisms. Precursor tRNA synthesis was increased in multiple tissues without significant effects on mature tRNA levels, implying increased turnover in a futile tRNA cycle. Elevated futile cycling of hepatic lipids was also observed. Metabolite profiling of the liver and skeletal muscle revealed elevated levels of many amino acids and spermidine, which links the induction of autophagy in Maf1−/− mice with their extended life span. The increase in spermidine was accompanied by reduced levels of nicotinamide N-methyltransferase, which promotes polyamine synthesis, enables nicotinamide salvage to regenerate NAD+, and is associated with obesity resistance. Consistent with this, NAD+ levels were increased in muscle. The importance of MAF1 for metabolic economy reveals the potential for MAF1 modulators to protect against obesity and its harmful consequences. PMID:25934505

Primers for polymerase chain reaction to detect genomic DNA of Toxocara canis and T. cati.

PubMed

Wu, Z; Nagano, I; Xu, D; Takahashi, Y

1997-03-01

Primers for polymerase chain reaction to amplify genomic DNA of both Toxocara canis and T. cati were constructed by adapting cloning and sequencing random amplified polymorphic DNA. The primers are expected to detect eggs and/or larvae of T. canis and T. cati, both of which are known to cause toxocariasis in humans.
Single-molecule visualization of fast polymerase turnover in the bacterial replisome

PubMed Central

Lewis, Jacob S; Spenkelink, Lisanne M; Jergic, Slobodan; Wood, Elizabeth A; Monachino, Enrico; Horan, Nicholas P; Duderstadt, Karl E; Cox, Michael M; Robinson, Andrew; Dixon, Nicholas E; van Oijen, Antoine M

2017-01-01

The Escherichia coli DNA replication machinery has been used as a road map to uncover design rules that enable DNA duplication with high efficiency and fidelity. Although the enzymatic activities of the replicative DNA Pol III are well understood, its dynamics within the replisome are not. Here, we test the accepted view that the Pol III holoenzyme remains stably associated within the replisome. We use in vitro single-molecule assays with fluorescently labeled polymerases to demonstrate that the Pol III* complex (holoenzyme lacking the β2 sliding clamp), is rapidly exchanged during processive DNA replication. Nevertheless, the replisome is highly resistant to dilution in the absence of Pol III* in solution. We further show similar exchange in live cells containing labeled clamp loader and polymerase. These observations suggest a concentration-dependent exchange mechanism providing a balance between stability and plasticity, facilitating replacement of replisomal components dependent on their availability in the environment. DOI: http://dx.doi.org/10.7554/eLife.23932.001 PMID:28432790
Polymerase chain reaction detection of Propionibacterium propionicus and Actinomyces radicidentis in primary and persistent endodontic infections.

PubMed

Siqueira, José F; Rôças, Isabela N

2003-08-01

Propionibacterium propionicus and the recently described species Actinomyces radicidentis have been isolated from infections of endodontic origin; nevertheless, the possibility exists that their actual prevalence may have been underestimated by culture. The purpose of our study was to assess the occurrence of these 2 species in different types of endodontic infections by using the sensitive 16S rDNA-based nested polymerase chain reaction approach. To detect these 2 species, nested polymerase chain reaction was performed directly in samples taken from primary endodontic infections associated with asymptomatic periradicular lesions, acute apical periodontitis, or acute periradicular abscesses and in samples from patients in whom endodontic therapy had failed. DNA was extracted from the samples and initially amplified by using universal 16S rDNA primers. In the second round of amplification, the first polymerase chain reaction products were used to detect a specific 16S rDNA fragment of either P propionicus or A radicidentis. P propionicus was detected in 6/21 (29%) root canal samples from teeth with chronic periradicular lesions, in 5/10 (50%) cases diagnosed as acute apical periodontitis, and in 7/19 (37%) pus samples aspirated from acute periradicular abscesses. Overall, this species was found in 18/50 (36%) samples taken from primary endodontic infections. Of the root canal samples obtained from root-filled teeth with chronic periradicular lesions, P propionicus was detected in 7/12 (58%) cases. A radicidentis was detected in 1/21 (5%) root canal samples from teeth with chronic periradicular lesions and in 1/10 (10%) cases of acute apical periodontitis. No pus sample yielded this species. In general, A radicidentis was detected in 2/50 (4%) samples taken from primary endodontic infections and in 1/12 (8%) root canal samples taken from patients in whom endodontic treatment had failed. P propionicus was found in a relatively large number of patients with primary and
Evaluation of Polymerase Chain Reaction for Detecting Coliform Bacteria in Drinking Water Sources.

PubMed

Isfahani, Bahram Nasr; Fazeli, Hossein; Babaie, Zeinab; Poursina, Farkhondeh; Moghim, Sharareh; Rouzbahani, Meisam

2017-01-01

Coliform bacteria are used as indicator organisms for detecting fecal pollution in water. Traditional methods including microbial culture tests in lactose-containing media and enzyme-based tests for the detection of β-galactosidase; however, these methods are time-consuming and less specific. The aim of this study was to evaluate polymerase chain reaction (PCR) for detecting coliform. Totally, 100 of water samples from Isfahan drinking water source were collected. Coliform bacteria and Escherichia coli were detected in drinking water using LacZ and LamB genes in PCR method performed in comparison with biochemical tests for all samples. Using phenotyping, 80 coliform isolates were found. The results of the biochemical tests illustrated 78.7% coliform bacteria and 21.2% E. coli . PCR results for LacZ and LamB genes were 67.5% and 17.5%, respectively. The PCR method was shown to be an effective, sensitive, and rapid method for detecting coliform and E. coli in drinking water from the Isfahan drinking water sources.
Development of a recombinase polymerase amplification assay for the detection of pathogenic Leptospira.

PubMed

Ahmed, Ahmed; van der Linden, Hans; Hartskeerl, Rudy A

2014-05-08

Detection of leptospires based on DNA amplification techniques is essential for the early diagnosis of leptospirosis when anti-Leptospira antibodies are below the detection limit of most serological tests. In middle and low income countries where leptospirosis is endemic, routine implementation of real-time PCR is financially and technically challenging due to the requirement of expensive thermocycler equipment. In this study we report the development and evaluation of a novel isothermal recombinase polymerase amplification assay (RPA) for detection of pathogenic Leptospira based on TwistAmp chemistry. RPA enabled the detection of less than two genome copies per reaction. Retrospective evaluation revealed a high diagnostic accuracy (sensitivity and specificity of 94.7% and 97.7%, respectively) compared to culturing as the reference standard. RPA presents a powerful tool for the early diagnosis of leptospirosis in humans and in animals. Furthermore, it enables the detection of the causative agent in reservoirs and environment, and as such is a valuable adjunct to current tools for surveillance and early outbreak warning.
Concordance of polymerase chain reaction with human immunodeficiency virus antibody detection.

PubMed

Horsburgh, C R; Ou, C Y; Jason, J; Holmberg, S D; Lifson, A R; Moore, J L; Ward, J W; Seage, G R; Mayer, K H; Evatt, B L

1990-08-01

To evaluate the correlation of detection of human immunodeficiency virus (HIV) by polymerase chain reaction (PCR) with detection of HIV antibody, 271 simultaneous serum and peripheral blood mononuclear cell samples were examined from 242 persons whose activities placed them at increased risk for HIV infection: 142 from homosexual men, 86 from hemophilic men, and 43 from heterosexual partners of HIV-infected persons. PCR was performed using the gag region primer pair SK38/39 and the env region primer pairs SK68/69 and CO71/72. Amplified HIV DNA was detected using specific oligomer probes. Of 63 HIV antibody-positive samples, 58 (92%) had HIV DNA by PCR. Of 208 HIV antibody-negative samples, 7 (3.4%) had HIV DNA by PCR. On follow-up, 4 of the latter persons were seropositive when next tested; 2 were well and antibody- and PCR-negative; 1 had died of a stroke before retesting. Thus, PCR detects HIV in most antibody-positive persons; detection is increased by use of multiple primer pairs. PCR-positive antibody-negative specimens may indicate HIV infection in which antibody has not yet developed or may be false-positive PCR results. When PCR is discordant with HIV antibody, testing of additional specimens and clinical follow-up are necessary to assess HIV infection status.
[Detection of large deletions in X linked Alport syndrome using competitive multiplex fluorescence polymerase chain reaction].

PubMed

Wang, F; Zhang, Y Q; Ding, J; Yu, L X

2017-10-18

To evaluate the ability of multiplex competitive fluorescence polymerase chain reaction in detection of large deletion and duplication genotypes of X-linked Alport syndrome. Clinical diagnosis of X-linked Alport syndrome was based on either abnormal staining of type IV collagen α5 chain in the epidermal basement membrane alone or with abnormal staining of type IV collagen α5 chain in the glomerular basement membrane and Bowman's capsule/ultrastructural changes in the glomerular basement membrane typical of Alport syndrome. A total of 20 unrelated Chinese patients (13 males and 7 females) clinically diagnosed as X-linked Alport syndrome were included in the study. Their genotypes were unknown. Control subjects included a male patient with other renal disease and two patients who had large deletions in COL4A5 gene detected by multiplex ligation-dependent probe amplification. Genomic DNA was isolated from peripheral blood leukocytes in all the participants. Multiplex competitive fluorescence polymerase chain reaction was used to coamplify 53 exons of COL4A5 gene and four reference genes in a single reaction. When a deletion removed exon 1 of COL4A5 gene was identified, the same method was used to coamplify the first 4 exons of COL4A5 and COL4A6 genes, a promoter shared by COL4A5 and COL4A6 genes, and three reference genes in a single reaction. Any copy number loss suggested by this method was verified by electrophoresis of corresponding polymerase chain reaction amplified products or DNA sequencing to exclude possible DNA variations in the primer regions. Genotypes of two positive controls identified by multiplex competitive fluorescence polymerase chain reaction were consistent with those detected by multiplex ligation-dependent probe amplification. Deletions were identified in 6 of the 20 patients, including two large deletions removing the 5' part of both COL4A5 and COL4A6 genes with the breakpoint located in the second intron of COL4A6, two large deletions
N-butylamine functionalized graphene oxide for detection of iron(III) by photoluminescence quenching.

PubMed

Gholami, Javad; Manteghian, Mehrdad; Badiei, Alireza; Ueda, Hiroshi; Javanbakht, Mehran

2016-02-01

An N-butylamine functionalized graphene oxide nanolayer was synthesized and characterized by ultraviolet (UV)-visible spectrometry, Fourier transform infrared spectroscopy, X-ray photoelectron spectroscopy, and transmission electron microscopy. Detection of iron(III) based on photoluminescence spectroscopy was investigated. The N-butylamine functionalized graphene oxide was shown to specifically interact with iron (III), compared with other cationic trace elements including potassium (I), sodium (I), calcium (II), chromium (III), zinc (II), cobalt (II), copper (II), magnesium (II), manganese (II), and molybdenum (VI). The quenching effect of iron (III) on the luminescence emission of N-butylamine functionalized graphene oxide layer was used to detect iron (III). The limit of detection (2.8 × 10(-6) M) and limit of quantitation (2.9 × 10(-5) M) were obtained under optimal conditions. Copyright © 2015 John Wiley & Sons, Ltd.
Polymerase chain reaction-based detection of myc transduction in feline leukemia virus-infected cats.

PubMed

Sumi, Ryosuke; Miyake, Ariko; Endo, Taiji; Ohsato, Yoshiharu; Ngo, Minh Ha; Nishigaki, Kazuo

2018-04-01

Feline lymphomas are associated with the transduction and activation of cellular proto-oncogenes, such as c-myc, by feline leukemia virus (FeLV). We describe a polymerase chain reaction assay for detection of myc transduction usable in clinical diagnosis. The assay targets c-myc exons 2 and 3, which together result in a FeLV-specific fusion gene following c-myc transduction. When this assay was conducted on FeLV-infected feline tissues submitted for clinical diagnosis of tumors, myc transduction was detected in 14% of T-cell lymphoma/leukemias. This newly established system could become a useful diagnostic tool in veterinary medicine.
Simultaneous detection of Theileria annulata and Theileria orientalis infections using recombinase polymerase amplification.

PubMed

Hassan, Muhammad Adeel; Liu, Junlong; Sajid, Muhammad Sohail; Rashid, Muhammad; Mahmood, Altaf; Abbas, Qamar; Guan, Guiquan; Yin, Hong; Luo, Jianxun

2018-05-01

Theileriosis is a disease of domesticated animals in tropical and subtropical countries and causes significant reductions in livestock productivity. The arid region of Punjab in Pakistan is notorious for the presence of the vector tick (Acari: Ixodidae) and tick-borne diseases, such as theileriosis and babesiosis. The distribution of Theileria annulata and T. orientalis in the Chakwal district of Punjab was determined by developing a multiplex recombinase polymerase amplification (RPA) assay as a scientific basis for formulating control strategies for bovine theileriosis. Specificity was evaluated using DNA from related piroplasm species, while analytical sensitivity was calculated using a long fragment of the enolase gene. A total of 188 blood samples were collected on FTA cards (Whatman ® ) from tick-infested asymptomatic breeds of cattle (Bos indicus, Bos taurus, and Bos indicus × Bos taurus) in the study district. Finally, infections with of T. annulata and T. orientalis were detected using the multiplex RPA and compared with the conventional multiplex polymerase chain reaction (PCR). The multiplex RPA specifically amplified 282-bp and 229-bp fragments of the enolase gene from T. annulata and T. orientalis and had no cross-reaction with other piroplasm species. It was determined that 45 (23.9%) and 5 (2.6%) out of 188 blood samples were positive for T. annulata and T. orientalis, respectively, when examined using RPA. Multiplex PCR detection indicated that 32 (17.0%) and 3 (1.6%) blood samples were positive for T. annulata and T. orientalis, respectively. In the present study, a specific RPA method was developed for simultaneous differentiation and detection of T. annulata and T. orientalis infections and used for the first time for the detection of the two bovine Theileria infections. Copyright © 2018 Elsevier GmbH. All rights reserved.
An exonuclease III and graphene oxide-aided assay for DNA detection.

PubMed

Peng, Lu; Zhu, Zhi; Chen, Yan; Han, Da; Tan, Weihong

2012-05-15

We have developed a novel DNA assay based on exonuclease III (ExoIII)-induced target recycling and the fluorescence quenching ability of graphene oxide (GO). This assay consists of a linear DNA probe labeled with a fluorophore in the middle. Introduction of target sequence induces the exonuclease III catalyzed probe digestion and generation of single nucleotides. After each cycle of digestion, the target is recycled to realize the amplification. Finally, graphene oxide is added to quench the remaining probes and the signal from the resulting fluorophore labeled single nucleotides is detected. With this approach, a sub-picomolar detection limit can be achieved within 40 min at 37°C. The method was successfully applied to multicolor DNA detection and the analysis of telomerase activity in extracts from cancer cells. Copyright © 2012 Elsevier B.V. All rights reserved.
Polymerase chain reaction for detection of Leptospira spp. in clinical samples.

PubMed Central

Mérien, F; Amouriaux, P; Perolat, P; Baranton, G; Saint Girons, I

1992-01-01

A sensitive assay for Leptospira spp., the causative agent of leptospirosis, was developed on the basis of the polymerase chain reaction (PCR). A 331-bp sequence from the Leptospira interrogans serovar canicola rrs (16S) gene was amplified, and the PCR products were analyzed by DNA-DNA hybridization by using a 289-bp fragment internal to the amplified DNA. Specific PCR products also were obtained with DNA from the closely related nonpathogenic Leptospira biflexa but not with DNA from other spirochetes, such as Borrelia burgdorferi, Borrelia hermsii, Treponema denticola, Treponema pallidum, Spirochaeta aurantia, or more distant organisms such as Escherichia coli, Staphylococcus aureus, Mycobacterium tuberculosis, and Proteus mirabilis. The assay was able to detect as few as 10 bacteria. Leptospira DNA was detected in urine from experimentally infected mice. In addition, the test was found to be suitable for diagnosing leptospirosis in humans. Cerebrospinal fluid and urine from patients with leptospirosis were positive, whereas samples from control uninfected patients were negative. Images PMID:1400983
Rapid detection of Porcine circovirus 2 by recombinase polymerase amplification.

PubMed

Wang, Jianchang; Wang, Jinfeng; Liu, Libing; Li, Ruiwen; Yuan, Wanzhe

2016-09-01

Porcine circovirus-associated disease, caused primarily by Porcine circovirus 2 (PCV-2), has become endemic in many pig-producing countries and has resulted in significant economic losses to the swine industry worldwide. Tests for PCV-2 infection include PCR, nested PCR, competitive PCR, and real-time PCR (rtPCR). Recombinase polymerase amplification (RPA) has emerged as an isothermal gene amplification technology for the molecular detection of infectious disease agents. RPA is performed at a constant temperature and therefore can be carried out in a water bath. In addition, RPA is completed in ~30 min, much faster than PCR, which usually takes >60 min. We developed a RPA-based method for the detection of PCV-2. The detection limit of RPA was 10(2) copies of PCV-2 genomic DNA. RPA showed the same sensitivity as rtPCR but was 10 times more sensitive than conventional PCR. Successful amplification of PCV-2 DNA, but not other viral templates, demonstrated high specificity of the RPA assay. This method was also validated using clinical samples. The results showed that the RPA assay had a diagnostic agreement rate of 93.7% with conventional PCR and 100% with rtPCR. These findings suggest that the RPA assay is a simple, rapid, and cost-effective method for PCV-2 detection, which could be potentially applied in clinical diagnosis and field surveillance of PCV-2 infection. © 2016 The Author(s).
Evaluation of Polymerase Chain Reaction for Detecting Coliform Bacteria in Drinking Water Sources

PubMed Central

Isfahani, Bahram Nasr; Fazeli, Hossein; Babaie, Zeinab; Poursina, Farkhondeh; Moghim, Sharareh; Rouzbahani, Meisam

2017-01-01

Background: Coliform bacteria are used as indicator organisms for detecting fecal pollution in water. Traditional methods including microbial culture tests in lactose-containing media and enzyme-based tests for the detection of β-galactosidase; however, these methods are time-consuming and less specific. The aim of this study was to evaluate polymerase chain reaction (PCR) for detecting coliform. Materials and Methods: Totally, 100 of water samples from Isfahan drinking water source were collected. Coliform bacteria and Escherichia coli were detected in drinking water using LacZ and LamB genes in PCR method performed in comparison with biochemical tests for all samples. Results: Using phenotyping, 80 coliform isolates were found. The results of the biochemical tests illustrated 78.7% coliform bacteria and 21.2% E. coli. PCR results for LacZ and LamB genes were 67.5% and 17.5%, respectively. Conclusion: The PCR method was shown to be an effective, sensitive, and rapid method for detecting coliform and E. coli in drinking water from the Isfahan drinking water sources. PMID:29142893
Development of a Recombinase Polymerase Amplification Assay for the Detection of Pathogenic Leptospira

PubMed Central

Ahmed, Ahmed; van der Linden, Hans; Hartskeerl, Rudy A.

2014-01-01

Detection of leptospires based on DNA amplification techniques is essential for the early diagnosis of leptospirosis when anti-Leptospira antibodies are below the detection limit of most serological tests. In middle and low income countries where leptospirosis is endemic, routine implementation of real-time PCR is financially and technically challenging due to the requirement of expensive thermocycler equipment. In this study we report the development and evaluation of a novel isothermal recombinase polymerase amplification assay (RPA) for detection of pathogenic Leptospira based on TwistAmp chemistry. RPA enabled the detection of less than two genome copies per reaction. Retrospective evaluation revealed a high diagnostic accuracy (sensitivity and specificity of 94.7% and 97.7%, respectively) compared to culturing as the reference standard. RPA presents a powerful tool for the early diagnosis of leptospirosis in humans and in animals. Furthermore, it enables the detection of the causative agent in reservoirs and environment, and as such is a valuable adjunct to current tools for surveillance and early outbreak warning. PMID:24814943
Development of a recombinase polymerase amplification assay for rapid detection of Francisella noatunensis subsp. orientalis

PubMed Central

Gustavo Ramirez-Paredes, Jose; Harold, Graham; Lopez-Jimena, Benjamin; Adams, Alexandra; Weidmann, Manfred

2018-01-01

Francisella noatunensis subsp. orientalis (Fno) is the causative agent of piscine francisellosis in warm water fish including tilapia. The disease induces chronic granulomatous inflammation with high morbidity and can result in high mortality. Early and accurate detection of Fno is crucial to set appropriate outbreak control measures in tilapia farms. Laboratory detection of Fno mainly depends on bacterial culture and molecular techniques. Recombinase polymerase amplification (RPA) is a novel isothermal technology that has been widely used for the molecular diagnosis of various infectious diseases. In this study, a recombinase polymerase amplification (RPA) assay for rapid detection of Fno was developed and validated. The RPA reaction was performed at a constant temperature of 42°C for 20 min. The RPA assay was performed using a quantitative plasmid standard containing a unique Fno gene sequence. Validation of the assay was performed not only by using DNA from Fno, closely related Francisella species and other common bacterial pathogens in tilapia farms, but also by screening 78 Nile tilapia and 5 water samples. All results were compared with those obtained by previously established real-time qPCR. The developed RPA showed high specificity in detection of Fno with no cross-detection of either the closely related Francisella spp. or the other tested bacteria. The Fno-RPA performance was highly comparable to the published qPCR with detection limits at 15 and 11 DNA molecules detected, respectively. The RPA gave quicker results in approximately 6 min in contrast to the qPCR that needed about 90 min to reach the same detection limit, taking only 2.7–3 min to determine Fno in clinical samples. Moreover, RPA was more tolerant to reaction inhibitors than qPCR when tested with field samples. The fast reaction, simplicity, cost-effectiveness, sensitivity and specificity make the RPA an attractive diagnostic tool that will contribute to controlling the infection through
Development of a recombinase polymerase amplification assay for rapid detection of Francisella noatunensis subsp. orientalis.

PubMed

Shahin, Khalid; Gustavo Ramirez-Paredes, Jose; Harold, Graham; Lopez-Jimena, Benjamin; Adams, Alexandra; Weidmann, Manfred

2018-01-01

Francisella noatunensis subsp. orientalis (Fno) is the causative agent of piscine francisellosis in warm water fish including tilapia. The disease induces chronic granulomatous inflammation with high morbidity and can result in high mortality. Early and accurate detection of Fno is crucial to set appropriate outbreak control measures in tilapia farms. Laboratory detection of Fno mainly depends on bacterial culture and molecular techniques. Recombinase polymerase amplification (RPA) is a novel isothermal technology that has been widely used for the molecular diagnosis of various infectious diseases. In this study, a recombinase polymerase amplification (RPA) assay for rapid detection of Fno was developed and validated. The RPA reaction was performed at a constant temperature of 42°C for 20 min. The RPA assay was performed using a quantitative plasmid standard containing a unique Fno gene sequence. Validation of the assay was performed not only by using DNA from Fno, closely related Francisella species and other common bacterial pathogens in tilapia farms, but also by screening 78 Nile tilapia and 5 water samples. All results were compared with those obtained by previously established real-time qPCR. The developed RPA showed high specificity in detection of Fno with no cross-detection of either the closely related Francisella spp. or the other tested bacteria. The Fno-RPA performance was highly comparable to the published qPCR with detection limits at 15 and 11 DNA molecules detected, respectively. The RPA gave quicker results in approximately 6 min in contrast to the qPCR that needed about 90 min to reach the same detection limit, taking only 2.7-3 min to determine Fno in clinical samples. Moreover, RPA was more tolerant to reaction inhibitors than qPCR when tested with field samples. The fast reaction, simplicity, cost-effectiveness, sensitivity and specificity make the RPA an attractive diagnostic tool that will contribute to controlling the infection through
A Portable Reverse Transcription Recombinase Polymerase Amplification Assay for Rapid Detection of Foot-and-Mouth Disease Virus

PubMed Central

Abd El Wahed, Ahmed; El-Deeb, Ayman; El-Tholoth, Mohamed; Abd El Kader, Hanaa; Ahmed, Abeer; Hassan, Sayed; Hoffmann, Bernd; Haas, Bernd; Shalaby, Mohamed A.; Hufert, Frank T.; Weidmann, Manfred

2013-01-01

Foot-and-mouth disease (FMD) is a trans-boundary viral disease of livestock, which causes huge economic losses and constitutes a serious infectious threat for livestock farming worldwide. Early diagnosis of FMD helps to diminish its impact by adequate outbreak management. In this study, we describe the development of a real-time reverse transcription recombinase polymerase amplification (RT-RPA) assay for the detection of FMD virus (FMDV). The FMDV RT-RPA design targeted the 3D gene of FMDV and a 260 nt molecular RNA standard was used for assay validation. The RT-RPA assay was fast (4–10 minutes) and the analytical sensitivity was determined at 1436 RNA molecules detected by probit regression analysis. The FMDV RT-RPA assay detected RNA prepared from all seven FMDV serotypes but did not detect classical swine fever virus or swine vesicular disease virus. The FMDV RT-RPA assay was used in the field during the recent FMD outbreak in Egypt. In clinical samples, reverse transcription polymerase chain reaction (RT-PCR) and RT-RPA showed a diagnostic sensitivity of 100% and 98%, respectively. In conclusion, FMDV RT-RPA was quicker and much easier to handle in the field than real-time RT-PCR. Thus RT-RPA could be easily implemented to perform diagnostics at quarantine stations or farms for rapid spot-of-infection detection. PMID:23977101
A portable reverse transcription recombinase polymerase amplification assay for rapid detection of foot-and-mouth disease virus.

PubMed

Abd El Wahed, Ahmed; El-Deeb, Ayman; El-Tholoth, Mohamed; Abd El Kader, Hanaa; Ahmed, Abeer; Hassan, Sayed; Hoffmann, Bernd; Haas, Bernd; Shalaby, Mohamed A; Hufert, Frank T; Weidmann, Manfred

2013-01-01

Foot-and-mouth disease (FMD) is a trans-boundary viral disease of livestock, which causes huge economic losses and constitutes a serious infectious threat for livestock farming worldwide. Early diagnosis of FMD helps to diminish its impact by adequate outbreak management. In this study, we describe the development of a real-time reverse transcription recombinase polymerase amplification (RT-RPA) assay for the detection of FMD virus (FMDV). The FMDV RT-RPA design targeted the 3D gene of FMDV and a 260 nt molecular RNA standard was used for assay validation. The RT-RPA assay was fast (4-10 minutes) and the analytical sensitivity was determined at 1436 RNA molecules detected by probit regression analysis. The FMDV RT-RPA assay detected RNA prepared from all seven FMDV serotypes but did not detect classical swine fever virus or swine vesicular disease virus. The FMDV RT-RPA assay was used in the field during the recent FMD outbreak in Egypt. In clinical samples, reverse transcription polymerase chain reaction (RT-PCR) and RT-RPA showed a diagnostic sensitivity of 100% and 98%, respectively. In conclusion, FMDV RT-RPA was quicker and much easier to handle in the field than real-time RT-PCR. Thus RT-RPA could be easily implemented to perform diagnostics at quarantine stations or farms for rapid spot-of-infection detection.
Signal-on electrochemiluminescence biosensor for microRNA-319a detection based on two-stage isothermal strand-displacement polymerase reaction.

PubMed

Wang, Minghui; Zhou, Yunlei; Yin, Huanshun; Jiang, Wenjing; Wang, Haiyan; Ai, Shiyun

2018-06-01

MicroRNAs play crucial role in regulating gene expression in organism, thus it is very necessary to exploit an efficient method for the sensitive and specific detection of microRNA. Herein, a signal-on electrochemiluminescence biosensor was fabricated for microRNA-319a detection based on two-stage isothermal strand-displacement polymerase reaction (ISDPR). In the presence of target microRNA, amounts of trigger DNA could be generated by the first ISDPR. Then, the trigger DNA and the primer hybridized simultaneously with the hairpin probe to open the stem of the probe, and then the ECL signal will be emitted. In the presence of phi29 DNA polymerase and dNTPs, the trigger DNA could be displaced to initiate a new cycle which was the second ISDPR. Due to the two-stage amplification, this method presented excellent detection sensitivity with a low detection limit of 0.14 fM. Moreover, the applicability of the developed method was demonstrated by detecting the change of microRNA-319a content in the leaves of rice seedlings after the rice seeds were incubated with chemical mutagen of ethyl methanesulfonate. Copyright © 2018 Elsevier B.V. All rights reserved.

A novel electrochemical biosensor based on dynamic polymerase-extending hybridization for E. coli O157:H7 DNA detection.

PubMed

Wang, Lijiang; Liu, Qingjun; Hu, Zhaoying; Zhang, Yuanfan; Wu, Chunsheng; Yang, Mo; Wang, Ping

2009-05-15

A novel biosensor based on single-stranded DNA (ssDNA) probe functionalized aluminum anodized oxide (AAO) nanopore membranes was demonstrated for Escherichia coli O157:H7 DNA detection. An original and dynamic polymerase-extending (PE) DNA hybridization procedure is proposed, where hybridization happens in the existence of Taq DNA polymerase and dNTPs under controlled reaction temperature. The probe strand would be extended as long as the target DNA strand, then the capability to block the ionic flow in the pores has been prominently enhanced by the double strand complex. We have investigated the variation of ionic conductivity during the fabrication of the film and the hybridization using cyclic voltammetry and impedance spectroscopy. The present approach provides low detection limit for DNA (a few hundreds of pmol), rapid label-free and easy-to-use bacteria detection, which holds the potential for future use in various ss-DNA analyses by integrated into a self-contained biochip.
Detection of canine cytokine gene expression by reverse transcription-polymerase chain reaction.

PubMed

Pinelli, E; van der Kaaij, S Y; Slappendel, R; Fragio, C; Ruitenberg, E J; Bernadina, W; Rutten, V P

1999-08-02

Further characterization of the canine immune system will greatly benefit from the availability of tools to detect canine cytokines. Our interest concerns the study on the role of cytokines in canine visceral leishmaniasis. For this purpose, we have designed specific primers using previously published sequences for the detection of canine IL-2, IFN-gamma and IL10 mRNA by reverse transcription-polymerase chain reaction (RT-PCR). For IL-4, we have cloned and sequenced this cytokine gene, and developed canine-specific primers. To control for sample-to-sample variation in the quantity of mRNA and variation in the RT and PCR reactions, the mRNA levels of glyceraldehyde-3-phosphate dehydrogenase (G3PDH), a housekeeping gene, were determined in parallel. Primers to amplify G3PDH were designed from consensus sequences obtained from the Genbank database. The mRNA levels of the cytokines mentioned here were detected from ConA-stimulated peripheral mononuclear cells derived from Leishmania-infected dogs. A different pattern of cytokine production among infected animals was found.
DNA Polymerase α Subunit Residues and Interactions Required for Efficient Initiation Complex Formation Identified by a Genetic Selection.

PubMed

Lindow, Janet C; Dohrmann, Paul R; McHenry, Charles S

2015-07-03

Biophysical and structural studies have defined many of the interactions that occur between individual components or subassemblies of the bacterial replicase, DNA polymerase III holoenzyme (Pol III HE). Here, we extended our knowledge of residues and interactions that are important for the first step of the replicase reaction: the ATP-dependent formation of an initiation complex between the Pol III HE and primed DNA. We exploited a genetic selection using a dominant negative variant of the polymerase catalytic subunit that can effectively compete with wild-type Pol III α and form initiation complexes, but cannot elongate. Suppression of the dominant negative phenotype was achieved by secondary mutations that were ineffective in initiation complex formation. The corresponding proteins were purified and characterized. One class of mutant mapped to the PHP domain of Pol III α, ablating interaction with the ϵ proofreading subunit and distorting the polymerase active site in the adjacent polymerase domain. Another class of mutation, found near the C terminus, interfered with τ binding. A third class mapped within the known β-binding domain, decreasing interaction with the β2 processivity factor. Surprisingly, mutations within the β binding domain also ablated interaction with τ, suggesting a larger τ binding site than previously recognized. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.
Detection of human Pneumocystis carinii by the polymerase chain reaction.

PubMed

Becker-Hapak, M; Liberator, P; Graves, D

1991-01-01

Oligonucleotide primers were prepared from a clone (B12) which has been shown to be a repetitive sequence in the rat P. carinii genome. Polymerase chain reaction was employed to amplify both rat and human P. carinii DNA. The detection limit of the assay was approximately 600 ng of total nucleic acid. Amplification products from both the rat and human isolates (ca. 780 bp) were characterized by denaturing gradient gel electrophoresis after digestion with Sau3A. No amplification products were obtained when DNA from the following potential pulmonary pathogens were used in identical reactions: Aspergillus fumigatus, Cryptococcus neoformans, Candida albicans, Mycobacterium avium-intracellulare and cytomegalovirus. In a blind study using the B12 primers, P. carinii DNA was successfully amplified in clinical samples which were positive by direct immunofluorescence assay (IFA) as well as in some specimens not identified by direct IFA.
Rapid and sensitive detection of mink circovirus by recombinase polymerase amplification.

PubMed

Ge, Junwei; Shi, Yunjia; Cui, Xingyang; Gu, Shanshan; Zhao, Lili; Chen, Hongyan

2018-06-01

To date, the pathogenic role of mink circovirus (MiCV) remains unclear, and its prevalence and economic importance are unknown. Therefore, a rapid and sensitive molecular diagnosis is necessary for disease management and epidemiological surveillance. However, only PCR methods can identify MiCV infection at present. In this study, we developed a nested PCR and established a novel recombinase polymerase amplification (RPA) assay for MiCV detection. Sensitivity analysis showed that the detection limit of nested PCR and RPA assay was 10 1 copies/reaction, and these methods were more sensitive than conventional PCR, which has a detection limit of 10 5 copies/reaction. The RPA assay had no cross-reactivity with other related viral pathogens, and amplification was completed in less than 20 min with a simple device. Further assessment of clinical samples showed that the two assays were accurate in identifying positive and negative conventional PCR samples. The detection rate of MiCV by the RPA assay in clinical samples was 38.09%, which was 97% consistent with that by the nested PCR. The developed nested PCR is a highly sensitive tool for practical use, and the RPA assay is a simple, sensitive, and potential alternative method for rapid and accurate MiCV diagnosis. Copyright © 2018 Elsevier B.V. All rights reserved.
[Application of recombinase polymerase amplification in the detection of Pseudomonas aeruginosa].

PubMed

Jin, X J; Gong, Y L; Yang, L; Mo, B H; Peng, Y Z; He, P; Zhao, J N; Li, X L

2018-04-20

Objective: To establish an optimized method of recombinase polymerase amplification (RPA) to rapidly detect Pseudomonas aeruginosa in clinic. Methods: (1) The DNA templates of one standard Pseudomonas aeruginosa strain was extracted and detected by polymerase chain reaction (PCR), real-time fluorescence quantitative PCR and RPA. Time of sample loading, time of amplification, and time of detection of the three methods were recorded. (2) One standard Pseudomonas aeruginosa strain was diluted in 7 concentrations of 1×10(7,) 1×10(6,) 1×10(5,) 1×10(4,) 1×10(3,) 1×10(2,) and 1×10(1) colony forming unit (CFU)/mL after recovery and cultivation. The DNA templates of Pseudomonas aeruginosa and negative control strain Pseudomonas putida were extracted and detected by PCR, real-time fluorescence quantitative PCR, and RPA separately. The sensitivity of the three methods in detecting Pseudomonas aeruginosa was analyzed. (3) The DNA templates of one standard Pseudomonas aeruginosa strain and four negative control strains ( Staphylococcus aureus, Acinetobacter baumanii, Candida albicans, and Pseudomonas putida ) were extracted separately, and then they were detected by PCR, real-time fluorescence quantitative PCR, and RPA. The specificity of the three methods in detecting Pseudomonas aeruginosa was analyzed. (4) The DNA templates of 28 clinical strains of Pseudomonas aeruginosa preserved in glycerin, 1 clinical strain of which was taken by cotton swab, and negative control strain Pseudomonas putida were extracted separately, and then they were detected by RPA. Positive amplification signals of the clinical strains were observed, and the detection rate was calculated. All experiments were repeated for 3 times. Sensitivity results were analyzed by GraphPad Prism 5.01 statistical software. Results: (1) The loading time of RPA, PCR, and real-time fluorescence quantitative PCR for detecting Pseudomonas aeruginosa were all 20 minutes. In PCR, time of amplification was 98 minutes
DNA synthesis involving a complexes form of DNA polymerase I in extracts of Escherichia coli.

PubMed Central

Hendler, R W; Pereira, M; Scharff, R

1975-01-01

DNA polymerase I (EC 2.7.7.7; deoxynucleosidetriphosphate:DNA deoxynucleotidyltransferase) has been recovered as a complex of about 390,000 molecular weight. The complex displays an ATP-stimulated DNA-synthesizing activity that prefers native to heat-denatured DNA. Genetic evidence indicates that the recBC enzyme is associated with the polymerase in the complex. Preliminary evidence for complexes involving DNA polymerases II and III is also presented. PMID:1094453
Rapid Detection and Identification of a Pathogen's DNA Using Phi29 DNA Polymerase

DOE Office of Scientific and Technical Information (OSTI.GOV)

Xu, Y.; Dunn, J.; Gao, S.

2008-10-31

Zoonotic pathogens including those transmitted by insect vectors are some of the most deadly of all infectious diseases known to mankind. A number of these agents have been further weaponized and are widely recognized as being potentially significant biothreat agents. We describe a novel method based on multiply-primed rolling circle in vitro amplification for profiling genomic DNAs to permit rapid, cultivation-free differential detection and identification of circular plasmids in infectious agents. Using Phi29 DNA polymerase and a two-step priming reaction we could reproducibly detect and characterize by DNA sequencing circular DNA from Borrelia burgdorferi B31 in DNA samples containing asmore » little as 25 pg of Borrelia DNA amongst a vast excess of human DNA. This simple technology can ultimately be adapted as a sensitive method to detect specific DNA from both known and unknown pathogens in a wide variety of complex environments.« less
Cross-subtype detection of HIV-1 using reverse transcription and recombinase polymerase amplification.

PubMed

Lillis, Lorraine; Lehman, Dara A; Siverson, Joshua B; Weis, Julie; Cantera, Jason; Parker, Mathew; Piepenburg, Olaf; Overbaugh, Julie; Boyle, David S

2016-04-01

A low complexity diagnostic test that rapidly and reliably detects HIV infection in infants at the point of care could facilitate early treatment, improving outcomes. However, many infant HIV diagnostics can only be performed in laboratory settings. Recombinase polymerase amplification (RPA) is an isothermal amplification technology that can rapidly amplify proviral DNA from multiple subtypes of HIV-1 in under twenty minutes without complex equipment. In this study we added reverse transcription (RT) to RPA to allow detection of both HIV-1 RNA and DNA. We show that this RT-RPA HIV-1 assay has a limit of detection of 10-30 copies of an exact sequence matched DNA or RNA, respectively. In addition, at 100 copies of RNA or DNA, the assay detected 171 of 175 (97.7%) sequence variants that represent all the major subtypes and recombinant forms of HIV-1 Groups M and O. This data suggests that the application of RT-RPA for the combined detection of HIV-1 viral RNA and proviral DNA may prove a highly sensitive tool for rapid and accurate diagnosis of infant HIV. Copyright © 2016 Elsevier B.V. All rights reserved.
Cross-subtype Detection of HIV-1 Using Reverse Transcription and Recombinase Polymerase Amplification

PubMed Central

Lillis, Lorraine; Lehman, Dara A.; Siverson, Joshua B.; Weis, Julie; Cantera, Jason; Parker, Mathew; Piepenburg, Olaf; Overbaugh, Julie; Boyle, David S.

2016-01-01

A low complexity diagnostic test that rapidly and reliably detects HIV infection in infants at the point of care could facilitate early treatment, improving outcomes. However, many infant HIV diagnostics can only be performed in laboratory settings. Recombinase polymerase amplification (RPA) is an isothermal amplification technology that can rapidly amplify proviral DNA from multiple subtypes of HIV-1 in under twenty minutes without complex equipment. In this study we added reverse transcription (RT) to RPA to allow detection of both HIV-1 RNA and DNA. We show that this RT-RPA HIV-1 assay has a limit of detection of 10 to 30 copies of an exact sequence matched DNA or RNA, respectively. In addition, at 100 copies of RNA or DNA, the assay detected 171 of 175 (97.7 %) sequence variants that represent all the major subtypes and recombinant forms of HIV-1 Groups M and O. This data suggests that the application of RT-RPA for the combined detection of HIV-1 viral RNA and proviral DNA may prove a highly sensitive tool for rapid and accurate diagnosis of infant HIV. PMID:26821087
Label-free electrical detection of pyrophosphate generated from DNA polymerase reactions on field-effect devices.

PubMed

Credo, Grace M; Su, Xing; Wu, Kai; Elibol, Oguz H; Liu, David J; Reddy, Bobby; Tsai, Ta-Wei; Dorvel, Brian R; Daniels, Jonathan S; Bashir, Rashid; Varma, Madoo

2012-03-21

We introduce a label-free approach for sensing polymerase reactions on deoxyribonucleic acid (DNA) using a chelator-modified silicon-on-insulator field-effect transistor (SOI-FET) that exhibits selective and reversible electrical response to pyrophosphate anions. The chemical modification of the sensor surface was designed to include rolling-circle amplification (RCA) DNA colonies for locally enhanced pyrophosphate (PPi) signal generation and sensors with immobilized chelators for capture and surface-sensitive detection of diffusible reaction by-products. While detecting arrays of enzymatic base incorporation reactions is typically accomplished using optical fluorescence or chemiluminescence techniques, our results suggest that it is possible to develop scalable and portable PPi-specific sensors and platforms for broad biomedical applications such as DNA sequencing and microbe detection using surface-sensitive electrical readout techniques.
DISCUSSION OF "DETECTION OF CRYPTOSPORIDIUM PARVUM IN SECONDARY EFFLUENTS USING A MOST PROBABLE NUMBER-POLYMERASE CHAIN REACTION ASSAY"

EPA Science Inventory

The emphasis of this paper is to show that most probable number-polymerase chain reaction (MPNPCR) assay can be used to detect Cryptosporidium parvum in WWTP effluents as an alternative to immunfluorescent assay (IFA). I am concerned, however, that the paper suggests that all WW...
Detection and Characterization of Viral Species/Subspecies Using Isothermal Recombinase Polymerase Amplification (RPA) Assays.

PubMed

Glais, Laurent; Jacquot, Emmanuel

2015-01-01

Numerous molecular-based detection protocols include an amplification step of the targeted nucleic acids. This step is important to reach the expected sensitive detection of pathogens in diagnostic procedures. Amplifications of nucleic acid sequences are generally performed, in the presence of appropriate primers, using thermocyclers. However, the time requested to amplify molecular targets and the cost of the thermocycler machines could impair the use of these methods in routine diagnostics. Recombinase polymerase amplification (RPA) technique allows rapid (short-term incubation of sample and primers in an enzymatic mixture) and simple (isothermal) amplification of molecular targets. RPA protocol requires only basic molecular steps such as extraction procedures and agarose gel electrophoresis. Thus, RPA can be considered as an interesting alternative to standard molecular-based diagnostic tools. In this paper, the complete procedures to set up an RPA assay, applied to detection of RNA (Potato virus Y, Potyvirus) and DNA (Wheat dwarf virus, Mastrevirus) viruses, are described. The proposed procedure allows developing species- or subspecies-specific detection assay.
Polymerase chain reaction for detection of invasive Shigella flexneri in food.

PubMed

Lampel, K A; Jagow, J A; Trucksess, M; Hill, W E

1990-06-01

The polymerase chain reaction (PCR) was used to amplify a 760-base-pair (bp) fragment with the 220-kbp invasive plasmids of enteroinvasive Escherichia coli, Shigella flexneri, Shigella dysenteriae, Shigella boydii, and Shigella sonnei as templates. This PCR product was easily detected by agarose gel electrophoresis. A 210-bp AccI-PstI fragment lying within the amplified region was used as a probe in Southern hybridization blots and showed that the PCR-generated product was derived from the invasive plasmid. The application of PCR as a rapid method to detect enteroinvasive bacteria in foods was tested by inoculating lettuce with 10(4) S. flexneri cells per g in shigella broth base. Plasmid DNA was isolated from cultures of inoculated and uninoculated lettuce in broth after 0, 4, and 24 h of incubation. With the PCR, the 760-bp fragment was generated only from lettuce inoculated with S. flexneri, as shown by gel electrophoresis and confirmed both by Southern blotting and by nucleotide sequencing of the amplified region. Because the isolation of plasmid DNA, the performance of PCR, and gel electrophoresis all can be completed in 6 to 7 h, invasive enteric bacteria can be detected in less than 1 day.
A polymerase chain reaction-based methodology to detect gene doping.

PubMed

Carter, Adam; Flueck, Martin

2012-04-01

The non-therapeutic use of genes to enhance athletic performance (gene doping) is a novel threat to the world of sports. Skeletal muscle is a prime target of gene therapy and we asked whether we can develop a test system to produce and detect gene doping. Towards this end, we introduced a plasmid (pCMV-FAK, 3.8 kb, 50 μg) for constitutive expression of the chicken homologue for the regulator of muscle growth, focal adhesion kinase (FAK), via gene electro transfer in the anti-gravitational muscle, m. soleus, or gastrocnemius medialis of rats. Activation of hypertrophy signalling was monitored by assessing the ribosomal kinase p70S6K and muscle fibre cross section. Detectability of the introduced plasmid was monitored with polymerase chain reaction in deoxyribonucleic acids (DNA) from transfected muscle and serum. Muscle transfection with pCMV-FAK elevated FAK expression 7- and 73-fold, respectively, and increased mean cross section by 52 and 16% in targeted muscle fibres of soleus and gastrocnemius muscle 7 days after gene electro transfer. Concomitantly p70S6K content was increased in transfected soleus muscle (+110%). Detection of the exogenous plasmid sequence was possible in DNA and cDNA of muscle until 7 days after transfection, but not in serum except close to the site of plasmid deposition, 1 h after injection and surgery. The findings suggest that the reliable detection of gene doping in the immoral athlete is not possible unless a change in the current practice of tissue sampling is applied involving the collection of muscle biopsy close to the site of gene injection.
Development of a Tandem Repeat-Based Polymerase Chain Displacement Reaction Method for Highly Sensitive Detection of 'Candidatus Liberibacter asiaticus'.

PubMed

Lou, Binghai; Song, Yaqin; RoyChowdhury, Moytri; Deng, Chongling; Niu, Ying; Fan, Qijun; Tang, Yan; Zhou, Changyong

2018-02-01

Huanglongbing (HLB) is one of the most destructive diseases in citrus production worldwide. Early detection of HLB pathogens can facilitate timely removal of infected citrus trees in the field. However, low titer and uneven distribution of HLB pathogens in host plants make reliable detection challenging. Therefore, the development of effective detection methods with high sensitivity is imperative. This study reports the development of a novel method, tandem repeat-based polymerase chain displacement reaction (TR-PCDR), for the detection of 'Candidatus Liberibacter asiaticus', a widely distributed HLB-associated bacterium. A uniquely designed primer set (TR2-PCDR-F/TR2-PCDR-1R) and a thermostable Taq DNA polymerase mutant with strand displacement activity were used for TR-PCDR amplification. Performed in a regular thermal cycler, TR-PCDR could produce more than two amplicons after each amplification cycle. Sensitivity of the developed TR-PCDR was 10 copies of target DNA fragment. The sensitive level was proven to be 100× higher than conventional PCR and similar to real-time PCR. Data from the detection of 'Ca. L. asiaticus' with filed samples using the above three methods also showed similar results. No false-positive TR-PCDR amplification was observed from healthy citrus samples and water controls. These results thereby illustrated that the developed TR-PCDR method can be applied to the reliable, highly sensitive, and cost-effective detection of 'Ca. L. asiaticus'.
Polymerase chain displacement reaction.

PubMed

Harris, Claire L; Sanchez-Vargas, Irma J; Olson, Ken E; Alphey, Luke; Fu, Guoliang

2013-02-01

Quantitative PCR assays are now the standard method for viral diagnostics. These assays must be specific, as well as sensitive, to detect the potentially low starting copy number of viral genomic material. We describe a new technique, polymerase chain displacement reaction (PCDR), which uses multiple nested primers in a rapid, capped, one-tube reaction that increases the sensitivity of normal quantitative PCR (qPCR) assays. Sensitivity was increased by approximately 10-fold in a proof-of-principle test on dengue virus sequence. In PCDR, when extension occurs from the outer primer, it displaces the extension strand produced from the inner primer by utilizing a polymerase that has strand displacement activity. This allows a greater than 2-fold increase of amplification product for each amplification cycle and therefore increased sensitivity and speed over conventional PCR. Increased sensitivity in PCDR would be useful in nucleic acid detection for viral diagnostics.
Mapping DNA polymerase errors by single-molecule sequencing

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lee, David F.; Lu, Jenny; Chang, Seungwoo

Genomic integrity is compromised by DNA polymerase replication errors, which occur in a sequence-dependent manner across the genome. Accurate and complete quantification of a DNA polymerase's error spectrum is challenging because errors are rare and difficult to detect. We report a high-throughput sequencing assay to map in vitro DNA replication errors at the single-molecule level. Unlike previous methods, our assay is able to rapidly detect a large number of polymerase errors at base resolution over any template substrate without quantification bias. To overcome the high error rate of high-throughput sequencing, our assay uses a barcoding strategy in which each replicationmore » product is tagged with a unique nucleotide sequence before amplification. Here, this allows multiple sequencing reads of the same product to be compared so that sequencing errors can be found and removed. We demonstrate the ability of our assay to characterize the average error rate, error hotspots and lesion bypass fidelity of several DNA polymerases.« less
Mapping DNA polymerase errors by single-molecule sequencing

DOE PAGES

Lee, David F.; Lu, Jenny; Chang, Seungwoo; ...

2016-05-16

Genomic integrity is compromised by DNA polymerase replication errors, which occur in a sequence-dependent manner across the genome. Accurate and complete quantification of a DNA polymerase's error spectrum is challenging because errors are rare and difficult to detect. We report a high-throughput sequencing assay to map in vitro DNA replication errors at the single-molecule level. Unlike previous methods, our assay is able to rapidly detect a large number of polymerase errors at base resolution over any template substrate without quantification bias. To overcome the high error rate of high-throughput sequencing, our assay uses a barcoding strategy in which each replicationmore » product is tagged with a unique nucleotide sequence before amplification. Here, this allows multiple sequencing reads of the same product to be compared so that sequencing errors can be found and removed. We demonstrate the ability of our assay to characterize the average error rate, error hotspots and lesion bypass fidelity of several DNA polymerases.« less
Rapid and specific detection of porcine parvovirus by isothermal recombinase polymerase amplification assays.

PubMed

Yang, Yang; Qin, Xiaodong; Zhang, Wei; Li, Yanmin; Zhang, Zhidong

2016-10-01

Porcine parvovirus (PPV) is a major cause of swine reproductive failure and reported in many countries worldwide. Recombinase polymerase amplification (RPA) assays using a real-time fluorescent detection (PPV real-time RPA assay) and a lateral flow dipstick (PPV RPA LFD assay) were developed targeting PPV NS1 gene. The detection limit of PPV real-time RPA assay was 300 copies per reaction within 9 min at 38 °C, while the RPA LFD assay has a detection limit of 400 copies per reaction in less than 20 min at 38 °C. In both assays, there were no cross-reactions with porcine circovirus type 2, pseudorabies virus, porcine reproductive and respiratory syndrome virus, classical swine fever virus, and foot-and-mouth disease virus. Based on a total of 128 clinical samples examined, the sensitivity and the specificity of the developed RPA assays for identification of PPV was 94.4% and 100%, respectively, when compared to real-time (qPCR) assay. Therefore, the RPA assay provides a rapid, sensitive and specific alternative for PPV detection. Copyright © 2016 Elsevier Ltd. All rights reserved.

Polymerase chain reaction system

DOEpatents

Benett, William J.; Richards, James B.; Stratton, Paul L.; Hadley, Dean R.; Milanovich, Fred P.; Belgrader, Phil; Meyer, Peter L.

2004-03-02

A portable polymerase chain reaction DNA amplification and detection system includes one or more chamber modules. Each module supports a duplex assay of a biological sample. Each module has two parallel interrogation ports with a linear optical system. The system is capable of being handheld.
Rapid detection of Mycobacterium tuberculosis by recombinase polymerase amplification.

PubMed

Boyle, David S; McNerney, Ruth; Teng Low, Hwee; Leader, Brandon Troy; Pérez-Osorio, Ailyn C; Meyer, Jessica C; O'Sullivan, Denise M; Brooks, David G; Piepenburg, Olaf; Forrest, Matthew S

2014-01-01

Improved access to effective tests for diagnosing tuberculosis (TB) has been designated a public health priority by the World Health Organisation. In high burden TB countries nucleic acid based TB tests have been restricted to centralised laboratories and specialised research settings. Requirements such as a constant electrical supply, air conditioning and skilled, computer literate operators prevent implementation of such tests in many settings. Isothermal DNA amplification technologies permit the use of simpler, less energy intensive detection platforms more suited to low resource settings that allow the accurate diagnosis of a disease within a short timeframe. Recombinase Polymerase Amplification (RPA) is a rapid, low temperature isothermal DNA amplification reaction. We report here RPA-based detection of Mycobacterium tuberculosis complex (MTC) DNA in <20 minutes at 39 °C. Assays for two MTC specific targets were investigated, IS6110 and IS1081. When testing purified MTC genomic DNA, limits of detection of 6.25 fg (IS6110) and 20 fg (IS1081)were consistently achieved. When testing a convenience sample of pulmonary specimens from suspected TB patients, RPA demonstrated superior accuracy to indirect fluorescence microscopy. Compared to culture, sensitivities for the IS1081 RPA and microscopy were 91.4% (95%CI: 85, 97.9) and 86.1% (95%CI: 78.1, 94.1) respectively (n = 71). Specificities were 100% and 88.6% (95% CI: 80.8, 96.1) respectively. For the IS6110 RPA and microscopy sensitivities of 87.5% (95%CI: 81.7, 93.2) and 70.8% (95%CI: 62.9, 78.7) were obtained (n = 90). Specificities were 95.4 (95% CI: 92.3,98.1) and 88% (95% CI: 83.6, 92.4) respectively. The superior specificity of RPA for detecting tuberculosis was due to the reduced ability of fluorescence microscopy to distinguish Mtb complex from other acid fast bacteria. The rapid nature of the RPA assay and its low energy requirement compared to other amplification technologies suggest RPA-based TB assays
An Enhanced Polymerase Chain Reaction Assay to Detect Pre- and Full Mutation Alleles of the Fragile X Mental Retardation 1 Gene

PubMed Central

Saluto, Alessandro; Brussino, Alessandro; Tassone, Flora; Arduino, Carlo; Cagnoli, Claudia; Pappi, Patrizia; Hagerman, Paul; Migone, Nicola; Brusco, Alfredo

2005-01-01

Several diagnostic strategies have been applied to the detection of FMR1 gene repeat expansions in fragile X syndrome. Here, we report a novel polymerase chain reaction-based strategy using the Expand Long Template PCR System (Roche Diagnostics, Mannheim, Germany) and the osmolyte betaine. Repeat expansions up to ∼330 CGGs in males and up to at least ∼160 CGGs in carrier women could be easily visualized on ethidium bromide agarose gels. We also demonstrated that fluorescence analysis of polymerase chain reaction products was a reliable tool to verify the presence of premutation and full mutation alleles both in males and in females. This technique, primarily designed to detect premutation alleles, can be used as a routine first screen for expanded FMR1 alleles. PMID:16258159
A METHOD TO REMOVE ENVIRONMENTAL INHIBITORS PRIOR TO THE DETECTION OF WATERBORNE ENTERIC VIRUSES BY REVERSE TRANSCRIPTION-POLYMERASE CHAIN REACTION

EPA Science Inventory

A method was developed to remove environmental inhibitors from sample concentrates prior to detection of human enteric viruses using the reverse transcription-polymerase chain reaction (RT-PCR).Environmental inhibitors, concentrated along with viruses during water sample processi...
Multisite analytic performance studies of a real-time polymerase chain reaction assay for the detection of BRAF V600E mutations in formalin-fixed, paraffin-embedded tissue specimens of malignant melanoma.

PubMed

Anderson, Steven; Bloom, Kenneth J; Vallera, Dino U; Rueschoff, Josef; Meldrum, Cliff; Schilling, Robert; Kovach, Barbara; Lee, Ju Ruey-Jiuan; Ochoa, Pam; Langland, Rachel; Halait, Harkanwal; Lawrence, H Jeffrey; Dugan, Michael C

2012-11-01

A polymerase chain reaction-based companion diagnostic (cobas 4800 BRAF V600 Mutation Test) was recently approved by the US Food and Drug Administration to select patients with BRAF-mutant metastatic melanoma for treatment with the BRAF inhibitor vemurafenib. (1) To compare the analytic performance of the cobas test to Sanger sequencing by using screening specimens from phase II and phase III trials of vemurafenib, and (2) to assess the reproducibility of the cobas test at different testing sites. Specimens from 477 patients were used to determine positive and negative percent agreements between the cobas test and Sanger sequencing for detecting V600E (1799T>A) mutations. Specimens were evaluated with a massively parallel pyrosequencing method (454) to resolve discordances between polymerase chain reaction and Sanger results. Reproducibility of the cobas test was assessed at 3 sites by using 3 reagent lots and an 8-member panel of melanoma samples. A valid cobas result was obtained for all eligible patients. Sanger sequencing had a failure rate of 9.2% (44 of 477). For the remaining 433 specimens, positive percent agreement was 96.4% (215 of 223) and negative percent agreement, 80% (168 of 210). Among 42 cobas mutation-positive/Sanger V600E-negative specimens, 17 were V600E positive and 24 were V600K positive by 454. The cobas test detected 70% of V600K mutations. In the reproducibility study, a correct interpretation was made for 100% of wild-type specimens and specimens with greater than 5% mutant alleles; V600E mutations were detected in 90% of specimens with less than 5% mutant alleles. The cobas test (1) had a lower assay failure rate than that of Sanger, (2) was more sensitive in detecting V600E mutations, (3) detected most V600K mutations, and (4) was highly reproducible.
Evaluation of recombinase polymerase amplification for detection of begomoviruses by plant diagnostic clinics.

PubMed

Londoño, Maria A; Harmon, Carrie L; Polston, Jane E

2016-03-22

Plant viruses in the genus Begomovirus, family Geminiviridae often cause substantial crop losses. These viruses have been emerging in many locations throughout the tropics and subtropics. Like many plant viruses, they are often not recognized by plant diagnostic clinics due in large part to the lack of rapid and cost effective assays. An isothermal amplification assay, Recombinase polymerase amplification (RPA), was evaluated for its ability to detect three begomoviruses and for its suitability for use in plant diagnostic clinics. Methods for DNA extraction and separation of amplicons from proteins used in the assay were modified and compared to RPA manufacturer's protocols. The modified RPA assays were compared to PCR assays for sensitivity, use in downstream applications, cost, and speed. Recombinase polymerase amplification (RPA) assays for the detection of Bean golden yellow mosaic virus, Tomato mottle virus and Tomato yellow leaf curl virus (TYLCV) were specific, only amplifying the target viruses in three different host species. RPA was able to detect the target virus when the template was in a crude extract generated using a simple inexpensive extraction method, while PCR was not. Separation of RPA-generated amplicons from DNA-binding proteins could be accomplished by several methods, all of which were faster and less expensive than that recommended by the manufacturer. Use of these modifications resulted in an RPA assay that was faster than PCR but with a similar reagent cost. This modified RPA was the more cost effective assay when labor is added to the cost since RPA can be performed much faster than PCR. RPA had a sensitivity approximate to that of ELISA when crude extract was used as template. RPA-generated amplicons could be used in downstream applications (TA cloning, digestion with a restriction endonuclease, direct sequencing) similar to PCR but unlike some other isothermal reactions. RPA could prove useful for the cost effective detection of plant
Production of a monoclonal antibody and development of an immunoassay for detection of Cr(III) in water samples.

PubMed

Zhou, Y; Li, Y S; Meng, X Y; Zhang, Y Y; Yang, L; Li, Z H; Zhang, J H; Wang, X R; Liu, J Q; Lu, S Y; Ren, H L; Hu, P; Liu, Z S

2013-11-01

In this study we report the production of a monoclonal antibody (Mab) specific for Cr(III)-chelate and the development of a competitive immunoassay for detection of Cr(III) in water samples. In the assay, the complete antigen (Cr(III)-ITCBE-BSA) was used as coating antigen, and Cr(III)-ITCBE as competitor competes with coating antigen to bind with Mab. Using this approach, the spiked water samples with Cr(III) were detected. The linear range of the detection was 0.7-12.4 ng mL(-1). The limit of the detection (LOD) was 0.51 ng mL(-1). The spiked results were also confirmed by ICP-MS, which showed a good correlation (R(2)=0.997) between the two methods. The results indicated that the developed assay was reliable and suitable for the detection of Cr(III) in water samples. Copyright © 2013 Elsevier Ltd. All rights reserved.
A Novel Isothermal Assay of Borrelia burgdorferi by Recombinase Polymerase Amplification with Lateral Flow Detection.

PubMed

Liu, Wei; Liu, Hui-Xin; Zhang, Lin; Hou, Xue-Xia; Wan, Kang-Lin; Hao, Qin

2016-08-03

A novel isothermal detection for recombinase polymerase amplification with lateral flow (LF-RPA) was established for Borrelia burgdorferi (B. burgdorferi) detection in this study. This assay with high sensitivity and specificity can get a visible result without any additional equipment in 30 min. We designed a pair of primers according to recA gene of B. burgdorferi strains and a methodology evaluation was performed. The results showed that the RPA assay based on the recA gene was successfully applied in B. burgdorferi detection, and its specific amplification was only achieved from the genomic DNA of B. burgdorferi. The detection limit of the new assay was about 25 copies of the B. burgdorferi genomic DNA. Twenty Lyme borreliosis patients' serum samples were detected by LF-RPA assay, real-time qPCR and nested-PCR. Results showed the LF-RPA assay is more effective than nested-PCR for its shorter reaction time and considerably higher detection rate. This method is of great value in clinical rapid detection for Lyme borreliosis. Using the RPA assay might be a megatrend for DNA detection in clinics and endemic regions.
Sensitive detection of Treponema pallidum by using the polymerase chain reaction.

PubMed

Burstain, J M; Grimprel, E; Lukehart, S A; Norgard, M V; Radolf, J D

1991-01-01

We have developed a sensitive assay for Treponema pallidum subsp. pallidum (T. pallidum), the agent of veneral syphilis, based upon the polymerase chain reaction (PCR). A 658-bp portion of the gene encoding the 47-kDa membrane immunogen was amplified, and the PCR products were probed by DNA-DNA hybridization with a 496-bp fragment internal to the amplitifed DNA. The assay detected approximately 0.01 pg of purified T. pallidum DNA, and positive results were obtained routinely from suspensions of treponemes calculated to contain 10 or more organism and from some suspensions calculated to contain a single organism. Specific PCR products were obtained for the closely related agent of yaws, Treponema pallidum subsp. pertenue, but not with human DNA or DNAs from other spirochetes (including Borrelia burgdoferi), skin microorganisms, sexually transmitted disease pathogens, and central nervous system pathogens. T. pallidum DNA was detected in serum, cerebrospinal fluids, and amniotic fluids from syphilis patients but not in in nonsyphilitic controls. T. pallidum DNA was also amplified from paraffin-embedded tissue. The diagnosis of syphillis by using PCR may become a significant addition to the diagnostic armamentarium and a valuable technique for the investigation of syphilis pathogenesis.
Detection of Zaire Ebola virus by real-time reverse transcription-polymerase chain reaction, Sierra Leone, 2014.

PubMed

Liu, Licheng; Sun, Yang; Kargbo, Brima; Zhang, Chuntao; Feng, Huahua; Lu, Huijun; Liu, Wenseng; Wang, Chengyu; Hu, Yi; Deng, Yongqiang; Jiang, Jiafu; Kang, Xiaoping; Yang, Honglei; Jiang, Yongqiang; Yang, Yinhui; Kargbo, David; Qian, Jun; Chen, Weijun

2015-09-15

During the 2014 Ebola virus disease (EVD) outbreak, a real-time quantitative polymerase chain reaction was established to detect and identify the Zaire Ebola virus. We describe the use of this assay to screen 315 clinical samples from EVD suspected person in Sierra Leone. The detection rate in blood samples was 77.81% (207/266), and there were relatively higher detection rate (79.32% and 81.42%, respectively) during the first two weeks after onset of symptoms. In the two weeks that followed, the detection rate declined to 66.67% and 25.00%, respectively. There was the highest virus load at the first week and then decreased. The detection rate in swab samples was 89.79% (44/49). This may be benefit from the included patients. 46 of 49 swab samples were collected from died patients. Taken together, the results presented here indicate that the assay specifically and sensitively detects Zaire Ebola virus. Copyright © 2015 Elsevier B.V. All rights reserved.
Fast real-time polymerase chain reaction for quantitative detection of Lactobacillus delbrueckii bacteriophages in milk.

PubMed

Martín, Maria Cruz; del Rio, Beatriz; Martínez, Noelia; Magadán, Alfonso H; Alvarez, Miguel A

2008-12-01

One of the main microbiological problems of the dairy industry is the susceptibility of starter bacteria to virus infections. Lactobacillus delbrueckii, a component of thermophilic starter cultures used in the manufacture of several fermented dairy products, including yogurt, is also sensitive to bacteriophage attacks. To avoid the problems associated with these viruses, quick and sensitive detection methods are necessary. In the present study, a fast real-time quantitative polymerase chain reaction assay for the direct detection and quantification of L. delbrueckii phages in milk was developed. A set of primers and a TaqMan MGB probe was designed, based on the lysin gene sequence of different L. delbrueckii phages. The results show the proposed method to be a rapid (total processing time 30 min), specific and highly sensitive technique for detecting L. delbrueckii phages in milk.
Detection of medically important Candida species by absolute quantitation real-time polymerase chain reaction.

PubMed

Than, Leslie Thian Lung; Chong, Pei Pei; Ng, Kee Peng; Seow, Heng Fong

2015-01-01

The number of invasive candidiasis cases has risen especially with an increase in the number of immunosuppressed and immunocom promised patients. The early detection of Candida species which is specific and sensitive is important in determining the correct administration of antifungal drugs to patients. This study aims to develop a method for the detection, identification and quantitation of medically important Candida species through quantitative polymerase chain reaction (qPCR). The isocitrate lyase (ICL) gene which is not found in mammals was chosen as the target gene of real-time PCR. Absolute quantitation of the gene copy number was achieved by constructing the plasmid containing the ICL gene which is used to generate standard curve. Twenty fungal species, two bacterial species and human DNA were tested to check the specificity of the detection method. All eight Candida species were successfully detected, identified and quantitated based on the ICL gene. A seven-log range of the gene copy number and a minimum detection limit of 10(3) copies were achieved. A one-tube absolute quantification real-time PCR that differentiates medically important Candida species via individual unique melting temperature was achieved. Analytical sensitivity and specificity were not compromised.
Rapid detection of HIV-1 proviral DNA for early infant diagnosis using recombinase polymerase amplification.

PubMed

Boyle, David S; Lehman, Dara A; Lillis, Lorraine; Peterson, Dylan; Singhal, Mitra; Armes, Niall; Parker, Mathew; Piepenburg, Olaf; Overbaugh, Julie

2013-04-02

Early diagnosis and treatment of human immunodeficiency virus type 1 (HIV-1) infection in infants can greatly reduce mortality rates. However, current infant HIV-1 diagnostics cannot reliably be performed at the point of care, often delaying treatment and compromising its efficacy. Recombinase polymerase amplification (RPA) is a novel technology that is ideal for an HIV-1 diagnostic, as it amplifies target DNA in <20 min at a constant temperature, without the need for complex thermocycling equipment. Here we tested 63 HIV-1-specific primer and probe combinations and identified two RPA assays that target distinct regions of the HIV-1 genome (long terminal repeat [LTR] and pol) and can reliably detect 3 copies of proviral DNA by the use of fluorescence detection and lateral-flow strip detection. These pol and LTR primers amplified 98.6% and 93%, respectively, of the diverse HIV-1 variants tested. This is the first example of an isothermal assay that consistently detects all of the major HIV-1 global subtypes.
Polymerase chain reaction detection of Bartonella spp. in dogs from Spain with blood culture-negative infectious endocarditis.

PubMed

Roura, X; Santamarina, G; Tabar, M-D; Francino, O; Altet, L

2018-05-25

The presence of Bartonella spp. was detected by polymerase chain reaction (PCR) in dogs from Spain with blood culture-negative endocarditis. The aim of this study is to add information about canine infectious endocarditis in Europe. Thirty dogs with naturally occurring blood culture-negative endocarditis were examined from 2010 to 2017 at three veterinary referral hospitals, located in northwest, northeast, and southeast of Spain. It is a retrospective study. Medical records were reviewed to extract relevant data. Frozen or paraffin-embedded cardiac valve tissue and/or ethylenediamine tetraacetic acid blood samples were evaluated by PCR for the presence of Bartonella DNA. Positive results were sequenced to confirm the species. Polymerase chain reaction was positive for eight out of 30 dogs included (26.6%). Bartonella rochalimae, Bartonella vinsonii subsp. berkhoffii, and Bartonella koehlerae were detected in valve tissue or blood. Bartonella could be an important cause of blood culture-negative infectious endocarditis in dogs from Spain. The outcome for those dogs affected with Bartonella spp. was grave. Prompt empirical treatment with amoxicillin-clavulanate plus fluoroquinolones could be of value in cases of blood culture-negative endocarditis. Copyright © 2018 Elsevier B.V. All rights reserved.
Reaction mechanism of the ε subunit of E. coli DNA polymerase III: Insights into active site metal coordination and catalytically significant residues

PubMed Central

Cisneros, G. Andrés; Perera, Lalith; Schaaper, Roel M.; Pedersen, Lars C.; London, Robert E.; Pedersen, Lee G.; Darden, Thomas A.

2009-01-01

The 28kDa ε subunit of Escherichia coli DNA polymerase III is the exonucleotidic proofreader responsible for editing polymerase insertion errors. Here, we study the mechanism by which ε carries out the exonuclease activity. We performed quantum mechanics/molecular mechanics calculations on the N–terminal domain containing the exonuclease activity. Both the free–ε and a complex, ε bound to a θ homolog (HOT), were studied. For the ε–HOT complex, Mg2+ or Mn2+ were investigated as the essential divalent metal cofactors, while only Mg2+ was used for free–ε. In all calculations, a water molecule bound to the catalytic metal acts as the nucleophile for the hydrolysis of the phosphate bond. Initially, a direct proton transfer to H162 is observed. Subsequently, the nucleophilic attack takes place, followed by a second proton transfer to E14. Our results show that the reaction catalyzed with Mn2+ is faster than with Mg2+, in agreement with experiment. In addition, the ε–HOT complex shows a slightly lower energy barrier compared to free–ε. In all cases the catalytic metal is observed to be penta–coordinated. Charge and frontier orbital analyses suggest that charge transfer may stabilize the penta–coordination. Energy decomposition analysis to study the contribution of each residue to catalysis suggests that there are several important residues. Among these, H98, D103, D129 and D146 have been implicated in catalysis by mutagenesis studies. Some of these residues were found to be structurally conserved on human TREX1, the exonuclease domains from E. coli DNA–Pol I, and the DNA polymerase of bacteriophage RB69. PMID:19119875
Detection of Listeria monocytogenes in ready-to-eat food by Step One real-time polymerase chain reaction.

PubMed

Pochop, Jaroslav; Kačániová, Miroslava; Hleba, Lukáš; Lopasovský, L'ubomír; Bobková, Alica; Zeleňáková, Lucia; Stričík, Michal

2012-01-01

The aim of this study was to follow contamination of ready-to-eat food with Listeria monocytogenes by using the Step One real time polymerase chain reaction (PCR). We used the PrepSEQ Rapid Spin Sample Preparation Kit for isolation of DNA and MicroSEQ® Listeria monocytogenes Detection Kit for the real-time PCR performance. In 30 samples of ready-to-eat milk and meat products without incubation we detected strains of Listeria monocytogenes in five samples (swabs). Internal positive control (IPC) was positive in all samples. Our results indicated that the real-time PCR assay developed in this study could sensitively detect Listeria monocytogenes in ready-to-eat food without incubation.
Detecting DNA methylation of the BCL2, CDKN2A and NID2 genes in urine using a nested methylation specific polymerase chain reaction assay to predict bladder cancer.

PubMed

Scher, Michael B; Elbaum, Michael B; Mogilevkin, Yakov; Hilbert, David W; Mydlo, Jack H; Sidi, A Ami; Adelson, Martin E; Mordechai, Eli; Trama, Jason P

2012-12-01

Detection of methylated DNA has been shown to be a good biomarker for bladder cancer. Bladder cancer has the highest recurrence rate of any cancer and, as such, patients are regularly monitored using invasive diagnostic techniques. As urine is easily attainable, bladder cancer is an optimal cancer to detect using DNA methylation. DNA methylation is highly specific in cancer detection. However, it is difficult to detect because of the limited amount of DNA present in the urine of patients with bladder cancer. Therefore, an improved, sensitive and noninvasive diagnostic test is needed. We developed a highly specific and sensitive nested methylation specific polymerase chain reaction assay to detect the presence of bladder cancer in small volumes of patient urine. The genes assayed for DNA methylation are BCL2, CDKN2A and NID2. The regions surrounding the DNA methylation sites were amplified in a methylation independent first round polymerase chain reaction and the amplification product from the first polymerase chain reaction was used in a real-time methylation specific polymerase chain reaction. Urine samples were collected from patients receiving treatment at Wolfson Medical Center in Holon, Israel. In a pilot clinical study using patient urine samples we were able to differentiate bladder cancer from other urogenital malignancies and nonmalignant conditions with a sensitivity of 80.9% and a specificity of 86.4%. We developed a novel methylation specific polymerase chain reaction assay for the detection and monitoring of bladder cancer using DNA extracted from patient urine. The assay may also be combined with other diagnostic tests to improve accuracy. Copyright © 2012 American Urological Association Education and Research, Inc. Published by Elsevier Inc. All rights reserved.
Detection of Salmonella invA gene in shrimp enrichment culture by polymerase chain reaction.

PubMed

Upadhyay, Bishnu Prasad; Utrarachkij, Fuangfa; Thongshoob, Jarinee; Mahakunkijcharoen, Yuvadee; Wongchinda, Niracha; Suthienkul, Orasa; Khusmith, Srisin

2010-03-01

Contamination of seafood with salmonellae is a major public health concern. Detection of Salmonella by standard culture methods is time consuming. In this study, an enrichment culture step prior to polymerase chain reaction (PCR) was applied to detect 284 bp fragment of Salmonella invA in comparison with the conventional culture method in 100 shrimp samples collected from four different shrimp farms and fresh food markets around Bangkok. Samples were pre-enriched in non-selective lactose broth (LB) and selective tetrathionate broth (TTB). PCR detection limit was 10 pg and 10(4) cfu/ml of viable salmonellae with 100% specificity. PCR assay detected 19 different Salmonella serovars belonging to 8 serogroups (B, C1, C2-C3, D1, E1, E4 and K) commonly found in clinical and environmental samples in Thailand. The detection rate of PCR following TTB enrichment (24%) was higher than conventional culture method (19%). PCR following TTB, but not in LB enrichment allowed salmonella detection with 84% sensitivity, 90% specificity and 89% accuracy. Shrimp samples collected from fresh food markets had higher levels of contaminated salmonellae than those from shrimp farms. The results indicated that incorporation of an enrichment step prior to PCR has the potential to be applied for detection of naturally contaminated salmonellae in food, environment and clinical samples.
Detection of the aerolysin gene in Aeromonas hydrophila by the polymerase chain reaction.

PubMed Central

Pollard, D R; Johnson, W M; Lior, H; Tyler, S D; Rozee, K R

1990-01-01

Synthetic oligonucleotide primers were used in a polymerase chain reaction (PCR) technique to detect the gene for aerolysin in strains of Aeromonas hydrophila and to screen for identical genes in A. caviae, A. sobria, and A. veronii isolated from patients with diarrheal disease. Primers targeted a 209-bp fragment of the aer gene coding for the beta-hemolysin and detected template DNA only in the PCR using nucleic acid (NA) from hemolytic strains of A. hydrophila which were also cytotoxic to Vero and CHO cells and enterotoxic in suckling-mouse assays. PCR amplification of NA from hemolytic A. sobria or nonhemolytic A. hydrophila and A. caviae strains was consistently negative. Primer specificity was determined in the PCR by using NA extracted from 56 strains of bacteria, including hemolytic Escherichia coli and Listeria monocytogenes as well as several recognized enteric pathogens defined in terms of their toxigenicity. The detection limit for the aerolysin gene by PCR amplification was 1 ng of total NA. The PCR clearly identified aerolysin-producing strains of A. hydrophila and may have application as a species-specific virulence test because other hemolytic Aeromonas species tested were negative. Images PMID:2254423
Recombinase polymerase amplification (RPA) combined with lateral flow (LF) strip for equipment-free detection of Cryptosporidium spp. oocysts in dairy cattle feces.

PubMed

Wu, Yao-Dong; Zhou, Dong-Hui; Zhang, Long-Xian; Zheng, Wen-Bin; Ma, Jian-Gang; Wang, Meng; Zhu, Xing-Quan; Xu, Min-Jun

2016-09-01

Cryptosporidium is a widespread protozoan parasite that infects a large number of vertebrate animals, resulting in varying degrees of diarrhea or even death. As dairy cattle feces is an important source of Cryptosporidium spp. infection, development of a handy and accurate detection method via its oocysts in dairy cattle feces would be interesting and necessary. We herein developed a quick detecting method using recombinase polymerase amplification (RPA) combined with lateral flow (LF) strip to detect DNA of Cryptosporidium oocysts in dairy cattle feces. The DNA was released by boiled water with 0.1 % N-lauroylsarcosine sodium salt (LSS). The established method was proven to be of higher sensitivity than normal polymerase chain reaction (PCR) amplification with the lowest detection of 0.5 oocyst per reaction, and specificity with no cross reactivity to other common protozoan species in the intestine of dairy cattle. The diagnostic method established herein is simple, rapid, and cost-effective, and has potential for further development as a diagnostic kit for the diagnosis of cryptosporidiosis of dairy cattle.

An isothermal based recombinase polymerase amplification assay for rapid, sensitive and robust indexing of citrus yellow mosaic virus.

PubMed

Kumar, P V; Sharma, S K; Rishi, N; Ghosh, D K; Baranwal, V K

Management of viral diseases relies on definite and sensitive detection methods. Citrus yellow mosaic virus (CYMV), a double stranded DNA virus of the genus Badnavirus, causes yellow mosaic disease in citrus plants. CYMV is transmitted through budwood and requires a robust and simplified indexing protocol for budwood certification programme. The present study reports development and standardization of an isothermal based recombinase polymerase amplification (RPA) assay for a sensitive, rapid, easy, and cost-effective method for detection and diagnosis of CYMV. Two different oligonucleotide primer sets were designed from ORF III (coding for polyprotein) and ORF II (coding for virion associated protein) regions of CYMV to perform amplification assays. Comparative evaluation of RPA, PCR and immuno-capture recombinase polymerase amplification (IC-RPA) based assays were done using purified DNA and plant crude sap. CYMV infection was efficiently detected from the crude sap in RPA and IC-RPA assays. The primer set used in RPA was specific and did not show any cross-amplification with banana streak MY virus (BSMYV), another Badnavirus species. The results from the present study indicated that RPA assay can be used easily in routine indexing of citrus planting material. To the best of our knowledge, this is the first report on development of a rapid and simplified isothermal detection assay for CYMV and can be utilized as an effective technique in quarantine and budwood certification process.
Escherichia coli DnaE Polymerase Couples Pyrophosphatase Activity to DNA Replication

PubMed Central

Lapenta, Fabio; Montón Silva, Alejandro; Brandimarti, Renato; Lanzi, Massimiliano; Gratani, Fabio Lino; Vellosillo Gonzalez, Perceval; Perticarari, Sofia; Hochkoeppler, Alejandro

2016-01-01

DNA Polymerases generate pyrophosphate every time they catalyze a step of DNA elongation. This elongation reaction is generally believed as thermodynamically favoured by the hydrolysis of pyrophosphate, catalyzed by inorganic pyrophosphatases. However, the specific action of inorganic pyrophosphatases coupled to DNA replication in vivo was never demonstrated. Here we show that the Polymerase-Histidinol-Phosphatase (PHP) domain of Escherichia coli DNA Polymerase III α subunit features pyrophosphatase activity. We also show that this activity is inhibited by fluoride, as commonly observed for inorganic pyrophosphatases, and we identified 3 amino acids of the PHP active site. Remarkably, E. coli cells expressing variants of these catalytic residues of α subunit feature aberrant phenotypes, poor viability, and are subject to high mutation frequencies. Our findings indicate that DNA Polymerases can couple DNA elongation and pyrophosphate hydrolysis, providing a mechanism for the control of DNA extension rate, and suggest a promising target for novel antibiotics. PMID:27050298
Detecting Malaria Hotspots: A Comparison of Rapid Diagnostic Test, Microscopy, and Polymerase Chain Reaction

PubMed Central

Mogeni, Polycarp; Williams, Thomas N; Omedo, Irene; Kimani, Domtila; Ngoi, Joyce M; Mwacharo, Jedida; Morter, Richard; Nyundo, Christopher; Wambua, Juliana; Nyangweso, George; Kapulu, Melissa; Fegan, Gregory; Bejon, Philip

2017-01-01

Abstract Background Malaria control strategies need to respond to geographical hotspots of transmission. Detection of hotspots depends on the sensitivity of the diagnostic tool used. Methods We conducted cross-sectional surveys in 3 sites within Kilifi County, Kenya, that had variable transmission intensities. Rapid diagnostic test (RDT), microscopy, and polymerase chain reaction (PCR) were used to detect asymptomatic parasitemia, and hotspots were detected using the spatial scan statistic. Results Eight thousand five hundred eighty-one study participants were surveyed in 3 sites. There were statistically significant malaria hotspots by RDT, microscopy, and PCR for all sites except by microscopy in 1 low transmission site. Pooled data analysis of hotspots by PCR overlapped with hotspots by microscopy at a moderate setting but not at 2 lower transmission settings. However, variations in degree of overlap were noted when data were analyzed by year. Hotspots by RDT were predictive of PCR/microscopy at the moderate setting, but not at the 2 low transmission settings. We observed long-term stability of hotspots by PCR and microscopy but not RDT. Conclusion Malaria control programs may consider PCR testing to guide asymptomatic malaria hotspot detection once the prevalence of infection falls. PMID:28973672
Sensitive detection of Treponema pallidum by using the polymerase chain reaction.

PubMed Central

Burstain, J M; Grimprel, E; Lukehart, S A; Norgard, M V; Radolf, J D

1991-01-01

We have developed a sensitive assay for Treponema pallidum subsp. pallidum (T. pallidum), the agent of veneral syphilis, based upon the polymerase chain reaction (PCR). A 658-bp portion of the gene encoding the 47-kDa membrane immunogen was amplified, and the PCR products were probed by DNA-DNA hybridization with a 496-bp fragment internal to the amplitifed DNA. The assay detected approximately 0.01 pg of purified T. pallidum DNA, and positive results were obtained routinely from suspensions of treponemes calculated to contain 10 or more organism and from some suspensions calculated to contain a single organism. Specific PCR products were obtained for the closely related agent of yaws, Treponema pallidum subsp. pertenue, but not with human DNA or DNAs from other spirochetes (including Borrelia burgdoferi), skin microorganisms, sexually transmitted disease pathogens, and central nervous system pathogens. T. pallidum DNA was detected in serum, cerebrospinal fluids, and amniotic fluids from syphilis patients but not in in nonsyphilitic controls. T. pallidum DNA was also amplified from paraffin-embedded tissue. The diagnosis of syphillis by using PCR may become a significant addition to the diagnostic armamentarium and a valuable technique for the investigation of syphilis pathogenesis. Images PMID:1993770
Exonuclease III-assisted graphene oxide amplified fluorescence anisotropy strategy for ricin detection.

PubMed

Xiao, Xue; Tao, Jing; Zhang, Hong Zhi; Huang, Cheng Zhi; Zhen, Shu Jun

2016-11-15

Graphene oxide (GO) is an excellent fluorescence anisotropy (FA) amplifier. However, in the conventional GO amplified FA strategy, one target can only induce the FA change of one fluorophore on probe, which limits the detection sensitivity. Herein, we developed an exonuclease III (Exo III) aided GO amplified FA strategy by using aptamer as an recognition element and ricin B-chain as a proof-of-concept target. The aptamer was hybridized with a blocker sequence and linked onto the surface of magnetic beads (MBs). Upon the addition of ricin B-chain, blocker was released from the surface of MBs and hybridized with the dye-modified probe DNA on the surface of GO through the toehold-mediated strand exchange reaction. The formed blocker-probe DNA duplex triggered the Exo III-assisted cyclic signal amplification by repeating the hybridization and digestion of probe DNA, liberating the fluorophore with several nucleotides (low FA value). Thus, ricin B-chain could be sensitively detected by the significantly decreased FA. The linear range was from 1.0μg/mL to 13.3μg/mL and the limit of detection (LOD) was 400ng/mL. This method improved the sensitivity of FA assay and it could be generalized to any kind of target detection based on the use of an appropriate aptamer. Copyright © 2016 Elsevier B.V. All rights reserved.
Detection of cashew nut DNA in spiked baked goods using a real-time polymerase chain reaction method.

PubMed

Brzezinski, Jennifer L

2006-01-01

The detection of potentially allergenic foods, such as tree nuts, in food products is a major concern for the food processing industry. A real-time polymerase chain reaction (PCR) method was designed to determine the presence of cashew DNA in food products. The PCR amplifies a 67 bp fragment of the cashew 2S albumin gene, which is detected with a cashew-specific, dual-labeled TaqMan probe. This reaction will not amplify DNA derived from other tree nut species, such as almond, Brazil nut, hazelnut, and walnut, as well as 4 varieties of peanut. This assay was sensitive enough to detect 5 pg purified cashew DNA as well as cashew DNA in a spiked chocolate cookie sample containing 0.01% (100 mg/kg) cashew.
Susceptibility of Culicoides variipennis sonorensis to infection by polymerase chain reaction-detectable bluetongue virus in cattle blood.

PubMed

Tabachnick, W J; MacLachlan, N J; Thompson, L H; Hunt, G J; Patton, J F

1996-05-01

Cattle bloods containing only polymerase chain reaction (PCR)--detectable bluetongue-10 viral nucleic acid, but as determined by virus isolation techniques, not bluetongue-10 virus, were incapable of infecting intrathoracically inoculated Culicoides variipennis sonorensis. These insects also failed to transmit bluetongue-10 virus when fed on sheep. Cattle whose blood contain only PCR-detectable bluetongue viral nucleic acid, but no infectious virus, are unlikely to play a role in the epidemiology of bluetongue. The biological significance of PCR-based detection assays and their effect on animal health regulations on the international trade of livestock and livestock germplasm is discussed. Bluetongue virus infection provides a very useful model with which to study arthropod-transmitted RNA virus infections of humans and other animals.
Multiplex polymerase chain reaction detection of black-pigmented bacteria in infections of endodontic origin.

PubMed

Seol, Jung-Hwan; Cho, Byung-Hoon; Chung, Chong-Pyoung; Bae, Kwang-Shik

2006-02-01

The purpose of this study was to detect the presence of Porphyromonas endodontalis, P. gingivalis, Prevotella intermedia, P. nigrescens, and P. tannerae from clinical samples using multiplex polymerase chain reactions (PCR). Two different multiplex PCR protocols were used (one for the two Porphyromonas species and the other for the three Prevotella species), each one using a primer pair specific for each target species. The results were compared to those of the conventional culture procedures. Microbial samples were taken aseptically from 40 infected root canals and abscesses from patients. Samples were cultured in an anaerobic condition for conventional identification using a Rapid ID 32 A kit. Multiplex PCR was processed using the DNA extracted from each sample. At least one of the five species of black-pigmented bacteria (BPB) were detected in 65% (26 of 40) of the samples using multiplex PCR, and in 15% (6 of 40) using the conventional culture procedures. Multiplex PCR was more rapid, sensitive, specific, and effective in detecting BPB than the conventional culture procedures.
Mentha-Stabilized Silver Nanoparticles for High-Performance Colorimetric Detection of Al(III) in Aqueous Systems.

PubMed

Sharma, Rekha; Dhillon, Ankita; Kumar, Dinesh

2018-03-26

The present paper reports a facile and selective colorimetric method for the detection of potential environmental and health hazardous metal ions using green synthesized silver nanoparticles (AgNPs). Here the organic functional groups present in the plant extract (Mentha arvensis) are used as reductants and stabilizers in the synthesis of AgNPs. They also provide a suitable binding site to the (Al(III)) analyte in the detection mechanism. The leaf extract of Mentha arvensis was used to synthesize AgNPs at room-temperature and at 80 °C. The AgNPs synthesized at 80 °C exhibit excellent selective colorimetric detection of Al(III). The as-synthesized AgNPs have been characterized, and the synthesis, stabilization of NPs and detection mechanism has also been illustrated by using UV-vis, XPS, FTIR, TEM, EDX, SEM, AAS, and TGA analytical tools and techniques. The selectivity of detection probe was supported by the reaction between probe and metal ions followed first-order kinetics having the highest value of the regression coefficient (R 2 = 0.99) for Al(III) and the analysis of thermodynamic parameters. The prepared sensor showed a lower limit of detection (LOD) of 1 nM (S/N = 3.2) in real water samples. The proposed method can be successfully utilized for the detection of Al(III) from both drinking and real water samples at the nanomolar level.
The Maize Imprinted Gene Floury3 Encodes a PLATZ Protein Required for tRNA and 5S rRNA Transcription through Interaction with RNA Polymerase III[OPEN

PubMed Central

Wang, Jiechen; Ye, Jianwei; Zheng, Xixi; Xiang, Xiaoli; Li, Changsheng; Fu, Miaomiao; Wang, Qiong; Zhang, Zhiyong; Wu, Yongrui

2017-01-01

Maize (Zea mays) floury3 (fl3) is a classic semidominant negative mutant that exhibits severe defects in the endosperm but fl3 plants otherwise appear normal. We cloned the fl3 gene and determined that it encodes a PLATZ (plant AT-rich sequence and zinc binding) protein. The mutation in fl3 resulted in an Asn-to-His replacement in the conserved PLATZ domain, creating a dominant allele. Fl3 is specifically expressed in starchy endosperm cells and regulated by genomic imprinting, which leads to the suppressed expression of fl3 when transmitted through the male, perhaps as a consequence the semidominant behavior. Yeast two-hybrid screening and bimolecular luciferase complementation experiments revealed that FL3 interacts with the RNA polymerase III subunit 53 (RPC53) and transcription factor class C 1 (TFC1), two critical factors of the RNA polymerase III (RNAPIII) transcription complex. In the fl3 endosperm, the levels of many tRNAs and 5S rRNA that are transcribed by RNAPIII are significantly reduced, suggesting that the incorrectly folded fl3 protein may impair the function of RNAPIII. The transcriptome is dramatically altered in fl3 mutants, in which the downregulated genes are primarily enriched in pathways related to translation, ribosome, misfolded protein responses, and nutrient reservoir activity. Collectively, these changes may lead to defects in endosperm development and storage reserve filling in fl3 seeds. PMID:28874509
An exo probe-based recombinase polymerase amplification assay for the rapid detection of porcine parvovirus.

PubMed

Wang, Jian-Chang; Liu, Li-Bing; Han, Qing-An; Wang, Jin-Feng; Yuan, Wan-Zhe

2017-10-01

Recombinase polymerase amplification (RPA), an isothermal amplification technology, has been developed as an alternative to PCR in pathogen detection. A real-time RPA assay (rt-RPA) was developed to detect the porcine parvovirus (PPV) using primers and exo probe specific for the VP2 gene. The amplification was performed at 39°C for 20min. There was no cross-reaction with other pathogens tested. Using the recombinant plasmid pPPV-VP2 as template, the analytical sensitivity was 103 copies. The assay performance was evaluated by testing 115 field samples by rt-RPA and a real-time PCR assay. The diagnostic agreement between assays was 100%, and PPV DNA was detected in 94 samples. The R 2 value of rt-RPA and real-time PCR was 0.909 by linear regression analysis. The developed rt-RPA assay provides a useful alternative tool for rapid, simple and reliable detection of PPV in diagnostic laboratories and at point-of-care, especially in remote and rural areas. Copyright © 2017 Elsevier B.V. All rights reserved.
Rapid Detection of Cyprinid Herpesvirus 3 in Latently Infected Koi by Recombinase Polymerase Amplification.

PubMed

Prescott, Meagan A; Reed, Aimee N; Jin, Ling; Pastey, Manoj K

2016-09-01

Since the emergence of cyprinid herpesvirus 3 (CyHV-3), outbreaks have been devastating to Common Carp Cyprinus carpio and koi (a variant of Common Carp), leading to high economic losses. Current diagnostics for detecting CyHV-3 are limited in sensitivity and are further complicated by latency. Here we describe the detection of CyHV-3 by recombinase polymerase amplification (RPA). The RPA assay can detect as low as 10 copies of the CyHV-3 genome by an isothermal reaction and yields results in approximately 20 min. Using the RPA assay, the CyHV-3 genome can be detected in the total DNA of white blood cells isolated from koi latently infected with CyHV-3, while less than 10% of the latently infected koi can be detected by a real-time PCR assay in the total DNA of white blood cells. In addition, RPA products can be detected in a lateral flow device that is cheap and fast and can be used outside of the diagnostic lab. The RPA assay and lateral flow device provide for the rapid, sensitive, and specific amplification of CyHV-3 that with future modifications for field use and validation could lead to enhanced surveillance and early diagnosis of CyHV-3 in the laboratory and field. Received September 14, 2015; accepted April 9, 2016.
Rapid visual detection of Mycobacterium avium subsp. paratuberculosis by recombinase polymerase amplification combined with a lateral flow dipstick

PubMed Central

Zhao, Guimin; Wang, Hongmei; Hou, Peili; He, Chengqiang

2018-01-01

Paratuberculosis (Johne's disease) is a chronic debilitating disease of domestic and wild ruminants. However, widespread point-of-care testing is infrequent due to the lack of a robust method. The isothermal recombinase polymerase amplification (RPA) technique has applied for rapid diagnosis. Herein, RPA combined with a lateral flow dipstick (LFD) assay was developed to estimate DNA from Mycobacterium avium subsp. paratuberculosis. First, analytical specificity and sensitivity of the RPA-nfo primer and probe sets were assessed. The assay successfully detected M. paratuberculosis DNA in 30 min at 39℃ with a detection limit of up to eight copies per reaction, which was equivalent to that of the real-time quantitative polymerase chain reaction (qPCR) assay. The assay was specific, as it did not amplify genomes from five other Mycobacterium spp. or five pathogenic enteric bacteria. Six hundred-twelve clinical samples (320 fecal and 292 serum) were assessed by RPA-LFD, qPCR, and enzyme-linked immunosorbent assay, respectively. The RPA-LFD assay yielded 100% sensitivity, 97.63% specificity, and 98.44% concordance rate with the qPCR results. This is the first report utilizing an RPA-LFD assay to visualize and rapidly detect M. paratuberculosis. Our results show this assay should be a useful method for the diagnosis of paratuberculosis in resource-constrained settings. PMID:29284204
Rapid visual detection of Mycobacterium avium subsp. paratuberculosis by recombinase polymerase amplification combined with a lateral flow dipstick.

PubMed

Zhao, Guimin; Wang, Hongmei; Hou, Peili; He, Chengqiang; He, Hongbin

2018-03-31

Paratuberculosis (Johne's disease) is a chronic debilitating disease of domestic and wild ruminants. However, widespread point-of-care testing is infrequent due to the lack of a robust method. The isothermal recombinase polymerase amplification (RPA) technique has applied for rapid diagnosis. Herein, RPA combined with a lateral flow dipstick (LFD) assay was developed to estimate DNA from Mycobacterium avium subsp. paratuberculosis . First, analytical specificity and sensitivity of the RPA-nfo primer and probe sets were assessed. The assay successfully detected M. paratuberculosis DNA in 30 min at 39°C with a detection limit of up to eight copies per reaction, which was equivalent to that of the real-time quantitative polymerase chain reaction (qPCR) assay. The assay was specific, as it did not amplify genomes from five other Mycobacterium spp. or five pathogenic enteric bacteria. Six hundred-twelve clinical samples (320 fecal and 292 serum) were assessed by RPA-LFD, qPCR, and enzyme-linked immunosorbent assay, respectively. The RPA-LFD assay yielded 100% sensitivity, 97.63% specificity, and 98.44% concordance rate with the qPCR results. This is the first report utilizing an RPA-LFD assay to visualize and rapidly detect M. paratuberculosis . Our results show this assay should be a useful method for the diagnosis of paratuberculosis in resource-constrained settings.
Duplex recombinase polymerase amplification assays incorporating competitive internal controls for bacterial meningitis detection.

PubMed

Higgins, Owen; Clancy, Eoin; Forrest, Matthew S; Piepenburg, Olaf; Cormican, Martin; Boo, Teck Wee; O'Sullivan, Nicola; McGuinness, Claire; Cafferty, Deirdre; Cunney, Robert; Smith, Terry J

2018-04-01

Recombinase polymerase amplification (RPA) is an isothermal nucleic acid amplification technology that provides rapid and robust infectious disease pathogen detection, ideal for point-of-care (POC) diagnostics in disease-prevalent low-resource countries. We have developed and evaluated three duplex RPA assays incorporating competitive internal controls for the detection of leading bacterial meningitis pathogens. Streptococcus pneumoniae, Neisseria meningitidis and Haemophilus influenzae singleplex RPA assays were initially developed and evaluated, demonstrating 100% specificity with limits of detection of 4.1, 8.5 and 3.9 genome copies per reaction, respectively. Each assay was further developed into internally controlled duplex RPA assays via the incorporation of internal amplification control templates. Clinical performance of each internally controlled duplex RPA assay was evaluated by testing 64 archived PCR-positive clinical samples. Compared to real-time PCR, all duplex RPA assays demonstrated 100% diagnostic specificity, with diagnostic sensitivities of 100%, 86.3% and 100% for the S. pneumoniae, N. meningitidis and H. influenzae assays, respectively. This study details the first report of internally controlled duplex RPA assays for the detection of bacterial meningitis pathogens: S. pneumoniae, N. meningitidis and H. influenzae. We have successfully demonstrated the clinical diagnostic utility of each duplex RPA assay, introducing effective diagnostic technology for POC bacterial meningitis identification in disease-prevalent developing countries. Copyright © 2018 Elsevier Inc. All rights reserved.
Construction of an electrode modified with gallium(III) for voltammetric detection of ovalbumin.

PubMed

Sugawara, Kazuharu; Okusawa, Makoto; Takano, Yusaku; Kadoya, Toshihiko

2014-01-01

Electrodes modified with gallium(III) complexes were constructed to detect ovalbumin (OVA). For immobilization of a gallium(III)-nitrilotriacetate (NTA) complex, the electrode was first covered with collagen film. After the amino groups of the film had reacted with isothiocyanobenzyl-NTA, the gallium(III) was then able to combine with the NTA moieties. Another design featured an electrode cast with a gallium(III)-acetylacetonate (AA) complex. The amount of gallium(III) in the NTA complex was equivalent to one-quarter of the gallium(III) that could be utilized from an AA complex. However, the calibration curves of OVA using gallium(III)-NTA and gallium(III)-AA complexes were linear in the ranges of 7.0 × 10(-11) - 3.0 × 10(-9) M and 5.0 × 10(-10) - 8.0 × 10(-9) M, respectively. The gallium(III) on the electrode with NTA complex had high flexibility due to the existence of a spacer between the NTA and the collagen film, and, therefore, the reactivity of the gallium(III) to OVA was superior to that of the gallium(III)-AA complex with no spacer.
Early Detection of Dengue Virus by Use of Reverse Transcription-Recombinase Polymerase Amplification

PubMed Central

Teoh, Boon-Teong; Sam, Sing-Sin; Tan, Kim-Kee; Danlami, Mohammed Bashar; Shu, Meng-Hooi; Johari, Jefree; Hooi, Poh-Sim; Brooks, David; Piepenburg, Olaf; Nentwich, Oliver; Wilder-Smith, Annelies; Franco, Leticia; Tenorio, Antonio

2015-01-01

A method for the rapid diagnosis of early dengue virus (DENV) infection is highly needed. Here, a prototype reverse transcription-recombinase polymerase amplification (RT-RPA) assay was developed. The assay detected DENV RNA in <20 min without the need for thermocycling amplification. The assay enabled the detection of as few as 10 copies of DENV RNA. The designed RT-RPA primers and exo probe detected the DENV genome of at least 12 genotypes of DENV circulating globally without cross-reacting with other arboviruses. We assessed the diagnostic performance of the RT-RPA assay for the detection of DENV RNA in 203 serum samples of patients with clinically suspected dengue. The sera were simultaneously tested for DENV using a reverse transcription-loop-mediated isothermal amplification (RT-LAMP) assay, quantitative RT-PCR (qRT-PCR), and IgM- and IgG-capture enzyme-linked immunosorbent assays (ELISA). Acute DENV infection was confirmed in 130 samples and 61 of the samples (46.9%) were classified as viremic with qRT-PCR. The RT-RPA assay showed good concordance (κ of ≥0.723) with the RT-LAMP and qRT-PCR assays in detecting the dengue viremic samples. When used in combination with ELISA, both the RT-RPA and RT-LAMP assays increased the detection of acute DENV infection to ≥95.7% (≥45/47) in samples obtained within 5 days of illness. The results from the study suggest that the RT-RPA assay is the most rapid molecular diagnostic tool available for the detection of DENV. Hence, it is possible to use the RT-RPA assay in a laboratory to complement routine serology testing for dengue. PMID:25568438
[Polymerase chain reaction applied for detection of Toxoplasma gondii in lymph nodes].

PubMed

Liu, C; Ouyang, K; Tan, D

1998-01-01

In order to investigate the morbidity of toxoplasmic lymphadenitis, polymerase chain reaction (PCR) was used to detect DNA of Toxoplasma gondii within lymph nodes in 3 groups of 120 patients with different diseases. After extracting the DNA of each sample, PCR was employed to amplify toxoplasma DNA. The results showed that the amplification product of 210 bp was confirmed in 7 patients: 3 cases of Hodgkin's disease (HD), 2 cases of non-Hodgkin's lymphoma (NHL) and 2 cases of chronic lymphadenitis (CL). Each PCR product was then subjected to Southern blot hybridization. Besides the 7 cases proved by PCR, 1 case of CL was found positive. The positive percentages of HD, NHL and CL were 9.38% (3/32), 4.88% (2/41), and 6.38% (3/47), respectively. The total positive rate was 6.67% (8/120).
Micro-droplet Digital Polymerase Chain Reaction and Real-Time Quantitative Polymerase Chain Reaction Technologies Provide Highly Sensitive and Accurate Detection of Zika Virus.

PubMed

Hui, Yuan; Wu, Zhiming; Qin, Zhiran; Zhu, Li; Liang, Junhe; Li, Xujuan; Fu, Hanmin; Feng, Shiyu; Yu, Jianhai; He, Xiaoen; Lu, Weizhi; Xiao, Weiwei; Wu, Qinghua; Zhang, Bao; Zhao, Wei

2018-06-01

The establishment of highly sensitive diagnostic methods is critical in the early diagnosis and control of Zika virus (ZIKV) and in preventing serious neurological complications of ZIKV infection. In this study, we established micro-droplet digital polymerase chain reaction (ddPCR) and real-time quantitative PCR (RT-qPCR) protocols for the detection of ZIKV based on the amplification of the NS5 gene. For the ZIKV standard plasmid, the RT-qPCR results showed that the cycle threshold (Ct) value was linear from 10 1 to 10 8 copy/μL, with a standard curve R 2 of 0.999 and amplification efficiency of 92.203%; however, a concentration as low as 1 copy/μL could not be detected. In comparison with RT-qPCR, the ddPCR method resulted in a linear range of 10 1 -10 4 copy/μL and was able to detect concentrations as low as 1 copy/μL. Thus, for detecting ZIKV from clinical samples, RT-qPCR is a better choice for high-concentration samples (above 10 1 copy/μL), while ddPCR has excellent accuracy and sensitivity for low-concentration samples. These results indicate that the ddPCR method should be of considerable use in the early diagnosis, laboratory study, and monitoring of ZIKV.
Development of multiplex polymerase chain reaction for detection of Ehrlichia canis, Babesia spp and Hepatozoon canis in canine blood.

PubMed

Kledmanee, Kan; Suwanpakdee, Sarin; Krajangwong, Sakranmanee; Chatsiriwech, Jarin; Suksai, Parut; Suwannachat, Pongpun; Sariya, Ladawan; Buddhirongawatr, Ruangrat; Charoonrut, Phingphol; Chaichoun, Kridsada

2009-01-01

A multiplex polymerase chain reaction (PCR) has been developed for simultaneous detection of canine blood parasites, Ehrlichia canis, Babesia spp and Hepatozoon canis, from blood samples in a single reaction. The multiplex PCR primers were specific to E. canis VirB9, Babesia spp 16S rRNA and H. canis 16S rRNA genes. Specificity of the amplicons was confirmed by DNA sequencing. The assay was evaluated using normal canine and infected blood samples, which were detected by microscopic examination. This multiplex PCR offers scope for simultaneous detection of three important canine blood parasites and should be valuable in monitoring parasite infections in dogs and ticks.

Development of a reverse transcription polymerase chain reaction method for yellow fever virus detection.

PubMed

Méndez, María C; Domingo, Cristina; Tenorio, Antonio; Pardo, Lissethe C; Rey, Gloria J; Méndez, Jairo A

2013-09-01

Yellow fever is considered a re-emerging disease and is endemic in tropical regions of Africa and South America. At present, there are no standardized or commercialized kits available for yellow fever virus detection. Therefore, diagnosis must be made by time-consuming routine techniques, and sometimes, the virus or its proteins are not detected. Furthermore, co-circulation with other flaviviruses, including dengue virus, increases the difficulty of diagnosis. To develop a specific reverse transcriptase-polymerase chain reaction (RT-PCR) and nested PCR-based assay to improve the detection and diagnosis of yellow fever virus using both serum and fresh tissue samples. RT-PCR primers were designed to amplify a short fragment of all yellow fever virus genotypes reported. A second set of primers was used in a nested PCR to increase sensitivity. Thirty-three clinical samples were tested with the standardized reaction. The expected amplicon was obtained in 25 out of 33 samples analyzed using this approach, and 2 more samples tested positive after a subsequent nested PCR approach. This improved technique not only ensures the specific detection of a wide range of yellow fever virus genotypes but also may increase the sensitivity of detection by introducing a second round of amplification, allowing a rapid differential diagnosis between dengue and yellow fever infection, which is required for effective surveillance and opportune epidemiologic measures.
Detecting Malaria Hotspots: A Comparison of Rapid Diagnostic Test, Microscopy, and Polymerase Chain Reaction.

PubMed

Mogeni, Polycarp; Williams, Thomas N; Omedo, Irene; Kimani, Domtila; Ngoi, Joyce M; Mwacharo, Jedida; Morter, Richard; Nyundo, Christopher; Wambua, Juliana; Nyangweso, George; Kapulu, Melissa; Fegan, Gregory; Bejon, Philip

2017-11-27

Malaria control strategies need to respond to geographical hotspots of transmission. Detection of hotspots depends on the sensitivity of the diagnostic tool used. We conducted cross-sectional surveys in 3 sites within Kilifi County, Kenya, that had variable transmission intensities. Rapid diagnostic test (RDT), microscopy, and polymerase chain reaction (PCR) were used to detect asymptomatic parasitemia, and hotspots were detected using the spatial scan statistic. Eight thousand five hundred eighty-one study participants were surveyed in 3 sites. There were statistically significant malaria hotspots by RDT, microscopy, and PCR for all sites except by microscopy in 1 low transmission site. Pooled data analysis of hotspots by PCR overlapped with hotspots by microscopy at a moderate setting but not at 2 lower transmission settings. However, variations in degree of overlap were noted when data were analyzed by year. Hotspots by RDT were predictive of PCR/microscopy at the moderate setting, but not at the 2 low transmission settings. We observed long-term stability of hotspots by PCR and microscopy but not RDT. Malaria control programs may consider PCR testing to guide asymptomatic malaria hotspot detection once the prevalence of infection falls. © The Author 2017. Published by Oxford University Press for the Infectious Diseases Society of America.
Single molecule imaging of RNA polymerase II using atomic force microscopy

NASA Astrophysics Data System (ADS)

Rhodin, Thor; Fu, Jianhua; Umemura, Kazuo; Gad, Mohammed; Jarvis, Suzi; Ishikawa, Mitsuru

2003-03-01

An atomic force microscopy (AFM) study of the shape, orientation and surface topology of RNA polymerase II supported on silanized freshly cleaved mica was made. The overall aim is to define the molecular topology of RNA polymerase II in appropriate fluids to help clarify the relationship of conformational features to biofunctionality. A Nanoscope III atomic force microscope was used in the tapping mode with oxide-sharpened (8-10 nm) Si 3N 4 probes in aqueous zinc chloride buffer. The main structural features observed by AFM were compared to those derived from electron-density plots based on X-ray crystallographic studies. The conformational features included a bilobal silhouette with an inverted umbrella-shaped crater connected to a reaction site. These studies provide a starting point for constructing a 3D-AFM profiling analysis of proteins such as RNA polymerase complexes.
Real-time polymerase chain reaction for detection of encapsulated Haemophilus influenzae using degenerate primers to target the capsule transport gene bexA.

PubMed

Law, Dennis K S; Tsang, Raymond S W

2013-05-01

A real-time polymerase chain reaction assay that uses degenerate primers and a dual-labelled probe was developed to detect the bexA gene of Haemophilus influenzae, including those belonging to non-b serotypes as well as clonal division II strains. This assay is sensitive and specific, detecting 20 copies of the gene, but negative with a variety of bacteria associated with meningitis and bacteremia or septicemia.
Recombinase Polymerase Amplification-Based Assay to Diagnose Giardia in Stool Samples

PubMed Central

Crannell, Zachary Austin; Cabada, Miguel Mauricio; Castellanos-Gonzalez, Alejandro; Irani, Ayesha; White, Arthur Clinton; Richards-Kortum, Rebecca

2015-01-01

Giardia duodenalis is one of the most commonly identified parasites in stool samples. Although relatively easy to treat, giardiasis can be difficult to detect as it presents similar to other diarrheal diseases. Here, we present a recombinase polymerase amplification-based Giardia (RPAG) assay to detect the presence of Giardia in stool samples. The RPAG assay was characterized on the bench top using stool samples spiked with Giardia cysts where it showed a limit-of-detection nearly as low as the gold standard polymerase chain reaction assay. The RPAG assay was then tested in the highlands of Peru on 104 stool samples collected from the surrounding communities where it showed 73% sensitivity and 95% specificity against a polymerase chain reaction and microscopy composite gold standard. Further improvements in clinical sensitivity will be needed for the RPAG assay to have clinical relevance. PMID:25510713
Detection and phylogenetic analysis of a new adenoviral polymerase gene in reptiles in Korea.

PubMed

Bak, Eun-Jung; Jho, Yeonsook; Woo, Gye-Hyeong

2018-06-01

Over a period of 7 years (2004-2011), samples from 34 diseased reptiles provided by local governments, zoos, and pet shops were tested for viral infection. Animals were diagnosed based on clinical signs, including loss of appetite, diarrhea, rhinorrhea, and unexpected sudden death. Most of the exotic animals had gastrointestinal problems, such as mucosal redness and ulcers, while the native animals had no clinical symptoms. Viral sequences were found in seven animals. Retroviral genes were amplified from samples from five Burmese pythons (Python molurus bivittatus), an adenovirus was detected in a panther chameleon (Furcifer pardalis), and an adenovirus and a paramyxovirus were detected in a tropical girdled lizard (Cordylus tropidosternum). Phylogenetic analysis of retroviruses and paramyxoviruses showed the highest sequence identity to both a Python molurus endogenous retrovirus and a Python curtus endogenous retrovirus and to a lizard isolate, respectively. Partial sequencing of an adenoviral DNA polymerase gene from the lizard isolate suggested that the corresponding virus was a novel isolate different from the reference strain (accession no. AY576677.1). The virus was not isolated but was detected, using molecular genetic techniques, in a lizard raised in a pet shop. This animal was also coinfected with a paramyxovirus.
Ultrasensitive and rapid detection of β-conglutin combining aptamers and isothermal recombinase polymerase amplification.

PubMed

Jauset-Rubio, Miriam; Sabaté Del Río, Jonathan; Mairal, Teresa; Svobodová, Markéta; El-Shahawi, Mohammad S; Bashammakh, Abdulaziz S; Alyoubi, Abdulrahman O; O'Sullivan, Ciara K

2017-01-01

Lupin is increasingly being used in a variety of food products due to its nutritional, functional and nutraceutical properties. However, several examples of severe and even fatal food-associated anaphylaxis due to lupin inhalation or ingestion have been reported, resulting in the lupin subunit β-conglutin, being defined as the Lup an 1 allergen by the International Union of Immunological Societies (IUIS) in 2008. Here, we report an innovative method termed aptamer-recombinase polymerase amplification (Apta-RPA) exploiting the affinity and specificity of a DNA aptamer selected against the anaphylactic β-conglutin allergen termed β-conglutin binding aptamer II (β-CBA II), facilitating ultrasensitive detection via isothermal amplification. Combining magnetic beads as the solid phase with Apta-RPA detection, the total assay time was reduced from 210 min to just 25 min, with a limit of detection of 3.5 × 10 -11 M, demonstrating a rapid and ultrasensitive generic methodology that can be used with any aptamer. Future work will focus on further simplification of the assay to a lateral flow format. Graphical Abstract Schematic representation of the rapid and novel bead-based Apta-RPA assay.
A recombinase polymerase amplification assay for rapid detection of Crimean-Congo Haemorrhagic fever Virus infection

PubMed Central

Afrough, Babak; Mullojonova, Manija; Dzhuraeva, Viktoriya; Tishkova, Farida; Hewson, Roger

2017-01-01

Background Crimean-Congo Haemorrhagic fever Virus (CCHFV) is a rapidly emerging vector-borne pathogen and the cause of a virulent haemorrhagic fever affecting large parts of Europe, Africa, the Middle East and Asia. Methodology/principle findings An isothermal recombinase polymerase amplification (RPA) assay was successfully developed for molecular detection of CCHFV. The assay showed rapid (under 10 minutes) detection of viral extracts/synthetic virus RNA of all 7 S-segment clades of CCHFV, with high target specificity. The assay was shown to tolerate the presence of inhibitors in crude preparations of mock field samples, indicating that this assay may be suitable for use in the field with minimal sample preparation. The CCHFV RPA was successfully used to screen and detect CCHFV positives from a panel of clinical samples from Tajikistan. Conclusions/significance The assay is a rapid, isothermal, simple-to-perform molecular diagnostic, which can be performed on a light, portable real-time detection device. It is ideally placed therefore for use as a field-diagnostic or in-low resource laboratories, for monitoring of CCHF outbreaks at the point-of-need, such as in remote rural regions in affected countries. PMID:29028804
A recombinase polymerase amplification assay for rapid detection of Crimean-Congo Haemorrhagic fever Virus infection.

PubMed

Bonney, Laura C; Watson, Robert J; Afrough, Babak; Mullojonova, Manija; Dzhuraeva, Viktoriya; Tishkova, Farida; Hewson, Roger

2017-10-01

Crimean-Congo Haemorrhagic fever Virus (CCHFV) is a rapidly emerging vector-borne pathogen and the cause of a virulent haemorrhagic fever affecting large parts of Europe, Africa, the Middle East and Asia. An isothermal recombinase polymerase amplification (RPA) assay was successfully developed for molecular detection of CCHFV. The assay showed rapid (under 10 minutes) detection of viral extracts/synthetic virus RNA of all 7 S-segment clades of CCHFV, with high target specificity. The assay was shown to tolerate the presence of inhibitors in crude preparations of mock field samples, indicating that this assay may be suitable for use in the field with minimal sample preparation. The CCHFV RPA was successfully used to screen and detect CCHFV positives from a panel of clinical samples from Tajikistan. The assay is a rapid, isothermal, simple-to-perform molecular diagnostic, which can be performed on a light, portable real-time detection device. It is ideally placed therefore for use as a field-diagnostic or in-low resource laboratories, for monitoring of CCHF outbreaks at the point-of-need, such as in remote rural regions in affected countries.
Development and evaluation of a rapid recombinase polymerase amplification assay for detection of coxsackievirus A6.

PubMed

Wang, Kaifeng; Wu, Yue; Yin, Dan; Tang, Shixing; Hu, Guifang; He, Yaqing

2017-01-01

Coxsackievirus A6 (CV-A6) is an important pathogen causing hand, foot and mouth disease (HFMD). The aim of this study was to develop and evaluate a rapid real-time reverse transcription recombinase polymerase amplification (RT-RPA) assay for detection of CV-A6. The sensitivity of this assay was 202 copies/reaction, with 100 % specificity. Furthermore, this assay yielded consistent results comparable with a commercial qRT-PCR diagnostic kit. This assay is therefore potentially useful for surveillance of CV-A6 infections and outbreak control.
Subunit Compositions of the RNA-Silencing Enzymes Pol IV and Pol V Reveal Their Origins as Specialized Forms of RNA Polymerase II

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ream, Thomas S.; Haag, J. R.; Wierzbicki, A. T.

2009-01-30

In addition to RNA polymerases I, II and III, which are multi-subunit RNA polymerases found in all eukaryotes, plants have catalytic subunits for two additional nuclear RNA polymerases, abbreviated as Pol IV and Pol V (formerly Pol IVa and Pol IVb, respectively). Pol IV and Pol V play non-redundant roles in siRNA-directed DNA methylation and gene silencing pathways.
Real-time isothermal detection of Shiga toxin-producing Escherichia coli using recombinase polymerase amplification.

PubMed

Murinda, Shelton E; Ibekwe, A Mark; Zulkaffly, Syaizul; Cruz, Andrew; Park, Stanley; Razak, Nur; Paudzai, Farah Md; Ab Samad, Liana; Baquir, Khairul; Muthaiyah, Kokilah; Santiago, Brenna; Rusli, Amirul; Balkcom, Sean

2014-07-01

Shiga toxin-producing Escherichia coli (STEC) are a major family of foodborne pathogens of public health, zoonotic, and economic significance in the United States and worldwide. To date, there are no published reports on use of recombinase polymerase amplification (RPA) for STEC detection. The primary goal of this study was to assess the potential application of RPA in detection of STEC. This study focused on designing and evaluating RPA primers and fluorescent probes for isothermal (39°C) detection of STEC. Compatible sets of candidate primers and probes were designed for detection of Shiga toxin 1 and 2 (Stx1 and 2), respectively. The sets were evaluated for specificity and sensitivity against STEC (n=12) of various stx genotypes (stx1/stx2, stx1, or stx2, respectively), including non-Stx-producing E. coli (n=28) and other genera (n=7). The primers and probes that were designed targeted amplification of the subunit A moiety of stx1 and stx2. The assay detected STEC in real time (within 5-10 min at 39°C) with high sensitivity (93.5% vs. 90%; stx1 vs. stx2), specificity (99.1% vs. 100%; stx1 vs. stx2), and predictive value (97.9% for both stx1 vs. stx2). Limits of detection of ∼ 5-50 colony-forming units/mL were achieved in serially diluted cultures grown in brain heart infusion broth. This study successfully demonstrated for the first time that RPA can be used for isothermal real-time detection of STEC.
Development of a rapid diagnostic assay for the detection of tomato chlorotic dwarf viroid based on isothermal reverse-transcription-recombinase polymerase amplification

USDA-ARS?s Scientific Manuscript database

A molecular diagnostic assay utilizing reverse transcription-recombinase polymerase amplification (RT-RPA) at an isothermal constant temperature of 39 °C and target-specific primers and probe were developed for the rapid, sensitive, and specific detection of tomato chlorotic dwarf viroid (TCDVd) in ...
Detection of putative oral pathogens in acute periradicular abscesses by 16S rDNA-directed polymerase chain reaction.

PubMed

Siqueira, J F; Rôças, I N; Oliveira, J C; Santos, K R

2001-03-01

A 16S rDNA-directed polymerase chain reaction method was used to assess the occurrence of four black-pigmented anaerobic rods, Treponema denticola, and Actinobacillus actinomycetemcomitans in acute periradicular abscesses. Pus was collected by aspiration from 10 cases diagnosed as acute abscesses of endodontic origin. DNA was extracted from the samples and analyzed using a polymerase chain reaction-based identification assay. The method allowed detecting black-pigmented anaerobes in 80% of the examined abscesses. Porphyromonas endodontalis was found in 70%, T. denticola in 50%, Porphyromonas gingivalis in 40%, and Prevotella intermedia in 10% of the cases. P. gingivalis was always found associated with P. endodontalis. Prevotella nigrescens and A. actinomycetemcomitans were not found in any pus sample. The high prevalence of P. endodontalis, T. denticola, and P. gingivalis suggests that they can play an important role in the etiology of acute periradicular abscesses.
Quencher-Free Fluorescence Method for the Detection of Mercury(II) Based on Polymerase-Aided Photoinduced Electron Transfer Strategy.

PubMed

Liu, Haisheng; Ma, Linbin; Ma, Changbei; Du, Junyan; Wang, Meilan; Wang, Kemin

2016-11-18

A new quencher-free Hg 2+ ion assay method was developed based on polymerase-assisted photoinduced electron transfer (PIET). In this approach, a probe is designed with a mercury ion recognition sequence (MRS) that is composed of two T-rich functional areas separated by a spacer of random bases at the 3'-end, and a sequence of stacked cytosines at the 5'-end, to which a fluorescein (FAM) is attached. Upon addition of Hg 2+ ions into this sensing system, the MRS folds into a hairpin structure at the 3'-end with Hg 2+ -mediated base pairs. In the presence of DNA polymerase, it will catalyze the extension reaction, resulting in the formation of stacked guanines, which will instantly quench the fluorescence of FAM through PIET. Under optimal conditions, the limit of detection for Hg 2+ ions was estimated to be 5 nM which is higher than the US Environmental Protection Agency (EPA) standard limit. In addition, no labeling with a quencher was requiring, and the present method is fairly simple, fast and low cost. It is expected that this cost-effective fluorescence method might hold considerable potential in the detection of Hg 2+ ions in real biological and environmental samples.
In-house polymerase chain reaction for affordable and sustainable Chlamydia trachomatis detection in Trinidad and Tobago.

PubMed

Rampersad, Joanne; Wang, Xiaohui; Gayadeen, Helen; Ramsewak, Samuel; Ammons, David

2007-11-01

To provide a preliminary assessment of in-house polymerase chain reaction (PCR) as an alternative to the more costly commercial test for detection of asymptomatic infection by Chlamydia trachomatis and to provide much needed demographic data on infection indicators within the Trinidad and Tobago public health care system. An inexpensive in-house nested-PCR with an Internal Amplification Control was used to detect C. trachomatis and Neisseria gonorrhoeae in urine samples collected from 273 apparently healthy, pregnant women from March-September 2004 in Trinidad, West Indies. Demographic information on participants was collected and subjected to statistical analyses. C. trachomatis was detected in 57/273 (21%) samples, of which 5 (2%) were also positive for N. gonorrhoeae. Infection correlated well with certain demographic parameters, with the highest incidence of C. trachomatis infection found among pregnant women that were single or of African descent. Given the lack of commercial tests in Trinidad, in-house PCR is an inexpensive alternative that can be used to detect asymptomatic infections of C. trachomatis and to provide demographic information needed for interventions by the public health care system.
Detection of hepatitis "C" virus in formalin-fixed liver tissue by nested polymerase chain reaction.

PubMed

Sallie, R; Rayner, A; Portmann, B; Eddleston, A L; Williams, R

1992-08-01

Interpretation of antibody to hepatitis C virus (HCV) in patients with liver disease is difficult due to false-positive reactivity in some conditions. To evaluate the feasibility of HCV in archival material, HCV was sought in formalin-fixed, paraffin-embedded liver biopsy specimens. Nested polymerase chain reaction was used to detect hepatitis C virus in formalin-fixed, paraffin-embedded liver biopsy specimens after total RNA was extracted from tissue by proteinase K digestion and phenol/chloroform purification. The relative efficiency of amplification of HCV RNA from formalin-fixed material was estimated semiquantitatively by serial dilution of cDNA synthesised from RNA extracted from fresh and formalin-fixed sections from the same liver. Although HCV RNA could be detected in formalin-fixed liver tissue by nested PCR in 5/5 cases in which HCV was detected in serum, amplification was approximately 5-fold less efficient than when HCV was amplified from fresh tissue. Nevertheless, nested PCR of HCV from formalin-fixed liver tissue represents a useful technique in addressing some important questions related to the pathogenesis of liver disease.
Similarities in transcription factor IIIC subunits that bind to the posterior regions of internal promoters for RNA polymerase III.

PubMed

Matsutani, Sachiko

2004-08-09

In eukaryotes, RNA polymerase III (RNAP III) transcribes the genes for small RNAs like tRNAs, 5S rRNA, and several viral RNAs, and short interspersed repetitive elements (SINEs). The genes for these RNAs and SINEs have internal promoters that consist of two regions. These two regions are called the A and B blocks. The multisubunit transcription factor TFIIIC is required for transcription initiation of RNAP III; in transcription of tRNAs, the B-block binding subunit of TFIIIC recognizes a promoter. Although internal promoter sequences are conserved in eukaryotes, no evidence of homology between the B-block binding subunits of vertebrates and yeasts has been reported previously. Here, I reported the results of PSI-BLAST searches using the B-block binding subunits of human and Shizosacchromyces pombe as queries, showing that the same Arabidopsis proteins were hit with low E-values in both searches. Comparison of the convergent iterative alignments obtained by these PSI-BLAST searches revealed that the vertebrate, yeast, and Arabidopsis proteins have similarities in their N-terminal one-third regions. In these regions, there were three domains with conserved sequence similarities, one located in the N-terminal end region. The N-terminal end region of the B-block binding subunit of Saccharomyces cerevisiae is tentatively identified as a HMG box, which is the DNA binding motif. Although I compared the alignment of the N-terminal end regions of the B-block binding subunits, and their homologs, with that of the HMG boxes, it is not clear whether they are related. Molecular phylogenetic analyses using the small subunit rRNA and ubiquitous proteins like actin and alpha-tubulin, show that fungi are more closely related to animals than either is to plants. Interestingly, the results obtained in this study show that, with respect to the B-block binding subunits of TFIIICs, animals appear to be evolutionarily closer to plants than to fungi.
Development of an on-site rapid real-time polymerase chain reaction system and the characterization of suitable DNA polymerases for TaqMan probe technology.

PubMed

Furutani, Shunsuke; Naruishi, Nahoko; Hagihara, Yoshihisa; Nagai, Hidenori

2016-08-01

On-site quantitative analyses of microorganisms (including viruses) by the polymerase chain reaction (PCR) system are significantly influencing medical and biological research. We have developed a remarkably rapid and portable real-time PCR system that is based on microfluidic approaches. Real-time PCR using TaqMan probes consists of a complex reaction. Therefore, in a rapid real-time PCR, the optimum DNA polymerase must be estimated by using actual real-time PCR conditions. In this study, we compared the performance of three DNA polymerases in actual PCR conditions using our rapid real-time PCR system. Although KAPA2G Fast HS DNA Polymerase has the highest enzymatic activity among them, SpeedSTAR HS DNA Polymerase exhibited better performance to rapidly increase the fluorescence signal in an actual real-time PCR using TaqMan probes. Furthermore, we achieved rapid detection of Escherichia coli in 7 min by using SpeedSTAR HS DNA Polymerase with the same sensitivity as that of a conventional thermal cycler.
Detection of Clostridium botulinum type C cells in the gastrointestinal tracts of Mozambique tilapia (Oreochromis mossambicus) by polymerase chain reaction

USGS Publications Warehouse

Nol, P.; Williamson, J.L.; Rocke, T.E.; Yuill, Thomas M.

2004-01-01

We established a method of directly detecting Clostridium botulinum type C cells, while minimizing spore detection, in the intestinal contents of Mozambique tilapia (Oreochromis mossambicus). This technique involved extraction of predominantly cellular DNA from tilapia intestinal tracts and used a polymerase chain reaction assay to detect presence of type C1 toxin gene. We consistently detected C. botulinum type C cells in tilapia gastrointestinal contents at a level of 7.5×104 cells per 0.25 g material or 1.9×103 cells. This technique is useful for determining prevalence of the potentially active organisms within a given population of fish and may be adapted to other types of C. botulinum and vertebrate populations as well.

Recombinase polymerase amplification-based assay to diagnose Giardia in stool samples.

PubMed

Crannell, Zachary Austin; Cabada, Miguel Mauricio; Castellanos-Gonzalez, Alejandro; Irani, Ayesha; White, Arthur Clinton; Richards-Kortum, Rebecca

2015-03-01

Giardia duodenalis is one of the most commonly identified parasites in stool samples. Although relatively easy to treat, giardiasis can be difficult to detect as it presents similar to other diarrheal diseases. Here, we present a recombinase polymerase amplification-based Giardia (RPAG) assay to detect the presence of Giardia in stool samples. The RPAG assay was characterized on the bench top using stool samples spiked with Giardia cysts where it showed a limit-of-detection nearly as low as the gold standard polymerase chain reaction assay. The RPAG assay was then tested in the highlands of Peru on 104 stool samples collected from the surrounding communities where it showed 73% sensitivity and 95% specificity against a polymerase chain reaction and microscopy composite gold standard. Further improvements in clinical sensitivity will be needed for the RPAG assay to have clinical relevance. © The American Society of Tropical Medicine and Hygiene.
Connective tissue-activating peptide III: a novel blood biomarker for early lung cancer detection.

PubMed

Yee, John; Sadar, Marianne D; Sin, Don D; Kuzyk, Michael; Xing, Li; Kondra, Jennifer; McWilliams, Annette; Man, S F Paul; Lam, Stephen

2009-06-10

There are no reliable blood biomarkers to detect early lung cancer. We used a novel strategy that allows discovery of differentially present proteins against a complex and variable background. Mass spectrometry analyses of paired pulmonary venous-radial arterial blood from 16 lung cancer patients were applied to identify plasma proteins potentially derived from the tumor microenvironment. Two differentially expressed proteins were confirmed in 64 paired venous-arterial blood samples using an immunoassay. Twenty-eight pre- and postsurgical resection peripheral blood samples and two independent, blinded sets of plasma from 149 participants in a lung cancer screening study (49 lung cancers and 100 controls) and 266 participants from the National Heart Lung and Blood Institute Lung Health Study (45 lung cancer and 221 matched controls) determined the accuracy of the two protein markers to detect subclinical lung cancer. Connective tissue-activating peptide III (CTAP III)/ neutrophil activating protein-2 (NAP-2) and haptoglobin were identified to be significantly higher in venous than in arterial blood. CTAP III/NAP-2 levels decreased after tumor resection (P = .01). In two independent population cohorts, CTAP III/NAP-2 was significantly associated with lung cancer and improved the accuracy of a lung cancer risk prediction model that included age, smoking, lung function (FEV(1)), and an interaction term between FEV(1) and CTAP III/NAP-2 (area under the curve, 0.84; 95% CI, 0.77 to 0.91) compared to CAPIII/NAP-2 alone. We identified CTAP III/NAP-2 as a novel biomarker to detect preclinical lung cancer. The study underscores the importance of applying blood biomarkers as part of a multimodal lung cancer risk prediction model instead of as stand-alone tests.
Robust detection of EGFR copy number changes and EGFR variant III: technical aspects and relevance for glioma diagnostics.

PubMed

Jeuken, Judith; Sijben, Angelique; Alenda, Cristina; Rijntjes, Jos; Dekkers, Marieke; Boots-Sprenger, Sandra; McLendon, Roger; Wesseling, Pieter

2009-10-01

Epidermal growth factor receptor (EGFR) is commonly affected in cancer, generally in the form of an increase in DNA copy number and/or as mutation variants [e.g., EGFR variant III (EGFRvIII), an in-frame deletion of exons 2-7]. While detection of EGFR aberrations can be expected to be relevant for glioma patients, such analysis has not yet been implemented in a routine setting, also because feasible and robust assays were lacking. We evaluated multiplex ligation-dependent probe amplification (MLPA) for detection of EGFR amplification and EGFRvIII in DNA of a spectrum of 216 diffuse gliomas. EGFRvIII detection was verified at the protein level by immunohistochemistry and at the RNA level using the conventionally used endpoint RT-PCR as well as a newly developed quantitative RT-PCR. Compared to these techniques, the DNA-based MLPA assay for EGFR/EGFRvIII analysis tested showed 100% sensitivity and specificity. We conclude that MLPA is a robust assay for detection of EGFR/EGFRvIII aberrations. While the exact diagnostic, prognostic and predictive value of such EGFR testing remains to be seen, MLPA has great potential as it can reliably and relatively easily be performed on routinely processed (formalin-fixed, paraffin-embedded) tumor tissue in combination with testing for other relevant glioma markers.
Rapid Detection of Cyprinid Herpesvirus 3 in Latently Infected Koi (Cyprinus carpio) by Recombinase Polymerase Amplification

PubMed Central

Prescott, Meagan A.; Reed, Aimee N.; Jin, Ling; Pastey, Manoj K.

2018-01-01

Since the emergence of cyprinid herpes virus 3 (CyHV-3), outbreaks have been devastating to koi and common carp leading to high economic losses. Current diagnostics for detecting CyHV-3 are limited in sensitivity and are further complicated by latency. Here we describe the detection of CyHV-3 by recombinase polymerase amplification (RPA). The RPA assay can detect as low as 10 copies of CyHV-3 genome by an isothermal reaction and yields results in approximately 20 minutes. Using the RPA assay, CyHV-3 genome can be detected in total DNA of white blood cells isolated from koi latently infected with CyHV-3, while less than 10% of the latently infected koi can be detected by a real-time PCR assay in total DNA of white blood cells. In addition, RPA products can be detected in a lateral flow device that is cheap, fast, and can be used outside of the diagnostic lab. The RPA assay and lateral flow device provide for the rapid, sensitive, and specific amplification of CyHV-3 that with future modifications for field use and validation could lead to enhanced surveillance and early diagnosis of CyHV-3 in the laboratory and field. PMID:27485254
Comparison of Nested Polymerase Chain Reaction and Real-Time Polymerase Chain Reaction with Parasitological Methods for Detection of Strongyloides stercoralis in Human Fecal Samples

PubMed Central

Sharifdini, Meysam; Mirhendi, Hossein; Ashrafi, Keyhan; Hosseini, Mostafa; Mohebali, Mehdi; Khodadadi, Hossein; Kia, Eshrat Beigom

2015-01-01

This study was performed to evaluate nested polymerase chain reaction (PCR) and real-time PCR methods for detection of Strongyloides stercoralis in fecal samples compared with parasitological methods. A total of 466 stool samples were examined by conventional parasitological methods (formalin ether concentration [FEC] and agar plate culture [APC]). DNA was extracted using an in-house method, and mitochondrial cytochrome c oxidase subunit 1 and 18S ribosomal genes were amplified by nested PCR and real-time PCR, respectively. Among 466 samples, 12.7% and 18.2% were found infected with S. stercoralis by FEC and APC, respectively. DNA of S. stercoralis was detected in 18.9% and 25.1% of samples by real-time PCR and nested PCR, respectively. Considering parasitological methods as the diagnostic gold standard, the sensitivity and specificity of nested PCR were 100% and 91.6%, respectively, and that of real-time PCR were 84.7% and 95.8%, respectively. However, considering sequence analyzes of the selected nested PCR products, the specificity of nested PCR is increased. In general, molecular methods were superior to parasitological methods. They were more sensitive and more reliable in detection of S. stercoralis in comparison with parasitological methods. Between the two molecular methods, the sensitivity of nested PCR was higher than real-time PCR. PMID:26350449
Association of anti-RNA polymerase III autoantibodies and cancer in scleroderma

PubMed Central

2014-01-01

Introduction We assessed the profile and frequency of malignancy subtypes in a large single-centre UK cohort for patients with scleroderma (systemic sclerosis; SSc). We evaluated the cancer risk among SSc patients with different antibody reactivities and explored the temporal association of cancer with the duration between SSc onset and cancer diagnosis. Methods We conducted a retrospective study of a well-characterised cohort of SSc patients attending a large tertiary referral centre, with clinical data collected from our clinical database and by review of patient records. We evaluated development of all cancers in this cohort, and comparison was assessed with the SSc cohort without cancer. The effect of demographics and clinical details, including antibody reactivities, were explored to find associations relevant to the risk for development of cancer in SSc patients. Results Among 2,177 patients with SSc, 7.1% had a history of cancer, 26% were positive for anticentromere antibodies (ACAs), 18.2% were positive for anti-Scl-70 antibodies and 26.6% were positive for anti-RNA polymerase III (anti-RNAP) antibody. The major malignancy cancer subtypes were breast (42.2%), haematological (12.3%), gastrointestinal (11.0%) and gynaecological (11.0%). The frequency of cancers among patients with RNAP (14.2%) was significantly increased compared with those with anti-Scl-70 antibodies (6.3%) and ACAs (6.8%) (P < 0.0001 and P < 0.001, respectively). Among the patients, who were diagnosed with cancer within 36 months of the clinical onset of SSc, there were more patients with RNAP (55.3%) than those with other autoantibody specificities (ACA = 23.5%, P < 0.008; and anti-Scl-70 antibodies = 13.6%, P < 0.002, respectively). Breast cancers were temporally associated with onset of SSc among patients with anti-RNAP, and SSc patients with anti-RNAP had a twofold increased hazard ratio for cancers compared to patients with ACAs (P < 0.0001). Conclusions
Recombinase polymerase and enzyme-linked immunosorbent assay as a DNA amplification-detection strategy for food analysis.

PubMed

Santiago-Felipe, S; Tortajada-Genaro, L A; Puchades, R; Maquieira, A

2014-02-06

Polymerase chain reaction in conjunction with enzyme-linked immunosorbent assay (PCR-ELISA) is a well-established technique that provides a suitable rapid, sensitive, and selective method for a broad range of applications. However, the need for precise rapid temperature cycling of PCR is an important drawback that can be overcome by employing isothermal amplification reactions such as recombinase polymerase amplification (RPA). The RPA-ELISA combination is proposed for amplification at a low, constant temperature (40°C) in a short time (40 min), for the hybridisation of labelled products to specific 5'-biotinylated probes/streptavidin in coated microtiter plates at room temperature, and for detection by colorimetric immunoassay. RPA-ELISA was applied to screen common safety threats in foodstuffs, such as allergens (hazelnut, peanut, soybean, tomato, and maize), genetically modified organisms (P35S and TNOS), pathogenic bacteria (Salmonella sp. and Cronobacter sp.), and fungi (Fusarium sp.). Satisfactory sensitivity and reproducibility results were achieved for all the targets. The RPA-ELISA technique does away with thermocycling and provides a suitable sensitive, specific, and cost-effective method for routine applications, and proves particularly useful for resource-limited settings. Copyright © 2013 Elsevier B.V. All rights reserved.
Lack of detection of feline leukemia and feline sarcoma viruses in diffuse iris melanomas of cats by immunohistochemistry and polymerase chain reaction.

PubMed

Cullen, Cheryl L; Haines, Deborah M; Jackson, Marion L; Grahn, Bruce H

2002-07-01

Diffuse iris melanoma was confirmed by light-microscopic examination in 10 formalin-fixed, paraffin-embedded globes from 10 cats. To determine if feline leukemia virus or a replication defective feline leukemia virus, feline sarcoma virus, was present in these anterior uveal melanomas, immunohistochemistry and polymerase chain reaction for feline leukemia virus were utilized. Immunohistochemical staining for feline leukemia virus glycoprotein 70 was performed on all 10 tumors using an avidin-biotin complex technique. The DNA was extracted from each specimen and a 166-base pair region of the feline leukemia virus long terminal repeat was targeted by polymerase chain reaction. Immunohistochemical staining for feline leukemia virus glycoprotein 70 and polymerase chain reaction amplification of a feline leukemia virus long terminal repeat region were negative in all cases. Feline leukemia virus/feline sarcoma virus was not detected in any neoplasms and therefore was unlikely to play a role in the tumorigenesis of these feline diffuse iris melanomas.
Error Rate Comparison during Polymerase Chain Reaction by DNA Polymerase

DOE PAGES

McInerney, Peter; Adams, Paul; Hadi, Masood Z.

2014-01-01

As larger-scale cloning projects become more prevalent, there is an increasing need for comparisons among high fidelity DNA polymerases used for PCR amplification. All polymerases marketed for PCR applications are tested for fidelity properties (i.e., error rate determination) by vendors, and numerous literature reports have addressed PCR enzyme fidelity. Nonetheless, it is often difficult to make direct comparisons among different enzymes due to numerous methodological and analytical differences from study to study. We have measured the error rates for 6 DNA polymerases commonly used in PCR applications, including 3 polymerases typically used for cloning applications requiring high fidelity. Error ratemore » measurement values reported here were obtained by direct sequencing of cloned PCR products. The strategy employed here allows interrogation of error rate across a very large DNA sequence space, since 94 unique DNA targets were used as templates for PCR cloning. The six enzymes included in the study, Taq polymerase, AccuPrime-Taq High Fidelity, KOD Hot Start, cloned Pfu polymerase, Phusion Hot Start, and Pwo polymerase, we find the lowest error rates with Pfu , Phusion, and Pwo polymerases. Error rates are comparable for these 3 enzymes and are >10x lower than the error rate observed with Taq polymerase. Mutation spectra are reported, with the 3 high fidelity enzymes displaying broadly similar types of mutations. For these enzymes, transition mutations predominate, with little bias observed for type of transition.« less
A rapid assay for detection of Rose rosette virus using reverse transcription-recombinase polymerase amplification using multiple gene targets.

PubMed

Babu, Binoy; Washburn, Brian K; Miller, Steven H; Poduch, Kristina; Sarigul, Tulin; Knox, Gary W; Ochoa-Corona, Francisco M; Paret, Mathews L

2017-02-01

Rose rosette disease caused by Rose rosette virus (RRV; genus Emaravirus) is the most economically relevant disease of Knock Out ® series roses in the U.S. As there are no effective chemical control options for the disease, the most critical disease management strategies include the use of virus free clean plants for propagation and early detection and destruction of infected plants. The current diagnostic techniques for RRV including end-point reverse transcription-polymerase chain reaction (RT-PCR) and real-time PCR (RT-qPCR) are highly sensitive, but limited to diagnostic labs with the equipment and expertise; and is time consuming. To address this limitation, an isothermal reverse transcription-recombinase polymerase amplification (RT-RPA) assay based on multiple gene targets for specific detection of RRV was developed. The assay is highly specific and did not cross react with other viruses belonging to the inclusive and exclusive genus. Dilution assays using the in vitro transcripts showed that the primer sets designed (RPA-267, RPA-131, and RPA-321) are highly sensitive, consistently detecting RRV with a detection limit of 1fg/μL. Testing of the infected plants using the primer sets indicated that the virus could be detected from leaves, stems and petals of roses. The primer pair RPA-267 produced 100% positive detection of the virus from infected leaf tissues, while primer set RPA-131 produced 100% detection from stems and petals. The primer set RPA-321 produced 83%, 87.5% and 75% positive detection from leaves, petals and stem tissues, respectively. In addition, the assay has been efficiently used in the detection of RRV infecting Knock Out ® roses, collected from different states in the U.S. The assay can be completed in 20min as compared to the end-point RT-PCR assay (3-4h) and RT-qPCR (1.5h). The RT-RPA assay is reliable, rapid, highly sensitive, and can be easily used in diagnostic laboratories for detection of RRV with no need for any special
A simple nucleic acid hybridization/latex agglutination assay for the rapid detection of polymerase chain reaction amplicons.

PubMed

Vollenhofer-Schrumpf, Sabine; Buresch, Ronald; Schinkinger, Manfred

2007-03-01

We have developed a new method for the detection of nucleic acid hybridization, based on a simple latex agglutination test that can be evaluated by the unaided eye. Nucleic acid, e.g., a polymerase chain reaction (PCR) product, is denatured and incubated with polystyrene beads carrying covalently bound complementary oligonucleotide sequences. Hybridization of the nucleic acids leads to aggregation of the latex particles, thereby verifying the presence of target sequence. The test is performed at room temperature, and results are available within 10 min. As a proof of principle, the hybridization/latex agglutination assay was applied to the detection of purified PCR fragments either specific for Salmonella spp. or a synthetic sequence, and to the detection of Salmonella enterica in artificially contaminated chicken samples. A few nanograms of purified PCR fragments were detectable. In artificially contaminated chicken samples, 3 colony-forming units (cfu)/25 g were detected in one of three replicates, and 30 cfu/25 g were detected in both of two replicates when samples for PCR were taken directly from primary enrichment, demonstrating the practical applicability of this test system. Even multiplex detection might be achievable. This novel kind of assay could be useful for a range of applications where hybridization of nucleic acids, e.g., PCR fragments, is to be detected.
Identification of new antibacterial targets in RNA polymerase of Mycobacterium tuberculosis by detecting positive selection sites.

PubMed

Wang, QingBiao; Xu, Yiqin; Gu, Zhuoya; Liu, Nian; Jin, Ke; Li, Yao; Crabbe, M James C; Zhong, Yang

2018-04-01

Bacterial RNA polymerase (RNAP) is an effective target for antibacterial treatment. In order to search new potential targets in RNAP of Mycobacterium, we detected adaptive selections of RNAP related genes in 13 strains of Mycobacterium by phylogenetic analysis. We first collected sequences of 17 genes including rpoA, rpoB, rpoC, rpoZ, and sigma factor A-M. Then maximum likelihood trees were constructed, followed by positive selection detection. We found that sigG shows positive selection along the clade (M. tuberculosis, M. bovis), suggesting its important evolutionary role and its potential to be a new antibacterial target. Moreover, the regions near 933Cys and 935His on the rpoB subunit of M. tuberculosis showed significant positive selection, which could also be a new attractive target for anti-tuberculosis drugs. Copyright © 2017 Elsevier Ltd. All rights reserved.
Nanobarcoding: detecting nanoparticles in biological samples using in situ polymerase chain reaction

PubMed Central

Eustaquio, Trisha; Leary, James F

2012-01-01

Background Determination of the fate of nanoparticles (NPs) in a biological system, or NP biodistribution, is critical in evaluating an NP formulation for nanomedicine. Current methods to determine NP biodistribution are greatly inadequate, due to their limited detection thresholds. Herein, proof of concept of a novel method for improved NP detection based on in situ polymerase chain reaction (ISPCR), coined “nanobarcoding,” is demonstrated. Methods Nanobarcoded superparamagnetic iron oxide nanoparticles (NB-SPIONs) were characterized by dynamic light scattering, zeta potential, and hyperspectral imaging measurements. Cellular uptake of Cy5-labeled NB-SPIONs (Cy5-NB-SPIONs) was imaged by confocal microscopy. The feasibility of the nanobarcoding method was first validated by solution-phase PCR and “pseudo”-ISPCR before implementation in the model in vitro system of HeLa human cervical adenocarcinoma cells, a cell line commonly used for ISPCR-mediated detection of human papilloma virus (HPV). Results Dynamic light-scattering measurements showed that NB conjugation stabilized SPION size in different dispersion media compared to that of its precursor, carboxylated SPIONs (COOH-SPIONs), while the zeta potential became more positive after NB conjugation. Hyperspectral imaging confirmed NB conjugation and showed that the NB completely covered the SPION surface. Solution-phase PCR and pseudo-ISPCR showed that the expected amplicons were exclusively generated from the NB-SPIONs in a dose-dependent manner. Although confocal microscopy revealed minimal cellular uptake of Cy5-NB-SPIONs at 50 nM over 24 hours in individual cells, ISPCR detected definitive NB-SPION signals inside HeLa cells over large sample areas. Conclusion Proof of concept of the nanobarcoding method has been demonstrated in in vitro systems, but the technique needs further development before its widespread use as a standardized assay. PMID:23144562
New Fpg probe chemistry for direct detection of recombinase polymerase amplification on lateral flow strips.

PubMed

Powell, Michael L; Bowler, Frank R; Martinez, Aurore J; Greenwood, Catherine J; Armes, Niall; Piepenburg, Olaf

2018-02-15

Rapid, cost-effective and sensitive detection of nucleic acids has the ability to improve upon current practices employed for pathogen detection in diagnosis of infectious disease and food testing. Furthermore, if assay complexity can be reduced, nucleic acid amplification tests could be deployed in resource-limited and home use scenarios. In this study, we developed a novel Fpg (Formamidopyrimidine DNA glycosylase) probe chemistry, which allows lateral flow detection of amplification in undiluted recombinase polymerase amplification (RPA) reactions. The prototype nucleic acid lateral flow chemistry was applied to a human genomic target (rs1207445), Campylobacter jejuni 16S rDNA and two genetic markers of the important food pathogen E. coli O157:H7. All four assays have an analytical sensitivity between 10 and 100 copies DNA per amplification. Furthermore, the assay is performed with fewer hands-on steps than using the current RPA Nfo lateral flow method as dilution of amplicon is not required for lateral flow analysis. Due to the simplicity of the workflow, we believe that the lateral flow chemistry for direct detection could be readily adapted to a cost-effective single-use consumable, ideal for use in non-laboratory settings. Copyright © 2017. Published by Elsevier Inc.
Isothermal Recombinase Polymerase amplification (RPA) of Schistosoma haematobium DNA and oligochromatographic lateral flow detection.

PubMed

Rosser, A; Rollinson, D; Forrest, M; Webster, B L

2015-09-04

Accurate diagnosis of urogenital schistosomiasis is vital for surveillance/control programs. Amplification of schistosome DNA in urine by PCR is sensitive and specific but requires infrastructure, financial resources and skilled personnel, often not available in endemic areas. Recombinase Polymerase Amplification (RPA) is an isothermal DNA amplification/detection technology that is simple, rapid, portable and needs few resources. Here a Schistosoma haematobium RPA assay was developed and adapted so that DNA amplicons could be detected using oligochromatographic Lateral Flow (LF) strips. The assay successfully amplified S. haematobium DNA at 30-45 °C in 10 mins and was sensitive to a lower limit of 100 fg of DNA. The assay was also successful with the addition of crude urine, up to 5% of the total reaction volume. Cross amplification occurred with other schistosome species but not with other common urine microorganisms. The LF-RPA assay developed here can amplify and detect low levels of S. haematobium DNA. Reactions are rapid, require low temperatures and positive reactions are interpreted using lateral flow strips, reducing the need for infrastructure and resources. This together with an ability to withstand inhibitors within urine makes RPA a promising technology for further development as a molecular diagnostic tool for urogenital schistosomiasis.
Detection of wild-type EGFR amplification and EGFRvIII mutation in CSF-derived extracellular vesicles of glioblastoma patients.

PubMed

Figueroa, Javier M; Skog, Johan; Akers, Johnny; Li, Hongying; Komotar, Ricardo; Jensen, Randy; Ringel, Florian; Yang, Isaac; Kalkanis, Steven; Thompson, Reid; LoGuidice, Lori; Berghoff, Emily; Parsa, Andrew; Liau, Linda; Curry, William; Cahill, Daniel; Bettegowda, Chetan; Lang, Frederick F; Chiocca, E Antonio; Henson, John; Kim, Ryan; Breakefield, Xandra; Chen, Clark; Messer, Karen; Hochberg, Fred; Carter, Bob S

2017-10-19

RNAs within extracellular vesicles (EVs) have potential as diagnostic biomarkers for patients with cancer and are identified in a variety of biofluids. Glioblastomas (GBMs) release EVs containing RNA into cerebrospinal fluid (CSF). Here we describe a multi-institutional study of RNA extracted from CSF-derived EVs of GBM patients to detect the presence of tumor-associated amplifications and mutations in epidermal growth factor receptor (EGFR). CSF and matching tumor tissue were obtained from patients undergoing resection of GBMs. We determined wild-type (wt)EGFR DNA copy number amplification, as well as wtEGFR and EGFR variant (v)III RNA expression in tumor samples. We also characterized wtEGFR and EGFRvIII RNA expression in CSF-derived EVs. EGFRvIII-positive tumors had significantly greater wtEGFR DNA amplification (P = 0.02) and RNA expression (P = 0.03), and EGFRvIII-positive CSF-derived EVs had significantly more wtEGFR RNA expression (P = 0.004). EGFRvIII was detected in CSF-derived EVs for 14 of the 23 EGFRvIII tissue-positive GBM patients. Conversely, only one of the 48 EGFRvIII tissue-negative patients had the EGFRvIII mutation detected in their CSF-derived EVs. These results yield a sensitivity of 61% and a specificity of 98% for the utility of CSF-derived EVs to detect an EGFRvIII-positive GBM. Our results demonstrate CSF-derived EVs contain RNA signatures reflective of the underlying molecular genetic status of GBMs in terms of wtEGFR expression and EGFRvIII status. The high specificity of the CSF-derived EV diagnostic test gives us an accurate determination of positive EGFRvIII tumor status and is essentially a less invasive "liquid biopsy" that might direct mutation-specific therapies for GBMs. © The Author(s) 2017. Published by Oxford University Press on behalf of the Society for Neuro-Oncology. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com
The possible existence of Pop III NS-BH binary and its detectability

NASA Astrophysics Data System (ADS)

Kinugawa, Tomoya; Nakamura, Takashi; Nakano, Hiroyuki

2017-02-01

In the population synthesis simulations of Pop III stars, many BH (black hole)-BH binaries with merger time less than the age of the Universe (τH) are formed, while NS (neutron star)-BH binaries are not. The reason is that Pop III stars have no metal so that no mass loss is expected. Then, in the final supernova explosion to NS, much mass is lost so that the semimajor axis becomes too large for Pop III NS-BH binaries to merge within τH . However it is almost established that the kick velocity of the order of 200 ‑500 km s‑1 exists for NS from the observation of the proper motion of the pulsar. Therefore, the semimajor axis of the half of NS-BH binaries can be smaller than that of the previous argument for Pop III NS-BH binaries to decrease the merging time. We perform population synthesis Monte Carlo simulations of Pop III NS-BH binaries including the kick of NS and find that the event rate of Pop III NS-BH merger rate is 1 Gpc‑3 yr‑1 . This suggests that there is a good chance of detecting Pop III NS-BH mergers in O2 (Observation run 2) of Advanced LIGO and Advanced Virgo from this autumn.
Development of a polymerase chain reaction applicable to rapid and sensitive detection of Clonorchis sinensis eggs in human stool samples

PubMed Central

Cho, Pyo Yun; Na, Byoung-Kuk; Mi Choi, Kyung; Kim, Jin Su; Cho, Shin-Hyeong; Lee, Won-Ja; Lim, Sung-Bin; Cha, Seok Ho; Park, Yun-Kyu; Pak, Jhang Ho; Lee, Hyeong-Woo; Hong, Sung-Jong; Kim, Tong-Soo

2013-01-01

Microscopic examination of eggs of parasitic helminths in stool samples has been the most widely used classical diagnostic method for infections, but tiny and low numbers of eggs in stool samples often hamper diagnosis of helminthic infections with classical microscopic examination. Moreover, it is also difficult to differentiate parasite eggs by the classical method, if they have similar morphological characteristics. In this study, we developed a rapid and sensitive polymerase chain reaction (PCR)-based molecular diagnostic method for detection of Clonorchis sinensis eggs in stool samples. Nine primers were designed based on the long-terminal repeat (LTR) of C. sinensis retrotransposon1 (CsRn1) gene, and seven PCR primer sets were paired. Polymerase chain reaction with each primer pair produced specific amplicons for C. sinensis, but not for other trematodes including Metagonimus yokogawai and Paragonimus westermani. Particularly, three primer sets were able to detect 10 C. sinensis eggs and were applicable to amplify specific amplicons from DNA samples purified from stool of C. sinensis-infected patients. This PCR method could be useful for diagnosis of C. sinensis infections in human stool samples with a high level of specificity and sensitivity. PMID:23916334
[Application of transcription mediated amplification and real-time reverse transcription polymerase chain reaction in detection of human immunodeficiency virus RNA].

PubMed

Wu, Daxian; Tao, Shuhui; Liu, Shuiping; Zhou, Jiebin; Tan, Deming; Hou, Zhouhua

2017-07-28

To observe the sensitivity of transcription mediated amplification (TMA), and to compare its performance with real-time reverse transcription polymerase chain reaction (real-time RT-PCR) in detecting human immunodeficiency virus RNA (HIV RNA).  Methods: TMA system was established with TaqMan probes, specific primers, moloney murine leukemia virus (MMLV) reverse transcriptase, T7 RNA polymerase, and reaction substrates. The sensitivity of TMA was evaluated by amplifying a group of 10-fold diluted HIV RNA standards which were transcribed in vitro. A total of 60 plasma of HIV infected patients were measured by TMA and Cobas Amplicor HIV-1 Monitor test to observe the positive rate. The correlation and concordance of the above two technologies were investigated by linear regression and Bland-Altman analysis.  Results: TMA system was established successfully and HIV RNA transcribed standards at concentration of equal or more than 10 copies/mL could be detected by TMA technology. Among 60 samples of plasma from HIV infected patients, 46 were positively detected and 12 were negatively amplified by both TMA and Cobas reagents; 2 samples were positively tested by Cobas reagent but negatively tested by TMA system. The concordance rate of the two methods was 97.1% and the difference of positive detection rate between the two methods was not statistically significant (P>0.05). Linear regression was used for 46 samples which were positively detected by both TMA and Cobas reagents and showed an excellent correlation between the two reagents (r=0.997, P<0.001). Bland-Altma analysis revealed that the mean different value of HIV RNA levels for denary logarithm was 0.02. Forty-four samples were included in 95% of credibility interval of concordance.  Conclusion: TMA system has the potential of high sensitivity. TMA and real-time RT-PCR keep an excellent correlation and consistency in detecting HIV RNA.
Electrochemical detection of Piscirickettsia salmonis genomic DNA from salmon samples using solid-phase recombinase polymerase amplification.

PubMed

Del Río, Jonathan Sabaté; Svobodova, Marketa; Bustos, Paulina; Conejeros, Pablo; O'Sullivan, Ciara K

2016-12-01

Electrochemical detection of solid-phase isothermal recombinase polymerase amplification (RPA) of Piscirickettsia salmonis in salmon genomic DNA is reported. The electrochemical biosensor was constructed by surface functionalization of gold electrodes with a thiolated forward primer specific to the genomic region of interest. Solid-phase RPA and primer elongation were achieved in the presence of the specific target sequence and biotinylated reverse primers. The formation of the subsequent surface-tethered duplex amplicons was electrochemically monitored via addition of streptavidin-linked HRP upon completion of solid-phase RPA. Successful quantitative amplification and detection were achieved in less than 1 h at 37 °C, calibrating with PCR-amplified genomic DNA standards and achieving a limit of detection of 5 · 10 -8 μg ml -1 (3 · 10 3 copies in 10 μl). The presented system was applied to the analysis of eight real salmon samples, and the method was also compared to qPCR analysis, observing an excellent degree of correlation. Graphical abstract Schematic of use of electrochemical RPA for detection of Psiricketessia salmonis in salmon liver.

Development of Isothermal Recombinase Polymerase Amplification Assay for Rapid Detection of Porcine Circovirus Type 2.

PubMed

Yang, Yang; Qin, Xiaodong; Sun, Yingjun; Cong, Guozheng; Li, Yanmin; Zhang, Zhidong

2017-01-01

Porcine circovirus virus type II (PCV2) is the etiology of postweaning multisystemic wasting syndrome (PMWS), porcine dermatitis, nephropathy syndrome (PDNS), and necrotizing pneumonia. Rapid diagnosis tool for detection of PCV2 plays an important role in the disease control and eradication program. Recombinase polymerase amplification (RPA) assays using a real-time fluorescent detection (PCV2 real-time RPA assay) and RPA combined with lateral flow dipstick (PCV2 RPA LFD assay) were developed targeting the PCV2 ORF2 gene. The results showed that the sensitivity of the PCV2 real-time RPA assay was 10 2 copies per reaction within 20 min at 37°C and the PCV2 RPA LFD assay had a detection limit of 10 2 copies per reaction in less than 20 min at 37°C. Both assays were highly specific for PCV2, with no cross-reactions with porcine circovirus virus type 1, foot-and-mouth disease virus, pseudorabies virus, porcine parvovirus, porcine reproductive and respiratory syndrome virus, and classical swine fever virus. Therefore, the RPA assays provide a novel alternative for simple, sensitive, and specific identification of PCV2.
Development of Isothermal Recombinase Polymerase Amplification Assay for Rapid Detection of Porcine Circovirus Type 2

PubMed Central

Yang, Yang; Qin, Xiaodong; Sun, Yingjun; Cong, Guozheng; Li, Yanmin

2017-01-01

Porcine circovirus virus type II (PCV2) is the etiology of postweaning multisystemic wasting syndrome (PMWS), porcine dermatitis, nephropathy syndrome (PDNS), and necrotizing pneumonia. Rapid diagnosis tool for detection of PCV2 plays an important role in the disease control and eradication program. Recombinase polymerase amplification (RPA) assays using a real-time fluorescent detection (PCV2 real-time RPA assay) and RPA combined with lateral flow dipstick (PCV2 RPA LFD assay) were developed targeting the PCV2 ORF2 gene. The results showed that the sensitivity of the PCV2 real-time RPA assay was 102 copies per reaction within 20 min at 37°C and the PCV2 RPA LFD assay had a detection limit of 102 copies per reaction in less than 20 min at 37°C. Both assays were highly specific for PCV2, with no cross-reactions with porcine circovirus virus type 1, foot-and-mouth disease virus, pseudorabies virus, porcine parvovirus, porcine reproductive and respiratory syndrome virus, and classical swine fever virus. Therefore, the RPA assays provide a novel alternative for simple, sensitive, and specific identification of PCV2. PMID:28424790
Identification of carriers among individuals recruited in the typhoid registry in Malaysia using stool culture, polymerase chain reaction, and dot enzyme immunoassay as detection tools.

PubMed

Chua, Ang Lim; Aziah, Ismail; Balaram, Prabha; Bhuvanendran, Saatheeyavaane; Anthony, Amy Amilda; Mohmad, Siti Norazura; Nasir, Norhafiza M; Hassan, Haslizai; Naim, Rochman; Meran, Lila P; Hussin, Hani M; Ismail, Asma

2015-03-01

Chronic carriers of Salmonella Typhi act as reservoirs for the organism and become the agents of typhoid outbreaks in a community. In this study, chronic carriers in Kelantan, Malaysia were first identified using the culture and polymerase chain reaction method. Then, a novel serological tool, designated Typhidot-C, was evaluated in retrospect using the detected individuals as control positives. Chronic carriage positive by the culture and polymerase chain reaction method was recorded at 3.6% (4 out of 110) among individuals who previously had acute typhoid fever and a 9.4% (10 out of 106) carriage rate was observed among food handlers screened during outbreaks. The Typhidot-C assay was able to detect all these positive carriers showing its potential as a viable carrier screening tool and can be used for efficient detection of typhoid carriers in an endemic area. These findings were used to establish the first carrier registry for S Typhi carriers in Malaysia. © 2012 APJPH.
Rapid detection of infectious hypodermal and hematopoietic necrosis virus (IHHNV) by real-time, isothermal recombinase polymerase amplification assay.

PubMed

Xia, Xiaoming; Yu, Yongxin; Hu, Linghao; Weidmann, Manfred; Pan, Yingjie; Yan, Shuling; Wang, Yongjie

2015-04-01

Infectious hypodermal and hematopoietic necrosis virus (IHHNV) causes mortality or runt deformity syndrome in penaeid shrimps and is responsible for significant economic losses in the shrimp aquaculture industry. Here, we describe a novel real-time isothermal recombinase polymerase amplification (RPA) assay developed for IHHNV detection. Using IHHNV plasmid standards and DNA samples from a variety of organisms, we evaluated the ability of the IHHNV-RPA assay to detect IHHNV based on analysis of its sensitivity, specificity, rapidity, and reproducibility. Probit analysis of eight independent experimental replicates indicated satisfactory performance of the RPA assay, which is sufficiently sensitive to detect as few as 4 copies of the IHHNV genome within 7 min at 39 °C with 95 % reliability. Therefore, this rapid RPA method has great potential for applications, either in field use or as a point of care diagnostic technique.
Detection of common diarrhea-causing pathogens in Northern Taiwan by multiplex polymerase chain reaction.

PubMed

Huang, Shu-Huan; Lin, Yi-Fang; Tsai, Ming-Han; Yang, Shuan; Liao, Mei-Ling; Chao, Shao-Wen; Hwang, Cheng-Cheng

2018-06-01

Conventional methods for identifying gastroenteritis pathogens are time consuming, more likely to result in a false-negative, rely on personnel with diagnostic expertise, and are dependent on the specimen status. Alternatively, molecular diagnostic methods permit the rapid, simultaneous detection of multiple pathogens with high sensitivity and specificity. The present study compared conventional methods with the Luminex xTAG Gastrointestinal Pathogen Panel (xTAG GPP) for the diagnosis of infectious gastroenteritis in northern Taiwan. From July 2015 to April 2016, 217 clinical fecal samples were collected from patients with suspected infectious gastroenteritis. All specimens were tested using conventional diagnostic techniques following physicians' orders as well as with the xTAG GPP. The multiplex polymerase chain reaction (PCR) approach detected significantly more positive samples with bacterial, viral, and/or parasitic infections as compared to conventional analysis (55.8% vs 40.1%, respectively; P < .001). Moreover, multiplex PCR could detect Escherichia coli O157, enterotoxigenic E coli, Shiga-like toxin-producing E coli, Cryptosporidium, and Giardia, which were undetectable by conventional methods. Furthermore, 48 pathogens in 23 patients (10.6%) with coinfections were identified only using the multiplex PCR approach. Of which, 82.6% were from pediatric patients. Because the detection rates using multiplex PCR are higher than conventional methods, and some pediatric pathogens could only be detected by multiplex PCR, this approach may be useful in rapidly diagnosing diarrheal disease in children and facilitating treatment initiation. Further studies are necessary to determine if multiplex PCR improves patient outcomes and reduces costs.
Detection of common diarrhea-causing pathogens in Northern Taiwan by multiplex polymerase chain reaction

PubMed Central

Huang, Shu-Huan; Lin, Yi-Fang; Tsai, Ming-Han; Yang, Shuan; Liao, Mei-Ling; Chao, Shao-Wen; Hwang, Cheng-Cheng

2018-01-01

Abstract Conventional methods for identifying gastroenteritis pathogens are time consuming, more likely to result in a false-negative, rely on personnel with diagnostic expertise, and are dependent on the specimen status. Alternatively, molecular diagnostic methods permit the rapid, simultaneous detection of multiple pathogens with high sensitivity and specificity. The present study compared conventional methods with the Luminex xTAG Gastrointestinal Pathogen Panel (xTAG GPP) for the diagnosis of infectious gastroenteritis in northern Taiwan. From July 2015 to April 2016, 217 clinical fecal samples were collected from patients with suspected infectious gastroenteritis. All specimens were tested using conventional diagnostic techniques following physicians’ orders as well as with the xTAG GPP. The multiplex polymerase chain reaction (PCR) approach detected significantly more positive samples with bacterial, viral, and/or parasitic infections as compared to conventional analysis (55.8% vs 40.1%, respectively; P < .001). Moreover, multiplex PCR could detect Escherichia coli O157, enterotoxigenic E coli, Shiga-like toxin-producing E coli, Cryptosporidium, and Giardia, which were undetectable by conventional methods. Furthermore, 48 pathogens in 23 patients (10.6%) with coinfections were identified only using the multiplex PCR approach. Of which, 82.6% were from pediatric patients. Because the detection rates using multiplex PCR are higher than conventional methods, and some pediatric pathogens could only be detected by multiplex PCR, this approach may be useful in rapidly diagnosing diarrheal disease in children and facilitating treatment initiation. Further studies are necessary to determine if multiplex PCR improves patient outcomes and reduces costs. PMID:29879060
Rapid Detection of Candida albicans by Polymerase Spiral Reaction Assay in Clinical Blood Samples

PubMed Central

Jiang, Xiaoqun; Dong, Derong; Bian, Lihong; Zou, Dayang; He, Xiaoming; Ao, Da; Yang, Zhan; Huang, Simo; Liu, Ningwei; Liu, Wei; Huang, Liuyu

2016-01-01

Candida albicans is the most common human yeast pathogen which causes mucosal infections and invasive fungal diseases. Early detection of this pathogen is needed to guide preventative and therapeutic treatment. The aim of this study was to establish a polymerase spiral reaction (PSR) assay that rapidly and accurately detects C. albicans and to assess the clinical applicability of PSR-based diagnostic testing. Internal transcribed spacer 2 (ITS2), a region between 5.8S and 28S fungal ribosomal DNA, was used as the target sequence. Four primers were designed for amplification of ITS2 with the PSR method, which was evaluated using real time turbidity monitoring and visual detection using a pH indicator. Fourteen non-C. albicans yeast strains were negative for detection, which indicated the specificity of PSR assay was 100%. A 10-fold serial dilution of C. albicans genomic DNA was subjected to PSR and conventional polimerase chain reaction (PCR) to compare their sensitivities. The detection limit of PSR was 6.9 pg/μl within 1 h, 10-fold higher than that of PCR (69.0 pg/μl). Blood samples (n = 122) were collected from intensive care unit and hematological patients with proven or suspected C. albicans infection at two hospitals in Beijing, China. Both PSR assay and the culture method were used to analyze the samples. Of the 122 clinical samples, 34 were identified as positive by PSR. The result was consistent with those obtained by the culture method. In conclusion, a novel and effective C. albicans detection assay was developed that has a great potential for clinical screening and point-of-care testing. PMID:27379048
Multiplex polymerase chain reaction assay for the detection of minute virus of mice and mouse parvovirus infections in laboratory mice.

PubMed

Wang, K W; Chueh, L L; Wang, M H; Huang, Y T; Fang, B H; Chang, C Y; Fang, M C; Chou, J Y; Hsieh, S C; Wan, C H

2013-04-01

Mouse parvoviruses are among the most prevalent infectious pathogens in contemporary mouse colonies. To improve the efficiency of routine screening for mouse parvovirus infections, a multiplex polymerase chain reaction (PCR) assay targeting the VP gene was developed. The assay detected minute virus of mice (MVM), mouse parvovirus (MPV) and a mouse housekeeping gene (α-actin) and was able to specifically detect MVM and MPV at levels as low as 50 copies. Co-infection with the two viruses with up to 200-fold differences in viral concentrations can easily be detected. The multiplex PCR assay developed here could be a useful tool for monitoring mouse health and the viral contamination of biological materials.
Reverse transcriptase polymerase chain reaction on fine needle aspirates for rapid detection of translocations in synovial sarcoma.

PubMed

Nilsson, G; Wang, M; Wejde, J; Kanter, L; Karlén, J; Tani, E; Kreicbergs, A; Larsson, O

1998-01-01

To evaluate the utilization of fine needle aspiration (FNA) biopsy to obtain material for reverse-transcriptase polymerase chain reaction (RT-PCR) in the detection of the t(X;18)(p11.2;q11.2) translocation in synovial sarcomas. We applied RT-PCR to detection of synovial sarcoma fusion gene transcripts on fine needle aspirates. Five clinical samples were first analyzed: one was a tumor previously diagnosed as malignant hemangiopericytoma, one was a poorly defined tumor, and three were suspected synovial sarcomas. FNA material was transferred directly to the RT-PCR reaction tube without RNA extraction. The t(X;18) translocation could be detected on the limited amount of material that FNA provides. In each of the cases studied the representivity of the tumor samples was confirmed microscopically. Our protocol permits analysis directly on representative samples without extraction of RNA. The results imply that RT-PCR offers reliable detection of sarcoma fusion gene transcripts on fine needle aspirates. The procedure, apart from being applicable to outpatients, is rapid and sensitive.
Quantitative fucK gene polymerase chain reaction on sputum and nasopharyngeal secretions to detect Haemophilus influenzae pneumonia.

PubMed

Abdeldaim, Guma M K; Strålin, Kristoffer; Olcén, Per; Blomberg, Jonas; Mölling, Paula; Herrmann, Björn

2013-06-01

A quantitative polymerase chain reaction (PCR) for the fucK gene was developed for specific detection of Haemophilus influenzae. The method was tested on sputum and nasopharyngeal aspirate (NPA) from 78 patients with community-acquired pneumonia (CAP). With a reference standard of sputum culture and/or serology against the patient's own nasopharyngeal isolate, H. influenzae etiology was detected in 20 patients. Compared with the reference standard, fucK PCR (using the detection limit 10(5) DNA copies/mL) on sputum and NPA showed a sensitivity of 95.0% (19/20) in both cases, and specificities of 87.9% (51/58) and 89.5% (52/58), respectively. In a receiver operating characteristic curve analysis, sputum fucK PCR was found to be significantly superior to sputum P6 PCR for detection of H. influenzae CAP. NPA fucK PCR was positive in 3 of 54 adult controls without respiratory symptoms. In conclusion, quantitative fucK real-time PCR provides a sensitive and specific identification of H. influenzae in respiratory secretions. Copyright © 2013 Elsevier Inc. All rights reserved.
Characterization of vitellogenin gene expression in round goby (Neogobius melanostomus) using a quantitative polymerase chain reaction assay.

PubMed

Bowley, Lucas A; Alam, Farhana; Marentette, Julie R; Balshine, Sigal; Wilson, Joanna Y

2010-12-01

A growing concern over endocrine disruption in aquatic species has prompted the development of molecular assays to monitor environmental impacts. This study describes the development of quantitative polymerase chain reaction (qPCR) assays to characterize the expression of two vitellogenin (Vtg) genes in the invasive round goby (Neogobius melanostomus). Fragments from the 18SrRNA (housekeeping gene), Vtg II, and Vtg III genes were cloned and sequenced. The qPCR assays were developed to detect hepatic Vtg expression in goby. The assays detected induction of both Vtg genes in nonreproductive males following a two-week laboratory exposure to 17β-estradiol (≥1 mg/kg i.p. injection). The assays were applied to goby from Hamilton Harbour, Lake Ontario (Canada), including those from sites where feminization and intersex of goby has been documented. Both Vtg genes had significantly higher expression in females compared to males. Male reproductive goby adopt either parental or sneaker tactics; Vtg II expression was higher in sneaker than in parental males but parental and nonreproductive males did not differ from each other. The Vtg III expression was significantly higher in sneaker males followed by parental males and nonreproductive males, respectively. The Vtg II and III expression in nonreproductive males was elevated in the contaminated site with documented intersex. This assay provides an important tool for the use of an invasive species in monitoring endocrine disruption in the Great Lakes region. Copyright © 2010 SETAC.
Development of a fluorescent probe-based recombinase polymerase amplification assay for rapid detection of Orf virus.

PubMed

Yang, Yang; Qin, Xiaodong; Wang, Guangxiang; Zhang, Yuen; Shang, Youjun; Zhang, Zhidong

2015-12-02

Orf virus (ORFV) is the causative agent of Orf (also known as contagious ecthyma or contagious papular dermatitis), a severe infectious skin disease in goats, sheep and other ruminants. The rapid detection of ORFV is of great importance in disease control and highly needed. A isothermal molecular diagnostic approach, termed recombinase polymerase amplification (RPA), is considered as an novel and rapid alternative techonology to PCR assay. In the present study, a novel fluorescent probe based on RPA assay (ORFV exo RPA assay) was developed. The developed ORFV exo RPA assay was capable of as low as 100 copies of ORFV DNA /reaction and was highly specific, with no cross-reaction with closely related viruses (capripox virus, foot-and-mouth disease virus or peste des petits ruminants virus). Further assessment with clinical samples showed that the developed ORFV exo RPA assay has good correlation with qPCR assays for detection of ORFV. These results suggest that the developed ORFV exo RPA assay is suitable for rapid detection of ORFV.
Field Detection of Citrus Huanglongbing Associated with ' Candidatus Liberibacter Asiaticus' by Recombinese Polymerase Amplification within 15 min.

PubMed

Qian, Wenjuan; Lu, Ying; Meng, Youqing; Ye, Zunzhong; Wang, Liu; Wang, Rui; Zheng, Qiqi; Wu, Hui; Wu, Jian

2018-06-06

' Candidatus Liberibacter asiaticus' (Las) is the most prevalent bacterium associated with huanglongbing, which is one of the most destructive diseases of citrus. In this paper, an extremely rapid and simple method for field detection of Las from leaf samples, based on recombinase polymerase amplification (RPA), is described. Three RPA primer pairs were designed and evaluated. RPA amplification was optimized so that it could be accomplished within 10 min. In combination with DNA crude extraction by a 50-fold dilution after 1 min of grinding in 0.5 M sodium hydroxide and visual detection via fluorescent DNA dye (positive samples display obvious green fluorescence while negative samples remain colorless), the whole detection process can be accomplished within 15 min. The sensitivity and specificity of this RPA-based method were evaluated and were proven to be equal to those of real-time PCR. The reliability of this method was also verified by analyzing field samples.
Uracil recognition by replicative DNA polymerases is limited to the archaea, not occurring with bacteria and eukarya.

PubMed

Wardle, Josephine; Burgers, Peter M J; Cann, Isaac K O; Darley, Kate; Heslop, Pauline; Johansson, Erik; Lin, Li-Jung; McGlynn, Peter; Sanvoisin, Jonathan; Stith, Carrie M; Connolly, Bernard A

2008-02-01

Family B DNA polymerases from archaea such as Pyrococcus furiosus, which live at temperatures approximately 100 degrees C, specifically recognize uracil in DNA templates and stall replication in response to this base. Here it is demonstrated that interaction with uracil is not restricted to hyperthermophilic archaea and that the polymerase from mesophilic Methanosarcina acetivorans shows identical behaviour. The family B DNA polymerases replicate the genomes of archaea, one of the three fundamental domains of life. This publication further shows that the DNA replicating polymerases from the other two domains, bacteria (polymerase III) and eukaryotes (polymerases delta and epsilon for nuclear DNA and polymerase gamma for mitochondrial) are also unable to recognize uracil. Uracil occurs in DNA as a result of deamination of cytosine, either in G:C base-pairs or, more rapidly, in single stranded regions produced, for example, during replication. The resulting G:U mis-pairs/single stranded uracils are promutagenic and, unless repaired, give rise to G:C to A:T transitions in 50% of the progeny. The confinement of uracil recognition to polymerases of the archaeal domain is discussed in terms of the DNA repair pathways necessary for the elimination of uracil.
Detection of epidermal growth factor receptor mutation in lung cancer by droplet digital polymerase chain reaction

PubMed Central

Xu, Qing; Zhu, Yazhen; Bai, Yali; Wei, Xiumin; Zheng, Xirun; Mao, Mao; Zheng, Guangjuan

2015-01-01

Background Two types of epidermal growth factor receptor (EGFR) mutations in exon 19 and exon 21 (ex19del and L858R) are prevalent in lung cancer patients and sensitive to targeted EGFR inhibition. A resistance mutation in exon 20 (T790M) has been found to accompany drug treatment when patients relapse. These three mutations are valuable companion diagnostic biomarkers for guiding personalized treatment. Quantitative polymerase chain reaction (qPCR)-based methods have been widely used in the clinic by physicians to guide treatment decisions. The aim of this study was to evaluate the technical and clinical sensitivity and specificity of the droplet digital polymerase chain reaction (ddPCR) method in detecting the three EGFR mutations in patients with lung cancer. Methods Genomic DNA from H1975 and PC-9 cells, as well as 92 normal human blood specimens, was used to determine the technical sensitivity and specificity of the ddPCR assays. Genomic DNA of formalin-fixed, paraffin-embedded specimens from 78 Chinese patients with lung adenocarcinoma were assayed using both qPCR and ddPCR. Results The three ddPCR assays had a limit of detection of 0.02% and a wide dynamic range from 1 to 20,000 copies measurement. The L858R and ex19del assays had a 0% background level in the technical and clinical settings. The T790M assay appeared to have a 0.03% technical background. The ddPCR assays were robust for correct determination of EGFR mutation status in patients, and the dynamic range appeared to be better than qPCR methods. The ddPCR assay for T790M could detect patient samples that the qPCR method failed to detect. About 49% of this patient cohort had EGFR mutations (L858R, 15.4%; ex19del, 29.5%; T790M, 6.4%). Two patients with the ex19del mutation also had a naïve T790M mutation. Conclusion These data suggest that the ddPCR method could be useful in the personalized treatment of patients with lung cancer. PMID:26124670
DNA Polymerase in Virions of a Reptilian Type C Virus

PubMed Central

Twardzik, Daniel R.; Papas, Takis S.; Portugal, Frank H.

1974-01-01

A study was made of the DNA polymerase of reptilian type C virus isolated from Russell's viper spleen cells. Simultaneous detection experiments demonstrated the presence of 70S RNA and RNA-dependent DNA polymerase activity in reptilian type C virions. The endogenous activity was dependent on the addition of all four deoxynucleotide triphosphates and demonstrated an absolute requirement for a divalent cation. The reptilian viral DNA polymerase elutes from phosphocellulose at 0.22 M salt. In this respect, it is similar to the avian (avian myeloblastosis virus; AMV) viral enzyme but is different from the mammalian (Rauscher leukemia virus; RLV) viral enzyme which elutes at 0.4 M salt. The molecular weight of the viper DNA polymerase as estimated from glycerol gradient centrifugation is 109,000. It is a smaller enzyme than the AMV DNA polymerase (180,000 daltons) and somewhat larger than the RLV enzyme (70,000 daltons). A comparison of other properties of the type C reptilian DNA polymerase with the enzyme found in other type C oncogenic viruses is made. PMID:4129837
[The detection and sequence analysis of the simian T-lymphotrophic retrovirus (STLV-1 Papio) by using the polymerase chain reaction].

PubMed

D'iachenko, A G; Dzhalagoniia, B E; Kapanadze, B I

1993-01-01

The gene amplification technique was used for detection and sequence analysis of STLV-1 Papio proviral DNA. The polymerase chain reaction was performed with a primer pair at tax region of HTLV-1, 7336-7354, sense strand, and 7516-7494, antisense strand. One microgram of DNAs isolated from LUG-4 cells and autopsies was used in a reaction volume of 50 microliters involving 30 cycles of amplifications. The reaction product was blunt-end cloned into pUC19 cut with Smal. The sequence was done with T7-polymerase using 32P-dATR as a label. Our results indicate that STLV-1 Papio provirus is actually present in the cells of a lymphoid cell line and tumor cells of lymphomatous monkeys. There are some differences between STLV-1 Papio and reported sequences of HTLV-1 and STLV-1.
Detection of hepatitis C virus RNA using ligation-dependent polymerase chain reaction in formalin-fixed, paraffin-embedded liver tissues.

PubMed Central

Park, Y. N.; Abe, K.; Li, H.; Hsuih, T.; Thung, S. N.; Zhang, D. Y.

1996-01-01

Reverse transcription polymerase chain reaction (RT-PCR) has been used to detect hepatitis C virus (HCV) sequences in liver tissue. However, RT-PCR has a variable detection sensitivity, especially on routinely processed formalin-fixed, paraffin-embedded (FFPE) specimens. RNA-RNA and RNA-protein cross-links formed during formalin fixation is the major limiting factor preventing reverse trans criptase from extending the primers. To overcome this problem, we applied the ligation-dependent PCR (LD-PCR) for the detection of HCV RNA in FFPE liver tissue. This method uses two capture probes for RNA isolation and two hemiprobes for the subsequent PCR. Despite cross-links, the capture probes and the hemiprobes are able to form hybrids with HCV RNAs released from the FFPE tissue. The hybrids are isolated through binding of the capture probes to paramagnetic beads. The hemiprobes are then ligated by a T4 DNA ligase to form a full probe that serves as a template for the Taq DNA polymerase. A total of 22 FFPE liver specimens, 21 with hepatocellular carcinoma (HCC) and 1 with biliary cirrhosis secondary to bile duct atresia were selected for this study, of which 13 patients were HCV seropositive and 9 seronegative. HCV RNA was detectable by ID-PCR from all 13 HCV-seropositive HCCs and from 5 of 8 HCV-seronegative HCCs but not from the HCV-seronegative liver with biliary atresia. By contrast, RT-PCR detected HCV sequences in only 5 of the HCV-sero-positive and in 1 of the HCV-seronegative HCCs. To resolve the discordance between the LD-PCR and RT-PCR results, RT-PCR was performed on frozen liver tissue of the discrepant specimens, which confirmed the LD-PCR positive results. In conclusion, LD-PCR is a more sensitive method than RT-PCR for the detection of HCV sequences in routinely processed liver tissues. A high rate of HCV infection (86%) is found in HCC specimens, indicating a previously underestimated role of HCV in HCC pathogenesis. Images Figure 2 PMID:8909238
Serial detection of circulating tumour cells by reverse transcriptase-polymerase chain reaction assays is a marker for poor outcome in patients with malignant melanoma

PubMed Central

Palmieri, Giuseppe; Satriano, Sabrina MR; Budroni, Mario; Cossu, Antonio; Tanda, Francesco; Canzanella, Sergio; Caracò, Corrado; Simeone, Ester; Daponte, Antonio; Mozzillo, Nicola; Comella, Giuseppe; Castello, Giuseppe; Ascierto, Paolo A

2006-01-01

Background Detection of circulating malignant cells (CMCs) through a reverse transcriptase-polymerase chain reaction (RT-PCR) assay seems to be a demonstration of systemic disease. We here evaluated the prognostic role of RT-PCR assays in serially-taken peripheral blood samples from patients with malignant melanoma (MM). Methods One hundred forty-nine melanoma patients with disease stage ranging from I to III were consecutively collected in 1997. A multi-marker RT-PCR assay was used on peripheral blood samples obtained at time of diagnosis and every 6 months during the first two years of follow-up (total: 5 samples). Univariate and multivariate analyses were performed after 83 months of median follow-up. Results Detection of at least one circulating mRNA marker was considered a signal of the presence of CMC (referred to as PCR-positive assay). A significant correlation was found between the rate of recurrences and the increasing number of PCR-positive assays (P = 0.007). Presence of CMC in a high number (≥2) of analysed blood samples was significantly correlated with a poor clinical outcome (disease-free survival: P = 0.019; overall survival: P = 0.034). Multivariate analysis revealed that presence of a PCR-positive status does play a role as independent prognostic factors for overall survival in melanoma patients, adding precision to the predictive power of the disease stage. Conclusion Our findings indicated that serial RT-PCR assay may identify a high risk subset of melanoma patients with occult cancer cells constantly detected in blood circulation. Prolonged presence of CMCs seems to act as a surrogate marker of disease progression or a sign of more aggressive disease. PMID:17107608
Serial detection of circulating tumour cells by reverse transcriptase-polymerase chain reaction assays is a marker for poor outcome in patients with malignant melanoma.

PubMed

Palmieri, Giuseppe; Satriano, Sabrina M R; Budroni, Mario; Cossu, Antonio; Tanda, Francesco; Canzanella, Sergio; Caracò, Corrado; Simeone, Ester; Daponte, Antonio; Mozzillo, Nicola; Comella, Giuseppe; Castello, Giuseppe; Ascierto, Paolo A

2006-11-15

Detection of circulating malignant cells (CMCs) through a reverse transcriptase-polymerase chain reaction (RT-PCR) assay seems to be a demonstration of systemic disease. We here evaluated the prognostic role of RT-PCR assays in serially-taken peripheral blood samples from patients with malignant melanoma (MM). One hundred forty-nine melanoma patients with disease stage ranging from I to III were consecutively collected in 1997. A multi-marker RT-PCR assay was used on peripheral blood samples obtained at time of diagnosis and every 6 months during the first two years of follow-up (total: 5 samples). Univariate and multivariate analyses were performed after 83 months of median follow-up. Detection of at least one circulating mRNA marker was considered a signal of the presence of CMC (referred to as PCR-positive assay). A significant correlation was found between the rate of recurrences and the increasing number of PCR-positive assays (P = 0.007). Presence of CMC in a high number (> or =2) of analysed blood samples was significantly correlated with a poor clinical outcome (disease-free survival: P = 0.019; overall survival: P = 0.034). Multivariate analysis revealed that presence of a PCR-positive status does play a role as independent prognostic factors for overall survival in melanoma patients, adding precision to the predictive power of the disease stage. Our findings indicated that serial RT-PCR assay may identify a high risk subset of melanoma patients with occult cancer cells constantly detected in blood circulation. Prolonged presence of CMCs seems to act as a surrogate marker of disease progression or a sign of more aggressive disease.

A new family of polymerases related to superfamily A DNA polymerases and T7-like DNA-dependent RNA polymerases.

PubMed

Iyer, Lakshminarayan M; Abhiman, Saraswathi; Aravind, L

2008-10-04

Using sequence profile methods and structural comparisons we characterize a previously unknown family of nucleic acid polymerases in a group of mobile elements from genomes of diverse bacteria, an algal plastid and certain DNA viruses, including the recently reported Sputnik virus. Using contextual information from domain architectures and gene-neighborhoods we present evidence that they are likely to possess both primase and DNA polymerase activity, comparable to the previously reported prim-pol proteins. These newly identified polymerases help in defining the minimal functional core of superfamily A DNA polymerases and related RNA polymerases. Thus, they provide a framework to understand the emergence of both DNA and RNA polymerization activity in this class of enzymes. They also provide evidence that enigmatic DNA viruses, such as Sputnik, might have emerged from mobile elements coding these polymerases.
Quantitative polymerase chain reaction (PCR) for detection of aquatic animal pathogens in a diagnostic laboratory setting

USGS Publications Warehouse

Purcell, Maureen K.; Getchell, Rodman G.; McClure, Carol A.; Weber, S.E.; Garver, Kyle A.

2011-01-01

Real-time, or quantitative, polymerase chain reaction (qPCR) is quickly supplanting other molecular methods for detecting the nucleic acids of human and other animal pathogens owing to the speed and robustness of the technology. As the aquatic animal health community moves toward implementing national diagnostic testing schemes, it will need to evaluate how qPCR technology should be employed. This review outlines the basic principles of qPCR technology, considerations for assay development, standards and controls, assay performance, diagnostic validation, implementation in the diagnostic laboratory, and quality assurance and control measures. These factors are fundamental for ensuring the validity of qPCR assay results obtained in the diagnostic laboratory setting.
Quencher-free fluorescence strategy for detection of DNA methyltransferase activity based on exonuclease III-assisted signal amplification.

PubMed

Liu, Haisheng; Ma, Changbei; Zhou, Meijuan; Chen, Hanchun; He, Hailun; Wang, Kemin

2016-11-01

This work demonstrates a novel method for DNA methyltransferase (MTase) activity detection with a quencher-free molecular beacon (MB) probe based on exonuclease (Exo) III-assisted signal amplification. In the presence of Dam MTase and DpnI endonuclease, the elaborately designed hairpin substrate (MB1) was cleaved into two parts (part A and part B). Exo III can then digest part A and release a single-stranded target of the 2-aminopurine-labeled MB (MB2). Subsequently, the MB2 can hybridize with its target to form a double-stranded structure with a protruding 3'-terminus and then trigger the digestion of MB2 by Exo III. During the digestion of MB2, the 2-aminopurine is separated from the DNA strands and released free in solution, inducing an increase of the fluorescent signal. Owing to the presence of a recessed 3'-terminus in the formed double-stranded DNA, Exo III-assisted recyclable cleavage of MB2 was achieved. Therefore, an amplified fluorescence signal was observed. Under the optimized conditions, Dam MTase can be detected in the range of 0.2-40 units/mL with a limit of detection of 0.2 units/mL and good selectivity. Furthermore, the present assay can be used for screening potential DNA MTase inhibitors. Graphical Abstract A quencher-free fluorescence assay for sensitive detection of DNA methyltransferase activity based on exonuclease III-assisted signal amplification is reported.
Detection of Alternaria fungal contamination in cereal grains by a polymerase chain reaction-based assay.

PubMed

Zur, Gideon; Shimoni, Eyal; Hallerman, Eric; Kashi, Yechezkel

2002-09-01

Alternaria sp. are important fungal contaminants of grain products; they secrete four structural classes of compounds that are toxic or carcinogenic to plants and animals and cause considerable economic losses to growers and the food-processing industry. Alternaria toxins have been detected by high-performance liquid chromatography (HPLC), enzyme-linked immunosorbent assay, and other techniques. Here, we report the development of a polymerase chain reaction (PCR)-based method for the detection of Alternaria DNA. PCR primers were designed to anneal to the ITS1 and ITS2 regions of the 5.8S rDNA gene of Alternaria alternata or Alternaria solani but not to other microbial or plant DNA. We compared the sensitivity of PCR in detecting Alternaria DNA, that of the HPLC method in detecting Alternaria alternariol and alternariol methyl ether toxins, and that of the morphological examination of mycelia and conidia in experimentally infested corn samples. The sensitivity of toxin detection for HPLC was above the level of contamination in a set of commercially obtained grain samples, resulting in negative scores for all samples, while the PCR-based method and mold growth plating followed by morphological identification of Alternaria gave parallel, positive results for 8 of 10 samples. The PCR assay required just 8 h, enabling the rapid and simultaneous testing of many samples at a low cost. PCR-based evidence for the presence of Alternaria DNA followed by positive assay results for Alternaria toxins would support the rejection of a shipment of grain.
Immunohistochemistry and Polymerase Chain Reaction for Detection Human Papilloma Virus in Warts: A Comparative Study

PubMed Central

Lee, Hong Sun; Lee, Ji Hyun; Choo, Ji Yoon; Byun, Hee Jin; Jun, Jin Hyun

2016-01-01

Background Immunohistochemistry and polymerase chain reaction (PCR) are the most widely used methods for the detection of viruses. PCR is known to be a more sensitive and specific method than the immunohistochemical method at this time, but PCR has the disadvantages of high cost and skilled work to use widely. With the progress of technology, the immunohistochemical methods used in these days has come to be highly sensitive and actively used in the diagnostic fields. Objective To evaluate and compare the usefulness of immunohistochemistry and PCR for detection human papilloma virus (HPV) in wart lesions. Methods Nine biopsy samples of verruca vulgaris and 10 of condyloma accuminatum were examined. Immunohistochemical staining using monoclonal antibody to HPV L1 capsid protein and PCR were done for the samples. DNA sequencing of the PCR products and HPV genotyping were also done. Results HPV detection rate was 78.9% (88.9% in verruca vulgaris, 70.0% in condyloma accuminatum) on immunohistochemistry and 100.0% for PCR. HPV-6 genotype showed a lower positivity rate on immunohistochemistry (50.0%) as compared to that of the other HPV genotypes. Conclusion Immunohistochemistry for HPV L1 capsid protein showed comparable sensitivity for detection HPV. Considering the high cost and great effort needed for the PCR methods, we can use immunohistochemistry for HPV L1 capsid protein with the advantage of lower cost and simple methods for HPV detection. PMID:27489431
A novel magneto-DNA duplex probe for bacterial DNA detection based on exonuclease III-aided cycling amplification.

PubMed

Zeng, Yan; Wan, Yi; Zhang, Dun; Qi, Peng

2015-01-01

A novel magneto-DNA duplex probe for bacterial DNA detection based on exonuclease III (Exo-III) aided cycling amplification has been developed. This magneto-DNA duplex probe contains a partly hybrid fluorophore-modified capture probe and a fluorophore-modified signal probe with magnetic microparticle as carrier. In the presence of a perfectly matched target bacterial DNA, blunt 3'-terminus of the capture probe is formed, activating the Exo-III aided cycling amplification. Thus, Exo-III catalyzes the stepwise removal of mononucleotides from this terminus, releasing both fluorophore-modified signal probe, fluorescent dyes of the capture probe and target DNA. The released target DNA then starts a new cycle, while released fluorescent fragments are recovered with magnetic separation for fluorescence signal collection. This system exhibited sensitive detection of bacterial DNA, with a detection limit of 14 pM because of the unique cleavage function of Exo-III, high fluorescence intensity, and separating function of magneto-DNA duplex probes. Besides this sensitivity, this strategy exhibited excellent selectivity with mismatched bacterial DNA targets and other bacterial species targets and good applicability in real seawater samples, hence, this strategy could be potentially used for qualitative and quantitative analysis of bacteria. Copyright © 2014 Elsevier B.V. All rights reserved.
Engineering of a DNA Polymerase for Direct m6 A Sequencing.

PubMed

Aschenbrenner, Joos; Werner, Stephan; Marchand, Virginie; Adam, Martina; Motorin, Yuri; Helm, Mark; Marx, Andreas

2018-01-08

Methods for the detection of RNA modifications are of fundamental importance for advancing epitranscriptomics. N 6 -methyladenosine (m 6 A) is the most abundant RNA modification in mammalian mRNA and is involved in the regulation of gene expression. Current detection techniques are laborious and rely on antibody-based enrichment of m 6 A-containing RNA prior to sequencing, since m 6 A modifications are generally "erased" during reverse transcription (RT). To overcome the drawbacks associated with indirect detection, we aimed to generate novel DNA polymerase variants for direct m 6 A sequencing. Therefore, we developed a screen to evolve an RT-active KlenTaq DNA polymerase variant that sets a mark for N 6 -methylation. We identified a mutant that exhibits increased misincorporation opposite m 6 A compared to unmodified A. Application of the generated DNA polymerase in next-generation sequencing allowed the identification of m 6 A sites directly from the sequencing data of untreated RNA samples. © 2017 The Authors. Published by Wiley-VCH Verlag GmbH & Co. KGaA.
The Roles of RNA Polymerase I and III Subunits Polr1c and Polr1d in Craniofacial Development and in Zebrafish Models of Treacher Collins Syndrome

PubMed Central

Achilleos, Annita; Neben, Cynthia L.; Merrill, Amy E.; Trainor, Paul A.

2016-01-01

Ribosome biogenesis is a global process required for growth and proliferation of all cells, yet perturbation of ribosome biogenesis during human development often leads to tissue-specific defects termed ribosomopathies. Transcription of the ribosomal RNAs (rRNAs) by RNA polymerases (Pol) I and III, is considered a rate limiting step of ribosome biogenesis and mutations in the genes coding for RNA Pol I and III subunits, POLR1C and POLR1D cause Treacher Collins syndrome, a rare congenital craniofacial disorder. Our understanding of the functions of individual RNA polymerase subunits, however, remains poor. We discovered that polr1c and polr1d are dynamically expressed during zebrafish embryonic development, particularly in craniofacial tissues. Consistent with this pattern of activity, polr1c and polr1d homozygous mutant zebrafish exhibit cartilage hypoplasia and cranioskeletal anomalies characteristic of humans with Treacher Collins syndrome. Mechanistically, we discovered that polr1c and polr1d loss-of-function results in deficient ribosome biogenesis, Tp53-dependent neuroepithelial cell death and a deficiency of migrating neural crest cells, which are the primary progenitors of the craniofacial skeleton. More importantly, we show that genetic inhibition of tp53 can suppress neuroepithelial cell death and ameliorate the skeletal anomalies in polr1c and polr1d mutants, providing a potential avenue to prevent the pathogenesis of Treacher Collins syndrome. Our work therefore has uncovered tissue-specific roles for polr1c and polr1d in rRNA transcription, ribosome biogenesis, and neural crest and craniofacial development during embryogenesis. Furthermore, we have established polr1c and polr1d mutant zebrafish as models of Treacher Collins syndrome together with a unifying mechanism underlying its pathogenesis and possible prevention. PMID:27448281
[The validation of kit of reagents for quantitative detection of DNA of human cytomegalovirus in biological material using polymerase chain reaction technique in real time operation mode].

PubMed

Sil'veĭstrova, O Iu; Domonova, É A; Shipulina, O Iu

2014-04-01

The validation of kit of reagents destined to detection and quantitative evaluation of DNA of human cytomegalovirus in biological material using polymerase chain reaction technique in real time operation mode was implemented. The comparison was made against international WHO standard--The first WHO international standard for human cytomegalovirus to implement measures the kit of reagents "AmpliSens CMV-screen/monitor-FL" and standard sample of enterprise DNA HCMV (The central research institute of epidemiology of Rospotrebnadzor) was applied. The fivefold dilution of international WHO standard and standard sample of enterprise were carried out in concentrations of DNA HCMV from 106 to 102. The arrangement of polymerase chain reaction and analysis of results were implemented using programed amplifier with system of detection of fluorescent signal in real-time mode "Rotor-Gene Q" ("Qiagen", Germany). In the total of three series of experiments, all stages of polymerase chain reaction study included, the coefficient of translation of quantitative evaluation of DNA HCMV from copy/ml to ME/ml equal to 0.6 was introduced for this kit of reagents.
The detection of melanoma cells in peripheral blood by reverse transcription-polymerase chain reaction.

PubMed Central

Foss, A. J.; Guille, M. J.; Occleston, N. L.; Hykin, P. G.; Hungerford, J. L.; Lightman, S.

1995-01-01

Both cutaneous and uveal melanoma undergo haematogenous dissemination. Detection of tyrosinase mRNA by reverse transcription-polymerase chain reaction (RT-PCR) has been described as an extremely sensitive way of detecting circulating viable melanoma cells in the peripheral venous blood, and this technique may be of value in the early detection of dissemination. Also, it has been suggested that surgical manipulation of the eye, such as occurs during enucleation, can provoke uveal melanoma dissemination. The purpose of this study was to evaluate whether tyrosinase mRNA is detectable in the peripheral blood of patients with uveal and cutaneous melanoma and in patients with uveal melanoma undergoing surgical procedures on the eye harbouring the tumour. Venous blood samples from 36 patients diagnosed as having active uveal melanoma and from six patients with advanced metastatic cutaneous melanoma were analysed. In addition, blood samples were spiked with known numbers of cells from three cell lines and four primary uveal melanoma cultures. The reported sensitivity of the technique was confirmed, with an ability to detect down to one cell per ml of blood. All 51 blood samples from the 36 patients with uveal melanoma were negative, and this included 20 perioperative blood samples. The test was also negative for the six patients with advanced cutaneous melanoma. There were two positives among 31 control samples analysed. This study demonstrates that there are far fewer circulating viable melanocytes than has been previously supposed in patients with melanoma and that the RT-PCR is of no clinical value in detecting metastatic melanoma disease. There was no evidence for surgery causing a bolus of melanoma cells to enter the peripheral circulation. Images Figure 1 Figure 2 PMID:7599046
Development of a Panel of Recombinase Polymerase Amplification Assays for Detection of Biothreat Agents

PubMed Central

Euler, Milena; Wang, Yongjie; Heidenreich, Doris; Patel, Pranav; Strohmeier, Oliver; Hakenberg, Sydney; Niedrig, Matthias; Hufert, Frank T.

2013-01-01

Syndromic panels for infectious disease have been suggested to be of value in point-of-care diagnostics for developing countries and for biodefense. To test the performance of isothermal recombinase polymerase amplification (RPA) assays, we developed a panel of 10 RPAs for biothreat agents. The panel included RPAs for Francisella tularensis, Yersinia pestis, Bacillus anthracis, variola virus, and reverse transcriptase RPA (RT-RPA) assays for Rift Valley fever virus, Ebola virus, Sudan virus, and Marburg virus. Their analytical sensitivities ranged from 16 to 21 molecules detected (probit analysis) for the majority of RPA and RT-RPA assays. A magnetic bead-based total nucleic acid extraction method was combined with the RPAs and tested using inactivated whole organisms spiked into plasma. The RPA showed comparable sensitivities to real-time RCR assays in these extracts. The run times of the assays at 42°C ranged from 6 to 10 min, and they showed no cross-detection of any of the target genomes of the panel nor of the human genome. The RPAs therefore seem suitable for the implementation of syndromic panels onto microfluidic platforms. PMID:23345286
Diagnostic application of polymerase chain reaction for detection of Ehrlichia risticii in equine monocytic ehrlichiosis (Potomac horse fever).

PubMed

Biswas, B; Mukherjee, D; Mattingly-Napier, B L; Dutta, S K

1991-10-01

Genomic amplification by the polymerase chain reaction (PCR) was used to identify a unique genomic sequence of Ehrlichia risticii directly in DNA isolated from peripheral-blood buffy coat cells of E. risticii-infected horses (Potomac horse fever) and from infected cell cultures. A specific primer pair, selected from a cloned, species-specific, 1-kb DNA fragment of the E. risticii genome as a template, was used for the amplification of the target DNA of 247 bp. The optimal number of 40 PCR cycles, determined by analyzing an amplification profile obtained with a constant Taq polymerase concentration, was used to achieve maximum amplification of the E. risticii DNA segment. Efficient amplification of target DNA was achieved with specimens processed by either the phenol extraction or rapid lysis method. The specificity of the amplified DNA product was confirmed by the proper size (247 bp) and appropriate restriction enzyme cleavage pattern of the amplified target DNA, as well as by the specific hybridization signal obtained by using a PCR-amplified 185-bp internal DNA probe. A 10(5)- to 10(6)-fold amplification of target DNA, which allowed detection of E. risticii from as few as two to three infected cells in culture and from a very small volume of buffy coat cells from infected horses, was achieved. This PCR amplification procedure was found to be highly specific and sensitive for the detection of E. risticii for the study of Potomac horse fever.
Peptostreptococcus micros in primary endodontic infections as detected by 16S rDNA-based polymerase chain reaction.

PubMed

Siqueira, José F; Rôças, Isabela N; Andrade, Arnaldo F B; de Uzeda, Milton

2003-02-01

A 16S rDNA-based polymerase chain reaction (PCR) method was used to detect Peptostreptococcus micros in primary root canal infections. Samples were collected from 50 teeth having carious lesions, necrotic pulps, and different forms of periradicular diseases. DNA extracted from the samples was amplified using the PCR assay, which yielded a specific fragment of P. micros 16S rDNA. P. micros was detected in 6 of 22 root canals associated with asymptomatic chronic periradicular lesions (27.3%), 2 of 8 teeth with acute apical periodontitis (25%), and 6 of 20 cases of acute periradicular abscess (30%). In general, P. micros was found in 14 of 50 cases (28%). There was no correlation between the presence of P. micros and the occurrence of symptoms. Findings suggested that P. micros can be involved in the pathogenesis of different forms of periradicular lesions.
DNA-based identification of spices: DNA isolation, whole genome amplification, and polymerase chain reaction.

PubMed

Focke, Felix; Haase, Ilka; Fischer, Markus

2011-01-26

Usually spices are identified morphologically using simple methods like magnifying glasses or microscopic instruments. On the other hand, molecular biological methods like the polymerase chain reaction (PCR) enable an accurate and specific detection also in complex matrices. Generally, the origins of spices are plants with diverse genetic backgrounds and relationships. The processing methods used for the production of spices are complex and individual. Consequently, the development of a reliable DNA-based method for spice analysis is a challenging intention. However, once established, this method will be easily adapted to less difficult food matrices. In the current study, several alternative methods for the isolation of DNA from spices have been developed and evaluated in detail with regard to (i) its purity (photometric), (ii) yield (fluorimetric methods), and (iii) its amplifiability (PCR). Whole genome amplification methods were used to preamplify isolates to improve the ratio between amplifiable DNA and inhibiting substances. Specific primer sets were designed, and the PCR conditions were optimized to detect 18 spices selectively. Assays of self-made spice mixtures were performed to proof the applicability of the developed methods.
A new family of polymerases related to superfamily A DNA polymerases and T7-like DNA-dependent RNA polymerases

PubMed Central

Iyer, Lakshminarayan M; Abhiman, Saraswathi; Aravind, L

2008-01-01

Using sequence profile methods and structural comparisons we characterize a previously unknown family of nucleic acid polymerases in a group of mobile elements from genomes of diverse bacteria, an algal plastid and certain DNA viruses, including the recently reported Sputnik virus. Using contextual information from domain architectures and gene-neighborhoods we present evidence that they are likely to possess both primase and DNA polymerase activity, comparable to the previously reported prim-pol proteins. These newly identified polymerases help in defining the minimal functional core of superfamily A DNA polymerases and related RNA polymerases. Thus, they provide a framework to understand the emergence of both DNA and RNA polymerization activity in this class of enzymes. They also provide evidence that enigmatic DNA viruses, such as Sputnik, might have emerged from mobile elements coding these polymerases. This article was reviewed by Eugene Koonin and Mark Ragan. PMID:18834537
Analysis of the Mutations in the Active Site of the RNA-Dependent RNA Polymerase of Human Parainfluenza Virus Type 3 (HPIV3)

PubMed Central

Malur, Achut G.; Gupta, Neera K.; De, Bishnu P.; Banerjee, Amiya K.

2002-01-01

The large protein (L) of the human parainfluenza virus type 3 (HPIV3) is the functional RNA-dependent RNA polymerase, which possesses highly conserved residues QGDNQ located within motif C of domain III comprising the putative polymerase active site. We have characterized the role of the QGDNQ residues as well as the residues flanking this region in the polymerase activity of the L protein by site-directed mutagenesis and examining the polymerase activity of the wild-type and mutant L proteins by an in vivo minigenome replication assay and an in vitro mRNA transcription assay. All mutations in the QGDNQ residues abolished transcription while mutations in the flanking residues gave rise to variable polymerase activities. These observations support the contention that the QGDNQ sequence is absolutely required for the polymerase activity of the HPIV3 RNA-dependent RNA polymerase. PMID:12064576
Detection of Babesia bovis carrier cattle by using polymerase chain reaction amplification of parasite DNA.

PubMed Central

Fahrimal, Y; Goff, W L; Jasmer, D P

1992-01-01

Carrier cattle infected with Babesia bovis are difficult to detect because of the low numbers of parasites that occur in peripheral blood. However, diagnosis of low-level infections with the parasite is important for evaluating the efficacies of vaccines and in transmission and epidemiological studies. We used the polymerase chain reaction (PCR) to amplify a portion of the apocytochrome b gene from the parasite and tested the ability of this method to detect carrier cattle. The target sequence is associated with a 7.4-kb DNA element in undigested B. bovis genomic DNA (as shown previously), and the amplified product was detected by Southern and dot blot hybridization. The assay was specific for B. bovis, since no amplification was detected with Babesia bigemina, Trypanosoma brucei, Anaplasma marginale, or leukocyte DNA. The target sequence was amplified in DNA from B. bovis Mexico, Texas, and Australia S and L strains, demonstrating the applicability of the method to strains from different geographic regions. The sensitivity of the method ranged from 1 to 10 infected erythrocytes extracted from 0.5 ml of blood. This sensitivity was about 1,000 times greater than that from the use of unamplified parasite DNA. By the PCR method, six B. bovis carrier cattle were detected 86% of the time (range, 66 to 100%) when they were tested 11 times, while with microscopic examination of thick blood smears, the same carrier cattle were detected only 36% of the time (range, 17 to 66%). The method provides a useful diagnostic tool for detecting B. bovis carrier cattle, and the sensitivity is significantly improved over that of current methods. The results also suggest that characteristics of the apocytchrome b gene may make this a valuable target DNA for PCR-based detection of other hemoparasites. Images PMID:1624551
Detection of egg drop syndrome 1976 virus by polymerase chain reaction and study of its persistence in experimentally infected layer birds.

PubMed

Kumar, N S; Kataria, J M; Koti, M; Dhama, K; Toroghi, R

2003-01-01

Polymerase chain reaction (PCR) assay was developed for the detection of Egg drop syndrome 1976 (EDS-76) virus in tissues, namely in the uterus, spleen and buffy coat. It was also used to study the persistence of the virus in tissues of experimentally infected layer birds. The PCR assay could detect as little as 10 fg of purified EDS-76 viral DNA. It also amplified the DNA of Fowl adenovirus serotypes 4 (FAV-4) and 8 (FAV-8). The virus persisted in the uterus up to day 21 post infection (p.i.). Detection of EDS-76 viral DNA in the buffy coat could be useful for studying the occurrence of the respective disease in layer bird flocks.
Reverse Transcription Recombinase Polymerase Amplification Assay for the Detection of Middle East Respiratory Syndrome Coronavirus

PubMed Central

Abd El Wahed, Ahmed; Patel, Pranav; Heidenreich, Doris; Hufert, Frank T.; Weidmann, Manfred

2013-01-01

The emergence of Middle East Respiratory Syndrome Coronavirus (MERS-CoV) in the eastern Mediterranean and imported cases to Europe has alerted public health authorities. Currently, detection of MERS-CoV in patient samples is done by real-time RT-PCR. Samples collected from suspected cases are sent to highly-equipped centralized laboratories for screening. A rapid point-of-care test is needed to allow more widespread mobile detection of the virus directly from patient material. In this study, we describe the development of a reverse transcription isothermal Recombinase Polymerase Amplification (RT-RPA) assay for the identification of MERS-CoV. A partial nucleocapsid gene RNA molecular standard of MERS-coronavirus was used to determine the assay sensitivity. The isothermal (42°C) MERS-CoV RT-RPA was as sensitive as real-time RT-PCR (10 RNA molecules), rapid (3-7 minutes) and mobile (using tubescanner weighing 1kg). The MERS-CoV RT-RPA showed cross-detection neither of any of the RNAs of several coronaviruses and respiratory viruses affecting humans nor of the human genome. The developed isothermal real-time RT-RPA is ideal for rapid mobile molecular MERS-CoV monitoring in acute patients and may also facilitate the search for the animal reservoir of MERS-CoV. PMID:24459611
Sensitive and rapid detection of Chlamydia trachomatis by recombinase polymerase amplification directly from urine samples.

PubMed

Krõlov, Katrin; Frolova, Jekaterina; Tudoran, Oana; Suhorutsenko, Julia; Lehto, Taavi; Sibul, Hiljar; Mäger, Imre; Laanpere, Made; Tulp, Indrek; Langel, Ülo

2014-01-01

Chlamydia trachomatis is the most common sexually transmitted human pathogen. Infection results in minimal to no symptoms in approximately two-thirds of women and therefore often goes undiagnosed. C. trachomatis infections are a major public health concern because of the potential severe long-term consequences, including an increased risk of ectopic pregnancy, chronic pelvic pain, and infertility. To date, several point-of-care tests have been developed for C. trachomatis diagnostics. Although many of them are fast and specific, they lack the required sensitivity for large-scale application. We describe a rapid and sensitive form of detection directly from urine samples. The assay uses recombinase polymerase amplification and has a minimum detection limit of 5 to 12 pathogens per test. Furthermore, it enables detection within 20 minutes directly from urine samples without DNA purification before the amplification reaction. Initial analysis of the assay from clinical patient samples had a specificity of 100% (95% CI, 92%-100%) and a sensitivity of 83% (95% CI, 51%-97%). The whole procedure is fairly simple and does not require specific machinery, making it potentially applicable in point-of-care settings. Copyright © 2014 American Society for Investigative Pathology and the Association for Molecular Pathology. Published by Elsevier Inc. All rights reserved.

Rapid detection of infectious bovine Rhinotracheitis virus using recombinase polymerase amplification assays.

PubMed

Hou, Peili; Wang, Hongmei; Zhao, Guimin; He, Chengqiang; He, Hongbin

2017-12-13

Infectious bovine rhinotracheitis virus (IBRV) is a major pathogen in cattle and has led to significant economic losses to the dairy industry worldwide, and therefore a more optimal method for the rapid diagnosis of IBRV infection is highly needed. In this study, we described the development of a lateral flow dipstrip (LFD) of isothermal recombinase polymerase amplification (RPA) method for rapid detection of IBRV. Distinct regions were selected as a candidate target for designing the LFD-RPA primers and probes. The analytical sensitivity of the RPA assay was determined using ten-fold serially diluted IBRV DNA. The specificity of the assay was assessed with other viral pathogens of cattle with similar clinic and other herpesviruses. The clinical performance was evaluated by testing 106 acute-phase high fever clinical specimens. RPA primers and probe were designed to target the specific conserved UL52 region fragment of IBRV. The detection could be completed at a constant temperature of 38 °C for 25 min, and the amplification products were easily visualized on a simple LFD. The detection limit of this assay was 5 copies per reaction of IBRV DNA and there was no cross-reactivity with other viruses causing bovine gastrointestinal and respiratory infections or other herpesviruses. The assay performance on acute-phase high fever clinical samples collected from cattle with no vaccine against IBRV, which were suspected to be infected with IBRV, was validated by detecting 24 fecal, 36 blood, 38 nasal swab and 8 tissue specimens, and compared with SYBR Green I based real-time PCR. The coincidence between IBRV LFD-RPA and real-time PCR was 100%. IBRV LFD-RPA was fast and much easier to serve as an alternative to the common measures used for IBRV diagnosis, as there is reduction in the use of instruments for identification of the infected animals. In addition, this assay may be the potential candidate to be used as point-of-care diagnostics in the field.
Detection and differentiation of wild-type and vaccine strains of canine distemper virus by a duplex reverse transcription polymerase chain reaction

PubMed Central

Dong, X. Y.; Li, W. H.; Zhu, J. L.; Liu, W. J.; Zhao, M. Q.; Luo, Y. W.; Chen, J. D.

2015-01-01

Canine distemper virus (CDV) is the cause of canine distemper (CD) which is a severe and highly contagious disease in dogs. In the present study, a duplex reverse transcription polymerase chain reaction (RT-PCR) method was developed for the detection and differentiation of wild-type and vaccine strains of CDV. Four primers were designed to detect and discriminate the two viruses by generating 638- and 781-bp cDNA products, respectively. Furthermore, the duplex RT-PCR method was used to detect 67 field samples suspected of CD from Guangdong province in China. Results showed that, 33 samples were to be wild-type-like. The duplex RT-PCR method exhibited high specificity and sensitivity which could be used to effectively detect and differentiate wild-type and vaccine CDV, indicating its use for clinical detection and epidemiological surveillance. PMID:27175171
[DNA-dependent DNA polymerase induced by herpes virus papio (HVP) in producing cells].

PubMed

D'iachenko, A G; Beriia, L Ia; Matsenko, L D; Kakubava, V V; Kokosh, L V

1980-11-01

A new DNA polymerase was found in the cells of suspension lymphoblastoid cultures, which produce lymphotropic baboon herpes virus (HVP). The enzyme was isolated in a partially purified form. In some properties the enzyme differs from other cellular DNA polymerases. The HVP-induced DNA polymerase has the molecular weight of 1,6 x 10(5) and sedimentation coefficient of about 8S. The enzyme is resistant to high salt concentrations and N-ethylmaleimide, but shows a pronounced sensitivity to phosphonoacetate. The enzyme effectively copies "activated" DNA and synthetic deoxyribohomopolymers. The attempts to detect the DNA polymerase activity in HVP virions were unsuccessful.
A polymerase chain reaction assay for detection of virulent and attenuated strains of duck plague virus.

PubMed

Xie, Liji; Xie, Zhixun; Huang, Li; Wang, Sheng; Huang, Jiaoling; Zhang, Yanfang; Zeng, Tingting; Luo, Sisi

2017-11-01

Sequence analysis of duck plague virus (DPV) revealed that there was a 528bp (B fragment) deletion within the UL2 gene of DPV attenuated vaccine strain in comparison with field virulent strains. The finding of gene deletion provides a potential differentiation test between DPV virulent strain and attenuated strain based on their UL2 gene sizes. Thus we developed a polymerase chain reaction (PCR) assay targeting to the DPV UL2 gene for simultaneous detection of DPV virulent strain and attenuated strain, 827bp for virulent strain and 299bp for attenuated strain. This newly developed PCR for DPV was highly sensitive and specific. It detected as low as 100fg of DNA on both DPV virulent and attenuated strains, no same size bands were amplified from other duck viruses including duck paramyxovirus, duck tembusu virus, duck circovirus, Muscovy duck parvovirus, duck hepatitis virus type I, avian influenza virus and gosling plague virus. Therefore, this PCR assay can be used for the rapid, sensitive and specific detection of DPV virulent and attenuated strains affecting ducks. Copyright © 2017. Published by Elsevier B.V.
Rapid detection of highly pathogenic porcine reproductive and respiratory syndrome virus by a fluorescent probe-based isothermal recombinase polymerase amplification assay.

PubMed

Yang, Yang; Qin, Xiaodong; Sun, Yingjun; Chen, Ting; Zhang, Zhidong

2016-12-01

A novel fluorescent probe-based real-time reverse transcription recombinase polymerase amplification (real-time RT-RPA) assay was developed for rapid detection of highly pathogenic type 2 porcine reproductive and respiratory syndrome virus (HP-PRRSV). The sensitivity analysis showed that the detection limit of RPA was 70 copies of HP-PRRSV RNA/reaction. The real-time RT-RPA highly specific amplified HP-PRRSV with no cross-reaction with classic PRRSV, classic swine fever virus, pseudorabies virus, and foot-and-mouth disease virus. Assessment with 125 clinical samples showed that the developed real-time RT-RPA assay was well correlated with real-time RT-qPCR assays for detection of HP-PRRSV. These results suggest that the developed real-time RT-RPA assay is suitable for rapid detection of HP-PRRSV.
Real-Time Polymerase Chain Reaction Detection of Angiostrongylus cantonensis DNA in Cerebrospinal Fluid from Patients with Eosinophilic Meningitis.

PubMed

Qvarnstrom, Yvonne; Xayavong, Maniphet; da Silva, Ana Cristina Aramburu; Park, Sarah Y; Whelen, A Christian; Calimlim, Precilia S; Sciulli, Rebecca H; Honda, Stacey A A; Higa, Karen; Kitsutani, Paul; Chea, Nora; Heng, Seng; Johnson, Stuart; Graeff-Teixeira, Carlos; Fox, LeAnne M; da Silva, Alexandre J

2016-01-01

Angiostrongylus cantonensis is the most common infectious cause of eosinophilic meningitis. Timely diagnosis of these infections is difficult, partly because reliable laboratory diagnostic methods are unavailable. The aim of this study was to evaluate the usefulness of a real-time polymerase chain reaction (PCR) assay for the detection of A. cantonensis DNA in human cerebrospinal fluid (CSF) specimens. A total of 49 CSF specimens from 33 patients with eosinophilic meningitis were included: A. cantonensis DNA was detected in 32 CSF specimens, from 22 patients. Four patients had intermittently positive and negative real-time PCR results on subsequent samples, indicating that the level of A. cantonensis DNA present in CSF may fluctuate during the course of the illness. Immunodiagnosis and/or supplemental PCR testing supported the real-time PCR findings for 30 patients. On the basis of these observations, this real-time PCR assay can be useful to detect A. cantonensis in the CSF from patients with eosinophilic meningitis. © The American Society of Tropical Medicine and Hygiene.
Real-Time Polymerase Chain Reaction Detection of Angiostrongylus cantonensis DNA in Cerebrospinal Fluid from Patients with Eosinophilic Meningitis

PubMed Central

Qvarnstrom, Yvonne; Xayavong, Maniphet; da Silva, Ana Cristina Aramburu; Park, Sarah Y.; Whelen, A. Christian; Calimlim, Precilia S.; Sciulli, Rebecca H.; Honda, Stacey A. A.; Higa, Karen; Kitsutani, Paul; Chea, Nora; Heng, Seng; Johnson, Stuart; Graeff-Teixeira, Carlos; Fox, LeAnne M.; da Silva, Alexandre J.

2016-01-01

Angiostrongylus cantonensis is the most common infectious cause of eosinophilic meningitis. Timely diagnosis of these infections is difficult, partly because reliable laboratory diagnostic methods are unavailable. The aim of this study was to evaluate the usefulness of a real-time polymerase chain reaction (PCR) assay for the detection of A. cantonensis DNA in human cerebrospinal fluid (CSF) specimens. A total of 49 CSF specimens from 33 patients with eosinophilic meningitis were included: A. cantonensis DNA was detected in 32 CSF specimens, from 22 patients. Four patients had intermittently positive and negative real-time PCR results on subsequent samples, indicating that the level of A. cantonensis DNA present in CSF may fluctuate during the course of the illness. Immunodiagnosis and/or supplemental PCR testing supported the real-time PCR findings for 30 patients. On the basis of these observations, this real-time PCR assay can be useful to detect A. cantonensis in the CSF from patients with eosinophilic meningitis. PMID:26526920
relA-dependent RNA polymerase activity in Escherichia coli.

PubMed Central

Ryals, J; Bremer, H

1982-01-01

Parameters relating to RNA synthesis were measured after a temperature shift from 30 to 42 degrees C, in a relA+ and relA- isogenic pair of Escherichia coli strains containing a temperature-sensitive valyl tRNA synthetase. The following results were obtained: (i) the rRNA chain growth rate increased 2-fold in both strains; (ii) newly synthesized rRNA became unstable in both strains; (iii) the stable RNA gene activity (rRNA and tRNA, measured as stable RNA synthesis rate relative to the total instantaneous rate of RNA synthesis) decreased 1.7-fold in the relA+ strain and increased 1.9-fold in the relA mutant; and (iv) the RNA polymerase activity (measured by the percentage of total RNA polymerase enzyme active in transcription an any instant) decreased from 20 to 3.6% in the relA+ strain and remained unchanged (or increased at most to 22%) in the relA mutant. It is suggested that both rRNA gene activity and the RNA polymerase activity depend on the intracellular concentration of guanosine tetraphosphate, whereas the altered chain elongation rate and stability of rRNA are temperature or amino acid starvation effects, respectively, without involvement of relA function. PMID:6174501
Development of a Novel, Rapid Multiplex Polymerase Chain Reaction Assay for the Detection and Differentiation of Salmonella enterica Serovars Enteritidis and Typhimurium Using Ultra-Fast Convection Polymerase Chain Reaction.

PubMed

Kim, Tae-Hoon; Hwang, Hyun Jin; Kim, Jeong Hee

2017-10-01

Salmonella enterica serovars Enteritidis and Typhimurium are the most common causative agents of human nontyphoidal salmonellosis. The rapid detection and timely treatment of salmonellosis are important to increase the curative ratio and prevent spreading of the disease. In this study, we developed a rapid multiplex convection polymerase chain reaction (PCR) method to detect Salmonella spp. and differentiate Salmonella Enteritidis and Salmonella Typhimurium. We used the invA gene for Salmonella spp. detection. Salmonella Enteritidis-specific primers and Salmonella Typhimurium-specific primers were designed using the insertion element (IE) and spy genes, respectively. The primer set for Salmonella spp. detection clearly detected both Salmonella Enteritidis and Salmonella Typhimurium after a 21-min amplification reaction. Serovar-specific primer sets for Salmonella Enteritidis and Salmonella Typhimurium specifically detected each target species in a 21-min amplification reaction. We were able to detect Salmonella spp. at a single copy level in the singleplex mode. The limits of detection for Salmonella Enteritidis and Salmonella Typhimurium were 30 copies in both the singleplex and multiplex modes. The PCR run time could be reduced to 10.5 min/15 cycles. The multiplex convection PCR method developed in this study could detect the Salmonella spp. Salmonella Enteritidis and Salmonella Typhimurium in artificially contaminated milk with as few as 10 0 colony-forming unit/mL after 4-h enrichment. The PCR assay developed in this study provides a rapid, specific, and sensitive method for the detection of Salmonella spp. and the differentiation of Salmonella Enteritidis and Salmonella Typhimurium.
Detection of coliform bacteria and Escherichia coli by multiplex polymerase chain reaction: comparison with defined substrate and plating methods for water quality monitoring.

PubMed Central

Bej, A K; McCarty, S C; Atlas, R M

1991-01-01

Multiplex polymerase chain reaction (PCR) and gene probe detection of target lacZ and uidA genes were used to detect total coliform bacteria and Escherichia coli, respectively, for determining water quality. In tests of environmental water samples, the lacZ PCR method gave results statistically equivalent to those of the plate count and defined substrate methods accepted by the U.S. Environmental Protection Agency for water quality monitoring and the uidA PCR method was more sensitive than 4-methylumbelliferyl-beta-D-glucuronide-based defined substrate tests for specific detection of E. coli. Images PMID:1768116
Development of a diagnostic real-time polymerase chain reaction assay for the detection of invasive Haemophilus influenzae in clinical samples.

PubMed

Meyler, Kenneth L; Meehan, Mary; Bennett, Desiree; Cunney, Robert; Cafferkey, Mary

2012-12-01

Since the introduction of the Haemophilus influenzae serotype b vaccine, invasive H. influenzae disease has become dominated by nontypeable (NT) strains. Several widely used molecular diagnostic methods have been shown to lack sensitivity or specificity in the detection of some of these strains. Novel real-time assays targeting the fucK, licA, and ompP2 genes were developed and evaluated. The fucK assay detected all strains of H. influenzae tested (n = 116) and had an analytical sensitivity of 10 genome copies/polymerase chain reaction (PCR). This assay detected both serotype b and NT H. influenzae in 12 previously positive specimens (culture and/or bexA PCR) and also detected H. influenzae in a further 5 of 883 culture-negative blood and cerebrospinal fluid (CSF) samples. The fucK assay has excellent potential as a diagnostic test for detection of typeable and nontypeable strains of invasive H. influenzae in clinical samples of blood and CSF. Copyright © 2012 Elsevier Inc. All rights reserved.
The yeast Saccharomyces cerevisiae DNA polymerase IV: possible involvement in double strand break DNA repair.

PubMed

Leem, S H; Ropp, P A; Sugino, A

1994-08-11

We identified and purified a new DNA polymerase (DNA polymerase IV), which is similar to mammalian DNA polymerase beta, from Saccharomyces cerevisiae and suggested that it is encoded by YCR14C (POLX) on chromosome III. Here, we provided a direct evidence that the purified DNA polymerase IV is indeed encoded by POLX. Strains harboring a pol4 deletion mutation exhibit neither mitotic growth defect nor a meiosis defect, suggesting that DNA polymerase IV participates in nonessential functions in DNA metabolism. The deletion strains did not exhibit UV-sensitivity. However, they did show weak sensitivity to MMS-treatment and exhibited a hyper-recombination phenotype when intragenic recombination was measured during meiosis. Furthermore, MAT alpha pol4 delta segregants had a higher frequency of illegitimate mating with a MAT alpha tester strain than that of wild-type cells. These results suggest that DNA polymerase IV participates in a double-strand break repair pathway. A 3.2kb of the POL4 transcript was weakly expressed in mitotically growing cells. During meiosis, a 2.2 kb POL4 transcript was greatly induced, while the 3.2 kb transcript stayed at constant levels. This induction was delayed in a swi4 delta strain during meiosis, while no effect was observed in a swi6 delta strain.
Recombinase Polymerase Amplification (RPA) of CaMV-35S Promoter and nos Terminator for Rapid Detection of Genetically Modified Crops

PubMed Central

Xu, Chao; Li, Liang; Jin, Wujun; Wan, Yusong

2014-01-01

Recombinase polymerase amplification (RPA) is a novel isothermal DNA amplification and detection technology that enables the amplification of DNA within 30 min at a constant temperature of 37–42 °C by simulating in vivo DNA recombination. In this study, based on the regulatory sequence of the cauliflower mosaic virus 35S (CaMV-35S) promoter and the Agrobacterium tumefaciens nopaline synthase gene (nos) terminator, which are widely incorporated in genetically modified (GM) crops, we designed two sets of RPA primers and established a real-time RPA detection method for GM crop screening and detection. This method could reliably detect as few as 100 copies of the target molecule in a sample within 15–25 min. Furthermore, the real-time RPA detection method was successfully used to amplify and detect DNA from samples of four major GM crops (maize, rice, cotton, and soybean). With this novel amplification method, the test time was significantly shortened and the reaction process was simplified; thus, this method represents an effective approach to the rapid detection of GM crops. PMID:25310647
Recombinase polymerase amplification (RPA) of CaMV-35S promoter and nos terminator for rapid detection of genetically modified crops.

PubMed

Xu, Chao; Li, Liang; Jin, Wujun; Wan, Yusong

2014-10-10

Recombinase polymerase amplification (RPA) is a novel isothermal DNA amplification and detection technology that enables the amplification of DNA within 30 min at a constant temperature of 37-42 °C by simulating in vivo DNA recombination. In this study, based on the regulatory sequence of the cauliflower mosaic virus 35S (CaMV-35S) promoter and the Agrobacterium tumefaciens nopaline synthase gene (nos) terminator, which are widely incorporated in genetically modified (GM) crops, we designed two sets of RPA primers and established a real-time RPA detection method for GM crop screening and detection. This method could reliably detect as few as 100 copies of the target molecule in a sample within 15-25 min. Furthermore, the real-time RPA detection method was successfully used to amplify and detect DNA from samples of four major GM crops (maize, rice, cotton, and soybean). With this novel amplification method, the test time was significantly shortened and the reaction process was simplified; thus, this method represents an effective approach to the rapid detection of GM crops.
Development of real-time recombinase polymerase amplification assay for rapid and sensitive detection of canine parvovirus 2.

PubMed

Geng, Yunyun; Wang, Jianchang; Liu, Libing; Lu, Yan; Tan, Ke; Chang, Yan-Zhong

2017-11-06

Canine parvovirus 2, a linear single-stranded DNA virus belonging to the genus Parvovirus within the family Parvoviridae, is a highly contagious pathogen of domestic dogs and several wild canidae species. Early detection of canine parvovirus (CPV-2) is crucial to initiating appropriate outbreak control strategies. Recombinase polymerase amplification (RPA), a novel isothermal gene amplification technique, has been developed for the molecular detection of diverse pathogens. In this study, a real-time RPA assay was developed for the detection of CPV-2 using primers and an exo probe targeting the CPV-2 nucleocapsid protein gene. The real-time RPA assay was performed successfully at 38 °C, and the results were obtained within 4-12 min for 10 5 -10 1 molecules of template DNA. The assay only detected CPV-2, and did not show cross-detection of other viral pathogens, demonstrating a high level of specificity. The analytical sensitivity of the real-time RPA was 10 1 copies/reaction of a standard DNA template, which was 10 times more sensitive than the common RPA method. The clinical sensitivity of the real-time RPA assay matched 100% (n = 91) to the real-time PCR results. The real-time RPA assay is a simple, rapid, reliable and affordable method that can potentially be applied for the detection of CPV-2 in the research laboratory and point-of-care diagnosis.
A modified single-tube one-step product-enhanced reverse transcriptase (mSTOS-PERT) assay with heparin as DNA polymerase inhibitor for specific detection of RTase activity.

PubMed

Fan, Xiao-Yong; Lü, Guo-Zhen; Wu, Li-Na; Chen, Jing-Hua; Xu, Wen-Qing; Zhao, Chun-Nü; Guo, Sheng-Qi

2006-12-01

Current regulations and recommendations proposed for the production of vaccines in continuous cell lines of any origin demand that these be free of exogenous viruses, particularly retroviruses. Recently, the ultra-sensitive product-enhanced reverse transcriptase (PERT) assay can be used to detect minute of reverse transcriptase (RTase) in single retroviral particle and is 10(6) times more sensitive than the conventional RTase assays. However, coincidental with this increase in sensitivity is an increase in false-positive reactions derived from contaminating cellular DNA polymerases, which are known to have RTase-like activities. To develop a modified single-tube one-step PERT (mSTOS-PERT) assay with improvements on decreasing significantly the level of false-positive reactions, and to evaluate the mSTOS-PERT assay for sensitivity and specificity. Ampliwaxtrade mark was used to compartmentalize the reverse transcription (RT) and PCR step in the same micro-tube with more efficiency and reproducibility, while maintaining the high sensitivity. The DNA amplification products were separated by 2% agarose gel electrophoresis, and then analyzed by non-isotopic Southern blot hybridization. A wide variety of cell lines used in biologicals production were detected to validate the improved mSTOS-PERT assay. The detection limit for the mSTOS-PERT assay was at least 10(-9)U, when using AMV-RTase as a positive control. Furthermore, heparin involvement in the RT step can eliminate completely the false-positive PERT signals which are exhibited by cellular polymerases such as DNA-dependent DNA polymerase alpha, gamma released by cell death. Most mammalian cells (MRC-5, Vero, WISH, 2BS, RK-13, MDCK, etc.) are PERT-negative in cell supernatants. Some PERT-positive signals in cell lysates were found to be introduced by the cellular DNA polymerases and could be inhibited specifically by heparin. Chick cells derived from either chick embryo fibroblasts (CEF) or allantoic fluid from SPF
Development of Recombinase Polymerase Amplification Assays for Detection of Orientia tsutsugamushi or Rickettsia typhi.

PubMed

Chao, Chien-Chung; Belinskaya, Tatyana; Zhang, Zhiwen; Ching, Wei-Mei

2015-01-01

Sensitive, specific and rapid diagnostic tests for the detection of Orientia tsutsugamushi (O. tsutsugamushi) and Rickettsia typhi (R. typhi), the causative agents of scrub typhus and murine typhus, respectively, are necessary to accurately and promptly diagnose patients and ensure that they receive proper treatment. Recombinase polymerase amplification (RPA) assays using a lateral flow test (RPA-nfo) and real-time fluorescent detection (RPA-exo) were developed targeting the 47-kDa gene of O. tsutsugamushi or 17 kDa gene of R. typhi. The RPA assay was capable of detecting O. tsutsugamushi or R. typhi at levels comparable to that of the quantitative PCR method. Both the RPA-nfo and RPA-exo methods performed similarly with regards to sensitivity when detecting the 17 kDa gene of R. typhi. On the contrary, RPA-exo performed better than RPA-nfo in detecting the 47 kDa gene of O. tsutsugamushi. The clinical performance of the O. tsutsugamushi RPA assay was evaluated using either human patient samples or infected mouse samples. Eight out of ten PCR confirmed positives were determined positive by RPA, and all PCR confirmed negative samples were negative by RPA. Similar results were obtained for R. typhi spiked patient sera. The assays were able to differentiate O. tsutsugamushi and R. typhi from other phylogenetically related bacteria as well as mouse and human DNA. Furthermore, the RPA-nfo reaction was completed in 20 minutes at 37°C followed by a 10 minute incubation at room temperature for development of an immunochromatographic strip. The RPA-exo reaction was completed in 20 minutes at 39°C. The implementation of a cross contamination proof cassette to detect the RPA-nfo fluorescent amplicons provided an alternative to regular lateral flow detection strips, which are more prone to cross contamination. The RPA assays provide a highly time-efficient, sensitive and specific alternative to other methods for diagnosing scrub typhus or murine typhus.
Development of Recombinase Polymerase Amplification Assays for Detection of Orientia tsutsugamushi or Rickettsia typhi

PubMed Central

Chao, Chien-Chung; Belinskaya, Tatyana; Zhang, Zhiwen; Ching, Wei-Mei

2015-01-01

Sensitive, specific and rapid diagnostic tests for the detection of Orientia tsutsugamushi (O. tsutsugamushi) and Rickettsia typhi (R. typhi), the causative agents of scrub typhus and murine typhus, respectively, are necessary to accurately and promptly diagnose patients and ensure that they receive proper treatment. Recombinase polymerase amplification (RPA) assays using a lateral flow test (RPA-nfo) and real-time fluorescent detection (RPA-exo) were developed targeting the 47-kDa gene of O. tsutsugamushi or 17 kDa gene of R. typhi. The RPA assay was capable of detecting O. tsutsugamushi or R. typhi at levels comparable to that of the quantitative PCR method. Both the RPA-nfo and RPA-exo methods performed similarly with regards to sensitivity when detecting the 17 kDa gene of R. typhi. On the contrary, RPA-exo performed better than RPA-nfo in detecting the 47 kDa gene of O. tsutsugamushi. The clinical performance of the O. tsutsugamushi RPA assay was evaluated using either human patient samples or infected mouse samples. Eight out of ten PCR confirmed positives were determined positive by RPA, and all PCR confirmed negative samples were negative by RPA. Similar results were obtained for R. typhi spiked patient sera. The assays were able to differentiate O. tsutsugamushi and R. typhi from other phylogenetically related bacteria as well as mouse and human DNA. Furthermore, the RPA-nfo reaction was completed in 20 minutes at 37oC followed by a 10 minute incubation at room temperature for development of an immunochromatographic strip. The RPA-exo reaction was completed in 20 minutes at 39oC. The implementation of a cross contamination proof cassette to detect the RPA-nfo fluorescent amplicons provided an alternative to regular lateral flow detection strips, which are more prone to cross contamination. The RPA assays provide a highly time-efficient, sensitive and specific alternative to other methods for diagnosing scrub typhus or murine typhus. PMID:26161793
A fluorescence-based alkaline phosphatase-coupled polymerase assay for identification of inhibitors of dengue virus RNA-dependent RNA polymerase.

PubMed

Niyomrattanakit, Pornwaratt; Abas, Siti Nurdiana; Lim, Chin Chin; Beer, David; Shi, Pei-Yong; Chen, Yen-Liang

2011-02-01

The flaviviral RNA-dependent RNA polymerase (RdRp) is an attractive drug target. To discover new inhibitors of dengue virus RdRp, the authors have developed a fluorescence-based alkaline phosphatase-coupled polymerase assay (FAPA) for high-throughput screening (HTS). A modified nucleotide analogue (2'-[2-benzothiazoyl]-6'-hydroxybenzothiazole) conjugated adenosine triphosphate (BBT-ATP) and 3'UTR-U(30) RNA were used as substrates. After the polymerase reaction, treatment with alkaline phosphatase liberates the BBT fluorophore from the polymerase reaction by-product, BBT(PPi), which can be detected at excitation and emission wavelengths of 422 and 566 nm, respectively. The assay was evaluated by examining the time dependency, assay reagent effects, reaction kinetics, and signal stability and was validated with 3'dATP and an adenosine-nucleotide triphosphate inhibitor, giving IC(50) values of 0.13 µM and 0.01 µM, respectively. A pilot screen of a diverse compound library of 40,572 compounds at 20 µM demonstrated good performance with an average Z factor of 0.81. The versatility and robustness of FAPA were evaluated with another substrate system, BBT-GTP paired with 3'UTR-C(30) RNA. The FAPA method presented here can be readily adapted for other nucleotide-dependent enzymes that generate PPi.
Investigation of Influenza Virus Polymerase Activity in Pig Cells

PubMed Central

Moncorgé, Olivier; Long, Jason S.; Cauldwell, Anna V.; Zhou, Hongbo; Lycett, Samantha J.

2013-01-01

Reassortant influenza viruses with combinations of avian, human, and/or swine genomic segments have been detected frequently in pigs. As a consequence, pigs have been accused of being a “mixing vessel” for influenza viruses. This implies that pig cells support transcription and replication of avian influenza viruses, in contrast to human cells, in which most avian influenza virus polymerases display limited activity. Although influenza virus polymerase activity has been studied in human and avian cells for many years by use of a minigenome assay, similar investigations in pig cells have not been reported. We developed the first minigenome assay for pig cells and compared the activities of polymerases of avian or human influenza virus origin in pig, human, and avian cells. We also investigated in pig cells the consequences of some known mammalian host range determinants that enhance influenza virus polymerase activity in human cells, such as PB2 mutations E627K, D701N, G590S/Q591R, and T271A. The two typical avian influenza virus polymerases used in this study were poorly active in pig cells, similar to what is seen in human cells, and mutations that adapt the avian influenza virus polymerase for human cells also increased activity in pig cells. In contrast, a different pattern was observed in avian cells. Finally, highly pathogenic avian influenza virus H5N1 polymerase activity was tested because this subtype has been reported to replicate only poorly in pigs. H5N1 polymerase was active in swine cells, suggesting that other barriers restrict these viruses from becoming endemic in pigs. PMID:23077313

Investigation of polymerase chain reaction assays to improve detection of bacterial involvement in bovine respiratory disease.

PubMed

Bell, Colin J; Blackburn, Paul; Elliott, Mark; Patterson, Tony I A P; Ellison, Sean; Lahuerta-Marin, Angela; Ball, Hywel J

2014-09-01

Bovine respiratory disease (BRD) causes severe economic losses to the cattle farming industry worldwide. The major bacterial organisms contributing to the BRD complex are Mannheimia haemolytica, Histophilus somni, Mycoplasma bovis, Pasteurella multocida, and Trueperella pyogenes. The postmortem detection of these organisms in pneumonic lung tissue is generally conducted using standard culture-based techniques where the presence of therapeutic antibiotics in the tissue can inhibit bacterial isolation. In the current study, conventional and real-time polymerase chain reaction (PCR) assays were used to assess the prevalence of these 5 organisms in grossly pneumonic lung samples from 150 animals submitted for postmortem examination, and the results were compared with those obtained using culture techniques. Mannheimia haemolytica was detected in 51 cases (34%) by PCR and in 33 cases (22%) by culture, H. somni was detected in 35 cases (23.3%) by PCR and in 6 cases (4%) by culture, Myc. bovis was detected in 53 cases (35.3%) by PCR and in 29 cases (19.3%) by culture, P. multocida was detected in 50 cases (33.3%) by PCR and in 31 cases (20.7%) by culture, and T. pyogenes was detected in 42 cases (28%) by PCR and in 31 cases (20.7%) by culture, with all differences being statistically significant. The PCR assays indicated positive results for 111 cases (74%) whereas 82 cases (54.6%) were culture positive. The PCR assays have demonstrated a significantly higher rate of detection of all 5 organisms in cases of pneumonia in cattle in Northern Ireland than was detected by current standard procedures. © 2014 The Author(s).
Multiplex Polymerase Chain Reaction for Detection of Gastrointestinal Pathogens in Migrant Workers in Qatar.

PubMed

Humphrey, John M; Ranbhise, Sanjay; Ibrahim, Emad; Al-Romaihi, Hamad E; Farag, Elmoubasher; Abu-Raddad, Laith J; Glesby, Marshall J

2016-12-07

The causes of infectious diarrhea among the migrant worker population in Qatar are not well understood. We conducted a prospective observational study to understand the demographic and clinical characteristics and infectious causes of diarrhea among migrant workers in Doha, Qatar. A total of 126 male workers presenting to the Qatar Red Crescent Worker's Health Center outpatient clinic or emergency department were studied over a 5-month period in 2015-2016. Epidemiologic surveys were administered to all subjects and the prevalence of 22 different stool pathogens was determined using multiplex polymerase chain reaction (PCR) (FilmArray ® Gastrointestinal PCR). A target pathogen was identified in 62.7% of subjects. Enteropathogenic Escherichia coli was the most prevalent pathogen and was detected in 24.6% of subjects, followed by Salmonella (22.2%), enteroaggregative E. coli (15.1%), Giardia lamblia (9.5%), and enterotoxigenic E. coli (8.7%). Multiple pathogens were identified in 49.3% of positive stool samples. In a multivariable analysis, the presence of a heart rate ≥ 90 (adjusted odds ratio [OR] = 3.7, 95% confidence interval [CI] = 1.4-10.0) and > 5 fecal leukocytes/high-power field (adjusted OR = 2.8, 95% CI = 1.2-7.0) were significant predictors of detecting an acute inflammatory pathogen by PCR. Use of multiplex PCR enabled the detection of gastrointestinal pathogens in a high proportion of cases, illustrating the utility of this diagnostic tool in epidemiologic studies of infectious diarrhea. © The American Society of Tropical Medicine and Hygiene.
Ultrasensitive and selective signal-on electrochemical DNA detection via exonuclease III catalysis and hybridization chain reaction amplification.

PubMed

Ren, Wang; Gao, Zhong Feng; Li, Nian Bing; Luo, Hong Qun

2015-01-15

This work reported a novel, ultrasensitive, and selective platform for electrochemical detection of DNA, employing an integration of exonuclease III (Exo-III) assisted target recycling and hybridization chain reaction (HCR) for the dual signal amplification strategy. The hairpin capture probe DNA (C-DNA) with an Exo-III 3' overhang end was self-assembled on a gold electrode. In the presence of target DNA (T-DNA), C-DNA hybridized with the T-DNA to form a duplex region, exposing its 5' complementary sequence (initiator). Exo-III was applied to selectively digest duplex region from its 3-hydroxyl termini until the duplex was fully consumed, leaving the remnant initiator. The intact T-DNA spontaneously dissociated from the structure and then initiated the next hybridization process as a result of catalysis of the Exo-III. HCR event was triggered by the initiator and two hairpin helper signal probes labeled with methylene blue, facilitating the polymerization of oligonucleotides into a long nicked dsDNA molecule. The numerous exposed remnant initiators can trigger more HCR events. Because of integration of dual signal amplification and the specific HCR process reaction, the resultant sensor showed a high sensitivity for the detection of the target DNA in a linear range from 1.0 fM to 1.0 nM, and a detection limit as low as 0.2 fM. The proposed dual signal amplification strategy provides a powerful tool for detecting different sequences of target DNA by changing the sequence of capture probe and signal probes, holding a great potential for early diagnosis in gene-related diseases. Copyright © 2014 Elsevier B.V. All rights reserved.
Detection of trypanosomatid Phytomonas parasitic in plants by polymerase chain reaction amplification of small subunit ribosomal DNA.

PubMed

Teixeira, M M; Campaner, M; Camargo, E P

1994-01-01

To improve the diagnosis of Phytomonas infections in plants, we developed a polymerase chain reaction (PCR) assay using synthetic oligonucleotides complementary to conserved sequences of the 18S small subunit ribosomal (SSU) gene. From 10 ng upward of DNA of cultures of Phytomonas isolated from plants, fruits, and insects, PCR amplified an 800-bp DNA band that, after restriction analysis and probe hybridization, proved to be of 18S rDNA Phytomonas origin. PCR was also done with sap samples of tomatoes experimentally infected with Phytomonas, yielding amplified 800-bp ribosomal DNA bands before any flagellate could be detected by microscopic examination of the fruit sap.
Automatic polymerase chain reaction product detection system for food safety monitoring using zinc finger protein fused to luciferase.

PubMed

Yoshida, Wataru; Kezuka, Aki; Murakami, Yoshiyuki; Lee, Jinhee; Abe, Koichi; Motoki, Hiroaki; Matsuo, Takafumi; Shimura, Nobuaki; Noda, Mamoru; Igimi, Shizunobu; Ikebukuro, Kazunori

2013-11-01

An automatic polymerase chain reaction (PCR) product detection system for food safety monitoring using zinc finger (ZF) protein fused to luciferase was developed. ZF protein fused to luciferase specifically binds to target double stranded DNA sequence and has luciferase enzymatic activity. Therefore, PCR products that comprise ZF protein recognition sequence can be detected by measuring the luciferase activity of the fusion protein. We previously reported that PCR products from Legionella pneumophila and Escherichia coli (E. coli) O157 genomic DNA were detected by Zif268, a natural ZF protein, fused to luciferase. In this study, Zif268-luciferase was applied to detect the presence of Salmonella and coliforms. Moreover, an artificial zinc finger protein (B2) fused to luciferase was constructed for a Norovirus detection system. In the luciferase activity detection assay, several bound/free separation process is required. Therefore, an analyzer that automatically performed the bound/free separation process was developed to detect PCR products using the ZF-luciferase fusion protein. By means of the automatic analyzer with ZF-luciferase fusion protein, target pathogenic genomes were specifically detected in the presence of other pathogenic genomes. Moreover, we succeeded in the detection of 10 copies of E. coli BL21 without extraction of genomic DNA by the automatic analyzer and E. coli was detected with a logarithmic dependency in the range of 1.0×10 to 1.0×10(6) copies. Copyright © 2013 Elsevier B.V. All rights reserved.
Colorimetric TMPRSS2-ERG Gene Fusion Detection in Prostate Cancer Urinary Samples via Recombinase Polymerase Amplification.

PubMed

Koo, Kevin M; Wee, Eugene J H; Trau, Matt

2016-01-01

TMPRSS2 (Exon 1)-ERG (Exon 4) is the most frequent gene fusion event in prostate cancer (PC), and is highly PC-specific unlike the current serum prostate specific antigen (PSA) biomarker. However, TMPRSS2-ERG levels are currently measured with quantitative reverse-transcription PCR (RT-qPCR) which is time-consuming and requires costly equipment, thus limiting its use in clinical diagnostics. Herein, we report a novel rapid, cost-efficient and minimal-equipment assay named "FusBLU" for detecting TMPRSS2-ERG gene fusions from urine. TMPRSS2-ERG mRNA was amplified by isothermal reverse transcription-recombinase polymerase amplification (RT-RPA), magnetically-isolated, and detected through horseradish peroxidase (HRP)-catalyzed colorimetric reaction. FusBLU was specific for TMPRSS2-ERG mRNA with a low visual detection limit of 10(5) copies. We also demonstrated assay readout versatility on 3 potentially useful platforms. The colorimetric readout was detectable by naked eye for a quick yes/no evaluation of gene fusion presence. On the other hand, a more quantitative TMPRSS2-ERG detection was achievable by absorbance/electrochemical measurements. FusBLU was successfully applied to 12 urinary samples and results were validated by gold-standard RT-qPCR. We also showed that sediment RNA was likely the main source of TMPRSS2-ERG mRNA in urinary samples. We believe that our assay is a potential clinical screening tool for PC and could also have wide applications for other disease-related fusion genes.
Standardisation of polymerase chain reaction for the detection of Salmonella typhi in typhoid fever.

PubMed Central

Chaudhry, R; Laxmi, B V; Nisar, N; Ray, K; Kumar, D

1997-01-01

To improve the diagnosis of Salmonella typhi infection, a polymerase chain reaction (PCR) assay was developed for the amplification of the dH flagellin gene of S typhi. Primers were designed from dH flagellin gene sequence which will give an amplification product of 486 base pairs. In tests to study the specificity of the assay, no amplification was seen in non-salmonella strains or salmonella strains with flagellar gene other than "d". Sensitivity tests determined that 28 pg of S typhi target DNA or 3 x 10(2) target bacteria could be detected by the PCR assay. Subsequently, the PCR technique was used for detection of S typhi in blood or clot cultures from 84 patients clinically suspected of having typhoid fever, and from 20 healthy control subjects. Twenty five of 84 samples from clinically suspected cases were positive by PCR; four of which were culture negative. No amplification was seen in samples from patients who were culture positive for organisms other than S typhi or from controls. The time taken for each sample for PCR analysis was less than 48 hours compared with three to five days for blood or clot culture. PCR appeared to be a promising diagnostic test for typhoid fever. Images PMID:9215131
Detection of Legionella by quantitative-polymerase chain reaction (qPCR) for monitoring and risk assessment.

PubMed

Krøjgaard, Louise H; Krogfelt, Karen A; Albrechtsen, Hans-Jørgen; Uldum, Søren A

2011-11-21

Culture and quantitative polymerase chain reaction (qPCR) assays for the detection of Legionella were compared on samples from a residential area before and after two interventions. A total of 84 samples were collected from shower hoses and taps as first flush samples and at constant temperature. Samples were grouped according to the origin of the sample, a) circulation water b) water from empty apartments c) water from shower hoses. The aims were to investigate the usefulness of qPCR compared to culture for monitoring remedial actions for elimination of Legionella bacteria and as a tool for risk assessment. In water collected from the apartments Legionella spp were detected by qPCR in the concentration range from LOQ to 9.6*105GU/L while L. pneumophila were detected in a range from LOQ to 6.8*105 GU/L. By culturing, the legionellae were detected in the range from below detection limit (> 10 CFU/L) to 1.6*106 CFU/L. In circulating water and in first flush water from shower hoses, culture and qPCR showed the same tendencies. The overall correlation between the bacteria number detected by culture and the two developed qPCR assays (L. spp and L. pneumophila) was relatively poor (r2 = 0.31 for culture and Legionella spp. assay, r2 = 0.20 for culture and L. pneumophila assay). Detection by qPCR was suitable for monitoring changes in the concentration of Legionella but the precise determination of bacteria is difficult. Risk assessment by qPCR only on samples without any background information regarding treatment, timing, etc is dubious. However, the rapid detection by qPCR of high concentrations of Legionella - especially Legionella pneumophila - is valuable as an indicator of risk, although it may be false positive compared to culture results. On the other hand, the detection of a low number of bacteria by qPCR is a strong indication for the absence of risk.
The use of real-time polymerase chain reaction for rapid diagnosis of skeletal tuberculosis.

PubMed

Kobayashi, Naomi; Fraser, Thomas G; Bauer, Thomas W; Joyce, Michael J; Hall, Gerri S; Tuohy, Marion J; Procop, Gary W

2006-07-01

We identified Mycobacterium tuberculosis DNA using real-time polymerase chain reaction on a specimen from an osteolytic lesion of a femoral condyle, in which the frozen section demonstrated granulomas. The process was much more rapid than is possible with culture. The rapid detection of M tuberculosis and the concomitant exclusion of granulomatous disease caused by nontuberculous mycobacteria or systemic fungi are necessary to appropriately treat skeletal tuberculosis. The detection and identification of M tuberculosis by culture may require several weeks using traditional methods. The real-time polymerase chain reaction method used has been shown to be rapid and reliable, and is able to detect and differentiate both tuberculous and nontuberculous mycobacteria. Real-time polymerase chain reaction may become a diagnostic standard for the evaluation of clinical specimens for the presence of mycobacteria; this case demonstrates the potential utility of this assay for the rapid diagnosis of skeletal tuberculosis.
Polymeric Optical Sensors for Selective and Sensitive Nitrite Detection Using Cobalt(III) Corrole and Rh(III) Porphyrin as Ionophores

PubMed Central

Yang, Si; Wo, Yaqi; Meyerhoff, Mark E.

2014-01-01

Cobalt(III) 5, 10, 15-tris(4-tert-butylphenyl) corrole with a triphenylphosphine axial ligand and rhodium(III) 5,10,15,20-tetra(p-tert-butylphenyl)porphyrin are incorporated into plasticized poly(vinyl chloride) films to fabricate nitrite-selective bulk optodes via absorbance measurements. The resulting films yield sensitive, fast and fully reversible response toward nitrite with significantly enhanced nitrite selectivity over other anions including lipophilic anions such as thiocyanate and perchlorate. The selectivity patterns differ greatly from the Hofmeister series based on anion lipophilicity and are consistent with selectivity obtained with potentiometric sensors based on the same ionophores. The optical nitrite sensors are shown to be useful for detecting rates of emission of nitric oxide (NO) from NO releasing polymers containing S-nitroso-N-acetyl-penicillamine. PMID:25150700
Crystal structure of the DNA polymerase III β subunit (β-clamp) from the extremophile Deinococcus radiodurans.

PubMed

Niiranen, Laila; Lian, Kjersti; Johnson, Kenneth A; Moe, Elin

2015-02-27

Deinococcus radiodurans is an extremely radiation and desiccation resistant bacterium which can tolerate radiation doses up to 5,000 Grays without losing viability. We are studying the role of DNA repair and replication proteins for this unusual phenotype by a structural biology approach. The DNA polymerase III β subunit (β-clamp) acts as a sliding clamp on DNA, promoting the binding and processivity of many DNA-acting proteins, and here we report the crystal structure of D. radiodurans β-clamp (Drβ-clamp) at 2.0 Å resolution. The sequence verification process revealed that at the time of the study the gene encoding Drβ-clamp was wrongly annotated in the genome database, encoding a protein of 393 instead of 362 amino acids. The short protein was successfully expressed, purified and used for crystallisation purposes in complex with Cy5-labeled DNA. The structure, which was obtained from blue crystals, shows a typical ring-shaped bacterial β-clamp formed of two monomers, each with three domains of identical topology, but with no visible DNA in electron density. A visualisation of the electrostatic surface potential reveals a highly negatively charged outer surface while the inner surface and the dimer forming interface have a more even charge distribution. The structure of Drβ-clamp was determined to 2.0 Å resolution and shows an evenly distributed electrostatic surface charge on the DNA interacting side. We hypothesise that this charge distribution may facilitate efficient movement on encircled DNA and help ensure efficient DNA metabolism in D. radiodurans upon exposure to high doses of ionizing irradiation or desiccation.
Exonuclease III-assisted cascade signal amplification strategy for label-free and ultrasensitive electrochemical detection of nucleic acids.

PubMed

Xiong, Erhu; Yan, Xiaoxia; Zhang, Xiaohua; Liu, Yunqing; Zhou, Jiawan; Chen, Jinhua

2017-01-15

In this work, a simple, signal-on and label-free electrochemical biosensor for ultrasensitive DNA detection is reported on the basis of an autocatalytic and exonuclease III (Exo III)-assisted cascade signal amplification strategy. In the presence of target DNA (T-DNA), the hybridization between the 3'-protruding DNA fragment of hairpin DNA probe (HP1) and T-DNA triggered the Exo III cleavage process, accompanied by the releasing of T-DNA and autonomous generation of new DNA fragment which was used for the successive hybridization with the another hairpin DNA (HP2) on the electrode. After the Exo III cleavage process, numerous quadruplex-forming oligomers which caged in HP2 were liberated on the electrode surface and folded into G-quadruplex-hemin complexes with the help of K + and hemin to give a remarkable electrochemical response. As a result, a low detection limit of 4.83fM with an excellent selectivity toward T-DNA was achieved. The developed electrochemical biosensor should be further extended for the detection of a wide spectrum of analytes and has great potential for the development of ultrasensitive biosensing platform for early diagnosis in gene-related diseases. Copyright Â© 2016 Elsevier B.V. All rights reserved.
Optimization of the elution buffer and concentration method for detecting hepatitis E virus in swine liver using a nested reverse transcription-polymerase chain reaction and real-time reverse transcription-polymerase chain reaction.

PubMed

Son, Na Ry; Seo, Dong Joo; Lee, Min Hwa; Seo, Sheungwoo; Wang, Xiaoyu; Lee, Bog-Hieu; Lee, Jeong-Su; Joo, In-Sun; Hwang, In-Gyun; Choi, Changsun

2014-09-01

The aim of this study was to develop an optimal technique for detecting hepatitis E virus (HEV) in swine livers. Here, three elution buffers and two concentration methods were compared with respect to enhancing recovery of HEV from swine liver samples. Real-time reverse transcription-polymerase chain reaction (RT-PCR) and nested RT-PCR were performed to detect HEV RNA. When phosphate-buffered saline (PBS, pH 7.4) was used to concentrate HEV in swine liver samples using ultrafiltration, real-time RT-PCR detected HEV in 6 of the 26 samples. When threonine buffer was used to concentrate HEV using polyethylene glycol (PEG) precipitation and ultrafiltration, real-time RT-PCR detected HEV in 1 and 3 of the 26 samples, respectively. When glycine buffer was used to concentrate HEV using ultrafiltration and PEG precipitation, real-time RT-PCR detected HEV in 1 and 3 samples of the 26 samples, respectively. When nested RT-PCR was used to detect HEV, all samples tested negative regardless of the type of elution buffer or concentration method used. Therefore, the combination of real-time RT-PCR and ultrafiltration with PBS buffer was the most sensitive and reliable method for detecting HEV in swine livers. Copyright © 2014 Elsevier B.V. All rights reserved.
High sensitive RNA detection by one-step RT-PCR using the genetically engineered variant of DNA polymerase with reverse transcriptase activity from hyperthermophilies.

PubMed

Okano, Hiroyuki; Baba, Misato; Kawato, Katsuhiro; Hidese, Ryota; Yanagihara, Itaru; Kojima, Kenji; Takita, Teisuke; Fujiwara, Shinsuke; Yasukawa, Kiyoshi

2018-03-01

One-step RT-PCR has not been widely used even though some thermostable DNA polymerases with reverse transcriptase (RT) activity were developed from bacterial and archaeal polymerases, which is owing to low cDNA synthesis activity from RNA. In the present study, we developed highly-sensitive one-step RT-PCR using the single variant of family A DNA polymerase with RT activity, K4pol L329A (L329A), from the hyperthermophilic bacterium Thermotoga petrophila K4 or the 16-tuple variant of family B DNA polymerase with RT activity, RTX, from the hyperthermophilic archaeon Thermococcus kodakarensis. Optimization of reaction condition revealed that the activities for cDNA synthesis and PCR of K4pol L329A and RTX were highly affected by the concentrations of MgCl 2 and Mn(OCOCH 3 ) 2 as well as those of K4pol L329A or RTX. Under the optimized condition, 300 copies/μl of target RNA in 10 μl reaction volumes were successfully detected by the one-step RT-PCR with K4pol L329A or RTX, which was almost equally sensitive enough compared with the current RT-PCR condition using retroviral RT and thermostable DNA polymerase. Considering that K4pol L329A and RTX are stable even at 90-100°C, our results suggest that the one-step RT-PCR with K4pol L329A or RTX is more advantageous than the current one. Copyright © 2017 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.
Rapid and visual detection of Mycobacterium tuberculosis complex using recombinase polymerase amplification combined with lateral flow strips.

PubMed

Ma, Qinglin; Liu, Houming; Ye, Feidi; Xiang, Guangxin; Shan, Wanshui; Xing, Wanli

2017-12-01

To definitively diagnose active pulmonary Tuberculosis (TB), Mycobacterium tuberculosis complex (MTBC) bacilli must be identified within clinical specimens from patients. In this study, we introduced a rapid and visual detection method of MTBC using recombinase polymerase amplification (RPA) combined with lateral flow (LF) strips. The LF-RPA assay, read results with naked eyes, could detect as few as 5 genome copies of M. tuberculosis H37Rv (ATCC 27294) per reaction and had no cross-reactions with other control bacteria even using excessive amount of template DNA. The system could work well at a broad range of temperature 25-45 °C and reach detectable level even within 5 min. When testing a total of 137 clinical specimens, the sensitivity and specificity of the LF-RPA assay were 100% (95% CI: 95.94%-100%) and 97.92% (95% CI: 88.93%-99.95%), respectively, compared to culture identification method. Therefore, the LF-RPA system we have demonstrated is a rapid, simple, robust method for MTBC detection which, subject to the availability of a suitable sample extraction method, has the potentiality to diagnose TB at the point-of-care testing. Copyright © 2017 Elsevier Ltd. All rights reserved.
A chemiluminescence method to detect hydroquinone with water-soluble sulphonato-(salen)manganese(III) complex as catalyst.

PubMed

Zhang, Guangbin; Tang, Yuhai; Sun, Yang; Yu, Hua; Du, Wei; Fu, Qiang

2016-02-01

A water-soluble sulphonato-(salen)manganese(III) complex with excellent catalytic properties was synthesized and demonstrated to greatly enhance the chemiluminescence signal of the hydrogen peroxide - luminol reaction. Coupled with flow-injection technique, a simple and sensitive chemiluminescence method was first developed to detect hydroquinone based on the chemiluminescence system of the hydrogen peroxide-luminol-sulphonato-(salen)manganese(III) complex. Under optimal conditions, the assay exhibited a wide linear range from 0.1 to 10 ng mL(-1) with a detection limit of 0.05 ng mL(-1) for hydroquinone. The method was applied successfully to detect hydroquinone in tap-water and mineral-water, with a sampling frequency of 120 times per hour. The relative standard deviation for determination of hydroquinone was less than 5.6%, and the recoveries ranged from 96.8 to 103.0%. The ultraviolet spectra, chemiluminescence spectra, and the reaction kinetics for the peroxide-luminol-sulphonato-(salen)manganese(III) complex system were employed to study the possible chemiluminescence mechanism. The proposed chemiluminescence analysis technique is rapid and sensitive, with low cost, and could be easily extended and applied to other compounds. Copyright © 2015 John Wiley & Sons, Ltd.
Rapid and sensitive detection of Little cherry virus 2 using isothermal reverse transcription-recombinase polymerase amplification.

PubMed

Mekuria, Tefera A; Zhang, Shulu; Eastwell, Kenneth C

2014-09-01

Little cherry virus 2 (LChV2) (genus Ampelovirus) is the primary causal agent of little cherry disease (LCD) in sweet cherry (Prunus avium) in North America and other parts of the world. This mealybug-transmitted virus does not induce significant foliar symptoms in most sweet cherry cultivars, but does cause virus-infected trees to yield unevenly ripened small fruits with poor flavor. Most fruits from infected trees are unmarketable. In the present study, an isothermal reverse transcription-recombinase polymerase amplification (RT-RPA) technique was developed using LChV2 coat protein specific primers and probe. Detection of terminally labeled amplicons was achieved with a high affinity lateral flow strip. The RT-RPA is confirmed to be simple, fast, and specific. In comparison, although it retains the sensitivity of RT-PCR, it is a more cost-effective procedure. RT-RPA will be a very useful tool for detecting LChV2 from crude extracts in any growth stage of sweet cherry from field samples. Copyright © 2014 The Authors. Published by Elsevier B.V. All rights reserved.
Fast Photo-detection in Phototransistors based on Group III-VI Layered Materials.

NASA Astrophysics Data System (ADS)

Patil, Prasanna; Ghosh, Sujoy; Wasala, Milinda; Lei, Sidong; Vajtai, Robert; Ajayan, Pulickel; Talapatra, Saikat

Response time of a photo detector is one of the crucial aspect of photo-detection. Recently it has been shown that direct band gap of few layered group III-VI materials helps in increased absorption of light thereby enhancing the photo responsive properties of these materials. Ternary system of Copper Indium Selenide has been extensively used in optoelectronics industry and it is expected that 2D layered structure of Copper Indium Selenide will be a key component of future optoelectronics devices based on 2D materials. Here we report fast photo detection in few layers of Copper Indium Selenide (CuIn7Se11) phototransistor. Few-layers of CuIn7Se11 flakes were exfoliated from crystals grown using chemical vapor transport technique. Our photo response characterization indicates responsivity of 104 mA/W with external quantum efficiency exceeding 103. We have found response time of few μs which is one of the fastest response among photodetectors based on 2D materials. We also found specific detectivity of 1012 Jones which is an order higher than conventional photodetectors. A comparison between response times of various layered group III-VI materials will be presented and discussed. This work is supported by the U.S. Army Research Office through a MURI Grant # W911NF-11-1-0362.
Encephalomyocarditis Virus Ribonucleic Acid Polymerase Associated with 150S Cytoplasmic Particles

PubMed Central

Bases, Robert; Tarikas, Helgi

1969-01-01

Cytoplasmic particles which sedimented at 150S were the smallest structures containing detectable viral ribonucleic acid polymerase in mouse cells infected with encephalomyocarditis virus. PMID:4307906
Assessment of cell culture and polymerase chain reaction procedures for the detection of polioviruses in wastewater.

PubMed Central

Grabow, W. O.; Botma, K. L.; de Villiers, J. C.; Clay, C. G.; Erasmus, B.

1999-01-01

WHO considers that environmental surveillance for wild-type polioviruses is potentially important for surveillance for acute flaccid paralysis as a means of confirming eradication of poliomyelitis. The present study investigated methods for detecting polioviruses in a variety of water environments in South Africa. Most polioviruses were isolated on L20B mouse cells, which, however, were not selective: 16 reoviruses and 8 enteroviruses, apparently animal strains, were also isolated on these cells. Vaccine strains of polioviruses were isolated from surface waters during and shortly after two rounds of mass vaccination of children in an informal settlement where there was no sewerage. The results demonstrated the feasibility of poliovirus surveillance in such settlements. It was also evident that neither poliovirus vaccine strains nor other viruses were likely to interfere significantly with the detection of wild-type polioviruses. Optimal isolation of polioviruses was accomplished by parallel inoculation of L20B mouse cells and at least the PLC/PRF/5 human liver and buffalo green monkey (BGM) kidney cell lines. Analysis of cell cultures using the polymerase chain reaction revealed that 319 test samples contained at least 263 human enteroviruses that failed to produce a cytopathogenic effect. This type of analysis thus significantly increased the sensitivity of enterovirus detection. PMID:10680244

Recombinase polymerase amplification combined with lateral flow dipstick for equipment-free detection of Salmonella in shellfish.

PubMed

Gao, Weifang; Huang, Hailong; Zhu, Peng; Yan, Xiaojun; Fan, Jianzhong; Jiang, Jinpo; Xu, Jilin

2018-05-01

Salmonella is a major pathogen that causes acute foodborne outbreaks worldwide. Seafood, particularly shellfish, is a proven source of Salmonella spp. infection because many people prefer to eat it raw or lightly cooked. However, traditional identification methods are too time-consuming and complex to detect contamination of bacteria in the food chain in a timely manner, and few studies have aimed to identify Salmonella in shellfish early in the supply chain. We herein developed a method for rapid detection of Salmonella in shellfish based on the method of recombinase polymerase amplification (RPA) combined with lateral flow dipstick (LFD), which targets the invasion gene A (invA). The RPA-LFD was able to function at 30-45 °C, and at the temperature of 40 °C, it only took 8 min of amplification to reach the test threshold of amplicons. The established method had both a good specificity and a sensitivity of 100 fg DNA per reaction (20 µL). Regarding practical performance, RPA-LFD performed better than real-time PCR. Another advantage of RPA-LFD is that it was capable of being performed without expensive equipments. Thus, RPA-LFD has potential for further development as a detection kit for Salmonella in shellfish and other foods under field conditions.
Detection of nonauthorized genetically modified organisms using differential quantitative polymerase chain reaction: application to 35S in maize.

PubMed

Cankar, Katarina; Chauvensy-Ancel, Valérie; Fortabat, Marie-Noelle; Gruden, Kristina; Kobilinsky, André; Zel, Jana; Bertheau, Yves

2008-05-15

Detection of nonauthorized genetically modified organisms (GMOs) has always presented an analytical challenge because the complete sequence data needed to detect them are generally unavailable although sequence similarity to known GMOs can be expected. A new approach, differential quantitative polymerase chain reaction (PCR), for detection of nonauthorized GMOs is presented here. This method is based on the presence of several common elements (e.g., promoter, genes of interest) in different GMOs. A statistical model was developed to study the difference between the number of molecules of such a common sequence and the number of molecules identifying the approved GMO (as determined by border-fragment-based PCR) and the donor organism of the common sequence. When this difference differs statistically from zero, the presence of a nonauthorized GMO can be inferred. The interest and scope of such an approach were tested on a case study of different proportions of genetically modified maize events, with the P35S promoter as the Cauliflower Mosaic Virus common sequence. The presence of a nonauthorized GMO was successfully detected in the mixtures analyzed and in the presence of (donor organism of P35S promoter). This method could be easily transposed to other common GMO sequences and other species and is applicable to other detection areas such as microbiology.
Pyrosequencing-based validation of a simple cell-suspension polymerase chain reaction assay for Campylobacter with application of high-processivity polymerase and novel internal amplification controls for rapid and specific detection.

PubMed

Oakley, Brian B; Line, J Eric; Berrang, Mark E; Johnson, Jessica M; Buhr, R Jeff; Cox, Nelson A; Hiett, Kelli L; Seal, Bruce S

2012-02-01

Although Campylobacter is an important food-borne human pathogen, there remains a lack of molecular diagnostic assays that are simple to use, cost-effective, and provide rapid results in research, clinical, or regulatory laboratories. Of the numerous Campylobacter assays that do exist, to our knowledge none has been empirically tested for specificity using high-throughput sequencing. Here we demonstrate the power of next-generation sequencing to determine the specificity of a widely cited Campylobacter-specific polymerase chain reaction (PCR) assay and describe a rapid method for direct cell suspension PCR to quickly and easily screen samples for Campylobacter. We present a specific protocol which eliminates the need for time-consuming and expensive genomic DNA extractions and, using a high-processivity polymerase, demonstrate conclusive screening of samples in <1 h. Pyrosequencing results show the assay to be extremely (>99%) sensitive, and spike-back experiments demonstrated a detection threshold of <10(2) CFU mL(-1). Additionally, we present 2 newly designed broad-range bacterial primer sets targeting the 23S rRNA gene that have wide applicability as internal amplification controls. Empirical testing of putative taxon-specific assays using high-throughput sequencing is an important validation step that is now financially feasible for research, regulatory, or clinical applications. Published by Elsevier Inc.
Comparison of four polymerase chain reaction assays for the detection of Brucella spp. in clinical samples from dogs

PubMed Central

Boeri, Eduardo J.; Wanke, María M.; Madariaga, María J.; Teijeiro, María L.; Elena, Sebastian A.; Trangoni, Marcos D.

2018-01-01

Aim: This study aimed to compare the sensitivity (S), specificity (Sp), and positive likelihood ratios (LR+) of four polymerase chain reaction (PCR) assays for the detection of Brucella spp. in dog’s clinical samples. Materials and Methods: A total of 595 samples of whole blood, urine, and genital fluids were evaluated between October 2014 and November 2016. To compare PCR assays, the gold standard was defined using a combination of different serological and microbiological test. Bacterial isolation from urine and blood cultures was carried out. Serological methods such as rapid slide agglutination test, indirect enzyme-linked immunosorbent assay, agar gel immunodiffusion test, and buffered plate antigen test were performed. Four genes were evaluated: (i) The gene coding for the BCSP31 protein, (ii) the ribosomal gene coding for the 16S-23S intergenic spacer region, (iii) the gene coding for porins omp2a/omp2b, and (iv) the gene coding for the insertion sequence IS711. Results: The results obtained were as follows: (1) For the primers that amplify the gene coding for the BCSP31 protein: S: 45.64% (confidence interval [CI] 39.81-51.46), Sp: 95.62% (CI 93.13-98.12), and LR+: 10.43 (CI 6.04-18); (2) for the primers that amplify the ribosomal gene of the 16S-23S rDNA intergenic spacer region: S: 69.80% (CI 64.42-75.18), Sp: 95.62 % (CI 93.13-98.12), and LR+: 11.52 (CI 7.31-18.13); (3) for the primers that amplify the omp2a and omp2b genes: S: 39.26% (CI 33.55-44.97), Sp: 97.31% (CI 95.30-99.32), and LR+ 14.58 (CI 7.25-29.29); and (4) for the primers that amplify the insertion sequence IS711: S: 22.82% (CI 17.89 - 27.75), Sp: 99.66% (CI 98.84-100), and LR+ 67.77 (CI 9.47-484.89). Conclusion: We concluded that the gene coding for the 16S-23S rDNA intergenic spacer region was the one that best detected Brucella spp. in canine clinical samples. PMID:29657404
Signal-off Electrochemiluminescence Biosensor Based on Phi29 DNA Polymerase Mediated Strand Displacement Amplification for MicroRNA Detection.

PubMed

Chen, Anyi; Gui, Guo-Feng; Zhuo, Ying; Chai, Ya-Qin; Xiang, Yun; Yuan, Ruo

2015-06-16

A target induced cycling strand displacement amplification (SDA) mediated by phi29 DNA polymerase (phi29) was first investigated and applied in a signal-off electrochemiluminescence (ECL) biosensor for microRNA (miRNA) detection. Herein, the target miRNA triggered the phi29-mediated SDA which could produce amounts of single-stranded DNA (assistant probe) with accurate and comprehensive nucleotide sequence. Then, the assistant probe hybridized with the capture probe and the ferrocene-labeled probe (Fc-probe) to form a ternary "Y" structure for ECL signal quenching by ferrocene. Therefore, the ECL intensity would decrease with increasing concentration of the target miRNA, and the sensitivity of biosensor would be promoted on account of the efficient signal amplification of the target induced cycling reaction. Besides, a self-enhanced Ru(II) ECL system was designed to obtain a stable and strong initial signal to further improve the sensitivity. The ECL assay for miRNA-21 detection is developed with excellent sensitivity of a concentration variation from 10 aM to 1.0 pM and limit of detection down to 3.3 aM.
Detection and quantification of Renibacterium salmoninarum DNA in salmonid tissues by real-time quantitative polymerase chain reaction analysis

USGS Publications Warehouse

Chase, D.M.; Elliott, D.G.; Pascho, R.J.

2006-01-01

Renibacterium salmoninarum is an important salmonid pathogen that is difficult to culture. We developed and assessed a real-time, quantitative, polymerase chain reaction (qPCR) assay for the detection and enumeration of R. salmoninarum. The qPCR is based on TaqMan technology and amplifies a 69-base pair (bp) region of the gene encoding the major soluble antigen (MSA) of R. salmoninarum. The qPCR assay consistently detected as few as 5 R. salmoninarum cells per reaction in kidney tissue. The specificity of the qPCR was confirmed by testing the DNA extracts from a panel of microorganisms that were either common fish pathogens or reported to cause false-positive reactions in the enzyme-linked immunosorbent assay (ELISA). Kidney samples from 38 juvenile Chinook salmon (Oncorhynchus tshawytscha) in a naturally infected population were examined by real-time qPCR, a nested PCR, and ELISA, and prevalences of R. salmoninarum detected were 71, 66, and 71%, respectively. The qPCR should be a valuable tool for evaluating the R. salmoninarum infection status of salmonids.
Detection of indomethacin by high-performance liquid chromatography with in situ electrogenerated Mn(III) chemiluminescence detection.

PubMed

Zhang, Yantu; Zhang, Zhujun; Qi, Guangcai; Sun, Yonghua; Wei, Yue; Ma, Hongyan

2007-01-23

The determination of indomethacin (INM) in pharmaceutical and biological samples by means of high-performance liquid chromatography (HPLC) with in situ electrogenerated Mn(III) chemiluminescence (CL) detection was proposed. The method was based on the direct CL reaction of INM and Mn(III), which was in situ electrogenerated by constant current electrolysis. The chromatographic separation was carried out on Nucleosil RP-C(18) column (250 mm x 4.6 mm; i.d., 5 microm; pore size, 100 A) at 20 degrees C. The mobile phase consisted of methanol:water:acetic acid=67:33:0.1 solution. At a flow rate of 1.0 mL min(-1), the total run time was 10 min. The effects of several parameters on the HPLC resolution and CL emission were studied systematically. Under the optimal conditions, a linear range from 0.01 to 10 microg mL(-1)(R(2)=0.9991), and a detection limit of 8 ng mL(-1) (signal-to-noise ratio=3) for INM were achieved. The relative standard deviations (R.S.D.) for 0.1 microg mL(-1) INM were 2.2% within a day (n=11) and 3.0% on 5 consecutive days (n=6), respectively. The recovery of INM from urine samples was more than 92%. The applicability of the method for the analysis of pharmaceutical and biological samples was examined.
A flow method based on solvent extraction coupled on-line to a reversed micellar mediated chemiluminescence detection for selective determination of gold(III) and gallium(III) in water and industrial samples.

PubMed

Hasanin, Tamer H A; Okamoto, Yasuaki; Fujiwara, Terufumi

2016-02-01

A rapid and sensitive flow method, based on the combination of on-line solvent extraction with reversed micellar mediated chemiluminescence (CL) detection using rhodamine B (RB), was investigated for the selective determination of Au(III) and Ga(III) in aqueous solutions. 2.0 M HCl was the optimum for extracting Au(III) while a 5.0M HCl solution containing 2.5M LiCl was selected as an optimum acidic medium for extraction of Ga(III). The Au(III) and Ga(III) chloro-complex anions were extracted from the above aqueous acidic solutions into toluene as their ion-pair complexes with the protonated RBH(+) ion followed by membrane phase separation in a flow system. In a flow cell of a detector, the extract was mixed with the reversed micellar solution of cetyltrimethylammonium chloride (CTAC) in 1-hexanol-cyclohexane/water (1.0M HCl) containing 0.10 M cerium(IV) and 0.05 M lithium sulfate. Then uptake of the ion-pair by the CTAC reversed micelles and the subsequent CL oxidation of RB with Ce(IV) occurred easily and the CL signals produced were recorded. Using a flow injection system, a detection limit (DL) of 0.4 μM Au(III) and 0.6 μM Ga(III), and linear calibration graphs with dynamic ranges from the respective DLs to 10 μM for Au(III) and Ga(III) were obtained under the optimized experimental conditions. The relative standard deviations (n=6) obtained at 2.0 µM Au(III) and 4.0 µM Ga(III) were 3.0% and 2.4%, respectively. The presented CL methodology has been applied for the determination of Au(III) and Ga(III) in water and industrial samples with satisfactory results. Copyright © 2015 Elsevier B.V. All rights reserved.
T7-RNA Polymerase

NASA Technical Reports Server (NTRS)

1997-01-01

T7-RNA Polymerase grown on STS-81. Structure-Function Relationships of RNA Polymerase: DNA-dependent RNA polymerase is the key enzyme responsible for the biosynthesis of RNA, a process known as transcription. Principal Investigator's include Dr. Dan Carter, Dr. B.C. Wang, and Dr. John Rose of New Century Pharmaceuticals.
Prokaryotic histone-like protein interacting with RNA polymerase.

PubMed Central

Lathe, R; Buc, H; Lecocq, J P; Bautz, E K

1980-01-01

firA mutation of Escherichia coli can render RNA synthesis thermosensitive and confer abnormal sensitivity to rifampicin, an antibiotic that specifically inhibits the activity of RNA polymerase. We previously described the cloning of a chromosomal HindIII fragment containing the firA gene, and we now present strong evidence that the product of this gene is a 17,000-dalton polypeptide which, by various criteria, closely resembles the eukaryotic histones. This protein forms the largest of a unique set of three abundant histone-like proteins (HLP) found in E. coli and is hence referred to as HLPI. We discuss possible routes by which these proteins might affect transcription. Images PMID:6447875
Reverse Transcription Quantitative Polymerase Chain Reaction for Detection of and Differentiation Between RNA and DNA of HIV-1-Based Lentiviral Vectors.

PubMed

Pavlovic, Melanie; Koehler, Nina; Anton, Martina; Dinkelmeier, Anna; Haase, Maren; Stellberger, Thorsten; Busch, Ulrich; Baiker, Armin E

2017-08-01

The purpose of the described method is the detection of and differentiation between RNA and DNA of human immunodeficiency virus (HIV)-derived lentiviral vectors (LV) in cell culture supernatants and swab samples. For the analytical surveillance of genetic engineering, operations methods for the detection of the HIV-1-based LV generations are required. Furthermore, for research issues, it is important to prove the absence of LV particles for downgrading experimental settings in terms of the biosafety level. Here, a quantitative polymerase chain reaction method targeting the long terminal repeat U5 subunit and the start sequence of the packaging signal ψ is described. Numerous controls are included in order to monitor the technical procedure.
Mobile suitcase laboratory for rapid detection of Leishmania donovani using recombinase polymerase amplification assay.

PubMed

Mondal, Dinesh; Ghosh, Prakash; Khan, Md Anik Ashfaq; Hossain, Faria; Böhlken-Fascher, Susanne; Matlashewski, Greg; Kroeger, Axel; Olliaro, Piero; Abd El Wahed, Ahmed

2016-05-13

Leishmania donovani (LD) is a protozoan parasite transmitted to humans from sand flies, which causes Visceral Leishmaniasis (VL). Currently, the diagnosis is based on presence of the anti-LD antibodies and clinical symptoms. Molecular diagnosis would require real-time PCR, which is not easy to implement at field settings. In this study, we report on the development and testing of a recombinase polymerase amplification (RPA) assay for the detection of LD. A genomic DNA sample was applied to determine the assay analytical sensitivity. The cross-reactivity of the assay was tested by DNA of Leishmania spp. and of pathogens considered for differential diagnosis. The clinical performance of the assay was evaluated on LD positive and negative samples. All results were compared with real-time PCR. To allow the use of the assay at field settings, a mobile suitcase laboratory (56 × 45.5 × 26.5 cm) was developed and operated at the local hospital in Mymensingh, Bangladesh. The LD RPA assay detected equivalent to one LD genomic DNA. The assay was performed at constant temperature (42 °C) in 15 min. The RPA assay also detected other Leishmania species (L. major, L. aethiopica and L. infantum), but did not identify nucleic acid of other pathogens. Forty-eight samples from VL, asymptomatic and post-kala-azar dermal leishmaniasis subjects were detected positive and 48 LD-negative samples were negative by both LD RPA and real-time PCR assays, which indicates 100 % agreement. The suitcase laboratory was successfully operated at the local hospital by using a solar-powered battery. DNA extraction was performed by a novel magnetic bead based method (SpeedXtract), in which a simple fast lysis protocol was applied. Moreover, All reagents were cold-chain independent. The mobile suitcase laboratory using RPA is ideal for rapid sensitive and specific detection of LD especially at low resource settings and could contribute to VL control and elimination programmes.
Rapid visual detection of cyprinid herpesvirus 2 by recombinase polymerase amplification combined with a lateral flow dipstick.

PubMed

Wang, H; Sun, M; Xu, D; Podok, P; Xie, J; Jiang, Ys; Lu, Lq

2018-05-28

Herpesviral haematopoietic necrosis (HVHN), caused by cyprinid herpesvirus 2 (CyHV-2), causes significant losses in crucian carp (Carassius carassius) aquaculture. Rapid and convenient DNA assay detection of CyHV-2 is useful for field diagnosis. Recombinase polymerase amplification (RPA) is a novel isothermal DNA amplification and detection technology that can amplify DNA within 30 min at ~37°C by simulating in vivo DNA recombination. Herein, a rapid and convenient detection assay based on RPA with a lateral flow dipstick (LFD) was developed for detecting CyHV-2. The highly conserved ORF72 of CyHV-2 was targeted by specific and sensitive primers and probes. The optimized assay takes only 15 min at 38°C using a water bath, with analysis of products by 2% agarose gel electrophoresis within 30 min. A simple lateral flow strip based on the unique probe in reaction buffer was developed for visualization. The entire RPA-LFD assay takes 50 min less than the routine PCR method, is 100 times more sensitive and displays no cross-reaction with other aquatic viruses. The combined isothermal RPA and lateral flow assay (RPA-LFD) provides a simple, rapid, reliable method that could improve field diagnosis of CyHV-2 when resources are limited. © 2018 John Wiley & Sons Ltd.
Microchip capillary electrophoresis with laser-induced fluorescence combined with one-step duplex reverse-transcription polymerase chain reaction for the rapid detection of Enterovirus 71 and Coxsackievirus A16 in throat swab specimens.

PubMed

Jia, Ruan; Chengjun, Sun; Heng, Chen; Chen, Zhou; Yuanqian, Li; Yongxin, Li

2015-07-01

Enterovirus 71 and Coxsackievirus A16 are the main pathogens causing hand-foot-mouth disease. In this paper, microchip capillary electrophoresis with laser-induced fluorescence combined with one-step duplex reverse transcript-polymerase chain reaction has been developed for the detection of Enterovirus 71 and Coxsackievirus A16 in throat swab specimens. The specific reverse transcription-polymerase chain reaction amplicons labeled with SYBR Orange were separated by microchip capillary electrophoresis and detected by laser induced fluorescence detector within 7 min. The intraday and interday relative standard deviation of migration time for DNA Marker was in the range of 1.36-2.94 and 2.78-3.96%, respectively. The detection limits were as low as 2.06 × 10(3) copies/mL for Enterovirus 71 and 5 × 10(3) copies/mL for Coxsackievirus A16. No cross-reactivity was observed with rotavirus, astrovirus, norovirus, and adenovirus, which showed good specificity of the method. This assay was validated using 100 throat swab specimens that were detected by real-time reverse-transcript polymerase chain reaction in parallel and the two methods produced the same results. This study provided a rapid, sensitive and specific method for the detection of Enterovirus 71 and Coxsackievirus A16, which make a contribution to significant time and cost saving for the identification and treatment of patients. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Fluorescence resonance energy transfer analysis of escherichia coli RNA polymerase and polymerase-DNA complexes.

PubMed

Heyduk, T; Niedziela-Majka, A

Fluorescence resonance energy transfer (FRET) is a technique allowing measurements of atomic-scale distances in diluted solutions of macromolecules under native conditions. This feature makes FRET a powerful tool to study complicated biological assemblies. In this report we review the applications of FRET to studies of transcription initiation by Escherichia coli RNA polymerase. The versatility of FRET for studies of a large macromolecular assembly such as RNA polymerase is illustrated by examples of using FRET to address several different aspects of transcription initiation by polymerase. FRET has been used to determine the architecture of polymerase, its complex with single-stranded DNA, and the conformation of promoter fragment bound to polymerase. FRET has been also used as a binding assay to determine the thermodynamics of promoter DNA fragment binding to the polymerase. Functional conformational changes in the specificity subunit of polymerase responsible for the modulation of the promoter binding activity of the enzyme and the mechanistic aspects of the transition from the initiation to the elongation complex were also investigated. Copyright 2002 Wiley Periodicals, Inc.
G-quadruplex based Exo III-assisted signal amplification aptasensor for the colorimetric detection of adenosine.

PubMed

Xu, Lei; Shen, Xin; Li, Bingzhi; Zhu, Chunhong; Zhou, Xuemin

2017-08-08

Adenosine is an endogenous nucleotide pivotally involved in nucleic acid and energy metabolism. Its excessive existence may indicate tumorigenesis, typically lung cancer. Encouraged by its significance as the clinical biomarker, sensitive assay methods towards adenosine have been popularized, with high cost and tedious procedures as the inevitable defects. Herein, we report a label-free aptamer-based exonuclease III (Exo III) amplification colorimetric aptasensor for the highly sensitive and cost-effective detection of adenosine. The strategy employed two unlabeled hairpin DNA oligonucleotides (HP1 and HP2), where HP1 contained the aptamer towards adenosine and HP2 embedded the guanine-rich sequence (GRS). In the presence of adenosine, hairpin HP1 could form specific binding with adenosine and trigger the unfolding of HP1's hairpin structure. The resulting adenosine-HP1 complex could hybridize with HP2, generating the Exo III recognition site. After Exo III-assisted degradation, the GRS was released from HP2, and the adenosine-HP1 was released back to the solution to combine another HP2, inducing the cycling amplification. After multiple circulations, the released ample GRSs were induced to form G-quadruplex, further catalyzing the oxidation of TMB, yielding a color change which was finally mirrored in the absorbance change. On the contrary, the absence of adenosine failed to unfold HP1, remaining color unchanged eventually. Thanks to the amplification strategy, the limit of detection was lowered to 17 nM with a broad linear range from 50 nM to 6 μM. The proposed method was successfully applied to the detection of adenosine in biological samples and satisfying recoveries were acquired. Copyright © 2017 Elsevier B.V. All rights reserved.
An aptamer-based bio-barcode assay with isothermal recombinase polymerase amplification for cytochrome-c detection and anti-cancer drug screening.

PubMed

Loo, Jacky F C; Lau, P M; Ho, H P; Kong, S K

2013-10-15

Based on a recently reported ultra-sensitive bio-barcode (BBC) assay, we have developed an aptamer-based bio-barcode (ABC) alternative to detect a cell death marker cytochrome-c (Cyto-c) and its subsequent application to screen anti-cancer drugs. Aptamer is a short single-stranded DNA selected from a synthetic DNA library by virtue of its high binding affinity and specificity to its target based on its unique 3D structure from the nucleotide sequence after folding. In the BBC assay, an antigen (Ag) in analytes is captured by a micro-magnetic particle (MMP) coated with capturing antibodies (Abs). Gold nanoparticles (NPs) with another recognition Ab against the same target and hundreds of identical DNA molecules of known sequence are subsequently added to allow the formation of sandwich structures ([MMP-Ab1]-Ag-[Ab2-NP-DNA]). After isolating the sandwiches by a magnetic field, the DNAs hybridized to their complementary DNAs covalently bound on the NPs are released from the sandwiches after heating. Acting as an Ag identification tag, these bio-barcode DNAs with known DNA sequence are then amplified by polymerase chain reaction (PCR) and detected by fluorescence. In our ABC assay, we employed a Cyto-c-specific aptamer to substitute both the recognition Ab and barcode DNAs on the NPs in the BBC assay; and a novel isothermal recombinase polymerase amplification for the time-consuming PCR. The detection limit of our ABC assay for the Cyto-c was found to be 10 ng/mL and this new assay can be completed within 3h. Several potential anti-cancer drugs have been tested in vitro for their efficacy to kill liver cancer with or without multi-drug resistance. © 2013 Elsevier B.V. All rights reserved.
[Usefulness of conventional polymerase chain reaction for the detection of Mycoplasma hominis, Ureaplasma spp. and Trichomonas vaginalis in female outpatient's genital samples].

PubMed

Alarcón, Gonzalo; Barraza, Gabriela; Vera, Andrea; Wozniak, Aniela; García, Patricia

2016-02-01

Trichomonas vaginalis, Mycoplasma hominis and Ureaplasma spp. are microorganisms responsible for genitourinary and pregnancy pathologies. Nucleic acid amplification methods have shown several advantages, but have not been widely studied for the detection of these microorganisms. To implement a conventional polymerase chain reaction (PCR) for the detection of the microorganisms and to compare its results versus the methods currently used at our laboratory. 91 available samples were processed by PCR, culture (M. hominis y Ureaplasma spp.) and wet mount (T vaginalis). Results were compared and statistically analyzed by kappa agreement test. 85, 80 and 87 samples resulted in agreement for the detection of M. hominis, Ureaplasma spp. y T. vaginalis, respectively. For M. hominis and Ureaplasma spp., agreement was substantial, whereas for T. vaginalis it was moderate, however, for the latter, PCR detected more cases than wet mount. We recommend the implementation of PCR for detection of T. vaginalis whereas culture kit is still a useful method for the other microorganisms.
Multiplex Real-Time PCR for Detecting and Typing Clostridium botulinum Group III Organisms and Their Mosaic Variants

PubMed Central

Auricchio, Bruna; Woudstra, Cédric; Fach, Patrick; Fiore, Alfonsina; Skarin, Hanna; Bano, Luca; Segerman, Bo; Knutsson, Rickard; De Medici, Dario

2013-01-01

Botulism is a neuroparalytic disease that can occur in all warm-blooded animals, birds, and fishes. The disease in animals is mainly caused by toxins produced by Clostridium botulinum strains belonging to group III, although outbreaks due to toxins produced by group I and II organisms have been recognized. Group III strains are capable of producing botulinum toxins of type C, D, and C/D and D/C mosaic variants. Definitive diagnosis of animal botulism is made by combining clinical findings with laboratory investigations. Detection of toxins in clinical specimens and feed is the gold standard for laboratory diagnosis. Since toxins may be degraded by organisms contained in the gastrointestinal tract or may be present at levels below the detection limit, the recovery of C. botulinum from sick animal specimens is consistent for laboratory confirmation. In this article we report the development and in-house validation of a new multiplex real-time PCR for detecting and typing the neurotoxin genes found in C. botulinum group III organisms. Validation procedures have been carried out according to ISO 16140, using strains and samples recovered from cases of animal botulism in Italy and France. PMID:23971808
A Genetic Selection for dinB Mutants Reveals an Interaction between DNA Polymerase IV and the Replicative Polymerase That Is Required for Translesion Synthesis.

PubMed

Scotland, Michelle K; Heltzel, Justin M H; Kath, James E; Choi, Jung-Suk; Berdis, Anthony J; Loparo, Joseph J; Sutton, Mark D

2015-09-01

Translesion DNA synthesis (TLS) by specialized DNA polymerases (Pols) is a conserved mechanism for tolerating replication blocking DNA lesions. The actions of TLS Pols are managed in part by ring-shaped sliding clamp proteins. In addition to catalyzing TLS, altered expression of TLS Pols impedes cellular growth. The goal of this study was to define the relationship between the physiological function of Escherichia coli Pol IV in TLS and its ability to impede growth when overproduced. To this end, 13 novel Pol IV mutants were identified that failed to impede growth. Subsequent analysis of these mutants suggest that overproduced levels of Pol IV inhibit E. coli growth by gaining inappropriate access to the replication fork via a Pol III-Pol IV switch that is mechanistically similar to that used under physiological conditions to coordinate Pol IV-catalyzed TLS with Pol III-catalyzed replication. Detailed analysis of one mutant, Pol IV-T120P, and two previously described Pol IV mutants impaired for interaction with either the rim (Pol IVR) or the cleft (Pol IVC) of the β sliding clamp revealed novel insights into the mechanism of the Pol III-Pol IV switch. Specifically, Pol IV-T120P retained complete catalytic activity in vitro but, like Pol IVR and Pol IVC, failed to support Pol IV TLS function in vivo. Notably, the T120P mutation abrogated a biochemical interaction of Pol IV with Pol III that was required for Pol III-Pol IV switching. Taken together, these results support a model in which Pol III-Pol IV switching involves interaction of Pol IV with Pol III, as well as the β clamp rim and cleft. Moreover, they provide strong support for the view that Pol III-Pol IV switching represents a vitally important mechanism for regulating TLS in vivo by managing access of Pol IV to the DNA.

Development of a panel of recombinase polymerase amplification assays for detection of common bacterial urinary tract infection pathogens.

PubMed

Raja, B; Goux, H J; Marapadaga, A; Rajagopalan, S; Kourentzi, K; Willson, R C

2017-08-01

To develop and evaluate the performance of a panel of isothermal real-time recombinase polymerase amplification (RPA) assays for detection of common bacterial urinary tract infection (UTI) pathogens. The panel included RPAs for Escherichia coli, Klebsiella pneumoniae, Proteus mirabilis, Pseudomonas aeruginosa and Enterococcus faecalis. All five RPAs required reaction times of under 12 min to reach their lower limit of detection of 100 genomes per reaction or less, and did not cross-react with high concentrations of nontarget bacterial genomic DNA. In a 50-sample retrospective clinical study, the five-RPA assay panel was found to have a specificity of 100% (95% CI, 78-100%) and a sensitivity of 89% (95% CI, 75-96%) for UTI detection. The analytical and clinical validity of RPA for the rapid and sensitive detection of common UTI pathogens was established. Rapid identification of the causative pathogens of UTIs can be valuable in preventing serious complications by helping avoid the empirical treatment necessitated by traditional urine culture's 48-72-h turnaround time. The routine and widespread use of RPA to supplement or replace culture-based methods could profoundly impact UTI management and the emergence of multidrug-resistant pathogens. © 2017 The Society for Applied Microbiology.
Case Report of Focal Epithelial Hyperplasia (Heck's Disease) with Polymerase Chain Reaction Detection of Human Papillomavirus 13.

PubMed

Brehm, Mary A; Gordon, Katie; Firan, Miahil; Rady, Peter; Agim, Nnenna

2016-05-01

Focal epithelial hyperplasia (FEH), or Heck's disease, is an uncommon benign proliferation of oral mucosa caused by the human papillomavirus (HPV), particularly subtypes 13 and 32. The disease typically presents in young Native American patients and is characterized by multiple asymptomatic papules and nodules on the oral mucosa, lips, tongue, and gingiva. The factors that determine susceptibility to FEH are unknown, but the ethnic and geographic distribution of FEH suggests that genetic predisposition, particularly having the human lymphocytic antigen DR4 type, may be involved in pathogenesis. We report a case of FEH with polymerase chain reaction detection of HPV13 in a healthy 11-year-old Hispanic girl and discuss the current understanding of disease pathogenesis, susceptibility, and treatment. © 2016 Wiley Periodicals, Inc.
Modeling RNA polymerase interaction in mitochondria of chordates

PubMed Central

2012-01-01

Background In previous work, we introduced a concept, a mathematical model and its computer realization that describe the interaction between bacterial and phage type RNA polymerases, protein factors, DNA and RNA secondary structures during transcription, including transcription initiation and termination. The model accurately reproduces changes of gene transcription level observed in polymerase sigma-subunit knockout and heat shock experiments in plant plastids. The corresponding computer program and a user guide are available at http://lab6.iitp.ru/en/rivals. Here we apply the model to the analysis of transcription and (partially) translation processes in the mitochondria of frog, rat and human. Notably, mitochondria possess only phage-type polymerases. We consider the entire mitochondrial genome so that our model allows RNA polymerases to complete more than one circle on the DNA strand. Results Our model of RNA polymerase interaction during transcription initiation and elongation accurately reproduces experimental data obtained for plastids. Moreover, it also reproduces evidence on bulk RNA concentrations and RNA half-lives in the mitochondria of frog, human with or without the MELAS mutation, and rat with normal (euthyroid) or hyposecretion of thyroid hormone (hypothyroid). The transcription characteristics predicted by the model include: (i) the fraction of polymerases terminating at a protein-dependent terminator in both directions (the terminator polarization), (ii) the binding intensities of the regulatory protein factor (mTERF) with the termination site and, (iii) the transcription initiation intensities (initiation frequencies) of all promoters in all five conditions (frog, healthy human, human with MELAS syndrome, healthy rat, and hypothyroid rat with aberrant mtDNA methylation). Using the model, absolute levels of all gene transcription can be inferred from an arbitrary array of the three transcription characteristics, whereas, for selected genes only
Engineering of DNA polymerase I from Thermus thermophilus using compartmentalized self-replication.

PubMed

Aye, Seaim Lwin; Fujiwara, Kei; Ueki, Asuka; Doi, Nobuhide

2018-05-05

Although compartmentalized self-replication (CSR) and compartmentalized partnered replication (CPR) are powerful tools for directed evolution of proteins and gene circuits, limitations remain in the emulsion PCR process with the wild-type Taq DNA polymerase used so far, including long run times, low amounts of product, and false negative results due to inhibitors. In this study, we developed a high-efficiency mutant of DNA polymerase I from Thermus thermophilus HB27 (Tth pol) suited for CSR and CPR. We modified the wild-type Tth pol by (i) deletion of the N-terminal 5' to 3' exonuclease domain, (ii) fusion with the DNA-binding protein Sso7d, (iii) introduction of four known effective point mutations from other DNA polymerase mutants, and (iv) codon optimization to reduce the GC content. Consequently, we obtained a mutant that provides higher product yields than the conventional Taq pol without decreased fidelity. Next, we performed four rounds of CSR selection with a randomly mutated library of this modified Tth pol and obtained mutants that provide higher product yields in fewer cycles of emulsion PCR than the parent Tth pol as well as the conventional Taq pol. Copyright © 2018 Elsevier Inc. All rights reserved.
Detection of Porphyromonas endodontalis in infected root canals by 16S rRNA gene-directed polymerase chain reaction.

PubMed

Machado de Oliveira, J C; Siqueira, J F; Alves, G B; Hirata, R; Andrade, A F

2000-12-01

Porphyromonas endodontalis has been isolated from the endodontic infections mainly in symptomatic teeth. This study evaluated the occurrence of P. endodontalis in both symptomatic and asymptomatic endodontic infections using 16S rRNA gene-directed polymerase chain reaction. P. endodontalis was detected in 39.5% of the cases (17 of 43 teeth). It was present in 4 of the 6 cases with acute periradicular abscess (66.7%) and in 13 of the 37 other cases (35.1%). The presence of P. endodontalis was associated with an asymptomatic periradicular lesion in 6 cases (25%) and in 10 teeth with tenderness to percussion (52.6%). P. endodontalis was also found in one asymptomatic case without evidence of periradicular pathosis. Our results indicated that, although P. endodontalis is commonly detected in symptomatic cases, it can be present in asymptomatic root canal infections. Further studies should determine if this bacterial species is really an important endodontopathogen.
Enhanced detection of intracellular organism of swine proliferative enteritis, ileal symbiont intracellularis, in feces by polymerase chain reaction.

PubMed Central

Jones, G F; Ward, G E; Murtaugh, M P; Lin, G; Gebhart, C J

1993-01-01

A sensitive assay based on amplification of a 319-bp DNA fragment of the intracellular bacterium of swine proliferative enteritis was developed for the detection of the organism in the feces of swine. A vernacular name, ileal symbiont intracellularis (IS-intracellularis), has recently been published for the intracellular bacterium, which was formerly known as a Campylobacter-like organism (C.J. Gebhart, S.M. Barnes, S. McOrist, G.F. Lin, and G.H.K. Larson, Int. J. Syst. Bacteriol. 43:533-538, 1993). As few as 10(1) IS-intracellularis organisms purified from intestinal mucosa, or 10(3) IS-intracellularis per g of feces, were detected. No amplification product was produced from a polymerase chain reaction performed on DNA extracted from the feces of healthy pigs. A 319-bp DNA fragment specific for IS-intracellularis was produced on amplification of DNA from the feces of pigs with experimental and naturally occurring proliferative enteritis. Images PMID:8253956
Development of a polymerase chain reaction-based assay for the detection of Alternaria fungal contamination in food products.

PubMed

Zur, G; Hallerman, E M; Sharf, R; Kashi, Y

1999-10-01

Alternaria sp. are important fungal contaminants of vegetable, fruit, and grain products, including Alternaria alternata, a contaminant of tomato products. To date, the Howard method, based on microscopic observation of fungal filaments, has been the standard examination for inspection of tomato products. We report development of a polymerase chain reaction (PCR)-based method for detection of Alternaria DNA. PCR primers were designed to anneal to the internal transcribed regions ITS1 and ITS2 of the 5.8S rRNA gene of Alternaria but not to other microbial or tomato DNA. We demonstrate use of the PCR assay to detect Alternaria DNA in experimentally infested and commercially obtained tomato sauce and tomato powder. Use of the PCR method offers a rapid and sensitive assay for the presence of Alternaria DNA in tomato products. The apparent breakdown of DNA in tomato sauce may limit the utility of the assay to freshly prepared products. The assay for tomato powder is not affected by storage time.
Polymerase Chain Reaction Detection of Leishmania kDNA from the Urine of Peruvian Patients with Cutaneous and Mucocutaneous Leishmaniasis

PubMed Central

Veland, Nicolas; Espinosa, Diego; Valencia, Braulio Mark; Ramos, Ana Pilar; Calderon, Flor; Arevalo, Jorge; Low, Donald E.; Llanos-Cuentas, Alejandro; Boggild, Andrea K.

2011-01-01

We hypothesized that Leishmania kDNA may be present in urine of patients with cutaneous leishmaniasis (CL). Urine samples and standard diagnostic specimens were collected from patients with skin lesions. kDNA polymerase chain reaction (PCR) was performed on samples from patients and 10 healthy volunteers from non-endemic areas. Eighty-six of 108 patients were diagnosed with CL and 18 (21%) had detectable Leishmania Viannia kDNA in the urine. Sensitivity and specificity were 20.9% (95% confidence interval [CI] 12.3–29.5%) and 100%. Six of 8 patients with mucocutaneous involvement had detectable kDNA in urine versus 12 of 78 patients with isolated cutaneous disease (P < 0.001). L. (V.) braziliensis (N = 3), L. (V.) guyanensis (N = 6), and L. (V.) peruviana (N = 3) were identified from urine. No healthy volunteer or patient with an alternate diagnosis had detectable kDNA in urine. Sensitivity of urine PCR is sub-optimal for diagnosis. On the basis of these preliminary data in a small number of patients, detectable kDNA in urine may identify less localized forms of infection and inform treatment decisions. PMID:21460009
Optimal DNA Isolation Method for Detection of Nontuberculous Mycobacteria by Polymerase Chain Reaction

PubMed Central

Mohammadi, Samira; Esfahani, Bahram Nasr; Moghim, Sharareh; Mirhendi, Hossein; Zaniani, Fatemeh Riyahi; Safaei, Hajieh Ghasemian; Fazeli, Hossein; Salehi, Mahshid

2017-01-01

Background: Nontuberculous mycobacteria (NTM) are a group of opportunistic pathogens and these are widely dispersed in water and soil resources. Identification of mycobacteria isolates by conventional methods including biochemical tests, growth rates, colony pigmentation, and presence of acid-fast bacilli is widely used, but these methods are time-consuming, labor-intensive, and may sometimes remain inconclusive. Materials and Methods: The DNA was extracted from NTM cultures using CTAB, Chelex, Chelex + Nonidet P-40, FTA® Elute card, and boiling The quantity and quality of the DNA extracted via these methods were determined using UV-photometer at 260 and 280 nm, and polymerase chain reaction (PCR) amplification of the heat-shock protein 65 gene with serially diluted DNA samples. Results: The CTAB method showed more positive results at 1:10–1:100,000 at which the DNA amount was substantial. With the Chelex method of DNA extraction, PCR amplification was detected at 1:10 and 1:1000 dilutions. Conclusions: According to the electrophoresis results, the CTAB and Chelex DNA extraction methods were more successful in comparison with the others as regard producing suitable concentrations of DNA with the minimum use of PCR inhibitor. PMID:29279831
Optimal DNA Isolation Method for Detection of Nontuberculous Mycobacteria by Polymerase Chain Reaction.

PubMed

Mohammadi, Samira; Esfahani, Bahram Nasr; Moghim, Sharareh; Mirhendi, Hossein; Zaniani, Fatemeh Riyahi; Safaei, Hajieh Ghasemian; Fazeli, Hossein; Salehi, Mahshid

2017-01-01

Nontuberculous mycobacteria (NTM) are a group of opportunistic pathogens and these are widely dispersed in water and soil resources. Identification of mycobacteria isolates by conventional methods including biochemical tests, growth rates, colony pigmentation, and presence of acid-fast bacilli is widely used, but these methods are time-consuming, labor-intensive, and may sometimes remain inconclusive. The DNA was extracted from NTM cultures using CTAB, Chelex, Chelex + Nonidet P-40, FTA ® Elute card, and boiling The quantity and quality of the DNA extracted via these methods were determined using UV-photometer at 260 and 280 nm, and polymerase chain reaction (PCR) amplification of the heat-shock protein 65 gene with serially diluted DNA samples. The CTAB method showed more positive results at 1:10-1:100,000 at which the DNA amount was substantial. With the Chelex method of DNA extraction, PCR amplification was detected at 1:10 and 1:1000 dilutions. According to the electrophoresis results, the CTAB and Chelex DNA extraction methods were more successful in comparison with the others as regard producing suitable concentrations of DNA with the minimum use of PCR inhibitor.
Structural Basis for Recognition and Sequestration of UUUOH 3 ' Temini of Nascent RNA Polymerase III Transcripts by La, a Rheumatic Disease Autoantigen

DOE Office of Scientific and Technical Information (OSTI.GOV)

Teplova,M.; Yuan, Y.; Phan, A.

2006-01-01

The nuclear phosphoprotein La was identified as an autoantigen in patients with systemic lupus erythematosus and Sjogren's syndrome. La binds to and protects the UUUOH 3' terminii of nascent RNA polymerase III transcripts from exonuclease digestion. We report the 1.85 Angstroms crystal structure of the N-terminal domain of human La, consisting of La and RRM1 motifs, bound to r(U1-G2-C3-U4-G5-U6-U7-U8-U9OH). The U7-U8-U9OH 3' end, in a splayed-apart orientation, is sequestered within a basic and aromatic amino acid-lined cleft between the La and RRM1 motifs. The specificity-determining U8 residue bridges both motifs, in part through unprecedented targeting of the {beta} sheet edge,more » rather than the anticipated face, of the RRM1 motif. Our structural observations, supported by mutation studies of both La and RNA components, illustrate the principles behind RNA sequestration by a rheumatic disease autoantigen, whereby the UUUOH 3' ends of nascent RNA transcripts are protected during downstream processing and maturation events.« less
DNA polymerase γ and disease: what we have learned from yeast

PubMed Central

Lodi, Tiziana; Dallabona, Cristina; Nolli, Cecilia; Goffrini, Paola; Donnini, Claudia; Baruffini, Enrico

2015-01-01

Mip1 is the Saccharomyces cerevisiae DNA polymerase γ (Pol γ), which is responsible for the replication of mitochondrial DNA (mtDNA). It belongs to the family A of the DNA polymerases and it is orthologs to human POLGA. In humans, mutations in POLG(1) cause many mitochondrial pathologies, such as progressive external ophthalmoplegia (PEO), Alpers' syndrome, and ataxia-neuropathy syndrome, all of which present instability of mtDNA, which results in impaired mitochondrial function in several tissues with variable degrees of severity. In this review, we summarize the genetic and biochemical knowledge published on yeast mitochondrial DNA polymerase from 1989, when the MIP1 gene was first cloned, up until now. The role of yeast is particularly emphasized in (i) validating the pathological mutations found in human POLG and modeled in MIP1, (ii) determining the molecular defects caused by these mutations and (iii) finding the correlation between mutations/polymorphisms in POLGA and mtDNA toxicity induced by specific drugs. We also describe recent findings regarding the discovery of molecules able to rescue the phenotypic defects caused by pathological mutations in Mip1, and the construction of a model system in which the human Pol γ holoenzyme is expressed in yeast and complements the loss of Mip1. PMID:25852747
Pea chloroplast DNA encodes homologues of Escherichia coli ribosomal subunit S2 and the beta'-subunit of RNA polymerase.

PubMed Central

Cozens, A L; Walker, J E

1986-01-01

The nucleotide sequence has been determined of a segment of 4680 bases of the pea chloroplast genome. It adjoins a sequence described elsewhere that encodes subunits of the F0 membrane domain of the ATP-synthase complex. The sequence contains a potential gene encoding a protein which is strongly related to the S2 polypeptide of Escherichia coli ribosomes. It also encodes an incomplete protein which contains segments that are homologous to the beta'-subunit of E. coli RNA polymerase and to yeast RNA polymerases II and III. PMID:3530249
A novel quantitative real-time polymerase chain reaction method for detecting toxigenic Pasteurella multocida in nasal swabs from swine.

PubMed

Scherrer, Simone; Frei, Daniel; Wittenbrink, Max Michael

2016-12-01

Progressive atrophic rhinitis (PAR) in pigs is caused by toxigenic Pasteurella multocida. In Switzerland, PAR is monitored by selective culture of nasal swabs and subsequent polymerase chain reaction (PCR) screening of bacterial colonies for the P. multocida toxA gene. A panel of 203 nasal swabs from a recent PAR outbreak were used to evaluate a novel quantitative real-time PCR for toxigenic P. multocida in porcine nasal swabs. In comparison to the conventional PCR with a limit of detection of 100 genome equivalents per PCR reaction, the real-time PCR had a limit of detection of 10 genome equivalents. The real-time PCR detected toxA-positive P. multocida in 101 samples (49.8%), whereas the conventional PCR was less sensitive with 90 toxA-positive samples (44.3%). In comparison to the real-time PCR, 5.4% of the toxA-positive samples revealed unevaluable results by conventional PCR. The approach of culture-coupled toxA PCR for the monitoring of PAR in pigs is substantially improved by a novel quantitative real-time PCR.
Development and use of a real-time polymerase chain reaction assay for the detection of Ophidiomyces ophiodiicola in snakes.

PubMed

Allender, Matthew C; Bunick, David; Dzhaman, Elena; Burrus, Lucienne; Maddox, Carol

2015-03-01

Fungal pathogens threatening the conservation of wildlife are becoming increasingly common. Since 2008, free-ranging snakes across North America have been experiencing a marked increase in the prevalence of snake fungal disease associated with Ophidiomyces ophiodiicola. Diagnosis has historically relied on histology, microbiology, and conventional polymerase chain reaction (PCR). More sensitive methods are needed to adequately characterize the epidemiology. The current study describes the development of a real-time PCR (qPCR) assay for detecting a segment of the internal transcribed spacer 1 region between the 18S and 5.8S ribosomal RNA gene. The assay was able to detect as few as 1.05 × 10(1) gene copies per reaction. An additional 4 positive cases were detected when comparing a conventional PCR (n = 3) and the qPCR (n = 7) when used on swab samples from 47 eastern massasauga rattlesnakes. The newly developed assay is a sensitive and specific tool for surveillance and monitoring in the conservation of free-ranging snakes. © 2015 The Author(s).
Development of recombinase polymerase amplification assays for the rapid detection of peste des petits ruminants virus.

PubMed

Zhang, Yongning; Wang, Jianchang; Zhang, Zhou; Mei, Lin; Wang, Jinfeng; Wu, Shaoqiang; Lin, Xiangmei

2018-04-01

Peste des petits ruminants (PPR) is a severe infectious disease of small ruminants caused by PPR virus (PPRV). Rapid and sensitive detection of PPRV is critical for controlling PPR. This report describes the development and evaluation of a conventional reverse transcription recombinase polymerase amplification (RT-RPA) assay and a real-time RT-RPA assay, targeting the PPRV N gene. Sensitivity analysis revealed that the conventional RT-RPA assay could detect 852 copies of standard PPRV RNA per reaction at 95% probability within 20 min at 41 °C, and the real-time RT-RPA assay could detect 103 copies of RNA molecules per reaction at 95% probability. Specificity analysis showed that both assays have no cross-reactivity with nucleic acid templates prepared from other selected viruses or common pathogens. Clinical evaluation using 162 ovine and hircine serum and nasal swab samples showed that the performance of both the real-time RT-RPA assay and the conventional RT-RPA assay were comparable to that of real-time RT-PCR. The overall agreements between real-time RT-PCR and real-time RT-RPA, and conventional RT-RPA were 99.4% (161/162) and 98.8% (160/162), respectively. The R 2 value of real-time RT-RPA and real-time RT-PCR was 0.900 by linear regression analysis. Our results suggest that both RT-RPA assays have a potential application in the rapid, sensitive and specific detection of PPRV. Copyright © 2018 Elsevier B.V. All rights reserved.
Long Detection Programming in Single-Chamber Defibrillators Reduces Unnecessary Therapies and Mortality: The ADVANCE III Trial.

PubMed

Gasparini, Maurizio; Lunati, Maurizio G; Proclemer, Alessandro; Arenal, Angel; Kloppe, Axel; Martínez Ferrer, Josè B; Hersi, Ahmad S; Gulaj, Marcin; Wijffels, Maurits C E; Santi, Elisabetta; Manotta, Laura; Varma, Niraj

2017-11-01

This study sought to evaluate the effects of programming a long detection in single-chamber (VVI) implantable cardioverter-defibrillators (ICDs) in the multicenter prospective ADVANCE III (Avoid DeliVering TherApies for Non-sustained Arrhythmias in ICD PatiEnts III) trial. Programming strategies may reduce unnecessary ICD shocks and their adverse effects but to date have been described only for dual-chamber ICDs. A total of 545 subjects (85% male; atrial fibrillation 25%, left ventricular ejection fraction 31%, ischemic etiology 68%, secondary prevention indications 32%) receiving a VVI ICD were randomized to long detection (30 of 40 intervals) or standard programming (18 of 24 intervals) based on device type, atrial fibrillation history, and indication. In both arms, antitachycardia pacing (ATP) therapy during charging was programmed for episodes with cycle length 320 to 200 ms and shock only for cycle length <200 ms. Wavelet and stability functions enabled. Therapies delivered were compared using a negative binomial regression model. A total of 267 patients were randomized to long detection and 278 to the control group. Median follow-up was 12 months. One hundred twelve therapies (shocks and ATP) occurred in the long detection arm versus 257 in the control arm, for a 48% reduction with 30 of 40 intervals (95% confidence interval [CI]: 0.36 to 0.76; p = 0.002). In the long detection arm, overall shocks were reduced by 40% compared to the control arm (48 vs. 24; 95% CI: 0.38 to 0.94; p = 0.026) and appropriate shocks by 51% (34 vs. 74; 95% CI: 0.26 to 0.94; p = 0.033). Syncopal events did not differ between arms, but survival improved in the long detection arm. Among patients implanted with a VVI ICD, programming with the long detection interval significantly reduced appropriate therapies, shocks, and all-cause mortality. (Avoid DeliVering TherApies for Non-sustained Arrhythmias in ICD PatiEnts III [ADVANCEIII]; NCT00617175). Copyright © 2017 The Authors
Comparison of automated BAX polymerase chain reaction and standard culture methods for detection of Listeria monocyogenes in blue crab meat (Callinectus sapidus) and blue crab processing plants

USDA-ARS?s Scientific Manuscript database

This study compared the BAX Polymerase Chain Reaction method (BAX PCR) with the Standard Culture Method (SCM) for detection of L. monocytogenes in blue crab meat and crab processing plants. The aim of this study was to address this data gap. Raw crabs, finished products and environmental sponge samp...
Molecular screening by polymerase chain reaction detects panleukopenia virus DNA in formalin-fixed hearts from cats with idiopathic cardiomyopathy and myocarditis.

PubMed

Meurs, K M; Fox, P R; Magnon, A L; Liu, S; Towbin, J A

2000-01-01

Viral myocarditis has been suggested as an etiology for cardiomyopathy in several mammalian species. Myocarditis and idiopathic cardiomyopathy have been reported in the domestic cat, although a viral etiology has not been demonstrated. Because of the continuing interest in the potential relationship between viral myocarditis and cardiomyopathy, we evaluated hearts from cats with spontaneous, idiopathic cardiomyopathy for viral genomic material within myocytes by polymerase chain reaction, and for the presence of myocarditis by light microscopy. Thirty-one (31) formalin-fixed hearts from domestic cats who died of idiopathic cardiomyopathy were randomly selected from pathology archives. Seventeen (17) formalin-fixed hearts from healthy cats were similarly selected as normal controls. The polymerase chain reaction (PCR) was used to evaluate myocardial tissue for the presence of viral genome from feline panleukopenia virus, herpes virus, calici virus, and corona virus. Hearts were examined using light microscopy for histologic evidence of myocarditis according to the Dallas criteria. Panleukopenia virus was identified by PCR in 10 of 31 cats with cardiomyopathy but in none of the controls. Neither cardiomyopathic or control cats tested positive by PCR for herpes virus, calici virus, and corona virus. Myocarditis was detected by histologic examination in 18 of 31 cardiomyopathic cats and in none of 17 control cats. Myocarditis and or feline panleukopenia virus genome was detected in felines with idiopathic hypertrophic, dilated, and restrictive cardiomyopathy, suggesting a possible role of viral infection and inflammation in the pathogenesis of cardiomyopathy in this species.
Rapid isothermal detection of Phytophthora species on plant samples using recombinase polymerase amplification

USDA-ARS?s Scientific Manuscript database

Recently several isothermal amplification techniques have been developed that are extremely tolerant towards inhibitors present in many plant extracts. Recombinase polymerase amplification (RPA) assays for the genus Phytophthora have been developed which provide a simple and rapid method to macerate...

Rapid detection of the Vibrio cholerae ctx gene in food enrichments using real-time polymerase chain reaction.

PubMed

Fedio, Willis; Blackstone, George M; Kikuta-Oshima, Lynne; Wendakoon, Chitra; McGrath, Timothy H; DePaola, Angelo

2007-01-01

A real-time polymerase chain reaction (qPCR) assay for the detection of the ctxA gene of toxigenic Vibrio cholerae (Vc) was validated against standard culture techniques. The first experimental phase determined optimal enrichment conditions for detection by culture and qPCR of Vc in shrimp, bottled water, milk, and potato salad. The conditions tested included temperature (35 and 42 degrees C), time (6 and 18 h), and effect of shaking (0 and 100 rpm). No definitive trends were found with enrichment temperature or shaking on Vc isolation frequency or detection by qPCR. Generally, Vc was detected by qPCR more frequently than Vc was isolated, but this difference was significant only in the 35 degrees C 6 h enrichment without shaking. In the second phase of experiments, shrimp, bottled water, milk, potato salad, and oysters were inoculated with each of 3 toxigenic Vc strains (Latin American O1 strain, an O139 strain, and an O1 strain from the U.S. Gulf Coast) and enriched under static conditions at 42OC for 6 and 18 h. Overall, detection frequency of ctx by qPCR was 98% (88/90) and 100% (90/90) after 6 and 18 h enrichments, respectively, while Vc isolation frequency was 87% (78/90) and 83% (75/90) after 6 and 18 h, respectively. Toxigenic Vc can be detected by qPCR within an 8 h work day using the 6 h enrichment procedure, assuming an initial level of at least 1-2 colony-forming units/g; however, overnight enrichment may be necessary to detect lower levels. These data indicate that the qPCR assay for ctx is a more reliable, sensitive, and rapid alternative to standard Vc culture methods and is applicable to diverse food products.
Performance of transport and selective media for swine Bordetella bronchiseptica recovery and it comparison to polymerase chain reaction detection

PubMed Central

Coutinho, Tania Alen; Bernardi, Mari Lourdes; de Itapema Cardoso, Marisa Ribeiro; Borowski, Sandra Maria; Moreno, Andrea Micke; de Barcellos, David Emilio Santos Neves

2009-01-01

Three comparative assays were performed seeking to improve the sensitivity of the diagnosis of Bordetella bronchiseptica infection analyzing swine nasal swabs. An initial assay compared the recovery of B. bronchiseptica from swabs simultaneously inoculated with B. bronchiseptica and some interfering bacteria, immersed into three transport formulations (Amies with charcoal, trypticase soy broth and phosphate buffer according to Soerensen supplemented with 5% of bovine fetal serum) and submitted to different temperatures (10°C and 27°C) and periods of incubation (24, 72 and 120 hours). A subsequent assay compared three selective media (MacConkey agar, modified selective medium G20G and a ceftiofur medium) for their recovery capabilities from clinical specimens. One last assay compared the polymerase chain reaction to the three selective media. In the first assay, the recovery of B. bronchiseptica from transport systems was better at 27°C and the three formulations had good performances at this temperature, but the collection of qualitative and quantitative analysis indicated the advantage of Amies medium for nasal swabs transportation. The second assay indicated that MacConkey agar and modified G20G had similar results and were superior to the ceftiofur medium. In the final assay, polymerase chain reaction presented superior capability of B. bronchiseptica detection to culture procedures. PMID:24031390
Detection and Typing of Human Papilloma Viruses by Nested Multiplex Polymerase Chain Reaction Assay in Cervical Cancer

PubMed Central

Jalal Kiani, Seyed; Shatizadeh Malekshahi, Somayeh; Yousefi Ghalejoogh, Zohreh; Ghavvami, Nastaran; Shafiei Jandaghi, Nazanin Zahra; Shahsiah, Reza; Jahanzad, Isa; Yavarian, Jila

2015-01-01

Background: Cervical cancer is the leading cause of death from cancer in under-developed countries. Human papilloma virus (HPV) 16 and 18 are the most prevalent types associated with carcinogenesis in the cervix. Conventional Polymerase Chain Reaction (PCR), type-specific and consensus primer-based PCR followed by sequencing, Restriction Fragment Length Polymorphism (RFLP) or hybridization by specific probes are common methods for HPV detection and typing. In addition, some researchers have developed a multiplex PCR for simultaneous detection and typing of different HPVs. Objectives: The aim of the present study was to investigate the prevalence of HPV infection and its types in cervical Squamous Cell Carcinoma (SCC) using the Nested Multiplex PCR (NMPCR) assay. Patients and Methods: Sixty-six samples with histologically confirmed SCC were evaluated. Total DNA was isolated by phenol–chloroform extraction and ethanol precipitation. Nested multiplex PCR was performed with first-round PCR by GP-E6/E7 consensus primers for amplification of the genomic DNA of all known mucosal HPV genotypes and second-round PCR by type-specific multiplex PCR primer cocktails. Results: Human papilloma virus infection was detected in 78.8% of samples, with the highest prevalence of HPV 16 (60.6%) while concurrent infections with two types was detected in 10.6%. Conclusions: The NMPCR assay is more convenient and easy for analysis of results, which is important for fast diagnosis and patient management, in a type-specific manner. PMID:26865940
Isothermal strand-displacement polymerase reaction for visual detection of the Southeast Asian-type deletion of α-thalassemia.

PubMed

Yu, Luxin; Wu, Wei; Lie, Puchang; Liu, Yunhua; Zeng, Lingwen

2013-11-01

A rapid and reliable screening test for thalassemia carrier couples is the most effective strategy to decrease the risk of conceiving fetuses with severe thalassemia. We present an approach based on the isothermal strand-displacement polymerase reaction and the use of a lateral flow strip for the visual detection of an α-thalassemia Southeast Asian-type deletion. This assay was used to evaluate 86 clinical samples (72 cases of Southeast Asian-type deletions and 14 cases of other types of thalassemia), and the results obtained were 100% consistent with those obtained using conventional gap-PCR. The approach thus provides a simple, sensitive, rapid, and cost-effective method for the diagnosis of thalassemia genotypes. Copyright © 2013 American Society for Investigative Pathology and the Association for Molecular Pathology. Published by Elsevier Inc. All rights reserved.
Development of a rapid diagnostic assay for the detection of tomato chlorotic dwarf viroid based on isothermal reverse-transcription-recombinase polymerase amplification.

PubMed

Hammond, Rosemarie W; Zhang, Shulu

2016-10-01

A molecular diagnostic assay utilizing reverse transcription-recombinase polymerase amplification (RT-RPA) at an isothermal constant temperature of 39°C and target-specific primers and probe were developed for the rapid, sensitive, and specific detection of tomato chlorotic dwarf viroid (TCDVd) in infected leaf and seed tissues. The performance of the AmplifyRP(®) Acceler8™ RT-RPA diagnostic assay, utilizing a lateral flow strip contained within an amplicon detection chamber, was evaluated and the results were compared with a standard RT-PCR assay. The AmplifyRP(®) Acceler8™ assay was specific for TCDVd in leaf and seed tissues, its sensitivity was comparable to conventional RT-PCR in leaf tissues, and it does not require extensive sample purification, specialized equipment, or technical expertise. This is the first report utilizing an RT-RPA assay to detect viroids and the assay can be used both in the laboratory and in the field for TCDVd detection. Published by Elsevier B.V.
Detection of pathogenic Yersinia enterocolitica in foods and water by immunomagnetic separation, nested polymerase chain reactions, and colorimetric detection of amplified DNA.

PubMed Central

Kapperud, G; Vardund, T; Skjerve, E; Hornes, E; Michaelsen, T E

1993-01-01

A two-step polymerase chain reaction (PCR) procedure with two nested pairs of primers specific for the yadA gene of Yersinia enterocolitica was developed. The PCR assay identified all common pathogenic serogroups (O:3, O:5,27, O:8, O:9, O:13, and O:21) from three continents and differentiated pathogenic Y. enterocolitica from Y. pseudotuberculosis and from a variety of nonpathogenic yersiniae representing 25 serogroups and four species. The performance of the method was evaluated with seeded food and water samples. We compared two procedures for sample preparation prior to PCR: one was based on immunomagnetic separation of the target bacteria from the sample, using magnetic particles coated with immunoglobulin antibodies to Y. enterocolitica serogroup O:3, and the other method consisted of a series of centrifugation steps combined with proteinase treatment. Regardless of the method used, the PCR assay was capable of detecting 10 to 30 CFU/g of meat in 10(6)-fold excess of indigenous bacteria. When the samples were enriched overnight in a nonselective medium, the sensitivity was increased to approximately 2 CFU/g, except for samples with an extremely high background flora (> 10(7) CFU/g). We compared gel electrophoretic detection of PCR products with a colorimetric detection method designated DIANA (detection of immobilized amplified nucleic acids), which enabled easy visualization of amplified fragments in a microtiter plate format with an optical density reader. DIANA and gel electrophoresis showed complete concordance in their discrimination between positive and negative samples. The combination of immunomagnetic separation, nested PCR, and DIANA makes possible the development of a fully automated analytic process which requires a minimum of laboratory manipulations. Images PMID:8215366
Rapid and sensitive detection of canine distemper virus by real-time reverse transcription recombinase polymerase amplification.

PubMed

Wang, Jianchang; Wang, Jinfeng; Li, Ruiwen; Liu, Libing; Yuan, Wanzhe

2017-08-15

Canine distemper, caused by Canine distemper virus (CDV), is a highly contagious and fatal systemic disease in free-living and captive carnivores worldwide. Recombinase polymerase amplification (RPA), as an isothermal gene amplification technique, has been explored for the molecular detection of diverse pathogens. A real-time reverse transcription RPA (RT-RPA) assay for the detection of canine distemper virus (CDV) using primers and exo probe targeting the CDV nucleocapsid protein gene was developed. A series of other viruses were tested by the RT-RPA.Thirty-two field samples were further tested by RT-RPA, and the resuts were compared with those obtained by the real-time RT-PCR. The RT-RPA assay was performed successfully at 40 °C, and the results were obtained within 3 min-12 min. The assay could detect CDV, but did not show cross-detection of canine parvovirus-2 (CPV-2), canine coronavirus (CCoV), canine parainfluenza virus (CPIV), pseudorabies virus (PRV) or Newcastle disease virus (NDV), demonstrating high specificity. The analytical sensitivity of RT-RPA was 31.8 copies in vitro transcribed CDV RNA, which is 10 times lower than the real-time RT-PCR. The assay performance was validated by testing 32 field samples and compared to real-time RT-PCR. The results indicated an excellent correlation between RT-RPA and a reference real-time RT-PCR method. Both assays provided the same results, and R 2 value of the positive results was 0.947. The results demonstrated that the RT-RPA assay offers an alternative tool for simple, rapid, and reliable detection of CDV both in the laboratory and point-of-care facility, especially in the resource-limited settings.
Observations of (S III) emission from Galactic radio sources - The detection of distant planetary nebulae and a search for supernova remnant emission

NASA Technical Reports Server (NTRS)

Kistiakowsky, V.; Helfand, D. J.

1993-01-01

Narrow-band near-infrared imaging observations at wavelengths corresponding to forbidden S III 9069,9532 A have been carried out at the MDM 1.3 m telescope for 23 radio sources near the Galactic plane in an attempt to detect emission associated with nebulae marking the endpoints of stellar evolution. While none of the known remnants or remnant candidates were detected, 10 of the 11 PN candidates from a new radio imaging survey of the Galactic plane were clearly seen in the forbidden S III 9532 A line. We present a calculation of the relative efficacy of searching for PNe in the forbidden O III and forbidden S III lines; for the majority of all PNe, the observed forbidden S III 9532 A line is predicted to be stronger than forbiden O III 5007 A whenever the visual extinction exceeds 3 magnitudes. This makes forbidden S III the superior tracer of PNe at distances exceeding a few kpc. We briefly comment on the significance of this approach to defining the spatial distribution of the PN population of the Galaxy.
A plasmid-based lacZα gene assay for DNA polymerase fidelity measurement

PubMed Central

Keith, Brian J.; Jozwiakowski, Stanislaw K.; Connolly, Bernard A.

2013-01-01

A significantly improved DNA polymerase fidelity assay, based on a gapped plasmid containing the lacZα reporter gene in a single-stranded region, is described. Nicking at two sites flanking lacZα, and removing the excised strand by thermocycling in the presence of complementary competitor DNA, is used to generate the gap. Simple methods are presented for preparing the single-stranded competitor. The gapped plasmid can be purified, in high amounts and in a very pure state, using benzoylated–naphthoylated DEAE–cellulose, resulting in a low background mutation frequency (∼1 × 10−4). Two key parameters, the number of detectable sites and the expression frequency, necessary for measuring polymerase error rates have been determined. DNA polymerase fidelity is measured by gap filling in vitro, followed by transformation into Escherichia coli and scoring of blue/white colonies and converting the ratio to error rate. Several DNA polymerases have been used to fully validate this straightforward and highly sensitive system. PMID:23098700
Detection of periodontal bacteria in thrombi of patients with acute myocardial infarction by polymerase chain reaction.

PubMed

Ohki, Takahiro; Itabashi, Yuji; Kohno, Takashi; Yoshizawa, Akihiro; Nishikubo, Shuichi; Watanabe, Shinya; Yamane, Genyuki; Ishihara, Kazuyuki

2012-02-01

Numerous reports have demonstrated that periodontal bacteria are present in plaques from atherosclerotic arteries. Although periodontitis has recently been recognized as a risk factor for coronary artery disease, the direct relationship between periodontal bacteria and coronary artery disease has not yet been clarified. It has been suggested that these bacteria might contribute to inflammation and plaque instability. We assumed that if periodontal bacteria induce inflammation of plaque, the bacteria would be released into the bloodstream when vulnerable plaque ruptures. To determine whether periodontal bacteria are present in thrombi at the site of acute myocardial infarction, we tried to detect periodontal bacteria in thrombi of patients with acute myocardial infarction by polymerase chain reaction (PCR). We studied 81 consecutive adults with ST-segment elevation acute myocardial infarction who underwent primary percutaneous coronary intervention (PCI). All patients underwent removal of thrombus with aspiration catheters at the beginning of percutaneous coronary intervention, and a small sample of thrombus was obtained for PCR. The detection rates of periodontal bacteria by PCR were 19.7% for Aggregatibacter actinomycetemcomitans, 3.4% for Porphyromonas gingivalis, and 2.3% for Treponema denticola. Three species of periodontal bacteria were detected in the thrombi of patients with acute myocardial infarction. This raises the possibility that such bacteria are latently present in plaque and also suggests that these bacteria might have a role in plaque inflammation and instability. Copyright © 2012 Mosby, Inc. All rights reserved.
Evaluation of RealStar Reverse Transcription–Polymerase Chain Reaction Kits for Filovirus Detection in the Laboratory and Field

PubMed Central

Rieger, Toni; Kerber, Romy; El Halas, Hussein; Pallasch, Elisa; Duraffour, Sophie; Günther, Stephan; Ölschläger, Stephan

2016-01-01

Background. Diagnosis of Ebola virus (EBOV) disease (EVD) requires laboratory testing. Methods. The RealStar Filovirus Screen reverse transcription–polymerase chain reaction (RT-PCR) kit and the derived RealStar Zaire Ebolavirus RT-PCR kit were validated using in vitro transcripts, supernatant of infected cell cultures, and clinical specimens from patients with EVD. Results. The Filovirus Screen kit detected EBOV, Sudan virus, Taï Forest virus, Bundibugyo virus, Reston virus, and Marburg virus and differentiated between the genera Ebolavirus and Marburgvirus. The amount of filovirus RNA that could be detected with a probability of 95% ranged from 11 to 67 RNA copies/reaction on a LightCycler 480 II. The Zaire Ebolavirus kit is based on the Filovirus Screen kit but was optimized for detection of EBOV. It has an improved signal-to-noise ratio at low EBOV RNA concentrations and is somewhat more sensitive than the Filovirus kit. Both kits show significantly lower analytical sensitivity on a SmartCycler II. Clinical evaluation revealed that the SmartCycler II, compared with other real-time PCR platforms, decreases the clinical sensitivity of the Filovirus Screen kit to diagnose EVD at an early stage. Conclusions. The Filovirus Screen kit detects all human-pathogenic filoviruses with good analytical sensitivity if performed on an appropriate real-time PCR platform. High analytical sensitivity is important for early diagnosis of EVD. PMID:27549586
A Novel Strategy for Human Papillomavirus Detection and Genotyping with SybrGreen and Molecular Beacon Polymerase Chain Reaction

PubMed Central

Szuhai, Károly; Sandhaus, Emily; Kolkman-Uljee, Sandra M.; Lemaître, Marc; Truffert, Jean-Christophe; Dirks, Roeland W.; Tanke, Hans J.; Fleuren, Gert Jan; Schuuring, Ed; Raap, Anton K.

2001-01-01

Human papillomaviruses (HPVs) play an important role in the pathogenesis of cervical cancer. For identification of the large number of different HPV types found in (pre)malignant lesions, a robust methodology is needed that combines general HPV detection with HPV genotyping. We have developed for formaldehyde-fixed samples a strategy that, in a homogenous, real-time fluorescence polymerase chain reaction (PCR)-based assay, accomplishes general HPV detection by SybrGreen reporting of HPV-DNA amplicons, and genotyping of seven prevalent HPV types (HPV-6, -11, -16, -18, -31, -33, -45) by real-time molecular beacon PCR. The false-positive rate of the HPV SybrGreen-PCR was 4%, making it well suited as a prescreening, general HPV detection technology. The type specificity of the seven selected HPV molecular beacons was 100% and double infections were readily identified. The multiplexing capacity of the HPV molecular beacon PCR was analyzed and up to three differently labeled molecular beacons could be used in one PCR reaction without observing cross talk. The inherent quantitation capacities of real-time fluorescence PCR allowed the determination of average HPV copy number per cell. We conclude that the HPV SybrGreen-PCR in combination with the HPV molecular beacon PCR provides a robust, sensitive, and quantitative general HPV detection and genotyping methodology. PMID:11696426
Development of a polymerase chain reaction assay for the rapid detection of the oral pathogenic bacterium, Selenomonas noxia.

PubMed

Cruz, Patricia; Mehretu, Arthuro M; Buttner, Mark P; Trice, Theresa; Howard, Katherine M

2015-08-14

In recent studies, periodontal health has been linked to being overweight and/or obese. Among common oral bacteria, Selenomonas noxia has been implicated in converting periodontal health to disease, and Selenomonas species have also been found in gastric ulcers. The objective of this study was to develop and validate a quantitative polymerase chain reaction (qPCR) assay for the specific and rapid detection of S. noxia. Two oligonucleotide primer pairs and one probe were designed and tested to determine optimal amplification signal with three strains of S. noxia. The PCR assay was tested against fourteen non-target organisms, including closely related oral Selenomonads, one phylogenetically closely related bacterium, and two commonly isolated oral bacteria. One of the primer sets was more sensitive at detecting the target organism and was selected for optimization and validation experiments. The designed primers and probe amplified the target organism with 100% specificity. PCR inhibition was observed with an internal positive control, and inhibition was resolved by diluting the DNA extract. The qPCR assay designed in this study can be used to specifically detect S. noxia in the clinical setting and in future research involving the enhanced detection of S. noxia. The assay can also be used in epidemiological studies for understanding the role of S. noxia in disease processes including, but not limited to, oral health and obesity of infectious origin.
Detection of Mycobacterium tuberculosis complex by nested polymerase chain reaction in pulmonary and extrapulmonary specimens* ,**

PubMed Central

Furini, Adriana Antônia da Cruz; Pedro, Heloisa da Silveira Paro; Rodrigues, Jean Francisco; Montenegro, Lilian Maria Lapa; Machado, Ricardo Luiz Dantas; Franco, Célia; Schindler, Haiana Charifker; Batista, Ida Maria Foschiani Dias; Rossit, Andrea Regina Baptista

2013-01-01

OBJECTIVE: To compare the performance of nested polymerase chain reaction (NPCR) with that of cultures in the detection of the Mycobacterium tuberculosis complex in pulmonary and extrapulmonary specimens. METHODS: We analyzed 20 and 78 pulmonary and extrapulmonary specimens, respectively, of 67 hospitalized patients suspected of having tuberculosis. An automated microbial system was used for the identification of Mycobacterium spp. cultures, and M. tuberculosis IS6110 was used as the target sequence in the NPCR. The kappa statistic was used in order to assess the level of agreement among the results. RESULTS: Among the 67 patients, 6 and 5, respectively, were diagnosed with pulmonary and extrapulmonary tuberculosis, and the NPCR was positive in all of the cases. Among the 98 clinical specimens, smear microscopy, culture, and NPCR were positive in 6.00%, 8.16%, and 13.26%, respectively. Comparing the results of NPCR with those of cultures (the gold standard), we found that NPCR had a sensitivity and specificity of 100% and 83%, respectively, in pulmonary specimens, compared with 83% and 96%, respectively, in extrapulmonary specimens, with good concordance between the tests (kappa, 0.50 and 0.6867, respectively). CONCLUSIONS: Although NPCR proved to be a very useful tool for the detection of M. tuberculosis complex, clinical, epidemiological, and other laboratory data should also be considered in the diagnosis and treatment of pulmonary and extrapulmonary tuberculosis. PMID:24473765
A fluorescence microplate screen assay for the detection of neurite outgrowth and neurotoxicity using an antibody against βIII-tubulin.

PubMed

Popova, Dina; Jacobsson, Stig O P

2014-04-01

The majority of environmental and commercial chemicals have not been evaluated for their potential to cause neurotoxicity. We have investigated if neuron specific anti-βIII-tubulin antibodies are useful in a microplate assay of neurite outgrowth of retinoic acid-induced neurons from mouse P19 embryonal carcinoma cells. By incubating the P19-derived neurons with the primary anti-βIII-tubulin antibody and a secondary Alexa Fluor 488-conjugated antibody, followed by measuring the fluorescence in a microplate reader, a time-dependent increase in anti-βIII-tubulin immunofluorescence was observed. The relative fluorescence units increased by 4.3-fold from 2 to 10 days in culture. The results corresponded well with those obtained by semi-automatic tracing of neurites in fluorescence microscopy images of βIII-tubulin-labeled neurons. The sensitivity of the neurite outgrowth assay using a microplate reader to detect neurotoxicity produced by nocodazole, methyl mercury chloride and okadaic acid was significantly higher than for a cell viability assay measuring intracellular fluorescence of calcein-AM. The microplate-based method to measure toxicity targeting neurites using anti-βIII-tubulin antibodies is however less sensitive than the extracellular lactate dehydrogenase activity assay to detect general cytotoxicity produced by high concentrations of clomipramine, or glutamate-induced excitotoxicity. In conclusion, the fluorescence microplate assay for the detection of neurite outgrowth by measuring changes in βIII-tubulin immunoreactivity is a rapid and sensitive method to assess chemical- or toxin-induced neurite toxicity. Copyright © 2013 Elsevier Ltd. All rights reserved.
Eukaryote-Made Thermostable DNA Polymerase Enables Rapid PCR-Based Detection of Mycoplasma, Ureaplasma and Other Bacteria in the Amniotic Fluid of Preterm Labor Cases.

PubMed

Ueno, Tomohiro; Niimi, Hideki; Yoneda, Noriko; Yoneda, Satoshi; Mori, Masashi; Tabata, Homare; Minami, Hiroshi; Saito, Shigeru; Kitajima, Isao

2015-01-01

Intra-amniotic infection has long been recognized as the leading cause of preterm delivery. Microbial culture is the gold standard for the detection of intra-amniotic infection, but several days are required, and many bacterial species in the amniotic fluid are difficult to cultivate. We developed a novel nested-PCR-based assay for detecting Mycoplasma, Ureaplasma, other bacteria and fungi in amniotic fluid samples within three hours of sample collection. To detect prokaryotes, eukaryote-made thermostable DNA polymerase, which is free from bacterial DNA contamination, is used in combination with bacterial universal primers. In contrast, to detect eukaryotes, conventional bacterially-made thermostable DNA polymerase is used in combination with fungal universal primers. To assess the validity of the PCR assay, we compared the PCR and conventional culture results using 300 amniotic fluid samples. Based on the detection level (positive and negative), 93.3% (280/300) of Mycoplasma, 94.3% (283/300) of Ureaplasma, 89.3% (268/300) of other bacteria and 99.7% (299/300) of fungi matched the culture results. Meanwhile, concerning the detection of bacteria other than Mycoplasma and Ureaplasma, 228 samples were negative according to the PCR method, 98.2% (224/228) of which were also negative based on the culture method. Employing the devised primer sets, mixed amniotic fluid infections of Mycoplasma, Ureaplasma and/or other bacteria could be clearly distinguished. In addition, we also attempted to compare the relative abundance in 28 amniotic fluid samples with mixed infection, and judged dominance by comparing the Ct values of quantitative real-time PCR. We developed a novel PCR assay for the rapid detection of Mycoplasma, Ureaplasma, other bacteria and fungi in amniotic fluid samples. This assay can also be applied to accurately diagnose the absence of bacteria in samples. We believe that this assay will positively contribute to the treatment of intra-amniotic infection and
Eukaryote-Made Thermostable DNA Polymerase Enables Rapid PCR-Based Detection of Mycoplasma, Ureaplasma and Other Bacteria in the Amniotic Fluid of Preterm Labor Cases

PubMed Central

Yoneda, Noriko; Yoneda, Satoshi; Mori, Masashi; Tabata, Homare; Minami, Hiroshi; Saito, Shigeru; Kitajima, Isao

2015-01-01

Background Intra-amniotic infection has long been recognized as the leading cause of preterm delivery. Microbial culture is the gold standard for the detection of intra-amniotic infection, but several days are required, and many bacterial species in the amniotic fluid are difficult to cultivate. Methods We developed a novel nested-PCR-based assay for detecting Mycoplasma, Ureaplasma, other bacteria and fungi in amniotic fluid samples within three hours of sample collection. To detect prokaryotes, eukaryote-made thermostable DNA polymerase, which is free from bacterial DNA contamination, is used in combination with bacterial universal primers. In contrast, to detect eukaryotes, conventional bacterially-made thermostable DNA polymerase is used in combination with fungal universal primers. To assess the validity of the PCR assay, we compared the PCR and conventional culture results using 300 amniotic fluid samples. Results Based on the detection level (positive and negative), 93.3% (280/300) of Mycoplasma, 94.3% (283/300) of Ureaplasma, 89.3% (268/300) of other bacteria and 99.7% (299/300) of fungi matched the culture results. Meanwhile, concerning the detection of bacteria other than Mycoplasma and Ureaplasma, 228 samples were negative according to the PCR method, 98.2% (224/228) of which were also negative based on the culture method. Employing the devised primer sets, mixed amniotic fluid infections of Mycoplasma, Ureaplasma and/or other bacteria could be clearly distinguished. In addition, we also attempted to compare the relative abundance in 28 amniotic fluid samples with mixed infection, and judged dominance by comparing the Ct values of quantitative real-time PCR. Conclusions We developed a novel PCR assay for the rapid detection of Mycoplasma, Ureaplasma, other bacteria and fungi in amniotic fluid samples. This assay can also be applied to accurately diagnose the absence of bacteria in samples. We believe that this assay will positively contribute to the
Competitive fitness during feast and famine: how SOS DNA polymerases influence physiology and evolution in Escherichia coli.

PubMed

Corzett, Christopher H; Goodman, Myron F; Finkel, Steven E

2013-06-01

Escherichia coli DNA polymerases (Pol) II, IV, and V serve dual roles by facilitating efficient translesion DNA synthesis while simultaneously introducing genetic variation that can promote adaptive evolution. Here we show that these alternative polymerases are induced as cells transition from exponential to long-term stationary-phase growth in the absence of induction of the SOS regulon by external agents that damage DNA. By monitoring the relative fitness of isogenic mutant strains expressing only one alternative polymerase over time, spanning hours to weeks, we establish distinct growth phase-dependent hierarchies of polymerase mutant strain competitiveness. Pol II confers a significant physiological advantage by facilitating efficient replication and creating genetic diversity during periods of rapid growth. Pol IV and Pol V make the largest contributions to evolutionary fitness during long-term stationary phase. Consistent with their roles providing both a physiological and an adaptive advantage during stationary phase, the expression patterns of all three SOS polymerases change during the transition from log phase to long-term stationary phase. Compared to the alternative polymerases, Pol III transcription dominates during mid-exponential phase; however, its abundance decreases to <20% during long-term stationary phase. Pol IV transcription dominates as cells transition out of exponential phase into stationary phase and a burst of Pol V transcription is observed as cells transition from death phase to long-term stationary phase. These changes in alternative DNA polymerase transcription occur in the absence of SOS induction by exogenous agents and indicate that cell populations require appropriate expression of all three alternative DNA polymerases during exponential, stationary, and long-term stationary phases to attain optimal fitness and undergo adaptive evolution.
Development of two real-time polymerase chain reaction assays to detect Actinobacillus pleuropneumoniae serovars 1-9-11 and serovar 2.

PubMed

Marois-Créhan, Corinne; Lacouture, Sonia; Jacques, Mario; Fittipaldi, Nahuel; Kobisch, Marylène; Gottschalk, Marcelo

2014-01-01

Two real-time, or quantitative, polymerase chain reaction (qPCR) assays were developed to detect Actinobacillus pleuropneumoniae serovars 1-9-11 (highly related serovars with similar virulence potential) and serovar 2, respectively. The specificity of these assays was verified on a collection of 294 strains, which included all 16 reference A. pleuropneumoniae strains (including serovars 5a and 5b), 263 A. pleuropneumoniae field strains isolated between 1992 and 2009 in different countries, and 15 bacterial strains other than A. pleuropneumoniae. The detection levels of both qPCR tests were evaluated using 10-fold dilutions of chromosomal DNA from reference strains of A. pleuropneumoniae serovars 1 and 2, and the detection limit for both assays was 50 fg per assay. The analytical sensitivities of the qPCR tests were also estimated by using pure cultures and tonsils experimentally spiked with A. pleuropneumoniae. The detection threshold was 2.5 × 10(4) colony forming units (CFU)/ml and 2.9 × 10(5) CFU/0.1 g of tonsil, respectively, for both assays. These specific and sensitive tests can be used for the serotyping of A. pleuropneumoniae in diagnostic laboratories to control porcine pleuropneumonia.
Real-time polymerase chain reaction assay for rapid and sensitive detection of anthrax spores in spiked soil and talcum powder.

PubMed

Jain, Neha; Merwyn, S; Rai, G P; Agarwal, G S

2012-05-01

Real-time polymerase chain reaction (real-time PCR) is a laboratory technique based on PCR. This technique is able to detect sequence-specific PCR products as they accumulate in "real time" during the PCR amplification, and also to quantify the number of substrates present in the initial PCR mixture before amplification begins. In the present study, real-time PCR assay was employed for rapid and real-time detection of Bacillus anthracis spores spiked in 0.1 g of soil and talcum powder ranging from 5 to 10(7) spores. DNA was isolated from spiked soil and talcum powder, using PBS containing 1 % Triton-X-100, followed by heat treatment. The isolated DNA was used as template for real-time PCR and PCR. Real-time PCR amplification was obtained in 60 min under the annealing condition at 60°C by employing primers targeting the pag gene of B. anthracis. In the present study, the detection limit of real-time PCR assay in soil was 10(3) spores and 10(2) spores in talcum powder, respectively, whereas PCR could detect 10(4) spores in soil and 10(3) spores in talcum powder, respectively.

Comparison between culture and a multiplex quantitative real-time polymerase chain reaction assay detecting Ureaplasma urealyticum and U. parvum.

PubMed

Frølund, Maria; Björnelius, Eva; Lidbrink, Peter; Ahrens, Peter; Jensen, Jørgen Skov

2014-01-01

A novel multiplex quantitative real-time polymerase chain reaction (qPCR) for simultaneous detection of U. urealyticum and U. parvum was developed and compared with quantitative culture in Shepard's 10 C medium for ureaplasmas in urethral swabs from 129 men and 66 women, and cervical swabs from 61 women. Using culture as the gold standard, the sensitivity of the qPCR was 96% and 95% for female urethral and cervical swabs, respectively. In male urethral swabs the sensitivity was 89%. The corresponding specificities were 100%, 87% and 99%. The qPCR showed a linear increasing DNA copy number with increasing colour-changing units. Although slightly less sensitive than culture, this multiplex qPCR assay detecting U. urealyticum and U. parvum constitutes a simple and fast alternative to the traditional methods for identification of ureaplasmas and allows simultaneous species differentiation and quantitation in clinical samples. Furthermore, specimens overgrown by other bacteria using the culture method can be evaluated in the qPCR.
Simultaneous detection of viruses and Toxoplasma gondii in cerebrospinal fluid specimens by multiplex polymerase chain reaction-based reverse hybridization assay.

PubMed

Del Prete, Raffaele; Di Taranto, Anna Maria; Lipsi, Maria Rosaria; Natalicchio, Maria Iole; Antonetti, Raffaele; Miragliotta, Giuseppe

2009-04-01

The lack of rapidity and the low sensitivity and specificity of traditional laboratory methods limits their usefulness in the laboratory diagnosis of viral central nervous system (CNS) infections. This study describes the use of a commercially available multiplex polymerase chain reaction (mPCR)-based reverse hybridization assay (RHA) for the simultaneous detection of the genomes of 8 viruses and Toxoplasma gondii in cerebrospinal fluids (CSF) from 181 patients suspected of having viral meningitis. Twenty-two/181 (12.15%) CSF samples resulted positive by mPCR. Eighteen/22 were positive for 1 viral pathogen, whereas a dual infection was detected in 4/22 samples. Epstein-Barr virus (EBV) was the most commonly detected virus (6/22), followed by herpes simplex virus type-1 (HSV-1) (5/22) and -2 (HSV-2) (4/22). Cytomegalovirus (CMV), human herpesvirus-6 (HHV-6), and Epstein-Barr virus (EBV) were detected in 1 specimen each. Two CSF samples were co-infected by HSV-1/HSV-2, 1 sample by HHV-6/T. gondii, and 1 sample by EBV/EV, respectively. Our data support the usefulness of mPCR as a rapid molecular method for the simultaneous detection of major viral pathogens and T. gondii in aseptic meningitis also to allow the earlier application of specific antiviral therapy.
Structural basis for recognition and sequestration of UUU(OH) 3' temini of nascent RNA polymerase III transcripts by La, a rheumatic disease autoantigen.

PubMed

Teplova, Marianna; Yuan, Yu-Ren; Phan, Anh Tuân; Malinina, Lucy; Ilin, Serge; Teplov, Alexei; Patel, Dinshaw J

2006-01-06

The nuclear phosphoprotein La was identified as an autoantigen in patients with systemic lupus erythematosus and Sjogren's syndrome. La binds to and protects the UUU(OH) 3' terminii of nascent RNA polymerase III transcripts from exonuclease digestion. We report the 1.85 angstroms crystal structure of the N-terminal domain of human La, consisting of La and RRM1 motifs, bound to r(U1-G2-C3-U4-G5-U6-U7-U8-U9OH). The U7-U8-U9OH 3' end, in a splayed-apart orientation, is sequestered within a basic and aromatic amino acid-lined cleft between the La and RRM1 motifs. The specificity-determining U8 residue bridges both motifs, in part through unprecedented targeting of the beta sheet edge, rather than the anticipated face, of the RRM1 motif. Our structural observations, supported by mutation studies of both La and RNA components, illustrate the principles behind RNA sequestration by a rheumatic disease autoantigen, whereby the UUU(OH) 3' ends of nascent RNA transcripts are protected during downstream processing and maturation events.
Reverse transcription recombinase polymerase amplification assay for the rapid detection of type 2 porcine reproductive and respiratory syndrome virus.

PubMed

Wang, Jian-Chang; Yuan, Wan-Zhe; Han, Qing-An; Wang, Jin-Feng; Liu, Li-Bing

2017-05-01

Porcine reproductive and respiratory syndrome virus (PRRSV) is one of the most important pathogens in pigs, and has tremendous negative economic impact on the swine industry worldwide. PRRSV is classified into the two distinct genotypes: type 1 and type 2, and most of the described PRRSV isolates in China are type 2. Rapid and sensitive detection of PRRSV is of great importance for the disease control and regional eradication programs. Recombinase polymerase amplification (RPA) has emerged as a novel isothermal amplification technology for the molecular diagnosis of infectious diseases. In this study, a fluorescence reverse transcription RPA (RT-RPA) assay was developed to detect the type 2 PRRSV using primers and exo probe specific for the viral nucleocapsid gene. The reaction was performed at 40°C within 20min. The RT-RPA assay could detect both the classical (C-PRRSV) and highly pathogenic PRRSV (HP-PRRSV), but there was no cross-reaction to other pathogens. Using the in vitro transcribed PRRSV RNA as template, the analytical sensitivity of RT-RPA was 690 copies. The assay performance was evaluated by testing 60 field samples and compared to real-time RT-PCR. The detection rate of RT-RPA was 86.6% (52/60), while the detection rate of real-time RT-PCR was 83.3% (50/60). This simple, rapid and reliable method could be potentially applied for rapid detection of PRRSV in point-of-care and rural areas. Copyright © 2017 Elsevier B.V. All rights reserved.
Ultrasensitive electrochemical DNA detection based on dual amplification of circular strand-displacement polymerase reaction and hybridization chain reaction.

PubMed

Wang, Cui; Zhou, Hui; Zhu, Wenping; Li, Hongbo; Jiang, Jianhui; Shen, Guoli; Yu, Ruqin

2013-09-15

We developed a novel electrochemical strategy for ultrasensitive DNA detection using a dual amplification strategy based on the circular strand-displacement polymerase reaction (CSDPR) and the hybridization chain reaction (HCR). In this assay, hybridization of hairpin-shaped capture DNA to target DNA resulted in a conformational change of the capture DNA with a concomitant exposure of its stem. The primer was then hybridized with the exposed stem and triggered a polymerization reaction, allowing a cyclic reaction comprising release of target DNA, hybridization of target with remaining capture DNA, polymerization initiated by the primer. Furthermore, the free part of the primer propagated a chain reaction of hybridization events between two DNA hairpin probes with biotin labels, enabling an electrochemical reading using the streptavidin-alkaline phosphatase. The proposed biosensor showed to have very high sensitivity and selectivity with a dynamic response range through 10fM to 1nM, and the detect limit was as low as 8fM. The proposed strategy could have the potential for molecular diagnostics in complex biological systems. Copyright © 2013 Elsevier B.V. All rights reserved.
Electrochemical Branched-DNA Assay for Polymerase Chain Reaction-Free Detection and Quantification of Oncogenes in Messenger RNA

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lee, Ai Cheng; Dai, Ziyu; Chen, Baowei

2008-12-01

We describe a novel electrochemical branched-DNA (bDNA) assay for polymerase chain reaction (PCR)-free detection and quantification of p185 BCR-ABL leukemia fusion transcript in the population of messenger RNA (mRNA) extracted from cell lines. The bDNA amplifier carrying high loading of alkaline phosphatase (ALP) tracers was used to amplify targets signal. The targets were captured on microplate well surfaces through cooperative sandwich hybridization prior to the labeling of bDNA. The activity of captured ALP was monitored by square-wave voltammetric (SWV) analysis of the electroactive enzymatic product in the presence of 1-napthyl-phosphate. The specificity and sensitivity of assay enabled direct detection ofmore » target transcript in as little as 4.6 ng mRNA without PCR amplification. In combination with the use of a well-quantified standard, the electrochemical bDNA assay was capable of direct use for a PCR-free quantitative analysis of target transcript in total mRNA population. The approach thus provides a simple, sensitive, accurate and quantitative tool alternate to the RQ-PCR for early disease diagnosis.« less
Rapid detection of HLA-B*51 by real-time polymerase chain reaction and high-resolution melting analysis.

PubMed

Imperiali, C; Alía-Ramos, P; Padró-Miquel, A

2015-08-01

HLA-B*51, a class I human leukocyte antigen (HLA) molecule, is the strongest known genetic risk factor for Behçet disease. However, there are only few articles reporting methods to determine the presence or absence of HLA-B51. For this reason, we designed and developed an easy, fast, and inexpensive real-time high-resolution melting (HRM) assay to detect HLA-B*51. We genotyped 61 samples by our HRM assay and by conventional polymerase chain reaction, and no discrepancies were found between results. Besides, a subgroup of 25 samples was also genotyped in a different laboratory, and another subgroup of 16 samples was obtained from the International Histocompatibility Working Group DNA Bank, and a full concordance of results was observed with those obtained by HRM. Regarding the identifying system evaluated, we obtained 100% of specificity, sensibility, and repeatability, and 0% of false positive and false negative rates. Therefore, this HRM analysis is easily applicable to the rapid detection of HLA-B*51, exhibits a high speed, and requires a very low budget. © 2015 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.
Temporal relationships between colds, upper respiratory viruses detected by polymerase chain reaction, and otitis media in young children followed through a typical cold season.

PubMed

Winther, Birgit; Alper, Cuneyt M; Mandel, Ellen M; Doyle, William J; Hendley, J Owen

2007-06-01

Otitis media is a frequent complication of a viral upper respiratory tract infection, and the reported co-incidence of those diseases increases with assay sensitivity and sampling density. We determined the incidence of otitis-media complications in young children when referenced to cold-like illnesses and to concurrent virus recovery from the nasopharynx. A total of 60 children from 24 families were followed from October 2003 through April 30, 2004, by daily parental recording of illness signs, weekly pneumatic otoscopic examinations, and periodic polymerase chain reaction assay of collected nasal fluids for common viruses. One hundred ninety-nine cold-like illnesses were observed, but a sample for virus assay was not collected concurrent with 71 episodes. Of the remainder, 73% of cold-like illnesses were temporally related to recovery of 1 or a combination of the assayed viruses, with rhinovirus predominating. For non-cold-like illness periods, 54 (18%) of 297 assays were positive for virus, and the virus frequency distribution was similar to that for cold-like illnesses. There were 93 diagnosed otitis-media episodes; 65 (70%) of these occurred during a cold-like illness. For the 79 otitis-media episodes with available nasal samples, 61 (77%) were associated with a positive virus result. In this population, the otitis-media complication rate for a cold-like illness was 33%. A cold-like illness was not a prerequisite for polymerase chain reaction detection of viruses in the nose and nasopharynx of young children. Viral detection by polymerase chain reaction in the absence of a cold-like illness is associated with complications in some subjects. Otitis media is a complication of viral infection both with and without concurrent cold-like illnesses, thus downwardly biasing coincidence estimates that use cold-based illnesses as the denominator.
Two assays for measuring fibrosis: reverse transcriptase-polymerase chain reaction of collagen alpha(1) (III) mRNA is an early predictor of subsequent collagen deposition while a novel serum N-terminal procollagen (III) propeptide assay reflects manifest fibrosis in carbon tetrachloride-treated rats.

PubMed

Kauschke, S G; Knorr, A; Heke, M; Kohlmeyer, J; Schauer, M; Theiss, G; Waehler, R; Burchardt, E R

1999-11-15

Using a novel quantitative reverse transcriptase-polymerase chain reaction assay, we have determined the amount of specific mRNA for procollagen alpha(1) (III) (PIIIP) in the carbon tetrachloride (CCl(4)) model of liver fibrosis in rats. After a single week of CCl(4) application, the amount of PIIIP mRNA was increased approximately 10 times over the untreated control group and continued to increase to approximately 30 times after 7 weeks of intoxication. In this model substantial fibrosis was demonstrated by computer-aided morphometry after 5 to 7 weeks of treatment. Using recombinant murine N-terminal procollagen alpha(1) (III) propeptide (PIIINP), a novel sensitive immunoassay for the measurement of circulating PIIINP in rodent sera was established. An increase in PIIINP serum levels was observed after 5 to 7 weeks of CCl(4) intoxication. Our results suggest PIIIP gene expression is an early marker of tissue fibrosis. Early PIIIP gene expression is correlated with the extent of the subsequent fibrosis. PIIIP mRNA levels increase much earlier than conventional histological examination or PIIINP levels. PIIINP measurements with our new serum assay, on the other hand, are a good noninvasive marker of manifest fibrosis but are a poor marker of fibrogenesis. Copyright 1999 Academic Press.
BRF1 mutations alter RNA polymerase III–dependent transcription and cause neurodevelopmental anomalies

PubMed Central

Hög, Friederike; Dentici, Maria Lisa; Tan, Perciliz L.; Sowada, Nadine; Medeira, Ana; Gueneau, Lucie; Thiele, Holger; Kousi, Maria; Lepri, Francesca; Wenzeck, Larissa; Blumenthal, Ian; Radicioni, Antonio; Schwarzenberg, Tito Livio; Mandriani, Barbara; Fischetto, Rita; Morris-Rosendahl, Deborah J.; Altmüller, Janine; Reymond, Alexandre; Nürnberg, Peter; Merla, Giuseppe; Dallapiccola, Bruno; Katsanis, Nicholas; Cramer, Patrick; Kubisch, Christian

2015-01-01

RNA polymerase III (Pol III) synthesizes tRNAs and other small noncoding RNAs to regulate protein synthesis. Dysregulation of Pol III transcription has been linked to cancer, and germline mutations in genes encoding Pol III subunits or tRNA processing factors cause neurogenetic disorders in humans, such as hypomyelinating leukodystrophies and pontocerebellar hypoplasia. Here we describe an autosomal recessive disorder characterized by cerebellar hypoplasia and intellectual disability, as well as facial dysmorphic features, short stature, microcephaly, and dental anomalies. Whole-exome sequencing revealed biallelic missense alterations of BRF1 in three families. In support of the pathogenic potential of the discovered alleles, suppression or CRISPR-mediated deletion of brf1 in zebrafish embryos recapitulated key neurodevelopmental phenotypes; in vivo complementation showed all four candidate mutations to be pathogenic in an apparent isoform-specific context. BRF1 associates with BDP1 and TBP to form the transcription factor IIIB (TFIIIB), which recruits Pol III to target genes. We show that disease-causing mutations reduce Brf1 occupancy at tRNA target genes in Saccharomyces cerevisiae and impair cell growth. Moreover, BRF1 mutations reduce Pol III–related transcription activity in vitro. Taken together, our data show that BRF1 mutations that reduce protein activity cause neurodevelopmental anomalies, suggesting that BRF1-mediated Pol III transcription is required for normal cerebellar and cognitive development. PMID:25561519
Directed evolution of DNA polymerase, RNA polymerase and reverse transcriptase activity in a single polypeptide.

PubMed

Ong, Jennifer L; Loakes, David; Jaroslawski, Szymon; Too, Kathleen; Holliger, Philipp

2006-08-18

DNA polymerases enable key technologies in modern biology but for many applications, native polymerases are limited by their stringent substrate recognition. Here we describe short-patch compartmentalized self-replication (spCSR), a novel strategy to expand the substrate spectrum of polymerases in a targeted way. spCSR is based on the previously described CSR, but unlike CSR only a short region (a "patch") of the gene under investigation is diversified and replicated. This allows the selection of polymerases under conditions where catalytic activity and processivity are compromised to the extent that full self-replication is inefficient. We targeted two specific motifs involved in substrate recognition in the active site of DNA polymerase I from Thermus aquaticus (Taq) and selected for incorporation of both ribonucleotide- (NTP) and deoxyribonucleotide-triphosphates (dNTPs) using spCSR. This allowed the isolation of multiple variants of Taq with apparent dual substrate specificity. They were able to synthesize RNA, while still retaining essentially wild-type (wt) DNA polymerase activity as judged by PCR. One such mutant (AA40: E602V, A608V, I614M, E615G) was able to incorporate both NTPs and dNTPs with the same catalytic efficiency as the wt enzyme incorporates dNTPs. AA40 allowed the generation of mixed RNA-DNA amplification products in PCR demonstrating DNA polymerase, RNA polymerase as well as reverse transcriptase activity within the same polypeptide. Furthermore, AA40 displayed an expanded substrate spectrum towards other 2'-substituted nucleotides and was able to synthesize nucleic acid polymers in which each base bore a different 2'-substituent. Our results suggest that spCSR will be a powerful strategy for the generation of polymerases with altered substrate specificity for applications in nano- and biotechnology and in the enzymatic synthesis of antisense and RNAi probes.
RNA Pol IV and V in Gene Silencing: Rebel Polymerases Evolving Away From Pol II’s Rules

PubMed Central

Zhou, Ming; Law, Julie A.

2015-01-01

Noncoding RNAs regulate gene expression at both the transcriptional and post-transcriptional levels, and play critical roles in development, imprinting and the maintenance of genome integrity in eukaryotic organisms [1–3]. Therefore, it is important to understand how the production of such RNAs are controlled. In addition to the three canonical DNA dependent RNA polymerases (Pol) Pol I, II and III, two non-redundant plant-specific RNA polymerases, Pol IV and Pol V, have been identified and shown to generate noncoding RNAs that are required for transcriptional gene silencing via the RNA-directed DNA methylation (RdDM) pathway. Thus, somewhat paradoxically, transcription is required for gene silencing. This paradox extends beyond plants, as silencing pathways in yeast, fungi, flies, worms, and mammals also require transcriptional machinery [4,5]. As plants have evolved specialized RNA polymerases to carry out gene silencing in a manner that is separate from the essential roles of Pol II, their characterization offers unique insight into how RNA polymerases facilitate gene silencing. In this review, we focus on the mechanisms of Pol IV and Pol V function, including their compositions, their transcripts, and their modes of recruitment to chromatin. PMID:26344361
Quantitative polymerase chain reaction detection of circulating DNA in serum for early diagnosis of mucormycosis in immunocompromised patients.

PubMed

Millon, Laurence; Larosa, Fabrice; Lepiller, Quentin; Legrand, Faezeh; Rocchi, Steffi; Daguindau, Etienne; Scherer, Emeline; Bellanger, Anne-Pauline; Leroy, Joel; Grenouillet, Frederic

2013-05-01

The aim of our study was to assess the detection of circulating DNA from the most common species of Mucorales for early diagnosis of mucormycosis in at-risk patients. We retrospectively evaluated a combination of 3 quantitative polymerase chain reaction (qPCR) assays using hydrolysis probes targeting Mucor/Rhizopus, Lichtheimia (formerly Absidia), and Rhizomucor for circulating Mucorales detection. Serial serum samples from 10 patients diagnosed with proven mucormycosis (2-9 samples per patient) were analyzed. No cross-reactivity was detected in the 3 qPCR assays using 19 reference strains of opportunistic fungi, and the limit of detection ranged from 3.7 to 15 femtograms/10 µL, depending on the species. DNA from Mucorales was detected in the serum of 9 of 10 patients between 68 and 3 days before mucormycosis diagnosis was confirmed by histopathological examination and/or positive culture. All the qPCR results were concordant with culture and/or PCR-based identification of the causing agents in tissue (Lichtheimia species, Rhizomucor species, and Mucor/Rhizopus species in 4, 3, and 2 patients, respectively). Quantitative PCR was negative in only 1 patient with proven disseminated mucormycosis caused by Lichtheimia species. Our study suggests that using specific qPCR targeting several species of Mucorales according to local ecology to screen at-risk patients could be useful in a clinical setting. The cost and efficacy of this strategy should be evaluated. However, given the human and economic cost of mucormycosis and the need for rapid diagnosis to initiate prompt directed antifungal therapy, this strategy could be highly attractive.
Early polymerase chain reaction detection of Chagas disease reactivation in heart transplant patients.

PubMed

da Costa, Priscilla Almeida; Segatto, Marcela; Durso, Danielle Fernandes; de Carvalho Moreira, Wagson José; Junqueira, Lucas Lodi; de Castilho, Fábio Morato; de Andrade, Silvio Amadeu; Gelape, Cláudio Léo; Chiari, Egler; Teixeira-Carvalho, Andréa; Junho Pena, Sergio Danilo; Machado, Carlos Renato; Franco, Gloria Regina; Filho, Geraldo Brasileiro; Vieira Moreira, Maria da Consolação; Mara Macedo, Andréa

2017-07-01

Heart transplantation is a valuable therapeutic option for Chagas disease patients with severe cardiomyopathy. During patient follow-up, the differential diagnosis between cardiac transplant rejection and Chagas disease infection reactivation remains a challenging task, which hinders rapid implementation of the appropriate treatment. Herein we investigate whether polymerase chain reaction (PCR) strategies could facilitate early detection of Trypanosoma cruzi (T cruzi) in transplanted endomyocardial biopsies (EMBs). In this study we analyzed 500 EMB specimens obtained from 58 chagasic cardiac transplant patients, using PCR approaches targeted to nuclear (rDNA 24Sα) and kinetoplastid (kDNA) markers, and compared the efficiency of these approaches with that of other tests routinely used. T cruzi DNA was detected in 112 EMB specimens derived from 39 patients (67.2%). The first positive result occurred at a median 1.0 month post-transplant. Conventional histopathologic, blood smear and hemoculture analyses showed lower sensitivity and higher median time to the first positive result. Patient follow-up revealed that 31 of 39 PCR-positive cases presented clinical reactivation of Chagas disease at different time-points after transplantation. PCR techniques showed considerable sensitivity (0.82) and specificity (0.60), with area under the receiver operating characteristic (ROC) curves of 0.708 (p = 0.001). Moreover, PCR techniques anticipated the clinical signs of Chagas disease reactivation by up to 36 months, with a median time of 6 months and an average of 9.1 months. We found a good association between the PCR diagnosis and the clinical signs of the disease, indicating that the PCR approaches used herein are suitable for early diagnosis of Chagas disease reactivation, with high potential to assist physicians in treatment decisions. For this purpose, an algorithm is proposed for surveillance based on the molecular tests. Copyright © 2017 International Society for the
Conformational transitions in DNA polymerase I revealed by single-molecule FRET

PubMed Central

Santoso, Yusdi; Joyce, Catherine M.; Potapova, Olga; Le Reste, Ludovic; Hohlbein, Johannes; Torella, Joseph P.; Grindley, Nigel D. F.; Kapanidis, Achillefs N.

2010-01-01

The remarkable fidelity of most DNA polymerases depends on a series of early steps in the reaction pathway which allow the selection of the correct nucleotide substrate, while excluding all incorrect ones, before the enzyme is committed to the chemical step of nucleotide incorporation. The conformational transitions that are involved in these early steps are detectable with a variety of fluorescence assays and include the fingers-closing transition that has been characterized in structural studies. Using DNA polymerase I (Klenow fragment) labeled with both donor and acceptor fluorophores, we have employed single-molecule fluorescence resonance energy transfer to study the polymerase conformational transitions that precede nucleotide addition. Our experiments clearly distinguish the open and closed conformations that predominate in Pol-DNA and Pol-DNA-dNTP complexes, respectively. By contrast, the unliganded polymerase shows a broad distribution of FRET values, indicating a high degree of conformational flexibility in the protein in the absence of its substrates; such flexibility was not anticipated on the basis of the available crystallographic structures. Real-time observation of conformational dynamics showed that most of the unliganded polymerase molecules sample the open and closed conformations in the millisecond timescale. Ternary complexes formed in the presence of mismatched dNTPs or complementary ribonucleotides show unique FRET species, which we suggest are relevant to kinetic checkpoints that discriminate against these incorrect substrates. PMID:20080740
Colorimetric detection of genetically modified organisms based on exonuclease III-assisted target recycling and hemin/G-quadruplex DNAzyme amplification.

PubMed

Zhang, Decai; Wang, Weijia; Dong, Qian; Huang, Yunxiu; Wen, Dongmei; Mu, Yuejing; Yuan, Yong

2017-12-21

An isothermal colorimetric method is described for amplified detection of the CaMV 35S promoter sequence in genetically modified organism (GMO). It is based on (a) target DNA-triggered unlabeled molecular beacon (UMB) termini binding, and (b) exonuclease III (Exo III)-assisted target recycling, and (c) hemin/G-quadruplex (DNAzyme) based signal amplification. The specific binding of target to the G-quadruplex sequence-locked UMB triggers the digestion of Exo III. This, in turn, releases an active G-quadruplex segment and target DNA for successive hybridization and cleavage. The Exo III impellent recycling of targets produces numerous G-quadruplex sequences. These further associate with hemin to form DNAzymes and hence will catalyze H 2 O 2 -mediated oxidation of the chromogenic enzyme substrate ABTS 2- causing the formation of a green colored product. This finding enables a sensitive colorimetric determination of GMO DNA (at an analytical wavelength of 420 nm) at concentrations as low as 0.23 nM. By taking advantage of isothermal incubation, this method does not require sophisticated equipment or complicated syntheses. Analyses can be performed within 90 min. The method also discriminates single base mismatches. In our perception, it has a wide scope in that it may be applied to the detection of many other GMOs. Graphical abstract An isothermal and sensitive colorimetric method is described for amplified detection of CaMV 35S promoter sequence in genetically modified organism (GMO). It is based on target DNA-triggered molecular beacon (UMB) termini-binding and exonuclease III assisted target recycling, and on hemin/G-quadruplex (DNAzyme) signal amplification.
Detection of nucleophosmin 1 mutations by quantitative real-time polymerase chain reaction versus capillary electrophoresis: a comparative study.

PubMed

Barakat, Fareed H; Luthra, Rajyalakshmi; Yin, C Cameron; Barkoh, Bedia A; Hai, Seema; Jamil, Waqar; Bhakta, Yaminiben I; Chen, Su; Medeiros, L Jeffrey; Zuo, Zhuang

2011-08-01

Nucleophosmin 1 (NPM1) is the most commonly mutated gene in acute myeloid leukemia. Detection of NPM1 mutations is useful for stratifying patients for therapy, predicting prognosis, and assessing for minimal residual disease. Several methods have been developed to rapidly detect NPM1 mutations in genomic DNA and/or messenger RNA specimens. To directly compare a quantitative real-time polymerase chain reaction (qPCR) assay with a widely used capillary electrophoresis assay for detecting NPM1 mutations. We adopted and modified a qPCR assay designed to detect the 6 most common NPM1 mutations and performed the assay in parallel with capillary electrophoresis assay in 207 bone marrow aspirate or peripheral blood samples from patients with a range of hematolymphoid neoplasms. The qPCR assay demonstrated a higher analytical sensitivity than the capillary electrophoresis 1/1000 versus 1/40, respectively. The capillary electrophoresis assay generated 10 equivocal results that needed to be repeated, whereas the qPCR assay generated only 1 equivocal result. After test conditions were optimized, the qPCR and capillary electrophoresis methods produced 100% concordant results, 85 positive and 122 negative. Given the higher analytical sensitivity and specificity of the qPCR assay, that assay is less likely to generate equivocal results than the capillary electrophoresis assay. Moreover, the qPCR assay is quantitative, faster, cheaper, less prone to contamination, and well suited for monitoring minimal residual disease.
Recombinase Polymerase Amplification Assay-A Simple, Fast and Cost-Effective Alternative to Real Time PCR for Specific Detection of Feline Herpesvirus-1.

PubMed

Wang, Jianchang; Liu, Libing; Wang, Jinfeng; Sun, Xiaoxia; Yuan, Wanzhe

2017-01-01

Feline herpesvirus 1 (FHV-1), an enveloped dsDNA virus, is one of the major pathogens of feline upper respiratory tract disease (URTD) and ocular disease. Currently, polymerase chain reaction (PCR) remains the gold standard diagnostic tool for FHV-1 infection but is relatively expensive, requires well-equipped laboratories and is not suitable for field tests. Recombinase polymerase amplification (RPA), an isothermal gene amplification technology, has been explored for the molecular diagnosis of infectious diseases. In this study, an exo-RPA assay for FHV-1 detection was developed and validated. Primers targeting specifically the thymidine kinase (TK) gene of FHV-1 were designed. The RPA reaction was performed successfully at 39°C and the results were obtained within 20 min. Using different copy numbers of recombinant plasmid DNA that contains the TK gene as template, we showed the detection limit of exo-RPA was 102 copies DNA/reaction, the same as that of real time PCR. The exo-RPA assay did not cross-detect feline panleukopenia virus, feline calicivirus, bovine herpesvirus-1, pseudorabies virus or chlamydia psittaci, a panel of pathogens important in feline URTD or other viruses in Alphaherpesvirinae, demonstrating high specificity. The assay was validated by testing 120 nasal and ocular conjunctival swabs of cats, and the results were compared with those obtained with real-time PCR. Both assays provided the same testing results in the clinical samples. Compared with real time PCR, the exo-RPA assay uses less-complex equipment that is portable and the reaction is completed much faster. Additionally, commercial RPA reagents in vacuum-sealed pouches can tolerate temperatures up to room temperature for days without loss of activity, suitable for shipment and storage for field tests. Taken together, the exo-RPA assay is a simple, fast and cost-effective alternative to real time PCR, suitable for use in less advanced laboratories and for field detection of FHV-1
Recombinase Polymerase Amplification Assay—A Simple, Fast and Cost-Effective Alternative to Real Time PCR for Specific Detection of Feline Herpesvirus-1

PubMed Central

Wang, Jianchang; Liu, Libing; Wang, Jinfeng; Sun, Xiaoxia; Yuan, Wanzhe

2017-01-01

Feline herpesvirus 1 (FHV-1), an enveloped dsDNA virus, is one of the major pathogens of feline upper respiratory tract disease (URTD) and ocular disease. Currently, polymerase chain reaction (PCR) remains the gold standard diagnostic tool for FHV-1 infection but is relatively expensive, requires well-equipped laboratories and is not suitable for field tests. Recombinase polymerase amplification (RPA), an isothermal gene amplification technology, has been explored for the molecular diagnosis of infectious diseases. In this study, an exo-RPA assay for FHV-1 detection was developed and validated. Primers targeting specifically the thymidine kinase (TK) gene of FHV-1 were designed. The RPA reaction was performed successfully at 39°C and the results were obtained within 20 min. Using different copy numbers of recombinant plasmid DNA that contains the TK gene as template, we showed the detection limit of exo-RPA was 102 copies DNA/reaction, the same as that of real time PCR. The exo-RPA assay did not cross-detect feline panleukopenia virus, feline calicivirus, bovine herpesvirus-1, pseudorabies virus or chlamydia psittaci, a panel of pathogens important in feline URTD or other viruses in Alphaherpesvirinae, demonstrating high specificity. The assay was validated by testing 120 nasal and ocular conjunctival swabs of cats, and the results were compared with those obtained with real-time PCR. Both assays provided the same testing results in the clinical samples. Compared with real time PCR, the exo-RPA assay uses less-complex equipment that is portable and the reaction is completed much faster. Additionally, commercial RPA reagents in vacuum-sealed pouches can tolerate temperatures up to room temperature for days without loss of activity, suitable for shipment and storage for field tests. Taken together, the exo-RPA assay is a simple, fast and cost-effective alternative to real time PCR, suitable for use in less advanced laboratories and for field detection of FHV-1
RNA polymerase gene, microorganism having said gene and the production of RNA polymerase by the use of said microorganism

DOEpatents

Kotani, Hirokazu; Hiraoka, Nobutsugu; Obayashi, Akira

1991-01-01

SP6 bacteriophage RNA polymerase is produced by cultivating a new microorganism (particularly new strains of Escherichia coli) harboring a plasmid that carries SP6 bacteriophage RNA polymerase gene and recovering SP6 bacteriophage RNA polymerase from the culture broth. SP6 bacteriophage RNA polymerase gene is provided as are new microorganisms harboring a plasmid that carries SP6 bacteriophage RNA polymerase gene.

Automated real-time detection of drug-resistant Mycobacterium tuberculosis on a lab-on-a-disc by Recombinase Polymerase Amplification.

PubMed

Law, I L G; Loo, J F C; Kwok, H C; Yeung, H Y; Leung, C C H; Hui, M; Wu, S Y; Chan, H S; Kwan, Y W; Ho, H P; Kong, S K

2018-03-01

With the emergence of multi- and extensive-drug (MDR/XDR) resistant Mycobacterium tuberculosis (M. tb), tuberculosis (TB) persists as one of the world's leading causes of death. Recently, isothermal DNA amplification methods received much attention due to their ease of translation onto portable point-of-care (POC) devices for TB diagnosis. In this study, we aimed to devise a simple yet robust detection method for M. tb. Amongst the numerous up-and-coming isothermal techniques, Recombinase Polymerase Amplification (RPA) was chosen for a real-time detection of TB with or without MDR. In our platform, real-time RPA (RT-RPA) was integrated on a lab-on-a-disc (LOAD) with on-board power to maintain temperature for DNA amplification. Sputa collected from healthy volunteers were spiked with respective target M. tb samples for testing. A limit of detection of 10 2  colony-forming unit per millilitre in 15 min was achieved, making early detection and differentiation of M. tb strains highly feasible in extreme POC settings. Our RT-RPA LOAD platform has also been successfully applied in the differentiation of MDR-TB from H37Ra, an attenuated TB strain. In summary, a quantitative RT-RPA on LOAD assay with a high level of sensitivity was developed as a foundation for further developments in medical bedside and POC diagnostics. Copyright © 2018 Elsevier Inc. All rights reserved.
Hybrid Methods Reveal Multiple Flexibly Linked DNA Polymerases within the Bacteriophage T7 Replisome

DOE PAGES

Wallen, Jamie R.; Zhang, Hao; Weis, Caroline; ...

2017-01-03

The physical organization of DNA enzymes at a replication fork enables efficient copying of two antiparallel DNA strands, yet dynamic protein interactions within the replication complex complicate replisome structural studies. We employed a combination of crystallographic, native mass spectrometry and small-angle X-ray scattering experiments to capture alternative structures of a model replication system encoded by bacteriophage T7. then, the two molecules of DNA polymerase bind the ring-shaped primase-helicase in a conserved orientation and provide structural insight into how the acidic C-terminal tail of the primase-helicase contacts the DNA polymerase to facilitate loading of the polymerase onto DNA. A third DNA polymerasemore » binds the ring in an offset manner that may enable polymerase exchange during replication. Alternative polymerase binding modes are also detected by small-angle X-ray scattering with DNA substrates present. The collective results unveil complex motions within T7 replisome higher-order structures that are underpinned by multivalent protein-protein interactions with functional implications.« less
Hybrid Methods Reveal Multiple Flexibly Linked DNA Polymerases within the Bacteriophage T7 Replisome

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wallen, Jamie R.; Zhang, Hao; Weis, Caroline

The physical organization of DNA enzymes at a replication fork enables efficient copying of two antiparallel DNA strands, yet dynamic protein interactions within the replication complex complicate replisome structural studies. We employed a combination of crystallographic, native mass spectrometry and small-angle X-ray scattering experiments to capture alternative structures of a model replication system encoded by bacteriophage T7. then, the two molecules of DNA polymerase bind the ring-shaped primase-helicase in a conserved orientation and provide structural insight into how the acidic C-terminal tail of the primase-helicase contacts the DNA polymerase to facilitate loading of the polymerase onto DNA. A third DNA polymerasemore » binds the ring in an offset manner that may enable polymerase exchange during replication. Alternative polymerase binding modes are also detected by small-angle X-ray scattering with DNA substrates present. The collective results unveil complex motions within T7 replisome higher-order structures that are underpinned by multivalent protein-protein interactions with functional implications.« less
Recombinase polymerase amplification combined with a lateral flow dipstick for rapid and visual detection of Schistosoma japonicum.

PubMed

Sun, Kui; Xing, Weiwei; Yu, Xinling; Fu, Wenliang; Wang, Yuanyuan; Zou, Minji; Luo, Zhihong; Xu, Donggang

2016-08-31

With the continuous decline in prevalence and intensity of Schistosoma japonicum infection in China, more accurate and sensitive methods suitable for field detection become much needed for schistosomiasis control. Here, a novel rapid and visual detection method based on the combination of recombinase polymerase amplification (RPA) and lateral flow dipstick (LFD) was developed to detect S. japonicum DNA in fecal samples. The LFD-RPA assay targeting SjR2 could detect 5 fg S. japonicum DNA, which was identical to qPCR and real-time RPA assay, and showed no cross-reaction with other parasites. The detection could be finished within 15-20 min at a wide temperature range (25-45 °C), and the results could be visualized by naked eye. The diagnostic validity of LFD-RPA assay was further assessed with 14 fecal samples of infected patients diagnosed by Kato-Katz method and 31 fecal samples of healthy persons, and compared with that of Enzyme-linked immunosorbent assay (ELSIA) and Indirect Hemagglutination Assay (IHA). The LFD-RPA assay showed 92.68 % sensitivity, 100 % specificity and excellent diagnostic agreement with the gold standard Kato-Katz test (k = 0.947, Z = 6.36, P < 0.001), whereas ELISA showed 85.71 % sensitivity, 93.55 % specificity, and substantial diagnostic agreement (k = 0.793, Z = 5.31, P < 0.001), and IHA showed 78.57 % sensitivity, 83.87 % specificity, and moderate diagnostic agreement (k = 0.600, Z = 4.05, P < 0.001), indicating that the LFD-RPA was much better than the traditional methods. The LFD-RPA assay established by us is a sensitive, specific, rapid and convenient method for the diagnosis of schistosomiasis, and shows a great potency in field application.
Transient expression and activity of human DNA polymerase iota in loach embryos.

PubMed

Makarova, Irina V; Kazakov, Andrey A; Makarova, Alena V; Khaidarova, Nella V; Kozikova, Larisa V; Nenasheva, Valentina V; Gening, Leonid V; Tarantul, Vyacheslav Z; Andreeva, Ludmila E

2012-02-01

Human DNA polymerase iota (Pol ι) is a Y-family DNA polymerase with unusual biochemical properties and not fully understood functions. Pol ι preferentially incorporates dGTP opposite template thymine. This property can be used to monitor Pol ι activity in the presence of other DNA polymerases, e.g. in cell extracts of tissues and tumors. We have now confirmed the specificity and sensitivity of the method of Pol ι activity detection in cell extracts using an animal model of loach Misgurnus fossilis embryos transiently expressing human Pol ι. The overexpression of Pol ι was shown to be accompanied by an increase in abnormalities in development and the frequency of pycnotic nuclei in fish embryos. Further analysis of fish embryos with constitutive or regulated Pol ι expression may provide insights into Pol ι functions in vertebrate animals.
Droplet digital polymerase chain reaction (PCR) outperforms real-time PCR in the detection of environmental DNA from an invasive fish species.

PubMed

Doi, Hideyuki; Takahara, Teruhiko; Minamoto, Toshifumi; Matsuhashi, Saeko; Uchii, Kimiko; Yamanaka, Hiroki

2015-05-05

Environmental DNA (eDNA) has been used to investigate species distributions in aquatic ecosystems. Most of these studies use real-time polymerase chain reaction (PCR) to detect eDNA in water; however, PCR amplification is often inhibited by the presence of organic and inorganic matter. In droplet digital PCR (ddPCR), the sample is partitioned into thousands of nanoliter droplets, and PCR inhibition may be reduced by the detection of the end-point of PCR amplification in each droplet, independent of the amplification efficiency. In addition, real-time PCR reagents can affect PCR amplification and consequently alter detection rates. We compared the effectiveness of ddPCR and real-time PCR using two different PCR reagents for the detection of the eDNA from invasive bluegill sunfish, Lepomis macrochirus, in ponds. We found that ddPCR had higher detection rates of bluegill eDNA in pond water than real-time PCR with either of the PCR reagents, especially at low DNA concentrations. Limits of DNA detection, which were tested by spiking the bluegill DNA to DNA extracts from the ponds containing natural inhibitors, found that ddPCR had higher detection rate than real-time PCR. Our results suggest that ddPCR is more resistant to the presence of PCR inhibitors in field samples than real-time PCR. Thus, ddPCR outperforms real-time PCR methods for detecting eDNA to document species distributions in natural habitats, especially in habitats with high concentrations of PCR inhibitors.
Development of field-based real-time reverse transcription-polymerase chain reaction assays for detection of Chikungunya and O'nyong-nyong viruses in mosquitoes.

PubMed

Smith, Darci R; Lee, John S; Jahrling, Jordan; Kulesh, David A; Turell, Michael J; Groebner, Jennifer L; O'Guinn, Monica L

2009-10-01

Chikungunya (CHIK) and O'nyong-nyong (ONN) are important emerging arthropod-borne diseases. Molecular diagnosis of these two viruses in mosquitoes has not been evaluated, and the effects of extraneous mosquito tissue on assay performance have not been tested. Additionally, no real-time reverse transcription-polymerase chain reaction (RT-PCR) assay exists for detecting ONN virus (ONNV) RNA. We describe the development of sensitive and specific real-time RT-PCR assays for detecting CHIK and ONN viral RNA in mosquitoes, which have application for field use. In addition, we compared three methods for primer/probe design for assay development by evaluating their sensitivity and specificity. This comparison resulted in development of virus-specific assays that could detect less than one plaque-forming unit equivalent of each of the viruses in mosquitoes. The use of these assays will aid in arthropod-borne disease surveillance and in the control of the associated diseases.
Polymerase chain reaction-based detection of Pneumocystis jirovecii in bronchoalveolar lavage fluid for the diagnosis of pneumocystis pneumonia.

PubMed

Oren, Ilana; Hardak, Emilia; Finkelstein, Renato; Yigla, Mordechai; Sprecher, Hannah

2011-09-01

The diagnosis of pneumocystis pneumonia (PCP) in non-human immunodeficiency virus (HIV)-infected immunocompromised patients is notoriously difficult. The recent advent of polymerase chain reaction (PCR)-based detection systems, based on the identification of single fungal genes, has markedly improved diagnostic accuracy in this ominous disease. In an attempt to further improve diagnostic yield, the authors used a PCR-based detection system for Pneumocystis jirovecii, based on targeting 3 distinct genes. During the 4-year period (January 2005 to January 2009), all consecutive immunocompromised patients suspected of having PCP in the differential diagnosis underwent bronchoscopy with bronchoalveolar lavage sampling for the evaluation of the etiology of pulmonary infiltrates. Bronchoalveolar fluid was tested for the presence of a wide variety of possible etiological microorganisms. In a cohort of 214 immunocompromised patients (of which 198 were non-HIV immunocompromised patients) who underwent bronchoscopy with bronchoalveolar lavage for evaluation of pulmonary infiltrates, PCR correctly diagnosed PCP in 75% (42/56) compared with 14% (8/56) diagnosed by traditional stains, and increased diagnostic yield 5.4-fold. Given the absence of a sensitive gold standard, this study demonstrates the usefulness of a multigene PCR-based detection of Pneumocystis jirovecii DNA for supporting the clinical diagnosis of PCP, with high sensitivity and negative predictive value rates compared with direct stains, especially in non-HIV immunocompromised patients.
Development and validation of a reverse transcription quantitative polymerase chain reaction for tilapia lake virus detection in clinical samples and experimentally challenged fish.

PubMed

Tattiyapong, P; Sirikanchana, K; Surachetpong, W

2018-02-01

Tilapia lake virus (TiLV) is an emerging pathogen associated with high mortalities of wild and farm-raised tilapia in different countries. In this study, a SYBR green-based reverse transcription quantitative polymerase chain reaction (RT-qPCR) assay targeting segment three of the virus was developed to detect and quantify TiLV in clinical samples and experimentally challenged fish. All 30 field samples with clinical signs and history consistent with TiLV infection were positive for TiLV as detected by the developed RT-qPCR method. The RT-qPCR technique provided 100 and 10,000 times more sensitive for virus detection than those offered by the RT-PCR and virus isolation in cell culture methods, respectively. The detection limit of the RT-qPCR method was as low as two viral copies/μl. Moreover, the RT-qPCR technique could be applied for TiLV detection in various fish tissues including gills, liver, brain, heart, anterior kidney and spleen. Significantly, this study delivered an accurate and reliable method for rapid detection of TiLV viruses that facilitates active surveillance programme and disease containment. © 2017 John Wiley & Sons Ltd.
Multisubunit DNA-Dependent RNA Polymerases from Vaccinia Virus and Other Nucleocytoplasmic Large-DNA Viruses: Impressions from the Age of Structure.

PubMed

Mirzakhanyan, Yeva; Gershon, Paul D

2017-09-01

The past 17 years have been marked by a revolution in our understanding of cellular multisubunit DNA-dependent RNA polymerases (MSDDRPs) at the structural level. A parallel development over the past 15 years has been the emerging story of the giant viruses, which encode MSDDRPs. Here we link the two in an attempt to understand the specialization of multisubunit RNA polymerases in the domain of life encompassing the large nucleocytoplasmic DNA viruses (NCLDV), a superclade that includes the giant viruses and the biochemically well-characterized poxvirus vaccinia virus. The first half of this review surveys the recently determined structural biology of cellular RNA polymerases for a microbiology readership. The second half discusses a reannotation of MSDDRP subunits from NCLDV families and the apparent specialization of these enzymes by virus family and by subunit with regard to subunit or domain loss, subunit dissociability, endogenous control of polymerase arrest, and the elimination/customization of regulatory interactions that would confer higher-order cellular control. Some themes are apparent in linking subunit function to structure in the viral world: as with cellular RNA polymerases I and III and unlike cellular RNA polymerase II, the viral enzymes seem to opt for speed and processivity and seem to have eliminated domains associated with higher-order regulation. The adoption/loss of viral RNA polymerase proofreading functions may have played a part in matching intrinsic mutability to genome size. Copyright © 2017 American Society for Microbiology.
A simple and sensitive fluorimetric aptasensor for the ultrasensitive detection of arsenic(III) based on cysteamine stabilized CdTe/ZnS quantum dots aggregation.

PubMed

Ensafi, Ali A; Kazemifard, N; Rezaei, B

2016-03-15

A new approach for developing a fluorimetric aptasensor has been described and applied for determination of a highly toxic cation, As(III). In this method an aptamer was used to aggregate cationic cysteamine-stabilized CdTe/ZnS core/shell quantum dots, as a result fluorescence quenching was accrued. In the presence of As(III), the aptamer and As(III) make a complex, which prevents aggregation of the quantum dots. Thus, the fluorescence intensity of the quantum dots was enhanced upon the de-aggregation, which depends on the concentration of As(III). The fluorimetric assay has a very low detection limit of 1.3 pmolL(-1) As(III) with a dynamic range of 1.0 × 10(-11) to 1.0 × 10(-6) molL(-1). The interference effect of a wide variety of cations and anions was investigated, and the obtained results confirm high selectivity of the aptasensor for As(III) detection. The present assay was successfully applied for the determination of As(III) in several water samples. Copyright © 2015 Elsevier B.V. All rights reserved.
Development and deployment of a rapid recombinase polymerase amplification Ebola virus detection assay in Guinea in 2015.

PubMed

Faye, Oumar; Faye, Ousmane; Soropogui, Barré; Patel, Pranav; El Wahed, Ahmed Abd; Loucoubar, Cheikh; Fall, Gamou; Kiory, Davy; Magassouba, N'Faly; Keita, Sakoba; Kondé, Mandy Kader; Diallo, Alpha Amadou; Koivogui, Lamine; Karlberg, Helen; Mirazimi, Ali; Nentwich, Oliver; Piepenburg, Olaf; Niedrig, Matthias; Weidmann, Manfred; Sall, Amadou Alpha

2015-01-01

In the absence of a vaccine or specific treatments for Ebola virus disease (EVD), early identification of cases is crucial for the control of EVD epidemics. We evaluated a new extraction kit (SpeedXtract (SE), Qiagen) on sera and swabs in combination with an improved diagnostic reverse transcription recombinase polymerase amplification assay for the detection of Ebola virus (EBOV-RT-RPA). The performance of combined extraction and detection was best for swabs. Sensitivity and specificity of the combined SE and EBOV-RT-RPA were tested in a mobile laboratory consisting of a mobile glovebox and a Diagnostics-in-a-Suitcase powered by a battery and solar panel, deployed to Matoto Conakry, Guinea as part of the reinforced surveillance strategy in April 2015 to reach the goal of zero cases. The EBOV-RT-RPA was evaluated in comparison to two real-time PCR assays. Of 928 post-mortem swabs, 120 tested positive, and the combined SE and EBOV-RT-RPA yielded a sensitivity and specificity of 100% in reference to one real-time RT-PCR assay. Another widely used real-time RT-PCR was much less sensitive than expected. Results were provided very fast within 30 to 60 min, and the field deployment of the mobile laboratory helped improve burial management and community engagement.
Ring test evaluation of the detection of influenza A virus in swine oral fluids by real-time, reverse transcription polymerase chain reaction (rRT-PCR) and virus isolation

USDA-ARS?s Scientific Manuscript database

The probability of detecting influenza A virus (IAV) in oral fluid (OF) specimens was calculated for each of 13 real-time, reverse transcription polymerase chain reaction (rRT-PCR) and 7 virus isolation (VI) assays. To conduct the study, OF was inoculated with H1N1 or H3N2 IAV and serially 10-fold d...
Development of a real-time polymerase chain reaction assay for the detection of the invasive Mediterranean fanworm, Sabella spallanzanii, in environmental samples.

PubMed

Wood, Susanna A; Zaiko, Anastasija; Richter, Ingrid; Inglis, Graeme J; Pochon, Xavier

2017-07-01

The Mediterranean fanworm, Sabella spallanzanii Gmelin 1791, was first detected in the Southern Hemisphere in the 1990s and is now abundant in many parts of southern Australia and in several locations around northern New Zealand. Once established, it can proliferate rapidly, reaching high densities with potential ecological and economic impacts. Early detection of new S. spallanzanii incursions is important to prevent its spread, guide eradication or control efforts and to increase knowledge on the species' dispersal pathways. In this study, we developed a TaqMan probe real-time polymerase chain reaction assay targeting a region of the mitochondrial cytochrome oxidase I gene. The assay was validated in silico and in vitro using DNA from New Zealand and Australian Sabellidae with no cross-reactivity detected. The assay has a linear range of detection over seven orders of magnitude with a limit of detection reached at 12.4 × 10 -4 ng/μL of DNA. We analysed 145 environmental (water, sediment and biofouling) samples and obtained positive detections only from spiked samples and those collected at a port where S. spallanzanii is known to be established. This assay has the potential to enhance current morphological and molecular-based methods, through its ability to rapidly and accurately identify S. spallanzanii in environmental samples.
Polymerase chain reaction-hybridization method using urease gene sequences for high-throughput Ureaplasma urealyticum and Ureaplasma parvum detection and differentiation.

PubMed

Xu, Chen; Zhang, Nan; Huo, Qianyu; Chen, Minghui; Wang, Rengfeng; Liu, Zhili; Li, Xue; Liu, Yunde; Bao, Huijing

2016-04-15

In this article, we discuss the polymerase chain reaction (PCR)-hybridization assay that we developed for high-throughput simultaneous detection and differentiation of Ureaplasma urealyticum and Ureaplasma parvum using one set of primers and two specific DNA probes based on urease gene nucleotide sequence differences. First, U. urealyticum and U. parvum DNA samples were specifically amplified using one set of biotin-labeled primers. Furthermore, amine-modified DNA probes, which can specifically react with U. urealyticum or U. parvum DNA, were covalently immobilized to a DNA-BIND plate surface. The plate was then incubated with the PCR products to facilitate sequence-specific DNA binding. Horseradish peroxidase-streptavidin conjugation and a colorimetric assay were used. Based on the results, the PCR-hybridization assay we developed can specifically differentiate U. urealyticum and U. parvum with high sensitivity (95%) compared with cultivation (72.5%). Hence, this study demonstrates a new method for high-throughput simultaneous differentiation and detection of U. urealyticum and U. parvum with high sensitivity. Based on these observations, the PCR-hybridization assay developed in this study is ideal for detecting and discriminating U. urealyticum and U. parvum in clinical applications. Copyright © 2016 Elsevier Inc. All rights reserved.
Design principles of a microtubule polymerase

PubMed Central

Geyer, Elisabeth A; Miller, Matthew P; Brautigam, Chad A; Biggins, Sue

2018-01-01

Stu2/XMAP215 microtubule polymerases use multiple tubulin-binding TOG domains and a lattice-binding basic region to processively promote faster elongation. How the domain composition and organization of these proteins dictate polymerase activity, end localization, and processivity is unknown. We show that polymerase activity does not require different kinds of TOGs, nor are there strict requirements for how the TOGs are linked. We identify an unexpected antagonism between the tubulin-binding TOGs and the lattice-binding basic region: lattice binding by the basic region is weak when at least two TOGs engage tubulins, strong when TOGs are empty. End-localization of Stu2 requires unpolymerized tubulin, at least two TOGs, and polymerase competence. We propose a ‘ratcheting’ model for processivity: transfer of tubulin from TOGs to the lattice activates the basic region, retaining the polymerase at the end for subsequent rounds of tubulin binding and incorporation. These results clarify design principles of the polymerase. PMID:29897335
[Three regions of Rpb10 mini-subunit of nuclear RNA polymerases are strictly conserved in all eukaryotes].

PubMed

Shpakovskiĭ, G V; Lebedenko, E N

1996-12-01

The rpb10+ cDNA from the fission yeast Schizosaccharomyces pombe was cloned using two independent approaches (PCR and genetic suppression). The cloned cDNA encoded the Rpb10 subunit common for all three RNA polymerases. Comparison of the deduced amino acid sequence of the Sz. pombe Rbp10 subunit (71 amino acid residues) with those of the homologous subunits of RNA polymerases I, II, and III from Saccharomyces cerevisiae and Home sapiens revealed that heptapeptides RCFT/SCGK (residues 6-12), RYCCRRM (residues 43-49), and HVDLIEK (residues 53-59) were evolutionarily the most conserved structural motifs of these subunits. It is shown that the Rbp10 subunit from Sz. pombe can substitute its homolog (ABC10 beta) in the baker's yeast S. cerevisiae.
Disruption of Higher-Order Folding by Core Histone Acetylation Dramatically Enhances Transcription of Nucleosomal Arrays by RNA Polymerase III

PubMed Central

Tse, Christin; Sera, Takashi; Wolffe, Alan P.; Hansen, Jeffrey C.

1998-01-01

We have examined the effects of core histone acetylation on the transcriptional activity and higher-order folding of defined 12-mer nucleosomal arrays. Purified HeLa core histone octamers containing an average of 2, 6, or 12 acetates per octamer (8, 23, or 46% maximal site occupancy, respectively) were assembled onto a DNA template consisting of 12 tandem repeats of a 208-bp Lytechinus 5S rRNA gene fragment. Reconstituted nucleosomal arrays were transcribed in a Xenopus oocyte nuclear extract and analyzed by analytical hydrodynamic and electrophoretic approaches to determine the extent of array compaction. Results indicated that in buffer containing 5 mM free Mg2+ and 50 mM KCl, high levels of acetylation (12 acetates/octamer) completely inhibited higher-order folding and concurrently led to a 15-fold enhancement of transcription by RNA polymerase III. The molecular mechanisms underlying the acetylation effects on chromatin condensation were investigated by analyzing the ability of differentially acetylated nucleosomal arrays to fold and oligomerize. In MgCl2-containing buffer the folding of 12-mer nucleosomal arrays containing an average of two or six acetates per histone octamer was indistinguishable, while a level of 12 acetates per octamer completely disrupted the ability of nucleosomal arrays to form higher-order folded structures at all ionic conditions tested. In contrast, there was a linear relationship between the extent of histone octamer acetylation and the extent of disruption of Mg2+-dependent oligomerization. These results have yielded new insight into the molecular basis of acetylation effects on both transcription and higher-order compaction of nucleosomal arrays. PMID:9671473
DNA polymerase preference determines PCR priming efficiency.

PubMed

Pan, Wenjing; Byrne-Steele, Miranda; Wang, Chunlin; Lu, Stanley; Clemmons, Scott; Zahorchak, Robert J; Han, Jian

2014-01-30

Polymerase chain reaction (PCR) is one of the most important developments in modern biotechnology. However, PCR is known to introduce biases, especially during multiplex reactions. Recent studies have implicated the DNA polymerase as the primary source of bias, particularly initiation of polymerization on the template strand. In our study, amplification from a synthetic library containing a 12 nucleotide random portion was used to provide an in-depth characterization of DNA polymerase priming bias. The synthetic library was amplified with three commercially available DNA polymerases using an anchored primer with a random 3' hexamer end. After normalization, the next generation sequencing (NGS) results of the amplified libraries were directly compared to the unamplified synthetic library. Here, high throughput sequencing was used to systematically demonstrate and characterize DNA polymerase priming bias. We demonstrate that certain sequence motifs are preferred over others as primers where the six nucleotide sequences at the 3' end of the primer, as well as the sequences four base pairs downstream of the priming site, may influence priming efficiencies. DNA polymerases in the same family from two different commercial vendors prefer similar motifs, while another commercially available enzyme from a different DNA polymerase family prefers different motifs. Furthermore, the preferred priming motifs are GC-rich. The DNA polymerase preference for certain sequence motifs was verified by amplification from single-primer templates. We incorporated the observed DNA polymerase preference into a primer-design program that guides the placement of the primer to an optimal location on the template. DNA polymerase priming bias was characterized using a synthetic library amplification system and NGS. The characterization of DNA polymerase priming bias was then utilized to guide the primer-design process and demonstrate varying amplification efficiencies among three commercially
Development and use of polymerase chain reaction for the specific detection of Salmonella Typhimurium in stool and food samples.

PubMed

Lin, J S; Tsen, H Y

1999-10-01

Salmonella Typhimurium is one of the most important Salmonella serovars that may cause foodborne disease and human salmonellosis infection. Detection of this organism in the clinical samples of persons with gastroenteritis and the food samples associated with such persons may allow us to trace the cause of disease. Because malic acid dehydrogenase, an enzyme of the citric acid cycle, is common to organisms, the gene (mdh) coding for this enzyme was selected for the design of Salmonella Typhimurium-specific polymerase chain reaction (PCR) primers. By comparison of the mdh gene sequences of Salmonella Typhimurium and other Salmonella serotypes and of some isolates of other genera, two oligonucleotides were designed and used as PCR primers for the specific detection of Salmonella Typhimurium. The molecular weight of the PCR product was 261 bp as expected. Salmonella serovars other than Salmonella Typhimurium and isolates of other genera in the Enterobacteriaceae that is closely related to Salmonella did not generate any false-positive results. When this primer pair was used for the detection of Salmonella Typhimurium cells artificially inoculated into human stool specimens and food samples, such as milk and raw chicken meat, levels as low as 10(0) CFU per 0.1 g of stool specimen or per ml of milk or food homogenate could be detected if an 8- to 12-h preculture step using combined lactose-tetrathionate broth was performed prior to the PCR.

DNA extraction from coral reef sediment bacteria for the polymerase chain reaction.

PubMed

Guthrie, J N; Moriarty, D J; Blackall, L L

2000-12-15

A rapid and effective method for the direct extraction of high molecular weight amplifiable DNA from two coral reef sediments was developed. DNA was amplified by the polymerase chain reaction (PCR) using 16S rDNA specific primers. The amplicons were digested with HaeIII, HinP1I and MspI and separated using polyacrylamide gel electrophoresis and silver staining. The resulting amplified ribosomal DNA restriction analysis (ARDRA) patterns were used as a fingerprint to discern differences between the coral reef sediment samples. Results indicated that ARDRA is an effective method for determining differences within the bacterial community amongst different environmental samples.
Development of a polymerase chain reaction assay for the detection of pseudorabies virus in clinical samples

PubMed Central

Pérez, Lester J.; de Arce, Heidy Díaz

2009-01-01

Aujeszky’s disease, also known as pseudorabies causes severe economic losses in swine industry and affects the pig husbandry all over the world. The conventional diagnostic procedure is time-consuming and false-negative results may occur in submissions from latently infected animals. The development, optimization and evaluation of a polymerase chain reaction (PCR) assay are presented for the diagnosis of pseudorabies infection. This assay was based on the amplification of a highly conserved viral gD gene fragment. PCR products of the expected size were obtained from PRV strains. Non-specific reactions were not observed when a related herpesvirus, other porcine DNA genome viruses and uninfected cells were used to assess PCR. The analytical sensitivity of the test was estimated to be 1.34 TCID50/ 50 uL. The analysis of tissue homogenate samples from naturally infected animals proved the potential usefulness of the method for a rapid disease diagnosis from field cases. A rapid, sensitive and specific PCR-based diagnostic assay to detect pseudorabies virus in clinical samples is provided. PMID:24031383
Development of Multiplex Reverse Transcription-Polymerase Chain Reaction for Simultaneous Detection of Influenza A, B and Adenoviruses

PubMed Central

Nakhaie, Mohsen; Soleimanjahi, Hoorieh; Mollaie, Hamid Reza; Arabzadeh, Seyed Mohamad Ali

2018-01-01

Background and objective: Millions of people in developing countries lose their lives due to acute respiratory infections, such as Influenza A & B and Adeno viruses. Given the importance of rapid identification of the virus, in this study the researchers attempted to design a method that enables detection of influenza A, B, and adenoviruses, quickly and simultaneously. The Multiplex RT PCR method was the preferred method for the detection of influenza A, B, and adenoviruses in clinical specimens because it is rapid, sensitive, specific, and more cost-effective than alternative methods Methods: After collecting samples from patients with respiratory disease, virus genome was extracted, then Monoplex PCR was used on positive samples and Multiplex RT-PCR on clinical specimens. Finally, by comparing the bands of these samples, the type of virus in the clinical samples was determined. Results: Performing Multiplex RT-PCR on 50 samples of respiratory tract led to following results; flu A: 12.5%, fluB: 50%, adeno: 27.5%, negative: 7.5%, and 2.5% contamination. Conclusion: Reverse transcription-multiplex Polymerase Chain Reaction (PCR) technique, a rapid diagnostic tool, has potential for high-throughput testing. This method has a significant advantage, which provides simultaneous amplification of numerous viruses in a single reaction. This study concentrates on multiplex molecular technologies and their clinical application for the detection and quantification of respiratory pathogens. The improvement in diagnostic testing for viral respiratory pathogens effects patient management, and leads to more cost-effective delivery of care. It limits unnecessary antibiotic use and improves clinical management by use of suitable treatment. PMID:29731796
Optimization of polymerase chain reaction for detection of Clostridium botulinum type C and D in bovine samples.

PubMed

Prévot, V; Tweepenninckx, F; Van Nerom, E; Linden, A; Content, J; Kimpe, A

2007-01-01

Botulism is a rare but serious paralytic illness caused by a nerve toxin that is produced by the bacterium Clostridium botulinum. The economic, medical and alimentary consequences can be catastrophic in case of an epizooty. A polymerase chain reaction (PCR)-based assay was developed for the detection of C. botulinum toxigenic strains type C and D in bovine samples. This assay has proved to be less expensive, faster and simpler to use than the mouse bioassay, the current reference method for diagnosis of C. botulinum toxigenic strains. Three pairs of primers were designed, one for global detection of C. botulinum types C and D (primer pair Y), and two strain-specific pairs specifically designed for types C (primer pair VC) and D (primer pair VD). The PCR amplification conditions were optimized and evaluated on 13 bovine and two duck samples that had been previously tested by the mouse bioassay. In order to assess the impact of sample treatment, both DNA extracted from crude samples and three different enrichment broths (TYG, CMM, CMM followed by TYG) were tested. A 100% sensitivity was observed when samples were enriched for 5 days in CMM followed by 1 day in TYG broth. False-negative results were encountered when C. botulinum was screened for in crude samples. These findings indicate that the current PCR is a reliable method for the detection of C. botulinum toxigenic strains type C and D in bovine samples but only after proper enrichment in CMM and TYG broth.
Probes of eukaryotic DNA-dependent RNA polymerase II-I. Binding of 9-beta-D-arabinofuranosyl-6-mercaptopurine to the elongation subsite.

PubMed

Cho, J M; Kimball, A P

1982-08-15

9-beta-D-Arabinofuranosyl-6-mercaptopurine (ara-6-MP) was used to affinity-label wheat germ DNA-dependent RNA polymerase II (or B) (nucleosidetriphosphate:RNA nucleotidyltransferase, EC 2.7.7.6). This nucleoside analogue was found to be a competitive inhibitor with respect to [3H]UMP incorporation. Natural substrates protected the enzyme from inactivation by ara-6-MP when the enzyme was preincubated with excess concentrations of substrates, suggesting that the inhibitor binds at the elongation subsite. The inhibitor bound the catalytic center of the enzyme with a stoichiometry of 0.6:1. The sulfhydryl reagent, dithiothreitol, reversed the inhibition by ara-6-MP, suggesting that the 6-thiol group of the inhibitor was interacting closely with an essential cysteine residue in the catalytic center of the enzyme. Chromatographic analysis of the pronase-digestion products of the RNA polymerase II-ara-6-MP complex also showed that ara-6-MP had bound a cysteine residue. Sodium dodecyl sulfate-polyacrylamide gel electrophoresis of the denatured [6-35S]ara-6-MP-labeled RNA polymerase II revealed that over 80% of the radioactivity was associated with the IIb subunit of the enzyme.
Use of polymerase chain reaction for the detection of Chlamydia trachomatis in ocular and nasopharyngeal specimens from infants with conjunctivitis.

PubMed

Hammerschlag, M R; Roblin, P M; Gelling, M; Tsumura, N; Jule, J E; Kutlin, A

1997-03-01

Chlamydia trachomatis is the most common identifiable infectious cause of neonatal conjunctivitis. Nonculture tests including enzyme immunoassays and direct fluorescent antibody tests have been shown to perform well for the diagnosis of chlamydial conjunctivitis with sensitivities and specificities > or = 90%. However, the performance with respiratory specimens has been less than satisfactory. We compared a new, commercially available polymerase chain reaction (PCR) assay, Roche AMPLICOR (Roche Diagnostic Systems, Branchburg, NJ) with culture for the detection of C. trachomatis in conjunctival and nasopharyngeal specimens from infants with conjunctivitis. We also evaluated AMPLICOR for the detection of C. trachomatis in the urine of mothers of positive infants. Ocular and nasopharyngeal specimens from 75 infants with conjunctivitis were obtained for culture and PCR. AMPLICOR was equivalent to culture for eye specimens and more sensitive than culture for nasopharyngeal specimens. The sensitivity, specificity and positive and negative predictive values of PCR compared with culture for conjunctival specimens were 92.3, 100, 100 and 98.4%, respectively. The sensitivity, specificity and positive and negative predictive values for nasopharyngeal specimens were 100, 97.2, 60 and 100%, respectively. We also detected C. trachomatis by PCR in the urine of 12 mothers of culture positive infants. PCR performed comparably to culture for detection of C. trachomatis in conjunctival and nasopharyngeal specimens from infants with conjunctivitis.
Development of real-time and lateral flow dipstick recombinase polymerase amplification assays for rapid detection of goatpox virus and sheeppox virus.

PubMed

Yang, Yang; Qin, Xiaodong; Zhang, Xiangle; Zhao, Zhixun; Zhang, Wei; Zhu, Xueliang; Cong, Guozheng; Li, Yanmin; Zhang, Zhidong

2017-07-17

Goatpox virus (GTPV) and sheeppox virus (SPPV), which belong to the Capripoxvirus (CaPV), are economically important pathogens of small ruminants. Therefore, a sensitive, specific and rapid diagnostic assay for detection of GTPV and SPPV is necessary to accurately and promptly control these diseases. Recombinase polymerase amplification (RPA) assays combined with a real-time fluorescent detection (real-time RPA assay) and lateral flow dipstick (RPA LFD assay) were developed targeting the CaPV G-protein-coupled chemokine receptor (GPCR) gene, respectively. The sensitivity of both CaPV real-time RPA assay and CaPV RPA LFD assay were 3 × 10 2 copies per reaction within 20 min at 38 °C. Both assays were highly specific for CaPV, with no cross-reactions with peste des petits ruminants virus, foot-and-mouth disease virus and Orf virus. The evaluation of the performance of these two assays with clinical sample (n = 107) showed that the CaPV real-time RPA assay and CaPV RPA LFD assay were able to specially detect SPPV or GTPV present in samples of ovine in liver, lung, kidney, spleen, skin and blood. This study provided a highly time-efficient and simple alternative for rapid detection of GTPV and SPPV.
THE SPECTRAL EVOLUTION OF THE FIRST GALAXIES. I. JAMES WEBB SPACE TELESCOPE DETECTION LIMITS AND COLOR CRITERIA FOR POPULATION III GALAXIES

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zackrisson, Erik; Rydberg, Claes-Erik; Oestlin, Goeran

The James Webb Space Telescope (JWST) is expected to revolutionize our understanding of the high-redshift universe, and may be able to test the prediction that the first, chemically pristine (Population III) stars are formed with very high characteristic masses. Since isolated Population III stars are likely to be beyond the reach of JWST, small Population III galaxies may offer the best prospects of directly probing the properties of metal-free stars. Here, we present Yggdrasil, a new spectral synthesis code geared toward the first galaxies. Using this model, we explore the JWST imaging detection limits for Population III galaxies and investigatemore » to what extent such objects may be identified based on their JWST colors. We predict that JWST should be able to detect Population III galaxies with stellar population masses as low as {approx}10{sup 5} M{sub sun} at z {approx} 10 in ultra deep exposures. Over limited redshift intervals, it may also be possible to use color criteria to select Population III galaxy candidates for follow-up spectroscopy. The colors of young Population III galaxies dominated by direct starlight can be used to probe the stellar initial mass function (IMF), but this requires almost complete leakage of ionizing photons into the intergalactic medium. The colors of objects dominated by nebular emission show no corresponding IMF sensitivity. We also note that a clean selection of Population III galaxies at z {approx} 7-8 can be achieved by adding two JWST/MIRI filters to the JWST/NIRCam filter sets usually discussed in the context of JWST ultra deep fields.« less
Detection and identification of cutaneous leishmaniasis isolates by culture, Polymerase chain reaction and sequence analyses in Syrian and Central Anatolia patients.

PubMed

Beyhan, Yunus E; Karakus, Mehmet; Karagoz, Alper; Mungan, Mesut; Ozkan, Aysegul T; Hokelek, Murat

2017-09-01

To characterize the cutaneous leishmaniasis (CL) isolates of Syrian and Central Anatolia patients at species levels. Methods: Skin scrapings of 3 patients (2 Syrian, 1 Turkish) were taken and examined by direct examination, culture in Novy-MacNeal-Nicole (NNN) medium, internal transcribed spacer polymerase chain reaction and sequence analysis (PCR). Results:According to microscopic examination, culture and PCR methods, 3 samples were detected positive. The sequencing results of all isolates in the study were identified as Leishmania tropica. The same genotypes were detected in the 3 isolates and nucleotide sequence submitted into GenBank with the accession number: KP689599. Conclusion: This finding could give information about the transmission of CL between Turkey and Syria. Because of the Syrian civil war, most of the Syrian citizens circulating in Turkey and different part of Europe, this can be increase the risk of spreading the disease. So, prevention measurements must be taken urgently.
Simultaneous detection and differentiation of three genotypes of Brassica yellows virus by multiplex reverse transcription-polymerase chain reaction.

PubMed

Zhang, Xiaoyan; Peng, Yanmei; Wang, Ying; Zhang, Zongying; Li, Dawei; Yu, Jialin; Han, Chenggui

2016-11-22

Brassica yellows virus (BrYV), proposed to be a new polerovirus species, three distinct genotypes (BrYV-A, BrYV-B and BrYV-C) have been described. This study was to develop a simple, rapid, sensitive, cost-effective method for simultaneous detection and differentiation of three genotypes of BrYV. In this study, a multiplex reverse transcription-polymerase chain reaction (mRT-PCR) was developed for simultaneous detection and differentiation of the three genotypes of BrYV. The three genotypes of BrYV and Tunip yellows virus (TuYV) could be differentiated simultaneously using six optimized specific oligonucleotide primers, including one universal primer for detecting BrYV, three BrYV genotype-specific primers, and a pair of primers for specific detection of TuYV. Primers were designed from conserved regions of each virus and their specificity was confirmed by sequencing PCR products. The mRT-PCR products were 278 bp for BrYV-A, 674 bp for BrYV-B, 505 bp for BrYV-C, and 205 bp for TuYV. Amplification of three target genotypes was optimized by increasing the PCR annealing temperatures to 62 °C. One to three fragments specific for the virus genotypes were simultaneously amplified from infected samples and identified by their specific molecular sizes in agarose gel electrophoresis. No specific products could be amplified from cDNAs of other viruses which could infect crucifer crops. Detection limits of the plasmids for multiplex PCR were 100 fg for BrYV-A and BrYV-B, 10 pg for BrYV-C, and 1 pg for TuYV, respectively. The mRT-PCR was applied successfully for detection of three BrYV genotypes from field samples collected in China. The simple, rapid, sensitive, and cost-effective mRT-PCR was developed successfully for detection and differentiation of the three genotypes of BrYV.
Spectroscopic detections of C III] λ1909 Å at z ≃ 6-7: a new probe of early star-forming galaxies and cosmic reionization

NASA Astrophysics Data System (ADS)

Stark, Daniel P.; Richard, Johan; Charlot, Stéphane; Clément, Benjamin; Ellis, Richard; Siana, Brian; Robertson, Brant; Schenker, Matthew; Gutkin, Julia; Wofford, Aida

2015-06-01

Deep spectroscopic observations of z ≳ 6.5 galaxies have revealed a marked decline with increasing redshift in the detectability of Ly α emission. While this may offer valuable insight into the end of the reionization process, it presents a challenge to the detailed spectroscopic study of bright photometrically-selected distant sources now being found via deep Hubble Space Telescope imaging, and particularly those highly magnified sources viewed through foreground lensing clusters. In this paper, we demonstrate the validity of a new way forward via the detection of an alternative diagnostic line, C III] λ1909 Å, seen in spectroscopic exposures of a star-forming galaxy at zLyα = 6.029. We also report tentative detection of C III] λ1909 Å in a galaxy at zLyα = 7.213. The former 3.3σ detection is based on a 3.5 h XShooter spectrum of a bright (J125 = 25.2) gravitationally-lensed galaxy behind the cluster Abell 383. The latter 2.8σ detection is based on a 4.2 h MOSFIRE spectra of one of the most distant spectroscopically confirmed galaxies, GN-108036, with J140 = 25.2. Both targets were chosen for their continuum brightness and previously-known redshift (based on Ly α), ensuring that any C III] emission would be located in a favourable portion of the near-infrared sky spectrum. Since the availability of secure Ly α redshifts significantly narrows the wavelength range where C III] is sought, this increases confidence in these, otherwise, low-signal-to-noise ratio detections. We compare our C III] and Ly α equivalent widths in the context of those found at z ≃ 2 from earlier work and discuss the motivation for using lines other than Ly α to study galaxies in the reionization era.
[Detection of astrovirus RNA from sewage works, seawater and native oysters samples in Chiba City, Japan using reverse transcription-polymerase chain reaction].

PubMed

Yokoi, H; Kitahashi, T; Tanaka, T; Utagawa, E

2001-04-01

Through a year from April, 1999 to March, 2000, 20 samples, which consisted of raw sewage (2), chlorine-treated sewage (2), seawater (10) and naturally grown oysters (6), were collected monthly both from the sewage works at Mihama-ku, Chiba City and at a yacht harbor in Chiba City Bay, Japan. Astrovirus RNA were detected by reverse transcription-polymerase chain reaction (RT-PCR) and was typed by direct sequencing. Astrovirus positive products were detected from 9 samples (raw sewage; 1/2, chlorine-treated sewage; 2/2, seawater; 5/10 and oysters; 1/6) collected in April, 1999. In May, positive products were detected from 4 samples (raw sewage; 2/2 and seawater; 2/10). In June, only 1 positive product was detected from raw sewage. The number of positive samples showed a tendency to decrease and no positive products were detected from samples collected in July, 1999 to January, 2000. After that period, positive products were again detected from 3 samples (raw sewage; 1/2, chlorine-treated sewage; 2/2) collected in February, 2000. In March, the number of positive samples showed the peak and positive products were detected from 12 samples (raw sewage; 2/2, chlorine-treated sewage; 2/2, seawater; 7/10 and oysters: 1/6). Astrovirus positive products detected in April, May, June, July, 1999 and February, 2000 were classified into type 1 or 2 by sequencing, whereas in March, 2000 were type 1, 2, 3, 6 and 7.
Recombinase polymerase amplification (RPA) combined with lateral flow (LF) strip for detection of Toxoplasma gondii in the environment.

PubMed

Wu, Y D; Xu, M J; Wang, Q Q; Zhou, C X; Wang, M; Zhu, X Q; Zhou, D H

2017-08-30

Toxoplasma gondii infects all warm-blooded vertebrates, resulting in a great threat to human health and significant economic loss to the livestock industry. Ingestion of infectious oocysts of T. gondii from the environment is the major source of transmission. Detection of T. gondii oocysts by existing methods is laborious, time-consuming and expensive. The objective of the present study was to develop a recombinase polymerase amplification (RPA) method combined with a lateral flow (LF) strip for detection of T. gondii oocysts in the soil and water. The DNA of T. gondii oocysts was amplified by a pair of specific primers based on the T. gondii B1 gene over 15min at a constant temperature ranging from 30°C to 45°C using RPA. The amplification product was visualized by the lateral flow (LF) strip within 5min using the specific probe added to the RPA reaction system. The sensitivity of the established assay was 10 times higher than that of nested PCR with a lower detection limit of 0.1 oocyst per reaction, and there was no cross-reactivity with other closely related protozoan species. Fifty environmental samples were further assessed for the detection validity of the LF-RPA assay (B1-LF-RPA) and compared with nested PCR based on the B1 gene sequence. The B1-LF-RPA and nested PCR both showed that 5 out of the 50 environmental samples were positive. The B1-LF-RPA method was also proven to be sufficiently tolerant of existing inhibitors in the environment. In addition, the advantages of simple operation, speediness and cost-effectiveness make B1-LF-RPA a promising molecular detection tool for T. gondii. Copyright © 2017 Elsevier B.V. All rights reserved.
Rapid diagnostic detection of plum pox virus in Prunus plants by isothermal AmplifyRP(®) using reverse transcription-recombinase polymerase amplification.

PubMed

Zhang, Shulu; Ravelonandro, Michel; Russell, Paul; McOwen, Nathan; Briard, Pascal; Bohannon, Seven; Vrient, Albert

2014-10-01

Plum pox virus (PPV) causes the most destructive viral disease known as plum pox or Sharka disease in stone fruit trees. As an important regulated pathogen, detection of PPV is thus of critical importance to quarantine and eradication of the spreading disease. In this study, the innovative development of two AmplifyRP(®) tests is reported for a rapid isothermal detection of PPV using reverse transcription-recombinase polymerase amplification. In an AmplifyRP(®) test, all specific recombination and amplification reactions occur at a constant temperature without thermal cycling and the test results are either recorded in real-time with a portable fluorescence reader or displayed using a lateral flow strip contained inside an amplicon detection chamber. The major improvement of this assay is that the entire test from sample preparation to result can be completed in as little as 20min and can be performed easily both in laboratories and in the field. The results from this study demonstrated the ability of the AmplifyRP(®) technique to detect all nine PPV strains (An, C, CR, D, EA, M, Rec, T, or W). Among the economic benefits to pathogen surveys is the higher sensitivity of the AmplifyRP(®) to detect PPV when compared to the conventional ELISA and ImmunoStrip(®) assays. This is the first report describing the use of such an innovative technique to detect rapidly plant viruses affecting perennial crops. Copyright © 2014 Elsevier B.V. All rights reserved.
Clinical value of polymerase chain reaction in detecting group B streptococcus during labor.

PubMed

Koppes, Dorothea Maria; Vriends, Antonius Arnoldus Cornelis Maria; van Rijn, Michiel; van Heesewijk, Antonine Dimphne

2017-06-01

To reduce the intrapartum use of antibiotics in women with prolonged rupture of the membranes (PROM) by restriction of antibiotics to women who are colonized with group B streptococci (GBS), as identified with the Cepheid Gene Xpert polymerase chain reaction (PCR) for detecting GBS. We conducted a randomized controlled trial among full-term delivering women with PROM. Fifty-four women were enrolled, based on a power calculation with a significance level of 5% and a power of 95%. Twenty-seven women received the standard treatment (rectovaginal swab [RVS] for bacterial culture and antibiotics). For another 27 women PCR was performed on the RVS and antibiotics were used only when the PCR was positive. The primary outcome was reduction in antibiotic use, defined as the percentage of women who received antibiotics during labor. 54 Women were enrolled in the study between 1 May and 18 November 2014. There were no significant differences in baseline characteristics. In total, 10 of the 54 women were GBS positive (18.5%). Of those 10 women, three were identified on bacterial culture and seven on PCR. In the bacterial culture group all the women received antibiotics. In the PCR group 10 women (37%) received antibiotics (P = 0.002). Two false-positive PCR tests were identified. There were no false-negative PCR tests. Real-time identification of GBS on PCR reduces the intrapartum use of antibiotics in women with PROM. © 2017 Japan Society of Obstetrics and Gynecology.
Homology between DNA polymerases of poxviruses, herpesviruses, and adenoviruses: nucleotide sequence of the vaccinia virus DNA polymerase gene.

PubMed Central

Earl, P L; Jones, E V; Moss, B

1986-01-01

A 5400-base-pair segment of the vaccinia virus genome was sequenced and an open reading frame of 938 codons was found precisely where the DNA polymerase had been mapped by transfer of a phosphonoacetate-resistance marker. A single nucleotide substitution changing glycine at position 347 to aspartic acid accounts for the drug resistance of the mutant vaccinia virus. The 5' end of the DNA polymerase mRNA was located 80 base pairs before the methionine codon initiating the open reading frame. Correspondence between the predicted Mr 108,577 polypeptide and the 110,000 purified enzyme indicates that little or no proteolytic processing occurs. Extensive homology, extending over 435 amino acids, was found upon comparing the DNA polymerase of vaccinia virus and DNA polymerase of Epstein-Barr virus. A highly conserved sequence of 14 amino acids in the carboxyl-terminal regions of the above DNA polymerases is also present at a similar location in adenovirus DNA polymerase. This structure, which is predicted to form a turn flanked by beta-pleated sheets, may form part of an essential binding or catalytic site that accounts for its presence in DNA polymerases of poxviruses, herpesviruses, and adenoviruses. Images PMID:3012524
Functional diversification of maize RNA polymerase IV and V subtypes via alternative catalytic subunits

DOE PAGES

Haag, Jeremy R.; Brower-Toland, Brent; Krieger, Elysia K.; ...

2014-10-02

Unlike nuclear multisubunit RNA polymerases I, II, and III, whose subunit compositions are conserved throughout eukaryotes, plant RNA polymerases IV and V are nonessential, Pol II-related enzymes whose subunit compositions are still evolving. Whereas Arabidopsis Pols IV and V differ from Pol II in four or five of their 12 subunits, respectively, and differ from one another in three subunits, proteomic analyses show that maize Pols IV and V differ from Pol II in six subunits but differ from each other only in their largest subunits. Use of alternative catalytic second subunits, which are nonredundant for development and paramutation, yieldsmore » at least two sub-types of Pol IV and three subtypes of Pol V in maize. Pol IV/Pol V associations with MOP1, RMR1, AGO121, Zm_DRD1/CHR127, SHH2a, and SHH2b extend parallels between paramutation in maize and the RNA-directed DNA methylation pathway in Arabidopsis.« less
Functional diversification of maize RNA polymerase IV and V subtypes via alternative catalytic subunits

PubMed Central

Haag, Jeremy R.; Brower-Toland, Brent; Krieger, Elysia K.; Sidorenko, Lyudmila; Nicora, Carrie D.; Norbeck, Angela D.; Irsigler, Andre; LaRue, Huachun; Brzeski, Jan; McGinnis, Karen; Ivashuta, Sergey; Pasa-Tolic, Ljiljana; Chandler, Vicki L.; Pikaard, Craig S.

2014-01-01

Summary Unlike nuclear multisubunit RNA polymerases I, II and III, whose subunit compositions are conserved throughout eukaryotes, plant RNA Polymerases IV and V are non-essential, Pol II-related enzymes whose subunit compositions are still evolving. Whereas Arabidopsis Pols IV and V differ from Pol II in four or five of their twelve subunits, respectively, and differ from one another in three subunits, proteomic analyses show that maize Pols IV and V differ from Pol II in six subunits, but differ from each other only in their largest subunits. Use of alternative catalytic second-subunits, which are non-redundant for development and paramutation, yields at least two subtypes of Pol IV, and three subtypes of Pol V in maize. Pol IV/V associations with MOP1, RMR1, AGO121, Zm_DRD1/CHR127, SHH2a and SHH2b extend parallels between paramutation in maize and the RNA-directed DNA methylation pathway in Arabidopsis. PMID:25284785
Polymerase chain reaction assay targeting cytochrome b gene for the detection of dog meat adulteration in meatball formulation.

PubMed

Rahman, Md Mahfujur; Ali, Md Eaqub; Hamid, Sharifah Bee Abd; Mustafa, Shuhaimi; Hashim, Uda; Hanapi, Ummi Kalthum

2014-08-01

A polymerase chain reaction (PCR) assay for the assessment of dog meat adulteration in meatballs was developed. The assay selectively amplified a 100-bp region of canine mitochondrial cytochrome b gene from pure, raw, processed and mixed backgrounds. The specificity of the assay was tested against 11 animals and 3 plants species, commonly available for meatball formulation. The stability of the assay was proven under extensively autoclaving conditions that breakdown target DNA. A blind test from ready to eat chicken and beef meatballs showed that the assay can repeatedly detect 0.2% canine meat tissues under complex matrices using 0.04 ng of dog DNA extracted from differentially treated meatballs. The simplicity, stability and sensitivity of the assay suggested that it could be used in halal food industry for the authentication of canine derivatives in processed foods. Copyright © 2014 Elsevier Ltd. All rights reserved.
In Vivo Detection of EGFRvIII in Glioblastoma via Perfusion Magnetic Resonance Imaging Signature Consistent with Deep Peritumoral Infiltration: The φ-Index.

PubMed

Bakas, Spyridon; Akbari, Hamed; Pisapia, Jared; Martinez-Lage, Maria; Rozycki, Martin; Rathore, Saima; Dahmane, Nadia; O'Rourke, Donald M; Davatzikos, Christos

2017-08-15

Purpose: The epidermal growth factor receptor variant III ( EGFRvIII ) mutation has been considered a driver mutation and therapeutic target in glioblastoma, the most common and aggressive brain cancer. Currently, detecting EGFRvIII requires postoperative tissue analyses, which are ex vivo and unable to capture the tumor's spatial heterogeneity. Considering the increasing evidence of in vivo imaging signatures capturing molecular characteristics of cancer, this study aims to detect EGFRvIII in primary glioblastoma noninvasively, using routine clinically acquired imaging. Experimental Design: We found peritumoral infiltration and vascularization patterns being related to EGFRvIII status. We therefore constructed a quantitative within-patient peritumoral heterogeneity index (PHI/φ-index), by contrasting perfusion patterns of immediate and distant peritumoral edema. Application of φ-index in preoperative perfusion scans of independent discovery ( n = 64) and validation ( n = 78) cohorts, revealed the generalizability of this EGFRvIII imaging signature. Results: Analysis in both cohorts demonstrated that the obtained signature is highly accurate (89.92%), specific (92.35%), and sensitive (83.77%), with significantly distinctive ability ( P = 4.0033 × 10 -10 , AUC = 0.8869). Findings indicated a highly infiltrative-migratory phenotype for EGFRvIII + tumors, which displayed similar perfusion patterns throughout peritumoral edema. Contrarily, EGFRvIII - tumors displayed perfusion dynamics consistent with peritumorally confined vascularization, suggesting potential benefit from extensive peritumoral resection/radiation. Conclusions: This EGFRvIII signature is potentially suitable for clinical translation, since obtained from analysis of clinically acquired images. Use of within-patient heterogeneity measures, rather than population-based associations, renders φ-index potentially resistant to inter-scanner variations. Overall, our findings enable noninvasive evaluation

Distinguishing Heterodera filipjevi and H. avenae using polymerase chain reaction-restriction fragment length polymorphism and cyst morphology.

PubMed

Yan, Guiping; Smiley, Richard W

2010-03-01

The cereal cyst nematodes Heterodera filipjevi and H. avenae impede wheat production in the Pacific Northwest (PNW). Accurate identification of cyst nematode species and awareness of high population density in affected fields are essential for designing effective control measures. Morphological methods for differentiating these species are laborious. These species were differentiated using polymerase chain reaction restriction fragment length polymorphism (PCR-RFLP) of internal transcribed spacer (ITS)-ribosomal (r)DNA with up to six restriction endonucleases (TaqI, HinfI, PstI, HaeIII, RsaI, and AluI). The method was validated by inspecting underbridge structures of cyst vulval cones. Grid soil sampling of an Oregon field infested by both species revealed that H. filipjevi was present at most of the infested grid sites but mixtures of H. avenae and H. filipjevi also occurred. These procedures also detected and differentiated H. filipjevi and H. avenae in soil samples from nearby fields in Oregon and H. avenae in samples from Idaho and Washington. Intraspecific polymorphism was not observed within H. filipjevi or PNW H. avenae populations based on the ITS-rDNA. However, intraspecific variation was observed between H. avenae populations occurring in the PNW and France. Methods described here will improve detection and identification efficiencies for cereal cyst nematodes in wheat fields.
Standardization and application of real-time polymerase chain reaction for rapid detection of bluetongue virus.

PubMed

Lakshmi, I Karthika; Putty, Kalyani; Raut, Satya Samparna; Patil, Sunil R; Rao, P P; Bhagyalakshmi, B; Jyothi, Y Krishna; Susmitha, B; Reddy, Y Vishnuvardhan; Kasulanati, Sowmya; Jyothi, J Shiva; Reddy, Y N

2018-04-01

The present study was designed to standardize real-time polymerase chain reaction (PCR) for detecting the bluetongue virus from blood samples of sheep collected during outbreaks of bluetongue disease in the year 2014 in Andhra Pradesh and Telangana states of India. A 10-fold serial dilution of Plasmid PUC59 with bluetongue virus (BTV) NS3 insert was used to plot the standard curve. BHK-21 and KC cells were used for in vitro propagation of virus BTV-9 at a TCID50/ml of 10 5 ml and RNA was isolated by the Trizol method. Both reverse transcription-PCR and real-time PCR using TaqMan probe were carried out with RNA extracted from virus-spiked culture medium and blood to compare the sensitivity by means of finding out the limit of detection (LoD). The results were verified by inoculating the detected and undetected dilutions onto cell cultures with further cytological (cytopathic effect) and molecular confirmation (by BTV-NS1 group-specific PCR). The standardized technique was then applied to field samples (blood) for detecting BTV. The slope of the standard curve obtained was -3.23, and the efficiency was 103%. The LoD with RT-PCR was 8.269E×10 3 number of copies of plasmid, whereas it was 13 with real-time PCR for plasmid dilutions. Similarly, LoD was determined for virus-spiked culture medium, and blood with both the types of PCR and the values were 10 3 TCID 50/ml and 10 4 TCID 50/ml with RT-PCR and 10° TCID 50/ml and 10 2 TCID 50/ml with real-time PCR, respectively. The standardized technique was applied to blood samples collected from BTV suspected animals; 10 among 20 samples were found positive with Cq values ranging from 27 to 39. The Cq value exhibiting samples were further processed in cell cultures and were confirmed to be BT positive. Likewise, Cq undetected samples on processing in cell cultures turned out to be BTV negative. Real-time PCR was found to be a very sensitive as well as reliable method to detect BTV present in different types of samples
Detection of Brucella spp. in milk from seronegative cows by real-time polymerase chain reaction in the region of Batna, Algeria

PubMed Central

Sabrina, Rabehi; Mossadak, Hamdi Taha; Bakir, Mamache; Asma, Meghezzi; Khaoula, Boushaba

2018-01-01

Aim: The aim of this study was to detect Brucella spp. DNA in milk samples collected from seronegative cows using the real-time polymerase chain reaction (PCR) assay for diagnosis of brucellosis in seronegative dairy cows to prevent transmission of disease to humans and to reduce economic losses in animal production. Materials and Methods: In this study, 65 milk samples were investigated for the detection of Brucella spp. The detection of the IS711 gene in all samples was done by real-time PCR assay by comparative cycle threshold method. Results: The results show that of the 65 DNA samples tested, 2 (3.08%) were positive for Brucella infection. The mean cyclic threshold values of IS711 real-time PCR test were 37.97 and 40.48, indicating a positive reaction. Conclusion: The results of the present study indicated that the real-time PCR appears to offer several advantages over serological tests. For this reason, the real-time PCR should be validated on representative numbers of Brucella-infected and free samples before being implemented in routine diagnosis in human and animal brucellosis for controlling this disease. PMID:29657430
Value of the polymerase chain reaction method for detecting tuberculosis in the bronchial tissue involved by anthracosis.

PubMed

Mirsadraee, Majid; Shafahie, Ahmad; Reza Khakzad, Mohammad; Sankian, Mojtaba

2014-04-01

Anthracofibrosis is the black discoloration of the bronchial mucosa with deformity and obstruction. Association of this disease with tuberculosis (TB) was approved. The objective of this study was to find the additional benefit of assessment of TB by the polymerase chain reaction (PCR) method. Bronchoscopy was performed on 103 subjects (54 anthracofibrosis and 49 control subjects) who required bronchoscopy for their pulmonary problems. According to bronchoscopic findings, participants were classified to anthracofibrosis and nonanthracotic groups. They were examined for TB with traditional methods such as direct smear (Ziehl-Neelsen staining), Löwenstein-Jensen culture, and histopathology and the new method "PCR" for Mycobacterium tuberculosis genome (IS6110). Age, sex, smoking, and clinical findings were not significantly different in the TB and the non-TB groups. Acid-fast bacilli could be detected by a direct smear in 12 (25%) of the anthracofibrosis subjects, and adding the results of culture and histopathology traditional tests indicated TB in 27 (31%) of the cases. Mycobacterium tuberculosis was diagnosed by PCR in 18 (33%) patients, but the difference was not significant. Detection of acid-fast bacilli in control nonanthracosis subjects was significantly lower (3, 6%), but PCR (20, 40%) and accumulation of results from all traditional methods (22, 44%) showed a nonsignificant difference. The PCR method showed a result equal to traditional methods including accumulation of smear, culture, and histopathology.
A Sensitive Detection Method for MPLW515L or MPLW515K Mutation in Chronic Myeloproliferative Disorders with Locked Nucleic Acid-Modified Probes and Real-Time Polymerase Chain Reaction

PubMed Central

Pancrazzi, Alessandro; Guglielmelli, Paola; Ponziani, Vanessa; Bergamaschi, Gaetano; Bosi, Alberto; Barosi, Giovanni; Vannucchi, Alessandro M.

2008-01-01

Acquired mutations in the juxtamembrane region of MPL (W515K or W515L), the receptor for thrombopoietin, have been described in patients with primary myelofibrosis or essential thrombocythemia, which are chronic myeloproliferative disorders. We have developed a real-time polymerase chain reaction assay for the detection and quantification of MPL mutations that is based on locked nucleic acid fluorescent probes. Mutational analysis was performed using DNA from granulocytes. Reference curves were obtained using cloned fragments of MPL containing either the wild-type or mutated sequence; the predicted sensitivity level was at least 0.1% mutant allele in a wild-type background. None of the 60 control subjects presented with a MPLW515L/K mutation. Of 217 patients with myelofibrosis, 19 (8.7%) harbored the MPLW515 mutation, 10 (52.6%) with the W515L allele. In one case, both the W515L and W515K alleles were detected by real-time polymerase chain reaction. By comparing results obtained with conventional sequencing, no erroneous genotype attribution using real-time polymerase chain reaction was found, whereas one patient considered wild type according to sequence analysis actually harbored a low W515L allele burden. This is a simple, sensitive, and cost-effective procedure for large-scale screening of the MPLW515L/K mutation in patients suspected to have a myeloproliferative disorder. It can also provide a quantitative estimate of mutant allele burden that might be useful for both patient prognosis and monitoring response to therapy. PMID:18669880
A sensitive detection method for MPLW515L or MPLW515K mutation in chronic myeloproliferative disorders with locked nucleic acid-modified probes and real-time polymerase chain reaction.

PubMed

Pancrazzi, Alessandro; Guglielmelli, Paola; Ponziani, Vanessa; Bergamaschi, Gaetano; Bosi, Alberto; Barosi, Giovanni; Vannucchi, Alessandro M

2008-09-01

Acquired mutations in the juxtamembrane region of MPL (W515K or W515L), the receptor for thrombopoietin, have been described in patients with primary myelofibrosis or essential thrombocythemia, which are chronic myeloproliferative disorders. We have developed a real-time polymerase chain reaction assay for the detection and quantification of MPL mutations that is based on locked nucleic acid fluorescent probes. Mutational analysis was performed using DNA from granulocytes. Reference curves were obtained using cloned fragments of MPL containing either the wild-type or mutated sequence; the predicted sensitivity level was at least 0.1% mutant allele in a wild-type background. None of the 60 control subjects presented with a MPLW515L/K mutation. Of 217 patients with myelofibrosis, 19 (8.7%) harbored the MPLW515 mutation, 10 (52.6%) with the W515L allele. In one case, both the W515L and W515K alleles were detected by real-time polymerase chain reaction. By comparing results obtained with conventional sequencing, no erroneous genotype attribution using real-time polymerase chain reaction was found, whereas one patient considered wild type according to sequence analysis actually harbored a low W515L allele burden. This is a simple, sensitive, and cost-effective procedure for large-scale screening of the MPLW515L/K mutation in patients suspected to have a myeloproliferative disorder. It can also provide a quantitative estimate of mutant allele burden that might be useful for both patient prognosis and monitoring response to therapy.
Detection of Natural Toxoplasma gondii Infection in Chicken in Thika Region of Kenya Using Nested Polymerase Chain Reaction

PubMed Central

Karanja, Simon Muturi; Ngotho, Maina; Kamau, David Muchina; Njuguna, Adele Nyambura

2016-01-01

The detection of Toxoplasma gondii in free-range chickens is a good indicator of possible risk to human beings. The aim of this study was to investigate the occurrence of T. gondii in free-range chicken using polymerase chain reaction (PCR). Brain samples from 105 free-range chickens from three administrative areas in Thika region, Kenya, were collected, DNA-extracted, and analyzed using PCR to detect presence of T. gondii. The overall prevalence of T. gondii in all the three areas was 79.0% (95% CI: 70.0–86.4%) and the prevalence across the three areas was not significantly different (P = 0.5088; χ 2 = 1.354). Female chickens had higher (79.4%) prevalence than males (78.6%), although the difference was not significant (P = 0.922, χ 2 = 0.01). However, chickens that were more than 2 years old had significantly (P = 0.003; χ 2 = 11.87) higher prevalence compared to younger ones. The study indicates that there was a high occurrence of T. gondii infection in free-range chickens from Thika region and that the infection rate is age dependent. Further studies should be carried out to determine the possible role of roaming chickens in the epidemiology of the disease among humans in the area. PMID:27981052
Detection of Natural Toxoplasma gondii Infection in Chicken in Thika Region of Kenya Using Nested Polymerase Chain Reaction.

PubMed

Mose, John Mokua; Kagira, John Maina; Karanja, Simon Muturi; Ngotho, Maina; Kamau, David Muchina; Njuguna, Adele Nyambura; Maina, Naomi Wangari

2016-01-01

The detection of Toxoplasma gondii in free-range chickens is a good indicator of possible risk to human beings. The aim of this study was to investigate the occurrence of T. gondii in free-range chicken using polymerase chain reaction (PCR). Brain samples from 105 free-range chickens from three administrative areas in Thika region, Kenya, were collected, DNA-extracted, and analyzed using PCR to detect presence of T. gondii . The overall prevalence of T. gondii in all the three areas was 79.0% (95% CI: 70.0-86.4%) and the prevalence across the three areas was not significantly different ( P = 0.5088; χ 2 = 1.354). Female chickens had higher (79.4%) prevalence than males (78.6%), although the difference was not significant ( P = 0.922, χ 2 = 0.01). However, chickens that were more than 2 years old had significantly ( P = 0.003; χ 2 = 11.87) higher prevalence compared to younger ones. The study indicates that there was a high occurrence of T. gondii infection in free-range chickens from Thika region and that the infection rate is age dependent. Further studies should be carried out to determine the possible role of roaming chickens in the epidemiology of the disease among humans in the area.
RNA Polymerase in Mumps Virion

PubMed Central

Bernard, Jacqueline P.; Northrop, Robert L.

1974-01-01

Mumps virions of the Enders' strain were examined for polymerase activity in vitro. An RNA-dependent RNA polymerase was found to be associated with the virion. The general properties of the reaction appear to be similar to those described for other paramyxoviruses. PMID:4836602
Detection of viable Salmonella in ice cream by TaqMan real-time polymerase chain reaction assay combining propidium monoazide.

PubMed

Wang, Yuexia; Yang, Ming; Liu, Shuchun; Chen, Wanyi; Suo, Biao

2015-09-01

Real-time polymerase chain reaction (PCR) allows rapid detection of Salmonella in frozen dairy products, but it might cause a false positive detection result because it might amplify DNA from dead target cells as well. In this study, Salmonella-free frozen ice cream was initially inoculated with heat-killed Salmonella Typhimurium cells and stored at -18°C. Bacterial DNA extracted from the sample was amplified using TaqMan probe-based real-time PCR targeting the invA gene. Our results indicated that DNA from the dead cells remained stable in frozen ice cream for at least 20 days, and could produce fluorescence signal for real-time PCR as well. To overcome this limitation, propidium monoazide (PMA) was combined with real-time PCR. PMA treatment can effectively prevent PCR amplification from heat-killed Salmonella cells in frozen ice cream. The PMA real-time PCR assay can selectively detect viable Salmonella at as low as 10 3 CFU/mL. Combining 18 hours of pre-enrichment with the assay allows for the detection of viable Salmonella at 10 0 CFU/mL and avoiding the false-positive result of dead cells. The PMA real-time PCR assay provides an alternative specifically for detection of viable Salmonella in ice cream. However, when the PMA real-time PCR assay was evaluated in ice cream subjected to frozen storage, it obviously underestimated the contamination situation of viable Salmonella, which might lead to a false negative result. According to this result, the use of enrichment prior to PMA real-time PCR analysis remains as the more appropriate approach. Copyright © 2015. Published by Elsevier B.V.
Detecting and Targeting Oncogenic Myc in Breast Cancer

DTIC Science & Technology

2007-06-01

through an MBII- dependent interaction with TRRAP [40,41]. Inhibition of TRRAP synthesis or function blocks Myc-mediated oncogenesis, establishing an...transcribed by RNAP I and III. In fact, the various components of the ribosomal machinery are synthesised by all three RNA polymerases, RNAP I, II and III... synthesis . Remarkably, the nucleoli are en- larged in cancer cells and several ribosomal proteins are overexpressed in tumours, suggesting a
Detection of Citrus leprosis virus C using specific primers and TaqMan probe in one-step real-time reverse-transcription polymerase chain reaction assays.

PubMed

Choudhary, Nandlal; Wei, G; Govindarajulu, A; Roy, Avijit; Li, Wenbin; Picton, Deric D; Nakhla, M K; Levy, L; Brlansky, R H

2015-11-01

Citrus leprosis virus C (CiLV-C), a causal agent of the leprosis disease in citrus, is mostly present in the South and Central America and spreading toward the North America. To enable better diagnosis and inhibit the further spread of this re-emerging virus a quantitative (q) real-time reverse transcription polymerase chain reaction (qRT-PCR) assay is needed for early detection of CiLV-C when the virus is present in low titer in citrus leprosis samples. Using the genomic sequence of CiLV-C, specific primers and probe were designed and synthesized to amplify a 73 nt amplicon from the movement protein (MP) gene. A standard curve of the 73 nt amplicon MP gene was developed using known 10(10)-10(1) copies of in vitro synthesized RNA transcript to estimate the copy number of RNA transcript in the citrus leprosis samples. The one-step qRT-PCR detection assays for CiLV-C were determined to be 1000 times more sensitive when compared to the one-step conventional reverse transcription polymerase chain reaction (RT-PCR) CiLV-C detection method. To evaluate the quality of the total RNA extracts, NADH dehydrogenase gene specific primers (nad5) and probe were included in reactions as an internal control. The one-step qRT-PCR specificity was successfully validated by testing for the presence of CiLV-C in the total RNA extracts of the citrus leprosis samples collected from Belize, Costa Rica, Mexico and Panama. Implementation of the one-step qRT-PCR assays for CiLV-C diagnosis should assist regulatory agencies in surveillance activities to monitor the distribution pattern of CiLV-C in countries where it is present and to prevent further dissemination into citrus growing countries where there is no report of CiLV-C presence. Published by Elsevier B.V.
DNA Polymerase Eta and Chemotherapeutic Agents

PubMed Central

2011-01-01

Abstract The discovery of human DNA polymerase eta (pol η) has a major impact on the fields of DNA replication/repair fields. Since the discovery of human pol η, a number of new DNA polymerases with the ability to bypass various DNA lesions have been discovered. Among these polymerases, pol η is the most extensively studied lesion bypass polymerase with a defined major biological function, that is, to replicate across the cyclobutane pyrimidine dimers introduced by UV irradiation. Cyclobutane pyrimidine dimer is a major DNA lesion that causes distortion of DNA structure and block the replicative DNA polymerases during DNA replication process. Genetic defects in the pol η gene, Rad30, results in a disease called xeroderma pigmentosum variant. This review focuses on the overall properties of pol η and the mechanism that involved in regulating its activity in cells. In addition, the role of pol η in the action of DNA-targeting anticancer compounds is also discussed. Antioxid. Redox Signal. 14, 2521–2529. PMID:21050139
Identification of two essential aspartates for polymerase activity in parainfluenza virus L protein by a minireplicon system expressing secretory luciferase.

PubMed

Matsumoto, Yusuke; Ohta, Keisuke; Yumine, Natsuko; Goto, Hideo; Nishio, Machiko

2015-11-01

Gene expression of nonsegmented negative-strand RNA viruses (nsNSVs) such as parainfluenza viruses requires the RNA synthesis activity of their polymerase L protein; however, the detailed mechanism of this process is poorly understood. In this study, a parainfluenza minireplicon assay expressing secretory Gaussia luciferase (Gluc) was established to analyze large protein (L) activity. Measurement of Gluc expression in the culture medium of cells transfected with the minigenome and viral polymerase components enabled quick and concise calculation of L activity. By comparing the amino acid sequences in conserved region III (CRIII), a putative polymerase-active domain of the L protein, two strictly conserved aspartates were identified in all families of nsNSV. A series of L mutants from human parainfluenza virus type 2 and parainfluenza virus type 5 showed that these aspartates are necessary for reporter gene expression. It was also confirmed that these aspartates are important for the production of viral mRNA and antigenome cRNA, but not for a polymerase-complex formation. These findings suggest that these two aspartates are key players in the nucleotidyl transfer reaction using two metal ions. © 2015 The Societies and Wiley Publishing Asia Pty Ltd.
Novel approach to quantitative polymerase chain reaction using real-time detection: application to the detection of gene amplification in breast cancer.

PubMed

Bièche, I; Olivi, M; Champème, M H; Vidaud, D; Lidereau, R; Vidaud, M

1998-11-23

Gene amplification is a common event in the progression of human cancers, and amplified oncogenes have been shown to have diagnostic, prognostic and therapeutic relevance. A kinetic quantitative polymerase-chain-reaction (PCR) method, based on fluorescent TaqMan methodology and a new instrument (ABI Prism 7700 Sequence Detection System) capable of measuring fluorescence in real-time, was used to quantify gene amplification in tumor DNA. Reactions are characterized by the point during cycling when PCR amplification is still in the exponential phase, rather than the amount of PCR product accumulated after a fixed number of cycles. None of the reaction components is limited during the exponential phase, meaning that values are highly reproducible in reactions starting with the same copy number. This greatly improves the precision of DNA quantification. Moreover, real-time PCR does not require post-PCR sample handling, thereby preventing potential PCR-product carry-over contamination; it possesses a wide dynamic range of quantification and results in much faster and higher sample throughput. The real-time PCR method, was used to develop and validate a simple and rapid assay for the detection and quantification of the 3 most frequently amplified genes (myc, ccndl and erbB2) in breast tumors. Extra copies of myc, ccndl and erbB2 were observed in 10, 23 and 15%, respectively, of 108 breast-tumor DNA; the largest observed numbers of gene copies were 4.6, 18.6 and 15.1, respectively. These results correlated well with those of Southern blotting. The use of this new semi-automated technique will make molecular analysis of human cancers simpler and more reliable, and should find broad applications in clinical and research settings.
Massively parallel polymerase cloning and genome sequencing of single cells using nanoliter microwells

PubMed Central

Gole, Jeff; Gore, Athurva; Richards, Andrew; Chiu, Yu-Jui; Fung, Ho-Lim; Bushman, Diane; Chiang, Hsin-I; Chun, Jerold; Lo, Yu-Hwa; Zhang, Kun

2013-01-01

Genome sequencing of single cells has a variety of applications, including characterizing difficult-to-culture microorganisms and identifying somatic mutations in single cells from mammalian tissues. A major hurdle in this process is the bias in amplifying the genetic material from a single cell, a procedure known as polymerase cloning. Here we describe the microwell displacement amplification system (MIDAS), a massively parallel polymerase cloning method in which single cells are randomly distributed into hundreds to thousands of nanoliter wells and simultaneously amplified for shotgun sequencing. MIDAS reduces amplification bias because polymerase cloning occurs in physically separated nanoliter-scale reactors, facilitating the de novo assembly of near-complete microbial genomes from single E. coli cells. In addition, MIDAS allowed us to detect single-copy number changes in primary human adult neurons at 1–2 Mb resolution. MIDAS will further the characterization of genomic diversity in many heterogeneous cell populations. PMID:24213699
The A12.2 Subunit Is an Intrinsic Destabilizer of the RNA Polymerase I Elongation Complex.

PubMed

Appling, Francis D; Scull, Catherine E; Lucius, Aaron L; Schneider, David A

2018-06-05

Despite sharing a highly conserved core architecture with their prokaryotic counterparts, eukaryotic multisubunit RNA polymerases (Pols) have undergone structural divergence and biological specialization. Interesting examples of structural divergence are the A12.2 and C11 subunits of Pols I and III, respectively. Whereas all known cellular Pols possess cognate protein factors that stimulate cleavage of the nascent RNA, Pols I and III have incorporated their cleavage factors as bona fide subunits. Although it is not yet clear why these polymerases have incorporated their cleavage factors as subunits, a picture is emerging that identifies roles for these subunits beyond providing nucleolytic activity. Specifically, it appears that both A12.2 and C11 are required for efficient termination of transcription by Pols I and III. Given that termination involves destabilization of the elongation complex (EC), we tested whether A12.2 influences stability of the Pol I EC. Using, to our knowledge, a novel assay to measure EC dissociation kinetics, we have determined that A12.2 is an intrinsic destabilizer of the Pol I EC. In addition, the salt concentration dependence of Pol I EC dissociation kinetics suggests that A12.2 alters electrostatic interactions within the EC. Importantly, these data present a mechanistic basis for the requirement of A12.2 in Pol I termination. Combined with recent work demonstrating the direct involvement of A12.2 in Pol I nucleotide incorporation, this study further supports the concept that A12.2 cannot be viewed solely as a cleavage factor. Copyright © 2018 Biophysical Society. Published by Elsevier Inc. All rights reserved.
Development of polymerase chain reaction-based diagnostic tests for detection of Malsoor virus & adenovirus isolated from Rousettus species of bats in Maharashtra, India.

PubMed

Shete, Anita M; Yadav, Pragya; Kumar, Vimal; Nikam, Tushar; Mehershahi, Kurosh; Kokate, Prasad; Patil, Deepak; Mourya, Devendra T

2017-01-01

Bats are recognized as important reservoirs for emerging infectious disease and some unknown viral diseases. Two novel viruses, Malsoor virus (family Bunyaviridae, genus, Phlebovirus) and a novel adenovirus (AdV) (family, Adenoviridae genus, Mastadenovirus), were identified from Rousettus bats in the Maharashtra State of India. This study was done to develop and optimize real time reverse transcription - polymerase chain reaction (RT-PCR) assays for Malsoor virus and real time and nested PCR for adenovirus from Rousettus bats. For rapid and accurate screening of Malsoor virus and adenovirus a nested polymerase chain reaction and TaqMan-based real-time PCR were developed. Highly conserved region of nucleoprotein gene of phleboviruses and polymerase gene sequence from the Indian bat AdV isolate polyprotein gene were selected respectively for diagnostic assay development of Malsoor virus and AdV. Sensitivity and specificity of assays were calculated and optimized assays were used to screen bat samples. Molecular diagnostic assays were developed for screening of Malsoor virus and AdV and those were found to be specific. Based on the experiments performed with different parameters, nested PCR was found to be more sensitive than real-time PCR; however, for rapid screening, real-time PCR can be used and further nested PCR can be used for final confirmation or in those laboratories where real-time facility/expertise is not existing. This study reports the development and optimization of nested RT-PCR and a TaqMan-based real-time PCR for Malsoor virus and AdV. The diagnostic assays can be used for rapid detection of these novel viruses to understand their prevalence among bat population.
Aphids preserved in propylene glycol can be used for reverse transcription-polymerase chain reaction detection of Potato virus Y.

PubMed

Nie, Xianzhou; Pelletier, Yvan; Mason, Nicola; Dilworth, Andrea; Giguère, Marie-Andrée

2011-08-01

The effectiveness of propylene glycol on the retention of RNA target of Potato virus Y (PVY), an aphid stylet-borne virus, in Myzus persicae was investigated in comparison to ethanol and liquid nitrogen/-80°C. Reverse transcription-polymerase chain reaction (RT-PCR) was used to detect the PVY targets from the propylene glycol/ethanol/liquid nitrogen preserved single aphids after a 5min acquisition period from infected potato plants. In the liquid nitrogen/-80°C and 70% ethanol treatments, 55.6% and 38.8% aphids tested PVY-positive, respectively. In the 0-75% propylene glycol treatments, 12.2-44.7% aphids tested PVY-positive. The lowest detection rate was in the 0% (positive rate, 15.2%) and the 10% propylene glycol (positive rate, 12.2%). As the propylene glycol concentration increased to 25%, 29.8% aphids tested positive. A high PVY-positive rate was also found in 35-75% propylene glycol treatments at 44.7% (35% propylene glycol), 36.7% (50% propylene glycol) and 34.8% (75% propylene glycol), which is comparable to the rate shown in 70% ethanol. No significant difference in the positive detection rate was observed in aphids preserved in 50% propylene glycol at room temperature for 2, 4 and 10 days. These results demonstrate that propylene glycol at 25-75% can retain PVY targets effectively in aphids for an extended time period, and thus can be used in aphid traps to preserve viruliferous aphids for later RT-PCR detection of PVY. Crown Copyright © 2011. Published by Elsevier B.V. All rights reserved.
Multiplex polymerase chain reaction assay for the differential detection of trichothecene- and fumonisin-producing species of Fusarium in cornmeal.

PubMed

Bluhm, B H; Flaherty, J E; Cousin, M A; Woloshuk, C P

2002-12-01

The genus Fusarium comprises a diverse group of fungi including several species that produce mycotoxins in food commodities. In this study, a multiplex polymerase chain reaction (PCR) assay was developed for the group-specific detection of fumonisin-producing and trichothecene-producing species of Fusarium. Primers for genus-level recognition of Fusarium spp. were designed from the internal transcribed spacer regions (ITS1 and ITS2) of rDNA. Primers for group-specific detection were designed from the TRI6 gene involved in trichothecene biosynthesis and the FUM5 gene involved in fumonisin biosynthesis. Primer specificity was determined by testing for cross-reactivity against purified genomic DNA from 43 fungal species representing 14 genera, including 9 Aspergillus spp., 9 Fusarium spp., and 10 Penicillium spp. With purified genomic DNA as a template, genus-specific recognition was observed at 10 pg per reaction; group-specific recognition occurred at 100 pg of template per reaction for the trichothecene producer Fusarium graminearum and at 1 ng of template per reaction for the fumonisin producer Fusarium verticillioides. For the application of the PCR assay, a protocol was developed to isolate fungal DNA from cornmeal. The detection of F. graminearum and its differentiation from F. verticillioides were accomplished prior to visible fungal growth at <10(5) CFU/g of cornmeal. This level of detection is comparable to those of other methods such as enzyme-linked immunosorbent assay, and the assay described here can be used in the food industry's effort to monitor quality and safety.

Development of a propidium monoazide-polymerase chain reaction assay for detection of viable Lactobacillus brevis in beer.

PubMed

Ma, Yanlin; Deng, Yang; Xu, Zhenbo; Liu, Junyan; Dong, Jianjun; Yin, Hua; Yu, Junhong; Chang, Zongming; Wang, Dongfeng

The spoilage of beer by bacteria is of great concern to the brewer as this can lead to turbidity and abnormal flavors. The polymerase chain reaction (PCR) method for detection of beer-spoilage bacteria is highly specific and provides results much faster than traditional microbiology techniques. However, one of the drawbacks is the inability to differentiate between live and dead cells. In this paper, the combination of propidium monoazide (PMA) pretreatment and conventional PCR had been described. The established PMA-PCR identified beer spoilage Lactobacillus brevis based not on their identity, but on the presence of horA gene which we show to be highly correlated with the ability of beer spoilage LAB to grow in beer. The results suggested that the use of 30μg/mL or less of PMA did not inhibit the PCR amplification of DNA derived from viable L. brevis cells. The minimum amount of PMA to completely inhibit the PCR amplification of DNA derived from dead L. brevis cells was 2.0μg/mL. The detection limit of PMA-PCR assay described here was found to be 10 colony forming units (CFU)/reaction for the horA gene. Moreover, the horA-specific PMA-PCR assays were subjected to 18 reference isolates, representing 100% specificity with no false positive amplification observed. Overall the use of horA-specific PMA-PCR allows for a substantial reduction in the time required for detection of potential beer spoilage L. brevis and efficiently differentiates between viable and nonviable cells. Copyright © 2017 Sociedade Brasileira de Microbiologia. Published by Elsevier Editora Ltda. All rights reserved.
The expanding polymerase universe.

PubMed

Goodman, M F; Tippin, B

2000-11-01

Over the past year, the number of known prokaryotic and eukaryotic DNA polymerases has exploded. Many of these newly discovered enzymes copy aberrant bases in the DNA template over which 'respectable' polymerases fear to tread. The next step is to unravel their functions, which are thought to range from error-prone copying of DNA lesions, somatic hypermutation and avoidance of skin cancer, to restarting stalled replication forks and repairing double-stranded DNA breaks.
Determination of human DNA polymerase utilization for the repair of a model ionizing radiation-induced DNA strand break lesion in a defined vector substrate

NASA Technical Reports Server (NTRS)

Winters, T. A.; Russell, P. S.; Kohli, M.; Dar, M. E.; Neumann, R. D.; Jorgensen, T. J.

1999-01-01

Human DNA polymerase and DNA ligase utilization for the repair of a major class of ionizing radiation-induced DNA lesion [DNA single-strand breaks containing 3'-phosphoglycolate (3'-PG)] was examined using a novel, chemically defined vector substrate containing a single, site-specific 3'-PG single-strand break lesion. In addition, the major human AP endonuclease, HAP1 (also known as APE1, APEX, Ref-1), was tested to determine if it was involved in initiating repair of 3'-PG-containing single-strand break lesions. DNA polymerase beta was found to be the primary polymerase responsible for nucleotide incorporation at the lesion site following excision of the 3'-PG blocking group. However, DNA polymerase delta/straightepsilon was also capable of nucleotide incorporation at the lesion site following 3'-PG excision. In addition, repair reactions catalyzed by DNA polymerase beta were found to be most effective in the presence of DNA ligase III, while those catalyzed by DNA polymerase delta/straightepsilon appeared to be more effective in the presence of DNA ligase I. Also, it was demonstrated that the repair initiating 3'-PG excision reaction was not dependent upon HAP1 activity, as judged by inhibition of HAP1 with neutralizing HAP1-specific polyclonal antibody.
Polymerase chain reaction with phase change as intrinsic thermal control

NASA Astrophysics Data System (ADS)

Hsieh, Yi-Fan; Yonezawa, Eri; Kuo, Long-Sheng; Yeh, Shiou-Hwei; Chen, Pei-Jer; Chen, Ping-Hei

2013-04-01

This research demonstrated that without any external temperature controller, the capillary convective polymerase chain reaction (ccPCR) powered by a candle can operate with the help of phase change. The candle ccPCR system productively amplified hepatitis B virus 122 base-pairs DNA fragment. The detection sensitivity can achieve at an initial DNA concentration to 5 copies per reaction. The results also show that the candle ccPCR system can operate functionally even the ambient temperature varies from 7 °C to 45 °C. These features imply that the candle ccPCR system can provide robust medical detection services.
Multiplex detection of quality indicator molecule targets in urine using programmable hairpin probes based on a simple double-T type microchip electrophoresis platform and isothermal polymerase-catalyzed target recycling.

PubMed

Zhou, Lingying; Gan, Ning; Wu, Yongxiang; Hu, Futao; Lin, Jianyuan; Cao, Yuting; Wu, Dazhen

2018-05-29

Recently, it has been crucial to be able to detect and quantify small molecular targets simultaneously in biological samples. Herein, a simple and conventional double-T type microchip electrophoresis (MCE) based platform for the multiplex detection of quality indicator molecule targets in urine, using ampicillin (AMPI), adenosine triphosphate (ATP) and estradiol (E2) as models, was developed. Several programmable hairpin probes (PHPs) were designed for detecting different targets and triggering isothermal polymerase-catalyzed target recycling (IPCTR) for signal amplification. Based on the target-responsive aptamer structure of PHP (Domain I), target recognition can induce PHP conformational transition and produce extension duplex DNA (dsDNA), assisted by primers & Bst polymerase. Afterwards, the target can be displaced to react with another PHP and initiate the next cycle. After several rounds of reaction, the dsDNA can be produced in large amounts by IPCTR. Three targets can be simultaneously converted to dsDNA fragments with different lengths, which can be separated and detected using MCE. Thus, a simple double-T type MCE based platform was successfully built for the homogeneous detection of multiplex targets in one channel. Under optimal conditions, the assay exhibited high throughput (48 samples per hour at most, not including reaction time) and sensitivity to three targets in urine with a detection limit of 1 nM (ATP), 0.05 nM (AMPI) and 0.1 nM (E2) respectively. The multiplex assay was successfully employed for the above three targets in several urine samples and combined the advantages of the high specificity of programmable hairpin probes, the excellent signal amplification of IPCTR, and the high through-put of MCE which can be employed for screening in biochemical analysis.
A cascade signal amplification strategy for sensitive and label-free DNA detection based on Exo III-catalyzed recycling coupled with rolling circle amplification.

PubMed

Liu, Xingti; Xue, Qingwang; Ding, Yongshun; Zhu, Jing; Wang, Lei; Jiang, Wei

2014-06-07

A sensitive and label-free fluorescence assay for DNA detection has been developed based on cascade signal amplification combining exonuclease III (Exo III)-catalyzed recycling with rolling circle amplification. In this assay, probe DNA hybridized with template DNA was coupled onto magnetic nanoparticles to prepare a magnetic bead-probe (MNB-probe)-template complex. The complex could hybridize with the target DNA, which transformed the protruding 3' terminus of template DNA into a blunt end. Exo III could then digest template DNA, liberating the MNB-probe and target DNA. The intact target DNA then hybridized with other templates and released more MNB-probes. The liberated MNB-probe captured the primer, circular DNA and then initiated the rolling circle amplification (RCA) reaction, realizing a cascade signal amplification. Using this cascade amplification strategy, a sensitive DNA detection method was developed which was superior to many existing Exo III-based signal amplification methods. Moreover, N-methyl mesoporphyrin IX, which had a pronounced structural selectivity for the G-quadruplex, was used to combine with the G-quadruplex RCA products and generate a fluorescence signal, avoiding the need for any fluorophore-label probes. The spike and recovery experiments in a human serum sample indicated that our assay also had great potential for DNA detection in real biological samples.
Development of a reverse transcription quantitative polymerase chain reaction-based assay for broad coverage detection of African and Asian Zika virus lineages.

PubMed

Yang, Yang; Wong, Gary; Ye, Baoguo; Li, Shihua; Li, Shanqin; Zheng, Haixia; Wang, Qiang; Liang, Mifang; Gao, George F; Liu, Lei; Liu, Yingxia; Bi, Yuhai

2017-06-01

The Zika virus (ZIKV) is an arbovirus that has spread rapidly worldwide within recent times. There is accumulating evidence that associates ZIKV infections with Guillain-Barré Syndrome (GBS) and microcephaly in humans. The ZIKV is genetically diverse and can be separated into Asian and African lineages. A rapid, sensitive, and specific assay is needed for the detection of ZIKV across various pandemic regions. So far, the available primers and probes do not cover the genetic diversity and geographic distribution of all ZIKV strains. To this end, we have developed a one-step quantitative reverse transcription polymerase chain reaction (qRT-PCR) assay based on conserved sequences in the ZIKV envelope (E) gene. The detection limit of the assay was determined to be five RNA transcript copies and 2.94 × 10 -3 50% tissue culture infectious doses (TCID 50 ) of live ZIKV per reaction. The assay was highly specific and able to detect five different ZIKV strains covering the Asian and African lineages without nonspecific amplification, when tested against other flaviviruses. The assay was also successful in testing for ZIKV in clinical samples. Our assay represents an improvement over the current methods available for the detection ZIKV and would be valuable as a diagnostic tool in various pandemic regions.
[The development and implementation of polymerase chain reaction to detect in real-time operation mode yersinia pestis in field material].

PubMed

Afanas'ev, M V; Chipanin, E V; Shestakov, V E; Denisov, A V; Fomina, L A; Ostiak, A S; Balakhonov, S V

2013-03-01

The article presents the results of development and practical implementation of system of polymerase chain reaction testing in real-time operation mode to detect agent of plague infield material. In laboratory conditions the system demonstrated good results and hence it was applied in conditions of field laboratory of epidemiologic team during planned epizootologic examination of Gorno-Altaisk hot spot of plague. The sampling consisted of more than 1400 objects. It was demonstrated that high sensitivity and specificity is immanent to proposed system. The adaptation of the system to the real time amplifier "Smart Cycler" (Cephid, USA) having some specific technical characteristics makes it possible to consider the proposed test-system as an effective sensitive and precise instrument for screening studies in the process of regular epizootologic examinations of hot spots of plague.
A novel one-step real-time multiplex PCR assay to detect Streptococcus agalactiae presence and serotypes Ia, Ib, and III.

PubMed

Furfaro, Lucy L; Chang, Barbara J; Payne, Matthew S

2017-09-01

Streptococcus agalactiae is the leading cause of early-onset neonatal sepsis. Culture-based screening methods lack the sensitivity of molecular assays and do not indicate serotype; a potentially important virulence marker. We aimed to develop a multiplex PCR to detect S. agalactiae while simultaneously identifying serotypes Ia, Ib, and III; commonly associated with infant disease. Primers were designed to target S. agalactiae serotype-specific cps genes and the dltS gene. The assay was validated with 512 vaginal specimens from pregnant women. 112 (21.9%) were dltS positive, with 14.3%, 0.9%, and 6.3% of these identified as cps Ia, Ib, and III, respectively. Our assay is a specific and sensitive method to simultaneously detect S. agalactiae and serotypes Ia, Ib, and III in a single step. It is of high significance for clinical diagnostic applications and also provides epidemiological data on serotype, information that may be important for vaccine development and other targeted non-antibiotic therapies. Copyright © 2017 Elsevier Inc. All rights reserved.
A Blood-based Test for the Detection of ROS1 and RET Fusion Transcripts from Circulating Ribonucleic Acid Using Digital Polymerase Chain Reaction

PubMed Central

Mellert, Hestia S.; Alexander, Kristin E.; Jackson, Leisa P.; Pestano, Gary A.

2018-01-01

We have developed novel methods for the isolation and characterization of tumor-derived circulating ribonucleic acid (cRNA) for blood-based liquid biopsy. Robust detection of cRNA recovered from blood represents a solution to a critical unmet need in clinical diagnostics. The test begins with the collection of whole blood into blood collection tubes containing preservatives that stabilize cRNA. Cell-free, exosomal, and platelet-associated RNA is isolated from plasma in this test system. The cRNA is reverse transcribed to complementary DNA (cDNA) and amplified using digital polymerase chain reaction (dPCR). Samples are evaluated for both the target biomarker as well as a control gene. Test validation included limit of detection, accuracy, and robustness studies with analytic samples. The method developed as a result of these studies reproducibly detect multiple fusion variants for ROS1 (C-Ros proto-oncogene 1; 8 variants) and RET (rearranged during transfection proto-oncogene; 8 variants). The sample processing workflow has been optimized so that test results can consistently be generated within 72 hours of sample receipt. PMID:29683453
Identification of duck plague virus by polymerase chain reaction.

PubMed

Hansen, W R; Brown, S E; Nashold, S W; Knudson, D L

1999-01-01

A polymerase chain reaction (PCR) assay was developed for detecting duck plague virus. A 765-bp EcoRI fragment cloned from the genome of the duck plague vaccine (DP-VAC) virus was sequenced for PCR primer development. The fragment sequence was found by GenBank alignment searches to be similar to the 3' ends of an undefined open reading frame and the gene for DNA polymerase protein in other herpesviruses. Three of four primers sets were found to be specific for the DP-VAC virus and 100% (7/7) of field isolates but did not amplify DNA from inclusion body disease of cranes virus. The specificity of one primer set was tested with genome templates from other avian herpesviruses, including those from a golden eagle, bald eagle, great horned owl, snowy owl, peregrine falcon, prairie falcon, pigeon, psittacine, and chicken (infectious laryngotracheitis), but amplicons were not produced. Hence, this PCR test is highly specific for duck plague virus DNA. Two primer sets were able to detect 1 fg of DNA from the duck plague vaccine strain, equivalent to five genome copies. In addition, the ratio of tissue culture infectious doses to genome copies of duck plague vaccine virus from infected duck embryo cells was determined to be 1:100, making the PCR assay 20 times more sensitive than tissue culture for detecting duck plague virus. The speed, sensitivity, and specificity of this PCR provide a greatly improved diagnostic and research tool for studying the epizootiology of duck plague.
Real-Time Polymerase Chain Reaction for Detection of Schistosoma DNA in Small-Volume Urine Samples Reflects Focal Distribution of Urogenital Schistosomiasis in Primary School Girls in KwaZulu Natal, South Africa

PubMed Central

Pillay, Pavitra; Taylor, Myra; Zulu, Siphosenkosi G.; Gundersen, Svein G.; Verweij, Jaco J.; Hoekstra, Pytsje; Brienen, Eric A. T.; Kleppa, Elisabeth; Kjetland, Eyrun F.; van Lieshout, Lisette

2014-01-01

Schistosoma haematobium eggs and Schistosoma DNA levels were measured in urine samples from 708 girls recruited from 18 randomly sampled primary schools in South Africa. Microscopic analysis of two 10-mL urine subsamples collected on three consecutive days confirmed high day-to-day variation; 103 (14.5%) girls had positive results at all six examinations, and at least one positive sample was seen in 225 (31.8%) girls. Schistosoma-specific DNA, which was measured in a 200-μL urine subsample by using real-time polymerase chain reaction, was detected in 180 (25.4%) cases, and levels of DNA corresponded significantly with average urine egg excretion. In concordance with microscopic results, polymerase chain reaction results were significantly associated with history of gynecologic symptoms and confirmed highly focal distribution of urogenital schistosomiasis. Parasite-specific DNA detection has a sensitivity comparable to single urine microscopy and could be used as a standardized high-throughput procedure to assess distribution of urogenital schistosomiasis in relatively large study populations by using small sample volumes. PMID:24470560
High-throughput detection and screening of plants modified by gene editing using quantitative real-time polymerase chain reaction.

PubMed

Peng, Cheng; Wang, Hua; Xu, Xiaoli; Wang, Xiaofu; Chen, Xiaoyun; Wei, Wei; Lai, Yongmin; Liu, Guoquan; Godwin, Ian Douglas; Li, Jieqin; Zhang, Ling; Xu, Junfeng

2018-05-15

Gene editing techniques are becoming powerful tools for modifying target genes in organisms. Although several methods have been developed to detect gene-edited organisms, these techniques are time and labour intensive. Meanwhile, few studies have investigated high-throughput detection and screening strategies for plants modified by gene editing. In this study, we developed a simple, sensitive and high-throughput quantitative real-time (qPCR)-based method. The qPCR-based method exploits two differently labelled probes that are placed within one amplicon at the gene editing target site to simultaneously detect the wild-type and a gene-edited mutant. We showed that the qPCR-based method can accurately distinguish CRISPR/Cas9-induced mutants from the wild-type in several different plant species, such as Oryza sativa, Arabidopsis thaliana, Sorghum bicolor, and Zea mays. Moreover, the method can subsequently determine the mutation type by direct sequencing of the qPCR products of mutations due to gene editing. The qPCR-based method is also sufficiently sensitive to distinguish between heterozygous and homozygous mutations in T 0 transgenic plants. In a 384-well plate format, the method enabled the simultaneous analysis of up to 128 samples in three replicates without handling the post-polymerase chain reaction (PCR) products. Thus, we propose that our method is an ideal choice for screening plants modified by gene editing from many candidates in T 0 transgenic plants, which will be widely used in the area of plant gene editing. © 2018 The Authors The Plant Journal © 2018 John Wiley & Sons Ltd.
Detection of egg drop syndrome virus antigen or genome by enzyme-linked immunosorbent assay or polymerase chain reaction.

PubMed

Dhinakar Raj, G; Sivakumar, S; Matheswaran, K; Chandrasekhar, M; Thiagarajan, V; Nachimuthu, K

2003-10-01

Mouse monoclonal antibodies (mAbs) were produced against an Indian isolate of egg drop syndrome (EDS) virus and characterized. Four hybridoma clones were secreting mAbs that bound to a 100 kDa protein, presumably the hexon protein. These mAbs were found to cross-react with two other Indian isolates of EDS virus and to the reference UK 127 strain. Three of these mAbs were mapped to the same epitope compared with the other mAb (F8), which bound to a different epitope. An antigen-capture enzyme-linked immunosorbent assay (AC-ELISA) was developed using the F8 mAbs as capture antibody and polyclonal chicken serum against EDS virus as detection antibody. A polymerase chain reaction (PCR) was used to detect the EDS viral genome. Following experimental infection of oestrogen-treated chickens with EDS virus, cloacal swabs, oviduct, uterus and spleen were collected at different days post-infection and used in both AC-ELISA and PCR, directly and after a single passage in embryonated duck eggs. The sensitivity and specificity of antigen detection by AC-ELISA or PCR was 95% and 98%, respectively. For diagnosis of EDS viral infections, PCR is recommended due to its ease and the lack of requirement of prepared reagents such as mAbs or conjugates. We recommend that PCR be performed directly on boiled tissue homogenates. Any negative samples may be passaged in embryonated duck eggs and the allantoic fluids tested by PCR before a conclusive negative diagnosis is given.
Detection of Haemophilus influenzae in respiratory secretions from pneumonia patients by quantitative real-time polymerase chain reaction.

PubMed

Abdeldaim, Guma M K; Strålin, Kristoffer; Kirsebom, Leif A; Olcén, Per; Blomberg, Jonas; Herrmann, Björn

2009-08-01

A quantitative real-time polymerase chain reaction (PCR) based on the omp P6 gene was developed to detect Haemophilus influenzae. Its specificity was determined by analysis of 29 strains of 11 different Haemophilus spp. and was compared with PCR assays having other target genes: rnpB, 16S rRNA, and bexA. The method was evaluated on nasopharyngeal aspirates from 166 adult patients with community-acquired pneumonia. When 10(4) DNA copies/mL was used as cutoff limit for the method, P6 PCR had a sensitivity of 97.5% and a specificity of 96.0% compared with the culture. Of 20 culture-negative but P6 PCR-positive cases, 18 were confirmed by fucK PCR as H. influenzae. Five (5.9%) of 84 nasopharyngeal aspirates from adult controls tested PCR positive. We conclude that the P6 real-time PCR is both sensitive and specific for identification of H. influenzae in respiratory secretions. Quantification facilitates discrimination between disease-causing H. influenzae strains and commensal colonization.
Clinical Study of Styping Detection of Human Papillomavirus (HPV) Infection with Microarray from Paraffinembedded Specimens of Cervical Cancer and Precursor Lesions.

PubMed

Li, Hai; Wang, Xubo; Geng, Jianxiang; Zhao, Xue

2015-09-01

The prevalence and type distribution of human papillomavirus (HPV) in cervical cancer and cervical intraepithelial neoplasia (CIN) in Jiangsu, China was investigated. A total of 93 cases with cervical cancer and 176 CINII-III tissue samples were obtained from women undergoing biopsy or surgery. The 1047 exfoliated cervical cell samples were collected with cervical brush in physical examination women. HPV DNA and typing were examined by polymerase chain reaction (PCR) and gene-chip. The results showed that HPV DNA was detected in 82 cases with cervical cancer (88.17%), HPV 16 being detected in 65 (69.89%) cases, HPV 18 in 12 (12.90%) cases, HPV 33 in 10 (10.75%) cases, HPV 31 in 4 (4.30%) cases, and HPV 45 in 3 (3.23%) cases. HPV DNA was detected in 154 cases with CINII-III (87.50%), HPV 16 being detected in 92 (52.27%) cases, HPV 18 in 50 (28.41%) cases, HPV 33 in 25 (14.21%) cases, HPV 58 in 25 (14.21%) cases, and HPV 31 in 20 (11.36%) cases. About 20.43% cervical cancer and 38.64% CINII-III specimens exhibited multiple infections (p < 0.01). The total positive rate, single infection and mixed infection rate of the CINII-III and SCC group all had a significant difference (p < 0.05) when compared with the normal cells group. The total positive rate, single infection rate and mixed infection rate of CINII-III group did not show significant difference (p > 0.05) when compared with SCC group. CINII-III and SCC had all intimate relation with HPV infection. The high prevalence of HPV 16, 18, 33, 31 and 58 in Jiangsu (China) deserves more attention, as it has important implications for the successful use of HPV vaccine and choice of diagnostic methods.
A nested polymerase chain reaction for the detection of genomic DNA of Myxobolus cerebralis in rainbow trout Oncorhynchus mykiss.

PubMed

Andree, K B; MacConnell, E; Hedrick, R P

1998-10-08

A nested polymerase chain reaction (PCR) test was developed to amplify a segment of the 18S rRNA gene from Myxobolus cerebralis, the agent causing whirling disease in salmonid fish. The PCR amplifies a 415 bp amplicon that was identified by dideoxynucleotide terminated sequencing to be identical to the known 18S rDNA sequence of M. cerebralis. There was no amplification of genomic DNA from 4 other myxosporean parasites of salmonid fish from the genus Myxobolus including M. arcticus, M. insidiosus, M. neurobius, and M. squamalis. The efficacy of the PCR test to detect early infections was demonstrated by amplification of the 415 bp fragment from experimentally exposed rainbow trout Oncorhynchus mykiss at 2 h and at 1, 2, and 3 wk postexposure to actinosporean stages (triactinomyxons) of M. cerebralis. In contrast, standard microscopic examinations of stained tissue sections of the same fish used for PCR were less reliable in detecting the presence of the parasite. Additional examinations of fish 5 mo postexposure, after sporogenesis had occurred, found the PCR to be a more reliable indicator of infection than pepsin-trypsin digest (PTD) method, particularly when trout were experimentally exposed to low levels of the infectious stages of the parasite. The PCR was able to amplify to detectable levels the equivalent of a single sporoplasm of M. cerebralis as found in a tissue sample. This test improves the detection of M. cerebralis because it can detect the presence of the parasite: (1) in both hosts, (2) in all known stages of its life cycle, and (3) at lower thresholds than currently used diagnostic methods. Lastly, the PCR test is less susceptible to morphological misidentifications of the spores that can occur with current microscopic procedures.
Review of Detection of Brucella sp. by Polymerase Chain Reaction

PubMed Central

Yu, Wei Ling; Nielsen, Klaus

2010-01-01

Here we present a review of most of the currently used polymerase chain reaction (PCR)-based methods for identification of Brucella bacteria in biological samples. We focused in particular on methods using single-pair primers, multiplex primers, real-time PCRs, PCRs for marine Brucella, and PCRs for molecular biotyping. These methods are becoming very important tools for the identification of Brucella, at the species level and recently also at the biovar level. These techniques require minimum biological containment and can provide results in a very short time. In addition, genetic fingerprinting of isolates aid in epidemiological studies of the disease and its control. PCR-based methods are more useful and practical than conventional methods used to identify Brucella spp., and new methods for Brucella spp identification and typing are still being developed. However, the sensitivity, specificity, and issues of quality control and quality assurance using these methods must be fully validated on clinical samples before PCR can be used in routine laboratory testing for brucellosis. PMID:20718083
Detecting cooperative sequences in the binding of RNA Polymerase-II

NASA Astrophysics Data System (ADS)

Glass, Kimberly; Rozenberg, Julian; Girvan, Michelle; Losert, Wolfgang; Ott, Ed; Vinson, Charles

2008-03-01

Regulation of the expression level of genes is a key biological process controlled largely by the 1000 base pair (bp) sequence preceding each gene (the promoter region). Within that region transcription factor binding sites (TFBS), 5-10 bp long sequences, act individually or cooperate together in the recruitment of, and therefore subsequent gene transcription by, RNA Polymerase-II (RNAP). We have measured the binding of RNAP to promoters on a genome-wide basis using Chromatin Immunoprecipitation (ChIP-on-Chip) microarray assays. Using all 8-base pair long sequences as a test set, we have identified the DNA sequences that are enriched in promoters with high RNAP binding values. We are able to demonstrate that virtually all sequences enriched in such promoters contain a CpG dinucleotide, indicating that TFBS that contain the CpG dinucleotide are involved in RNAP binding to promoters. Further analysis shows that the presence of pairs of CpG containing sequences cooperate to enhance the binding of RNAP to the promoter.
Mutants of the base excision repair glycosylase, endonuclease III: DNA charge transport as a first step in lesion detection.

PubMed

Romano, Christine A; Sontz, Pamela A; Barton, Jacqueline K

2011-07-12

Endonuclease III (EndoIII) is a base excision repair glycosylase that targets damaged pyrimidines and contains a [4Fe-4S] cluster. We have proposed a model where BER proteins that contain redox-active [4Fe-4S] clusters utilize DNA charge transport (CT) as a first step in the detection of DNA lesions. Here, several mutants of EndoIII were prepared to probe their efficiency of DNA/protein charge transport. Cyclic voltammetry experiments on DNA-modified electrodes show that aromatic residues F30, Y55, Y75, and Y82 help mediate charge transport between DNA and the [4Fe-4S] cluster. On the basis of circular dichroism studies to measure protein stability, mutations at residues W178 and Y185 are found to destabilize the protein; these residues may function to protect the [4Fe-4S] cluster. Atomic force microscopy studies furthermore reveal a correlation in the ability of mutants to carry out protein/DNA CT and their ability to relocalize onto DNA strands containing a single base mismatch; EndoIII mutants that are defective in carrying out DNA/protein CT do not redistribute onto mismatch-containing strands, consistent with our model. These results demonstrate a link between the ability of the repair protein to carry out DNA CT and its ability to relocalize near lesions, thus pointing to DNA CT as a key first step in the detection of base damage in the genome.

Mutants of the Base Excision Repair Glycosylase, Endonuclease III: DNA Charge Transport as a First Step in Lesion Detection

PubMed Central

Romano, Christine A.; Sontz, Pamela A.; Barton, Jacqueline K.

2011-01-01

Endonuclease III (EndoIII) is a base excision repair glycosylase that targets damaged pyrimidines and contains a [4Fe-4S] cluster. We have proposed a model where BER proteins that contain redox-active [4Fe-4S] clusters utilize DNA charge transport (CT) as a first step in the detection of DNA lesions. Here, several mutants of EndoIII were prepared to probe their efficiency of DNA/protein charge transport. Cyclic voltammetry experiments on DNA-modified electrodes show that aromatic residues F30, Y55, Y75 and Y82 help mediate charge transport between DNA and the [4Fe-4S] cluster. Based on circular dichroism studies to measure protein stability, mutations at residues W178 and Y185 are found to destabilize the protein; these residues may function to protect the [4Fe-4S] cluster. Atomic force microscopy studies furthermore reveal a correlation in the ability of mutants to carry out protein/DNA CT and their ability to relocalize onto DNA strands containing a single base mismatch; EndoIII mutants that are defective in carrying out DNA/protein CT do not redistribute onto mismatch-containing strands, consistent with our model. These results demonstrate a link between the ability of the repair protein to carry out DNA CT and its ability to relocalize near lesions, thus pointing to DNA CT as a key first step in the detection of base damage in the genome. PMID:21651304
Recombinase Polymerase Amplification Assay for Rapid Diagnostics of Dengue Infection

PubMed Central

Abd El Wahed, Ahmed; Patel, Pranav; Faye, Oumar; Thaloengsok, Sasikanya; Heidenreich, Doris; Matangkasombut, Ponpan; Manopwisedjaroen, Khajohnpong; Sakuntabhai, Anavaj; Sall, Amadou A.; Hufert, Frank T.; Weidmann, Manfred

2015-01-01

Background Over 2.5 billion people are exposed to the risk of contracting dengue fever (DF). Early diagnosis of DF helps to diminish its burden on public health. Real-time reverse transcription polymerase amplification assays (RT-PCR) are the standard method for molecular detection of the dengue virus (DENV). Real-time RT-PCR analysis is not suitable for on-site screening since mobile devices are large, expensive, and complex. In this study, two RT-recombinase polymerase amplification (RT-RPA) assays were developed to detect DENV1-4. Methodology/Principal Findings Using two quantitative RNA molecular standards, the analytical sensitivity of a RT-RPA targeting the 3´non-translated region of DENV1-4 was found to range from 14 (DENV4) to 241 (DENV1-3) RNA molecules detected. The assay was specific and did not cross detect other Flaviviruses. The RT-RPA assay was tested in a mobile laboratory combining magnetic-bead based total nucleic acid extraction and a portable detection device in Kedougou (Senegal) and in Bangkok (Thailand). In Kedougou, the RT-RPA was operated at an ambient temperature of 38°C with auxiliary electricity tapped from a motor vehicle and yielded a clinical sensitivity and specificity of 98% (n=31) and 100% (n=23), respectively. While in the field trial in Bangkok, the clinical sensitivity and specificity were 72% (n=90) and 100%(n=41), respectively. Conclusions/Significance During the first 5 days of infection, the developed DENV1-4 RT-RPA assays constitute a suitable accurate and rapid assay for DENV diagnosis. Moreover, the use of a portable fluorescence-reading device broadens its application potential to the point-of-care for outbreak investigations. PMID:26075598
Development of a recombinase polymerase amplification combined with lateral-flow dipstick assay for detection of bovine ephemeral fever virus.

PubMed

Hou, Peili; Zhao, Guimin; Wang, Hongmei; He, Chengqiang; Huan, Yanjun; He, Hongbin

2018-04-01

Bovine ephemeral fever virus (BEFV), identified as the causative pathogen of bovine ephemeral fever (BEF), is responsible for increasing numbers of epidemics/outbreaks and has a significant harmful effect on the livestock industry. Therefore, a rapid detection assay is imperative for BEFV diagnosis. In this study, we described the development of lateral-flow dipstick isothermal recombinase polymerase amplification (LFD-RPA) assays for detection of BEFV. RPA primers and LF probes were designed by targeting the specific G gene, and the amplification product can be visualized on a simple lateral flow dipstick with the naked eyes. The amplification reaction was performed at 38 °C for 20 min and LFD incubation time within 5 min. The detection limit of this assay was 8 copies per reaction, and there was no cross-reactivity with other bovine infectious viruses such as bovine viral diarrhea virus, infectious bovine rhinotracheitis virus, bovine respiratory syncytial virus, bovine coronavirus, bovine parainfluenza virus type 3, bovine vesicular stomatitis virus. In addition, the assay was performed with total 128 clinical specimens and the diagnostic results were compared with conventional RT-PCR, real-time quantative(q) PCR. The result showed that the coincidence rate of BEFV LFD-RPA and real-time qPCR was 96.09% (123/128), which was higher than conventional RT-PCR. The RPA combined with LFD assay probably provides a rapid and sensitive alternative for diagnosis of BEFV infections outbreak. Copyright © 2018 Elsevier Ltd. All rights reserved.
Polymerase chain reaction in the detection of tumor cells: new approaches in diagnosis and follow-up of patients with thyroid cancer.

PubMed

Bojunga, Jörg; Kusterer, Klaus; Schumm-Draeger, Petra-Maria; Usadel, Klaus-Henning

2002-12-01

Thyroid cancers are the most common endocrine malignancies and are being diagnosed with increasing frequency. In addition to other measures, diagnosis is based on fine-needle aspiration cytology examination. Recently, new assays using reverse transcription-polymerase chain reaction (PCR) are being tested to improve sensitivity and specificity of primary diagnosis and detection of recurrent thyroid cancer. In the preoperative diagnosis of thyroid cancer, several tissue- and/or tumor-specific mRNA have been described and in several cases, a higher sensitivity and specificity could be achieved using molecular techniques compared to conventional methods. In the postoperative follow-up of patients with thyroid cancer, conflicting data have been published and the use of PCR techniques revealed several problems of the molecular approach, which are based on some technical as well as biologic limitations. Despite these problems, which are discussed in detail in this review, molecular techniques may nevertheless improve the sensitivity and accuracy of fine-needle aspiration of thyroid nodules, fine-needle aspiration of metastases, and detection of recurrent disease in peripheral blood samples.
Pathology and polymerase chain reaction detection of ovine progressive pneumonia (maedi) cases in slaughtered sheep in India

PubMed Central

Singh, Rahul; Kumar, Pawan; Singh, Rajendra; Dhama, Kuldeep; Kumari, Swati; Yadav, Jay Prakash; Kashyap, Gayatri; Singh, Karam Pal; Singh, Vidya; Sahoo, Monalisa

2017-01-01

Aim: The small ruminant lentiviruses are known to cause maedi-visna (MV) and caprine arthritis - encephalitis in sheep and goats, typically affecting joints, udder, lungs, and the central nervous system. The diagnosis usually involves serology, clinical signs, immunohistochemistry, and polymerase chain reaction (PCR). In the present study, the histopathologically positive pneumonia cases of MV were confirmed by PCR in lung tissue probably for the first time in India. Materials and Methods: A total of 888 lungs of adult sheep, aged between 2 and 5 years, were screened during slaughter, of which 121 were found to have pneumonic lesions. The tissues from each pneumonic lung including associated lymph nodes were collected in 10% neutral buffered formalin for histopathology. The frozen tissues of the same were also collected and stored at −20°C for PCR confirmation. Results: Three of 121 cases of pneumonic lungs of sheep revealed gross and histopathological lesions suggestive of maedi or ovine progressive pneumonia infection. These 3 cases were further confirmed by PCR technique that amplified 291-base pair DNA in the long terminal repeat sequence of MV provirus. Conclusion: This study suggests the low occurrence of MV virus (MVV) infection in India in naturally affected sheep based on pathomorphological lesions and using the molecular tool of PCR detection of the virus in tissues. Further, a combination of pathomorphology or/and PCR testing might be optimal for detecting the animals infected with MVV. PMID:29263606
Single cell digital polymerase chain reaction on self-priming compartmentalization chip.

PubMed

Zhu, Qiangyuan; Qiu, Lin; Xu, Yanan; Li, Guang; Mu, Ying

2017-01-01

Single cell analysis provides a new framework for understanding biology and disease, however, an absolute quantification of single cell gene expression still faces many challenges. Microfluidic digital polymerase chain reaction (PCR) provides a unique method to absolutely quantify the single cell gene expression, but only limited devices are developed to analyze a single cell with detection variation. This paper describes a self-priming compartmentalization (SPC) microfluidic digital polymerase chain reaction chip being capable of performing single molecule amplification from single cell. The chip can be used to detect four single cells simultaneously with 85% of sample digitization. With the optimized protocol for the SPC chip, we first tested the ability, precision, and sensitivity of our SPC digital PCR chip by assessing β-actin DNA gene expression in 1, 10, 100, and 1000 cells. And the reproducibility of the SPC chip is evaluated by testing 18S rRNA of single cells with 1.6%-4.6% of coefficient of variation. At last, by detecting the lung cancer related genes, PLAU gene expression of A549 cells at the single cell level, the single cell heterogeneity was demonstrated. So, with the power-free, valve-free SPC chip, the gene copy number of single cells can be quantified absolutely with higher sensitivity, reduced labor time, and reagent. We expect that this chip will enable new studies for biology and disease.
Single cell digital polymerase chain reaction on self-priming compartmentalization chip

PubMed Central

Zhu, Qiangyuan; Qiu, Lin; Xu, Yanan; Li, Guang; Mu, Ying

2017-01-01

Single cell analysis provides a new framework for understanding biology and disease, however, an absolute quantification of single cell gene expression still faces many challenges. Microfluidic digital polymerase chain reaction (PCR) provides a unique method to absolutely quantify the single cell gene expression, but only limited devices are developed to analyze a single cell with detection variation. This paper describes a self-priming compartmentalization (SPC) microfluidic digital polymerase chain reaction chip being capable of performing single molecule amplification from single cell. The chip can be used to detect four single cells simultaneously with 85% of sample digitization. With the optimized protocol for the SPC chip, we first tested the ability, precision, and sensitivity of our SPC digital PCR chip by assessing β-actin DNA gene expression in 1, 10, 100, and 1000 cells. And the reproducibility of the SPC chip is evaluated by testing 18S rRNA of single cells with 1.6%–4.6% of coefficient of variation. At last, by detecting the lung cancer related genes, PLAU gene expression of A549 cells at the single cell level, the single cell heterogeneity was demonstrated. So, with the power-free, valve-free SPC chip, the gene copy number of single cells can be quantified absolutely with higher sensitivity, reduced labor time, and reagent. We expect that this chip will enable new studies for biology and disease. PMID:28191267
Determination of Sulfonamide Residues in Food by Capillary Zone Electrophoresis with On-Line Chemiluminescence Detection Based on an Ag(III) Complex

PubMed Central

Dai, Tingting; Duan, Jie; Li, Xinghua; Xu, Xiangdong; Shi, Hongmei; Kang, Weijun

2017-01-01

The presence of sulfonamide (SA) residues in foods is largely due to the raising of animals with sulfonamide antibiotics added or polluted feedstuff. In this paper, a sensitive method was developed for the determination of the residues of three sulfonamides in animal-derived food; the SAs include sulfadimidine (SDD), sulfadiazine (SDZ), and sulfathiazole (STZ). The method is based on capillary zone electrophoresis (CE) with online chemiluminescence (CL) detection, using an Ag(III) complex as an oxidant. These SAs have an inhibiting effect on the Ag(III)–luminol CL reaction. The electrophoretic buffer is 12.0 mM sodium borate. Under a set of optimized conditions, the linear ranges for the detections were found to be 10.0–200 µg·mL−1 for SDD and SDZ, and 2.0–50.0 µg·mL−1 for STZ. The detection limits were 2.75, 3.14, and 0.65 µg·mL−1 for SDD, SDZ, and STZ, respectively. Relative standard deviations (RSD) for the peak heights were between 2.1% and 2.8% (n = 7). The proposed method was used in the analysis of the SAs in samples from pork meat, chicken meat, and milk, showing satisfactory detection results. A reaction mechanism was also proposed for the Ag(III)–luminol–SA CL reactions. The method has potential applications for the monitoring of residue levels of the three SAs in food, providing food safety data. PMID:28621728
Determination of Sulfonamide Residues in Food by Capillary Zone Electrophoresis with On-Line Chemiluminescence Detection Based on an Ag(III) Complex.

PubMed

Dai, Tingting; Duan, Jie; Li, Xinghua; Xu, Xiangdong; Shi, Hongmei; Kang, Weijun

2017-06-16

The presence of sulfonamide (SA) residues in foods is largely due to the raising of animals with sulfonamide antibiotics added or polluted feedstuff. In this paper, a sensitive method was developed for the determination of the residues of three sulfonamides in animal-derived food; the SAs include sulfadimidine (SDD), sulfadiazine (SDZ), and sulfathiazole (STZ). The method is based on capillary zone electrophoresis (CE) with online chemiluminescence (CL) detection, using an Ag(III) complex as an oxidant. These SAs have an inhibiting effect on the Ag(III)-luminol CL reaction. The electrophoretic buffer is 12.0 mM sodium borate. Under a set of optimized conditions, the linear ranges for the detections were found to be 10.0-200 µg·mL -1 for SDD and SDZ, and 2.0-50.0 µg·mL -1 for STZ. The detection limits were 2.75, 3.14, and 0.65 µg·mL -1 for SDD, SDZ, and STZ, respectively. Relative standard deviations (RSD) for the peak heights were between 2.1% and 2.8% (n = 7). The proposed method was used in the analysis of the SAs in samples from pork meat, chicken meat, and milk, showing satisfactory detection results. A reaction mechanism was also proposed for the Ag(III)-luminol-SA CL reactions. The method has potential applications for the monitoring of residue levels of the three SAs in food, providing food safety data.
A screening method for the detection of the 35S promoter and the nopaline synthase terminator in genetically modified organisms in a real-time multiplex polymerase chain reaction using high-resolution melting-curve analysis.

PubMed

Akiyama, Hiroshi; Nakamura, Fumi; Yamada, Chihiro; Nakamura, Kosuke; Nakajima, Osamu; Kawakami, Hiroshi; Harikai, Naoki; Furui, Satoshi; Kitta, Kazumi; Teshima, Reiko

2009-11-01

To screen for unauthorized genetically modified organisms (GMO) in the various crops, we developed a multiplex real-time polymerase chain reaction high-resolution melting-curve analysis method for the simultaneous qualitative detection of 35S promoter sequence of cauliflower mosaic virus (35SP) and the nopaline synthase terminator (NOST) in several crops. We selected suitable primer sets for the simultaneous detection of 35SP and NOST and designed the primer set for the detection of spiked ColE1 plasmid to evaluate the validity of the polymerase chain reaction (PCR) analyses. In addition, we optimized the multiplex PCR conditions using the designed primer sets and EvaGreen as an intercalating dye. The contamination of unauthorized GMO with single copy similar to NK603 maize can be detected as low as 0.1% in a maize sample. Furthermore, we showed that the present method would be applicable in identifying GMO in various crops and foods like authorized GM soybean, authorized GM potato, the biscuit which is contaminated with GM soybeans and the rice which is contaminated with unauthorized GM rice. We consider this method to be a simple and reliable assay for screening for unauthorized GMO in crops and the processing food products.
Electrochemical branched-DNA assay for polymerase chain reaction-free detection and quantification of oncogenes in messenger RNA.

PubMed

Lee, Ai-Cheng; Dai, Ziyu; Chen, Baowei; Wu, Hong; Wang, Jun; Zhang, Aiguo; Zhang, Lurong; Lim, Tit-Meng; Lin, Yuehe

2008-12-15

We describe a novel electrochemical branched-DNA (bDNA) assay for polymerase chain reaction (PCR)-free detection and quantification of p185 BCR-ABL leukemia fusion transcripts in the population of messenger ribonucleic acid (mRNA) extracted from cell lines. The bDNA amplifier carrying high loading of alkaline phosphatase (ALP) tracers was used to amplify the target signal. The targets were captured on microplate well surfaces through cooperative sandwich hybridization prior to the labeling of bDNA. The activity of captured ALP was monitored by square-wave voltammetric (SWV) analysis of the electroactive enzymatic product in the presence of 1-naphthyl phosphate. The voltammetric characteristics of substrate and enzymatic product as well as the parameters of SWV analysis were systematically optimized. A detection limit of 1 fM (1 x 10(-19) mol of target transcripts in 100 microL) and a 3-order-wide dynamic range of target concentration were achieved by the electrochemical bDNA assay. Such limit corresponded to approximately 17 fg of the p185 BCR-ABL fusion transcripts. The specificity and sensitivity of assay enabled direct detection of target transcripts in as little as 4.6 ng of mRNA population without PCR amplification. In combination with the use of a well-quantified standard, the electrochemical bDNA assay was capable of direct use for a PCR-free quantitative analysis of target transcripts in mRNA population. A mean transcript copy number of 62,900/ng of mRNA was determined, which was at least 50-fold higher than that of real-time quantitative PCR (qPCR). The finding was consistent with the underestimation of targets by qPCR reported earlier. In addition, the unique design based on bDNA technology increases the assay specificity as only the p185 BCR-ABL fusion transcripts will respond to the detection. The approach thus provides a simple, sensitive, accurate, and quantitative tool alternative to the qPCR for early disease diagnosis.
Detection of central nervous system leukemia in children with acute lymphoblastic leukemia by real-time polymerase chain reaction.

PubMed

Pine, Sharon R; Yin, Changhong; Matloub, Yousif H; Sabaawy, Hatem E; Sandoval, Claudio; Levendoglu-Tugal, Oya; Ozkaynak, M Fevzi; Jayabose, Somasundaram

2005-02-01

Accurate detection of central nervous system (CNS) involvement in children with newly diagnosed acute lymphoblastic leukemia (ALL) could have profound prognostic and therapeutic implications. We examined various cerebrospinal fluid (CSF) preservation methods to yield adequate DNA stability for polymerase chain reaction (PCR) analysis and developed a quantitative real-time PCR assay to detect occult CNS leukemia. Sixty CSF specimens were maintained in several storage conditions for varying amounts of time, and we found that preserving CSF in 1:1 serum-free RPMI tissue culture medium offers the best stability of DNA for PCR analysis. Sixty CSF samples (30 at diagnosis and 30 at the end of induction therapy) from 30 children with ALL were tested for CNS leukemic involvement by real-time PCR using patient-specific antigen receptor gene rearrangement primers. Six of thirty patient diagnosis samples were PCR-positive at levels ranging from 0.5 to 66% leukemic blasts in the CSF. Four of these patients had no clinical or cytomorphological evidence of CNS leukemia involvement at that time. All 30 CSF samples drawn at the end of induction therapy were PCR-negative. The data indicate that real-time PCR analysis of CSF is an excellent tool to assess occult CNS leukemia involvement in patients with ALL and can possibly be used to refine CNS status classification.
Detection of Central Nervous System Leukemia in Children with Acute Lymphoblastic Leukemia by Real-Time Polymerase Chain Reaction

PubMed Central

Pine, Sharon R.; Yin, Changhong; Matloub, Yousif H.; Sabaawy, Hatem E.; Sandoval, Claudio; Levendoglu-Tugal, Oya; Ozkaynak, M. Fevzi; Jayabose, Somasundaram

2005-01-01

Accurate detection of central nervous system (CNS) involvement in children with newly diagnosed acute lymphoblastic leukemia (ALL) could have profound prognostic and therapeutic implications. We examined various cerebrospinal fluid (CSF) preservation methods to yield adequate DNA stability for polymerase chain reaction (PCR) analysis and developed a quantitative real-time PCR assay to detect occult CNS leukemia. Sixty CSF specimens were maintained in several storage conditions for varying amounts of time, and we found that preserving CSF in 1:1 serum-free RPMI tissue culture medium offers the best stability of DNA for PCR analysis. Sixty CSF samples (30 at diagnosis and 30 at the end of induction therapy) from 30 children with ALL were tested for CNS leukemic involvement by real-time PCR using patient-specific antigen receptor gene rearrangement primers. Six of thirty patient diagnosis samples were PCR-positive at levels ranging from 0.5 to 66% leukemic blasts in the CSF. Four of these patients had no clinical or cytomorphological evidence of CNS leukemia involvement at that time. All 30 CSF samples drawn at the end of induction therapy were PCR-negative. The data indicate that real-time PCR analysis of CSF is an excellent tool to assess occult CNS leukemia involvement in patients with ALL and can possibly be used to refine CNS status classification. PMID:15681484
Cationic polyelectrolyte functionalized magnetic particles assisted highly sensitive pathogens detection in combination with polymerase chain reaction and capillary electrophoresis.

PubMed

Chen, Jia; Lin, Yuexin; Wang, Yu; Jia, Li

2015-06-01

Pathogenic bacteria cause significant morbidity and mortality to humans. There is a pressing need to establish a simple and reliable method to detect them. Herein, we show that magnetic particles (MPs) can be functionalized by poly(diallyl dimethylammonium chloride) (PDDA), and the particles (PDDA-MPs) can be utilized as adsorbents for capture of pathogenic bacteria from aqueous solution based on electrostatic interaction. The as-prepared PDDA-MPs were characterized by Fourier-transform infrared spectroscopy, zeta potential, vibrating sample magnetometry, X-ray diffraction spectrometry, scanning electron microscopy, and transmission electron microscopy. The adsorption equilibrium time can be achieved in 3min. According to the Langmuir adsorption isotherm, the maximum adsorption capacities for E. coli O157:H7 (Gram-negative bacteria) and L. monocytogenes (Gram-positive bacteria) were calculated to be 1.8×10(9) and 3.1×10(9)cfumg(-1), respectively. The bacteria in spiked mineral water (1000mL) can be completely captured when applying 50mg of PDDA-MPs and an adsorption time of 5min. In addition, PDDA-MPs-based magnetic separation method in combination with polymerase chain reaction and capillary electrophoresis allows for rapid detection of 10(1)cfumL(-1) bacteria. Copyright © 2015 Elsevier B.V. All rights reserved.
Real-time polymerase chain reaction in transfusion medicine: applications for detection of bacterial contamination in blood products.

PubMed

Dreier, Jens; Störmer, Melanie; Kleesiek, Knut

2007-07-01

Bacterial contamination of blood components, particularly of platelet concentrates (PCs), represents the greatest infectious risk in blood transfusion. Although the incidence of platelet bacterial contamination is approximately 1 per 2,000 U, the urgent need for a method for the routine screening of PCs to improve safety for patients had not been considered for a long time. Besides the culturing systems, which will remain the criterion standard, rapid methods for sterility screening will play a more important role in transfusion medicine in the future. In particular, nucleic acid amplification techniques (NATs) are powerful potential tools for bacterial screening assays. The combination of excellent sensitivity and specificity, reduced contamination risk, ease of performance, and speed has made real-time polymerase chain reaction (PCR) technology an appealing alternative to conventional culture-based testing methods. When using real-time PCR for the detection of bacterial contamination, several points have to be considered. The main focus is the choice of the target gene; the assay format; the nucleic acid extraction method, depending on the sample type; and the evaluation of an ideal sampling strategy. However, several factors such as the availability of bacterial-derived nucleic acid amplification reagents, the impracticability, and the cost have limited the use of NATs until now. Attempts to reduce the presence of contaminating nucleic acids from reagents in real-time PCR have been described, but none of these approaches have proven to be very effective or to lower the sensitivity of the assay. Recently, a number of broad-range NAT assays targeting the 16S ribosomal DNA or 23S ribosomal RNA for the detection of bacteria based on real-time technology have been reported. This review will give a short survey of current approaches to and the limitations of the application of real-time PCR for bacterial detection in blood components, with emphasis on the bacterial
Two-step glutamate dehydrogenase antigen real-time polymerase chain reaction assay for detection of toxigenic Clostridium difficile.

PubMed

Goldenberg, S D; Cliff, P R; Smith, S; Milner, M; French, G L

2010-01-01

Current diagnosis of Clostridium difficile infection (CDI) relies upon detection of toxins A/B in stool by enzyme immunoassay [EIA(A/B)]. This strategy is unsatisfactory because it has a low sensitivity resulting in significant false negatives. We investigated the performance of a two-step algorithm for diagnosis of CDI using detection of glutamate dehydrogenase (GDH). GDH-positive samples were tested for C. difficile toxin B gene (tcdB) by polymerase chain reaction (PCR). The performance of the two-step protocol was compared with toxin detection by the Meridian Premier EIA kit in 500 consecutive stool samples from patients with suspected CDI. The reference standard among samples that were positive by either EIA(A/B) or GDH testing was culture cytotoxin neutralisation (culture/CTN). Thirty-six (7%) of 500 samples were identified as true positives by culture/CTN. EIA(A/B) identified 14 of the positive specimens with 22 false negatives and two false positives. The two-step protocol identified 34 of the positive samples with two false positives and two false negatives. EIA(A/B) had a sensitivity of 39%, specificity of 99%, positive predictive value of 88% and negative predictive value of 95%. The two-step algorithm performed better, with corresponding values of 94%, 99%, 94% and 99% respectively. Screening for GDH before confirmation of positives by PCR is cheaper than screening all specimens by PCR and is an effective method for routine use. Current EIA(A/B) tests for CDI are of inadequate sensitivity and should be replaced; however, this may result in apparent changes in CDI rates that would need to be explained in national surveillance statistics. Copyright 2009 The Hospital Infection Society. Published by Elsevier Ltd. All rights reserved.
Event specific qualitative and quantitative polymerase chain reaction detection of genetically modified MON863 maize based on the 5'-transgene integration sequence.

PubMed

Yang, Litao; Xu, Songci; Pan, Aihu; Yin, Changsong; Zhang, Kewei; Wang, Zhenying; Zhou, Zhigang; Zhang, Dabing

2005-11-30

Because of the genetically modified organisms (GMOs) labeling policies issued in many countries and areas, polymerase chain reaction (PCR) methods were developed for the execution of GMO labeling policies, such as screening, gene specific, construct specific, and event specific PCR detection methods, which have become a mainstay of GMOs detection. The event specific PCR detection method is the primary trend in GMOs detection because of its high specificity based on the flanking sequence of the exogenous integrant. This genetically modified maize, MON863, contains a Cry3Bb1 coding sequence that produces a protein with enhanced insecticidal activity against the coleopteran pest, corn rootworm. In this study, the 5'-integration junction sequence between the host plant DNA and the integrated gene construct of the genetically modified maize MON863 was revealed by means of thermal asymmetric interlaced-PCR, and the specific PCR primers and TaqMan probe were designed based upon the revealed 5'-integration junction sequence; the conventional qualitative PCR and quantitative TaqMan real-time PCR detection methods employing these primers and probes were successfully developed. In conventional qualitative PCR assay, the limit of detection (LOD) was 0.1% for MON863 in 100 ng of maize genomic DNA for one reaction. In the quantitative TaqMan real-time PCR assay, the LOD and the limit of quantification were eight and 80 haploid genome copies, respectively. In addition, three mixed maize samples with known MON863 contents were detected using the established real-time PCR systems, and the ideal results indicated that the established event specific real-time PCR detection systems were reliable, sensitive, and accurate.
RNA Dependent RNA Polymerases: Insights from Structure, Function and Evolution.

PubMed

Venkataraman, Sangita; Prasad, Burra V L S; Selvarajan, Ramasamy

2018-02-10

RNA dependent RNA polymerase (RdRp) is one of the most versatile enzymes of RNA viruses that is indispensable for replicating the genome as well as for carrying out transcription. The core structural features of RdRps are conserved, despite the divergence in their sequences. The structure of RdRp resembles that of a cupped right hand and consists of fingers, palm and thumb subdomains. The catalysis involves the participation of conserved aspartates and divalent metal ions. Complexes of RdRps with substrates, inhibitors and metal ions provide a comprehensive view of their functional mechanism and offer valuable insights regarding the development of antivirals. In this article, we provide an overview of the structural aspects of RdRps and their complexes from the Group III, IV and V viruses and their structure-based phylogeny.
Poor phenotype-genotype association in a large series of patients with Type III Bartter syndrome.

PubMed

García Castaño, Alejandro; Pérez de Nanclares, Gustavo; Madariaga, Leire; Aguirre, Mireia; Madrid, Álvaro; Chocrón, Sara; Nadal, Inmaculada; Navarro, Mercedes; Lucas, Elena; Fijo, Julia; Espino, Mar; Espitaletta, Zilac; García Nieto, Víctor; Barajas de Frutos, David; Loza, Reyner; Pintos, Guillem; Castaño, Luis; Ariceta, Gema

2017-01-01

Type III Bartter syndrome (BS) is an autosomal recessive renal tubule disorder caused by loss-of-function mutations in the CLCNKB gene, which encodes the chloride channel protein ClC-Kb. In this study, we carried out a complete clinical and genetic characterization in a cohort of 30 patients, one of the largest series described. By comparing with other published populations, and considering that 80% of our patients presented the p.Ala204Thr Spanish founder mutation presumably associated with a common phenotype, we aimed to test the hypothesis that allelic differences could explain the wide phenotypic variability observed in patients with type III BS. Clinical data were retrieved from the referral centers. The exon regions and flanking intronic sequences of the CLCNKB gene were screened for mutations by polymerase chain reaction (PCR) followed by direct Sanger sequencing. Presence of gross deletions or duplications in the region was checked for by MLPA and QMPSF analyses. Polyuria, polydipsia and dehydration were the main common symptoms. Metabolic alkalosis and hypokalemia of renal origin were detected in all patients at diagnosis. Calciuria levels were variable: hypercalciuria was detected in 31% of patients, while 23% had hypocalciuria. Nephrocalcinosis was diagnosed in 20% of the cohort. Two novel CLCNKB mutations were identified: a small homozygous deletion (c.753delG) in one patient and a small deletion (c.1026delC) in another. The latter was present in compound heterozygosis with the already previously described p.Glu442Gly mutation. No phenotypic association was obtained regarding the genotype. A poor correlation was found between a specific type of mutation in the CLCNKB gene and type III BS phenotype. Importantly, two CLCNKB mutations not previously described were found in our cohort.
Poor phenotype-genotype association in a large series of patients with Type III Bartter syndrome

PubMed Central

Pérez de Nanclares, Gustavo; Madariaga, Leire; Aguirre, Mireia; Madrid, Álvaro; Chocrón, Sara; Nadal, Inmaculada; Navarro, Mercedes; Lucas, Elena; Fijo, Julia; Espino, Mar; Espitaletta, Zilac; García Nieto, Víctor; Barajas de Frutos, David; Loza, Reyner; Pintos, Guillem; Castaño, Luis; Ariceta, Gema

2017-01-01

Introduction Type III Bartter syndrome (BS) is an autosomal recessive renal tubule disorder caused by loss-of-function mutations in the CLCNKB gene, which encodes the chloride channel protein ClC-Kb. In this study, we carried out a complete clinical and genetic characterization in a cohort of 30 patients, one of the largest series described. By comparing with other published populations, and considering that 80% of our patients presented the p.Ala204Thr Spanish founder mutation presumably associated with a common phenotype, we aimed to test the hypothesis that allelic differences could explain the wide phenotypic variability observed in patients with type III BS. Methods Clinical data were retrieved from the referral centers. The exon regions and flanking intronic sequences of the CLCNKB gene were screened for mutations by polymerase chain reaction (PCR) followed by direct Sanger sequencing. Presence of gross deletions or duplications in the region was checked for by MLPA and QMPSF analyses. Results Polyuria, polydipsia and dehydration were the main common symptoms. Metabolic alkalosis and hypokalemia of renal origin were detected in all patients at diagnosis. Calciuria levels were variable: hypercalciuria was detected in 31% of patients, while 23% had hypocalciuria. Nephrocalcinosis was diagnosed in 20% of the cohort. Two novel CLCNKB mutations were identified: a small homozygous deletion (c.753delG) in one patient and a small deletion (c.1026delC) in another. The latter was present in compound heterozygosis with the already previously described p.Glu442Gly mutation. No phenotypic association was obtained regarding the genotype. Conclusion A poor correlation was found between a specific type of mutation in the CLCNKB gene and type III BS phenotype. Importantly, two CLCNKB mutations not previously described were found in our cohort. PMID:28288174

INTERNAL AMPLIFICATION CONTROL FOR USE IN QUANTITATIVE POLYMERASE CHAIN REACTION FECAL INDICATOR BACTERIA ASSAYS

EPA Science Inventory

Quantitative polymerase chain reaction (QPCR) can be used as a rapid method for detecting fecal indicator bacteria. Because false negative results can be caused by PCR inhibitors that co-extract with the DNA samples, an internal amplification control (IAC) should be run with eac...
Soluble Manganese(III) in the Marine Environment

NASA Astrophysics Data System (ADS)

Luther, G. W., III; Oldham, V.; Madison, A.; Tebo, B.; Jones, M.; Jensen, L.; Owings, S.; Mucci, A.; Sundby, B.

2014-12-01

Recent field studies have confirmed the presence of soluble manganese(III), which along with Mn(II) passes through a 0.2 μm filter, in suboxic marine waters. Here we applied a spectrophotometric method using a soluble porphyrin as a competitive ligand to calculate the concentrations and kinetics of Mn(II) and Mn(III) recovery. Data will be presented from the suboxic porewaters of the Saint Lawrence estuary, the suboxic and anoxic waters of the Chesapeake Bay and the oxygenated surface waters of a coastal waterway bordered by wetlands and salt marshes in Delaware. Soluble Mn(III) accounts for up to 100% of the dissolved Mn pool with concentrations ranging from the detection limit of 50 nM to 80 μM at the oxic/anoxic interface of the non-sulfidic porewaters from the hemipelagic sediments of the St. Lawrence Estuary. Data indicate weak-ligand complexation of Mn(III) formed from Mn(II) oxidation as well as reduction of MnO2. Complexation of Mn(III) in the anoxic waters of Chesapeake Bay appears stronger as the porphyrin could not outcompete the natural ligands binding Mn(III). Mn(III) complexes were reduced in the presence of hydroxylamine or hydrogen sulfide and detected as Mn(II). Soluble Mn(III) comprised up to 52 % of total dissolved Mn. Profiles over the course of a five day cruise showed that high Mn(III) concentrations (7.3 μM) were observed at low H2S (4.9 μM) whereas low Mn(III) (1.1 μM) was detected at high H2S (40 μM). The presence of Mn(III) in sulfidic waters indicated that it is kinetically stabilized in situ by strong ligands so reduction to Mn(II) was incomplete. One electron reductive dissolution of solid MnO2 particles formed at the oxic-anoxic interface appear to be the source of Mn(III). Lastly, soluble Mn(III) was detected in the oxygenated surface waters of a coastal waterway (salinity ranging from freshwater to 31) bordered by wetlands and salt marshes in Delaware. Soluble Mn(III) made up 0-49 % of the total dissolved Mn (maximum of 1.92 �
A field based detection method for Rose rosette virus using isothermal probe-based Reverse transcription-recombinase polymerase amplification assay.

PubMed

Babu, Binoy; Washburn, Brian K; Ertek, Tülin Sarigül; Miller, Steven H; Riddle, Charles B; Knox, Gary W; Ochoa-Corona, Francisco M; Olson, Jennifer; Katırcıoğlu, Yakup Zekai; Paret, Mathews L

2017-09-01

Rose rosette disease, caused by Rose rosette virus (RRV; genus Emaravirus) is a major threat to the rose industry in the U.S. The only strategy currently available for disease management is early detection and eradication of the infected plants, thereby limiting its potential spread. Current RT-PCR based diagnostic methods for RRV are time consuming and are inconsistent in detecting the virus from symptomatic plants. Real-time RT-qPCR assay is highly sensitive for detection of RRV, but it is expensive and requires well-equipped laboratories. Both the RT-PCR and RT-qPCR cannot be used in a field-based testing for RRV. Hence a novel probe based, isothermal reverse transcription-recombinase polymerase amplification (RT-exoRPA) assay, using primer/probe designed based on the nucleocapsid gene of the RRV has been developed. The assay is highly specific and did not give a positive reaction to other viruses infecting roses belonging to both inclusive and exclusive genus. Dilution assays using the in vitro transcript showed that the primer/probe set is highly sensitive, with a detection limit of 1 fg/μl. In addition, a rapid technique for the extraction of viral RNA (<5min) has been standardized from RRV infected tissue sources, using PBS-T buffer (pH 7.4), which facilitates the virus adsorption onto the PCR tubes at 4°C for 2min, followed by denaturation to release the RNA. RT-exoRPA analysis of the infected plants using the primer/probe indicated that the virus could be detected from leaves, stems, petals, pollen, primary roots and secondary roots. In addition, the assay was efficiently used in the diagnosis of RRV from different rose varieties, collected from different states in the U.S. The entire process, including the extraction can be completed in 25min, with less sophisticated equipments. The developed assay can be used with high efficiency in large scale field testing for rapid detection of RRV in commercial nurseries and landscapes. Copyright © 2017 Elsevier B
DNA polymerase ζ cooperates with polymerases κ and ι in translesion DNA synthesis across pyrimidine photodimers in cells from XPV patients

PubMed Central

Ziv, Omer; Geacintov, Nicholas; Nakajima, Satoshi; Yasui, Akira; Livneh, Zvi

2009-01-01

Human cells tolerate UV-induced cyclobutane pyrimidine dimers (CPD) by translesion DNA synthesis (TLS), carried out by DNA polymerase η, the POLH gene product. A deficiency in DNA polymerase η due to germ-line mutations in POLH causes the hereditary disease xeroderma pigmentosum variant (XPV), which is characterized by sunlight sensitivity and extreme predisposition to sunlight-induced skin cancer. XPV cells are UV hypermutable due to the activity of mutagenic TLS across CPD, which explains the cancer predisposition of the patients. However, the identity of the backup polymerase that carries out this mutagenic TLS was unclear. Here, we show that DNA polymerase ζ cooperates with DNA polymerases κ and ι to carry out error-prone TLS across a TT CPD. Moreover, DNA polymerases ζ and κ, but not ι, protect XPV cells against UV cytotoxicity, independently of nucleotide excision repair. This presents an extreme example of benefit-risk balance in the activity of TLS polymerases, which provide protection against UV cytotoxicity at the cost of increased mutagenic load. PMID:19564618
DNA polymerase zeta cooperates with polymerases kappa and iota in translesion DNA synthesis across pyrimidine photodimers in cells from XPV patients.

PubMed

Ziv, Omer; Geacintov, Nicholas; Nakajima, Satoshi; Yasui, Akira; Livneh, Zvi

2009-07-14

Human cells tolerate UV-induced cyclobutane pyrimidine dimers (CPD) by translesion DNA synthesis (TLS), carried out by DNA polymerase eta, the POLH gene product. A deficiency in DNA polymerase eta due to germ-line mutations in POLH causes the hereditary disease xeroderma pigmentosum variant (XPV), which is characterized by sunlight sensitivity and extreme predisposition to sunlight-induced skin cancer. XPV cells are UV hypermutable due to the activity of mutagenic TLS across CPD, which explains the cancer predisposition of the patients. However, the identity of the backup polymerase that carries out this mutagenic TLS was unclear. Here, we show that DNA polymerase zeta cooperates with DNA polymerases kappa and iota to carry out error-prone TLS across a TT CPD. Moreover, DNA polymerases zeta and kappa, but not iota, protect XPV cells against UV cytotoxicity, independently of nucleotide excision repair. This presents an extreme example of benefit-risk balance in the activity of TLS polymerases, which provide protection against UV cytotoxicity at the cost of increased mutagenic load.
Giardia and Cryptosporidium spp. dissemination during wastewater treatment and comparative detection via immunofluorescence assay (IFA), nested polymerase chain reaction (nested PCR) and loop mediated isothermal amplification (LAMP).

PubMed

Gallas-Lindemann, Carmen; Sotiriadou, Isaia; Plutzer, Judit; Noack, Michael J; Mahmoudi, Mohammad Reza; Karanis, Panagiotis

2016-06-01

Environmental water samples from the Lower Rhine area in Germany were investigated via immunofluorescence assays (IFAs), nested polymerase chain reaction (nested PCR) and loop-mediated isothermal amplification (LAMP) to detect the presence of Giardia spp. (n=185) and Cryptosporidium spp. (n=227). The samples were concentrated through filtration or flocculation, and oocysts were purified via centrifugation through a sucrose density gradient. For all samples, IFA was performed first, followed by DNA extraction for the nested PCR and LAMP assays. Giardia cysts were detected in 105 samples (56.8%) by IFA, 62 samples (33.5%) by nested PCR and 79 samples (42.7%) by LAMP. Cryptosporidium spp. were detected in 69 samples (30.4%) by IFA, 95 samples (41.9%) by nested PCR and 99 samples (43.6%) by LAMP. According to these results, the three detection methods are complementary for monitoring Giardia and Cryptosporidium in environmental waters. Copyright © 2016 Elsevier B.V. All rights reserved.
Subunit Compositions of the RNA-Silencing Enzymes Pol IV and Pol V Reveal Their Origins as Specialized Forms of RNA Polymerase II

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ream, Thomas S.; Haag, J. R.; Wierzbicki, A. T.

2009-01-30

In addition to RNA polymerases I, II, and III, the essential RNA polymerases present in all eukaryotes, plants have two additional nuclear RNA polymerases, abbreviated as Pol IV and Pol V, that play nonredundant roles in siRNA-directed DNA methylation and gene silencing. We show that Arabidopsis Pol IV and Pol V are composed of subunits that are paralogous or identical to the 12 subunits of Pol II. Four subunits of Pol IV are distinct from their Pol II paralogs, six subunits of Pol V are distinct from their Pol II paralogs, and four subunits differ between Pol IV and Polmore » V. Importantly, the subunit differences occur in key positions relative to the template entry and RNA exit paths. Our findings support the hypothesis that Pol IV and Pol V are Pol II-like enzymes that evolved specialized roles in the production of noncoding transcripts for RNA silencing and genome defense.« less
Development and inter-laboratory transfer of a decaplex polymerase chain reaction assay combined with capillary electrophoresis for the simultaneous detection of ten food allergens.

PubMed

Cheng, Fang; Wu, Jiajie; Zhang, Jin; Pan, Aihu; Quan, Sheng; Zhang, Dabing; Kim, HaeYeong; Li, Xiang; Zhou, Shan; Yang, Litao

2016-05-15

Food allergies cause health risks to susceptible consumers and regulations on labeling of food allergen contents have been implemented in many countries and regions. To achieve timely and accurate food allergen labeling, the development of fast and effective allergen detection methods is very important. Herein, a decaplex polymerase chain reaction (PCR) assay combined with capillary electrophoresis was developed to detect simultaneously 10 common food allergens from hazelnut, pistachio, oat, sesame, peanut, cashew, barley, wheat, soybean and pecan. The absolute limit of detection (LODa) of this system is between 2 and 20 copies of haploid genome, and the relative LOD (LODr) is as low as 0.005% (w/w) in simulated food mixtures. The developed assay was subsequently applied to 20 commercial food products and verified the allergen ingredients stated on the labels. Furthermore, results using this decaplex PCR assay was successfully replicated in three other laboratories, demonstrating the repeatability and applicability of this assay in routine analysis of the 10 food allergens. Copyright © 2015 Elsevier Ltd. All rights reserved.
Design and synthesis of heterobimetallic Ru(II)-Ln(III) complexes as chemodosimetric ensembles for the detection of biogenic amine odorants.

PubMed

Chow, Cheuk-Fai; Lam, Michael H W; Wong, Wai-Yeung

2013-09-03

The detection of neutral biogenic amines plays a crucial role in food safety. Three new heterobimetallic Ru(II)-Ln(III) donor-acceptor complexes, KPrRu, KNdRu, and KSmRu, K{[Ru((II))((t)Bubpy)(CN)4]2-Ln((III))(H2O)4} (where (t)Bubpy = 4,4'-di-tert-butyl-2,2'-bipyridine), have been synthesized and characterized. Their photophysical and X-ray crystallographic data were reported in this study. These complexes were found to be selective for biogenic amine vapors, such as histamine, putrescine, and spermidine, with a detection limit down to the ppb level. The sensitivities of these complexes to the amines were recorded as ~log K = 3.6-5.0. Submicron rods of the complexes, with a nanoscale diameter and microscale length, were obtained through a simple precipitation process. Free-standing polymeric films with different degrees of porosity were fabricated by blending the submicron rods with polystyrene polymer. The polymer with the highest level of porosity exhibited the strongest luminescence enhancement after amine exposure. Real time monitoring of gaseous biogenic amines was applied to real fish samples (Atlantic mackerel) by studying the spectrofluorimetric responses of the Ru(II)-Ln(III) blended polymer film.
Detection of human papillomavirus and Epstein-Barr virus DNA sequences in oral mucosa of HIV-infected patients by the polymerase chain reaction.

PubMed Central

Snijders, P. J.; Schulten, E. A.; Mullink, H.; ten Kate, R. W.; Jiwa, M.; van der Waal, I.; Meijer, C. J.; Walboomers, J. M.

1990-01-01

The presence of human papillomavirus (HPV) and Epstein-Barr virus (EBV) was analyzed in 21 oral biopsy specimens of HIV-infected patients using the polymerase chain reaction (PCR) method. Biopsies were categorized as hairy leukoplakia (HL) (n = 12), candidiasis (n = 3), oral warts (n = 2), and clinically normal epithelium (n = 4). For HPV detection a modified general primer-mediated PCR method (GP-PCR), which detects a broad spectrum of HPV genotypes at sub-picogram levels, was used. Human papillomavirus DNA was only found in two oral warts and was identified as HPV type 32. Epstein-Barr virus DNA was detected in 16 biopsy specimens, including the 12 HLs, 2 cases of candidiasis, and 2 samples of normal epithelium. Epstein-Barr virus positivity in HL could be confirmed by Southern blot analysis and DNA in situ hybridization using biotinylated DNA probes (bio-DISH). Epstein-Barr virus bio-DISH was also positive in one sample of normal epithelium from a patient with HL. The results indicate that HL is strongly associated with EBV and not with any of the common HPV types that react with general HPV primers in the PCR. However the detection of EBV in normal oral epithelium by PCR and bio-DISH suggests that the presence of this virus is not exclusively related to HL. Images Figure 1 Figure 2 Figure 3 Figure 4 PMID:2169191
Crosslinking-MS analysis reveals RNA polymerase I domain architecture and basis of rRNA cleavage

PubMed Central

Jennebach, Stefan; Herzog, Franz; Aebersold, Ruedi; Cramer, Patrick

2012-01-01

RNA polymerase (Pol) I contains a 10-subunit catalytic core that is related to the core of Pol II and includes subunit A12.2. In addition, Pol I contains the heterodimeric subcomplexes A14/43 and A49/34.5, which are related to the Pol II subcomplex Rpb4/7 and the Pol II initiation factor TFIIF, respectively. Here we used lysine-lysine crosslinking, mass spectrometry (MS) and modeling based on five crystal structures, to extend the previous homology model of the Pol I core, to confirm the location of A14/43 and to position A12.2 and A49/34.5 on the core. In the resulting model of Pol I, the C-terminal ribbon (C-ribbon) domain of A12.2 reaches the active site via the polymerase pore, like the C-ribbon of the Pol II cleavage factor TFIIS, explaining why the intrinsic RNA cleavage activity of Pol I is strong, in contrast to the weak cleavage activity of Pol II. The A49/34.5 dimerization module resides on the polymerase lobe, like TFIIF, whereas the A49 tWH domain resides above the cleft, resembling parts of TFIIE. This indicates that Pol I and also Pol III are distantly related to a Pol II–TFIIS–TFIIF–TFIIE complex. PMID:22396529
A domain of the Klenow fragment of Escherichia coli DNA polymerase I has polymerase but no exonuclease activity.

PubMed

Freemont, P S; Ollis, D L; Steitz, T A; Joyce, C M

1986-09-01

The Klenow fragment of DNA polymerase I from Escherichia coli has two enzymatic activities: DNA polymerase and 3'-5' exonuclease. The crystal structure showed that the fragment is folded into two distinct domains. The smaller domain has a binding site for deoxynucleoside monophosphate and a divalent metal ion that is thought to identify the 3'-5' exonuclease active site. The larger C-terminal domain contains a deep cleft that is believed to bind duplex DNA. Several lines of evidence suggested that the large domain also contains the polymerase active site. To test this hypothesis, we have cloned the DNA coding for the large domain into an expression system and purified the protein product. We find that the C-terminal domain has polymerase activity (albeit at a lower specific activity than the native Klenow fragment) but no measurable 3'-5' exonuclease activity. These data are consistent with the hypothesis that each of the three enzymatic activities of DNA polymerase I from E. coli resides on a separate protein structural domain.
Rifamycin action on RNA polymerase in antibiotic-tolerant Mycobacterium tuberculosis results in differentially detectable populations.

PubMed

Saito, Kohta; Warrier, Thulasi; Somersan-Karakaya, Selin; Kaminski, Lina; Mi, Jianjie; Jiang, Xiuju; Park, Suna; Shigyo, Kristi; Gold, Ben; Roberts, Julia; Weber, Elaina; Jacobs, William R; Nathan, Carl F

2017-06-13

Mycobacterium tuberculosis (Mtb) encounters stresses during the pathogenesis and treatment of tuberculosis (TB) that can suppress replication of the bacteria and render them phenotypically tolerant to most available drugs. Where studied, the majority of Mtb in the sputum of most untreated subjects with active TB have been found to be nonreplicating by the criterion that they do not grow as colony-forming units (cfus) when plated on agar. However, these cells are viable because they grow when diluted in liquid media. A method for generating such "differentially detectable" (DD) Mtb in vitro would aid studies of the biology and drug susceptibility of this population, but lack of independent confirmation of reported methods has contributed to skepticism about their existence. Here, we identified confounding artifacts that, when avoided, allowed development of a reliable method of producing cultures of ≥90% DD Mtb in starved cells. We then characterized several drugs according to whether they contribute to the generation of DD Mtb or kill them. Of the agents tested, rifamycins led to DD Mtb generation, an effect lacking in a rifampin-resistant strain with a mutation in rpoB , which encodes the canonical rifampin target, the β subunit of RNA polymerase. In contrast, thioridazine did not generate DD Mtb from starved cells but killed those generated by rifampin.
Real-Time Reverse Transcription–Polymerase Chain Reaction Assay for SARS-associated Coronavirus

PubMed Central

Emery, Shannon L.; Bowen, Michael D.; Newton, Bruce R.; Winchell, Jonas M.; Meyer, Richard F.; Tong, Suxiang; Cook, Byron T.; Holloway, Brian P.; McCaustland, Karen A.; Rota, Paul A.; Bankamp, Bettina; Lowe, Luis E.; Ksiazek, Tom G.; Bellini, William J.; Anderson, Larry J.

2004-01-01

A real-time reverse transcription–polymerase chain reaction (RT-PCR) assay was developed to rapidly detect the severe acute respiratory syndrome–associated coronavirus (SARS-CoV). The assay, based on multiple primer and probe sets located in different regions of the SARS-CoV genome, could discriminate SARS-CoV from other human and animal coronaviruses with a potential detection limit of <10 genomic copies per reaction. The real-time RT-PCR assay was more sensitive than a conventional RT-PCR assay or culture isolation and proved suitable to detect SARS-CoV in clinical specimens. Application of this assay will aid in diagnosing SARS-CoV infection. PMID:15030703
Directed evolution of polymerase function by compartmentalized self-replication.

PubMed

Ghadessy, F J; Ong, J L; Holliger, P

2001-04-10

We describe compartmentalized self-replication (CSR), a strategy for the directed evolution of enzymes, especially polymerases. CSR is based on a simple feedback loop consisting of a polymerase that replicates only its own encoding gene. Compartmentalization serves to isolate individual self-replication reactions from each other. In such a system, adaptive gains directly (and proportionally) translate into genetic amplification of the encoding gene. CSR has applications in the evolution of polymerases with novel and useful properties. By using three cycles of CSR, we obtained variants of Taq DNA polymerase with 11-fold higher thermostability than the wild-type enzyme or with a >130-fold increased resistance to the potent inhibitor heparin. Insertion of an extra stage into the CSR cycle before the polymerase reaction allows its application to enzymes other than polymerases. We show that nucleoside diphosphate kinase and Taq polymerase can form such a cooperative CSR cycle based on reciprocal catalysis, whereby nucleoside diphosphate kinase produces the substrates required for the replication of its own gene. We also find that in CSR the polymerase genes themselves evolve toward more efficient replication. Thus, polymerase genes and their encoded polypeptides cooperate to maximize postselection copy number. CSR should prove useful for the directed evolution of enzymes, particularly DNA or RNA polymerases, as well as for the design and study of in vitro self-replicating systems mimicking prebiotic evolution and viral replication.
Evolving a polymerase for hydrophobic base analogues.

PubMed

Loakes, David; Gallego, José; Pinheiro, Vitor B; Kool, Eric T; Holliger, Philipp

2009-10-21

Hydrophobic base analogues (HBAs) have shown great promise for the expansion of the chemical and coding potential of nucleic acids but are generally poor polymerase substrates. While extensive synthetic efforts have yielded examples of HBAs with favorable substrate properties, their discovery has remained challenging. Here we describe a complementary strategy for improving HBA substrate properties by directed evolution of a dedicated polymerase using compartmentalized self-replication (CSR) with the archetypal HBA 5-nitroindole (d5NI) and its derivative 5-nitroindole-3-carboxamide (d5NIC) as selection substrates. Starting from a repertoire of chimeric polymerases generated by molecular breeding of DNA polymerase genes from the genus Thermus, we isolated a polymerase (5D4) with a generically enhanced ability to utilize HBAs. The selected polymerase. 5D4 was able to form and extend d5NI and d5NIC (d5NI(C)) self-pairs as well as d5NI(C) heteropairs with all four bases with efficiencies approaching, or exceeding, those of the cognate Watson-Crick pairs, despite significant distortions caused by the intercalation of the d5NI(C) heterocycles into the opposing strand base stack, as shown by nuclear magnetic resonance spectroscopy (NMR). Unlike Taq polymerase, 5D4 was also able to extend HBA pairs such as Pyrene: varphi (abasic site), d5NI: varphi, and isocarbostyril (ICS): 7-azaindole (7AI), allowed bypass of a chemically diverse spectrum of HBAs, and enabled PCR amplification with primers comprising multiple d5NI(C)-substitutions, while maintaining high levels of catalytic activity and fidelity. The selected polymerase 5D4 promises to expand the range of nucleobase analogues amenable to replication and should find numerous applications, including the synthesis and replication of nucleic acid polymers with expanded chemical and functional diversity.
A Luminescent Cocaine Detection Platform Using a Split G-Quadruplex-Selective Iridium(III) Complex and a Three-Way DNA Junction Architecture.

PubMed

Ma, Dik-Lung; Wang, Modi; He, Bingyong; Yang, Chao; Wang, Wanhe; Leung, Chung-Hang

2015-09-02

In this study, a series of 10 in-house cyclometalated iridium(III) complexes bearing different auxiliary ligands were tested for their selectivity toward split G-quadruplex in order to construct a label-free switch-on cocaine detection platform employing a three-way junction architecture and a G-quadruplex motif as a signal output unit. Through two rounds of screening, we discovered that the iridium(III) complex 7 exhibited excellent selectivity toward the intermolecular G-quadruplex motif. A detection limit as low as 30 nM for cocaine can be achieved by this sensing approach with a linear relationship between luminescence intensity and cocaine concentration established from 30 to 300 nM. Furthermore, this sensing approach could detect cocaine in diluted oral fluid. We hope that our simple, signal-on, label-free oligonucleotide-based sensing method for cocaine using a three-way DNA junction architecture could act as a useful platform in bioanalytical research.
Development of a fluorescent quantitative real-time polymerase chain reaction assay for the detection of Goose parvovirus in vivo

PubMed Central

Yang, Jin-Long; Cheng, An-Chun; Wang, Ming-Shu; Pan, Kang-Cheng; Li, Min; Guo, Yu-Fei; Li, Chuan-Feng; Zhu, De-Kang; Chen, Xiao-Yue

2009-01-01

Background Goose parvovirus (GPV) is a Dependovirus associated with latent infection and mortality in geese. Currently, it severely affects geese production worldwide. The objective of this study was to develop a fluorescent quantitative real-time polymerase chain reaction (PCR) (FQ-PCR) assay for fast and accurate quantification of GPV DNA in infected goslings, which can aid in the understanding of the regular distribution pattern and the nosogenesis of GPV in vivo. Results The detection limit of the assay was 2.8 × 101 standard DNA copies, with a sensitivity of 3 logs higher than that of the conventional gel-based PCR assay targeting the same gene. The real-time PCR was reproducible, as shown by satisfactory low intraassay and interassay coefficients of variation. Conclusion The high sensitivity, specificity, simplicity, and reproducibility of the GPV fluorogenic PCR assay, combined with a high throughput, make this method suitable for a broad spectrum of GPV etiology-related applications. PMID:19754946
Deficient brain RNA polymerase and altered nucleolar structure persists until day 8 after perinatal asphyxia of the rat.

PubMed

Kastner, Philomena; Mosgoeller, Wilhelm; Fang-Kircher, Susanne; Kitzmueller, Erwin; Kirchner, Liselotte; Hoeger, Harald; Seither, Peter; Lubec, Gert; Lubec, Barbara

2003-01-01

RNA polymerases (POL) are integral constituents of the protein synthesis machinery, with POL I and POL III coding for ribosomal RNA and POL II coding for protein. POL I is located in the nucleolus and transcribes class I genes, those that code for large ribosomal RNA. It has been reported that the POL system is seriously affected in perinatal asphyxia (PA) immediately after birth. Because POL I is necessary for protein synthesis and brain protein synthesis was shown to be deranged after hypoxic-ischemic conditions, we aimed to study whether POL derangement persists in a simple, well-documented animal model of graded global PA at the activity, mRNA, protein, and morphologic level until 8 d after the asphyctic insult. Nuclear POL I activity was determined according to a radiochemical method; mRNA steady state and protein levels of RPA4O-an essential subunit of POL I and III-were evaluated by blotting methods; and the POL I subunit polymerase activating factor-53 was evaluated using immunohistochemistry. Silver staining and transmission electron microscopy were used to examine the nucleolus. At the eighth day after PA, nuclear POL I decreased with the length of the asphyctic period, whereas mRNA and protein levels for RPA4O were unchanged. The subunit polymerase activating factor-53, however, was unambiguously reduced in several brain regions. Dramatic changes of nucleolar morphology were observed, the main finding being nucleolar disintegration at the electron microscopy level. We suggest that severe acidosis and/or deficient protein kinase C in the brain during the asphyctic period may be responsible for disintegration of the nucleolus as well as for decreased POL activity persisting until the eighth day after PA. The biologic effect may be that PA causes impaired RNA and protein synthesis, which has been already observed in hypoxic-ischemic states.
Ultrasensitive sensing platform for platelet-derived growth factor BB detection based on layered molybdenum selenide-graphene composites and Exonuclease III assisted signal amplification.

PubMed

Huang, Ke-Jing; Shuai, Hong-Lei; Zhang, Ji-Zong

2016-03-15

A highly sensitive and ultrasensitive electrochemical aptasensor for platelet-derived growth factor BB (PDGF-BB) detection is fabricated based on layered molybdenum selenide-graphene (MoSe2-Gr) composites and Exonuclease III (Exo III)-aided signal amplification. MoSe2-Gr is prepared by a simple hydrothermal method and used as a promising sensing platform. Exo III has a specifical exo-deoxyribonuclease activity for duplex DNAs in the direction from 3' to 5' terminus, however its activity is limited on the duplex DNAs with more than 4 mismatched terminal bases at 3' ends. Herein, aptamer and complementary DNA (cDNA) sequences are designed with four thymine bases on 3' ends. In the presence of target protein, the aptamer associates with it and facilitates the formation of duplex DNA between cDNA and signal DNA. The duplex DNA then is digested by Exo III and releases cDNA, which hybridizes with signal DNA to perform a new cleavage process. Nevertheless, in the absence of target protein, the aptamer hybridizes with cDNA will inhibit the Exo III-assisted nucleotides cleavage. The signal DNA then hybridizes with capture DNA on the electrode. Subsequently, horse radish peroxidase is fixed on electrode by avidin-biotin reaction and then catalyzes hydrogen peroxide and hydroquinone to produce electrochemical response. Therefore, a bridge can be established between the concentration of target protein and the degree of the attenuation of the obtained signal, providing a quantitative measure of target protein with a broad detection range of 0.0001-1 nM and a detection limit of 20 fM. Copyright © 2015 Elsevier B.V. All rights reserved.

Some links on this page may take you to non-federal websites. Their policies may differ from this site.