Science.gov

Sample records for polymerase iii detects

  1. Antibodies to fibrillarin, PM-Scl and RNA polymerase III detected by ELISA assays in patients with systemic sclerosis.

    PubMed

    Villalta, Danilo; Morozzi, Gabriella; Tampoia, Marilina; Alpini, Claudia; Brusca, Ignazio; Salgarolo, Valeria; Papisch, Wolfgang; Bizzaro, Nicola

    2010-05-02

    Anti-fibrillarin (AFA), anti-RNA polymerase (anti-RNAP), and anti-PM-Scl autoantibodies are useful markers for the diagnosis of systemic sclerosis (SSc) in patients who are anti-centromere- (ACA) or anti-topoisomerase I (anti-topo I)-negative, but, until recently, the only specific method for their identification was the radio-immunoprecipitation assay. The aim of this study was to evaluate the clinical accuracy of the new enzyme-linked immunosorbent assays (ELISA) developed by Phadia for their detection. Sera of 50 ACA and anti-topo I-negative SSc patients, and, as control group, sera of 122 patients (42 with SSc, ACA or anti-topo I-positive, 40 with systemic lupus erythematosus and 40 with rheumatoid arthritis) were studied. Using the cutoff proposed by the manufacturer (10 AU/mL), sensitivity and specificity were: for AFA, 22% and 92.6%; for anti-RNAP, 16% and 97.5%; and for anti-PM-Scl, 8% and 98.8%, respectively. Using a cutoff corresponding to 98.8% specificity for all three antibodies, sensitivity was 10%, 14% and 8%, respectively. The combined use of these three antibody assays enabled identification of 32% of ACA- and anti-topo I-negative SSc patients. These new ELISA methods for AFA, anti-RNAP III and anti-PM-Scl detection have good diagnostic specificity, and may help identify a subset of SSc patients ACA and anti-topo I-negative. Copyright 2010 Elsevier B.V. All rights reserved.

  2. Transcription by RNA polymerases I and III

    PubMed Central

    Paule, Marvin R.; White, Robert J.

    2000-01-01

    The task of transcribing nuclear genes is shared between three RNA polymerases in eukaryotes: RNA polymerase (pol) I synthesises the large rRNA, pol II synthesises mRNA and pol III synthesises tRNA and 5S rRNA. Although pol II has received most attention, pol I and pol III are together responsible for the bulk of transcriptional activity. This survey will summarise what is known about the process of transcription by pol I and pol III, how it happens and the proteins involved. Attention will be drawn to the similarities between the three nuclear RNA polymerase systems and also to their differences. PMID:10684922

  3. RNA polymerase III detects cytosolic DNA and induces type I interferons through the RIG-I pathway.

    PubMed

    Chiu, Yu-Hsin; Macmillan, John B; Chen, Zhijian J

    2009-08-07

    Type I interferons (IFNs) are important for antiviral and autoimmune responses. Retinoic acid-induced gene I (RIG-I) and mitochondrial antiviral signaling (MAVS) proteins mediate IFN production in response to cytosolic double-stranded RNA or single-stranded RNA containing 5'-triphosphate (5'-ppp). Cytosolic B form double-stranded DNA, such as poly(dA-dT)*poly(dA-dT) [poly(dA-dT)], can also induce IFN-beta, but the underlying mechanism is unknown. Here, we show that the cytosolic poly(dA-dT) DNA is converted into 5'-ppp RNA to induce IFN-beta through the RIG-I pathway. Biochemical purification led to the identification of DNA-dependent RNA polymerase III (Pol-III) as the enzyme responsible for synthesizing 5'-ppp RNA from the poly(dA-dT) template. Inhibition of RNA Pol-III prevents IFN-beta induction by transfection of DNA or infection with DNA viruses. Furthermore, Pol-III inhibition abrogates IFN-beta induction by the intracellular bacterium Legionella pneumophila and promotes the bacterial growth. These results suggest that RNA Pol-III is a cytosolic DNA sensor involved in innate immune responses.

  4. Detection and differentiation of genotype I and III Japanese encephalitis virus in mosquitoes by multiplex reverse transcriptase-polymerase chain reaction.

    PubMed

    Chen, Y Y; Lin, J W; Fan, Y C; Chiou, S S

    2014-02-01

    Japanese encephalitis (JE) is a disease that threatens both human and animal populations in Asian countries, and the causative agent of JE, Japanese encephalitis virus (JEV), has recently changed from genotype III (GIII) to genotype I (GI). However, a test for the rapid differentiation of GI and GIII JEV is still unavailable, especially one that can be used for mosquito-based surveillance. We have designed GI- and GIII-specific primer sets for the rapid detection and differentiation of GI and GIII JEV by multiplex reverse transcriptase-polymerase chain reaction (multiplex RT-PCR). The GI-specific and GIII-specific primer sets were able to specifically amplify the target gene from GI and GIII JEV, respectively. The limitations of detection were 0.00225 and 0.225 pfu for the GI-specific and GIII-specific primers, respectively. Using a mixture of GI-specific and GIII-specific primers, the multiplex RT-PCR was able to specifically detect and differentiate GI and GIII JEV. The multiplex RT-PCR was able to successfully differentiate GI and GIII virus in JEV-infected mosquitoes. Thus, a sensitive and specific multiplex RT-PCR system for the rapid detection and differentiation of GI and GIII JEV has been developed, and this test is likely to be valuable when carrying out mosquito-based JEV surveillance. © 2012 Blackwell Verlag GmbH.

  5. Deoxyribonucleic acid polymerase III of Escherichia coli. Purification and properties.

    PubMed

    Livingston, D M; Hinkle, D C; Richardson, C C

    1975-01-25

    DNA polymerase III has been purified 4,500-fold from the Escherichis coli mutant, HMS83, which lacks DNA polymerases I and II. When subjected to disc gel electrophoresis, the most purified fraction exhibits a single major protein band from which enzymatic activity may be recovered. Polyacrylamide gel electrophoresis under denaturing conditions produces two protein bands with molecular weights of 140,000 and 40,000. The sedimentation coefficient of the enzyme is 7.0 S, and the Stokes radius is 62 A. Taken together these tow parameters indicate a native molecular weight of 180,000. Purified DNA polymerase III catalyzes the polymerization of nucleotides into DNA when provided with both a DNA template and a complementary primer strand. The newly synthesized DNA is covalently attached to the 3' terminus of the primer strand. Because the extent of polymerization is only 10 to 100 nucleotides, the best substrates are native DNA molecules with small single-stranded regions. The most purified enzyme preparation is devoid of endonuclease activities. In addition to the two exonuclease activities described in the accompanying paper, purified polymerase III also catalyzes pyrophosphorolysis and the exchange of pyrophosphate into deoxynucleoside triphosphates. DNA polymerase III has also been isolated from wild type E. coli containing the other two known DNA polymerases. Futhermore, the enzyme purified from three different polC mutants exhibits altered polymerase III activity, confirming that polC is the structural gene for DNA polymerase III (Gefter, M., Hirota, Y., Kornberb, T., Wechsler, J., and Barnoux, C. (1971) Proc. Natl. Acad. Sci. U. S. A. 68, 3150-3153).

  6. FACT facilitates chromatin transcription by RNA polymerases I and III

    PubMed Central

    Birch, Joanna L; Tan, Bertrand C-M; Panov, Kostya I; Panova, Tatiana B; Andersen, Jens S; Owen-Hughes, Tom A; Russell, Jackie; Lee, Sheng-Chung; Zomerdijk, Joost C B M

    2009-01-01

    Efficient transcription elongation from a chromatin template requires RNA polymerases (Pols) to negotiate nucleosomes. Our biochemical analyses demonstrate that RNA Pol I can transcribe through nucleosome templates and that this requires structural rearrangement of the nucleosomal core particle. The subunits of the histone chaperone FACT (facilitates chromatin transcription), SSRP1 and Spt16, co-purify and co-immunoprecipitate with mammalian Pol I complexes. In cells, SSRP1 is detectable at the rRNA gene repeats. Crucially, siRNA-mediated repression of FACT subunit expression in cells results in a significant reduction in 47S pre-rRNA levels, whereas synthesis of the first 40 nt of the rRNA is not affected, implying that FACT is important for Pol I transcription elongation through chromatin. FACT also associates with RNA Pol III complexes, is present at the chromatin of genes transcribed by Pol III and facilitates their transcription in cells. Our findings indicate that, beyond the established role in Pol II transcription, FACT has physiological functions in chromatin transcription by all three nuclear RNA Pols. Our data also imply that local chromatin dynamics influence transcription of the active rRNA genes by Pol I and of Pol III-transcribed genes. PMID:19214185

  7. Interplay between polymerase II- and polymerase III-assisted expression of overlapping genes.

    PubMed

    Lukoszek, Radoslaw; Mueller-Roeber, Bernd; Ignatova, Zoya

    2013-11-15

    Up to 15% of the genes in different genomes overlap. This architecture, although beneficial for the genome size, represents an obstacle for simultaneous transcription of both genes. Here we analyze the interference between RNA-polymerase II (Pol II) and RNA-polymerase III (Pol III) when transcribing their target genes encoded on opposing strands within the same DNA fragment in Arabidopsis thaliana. The expression of a Pol II-dependent protein-coding gene negatively correlated with the transcription of a Pol III-dependent, tRNA-coding gene set. We suggest that the architecture of the overlapping genes introduces an additional layer of control of gene expression.

  8. RNA polymerase III under control: repression and de-repression.

    PubMed

    Boguta, Magdalena; Graczyk, Damian

    2011-09-01

    The synthesis of tRNA by yeast RNA polymerase III (Pol III) is regulated in response to changing environmental conditions. This control is mediated by Maf1, the global negative regulator of Pol III transcription conserved from yeast to humans. Details regarding the molecular basis of Pol III repression by Maf1 are now emerging from recently reported structural and biochemical data on Pol III and Maf1. Efficient Pol III transcription, following the shift of cells from a non-fermentable carbon source to glucose, requires phosphorylation of Maf1. One of the newly identified Maf1 kinases is the chromatin-bound casein kinase II (CK2). Current studies have allowed us to propose an innovative mechanism of Pol III regulation. We suggest that CK2-mediated phosphorylation of Maf1, occurring directly on tDNA chromatin, controls Pol III recycling. Copyright © 2011 Elsevier Ltd. All rights reserved.

  9. RNA Polymerase III Accurately Initiates Transcription from RNA Polymerase II Promoters in Vitro*

    PubMed Central

    Duttke, Sascha H. C.

    2014-01-01

    In eukaryotes, there are three major RNA polymerases (Pol) in the nucleus, which are commonly described as transcribing non-overlapping subsets of genes. Structural studies have highlighted a conserved core shared among all three transcription systems. Initiation of human Pol III from TATA box-containing Pol II promoters under conditions with impaired Pol II transcription activity have been described previously. RNA polymerase III and Pol II were found to co-localize at the promoters of the c-myc gene and the RPPH1 sRNA in vivo. Here, I report that Pol III can, like Pol II, initiate transcription from most tested Pol II core promoters when assayed with crude human nuclear extracts (HSK, SNF, or Dignam). Both polymerases often initiate from the same transcription start site, and depend on a TATA box or AT-rich region but not the downstream promoter element (DPE) or the motif ten element (MTE). Moderate (∼2-fold) changes in the ratio of DNA template to nuclear extract were sufficient to change Pol II-mediated transcription to a mixture of Pol II- and Pol III-, or to a solely Pol III-dependent initiation of transcription from Pol II promoters. Polymerase specificity is thus not fixed but a variable that depends on the properties of the promoter and the transcription conditions. These findings provide functional evidence for a close similarity between the Pol II and Pol III transcription complexes, and additionally explain previous controversies in the literature. PMID:24917680

  10. Transcription termination by the eukaryotic RNA polymerase III

    PubMed Central

    Arimbasseri, Aneeshkumar G.; Rijal, Keshab; Maraia, Richard J.

    2012-01-01

    RNA polymerase (pol) III transcribes a multitude of tRNA and 5S rRNA genes as well as other small RNA genes distributed through the genome. By being sequence-specific, precise and efficient, transcription termination by pol III not only defines the 3′ end of the nascent RNA which directs subsequent association with the stabilizing La protein, it also prevents transcription into downstream DNA and promotes efficient recycling. Each of the RNA polymerases appears to have evolved unique mechanisms to initiate the process of termination in response to different types of termination signals. However, in eukaryotes much less is known about the final stage of termination, destabilization of the elongation complex with release of the RNA and DNA from the polymerase active center. By comparison to pols I & II, pol III exhibits the most direct coupling of the initial and final stages of termination, both of which occur at a short oligo(dT) tract on the non-template strand (dA on the template) of the DNA. While pol III termination is autonomous involving the core subunits C2 and probably C1, it also involves subunits C11, C37 and C53, which act on the pol III catalytic center and exhibit homology to the pol II elongation factor TFIIS, and TFIIFα/β respectively. Here we compile knowledge of pol III termination and associate mutations that affect this process with structural elements of the polymerase that illustrate the importance of C53/37 both at its docking site on the pol III lobe and in the active center. The models suggest that some of these features may apply to the other eukaryotic pols. PMID:23099421

  11. Comparative overview of RNA polymerase II and III transcription cycles, with focus on RNA polymerase III termination and reinitiation.

    PubMed

    Arimbasseri, Aneeshkumar G; Rijal, Keshab; Maraia, Richard J

    2014-01-01

    In eukaryotes, RNA polymerase (RNAP) III transcribes hundreds of genes for tRNAs and 5S rRNA, among others, which share similar promoters and stable transcription initiation complexes (TIC), which support rapid RNAP III recycling. In contrast, RNAP II transcribes a large number of genes with highly variable promoters and interacting factors, which exert fine regulatory control over TIC lability and modifications of RNAP II at different transitional points in the transcription cycle. We review data that illustrate a relatively smooth continuity of RNAP III initiation-elongation-termination and reinitiation toward its function to produce high levels of tRNAs and other RNAs that support growth and development.

  12. Retinoblastoma protein disrupts interactions required for RNA polymerase III transcription.

    PubMed

    Sutcliffe, J E; Brown, T R; Allison, S J; Scott, P H; White, R J

    2000-12-01

    The retinoblastoma protein (RB) has been shown to suppress RNA polymerase (Pol) III transcription in vivo (R. J. White, D. Trouche, K. Martin, S. P. Jackson, and T. Kouzarides, Nature 382:88-90, 1996). This regulation involves interaction with TFIIIB, a multisubunit factor that is required for the expression of all Pol III templates (C. G. C. Larminie, C. A. Cairns, R. Mital, K. Martin, T. Kouzarides, S. P. Jackson, and R. J. White, EMBO J. 16:2061-2071, 1997; W.-M. Chu, Z. Wang, R. G. Roeder, and C. W. Schmid, J. Biol. Chem. 272:14755-14761, 1997). However, it has not been established why RB binding to TFIIIB results in transcriptional repression. For several Pol II-transcribed genes, RB has been shown to inhibit expression by recruiting histone deacetylases, which are thought to decrease promoter accessibility. We present evidence that histone deacetylases exert a negative effect on Pol III activity in vivo. However, RB remains able to regulate Pol III transcription in the presence of the histone deacetylase inhibitor trichostatin A. Instead, RB represses by disrupting interactions between TFIIIB and other components of the basal Pol III transcription apparatus. Recruitment of TFIIIB to most class III genes requires its binding to TFIIIC2, but this can be blocked by RB. In addition, RB disrupts the interaction between TFIIIB and Pol III that is essential for transcription. The ability of RB to inhibit these key interactions can explain its action as a potent repressor of class III gene expression.

  13. Nucleosome Positioning and NDR Structure at RNA Polymerase III Promoters

    NASA Astrophysics Data System (ADS)

    Helbo, Alexandra Søgaard; Lay, Fides D.; Jones, Peter A.; Liang, Gangning; Grønbæk, Kirsten

    2017-02-01

    Chromatin is structurally involved in the transcriptional regulation of all genes. While the nucleosome positioning at RNA polymerase II (pol II) promoters has been extensively studied, less is known about the chromatin structure at pol III promoters in human cells. We use a high-resolution analysis to show substantial differences in chromatin structure of pol II and pol III promoters, and between subtypes of pol III genes. Notably, the nucleosome depleted region at the transcription start site of pol III genes extends past the termination sequences, resulting in nucleosome free gene bodies. The +1 nucleosome is located further downstream than at pol II genes and furthermore displays weak positioning. The variable position of the +1 location is seen not only within individual cell populations and between cell types, but also between different pol III promoter subtypes, suggesting that the +1 nucleosome may be involved in the transcriptional regulation of pol III genes. We find that expression and DNA methylation patterns correlate with distinct accessibility patterns, where DNA methylation associates with the silencing and inaccessibility at promoters. Taken together, this study provides the first high-resolution map of nucleosome positioning and occupancy at human pol III promoters at specific loci and genome wide.

  14. Nucleosome Positioning and NDR Structure at RNA Polymerase III Promoters

    PubMed Central

    Helbo, Alexandra Søgaard; Lay, Fides D.; Jones, Peter A.; Liang, Gangning; Grønbæk, Kirsten

    2017-01-01

    Chromatin is structurally involved in the transcriptional regulation of all genes. While the nucleosome positioning at RNA polymerase II (pol II) promoters has been extensively studied, less is known about the chromatin structure at pol III promoters in human cells. We use a high-resolution analysis to show substantial differences in chromatin structure of pol II and pol III promoters, and between subtypes of pol III genes. Notably, the nucleosome depleted region at the transcription start site of pol III genes extends past the termination sequences, resulting in nucleosome free gene bodies. The +1 nucleosome is located further downstream than at pol II genes and furthermore displays weak positioning. The variable position of the +1 location is seen not only within individual cell populations and between cell types, but also between different pol III promoter subtypes, suggesting that the +1 nucleosome may be involved in the transcriptional regulation of pol III genes. We find that expression and DNA methylation patterns correlate with distinct accessibility patterns, where DNA methylation associates with the silencing and inaccessibility at promoters. Taken together, this study provides the first high-resolution map of nucleosome positioning and occupancy at human pol III promoters at specific loci and genome wide. PMID:28176797

  15. Selective repression of SINE transcription by RNA polymerase III.

    PubMed

    Varshney, Dhaval; Vavrova-Anderson, Jana; Oler, Andrew J; Cairns, Bradley R; White, Robert J

    2015-01-01

    A million copies of the Alu short interspersed nuclear element (SINE) are scattered throughout the human genome, providing ∼11% of our total DNA. SINEs spread by retrotransposition, using a transcript generated by RNA polymerase (pol) III from an internal promoter. Levels of these pol III-dependent Alu transcripts are far lower than might be expected from the abundance of the template. This was believed to reflect transcriptional suppression through DNA methylation, denying pol III access to most SINEs through chromatin-mediated effects. Contrary to expectations, our recent study found no evidence that methylation of SINE DNA reduces its occupancy or expression by pol III. However, histone H3 associated with SINEs is prominently methylated on lysine 9, a mark that correlates with transcriptional silencing. The SUV39 methyltransferases that deposit this mark can be found at many SINEs. Furthermore, a selective inhibitor of SUV39 stimulates pol III recruitment to these loci, as well as SINE expression. These data suggest that methylation of histone H3 rather than DNA may mediate repression of SINE transcription by pol III, at least under the conditions we studied.

  16. Comparative overview of RNA polymerase II and III transcription cycles, with focus on RNA polymerase III termination and reinitiation

    PubMed Central

    Arimbasseri, Aneeshkumar G; Rijal, Keshab; Maraia, Richard J

    2013-01-01

    In eukaryotes, RNA polymerase (RNAP) III transcribes hundreds of genes for tRNAs and 5S rRNA, among others, which share similar promoters and stable transcription initiation complexes (TIC), which support rapid RNAP III recycling. In contrast, RNAP II transcribes a large number of genes with highly variable promoters and interacting factors, which exert fine regulatory control over TIC lability and modifications of RNAP II at different transitional points in the transcription cycle. We review data that illustrate a relatively smooth continuity of RNAP III initiation-elongation-termination and reinitiation toward its function to produce high levels of tRNAs and other RNAs that support growth and development. PMID:25764110

  17. Retinoblastoma Protein Disrupts Interactions Required for RNA Polymerase III Transcription

    PubMed Central

    Sutcliffe, Josephine E.; Brown, Timothy R. P.; Allison, Simon J.; Scott, Pamela H.; White, Robert J.

    2000-01-01

    The retinoblastoma protein (RB) has been shown to suppress RNA polymerase (Pol) III transcription in vivo (R. J. White, D. Trouche, K. Martin, S. P. Jackson, and T. Kouzarides, Nature 382:88–90, 1996). This regulation involves interaction with TFIIIB, a multisubunit factor that is required for the expression of all Pol III templates (C. G. C. Larminie, C. A. Cairns, R. Mital, K. Martin, T. Kouzarides, S. P. Jackson, and R. J. White, EMBO J. 16:2061–2071, 1997; W.-M. Chu, Z. Wang, R. G. Roeder, and C. W. Schmid, J. Biol. Chem. 272:14755–14761, 1997). However, it has not been established why RB binding to TFIIIB results in transcriptional repression. For several Pol II-transcribed genes, RB has been shown to inhibit expression by recruiting histone deacetylases, which are thought to decrease promoter accessibility. We present evidence that histone deacetylases exert a negative effect on Pol III activity in vivo. However, RB remains able to regulate Pol III transcription in the presence of the histone deacetylase inhibitor trichostatin A. Instead, RB represses by disrupting interactions between TFIIIB and other components of the basal Pol III transcription apparatus. Recruitment of TFIIIB to most class III genes requires its binding to TFIIIC2, but this can be blocked by RB. In addition, RB disrupts the interaction between TFIIIB and Pol III that is essential for transcription. The ability of RB to inhibit these key interactions can explain its action as a potent repressor of class III gene expression. PMID:11094071

  18. Transcription by RNA polymerase III: insights into mechanism and regulation

    PubMed Central

    Turowski, Tomasz W.; Tollervey, David

    2016-01-01

    The highly abundant, small stable RNAs that are synthesized by RNA polymerase III (RNAPIII) have key functional roles, particularly in the protein synthesis apparatus. Their expression is metabolically demanding, and is therefore coupled to changing demands for protein synthesis during cell growth and division. Here, we review the regulatory mechanisms that control the levels of RNAPIII transcripts and discuss their potential physiological relevance. Recent analyses have revealed differential regulation of tRNA expression at all steps on its biogenesis, with significant deregulation of mature tRNAs in cancer cells. PMID:27911719

  19. A Unique Presentation of Anti-RNA Polymerase III Positive Systemic Sclerosis Sine Scleroderma.

    PubMed

    Lee, Cody M; Girnita, Diana; Sharma, Arundhati; Khanna, Surabhi; Elwing, Jean M

    2016-01-01

    Systemic sclerosis is a rare autoimmune disorder with a wide spectrum of clinical manifestations and a multitude of autoantibodies that are associated with it. In the past several years, advances in serologic testing have led to research indicating important prognostic and phenotypic associations with certain subsets of autoantibodies. In particular, anti-RNA polymerase III (anti-RNAP III) has been associated with diffuse cutaneous disease, scleroderma renal crisis, a temporal relationship with malignancy, myositis, synovitis, joint contractures, and gastric antral vascular ectasia. However, anti-RNAP III has not been associated with systemic sclerosis sine scleroderma. We describe a patient with an atypical presentation of anti-RNAP III positive systemic sclerosis sine scleroderma who presented without the typical features of anti-RNAP III disease. Instead, she presented with critical digital ischemia, pulmonary arterial hypertension, gastroesophageal reflux disease, interstitial lung disease, and no clinically detectable sclerodactyly.

  20. Close Temporal Relationship Between Onset of Cancer and Scleroderma in Patients with RNA Polymerase I/III Antibodies

    PubMed Central

    Shah, Ami A.; Rosen, Antony; Hummers, Laura; Wigley, Fredrick; Casciola-Rosen, Livia

    2010-01-01

    Objective We examined the temporal relationship between scleroderma development and malignancy, and evaluated whether this differed by autoantibody status among affected patients. Methods Participants had a diagnosis of scleroderma, cancer, an available serum sample, and a cancer pathology specimen. Sera were tested for autoantibodies against topoisomerase I, centromere, and RNA polymerase I/III by immunoprecipitation and/or ELISA. Clinical and demographic characteristics were compared across autoantibody categories. Expression of RNA polymerases I and III was evaluated by immunohistochemistry using cancerous tissue from patients with anti-RNA polymerase antibodies. Results Twenty three subjects were enrolled. Six subjects tested positive for anti-RNA polymerase I/III (Pol), 5 for anti-topoisomerase I (Topo), 8 for anti-centromere (CENP), and 4 recognized none of these antigens (Negative). The median duration of scleroderma at cancer diagnosis differed significantly between groups: −1.2 years (Pol), +13.4 years (Topo), +11.1 years (CENP), and +2.3 years (Negative) (p=0.027). RNA polymerase III demonstrated a robust nucleolar staining pattern in 4 of 5 available tumors from patients with antibodies to RNA polymerase I/III. In contrast, nucleolar RNA polymerase III staining was not detected in any of 4 examined tumors in the RNA polymerase antibody-negative group (p=0.048). Conclusions There is a close temporal relationship between onset of cancer and scleroderma in patients with antibodies to RNA polymerase I/III, which is distinct from scleroderma patients with other autoantibody specificities. In this study, autoantibody response and tumor antigen expression are associated. We propose that malignancy may initiate the scleroderma-specific immune response and drive disease in a subset of scleroderma patients. PMID:20506513

  1. Novel layers of RNA polymerase III control affecting tRNA gene transcription in eukaryotes

    PubMed Central

    Leśniewska, Ewa

    2017-01-01

    RNA polymerase III (Pol III) transcribes a limited set of short genes in eukaryotes producing abundant small RNAs, mostly tRNA. The originally defined yeast Pol III transcriptome appears to be expanding owing to the application of new methods. Also, several factors required for assembly and nuclear import of Pol III complex have been identified recently. Models of Pol III based on cryo-electron microscopy reconstructions of distinct Pol III conformations reveal unique features distinguishing Pol III from other polymerases. Novel concepts concerning Pol III functioning involve recruitment of general Pol III-specific transcription factors and distinctive mechanisms of transcription initiation, elongation and termination. Despite the short length of Pol III transcription units, mapping of transcriptionally active Pol III with nucleotide resolution has revealed strikingly uneven polymerase distribution along all genes. This may be related, at least in part, to the transcription factors bound at the internal promoter regions. Pol III uses also a specific negative regulator, Maf1, which binds to polymerase under stress conditions; however, a subset of Pol III genes is not controlled by Maf1. Among other RNA polymerases, Pol III machinery represents unique features related to a short transcript length and high transcription efficiency. PMID:28228471

  2. Novel layers of RNA polymerase III control affecting tRNA gene transcription in eukaryotes.

    PubMed

    Leśniewska, Ewa; Boguta, Magdalena

    2017-02-01

    RNA polymerase III (Pol III) transcribes a limited set of short genes in eukaryotes producing abundant small RNAs, mostly tRNA. The originally defined yeast Pol III transcriptome appears to be expanding owing to the application of new methods. Also, several factors required for assembly and nuclear import of Pol III complex have been identified recently. Models of Pol III based on cryo-electron microscopy reconstructions of distinct Pol III conformations reveal unique features distinguishing Pol III from other polymerases. Novel concepts concerning Pol III functioning involve recruitment of general Pol III-specific transcription factors and distinctive mechanisms of transcription initiation, elongation and termination. Despite the short length of Pol III transcription units, mapping of transcriptionally active Pol III with nucleotide resolution has revealed strikingly uneven polymerase distribution along all genes. This may be related, at least in part, to the transcription factors bound at the internal promoter regions. Pol III uses also a specific negative regulator, Maf1, which binds to polymerase under stress conditions; however, a subset of Pol III genes is not controlled by Maf1. Among other RNA polymerases, Pol III machinery represents unique features related to a short transcript length and high transcription efficiency.

  3. DNA polymerase III requirement for repair of DNA damage caused by methyl methanesulfonate and hydrogen peroxide

    SciTech Connect

    Hagensee, M.E.; Bryan, S.K.; Moses, R.E.

    1987-10-01

    The pcbA1 mutation allows DNA replication dependent on DNA polymerase I at the restrictive temperature in polC(Ts) strains. Cells which carry pcbA1, a functional DNA polymerase I, and a temperature-sensitive DNA polymerase III gene were used to study the role of DNA polymerase III in DNA repair. At the restrictive temperature for DNA polymerase III, these strains were more sensitive to the alkylating agent methyl methanesulfonate (MMS) and hydrogen peroxide than normal cells. The same strains showed no increase in sensitivity to bleomycin, UV light, or psoralen at the restrictive temperature. The sensitivity of these strains to MMS and hydrogen peroxide was not due to the pcbAl allele, and normal sensitivity was restored by the introduction of a chromosomal or cloned DNA polymerase III gene, verifying that the sensitivity was due to loss of DNA polymerase III alpha-subunit activity. A functional DNA polymerase III is required for the reformation of high-molecular-weight DNA after treatment of cells with MMS or hydrogen peroxide, as demonstrated by alkaline sucrose sedimentation results. Thus, it appears that a functional DNA polymerase III is required for the optimal repair of DNA damage by MMS or hydrogen peroxide.

  4. Actinobaculum suis Detection Using Polymerase Chain Reaction

    PubMed Central

    Amigo, Cristina Román; de Gobbi, Debora Dirani Sena; Gomes, Vasco Túlio de Moura; Perina, Danilo do Prado; Nogueira de Lima Filsner, Pedro Henrique; Costa, Barbara Letícia Pereira; Spindola, Maria Garcia; Ferreira, Thais Sebastiana Porfida; Brandão, Paulo Eduardo; Moreno, Andrea Micke

    2012-01-01

    Actinobaculum suis is an important agent related to urinary infection in swine females. Due to its fastidious growth characteristics, the isolation of this anaerobic bacterium is difficult, thus impairing the estimation of its prevalence. The purpose of this study was to develop and test a polymerase chain reaction (PCR) for the detection and identification of A. suis and then compare these results with traditional isolation methods. Bacterial isolation and PCR were performed on one hundred and ninety-two urine samples from sows and forty-five preputial swabs from boars. The results indicate that this PCR was specific for A. suis, presenting a detection limit between 1.0 × 101 CFU/mL and 1.0 × 102 CFU/mL. A. suis frequencies, as measured by PCR, were 8.9% (17/192) in sow urine samples and 82.2% (37/45) in preputial swabs. Assessed using conventional culturing techniques, none of the urine samples were positive for A. suis; however, A. suis was detected in 31.1% (14/45) of the swabs. This PCR technique was shown to be an efficient method for the detection of A. suis in urine and preputial swabs. PMID:23346017

  5. Protein Affinity Chromatography with Purified Yeast DNA Polymerase α Detects Proteins that Bind to DNA Polymerase

    NASA Astrophysics Data System (ADS)

    Miles, Jeff; Formosa, Tim

    1992-02-01

    We have overexpressed the POL1 gene of the yeast Saccharomyces cerevisiae and purified the resulting DNA polymerase α polypeptide in an apparently intact form. We attached the purified DNA polymerase covalently to an agarose matrix and used this matrix to chromatograph extracts prepared from yeast cells. At least six proteins bound to the yeast DNA polymerase α matrix that did not bind to a control matrix. We speculate that these proteins might be DNA polymerase α accessory proteins. Consistent with this interpretation, one of the binding proteins, which we have named POB1 (polymerase one binding), is required for normal chromosome transmission. Mutations in this gene cause increased chromosome loss and an abnormal cell morphology, phenotypes that also occur in the presence of mutations in the yeast α or δ polymerase genes. These results suggest that the interactions detected by polymerase affinity chromatography are biologically relevant and may help to illuminate the architecture of the eukaryotic DNA replication machinery.

  6. Distinct molecular structures of nuclear class I, II, and III DNA-dependent RNA polymerases.

    PubMed

    Sklar, V E; Schwartz, L B; Roeder, R G

    1975-01-01

    Class III RNA polymerases purified from the murine plasmacytoma MOPC 315 and from Xenopus laevis ovaries were compared. The subunit structures of the chromatographically distinct murine enzymes IIIA and IIIB were indistinguishable and were remarkably similar to that of the amphibian enzyme III. The plasmacytoma class III RNA polymerases were also compared with purified plasmacytoma RNA polymerases I and II. Sedimentation studies indicated that RNA polymerase III si significantly larger than RNA polymerase II, which is slightly larger than RNA polymerase I. Structural analyses showed that the molecular weights of the large subunits present in the class III enzymes (138,000 and 155,000) differ from those of the class II enzymes (140,000 and either 170,000, 205,000, or 240,000) and from those of the class I enzymes (117,000 and 195,000). Some low-molecular-weight subunits are also unique to each enzyme class. These results clearly distinguish the class I, II, and III enzymes on a structural basis. In addition, polypeptides of molecular weight 29,000 and 19,000 were found in all enzyme classes, a polypeptide of molecular weight 52,000 was found only in class I and III enzymes, and a polypeptide of molecular weight 41,000 was found only in class II and III enzymes. These findings are discussed in terms of the function and regulation of the RNA polymerases.

  7. TATA elements direct bi-directional transcription by RNA polymerases II and III.

    PubMed Central

    Huang, W; Wong, J M; Bateman, E

    1996-01-01

    Eukaryotic promoter elements specify the direction and efficiency of transcription, as well as the type of RNA polymerase to be used. One such element, the TATA box, is thought to participate in determining the direction of transcription and can function within promoters for RNA polymerase II or III, depending on the sequence context. In this report the ability of four different TATA boxes to support transcription in vitro was determined. It was found that TATA elements are not directional. However, they support transcription by RNA polymerases II and III. An upstream activating sequence was found to stimulate downstream transcription by RNA polymerase II and to inhibit upstream transcription by RNA polymerases II and III. Thus a promoter necessarily consists of a TATA element and upstream sequences in order to specify the direction of transcription and the type of polymerase to be used. PMID:8604352

  8. Contributions of in vitro transcription to the understanding of human RNA polymerase III transcription

    PubMed Central

    Dumay-Odelot, Hélène; Durrieu-Gaillard, Stéphanie; El Ayoubi, Leyla; Parrot, Camila; Teichmann, Martin

    2014-01-01

    Human RNA polymerase III transcribes small untranslated RNAs that contribute to the regulation of essential cellular processes, including transcription, RNA processing and translation. Analysis of this transcription system by in vitro transcription techniques has largely contributed to the discovery of its transcription factors and to the understanding of the regulation of human RNA polymerase III transcription. Here we review some of the key steps that led to the identification of transcription factors and to the definition of minimal promoter sequences for human RNA polymerase III transcription. PMID:25764111

  9. Contributions of in vitro transcription to the understanding of human RNA polymerase III transcription.

    PubMed

    Dumay-Odelot, Hélène; Durrieu-Gaillard, Stéphanie; El Ayoubi, Leyla; Parrot, Camila; Teichmann, Martin

    2014-01-01

    Human RNA polymerase III transcribes small untranslated RNAs that contribute to the regulation of essential cellular processes, including transcription, RNA processing and translation. Analysis of this transcription system by in vitro transcription techniques has largely contributed to the discovery of its transcription factors and to the understanding of the regulation of human RNA polymerase III transcription. Here we review some of the key steps that led to the identification of transcription factors and to the definition of minimal promoter sequences for human RNA polymerase III transcription.

  10. Molecular structure of yeast RNA polymerase III: demonstration of the tripartite transcriptive system in lower eukaryotes.

    PubMed Central

    Valenzuela, P; Hager, G L; Weinberg, F; Rutter, W J

    1976-01-01

    Homogeneous RNA polymerase III (RNA nucleotidyltransferase III) has been obtained from yeast. The subunit composition of the enzyme was examined by polyacrylamide gel electrophoresis in the presence of sodium dodecyl sulfate. The enzyme is composed of 12 putative subunits with molecular weights 160,000, 128,000, 82,000, 41,000, 40,500, 37,000, 34,000, 28,000, 24,000, 20,000, 14,500, and 11,000. The high-molecular-weight subunits and several of the smaller subunits of yeast RNA polymerase III are clearly different from those of enzymes I and II, indicating a distinct molecular structure. However, the molecular weights of some of the small subunits (41,000, 28,000, 24,000, and 14,500) appear to be identical to those of polymerases I and II. Thus, it is possible that the three classes of enzymes in yeast have some common subunits. As in other eukaryotes, yeast polymerase II is inhibited by relatively low concentrations of alpha-amanitin; however, contrary to what has been found in higher eukaryotes, yeast polymerase III is resistant (up to 2 mg/ml) to alpha-amanitin, while yeast polymerase I is sensitive to high concentrations of the drug (50% inhibition at 0.3 mg/ml). These results establish the existence of RNA polymerase III in yeast and provide a structural basis for the discrimination of the three functional polymerases in eukaryotes. Images PMID:772675

  11. Molecular structure of yeast RNA polymerase III: demonstration of the tripartite transcriptive system in lower eukaryotes.

    PubMed

    Valenzuela, P; Hager, G L; Weinberg, F; Rutter, W J

    1976-04-01

    Homogeneous RNA polymerase III (RNA nucleotidyltransferase III) has been obtained from yeast. The subunit composition of the enzyme was examined by polyacrylamide gel electrophoresis in the presence of sodium dodecyl sulfate. The enzyme is composed of 12 putative subunits with molecular weights 160,000, 128,000, 82,000, 41,000, 40,500, 37,000, 34,000, 28,000, 24,000, 20,000, 14,500, and 11,000. The high-molecular-weight subunits and several of the smaller subunits of yeast RNA polymerase III are clearly different from those of enzymes I and II, indicating a distinct molecular structure. However, the molecular weights of some of the small subunits (41,000, 28,000, 24,000, and 14,500) appear to be identical to those of polymerases I and II. Thus, it is possible that the three classes of enzymes in yeast have some common subunits. As in other eukaryotes, yeast polymerase II is inhibited by relatively low concentrations of alpha-amanitin; however, contrary to what has been found in higher eukaryotes, yeast polymerase III is resistant (up to 2 mg/ml) to alpha-amanitin, while yeast polymerase I is sensitive to high concentrations of the drug (50% inhibition at 0.3 mg/ml). These results establish the existence of RNA polymerase III in yeast and provide a structural basis for the discrimination of the three functional polymerases in eukaryotes.

  12. Genome-wide location analysis reveals a role for Sub1 in RNA polymerase III transcription

    PubMed Central

    Tavenet, Arounie; Suleau, Audrey; Dubreuil, Géraldine; Ferrari, Roberto; Ducrot, Cécile; Michaut, Magali; Aude, Jean-Christophe; Dieci, Giorgio; Lefebvre, Olivier; Conesa, Christine; Acker, Joël

    2009-01-01

    Human PC4 and the yeast ortholog Sub1 have multiple functions in RNA polymerase II transcription. Genome-wide mapping revealed that Sub1 is present on Pol III-transcribed genes. Sub1 was found to interact with components of the Pol III transcription system and to stimulate the initiation and reinitiation steps in a system reconstituted with all recombinant factors. Sub1 was required for optimal Pol III gene transcription in exponentially growing cells. PMID:19706510

  13. Purification and Subunit Structure of DNA-dependent RNA Polymerase III from Wheat Germ 1

    PubMed Central

    Jendrisak, Jerry

    1981-01-01

    A rapid and simple, large-scale method for the purification of DNA-dependent RNA polymerase III (EC 2.7.7.6) from wheat germ is presented. The method involves enzyme extraction at low ionic strength, polyethyleneimine fractionation, (NH4)2SO4 precipitation, and chromatography on DEAE-Sepharose CL-6B, DEAE-cellulose, and heparin agarose. Milligram quantities of highly purified enzyme can be obtained from kilogram quantities of starting material in 2 to 3 days. Sodium dodecyl sulfate-polyacrylamide gel electrophoresis indicates that RNA polymerase III contains 14 subunits with molecular weights of: 150,000; 130,000; 94,000; 55,000; 38,000; 30,000; 28,000; 25,000; 24,500; 20,500; 20,000; 19,500; 17,800; and 17,000. Subunit structure comparison of wheat germ RNA polymerases I, II, and III indicates that all three enzymes may contain common subunits with molecular weights 20,000, 17,800, and 17,000. In addition, RNA polymerases II and III may contain a common subunit with a molecular weight of 25,000, and RNA polymerases I and III may contain a common subunit with a molecular weight of 38,000. Images PMID:16661690

  14. Exchange between Escherichia coli polymerases II and III on a processivity clamp

    PubMed Central

    Kath, James E.; Chang, Seungwoo; Scotland, Michelle K.; Wilbertz, Johannes H.; Jergic, Slobodan; Dixon, Nicholas E.; Sutton, Mark D.; Loparo, Joseph J.

    2016-01-01

    Escherichia coli has three DNA polymerases implicated in the bypass of DNA damage, a process called translesion synthesis (TLS) that alleviates replication stalling. Although these polymerases are specialized for different DNA lesions, it is unclear if they interact differently with the replication machinery. Of the three, DNA polymerase (Pol) II remains the most enigmatic. Here we report a stable ternary complex of Pol II, the replicative polymerase Pol III core complex and the dimeric processivity clamp, β. Single-molecule experiments reveal that the interactions of Pol II and Pol III with β allow for rapid exchange during DNA synthesis. As with another TLS polymerase, Pol IV, increasing concentrations of Pol II displace the Pol III core during DNA synthesis in a minimal reconstitution of primer extension. However, in contrast to Pol IV, Pol II is inefficient at disrupting rolling-circle synthesis by the fully reconstituted Pol III replisome. Together, these data suggest a β-mediated mechanism of exchange between Pol II and Pol III that occurs outside the replication fork. PMID:26657641

  15. Epigenetic regulation of noncoding RNA transcription by mammalian RNA polymerase III.

    PubMed

    Park, Jong-Lyul; Lee, Yeon-Su; Kunkeaw, Nawapol; Kim, Seon-Young; Kim, In-Hoo; Lee, Yong Sun

    2017-02-01

    RNA polymerase III (Pol III) synthesizes a range of medium-sized noncoding RNAs (collectively 'Pol III genes') whose early established biological roles were so essential that they were considered 'housekeeping genes'. Besides these fundamental functions, diverse unconventional roles of mammalian Pol III genes have recently been recognized and their expression must be exquisitely controlled. In this review, we summarize the epigenetic regulation of Pol III genes by chromatin structure, histone modification and CpG DNA methylation. We also recapitulate the association between dysregulation of Pol III genes and diseases such as cancer and neurological disorders. Additionally, we will discuss why in-depth molecular studies of Pol III genes have not been attempted and how nc886, a Pol III gene, may resolve this issue.

  16. A structural role for the PHP domain in E. coli DNA polymerase III.

    PubMed

    Barros, Tiago; Guenther, Joel; Kelch, Brian; Anaya, Jordan; Prabhakar, Arjun; O'Donnell, Mike; Kuriyan, John; Lamers, Meindert H

    2013-05-14

    In addition to the core catalytic machinery, bacterial replicative DNA polymerases contain a Polymerase and Histidinol Phosphatase (PHP) domain whose function is not entirely understood. The PHP domains of some bacterial replicases are active metal-dependent nucleases that may play a role in proofreading. In E. coli DNA polymerase III, however, the PHP domain has lost several metal-coordinating residues and is likely to be catalytically inactive. Genomic searches show that the loss of metal-coordinating residues in polymerase PHP domains is likely to have coevolved with the presence of a separate proofreading exonuclease that works with the polymerase. Although the E. coli Pol III PHP domain has lost metal-coordinating residues, the structure of the domain has been conserved to a remarkable degree when compared to that of metal-binding PHP domains. This is demonstrated by our ability to restore metal binding with only three point mutations, as confirmed by the metal-bound crystal structure of this mutant determined at 2.9 Å resolution. We also show that Pol III, a large multi-domain protein, unfolds cooperatively and that mutations in the degenerate metal-binding site of the PHP domain decrease the overall stability of Pol III and reduce its activity. While the presence of a PHP domain in replicative bacterial polymerases is strictly conserved, its ability to coordinate metals and to perform proofreading exonuclease activity is not, suggesting additional non-enzymatic roles for the domain. Our results show that the PHP domain is a major structural element in Pol III and its integrity modulates both the stability and activity of the polymerase.

  17. A structural role for the PHP domain in E. coli DNA polymerase III

    PubMed Central

    2013-01-01

    Background In addition to the core catalytic machinery, bacterial replicative DNA polymerases contain a Polymerase and Histidinol Phosphatase (PHP) domain whose function is not entirely understood. The PHP domains of some bacterial replicases are active metal-dependent nucleases that may play a role in proofreading. In E. coli DNA polymerase III, however, the PHP domain has lost several metal-coordinating residues and is likely to be catalytically inactive. Results Genomic searches show that the loss of metal-coordinating residues in polymerase PHP domains is likely to have coevolved with the presence of a separate proofreading exonuclease that works with the polymerase. Although the E. coli Pol III PHP domain has lost metal-coordinating residues, the structure of the domain has been conserved to a remarkable degree when compared to that of metal-binding PHP domains. This is demonstrated by our ability to restore metal binding with only three point mutations, as confirmed by the metal-bound crystal structure of this mutant determined at 2.9 Å resolution. We also show that Pol III, a large multi-domain protein, unfolds cooperatively and that mutations in the degenerate metal-binding site of the PHP domain decrease the overall stability of Pol III and reduce its activity. Conclusions While the presence of a PHP domain in replicative bacterial polymerases is strictly conserved, its ability to coordinate metals and to perform proofreading exonuclease activity is not, suggesting additional non-enzymatic roles for the domain. Our results show that the PHP domain is a major structural element in Pol III and its integrity modulates both the stability and activity of the polymerase. PMID:23672456

  18. [Cancers associated with systemic sclerosis involving anti-RNA polymerase III antibodies].

    PubMed

    Monfort, J-B; Mathian, A; Amoura, Z; Francès, C; Barbaud, A; Senet, P

    2017-09-13

    The incidence of cancer is increased in patients with systemic sclerosis (SSc). Further, recent studies have also shown that the presence of anti-RNA polymerase III antibodies is associated with a higher incidence of cancer in this population. Herein we present the cases of two men aged 56 and 23 years presenting SSc without anti-Scl70 or anti-centromere antibodies but with anti-RNA polymerase III antibodies. Clinical symptoms led us to prescribe more laboratory exams and both patients were diagnosed with cancer of the nasopharyngeal area. Anti-RNA polymerase III antibodies are useful for SSc diagnosis in patients without anti-centromere or anti-Scl70 antibodies. Their presence must lead physicians to screen for associated cancer, even in the absence of clinical signs. Copyright © 2017 Elsevier Masson SAS. All rights reserved.

  19. Transcriptional interference by RNA polymerase III affects expression of the Polr3e gene

    PubMed Central

    Yeganeh, Meghdad; Praz, Viviane; Cousin, Pascal; Hernandez, Nouria

    2017-01-01

    Overlapping gene arrangements can potentially contribute to gene expression regulation. A mammalian interspersed repeat (MIR) nested in antisense orientation within the first intron of the Polr3e gene, encoding an RNA polymerase III (Pol III) subunit, is conserved in mammals and highly occupied by Pol III. Using a fluorescence assay, CRISPR/Cas9-mediated deletion of the MIR in mouse embryonic stem cells, and chromatin immunoprecipitation assays, we show that the MIR affects Polr3e expression through transcriptional interference. Our study reveals a mechanism by which a Pol II gene can be regulated at the transcription elongation level by transcription of an embedded antisense Pol III gene. PMID:28289142

  20. Transcriptional interference by RNA polymerase III affects expression of the Polr3e gene.

    PubMed

    Yeganeh, Meghdad; Praz, Viviane; Cousin, Pascal; Hernandez, Nouria

    2017-02-15

    Overlapping gene arrangements can potentially contribute to gene expression regulation. A mammalian interspersed repeat (MIR) nested in antisense orientation within the first intron of the Polr3e gene, encoding an RNA polymerase III (Pol III) subunit, is conserved in mammals and highly occupied by Pol III. Using a fluorescence assay, CRISPR/Cas9-mediated deletion of the MIR in mouse embryonic stem cells, and chromatin immunoprecipitation assays, we show that the MIR affects Polr3e expression through transcriptional interference. Our study reveals a mechanism by which a Pol II gene can be regulated at the transcription elongation level by transcription of an embedded antisense Pol III gene.

  1. Identification of proteins associated with RNA polymerase III using a modified tandem chromatin affinity purification.

    PubMed

    Nguyen, Ngoc-Thuy-Trinh; Saguez, Cyril; Conesa, Christine; Lefebvre, Olivier; Acker, Joël

    2015-02-01

    To identify the proteins associated with the RNA polymerase III (Pol III) machinery in exponentially growing yeast cells, we developed our own tandem chromatin affinity purification procedure (TChAP) after in vivo cross-link, allowing a reproducible and good recovery of the protein bait and its associated partners. In contrast to TFIIIA that could only be purified as a free protein, this protocol allows us to capture free Pol III together with Pol III bound on its target genes. Transcription factors, elongation factors, RNA-associated proteins and proteins involved in Pol III biogenesis were identified by mass spectrometry. Interestingly, the presence of all the TFIIIB subunits found associated with Pol III together with the absence of TFIIIC and chromatin factors including histones suggest that DNA-bound Pol III purified using TChAP is mainly engaged in transcription reinitiation.

  2. Long-Range PCR Amplification of DNA by DNA Polymerase III Holoenzyme from Thermus thermophilus

    PubMed Central

    Kane, Shawn D.; Bullard, James M.

    2015-01-01

    DNA replication in bacteria is accomplished by a multicomponent replicase, the DNA polymerase III holoenzyme (pol III HE). The three essential components of the pol III HE are the α polymerase, the β sliding clamp processivity factor, and the DnaX clamp-loader complex. We report here the assembly of the functional holoenzyme from Thermus thermophilus (Tth), an extreme thermophile. The minimal holoenzyme capable of DNA synthesis consists of α, β and DnaX (τ and γ), δ and δ′ components of the clamp-loader complex. The proteins were each cloned and expressed in a native form. Each component of the system was purified extensively. The minimum holoenzyme from these five purified subunits reassembled is sufficient for rapid and processive DNA synthesis. In an isolated form the α polymerase was found to be unstable at temperatures above 65°C. We were able to increase the thermostability of the pol III HE to 98°C by addition and optimization of various buffers and cosolvents. In the optimized buffer system we show that a replicative polymerase apparatus, Tth pol III HE, is capable of rapid amplification of regions of DNA up to 15,000 base pairs in PCR reactions. PMID:25688300

  3. Proteolysis of the proofreading subunit controls the assembly of Escherichia coli DNA polymerase III catalytic core.

    PubMed

    Bressanin, Daniela; Stefan, Alessandra; Piaz, Fabrizio Dal; Cianchetta, Stefano; Reggiani, Luca; Hochkoeppler, Alejandro

    2009-11-01

    The C-terminal region of the proofreading subunit (epsilon) of Escherichia coli DNA polymerase III is shown here to be labile and to contain the residues (identified between F187 and R213) responsible for association with the polymerase subunit (alpha). We also identify two alpha-helices of the polymerase subunit (comprising the residues E311-M335 and G339-D353, respectively) as the determinants of binding to epsilon. The C-terminal region of epsilon is degraded by the ClpP protease assisted by the GroL molecular chaperone, while other factors control the overall concentration in vivo of epsilon. Among these factors, the chaperone DnaK is of primary importance for preserving the integrity of epsilon. Remarkably, inactivation of DnaK confers to Escherichia coli inviable phenotype at 42 degrees C, and viability can be restored over-expressing epsilon. Altogether, our observations indicate that the association between epsilon and alpha subunits of DNA polymerase III depends on small portions of both proteins, the association of which is controlled by proteolysis of epsilon. Accordingly, the factors catalysing (ClpP, GroL) or preventing (DnaK) this proteolysis exert a crucial checkpoint of the assembly of Escherichia coli DNA polymerase III core.

  4. Falling for the dark side of transcription: Nab2 fosters RNA polymerase III transcription

    PubMed Central

    Reuter, L. Maximilian; Sträßer, Katja

    2016-01-01

    ABSTRACT RNA polymerase III (RNAPIII) synthesizes diverse, small, non-coding RNAs with many important roles in the cellular metabolism. One of the open questions of RNAPIII transcription is whether and how additional factors are involved. Recently, Nab2 was identified as the first messenger ribonucleoprotein particle (mRNP) biogenesis factor with a function in RNAPIII transcription. PMID:27049816

  5. Two isoforms of human RNA polymerase III with specific functions in cell growth and transformation

    PubMed Central

    Dumay-Odelot, Hélène; Da Silva, Daniel; Rey, Christophe; Prochazkova, Martina; Roeder, Robert G.; Besser, Daniel; Teichmann, Martin

    2010-01-01

    Transcription in eukaryotic nuclei is carried out by DNA-dependent RNA polymerases I, II, and III. Human RNA polymerase III (Pol III) transcribes small untranslated RNAs that include tRNAs, 5S RNA, U6 RNA, and some microRNAs. Increased Pol III transcription has been reported to accompany or cause cell transformation. Here we describe a Pol III subunit (RPC32β) that led to the demonstration of two human Pol III isoforms (Pol IIIα and Pol IIIβ). RPC32β-containing Pol IIIβ is ubiquitously expressed and essential for growth of human cells. RPC32α-containing Pol IIIα is dispensable for cell survival, with expression being restricted to undifferentiated ES cells and to tumor cells. In this regard, and most importantly, suppression of RPC32α expression impedes anchorage-independent growth of HeLa cells, whereas ectopic expression of RPC32α in IMR90 fibroblasts enhances cell transformation and dramatically changes the expression of several tumor-related mRNAs and that of a subset of Pol III RNAs. These results identify a human Pol III isoform and isoform-specific functions in the regulation of cell growth and transformation. PMID:20154270

  6. Selectivity and proofreading both contribute significantly to the fidelity of RNA polymerase III transcription

    PubMed Central

    Alic, Nazif; Ayoub, Nayla; Landrieux, Emilie; Favry, Emmanuel; Baudouin-Cornu, Peggy; Riva, Michel; Carles, Christophe

    2007-01-01

    We examine here the mechanisms ensuring the fidelity of RNA synthesis by RNA polymerase III (Pol III). Misincorporation could only be observed by using variants of Pol III deficient in the intrinsic RNA cleavage activity. Determination of relative rates of the reactions producing correct and erroneous transcripts at a specific position on a tRNA gene, combined with computational methods, demonstrated that Pol III has a highly efficient proofreading activity increasing its transcriptional fidelity by a factor of 103 over the error rate determined solely by selectivity (1.8 × 10−4). We show that Pol III slows down synthesis past a misincorporation to achieve efficient proofreading. We discuss our findings in the context of transcriptional fidelity studies performed on RNA Pols, proposing that the fidelity of transcription is more crucial for Pol III than Pol II. PMID:17553959

  7. Chromatin-dependent regulation of RNA polymerases II and III activity throughout the transcription cycle.

    PubMed

    Jordán-Pla, Antonio; Gupta, Ishaan; de Miguel-Jiménez, Lola; Steinmetz, Lars M; Chávez, Sebastián; Pelechano, Vicent; Pérez-Ortín, José E

    2015-01-01

    The particular behaviour of eukaryotic RNA polymerases along different gene regions and amongst distinct gene functional groups is not totally understood. To cast light onto the alternative active or backtracking states of RNA polymerase II, we have quantitatively mapped active RNA polymerases at a high resolution following a new biotin-based genomic run-on (BioGRO) technique. Compared with conventional profiling with chromatin immunoprecipitation, the analysis of the BioGRO profiles in Saccharomyces cerevisiae shows that RNA polymerase II has unique activity profiles at both gene ends, which are highly dependent on positioned nucleosomes. This is the first demonstration of the in vivo influence of positioned nucleosomes on transcription elongation. The particular features at the 5' end and around the polyadenylation site indicate that this polymerase undergoes extensive specific-activity regulation in the initial and final transcription elongation phases. The genes encoding for ribosomal proteins show distinctive features at both ends. BioGRO also provides the first nascentome analysis for RNA polymerase III, which indicates that transcription of tRNA genes is poorly regulated at the individual copy level. The present study provides a novel perspective of the transcription cycle that incorporates inactivation/reactivation as an important aspect of RNA polymerase dynamics.

  8. Polymerase Chain Reaction for Detection of Systemic Plant Pathogens

    USDA-ARS?s Scientific Manuscript database

    This chapter outlines the advances and application of the polymerase chain reaction (PCR) since its development in 1984 and its enhancements and applications to detection of viruses, viroids and phytoplasma in pome and stone fruits. PCR is probably the most rapidly and widely adopted technology eve...

  9. Detection of Listeria monocytogenes by using the polymerase chain reaction

    SciTech Connect

    Bessesen, M.T.; Luo, Q.; Blaser, M.J.; Ellison, R.T. III.; Rotbart. H.A. )

    1990-09-01

    A method was developed for detection of Listeria monocytogens by polymerase chain reaction amplification followed by agarose gel electrophoresis or dot blot analysis with {sup 32}P-labeled internal probe. The technique identified 95 of 95 L. monocytogenes strains, 0 of 12 Listeria strains of other species, and 0 of 12 non-Listeria strains.

  10. New insights into the promoterless transcription of DNA coligo templates by RNA polymerase III

    PubMed Central

    Lama, Lodoe; Seidl, Christine I; Ryan, Kevin

    2014-01-01

    Chemically synthesized DNA can carry small RNA sequence information but converting that information into small RNA is generally thought to require large double-stranded promoters in the context of plasmids, viruses and genes. We previously found evidence that circularized oligodeoxynucleotides (coligos) containing certain sequences and secondary structures can template the synthesis of small RNA by RNA polymerase III in vitro and in human cells. By using immunoprecipitated RNA polymerase III we now report corroborating evidence that this enzyme is the sole polymerase responsible for coligo transcription. The immobilized polymerase enabled experiments showing that coligo transcripts can be formed through transcription termination without subsequent 3′ end trimming. To better define the determinants of productive transcription, a structure-activity relationship study was performed using over 20 new coligos. The results show that unpaired nucleotides in the coligo stem facilitate circumtranscription, but also that internal loops and bulges should be kept small to avoid secondary transcription initiation sites. A polymerase termination sequence embedded in the double-stranded region of a hairpin-encoding coligo stem can antagonize transcription. Using lessons learned from new and old coligos, we demonstrate how to convert poorly transcribed coligos into productive templates. Our findings support the possibility that coligos may prove useful as chemically synthesized vectors for the ectopic expression of small RNA in human cells. PMID:25764216

  11. New insights into the promoterless transcription of DNA coligo templates by RNA polymerase III.

    PubMed

    Lama, Lodoe; Seidl, Christine I; Ryan, Kevin

    2014-01-01

    Chemically synthesized DNA can carry small RNA sequence information but converting that information into small RNA is generally thought to require large double-stranded promoters in the context of plasmids, viruses and genes. We previously found evidence that circularized oligodeoxynucleotides (coligos) containing certain sequences and secondary structures can template the synthesis of small RNA by RNA polymerase III in vitro and in human cells. By using immunoprecipitated RNA polymerase III we now report corroborating evidence that this enzyme is the sole polymerase responsible for coligo transcription. The immobilized polymerase enabled experiments showing that coligo transcripts can be formed through transcription termination without subsequent 3' end trimming. To better define the determinants of productive transcription, a structure-activity relationship study was performed using over 20 new coligos. The results show that unpaired nucleotides in the coligo stem facilitate circumtranscription, but also that internal loops and bulges should be kept small to avoid secondary transcription initiation sites. A polymerase termination sequence embedded in the double-stranded region of a hairpin-encoding coligo stem can antagonize transcription. Using lessons learned from new and old coligos, we demonstrate how to convert poorly transcribed coligos into productive templates. Our findings support the possibility that coligos may prove useful as chemically synthesized vectors for the ectopic expression of small RNA in human cells.

  12. Rbs1, a new protein implicated in RNA polymerase III biogenesis in yeast Saccharomyces cerevisiae.

    PubMed

    Cieśla, Małgorzata; Makała, Ewa; Płonka, Marta; Bazan, Rafał; Gewartowski, Kamil; Dziembowski, Andrzej; Boguta, Magdalena

    2015-04-01

    Little is known about the RNA polymerase III (Pol III) complex assembly and its transport to the nucleus. We demonstrate that a missense cold-sensitive mutation, rpc128-1007, in the sequence encoding the C-terminal part of the second largest Pol III subunit, C128, affects the assembly and stability of the enzyme. The cellular levels and nuclear concentration of selected Pol III subunits were decreased in rpc128-1007 cells, and the association between Pol III subunits as evaluated by coimmunoprecipitation was also reduced. To identify the proteins involved in Pol III assembly, we performed a genetic screen for suppressors of the rpc128-1007 mutation and selected the Rbs1 gene, whose overexpression enhanced de novo tRNA transcription in rpc128-1007 cells, which correlated with increased stability, nuclear concentration, and interaction of Pol III subunits. The rpc128-1007 rbs1Δ double mutant shows a synthetic growth defect, indicating that rpc128-1007 and rbs1Δ function in parallel ways to negatively regulate Pol III assembly. Rbs1 physically interacts with a subset of Pol III subunits, AC19, AC40, and ABC27/Rpb5. Additionally, Rbs1 interacts with the Crm1 exportin and shuttles between the cytoplasm and nucleus. We postulate that Rbs1 binds to the Pol III complex or subcomplex and facilitates its translocation to the nucleus. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

  13. The effects of chromium(III) on DNA replication across O{sup 6}. Methylguanine by DNA polymerase {beta} and E. coli DNA polymerase I-Klenow fragment

    SciTech Connect

    Singh, J.; Su, L.; Snow, E.T.

    1995-11-01

    We are investigating the molecular mechanisms of how metal ions affect the fidelity of DNA replication. In our DNA replication system primed templates site-specifically modified with a model mutagenic lesion. O{sup 6}-methyldeoxyguanosine (O{sup 6}mG), are replicated in vitro by various purified DNA polymerases. O{sup 6}mG blocks DNA replication by human DNA polymerase {beta} but is less inhibitory to E. coli DNA Polymerase I-Klenow Fragment (KF) and its 3`-5` exonuclease deficient counterpart [KF (exo{sup {minus}})]. All three DNA polymerases exhibit a strong prelesion block and decreased rates of nucleotide extension. Polymerase {beta} exhibits discrimination against the incorporation of the right (dC) versus the wrong (dT) base. dT is incorporated in preference to dC opposite O{sup 6}mG-dT. KF (exo{sup {minus}}), on the other hand, extends the O{sup 6}mG-dT base pair more efficiently than O{sup 6}mG-dC. Thus individual polymerases may have opposing preferences for incorporation versus extension. Our previous studies have shown that chromium (III) [Cr(III)] increases DNA polymerase processivity and lowers the fidelity of DNA replication. At low final concentrations (about 0.1 {mu}M) Cr(III) stimulates the rate of nucleotide incorporation opposite O{sup 6}mG by KF(exo{sup {minus}}) and, to a lesser extent, by polymerase {beta}. Cr(III) does not affect incorporation of dT opposite dA, but decreases by 10-fold the K{sub M} for incorporation of dT opposite O{sup 6}mG. This constitutes an important mutagenic effect. Further experiments are underway to determine how Cr(III) affects the DNA binding and kinetic parameters of these exonuclease deficient DNA repair polymerases.

  14. Comprehensive analysis of DNA polymerase III α subunits and their homologs in bacterial genomes

    PubMed Central

    Timinskas, Kęstutis; Balvočiūtė, Monika; Timinskas, Albertas; Venclovas, Česlovas

    2014-01-01

    The analysis of ∼2000 bacterial genomes revealed that they all, without a single exception, encode one or more DNA polymerase III α-subunit (PolIIIα) homologs. Classified into C-family of DNA polymerases they come in two major forms, PolC and DnaE, related by ancient duplication. While PolC represents an evolutionary compact group, DnaE can be further subdivided into at least three groups (DnaE1-3). We performed an extensive analysis of various sequence, structure and surface properties of all four polymerase groups. Our analysis suggests a specific evolutionary pathway leading to PolC and DnaE from the last common ancestor and reveals important differences between extant polymerase groups. Among them, DnaE1 and PolC show the highest conservation of the analyzed properties. DnaE3 polymerases apparently represent an ‘impaired’ version of DnaE1. Nonessential DnaE2 polymerases, typical for oxygen-using bacteria with large GC-rich genomes, have a number of features in common with DnaE3 polymerases. The analysis of polymerase distribution in genomes revealed three major combinations: DnaE1 either alone or accompanied by one or more DnaE2s, PolC + DnaE3 and PolC + DnaE1. The first two combinations are present in Escherichia coli and Bacillus subtilis, respectively. The third one (PolC + DnaE1), found in Clostridia, represents a novel, so far experimentally uncharacterized, set. PMID:24106089

  15. SINE transcription by RNA polymerase III is suppressed by histone methylation but not by DNA methylation.

    PubMed

    Varshney, Dhaval; Vavrova-Anderson, Jana; Oler, Andrew J; Cowling, Victoria H; Cairns, Bradley R; White, Robert J

    2015-03-23

    Short interspersed nuclear elements (SINEs), such as Alu, spread by retrotransposition, which requires their transcripts to be copied into DNA and then inserted into new chromosomal sites. This can lead to genetic damage through insertional mutagenesis and chromosomal rearrangements between non-allelic SINEs at distinct loci. SINE DNA is heavily methylated and this was thought to suppress its accessibility and transcription, thereby protecting against retrotransposition. Here we provide several lines of evidence that methylated SINE DNA is occupied by RNA polymerase III, including the use of high-throughput bisulphite sequencing of ChIP DNA. We find that loss of DNA methylation has little effect on accessibility of SINEs to transcription machinery or their expression in vivo. In contrast, a histone methyltransferase inhibitor selectively promotes SINE expression and occupancy by RNA polymerase III. The data suggest that methylation of histones rather than DNA plays a dominant role in suppressing SINE transcription.

  16. SINE transcription by RNA polymerase III is suppressed by histone methylation but not by DNA methylation

    PubMed Central

    Varshney, Dhaval; Vavrova-Anderson, Jana; Oler, Andrew J.; Cowling, Victoria H.; Cairns, Bradley R.; White, Robert J.

    2015-01-01

    Short interspersed nuclear elements (SINEs), such as Alu, spread by retrotransposition, which requires their transcripts to be copied into DNA and then inserted into new chromosomal sites. This can lead to genetic damage through insertional mutagenesis and chromosomal rearrangements between non-allelic SINEs at distinct loci. SINE DNA is heavily methylated and this was thought to suppress its accessibility and transcription, thereby protecting against retrotransposition. Here we provide several lines of evidence that methylated SINE DNA is occupied by RNA polymerase III, including the use of high-throughput bisulphite sequencing of ChIP DNA. We find that loss of DNA methylation has little effect on accessibility of SINEs to transcription machinery or their expression in vivo. In contrast, a histone methyltransferase inhibitor selectively promotes SINE expression and occupancy by RNA polymerase III. The data suggest that methylation of histones rather than DNA plays a dominant role in suppressing SINE transcription. PMID:25798578

  17. A protein-protein interaction map of yeast RNA polymerase III.

    PubMed

    Flores, A; Briand, J F; Gadal, O; Andrau, J C; Rubbi, L; Van Mullem, V; Boschiero, C; Goussot, M; Marck, C; Carles, C; Thuriaux, P; Sentenac, A; Werner, M

    1999-07-06

    The structure of the yeast RNA polymerase (pol) III was investigated by exhaustive two-hybrid screening using a library of random genomic fragments fused to the Gal4 activation domain. This procedure allowed us to identify contacts between individual polypeptides, localize the contact domains, and deduce a protein-protein interaction map of the multisubunit enzyme. In all but one case, pol III subunits were able to interact in vivo with one or sometimes two partner subunits of the enzyme or with subunits of TFIIIC. Four subunits that are common to pol I, II, and III (ABC27, ABC14.5, ABC10alpha, and ABC10beta), two that are common to pol I and III (AC40 and AC19), and one pol III-specific subunit (C11) can associate with defined regions of the two large subunits. These regions overlapped with highly conserved domains. C53, a pol III-specific subunit, interacted with a 37-kDa polypeptide that copurifies with the enzyme and therefore appears to be a unique pol III subunit (C37). Together with parallel interaction studies based on dosage-dependent suppression of conditional mutants, our data suggest a model of the pol III preinitiation complex.

  18. Detection of Entamoeba histolytica by Recombinase Polymerase Amplification.

    PubMed

    Nair, Gayatri; Rebolledo, Mauricio; White, A Clinton; Crannell, Zachary; Richards-Kortum, R Rebecca; Pinilla, A Elizabeth; Ramírez, Juan David; López, M Consuelo; Castellanos-Gonzalez, Alejandro

    2015-09-01

    Amebiasis is an important cause of diarrheal disease worldwide and has been associated with childhood malnutrition. Traditional microscopy approaches are neither sensitive nor specific for Entamoeba histolytica. Antigen assays are more specific, but many cases are missed unless tested by molecular methods. Although polymerase chain reaction (PCR) is effective, the need for sophisticated, expensive equipment, infrastructure, and trained personnel limits its usefulness, especially in the resource-limited, endemic areas. Here, we report development of a recombinase polymerase amplification (RPA) method to detect E. histolytica specifically. Using visual detection by lateral flow (LF), the test was highly sensitive and specific and could be performed without additional equipment. The availability of this inexpensive, sensitive, and field-applicable diagnostic test could facilitate rapid diagnosis and treatment of amebiasis in endemic regions.

  19. Detection of Entamoeba histolytica by Recombinase Polymerase Amplification

    PubMed Central

    Nair, Gayatri; Rebolledo, Mauricio; White, A. Clinton; Crannell, Zachary; Richards-Kortum, R. Rebecca; Pinilla, A. Elizabeth; Ramírez, Juan David; López, M. Consuelo; Castellanos-Gonzalez, Alejandro

    2015-01-01

    Amebiasis is an important cause of diarrheal disease worldwide and has been associated with childhood malnutrition. Traditional microscopy approaches are neither sensitive nor specific for Entamoeba histolytica. Antigen assays are more specific, but many cases are missed unless tested by molecular methods. Although polymerase chain reaction (PCR) is effective, the need for sophisticated, expensive equipment, infrastructure, and trained personnel limits its usefulness, especially in the resource-limited, endemic areas. Here, we report development of a recombinase polymerase amplification (RPA) method to detect E. histolytica specifically. Using visual detection by lateral flow (LF), the test was highly sensitive and specific and could be performed without additional equipment. The availability of this inexpensive, sensitive, and field-applicable diagnostic test could facilitate rapid diagnosis and treatment of amebiasis in endemic regions. PMID:26123960

  20. The polymerase chain reaction for Mycoplasma gallisepticum detection.

    PubMed

    Kempf, I; Blanchard, A; Gesbert, F; Guittet, M; Bennejean, G

    1993-12-01

    On the basis of the aligned 16S rRNA sequences of Mollicutes, a pair of primers was chosen for the detection of Mycoplasma gallisepticum. When used in the polymerase chain reaction (PCR), the primers detected a specific amplification of all Mg strains tested, yielding an expected 330 bp product. Amplification was not detected when other Mollicutes or E. coli were used as PCR templates. SPF chickens were experimentally inoculated with two strains of M. gallisepticum or Mycoplasma iowae. Tracheal swabs were collected 8, 15, 20 and 28 days after inoculation, and cultured for mycoplasma or tested by PCR. PCR products were detected by hybridization with a digoxigenin-labeled probe and by chemiluminescence. The results showed that culture was positive for 49/73 swabs while PCR detected 70/72 positive samples. Thus, PCR can provide the basis of a sensitive, specific, rapid and non-radio-active method for detecting M. gallisepticum.

  1. Polyadenylation of RNA transcribed from mammalian SINEs by RNA polymerase III: Complex requirements for nucleotide sequences.

    PubMed

    Borodulina, Olga R; Golubchikova, Julia S; Ustyantsev, Ilia G; Kramerov, Dmitri A

    2016-02-01

    It is generally accepted that only transcripts synthesized by RNA polymerase II (e.g., mRNA) were subject to AAUAAA-dependent polyadenylation. However, we previously showed that RNA transcribed by RNA polymerase III (pol III) from mouse B2 SINE could be polyadenylated in an AAUAAA-dependent manner. Many species of mammalian SINEs end with the pol III transcriptional terminator (TTTTT) and contain hexamers AATAAA in their A-rich tail. Such SINEs were united into Class T(+), whereas SINEs lacking the terminator and AATAAA sequences were classified as T(-). Here we studied the structural features of SINE pol III transcripts that are necessary for their polyadenylation. Eight and six SINE families from classes T(+) and T(-), respectively, were analyzed. The replacement of AATAAA with AACAAA in T(+) SINEs abolished the RNA polyadenylation. Interestingly, insertion of the polyadenylation signal (AATAAA) and pol III transcription terminator in T(-) SINEs did not result in polyadenylation. The detailed analysis of three T(+) SINEs (B2, DIP, and VES) revealed areas important for the polyadenylation of their pol III transcripts: the polyadenylation signal and terminator in A-rich tail, β region positioned immediately downstream of the box B of pol III promoter, and τ region located upstream of the tail. In DIP and VES (but not in B2), the τ region is a polypyrimidine motif which is also characteristic of many other T(+) SINEs. Most likely, SINEs of different mammals acquired these structural features independently as a result of parallel evolution. Copyright © 2015 Elsevier B.V. All rights reserved.

  2. Imaging RNA polymerase III transcription using a photostable RNA-fluorophore complex.

    PubMed

    Song, Wenjiao; Filonov, Grigory S; Kim, Hyaeyeong; Hirsch, Markus; Li, Xing; Moon, Jared D; Jaffrey, Samie R

    2017-09-25

    Quantitative measurement of transcription rates in live cells is important for revealing mechanisms of transcriptional regulation. This is particularly challenging when measuring the activity of RNA polymerase III (Pol III), which transcribes growth-promoting small RNAs. To address this issue, we developed Corn, a genetically encoded fluorescent RNA reporter suitable for quantifying RNA transcription in cells. Corn binds and induces fluorescence of 3,5-difluoro-4-hydroxybenzylidene-imidazolinone-2-oxime, which resembles the fluorophore found in red fluorescent protein (RFP). Notably, Corn shows high photostability, enabling quantitative fluorescence imaging of mTOR-dependent Pol III transcription. We found that, unlike actinomycin D, mTOR inhibitors resulted in heterogeneous transcription suppression in individual cells. Quantitative imaging of Corn-tagged Pol III transcript levels revealed distinct Pol III transcription 'trajectories' elicited by mTOR inhibition. Together, these studies provide an approach for quantitative measurement of Pol III transcription by direct imaging of Pol III transcripts containing a photostable RNA-fluorophore complex.

  3. RNA Polymerase III Regulates Cytosolic RNA:DNA Hybrids and Intracellular MicroRNA Expression*

    PubMed Central

    Koo, Christine Xing'er; Kobiyama, Kouji; Shen, Yu J.; LeBert, Nina; Ahmad, Shandar; Khatoo, Muznah; Aoshi, Taiki; Gasser, Stephan; Ishii, Ken J.

    2015-01-01

    RNA:DNA hybrids form in the nuclei and mitochondria of cells as transcription-induced R-loops or G-quadruplexes, but exist only in the cytosol of virus-infected cells. Little is known about the existence of RNA:DNA hybrids in the cytosol of virus-free cells, in particular cancer or transformed cells. Here, we show that cytosolic RNA:DNA hybrids are present in various human cell lines, including transformed cells. Inhibition of RNA polymerase III (Pol III), but not DNA polymerase, abrogated cytosolic RNA:DNA hybrids. Cytosolic RNA:DNA hybrids bind to several components of the microRNA (miRNA) machinery-related proteins, including AGO2 and DDX17. Furthermore, we identified miRNAs that are specifically regulated by Pol III, providing a potential link between RNA:DNA hybrids and the miRNA machinery. One of the target genes, exportin-1, is shown to regulate cytosolic RNA:DNA hybrids. Taken together, we reveal previously unknown mechanism by which Pol III regulates the presence of cytosolic RNA:DNA hybrids and miRNA biogenesis in various human cells. PMID:25623070

  4. Treacher Collins syndrome mutations in Saccharomyces cerevisiae destabilizes RNA polymerase I and III complex integrity.

    PubMed

    Walker-Kopp, Nancy; Jackobel, Ashleigh J; Pannafino, Gianno N; Morocho, Paola A; Xu, Xia; Knutson, Bruce A

    2017-08-14

    Treacher Collins syndrome (TCS) is a craniofacial disorder that is characterized by the malformation of the facial bones. Mutations in three genes (TCOF1, POLR1C, and POLR1D) involved in RNA polymerase I (Pol I) transcription account for more than 90% of disease cases. Two of these TCS-associated genes, POLR1C and POLR1D, encode for essential Pol I/III subunits that form a heterodimer necessary for Pol I/III assembly, and many TCS mutations lie along their evolutionarily conserved dimerization interface. Here we elucidate the molecular basis of TCS mutations in S. cerevisiae, and present a new model for how TCS mutations may disrupt Pol I and III complex integrity. © The Author 2017. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  5. Characterization of new RNA polymerase III and RNA polymerase II transcriptional promoters in the Bovine Leukemia Virus genome

    PubMed Central

    Van Driessche, Benoit; Rodari, Anthony; Delacourt, Nadège; Fauquenoy, Sylvain; Vanhulle, Caroline; Burny, Arsène; Rohr, Olivier; Van Lint, Carine

    2016-01-01

    Bovine leukemia virus latency is a viral strategy used to escape from the host immune system and contribute to tumor development. However, a highly expressed BLV micro-RNA cluster has been reported, suggesting that the BLV silencing is not complete. Here, we demonstrate the in vivo recruitment of RNA polymerase III to the BLV miRNA cluster both in BLV-latently infected cell lines and in ovine BLV-infected primary cells, through a canonical type 2 RNAPIII promoter. Moreover, by RPC6-knockdown, we showed a direct functional link between RNAPIII transcription and BLV miRNAs expression. Furthermore, both the tumor- and the quiescent-related isoforms of RPC7 subunits were recruited to the miRNA cluster. We showed that the BLV miRNA cluster was enriched in positive epigenetic marks. Interestingly, we demonstrated the in vivo recruitment of RNAPII at the 3′LTR/host genomic junction, associated with positive epigenetic marks. Functionally, we showed that the BLV LTR exhibited a strong antisense promoter activity and identified cis-acting elements of an RNAPII-dependent promoter. Finally, we provided evidence for an in vivo collision between RNAPIII and RNAPII convergent transcriptions. Our results provide new insights into alternative ways used by BLV to counteract silencing of the viral 5′LTR promoter. PMID:27545598

  6. Distinct transcriptional responses of RNA polymerases I, II and III to aptamers that bind TBP

    PubMed Central

    Fan, Xiaochun; Shi, Hua; Lis, John T.

    2005-01-01

    The TATA-binding protein (TBP) is a general factor that is involved in transcription by all three types of nuclear RNA polymerase. To delineate the roles played by the DNA-binding surface of TBP in these transcription reactions, we used a set of RNA aptamers directed against TBP and examined their ability to perturb transcription in vitro by the different RNA polymerases. Distinct responses to the TBP aptamers were observed for transcription by different types of polymerase at either the initiation, reinitiation or both stages of the transcription cycle. We further probed the TBP interactions in the TFIIIB•DNA complex to elucidate the mechanism for the different sensitivity of Pol III dependent transcription before and after preinitiation complex (PIC) formation. Lastly, the aptamers were employed to measure the time required for Pol III PIC formation in vitro. This approach can be generalized to define the involvement of a particular region on the surface of a protein at particular stages in a biological process. PMID:15701755

  7. Direct regulation of RNA polymerase III transcription by RB, p53 and c-Myc.

    PubMed

    Felton-Edkins, Zoë A; Kenneth, Niall S; Brown, Timothy R P; Daly, Nicole L; Gomez-Roman, Natividad; Grandori, Carla; Eisenman, Robert N; White, Robert J

    2003-01-01

    The synthesis of tRNA and 5S rRNA by RNA polymerase (pol) III is cell cycle regulated in higher organisms. Overexpression of pol III products is a general feature of transformed cells. These observations may be explained by the fact that a pol III-specific transcription factor, TFIIIB, is strongly regulated by the tumor suppressors RB and p53, as well as the proto-oncogene product c-Myc. RB and p53 repress TFIIIB, but this restraint can be lost in tumors through a variety of mechanisms. In contrast, c-Myc binds and activates TFIIIB, causing potent induction of pol III transcription. Using chromatin immunoprecipitation and RNA interference, we show that c-Myc interacts with tRNA and 5S rRNA genes in transformed cervical cells, stimulating their expression. Availability of pol III products may be an important determinant of a cell's capacity to grow. The ability to regulate pol III output may therefore be integral to the growth control functions of RB, p53 and c-Myc.

  8. RNA polymerase III transcription factor TFIIIC2 is overexpressed in ovarian tumors

    PubMed Central

    Winter, Andrew G.; Sourvinos, George; Allison, Simon J.; Tosh, Kerrie; Scott, Pamela H.; Spandidos, Demetrios A.; White, Robert J.

    2000-01-01

    Most transformed cells display abnormally high levels of RNA polymerase (pol) III transcripts. Although the full significance of this is unclear, it may be fundamental because healthy cells use two key tumor suppressors to restrain pol III activity. We present the first evidence that a pol III transcription factor is overexpressed in tumors. This factor, TFIIIC2, is a histone acetyltransferase that is required for synthesis of most pol III products, including tRNA and 5S rRNA. TFIIIC2 is a complex of five polypeptides, and mRNAs encoding each of these subunits are overexpressed in human ovarian carcinomas; this may explain the elevated TFIIIC2 activity that is found consistently in the tumors. Deregulation in these cancers is unlikely to be a secondary response to rapid proliferation, because there is little or no change in TFIIIC2 mRNA levels when actively cycling cells are compared with growth-arrested cells in culture. Using purified factors, we show that raising the level of TFIIIC2 is sufficient to stimulate pol III transcription in ovarian cell extracts. The data suggest that overexpression of TFIIIC2 contributes to the abnormal abundance of pol III transcripts in ovarian tumors. PMID:11058163

  9. Insights into the Replisome from the Structure of a Ternary Complex of the DNA Polymerase III [alpha]-Subunit

    SciTech Connect

    Wing, R.A.; Bailey, S.; Steitz, T.A.

    2009-03-27

    The crystal structure of the catalytic {alpha}-subunit of the DNA polymerase III (PolIII{alpha}) holoenzyme bound to primer-template DNA and an incoming deoxy-nucleoside 5{prime}-triphosphate has been determined at 4.6-{angstrom} resolution. The polymerase interacts with the sugar-phosphate backbone of the DNA across its minor groove, which is made possible by significant movements of the thumb, finger, and {beta}-binding domains relative to their orientations in the unliganded polymerase structure. Additionally, the DNA and incoming nucleotide are bound to the active site of PolIII{alpha} nearly identically as they are in their complex with DNA polymerase {beta}, thereby proving that the eubacterial replicating polymerase, but not the eukaryotic replicating polymerase, is homologous to DNA polymerase {beta}. Finally, superimposing a recent structure of the clamp bound to DNA on this PolIII{alpha} complex with DNA places a loop of the {beta}-binding domain into the appropriate clamp cleft and supports a mechanism of polymerase switching.

  10. Nested methylation-specific polymerase chain reaction cancer detection method

    DOEpatents

    Belinsky, Steven A.; Palmisano, William A.

    2007-05-08

    A molecular marker-based method for monitoring and detecting cancer in humans. Aberrant methylation of gene promoters is a marker for cancer risk in humans. A two-stage, or "nested" polymerase chain reaction method is disclosed for detecting methylated DNA sequences at sufficiently high levels of sensitivity to permit cancer screening in biological fluid samples, such as sputum, obtained non-invasively. The method is for detecting the aberrant methylation of the p16 gene, O 6-methylguanine-DNA methyltransferase gene, Death-associated protein kinase gene, RAS-associated family 1 gene, or other gene promoters. The method offers a potentially powerful approach to population-based screening for the detection of lung and other cancers.

  11. Nested methylation-specific polymerase chain reaction cancer detection method

    DOEpatents

    Belinsky, Steven A.; Palmisano, William A.

    2007-05-08

    A molecular marker-based method for monitoring and detecting cancer in humans. Aberrant methylation of gene promoters is a marker for cancer risk in humans. A two-stage, or "nested" polymerase chain reaction method is disclosed for detecting methylated DNA sequences at sufficiently high levels of sensitivity to permit cancer screening in biological fluid samples, such as sputum, obtained non-invasively. The method is for detecting the aberrant methylation of the p16 gene, O 6-methylguanine-DNA methyltransferase gene, Death-associated protein kinase gene, RAS-associated family 1 gene, or other gene promoters. The method offers a potentially powerful approach to population-based screening for the detection of lung and other cancers.

  12. Detection of Mycoplasma pneumoniae by using the polymerase chain reaction.

    PubMed Central

    Bernet, C; Garret, M; de Barbeyrac, B; Bebear, C; Bonnet, J

    1989-01-01

    The polymerase chain reaction (PCR) technique was used to detect Mycoplasma pneumoniae. A specific DNA sequence for M. pneumoniae was selected from a genomic library, and two oligonucleotides were chosen in this sequence to give an amplified fragment of 144 base pairs. We show that DNA from different M. pneumoniae strains can be detected by PCR, with DNA from other Mycoplasma species giving negative results. Analysis of biological samples (throat swabs) obtained from hamsters that were experimentally infected with M. pneumoniae showed that PCR was more sensitive and reliable than conventional culture techniques for the detection of M. pneumoniae. Initial experiments on artificially seeded human bronchoalveolar lavages showed that PCR can be used to detect 10(2) to 10(3) organisms. Images PMID:2509513

  13. Nucleosomes inhibit both transcriptional initiation and elongation by RNA polymerase III in vitro.

    PubMed Central

    Morse, R H

    1989-01-01

    To examine the effect of nucleosomes on in vitro transcription, purified chicken erythrocyte core histones and plasmid DNA bearing the Xenopus 5S RNA gene were assembled into nucleosomes and used as templates for transcription in a Xenopus oocyte nuclear extract. Plasmids having a nucleosome incorporating a specific region of the gene were selected by treating the reconstituted molecules with restriction endonucleases. In this way, it was shown that a nucleosome on or close to the internal control region of the 5S RNA gene inhibits transcription. Furthermore, experiments with 5S maxigenes showed that RNA polymerase III, in contrast to SP6 RNA polymerase, will not transcribe through a nucleosome in vitro. Images PMID:2792088

  14. Recombinase Polymerase Amplification Assay for Rapid Detection of Francisella tularensis

    PubMed Central

    Euler, Milena; Wang, Yongjie; Otto, Peter; Tomaso, Herbert; Escudero, Raquel; Anda, Pedro; Hufert, Frank T.

    2012-01-01

    Several real-time PCR approaches to develop field detection for Francisella tularensis, the infectious agent causing tularemia, have been explored. We report the development of a novel qualitative real-time isothermal recombinase polymerase amplification (RPA) assay for use on a small ESEQuant Tube Scanner device. The analytical sensitivity and specificity were tested using a plasmid standard and DNA extracts from infected rabbit tissues. The assay showed a performance comparable to real-time PCR but reduced the assay time to 10 min. The rapid RPA method has great application potential for field use or point-of-care diagnostics. PMID:22518861

  15. Detection of Trypanosoma cruzi by Polymerase Chain Reaction.

    PubMed

    Márquez, María Elizabeth; Concepción, Juan Luis; González-Marcano, Eglys; Mondolfi, Alberto Paniz

    2016-01-01

    American Trypanosomiasis (Chagas disease) is an infectious disease caused by the hemoflagellate parasite Trypanosoma cruzi which is transmitted by reduviid bugs. T. cruzi infection occurs in a broad spectrum of reservoir animals throughout North, Central, and South America and usually evolves into an asymptomatic chronic clinical stage of the disease in which diagnosis is often challenging. This chapter describes the application of polymerase chain reaction (PCR) for the detection of Trypanosoma cruzi DNA including protocols for sample preparation, DNA extraction, and target amplification methods.

  16. Recombinase polymerase amplification assay for rapid detection of Francisella tularensis.

    PubMed

    Euler, Milena; Wang, Yongjie; Otto, Peter; Tomaso, Herbert; Escudero, Raquel; Anda, Pedro; Hufert, Frank T; Weidmann, Manfred

    2012-07-01

    Several real-time PCR approaches to develop field detection for Francisella tularensis, the infectious agent causing tularemia, have been explored. We report the development of a novel qualitative real-time isothermal recombinase polymerase amplification (RPA) assay for use on a small ESEQuant Tube Scanner device. The analytical sensitivity and specificity were tested using a plasmid standard and DNA extracts from infected rabbit tissues. The assay showed a performance comparable to real-time PCR but reduced the assay time to 10 min. The rapid RPA method has great application potential for field use or point-of-care diagnostics.

  17. Detection of Clostridium septicum hemolysin gene by polymerase chain reaction.

    PubMed

    Takeuchi, S; Hashizume, N; Kinoshita, T; Kaidoh, T; Tamura, Y

    1997-09-01

    A polymerase chain reaction (PCR) was developed for the detection of the hemolysin (alpha toxin) gene of Clostridium septicum. The PCR primers were designed from the sequence of the hemolysin gene and synthesized. A DNA fragment of 270 bp was amplified from 10 strains of C. septicum, but was not from strains of C. chauvoei, C. perfringens, C. novyi, or C. haemolyticum. When the PCR product was digested with Sau3AI, two DNA fragments of the expected 148 bp and 122 bp were recognized. The lowest detectable threshold of PCR for the hemolysin gene was 3.8 x 10(3) cells/ml. The PCR technique may be useful for rapid detection or identification of C. septicum associated with malignant edema.

  18. [Recombinase Polymerase Amplification and its Applications in Parasite Detection].

    PubMed

    ZHENG, Wen-bin; WU, Yao-dong; MA, Jian-gang; ZHU, Xing-quan; ZHOU, Dong-hui

    2015-10-01

    Recombinase polymerase amplification (RPA) is a recently -developed isothermal nucleic-acid-amplification technology that is based on the nucleic acid replication mechanism in T4 bacteriophage. With this technique, nucleic-acid templates can be amplified to measurable levels within 20 min at 37-42 °C. The. RPA process has high sensitivity and specificity, and is simple to operate, thus nucleic acids can be detected rapidly in non-laboratory conditions. Since its development in 2006, the RPA technique has been applied in agriculture, food safety, medicine, transgene detection, etc. In this review, we will give an overview on the research progress of RPA and its application in parasite detection.

  19. BC1 RNA: transcriptional analysis of a neural cell-specific RNA polymerase III transcript.

    PubMed Central

    Martignetti, J A; Brosius, J

    1995-01-01

    Rodent BC1 RNA represents the first example of a neural cell-specific RNA polymerase III (Pol III) transcription product. By developing a rat brain in vitro system capable of supporting Pol III-directed transcription, we showed that the rat BC1 RNA intragenic promoter elements, comprising an A box element and a variant B box element, as well as its upstream region, containing octamer-binding consensus sequences and functional TATA and proximal sequence element sites, are necessary for transcription. The BC1 B box, lacking the invariant A residue found in the consensus B boxes of tRNAs, represents a functionally related and possibly distinct promoter element. The transcriptional activity of the BC1 B box element is greatly increased, in both a BC1 RNA and a chimeric tRNA(Leu) gene construct, when the BC1 5' flanking region is present and is appropriately spaced. Moreover, a tRNA consensus B-box sequence can efficiently replace the BC1 B box only if the BC1 upstream region is removed. These interactions, identified only in a homologous in vitro system, between upstream Pol II and intragenic Pol III promoters suggest a mechanism by which the tissue-specific BC1 RNA gene and possibly other Pol III-transcribed genes can be regulated. PMID:7862155

  20. Sensitive detection of Helicobacter pylori by using polymerase chain reaction.

    PubMed Central

    Clayton, C L; Kleanthous, H; Coates, P J; Morgan, D D; Tabaqchali, S

    1992-01-01

    A polymerase chain reaction (PCR) for the specific detection of Helicobacter pylori was developed with a single primer pair derived from the nucleotide sequence of the urease A gene of H. pylori. We achieved specific amplification of a 411-bp DNA fragment in H. pylori. After 35 cycles of amplification, the product could be detected by agarose gel electrophoresis and contained conserved single HinfI and AluI restriction sites. This fragment was amplified in all 50 strains of H. pylori tested, but it was not detected in other bacterial species, showing the PCR assay to be 100% specific. PCR DNA amplification was able to detect as few as 10 H. pylori cells. PCR detected H. pylori in 15 of 23 clinical human gastric biopsy samples, whereas culturing and microscopy detected H. pylori in only 7 of the samples found to be positive by PCR. Additional primer pairs based on the urease genes enabled the detection of H. pylori in paraffin-embedded human gastric biopsy samples. The detection of H. pylori by PCR will enable both retrospective and prospective analyses of clinical samples, elucidating the role of this organism in gastroduodenal disease. Images PMID:1734052

  1. Multiplexed Recombinase Polymerase Amplification Assay To Detect Intestinal Protozoa.

    PubMed

    Crannell, Zachary; Castellanos-Gonzalez, Alejandro; Nair, Gayatri; Mejia, Rojelio; White, A Clinton; Richards-Kortum, Rebecca

    2016-02-02

    This work describes a proof-of-concept multiplex recombinase polymerase amplification (RPA) assay with lateral flow readout that is capable of simultaneously detecting and differentiating DNA from any of the diarrhea-causing protozoa Giardia, Cryptosporidium, and Entamoeba. Together, these parasites contribute significantly to the global burden of diarrheal illness. Differential diagnosis of these parasites is traditionally accomplished via stool microscopy. However, microscopy is insensitive and can miss up to half of all cases. DNA-based diagnostics such as polymerase chain reaction (PCR) are far more sensitive; however, they rely on expensive thermal cycling equipment, limiting their availability to centralized reference laboratories. Isothermal DNA amplification platforms, such as the RPA platform used in this study, alleviate the need for thermal cycling equipment and have the potential to broaden access to more sensitive diagnostics. Until now, multiplex RPA assays have not been developed that are capable of simultaneously detecting and differentiating infections caused by different pathogens. We developed a multiplex RPA assay to detect the presence of DNA from Giardia, Cryptosporidium, and Entamoeba. The multiplex assay was characterized using synthetic DNA, where the limits-of-detection were calculated to be 403, 425, and 368 gene copies per reaction of the synthetic Giardia, Cryptosporidium, and Entamoeba targets, respectively (roughly 1.5 orders of magnitude higher than for the same targets in a singleplex RPA assay). The multiplex assay was also characterized using DNA extracted from live parasites spiked into stool samples where the limits-of-detection were calculated to be 444, 6, and 9 parasites per reaction for Giardia, Cryptosporidium, and Entamoeba parasites, respectively. This proof-of-concept assay may be reconfigured to detect a wide variety of targets by re-designing the primer and probe sequences.

  2. RNA Polymerase III transcription in higher plants: Annual performance report, December 20, 1986 through December 15, 1987

    SciTech Connect

    Hall, B.D.

    1987-01-01

    tDNA-dependent Pol III transcription is not observed directly in extracts of wheat embryo cells or nuclei. This project seeks to purify wheat germ RNA Polymerase III, purify wheat factor TFIIIC based upon tDNA binding activity, and by using the two above components plus a specific cloned tDNA template, to screen extracts for the one missing component.

  3. Structure of the SSB-DNA polymerase III interface and its role in DNA replication

    SciTech Connect

    Marceau, Aimee H; Bahng, Soon; Massoni, Shawn C; George, Nicholas P; Sandler, Steven J; Marians, Kenneth J; Keck, James L

    2012-05-22

    Interactions between single-stranded DNA-binding proteins (SSBs) and the DNA replication machinery are found in all organisms, but the roles of these contacts remain poorly defined. In Escherichia coli, SSB's association with the χ subunit of the DNA polymerase III holoenzyme has been proposed to confer stability to the replisome and to aid delivery of primers to the lagging-strand DNA polymerase. Here, the SSB-binding site on χ is identified crystallographically and biochemical and cellular studies delineate the consequences of destabilizing the χ/SSB interface. An essential role for the χ/SSB interaction in lagging-strand primer utilization is not supported. However, sequence changes in χ that block complex formation with SSB lead to salt-dependent uncoupling of leading- and lagging-strand DNA synthesis and to a surprising obstruction of the leading-strand DNA polymerase in vitro, pointing to roles for the χ/SSB complex in replisome establishment and maintenance. Destabilization of the χ/SSB complex in vivo produces cells with temperature-dependent cell cycle defects that appear to arise from replisome instability.

  4. RNA polymerase III transcription in higher plants: (Annual) performance report, May 1, 1986 through December 20, 1986

    SciTech Connect

    Hall, B.D.

    1986-01-01

    From wheat germ, we have isolated and partially purified the RNA polymerase III. We have shown it to be functional for tRNA synthesis in combination with yeast transcription factors tau (TFIIIC) and B. In addition, by the test of specific DNA binding, we have isolated a putative wheat TFIIIC. Several critical tests have been made, using human (HeLa cell) RNA polymerase III and its factors as a model system, to see whether complementation of an incomplete yeast Pol III system with factors of heterologous origin is likely to be successful. 5 refs.

  5. Nutrient/TOR-dependent regulation of RNA polymerase III controls tissue and organismal growth in Drosophila

    PubMed Central

    Marshall, Lynne; Rideout, Elizabeth J; Grewal, Savraj S

    2012-01-01

    The nutrient/target-of-rapamycin (TOR) pathway has emerged as a key regulator of tissue and organismal growth in metazoans. The signalling components of the nutrient/TOR pathway are well defined; however, the downstream effectors are less understood. Here, we show that the control of RNA polymerase (Pol) III-dependent transcription is an essential target of TOR in Drosophila. We find that TOR activity controls Pol III in growing larvae via inhibition of the repressor Maf1 and, in part, via the transcription factor Drosophila Myc (dMyc). Moreover, we show that loss of the Pol III factor, Brf, leads to reduced tissue and organismal growth and prevents TOR-induced cellular growth. TOR activity in the larval fat body, a tissue equivalent to vertebrate fat or liver, couples nutrition to insulin release from the brain. Accordingly, we find that fat-specific loss of Brf phenocopies nutrient limitation and TOR inhibition, leading to decreased systemic insulin signalling and reduced organismal growth. Thus, stimulation of Pol III is a key downstream effector of TOR in the control of cellular and systemic growth. PMID:22367393

  6. A high density of cis-information terminates RNA Polymerase III on a 2-rail track

    PubMed Central

    Arimbasseri, Aneeshkumar G.; Maraia, Richard J.

    2016-01-01

    ABSTRACT Transcription termination delineates the 3′ ends of transcripts, prevents otherwise runaway RNA polymerase (RNAP) from intruding into downstream genes and regulatory elements, and enables release of the RNAP for recycling. While other eukaryotic RNAPs require complex cis-signals and/or accessory factors to achieve these activities, RNAP III does so autonomously with high efficiency and precision at a simple oligo(dT) stretch of 5–6 bp. A basis for this high density cis-information is that both template and nontemplate strands of the RNAP III terminator carry distinct signals for different stages of termination. High-density cis-information is a feature of the RNAP III system that is also reflected by dual functionalities of the tRNA promoters as both DNA and RNA elements. We review emerging developments in RNAP III termination and single strand nontemplate DNA use by other RNAPs. Use of nontemplate signals by RNAPs and associated transcription factors may be prevalent in gene regulation. PMID:26636900

  7. Modulation of yeast genome expression in response to defective RNA polymerase III-dependent transcription.

    PubMed

    Conesa, Christine; Ruotolo, Roberta; Soularue, Pascal; Simms, Tiffany A; Donze, David; Sentenac, André; Dieci, Giorgio

    2005-10-01

    We used genome-wide expression analysis in Saccharomyces cerevisiae to explore whether and how the expression of protein-coding, RNA polymerase (Pol) II-transcribed genes is influenced by a decrease in RNA Pol III-dependent transcription. The Pol II transcriptome was characterized in four thermosensitive, slow-growth mutants affected in different components of the RNA Pol III transcription machinery. Unexpectedly, we found only a modest correlation between altered expression of Pol II-transcribed genes and their proximity to class III genes, a result also confirmed by the analysis of single tRNA gene deletants. Instead, the transcriptome of all of the four mutants was characterized by increased expression of genes known to be under the control of the Gcn4p transcriptional activator. Indeed, GCN4 was found to be translationally induced in the mutants, and deleting the GCN4 gene eliminated the response. The Gcn4p-dependent expression changes did not require the Gcn2 protein kinase and could be specifically counteracted by an increased gene dosage of initiator tRNA(Met). Initiator tRNA(Met) depletion thus triggers a GCN4-dependent reprogramming of genome expression in response to decreased Pol III transcription. Such an effect might represent a key element in the coordinated transcriptional response of yeast cells to environmental changes.

  8. Nutrient/TOR-dependent regulation of RNA polymerase III controls tissue and organismal growth in Drosophila.

    PubMed

    Marshall, Lynne; Rideout, Elizabeth J; Grewal, Savraj S

    2012-04-18

    The nutrient/target-of-rapamycin (TOR) pathway has emerged as a key regulator of tissue and organismal growth in metazoans. The signalling components of the nutrient/TOR pathway are well defined; however, the downstream effectors are less understood. Here, we show that the control of RNA polymerase (Pol) III-dependent transcription is an essential target of TOR in Drosophila. We find that TOR activity controls Pol III in growing larvae via inhibition of the repressor Maf1 and, in part, via the transcription factor Drosophila Myc (dMyc). Moreover, we show that loss of the Pol III factor, Brf, leads to reduced tissue and organismal growth and prevents TOR-induced cellular growth. TOR activity in the larval fat body, a tissue equivalent to vertebrate fat or liver, couples nutrition to insulin release from the brain. Accordingly, we find that fat-specific loss of Brf phenocopies nutrient limitation and TOR inhibition, leading to decreased systemic insulin signalling and reduced organismal growth. Thus, stimulation of Pol III is a key downstream effector of TOR in the control of cellular and systemic growth.

  9. Architecture of TFIIIC and its role in RNA polymerase III pre-initiation complex assembly

    NASA Astrophysics Data System (ADS)

    Male, Gary; von Appen, Alexander; Glatt, Sebastian; Taylor, Nicholas M. I.; Cristovao, Michele; Groetsch, Helga; Beck, Martin; Müller, Christoph W.

    2015-06-01

    In eukaryotes, RNA Polymerase III (Pol III) is specifically responsible for transcribing genes encoding tRNAs and other short non-coding RNAs. The recruitment of Pol III to tRNA-encoding genes requires the transcription factors (TF) IIIB and IIIC. TFIIIC has been described as a conserved, multi-subunit protein complex composed of two subcomplexes, called τA and τB. How these two subcomplexes are linked and how their interaction affects the formation of the Pol III pre-initiation complex (PIC) is poorly understood. Here we use chemical crosslinking mass spectrometry and determine the molecular architecture of TFIIIC. We further report the crystal structure of the essential TPR array from τA subunit τ131 and characterize its interaction with a central region of τB subunit τ138. The identified τ131-τ138 interacting region is essential in vivo and overlaps with TFIIIB-binding sites, revealing a crucial interaction platform for the regulation of tRNA transcription initiation.

  10. A novel interaction between DNA ligase III and DNA polymerase gamma plays an essential role in mitochondrial DNA stability.

    PubMed

    De, Ananya; Campbell, Colin

    2007-02-15

    The data in the present study show that DNA polymerase gamma and DNA ligase III interact in mitochondrial protein extracts from cultured HT1080 cells. An interaction was also observed between the two recombinant proteins in vitro. Expression of catalytically inert versions of DNA ligase III that bind DNA polymerase gamma was associated with reduced mitochondrial DNA copy number and integrity. In contrast, overexpression of wild-type DNA ligase III had no effect on mitochondrial DNA copy number or integrity. Experiments revealed that wild-type DNA ligase III facilitates the interaction of DNA polymerase gamma with a nicked DNA substrate in vitro, and that the zinc finger domain of DNA ligase III is required for this activity. Mitochondrial protein extracts prepared from cells overexpressing a DNA ligase III protein that lacked the zinc finger domain had reduced base excision repair activity compared with extracts from cells overexpressing the wild-type protein. These data support the interpretation that the interaction of DNA ligase III and DNA polymerase gamma is required for proper maintenance of the mammalian mitochondrial genome.

  11. Identification of RNA polymerase III-transcribed Alu loci by computational screening of RNA-Seq data.

    PubMed

    Conti, Anastasia; Carnevali, Davide; Bollati, Valentina; Fustinoni, Silvia; Pellegrini, Matteo; Dieci, Giorgio

    2015-01-01

    Of the ∼ 1.3 million Alu elements in the human genome, only a tiny number are estimated to be active in transcription by RNA polymerase (Pol) III. Tracing the individual loci from which Alu transcripts originate is complicated by their highly repetitive nature. By exploiting RNA-Seq data sets and unique Alu DNA sequences, we devised a bioinformatic pipeline allowing us to identify Pol III-dependent transcripts of individual Alu elements. When applied to ENCODE transcriptomes of seven human cell lines, this search strategy identified ∼ 1300 Alu loci corresponding to detectable transcripts, with ∼ 120 of them expressed in at least three cell lines. In vitro transcription of selected Alus did not reflect their in vivo expression properties, and required the native 5'-flanking region in addition to internal promoter. We also identified a cluster of expressed AluYa5-derived transcription units, juxtaposed to snaR genes on chromosome 19, formed by a promoter-containing left monomer fused to an Alu-unrelated downstream moiety. Autonomous Pol III transcription was also revealed for Alus nested within Pol II-transcribed genes. The ability to investigate Alu transcriptomes at single-locus resolution will facilitate both the identification of novel biologically relevant Alu RNAs and the assessment of Alu expression alteration under pathological conditions.

  12. Identification of RNA polymerase III-transcribed Alu loci by computational screening of RNA-Seq data

    PubMed Central

    Conti, Anastasia; Carnevali, Davide; Bollati, Valentina; Fustinoni, Silvia; Pellegrini, Matteo; Dieci, Giorgio

    2015-01-01

    Of the ∼1.3 million Alu elements in the human genome, only a tiny number are estimated to be active in transcription by RNA polymerase (Pol) III. Tracing the individual loci from which Alu transcripts originate is complicated by their highly repetitive nature. By exploiting RNA-Seq data sets and unique Alu DNA sequences, we devised a bioinformatic pipeline allowing us to identify Pol III-dependent transcripts of individual Alu elements. When applied to ENCODE transcriptomes of seven human cell lines, this search strategy identified ∼1300 Alu loci corresponding to detectable transcripts, with ∼120 of them expressed in at least three cell lines. In vitro transcription of selected Alus did not reflect their in vivo expression properties, and required the native 5′-flanking region in addition to internal promoter. We also identified a cluster of expressed AluYa5-derived transcription units, juxtaposed to snaR genes on chromosome 19, formed by a promoter-containing left monomer fused to an Alu-unrelated downstream moiety. Autonomous Pol III transcription was also revealed for Alus nested within Pol II-transcribed genes. The ability to investigate Alu transcriptomes at single-locus resolution will facilitate both the identification of novel biologically relevant Alu RNAs and the assessment of Alu expression alteration under pathological conditions. PMID:25550429

  13. Enhanced solid-phase recombinase polymerase amplification and electrochemical detection.

    PubMed

    Del Río, Jonathan Sabaté; Lobato, Ivan Magriñà; Mayboroda, Olena; Katakis, Ioanis; O'Sullivan, Ciara K

    2017-03-02

    Recombinase polymerase amplification (RPA) is an elegant method for the rapid, isothermal amplification of nucleic acids. Here, we elucidate the optimal surface chemistry for rapid and efficient solid-phase RPA, which was fine-tuned in order to obtain a maximum signal-to-noise ratio, defining the optimal DNA probe density, probe-to-lateral spacer ratio (1:0, 1:1, 1:10 and 1:100) and length of a vertical spacer of the probe as well as investigating the effect of different types of lateral spacers. The use of different labelling strategies was also examined in order to reduce the number of steps required for the analysis, using biotin or horseradish peroxidase-labelled reverse primers. Optimisation of the amplification temperature used and the use of surface blocking agents were also pursued. The combination of these changes facilitated a significantly more rapid amplification and detection protocol, with a lowered limit of detection (LOD) of 1 · 10(-15) M. The optimised protocol was applied to the detection of Francisella tularensis in real samples from hares and a clear correlation with PCR and qPCR results observed and the solid-phase RPA demonstrated to be capable of detecting 500 fM target DNA in real samples. Graphical abstract Relative size of thiolated lateral spacers tested versus the primer and the uvsx recombinase protein.

  14. Rapid detection of Porcine circovirus 2 by recombinase polymerase amplification.

    PubMed

    Wang, Jianchang; Wang, Jinfeng; Liu, Libing; Li, Ruiwen; Yuan, Wanzhe

    2016-09-01

    Porcine circovirus-associated disease, caused primarily by Porcine circovirus 2 (PCV-2), has become endemic in many pig-producing countries and has resulted in significant economic losses to the swine industry worldwide. Tests for PCV-2 infection include PCR, nested PCR, competitive PCR, and real-time PCR (rtPCR). Recombinase polymerase amplification (RPA) has emerged as an isothermal gene amplification technology for the molecular detection of infectious disease agents. RPA is performed at a constant temperature and therefore can be carried out in a water bath. In addition, RPA is completed in ~30 min, much faster than PCR, which usually takes >60 min. We developed a RPA-based method for the detection of PCV-2. The detection limit of RPA was 10(2) copies of PCV-2 genomic DNA. RPA showed the same sensitivity as rtPCR but was 10 times more sensitive than conventional PCR. Successful amplification of PCV-2 DNA, but not other viral templates, demonstrated high specificity of the RPA assay. This method was also validated using clinical samples. The results showed that the RPA assay had a diagnostic agreement rate of 93.7% with conventional PCR and 100% with rtPCR. These findings suggest that the RPA assay is a simple, rapid, and cost-effective method for PCV-2 detection, which could be potentially applied in clinical diagnosis and field surveillance of PCV-2 infection.

  15. Protein kinase A regulates RNA polymerase III transcription through the nuclear localization of Maf1

    PubMed Central

    Moir, Robyn D.; Lee, JaeHoon; Haeusler, Rebecca A.; Desai, Neelam; Engelke, David R.; Willis, Ian M.

    2006-01-01

    Maf1 is an essential and specific mediator of transcriptional repression in the RNA polymerase (pol) III system. Maf1-dependent repression occurs in response to a wide range of conditions, suggesting that the protein itself is targeted by the major nutritional and stress-signaling pathways. We show that Maf1 is a substrate for cAMP-dependent PKA in vitro and is differentially phosphorylated on PKA sites in vivo under normal versus repressing conditions. PKA activity negatively regulates Maf1 function because strains with unregulated high PKA activity block repression of pol III transcription in vivo, and strains lacking all PKA activity are hyperrepressible. Nuclear accumulation of Maf1 is required for transcriptional repression and is regulated by two nuclear localization sequences in the protein. An analysis of PKA phosphosite mutants shows that the localization of Maf1 is affected via the N-terminal nuclear localization sequence. In particular, mutations that prevent phosphorylation at PKA consensus sites promote nuclear accumulation of Maf1 without inducing repression. These results indicate that negative regulation of Maf1 by PKA is achieved by inhibiting its nuclear import and suggest that a PKA-independent activation step is required for nuclear Maf1 to function in the repression of pol III transcription. Finally, we report a previously undescribed phenotype for Maf1 in tRNA gene-mediated silencing of nearby RNA pol II transcription. PMID:17005718

  16. Electrochemical product detection of an asymmetric convective polymerase chain reaction.

    PubMed

    Duwensee, Heiko; Mix, Maren; Stubbe, Marco; Gimsa, Jan; Adler, Marcel; Flechsig, Gerd-Uwe

    2009-10-15

    For the first time, we describe the application of heated microwires for an asymmetric convective polymerase chain reaction (PCR) in a modified PCR tube in a small volume. The partly single-stranded product was labeled with the electrochemically active compound osmium tetroxide bipyridine using a partially complementary protective strand with five mismatches compared to the single-stranded product. The labeled product could be successfully detected at a gold electrode modified with a complementary single-stranded capture probe immobilized via a thiol-linker. Our simple thermo-convective PCR yielded electrochemically detectable products after only 5-10 min. A significant discrimination between complementary and non-complementary target was possible using different immobilized capture probes. The total product yield was approx. half the amount of the classical thermocycler PCR. Numerical simulations describing the thermally driven convective PCR explain the received data. Discrimination between complementary capture probes and non-complementary capture probes was performed using square-wave voltammetry. The coupling of asymmetric thermo-convective PCR with electrochemical detection is very promising for future compact DNA sensor devices.

  17. Global analysis of transcriptionally engaged yeast RNA polymerase III reveals extended tRNA transcripts

    PubMed Central

    Turowski, Tomasz W.; Leśniewska, Ewa; Delan-Forino, Clementine; Sayou, Camille; Boguta, Magdalena; Tollervey, David

    2016-01-01

    RNA polymerase III (RNAPIII) synthesizes a range of highly abundant small stable RNAs, principally pre-tRNAs. Here we report the genome-wide analysis of nascent transcripts attached to RNAPIII under permissive and restrictive growth conditions. This revealed strikingly uneven polymerase distributions across transcription units, generally with a predominant 5′ peak. This peak was higher for more heavily transcribed genes, suggesting that initiation site clearance is rate-limiting during RNAPIII transcription. Down-regulation of RNAPIII transcription under stress conditions was found to be uneven; a subset of tRNA genes showed low response to nutrient shift or loss of the major transcription regulator Maf1, suggesting potential “housekeeping” roles. Many tRNA genes were found to generate long, 3′-extended forms due to read-through of the canonical poly(U) terminators. The degree of read-through was anti-correlated with the density of U-residues in the nascent tRNA, and multiple, functional terminators can be located far downstream. The steady-state levels of 3′-extended pre-tRNA transcripts are low, apparently due to targeting by the nuclear surveillance machinery, especially the RNA binding protein Nab2, cofactors for the nuclear exosome, and the 5′-exonuclease Rat1. PMID:27206856

  18. Recessive mutations in POLR1C cause a leukodystrophy by impairing biogenesis of RNA polymerase III

    PubMed Central

    Thiffault, Isabelle; Wolf, Nicole I.; Forget, Diane; Guerrero, Kether; Tran, Luan T.; Choquet, Karine; Lavallée-Adam, Mathieu; Poitras, Christian; Brais, Bernard; Yoon, Grace; Sztriha, Laszlo; Webster, Richard I.; Timmann, Dagmar; van de Warrenburg, Bart P.; Seeger, Jürgen; Zimmermann, Alíz; Máté, Adrienn; Goizet, Cyril; Fung, Eva; van der Knaap, Marjo S.; Fribourg, Sébastien; Vanderver, Adeline; Simons, Cas; Taft, Ryan J.; Yates III, John R.; Coulombe, Benoit; Bernard, Geneviève

    2015-01-01

    A small proportion of 4H (Hypomyelination, Hypodontia and Hypogonadotropic Hypogonadism) or RNA polymerase III (POLR3)-related leukodystrophy cases are negative for mutations in the previously identified causative genes POLR3A and POLR3B. Here we report eight of these cases carrying recessive mutations in POLR1C, a gene encoding a shared POLR1 and POLR3 subunit, also mutated in some Treacher Collins syndrome (TCS) cases. Using shotgun proteomics and ChIP sequencing, we demonstrate that leukodystrophy-causative mutations, but not TCS mutations, in POLR1C impair assembly and nuclear import of POLR3, but not POLR1, leading to decreased binding to POLR3 target genes. This study is the first to show that distinct mutations in a gene coding for a shared subunit of two RNA polymerases lead to selective modification of the enzymes' availability leading to two different clinical conditions and to shed some light on the pathophysiological mechanism of one of the most common hypomyelinating leukodystrophies, POLR3-related leukodystrophy. PMID:26151409

  19. Detection of Penicillium expansum by polymerase chain reaction.

    PubMed

    Marek, Patrick; Annamalai, Thirunavukkarasu; Venkitanarayanan, Kumar

    2003-12-31

    Penicillium expansum is a major causative agent of postharvest decay in a variety of fruits, including apples, peaches, nectarines, and cherries. It causes significant economic losses to the fruit industry and is also of potential public health significance, since it produces patulin, a mycotoxin known to cause harmful effects in animals. Rapid and specific detection of P. expansum is important for ensuring microbiological quality and safety of fruits and fruit juices. The traditional methods for identification of P. expansum are time-consuming and labor-intensive. In this study, we report a polymerase chain reaction utilizing primers based on the polygalacturonase gene of P. expansum. The PCR amplified a 404-bp DNA product from all the P. expansum isolates tested, but not in other common foodborne Penicillium species and Escherichia coli. Experiments to determine the sensitivity of the PCR indicated that it can detect the DNA equivalent from as low as 25 spores of P. expansum. The PCR could potentially be used as a rapid tool for screening fruits for the presence of P. expansum.

  20. Detection of Aspergillus fumigatus by polymerase chain reaction.

    PubMed Central

    Spreadbury, C; Holden, D; Aufauvre-Brown, A; Bainbridge, B; Cohen, J

    1993-01-01

    Aspergillus fumigatus is an opportunistic nosocomial pathogen causing an often fatal pneumonia, invasive aspergillosis (IA), in immunosuppressed patients. Oligonucleotide primers were used to amplify a 401-bp fragment spanning the 26S/intergenic spacer region of the rDNA complex of A. fumigatus by the polymerase chain reaction (PCR). The primers were highly sensitive and specific: as little as 1 pg of A. fumigatus genomic DNA could be detected, and the primers only amplified DNA from A. fumigatus and not any other fungal, bacterial, viral, or human DNA tested. Using the PCR, we were able to detect A. fumigatus DNA in lung homogenates from immunosuppressed mice experimentally infected with A. fumigatus but not from immunosuppressed uninfected controls. There was 93% correlation between the culture results and the PCR results. In a retrospective clinical study, the sensitivity of the PCR for the detection of A. fumigatus in clinical samples was confirmed by positive amplification in three of three culture-positive respiratory samples from confirmed cases of IA. Because isolation of Aspergillus spp. may reflect contamination and colonization without infection, the feasibility of using the PCR was evaluated by analyzing culture-negative samples from both immunosuppressed patients at high risk for IA and immunocompetent patients with other lung infections. Only 2 of 10 patients were culture negative and PCR positive in the high-risk group, and 2 of 7 patients were culture negative and PCR positive in the immunocompetent group. The results indicate that PCR detection might be a valuable adjunct to current laboratory methods to diagnose IA. Images PMID:8458955

  1. Inhibition of host cell RNA polymerase III-mediated transcription by poliovirus: Inactivation of specific transcription factors

    SciTech Connect

    Fradkin, L.G.; Yoshinaga, S.K.; Berk, A.J.; Dasgupta, A.

    1987-11-01

    The inhibition of transcription by RNA polymerase III in poliovirus-infected cells was studied. Experiments utilizing two different cell lines showed that the initiation step of transcription by RNA polymerase III was impaired by infection of these cells with the virus. The observed inhibition of transcription was not due to shut-off of host cell protein synthesis by poliovirus. Among four distinct components required for accurate transcription in vitro from cloned DNA templates, activities of RNA polymerase III and transcription factor TFIIIA were not significantly affected by virus infection. The activity of transcription factor TFIIIC, the limiting component required for transcription of RNA polymerase III genes, was severely inhibited in infected cells, whereas that of transcription factor TFIIIB was inhibited to a lesser extent. The sequence-specific DNA-binding of TFIIIC to the adenovirus VA1 gene internal promoted, however, was not altered by infection of cells with the virus. The authors conclude that (i) at least two transcription factors, TFIIIB and TFIIIC, are inhibited by infection of cells with poliovirtus, (ii) inactivation of TFIIIC does not involve destruction of its DNA-binding domain, and (iii) sequence-specific DNA binding by TFIIIC may be necessary but is not sufficient for the formation of productive transcription complexes.

  2. Polymerase chain reaction based detection of fungi in infected corneas

    PubMed Central

    Gaudio, P A; Gopinathan, U; Sangwan, V; Hughes, T E

    2002-01-01

    Aims: To evaluate a polymerase chain reaction (PCR) based assay to detect fungi in scrapings from infected corneas. Methods: A PCR assay was developed to amplify a portion of the fungal 18S ribosome gene. Corneal scrapings from 30 patients with presumed infectious keratitis were evaluated using this assay, as well as by standard microbiological techniques, and the results were compared. Conjunctival swabs from each patient's healthy, fellow eye were also evaluated by PCR. Results: PCR and fungal culture results matched (were both positive or both negative for fungi) in 22 (74%) of 30 scrapings from infected corneas. Three (10%) of 30 samples were PCR positive but fungal culture negative; two of these appeared clinically to represent fungal infections, and the third was clinically indeterminate. Four (13%) scrapings were positive by PCR but also by bacterial and not fungal culture. One specimen (3%) was PCR negative but fungal culture positive. Of the conjunctival swabs from each patient's healthy fellow eye, five (17%) of 30 were positive by PCR, and the opposite, infected eye of all five of these harboured a fungal infection. Conclusions: PCR is promising as a means to diagnose fungal keratitis and offers some advantages over culture methods, including rapid analysis and the ability to analyse specimens far from where they are collected. PMID:12084744

  3. Virus-induced gene silencing of RPC5-like subunit of RNA polymerase III caused pleiotropic effects in Nicotiana benthamiana

    USDA-ARS?s Scientific Manuscript database

    In eukaryotic cells, RNA polymerase III is highly conserved, contains 17 subunits and transcribes housekeeping genes such as ribosomal 50S rRNA, tRNA and other small RNAs. Functional roles of the RPC5 are poorly characterized in the literature. In this work, we report that virus-induced gene silenci...

  4. Rapid detection of Mycobacterium tuberculosis by recombinase polymerase amplification.

    PubMed

    Boyle, David S; McNerney, Ruth; Teng Low, Hwee; Leader, Brandon Troy; Pérez-Osorio, Ailyn C; Meyer, Jessica C; O'Sullivan, Denise M; Brooks, David G; Piepenburg, Olaf; Forrest, Matthew S

    2014-01-01

    Improved access to effective tests for diagnosing tuberculosis (TB) has been designated a public health priority by the World Health Organisation. In high burden TB countries nucleic acid based TB tests have been restricted to centralised laboratories and specialised research settings. Requirements such as a constant electrical supply, air conditioning and skilled, computer literate operators prevent implementation of such tests in many settings. Isothermal DNA amplification technologies permit the use of simpler, less energy intensive detection platforms more suited to low resource settings that allow the accurate diagnosis of a disease within a short timeframe. Recombinase Polymerase Amplification (RPA) is a rapid, low temperature isothermal DNA amplification reaction. We report here RPA-based detection of Mycobacterium tuberculosis complex (MTC) DNA in <20 minutes at 39 °C. Assays for two MTC specific targets were investigated, IS6110 and IS1081. When testing purified MTC genomic DNA, limits of detection of 6.25 fg (IS6110) and 20 fg (IS1081)were consistently achieved. When testing a convenience sample of pulmonary specimens from suspected TB patients, RPA demonstrated superior accuracy to indirect fluorescence microscopy. Compared to culture, sensitivities for the IS1081 RPA and microscopy were 91.4% (95%CI: 85, 97.9) and 86.1% (95%CI: 78.1, 94.1) respectively (n = 71). Specificities were 100% and 88.6% (95% CI: 80.8, 96.1) respectively. For the IS6110 RPA and microscopy sensitivities of 87.5% (95%CI: 81.7, 93.2) and 70.8% (95%CI: 62.9, 78.7) were obtained (n = 90). Specificities were 95.4 (95% CI: 92.3,98.1) and 88% (95% CI: 83.6, 92.4) respectively. The superior specificity of RPA for detecting tuberculosis was due to the reduced ability of fluorescence microscopy to distinguish Mtb complex from other acid fast bacteria. The rapid nature of the RPA assay and its low energy requirement compared to other amplification technologies suggest RPA-based TB assays

  5. Subunit compositions of Arabidopsis RNA polymerases I and III reveal Pol I- and Pol III-specific forms of the AC40 subunit and alternative forms of the C53 subunit

    SciTech Connect

    Ream, Thomas S.; Haag, Jeremy R.; Pontvianne, Frederic; Nicora, Carrie D.; Norbeck, Angela D.; Pasa-Tolic, Ljiljana; Pikaard, Craig S.

    2015-05-02

    Using affinity purification and mass spectrometry, we identified the subunits of Arabidopsis thaliana multisubunit RNA Polymerases I and III (abbreviated as Pol I and Pol III), providing the first description of their physical compositions in plants. AC40 and AC19 subunits are typically common to Pol I (a.k.a. Pol A) and Pol III (a.k.a. Pol C) and are encoded by single genes whose mutation, in humans, is a cause of the craniofacial disorder, Treacher-Collins Syndrome. Surprisingly, A. thaliana, and related species, express two distinct AC40 paralogs, one of which assembles into Pol I and the other of which assembles into Pol III. Changes at eight amino acid positions correlate with this functional divergence of Pol I and Pol III-specific AC40 paralogs. Two genes encode homologs of the yeast C53 subunit, and either variant can assemble into Pol III. By contrast, only one of two potential C17 variants, and one of two potential C31 variants were detected in Pol III. We introduce a new nomenclature system for plant Pol I and Pol III subunits in which the twelve subunits that are structurally and functionally homologous among Pols I through V are assigned equivalent numbers.

  6. Subunit compositions of Arabidopsis RNA polymerases I and III reveal Pol I- and Pol III-specific forms of the AC40 subunit and alternative forms of the C53 subunit

    DOE PAGES

    Ream, Thomas S.; Haag, Jeremy R.; Pontvianne, Frederic; ...

    2015-05-02

    Using affinity purification and mass spectrometry, we identified the subunits of Arabidopsis thaliana multisubunit RNA Polymerases I and III (abbreviated as Pol I and Pol III), providing the first description of their physical compositions in plants. AC40 and AC19 subunits are typically common to Pol I (a.k.a. Pol A) and Pol III (a.k.a. Pol C) and are encoded by single genes whose mutation, in humans, is a cause of the craniofacial disorder, Treacher-Collins Syndrome. Surprisingly, A. thaliana, and related species, express two distinct AC40 paralogs, one of which assembles into Pol I and the other of which assembles into Polmore » III. Changes at eight amino acid positions correlate with this functional divergence of Pol I and Pol III-specific AC40 paralogs. Two genes encode homologs of the yeast C53 subunit, and either variant can assemble into Pol III. By contrast, only one of two potential C17 variants, and one of two potential C31 variants were detected in Pol III. We introduce a new nomenclature system for plant Pol I and Pol III subunits in which the twelve subunits that are structurally and functionally homologous among Pols I through V are assigned equivalent numbers.« less

  7. Identification of an RNA Polymerase III Regulator Linked to Disease-Associated Protein Aggregation.

    PubMed

    Sin, Olga; de Jong, Tristan; Mata-Cabana, Alejandro; Kudron, Michelle; Zaini, Mohamad Amr; Aprile, Francesco A; Seinstra, Renée I; Stroo, Esther; Prins, Roméo Willinge; Martineau, Céline N; Wang, Hai Hui; Hogewerf, Wytse; Steinhof, Anne; Wanker, Erich E; Vendruscolo, Michele; Calkhoven, Cornelis F; Reinke, Valerie; Guryev, Victor; Nollen, Ellen A A

    2017-03-16

    Protein aggregation is associated with age-related neurodegenerative disorders, such as Alzheimer's and polyglutamine diseases. As a causal relationship between protein aggregation and neurodegeneration remains elusive, understanding the cellular mechanisms regulating protein aggregation will help develop future treatments. To identify such mechanisms, we conducted a forward genetic screen in a C. elegans model of polyglutamine aggregation and identified the protein MOAG-2/LIR-3 as a driver of protein aggregation. In the absence of polyglutamine, MOAG-2/LIR-3 regulates the RNA polymerase III-associated transcription of small non-coding RNAs. This regulation is lost in the presence of polyglutamine, which mislocalizes MOAG-2/LIR-3 from the nucleus to the cytosol. We then show biochemically that MOAG-2/LIR-3 can also catalyze the aggregation of polyglutamine-expanded huntingtin. These results suggest that polyglutamine can induce an aggregation-promoting activity of MOAG-2/LIR-3 in the cytosol. The concept that certain aggregation-prone proteins can convert other endogenous proteins into drivers of aggregation and toxicity adds to the understanding of how cellular homeostasis can be deteriorated in protein misfolding diseases.

  8. Inborn errors in RNA polymerase III underlie severe varicella zoster virus infections.

    PubMed

    Ogunjimi, Benson; Zhang, Shen-Ying; Sørensen, Katrine B; Skipper, Kristian A; Carter-Timofte, Madalina; Kerner, Gaspard; Luecke, Stefanie; Prabakaran, Thaneas; Cai, Yujia; Meester, Josephina; Bartholomeus, Esther; Bolar, Nikhita Ajit; Vandeweyer, Geert; Claes, Charlotte; Sillis, Yasmine; Lorenzo, Lazaro; Fiorenza, Raffaele A; Boucherit, Soraya; Dielman, Charlotte; Heynderickx, Steven; Elias, George; Kurotova, Andrea; Auwera, Ann Vander; Verstraete, Lieve; Lagae, Lieven; Verhelst, Helene; Jansen, Anna; Ramet, Jose; Suls, Arvid; Smits, Evelien; Ceulemans, Berten; Van Laer, Lut; Plat Wilson, Genevieve; Kreth, Jonas; Picard, Capucine; Von Bernuth, Horst; Fluss, Joël; Chabrier, Stephane; Abel, Laurent; Mortier, Geert; Fribourg, Sebastien; Mikkelsen, Jacob Giehm; Casanova, Jean-Laurent; Paludan, Søren R; Mogensen, Trine H

    2017-09-01

    Varicella zoster virus (VZV) typically causes chickenpox upon primary infection. In rare cases, VZV can give rise to life-threatening disease in otherwise healthy people, but the immunological basis for this remains unexplained. We report 4 cases of acute severe VZV infection affecting the central nervous system or the lungs in unrelated, otherwise healthy children who are heterozygous for rare missense mutations in POLR3A (one patient), POLR3C (one patient), or both (two patients). POLR3A and POLR3C encode subunits of RNA polymerase III. Leukocytes from all 4 patients tested exhibited poor IFN induction in response to synthetic or VZV-derived DNA. Moreover, leukocytes from 3 of the patients displayed defective IFN production upon VZV infection and reduced control of VZV replication. These phenotypes were rescued by transduction with relevant WT alleles. This work demonstrates that monogenic or digenic POLR3A and POLR3C deficiencies confer increased susceptibility to severe VZV disease in otherwise healthy children, providing evidence for an essential role of a DNA sensor in human immunity.

  9. TORC1-dependent sumoylation of Rpc82 promotes RNA polymerase III assembly and activity

    PubMed Central

    Chymkowitch, Pierre; Nguéa P, Aurélie; Aanes, Håvard; Robertson, Joseph; Klungland, Arne; Enserink, Jorrit M.

    2017-01-01

    Maintaining cellular homeostasis under changing nutrient conditions is essential for the growth and development of all organisms. The mechanisms that maintain homeostasis upon loss of nutrient supply are not well understood. By mapping the SUMO proteome in Saccharomyces cerevisiae, we discovered a specific set of differentially sumoylated proteins mainly involved in transcription. RNA polymerase III (RNAPIII) components, including Rpc53, Rpc82, and Ret1, are particularly prominent nutrient-dependent SUMO targets. Nitrogen starvation, as well as direct inhibition of the master nutrient response regulator target of rapamycin complex 1 (TORC1), results in rapid desumoylation of these proteins, which is reflected by loss of SUMO at tRNA genes. TORC1-dependent sumoylation of Rpc82 in particular is required for robust tRNA transcription. Mechanistically, sumoylation of Rpc82 is important for assembly of the RNAPIII holoenzyme and recruitment of Rpc82 to tRNA genes. In conclusion, our data show that TORC1-dependent sumoylation of Rpc82 bolsters the transcriptional capacity of RNAPIII under optimal growth conditions. PMID:28096404

  10. Stabilization of the Escherichia coli DNA polymerase III ε subunit by the θ subunit favors in vivo assembly of the Pol III catalytic core

    PubMed Central

    Conte, Emanuele; Vincelli, Gabriele; Schaaper, Roel M.; Bressanin, Daniela; Stefan, Alessandra; Dal Piaz, Fabrizio; Hochkoeppler, Alejandro

    2012-01-01

    Escherichia coli DNA polymerase III holoenzyme (HE) contains a core polymerase consisting of three subunits: α(polymerase), ε(3′-5′ exonuclease), and θ. Genetic experiments suggested that θ subunit stabilizes the intrinsically labile ε subunit and, furthermore, that θ might affect the cellular amounts of Pol III core and HE. Here, we provide biochemical evidence supporting this model by analyzing the amounts of the relevant proteins. First, we show that a ΔholE strain (lacking θ subunit) displays reduced amounts of free ε. We also demonstrate the existence of a dimer of ε, which may be involved in the stabilization of the protein. Second, θ, when overexpressed, dissociates the ε dimer and significantly increases the amount of Pol III core. The stability of ε also depends on cellular chaperones, including DnaK. Here, we report that: (i) temperature shift-up of ΔdnaK strains leads to rapid depletion of ε, and (ii) overproduction of θ overcomes both the depletion of ε and the temperature sensitivity of the strain. Overall, our data suggest that ε is a critical factor in the assembly of Pol III core, and that this is role is strongly influenced by the θ subunit through its prevention of ε degradation. PMID:22546509

  11. Characterization of the χψ subcomplex of Pseudomonas aeruginosa DNA polymerase III

    PubMed Central

    2011-01-01

    Background DNA polymerase III, the main enzyme responsible for bacterial DNA replication, is composed of three sub-assemblies: the polymerase core, the β-sliding clamp, and the clamp loader. During replication, single-stranded DNA-binding protein (SSB) coats and protects single-stranded DNA (ssDNA) and also interacts with the χψ heterodimer, a sub-complex of the clamp loader. Whereas the χ subunits of Escherichia coli and Pseudomonas aeruginosa are about 40% homologous, P. aeruginosa ψ is twice as large as its E. coli counterpart, and contains additional sequences. It was shown that P. aeruginosa χψ together with SSB increases the activity of its cognate clamp loader 25-fold at low salt. The E. coli clamp loader, however, is insensitive to the addition of its cognate χψ under similar conditions. In order to find out distinguishing properties within P. aeruginosa χψ which account for this higher stimulatory effect, we characterized P. aeruginosa χψ by a detailed structural and functional comparison with its E. coli counterpart. Results Using small-angle X-ray scattering, analytical ultracentrifugation, and homology-based modeling, we found the N-terminus of P. aeruginosa ψ to be unstructured. Under high salt conditions, the affinity of the χψ complexes from both organisms to their cognate SSB was similar. Under low salt conditions, P. aeruginosa χψ, contrary to E. coli χψ, binds to ssDNA via the N-terminus of ψ. Whereas it is also able to bind to double-stranded DNA, the affinity is somewhat reduced. Conclusions The binding to DNA, otherwise never reported for any other ψ protein, enhances the affinity of P. aeruginosa χψ towards the SSB/ssDNA complex and very likely contributes to the higher stimulatory effect of P. aeruginosa χψ on the clamp loader. We also observed DNA-binding activity for P. putida χψ, making this activity most probably a characteristic of the ψ proteins from the Pseudomonadaceae. PMID:21955458

  12. TATA-box DNA binding activity and subunit composition for RNA polymerase III transcription factor IIIB from Xenopus laevis.

    PubMed Central

    McBryant, S J; Meier, E; Leresche, A; Sharp, S J; Wolf, V J; Gottesfeld, J M

    1996-01-01

    The RNA polymerase III transcription initiation factor TFIIIB contains the TATA-box-binding protein (TBP) and polymerase III-specific TBP-associated factors (TAFs). Previous studies have shown that DNA oligonucleotides containing the consensus TATA-box sequence inhibit polymerase III transcription, implying that the DNA binding domain of TBP is exposed in TFIIIB. We have investigated the TATA-box DNA binding activity of Xenopus TFIIIB, using transcription inhibition assays and a gel mobility shift assay. Gel shift competition assays with mutant and nonspecific DNAs demonstrate the specificity of the TFIIIB-TATA box DNA complex. The apparent dissociation constant for this protein-DNA interaction is approximately 0.4 nM, similar to the affinity of yeast TBP for the same sequence. TFIIIB transcriptional activity and TATA-box binding activity cofractionate during a series of four ion-exchange chromatographic steps, and reconstituted transcription reactions demonstrate that the TATA-box DNA-protein complex contains TFIIIB TAF activity. Polypeptides with apparent molecular masses of 75 and 92 kDa are associated with TBP in this complex. These polypeptides were renatured after elution from sodium dodecyl sulfate-gels and tested individually and in combination for TFIIIB TAF activity. Recombinant TBP along with protein fractions containing the 75- and 92-kDa polypeptides were sufficient to reconstitute TFIIIB transcriptional activity and DNA binding activity, suggesting that Xenopus TFIIIB is composed of TBP along with these polypeptides. PMID:8756620

  13. Incorporation of gemcitabine and cytarabine into DNA by DNA polymerase beta and ligase III/XRCC1.

    PubMed

    Prakasha Gowda, A S; Polizzi, Joanna M; Eckert, Kristin A; Spratt, Thomas E

    2010-06-15

    1-Beta-D-arabinofuranosylcytosine (cytarabine, araC) and 2',2'-difluoro-2'-deoxycytidine (gemcitabine, dFdC), are effective cancer chemotherapeutic agents due to their ability to become incorporated into DNA and then subsequently inhibit DNA synthesis by replicative DNA polymerases. However, the impact of these 3'-modified nucleotides on the activity of specialized DNA polymerases has not been investigated. The role of polymerase beta and base excision repair may be of particular importance due to the increased oxidative stress in tumors, increased oxidative stress caused by chemotherapy treatment, and the variable amounts of polymerase beta in tumors. Here we directly investigate the incorporation of the 5'-triphosphorylated form of araC, dFdC, 2'-fluoro-2'-deoxycytidine (FdC), and cytidine into two nicked DNA substrates and the subsequent ligation. Opposite template dG, the relative k(pol)/K(d) for incorporation was dCTP > araCTP, dFdCTP > rCTP. The relative k(pol)/K(d) for FdCTP depended on sequence. The effect on k(pol)/K(d) was due largely to changes in k(pol) with no differences in the affinity of the nucleoside triphosphates to the polymerase. Ligation efficiency by T4 ligase and ligase III/XRCC1 was largely unaffected by the nucleotide analogues. Our results show that BER is capable of incorporating araC and dFdC into the genome.

  14. Mutations Affecting Potassium Import Restore the Viability of the Escherichia coli DNA Polymerase III holD Mutant

    PubMed Central

    Durand, Adeline

    2016-01-01

    Mutants lacking the ψ (HolD) subunit of the Escherichia coli DNA Polymerase III holoenzyme (Pol III HE) have poor viability, but a residual growth allows the isolation of spontaneous suppressor mutations that restore ΔholD mutant viability. Here we describe the isolation and characterization of two suppressor mutations in the trkA and trkE genes, involved in the main E. coli potassium import system. Viability of ΔholD trk mutants is abolished on media with low or high K+ concentrations, where alternative K+ import systems are activated, and is restored on low K+ concentrations by the inactivation of the alternative Kdp system. These findings show that the ΔholD mutant is rescued by a decrease in K+ import. The effect of trk inactivation is additive with the previously identified ΔholD suppressor mutation lexAind that blocks the SOS response indicating an SOS-independent mechanism of suppression. Accordingly, although lagging-strand synthesis is still perturbed in holD trkA mutants, the trkA mutation allows HolD-less Pol III HE to resist increased levels of the SOS-induced bypass polymerase DinB. trk inactivation is also partially additive with an ssb gene duplication, proposed to stabilize HolD-less Pol III HE by a modification of the single-stranded DNA binding protein (SSB) binding mode. We propose that lowering the intracellular K+ concentration stabilizes HolD-less Pol III HE on DNA by increasing electrostatic interactions between Pol III HE subunits, or between Pol III and DNA, directly or through a modification of the SSB binding mode; these three modes of action are not exclusive and could be additive. To our knowledge, the holD mutant provides the first example of an essential protein-DNA interaction that strongly depends on K+ import in vivo. PMID:27280472

  15. Kinetics and Fidelity of Polymerization by DNA Polymerase III from Sulfolobus solfataricus

    PubMed Central

    Bauer, Robert J.; Begley, Michael T.; Trakselis, Michael A.

    2013-01-01

    We have biochemically and kinetically characterized the polymerase and exonuclease activities of the third B-family polymerase (Dpo3) from the hyperthermophilic Crenarchaeon, Sulfolobus solfataricus (Sso). We have established through mutagenesis that despite incomplete sequence conservation; the polymerase and exonuclease active sites are functionally conserved in Dpo3. Using presteady-state kinetics, we can measure the fidelity of nucleotide incorporation by Dpo3 from the polymerase active site alone to be 103 to 104 at 37 °C. The functional exonuclease proofreading active site will increase fidelity by at least 102 making Dpo3 comparable to other DNA polymerases in this family. Additionally, Dpo3’s exonuclease activity is modulated by temperature, where a loss in promiscuous degradation activity can be attributed to a reorganization of the exonuclease domain when bound to primer template DNA at high temperatures. Unexpectedly, the DNA binding affinity is weak compared with other DNA polymerases of this family. A comparison of the fidelities, polymerization kinetics, and associated functional exonuclease domain with those previously reported for other Sso polymerases (Dpo1 and Dpo4) illustrates that Dpo3 is a potential player in the proper maintenance of the archaeal genome. PMID:22339170

  16. Relevance of GC content to the conservation of DNA polymerase III/mismatch repair system in Gram-positive bacteria

    PubMed Central

    Akashi, Motohiro; Yoshikawa, Hirofumi

    2013-01-01

    The mechanism of DNA replication is one of the driving forces of genome evolution. Bacterial DNA polymerase III, the primary complex of DNA replication, consists of PolC and DnaE. PolC is conserved in Gram-positive bacteria, especially in the Firmicutes with low GC content, whereas DnaE is widely conserved in most Gram-negative and Gram-positive bacteria. PolC contains two domains, the 3′-5′exonuclease domain and the polymerase domain, while DnaE only possesses the polymerase domain. Accordingly, DnaE does not have the proofreading function; in Escherichia coli, another enzyme DnaQ performs this function. In most bacteria, the fidelity of DNA replication is maintained by 3′-5′ exonuclease and a mismatch repair (MMR) system. However, we found that most Actinobacteria (a group of Gram-positive bacteria with high GC content) appear to have lost the MMR system and chromosomes may be replicated by DnaE-type DNA polymerase III with DnaQ-like 3′-5′ exonuclease. We tested the mutation bias of Bacillus subtilis, which belongs to the Firmicutes and found that the wild type strain is AT-biased while the mutS-deletant strain is remarkably GC-biased. If we presume that DnaE tends to make mistakes that increase GC content, these results can be explained by the mutS deletion (i.e., deletion of the MMR system). Thus, we propose that GC content is regulated by DNA polymerase and MMR system, and the absence of polC genes, which participate in the MMR system, may be the reason for the increase of GC content in Gram-positive bacteria such as Actinobacteria. PMID:24062730

  17. Specific Detection of Campylobacter Jejuni and Campylobacter Coli by Using Polymerase Chain Reaction

    DTIC Science & Technology

    1992-10-01

    polymerase descriptions and proposal of Arcobacter gen. nov. Int. J. Syst. chain reaction for the detection of Mycobacterium leprae . 1. Bacteriol. 41:451-455...with Campylobacter spp. Infect. Immun. 59:2259-2264. detection of Mycobacterium tuberculosis in clinical specimens 29. Rashtchian, A. 1985. Detection

  18. RIG-I-dependent sensing of poly(dA:dT) through the induction of an RNA polymerase III-transcribed RNA intermediate.

    PubMed

    Ablasser, Andrea; Bauernfeind, Franz; Hartmann, Gunther; Latz, Eicke; Fitzgerald, Katherine A; Hornung, Veit

    2009-10-01

    RNA is sensed by Toll-like receptor 7 (TLR7) and TLR8 or by the RNA helicases LGP2, Mda5 and RIG-I to trigger antiviral responses. Much less is known about sensors for DNA. Here we identify a novel DNA-sensing pathway involving RNA polymerase III and RIG-I. In this pathway, AT-rich double-stranded DNA (dsDNA) served as a template for RNA polymerase III and was transcribed into double-stranded RNA (dsRNA) containing a 5'-triphosphate moiety. Activation of RIG-I by this dsRNA induced production of type I interferon and activation of the transcription factor NF-kappaB. This pathway was important in the sensing of Epstein-Barr virus-encoded small RNAs, which were transcribed by RNA polymerase III and then triggered RIG-I activation. Thus, RNA polymerase III and RIG-I are pivotal in sensing viral DNA.

  19. Escherichia coli DNA polymerase III is responsible for the high level of spontaneous mutations in mutT strains

    PubMed Central

    Yamada, Masami; Shimizu, Masatomi; Katafuchi, Atsushi; Grúz, Petr; Fujii, Shingo; Usui, Yukio; Fuchs, Robert P; Nohmi, Takehiko

    2012-01-01

    Reactive oxygen species induce oxidative damage in DNA precursors, i.e. dNTPs, leading to point mutations upon incorporation. Escherichia coli mutT strains, deficient in the activity hydrolysing 8-oxo-7,8-dihydro-2′-deoxyguanosine 5′-triphosphate (8-oxo-dGTP), display more than a 100-fold higher spontaneous mutation frequency over the wild-type strain. 8-oxo-dGTP induces A to C transversions when misincorporated opposite template A. Here, we report that DNA pol III incorporates 8-oxo-dGTP ≍ 20 times more efficiently opposite template A compared with template C. Single, double or triple deletions of pol I, pol II, pol IV or pol V had modest effects on the mutT mutator phenotype. Only the deletion of all four polymerases led to a 70% reduction of the mutator phenotype. While pol III may account for nearly all 8-oxo-dGTP incorporation opposite template A, it only extends ≍ 30% of them, the remaining 70% being extended by the combined action of pol I, pol II, pol IV or pol V. The unique property of pol III, a C-family DNA polymerase present only in eubacteria, to preferentially incorporate 8-oxo-dGTP opposite template A during replication might explain the high spontaneous mutation frequency in E. coli mutT compared with the mammalian counterparts lacking the 8-oxo-dGTP hydrolysing activities. PMID:23043439

  20. The dnaN gene codes for the beta subunit of DNA polymerase III holoenzyme of escherichia coli.

    PubMed

    Burgers, P M; Kornberg, A; Sakakibara, Y

    1981-09-01

    An Escherichia coli mutant, dnaN59, stops DNA synthesis promptly upon a shift to a high temperature; the wild-type dnaN gene carried in a transducing phage encodes a polypeptide of about 41,000 daltons [Sakakibara, Y. & Mizukami, T. (1980) Mol. Gen. Genet. 178, 541-553; Yuasa, S. & Sakakibara, Y. (1980) Mol. Gen. Genet. 180, 267-273]. We now find that the product of dnaN gene is the beta subunit of DNA polymerase III holoenzyme, the principal DNA synthetic multipolypeptide complex in E. coli. The conclusion is based on the following observations: (i) Extracts from dnaN59 cells were defective in phage phi X174 and G4 DNA synthesis after the mutant cells had been exposed to the increased temperature. (ii) The enzymatic defect was overcome by addition of purified beta subunit but not by other subunits of DNA polymerase III holoenzyme or by other replication proteins required for phi X174 DNA synthesis. (iii) Partially purified beta subunit from the dnaN mutant, unlike that from the wild type, was inactive in reconstituting the holoenzyme when mixed with the other purified subunits. (iv) Increased dosage of the dnaN gene provided by a plasmid carrying the gene raised cellular levels of the beta subunit 5- to 6-fold.

  1. The dnaN gene codes for the beta subunit of DNA polymerase III holoenzyme of escherichia coli.

    PubMed Central

    Burgers, P M; Kornberg, A; Sakakibara, Y

    1981-01-01

    An Escherichia coli mutant, dnaN59, stops DNA synthesis promptly upon a shift to a high temperature; the wild-type dnaN gene carried in a transducing phage encodes a polypeptide of about 41,000 daltons [Sakakibara, Y. & Mizukami, T. (1980) Mol. Gen. Genet. 178, 541-553; Yuasa, S. & Sakakibara, Y. (1980) Mol. Gen. Genet. 180, 267-273]. We now find that the product of dnaN gene is the beta subunit of DNA polymerase III holoenzyme, the principal DNA synthetic multipolypeptide complex in E. coli. The conclusion is based on the following observations: (i) Extracts from dnaN59 cells were defective in phage phi X174 and G4 DNA synthesis after the mutant cells had been exposed to the increased temperature. (ii) The enzymatic defect was overcome by addition of purified beta subunit but not by other subunits of DNA polymerase III holoenzyme or by other replication proteins required for phi X174 DNA synthesis. (iii) Partially purified beta subunit from the dnaN mutant, unlike that from the wild type, was inactive in reconstituting the holoenzyme when mixed with the other purified subunits. (iv) Increased dosage of the dnaN gene provided by a plasmid carrying the gene raised cellular levels of the beta subunit 5- to 6-fold. PMID:6458041

  2. Decoding the principles underlying the frequency of association with nucleoli for RNA polymerase III-transcribed genes in budding yeast.

    PubMed

    Belagal, Praveen; Normand, Christophe; Shukla, Ashutosh; Wang, Renjie; Léger-Silvestre, Isabelle; Dez, Christophe; Bhargava, Purnima; Gadal, Olivier

    2016-10-15

    The association of RNA polymerase III (Pol III)-transcribed genes with nucleoli seems to be an evolutionarily conserved property of the spatial organization of eukaryotic genomes. However, recent studies of global chromosome architecture in budding yeast have challenged this view. We used live-cell imaging to determine the intranuclear positions of 13 Pol III-transcribed genes. The frequency of association with nucleolus and nuclear periphery depends on linear genomic distance from the tethering elements-centromeres or telomeres. Releasing the hold of the tethering elements by inactivating centromere attachment to the spindle pole body or changing the position of ribosomal DNA arrays resulted in the association of Pol III-transcribed genes with nucleoli. Conversely, ectopic insertion of a Pol III-transcribed gene in the vicinity of a centromere prevented its association with nucleolus. Pol III-dependent transcription was independent of the intranuclear position of the gene, but the nucleolar recruitment of Pol III-transcribed genes required active transcription. We conclude that the association of Pol III-transcribed genes with the nucleolus, when permitted by global chromosome architecture, provides nucleolar and/or nuclear peripheral anchoring points contributing locally to intranuclear chromosome organization. © 2016 Belagal et al. This article is distributed by The American Society for Cell Biology under license from the author(s). Two months after publication it is available to the public under an Attribution–Noncommercial–Share Alike 3.0 Unported Creative Commons License (http://creativecommons.org/licenses/by-nc-sa/3.0).

  3. Active Center Control of Termination by RNA Polymerase III and tRNA Gene Transcription Levels In Vivo

    PubMed Central

    Rijal, Keshab; Maraia, Richard J.

    2016-01-01

    The ability of RNA polymerase (RNAP) III to efficiently recycle from termination to reinitiation is critical for abundant tRNA production during cellular proliferation, development and cancer. Yet understanding of the unique termination mechanisms used by RNAP III is incomplete, as is its link to high transcription output. We used two tRNA-mediated suppression systems to screen for Rpc1 mutants with gain- and loss- of termination phenotypes in S. pombe. 122 point mutation mutants were mapped to a recently solved 3.9 Å structure of yeast RNAP III elongation complex (EC); they cluster in the active center bridge helix and trigger loop, as well as the pore and funnel, the latter of which indicate involvement of the RNA cleavage domain of the C11 subunit in termination. Purified RNAP III from a readthrough (RT) mutant exhibits increased elongation rate. The data strongly support a kinetic coupling model in which elongation rate is inversely related to termination efficiency. The mutants exhibit good correlations of terminator RT in vitro and in vivo, and surprisingly, amounts of transcription in vivo. Because assessing in vivo transcription can be confounded by various parameters, we used a tRNA reporter with a processing defect and a strong terminator. By ruling out differences in RNA decay rates, the data indicate that mutants with the RT phenotype synthesize more RNA than wild type cells, and than can be accounted for by their increased elongation rate. Finally, increased activity by the mutants appears unrelated to the RNAP III repressor, Maf1. The results show that the mobile elements of the RNAP III active center, including C11, are key determinants of termination, and that some of the mutations activate RNAP III for overall transcription. Similar mutations in spontaneous cancer suggest this as an unforeseen mechanism of RNAP III activation in disease. PMID:27518095

  4. An Rpb4/Rpb7-like complex in yeast RNA polymerase III contains the orthologue of mammalian CGRP-RCP.

    PubMed

    Siaut, Magali; Zaros, Cécile; Levivier, Emilie; Ferri, Maria-Laura; Court, Magali; Werner, Michel; Callebaut, Isabelle; Thuriaux, Pierre; Sentenac, André; Conesa, Christine

    2003-01-01

    The essential C17 subunit of yeast RNA polymerase (Pol) III interacts with Brf1, a component of TFIIIB, suggesting a role for C17 in the initiation step of transcription. The protein sequence of C17 (encoded by RPC17) is conserved from yeasts to humans. However, mammalian homologues of C17 (named CGRP-RCP) are known to be involved in a signal transduction pathway related to G protein-coupled receptors, not in transcription. In the present work, we first establish that human CGRP-RCP is the genuine orthologue of C17. CGRP-RCP was found to functionally replace C17 in Deltarpc17 yeast cells; the purified mutant Pol III contained CGRP-RCP and had a decreased specific activity but initiated faithfully. Furthermore, CGRP-RCP was identified by mass spectrometry in a highly purified human Pol III preparation. These results suggest that CGRP-RCP has a dual function in mammals. Next, we demonstrate by genetic and biochemical approaches that C17 forms with C25 (encoded by RPC25) a heterodimer akin to Rpb4/Rpb7 in Pol II. C17 and C25 were found to interact genetically in suppression screens and physically in coimmunopurification and two-hybrid experiments. Sequence analysis and molecular modeling indicated that the C17/C25 heterodimer likely adopts a structure similar to that of the archaeal RpoE/RpoF counterpart of the Rpb4/Rpb7 complex. These RNA polymerase subunits appear to have evolved to meet the distinct requirements of the multiple forms of RNA polymerases.

  5. High-resolution RNA allelotyping along the inactive X chromosome: evidence of RNA polymerase III in regulating chromatin configuration

    PubMed Central

    Hong, Ru; Lin, Bingqing; Lu, Xinyi; Lai, Lan-Tian; Chen, Xin; Sanyal, Amartya; Ng, Huck-Hui; Zhang, Kun; Zhang, Li-Feng

    2017-01-01

    We carried out padlock capture, a high-resolution RNA allelotyping method, to study X chromosome inactivation (XCI). We examined the gene reactivation pattern along the inactive X (Xi), after Xist (X-inactive specific transcript), a prototype long non-coding RNA essential for establishing X chromosome inactivation (XCI) in early embryos, is conditionally deleted from Xi in somatic cells (Xi∆Xist). We also monitored the behaviors of X-linked non-coding transcripts before and after XCI. In each mutant cell line, gene reactivation occurs to ~6% genes along Xi∆Xist in a recognizable pattern. Genes with upstream regions enriched for SINEs are prone to be reactivated. SINE is a class of retrotransposon transcribed by RNA polymerase III (Pol III). Intriguingly, a significant fraction of Pol III transcription from non-coding regions is not subjected to Xist-mediated transcriptional silencing. Pol III inhibition affects gene reactivation status along Xi∆Xist, alters chromatin configuration and interferes with the establishment XCI during in vitro differentiation of ES cells. These results suggest that Pol III transcription is involved in chromatin structure re-organization during the onset of XCI and functions as a general mechanism regulating chromatin configuration in mammalian cells. PMID:28368037

  6. High-resolution RNA allelotyping along the inactive X chromosome: evidence of RNA polymerase III in regulating chromatin configuration.

    PubMed

    Hong, Ru; Lin, Bingqing; Lu, Xinyi; Lai, Lan-Tian; Chen, Xin; Sanyal, Amartya; Ng, Huck-Hui; Zhang, Kun; Zhang, Li-Feng

    2017-04-03

    We carried out padlock capture, a high-resolution RNA allelotyping method, to study X chromosome inactivation (XCI). We examined the gene reactivation pattern along the inactive X (Xi), after Xist (X-inactive specific transcript), a prototype long non-coding RNA essential for establishing X chromosome inactivation (XCI) in early embryos, is conditionally deleted from Xi in somatic cells (Xi(∆Xist)). We also monitored the behaviors of X-linked non-coding transcripts before and after XCI. In each mutant cell line, gene reactivation occurs to ~6% genes along Xi(∆Xist) in a recognizable pattern. Genes with upstream regions enriched for SINEs are prone to be reactivated. SINE is a class of retrotransposon transcribed by RNA polymerase III (Pol III). Intriguingly, a significant fraction of Pol III transcription from non-coding regions is not subjected to Xist-mediated transcriptional silencing. Pol III inhibition affects gene reactivation status along Xi(∆Xist), alters chromatin configuration and interferes with the establishment XCI during in vitro differentiation of ES cells. These results suggest that Pol III transcription is involved in chromatin structure re-organization during the onset of XCI and functions as a general mechanism regulating chromatin configuration in mammalian cells.

  7. RNA polymerase III mutants in TFIIFα-like C37 that cause terminator readthrough with no decrease in transcription output

    PubMed Central

    Rijal, Keshab; Maraia, Richard J.

    2013-01-01

    How eukaryotic RNA polymerases switch from elongation to termination is unknown. Pol III subunits Rpc53 and Rpc37 (C53/37) form a heterodimer homologous to TFIIFβ/α. C53/37 promotes efficient termination and together with C11 also mediates pol III recycling in vitro. We previously developed Schizosaccharomyces pombe strains that report on two pol III termination activities: RNA oligo(U) 3′-end cleavage, and terminator readthrough. We randomly mutagenized C53 and C37 and isolated many C37 mutants with terminator readthrough but no comparable C53 mutants. The majority of C37 mutants have strong phenotypes with up to 40% readthrough and map to a C-terminal tract previously localized near Rpc2p in the pol III active center while a minority represent a distinct class with weaker phenotype, less readthrough and 3′-oligo(U) lengthening. Nascent pre-tRNAs released from a terminator by C37 mutants have shorter 3′-oligo(U) tracts than in cleavage-deficient C11 double mutants indicating RNA 3′-end cleavage during termination. We asked whether termination deficiency affects transcription output in the mutants in vivo both by monitoring intron-containing nascent transcript levels and 14C-uridine incorporation. Surprisingly, multiple termination mutants have no decrease in transcript output relative to controls. These data are discussed in context of current models of pol III transcription. PMID:23093604

  8. Single Multiplex Polymerase Chain Reaction To Detect Diverse Loci Associated with Diarrheagenic Escherichia coli

    PubMed Central

    López-Saucedo, Catalina; Cerna, Jorge F.; Villegas-Sepulveda, Nicolas; Thompson, Rocío; Velazquez, F. Raul; Torres, Javier; Tarr, Phillip I.

    2003-01-01

    We developed and tested a single multiplex polymerase chain reaction (PCR) that detects enterotoxigenic, enteropathogenic, enteroinvasive, and Shiga-toxin–producing Escherichia coli. This PCR is specific, sensitive, and rapid in detecting target isolates in stool and food. Because of its simplicity, economy, and efficiency, this protocol warrants further evaluation in large, prospective studies of polymicrobial substances. PMID:12533296

  9. Development of a rapid recombinase polymerase amplification assay for detection of Brucella in blood samples.

    PubMed

    Ren, Hang; Yang, Mingjuan; Zhang, Guoxia; Liu, Shiwei; Wang, Xinhui; Ke, Yuehua; Du, Xinying; Wang, Zhoujia; Huang, Liuyu; Liu, Chao; Chen, Zeliang

    2016-04-01

    A rapid and sensitive recombinase polymerase amplification (RPA) assay, Bruce-RPA, was developed for detection of Brucella. The assay could detect as few as 3 copies of Brucella per reaction within 20 min. Bruce-RPA represents a candidate point-of-care diagnosis assay for human brucellosis.

  10. Possible interaction between the bacterial transcription factor ArtA and the eukaryotic RNA polymerase III promoter.

    PubMed

    Matsutani, Sachiko

    2016-06-01

    Eukaryotic RNA polymerase III (RNAP III) transcribes tRNA genes and short interspersed elements that have internal promoters consisting of A- and B-blocks. The B-block binding subunit of the transcription initiation factor TFIIIC binds to the B-block. The mobile bacterial insertion sequence (IS) 1 contains a RNAP III promoter-like sequence, which stimulates bacterial transcription along with the bacterial ArtA protein. Here, the DNA-binding ability of ArtA was examined in vitro using a simple, newly developed method. Various DNA fragments, including RNAP III promoter fragments, were separately incubated with purified ArtA, and then loaded onto a polyacrylamide gel. Since DNAs bound by ArtA remain in the gel wells during electrophoresis, SDS was added into the wells at the electrophoresis halfway point. It was hypothesized that SDS would dissociate the DNA-ArtA complexes in the wells, and then the DNAs would begin to migrate. In fact, new bands appeared in all of the lanes at similar intensities, indicating that ArtA binds nonspecifically to DNA. Therefore, labeled wild-type RNAP III promoter fragments were incubated with either the unlabeled wild-type or mutant fragments and ArtA, and electrophoresed. The B-block(-like) sequences of IS1, a human Alu element, and an anuran tRNA gene were important for binding to ArtA. Additionally, in silico analyses revealed the presence of the RNAP III promoter-like structures in the IS1 isoforms and the IS3 family elements. These results suggest the presence of parts of the RNAP III transcription machinery in bacteria, and might imply that its prototype existed in the common ancestor.

  11. Sub1 and Maf1, two effectors of RNA polymerase III, are involved in the yeast quiescence cycle.

    PubMed

    Acker, Joël; Nguyen, Ngoc-Thuy-Trinh; Vandamme, Marie; Tavenet, Arounie; Briand-Suleau, Audrey; Conesa, Christine

    2014-01-01

    Sub1 and Maf1 exert an opposite effect on RNA polymerase III transcription interfering with different steps of the transcription cycle. In this study, we present evidence that Sub1 and Maf1 also exhibit an opposite role on yeast chronological life span. First, cells lacking Sub1 need more time than wild type to exit from resting and this lag in re-proliferation is correlated with a delay in transcriptional reactivation. Second, our data show that the capacity of the cells to properly establish a quiescent state is impaired in the absence of Sub1 resulting in a premature death that is dependent on the Ras/PKA and Tor1/Sch9 signalling pathways. On the other hand, we show that maf1Δ cells are long-lived mutant suggesting a connection between Pol III transcription and yeast longevity.

  12. Sub1 and Maf1, Two Effectors of RNA Polymerase III, Are Involved in the Yeast Quiescence Cycle

    PubMed Central

    Acker, Joël; Nguyen, Ngoc-Thuy-Trinh; Vandamme, Marie; Tavenet, Arounie; Briand-Suleau, Audrey; Conesa, Christine

    2014-01-01

    Sub1 and Maf1 exert an opposite effect on RNA polymerase III transcription interfering with different steps of the transcription cycle. In this study, we present evidence that Sub1 and Maf1 also exhibit an opposite role on yeast chronological life span. First, cells lacking Sub1 need more time than wild type to exit from resting and this lag in re-proliferation is correlated with a delay in transcriptional reactivation. Second, our data show that the capacity of the cells to properly establish a quiescent state is impaired in the absence of Sub1 resulting in a premature death that is dependent on the Ras/PKA and Tor1/Sch9 signalling pathways. On the other hand, we show that maf1Δ cells are long-lived mutant suggesting a connection between Pol III transcription and yeast longevity. PMID:25531541

  13. Highly Sensitive and Reliable Detection of EGFR Exon 19 Deletions by Droplet Digital Polymerase Chain Reaction.

    PubMed

    Oskina, Natalya; Oscorbin, Igor; Khrapov, Evgeniy; Boyarskikh, Ulyana; Subbotin, Dmitriy; Demidova, Irina; Imyanitov, Evgeny; Filipenko, Maxim

    2017-06-06

    Analysis of EGFR mutations is becoming a routine clinical practice but the optimal EGFR mutation testing method is still to be determined. We determined the nucleotide sequence of deletions located in exon 19 of the EGFR gene in lung tumor samples of patients residing in different regions of Russia (153 tumor DNA specimens), using Sanger sequencing. We developed a droplet digital polymerase chain reaction assay capable of detecting all common EGFR deletions in exon 19. We also compared the therascreen amplification refractory mutation system assay with a droplet digital polymerase chain reaction assay for the detection of all the deletions in our study. The droplet digital polymerase chain reaction assay demonstrated 100% sensitivity against polymerase chain reaction fragment length analysis and detected all possible types of deletions revealed in our study (22 types). At the same time, the therascreen EGFR RGQ PCR Kit was not able to detect deletions c.2252-2276>A and c.2253-2276 and showed low performance for another long deletion. Thus, we can conclude that the extraordinary length of deletions and their atypical locations (shift at the 3'-region compared to known deletions) could be problematic for the therascreen EGFR RGQ PCR Kit and should be taken into account during targeted mutation test development. However, droplet digital polymerase chain reaction is a promising and reliable assay that can be used as a diagnostic tool to genotype formalin-fixed paraffin-embedded cancer samples for EGFR or another clinically relevant somatic mutation.

  14. Identification of an ortholog of the eukaryotic RNA polymerase III subunit RPC34 in Crenarchaeota and Thaumarchaeota suggests specialization of RNA polymerases for coding and non-coding RNAs in Archaea.

    PubMed

    Blombach, Fabian; Makarova, Kira S; Marrero, Jeannette; Siebers, Bettina; Koonin, Eugene V; van der Oost, John

    2009-10-14

    One of the hallmarks of eukaryotic information processing is the co-existence of 3 distinct, multi-subunit RNA polymerase complexes that are dedicated to the transcription of specific classes of coding or non-coding RNAs. Archaea encode only one RNA polymerase that resembles the eukaryotic RNA polymerase II with respect to the subunit composition. Here we identify archaeal orthologs of the eukaryotic RNA polymerase III subunit RPC34. Genome context analysis supports a function of this archaeal protein in the transcription of non-coding RNAs. These findings suggest that functional separation of RNA polymerases for protein-coding genes and non-coding RNAs might predate the origin of the Eukaryotes.

  15. Identification of an ortholog of the eukaryotic RNA polymerase III subunit RPC34 in Crenarchaeota and Thaumarchaeota suggests specialization of RNA polymerases for coding and non-coding RNAs in Archaea

    PubMed Central

    Blombach, Fabian; Makarova, Kira S; Marrero, Jeannette; Siebers, Bettina; Koonin, Eugene V; Oost, John van der

    2009-01-01

    One of the hallmarks of eukaryotic information processing is the co-existence of 3 distinct, multi-subunit RNA polymerase complexes that are dedicated to the transcription of specific classes of coding or non-coding RNAs. Archaea encode only one RNA polymerase that resembles the eukaryotic RNA polymerase II with respect to the subunit composition. Here we identify archaeal orthologs of the eukaryotic RNA polymerase III subunit RPC34. Genome context analysis supports a function of this archaeal protein in the transcription of non-coding RNAs. These findings suggest that functional separation of RNA polymerases for protein-coding genes and non-coding RNAs might predate the origin of the Eukaryotes. Reviewers: This article was reviewed by Andrei Osterman and Patrick Forterre (nominated by Purificación López-García) PMID:19828044

  16. The hepatitis B virus X protein increases the cellular level of TATA-binding protein, which mediates transactivation of RNA polymerase III genes

    SciTech Connect

    Wang, Horng-Dar; Johnson, D.L.; Yuh, Chio-Hwa

    1995-12-01

    This report decribes the mechanism by which the hepatitis B virus X gene product induces RNA polymerase III genes. The RNA pol III transcription system serves as model for understanding the mechanism of X in the transactivation of cellular genes in both Drosophila and rat cell lines. 53 refs., 7 figs., 1 tab.

  17. Detection of biological warfare agents using the polymerase chain reaction. Final report, June-August 1991

    SciTech Connect

    Mann, B.J.

    1992-09-01

    The detection of biological warfare agents is an important mission for the U.S. Army. This report explores the feasibility of using the polymerase chain reaction as a means of rapid detection of biological warfare agents. Two levels of detection are proposed. The first level is group specific detection, using primers derived from 16S rDNA sequences, to detect various groups of pathogenic bacteria. The second level is species-specific detection using primers derived from DNA sequences, unique to each pathogenic organism targeted for detection. Specific examples of Vibrio cholerae, Francisella tularensis, Yersinia pestis, Staphylococcus aureus, and Bacillus anthracis are described.

  18. The 3'-5' exonuclease site of DNA polymerase III from gram-positive bacteria: definition of a novel motif structure.

    PubMed

    Barnes, M H; Spacciapoli, P; Li, D H; Brown, N C

    1995-11-07

    The primary structure of the 3'-5' exonuclease (Exo) site of the Gram+ bacterial DNA polymerase III (Pol III) was examined by site-directed mutagenesis of Bacillus subtilis Pol III (BsPol III). It was found to differ significantly from the conventional three-motif substructure established for the Exo site of DNA polymerase I of Escherichia coli (EcPol I) and the majority of other DNA polymerase-exonucleases. Motifs I and II were conventionally organized and anchored functionally by the predicted carboxylate residues. However, the conventional downstream motif, motif III, was replaced by motif III epsilon, a novel 55-amino-acid (aa) segment incorporating three essential aa (His565, Asp533 and Asp570) which are strictly conserved in three Gram+ Pol III and in the Ec Exo epsilon (epsilon). Despite its unique substructure, the Gram+ Pol III-specific Exo site was conventionally independent of Pol, the site of 2'-deoxyribonucleoside 5-triphosphate (dNTP) binding and polymerization. The entire Exo site, including motif III epsilon, could be deleted without profoundly affecting the enzyme's capacity to polymerize dNTPs. Conversely, Pol and all other sequences downstream of the Exo site could be deleted with little apparent effect on Exo activity. Whether the three essential aa within the unique motif III epsilon substructure participate in the conventional two-metal-ion mechanism elucidated for the model Exo site of EcPol I, remains to be established.

  19. Direct detection of hepatitis B virus from dried blood spots by polymerase chain reaction amplification.

    PubMed Central

    Gupta, B P; Jayasuryan, N; Jameel, S

    1992-01-01

    The presence of hepatitis B virus DNA in the sera of individuals is the most definitive marker of an active viral infection. We have used polymerase chain reaction detection of hepatitis B virus DNA directly on whole blood dried as a spot on filter paper. The method is rapid, specific, and sensitive and has the ability to detect as little as 10 virus particles by ethidium bromide staining of the polymerase chain reaction-amplified products. The method is cost-effective, and the stability of the spots makes the collection and transportation of potentially infectious blood safe. Images PMID:1500493

  20. Effects of mutations in the Exo III motif of the herpes simplex virus DNA polymerase gene on enzyme activities, viral replication, and replication fidelity.

    PubMed Central

    Hwang, Y T; Liu, B Y; Coen, D M; Hwang, C B

    1997-01-01

    The herpes simplex virus DNA polymerase catalytic subunit, which has intrinsic polymerase and 3'-5' exonuclease activities, contains sequence motifs that are homologous to those important for 3'-5' exonuclease activity in other polymerases. The role of one such motif, Exo III, was examined in this study. Mutated polymerases containing either a single tyrosine-to-histidine change at residue 577 or this change plus an aspartic acid-to-alanine at residue 581 in the Exo III motif exhibited defective or undetectable exonuclease activity, respectively, yet retained substantial polymerase activity. Despite the defects in exonuclease activity, the mutant polymerases were able to support viral replication in transient complementation assays, albeit inefficiently. Viruses replicated via the action of these mutant polymerases exhibited substantially increased frequencies of mutants resistant to ganciclovir. Furthermore, when the Exo III mutations were incorporated into the viral genome, the resulting mutant viruses displayed only modestly defect in replication in Vero cells and exhibited substantially increased mutation frequencies. The results suggest that herpes simplex virus can replicate despite severely impaired exonuclease activity and that the 3'-5' exonuclease contributes substantially to the fidelity of viral DNA replication. PMID:9311864

  1. B2 RNA and 7SK RNA, RNA polymerase III transcripts, have a cap-like structure at their 5' end.

    PubMed Central

    Shumyatsky, G P; Tillib, S V; Kramerov, D A

    1990-01-01

    We found that hydrolysates of poly(A)+ RNA from Ehrlich ascites carcinoma cells which were transcribed by RNA polymerase III contained an unusual component designated as X. It was part of B2 RNA representing a transcript of B2 retroposon, typical of rodents. The component X possesses a cap-like structure, xppp5'G, where x has a non-nucleotide structure. About half of all B2 RNAs contained this group at the 5' end. Previously, Epstein et al. (1) detected a similar structure at the 5' end of small nuclear U6 RNA. Later, Singh and Reddy (2) showed methyl to be the blocking group in the component x of U6 RNA. Besides B2 RNA, we found 5' ends containing methyl groups in 7SK RNA. Images PMID:1700854

  2. Association Between Germline Mutations in BRF1, a subunit of the RNA Polymerase III Transcription Complex, and Hereditary Colorectal Cancer.

    PubMed

    Bellido, Fernando; Sowada, Nadine; Mur, Pilar; Lázaro, Conxi; Pons, Tirso; Valdés-Mas, Rafael; Pineda, Marta; Aiza, Gemma; Iglesias, Silvia; Soto, José Luís; Urioste, Miguel; Caldés, Trinidad; Balbín, Milagros; Blay, Pilar; Rueda, Daniel; Durán, Mercedes; Valencia, Alfonso; Moreno, Victor; Brunet, Joan; Blanco, Ignacio; Navarro, Matilde; Calin, George A; Borck, Guntram; Puente, Xose S; Capellá, Gabriel; Valle, Laura

    2017-09-11

    Although there is a genetic predisposition to colorectal cancer (CRC), few of the genes that affect risk have been identified. We performed whole-exome sequence analysis of individuals in a high-risk family without mutations in genes previously associated with CRC risk to identify variants associated with inherited CRC. We collected blood samples from 3 relatives with CRC in Spain (65, 62 and 40 years old at diagnosis) and perfomed whole-exome sequence analyses. Rare missense, truncating or splice-site variants shared by the 3 relatives were selected. We used targeted pooled DNA amplification followed by next-generation sequencing to screen for mutations in candidate genes in 547 additional hereditary and/or early-onset CRC cases. We carried out protein-dependent yeast-growth assays and transfection studies in the HT29 human CRC cell line to test the effects of the identified variants. A total of 42 unique or rare (population minor allele frequency below 1%) non-synonymous genetic variants in 38 genes were shared by all 3 relatives. We selected the BRF1 gene, which encodes an RNA polymerase III transcription initiation factor subunit for further analysis, based on the predicted effect of the identified variant and previous association of BRF1 with cancer. Previously unreported or rare germline variants in BRF1 were identified in 11/503 individuals in families with a history of CRC or early-onset CRC,- a significantly greater proportion than in control population (34/4,300). Seven of the identified variants (1 detected in 2 families) affected BRF1 mRNA splicing, protein stability or expression and/or function. In an analysis of families with a history of CRC, we associated germline mutations in BRF1 with predisposition to CRC. We associated deleterious BRF1 variants with 1.4% of familial CRC cases, in individuals without mutations in high-penetrance genes previously associated with CRC. Our findings add additional evidence to the link between defects in genes that

  3. Multiwavelength detectability of Pop III GRBs from afterglow simulations

    NASA Astrophysics Data System (ADS)

    Macpherson, D.; Coward, D.

    2017-05-01

    Afterglows of gamma-ray bursts (GRBs) from Population III (Pop III) stars could reveal the formation history and properties of these first generation stars. Through detailed simulation, we predict the prospects of detecting these afterglows with a range of established, existing and upcoming telescopes across the spectrum from radio waves to X-rays. The simulations show that the afterglow light curves of Pop III GRBs at high redshift (≳8) are very similar to those of Pop I/II GRBs at lower redshift (˜2), with the distinction that Lyα absorption at Pop III redshifts removes any optical [and some near-infrared (NIR)] component. We calculate that within a single field of view (FOV) of the Australian Square Kilometre Array Pathfinder (ASKAP) telescope there will be on average four detectable Pop III GRB afterglows. This is the product of ASKAP's large FOV and excellent sensitivity at wavelengths where the afterglows are very long-lasting. We show that the exceptional sensitivity of the James Webb Space Telescope (JWST) Near-InfraRed Camera will make this the optimal instrument for afterglow follow-up and redshift measurement, while JWST Near-InfraRed Spectrograph will be able to detect the absorption features of Pop III-enriched environments in 70 per cent of directed Pop III GRB afterglows. We also find that the Atacama Large Millimetre Array is very poorly suited to observe these afterglows, and that the Spectrum-Roentgen-Gamma 4 yr all-sky X-ray survey has a 12 per cent chance of detecting an orphan Pop III GRB afterglow. The optimal strategy for detecting, identifying and studying Pop III GRB afterglows is to have JWST attempt NIR photometry of afterglows with a detected radio component but no detected optical component.

  4. Virus-induced gene silencing of the RPC5-like subunit of RNA polymerase III caused pleiotropic effects in Nicotiana benthamiana

    PubMed Central

    Nemchinov, Lev G.; Boutanaev, Alexander M.; Postnikova, Olga A.

    2016-01-01

    In eukaryotic cells, RNA polymerase III is highly conserved and transcribes housekeeping genes such as ribosomal 5S rRNA, tRNA and other small RNAs. The RPC5-like subunit is one of the 17 subunits forming RNAPIII and its exact functional roles in the transcription are poorly understood. In this work, we report that virus-induced gene silencing of transcripts encoding a putative RPC5-like subunit of the RNA Polymerase III in a model species Nicotiana benthamiana had pleiotropic effects, including but not limited to severe dwarfing appearance, chlorosis, nearly complete reduction of internodes and abnormal leaf shape. Using transcriptomic analysis, we identified genes and pathways affected by RPC5 silencing and thus presumably related to the cellular roles of the subunit as well as to the downstream cascade of reactions in response to partial loss of RNA Polymerase III function. Our results suggest that silencing of the RPC5L in N. benthamiana disrupted not only functions commonly associated with the core RNA Polymerase III transcripts, but also more diverse cellular processes, including responses to stress. We believe this is the first demonstration that activity of the RPC5 subunit is critical for proper functionality of RNA Polymerase III and normal plant development. PMID:27282827

  5. Real-time isothermal detection of Shiga toxin-producing Escherichia coli using recombinase polymerase amplification

    USDA-ARS?s Scientific Manuscript database

    Shiga toxin (Stx) producing E. coli (STEC) are a major family of foodborne pathogens of immense public health, zoonotic and economic significance in the US and worldwide. To date, there are no published reports on use of recombinase polymerase amplification (RPA) for STEC detection. The primary goal...

  6. Haemophilus ducreyi detection by polymerase chain reaction in oesophageal lesions of HIV patients.

    PubMed

    Borges, M C; Colares, J K B; Lima, D M; Fonseca, B A L

    2009-04-01

    HIV patients frequently have opportunistic oesophageal infections. We report Haemophilus ducreyi genetic material detected by polymerase chain reaction in biopsies of oesophageal lesions in three HIV-1-infected patients. This finding may be an indication of its aetiopathological role in oesophageal lesions of HIV patients.

  7. [Application of the polymerase chain reaction for detecting respiratory syncytial virus].

    PubMed

    Sarmiento, L; Chacón, D; Valdivia, A; Savón, C; Goyenechea, A

    1997-01-01

    The polymerase chain reaction (PCR) was developed in order to identify the respiratory syncytial virus by using the reference strain. The high sensitivity and specificity obtained show the PCR utility for detecting the RSV genoma and its application on the diagnosis.

  8. The RNA polymerase III-dependent family of genes in hemiascomycetes: comparative RNomics, decoding strategies, transcription and evolutionary implications

    PubMed Central

    Marck, Christian; Kachouri-Lafond, Rym; Lafontaine, Ingrid; Westhof, Eric; Dujon, Bernard; Grosjean, Henri

    2006-01-01

    We present the first comprehensive analysis of RNA polymerase III (Pol III) transcribed genes in ten yeast genomes. This set includes all tRNA genes (tDNA) and genes coding for SNR6 (U6), SNR52, SCR1 and RPR1 RNA in the nine hemiascomycetes Saccharomyces cerevisiae, Saccharomyces castellii, Candida glabrata, Kluyveromyces waltii, Kluyveromyces lactis, Eremothecium gossypii, Debaryomyces hansenii, Candida albicans, Yarrowia lipolytica and the archiascomycete Schizosaccharomyces pombe. We systematically analysed sequence specificities of tRNA genes, polymorphism, variability of introns, gene redundancy and gene clustering. Analysis of decoding strategies showed that yeasts close to S.cerevisiae use bacterial decoding rules to read the Leu CUN and Arg CGN codons, in contrast to all other known Eukaryotes. In D.hansenii and C.albicans, we identified a novel tDNA-Leu (AAG), reading the Leu CUU/CUC/CUA codons with an unusual G at position 32. A systematic ‘p-distance tree’ using the 60 variable positions of the tRNA molecule revealed that most tDNAs cluster into amino acid-specific sub-trees, suggesting that, within hemiascomycetes, orthologous tDNAs are more closely related than paralogs. We finally determined the bipartite A- and B-box sequences recognized by TFIIIC. These minimal sequences are nearly conserved throughout hemiascomycetes and were satisfactorily retrieved at appropriate locations in other Pol III genes. PMID:16600899

  9. Detection of enteric viruses in oysters by using the polymerase chain reaction.

    PubMed Central

    Atmar, R L; Metcalf, T G; Neill, F H; Estes, M K

    1993-01-01

    A procedure for the detection of enteric viral nucleic acid in oysters by the polymerase chain reaction was developed. Known quantities of poliovirus type 1 were seeded into oysters. Virus was extracted and concentrated by using organic flocculation and polyethylene glycol precipitation. Inhibitors of reverse transcription-polymerase chain reaction were present in the oyster extracts, preventing amplification of target viral nucleic acid. The use of cetyltrimethylammonium bromide precipitation sufficiently removed inhibitors to allow detection of as few as 10 PFU of poliovirus. Norwalk virus also could be detected after being seeded into oysters. This methodology may be useful for the detection of these and other shellfish-borne viral pathogens. Images PMID:8382024

  10. DNA polymerase III accessory proteins. I. holA and holB encoding delta and delta'.

    PubMed

    Dong, Z; Onrust, R; Skangalis, M; O'Donnell, M

    1993-06-05

    The genes encoding the delta and delta' subunits of the 10-subunit Escherichia coli replicase, DNA polymerase III holoenzyme, have been identified and sequenced. The holA gene encoding delta is located downstream of rlpB at 15.2 min and predicts a 38.7 kda protein. The holB gene encoding delta' is located at 24.3 min and predicts a 36.9-kDa protein. Hence the delta and delta' subunits are unrelated proteins encoded by separate genes. The genes have been used to express and purify delta and delta' in quantity. The predicted amino acid sequence of delta' is homologous to the sequences of the tau and gamma subunits revealing a large amount of structural redundancy within the holoenzyme.

  11. Detecting population III galaxies with HST and JWST

    NASA Astrophysics Data System (ADS)

    Zackrisson, E.

    2012-09-01

    A small fraction of the atomic-cooling halos assembling at z < 15 may form out of minihalos that never experienced any prior star formation, and could in principle host small galaxies of chemically unenriched stars. Since the prospects of detecting isolated population III stars appear bleak even with the upcoming James Webb Space Telescope (JWST), these population III galaxies may offer one of the best probes of population III stars in the foreseeable future. By projecting the results from population III galaxy simulations through cluster magnification maps, we predict the fluxes and surface number densities of pop III galaxy galaxies as a function of their typical star formation efficiency. We argue that a small number of lensed population III galaxies in principle could turn up at z ~ 7-10 in the ongoing Hubble Space Telecope survey CLASH, which covers a total of 25 low-redshift galaxy clusters.

  12. Rapid detection of waterborne viruses using the polymerase chain reaction and a gene probe.

    PubMed

    Jothikumar, N; Khanna, P; Kamatchiammal, S; Murugan, R P

    1992-01-01

    We describe a membrane-filter-based urea-arginine phosphate buffer method for concentrating waterborne viruses from large volumes of water to microlitre volumes, and their subsequent detection by the polymerase chain reaction (PCR). The detection step involves the extraction of RNA, synthesis of complementary DNA, amplification by PCR of target DNA with specific primers, and confirmation through nucleic acid hybridization with a radiolabelled oligonucleotide probe. The PCR technique detected the presence of enteroviruses in spiked as well as in contaminated water samples. The technique is sensitive and detects as few as 120 waterborne viral particles. PCR is simple, rapid, sensitive, specific and adaptable for water quality surveillance in less developed countries.

  13. Rapid and sensitive detection of canine parvovirus type 2 by recombinase polymerase amplification.

    PubMed

    Wang, Jianchang; Liu, Libing; Li, Ruiwen; Wang, Jinfeng; Fu, Qi; Yuan, Wanzhe

    2016-04-01

    A novel recombinase polymerase amplification (RPA)-based method for detection of canine parvovirus type 2 (CPV-2) was developed. Sensitivity analysis showed that the detection limit of RPA was 10 copies of CPV-2 genomic DNA. RPA amplified both CPV-2a and -2b DNA but did not amplify the template of other important dog viruses (CCoV, PRV or CDV), demonstrating high specificity. The method was further validated with 57 canine fecal samples. An outstanding advantage of RPA is that it is an isothermal reaction and can be performed in a water bath, making RPA a potential alternative method for CPV-2 detection in resource-limited settings.

  14. Development of an isothermal recombinase polymerase amplification assay for rapid detection of pseudorabies virus.

    PubMed

    Yang, Yang; Qin, Xiaodong; Zhang, Wei; Li, Zhiyong; Zhang, Shuaijun; Li, Yanmin; Zhang, Zhidong

    2017-03-22

    Recombinase polymerase amplification assays using real-time fluorescent detection (real-time RPA assay) and lateral flow dipstick (RPA LFD assay) were developed targeting the gD gene of pseudorabies virus (PRV). Both assays were performed at 39 °C within 20 min. The sensitivity of the real-time RPA assay and the RPA LFD assay was 100 copies per reaction and 160 copies per reaction, respectively. Both assays did not detect DNAs from other virus or PRV negative samples. Therefore, the developed RPA assays provide a rapid, simple, sensitive and specific alternative tool for detection of PRV.

  15. Detection of Murine Typhus Infection in Fleas by Using the Polymerase Chain Reaction

    DTIC Science & Technology

    1990-03-01

    spotted fever ( Rickettsia group-specific primers and probes for the diagnosis of rick- rickettsii ), epidemic typhus ( Rickettsia prowazekii), murine...Polymerase chain reaction, Xenops.yl~j.Lopsis;" Rickettsia typhi,- Enz me-linked immunosorbent assay ’ A amplificatin6 fProu)t 19. ABSTRACT (Continue on...olymerase chain reaction (PCR) amplification of CDNA was used to detect the etiologic agent of murine typhus, Rickettsia typhi, in experimentally infected

  16. Detection of equine herpesvirus 3 in equine skin lesions by polymerase chain reaction.

    PubMed

    Kleiboeker, Steven B; Chapman, Rodney K

    2004-01-01

    During a recent breeding season, ulcerative, pustular skin lesions were observed on the external genitalia of 2 mares and 1 stallion within a small herd. Based on the location and description of the skin lesions plus the clinical history, equine coital exanthema, caused by equine herpesvirus 3 (EHV3), was the primary differential diagnosis. Scrapings of skin lesions from the perineum of 2 mares were submitted for diagnostic evaluation. Virus isolation was attempted by inoculation of several cell lines of equine origin, but no cytopathic agent was detected. The skin scrapings were processed for DNA extraction, and polymerase chain reaction (PCR) amplification was performed for herpesvirus DNA polymerase and DNA-packaging protein (terminase) genes using nested, degenerate primers targeted to conserved regions of the herpesvirus genome. Products of the expected sizes were generated for both assays, and subsequent nucleotide sequencing of the amplification products established that EHV3 had been detected in DNA extracted from the skin lesions. Detection of EHV3 was confirmed using an EHV3-specific PCR assay targeted to the gC gene. Using the novel EHV3 nucleotide sequence identified in this report, a sensitive and specific PCR assay targeted to the highly conserved DNA polymerase gene was developed.

  17. Rapid detection of bovine viral diarrhea virus by polymerase chain reaction.

    PubMed Central

    Lopez, O J; Osorio, F A; Donis, R O

    1991-01-01

    The polymerase chain reaction was used to detect genomic sequences of the positive-stranded RNA of bovine viral diarrhea virus (BVDV), a member of the family Togaviridae. Using a set of 20-bp primers located within the conserved 3' region of the BVDV genome, we were able to consistently amplify a 205-bp target sequence from BVDV cDNA. BVDV RNAs from cell culture-propagated BVDV reference strains, diverse unrelated cytopathic and noncytopathic field isolates, and clinical serum samples were transcribed to cDNA by using avian myeloblastosis virus reverse transcriptase and further specifically amplified by using the polymerase chain reaction assay. The amplification assay was sensitive enough to detect one molecule of cloned BVDV cDNA. Reconstitution experiments conducted by adding decreasing amounts of BVDV (NADL strain) to BVDV-free serum indicated that the threshold of sensitivity of the assay was less than or equal to 1 50% tissue culture infective dose. These results show that the polymerase chain reaction may be used for the rapid detection of diverse strains of BVDV in cell cultures, biological products, and clinical specimens from cattle. Images PMID:1709950

  18. Transcription of eucaryotic tRNA1met and 5SRNA genes by RNA polymerase III is blocked by base mismatches in the intragenic control regions.

    PubMed Central

    Sullivan, M A; Folk, W R

    1987-01-01

    We have constructed duplex DNAs containing single G-T or A-C mismatches in the X. laevis tRNA1met gene. Mismatches within regions of this gene which are bound by transcription factor TFIIIC prevent transcription by RNA polymerase III. Homoduplexes with G-C----A-T mutations at some of the same sites, however, are transcribed efficiently in oocytes. Mismatches outside of the tRNA1met gene have no effect upon transcription. A survey of several point mutants in the Syrian hamster 5SRNA gene indicates that mismatches outside the internal control region somewhat reduce transcription, but a mismatch within the internal control region blocks transcription. Thus, the presence of mismatched bases in the region of DNA which interacts with RNA polymerase III transcription factors blocks transcription, perhaps by interfering with DNA renaturation following transit of the RNA polymerase. Images PMID:3645544

  19. The epsilon subunit of DNA polymerase III Is involved in the nalidixic acid-induced SOS response in Escherichia coli.

    PubMed

    Pohlhaus, Jennifer Reineke; Long, David T; O'Reilly, Erin; Kreuzer, Kenneth N

    2008-08-01

    Quinolone antibacterial drugs such as nalidixic acid target DNA gyrase in Escherichia coli. These inhibitors bind to and stabilize a normally transient covalent protein-DNA intermediate in the gyrase reaction cycle, referred to as the cleavage complex. Stabilization of the cleavage complex is necessary but not sufficient for cell killing--cytotoxicity apparently results from the conversion of cleavage complexes into overt DNA breaks by an as-yet-unknown mechanism(s). Quinolone treatment induces the bacterial SOS response in a RecBC-dependent manner, arguing that cleavage complexes are somehow converted into double-stranded breaks. However, the only proteins known to be required for SOS induction by nalidixic acid are RecA and RecBC. In hopes of identifying additional proteins involved in the cytotoxic response to nalidixic acid, we screened for E. coli mutants specifically deficient in SOS induction upon nalidixic acid treatment by using a dinD::lacZ reporter construct. From a collection of SOS partially constitutive mutants with disruptions of 47 different genes, we found that dnaQ insertion mutants are specifically deficient in the SOS response to nalidixic acid. dnaQ encodes DNA polymerase III epsilon subunit, the proofreading subunit of the replicative polymerase. The deficient response to nalidixic acid was rescued by the presence of the wild-type dnaQ gene, confirming involvement of the epsilon subunit. To further characterize the SOS deficiency of dnaQ mutants, we analyzed the expression of several additional SOS genes in response to nalidixic acid using real-time PCR. A subset of SOS genes lost their response to nalidixic acid in the dnaQ mutant strain, while two tested SOS genes (recA and recN) continued to exhibit induction. These results argue that the replication complex plays a role in modulating the SOS response to nalidixic acid and that the response is more complex than a simple on/off switch.

  20. Human MAF1 targets and represses active RNA polymerase III genes by preventing recruitment rather than inducing long-term transcriptional arrest

    PubMed Central

    Orioli, Andrea; Praz, Viviane; Lhôte, Philippe; Hernandez, Nouria

    2016-01-01

    RNA polymerase III (Pol III) is tightly controlled in response to environmental cues, yet a genomic-scale picture of Pol III regulation and the role played by its repressor MAF1 is lacking. Here, we describe genome-wide studies in human fibroblasts that reveal a dynamic and gene-specific adaptation of Pol III recruitment to extracellular signals in an mTORC1-dependent manner. Repression of Pol III recruitment and transcription are tightly linked to MAF1, which selectively localizes at Pol III loci, even under serum-replete conditions, and increasingly targets transcribing Pol III in response to serum starvation. Combining Pol III binding profiles with EU-labeling and high-throughput sequencing of newly synthesized small RNAs, we show that Pol III occupancy closely reflects ongoing transcription. Our results exclude the long-term, unproductive arrest of Pol III on the DNA as a major regulatory mechanism and identify previously uncharacterized, differential coordination in Pol III binding and transcription under different growth conditions. PMID:26941251

  1. Detection of infections of the eye with Chlamydia trachomatis by the polymerase chain reaction.

    PubMed

    Fan, J; Zhang, W H; Wu, Y Y; Jing, X Y; Claas, E C

    The aim of this study was to test the diagnostic feasibility of the polymerase chain reaction (PCR) for detection of infections with Chlamydia trachomatis in eye swabs from patients with conjunctivitis, and to establish the basic technique of the PCR for epidemiological survey. The results of the PCR were compared with the Mikro Trak immunofluorescence assay (IFA). From 49 specimens of patients with conjunctivitis, 31 were found positive by PCR (63%) and 23 by IFA (47%). On the other hand, in 10 normal eye specimens and 10 non-Chlamydia trachoma conjunctivitis specimens no Chlamydia trachomatis was detected.

  2. Detection of Listeria monocytogenes with a nonisotopic polymerase chain reaction-coupled ligase chain reaction assay.

    PubMed Central

    Wiedmann, M; Barany, F; Batt, C A

    1993-01-01

    A polymerase chain reaction (PCR)-coupled ligase chain reaction (LCR) assay for the specific detection of Listeria monocytogenes (M. Wiedmann, J. Czajka, F. Barany, and C. A. Batt, Appl. Environ. Microbiol. 58:3443-3447, 1992) has been modified for detection of the LCR products with a nonisotopic readout. When a chemiluminescent or a colorimetric substrate for the nonisotopic detection of the LCR products was used, the PCR-coupled LCR gave a sensitivity of 10 CFU of L. monocytogenes. The detection method with the chemiluminescent substrate Lumi-Phos 530 permitted detection of the LCR products in less than 3 h, so that the whole assay can be completed within 10 h. Images PMID:8368859

  3. Detection of Leishmania siamensis DNA in Saliva by Polymerase Chain Reaction

    PubMed Central

    Phumee, Atchara; Kraivichian, Kanyarat; Chusri, Sarunyou; Noppakun, Nopadon; Vibhagool, Asda; Sanprasert, Vivornpun; Tampanya, Vich; Wilde, Henry; Siriyasatien, Padet

    2013-01-01

    Polymerase chain reaction was used to detect Leishmania siamensis DNA from clinical samples collected from six leishmaniasis patients during 2011–2012. The samples used in this study came from bone marrow, blood, buffy coat, saliva, urine, and tissue biopsy specimens. Saliva was a good source for L. siamensis DNA by polymerase chain reaction. L. siamensis DNA was also found in saliva of an asymptomatic case-patient. Levels of L. siamensis DNA in saliva decreased until being undetectable after treatment. These levels could be used as a marker to evaluate efficacy of the treatment. A larger study is needed to evaluate this method as a screening and survey tool to study the silent background of Leishmania infection among the at-risk population. PMID:24062485

  4. Direct and sensitive detection of a pathogenic protozoan, Toxoplasma gondii, by polymerase chain reaction.

    PubMed Central

    Burg, J L; Grover, C M; Pouletty, P; Boothroyd, J C

    1989-01-01

    We applied the polymerase chain reaction to detection of the pathogenic protozoan Toxoplasma gondii based on our identification of a 35-fold-repetitive gene (the B1 gene) as a target. Using this procedure, we were able to amplify and detect the DNA of a single organism directly from a crude cell lysate. This level of sensitivity also allowed us to detect the B1 gene from purified DNA samples containing as few as 10 parasites in the presence of 100,000 human leukocytes. This is representative of the maximal cellular infiltration (10(5)/ml) in 1 ml of cerebrospinal fluid obtained from patients with toxoplasmic encephalitis. The B1 gene is present and conserved in all six T. gondii strains tested to date, including two isolates from patients with acquired immunodeficiency syndrome. No signal was detected by using this assay and DNAs from a variety of other organisms, including several which might be found in the central nervous system of an immunocompromised host. This combination of sensitivity and specificity should make detection of the B1 gene based on polymerase chain reaction amplification a very useful method for diagnosis of toxoplasmosis both in immunocompromised hosts and in congenitally infected fetuses. Images PMID:2768467

  5. Positive and negative functional interactions between promoter elements from different classes of RNA polymerase III-transcribed genes.

    PubMed Central

    Parry, H D; Mattaj, I W

    1990-01-01

    Consensus tRNA gene promoter elements, A and B boxes, were introduced into the coding sequence of a Xenopus U6 gene. Combinations in which A and B boxes were coupled to wild-type or mutant U6 promoters were made. In this way information about both the functions of individual promoter elements and functional relationships between different classes of RNA polymerase III promoter element were obtained. Mutants in which the U6 PSE was non-functional were rescued by the presence of a B box, indicating a degree of functional relationship between these two elements. Moreover, the B box acted to increase the transcriptional activity and competitive strength of the wild-type U6 promoter. In contrast, no evidence was obtained to suggest that a tRNA A box can interact productively with U6 promoter elements in the absence of a B box. Data obtained suggest that the U6 PSE functions as an 'adaptor', being necessary to enable the basal U6 promoter to respond to upstream enhancement. Certain combinations of U6 and tRNA promoter elements are shown to be mutually antagonistic by a mechanism which is likely to involve blockage of transcription initiation. In summary, the U6 and tRNA promoters are shown to consist of functionally related, but distinct, promoter elements whose interactions shed new light on their normal roles in transcription. Images Fig. 1. Fig. 2. Fig. 3. Fig. 4. Fig. 5. Fig. 6. Fig. 7. Fig. 8. PMID:2323333

  6. Characterization of a novel DNA polymerase activity assay enabling sensitive, quantitative and universal detection of viable microbes.

    PubMed

    Zweitzig, Daniel R; Riccardello, Nichol M; Sodowich, Bruce I; O'Hara, S Mark

    2012-08-01

    During the past 50 years, in vitro measurement of DNA polymerase activity has become an essential molecular biology tool. Traditional methods used to measure DNA polymerase activity in vitro are undesirable due to the usage of radionucleotides. Fluorescence-based DNA polymerase assays have been developed; however, they also suffer from various limitations. Herein we present a rapid, highly sensitive and quantitative assay capable of measuring DNA polymerase extension activity from purified enzymes or directly from microbial lysates. When tested with purified DNA polymerase, the assay detected as little as 2 × 10(-11)U of enzyme (∼ 50 molecules), while demonstrating excellent linearity (R(2)=0.992). The assay was also able to detect endogenous DNA polymerase extension activity down to less than 10 colony forming units (cfu) of input Gram-positive or Gram-negative bacteria when coupled to bead mill lysis while maintaining an R(2)=0.999. Furthermore, preliminary evidence presented here suggests that DNA polymerase extension activity is an indicator of microbial viability, as demonstrated by the reproducibly strong concordance between assay signal and bacterial colony formation. Together, the innovative methodology described here represents a significant advancement toward sensitive detection of potentially any microorganism containing active DNA polymerase within a given sample matrix.

  7. Multiplex polymerase chain reaction method to detect Cyclospora, Cystoisospora, and Microsporidia in stool samples.

    PubMed

    Taniuchi, Mami; Verweij, Jaco J; Sethabutr, Orntipa; Bodhidatta, Ladaporn; Garcia, Lynne; Maro, Athanasia; Kumburu, Happiness; Gratz, Jean; Kibiki, Gibson; Houpt, Eric R

    2011-12-01

    Cyclospora, Cystoisospora, and Microsporidia are eukaryotic enteropathogens that are difficult to detect in stool samples because they require special stains and microscopy. We developed a multiplex polymerase chain reaction (PCR) reaction with 4 primer sets to amplify Cyclospora cayetanensis, Cystoisospora belli, Enterocytozoon bieneusi, and Encephalitozoon intestinalis. Detection of the amplicon is through specific probes coupled to Luminex beads. Sensitivity of the assay was evaluated using Encephalitozoon intestinalis spores and revealed detection of 10(1) spores spiked into stool. No cross-reactivity was observed. We evaluated the assay on diarrheal specimens from Thailand, Tanzania, Indonesia, and the Netherlands that had been previously tested by microscopy, and the assay yielded 87-100% sensitivity and 88-100% specificity. Microscopy-negative/PCR-positive samples had lower Luminex values, suggesting they were true but with lower burden infections. In summary, this is a convenient single PCR reaction that can detect Cyclospora, Cystoisospora, and Microsporidia without the need for cumbersome microscopic analysis.

  8. Rapid and specific detection of Yam mosaic virus by reverse-transcription recombinase polymerase amplification.

    PubMed

    Silva, Gonçalo; Bömer, Moritz; Nkere, Chukwuemeka; Kumar, P Lava; Seal, Susan E

    2015-09-15

    Yam mosaic virus (YMV; genus Potyvirus) is considered to cause the most economically important viral disease of yams (Dioscorea spp.) in West Africa which is the dominant region for yam production globally. Yams are a vegetatively propagated crop and the use of virus-free planting material forms an essential component of disease control. Current serological and PCR-based diagnostic methods for YMV are time consuming involving a succession of target detection steps. In this study, a novel assay for specific YMV detection is described that is based on isothermal reverse transcription-recombinase polymerase amplification (RT-exoRPA). This test has been shown to be reproducible and able to detect as little as 14 pg/μl of purified RNA obtained from an YMV-infected plant, a sensitivity equivalent to that obtained with the reverse transcription-polymerase chain reaction (RT-PCR) in current general use. The RT-exoRPA assay has, however, several advantages over the RT-PCR; positive samples can be detected in less than 30 min, and amplification only requires a single incubation temperature (optimum 37°C). These features make the RT-exoRPA assay a promising candidate for adapting into a field test format to be used by yam breeding programmes or certification laboratories.

  9. Recombinase polymerase amplification assay for rapid detection of lumpy skin disease virus.

    PubMed

    Shalaby, Mohamed A; El-Deeb, Ayman; El-Tholoth, Mohamed; Hoffmann, Donata; Czerny, Claus-Peter; Hufert, Frank T; Weidmann, Manfred; Abd El Wahed, Ahmed

    2016-11-02

    Lumpy skin disease virus (LSDV) is a Capripoxvirus infecting cattle and Buffalos. Lumpy skin disease (LSD) leads to significant economic losses due to hide damage, reduction of milk production, mastitis, infertility and mortalities (10 %). Early detection of the virus is crucial to start appropriate outbreak control measures. Veterinarians rely on the presence of the characteristic clinical signs of LSD. Laboratory diagnostics including virus isolation, sequencing and real-time polymerase chain reaction (PCR) are performed at well-equipped laboratories. In this study, a portable, simple, and rapid recombinase polymerase amplification (RPA) assay for the detection of LSDV-genome for the use on farms was developed. The LSDV RPA assay was performed at 42 °C and detected down to 179 DNA copies/reaction in a maximum of 15 min. Unspecific amplification was observed with neither LSDV-negative samples (n = 12) nor nucleic acid preparations from orf virus, bovine papular stomatitis virus, cowpoxvirus, Peste des petits ruminants and Blue tongue virus (serotypes 1, 6 and 8). The clinical sensitivity of the LSDV RPA assay matched 100 % (n = 22) to real-time PCR results. In addition, the LSDV RPA assay detected sheep and goat poxviruses. The LSDV RPA assay is a rapid and sensitive test that could be implemented in field or at quarantine stations for the identification of LSDV infected case.

  10. The β2 clamp in the Mycobacterium tuberculosis DNA polymerase III αβ2ε replicase promotes polymerization and reduces exonuclease activity

    PubMed Central

    Gu, Shoujin; Li, Wenjuan; Zhang, Hongtai; Fleming, Joy; Yang, Weiqiang; Wang, Shihua; Wei, Wenjing; Zhou, Jie; Zhu, Guofeng; Deng, Jiaoyu; Hou, Jian; Zhou, Ying; Lin, Shiqiang; Zhang, Xian-En; Bi, Lijun

    2016-01-01

    DNA polymerase III (DNA pol III) is a multi-subunit replication machine responsible for the accurate and rapid replication of bacterial genomes, however, how it functions in Mycobacterium tuberculosis (Mtb) requires further investigation. We have reconstituted the leading-strand replication process of the Mtb DNA pol III holoenzyme in vitro, and investigated the physical and functional relationships between its key components. We verify the presence of an αβ2ε polymerase-clamp-exonuclease replicase complex by biochemical methods and protein-protein interaction assays in vitro and in vivo and confirm that, in addition to the polymerase activity of its α subunit, Mtb DNA pol III has two potential proofreading subunits; the α and ε subunits. During DNA replication, the presence of the β2 clamp strongly promotes the polymerization of the αβ2ε replicase and reduces its exonuclease activity. Our work provides a foundation for further research on the mechanism by which the replication machinery switches between replication and proofreading and provides an experimental platform for the selection of antimicrobials targeting DNA replication in Mtb. PMID:26822057

  11. Method for detection of Stachybotrys chartarum in pure culture and field samples using quantitative polymerase chain reaction

    DOEpatents

    Cruz-Perez, Patricia; Buttner, Mark P.

    2004-05-11

    A method for detecting the fungus Stachybotrys chartarum includes isolating DNA from a sample suspected of containing the fungus Stachybotrys chartarum. The method further includes subjecting the DNA to polymerase chain reaction amplification utilizing at least one of several primers, the several primers each including one of the base sequences 5'GTTGCTTCGGCGGGAAC3', 5'TTTGCGTTTGCCACTCAGAG3', 5'ACCTATCGTTGCTTCGGCG3', and 5'GCGTTTGCCACTCAGAGAATACT3'. The method additionally includes detecting the fungus Stachybotrys chartarum by visualizing the product of the polymerase chain reaction.

  12. Identification of specific amino acid residues in the E. coli beta processivity clamp involved in interactions with DNA polymerase III, UmuD and UmuD'.

    PubMed

    Duzen, Jill M; Walker, Graham C; Sutton, Mark D

    2004-03-04

    Variants of a pentapeptide sequence (QL[S/F]LF), referred to as the eubacterial clamp-binding motif, appear to be required for certain proteins to bind specifically to the Escherichia coli beta sliding clamp, apparently by making contact with a hydrophobic pocket located at the base of the C-terminal tail of each beta protomer. Although both UmuC (DNA pol V) and the alpha catalytic subunit of DNA polymerase III (pol III) each bear a reasonable match to this motif, which appears to be required for their respective interactions with the clamp, neither UmuD not UmuD' do. As part of an ongoing effort to understand how interactions involving the different E. coli umuDC gene products and components of DNA polymerase III help to coordinate DNA replication with a DNA damage checkpoint control and translesion DNA synthesis (TLS) following DNA damage, we characterized the surfaces on beta important for its interactions with the two forms of the umuD gene product. We also characterized the surface of beta important for its interaction with the alpha catalytic subunit of pol III. Our results indicate that although UmuD, UmuD' and alpha share some common contacts with beta, each also makes unique contacts with the clamp. These findings suggest that differential interactions of UmuD and UmuD' with beta impose a DNA damage-responsive conditionality on how beta interacts with the translesion DNA polymerase UmuC. This is formally analogous to how post-translational modification of the eukaryotic PCNA clamp influences mutagenesis. We discuss the implications of our findings in terms of how E. coli might coordinate the actions of the umuDC gene products with those of pol III, as well as for how organisms in general might manage the actions of their multiple DNA polymerases. Copyright 2003 Elsevier B.V.

  13. Inhibition of the RNA polymerase III-mediated dsDNA-sensing pathway of innate immunity by vaccinia virus protein E3.

    PubMed

    Valentine, Robert; Smith, Geoffrey L

    2010-09-01

    The vaccinia virus E3 protein is an important intracellular modulator of innate immunity that can be split into distinct halves. The C terminus contains a well defined dsRNA-binding domain, whereas the N terminus contains a Z-DNA-binding domain, and both domains are required for virulence. In this study, we investigated whether the E3 Z-DNA-binding domain functions by sequestering cytoplasmic dsDNA thereby preventing the induction of type I interferon (IFN). In line with this hypothesis, expression of E3 ablated both IFN-beta expression and NF-kappaB activity in response to the dsDNA, poly(dA-dT). However, surprisingly, the ability of E3 to block poly(dA-dT) signalling was independent of the N terminus, whereas the dsRNA-binding domain was essential, suggesting that the Z-DNA-binding domain does not bind immunostimulatory dsDNA. This was confirmed by the failure of E3 to co-precipitate with biotinylated dsDNA, whereas the recruitment of several cytoplasmic DNA-binding proteins could be detected. Recently, AT-rich dsDNA was reported to be transcribed into 5'-triphosphate poly(A-U) RNA by RNA polymerase III, which then activates retinoic acid-inducible gene I (RIG-I). Consistent with this, RNA from poly(dA-dT) transfected cells induced IFN-beta and expression of the E3 dsRNA-binding domain was sufficient to ablate this response. Given the well documented function of the E3 dsRNA-binding domain we propose that E3 blocks signalling in response to poly(dA-dT) by binding to transcribed poly(A-U) RNA preventing RIG-I activation. This report describes a DNA virus-encoded inhibitor of the RNA polymerase III-dsDNA-sensing pathway and extends our knowledge of E3 as a modulator of innate immunity.

  14. Development and evaluation of a rapid recombinase polymerase amplification assay for detection of coxsackievirus A6.

    PubMed

    Wang, Kaifeng; Wu, Yue; Yin, Dan; Tang, Shixing; Hu, Guifang; He, Yaqing

    2017-01-01

    Coxsackievirus A6 (CV-A6) is an important pathogen causing hand, foot and mouth disease (HFMD). The aim of this study was to develop and evaluate a rapid real-time reverse transcription recombinase polymerase amplification (RT-RPA) assay for detection of CV-A6. The sensitivity of this assay was 202 copies/reaction, with 100 % specificity. Furthermore, this assay yielded consistent results comparable with a commercial qRT-PCR diagnostic kit. This assay is therefore potentially useful for surveillance of CV-A6 infections and outbreak control.

  15. Rapid detection of influenza virus H1 by the polymerase chain reaction.

    PubMed

    Bressoud, A; Whitcomb, J; Pourzand, C; Haller, O; Cerutti, P

    1990-03-16

    We applied a combination of reverse transcription (RT) with the polymerase chain reaction (PCR) for a rapid detection of influenza virus H1 subtype. We amplified a 441 bp segment of relatively high genetic stability of the hemagglutinin gene. Experimental conditions were established using plasmid DNA and infected cell cultures. The test was applied to 28 nasopharyngeal lavages from patients, two of which were positive for influenza virus H1. When the amplified DNA of a positive sample was sequenced we found 97% homology with the recent strain A/USSR/70.

  16. Electrochemical aptameric sensor based on the Klenow fragment polymerase reaction for cocaine detection.

    PubMed

    He, Jing-Lin; Yang, Yi-Feng; Shen, Guo-Li; Yu, Ru-Qin

    2011-06-15

    An electrochemical aptasensor based on Klenow fragment (KF) polymerase reaction that combines the aggregation of ferrocene-functionalized oligonucleotide has been developed successfully for cocaine detection. In the presence of cocaine, the recognition probe changed its hairpin conformation into the tripartite complex. The aptamer-cocaine complex gave a 3'-single-stranded tail sequence complementary to the surface-tethered capture probe. In KF polymerase reaction, the recognition probe served as a template for the extension of a capture probe. It requires a sample volume of 2 μL and is complete within 1 h. The ferrocene-appended oligonucleotide incorporated into the newly synthesized complementary probe leads to an electrochemical response. This sensitive detection of cocaine is due to a very low background signal and large signal enhancement up to 9-fold upon addition of analyte. It permits detection of as low as 200 μM cocaine. The simple and isothermal procedure does not require thermal cycling or special laboratory conditions, which makes it adaptable to low-cost and robust biosensing. Copyright © 2011 Elsevier B.V. All rights reserved.

  17. Routine application of the polymerase chain reaction for detection of Mycobacterium tuberculosis in clinical samples.

    PubMed Central

    Noordhoek, G T; Kaan, J A; Mulder, S; Wilke, H; Kolk, A H

    1995-01-01

    AIM--To investigate the use of the polymerase chain reaction (PCR) in the routine laboratory for the detection of Mycobacterium tuberculosis in clinical samples. METHODS--Samples were divided and processed separately for the detection of M tuberculosis by microscopy, culture and PCR. After DNA extraction, PCR was performed with primers specific for the insertion element IS6110 and the product was analysed by agarose gel electrophoresis, Southern blotting or dot blotting and hybridisation with a digoxigenin labelled internal probe. Each sample was tested for inhibitors of Taq polymerase with the aid of an internal control. Multiple negative and positive controls were used to monitor each step of the procedure. RESULTS--The data from two laboratories, using the same operating procedures, were combined. Of 1957 specimens, 79 (4%) were culture and PCR positive, while 1839 (93.9%) were negative in both tests. Thirty specimens (1.5%) were PCR positive only and nine (0.5%) were culture positive but PCR negative. CONCLUSION--Using culture and clinical history as the gold standard, sensitivity and specificity for PCR were 92.1% and 99.8%, respectively. With elaborate precautions, PCR is a suitable and reliable method for the detection of M tuberculosis in clinical samples in a routine microbiology laboratory. Images PMID:7490312

  18. Coexistence of anti-RNA polymerase III and anti-U1RNP antibodies in patients with systemic lupus erythematosus: two cases without features of scleroderma

    PubMed Central

    Satoh, M; Vazquez-Del Mercado, M; Krzyszczak, ME; Li, Y; Ceribelli, A; Burlingame, RW; Webb, TT; Sobel, ES; Reeves, WH; Chan, EKL

    2013-01-01

    Anti-RNA polymerase III (RNAP III) antibodies are highly specific for scleroderma (SSc) and associated with diffuse SSc and renal crisis. Coexistence of anti-RNAP III and other SSc autoantibodies is rarely documented. We report three cases with coexisting anti-RNAP III and anti-U1RNP. Autoantibodies in 3829 sera from rheumatology clinics were screened by immunoprecipitation. Anti-RNAP III-positive sera were also examined by immunofluorescence and anti-RNAP III ELISA. In total, 35 anti-RNAP III-positive sera were identified by immunoprecipitation, in which three had coexisting anti-U1RNP. All three were anti-RNAP III ELISA positive. Two had anti-RNAP I dominant (vs. RNAP III) reactivity and showed strong nucleolar staining. A case with anti-U1/U2RNP (U2RNP dominant) had systemic lupus erythematosus (SLE)–SSc overlap syndrome; however, the remaining two cases had SLE without signs of SSc. All three cases of anti-RNAP III + U1RNP fulfilled ACR SLE criteria but none in the group with anti-RNAP III alone (p = 0.0002). In contrast, only one case in the former group had sclerodermatous skin changes and Raynaud’s phenomenon, vs. 92% with scleroderma in the latter (p < 0.05). Although anti-RNAP III is highly specific for SSc, cases with coexisting anti-U1RNP are not so uncommon among anti-RNAP III positives (8%, 3/35) and may be SLE without features of SSc. PMID:22025191

  19. Fast real-time polymerase chain reaction for quantitative detection of Lactobacillus delbrueckii bacteriophages in milk.

    PubMed

    Martín, Maria Cruz; del Rio, Beatriz; Martínez, Noelia; Magadán, Alfonso H; Alvarez, Miguel A

    2008-12-01

    One of the main microbiological problems of the dairy industry is the susceptibility of starter bacteria to virus infections. Lactobacillus delbrueckii, a component of thermophilic starter cultures used in the manufacture of several fermented dairy products, including yogurt, is also sensitive to bacteriophage attacks. To avoid the problems associated with these viruses, quick and sensitive detection methods are necessary. In the present study, a fast real-time quantitative polymerase chain reaction assay for the direct detection and quantification of L. delbrueckii phages in milk was developed. A set of primers and a TaqMan MGB probe was designed, based on the lysin gene sequence of different L. delbrueckii phages. The results show the proposed method to be a rapid (total processing time 30 min), specific and highly sensitive technique for detecting L. delbrueckii phages in milk.

  20. Polymerase chain reaction detection of Clostridium perfringens in feces from captive and wild chimpanzees, Pan troglodytes.

    PubMed

    Fujita, Shiho; Kageyama, Takashi

    2007-02-01

    For veterinary management of non-human primates in captivity, and conservation of wild-living primates, management of their health risks is necessary. Incidences of pathogenic bacteria in the fecal specimens are considered as one of the useful indicators for non-invasive health monitoring. We carried out the detection of Clostridium perfringens in feces from captive and wild chimpanzees by the rapid polymerase chain reaction method. The bacterium was detected in most fecal specimens (80%) in captive chimpanzees. Contrarily, the detection rate in the wild chimpanzees was low, with 23% (n = 12) of 53 fecal samples from the Bossou group, Guinea, and 1.2% (1/81) in the Mahale group, Tanzania. These results show that the intestinal microflora differs between Pan populations under various living conditions, being influenced by their diet and environment.

  1. Detection of rodent coronaviruses in tissues and cell cultures by using polymerase chain reaction.

    PubMed Central

    Homberger, F R; Smith, A L; Barthold, S W

    1991-01-01

    A polymerase chain reaction (PCR) method was developed for the detection of rodent coronaviruses in biological material by using reverse transcriptase and two primers which flanked an M gene sequence of 375 bp. PCR detected all of 11 different strains of mouse hepatitis virus (MHV) as well as rat sialodacryoadenitis virus but not bovine coronavirus or human coronavirus strains OC43 and 229E. The M gene sequences of bovine coronavirus and human coronavirus OC43 are homologous to that of MHV, but minor differences exist in the primer regions, preventing annealing of the primers. For detecting MHV-Y in tissue samples, PCR was faster than and at least as sensitive as either of the two bioassays (infant mouse bioassay and mouse antibody production test) currently used for MHV diagnostic purposes. Images PMID:1661745

  2. Rapid Detection and Identification of a Pathogen's DNA Using Phi29 DNA Polymerase

    SciTech Connect

    Xu, Y.; Dunn, J.; Gao, S.; Bruno, J. F.; Luft, B. J.

    2008-10-31

    Zoonotic pathogens including those transmitted by insect vectors are some of the most deadly of all infectious diseases known to mankind. A number of these agents have been further weaponized and are widely recognized as being potentially significant biothreat agents. We describe a novel method based on multiply-primed rolling circle in vitro amplification for profiling genomic DNAs to permit rapid, cultivation-free differential detection and identification of circular plasmids in infectious agents. Using Phi29 DNA polymerase and a two-step priming reaction we could reproducibly detect and characterize by DNA sequencing circular DNA from Borrelia burgdorferi B31 in DNA samples containing as little as 25 pg of Borrelia DNA amongst a vast excess of human DNA. This simple technology can ultimately be adapted as a sensitive method to detect specific DNA from both known and unknown pathogens in a wide variety of complex environments.

  3. A Novel Isothermal Assay of Borrelia burgdorferi by Recombinase Polymerase Amplification with Lateral Flow Detection.

    PubMed

    Liu, Wei; Liu, Hui-Xin; Zhang, Lin; Hou, Xue-Xia; Wan, Kang-Lin; Hao, Qin

    2016-08-03

    A novel isothermal detection for recombinase polymerase amplification with lateral flow (LF-RPA) was established for Borrelia burgdorferi (B. burgdorferi) detection in this study. This assay with high sensitivity and specificity can get a visible result without any additional equipment in 30 min. We designed a pair of primers according to recA gene of B. burgdorferi strains and a methodology evaluation was performed. The results showed that the RPA assay based on the recA gene was successfully applied in B. burgdorferi detection, and its specific amplification was only achieved from the genomic DNA of B. burgdorferi. The detection limit of the new assay was about 25 copies of the B. burgdorferi genomic DNA. Twenty Lyme borreliosis patients' serum samples were detected by LF-RPA assay, real-time qPCR and nested-PCR. Results showed the LF-RPA assay is more effective than nested-PCR for its shorter reaction time and considerably higher detection rate. This method is of great value in clinical rapid detection for Lyme borreliosis. Using the RPA assay might be a megatrend for DNA detection in clinics and endemic regions.

  4. Development of a Recombinase Polymerase Amplification Assay for Detection of Epidemic Human Noroviruses.

    PubMed

    Moore, Matthew D; Jaykus, Lee-Ann

    2017-01-09

    Human norovirus is a leading cause of viral gastroenteritis worldwide. Rapid detection could facilitate control, however widespread point-of-care testing is infrequently done due to the lack of robust and portable methods. Recombinase polymerase amplification (RPA) is a novel isothermal method which rapidly amplifies and detects nucleic acids using a simple device in near real-time. An RT-RPA assay targeting a recent epidemic human norovirus strain (GII.4 New Orleans) was developed and evaluated in this study. The assay successfully detected purified norovirus RNA from multiple patient outbreak isolates and had a limit of detection of 3.40 ± 0.20 log10 genomic copies (LGC), which is comparable to most other reported isothermal norovirus amplification methods. The assay also detected norovirus in directly boiled stool, and displayed better resistance to inhibitors than a commonly used RT-qPCR assay. The assay was specific, as it did not amplify genomes from 9 non-related enteric viruses and bacteria. The assay detected norovirus in some samples in as little as 6 min, and the entire detection process can be performed in less than 30 min. The reported RT-RPA method shows promise for sensitive point-of-care detection of epidemic human norovirus, and is the fastest human norovirus amplification method to date.

  5. Development of a Recombinase Polymerase Amplification Assay for Detection of Epidemic Human Noroviruses

    PubMed Central

    Moore, Matthew D.; Jaykus, Lee-Ann

    2017-01-01

    Human norovirus is a leading cause of viral gastroenteritis worldwide. Rapid detection could facilitate control, however widespread point-of-care testing is infrequently done due to the lack of robust and portable methods. Recombinase polymerase amplification (RPA) is a novel isothermal method which rapidly amplifies and detects nucleic acids using a simple device in near real-time. An RT-RPA assay targeting a recent epidemic human norovirus strain (GII.4 New Orleans) was developed and evaluated in this study. The assay successfully detected purified norovirus RNA from multiple patient outbreak isolates and had a limit of detection of 3.40 ± 0.20 log10 genomic copies (LGC), which is comparable to most other reported isothermal norovirus amplification methods. The assay also detected norovirus in directly boiled stool, and displayed better resistance to inhibitors than a commonly used RT-qPCR assay. The assay was specific, as it did not amplify genomes from 9 non-related enteric viruses and bacteria. The assay detected norovirus in some samples in as little as 6 min, and the entire detection process can be performed in less than 30 min. The reported RT-RPA method shows promise for sensitive point-of-care detection of epidemic human norovirus, and is the fastest human norovirus amplification method to date. PMID:28067278

  6. Polymerase chain reaction detection of Propionibacterium propionicus and Actinomyces radicidentis in primary and persistent endodontic infections.

    PubMed

    Siqueira, José F; Rôças, Isabela N

    2003-08-01

    Propionibacterium propionicus and the recently described species Actinomyces radicidentis have been isolated from infections of endodontic origin; nevertheless, the possibility exists that their actual prevalence may have been underestimated by culture. The purpose of our study was to assess the occurrence of these 2 species in different types of endodontic infections by using the sensitive 16S rDNA-based nested polymerase chain reaction approach. To detect these 2 species, nested polymerase chain reaction was performed directly in samples taken from primary endodontic infections associated with asymptomatic periradicular lesions, acute apical periodontitis, or acute periradicular abscesses and in samples from patients in whom endodontic therapy had failed. DNA was extracted from the samples and initially amplified by using universal 16S rDNA primers. In the second round of amplification, the first polymerase chain reaction products were used to detect a specific 16S rDNA fragment of either P propionicus or A radicidentis. P propionicus was detected in 6/21 (29%) root canal samples from teeth with chronic periradicular lesions, in 5/10 (50%) cases diagnosed as acute apical periodontitis, and in 7/19 (37%) pus samples aspirated from acute periradicular abscesses. Overall, this species was found in 18/50 (36%) samples taken from primary endodontic infections. Of the root canal samples obtained from root-filled teeth with chronic periradicular lesions, P propionicus was detected in 7/12 (58%) cases. A radicidentis was detected in 1/21 (5%) root canal samples from teeth with chronic periradicular lesions and in 1/10 (10%) cases of acute apical periodontitis. No pus sample yielded this species. In general, A radicidentis was detected in 2/50 (4%) samples taken from primary endodontic infections and in 1/12 (8%) root canal samples taken from patients in whom endodontic treatment had failed. P propionicus was found in a relatively large number of patients with primary and

  7. HPV detection using "hot start" polymerase chain reaction in patients with oral cancer: a clinicopathological study of 64 patients.

    PubMed

    Brandwein, M; Zeitlin, J; Nuovo, G J; MacConnell, P; Bodian, C; Urken, M; Biller, H

    1994-09-01

    We examined the incidence of human papillomavirus (HPV) in intraoral cancers from 64 patients as determined by the highly sensitive technique of "hot start" polymerase chain reaction (PCR) in formalin-fixed paraffin-embedded tissues. Polymerase-chain-reaction-amplified HPV DNA was detected in the carcinomas of 16 patients (25%). The percentage of men in the HPV-positive (HPV+) group was greater than that in the HPV-negative (HPV-) group (86% versus 68%), but the difference was not statistically significant. There was no intraoral site preference for the HPV+ tumors. The mean age of viral-positive and -negative groups was similar (55 versus 53.8 yr). Three of 16 HPV+ patients (19%) had never smoked cigarettes; however, 16% of the HPV- group had also never smoked. Of interest, 38% of patients interviewed had occupation-related exposures that may have contributed to their carcinogenesis, and a disproportionate percentage of these patients (57%) were from the HPV+ group. There were no statistically significant differences between HPV+ and HPV- cases regarding T stage, clinical stage, and tumor differentiation. The disease-free interval did not differ significantly for HPV+ and HPV- patients in total nor when patients were stratified for tumor stage and clinical stage. The only group that showed some difference in outcome was that of the stage III/IV patients with oral cancer. We observed a shorter survival time for the HPV+ patients as compared with the HPV- patients (P = 0.09). We conclude that, in general, HPV is associated with a minority of intraoral cancers and its presence is not predictive of patient outcome.

  8. Human RNase P ribonucleoprotein is required for formation of initiation complexes of RNA polymerase III

    PubMed Central

    Serruya, Raphael; Orlovetskie, Natalie; Reiner, Robert; Dehtiar-Zilber, Yana; Wesolowski, Donna; Altman, Sidney; Jarrous, Nayef

    2015-01-01

    Human RNase P is implicated in transcription of small non-coding RNA genes by RNA polymerase III (Pol III), but the precise role of this ribonucleoprotein therein remains unknown. We here show that targeted destruction of HeLa nuclear RNase P inhibits transcription of 5S rRNA genes in whole cell extracts, if this precedes the stage of initiation complex formation. Biochemical purification analyses further reveal that this ribonucleoprotein is recruited to 5S rRNA genes as a part of proficient initiation complexes and the activity persists at reinitiation. Knockdown of RNase P abolishes the assembly of initiation complexes by preventing the formation of the initiation sub-complex of Pol III. Our results demonstrate that the structural intactness, but not the endoribonucleolytic activity per se, of RNase P is critical for the function of Pol III in cells and in extracts. PMID:25953854

  9. Diurnal regulation of RNA polymerase III transcription is under the control of both the feeding-fasting response and the circadian clock.

    PubMed

    Mange, François; Praz, Viviane; Migliavacca, Eugenia; Willis, Ian M; Schütz, Frédéric; Hernandez, Nouria

    2017-03-24

    RNA polymerase III (pol III) synthesizes short non-coding RNAs, many of which are essential for translation. Accordingly, pol III activity is tightly regulated with cell growth and proliferation by factors such as MYC, RB1, TRP53, and MAF1. MAF1 is a repressor of pol III transcription whose activity is controlled by phosphorylation; in particular, it is inactivated through phosphorylation by the TORC1 kinase complex, a sensor of nutrient availability. Pol III regulation is thus sensitive to environmental cues, yet a diurnal profile of pol III transcription activity is so far lacking. Here we first use gene expression arrays to measure mRNA accumulation during the diurnal cycle in the livers of (i) wild-type mice, (ii) arrhythmic Arntl knockout mice, (iii) mice fed at regular intervals during both night and day, and (iv) mice lacking the Maf1 gene, and so provide a comprehensive view of the changes in cyclic mRNA accumulation occurring in these different systems. We then show that pol III occupancy of its target genes rises before the onset of the night, stays high during the night, when mice normally ingest food and when translation is known to be increased, and decreases in daytime. Whereas higher pol III occupancy during the night reflects a MAF1-dependent response to feeding, the rise of pol III occupancy before the onset of the night reflects a circadian clock-dependent response. Thus, pol III transcription during the diurnal cycle is regulated both in response to nutrients and by the circadian clock, which allows anticipatory pol III transcription.

  10. Presence of human immunodeficiency virus nucleic acids in wastewater and their detection by polymerase chain reaction.

    PubMed Central

    Ansari, S A; Farrah, S R; Chaudhry, G R

    1992-01-01

    The human immunodeficiency virus type 1 (HIV-1) released by infected individuals or present in human and hospital wastes can potentially cause contamination problems. The presence of HIV-1 was investigated in 16 environmental samples, including raw wastewater, sludge, final effluent, soil, and pond water, collected from different locations. A method was developed to extract total nucleic acids in intact form directly from the raw samples or from the viral concentrates of the raw samples. The isolated nucleic acids were analyzed for the presence of HIV-1 by using in vitro amplification of the target sequences by the polymerase chain reaction (PCR) method. HIV-1-specific proviral DNA and viral RNA were detected in the extracted nucleic acids obtained from three wastewater samples by this method. The specificity of the PCR-amplified products was determined by Southern blot hybridization with an HIV-1-specific oligonucleotide probe, SK19. The isolated nucleic acids from wastewater samples were also screened for the presence of poliovirus type 1, representing a commonly found enteric virus, and simian immunodeficiency virus, representing, presumably, rare viruses. While poliovirus type 1 viral RNA was found in all of the wastewater samples, none of the samples yielded a simian immunodeficiency virus-specific product. No PCR-amplified product was yielded when wastewater samples were directly used for the detection of HIV-1 and poliovirus type 1. The wastewater constituents appeared to be inhibitory to the enzymes reverse transcriptase and DNA polymerase.(ABSTRACT TRUNCATED AT 250 WORDS) Images PMID:1476440

  11. Role of RNA Polymerase III Transcription Factors in the Selection of Integration Sites by the Dictyostelium Non-Long Terminal Repeat Retrotransposon TRE5-A▿

    PubMed Central

    Siol, Oliver; Boutliliss, Moustapha; Chung, Thanh; Glöckner, Gernot; Dingermann, Theodor; Winckler, Thomas

    2006-01-01

    In the compact Dictyostelium discoideum genome, non-long terminal repeat (non-LTR) retrotransposons known as TREs avoid accidental integration-mediated gene disruption by targeting the vicinity of tRNA genes. In this study we provide the first evidence that proteins of a non-LTR retrotransposon interact with a target-specific transcription factor to direct its integration. We applied an in vivo selection system that allows for the isolation of natural TRE5-A integrations into a known genomic location upstream of tRNA genes. TRE5-A frequently modified the integration site in a way characteristic of other non-LTR retrotransposons by adding nontemplated extra nucleotides and generating small and extended target site deletions. Mutations within the B-box promoter of the targeted tRNA genes interfered with both the in vitro binding of RNA polymerase III transcription factor TFIIIC and the ability of TRE5-A to target these genes. An isolated B box was sufficient to enhance TRE5-A integration in the absence of a surrounding tRNA gene. The RNA polymerase III-transcribed ribosomal 5S gene recruits TFIIIC in a B-box-independent manner, yet it was readily targeted by TRE5-A in our assay. These results suggest a direct role of an RNA polymerase III transcription factor in the targeting process. PMID:16982688

  12. Rapid detection of pathogenic leptospires by lyophilized reagent-based polymerase chain reaction.

    PubMed

    Lee, S V; Tai, E S; Mutalib, A R; Khairani-Bejo, S; Bahaman, A R

    2011-12-01

    A simple and reliable tool for the early diagnosis of leptospirosis is urgently needed. We report the development of a lyophilized reagent-based polymerase chain reaction (PCR) assay targeting lipL32 gene, which is present only in pathogenic leptospires. To determine the effectiveness of the newly developed assay in the early diagnosis of leptospirosis, the sensitivity and specificity was evaluated. In simulated clinical samples, the assay was able to detect 10² and 10³ leptospires/ml in spiked urine and blood samples, respectively. In experimentally infected animals, leptospiral DNA could be detected in blood and lung samples as early as Day 1 post infection. This assay was also shown to be stable and remained sensitive for up to five months at ambient temperature. Hence, this lyophilized reagent-based PCR assay with high specificity, sensitivity and stability would provide a simple, rapid and reliable method in diagnosing acute leptospirosis, especially in the field of veterinary medicine.

  13. Rapid detection for rabbit-derived dermatophytes using microsatellite-primed polymerase chain reaction.

    PubMed

    Miao, Zengmin; Li, Song; Li, Daijun; Cai, Chunmei; Cai, Yumei

    2014-01-01

    A method exhibiting high sensitivity, specificity and rapidity to detect pathogenic dermatophytes was developed using microsatellite-primed polymerase chain reaction (PCR) in combination with a clustering method. The DNA fragments of Trichophyton mentagrophyton, Microsporum gypseum and Microsporum canis were amplified by using the primer (GACA)4 to detect the DNA polymorphism fingerprints. Twenty-one clinical strains identified as T. mentagrophyton, M. gypseum or M. canis by morphological methods were distinguished according to the differences of standard stains' bands combined with NTSYS-pc2.10 software. The results showed that there were obvious and direct differences in the bands of the three pathogenic dermatophytes, and the similarity of isolated strains and standard strains were above 90%, in line with the results of morphological identification. The method is more accurate, rapid and simple, which is meaningful for the clinical diagnosis and epidemic research of the dermatophytes.

  14. [The application of the polymerase chain reaction technic for the detection of human papillomavirus sequences].

    PubMed

    Soto, Y; Muné, M; Goicolea, A; Morales, E; Santoyo, J M; Valdés, O; Ramírez, R; Pimentel, T

    1998-01-01

    The polymerase chain reaction technique was applied to detect sequences of human Papillomavirus (HPV) by controls of cellular lines of cervical cancer and of tissues obtained through biopsy with a HPV-positive clinical diagnosis. A set of consensus oligonucleotides, which are complementary to a highly conserved region within the open reading frame E1 of the viral genome of HPV affecting the cervical mucosa, was used. With these primers it was possible to amplify DNA sequences corresponding to HPV 6 and 11, considered in the low risk group, and to HPV 16, 18, 31 and 33, included in the high risk group. The study of the sensitivity of the amplification technique showed a level of detection of 3,5 viral particles per each cellular diploid genome.

  15. Detection of Rickettsia rickettsii DNA in clinical specimens by using polymerase chain reaction technology.

    PubMed Central

    Tzianabos, T; Anderson, B E; McDade, J E

    1989-01-01

    A polymerase chain reaction (PCR) procedure for detecting rickettsial DNA was developed and shown to be specific for Rickettsia rickettsii and R. conorii, the etiologic agents of Rocky Mountain spotted fever (RMSF) and Boutonneuse fever, respectively. Blood clots were obtained from nine confirmed RMSF patients and six controls and analyzed for the presence of rickettsial DNA by the PCR method. A defined region of the rickettsial genome was successfully amplified from seven of the nine clinical specimens tested; all six control specimens gave negative results. These findings indicate that R. rickettsii can be detected early after the onset of RMSF, possibly facilitating the decision regarding appropriate antibiotic therapy for some patients. Further refinement of PCR technology could make this procedure a mainstay in the clinical laboratory. Images PMID:2512328

  16. Polymerase Chain Reaction-Based Detection Method Is Suitable for Dengue Infection During Epidemics.

    PubMed

    Iqbal, Kashif; Hashmi, Abu Saeed; Idrees, Muhammad; Shahzad, Sadeem; Fatima, Zareen

    2017-09-26

    Over the years, dengue fever has become a significant infectious disease in different parts of the world. Medical and public health services have been unable to deal with infection as there is no vaccine available for the prevention of this infection. With dengue, effective treatments are not available due to which severe symptoms may develop. To deal with this challenge, a sensitive and specific technique is required for its early diagnosis along with the knowledge of dengue serotype to increase the specificity of diagnosis and treatment. This study was designed to check the usefulness of immunological and nucleic acid-based molecular determination of dengue virus. The study recommends polymerase chain reaction as a suitable method for the rapid detection of dengue virus as it was found more sensitive than other utilized techniques, including antibodies detection. Nucleic acid analysis may also help to define the common serotypes/genotypes of dengue virus circulating in any region.

  17. Rapid detection of shrimp white spot syndrome virus by real time, isothermal recombinase polymerase amplification assay.

    PubMed

    Xia, Xiaoming; Yu, Yongxin; Weidmann, Manfred; Pan, Yingjie; Yan, Shuling; Wang, Yongjie

    2014-01-01

    White spot syndrome virus (WSSV) causes large economic losses to the shrimp aquaculture industry, and thus far there are no efficient therapeutic treatments available against this lethal virus. In this study, we present the development of a novel real time isothermal recombinase polymerase amplification (RPA) assay for WSSV detection on a small ESEQuant Tube Scanner device. The RPA sensitivity, specificity and rapidity were evaluated by using a plasmid standard as well as viral and shrimp genomic DNAs. Compared with qPCR, the RPA assay revealed more satisfactory performance. It reached a detection limit up to 10 molecules in 95% of cases as determined by probit analysis of 8 independent experiments within 6.41 ± 0.17 min at 39 °C. Consequently, this rapid RPA method has great application potential for field use or point of care diagnostics.

  18. Detection of Mycoplasma Contamination Directly from Culture Supernatant Using Polymerase Chain Reaction.

    PubMed

    Pisal, R V; Hrebíková, H; Chvátalová, J; Kunke, D; Filip, S; Mokrý, J

    2016-01-01

    Ensuring mycoplasma-free cell culture is of prime importance as they severely affect cellular characteristics leading to experimental artefacts and spurious results. Various methods persist for mycoplasma detection; out of the whole array of methods polymerase chain reaction (PCR) is the most favoured one because it is highly sensitive, specific and quick. The PCR-based detection procedure involves three steps: cell culture supernatant collection, DNA isolation, and PCR. We have modified this procedure so that cell culture supernatant can directly be used for PCR without the need for DNA extraction. This modification makes the procedure quicker and more sensitive because loss of mycoplasma DNA is prevented and this loss becomes more significant when the level of mycoplasma contamination is very low.

  19. Polymerase Chain Reaction Detection of Trypanosoma cruzi in Macaca fascicularis Using Archived Tissues

    PubMed Central

    Williams, Jeff T.; Mubiru, James N.; Schlabritz-Loutsevitch, Natalia E.; Rubicz, Rohina C.; VandeBerg, John L.; Dick, Edward J.; Hubbard, Gene B.

    2009-01-01

    This study describes conventional and real-time polymerase chain reaction (PCR) methods developed to detect and quantify Trypanosoma cruzi DNA in cynomolgus monkeys (Macaca fascicularis) using formalin-fixed paraffin-embedded blocks archived for periods of up to 6 years. The highest concentration of T. cruzi DNA was found in the myocardium, urinary bladder, stomach, lymph node, adrenal gland, and colon. The concentration of T. cruzi DNA detected in cardiac tissues was 10–100-fold greater than found elsewhere; the mean concentrations of T. cruzi DNA in non-cardiac tissues were otherwise comparable. Trypanosoma cruzi DNA was amplified from cerebrum but not cerebellum or kidney. Successful use of DNA from formalin-fixed, paraffin-embedded blocks is important because most pathology laboratories routinely archive wax blocks. This archived resource can be used for further studies on the prevalence of this disease. PMID:19635875

  20. Glyco-seek: Ultrasensitive Detection of Protein-Specific Glycosylation by Proximity Ligation Polymerase Chain Reaction.

    PubMed

    Robinson, Peter V; Tsai, Cheng-Ting; de Groot, Amber E; McKechnie, Julia L; Bertozzi, Carolyn R

    2016-08-31

    We report a non-destructive biochemical technique, termed "Glyco-seek", for analysis of O-GlcNAcylated proteins. Glyco-seek combines chemoenzymatic labeling, proximity ligation, and quantitative polymerase chain reaction to detect O-GlcNAcylated proteins with ultrahigh sensitivity. Our glycan-specific assay can be paired with traditional proximity ligation assays to simultaneously determine the change in total protein levels. We show that Glyco-seek detects attomoles of glycoproteins of interest from cell lysates, with sensitivity several orders of magnitude higher than that of current techniques. We used the method to directly assay the O-GlcNAcylation status of a low-abundance transcription factor from cell lysates without need for isolation or enrichment.

  1. Detection of Escherichia coli in sewage and sludge by polymerase chain reaction

    SciTech Connect

    Tsai, Yuli; Palmer, C.J.; Sangermano, L.R. )

    1993-02-01

    The polymerase chain reaction (PCR) is a powerful tool in exploration of microbial activities and identities in environmental microbiology. High concentrations of humic acidlike substances in raw sewage and raw sludge have prevented the use of PCR with sewage and sludge samples. However, monitoring waste water and sludge by the PCR would lead to increased public health protection. In this study a rapid DNA extraction method and rapid purification procedure are combined with the PCR to detect Escherichia coli in sewage and sludge. The PCR is successfully used to amplify from both, a fragment of the E. coli uidAgene that codes for [beta]-D-glucuronidase. Because of their sensitivity and specificity, the PCR and nonradioactive gene probe techniques can be used to detect potentially pathogenic microorganisms in raw sewage and sludge, allowing for evaluation of the efficiency of treatments to remove pathogens.

  2. DNA-Dependent RNA Polymerase Detects Hidden Giant Viruses in Published Databanks

    PubMed Central

    Sharma, Vikas; Colson, Philippe; Giorgi, Roch; Pontarotti, Pierre; Raoult, Didier

    2014-01-01

    Environmental metagenomic studies show that there is a “dark matter,” composed of sequences not linked to any known organism, as determined mainly using ribosomal DNA (rDNA) sequences, which therefore ignore giant viruses. DNA-dependent RNA polymerase (RNAP) genes are universal in microbes and conserved in giant viruses and may replace rDNA for identifying microbes. We found while reconstructing RNAP subunit 2 (RNAP2) phylogeny that a giant virus sequenced together with the genome of a large eukaryote, Hydra magnipapillata, has been overlooked. To explore the dark matter, we used viral RNAP2 and reconstructed putative ancestral RNAP2, which were significantly superior in detecting distant clades than current sequences, and we revealed two additional unknown mimiviruses, misclassified as an euryarchaeote and an oomycete plant pathogen, and detected unknown putative viral clades. We suggest using RNAP systematically to decipher the black matter and identify giant viruses. PMID:24929085

  3. Discrepancies between Antigen and Polymerase Chain Reaction Tests for the Detection of Rotavirus and Norovirus.

    PubMed

    Kim, Hyun Soo; Kim, Jae-Seok

    2016-05-01

    We compared the results of an antigen test (ELISA) with those of polymerase chain reaction (PCR) for the detection of rotavirus and norovirus in stool specimens. Rotavirus and norovirus antigen-positive stool specimens were collected, and rotavirus and norovirus PCRs were performed on these specimens. Of the 325 rotavirus antigen-positive specimens, 200 were positive for both assays and 125 were PCR negative. Of 286 norovirus antigen-positive specimens, 51 were PCR negative. Comparison of the lower limit of detection showed that rotavirus PCR was 16 times more sensitive and norovirus PCR was over 4,000 times more sensitive than the ELISA. Discrepant results between ELISA and PCR were common, and the possibility of false-positive and false-negative results should be considered with rotavirus and norovirus assays.

  4. Isothermal recombinase polymerase amplification assay applied to the detection of group B streptococci in vaginal/anal samples.

    PubMed

    Daher, Rana K; Stewart, Gale; Boissinot, Maurice; Bergeron, Michel G

    2014-04-01

    Group B streptococcal infections are the leading cause of sepsis and meningitis in newborns. A rapid and reliable method for the detection of this pathogen at the time of delivery is needed for the early treatment of neonates. Isothermal amplification techniques such as recombinase polymerase amplification have advantages relative to PCR in terms of the speed of reaction and simplicity. We studied the clinical performance of recombinase polymerase amplification for the screening of group B streptococci in vaginal/anal samples from 50 pregnant women. We also compared the limit of detection and the analytical specificity of this isothermal assay to real-time PCR (RT-PCR). Compared to RT-PCR, the recombinase polymerase amplification assay showed a clinical sensitivity of 96% and a clinical specificity of 100%. The limit of detection was 98 genome copies and the analytical specificity was 100% for a panel of 15 bacterial and/or fungal strains naturally found in the vaginal/anal flora. Time-to-result for the recombinase polymerase amplification assay was <20 min compared to 45 min for the RT-PCR assay; a positive sample could be detected as early as 8 min. We demonstrate the potential of isothermal recombinase polymerase amplification assay as a clinically useful molecular diagnostic tool that is simple and faster than PCR/RT-PCR. Recombinase polymerase amplification offers great potential for nucleic acid-based diagnostics at the point of care.

  5. Detection of schistosomes polymerase chain reaction amplified DNA by oligochromatographic dipstick.

    PubMed

    Akinwale, O P; Laurent, T; Mertens, P; Leclipteux, T; Rollinson, D; Kane, R; Emery, A; Ajayi, M B; Akande, D O; Fesobi, T W

    2008-08-01

    The applications of highly specific and sensitive molecular techniques based on polymerase chain reaction (PCR) have constituted a valuable tool for the diagnosis of schistosomiasis and also for the detection of schistosome infections in the snail intermediate hosts. The common method of detecting PCR amplicons is gel electrophoresis in the presence of ethidium bromide, a carcinogen, which is followed by UV transillumination. Other methods, which are available for detecting PCR products, are real-time PCR, PCR-enzyme-linked immunosorbent assay (PCR-ELIZA) and mass spectrometry but they are cumbersome while they are sometimes complex and expensive. Therefore, a simple method of PCR product detection would be a welcome idea and a most valuable tool particularly in disease endemic countries with limited research facilities and resources. In this study, we applied a simple and rapid method for the detection of Schistosoma haematobium and Schistosoma mansoni PCR amplified DNA products using oligochromatographic (OC) dipstick. The amplicons are visualized by hybridization with a gold conjugated probe, while a control for the chromatographic migration is incorporated in the assay. The lower detection limit observed was 10fg of genomic DNA from each of the two species, while the dipstick was also specific for each of the species used in this study.

  6. Development of a Recombinase Polymerase Amplification Assay for Rapid Detection of the Mycobacterium avium subsp. paratuberculosis

    PubMed Central

    Hansen, Sören; Schäfer, Jenny; Fechner, Kim; Czerny, Claus-Peter; Abd El Wahed, Ahmed

    2016-01-01

    Background The detection of Mycobacterium avium subsp. paratuberculosis (MAP) infections in ruminants is crucial to control spread among animals and to humans. Cultivation of MAP is seen as the gold standard for detection, although it is very time consuming and labour intensive. In addition, several PCR assays have been developed to detect MAP in around 90 minutes, but these assays required highly sophisticated equipment as well as lengthy and complicated procedure. Methodology/Principal Findings In this study, we have developed a rapid assay for the detection of MAP based on the recombinase polymerase amplification (RPA) assay targeting a MAP specific region, the IS900 gene. The detection limit was 16 DNA molecules in 15 minutes as determined by the probit analysis on eight runs of the plasmid standard. Cross reactivity with other mycobacterial and environmentally associated bacterial strains was not observed. The clinical performance of the MAP RPA assay was tested using 48 MAP-positive and 20 MAP-negative blood, sperm, faecal and tissue samples. All results were compared with reads of a highly sensitive real-time PCR assay. The specificity of the MAP RPA assay was 100%, while the sensitivity was 89.5%. Conclusions/Significance The RPA assay is quicker and much easier to handle than real-time PCR. All RPA reagents were cold-chain independent. Moreover, combining RPA assay with a simple extraction protocol will maximize its use at point of need for rapid detection of MAP. PMID:27992571

  7. Detection of Magnaporthe grisea in infested rice seeds using polymerase chain reaction.

    PubMed

    Chadha, S; Gopalakrishna, T

    2006-05-01

    To develop a diagnostic assay based on polymerase chain reaction for the detection of Magnaporthe grisea from infested rice seeds. Primers were designed based on the nucleotide sequence of the mif 23, an infection-specific gene of M. grisea. The primers amplified target DNA from genetically and geographically diverse isolates of the pathogen. The lowest concentration of template DNA that led to amplification was 20 rhog. No PCR product was detected when DNA from other fungi was used, indicating the specificity of the primers. With this PCR based seed assay, M. grisea was detected in rice seedlots with infestation rates as low as 0.2%. The PCR detection of M. grisea is simple, rapid, specific, sensitive and suitable for the routine detection of the pathogen in infested seeds. Introduction of the blast fungus into new areas where it has not been previously recorded could be avoided by the detection of infested seedlots. A PCR-based seed assay could facilitate risk assessment of naturally infested rice seeds; help design management programs and optimize fungicide use.

  8. Rapid Detection of Cyprinid Herpesvirus 3 in Latently Infected Koi by Recombinase Polymerase Amplification.

    PubMed

    Prescott, Meagan A; Reed, Aimee N; Jin, Ling; Pastey, Manoj K

    2016-09-01

    Since the emergence of cyprinid herpesvirus 3 (CyHV-3), outbreaks have been devastating to Common Carp Cyprinus carpio and koi (a variant of Common Carp), leading to high economic losses. Current diagnostics for detecting CyHV-3 are limited in sensitivity and are further complicated by latency. Here we describe the detection of CyHV-3 by recombinase polymerase amplification (RPA). The RPA assay can detect as low as 10 copies of the CyHV-3 genome by an isothermal reaction and yields results in approximately 20 min. Using the RPA assay, the CyHV-3 genome can be detected in the total DNA of white blood cells isolated from koi latently infected with CyHV-3, while less than 10% of the latently infected koi can be detected by a real-time PCR assay in the total DNA of white blood cells. In addition, RPA products can be detected in a lateral flow device that is cheap and fast and can be used outside of the diagnostic lab. The RPA assay and lateral flow device provide for the rapid, sensitive, and specific amplification of CyHV-3 that with future modifications for field use and validation could lead to enhanced surveillance and early diagnosis of CyHV-3 in the laboratory and field. Received September 14, 2015; accepted April 9, 2016.

  9. Development of a Recombinase Polymerase Amplification Assay for Rapid Detection of the Mycobacterium avium subsp. paratuberculosis.

    PubMed

    Hansen, Sören; Schäfer, Jenny; Fechner, Kim; Czerny, Claus-Peter; Abd El Wahed, Ahmed

    2016-01-01

    The detection of Mycobacterium avium subsp. paratuberculosis (MAP) infections in ruminants is crucial to control spread among animals and to humans. Cultivation of MAP is seen as the gold standard for detection, although it is very time consuming and labour intensive. In addition, several PCR assays have been developed to detect MAP in around 90 minutes, but these assays required highly sophisticated equipment as well as lengthy and complicated procedure. In this study, we have developed a rapid assay for the detection of MAP based on the recombinase polymerase amplification (RPA) assay targeting a MAP specific region, the IS900 gene. The detection limit was 16 DNA molecules in 15 minutes as determined by the probit analysis on eight runs of the plasmid standard. Cross reactivity with other mycobacterial and environmentally associated bacterial strains was not observed. The clinical performance of the MAP RPA assay was tested using 48 MAP-positive and 20 MAP-negative blood, sperm, faecal and tissue samples. All results were compared with reads of a highly sensitive real-time PCR assay. The specificity of the MAP RPA assay was 100%, while the sensitivity was 89.5%. The RPA assay is quicker and much easier to handle than real-time PCR. All RPA reagents were cold-chain independent. Moreover, combining RPA assay with a simple extraction protocol will maximize its use at point of need for rapid detection of MAP.

  10. Optimization of the reverse transcriptase polymerase chain reaction for the detection of circulating prostate cells

    PubMed Central

    McIntyre, I G; Spreckley, K; Clarke, R B; Anderson, E; Clarke, N W; George, N J R

    2000-01-01

    The reverse transcriptase polymerase chain reaction (RT-PCR) is a sensitive technique that can detect prostate-specific messenger RNA in circulating blood. Many authors have studied the potential of RT-PCR as a staging technique in prostate cancer (PC). Clinical sensitivity and in some cases specificity has been disappointing. Few authors have been able to correlate RT-PCR result with patient stage. We have compared the results of using two different RT-PCR protocols with different sensitivities on blood samples from prostate cancer patients. An 80-amplification-cycle nested primer RT-PCR assay had a detection limit of 10 prostate cells and a 50-cycle RT-PCR could detect 20 cells in 5 ml blood. The 80-cycle assay detected prostate mRNA in four of 10 female samples, whereas the 50-cycle assay detected it in none. There was little difference in the assays’ ability to detect prostate mRNA in advanced PC patients. The 50-cycle assay could differentiate between hormone-escaped, stable hormone-treated and untreated localized PC patients, whereas the 80-cycle assay could not. Each blood sample must be assayed several times with RT-PCR to avoid false-negative results and, if this is done, assay specificity can be increased with little effect on clinical sensitivity. © 2000 Cancer Research Campaign PMID:10993644

  11. TYPE III EXCITABILITY, SLOPE SENSITIVITY AND COINCIDENCE DETECTION

    PubMed Central

    Meng, Xiangying; Huguet, Gemma; Rinzel, John

    2013-01-01

    Some neurons in the nervous system do not show repetitive firing for steady currents. For time-varying inputs, they fire once if the input rise is fast enough. This property of phasic firing is known as Type III excitability. Type III excitability has been observed in neurons in the auditory brainstem (MSO), which show strong phase-locking and accurate coincidence detection. In this paper, we consider a Hodgkin-Huxley type model (RM03) that is widely-used for phasic MSO neurons and we compare it with a modification of it, showing tonic behavior. We provide insight into the temporal processing of these neuron models by means of developing and analyzing two reduced models that reproduce qualitatively the properties of the exemplar ones. The geometric and mathematical analysis of the reduced models allows us to detect and quantify relevant features for the temporal computation such as nearness to threshold and a temporal integration window. Our results underscore the importance of Type III excitability for precise coincidence detection. PMID:23667306

  12. Detection of Listeria monocytogenes in cheese with the magnetic immuno-polymerase chain reaction assay.

    PubMed

    Fluit, A C; Torensma, R; Visser, M J; Aarsman, C J; Poppelier, M J; Keller, B H; Klapwijk, P; Verhoef, J

    1993-05-01

    A new detection system, the magnetic immuno-polymerase chain reaction (PCR) assay (MIPA) has been developed to detect Listeria monocytogenes in food. This method separates Listeria cells from PCR-inhibitory factors present in enrichment broths containing food samples by using magnetic beads coated with specific monoclonal antibodies (MAbs). The separated bacteria were lysed, and the supernatant containing the bacterial DNA was subjected to the PCR. Detection of L. monocytogenes in three naturally contaminated cheese samples with two different MAbs and PCR primers specific for the gene encoding the delayed-hypersensitivity factor showed that with MAb 55 all three samples were positive whereas with MAb A two samples were positive. A further improvement of the method was obtained by using a PCR step based on the listeriolysin O gene. A MIPA employing MAb 55 and the listeriolysin O gene primer set detected L. monocytogenes after 24 h of culture in Listeria Enrichment Broth samples from Port Salut artificially contaminated with 40 CFU/25 g. We could detect 1 CFU of L. monocytogenes per g of cheese after a second enrichment for 24 h in Fraser broth. The analysis time including both enrichments is approximately 55 h.

  13. Development of a recombinase polymerase amplification assay for the detection of pathogenic Leptospira.

    PubMed

    Ahmed, Ahmed; van der Linden, Hans; Hartskeerl, Rudy A

    2014-05-08

    Detection of leptospires based on DNA amplification techniques is essential for the early diagnosis of leptospirosis when anti-Leptospira antibodies are below the detection limit of most serological tests. In middle and low income countries where leptospirosis is endemic, routine implementation of real-time PCR is financially and technically challenging due to the requirement of expensive thermocycler equipment. In this study we report the development and evaluation of a novel isothermal recombinase polymerase amplification assay (RPA) for detection of pathogenic Leptospira based on TwistAmp chemistry. RPA enabled the detection of less than two genome copies per reaction. Retrospective evaluation revealed a high diagnostic accuracy (sensitivity and specificity of 94.7% and 97.7%, respectively) compared to culturing as the reference standard. RPA presents a powerful tool for the early diagnosis of leptospirosis in humans and in animals. Furthermore, it enables the detection of the causative agent in reservoirs and environment, and as such is a valuable adjunct to current tools for surveillance and early outbreak warning.

  14. Cross-subtype detection of HIV-1 using reverse transcription and recombinase polymerase amplification.

    PubMed

    Lillis, Lorraine; Lehman, Dara A; Siverson, Joshua B; Weis, Julie; Cantera, Jason; Parker, Mathew; Piepenburg, Olaf; Overbaugh, Julie; Boyle, David S

    2016-04-01

    A low complexity diagnostic test that rapidly and reliably detects HIV infection in infants at the point of care could facilitate early treatment, improving outcomes. However, many infant HIV diagnostics can only be performed in laboratory settings. Recombinase polymerase amplification (RPA) is an isothermal amplification technology that can rapidly amplify proviral DNA from multiple subtypes of HIV-1 in under twenty minutes without complex equipment. In this study we added reverse transcription (RT) to RPA to allow detection of both HIV-1 RNA and DNA. We show that this RT-RPA HIV-1 assay has a limit of detection of 10-30 copies of an exact sequence matched DNA or RNA, respectively. In addition, at 100 copies of RNA or DNA, the assay detected 171 of 175 (97.7%) sequence variants that represent all the major subtypes and recombinant forms of HIV-1 Groups M and O. This data suggests that the application of RT-RPA for the combined detection of HIV-1 viral RNA and proviral DNA may prove a highly sensitive tool for rapid and accurate diagnosis of infant HIV.

  15. Development of a reverse transcription polymerase chain reaction method for yellow fever virus detection.

    PubMed

    Méndez, María C; Domingo, Cristina; Tenorio, Antonio; Pardo, Lissethe C; Rey, Gloria J; Méndez, Jairo A

    2013-09-01

    Yellow fever is considered a re-emerging disease and is endemic in tropical regions of Africa and South America. At present, there are no standardized or commercialized kits available for yellow fever virus detection. Therefore, diagnosis must be made by time-consuming routine techniques, and sometimes, the virus or its proteins are not detected. Furthermore, co-circulation with other flaviviruses, including dengue virus, increases the difficulty of diagnosis. To develop a specific reverse transcriptase-polymerase chain reaction (RT-PCR) and nested PCR-based assay to improve the detection and diagnosis of yellow fever virus using both serum and fresh tissue samples. RT-PCR primers were designed to amplify a short fragment of all yellow fever virus genotypes reported. A second set of primers was used in a nested PCR to increase sensitivity. Thirty-three clinical samples were tested with the standardized reaction. The expected amplicon was obtained in 25 out of 33 samples analyzed using this approach, and 2 more samples tested positive after a subsequent nested PCR approach. This improved technique not only ensures the specific detection of a wide range of yellow fever virus genotypes but also may increase the sensitivity of detection by introducing a second round of amplification, allowing a rapid differential diagnosis between dengue and yellow fever infection, which is required for effective surveillance and opportune epidemiologic measures.

  16. Immunohistochemistry and Polymerase Chain Reaction for Detection Human Papilloma Virus in Warts: A Comparative Study.

    PubMed

    Lee, Hong Sun; Lee, Ji Hyun; Choo, Ji Yoon; Byun, Hee Jin; Jun, Jin Hyun; Lee, Jun Young

    2016-08-01

    Immunohistochemistry and polymerase chain reaction (PCR) are the most widely used methods for the detection of viruses. PCR is known to be a more sensitive and specific method than the immunohistochemical method at this time, but PCR has the disadvantages of high cost and skilled work to use widely. With the progress of technology, the immunohistochemical methods used in these days has come to be highly sensitive and actively used in the diagnostic fields. To evaluate and compare the usefulness of immunohistochemistry and PCR for detection human papilloma virus (HPV) in wart lesions. Nine biopsy samples of verruca vulgaris and 10 of condyloma accuminatum were examined. Immunohistochemical staining using monoclonal antibody to HPV L1 capsid protein and PCR were done for the samples. DNA sequencing of the PCR products and HPV genotyping were also done. HPV detection rate was 78.9% (88.9% in verruca vulgaris, 70.0% in condyloma accuminatum) on immunohistochemistry and 100.0% for PCR. HPV-6 genotype showed a lower positivity rate on immunohistochemistry (50.0%) as compared to that of the other HPV genotypes. Immunohistochemistry for HPV L1 capsid protein showed comparable sensitivity for detection HPV. Considering the high cost and great effort needed for the PCR methods, we can use immunohistochemistry for HPV L1 capsid protein with the advantage of lower cost and simple methods for HPV detection.

  17. Cross-subtype Detection of HIV-1 Using Reverse Transcription and Recombinase Polymerase Amplification

    PubMed Central

    Lillis, Lorraine; Lehman, Dara A.; Siverson, Joshua B.; Weis, Julie; Cantera, Jason; Parker, Mathew; Piepenburg, Olaf; Overbaugh, Julie; Boyle, David S.

    2016-01-01

    A low complexity diagnostic test that rapidly and reliably detects HIV infection in infants at the point of care could facilitate early treatment, improving outcomes. However, many infant HIV diagnostics can only be performed in laboratory settings. Recombinase polymerase amplification (RPA) is an isothermal amplification technology that can rapidly amplify proviral DNA from multiple subtypes of HIV-1 in under twenty minutes without complex equipment. In this study we added reverse transcription (RT) to RPA to allow detection of both HIV-1 RNA and DNA. We show that this RT-RPA HIV-1 assay has a limit of detection of 10 to 30 copies of an exact sequence matched DNA or RNA, respectively. In addition, at 100 copies of RNA or DNA, the assay detected 171 of 175 (97.7 %) sequence variants that represent all the major subtypes and recombinant forms of HIV-1 Groups M and O. This data suggests that the application of RT-RPA for the combined detection of HIV-1 viral RNA and proviral DNA may prove a highly sensitive tool for rapid and accurate diagnosis of infant HIV. PMID:26821087

  18. Development of a Recombinase Polymerase Amplification Assay for the Detection of Pathogenic Leptospira

    PubMed Central

    Ahmed, Ahmed; van der Linden, Hans; Hartskeerl, Rudy A.

    2014-01-01

    Detection of leptospires based on DNA amplification techniques is essential for the early diagnosis of leptospirosis when anti-Leptospira antibodies are below the detection limit of most serological tests. In middle and low income countries where leptospirosis is endemic, routine implementation of real-time PCR is financially and technically challenging due to the requirement of expensive thermocycler equipment. In this study we report the development and evaluation of a novel isothermal recombinase polymerase amplification assay (RPA) for detection of pathogenic Leptospira based on TwistAmp chemistry. RPA enabled the detection of less than two genome copies per reaction. Retrospective evaluation revealed a high diagnostic accuracy (sensitivity and specificity of 94.7% and 97.7%, respectively) compared to culturing as the reference standard. RPA presents a powerful tool for the early diagnosis of leptospirosis in humans and in animals. Furthermore, it enables the detection of the causative agent in reservoirs and environment, and as such is a valuable adjunct to current tools for surveillance and early outbreak warning. PMID:24814943

  19. Detection of Giardia cysts by using the polymerase chain reaction and distinguishing live from dead cysts.

    PubMed Central

    Mahbubani, M H; Bej, A K; Perlin, M; Schaefer, F W; Jakubowski, W; Atlas, R M

    1991-01-01

    A method was developed for the detection of Giardia cysts by using the polymerase chain reaction (PCR) and the giardin gene as the target. DNA amplification by PCR, using giardin DNA as the target, resulted in detection of both live and dead cysts. When giardin mRNA was used as the target, the ability to amplify cDNA by PCR depended on the mode of killing. Cysts killed by freezing were not detected by PCR when giardin mRNA was the target. Cysts killed by heating or exposure to monochloramine, however, gave positive detection signals for both DNA and giardin mRNA targets. The amount of giardin mRNA and total RNA was significantly increased in live cysts following the induction of excystation. Cysts killed by freezing, heating, or exposure to monochloramine did not show a change in RNA content. The detection of the giardin gene by PCR permits a sensitive and specific diagnosis for Giardia spp. Discrimination between live and dead cysts can be made by measuring the amounts of RNA or PCR-amplified product from the giardin mRNA target before and after the induction of excystation. Images PMID:1785923

  20. Recombinase Polymerase Amplification Compared to Real-Time Polymerase Chain Reaction Test for the Detection of Fasciola hepatica in Human Stool.

    PubMed

    Cabada, Miguel M; Malaga, Jose L; Castellanos-Gonzalez, Alejandro; Bagwell, Kelli A; Naeger, Patrick A; Rogers, Hayley K; Maharsi, Safa; Mbaka, Maryann; White, A Clinton

    2017-02-08

    Fasciola hepatica is the most widely distributed trematode infection in the world. Control efforts may be hindered by the lack of diagnostic capacity especially in remote endemic areas. Polymerase chain reaction (PCR)-based methods offer high sensitivity and specificity but require expensive technology. However, the recombinase polymerase amplification (RPA) is an efficient isothermal method that eliminates the need for a thermal cycler and has a high deployment potential to resource-limited settings. We report on the characterization of RPA and PCR tests to detect Fasciola infection in clinical stool samples with low egg burdens. The sensitivity of the RPA and PCR were 87% and 66%, respectively. Both tests were 100% specific showing no cross-reactivity with trematode, cestode, or nematode parasites. In addition, RPA and PCR were able to detect 47% and 26% of infections not detected by microscopy, respectively. The RPA adapted to a lateral flow platform was more sensitive than gel-based detection of the reaction products. In conclusion, the Fasciola RPA is a highly sensitive and specific test to diagnose chronic infection using stool samples. The Fasciola RPA lateral flow has the potential for deployment to endemic areas after further characterization. © The American Society of Tropical Medicine and Hygiene.

  1. Detection of hepatitis C virus RNA by a combined reverse transcription-polymerase chain reaction assay.

    PubMed Central

    Young, K K; Resnick, R M; Myers, T W

    1993-01-01

    Amplification of RNA by the polymerase chain reaction (PCR) is normally a two-step process requiring separate enzymes and buffer conditions. We describe a combined reverse transcription-PCR (RT-PCR) assay for hepatitis C virus (HCV) RNA amplification in which a single enzyme and buffer condition are used. In this assay, both the RT and PCR steps are carried out with the thermoactive DNA polymerase of Thermus thermophilus. A transcription vector containing HCV sequences has also been constructed to generate quantifiable HCV RNA templates that can be used to optimize reaction conditions and to assess the efficiency of amplification. Amplification from < or = 100 copies of RNA was detected reproducibly by gel electrophoresis. The assay sensitivity was increased to 10 RNA copies by hybridization to a probe. The patterns of viremia in three individuals infected with HCV were examined by amplification of HCV RNA from plasma samples collected serially over a period of 1 year. These results were correlated with the times of seroconversion and the onset of rise in levels of alanine aminotransferase in serum. In all three subjects, HCV RNA was detected prior to seroconversion and the initial rise in levels of alanine aminotransferase in serum. Upon seroconversion, HCV RNA fell to a level below the detection limit of the assay. This pattern of transient viremia appears to be characteristic of acute, resolving HCV infections. The combined RT-PCR assay is a sensitive method which circumvents the problems associated with PCR amplification of RNA. Using this assay, we demonstrated that three donors infected by the same index case all have similar patterns of viremia. Images PMID:8385151

  2. Quantitative multiplexed detection of common pulmonary fungal pathogens by labeled primer polymerase chain reaction.

    PubMed

    Gu, Zhengming; Buelow, Daelynn R; Petraitiene, Ruta; Petraitis, Vidmantas; Walsh, Thomas J; Hayden, Randall T

    2014-11-01

    Invasive fungal infections are an important cause of morbidity and mortality among immunocompromised patients. To design and evaluate a multiplexed assay aimed at quantitative detection and differentiation of the 5 molds that are most commonly responsible for pulmonary infections. Using labeled primer polymerase chain reaction chemistry, an assay was designed to target the 5.8S and 28S ribosomal RNA genes of Aspergillus spp, Fusarium spp, Scedosporium spp, and members of the order Mucorales ( Rhizopus oryzae , Rhizopus microsporus, Cunninghamella bertholletiae, Mucor circinelloides, Lichtheimia corymbifera, and Rhizomucor pusillus). This assay was split into 2 multiplexed reactions and was evaluated using both samples seeded with purified nucleic acid from 42 well-characterized clinical fungal isolates and 105 archived samples (47 blood [45%], 42 bronchoalveolar lavage fluid [40%], and 16 tissue [15%]) collected from rabbit models of invasive pulmonary fungal infections. Assay detection sensitivity was less than 25 copies of the target sequence per reaction for Aspergillus spp, 5 copies for Fusarium spp and Scedosporium spp, and 10 copies for the Mucorales. The assay showed quantitative linearity from 5 × 10(1) to 5 × 10(5) copies of target sequence per reaction. Sensitivities and specificities for bronchoalveolar lavage fluid, tissue, and blood samples were 0.86 and 0.99, 0.60 and 1.00, and 0.46 and 1.00, respectively. Labeled primer polymerase chain reaction permits rapid, quantitative detection and differentiation of common agents of invasive fungal infection. The assay described herein shows promise for clinical implementation that may have a significant effect on the rapid diagnosis and treatment of patients' severe infections caused by these pulmonary fungal pathogens.

  3. Eradication of polymerase chain reaction-detectable chronic lymphocytic leukemia cells is associated with improved outcome after bone marrow transplantation.

    PubMed

    Provan, D; Bartlett-Pandite, L; Zwicky, C; Neuberg, D; Maddocks, A; Corradini, P; Soiffer, R; Ritz, J; Nadler, L M; Gribben, J G

    1996-09-15

    In chronic lymphocytic leukemia (CLL), clonal rearrangement of the immunoglobulin heavy chain locus (IgH) provides a useful marker for the detection of minimal residual disease (MRD) after treatment. At the time of initial presentation, DNA from patients with CLL was polymerase chain reaction (PCR)-amplified using consensus Variable (VH) and Joining (JH) region primers using complementarity determining region III consensus region primers or a panel of VH family-specific framework region 1 (FR1) primers. The clonal product was directly sequenced and patient-specific probes constructed using N region nucleotide sequences. We amplified and sequenced the CDRIII region and designed patient specific oligonucleotide probes for the detection of MRD in 55 of 66 patients (84%, 90% Confidence Intervals (CI): 74% to 90%) with poor prognosis CLL referred for autologous and allogeneic bone marrow transplantation (BMT). To determine the clinical utility of this technique, PCR amplification was performed on patient samples at the time of and following autologous (21 patients) and allogeneic (10 patients) BMT in whom serial bone marrow samples obtained after BMT were available for analysis. We show that the persistence of MRD after BMT is associated with increased probability of relapse. In all cases that have relapsed to date, the IgH CDRII region was identical at the time of initial presentation and at relapse suggesting that clonal evolution of the IgH locus is unusual in this disease. The finding that a significant number of patients remain disease free and with no evidence of PCR-detectable MRD after BMT suggests that high-dose therapy may contribute to improved outcome in selected patients with CLL.

  4. Specific detection of Flt3 point mutations by highly sensitive real-time polymerase chain reaction in acute myeloid leukemia.

    PubMed

    Scholl, Sebastian; Krause, Claudia; Loncarevic, Ivan F; Müller, Rouven; Kunert, Christa; Wedding, Ulrich; Sayer, Herbert G; Clement, Joachim H; Höffken, Klaus

    2005-06-01

    Among activating class III receptor tyrosine kinase (Flt3) mutations, internal tandem duplications of Flt3 (Flt3-ITD) are detected in about 25% of patients with acute myeloid leukemia (AML). In contrast, mutations within the tyrosine kinase domain of Flt3 (Flt3-TKD mutations) are less frequent (approximately 7%), and there are only limited data on the frequency of recently demonstrated activating Flt3 point mutation at codon 592 (Flt3-V592A mutation). We evaluated a new approach for rapid screening of Flt3-TKD and Flt3-V592A mutations using the fluorescence resonance energy transfer (FRET) principle in a group of 122 patients. Based on individual Flt3-TKD mutations, we designed patient-specific primers to perform a highly sensitive polymerase chain reaction (PCR) assay for rapid detection of minimal residual disease (MRD). We also used a model system with MonoMac-6 cells carrying the Flt3-V592A mutation to establish a mutation-specific real-time PCR approach also for this molecular aberration. We identified 9 cases (8%) of Flt3-TKD mutations (5 cases of mutation D835Y, 3 cases of mutation D835H, and 1 case of mutation Del836), and no cases of Flt3-V592A mutation. Screening for Flt3-TKD mutations with fluorescent probes is equivalent to conventional screening using standard PCR followed by EcoRV restriction. We present a real-time PCR protocol that can be used for MRD analyses based on individual Flt3-TKD mutations. Examples of MRD analyses are presented for all 3 subtypes of Flt3-TKD mutation identified in this study. In summary, we demonstrate new methodological approaches for rapid screening of Flt3 point mutations and for detection of MRD based on patient-specific Flt3-TKD mutations.

  5. The B-WICH chromatin-remodelling complex regulates RNA polymerase III transcription by promoting Max-dependent c-Myc binding

    PubMed Central

    Sadeghifar, Fatemeh; Böhm, Stefanie; Vintermist, Anna; Östlund Farrants, Ann-Kristin

    2015-01-01

    The chromatin-remodelling complex B-WICH, comprised of William syndrome transcription factor, the ATPase SNF2h and nuclear myosin, specifically activates RNA polymerase III transcription of the 5S rRNA and 7SL genes. However, the underlying mechanism is unknown. Using high-resolution MN walking we demonstrate here that B-WICH changes the chromatin structure in the vicinity of the 5S rRNA and 7SL RNA genes during RNA polymerase III transcription. The action of B-WICH is required for the binding of the RNA polymerase machinery and the regulatory factors c-Myc at the 5S rRNA and 7SL RNA genes. In addition to the c-Myc binding site at the 5S genes, we have revealed a novel c-Myc and Max binding site in the intergenic spacer of the 5S rDNA. This region also contains a region remodelled by B-WICH. We demonstrate that c-Myc binds to both sites in a Max-dependent way, and thereby activate transcription by acetylating histone H3. The novel binding patterns of c-Myc and Max link transcription of 5S rRNA to the Myc/Max/Mxd network. Since B-WICH acts prior to c-Myc and other factors, we propose a model in which the B-WICH complex is required to maintain an open chromatin structure at these RNA polymerase III genes. This is a prerequisite for the binding of additional regulatory factors. PMID:25883140

  6. Investigation of polymerase chain reaction assays to improve detection of bacterial involvement in bovine respiratory disease.

    PubMed

    Bell, Colin J; Blackburn, Paul; Elliott, Mark; Patterson, Tony I A P; Ellison, Sean; Lahuerta-Marin, Angela; Ball, Hywel J

    2014-09-01

    Bovine respiratory disease (BRD) causes severe economic losses to the cattle farming industry worldwide. The major bacterial organisms contributing to the BRD complex are Mannheimia haemolytica, Histophilus somni, Mycoplasma bovis, Pasteurella multocida, and Trueperella pyogenes. The postmortem detection of these organisms in pneumonic lung tissue is generally conducted using standard culture-based techniques where the presence of therapeutic antibiotics in the tissue can inhibit bacterial isolation. In the current study, conventional and real-time polymerase chain reaction (PCR) assays were used to assess the prevalence of these 5 organisms in grossly pneumonic lung samples from 150 animals submitted for postmortem examination, and the results were compared with those obtained using culture techniques. Mannheimia haemolytica was detected in 51 cases (34%) by PCR and in 33 cases (22%) by culture, H. somni was detected in 35 cases (23.3%) by PCR and in 6 cases (4%) by culture, Myc. bovis was detected in 53 cases (35.3%) by PCR and in 29 cases (19.3%) by culture, P. multocida was detected in 50 cases (33.3%) by PCR and in 31 cases (20.7%) by culture, and T. pyogenes was detected in 42 cases (28%) by PCR and in 31 cases (20.7%) by culture, with all differences being statistically significant. The PCR assays indicated positive results for 111 cases (74%) whereas 82 cases (54.6%) were culture positive. The PCR assays have demonstrated a significantly higher rate of detection of all 5 organisms in cases of pneumonia in cattle in Northern Ireland than was detected by current standard procedures. © 2014 The Author(s).

  7. Molecular detection of plant pathogenic bacteria using polymerase chain reaction single-strand conformation polymorphism.

    PubMed

    Srinivasa, Chandrashekar; Sharanaiah, Umesha; Shivamallu, Chandan

    2012-03-01

    The application of polymerase chain reaction (PCR) technology to molecular diagnostics holds great promise for the early identification of agriculturally important plant pathogens. Ralstonia solanacearum, Xanthomoans axonopodis pv. vesicatoria, and Xanthomonas oryzae pv. oryzae are phytopathogenic bacteria, which can infect vegetables, cause severe yield loss. PCR-single-strand conformation polymorphism (PCR-SSCP) is a simple and powerful technique for identifying sequence changes in amplified DNA. The technique of PCR-SSCP is being exploited so far, only to detect and diagnose human bacterial pathogens in addition to plant pathogenic fungi. Selective media and serology are the commonly used methods for the detection of plant pathogens in infected plant materials. In this study, we developed PCR-SSCP technique to identify phytopathogenic bacteria. The PCR product was denatured and separated on a non-denaturing polyacrylamide gel. SSCP banding patterns were detected by silver staining of nucleic acids. We tested over 56 isolates of R. solanacearum, 44 isolates of X. axonopodis pv. vesicatoria, and 20 isolates of X. oryzae pv. oryzae. With the use of universal primer 16S rRNA, we could discriminate such species at the genus and species levels. Species-specific patterns were obtained for bacteria R. solanacearum, X. axonopodis pv. vesicatoria, and X. oryzae pv. oryzae. The potential use of PCR-SSCP technique for the detection and diagnosis of phytobacterial pathogens is discussed in the present paper.

  8. Utility of Real-Time Quantitative Polymerase Chain Reaction in Detecting Mycobacterium tuberculosis

    PubMed Central

    Zhang, Mingxin; Zhang, Hui

    2017-01-01

    This study aimed to assess the value of real-time quantitative polymerase chain reaction (RT-qPCR) for the detection of Mycobacterium tuberculosis (MTB). Samples from 192 patients with suspected MTB were examined by RT-qPCR and an improved Löwenstein–Jensen (L-J) culture method. To evaluate the diagnostic usefulness of RT-qPCR in detecting MTB, a receiver operating characteristic (ROC) curve for RT-qPCR was generated, and the area under the curve (AUC) as well as a cutoff value was calculated. Using the L-J culture method as the gold standard, accuracy of the RT-qPCR method for detecting MTB was 92.7%, with sensitivity and specificity of 62.5% and 97.02%, respectively. In comparison with the improved L-J culture method, the AUC of RT-qPCR ROC curve was 0.957, which was statistically significant (p < 0.001). The Youden Index reached the maximum value (0.88) for gene copy number of 794.5 IU/mL, which was used as the cutoff value. RT-qPCR detection of MTB yielded results consistent with those of the improved L-J culture method, with high accuracy. RT-qPCR may be used as an auxiliary method for etiological diagnosis of tuberculosis. PMID:28168192

  9. [Species-specific detection of Proteus vulgaris and Proteus mirabilis by the polymerase chain reaction].

    PubMed

    Limanskiĭ, A; Minukhin, V; Limanskaia, O; Pavlenko, N; Mishina, M; Tsygenenko, A

    2005-01-01

    Sets of primers for the species-specific detection of P. mirabilis and P. vulgaris by the polymerase chain reaction (PCR) were developed. As targets for these primers beta-lactamase and 16S rRNA gene fragments were chosen on the basis of the multiple leveling of the sequences of the DNA of all known P. mirabilis and P. vulgaris isolates. For differential detection oligonucleotides were selected in such a way that primers, specific for P. vulgaris, contained the non-paired nucleotide for P. mirabilis isolate at the 3'-end, and all other nucleotides were complementary to the beta-lactamase gene fragment. Primers, specific for gene 16S rRNA of P. mirabilis, contained the non-paired nucleotide for P. vulgaris isolates at the 3'-end. Standard PCR was carried out for 6 P. mirabilis and P. vulgaris strains. The use of PCR species-specific primers to P. vulgaris DNA made it possible to amplify the DNA fragment of the expected length only for P. vulgaris isolates, while the result of PCR for P. mirabilis was negative. PCR with primers specific to P. mirabilis permitted the detection of amplicon sized 101 nucleotides pairs only for P. mirabilis strains. These primers were optimized so as to use them in the specific differentiation of closely related P. mirabilis and P. vulgaris species by multiplex PCR. Genus-specific primers permitted the detection of bacterial gyrB gene of the genus Proteus were developed also.

  10. Detection and Characterization of Viral Species/Subspecies Using Isothermal Recombinase Polymerase Amplification (RPA) Assays.

    PubMed

    Glais, Laurent; Jacquot, Emmanuel

    2015-01-01

    Numerous molecular-based detection protocols include an amplification step of the targeted nucleic acids. This step is important to reach the expected sensitive detection of pathogens in diagnostic procedures. Amplifications of nucleic acid sequences are generally performed, in the presence of appropriate primers, using thermocyclers. However, the time requested to amplify molecular targets and the cost of the thermocycler machines could impair the use of these methods in routine diagnostics. Recombinase polymerase amplification (RPA) technique allows rapid (short-term incubation of sample and primers in an enzymatic mixture) and simple (isothermal) amplification of molecular targets. RPA protocol requires only basic molecular steps such as extraction procedures and agarose gel electrophoresis. Thus, RPA can be considered as an interesting alternative to standard molecular-based diagnostic tools. In this paper, the complete procedures to set up an RPA assay, applied to detection of RNA (Potato virus Y, Potyvirus) and DNA (Wheat dwarf virus, Mastrevirus) viruses, are described. The proposed procedure allows developing species- or subspecies-specific detection assay.

  11. Rapid detection of HIV-1 proviral DNA for early infant diagnosis using recombinase polymerase amplification.

    PubMed

    Boyle, David S; Lehman, Dara A; Lillis, Lorraine; Peterson, Dylan; Singhal, Mitra; Armes, Niall; Parker, Mathew; Piepenburg, Olaf; Overbaugh, Julie

    2013-04-02

    Early diagnosis and treatment of human immunodeficiency virus type 1 (HIV-1) infection in infants can greatly reduce mortality rates. However, current infant HIV-1 diagnostics cannot reliably be performed at the point of care, often delaying treatment and compromising its efficacy. Recombinase polymerase amplification (RPA) is a novel technology that is ideal for an HIV-1 diagnostic, as it amplifies target DNA in <20 min at a constant temperature, without the need for complex thermocycling equipment. Here we tested 63 HIV-1-specific primer and probe combinations and identified two RPA assays that target distinct regions of the HIV-1 genome (long terminal repeat [LTR] and pol) and can reliably detect 3 copies of proviral DNA by the use of fluorescence detection and lateral-flow strip detection. These pol and LTR primers amplified 98.6% and 93%, respectively, of the diverse HIV-1 variants tested. This is the first example of an isothermal assay that consistently detects all of the major HIV-1 global subtypes.

  12. Rapid and specific detection of porcine parvovirus by isothermal recombinase polymerase amplification assays.

    PubMed

    Yang, Yang; Qin, Xiaodong; Zhang, Wei; Li, Yanmin; Zhang, Zhidong

    2016-10-01

    Porcine parvovirus (PPV) is a major cause of swine reproductive failure and reported in many countries worldwide. Recombinase polymerase amplification (RPA) assays using a real-time fluorescent detection (PPV real-time RPA assay) and a lateral flow dipstick (PPV RPA LFD assay) were developed targeting PPV NS1 gene. The detection limit of PPV real-time RPA assay was 300 copies per reaction within 9 min at 38 °C, while the RPA LFD assay has a detection limit of 400 copies per reaction in less than 20 min at 38 °C. In both assays, there were no cross-reactions with porcine circovirus type 2, pseudorabies virus, porcine reproductive and respiratory syndrome virus, classical swine fever virus, and foot-and-mouth disease virus. Based on a total of 128 clinical samples examined, the sensitivity and the specificity of the developed RPA assays for identification of PPV was 94.4% and 100%, respectively, when compared to real-time (qPCR) assay. Therefore, the RPA assay provides a rapid, sensitive and specific alternative for PPV detection.

  13. Development and clinical evaluation of a polymerase chain reaction test for detection of Chlamydia trachomatis.

    PubMed Central

    Ossewaarde, J M; Rieffe, M; Rozenberg-Arska, M; Ossenkoppele, P M; Nawrocki, R P; van Loon, A M

    1992-01-01

    A polymerase chain reaction (PCR) for the detection of Chlamydia trachomatis was developed and evaluated. Two primer-probe sets were designed; one detected a specific sequence of the plasmid, and the other detected the gene encoding the major outer membrane protein. Both sets reacted species specifically and amplified sequences from all human serovars. A simple protocol was used for sample pretreatment. The PCR was optimized by addition of tetramethylammonium chloride and bovine serum albumin. The results of the PCR with the plasmid primer-probe set were compared with those of culture and the Chlamydiazyme and Gen-Probe PACE 2 tests for urogenital specimens from 220 patients. The rates of prevalence of infection with C. trachomatis were 22.7, 16.4, 15.0, and 14.5%, respectively. The sensitivities of the Chlamydiazyme and Gen-Probe PACE 2 assays compared with culture were 66.7 and 61.1%, respectively, and their sensitivities compared with PCR were 60.0 and 60.0%, respectively. The sensitivity of culture compared with PCR was 70.0%. Forty-eight of the 50 specimens positive by PCR with the plasmid primer-probe set could be confirmed by PCR with the major outer membrane protein primer-probe set or culture. It is concluded that the PCR is the most sensitive technique for laboratory detection of C. trachomatis. PMID:1500521

  14. An exo probe-based recombinase polymerase amplification assay for the rapid detection of porcine parvovirus.

    PubMed

    Wang, Jian-Chang; Liu, Li-Bing; Han, Qing-An; Wang, Jin-Feng; Yuan, Wan-Zhe

    2017-10-01

    Recombinase polymerase amplification (RPA), an isothermal amplification technology, has been developed as an alternative to PCR in pathogen detection. A real-time RPA assay (rt-RPA) was developed to detect the porcine parvovirus (PPV) using primers and exo probe specific for the VP2 gene. The amplification was performed at 39°C for 20min. There was no cross-reaction with other pathogens tested. Using the recombinant plasmid pPPV-VP2 as template, the analytical sensitivity was 103 copies. The assay performance was evaluated by testing 115 field samples by rt-RPA and a real-time PCR assay. The diagnostic agreement between assays was 100%, and PPV DNA was detected in 94 samples. The R(2) value of rt-RPA and real-time PCR was 0.909 by linear regression analysis. The developed rt-RPA assay provides a useful alternative tool for rapid, simple and reliable detection of PPV in diagnostic laboratories and at point-of-care, especially in remote and rural areas. Copyright © 2017 Elsevier B.V. All rights reserved.

  15. Immunomagnetic separation combined with polymerase chain reaction for the detection of Alicyclobacillus acidoterrestris in apple juice.

    PubMed

    Wang, Zhouli; Wang, Jun; Yue, Tianli; Yuan, Yahong; Cai, Rui; Niu, Chen

    2013-01-01

    A combination of immunomagnetic separation (IMS) and polymerase chain reaction (PCR) was used to detect Alicyclobacillus acidoterrestris (A. acidoterrestris) in apple juice. The optimum technological parameters of the IMS system were investigated. The results indicated that the immunocapture reactions could be finished in 60 min and the quantity of IMPs used for IMS was 2.5 mg/mL. Then the combined IMS-PCR procedure was assessed by detecting A. acidoterrestris in apple juice samples. The agarose gel electrophoresis results of 20 different strains showed that the IMS-PCR procedure presented high specificity to the A. acidoterrestris. The sensitivity of the IMS-PCR was 2×10(1) CFU/mL and the total detection time was 3 to 4 h. Of the 78 naturally contaminated apple juice samples examined, the sensitivity, specificity and accuracy of IMS-PCR compared with the standardized pour plate method were 90.9%, 97.0% and 96.2%, respectively. The results exhibited that the developed IMS-PCR method will be a valuable tool for detecting A. acidoterrestris and improving food quality in juice samples.

  16. Immunomagnetic Separation Combined with Polymerase Chain Reaction for the Detection of Alicyclobacillus acidoterrestris in Apple Juice

    PubMed Central

    Wang, Zhouli; Wang, Jun; Yue, Tianli; Yuan, Yahong; Cai, Rui; Niu, Chen

    2013-01-01

    A combination of immunomagnetic separation (IMS) and polymerase chain reaction (PCR) was used to detect Alicyclobacillus acidoterrestris (A. acidoterrestris) in apple juice. The optimum technological parameters of the IMS system were investigated. The results indicated that the immunocapture reactions could be finished in 60 min and the quantity of IMPs used for IMS was 2.5 mg/mL. Then the combined IMS-PCR procedure was assessed by detecting A. acidoterrestris in apple juice samples. The agarose gel electrophoresis results of 20 different strains showed that the IMS-PCR procedure presented high specificity to the A. acidoterrestris. The sensitivity of the IMS-PCR was 2×101 CFU/mL and the total detection time was 3 to 4 h. Of the 78 naturally contaminated apple juice samples examined, the sensitivity, specificity and accuracy of IMS-PCR compared with the standardized pour plate method were 90.9%, 97.0% and 96.2%, respectively. The results exhibited that the developed IMS-PCR method will be a valuable tool for detecting A. acidoterrestris and improving food quality in juice samples. PMID:24349270

  17. Rapid Detection of HIV-1 Proviral DNA for Early Infant Diagnosis Using Recombinase Polymerase Amplification

    PubMed Central

    Boyle, David S.; Lehman, Dara A.; Lillis, Lorraine; Peterson, Dylan; Singhal, Mitra; Armes, Niall; Parker, Mathew; Piepenburg, Olaf; Overbaugh, Julie

    2013-01-01

    ABSTRACT Early diagnosis and treatment of human immunodeficiency virus type 1 (HIV-1) infection in infants can greatly reduce mortality rates. However, current infant HIV-1 diagnostics cannot reliably be performed at the point of care, often delaying treatment and compromising its efficacy. Recombinase polymerase amplification (RPA) is a novel technology that is ideal for an HIV-1 diagnostic, as it amplifies target DNA in <20 min at a constant temperature, without the need for complex thermocycling equipment. Here we tested 63 HIV-1-specific primer and probe combinations and identified two RPA assays that target distinct regions of the HIV-1 genome (long terminal repeat [LTR] and pol) and can reliably detect 3 copies of proviral DNA by the use of fluorescence detection and lateral-flow strip detection. These pol and LTR primers amplified 98.6% and 93%, respectively, of the diverse HIV-1 variants tested. This is the first example of an isothermal assay that consistently detects all of the major HIV-1 global subtypes. PMID:23549916

  18. Detection of campylobacter species: a comparison of culture and polymerase chain reaction based methods

    PubMed Central

    Kulkarni, S P; Lever, S; Logan, J M J; Lawson, A J; Stanley, J; Shafi, M S

    2002-01-01

    Aims: To investigate the optimal method for the detection of campylobacters from stool samples by comparing selective culture with membrane filtration and the polymerase chain reaction (PCR). Methods: Three hundred and forty three stool samples were investigated by each of the three methods mentioned above. Selective culture was performed with charcoal cefoperazone desoxycholate agar plates. Membrane filtration was performed using cellulose triacetate membranes with 0.45 μm pores placed on blood agar plates. Enteropathogenic campylobacters were detected using a PCR identification algorithm, consisting of screening PCRs and species identification using a PCR enzyme linked immunosorbent assay (PCR-ELISA), both based on the 16S rRNA gene. Results: Of the 343 samples tested, 23 were positive by one or more method. Of these, 17 were positive by selective culture, 12 by membrane filtration, and 20 by the PCR identification algorithm. A total of 18 of 23 positives were identified as C jejuni and/or C coli by the PCR identification algorithm, compared with 14 identified to the genus level by selective culture, and 10 by membrane filtration. Among the remaining five positive samples, one C hyointestinalis was detected only by the PCR identification algorithm; one C upsaliensis was detected only by the PCR identification algorithm; one Campylobacter sp was detected by membrane filtration and selective culture and later identified as C concisus; one Campylobacter sp was detected by membrane filtration alone and later identified as Arcobacter sp; and one Campylobacter sp detected only by selective culture was lost to study and therefore not speciated. There was no significant difference between detection by selective culture and the other two methods. However, detection by PCR was significantly better than by membrane filtration (0.05 > p > 0.02). Conclusion: The PCR identification algorithm can detect and identify Campylobacter spp to the species level and the result is

  19. Multiplex-microsphere-quantitative polymerase chain reaction: nucleic acid amplification and detection on microspheres.

    PubMed

    Liang, Fang; Lai, Richard; Arora, Neetika; Zhang, Kang Liang; Yeh, Che-Cheng; Barnett, Graeme R; Voigt, Paul; Corrie, Simon R; Barnard, Ross T

    2013-01-01

    We report the development of a new system to monitor the amplification of nucleic acids on microspheres. This was realized by the design of (i) a "universal" oligonucleotide "tagged" polymerase chain reaction (PCR) forward primer, (ii) a sensor sequence complementary to the universal sequence on the forward PCR primer modified with a fluorescent dye, and (iii) a universal oligonucleotide coupled to Luminex microspheres. The PCR takes place with the microspheres present in the reaction tube. With the consumption of the universal oligonucleotide tagged forward primer, the fluorescently labeled sequences can bind to the universal oligonucleotide on the microspheres. We tested the microsphere quantitative PCR system with up to three different target genes (Neisseria meningitides porA and ctrA and influenza A M gene segment) as templates in a single PCR tube. The analytical sensitivity of this quantitative PCR system was tested and compared with the TaqMan system. The multiplex-microsphere-quantitative PCR system does not require design of unique internal probes for each target and has potential for a high degree of multiplexing, greater than the limited multiplexing achievable with current real-time protocols.

  20. Early detection of dengue virus by use of reverse transcription-recombinase polymerase amplification.

    PubMed

    Teoh, Boon-Teong; Sam, Sing-Sin; Tan, Kim-Kee; Danlami, Mohammed Bashar; Shu, Meng-Hooi; Johari, Jefree; Hooi, Poh-Sim; Brooks, David; Piepenburg, Olaf; Nentwich, Oliver; Wilder-Smith, Annelies; Franco, Leticia; Tenorio, Antonio; AbuBakar, Sazaly

    2015-03-01

    A method for the rapid diagnosis of early dengue virus (DENV) infection is highly needed. Here, a prototype reverse transcription-recombinase polymerase amplification (RT-RPA) assay was developed. The assay detected DENV RNA in <20 min without the need for thermocycling amplification. The assay enabled the detection of as few as 10 copies of DENV RNA. The designed RT-RPA primers and exo probe detected the DENV genome of at least 12 genotypes of DENV circulating globally without cross-reacting with other arboviruses. We assessed the diagnostic performance of the RT-RPA assay for the detection of DENV RNA in 203 serum samples of patients with clinically suspected dengue. The sera were simultaneously tested for DENV using a reverse transcription-loop-mediated isothermal amplification (RT-LAMP) assay, quantitative RT-PCR (qRT-PCR), and IgM- and IgG-capture enzyme-linked immunosorbent assays (ELISA). Acute DENV infection was confirmed in 130 samples and 61 of the samples (46.9%) were classified as viremic with qRT-PCR. The RT-RPA assay showed good concordance (κ of ≥0.723) with the RT-LAMP and qRT-PCR assays in detecting the dengue viremic samples. When used in combination with ELISA, both the RT-RPA and RT-LAMP assays increased the detection of acute DENV infection to ≥95.7% (≥45/47) in samples obtained within 5 days of illness. The results from the study suggest that the RT-RPA assay is the most rapid molecular diagnostic tool available for the detection of DENV. Hence, it is possible to use the RT-RPA assay in a laboratory to complement routine serology testing for dengue.

  1. Real-time isothermal detection of Shiga toxin-producing Escherichia coli using recombinase polymerase amplification.

    PubMed

    Murinda, Shelton E; Ibekwe, A Mark; Zulkaffly, Syaizul; Cruz, Andrew; Park, Stanley; Razak, Nur; Paudzai, Farah Md; Ab Samad, Liana; Baquir, Khairul; Muthaiyah, Kokilah; Santiago, Brenna; Rusli, Amirul; Balkcom, Sean

    2014-07-01

    Shiga toxin-producing Escherichia coli (STEC) are a major family of foodborne pathogens of public health, zoonotic, and economic significance in the United States and worldwide. To date, there are no published reports on use of recombinase polymerase amplification (RPA) for STEC detection. The primary goal of this study was to assess the potential application of RPA in detection of STEC. This study focused on designing and evaluating RPA primers and fluorescent probes for isothermal (39°C) detection of STEC. Compatible sets of candidate primers and probes were designed for detection of Shiga toxin 1 and 2 (Stx1 and 2), respectively. The sets were evaluated for specificity and sensitivity against STEC (n=12) of various stx genotypes (stx1/stx2, stx1, or stx2, respectively), including non-Stx-producing E. coli (n=28) and other genera (n=7). The primers and probes that were designed targeted amplification of the subunit A moiety of stx1 and stx2. The assay detected STEC in real time (within 5-10 min at 39°C) with high sensitivity (93.5% vs. 90%; stx1 vs. stx2), specificity (99.1% vs. 100%; stx1 vs. stx2), and predictive value (97.9% for both stx1 vs. stx2). Limits of detection of ∼ 5-50 colony-forming units/mL were achieved in serially diluted cultures grown in brain heart infusion broth. This study successfully demonstrated for the first time that RPA can be used for isothermal real-time detection of STEC.

  2. Separation-Type Multiplex Polymerase Chain Reaction Chip for Detecting Male Infertility

    NASA Astrophysics Data System (ADS)

    Ha, Seung-Mo; Ju, Jin-Kyoung; Ahn, Yoomin; Hwang, Seung Young

    2008-06-01

    A novel polymerase chain reaction (PCR) biochip is presented in this paper. In this PCR chip, the glass substrate integrated with the microheater and microsensor is separable from the reaction chamber where the sample is injected, which now makes repeated reuse of the glass substrate possible. The heat transfer efficiency and target gene amplification of the proposed separable PCR chip was compared with that of the conventional united PCR chip. The results showed that the sex-determining Y chromosome (SRY) gene PCR for detecting male infertility was successfully performed in the separable chip. However, repeated multiplex PCR was successful for only two genes, SPGY1 and SRY, but not for gene SY586. Future work is needed for a multiplex PCR with more than three genes.

  3. Detection of DNA sequence polymorphisms in carcinogen metabolism genes by polymerase chain reaction

    SciTech Connect

    Bell, D.A. )

    1991-01-01

    The glutathione transferase mu gene (GST1) and the debrisoquine hydroxylase gene (CYP2D6) are known to be polymorphic in the human population and have been associated with increased susceptibility to cancer. Smokers with low lymphocyte GST mu activity are at higher risk for lung cancer, while low debrisoquine hydroxylase activity has been correlated with lower risk for lung and bladder cancer. Phenotypic characterization of these polymorphisms by lymphocyte enzyme activity (GST) and urine metabolite ratios (debrisoquine) is cumbersome for population studies. Recent cloning and sequencing of the mutant alleles of these genes has allowed genotyping via the polymerase chain reaction (PCR). Advantages of PCR approaches are speed, technical simplicity, and minimal sample requirements. This article reviews the PCR-based methods for detection of genetic polymorphisms in human cancer susceptibility genes.

  4. Detection of human papillomavirus types 45 and 51 by type-specific polymerase chain reaction.

    PubMed

    Weyn, Christine; Boulenouar, Selma; Mathys, Vanessa; Vanhoolandt, Julie; Bernis, Aurore; Fontaine, Véronique

    2007-12-01

    Human papillomavirus (HPV) types 45 and 51 are both considered as high risk types for the development of human cervical cancer. To optimize the detection of these two types in clinical samples, HPV-45 and HPV-51 specific primers were designed to amplify respectively a 141bp and a 266bp fragment from the L1 gene by polymerase chain reaction (PCR). The sensitivity and the specificity of these two PCR reactions were determined using varying amounts of HPV DNA containing plasmids and negative and positive controls. Overall, the sensitivity for the HPV-45 plasmid DNA is 10fg, while for HPV-51 the sensitivity is 1fg. This is equivalent to approximately 100 and 10 HPV genome copies per PCR reaction, respectively.

  5. Quantitative polymerase chain reaction (PCR) for detection of aquatic animal pathogens in a diagnostic laboratory setting.

    PubMed

    Purcell, Maureen K; Getchell, Rodman G; McClure, Carol A; Garver, Kyle A

    2011-09-01

    Real-time, or quantitative, polymerase chain reaction (qPCR) is quickly supplanting other molecular methods for detecting the nucleic acids of human and other animal pathogens owing to the speed and robustness of the technology. As the aquatic animal health community moves toward implementing national diagnostic testing schemes, it will need to evaluate how qPCR technology should be employed. This review outlines the basic principles of qPCR technology, considerations for assay development, standards and controls, assay performance, diagnostic validation, implementation in the diagnostic laboratory, and quality assurance and control measures. These factors are fundamental for ensuring the validity of qPCR assay results obtained in the diagnostic laboratory setting.

  6. Quantitative polymerase chain reaction (PCR) for detection of aquatic animal pathogens in a diagnostic laboratory setting

    USGS Publications Warehouse

    Purcell, Maureen K.; Getchell, Rodman G.; McClure, Carol A.; Weber, S.E.; Garver, Kyle A.

    2011-01-01

    Real-time, or quantitative, polymerase chain reaction (qPCR) is quickly supplanting other molecular methods for detecting the nucleic acids of human and other animal pathogens owing to the speed and robustness of the technology. As the aquatic animal health community moves toward implementing national diagnostic testing schemes, it will need to evaluate how qPCR technology should be employed. This review outlines the basic principles of qPCR technology, considerations for assay development, standards and controls, assay performance, diagnostic validation, implementation in the diagnostic laboratory, and quality assurance and control measures. These factors are fundamental for ensuring the validity of qPCR assay results obtained in the diagnostic laboratory setting.

  7. Polymerase chain reaction detection of potentially pathogenic free-living amoebae in dental units.

    PubMed

    Leduc, Annie; Gravel, Sabrina; Abikhzer, Jérémie; Roy, Stéphane; Barbeau, Jean

    2012-07-01

    Several genera of amoebae can be found in water from dental units and on the inner surface of waterlines. The presence of bacterial biofilms on these surfaces is thought to favor the proliferation of amoebae. Potentially pathogenic Acanthamoeba and Naegleria spp. may be an infection risk for patients through contact with open surgical sites or aerosolization. A polymerase chain reaction of DNA extracted from pelleted samples showed that Acanthamoeba spp. and Naegleria spp. were present in water from dental units, suction lines, and suction filters at the dental clinic of the Université de Montréal. Acanthamoeba spp. were detected in 24.2% of 66 samples and Naegleria spp. in 3.0%. We discuss the infection risk associated with these results.

  8. Rapid Detection of Plasmodium knowlesi by Isothermal Recombinase Polymerase Amplification Assay.

    PubMed

    Lai, Meng-Yee; Ooi, Choo-Huck; Lau, Yee-Ling

    2017-08-14

    In this study, we developed a recombinase polymerase amplification (RPA) assay for specific diagnosis of Plasmodium knowlesi. Genomic DNA was extracted from whole blood samples using a commercial kit. With incubation at 37°C, the samples were successfully amplified within 20 minutes. The end product of RPA was further examined by loading onto agarose gel and a specific band was observed with a size of 128 bp. The RPA assay exhibited high sensitivity with limits of detection down to one copy of the plasmid. From the specificity experiments, it was demonstrated that all P. knowlesi samples (N = 45) were positive while other Plasmodium spp. (N = 42) and negative samples (N = 6) were negative. Therefore, the RPA assay is a highly promising approach with the potential to be used in resource-limited settings. This assay can be further optimized for bedside and on field application.

  9. Detection of Fasciola gigantica infection in snails by polymerase chain reaction.

    PubMed

    Velusamy, R; Singh, B P; Raina, O K

    2004-02-26

    Polymerase chain reaction (PCR) was used to detect Fasciola gigantica infection in the snail intermediate host. Fasciola specific primers amplified a 124 bp fragment in PCR when the genomic DNA isolated from F. gigantica infected Lymnaea auricularia snails was used as template. In addition to the 124 bp amplicon, a ladder of DNA fragments representing amplification of the 124 bp repetitive sequences was observed. Genomic DNA of the parasite was used as a positive control, which also gave an amplification of the 124 bp fragment. DNA isolated from non-infected snails was used as a negative control and no amplification of this sequence was observed. This technique is highly specific and sensitive and possesses fairly good prospects of its utility as an epidemiological tool for ascertaining the infectivity status in ubiquitous snail populations.

  10. Intragenic promoter adaptation and facilitated RNA polymerase III recycling in the transcription of SCR1, the 7SL RNA gene of Saccharomyces cerevisiae.

    PubMed

    Dieci, Giorgio; Giuliodori, Silvia; Catellani, Manuela; Percudani, Riccardo; Ottonello, Simone

    2002-03-01

    The SCR1 gene, coding for the 7SL RNA of the signal recognition particle, is the last known class III gene of Saccharomyces cerevisiae that remains to be characterized with respect to its mode of transcription and promoter organization. We show here that SCR1 represents a unique case of a non-tRNA class III gene in which intragenic promoter elements (the TFIIIC-binding A- and B-blocks), corresponding to the D and TpsiC arms of mature tRNAs, have been adapted to a structurally different small RNA without losing their transcriptional function. In fact, despite the presence of an upstream canonical TATA box, SCR1 transcription strictly depends on the presence of functional, albeit quite unusual, A- and B-blocks and requires all the basal components of the RNA polymerase III transcription apparatus, including TFIIIC. Accordingly, TFIIIC was found to protect from DNase I digestion an 80-bp region comprising the A- and B-blocks. B-block inactivation completely compromised TFIIIC binding and transcription capacity in vitro and in vivo. An inactivating mutation in the A-block selectively affected TFIIIC binding to this promoter element but resulted in much more dramatic impairment of in vivo than in vitro transcription. Transcriptional competition and nucleosome disruption experiments showed that this stronger in vivo defect is due to a reduced ability of A-block-mutated SCR1 to compete with other genes for TFIIIC binding and to counteract the assembly of repressive chromatin structures through TFIIIC recruitment. A kinetic analysis further revealed that facilitated RNA polymerase III recycling, far from being restricted to typical small sized class III templates, also takes place on the 522-bp-long SCR1 gene, the longest known class III transcriptional unit.

  11. Rapid Detection of Candida albicans by Polymerase Spiral Reaction Assay in Clinical Blood Samples

    PubMed Central

    Jiang, Xiaoqun; Dong, Derong; Bian, Lihong; Zou, Dayang; He, Xiaoming; Ao, Da; Yang, Zhan; Huang, Simo; Liu, Ningwei; Liu, Wei; Huang, Liuyu

    2016-01-01

    Candida albicans is the most common human yeast pathogen which causes mucosal infections and invasive fungal diseases. Early detection of this pathogen is needed to guide preventative and therapeutic treatment. The aim of this study was to establish a polymerase spiral reaction (PSR) assay that rapidly and accurately detects C. albicans and to assess the clinical applicability of PSR-based diagnostic testing. Internal transcribed spacer 2 (ITS2), a region between 5.8S and 28S fungal ribosomal DNA, was used as the target sequence. Four primers were designed for amplification of ITS2 with the PSR method, which was evaluated using real time turbidity monitoring and visual detection using a pH indicator. Fourteen non-C. albicans yeast strains were negative for detection, which indicated the specificity of PSR assay was 100%. A 10-fold serial dilution of C. albicans genomic DNA was subjected to PSR and conventional polimerase chain reaction (PCR) to compare their sensitivities. The detection limit of PSR was 6.9 pg/μl within 1 h, 10-fold higher than that of PCR (69.0 pg/μl). Blood samples (n = 122) were collected from intensive care unit and hematological patients with proven or suspected C. albicans infection at two hospitals in Beijing, China. Both PSR assay and the culture method were used to analyze the samples. Of the 122 clinical samples, 34 were identified as positive by PSR. The result was consistent with those obtained by the culture method. In conclusion, a novel and effective C. albicans detection assay was developed that has a great potential for clinical screening and point-of-care testing. PMID:27379048

  12. The detection of melanoma cells in peripheral blood by reverse transcription-polymerase chain reaction.

    PubMed Central

    Foss, A. J.; Guille, M. J.; Occleston, N. L.; Hykin, P. G.; Hungerford, J. L.; Lightman, S.

    1995-01-01

    Both cutaneous and uveal melanoma undergo haematogenous dissemination. Detection of tyrosinase mRNA by reverse transcription-polymerase chain reaction (RT-PCR) has been described as an extremely sensitive way of detecting circulating viable melanoma cells in the peripheral venous blood, and this technique may be of value in the early detection of dissemination. Also, it has been suggested that surgical manipulation of the eye, such as occurs during enucleation, can provoke uveal melanoma dissemination. The purpose of this study was to evaluate whether tyrosinase mRNA is detectable in the peripheral blood of patients with uveal and cutaneous melanoma and in patients with uveal melanoma undergoing surgical procedures on the eye harbouring the tumour. Venous blood samples from 36 patients diagnosed as having active uveal melanoma and from six patients with advanced metastatic cutaneous melanoma were analysed. In addition, blood samples were spiked with known numbers of cells from three cell lines and four primary uveal melanoma cultures. The reported sensitivity of the technique was confirmed, with an ability to detect down to one cell per ml of blood. All 51 blood samples from the 36 patients with uveal melanoma were negative, and this included 20 perioperative blood samples. The test was also negative for the six patients with advanced cutaneous melanoma. There were two positives among 31 control samples analysed. This study demonstrates that there are far fewer circulating viable melanocytes than has been previously supposed in patients with melanoma and that the RT-PCR is of no clinical value in detecting metastatic melanoma disease. There was no evidence for surgery causing a bolus of melanoma cells to enter the peripheral circulation. Images Figure 1 Figure 2 PMID:7599046

  13. Specific detection of Pacific oyster (Crassostrea gigas) larvae in plankton samples using nested polymerase chain reaction.

    PubMed

    Patil, Jawahar G; Gunasekera, Rasanthi M; Deagle, Bruce E; Bax, Nicholas J

    2005-01-01

    Management of sustainable Pacific oyster fisheries would be assisted by an early, rapid, and accurate means of detecting their planktonic larvae. Reported here is an approach, based on polymerase chain reaction (PCR), for the detection of Pacific oyster larvae in plankton samples. Species-specific primers were designed by comparing partial mitochondrial cytochrome oxidase subunit I (COI) sequences from Crassostrea gigas, with other members of the family Ostreidae including those of Crassostrea angulata. Assay specificity was empirically validated through screening DNA samples obtained from several species of oysters. The assay was specific as only C. gigas samples returned PCR-positive results. A nested PCR approach could consistently detect 5 or more D-hinge-stage larvae spiked into a background of about 146 mg of plankton. The assay does not require prior sorting of larvae. We conclude that the assay could be used to screen environmental and ballast water samples, although further specificity testing against local bivalve species is recommended in new locations.

  14. A reverse transcriptase-polymerase chain reaction assay for detecting Highlands J virus.

    PubMed

    Whitehouse, C A; Guibeau, A; McGuire, D; Takeda, T; Mather, T N

    2001-01-01

    Highlands J (HJ) virus is an arbovirus frequently recovered at high rates in mosquitoes collected in the eastern United States. HJ virus is primarily a veterinary pathogen causing disease in domestic birds including turkeys, chickens, and partridges. It has an enzootic cycle similar to eastern equine encephalitis (EEE) virus and is often used as an indicator species in EEE surveillance programs. Current immunologic techniques to identify HJ virus are often inefficient and can involve cross-reactivity of antibodies. Therefore, we developed a molecular-based assay by a reverse transcriptase (RT)-polymerase chain reaction (PCR) technique. Primers were constructed from conserved sequences of the E1 coding region from 19 strains of HJ virus. PCR amplifications from serial dilutions of HJ virus-infected Vero cell culture supernatants indicated that this assay could detect viral RNA at concentrations of 10 plaque-forming units per reaction. Extracted RNAs from western equine encephalitis, EEE, LaCrosse, and Jamestown Canyon viruses were not detected with this assay. RNA extracted directly from the brain tissue of a dead house sparrow and from a pool of Culiseta mosquitoes yielded a PCR product of the expected size. The RT-PCR technique developed was both sensitive and specific for detecting HJ virus from infected cell culture supernatants, bird brain tissues, and mosquitoes. This new assay will permit rapid and accurate diagnosis of HJ virus, both enhancing surveillance activities for EEE transmission risk and monitoring infections in domestic poultry and wild birds.

  15. Nanostructured biochip for label-free and real-time optical detection of polymerase chain reaction.

    PubMed

    Hiep, Ha Minh; Kerman, Kagan; Endo, Tatsuro; Saito, Masato; Tamiya, Eiichi

    2010-02-19

    In this report, Au-coated nanostructured biochip with functionalized thiolated primers on its surface is developed for label-free and real-time optical detection of polymerase chain reaction (PCR). A PCR chamber of 150 microm in thickness containing Au-coated nanostructured substrate in the bottom layer was bordered with SU-8 100 walls. After immobilization of 5'-thiolated primers on the surface, simultaneous DNA amplification and detection were performed without any labeled molecules via the relative reflected intensity (RRI) of Au-coated nanostructured substrate. When human genomic DNA at several concentrations of 0.2, 0.5 and 1 ng microL(-1) was included in the initial DNA samples, the increases in the RRI peak values were clearly observed with the increasing PCR cycle numbers. We found that the starting point of the optical signal, which was divergent from the background in our PCR biochip, was around 3-4 cycles, much lower than that of the fluorescent real-time PCR analysis (around 23-25 cycles). Our proposed PCR device using Au-coated nanostructured substrate holds noteworthy promise for rapid, label-free and real-time DNA detection for point-of-care testing (POCT) applications.

  16. Detection of Leuconostoc strains at a meat processing plant using polymerase chain reaction.

    PubMed

    Goto, Seitaro; Takahashi, Hajime; Kawasaki, Susumu; Kimura, Bon; Fujii, Tateo; Nakatsuji, Miki; Watanabe, Itaru

    2004-02-01

    To simplify the labor-intensive conventional routine testing of samples to detect Leuconostoc at a meat processing plant, we developed polymerase chain reaction (PCR) primers specific for Leuconostoc from 16S rRNA gene sequences. These primers did not detect other common lactic acid bacteria such as Lactobacillus plantarum, Lact. sake, Lact. fermentum, Lact. acidophilus and Weissella viridescens. PCR with this primer detected all Leuconostoc species tested (Leu. mesenteroides subsp. mesenteroides, Leu. pseudomesenteroides, Leu. carnosum, Leu. lactic, Leu. citreum, Leu. amelibiosum, Leu. gelidum), except for Leu. fallax, and no other lactic acid bacteria on agarose gel electrophoresis. The method could identify areas contaminated with Leuconostoc in a large-scale industrial meat processing plant. Of 69 samples analyzed, 34 were positive for Leuconostoc according to the conventional culture method (isolation of LAB producing dextran) and PCR, whereas 29 were negative according to both. Six samples were culture-negative but positive by PCR. No false negative results were generated by PCR. The method is rapid and simple, is useful for routinely monitoring areas contaminated with Leuconostoc in meat processing plants, and could help to prevent the spoilage of meat products.

  17. Rapid detection of SAG 926delA mutation using real-time polymerase chain reaction.

    PubMed

    Yoshida, Shigeo; Yamaji, Yoko; Yoshida, Ayako; Ikeda, Yasuhiro; Yamamoto, Ken; Ishibashi, Tatsuro

    2006-12-06

    Mutation 926delA of the arrestin/S-antigen SAG gene is the main cause of Oguchi disease in the Japanese. The purpose of this study was to develop a rapid diagnostic assay to detect mutations in the SAG gene. Two sequence-specific primers and fluorophore-labeled probes for exon 11 of the SAG gene were designed, and the region spanning the mutations was amplified by polymerase chain reaction (PCR) using the LightCycler detection system (Roche Diagnostics, Mannheim, Germany). The mutations were then identified by melting curve analyses of the hybrid formed between the PCR product and a specific fluorescent probe. We clearly distinguished each SAG genotype (homozygous and heterozygous 926delA and wild type) by the distinct melting peaks at different temperatures. One thermal cycling required approximately 54 min to process, and the results were 100% in concordance with the genotypes determined by DNA sequencing. We have succeeded in developing a rapid method to detect the most frequent mutation in the SAG gene. This method will help in identifying gene mutations associated with Oguchi disease with a rapid and reliable identification or the exclusion of the frequent mutations in the SAG gene.

  18. Ultrasensitive and rapid detection of β-conglutin combining aptamers and isothermal recombinase polymerase amplification.

    PubMed

    Jauset-Rubio, Miriam; Sabaté Del Río, Jonathan; Mairal, Teresa; Svobodová, Markéta; El-Shahawi, Mohammad S; Bashammakh, Abdulaziz S; Alyoubi, Abdulrahman O; O'Sullivan, Ciara K

    2017-01-01

    Lupin is increasingly being used in a variety of food products due to its nutritional, functional and nutraceutical properties. However, several examples of severe and even fatal food-associated anaphylaxis due to lupin inhalation or ingestion have been reported, resulting in the lupin subunit β-conglutin, being defined as the Lup an 1 allergen by the International Union of Immunological Societies (IUIS) in 2008. Here, we report an innovative method termed aptamer-recombinase polymerase amplification (Apta-RPA) exploiting the affinity and specificity of a DNA aptamer selected against the anaphylactic β-conglutin allergen termed β-conglutin binding aptamer II (β-CBA II), facilitating ultrasensitive detection via isothermal amplification. Combining magnetic beads as the solid phase with Apta-RPA detection, the total assay time was reduced from 210 min to just 25 min, with a limit of detection of 3.5 × 10(-11) M, demonstrating a rapid and ultrasensitive generic methodology that can be used with any aptamer. Future work will focus on further simplification of the assay to a lateral flow format. Graphical Abstract Schematic representation of the rapid and novel bead-based Apta-RPA assay.

  19. Sensitive and rapid detection of Chlamydia trachomatis by recombinase polymerase amplification directly from urine samples.

    PubMed

    Krõlov, Katrin; Frolova, Jekaterina; Tudoran, Oana; Suhorutsenko, Julia; Lehto, Taavi; Sibul, Hiljar; Mäger, Imre; Laanpere, Made; Tulp, Indrek; Langel, Ülo

    2014-01-01

    Chlamydia trachomatis is the most common sexually transmitted human pathogen. Infection results in minimal to no symptoms in approximately two-thirds of women and therefore often goes undiagnosed. C. trachomatis infections are a major public health concern because of the potential severe long-term consequences, including an increased risk of ectopic pregnancy, chronic pelvic pain, and infertility. To date, several point-of-care tests have been developed for C. trachomatis diagnostics. Although many of them are fast and specific, they lack the required sensitivity for large-scale application. We describe a rapid and sensitive form of detection directly from urine samples. The assay uses recombinase polymerase amplification and has a minimum detection limit of 5 to 12 pathogens per test. Furthermore, it enables detection within 20 minutes directly from urine samples without DNA purification before the amplification reaction. Initial analysis of the assay from clinical patient samples had a specificity of 100% (95% CI, 92%-100%) and a sensitivity of 83% (95% CI, 51%-97%). The whole procedure is fairly simple and does not require specific machinery, making it potentially applicable in point-of-care settings.

  20. Reverse transcription recombinase polymerase amplification assay for the detection of middle East respiratory syndrome coronavirus.

    PubMed

    Abd El Wahed, Ahmed; Patel, Pranav; Heidenreich, Doris; Hufert, Frank T; Weidmann, Manfred

    2013-12-12

    The emergence of Middle East Respiratory Syndrome Coronavirus (MERS-CoV) in the eastern Mediterranean and imported cases to Europe has alerted public health authorities. Currently, detection of MERS-CoV in patient samples is done by real-time RT-PCR. Samples collected from suspected cases are sent to highly-equipped centralized laboratories for screening. A rapid point-of-care test is needed to allow more widespread mobile detection of the virus directly from patient material. In this study, we describe the development of a reverse transcription isothermal Recombinase Polymerase Amplification (RT-RPA) assay for the identification of MERS-CoV. A partial nucleocapsid gene RNA molecular standard of MERS-coronavirus was used to determine the assay sensitivity. The isothermal (42°C) MERS-CoV RT-RPA was as sensitive as real-time RT-PCR (10 RNA molecules), rapid (3-7 minutes) and mobile (using tubescanner weighing 1kg). The MERS-CoV RT-RPA showed cross-detection neither of any of the RNAs of several coronaviruses and respiratory viruses affecting humans nor of the human genome. The developed isothermal real-time RT-RPA is ideal for rapid mobile molecular MERS-CoV monitoring in acute patients and may also facilitate the search for the animal reservoir of MERS-CoV.

  1. Detection of Helicobacter pylori glmM gene in bovine milk using Nested polymerase chain reaction

    PubMed Central

    Osman, Eyman Y.; El-Eragi, A. M. S.; Musa, Abuobeida M.; El-Magboul, Salma B.; A/Rahman, Magdi B.; Abdo, Abdelmounem E.

    2015-01-01

    Aim: The aim was to detect the glmM gene of Helicobacter pylori (H. pylori) in cow’s milk from different dairy farms in Khartoum State using Nested polymerase chain reaction (PCR). Materials and Methods: A total of 50 milk samples were collected from different dairy farms in Khartoum State (13 from Khartoum, 24 Khartoum North, and 13 from Omdurman Provinces). Results: The generated results showed that 11/50 (22%) were harboring the investigated H. pylori glmM gene in Khartoum State (1/13 [7.7%] Khartoum, 9/24 [37.5%] Khartoum North, and 1/13 [7.7%] Omdurman provinces, respectively). Conclusion: To the best of our knowledge, this was the first report on the detection of H. pylori glmM gene in cattle milk in Khartoum State. Nonetheless, the high percentages of H. pylori DNA detection in milk opened new avenues toward exploring the risk of human infection with H. pylori through the consumption of raw milk. PMID:27047175

  2. Rapid detection of genetically modified organisms on a continuous-flow polymerase chain reaction microfluidics.

    PubMed

    Li, Yuyuan; Xing, Da; Zhang, Chunsun

    2009-02-01

    The ability to perform DNA amplification on a microfluidic device is very appealing. In this study, a compact continuous-flow polymerase chain reaction (PCR) microfluidics was developed for rapid analysis of genetically modified organisms (GMOs) in genetically modified soybeans. The device consists of three pieces of copper and a transparent polytetrafluoroethylene capillary tube embedded in the spiral channel fabricated on the copper. On this device, the P35S and Tnos sequences were successfully amplified within 9min, and the limit of detection of the DNA sample was estimated to be 0.005 ng microl(-1). Furthermore, a duplex continuous-flow PCR was also reported for the detection of the P35S and Tnos sequences in GMOs simultaneously. This method was coupled with the intercalating dye SYBR Green I and the melting curve analysis of the amplified products. Using this method, temperature differences were identified by the specific melting temperature values of two sequences, and the limit of detection of the DNA sample was assessed to be 0.01 ng microl(-1). Therefore, our results demonstrated that the continuous-flow PCR assay could discriminate the GMOs in a cost-saving and less time-consuming way.

  3. [Application of fluorescent real-time reverse transcriptase-polymerase chain reaction in detecting influenza viruses].

    PubMed

    Cheng, Xiao-wen; Zhou, Li; Zhao, Jin; Fang, Shi-song; Yu, Lei; Ye, Bao-ying; He, Jian-fan; Lu, Xing; Zhang, Zai-qing; Yang, Hong

    2004-09-01

    To apply fluorescent real-time reverse transcriptase-polymerase chain reaction (RT-PCR) in detecting influenza viruses. A total of 207 oral swab samples were obtained in 16 collections from SARS patients and suspected influenza outbreak cases. They were subjected to influenza virus detection by fluorescent real-time RT-PCR, MDCK cell culture, and hemagglutinin inhibition assay. Out of 207 samples, 79 (38.16%) were positive for influenza viruses when tested by fluorescent real-time PCR, and 62 (29.95%) positive when tested by MDCK cell culture. There was a statistically significant difference between them (chi square=8.64, P less than 0.005). From 104 cases in 9 collections dual serum samples were obtainable. When tested with hemagglutinin inhibition assay, 64 cases (61.54%) showed a 4-fold increase against H3N2 antigen. This study showed that fluorescent real-time PCR is a reliable, sensitive, and fast method for detecting influenza viruses.

  4. Development of Isothermal Recombinase Polymerase Amplification Assay for Rapid Detection of Porcine Circovirus Type 2.

    PubMed

    Yang, Yang; Qin, Xiaodong; Sun, Yingjun; Cong, Guozheng; Li, Yanmin; Zhang, Zhidong

    2017-01-01

    Porcine circovirus virus type II (PCV2) is the etiology of postweaning multisystemic wasting syndrome (PMWS), porcine dermatitis, nephropathy syndrome (PDNS), and necrotizing pneumonia. Rapid diagnosis tool for detection of PCV2 plays an important role in the disease control and eradication program. Recombinase polymerase amplification (RPA) assays using a real-time fluorescent detection (PCV2 real-time RPA assay) and RPA combined with lateral flow dipstick (PCV2 RPA LFD assay) were developed targeting the PCV2 ORF2 gene. The results showed that the sensitivity of the PCV2 real-time RPA assay was 10(2) copies per reaction within 20 min at 37°C and the PCV2 RPA LFD assay had a detection limit of 10(2) copies per reaction in less than 20 min at 37°C. Both assays were highly specific for PCV2, with no cross-reactions with porcine circovirus virus type 1, foot-and-mouth disease virus, pseudorabies virus, porcine parvovirus, porcine reproductive and respiratory syndrome virus, and classical swine fever virus. Therefore, the RPA assays provide a novel alternative for simple, sensitive, and specific identification of PCV2.

  5. Detection of horses infected naturally with equine infectious anemia virus by nested polymerase chain reaction.

    PubMed

    Nagarajan, M M; Simard, C

    2001-05-01

    A nested polymerase chain reaction (PCR) amplifying a region of the gag gene of equine infectious anemia virus (EIAV) was developed for the rapid and direct detection of proviral DNA from the peripheral blood of naturally infected horses and was compared with the Coggins test. DNA prepared from white blood cells of 122 field horses from 15 stables with reported cases of EIAV and one seronegative stable were analysed. Amplifications of expected size fragments were obtained by nested PCR for 88 horses using two different sets of primers targeting the gag region. The specificity of the amplified products was confirmed by hybridization using a digoxigenin-labeled probe. Gag-nested PCR-restriction fragment length polymorphism analysis distinguished two different subtypes of gag gene, A and B. Subtype A was found to be the most prevalent among the infected horses that were tested. The PCR-gag amplified sequence of subtype A shared 84.6% nucleotide and 93% deduced amino acid sequence identities with the prototype Wyoming strain whereas subtype B sequence was almost 100% identical to the prototype. Sequence analysis of gag subtype A suggests the presence of a novel EIAV variant among infected horses in Canada. The nested PCR assay developed in the present study detected more EIAV positive animals and was found as specific as the agar gel immunodiffusion (Coggins) assay and offers great potential a diagnostic test for the detection of EIAV infections in field horses.

  6. Isothermal Recombinase Polymerase amplification (RPA) of Schistosoma haematobium DNA and oligochromatographic lateral flow detection.

    PubMed

    Rosser, A; Rollinson, D; Forrest, M; Webster, B L

    2015-09-04

    Accurate diagnosis of urogenital schistosomiasis is vital for surveillance/control programs. Amplification of schistosome DNA in urine by PCR is sensitive and specific but requires infrastructure, financial resources and skilled personnel, often not available in endemic areas. Recombinase Polymerase Amplification (RPA) is an isothermal DNA amplification/detection technology that is simple, rapid, portable and needs few resources. Here a Schistosoma haematobium RPA assay was developed and adapted so that DNA amplicons could be detected using oligochromatographic Lateral Flow (LF) strips. The assay successfully amplified S. haematobium DNA at 30-45 °C in 10 mins and was sensitive to a lower limit of 100 fg of DNA. The assay was also successful with the addition of crude urine, up to 5% of the total reaction volume. Cross amplification occurred with other schistosome species but not with other common urine microorganisms. The LF-RPA assay developed here can amplify and detect low levels of S. haematobium DNA. Reactions are rapid, require low temperatures and positive reactions are interpreted using lateral flow strips, reducing the need for infrastructure and resources. This together with an ability to withstand inhibitors within urine makes RPA a promising technology for further development as a molecular diagnostic tool for urogenital schistosomiasis.

  7. Multiplex Polymerase Chain Reaction for Detection of Gastrointestinal Pathogens in Migrant Workers in Qatar.

    PubMed

    Humphrey, John M; Ranbhise, Sanjay; Ibrahim, Emad; Al-Romaihi, Hamad E; Farag, Elmoubasher; Abu-Raddad, Laith J; Glesby, Marshall J

    2016-12-07

    The causes of infectious diarrhea among the migrant worker population in Qatar are not well understood. We conducted a prospective observational study to understand the demographic and clinical characteristics and infectious causes of diarrhea among migrant workers in Doha, Qatar. A total of 126 male workers presenting to the Qatar Red Crescent Worker's Health Center outpatient clinic or emergency department were studied over a 5-month period in 2015-2016. Epidemiologic surveys were administered to all subjects and the prevalence of 22 different stool pathogens was determined using multiplex polymerase chain reaction (PCR) (FilmArray(®) Gastrointestinal PCR). A target pathogen was identified in 62.7% of subjects. Enteropathogenic Escherichia coli was the most prevalent pathogen and was detected in 24.6% of subjects, followed by Salmonella (22.2%), enteroaggregative E. coli (15.1%), Giardia lamblia (9.5%), and enterotoxigenic E. coli (8.7%). Multiple pathogens were identified in 49.3% of positive stool samples. In a multivariable analysis, the presence of a heart rate ≥ 90 (adjusted odds ratio [OR] = 3.7, 95% confidence interval [CI] = 1.4-10.0) and > 5 fecal leukocytes/high-power field (adjusted OR = 2.8, 95% CI = 1.2-7.0) were significant predictors of detecting an acute inflammatory pathogen by PCR. Use of multiplex PCR enabled the detection of gastrointestinal pathogens in a high proportion of cases, illustrating the utility of this diagnostic tool in epidemiologic studies of infectious diarrhea.

  8. Sensitive and species-specific detection of Erwinia amylovora by polymerase chain reaction analysis.

    PubMed Central

    Bereswill, S; Pahl, A; Bellemann, P; Zeller, W; Geider, K

    1992-01-01

    Detection and identification of the fire blight pathogen, Erwinia amylovora, can be accurately done by polymerase chain reaction (PCR) analysis in less than 6 h. Two oligomers derived from a 29-kb plasmid which is common to all strains of E. amylovora were used to amplify a 0.9-kb fragment of the plasmid. By separation of the PCR products on agarose gel, this fragment wa specifically detected when E. amylovora DNA was present in the amplification assay. It was not found when DNA from other plant-pathogenic bacteria was used for the assay. A visible band specific to the 0.9-kb fragment was produced with DNA from fewer than 100 E. amylovora cells. A signal of similar strength was also obtained from E. amylovora cell lysates in the presence of the mild detergent Tween 20. Signals were weaker when bacteria were added to the PCR mixture without the detergent. As with results obtained from hybridization experiments using pEA29 DNA< the PCR signal was obtained with E. amylovora isolates from various geographic regions. This technique could also be used for detection of the fire blight pathogen in extracts of tissue obtained from infected plant material. Images PMID:1482178

  9. A real-time reverse transcriptase polymerase chain reaction for detection and quantification of Vesiculovirus

    PubMed Central

    Tolardo, Aline Lavado; de Souza, William Marciel; Romeiro, Marilia Farignoli; Vieira, Luiz Carlos; Luna, Luciano Kleber de Souza; Henriques, Dyana Alves; de Araujo, Jansen; Siqueira, Carlos Eduardo Hassegawa; Colombo, Tatiana Elias; Aquino, Victor Hugo; da Fonseca, Benedito Antonio Lopes; Bronzoni, Roberta Vieira de Morais; Nogueira, Maurício Lacerda; Durigon, Edison Luiz; Figueiredo, Luiz Tadeu Moraes

    2016-01-01

    Vesiculoviruses (VSV) are zoonotic viruses that cause vesicular stomatitis disease in cattle, horses and pigs, as well as sporadic human cases of acute febrile illness. Therefore, diagnosis of VSV infections by reliable laboratory techniques is important to allow a proper case management and implementation of strategies for the containment of virus spread. We show here a sensitive and reproducible real-time reverse transcriptase polymerase chain reaction (RT-PCR) for detection and quantification of VSV. The assay was evaluated with arthropods and serum samples obtained from horses, cattle and patients with acute febrile disease. The real-time RT-PCR amplified the Piry, Carajas, Alagoas and Indiana Vesiculovirus at a melting temperature 81.02 ± 0.8ºC, and the sensitivity of assay was estimated in 10 RNA copies/mL to the Piry Vesiculovirus. The viral genome has been detected in samples of horses and cattle, but not detected in human sera or arthropods. Thus, this assay allows a preliminary differential diagnosis of VSV infections. PMID:27276185

  10. NEW PRIMERS FOR DETECTION OF Leishmania infantumUSING POLYMERASE CHAIN REACTION

    PubMed Central

    GUALDA, Kézia Peres; MARCUSSI, Lílian Mathias; NEITZKE-ABREU, Herintha Coeto; ARISTIDES, Sandra Mara Alessi; LONARDONI, Maria Valdrinez Campana; CARDOSO, Rosilene Fressatti; SILVEIRA, Thaís Gomes Verzignassi

    2015-01-01

    SUMMARY Leishmania infantum causes visceral leishmaniasis (VL) in the New World. The diagnosis of VL is confirmed by parasitological and serological tests, which are not always sensitive or specific. Our aim was to design new primers to perform a Polymerase Chain Reaction (PCR) for detecting L. infantum. Sequences of the minicircle kinetoplast DNA (kDNA) were obtained from GenBank, and the FLC2/RLC2 primers were designed. Samples of DNA from L. infantum, Leishmania amazonensis,Leishmania braziliensis, Leishmania guyanensis, Leishmania naiffi, Leishmania lainsoni, Leishmania panamensis,Leishmania major and Trypanosoma cruzi were used to standardize the PCR. PCR with FLC2/RLC2 primers amplified a fragment of 230 bp and the detection limit was 0.2 fg of L. infantum DNA. Of the parasite species assayed, only L. infantum DNA was amplified. After sequencing, the fragment was aligned to GenBank sequences, and showed (99%) homology with L. infantum. In the analysis of blood samples and lesion biopsy from a dog clinically suspected to have VL, the PCR detected DNA from L. infantum. In biopsy lesions from humans and dogs with cutaneous leishmaniasis, the PCR was negative. The PCR with FLC2/RLC2 primers showed high sensitivity and specificity, and constitutes a promising technique for the diagnosis of VL. PMID:26603223

  11. Direct detection of Bacillus anthracis DNA in animals by polymerase chain reaction.

    PubMed Central

    Makino, S I; Iinuma-Okada, Y; Maruyama, T; Ezaki, T; Sasakawa, C; Yoshikawa, M

    1993-01-01

    Bacillus anthracis is a soil pathogen capable of causing anthrax. To establish a method for specifically detecting B. anthracis for practical applications, such as for the inspection of slaughterhouses, the cap region, which is essential for encapsulation in B. anthracis, was used in a DNA hybridization study by polymerase chain reaction (PCR). Oligonucleotide primers were designed to amplify a 288-bp DNA fragment within the capA gene by PCR. The amplified DNA sequence specifically hybridized to the DNA of B. anthracis but not to that of other bacterial strains tested. Since this PCR-based method efficiently and specifically detected the capA sequence of bacteria in blood and spleen samples of mice within 8 h after the administration of live B. anthracis, this PCR system could be used for practical applications. By using lysis methods in preparing the samples for PCR, it was possible to amplify the 288-bp DNA segment from samples containing very few bacteria, as few as only 1 sporeforming unit, indicating that the PCR detection method developed in this study will permit the monitoring of B. anthracis contamination in the environment. Images PMID:8458949

  12. Nested polymerase chain reaction assay for detection of Mycobacterium shottsii and M. pseudoshottsii in striped bass.

    PubMed

    Gauthier, D T; Vogelbein, W K; Rhodes, M W; Reece, K S

    2008-12-01

    Wild striped bass Morone saxatilis in Chesapeake Bay are experiencing a high prevalence of mycobacteriosis, which produces granulomatous lesions of the skin and visceral organs. Culture-based studies have indicated that the newly described species Mycobacterium shottsii and M. pseudoshottsii are the dominant isolates from diseased fish. The classical fish pathogen M. marinum is also found, albeit at much lower frequencies. Both M. shottsii and M. pseudoshottsii are extremely slow-growing on standard selective media, and up to 12 months may be required for isolation and characterization. Epidemiological studies of mycobacteriosis in Chesapeake Bay would therefore benefit from rapid molecular assays with which to detect these species in fish. In this paper, we describe the development of polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) assays capable of detecting M. shottsii, M. pseudoshottsii, and, in most instances, coinfections thereof in striped bass tissues. In addition, PCR-RFLP assays were designed to detect M. marinum and other as-yet-undescribed Mycobacterium spp. present in Chesapeake Bay striped bass. Comparison of these molecular assays with culture-based techniques using splenic tissue from wild striped bass yielded generally concordant results and demonstrated the applicability of these techniques to the study of wild fish.

  13. Assessment of cell culture and polymerase chain reaction procedures for the detection of polioviruses in wastewater.

    PubMed Central

    Grabow, W. O.; Botma, K. L.; de Villiers, J. C.; Clay, C. G.; Erasmus, B.

    1999-01-01

    WHO considers that environmental surveillance for wild-type polioviruses is potentially important for surveillance for acute flaccid paralysis as a means of confirming eradication of poliomyelitis. The present study investigated methods for detecting polioviruses in a variety of water environments in South Africa. Most polioviruses were isolated on L20B mouse cells, which, however, were not selective: 16 reoviruses and 8 enteroviruses, apparently animal strains, were also isolated on these cells. Vaccine strains of polioviruses were isolated from surface waters during and shortly after two rounds of mass vaccination of children in an informal settlement where there was no sewerage. The results demonstrated the feasibility of poliovirus surveillance in such settlements. It was also evident that neither poliovirus vaccine strains nor other viruses were likely to interfere significantly with the detection of wild-type polioviruses. Optimal isolation of polioviruses was accomplished by parallel inoculation of L20B mouse cells and at least the PLC/PRF/5 human liver and buffalo green monkey (BGM) kidney cell lines. Analysis of cell cultures using the polymerase chain reaction revealed that 319 test samples contained at least 263 human enteroviruses that failed to produce a cytopathogenic effect. This type of analysis thus significantly increased the sensitivity of enterovirus detection. PMID:10680244

  14. Polymerase chain reaction-assisted papillomavirus detection in cervicovaginal smears: stratification by clinical risk and cytology reports.

    PubMed

    Kühler-Obbarius, C; Milde-Langosch, K; Helling-Giese, G; Salfelder, A; Peimann, C; Löning, T

    1994-01-01

    Seven hundred and twelve patients from cancer screening, pregnancy care, outpatient clinics for patients at risk for cervical dysplasia and human immunodeficiency virus (HIV) infection were tested simultaneously for cytological aberrations and human papillomavirus (HPV). Classification of these cases, and of all cytology records throughout 1991 and 1992 was performed according to the "Münchner Nomenklatur" and the Bethesda classification. HPV-directed polymerase chain reaction analysis was carried out with general primers, patients at risk for cervical dysplasia were tested by subsequent hybridization with HPV 16 and 18 probes. Patients from cancer screening and pregnancy care showed similar HPV prevalences ranging between 19.4%-24.6%. In contrast, patients from dysplasia and HIV units were infected in 56.2%-62.3% and 75.0%-76.9% respectively in centre of disease control stage III-IV, HPV detection rates in patients from dysplasia and HIV units increased gradually from 40.1%-52.9% in non-suspicious smears to 80.8%-100% in atypical smears. High risk HPV 16 and 18 infections were detected in 64% of smears with cytological evidence of HPV infection (koilocytosis) to 84.2% in severe dysplasia. Following the Bethesda guidelines, 2.9%-14.7% of all smears initially reported as Pap 2 K (suggestive of HPV infection) would be qualified as risk lesions (low grade squamous intraepithelial lesions), although they tested HPV negative in more than a third of cases. Thus, when using the Bethesda system, HPV analysis is needed to prevent overclassification and overtreatment. The "Münchner Nomenklatur" avoids this dilemma by not mixing morphological statements on infection, atypia and cancer risk.

  15. Rapid detection of Plasmodium falciparum with isothermal recombinase polymerase amplification and lateral flow analysis

    PubMed Central

    2014-01-01

    Background Nucleic acid amplification is the most sensitive and specific method to detect Plasmodium falciparum. However the polymerase chain reaction remains laboratory-based and has to be conducted by trained personnel. Furthermore, the power dependency for the thermocycling process and the costly equipment necessary for the read-out are difficult to cover in resource-limited settings. This study aims to develop and evaluate a combination of isothermal nucleic acid amplification and simple lateral flow dipstick detection of the malaria parasite for point-of-care testing. Methods A specific fragment of the 18S rRNA gene of P. falciparum was amplified in 10 min at a constant 38°C using the isothermal recombinase polymerase amplification (RPA) method. With a unique probe system added to the reaction solution, the amplification product can be visualized on a simple lateral flow strip without further labelling. The combination of these methods was tested for sensitivity and specificity with various Plasmodium and other protozoa/bacterial strains, as well as with human DNA. Additional investigations were conducted to analyse the temperature optimum, reaction speed and robustness of this assay. Results The lateral flow RPA (LF-RPA) assay exhibited a high sensitivity and specificity. Experiments confirmed a detection limit as low as 100 fg of genomic P. falciparum DNA, corresponding to a sensitivity of approximately four parasites per reaction. All investigated P. falciparum strains (n = 77) were positively tested while all of the total 11 non-Plasmodium samples, showed a negative test result. The enzymatic reaction can be conducted under a broad range of conditions from 30-45°C with high inhibitory concentration of known PCR inhibitors. A time to result of 15 min from start of the reaction to read-out was determined. Conclusions Combining the isothermal RPA and the lateral flow detection is an approach to improve molecular diagnostic for P. falciparum in

  16. Rapid detection of Plasmodium falciparum with isothermal recombinase polymerase amplification and lateral flow analysis.

    PubMed

    Kersting, Sebastian; Rausch, Valentina; Bier, Frank Fabian; von Nickisch-Rosenegk, Markus

    2014-03-15

    Nucleic acid amplification is the most sensitive and specific method to detect Plasmodium falciparum. However the polymerase chain reaction remains laboratory-based and has to be conducted by trained personnel. Furthermore, the power dependency for the thermocycling process and the costly equipment necessary for the read-out are difficult to cover in resource-limited settings. This study aims to develop and evaluate a combination of isothermal nucleic acid amplification and simple lateral flow dipstick detection of the malaria parasite for point-of-care testing. A specific fragment of the 18S rRNA gene of P. falciparum was amplified in 10 min at a constant 38°C using the isothermal recombinase polymerase amplification (RPA) method. With a unique probe system added to the reaction solution, the amplification product can be visualized on a simple lateral flow strip without further labelling. The combination of these methods was tested for sensitivity and specificity with various Plasmodium and other protozoa/bacterial strains, as well as with human DNA. Additional investigations were conducted to analyse the temperature optimum, reaction speed and robustness of this assay. The lateral flow RPA (LF-RPA) assay exhibited a high sensitivity and specificity. Experiments confirmed a detection limit as low as 100 fg of genomic P. falciparum DNA, corresponding to a sensitivity of approximately four parasites per reaction. All investigated P. falciparum strains (n=77) were positively tested while all of the total 11 non-Plasmodium samples, showed a negative test result. The enzymatic reaction can be conducted under a broad range of conditions from 30-45°C with high inhibitory concentration of known PCR inhibitors. A time to result of 15 min from start of the reaction to read-out was determined. Combining the isothermal RPA and the lateral flow detection is an approach to improve molecular diagnostic for P. falciparum in resource-limited settings. The system requires none or

  17. Evaluation of recombinase polymerase amplification for detection of begomoviruses by plant diagnostic clinics.

    PubMed

    Londoño, Maria A; Harmon, Carrie L; Polston, Jane E

    2016-03-22

    Plant viruses in the genus Begomovirus, family Geminiviridae often cause substantial crop losses. These viruses have been emerging in many locations throughout the tropics and subtropics. Like many plant viruses, they are often not recognized by plant diagnostic clinics due in large part to the lack of rapid and cost effective assays. An isothermal amplification assay, Recombinase polymerase amplification (RPA), was evaluated for its ability to detect three begomoviruses and for its suitability for use in plant diagnostic clinics. Methods for DNA extraction and separation of amplicons from proteins used in the assay were modified and compared to RPA manufacturer's protocols. The modified RPA assays were compared to PCR assays for sensitivity, use in downstream applications, cost, and speed. Recombinase polymerase amplification (RPA) assays for the detection of Bean golden yellow mosaic virus, Tomato mottle virus and Tomato yellow leaf curl virus (TYLCV) were specific, only amplifying the target viruses in three different host species. RPA was able to detect the target virus when the template was in a crude extract generated using a simple inexpensive extraction method, while PCR was not. Separation of RPA-generated amplicons from DNA-binding proteins could be accomplished by several methods, all of which were faster and less expensive than that recommended by the manufacturer. Use of these modifications resulted in an RPA assay that was faster than PCR but with a similar reagent cost. This modified RPA was the more cost effective assay when labor is added to the cost since RPA can be performed much faster than PCR. RPA had a sensitivity approximate to that of ELISA when crude extract was used as template. RPA-generated amplicons could be used in downstream applications (TA cloning, digestion with a restriction endonuclease, direct sequencing) similar to PCR but unlike some other isothermal reactions. RPA could prove useful for the cost effective detection of plant

  18. On-chip detection of a single nucleotide polymorphism without polymerase amplification

    PubMed Central

    Han, Jinhee; Tan, Matthew; Sudheendra, Lakshmana; Weiss, Robert H.; Kennedy, Ian M.

    2014-01-01

    A nanoparticle-assembled photonic crystal (PC) array was used to detect single nucleotide polymorphism (SNP). The assay platform with PC nanostructure enhanced the fluorescent signal from nanoparticle-hybridized DNA complexes due to phase matching of excitation and emission. Nanoparticles coupled with probe DNA were trapped into nanowells in an array by using an electrophoretic particle entrapment system. The PC/DNA assay platform was able to identify a 1 base pair (bp) difference in synthesized nucleotide sequences that mimicked the mutation seen in a feline model of human autosomal dominant polycystic kidney disease (PKD) with a sensitivity of 0.9 fg/mL (50 aM)-sensitivity, which corresponds to 30 oligos/array. The reliability of the PC/DNA assay platform to detect SNP in a real sample was demonstrated by using genomic DNA (gDNA) extracted from the urine and blood of two PKD− wild type and three PKD positive cats. The standard curves for PKD positive (PKD+) and negative (PKD−) DNA were created using two feline-urine samples. An additional three urine samples were analyzed in a similar fashion and showed satisfactory agreement with the standard curve, confirming the presence of the mutation in affected urine. The limit of detection (LOD) was 0.005 ng/mL which corresponds to 6 fg per array for gDNA in urine and blood. The PC system demonstrated the ability to detect a number of genome equivalents for the PKD SNP that was very similar to the results reported with real time polymerase chain reaction (PCR). The favorable comparison with quantitative PCR suggests that the PC technology may find application well beyond the detection of the PKD SNP, into areas where a simple, cheap and portable nucleic acid analysis is desirable. PMID:25580203

  19. On-chip detection of a single nucleotide polymorphism without polymerase amplification.

    PubMed

    Han, Jinhee; Tan, Matthew; Sudheendra, Lakshmana; Weiss, Robert H; Kennedy, Ian M

    2014-09-01

    A nanoparticle-assembled photonic crystal (PC) array was used to detect single nucleotide polymorphism (SNP). The assay platform with PC nanostructure enhanced the fluorescent signal from nanoparticle-hybridized DNA complexes due to phase matching of excitation and emission. Nanoparticles coupled with probe DNA were trapped into nanowells in an array by using an electrophoretic particle entrapment system. The PC/DNA assay platform was able to identify a 1 base pair (bp) difference in synthesized nucleotide sequences that mimicked the mutation seen in a feline model of human autosomal dominant polycystic kidney disease (PKD) with a sensitivity of 0.9 fg/mL (50 aM)-sensitivity, which corresponds to 30 oligos/array. The reliability of the PC/DNA assay platform to detect SNP in a real sample was demonstrated by using genomic DNA (gDNA) extracted from the urine and blood of two PKD(-) wild type and three PKD positive cats. The standard curves for PKD positive (PKD(+)) and negative (PKD(-)) DNA were created using two feline-urine samples. An additional three urine samples were analyzed in a similar fashion and showed satisfactory agreement with the standard curve, confirming the presence of the mutation in affected urine. The limit of detection (LOD) was 0.005 ng/mL which corresponds to 6 fg per array for gDNA in urine and blood. The PC system demonstrated the ability to detect a number of genome equivalents for the PKD SNP that was very similar to the results reported with real time polymerase chain reaction (PCR). The favorable comparison with quantitative PCR suggests that the PC technology may find application well beyond the detection of the PKD SNP, into areas where a simple, cheap and portable nucleic acid analysis is desirable.

  20. Colorimetric TMPRSS2-ERG Gene Fusion Detection in Prostate Cancer Urinary Samples via Recombinase Polymerase Amplification.

    PubMed

    Koo, Kevin M; Wee, Eugene J H; Trau, Matt

    2016-01-01

    TMPRSS2 (Exon 1)-ERG (Exon 4) is the most frequent gene fusion event in prostate cancer (PC), and is highly PC-specific unlike the current serum prostate specific antigen (PSA) biomarker. However, TMPRSS2-ERG levels are currently measured with quantitative reverse-transcription PCR (RT-qPCR) which is time-consuming and requires costly equipment, thus limiting its use in clinical diagnostics. Herein, we report a novel rapid, cost-efficient and minimal-equipment assay named "FusBLU" for detecting TMPRSS2-ERG gene fusions from urine. TMPRSS2-ERG mRNA was amplified by isothermal reverse transcription-recombinase polymerase amplification (RT-RPA), magnetically-isolated, and detected through horseradish peroxidase (HRP)-catalyzed colorimetric reaction. FusBLU was specific for TMPRSS2-ERG mRNA with a low visual detection limit of 10(5) copies. We also demonstrated assay readout versatility on 3 potentially useful platforms. The colorimetric readout was detectable by naked eye for a quick yes/no evaluation of gene fusion presence. On the other hand, a more quantitative TMPRSS2-ERG detection was achievable by absorbance/electrochemical measurements. FusBLU was successfully applied to 12 urinary samples and results were validated by gold-standard RT-qPCR. We also showed that sediment RNA was likely the main source of TMPRSS2-ERG mRNA in urinary samples. We believe that our assay is a potential clinical screening tool for PC and could also have wide applications for other disease-related fusion genes.

  1. A polymerase chain reaction assay for the detection of Leptospira spp. in bovine semen.

    PubMed Central

    Masri, S A; Nguyen, P T; Gale, S P; Howard, C J; Jung, S C

    1997-01-01

    A rapid and specific method for the detection of pathogenic Leptospira spp. in bovine semen using the polymerase chain reaction (PCR) is described. The primers used were derived from an EcoR1/BamH1 fragment that hybridized strongly to chromosomal DNA from the hardjobovis serovar. Three different extraction methods were evaluated in this study: phenol-chloroform extraction method, proteinase K (PK) in 1% SDS, followed by phenol-chloroform, and phenol-chloroform followed by 1% cetyltrimethylammonium bromide (CTAB). A PCR product of approximately 500 base pairs (bp) in length was obtained when DNA from pure Leptospira culture was used as a template for PCR, regardless of the DNA extraction method used. The product was consistent with that predicted from the gene sequence. However, in semen seeded in vitro, as well as in semen from infected bulls, a PCR product was obtained only when the leptospiral DNA was extracted from the specimen using the CTAB method. In contrast, other methods used for DNA extraction did not generate suitable templates for the PCR procedure. This is the first PCR protocol developed to detect Leptospira in bovine semen. The PCR protocol provided a direct and unequivocal demonstration that Leptospira can be detected in semen of infected animals. The CTAB method was also used successfully in detecting Leptospira in the urine of infected animals. The PCR procedure was shown to be more sensitive than either the fluorescent antibody test (FAT) or culture for detecting the organism in urine. Images Figure 1. Figure 2. Figure 3. Figure 4a. Figure 4b. Figure 5. PMID:9008795

  2. Colorimetric TMPRSS2-ERG Gene Fusion Detection in Prostate Cancer Urinary Samples via Recombinase Polymerase Amplification

    PubMed Central

    Koo, Kevin M.; Wee, Eugene J.H.; Trau, Matt

    2016-01-01

    TMPRSS2 (Exon 1)-ERG (Exon 4) is the most frequent gene fusion event in prostate cancer (PC), and is highly PC-specific unlike the current serum prostate specific antigen (PSA) biomarker. However, TMPRSS2-ERG levels are currently measured with quantitative reverse-transcription PCR (RT-qPCR) which is time-consuming and requires costly equipment, thus limiting its use in clinical diagnostics. Herein, we report a novel rapid, cost-efficient and minimal-equipment assay named “FusBLU” for detecting TMPRSS2-ERG gene fusions from urine. TMPRSS2-ERG mRNA was amplified by isothermal reverse transcription-recombinase polymerase amplification (RT-RPA), magnetically-isolated, and detected through horseradish peroxidase (HRP)-catalyzed colorimetric reaction. FusBLU was specific for TMPRSS2-ERG mRNA with a low visual detection limit of 105 copies. We also demonstrated assay readout versatility on 3 potentially useful platforms. The colorimetric readout was detectable by naked eye for a quick yes/no evaluation of gene fusion presence. On the other hand, a more quantitative TMPRSS2-ERG detection was achievable by absorbance/electrochemical measurements. FusBLU was successfully applied to 12 urinary samples and results were validated by gold-standard RT-qPCR. We also showed that sediment RNA was likely the main source of TMPRSS2-ERG mRNA in urinary samples. We believe that our assay is a potential clinical screening tool for PC and could also have wide applications for other disease-related fusion genes. PMID:27375789

  3. Detection of rice tungro bacilliform virus in field and glasshouse samples from India using the polymerase chain reaction.

    PubMed

    Dasgupta, I; Das, B K; Nath, P S; Mukhopadhyay, S; Niazi, F R; Varma, A

    1996-04-26

    Rice tungro bacilliform virus (RTBV) together with rice tungro spherical virus (RTSV) is the causal agent for the rice tungro disease. A rapid technique was developed to detect RTBV DNA in the crude extract of freshly collected leaf samples by polymerase chain reaction (PCR). This technique can detect the viral DNA in 1000-fold diluted leaf extract. Detection has been possible in samples stored upto 5 days after the collection. This technique may have wide application for the field diagnosis of RTBV infection.

  4. [THE HIGHLY EFFECTIVE DETECTION OF DNA RICKETTSIA USING TECHNIQUE OF POLYMERASE CHAIN REACTION IN REAL-TIME].

    PubMed

    Kartashov, M Yu; Mikryukova, T P; Ternovoi, V A; Moskvitina, N S; Loktev, V B

    2015-12-01

    The article considers development of highly effective technique of detection of genetic material of ricketsia based on polymerase chain reaction in real-time using original primers to the most conservative sites of gene of citrate synthase (gItA). The analytical sensitivity of the developed polymerase chain reaction in real-time test permits to detect from 80 genome equivalents in analyzed sample during three hours. The high specificity of test-system is substantiated by detection of nucleotide sequences of amplificated fragments of gene gltA. The approbation ofthe polymerase chain reaction in real-time test is carried out on collection of 310 ticks of species I. persulcatus, I. pavlovskyi, D. reticulatus. It is demonstrated that the developed alternate ofprimers and probe permits with high degree of sensitivity and specifcity to detect DNA of different species of ricketsia widespread on territory of Russia (R. sibirica, R. raoultii, R. helvetica, R. tarasevichiae). The proposed polymerase chain reaction in real-time test can be appliedfor isolation of fragment of gene gltA with purpose for detecting nucleotide sequence and subsequent genetic typing of ricketsia. The application ofthe proposed technique can facilitate task of monitoring hot spots of ricketsiosis.

  5. Sensitive Detection of Thirteen Bacterial Vaginosis-Associated Agents Using Multiplex Polymerase Chain Reaction.

    PubMed

    Malaguti, Natália; Bahls, Larissa Danielle; Uchimura, Nelson Shozo; Gimenes, Fabrícia; Consolaro, Marcia Edilaine Lopes

    2015-01-01

    Bacterial vaginosis (BV) is characterized by a polymicrobial proliferation of anaerobic bacteria and depletion of lactobacilli, which are components of natural vaginal microbiota. Currently, there are limited conventional methods for BV diagnosis, and these methods are time-consuming, expensive, and rarely allow for the detection of more than one agent simultaneously. Therefore, we conceived and validated a multiplex polymerase chain reaction (M-PCR) assay for the simultaneous screening of thirteen bacterial vaginosis-associated agents (BV-AAs) related to symptomatic BV: Gardnerella vaginalis, Mobiluncus curtisii, Mobiluncus mulieris, Bacteroides fragilis, Mycoplasma hominis, Atopobium vaginae, Ureaplasma urealyticum, Megasphaera type I, Clostridia-like bacteria vaginosis-associated bacteria (BVABs) 1, 2, and 3, Sneathia sanguinegens, and Mycoplasma genitalium. The overall validation parameters of M-PCR compared to single PCR (sPCR) were extremely high, including agreement of 99.1% and sensitivity, specificity, and positive predictive values of 100.0%, negative predictive value of 97.0%, accuracy of 99.3%, and agreement with Nugent results of 100.0%. The prevalence of BV-AAs was very high (72.6%), and simultaneous agents were detected in 53.0%, which demonstrates the effectiveness of the M-PCR assay. Therefore, the M-PCR assay has great potential to impact BV diagnostic methods in vaginal samples and diminish associated complications in the near future.

  6. Detection of Salmonella sp. in Dermanyssus gallinae using an FTA filter-based polymerase chain reaction.

    PubMed

    Moro, C Valiente; Desloire, S; Chauve, C; Zenner, L

    2007-06-01

    Salmonella spp. bacteria are responsible for some of the most important zoonoses worldwide. Because Dermanyssus gallinae (DeGeer) (Acari: Dermanyssidae) has been recently reported to be an experimental vector of Salmonella Enteritidis, it would be of benefit to evaluate the presence of this bacterium in mites. A molecular detection tool associating a simple filter-based DNA preparation with a specific 16S rDNA Salmonella sp. polymerase chain reaction (PCR) amplification was described. The limit of detection with this method was 2 x 10(4) bacteria per mite. To adapt this technique for large-scale studies, two sizes of mite pools were tested and a preliminary investigation was carried out on mites from 16 currently or previously contaminated farms. Mites sampled from one farm of each type were positive for Salmonella, suggesting that Dermanyssus could act as a reservoir between flocks. In further investigations, it will be necessary to carry out a large-scale study to assess the role of D. gallinae in the epidemiology of avian salmonellosis.

  7. Detection of Mycobacterium tuberculosis complex by nested polymerase chain reaction in pulmonary and extrapulmonary specimens* ,**

    PubMed Central

    Furini, Adriana Antônia da Cruz; Pedro, Heloisa da Silveira Paro; Rodrigues, Jean Francisco; Montenegro, Lilian Maria Lapa; Machado, Ricardo Luiz Dantas; Franco, Célia; Schindler, Haiana Charifker; Batista, Ida Maria Foschiani Dias; Rossit, Andrea Regina Baptista

    2013-01-01

    OBJECTIVE: To compare the performance of nested polymerase chain reaction (NPCR) with that of cultures in the detection of the Mycobacterium tuberculosis complex in pulmonary and extrapulmonary specimens. METHODS: We analyzed 20 and 78 pulmonary and extrapulmonary specimens, respectively, of 67 hospitalized patients suspected of having tuberculosis. An automated microbial system was used for the identification of Mycobacterium spp. cultures, and M. tuberculosis IS6110 was used as the target sequence in the NPCR. The kappa statistic was used in order to assess the level of agreement among the results. RESULTS: Among the 67 patients, 6 and 5, respectively, were diagnosed with pulmonary and extrapulmonary tuberculosis, and the NPCR was positive in all of the cases. Among the 98 clinical specimens, smear microscopy, culture, and NPCR were positive in 6.00%, 8.16%, and 13.26%, respectively. Comparing the results of NPCR with those of cultures (the gold standard), we found that NPCR had a sensitivity and specificity of 100% and 83%, respectively, in pulmonary specimens, compared with 83% and 96%, respectively, in extrapulmonary specimens, with good concordance between the tests (kappa, 0.50 and 0.6867, respectively). CONCLUSIONS: Although NPCR proved to be a very useful tool for the detection of M. tuberculosis complex, clinical, epidemiological, and other laboratory data should also be considered in the diagnosis and treatment of pulmonary and extrapulmonary tuberculosis. PMID:24473765

  8. Development of a panel of recombinase polymerase amplification assays for detection of biothreat agents.

    PubMed

    Euler, Milena; Wang, Yongjie; Heidenreich, Doris; Patel, Pranav; Strohmeier, Oliver; Hakenberg, Sydney; Niedrig, Matthias; Hufert, Frank T; Weidmann, Manfred

    2013-04-01

    Syndromic panels for infectious disease have been suggested to be of value in point-of-care diagnostics for developing countries and for biodefense. To test the performance of isothermal recombinase polymerase amplification (RPA) assays, we developed a panel of 10 RPAs for biothreat agents. The panel included RPAs for Francisella tularensis, Yersinia pestis, Bacillus anthracis, variola virus, and reverse transcriptase RPA (RT-RPA) assays for Rift Valley fever virus, Ebola virus, Sudan virus, and Marburg virus. Their analytical sensitivities ranged from 16 to 21 molecules detected (probit analysis) for the majority of RPA and RT-RPA assays. A magnetic bead-based total nucleic acid extraction method was combined with the RPAs and tested using inactivated whole organisms spiked into plasma. The RPA showed comparable sensitivities to real-time RCR assays in these extracts. The run times of the assays at 42°C ranged from 6 to 10 min, and they showed no cross-detection of any of the target genomes of the panel nor of the human genome. The RPAs therefore seem suitable for the implementation of syndromic panels onto microfluidic platforms.

  9. Detection of the genes encoding botulinum neurotoxin types A to E by the polymerase chain reaction.

    PubMed Central

    Szabo, E A; Pemberton, J M; Desmarchelier, P M

    1993-01-01

    The polymerase chain reaction (PCR) was used as the basis for the development of highly sensitive and specific diagnostic tests for organisms harboring botulinum neurotoxin type A through E genes. Synthetic DNA primers were selected from nucleic acid sequence data for Clostridium botulinum neurotoxins. Individual components of the PCR for each serotype (serotypes A through E) were adjusted for optimal amplification of the target fragment. Each PCR assay was tested with organisms expressing each of the botulinum neurotoxin types (types A through G), Clostridium tetani, genetically related nontoxigenic organisms, and unrelated strains. Each assay was specific for the intended target. The PCR reliably identified multiple strains having the same neurotoxin type. The sensitivity of the test was determined with different concentrations of genomic DNA from strains producing each toxin type. As little as 10 fg of DNA (approximately three clostridial cells) was detected. C. botulinum neurotoxin types A, B, and E, which are most commonly associated with human botulism, could be amplified from crude DNA extracts, from vegetative cells, and from spore preparations. This suggests that there is great potential for the PCR in the identification and detection of botulinum neurotoxin-producing strains. Images PMID:8215372

  10. DNA-dependent RNA polymerase detects hidden giant viruses in published databanks.

    PubMed

    Sharma, Vikas; Colson, Philippe; Giorgi, Roch; Pontarotti, Pierre; Raoult, Didier

    2014-06-13

    Environmental metagenomic studies show that there is a "dark matter," composed of sequences not linked to any known organism, as determined mainly using ribosomal DNA (rDNA) sequences, which therefore ignore giant viruses. DNA-dependent RNA polymerase (RNAP) genes are universal in microbes and conserved in giant viruses and may replace rDNA for identifying microbes. We found while reconstructing RNAP subunit 2 (RNAP2) phylogeny that a giant virus sequenced together with the genome of a large eukaryote, Hydra magnipapillata, has been overlooked. To explore the dark matter, we used viral RNAP2 and reconstructed putative ancestral RNAP2, which were significantly superior in detecting distant clades than current sequences, and we revealed two additional unknown mimiviruses, misclassified as an euryarchaeote and an oomycete plant pathogen, and detected unknown putative viral clades. We suggest using RNAP systematically to decipher the black matter and identify giant viruses. © The Author(s) 2014. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  11. A specific oligonucleotide primer for the rapid detection of Lactobacillus lindneri by polymerase chain reaction.

    PubMed

    Yasui, T; Okamoto, T; Taguchi, H

    1997-02-01

    A polymerase chain reaction (PCR) method was developed for the rapid detection of the beer-spoilage heterofermentative lactic acid bacterium Lactobacillus lindneri. Three strains, the Chinese brewery isolate DA1, the Japanese commercial beer isolate BG2, and the Japanese brewery isolate SE3, which were serologically classified as belonging to L. lindneri, were used in this study. After sequencing the 16S rDNA of the isolates DA1 and BG2 and the typical beer-spoilage heterofermentative Lactobacillus brevis L63, these sequences were compared with published data. A L. lindneri specific PCR primer, DA-40, was then constructed based on the V1 variable region of 16S rDNA. The specificity of PCR using the L. lindneri specific primer DA-40 and the universal primer 907r was examined using five L. lidneri strains: the three isolates described above and two strains from culture collection, DSM 20690 and DSM 20692. A variety of beer-spoilage lactic acid bacteria, including 71 Lactobacillus strains and 13 Pediococcus strains, were also included in this examination. No PCR product was obtained from any DNA with the exception of the five L. lindneri strains, indicating that the L. lindneri specific primer DA-40 was highly specific. The detection limit for L. lindneri in beer was 63 CFU/100 mL of beer.

  12. Sensitive Detection of Thirteen Bacterial Vaginosis-Associated Agents Using Multiplex Polymerase Chain Reaction

    PubMed Central

    Malaguti, Natália; Bahls, Larissa Danielle; Uchimura, Nelson Shozo; Gimenes, Fabrícia; Consolaro, Marcia Edilaine Lopes

    2015-01-01

    Bacterial vaginosis (BV) is characterized by a polymicrobial proliferation of anaerobic bacteria and depletion of lactobacilli, which are components of natural vaginal microbiota. Currently, there are limited conventional methods for BV diagnosis, and these methods are time-consuming, expensive, and rarely allow for the detection of more than one agent simultaneously. Therefore, we conceived and validated a multiplex polymerase chain reaction (M-PCR) assay for the simultaneous screening of thirteen bacterial vaginosis-associated agents (BV-AAs) related to symptomatic BV: Gardnerella vaginalis, Mobiluncus curtisii, Mobiluncus mulieris, Bacteroides fragilis, Mycoplasma hominis, Atopobium vaginae, Ureaplasma urealyticum, Megasphaera type I, Clostridia-like bacteria vaginosis-associated bacteria (BVABs) 1, 2, and 3, Sneathia sanguinegens, and Mycoplasma genitalium. The overall validation parameters of M-PCR compared to single PCR (sPCR) were extremely high, including agreement of 99.1% and sensitivity, specificity, and positive predictive values of 100.0%, negative predictive value of 97.0%, accuracy of 99.3%, and agreement with Nugent results of 100.0%. The prevalence of BV-AAs was very high (72.6%), and simultaneous agents were detected in 53.0%, which demonstrates the effectiveness of the M-PCR assay. Therefore, the M-PCR assay has great potential to impact BV diagnostic methods in vaginal samples and diminish associated complications in the near future. PMID:26078959

  13. Detection of helicobacter pylori in benign laryngeal lesions by polymerase chain reaction: a cross sectional study

    PubMed Central

    2012-01-01

    Background Although Helicobacter Pylori (HP) was detected in some cases of chronic laryngitis, the results were not confirmed by polymerase chain reaction (PCR). By this time, it has not been found in laryngeal lesions by in house PCR, the most sensitive method for detecting the genome tracks. Regarding the previous results and also few numbers of studies about the presence of HP in benign laryngeal lesions, specifically by PCR, we aimed to investigate the presence of HP in benign laryngeal lesions by in-house PCR. Methods The samples were taken from 55 patients with benign laryngeal lesions and frozen in −20°C. One milliliter (ml) of lysis buffer was added to 100 mg (mg) of each sample and the tube was placed in 56°C overnight. Then DNA extraction was carried out. Results To find HP DNA, in-house PCR was performed that revealed 5 positive results among 55 patients with benign laryngeal lesions. Of them, 3 were polyp, 1 was nodule and 1 was papilloma. Conclusion Although the number of positive results was not a lot in this study, it was in contrast with previous studies which could not find any HP tracks in benign laryngeal lesions by other methods. More studies about the prevalence of HP in benign laryngeal lesions improve judging about the effect of this infection on benign laryngeal lesions. PMID:22515206

  14. Detection of fastidious mycobacteria in human intestines by the polymerase chain reaction.

    PubMed

    Dumonceau, J M; Van Gossum, A; Adler, M; Van Vooren, J P; Fonteyne, P A; De Beenhouwer, H; Portaels, F

    1997-05-01

    The aim of this study was to determine whether difficult-to-grow mycobacteria are present in human intestines. Intestinal tissue samples were subjected to both mycobacterial culture and a polymerase chain reaction (PCR) assay. After detection by PCR, species identity was determined by hybridizing the amplified 16S rRNA gene fragments with species-specific oligonucleotides. Intestinal biopsies from 63 patients with noninflammatory bowel diseases (n = 22), Crohn's disease (n = 31), or ulcerative colitis (n = 10) were analyzed. Culture and PCR revealed mycobacteria in four (6%) and 25 (40%) samples, respectively. Samples positive by PCR were negative with all probes specific to nine common cultivable species but were positive with Mycobacterium genavense-specific probe in 68% of cases. Mycobacterial isolates were identified as Mycobacterium gordonae and Mycobacterium chelonae. Findings were similar in Crohn's disease samples compared to non-Chron's disease samples. This study shows that difficult-to-grow mycobacteria can be detected by PCR in large and similar proportions of inflamed intestinal tissue from patients with inflammatory bowel disease and intestinal tissue that appears normal from patients with noninflammatory bowel disease.

  15. A polymerase chain reaction-based methodology to detect gene doping.

    PubMed

    Carter, Adam; Flueck, Martin

    2012-04-01

    The non-therapeutic use of genes to enhance athletic performance (gene doping) is a novel threat to the world of sports. Skeletal muscle is a prime target of gene therapy and we asked whether we can develop a test system to produce and detect gene doping. Towards this end, we introduced a plasmid (pCMV-FAK, 3.8 kb, 50 μg) for constitutive expression of the chicken homologue for the regulator of muscle growth, focal adhesion kinase (FAK), via gene electro transfer in the anti-gravitational muscle, m. soleus, or gastrocnemius medialis of rats. Activation of hypertrophy signalling was monitored by assessing the ribosomal kinase p70S6K and muscle fibre cross section. Detectability of the introduced plasmid was monitored with polymerase chain reaction in deoxyribonucleic acids (DNA) from transfected muscle and serum. Muscle transfection with pCMV-FAK elevated FAK expression 7- and 73-fold, respectively, and increased mean cross section by 52 and 16% in targeted muscle fibres of soleus and gastrocnemius muscle 7 days after gene electro transfer. Concomitantly p70S6K content was increased in transfected soleus muscle (+110%). Detection of the exogenous plasmid sequence was possible in DNA and cDNA of muscle until 7 days after transfection, but not in serum except close to the site of plasmid deposition, 1 h after injection and surgery. The findings suggest that the reliable detection of gene doping in the immoral athlete is not possible unless a change in the current practice of tissue sampling is applied involving the collection of muscle biopsy close to the site of gene injection.

  16. Specific detection of Salmonella enterica serotype Enteritidis using the polymerase chain reaction.

    PubMed Central

    Lampel, K. A.; Keasler, S. P.; Hanes, D. E.

    1996-01-01

    An assay was developed for the specific detection of Salmonella enterica serotype Enteritidis, using a novel application of the polymerase chain reaction (PCR). This PCR assay is based on the mismatch amplification mutation assay, an allele-specific reaction, and can discriminate Enteritidis from all other salmonella. PCR primers were selected to amplify a 351-base pair (bp) DNA fragment from the salmonella plasmid virulence A (spv A) gene of Enteritidis. A single base difference at position 272 is present between the nucleotide sequence of the spvA gene of Enteritidis and other salmonellae. The downstream PCR primer, that encompasses position 272 of the Enteritidis spvA gene, was designed to contain a single base mismatch at the penultimate position, resulting in a 1-base mismatch with Enteritidis and a 2-base mismatch with other salmonellae that harbour the virulence plasmid. The upstream primer was completely homologous with the region immediately 5' to the spvA gene. When these primers were used and the annealing and extension reactions were performed at the same temperature, the PCR assay was specific for Enteritidis; no PCR product was detected for 40 other serotypes and 28 different genera examined. In pure culture, 120 colony forming units (c.f.u.) could be detected; a PCR product was observed from template derived from a 5 h enrichment broth culture of chicken seeded with 1 c.f.u. per gram of Enteritidis. This PCR assay is specific, reproducible, and less time consuming than the standard bacteriological methods used to detect Enteritidis. Images Fig. 2 Fig. 3 Fig. 4 PMID:8620904

  17. Streptococcus equi Detection Polymerase Chain Reaction Assay for Equine Nasopharyngeal and Guttural Pouch Wash Samples.

    PubMed

    Boyle, A G; Rankin, S C; Duffee, L; Boston, R C; Wheeler-Aceto, H

    2016-01-01

    Bacterial culture and polymerase chain reaction (PCR) assays for the detection of Streptococcus equi in nasopharyngeal washes (NPW) and guttural pouch lavage (GPL) samples have low sensitivity. In human diagnostics, processing of samples with flocked swabs has improved recovery rates of bacterial agents because of improved surface area and elution factors. For S. equi subsp. equi (S. equi) detection in NPW and GPL samples we hypothesized that: direct-PCR would be more reliable than flocked swab culture (FS culture); flocked swab PCR (FS-PCR) would be equivalent to direct-PCR; and FS culture would be more reliable than traditional culture. A total of 193 samples (134 NPW and 59 GPL) from 113 horses with either suspected S. equi infection, convalescing from a known S. equi infection, or asymptomatic horses screened for S. equi. Prospective study. Samples were submitted for S. equi direct-PCR. Using logistic regression, direct-PCR (gold standard) was compared to FS culture, traditional culture, and FS-PCR also performed. Direct-PCR was statistically more sensitive than FS-PCR, FS culture, and traditional culture (P < .001). All methods had sensitivities <70% relative to the direct-PCR. FS culture had a similar sensitivity relative to traditional culture. The odds of GPL samples being positive on direct-PCR (P = .030) and FS-PCR were greater than those for NPW samples (P = .021). Use of flocked swabs during laboratory preprocessing did not improve detection of S. equi via either PCR or bacterial culture from samples. Direct-PCR is the preferred method of detection of S. equi. Copyright © 2015 The Authors. Journal of Veterinary Internal Medicine published by Wiley Periodicals, Inc. on behalf of the American College of Veterinary Internal Medicine.

  18. Nanobarcoding: detecting nanoparticles in biological samples using in situ polymerase chain reaction

    PubMed Central

    Eustaquio, Trisha; Leary, James F

    2012-01-01

    Background Determination of the fate of nanoparticles (NPs) in a biological system, or NP biodistribution, is critical in evaluating an NP formulation for nanomedicine. Current methods to determine NP biodistribution are greatly inadequate, due to their limited detection thresholds. Herein, proof of concept of a novel method for improved NP detection based on in situ polymerase chain reaction (ISPCR), coined “nanobarcoding,” is demonstrated. Methods Nanobarcoded superparamagnetic iron oxide nanoparticles (NB-SPIONs) were characterized by dynamic light scattering, zeta potential, and hyperspectral imaging measurements. Cellular uptake of Cy5-labeled NB-SPIONs (Cy5-NB-SPIONs) was imaged by confocal microscopy. The feasibility of the nanobarcoding method was first validated by solution-phase PCR and “pseudo”-ISPCR before implementation in the model in vitro system of HeLa human cervical adenocarcinoma cells, a cell line commonly used for ISPCR-mediated detection of human papilloma virus (HPV). Results Dynamic light-scattering measurements showed that NB conjugation stabilized SPION size in different dispersion media compared to that of its precursor, carboxylated SPIONs (COOH-SPIONs), while the zeta potential became more positive after NB conjugation. Hyperspectral imaging confirmed NB conjugation and showed that the NB completely covered the SPION surface. Solution-phase PCR and pseudo-ISPCR showed that the expected amplicons were exclusively generated from the NB-SPIONs in a dose-dependent manner. Although confocal microscopy revealed minimal cellular uptake of Cy5-NB-SPIONs at 50 nM over 24 hours in individual cells, ISPCR detected definitive NB-SPION signals inside HeLa cells over large sample areas. Conclusion Proof of concept of the nanobarcoding method has been demonstrated in in vitro systems, but the technique needs further development before its widespread use as a standardized assay. PMID:23144562

  19. Thermostabilization of indigenous multiplex polymerase chain reaction reagents for detection of enterotoxigenic Staphylococcus aureus.

    PubMed

    Nagaraj, Sowmya; Ramlal, Shylaja; Kingston, Joseph; Batra, Harsh Vardhan

    2016-05-13

    Among DNA-based techniques, polymerase chain reaction (PCR) is the most widely accepted molecular tool for the detection of pathogens. However, the technique involves several reagents and multiple pipetting steps that often lead to error-prone results. Additionally, the reagents entail a cold-chain facility to maintain their stability during storage and transportation. The main aim of the present study was to simplify the utility of a pre-optimized multiplex PCR format that was developed to detect toxigenic strains of Staphylococcus aureus by providing stable, pre-mixed, and ready-to-use master mix in a lyophilized formulation. Master mix containing all reagents except the template was lyophilized in the presence of an excipient lyoprotectant to achieve long-term stability without altering the sensitivity, specificity and PCR performance. Bromophenol blue was also included in the master mix to reduce the risk of external contamination during gel loading. The stability of lyophilized master mix was analyzed at different temperatures. The PCR performance was also examined after exposure of master mix to notable temperature fluctuations during transportation. The shelf-life of lyophilized master mix was estimated to be 1.5 months at ambient temperature and 6 months at 4°C. Stability was unaffected by temperature fluctuations during transportation even in cold-chain-free conditions, thus reducing the cost required for cold storage. The sensitive, cost-effective, ready-to-use, and ambient temperature stable formulation could be implemented as a detection tool in food analysis and diagnostic laboratories and hospitals and for on-field application outside the laboratories, as well as for detection of toxigenic strains of S. aureus. Copyright © 2016. Published by Elsevier B.V.

  20. Development of Recombinase Polymerase Amplification Assays for Detection of Orientia tsutsugamushi or Rickettsia typhi.

    PubMed

    Chao, Chien-Chung; Belinskaya, Tatyana; Zhang, Zhiwen; Ching, Wei-Mei

    2015-01-01

    Sensitive, specific and rapid diagnostic tests for the detection of Orientia tsutsugamushi (O. tsutsugamushi) and Rickettsia typhi (R. typhi), the causative agents of scrub typhus and murine typhus, respectively, are necessary to accurately and promptly diagnose patients and ensure that they receive proper treatment. Recombinase polymerase amplification (RPA) assays using a lateral flow test (RPA-nfo) and real-time fluorescent detection (RPA-exo) were developed targeting the 47-kDa gene of O. tsutsugamushi or 17 kDa gene of R. typhi. The RPA assay was capable of detecting O. tsutsugamushi or R. typhi at levels comparable to that of the quantitative PCR method. Both the RPA-nfo and RPA-exo methods performed similarly with regards to sensitivity when detecting the 17 kDa gene of R. typhi. On the contrary, RPA-exo performed better than RPA-nfo in detecting the 47 kDa gene of O. tsutsugamushi. The clinical performance of the O. tsutsugamushi RPA assay was evaluated using either human patient samples or infected mouse samples. Eight out of ten PCR confirmed positives were determined positive by RPA, and all PCR confirmed negative samples were negative by RPA. Similar results were obtained for R. typhi spiked patient sera. The assays were able to differentiate O. tsutsugamushi and R. typhi from other phylogenetically related bacteria as well as mouse and human DNA. Furthermore, the RPA-nfo reaction was completed in 20 minutes at 37°C followed by a 10 minute incubation at room temperature for development of an immunochromatographic strip. The RPA-exo reaction was completed in 20 minutes at 39°C. The implementation of a cross contamination proof cassette to detect the RPA-nfo fluorescent amplicons provided an alternative to regular lateral flow detection strips, which are more prone to cross contamination. The RPA assays provide a highly time-efficient, sensitive and specific alternative to other methods for diagnosing scrub typhus or murine typhus.

  1. Development of Recombinase Polymerase Amplification Assays for Detection of Orientia tsutsugamushi or Rickettsia typhi

    PubMed Central

    Chao, Chien-Chung; Belinskaya, Tatyana; Zhang, Zhiwen; Ching, Wei-Mei

    2015-01-01

    Sensitive, specific and rapid diagnostic tests for the detection of Orientia tsutsugamushi (O. tsutsugamushi) and Rickettsia typhi (R. typhi), the causative agents of scrub typhus and murine typhus, respectively, are necessary to accurately and promptly diagnose patients and ensure that they receive proper treatment. Recombinase polymerase amplification (RPA) assays using a lateral flow test (RPA-nfo) and real-time fluorescent detection (RPA-exo) were developed targeting the 47-kDa gene of O. tsutsugamushi or 17 kDa gene of R. typhi. The RPA assay was capable of detecting O. tsutsugamushi or R. typhi at levels comparable to that of the quantitative PCR method. Both the RPA-nfo and RPA-exo methods performed similarly with regards to sensitivity when detecting the 17 kDa gene of R. typhi. On the contrary, RPA-exo performed better than RPA-nfo in detecting the 47 kDa gene of O. tsutsugamushi. The clinical performance of the O. tsutsugamushi RPA assay was evaluated using either human patient samples or infected mouse samples. Eight out of ten PCR confirmed positives were determined positive by RPA, and all PCR confirmed negative samples were negative by RPA. Similar results were obtained for R. typhi spiked patient sera. The assays were able to differentiate O. tsutsugamushi and R. typhi from other phylogenetically related bacteria as well as mouse and human DNA. Furthermore, the RPA-nfo reaction was completed in 20 minutes at 37oC followed by a 10 minute incubation at room temperature for development of an immunochromatographic strip. The RPA-exo reaction was completed in 20 minutes at 39oC. The implementation of a cross contamination proof cassette to detect the RPA-nfo fluorescent amplicons provided an alternative to regular lateral flow detection strips, which are more prone to cross contamination. The RPA assays provide a highly time-efficient, sensitive and specific alternative to other methods for diagnosing scrub typhus or murine typhus. PMID:26161793

  2. ZSCAN5B and primate-specific paralogs bind RNA polymerase III genes and extra-TFIIIC (ETC) sites to modulate mitotic progression

    PubMed Central

    Sun, Younguk; Zhang, Huimin; Kazemian, Majid; Troy, Joseph M.; Seward, Christopher; Lu, Xiaochen; Stubbs, Lisa

    2016-01-01

    Mammalian genomes contain hundreds of genes transcribed by RNA Polymerase III (Pol III), encoding noncoding RNAs and especially the tRNAs specialized to carry specific amino acids to the ribosome for protein synthesis. In addition to this well-known function, tRNAs and their genes (tDNAs) serve a variety of other critical cellular functions. For example, tRNAs and other Pol III transcripts can be cleaved to yield small RNAs with potent regulatory activities. Furthermore, from yeast to mammals, active tDNAs and related “extra-TFIIIC” (ETC) loci provide the DNA scaffolds for the most ancient known mechanism of three-dimensional chromatin architecture. Here we identify the ZSCAN5 TF family - including mammalian ZSCAN5B and its primate-specific paralogs - as proteins that occupy mammalian Pol III promoters and ETC sites. We show that ZSCAN5B binds with high specificity to a conserved subset of Pol III genes in human and mouse. Furthermore, primate-specific ZSCAN5A and ZSCAN5D also bind Pol III genes, although ZSCAN5D preferentially localizes to MIR SINE- and LINE2-associated ETC sites. ZSCAN5 genes are expressed in proliferating cell populations and are cell-cycle regulated, and siRNA knockdown experiments suggested a cooperative role in regulation of mitotic progression. Consistent with this prediction, ZSCAN5A knockdown led to increasing numbers of cells in mitosis and the appearance of cells. Together, these data implicate the role of ZSCAN5 genes in regulation of Pol III genes and nearby Pol II loci, ultimately influencing cell cycle progression and differentiation in a variety of tissues. PMID:27732952

  3. Detection of enteroviral RNA by polymerase chain reaction in cerebrospinal fluid from patients with aseptic meningitis.

    PubMed

    Glimåker, M; Johansson, B; Olcén, P; Ehrnst, A; Forsgren, M

    1993-01-01

    An assay based on a 2-step (semi-nested) polymerase chain reaction (PCR) was developed and evaluated for detection of enterovirus-specific RNA in cerebrospinal fluid (CSF) from patients with aseptic meningitis of different etiology. The limit of detectability of enteroviral RNA was equivalent to about 0.25 tissue culture infective doses 50%. In samples, stored at -70 degrees C, analyzed without repeated thawing, enteroviral RNA was demonstrable in 21/22 CSF specimens from which an enterovirus had been isolated. Enteroviral RNA was shown to be degraded during freeze-thawing of the samples. In repeatedly freeze-thawed samples from 134 consecutive patients with aseptic meningitis, a lower sensitivity (34/48 = 0.71) was observed. In the latest phase of the study, comprising 35 consecutive patients, the PCR was performed in CSF stored at -20 degrees C without thawing. In this material, the PCR yielded positive results in 19 patients, whereas enteroviruses were isolated from 6 cases only. In the total clinical material of 169 patients, 67 (40%) were found positive by PCR, whereas an enterovirus was isolated from CSF in 54 (32%) cases. All the 13 isolated enterovirus serotypes found in the study were demonstrable by PCR, indicating that the assay is broad-reacting within the enterovirus group. The specificity appeared to be high, since all of 21 patients with non-enteroviral diagnoses were negative by the PCR test, except 1 with an Epstein-Barr virus infection. As serological evidence of enteroviral etiology was found in this patient, a dual infection seemed probable. This study indicates that enteroviral RNA can be detected in CSF by a 2-step PCR in meningitis caused by enterovirus and that the technique has the potential to become a screening method for routine diagnosis of enteroviral meningitis.

  4. Polymerase chain reaction-free detection of hepatitis B virus DNA using a nanostructured impedance biosensor.

    PubMed

    Chen, Chun-Cheng; Lai, Zi-Lun; Wang, Gou-Jen; Wu, Chun-Ying

    2016-03-15

    A polymerase chain reaction (PCR)-free technique for the effective detection of genomic length hepatitis B virus (HBV) DNA is described in this study. The honeycomb-like barrier layer of an anodic aluminum oxide (AAO) film having a uniform nanohemisphere array was used as the substrate of the sensing electrode. A 30-nm gold film was sputtered onto the AAO barrier layer surface as the electrode, followed by electrochemical deposition of gold nanoparticles (GNPs) on the hemisphere surface. A specially designed single-strand 96-mer gene fragment of the target genomic DNA of HBV based on the genome sequences of HBV was immobilized on the nanostructured electrode as the capture probe. Target HBV DNA obtained from clinical samples was hybridized to the sensing probes. Detection results illustrate two dynamic linear ranges, 10(2)-10(3) and 10(3)-10(5.1) copies/mL, having R(2) values of 0.801 and 0.996 could be obtained, respectively. The detection limit of the proposed sending scheme was measured to be 111 copies/mL. The total of 45 target samples, including 20 samples with HBV concentration being lower than 10(2) copies/mL and 25 samples with HBV concentration being in the range of 10(3)-10(5.1) copies/mL, were used for real test. The concentration of these 45 HBV DNA samples was measured by the COBAS Ampliprep system. Comparing the measured results of the COBAS Ampliprep and our system, it was illustrated that the HBV DNA concentrations measured by the proposed method in this study had a high linear correlation with the COBAS Ampliprep, having R(2) values of 0.983. The proposed sensing scheme is highly feasible for future clinical applications.

  5. Use of the polymerase chain reaction to detect Mycobacterium leprae in urine.

    PubMed

    Caleffi, K R; Hirata, R D C; Hirata, M H; Caleffi, E R; Siqueira, V L D; Cardoso, R F

    2012-02-01

    Leprosy is an infectious disease caused by Mycobacterium leprae. The polymerase chain reaction (PCR) has been applied to detect M. leprae in different clinical samples and urine seems to be attractive for this purpose. PCR was used to improve the sensitivity for diagnosing leprosy by amplifying a 151-bp PCR fragment of the M. leprae pra gene (PCR-Pra) in urine samples. Seventy-three leprosy patients (39 males and 34 females, 14 to 78 years old) were selected for leprosy diagnosis at a reference laboratory in Maringá, PR, Brazil. Of these, 36 were under anti-leprosy multidrug therapy with dapsone and rifampicin for tuberculoid (TT) and dapsone, rifampicin and clofazimine for borderline (BB) and lepromatous (LL) forms. The control group contained 50 healthy individuals without any clinical history of leprosy. DNA isolated from leprosy patients' urine samples was successfully amplified by PCR-Pra in 46.6% (34/73) of the cases. The positivity of PCR-Pra for patients with the TT form was 75% for both patients under treatment and non-treated patients (P = 0.1306). In patients with the LL form, PCR-Pra positivity was 52 and 30% for patients under treatment and non-treated patients, respectively (P = 0.2386). PCR-Pra showed a statistically significant difference in detecting M. leprae between the TT and LL forms of leprosy in patients under treatment (P = 0.0033). Although the current study showed that the proposed PCR-Pra has some limitations in the detection of M. leprae, this method has the potential to be a useful tool for leprosy diagnosis mainly in TT leprosy where the AFB slit-skin smear is always negative.

  6. Detection of Yersinia ruckeri in rainbow trout blood by use of the polymerase chain reaction.

    PubMed

    Altinok, I; Grizzle, J M; Liu, Z

    2001-01-26

    We evaluated a polymerase chain reaction (PCR) method for detecting Yersinia ruckeri, the bacterial pathogen causing enteric redmouth disease (ERM), in blood of rainbow trout Oncorhynchus mykiss. Identification of the PCR product was confirmed by Southern blot hybridization with a 32P-labeled oligonucleotide probe matching a sequence within the small subunit ribosomal RNA gene of Y. ruckeri. Following a 1 h immersion of rainbow trout in water with 4.5 x 10(6) colony-forming units of Y. ruckeri l(-1), the PCR was positive for all blood samples from 1 h (first sample) to 5 d and was negative from 9 to 30 d (last sample). Fish in this experiment did not show signs of disease, probably because they had been vaccinated against Y. ruckeri. To test this method with naturally infected fish, 42 rainbow trout from hatcheries were examined. Four of these fish had clinical signs of ERM and were infected with Y. ruckeri based on bacteriological culture. The PCR method detected Y. ruckeri in blood, intestine, liver, and trunk kidney from the 4 fish with ERM and from 5 additional rainbow trout that were bacteriologically negative for Y. ruckeri. Three of 5 rainbow trout from streams receiving effluent from hatcheries were positive for Y. ruckeri when tested with PCR, although there was no growth of Y. ruckeri on culture plates inoculated with the same samples. Samples were successfully stored for 1 wk in lysis buffer at 25 degrees C. This study demonstrated that a non-lethal blood sample can be used with PCR to detect Y. ruckeri.

  7. Multiplex Polymerase Chain Reaction for Detection of Gastrointestinal Pathogens in Migrant Workers in Qatar

    PubMed Central

    Humphrey, John M.; Ranbhise, Sanjay; Ibrahim, Emad; Al-Romaihi, Hamad E.; Farag, Elmoubasher; Abu-Raddad, Laith J.; Glesby, Marshall J.

    2016-01-01

    The causes of infectious diarrhea among the migrant worker population in Qatar are not well understood. We conducted a prospective observational study to understand the demographic and clinical characteristics and infectious causes of diarrhea among migrant workers in Doha, Qatar. A total of 126 male workers presenting to the Qatar Red Crescent Worker's Health Center outpatient clinic or emergency department were studied over a 5-month period in 2015–2016. Epidemiologic surveys were administered to all subjects and the prevalence of 22 different stool pathogens was determined using multiplex polymerase chain reaction (PCR) (FilmArray® Gastrointestinal PCR). A target pathogen was identified in 62.7% of subjects. Enteropathogenic Escherichia coli was the most prevalent pathogen and was detected in 24.6% of subjects, followed by Salmonella (22.2%), enteroaggregative E. coli (15.1%), Giardia lamblia (9.5%), and enterotoxigenic E. coli (8.7%). Multiple pathogens were identified in 49.3% of positive stool samples. In a multivariable analysis, the presence of a heart rate ≥ 90 (adjusted odds ratio [OR] = 3.7, 95% confidence interval [CI] = 1.4–10.0) and > 5 fecal leukocytes/high-power field (adjusted OR = 2.8, 95% CI = 1.2–7.0) were significant predictors of detecting an acute inflammatory pathogen by PCR. Use of multiplex PCR enabled the detection of gastrointestinal pathogens in a high proportion of cases, illustrating the utility of this diagnostic tool in epidemiologic studies of infectious diarrhea. PMID:27928081

  8. Interlaboratory validation data on real-time polymerase chain reaction detection for unauthorized genetically modified papaya line PRSV-YK.

    PubMed

    Nakamura, Kosuke; Kondo, Kazunari; Akiyama, Hiroshi; Ishigaki, Takumi; Noguchi, Akio; Katsumata, Hiroshi; Takasaki, Kazuto; Futo, Satoshi; Sakata, Kozue; Fukuda, Nozomi; Mano, Junichi; Kitta, Kazumi; Tanaka, Hidenori; Akashi, Ryo; Nishimaki-Mogami, Tomoko

    2016-06-01

    This article is referred to research article entitled "Whole genome sequence analysis of unidentified genetically modified papaya for development of a specific detection method" (Nakamura et al., 2016) [1]. Real-time polymerase chain reaction (PCR) detection method for unauthorized genetically modified (GM) papaya (Carica papaya L.) line PRSV-YK (PRSV-YK detection method) was developed using whole genome sequence data (DDBJ Sequenced Read Archive under accession No. PRJDB3976). Interlaboratory validation datasets for PRSV-YK detection method were provided. Data indicating homogeneity of samples prepared for interlaboratory validation were included. Specificity and sensitivity test data for PRSV-YK detection method were also provided.

  9. Dynamic optimization of on-chip polymerase chain reaction by monitoring intracycle fluorescence using fast synchronous detection

    NASA Astrophysics Data System (ADS)

    Mondal, Sudip; Paul, Debjani; Venkataraman, V.

    2007-01-01

    The authors report on-chip dynamic optimization of polymerase chain reaction (PCR) based on a feedback technique utilizing synchronous detection of intracycle fluorescence every 500ms. From a direct measurement of polymerase activity, the authors determine the optimum extension temperature. The authors dynamically optimize PCR in an inductively heated microchip by sensing the saturation of extension in each cycle and applying the feedback. They demonstrate that, even with fast ramp rates, dynamic optimization leads to faster reactions compared to fixed-duration extension protocols for long DNA (>500bp). This optimization scheme uses a fairly universal dye Sybr Green I and can be applied to most PCRs.

  10. Direct polymerase chain reaction for detection of toxigenic Corynebacterium diphtheriae strains from the Republic of Georgia after prolonged storage.

    PubMed

    Kobaidze, K; Popovic, T; Nakao, H; Quick, L

    2000-02-01

    A total of 226 paired nose and throat swab specimens from 113 clinical diphtheria cases from the republic of Georgia were analyzed by direct polymerase chain reaction targeting both A and B subunits of the diphtheria toxin gene, tox. Even after prolonged transport and extensive storage (7-14 months) of the clinical specimens in silica gel packages, direct polymerase chain reaction detected the diphtheria tox gene in 54% of the specimens. Specimens obtained by throat swab were three times more likely than those obtained by nose swab to be positive for Corynebacterium diphtheriae.

  11. Quantitative detection of human enteric adenoviruses in river water by microfluidic digital polymerase chain reaction.

    PubMed

    Kishida, Naohiro; Noda, Naohiro; Haramoto, Eiji; Kawaharasaki, Mamoru; Akiba, Michihiro; Sekiguchi, Yuji

    2014-01-01

    We describe an assay for simple and accurate quantification of human enteric adenoviruses (EAdVs) in water samples using a recently developed quantification method named microfluidic digital polymerase chain reaction (dPCR). The assay is based on automatic distribution of reaction mixture into a large number of nanolitre-volume reaction chambers and absolute copy number quantification from the number of chambers containing amplification products on the basis of Poisson statistics. This assay allows absolute quantification of target genes without the use of standard DNA. Concentrations of EAdVs in Japanese river water samples were successfully quantified by the developed dPCR assay. The EAdVs were detected in seven of the 10 samples (1 L each), and the concentration ranged from 420 to 2,700 copies/L. The quantified values closely resemble those by most probable number (MPN)-PCR and real-time PCR when standard DNA was validated by dPCR whereas they varied substantially when the standard was not validated. Accuracy and sensitivity of the dPCR was higher than those of real-time PCR and MPN-PCR. To our knowledge, this is the first study that has successfully quantified enteric viruses in river water using dPCR. This method will contribute to better understanding of existence of viruses in water.

  12. Detecting and Number Counting of Single Engineered Nanoparticles by Digital Particle Polymerase Chain Reaction.

    PubMed

    Paunescu, Daniela; Mora, Carlos A; Querci, Lorenzo; Heckel, Reinhard; Puddu, Michela; Hattendorf, Bodo; Günther, Detlef; Grass, Robert N

    2015-10-27

    The concentrations of nanoparticles present in colloidal dispersions are usually measured and given in mass concentration (e.g. mg/mL), and number concentrations can only be obtained by making assumptions about nanoparticle size and morphology. Additionally traditional nanoparticle concentration measures are not very sensitive, and only the presence/absence of millions/billions of particles occurring together can be obtained. Here, we describe a method, which not only intrinsically results in number concentrations, but is also sensitive enough to count individual nanoparticles, one by one. To make this possible, the sensitivity of the polymerase chain reaction (PCR) was combined with a binary (=0/1, yes/no) measurement arrangement, binomial statistics and DNA comprising monodisperse silica nanoparticles. With this method, individual tagged particles in the range of 60-250 nm could be detected and counted in drinking water in absolute number, utilizing a standard qPCR device within 1.5 h of measurement time. For comparison, the method was validated with single particle inductively coupled plasma mass spectrometry (sp-ICPMS).

  13. Accuracy of universal polymerase chain reaction (PCR) for detection of bacterial meningitis among suspected patients.

    PubMed

    Moayedi, Ali Reza; Nejatizadeh, Abdolazim; Mohammadian, Maryam; Rahmati, Mohammad Bagher; Namardizadeh, Vahideh

    2015-12-01

    Central nervous system (CNS) infections are life-threatening diseases caused by viral, bacterial, parasitic and fungal microorganisms. The aim of this study was to determine the accuracy of universal polymerase chain reaction (PCR) for the detection of bacterial meningitis among patients who were referred to Koodakan Hospital in Bandar Abbas because they were suspected of having the disease. This study was conducted in 2013 on the patients who were admitted to Bandar Abbas' Koodakan Hospital because they were suspected of having meningitis. A questionnaire, including demographic data, was completed for each patient. Universal PCR, Cerebrospinal fluid (CSF) analysis, and gram staining and cultures were done for all the patients. The data were analyzed using SPSS software. Among the 100 patients studied 59 (59%) were male and 41 (41%) were female. No patient in our study had a positive smear and culture for meningitis. Among the patients with negative smears and cultures six (6%) had positive universal PCR, and 94 (94%) had negative universal PCR. Based on these results, PCR had 95% specificity and 100% negative predictive value for the prediction of meningitis. In 30 patients (30%), the biochemical analysis of CSF were in favor of meningitis. Among the 30 patients, six patients (20%) had positive universal PCR and 24 patients (80%) had negative universal PCR. Based on our results, the universal PCR test is useful in the diagnosis of bacterial meningitis in children. We recommend using it in combination with other tests, such as CSF analysis, for diagnosis of bacterial meningitis.

  14. Detecting and resolving position-dependent temperature effects in real-time quantitative polymerase chain reaction.

    PubMed

    von Kanel, Thomas; Gerber, Dominik; Wittwer, Carl T; Hermann, Mark; Gallati, Sabina

    2011-12-15

    Real-time quantitative polymerase chain reaction (qPCR) depends on precise temperature control of the sample during cycling. In the current study, we investigated how temperature variation in plate-based qPCR instruments influences qPCR results. Temperature variation was measured by amplicon melting analysis as a convenient means to assess well-to-well differences. Multiple technical replicates of several SYBR Green I-based qPCR assays allowed correlation of relative well temperature to quantification cycle. We found that inadequate template denaturation results in an inverse correlation and requires increasing the denaturation temperature, adding a DNA destabilizing agent, or pretreating with a restriction enzyme. In contrast, inadequate primer annealing results in a direct correlation and requires lowering the annealing temperature. Significant correlations were found in 18 of 25 assays. The critical nature of temperature-dependent effects was shown in a blinded study of 29 patients for the diagnosis of Prader-Willy and Angelman syndromes, where eight diagnoses were incorrect unless temperature-dependent effects were controlled. A method to detect temperature-dependent effects by pairwise comparisons of replicates in routine experiments is presented and applied. Systematic temperature errors in qPCR instruments can be recognized and their effects eliminated when high precision is required in quantitative genetic diagnostics and critical complementary DNA analyses. Copyright © 2011 Elsevier Inc. All rights reserved.

  15. Development of a polymerase chain reaction assay for the detection of pseudorabies virus in clinical samples

    PubMed Central

    Pérez, Lester J.; de Arce, Heidy Díaz

    2009-01-01

    Aujeszky’s disease, also known as pseudorabies causes severe economic losses in swine industry and affects the pig husbandry all over the world. The conventional diagnostic procedure is time-consuming and false-negative results may occur in submissions from latently infected animals. The development, optimization and evaluation of a polymerase chain reaction (PCR) assay are presented for the diagnosis of pseudorabies infection. This assay was based on the amplification of a highly conserved viral gD gene fragment. PCR products of the expected size were obtained from PRV strains. Non-specific reactions were not observed when a related herpesvirus, other porcine DNA genome viruses and uninfected cells were used to assess PCR. The analytical sensitivity of the test was estimated to be 1.34 TCID50/ 50 uL. The analysis of tissue homogenate samples from naturally infected animals proved the potential usefulness of the method for a rapid disease diagnosis from field cases. A rapid, sensitive and specific PCR-based diagnostic assay to detect pseudorabies virus in clinical samples is provided. PMID:24031383

  16. Clinical value of polymerase chain reaction in detecting group B streptococcus during labor.

    PubMed

    Koppes, Dorothea Maria; Vriends, Antonius Arnoldus Cornelis Maria; van Rijn, Michiel; van Heesewijk, Antonine Dimphne

    2017-06-01

    To reduce the intrapartum use of antibiotics in women with prolonged rupture of the membranes (PROM) by restriction of antibiotics to women who are colonized with group B streptococci (GBS), as identified with the Cepheid Gene Xpert polymerase chain reaction (PCR) for detecting GBS. We conducted a randomized controlled trial among full-term delivering women with PROM. Fifty-four women were enrolled, based on a power calculation with a significance level of 5% and a power of 95%. Twenty-seven women received the standard treatment (rectovaginal swab [RVS] for bacterial culture and antibiotics). For another 27 women PCR was performed on the RVS and antibiotics were used only when the PCR was positive. The primary outcome was reduction in antibiotic use, defined as the percentage of women who received antibiotics during labor. 54 Women were enrolled in the study between 1 May and 18 November 2014. There were no significant differences in baseline characteristics. In total, 10 of the 54 women were GBS positive (18.5%). Of those 10 women, three were identified on bacterial culture and seven on PCR. In the bacterial culture group all the women received antibiotics. In the PCR group 10 women (37%) received antibiotics (P = 0.002). Two false-positive PCR tests were identified. There were no false-negative PCR tests. Real-time identification of GBS on PCR reduces the intrapartum use of antibiotics in women with PROM. © 2017 Japan Society of Obstetrics and Gynecology.

  17. Detection of hepatitis E virus in raw and treated wastewater with the polymerase chain reaction.

    PubMed Central

    Jothikumar, N; Aparna, K; Kamatchiammal, S; Paulmurugan, R; Saravanadevi, S; Khanna, P

    1993-01-01

    The main objective of this study was to determine the applicability of the polymerase chain reaction (PCR) to detection of hepatitis E virus (HEV) in sewage treatment plants and establishment of the prevalence of hepatitis viral diseases in a population. Epidemics of HEV infection because of inadequate public sanitation have been reported in several developing countries. A procedure for concentration of HEV in sewage samples through adsorption to membrane filters, elution with urea-arginine phosphate buffer, and subsequent reconcentration with magnesium chloride enabled us to concentrate HEV to volumes in the microliter range. HEV-specific cDNA was prepared by reverse transcription of the total RNA extracted from samples. Specific DNA amplification by PCR in combination with slot blot hybridization was used to demonstrate the presence of HEV in sewage samples from the inlets and outlets of three sewage treatment plants. The assay was specific for HEV, and a 240-bp amplified product was visualized by ethidium bromide fluorescence. Sewage samples adjusted to pH 5.0 for adsorption of viruses to membrane filters were PCR positive, while samples adjusted to pH 3.5 were PCR negative. Images PMID:8368844

  18. Development of a diagnostic multiplex polymerase chain reaction microarray assay to detect and differentiate Brucella spp.

    PubMed

    Schmoock, Gernot; Ehricht, Ralf; Melzer, Falk; Elschner, Mandy; Tomaso, Herbert; Neubauer, Heinrich; Al Dahouk, Sascha

    2011-12-01

    Brucellosis is a worldwide zoonosis leading to tremendous economic losses and severe human illness. Fast and reliable laboratory tests are needed to detect disease in both humans and animals and to monitor the production of safe food products and feed. For rapid identification of the genus Brucella and differentiation of its species, a multiplex polymerase chain reaction microarray assay based on 11 signature sequences and redundant oligonucleotide probes was developed. The gene targets included genus-specific sequences in bcsp31, perA, cgs, and omp2b, as well as chromosomal regions displaying species-specific hybridization patterns. Brucella reference strains and a representative panel of 102 field isolates were unambiguously identified by their hybridization patterns. The differentiation of species, however, was limited in members of the groups B. suis bv 3/4/B. canis and B. neotomae/B. microti. In summary, the newly developed Brucella ArrayTube® assay is an easy-to-handle molecular test for high-throughput and parallel analysis. Copyright © 2011 Elsevier Inc. All rights reserved.

  19. Development of a polymerase chain reaction assay for the detection of pseudorabies virus in clinical samples.

    PubMed

    Pérez, Lester J; de Arce, Heidy Díaz

    2009-07-01

    Aujeszky's disease, also known as pseudorabies causes severe economic losses in swine industry and affects the pig husbandry all over the world. The conventional diagnostic procedure is time-consuming and false-negative results may occur in submissions from latently infected animals. The development, optimization and evaluation of a polymerase chain reaction (PCR) assay are presented for the diagnosis of pseudorabies infection. This assay was based on the amplification of a highly conserved viral gD gene fragment. PCR products of the expected size were obtained from PRV strains. Non-specific reactions were not observed when a related herpesvirus, other porcine DNA genome viruses and uninfected cells were used to assess PCR. The analytical sensitivity of the test was estimated to be 1.34 TCID50/ 50 uL. The analysis of tissue homogenate samples from naturally infected animals proved the potential usefulness of the method for a rapid disease diagnosis from field cases. A rapid, sensitive and specific PCR-based diagnostic assay to detect pseudorabies virus in clinical samples is provided.

  20. Detection of luciferase gene sequence in nonluminescent Vibrio cholerae by colony hygridization and polymerase chain reaction

    SciTech Connect

    Palmer, L.M.; Colwell, R.R. )

    1991-05-01

    Bioluminescence is a trait observed among approximately 10% of Vibrio cholerae isolates. We have demonstrated that not only do some strains of V. cholerae produce low levels of light, undetectable by the human eye, but the luciferase gene sequence is present in strains of V. cholerae which emit no detectable light, evidenced by hybridization with a luciferase DNA probe. Comparisons of the amino acid sequences of luciferase regions of amino acid identity. The polymerase chain reaction method of DNA amplification with oligonucleotide primers based on these regions was used to isolate a region of the luxA gene from both luminescent and nonluminescent V. cholerae strains. The nucleotide sequence of this region was determined and reveals that nonluminescent V. cholerae have 99.7% nucleotide sequence similarity in this region with the luminescent biovar V. cholerae by albensis as well as significant similarity to other species of bioluminescent bacteria, a finding that is in accord with the hypothesis that these species have a common luminescent ancestor, most probably from the marine environment.

  1. Transcriptional activation of RNA polymerase III-dependent genes by the human T-cell leukemia virus type 1 tax protein.

    PubMed Central

    Gottesfeld, J M; Johnson, D L; Nyborg, J K

    1996-01-01

    The human T-cell leukemia virus-encoded tax protein is a potent activator of many viral and cellular genes transcribed by RNA polymerase II. We find that both chromatin and cell extracts derived from human T-cell leukemia virus type 1-infected human T lymphocytes support higher levels of 5S rRNA and tRNA gene transcription than chromatin or extracts from uninfected T lymphocytes. The viral protein Tax was likely responsible for this higher level of class II gene transcription, as purified Tax was found to stimulate both genes when added to the uninfected cell extract or in reconstituted systems. Both limiting-component transcription assays and DNA binding assays identified the class III gene transcription factor TFIIIB as the principle target of Tax activity. Surprisingly, we find that Tax increases the effective concentration of active TFIIIB molecules. These data suggest that Tax stimulates RNA polymerase III-dependent gene expression by accelerating the rate and/or extent of transcription initiation complex assembly. PMID:8657153

  2. The Maize Imprinted Gene Floury3 Encodes a PLATZ Protein Required for tRNA and 5S rRNA Transcription Through Interaction with RNA Polymerase III.

    PubMed

    Li, Qi; Wang, Jiechen; Ye, Jianwei; Zheng, Xixi; Xiang, Xiaoli; Li, Changsheng; Fu, Miaomiao; Wang, Qiong; Zhang, Zhi-Yong; Wu, Yongrui

    2017-09-05

    Maize (Zea mays) floury3 (fl3) is a classic semi-dominant negative mutant that exhibits severe defects in the endosperm but fl3 plants otherwise appear normal. We cloned the fl3 gene and determined that it encodes a PLATZ (plant AT-rich sequence- and zinc-binding) protein. The mutation in fl3 resulted in an Asn to His replacement in the conserved PLATZ domain, creating a dominant allele. Fl3 is specifically expressed in starchy endosperm cells and regulated by genomic imprinting, which leads to the suppressed expression of fl3 when transmitted through the male, perhaps as a consequence the semi-dominant behavior. Yeast two-hybrid screening and bimolecular luciferase complementation (BiLC) experiments revealed that FL3 interacts with the RNA polymerase III subunit 53 (RPC53) and transcription factor class C 1 (TFC1), two critical factors of the RNA polymerase III (RNAPIII) transcription complex. In the fl3 endosperm, the levels of many tRNAs and 5S rRNA that are transcribed by RNAPIII are significantly reduced, suggesting that the incorrectly folded fl3 protein may impair the function of RNAPIII. The transcriptome is dramatically altered in fl3 mutants, in which the down-regulated genes are primarily enriched in pathways related to translation, ribosome, misfolded protein responses and nutrient reservoir activity. Collectively, these changes may lead to defects in endosperm development and storage reserve filling in fl3 seeds. © 2017 American Society of Plant Biologists. All rights reserved.

  3. Keratin gene expression in non-epithelial tissues. Detection with polymerase chain reaction.

    PubMed Central

    Traweek, S. T.; Liu, J.; Battifora, H.

    1993-01-01

    Keratin filament are characteristically present in epithelial cells and tumors, but have also been detected in many normal and neoplastic non-epithelial cell types using immunohistochemical techniques. To investigate the validity of this seemingly aberrant protein expression, we applied the highly sensitive polymerase chain reaction (PCR) technique to study keratin gene expression in a variety of non-epithelial tissues. Total RNA was extracted from nine samples of leiomyosarcoma, four non-Hodgkin's lymphoma, seven normal bone marrows, normal lymph node, normal peripheral blood cells, freshly isolated and cultured endothelial cells, cultured skin fibroblasts, and the myeloid leukemia cell line HL-60. Amplification primers and probes for the three most primitive keratin types (8, 18, and 19) were synthesized using published gene sequences. RNA from the breast carcinoma cell line MCF-7, known to be rich in all three keratins, was used as positive control. Concurrently run actin primers were used to confirm RNA integrity. After an initial cycle with reverse transcriptase, PCR amplification was performed for 30 cycles. Southern blots of the PCR products showed variably intense bands corresponding to keratin 8 and 18 gene products in all samples, offering conclusive evidence of keratin gene expression in cells of both stromal and hematopoietic derivation. However, keratin 19 gene transcription was not nearly so ubiquitous, being detected in normal fibroblasts and endothelial cells, two of four non-Hodgkin's lymphoma and four of nine leiomyosarcoma, but not in normal lymph node, peripheral blood cells, HL-60 cells, or any of the seven normal bone marrows examined. Dilutional experiments showed PCR to be highly sensitive in the detection of keratin 19 gene expression, capable of registering one MCF-7 cell in 10(6) HL-60 cells. These studies show that variable levels of keratin 8 and 18 gene expression may be detected by PCR in a wide variety of non-epithelial tissues

  4. Mobile suitcase laboratory for rapid detection of Leishmania donovani using recombinase polymerase amplification assay.

    PubMed

    Mondal, Dinesh; Ghosh, Prakash; Khan, Md Anik Ashfaq; Hossain, Faria; Böhlken-Fascher, Susanne; Matlashewski, Greg; Kroeger, Axel; Olliaro, Piero; Abd El Wahed, Ahmed

    2016-05-13

    Leishmania donovani (LD) is a protozoan parasite transmitted to humans from sand flies, which causes Visceral Leishmaniasis (VL). Currently, the diagnosis is based on presence of the anti-LD antibodies and clinical symptoms. Molecular diagnosis would require real-time PCR, which is not easy to implement at field settings. In this study, we report on the development and testing of a recombinase polymerase amplification (RPA) assay for the detection of LD. A genomic DNA sample was applied to determine the assay analytical sensitivity. The cross-reactivity of the assay was tested by DNA of Leishmania spp. and of pathogens considered for differential diagnosis. The clinical performance of the assay was evaluated on LD positive and negative samples. All results were compared with real-time PCR. To allow the use of the assay at field settings, a mobile suitcase laboratory (56 × 45.5 × 26.5 cm) was developed and operated at the local hospital in Mymensingh, Bangladesh. The LD RPA assay detected equivalent to one LD genomic DNA. The assay was performed at constant temperature (42 °C) in 15 min. The RPA assay also detected other Leishmania species (L. major, L. aethiopica and L. infantum), but did not identify nucleic acid of other pathogens. Forty-eight samples from VL, asymptomatic and post-kala-azar dermal leishmaniasis subjects were detected positive and 48 LD-negative samples were negative by both LD RPA and real-time PCR assays, which indicates 100 % agreement. The suitcase laboratory was successfully operated at the local hospital by using a solar-powered battery. DNA extraction was performed by a novel magnetic bead based method (SpeedXtract), in which a simple fast lysis protocol was applied. Moreover, All reagents were cold-chain independent. The mobile suitcase laboratory using RPA is ideal for rapid sensitive and specific detection of LD especially at low resource settings and could contribute to VL control and elimination programmes.

  5. Transcription of angiogenin and ribonuclease 4 is regulated by RNA polymerase III elements and a CCCTC binding factor (CTCF)-dependent intragenic chromatin loop.

    PubMed

    Sheng, Jinghao; Luo, Chi; Jiang, Yuxiang; Hinds, Philip W; Xu, Zhengping; Hu, Guo-fu

    2014-05-02

    Angiogenin (ANG) and ribonuclease 4 (RNASE4), two members of the secreted and vertebrate-specific ribonuclease superfamily, play important roles in cancers and neurodegenerative diseases. The ANG and RNASE4 genes share genetic regions with promoter activities, but the structure and regulation of these putative promotes are unknown. We have characterized the promoter regions, defined the transcription start site, and identified a mechanism of transcription regulation that involves both RNA polymerase III (Pol III) elements and CCCTC binding factor (CTCF) sites. We found that two Pol III elements within the promoter region influence ANG and RNASE4 expression in a position- and orientation-dependent manner. We also provide evidence for the presence of an intragenic chromatin loop between the two CTCF binding sites located in two introns flanking the ANG coding exon. We found that formation of this intragenic loop preferentially enhances ANG transcription. These results suggest a multilayer transcriptional regulation of ANG and RNASE4 gene locus. These data also add more direct evidence to the notion that Pol III elements are able to directly influence Pol II gene transcription. Furthermore, our data indicate that a CTCF-dependent chromatin loop is able to differentially regulate transcription of genes that share the same promoters.

  6. Detection of Mycobacterium tuberculosis DNA in clinical samples by using a simple lysis method and polymerase chain reaction.

    PubMed Central

    Folgueira, L; Delgado, R; Palenque, E; Noriega, A R

    1993-01-01

    We have evaluated the polymerase chain reaction for detection of Mycobacterium tuberculosis in clinical samples from patients with tuberculous infection. Two simple methods for mycobacterial DNA release have been compared: sonication and lysis with nonionic detergents and proteinase K. The more effective method was the enzymatic technique. By using this protocol with 75 specimens we detected M. tuberculosis DNA in all of the samples, whereas only 48 and 71 samples were positive by acid-fast staining and culture, respectively. Images PMID:8463383

  7. Detection of trypanosomes in suspected sleeping sickness patients in Uganda using the polymerase chain reaction.

    PubMed Central

    Kyambadde, J. W.; Enyaru, J. C.; Matovu, E.; Odiit, M.; Carasco, J. F.

    2000-01-01

    Diagnosis of sleeping sickness (trypanosomiasis) is difficult because of the fluctuating levels of parasitaemia encountered in patients. In the present study we found that the polymerase chain reaction (PCR) demonstrated trypanosome infection in 20 out of 35 (57.1%) blood samples and in 21 out of 34 (61.7%) cerebrospinal fluid (CSF) samples collected from an area endemic for sleeping sickness in north-west Uganda. A total of 14 blood samples and 13 CSF samples that were positive for trypanosomes by double centrifugation were also positive by PCR, demonstrating good concordance between the two methods. However, 6 (28.6%) of the 21 blood samples that were parasitologically negative were positive by PCR, while 8 (38.0%) out of 21 CSF samples that were negative by double centrifugation were positive by PCR. These 14 negative samples could therefore be from sleeping sickness cases even though a positive PCR test is not evidence for the presence of trypanosomes. Furthermore, of these 8 CSF samples, 4 had been designated as early cases, based on the absence of trypanosomes and on a count of < or = 5 white blood cells (WBC) per microliter. This suggests that some late-stage cases could potentially be missed according to the present criteria, and it is therefore important to perform clinical trials to determine whether these cases could be treated successfully with the first-stage drug alone. The remaining four CSF samples had been classified as late-stage cases, based on a count of > 6 WBC per microliter, even though trypanosomes could not be detected in these samples by either double centrifugation or PCR. A cut-off point of 5 WBC per microliter, which is used as a rule of thumb to stage sleeping sickness patients, seems to leave some late-stage cases undetected since trypanosomes were detected in four CSF samples from suspected cases with < 5 WBC per microliter. PMID:10686746

  8. Detection of MYCN Amplification in Serum DNA Using Conventional Polymerase Chain Reaction

    PubMed Central

    2016-01-01

    Neuroblastoma (NB) is the most common extra-cranial solid tumor of childhood and is characterized by a wide range of clinical behaviors. Amplification of MYCN is a well-known poor prognostic factor in NB patients. As the MYCN amplification status is usually tested using tumor specimens, lengthy and invasive procedures are unavoidable. To evaluate the possibility of detecting MYCN amplification without invasive procedure, we performed conventional polymerase chain reaction (PCR) analysis to identify MYCN amplification using the preserved serum DNA. PCR of serum DNA was done in 105 NB patients whose MYCN status had been confirmed by fluorescence in situ hybridization. MYCN amplification was evaluated as the ratio of signal intensities between MYCN and NAGK (M/N ratio). When regarding the tissue FISH results as a reference, 10 patients had MYCN-amplified (MNA) NB, and 95 had non-MNA NB. The M/N ratio of the MNA group (median 2.56, range 1.01-3.58) was significantly higher than that of the non-MNA group (median 0.97, range 0.67-5.18) (P < 0.001). In the receiver operating characteristic curve analysis, the area under the curve was 0.957 (95% confidence interval 0.898–1.000; P < 0.001), and it showed 90.9% sensitivity and 97.9% specificity with the selected cut-off value set as 1.6. The detection of MYCN amplification using conventional PCR analysis of serum samples seems to be a simple and promising method to evaluate the MYCN status of NB patients. Further study with a larger set of patients is needed to confirm the accuracy of this result. PMID:27510381

  9. Reverse transcription-polymerase chain reaction detection of transcribed sequences on human chromosome 21

    SciTech Connect

    Cheng, J.F.; Zhu, Y. )

    1994-03-15

    Seventy-four pairs of oligonucleotides derived from sequence-tagged sites (STSs) on the long arm of human chromosome 21, specifically from bands 21q22.1 to 21q22.3, were used in reverse transcription-polymerase chain reactions (RT-PCR) to detect the presence of expressed sequences in a fetal brain. These STSs included 69 that had not been related to transcribed sequences and 5 that had detected two known genes and three previously isolated cDNA clones. Of the 69 STSs analyzed in RT-PCR, 25 allowed amplification of specific cDNA fragments. The sizes of amplified cDNA fragments match those amplified from either human genomic DNA or somatic hybrid cells containing human chromosome 21. Of the 11 cDNA analyzed in Northern blot hybridizations, 6 hybridized to specific RNA species. The rapid screening for cDNA using previously mapped STSs has provided insight into the distribution of expressed sequences in this region of chromosome 21. Northern blot analysis of the amplified cDNA fragments has revealed interesting candidate genes in two disease loci. The marker D21S267 was previously mapped in the Down syndrome region of chromosome 21, and the marker D21S113 is closely linked to progressive myoclonus epilepsy. The cDNA fragments amplified using the primer sequences derived from D21S267 and D21S113 hybridized to 7- and 6.5-kb transcripts, respectively, which seems to express predominantly in brain. 37 refs., 3 figs., 1 tab.

  10. Field-Applicable Recombinase Polymerase Amplification Assay for Rapid Detection of Mycoplasma capricolum subsp. capripneumoniae

    PubMed Central

    Yu, Mingyan; O'Brien, Elizabeth; Heller, Martin; Nepper, Julia F.; Weibel, Douglas B.; Gluecks, Ilona; Younan, Mario; Frey, Joachim; Falquet, Laurent; Jores, Joerg

    2015-01-01

    Contagious caprine pleuropneumonia (CCPP) is a highly contagious disease caused by Mycoplasma capricolum subsp. capripneumoniae that affects goats in Africa and Asia. Current available methods for the diagnosis of Mycoplasma infection, including cultivation, serological assays, and PCR, are time-consuming and require fully equipped stationary laboratories, which make them incompatible with testing in the resource-poor settings that are most relevant to this disease. We report a rapid, specific, and sensitive assay employing isothermal DNA amplification using recombinase polymerase amplification (RPA) for the detection of M. capricolum subsp. capripneumoniae. We developed the assay using a specific target sequence in M. capricolum subsp. capripneumoniae, as found in the genome sequence of the field strain ILRI181 and the type strain F38 and that was further evidenced in 10 field strains from different geographical regions. Detection limits corresponding to 5 × 103 and 5 × 104 cells/ml were obtained using genomic DNA and bacterial culture from M. capricolum subsp. capripneumoniae strain ILRI181, while no amplification was obtained from 71 related Mycoplasma isolates or from the Acholeplasma or the Pasteurella isolates, demonstrating a high degree of specificity. The assay produces a fluorescent signal within 15 to 20 min and worked well using pleural fluid obtained directly from CCPP-positive animals without prior DNA extraction. We demonstrate that the diagnosis of CCPP can be achieved, with a short sample preparation time and a simple read-out device that can be powered by a car battery, in <45 min in a simulated field setting. PMID:26085615

  11. Early polymerase chain reaction detection of Chagas disease reactivation in heart transplant patients.

    PubMed

    da Costa, Priscilla Almeida; Segatto, Marcela; Durso, Danielle Fernandes; de Carvalho Moreira, Wagson José; Junqueira, Lucas Lodi; de Castilho, Fábio Morato; de Andrade, Silvio Amadeu; Gelape, Cláudio Léo; Chiari, Egler; Teixeira-Carvalho, Andréa; Junho Pena, Sergio Danilo; Machado, Carlos Renato; Franco, Gloria Regina; Filho, Geraldo Brasileiro; Vieira Moreira, Maria da Consolação; Mara Macedo, Andréa

    2017-07-01

    Heart transplantation is a valuable therapeutic option for Chagas disease patients with severe cardiomyopathy. During patient follow-up, the differential diagnosis between cardiac transplant rejection and Chagas disease infection reactivation remains a challenging task, which hinders rapid implementation of the appropriate treatment. Herein we investigate whether polymerase chain reaction (PCR) strategies could facilitate early detection of Trypanosoma cruzi (T cruzi) in transplanted endomyocardial biopsies (EMBs). In this study we analyzed 500 EMB specimens obtained from 58 chagasic cardiac transplant patients, using PCR approaches targeted to nuclear (rDNA 24Sα) and kinetoplastid (kDNA) markers, and compared the efficiency of these approaches with that of other tests routinely used. T cruzi DNA was detected in 112 EMB specimens derived from 39 patients (67.2%). The first positive result occurred at a median 1.0 month post-transplant. Conventional histopathologic, blood smear and hemoculture analyses showed lower sensitivity and higher median time to the first positive result. Patient follow-up revealed that 31 of 39 PCR-positive cases presented clinical reactivation of Chagas disease at different time-points after transplantation. PCR techniques showed considerable sensitivity (0.82) and specificity (0.60), with area under the receiver operating characteristic (ROC) curves of 0.708 (p = 0.001). Moreover, PCR techniques anticipated the clinical signs of Chagas disease reactivation by up to 36 months, with a median time of 6 months and an average of 9.1 months. We found a good association between the PCR diagnosis and the clinical signs of the disease, indicating that the PCR approaches used herein are suitable for early diagnosis of Chagas disease reactivation, with high potential to assist physicians in treatment decisions. For this purpose, an algorithm is proposed for surveillance based on the molecular tests. Copyright © 2017 International Society for the

  12. Field-Applicable Recombinase Polymerase Amplification Assay for Rapid Detection of Mycoplasma capricolum subsp. capripneumoniae.

    PubMed

    Liljander, Anne; Yu, Mingyan; O'Brien, Elizabeth; Heller, Martin; Nepper, Julia F; Weibel, Douglas B; Gluecks, Ilona; Younan, Mario; Frey, Joachim; Falquet, Laurent; Jores, Joerg

    2015-09-01

    Contagious caprine pleuropneumonia (CCPP) is a highly contagious disease caused by Mycoplasma capricolum subsp. capripneumoniae that affects goats in Africa and Asia. Current available methods for the diagnosis of Mycoplasma infection, including cultivation, serological assays, and PCR, are time-consuming and require fully equipped stationary laboratories, which make them incompatible with testing in the resource-poor settings that are most relevant to this disease. We report a rapid, specific, and sensitive assay employing isothermal DNA amplification using recombinase polymerase amplification (RPA) for the detection of M. capricolum subsp. capripneumoniae. We developed the assay using a specific target sequence in M. capricolum subsp. capripneumoniae, as found in the genome sequence of the field strain ILRI181 and the type strain F38 and that was further evidenced in 10 field strains from different geographical regions. Detection limits corresponding to 5 × 10(3) and 5 × 10(4) cells/ml were obtained using genomic DNA and bacterial culture from M. capricolum subsp. capripneumoniae strain ILRI181, while no amplification was obtained from 71 related Mycoplasma isolates or from the Acholeplasma or the Pasteurella isolates, demonstrating a high degree of specificity. The assay produces a fluorescent signal within 15 to 20 min and worked well using pleural fluid obtained directly from CCPP-positive animals without prior DNA extraction. We demonstrate that the diagnosis of CCPP can be achieved, with a short sample preparation time and a simple read-out device that can be powered by a car battery, in <45 min in a simulated field setting. Copyright © 2015 Liljander et al.

  13. Detection of trypanosomes in suspected sleeping sickness patients in Uganda using the polymerase chain reaction.

    PubMed

    Kyambadde, J W; Enyaru, J C; Matovu, E; Odiit, M; Carasco, J F

    2000-01-01

    Diagnosis of sleeping sickness (trypanosomiasis) is difficult because of the fluctuating levels of parasitaemia encountered in patients. In the present study we found that the polymerase chain reaction (PCR) demonstrated trypanosome infection in 20 out of 35 (57.1%) blood samples and in 21 out of 34 (61.7%) cerebrospinal fluid (CSF) samples collected from an area endemic for sleeping sickness in north-west Uganda. A total of 14 blood samples and 13 CSF samples that were positive for trypanosomes by double centrifugation were also positive by PCR, demonstrating good concordance between the two methods. However, 6 (28.6%) of the 21 blood samples that were parasitologically negative were positive by PCR, while 8 (38.0%) out of 21 CSF samples that were negative by double centrifugation were positive by PCR. These 14 negative samples could therefore be from sleeping sickness cases even though a positive PCR test is not evidence for the presence of trypanosomes. Furthermore, of these 8 CSF samples, 4 had been designated as early cases, based on the absence of trypanosomes and on a count of < or = 5 white blood cells (WBC) per microliter. This suggests that some late-stage cases could potentially be missed according to the present criteria, and it is therefore important to perform clinical trials to determine whether these cases could be treated successfully with the first-stage drug alone. The remaining four CSF samples had been classified as late-stage cases, based on a count of > 6 WBC per microliter, even though trypanosomes could not be detected in these samples by either double centrifugation or PCR. A cut-off point of 5 WBC per microliter, which is used as a rule of thumb to stage sleeping sickness patients, seems to leave some late-stage cases undetected since trypanosomes were detected in four CSF samples from suspected cases with < 5 WBC per microliter.

  14. Comparison of Nested Polymerase Chain Reaction and Real-Time Polymerase Chain Reaction with Parasitological Methods for Detection of Strongyloides stercoralis in Human Fecal Samples

    PubMed Central

    Sharifdini, Meysam; Mirhendi, Hossein; Ashrafi, Keyhan; Hosseini, Mostafa; Mohebali, Mehdi; Khodadadi, Hossein; Kia, Eshrat Beigom

    2015-01-01

    This study was performed to evaluate nested polymerase chain reaction (PCR) and real-time PCR methods for detection of Strongyloides stercoralis in fecal samples compared with parasitological methods. A total of 466 stool samples were examined by conventional parasitological methods (formalin ether concentration [FEC] and agar plate culture [APC]). DNA was extracted using an in-house method, and mitochondrial cytochrome c oxidase subunit 1 and 18S ribosomal genes were amplified by nested PCR and real-time PCR, respectively. Among 466 samples, 12.7% and 18.2% were found infected with S. stercoralis by FEC and APC, respectively. DNA of S. stercoralis was detected in 18.9% and 25.1% of samples by real-time PCR and nested PCR, respectively. Considering parasitological methods as the diagnostic gold standard, the sensitivity and specificity of nested PCR were 100% and 91.6%, respectively, and that of real-time PCR were 84.7% and 95.8%, respectively. However, considering sequence analyzes of the selected nested PCR products, the specificity of nested PCR is increased. In general, molecular methods were superior to parasitological methods. They were more sensitive and more reliable in detection of S. stercoralis in comparison with parasitological methods. Between the two molecular methods, the sensitivity of nested PCR was higher than real-time PCR. PMID:26350449

  15. Comparison of Nested Polymerase Chain Reaction and Real-Time Polymerase Chain Reaction with Parasitological Methods for Detection of Strongyloides stercoralis in Human Fecal Samples.

    PubMed

    Sharifdini, Meysam; Mirhendi, Hossein; Ashrafi, Keyhan; Hosseini, Mostafa; Mohebali, Mehdi; Khodadadi, Hossein; Kia, Eshrat Beigom

    2015-12-01

    This study was performed to evaluate nested polymerase chain reaction (PCR) and real-time PCR methods for detection of Strongyloides stercoralis in fecal samples compared with parasitological methods. A total of 466 stool samples were examined by conventional parasitological methods (formalin ether concentration [FEC] and agar plate culture [APC]). DNA was extracted using an in-house method, and mitochondrial cytochrome c oxidase subunit 1 and 18S ribosomal genes were amplified by nested PCR and real-time PCR, respectively. Among 466 samples, 12.7% and 18.2% were found infected with S. stercoralis by FEC and APC, respectively. DNA of S. stercoralis was detected in 18.9% and 25.1% of samples by real-time PCR and nested PCR, respectively. Considering parasitological methods as the diagnostic gold standard, the sensitivity and specificity of nested PCR were 100% and 91.6%, respectively, and that of real-time PCR were 84.7% and 95.8%, respectively. However, considering sequence analyzes of the selected nested PCR products, the specificity of nested PCR is increased. In general, molecular methods were superior to parasitological methods. They were more sensitive and more reliable in detection of S. stercoralis in comparison with parasitological methods. Between the two molecular methods, the sensitivity of nested PCR was higher than real-time PCR. © The American Society of Tropical Medicine and Hygiene.

  16. Rapid isothermal detection of Phytophthora species on plant samples using recombinase polymerase amplification

    USDA-ARS?s Scientific Manuscript database

    Recently several isothermal amplification techniques have been developed that are extremely tolerant towards inhibitors present in many plant extracts. Recombinase polymerase amplification (RPA) assays for the genus Phytophthora have been developed which provide a simple and rapid method to macerate...

  17. Sequence-specific detection of individual DNA polymerase complexes in real time using a nanopore

    NASA Astrophysics Data System (ADS)

    Benner, Seico; Chen, Roger J. A.; Wilson, Noah A.; Abu-Shumays, Robin; Hurt, Nicholas; Lieberman, Kate R.; Deamer, David W.; Dunbar, William B.; Akeson, Mark

    2007-11-01

    Nanoscale pores have potential to be used as biosensors and are an established tool for analysing the structure and composition of single DNA or RNA molecules. Recently, nanopores have been used to measure the binding of enzymes to their DNA substrates. In this technique, a polynucleotide bound to an enzyme is drawn into the nanopore by an applied voltage. The force exerted on the charged backbone of the polynucleotide by the electric field is used to examine the enzyme-polynucleotide interactions. Here we show that a nanopore sensor can accurately identify DNA templates bound in the catalytic site of individual DNA polymerase molecules. Discrimination among unbound DNA, binary DNA/polymerase complexes, and ternary DNA/polymerase/deoxynucleotide triphosphate complexes was achieved in real time using finite state machine logic. This technique is applicable to numerous enzymes that bind or modify DNA or RNA including exonucleases, kinases and other polymerases.

  18. Detection of submicroscopic lymph node metastases with polymerase chain reaction in patients with malignant melanoma.

    PubMed Central

    Wang, X; Heller, R; VanVoorhis, N; Cruse, C W; Glass, F; Fenske, N; Berman, C; Leo-Messina, J; Rappaport, D; Wells, K

    1994-01-01

    BACKGROUND. The presence or absence of lymph node metastases in patients with malignant melanoma is the most powerful prognostic factor for predicting survival. If regional nodal metastases are found, the 5-year survival for the patient decreases approximately 50%. If the presence or absence of regional nodal metastases will determine which patients receive formal dissections or which patients enter adjuvant trials, then a technique is needed to accurately screen lymph node samples for occult disease. Routine histopathologic examination routinely underestimates the number of patients with metastases. This study was initiated to develop a highly sensitive clinically applicable method to detect micrometastases by examining lymph nodes for the presence of tyrosinase messenger RNA (mRNA). The hypothesis was that if mRNA for tyrosinase is found in the lymph node preparation, that finding is good evidence that metastatic melanoma cells are present. METHODS. The assay is accomplished using the combination of reverse transcription and double-round polymerase chain reaction (RT-PCR). The amplified samples are examined on a 2% agarose gel and tyrosinase cDNA is seen as a 207 base pair fragment. Lymph node preparations from 29 patients who were clinically stage I and II and undergoing elective node dissections were analyzed both by standard pathologic staining and RT-PCR. RESULTS. Eleven of 29 lymph node (38%) samples from 29 patients with intermediate thickness melanoma were pathologically positive. Nineteen of the 29 lymph node preparations (66%) were RT-PCR-positive, and these included all of the pathologically positive samples, so that the false-negative rate was 0. In a spiking experiment, one SK-Mel-28 melanoma cell in a background of one million normal lymphocytes could be detected, thus indicating the sensitivity of this method. In addition, analysis by restriction enzyme mapping showed that the amplified 207-bp PCR product produced is part of the tyrosinase gene

  19. Detection of Babesia bigemina-infected carriers by polymerase chain reaction amplification.

    PubMed Central

    Figueroa, J V; Chieves, L P; Johnson, G S; Buening, G M

    1992-01-01

    A SpeI-AvaI fragment (0.3 kbp) from pBbi16 (a pBR322 derivative containing a 6.3-kbp Babesia bigemina DNA insert) was subcloned into the pBluescript phagemid vector and was sequenced by the dideoxy-mediated chain termination method. Two sets of primers were designed for the polymerase chain reaction (PCR) assay. Primer set IA-IB was used to amplify a 278-bp DNA fragment, and primer set IAN-IBN was used to prepare a probe directed to a site within the PCR-amplified target DNA. Digoxigenin-dUTP was incorporated into the probe during the amplification reaction. PCR amplification of target DNA obtained from in vitro-cultured B. bigemina and nucleic acid hybridization of amplified product with the nonradioactive DNA probe showed that a 278-bp fragment could be detected when as little as 100 fg of parasite genomic DNA was used in the assay. A fragment of similar size was amplified from genomic DNAs from several B. bigemina isolates but not from DNAs from Babesia bovis, Anaplasma marginale, or six species of bacteria or bovine leukocytes. Similarly, the PCR product could be detected in DNA samples purified from 200 microliters of blood with a parasitemia of as low as 1 in 10(8) cells and which contained an estimated 30 B. bigemina-infected erythrocytes. By a direct PCR method, B. bigemina DNA was amplified from 20 microliters of packed erythrocytes with a calculated parasitemia of 1 in 10(9) cells. With the analytical sensitivity level of the PCR-DNA probe assay, six cattle with inapparent, 11-month chronic B. bigemina infection were found to be positive. No PCR product was observed in bovine blood samples collected from a splenectomized, A. marginale-infected bovine, a 4-year chronic B. bovis-infected animal, or 20 uninfected cattle from Missouri which were subjected to amplification. The PCR-DNA probe assay was shown to be sensitive in detecting latently infected cattle. The specificity and high analytical sensitivity of the test provide valuable tools for performing

  20. Early detection of Brucella canis via quantitative polymerase chain reaction analysis.

    PubMed

    Kauffman, L K; Bjork, J K; Gallup, J M; Boggiatto, P M; Bellaire, B H; Petersen, C A

    2014-02-01

    Canine brucellosis is a reportable zoonotic disease that can lead to canine reproductive losses and human infection through contact with infected urine or other genitourinary secretions. Although many locations require testing and euthanasia of positive dogs, current diagnosis is limited by the time required for seroconversion, for example, presence of B. canis-specific antibodies. The goal of this study was to determine the diagnostic ability of Brucella canis-specific quantitative polymerase chain reaction (qPCR) assay to detect B. canis in field samples prior to serological positivity for faster diagnosis and prevention of transmission within kennels or in households. Two kennels, one of which was located in the owner's home, were sampled following observation of suggestive clinical signs and positive serology of at least one dog. Specimens obtained were comparatively analysed via serology and qPCR analysis. 107 dogs were analysed for B. canis infection via qPCR: 105 via whole-blood samples, 65 via vaginal swab, six via urine and seven via genitourinary tract tissue taken at necropsy. Forty-five dogs were found to be infected with canine brucellosis via qPCR, of which 22 (48.89%) were seropositive. A statistically significant number (P = 0.0228) of qPCR-positive dogs, 5/25 (20.00%), seroconverted within a 30-day interval after initial serologic testing. As compared to serology, qPCR analysis of DNA from vaginal swabs had a sensitivity of 92.31% and specificity of 51.92%, and qPCR analysis of DNA from whole-blood samples had a sensitivity of 16.67% and specificity of 100%. B. canis outer membrane protein 25 DNA qPCR from non-invasive vaginal swab and urine samples provided early detection of B. canis infection in dogs prior to detection of antibodies. This assay provides a critical tool to decrease zoonotic spread of canine brucellosis, its associated clinical presentation(s), and emotional and economic repercussions.

  1. Epstein-Barr virus-encoded EBNA1 enhances RNA polymerase III-dependent EBER expression through induction of EBER-associated cellular transcription factors.

    PubMed

    Owen, Thomas J; O'Neil, John D; Dawson, Christopher W; Hu, Chunfang; Chen, Xiaoyi; Yao, Yunhong; Wood, Victoria H J; Mitchell, Louise E; White, Robert J; Young, Lawrence S; Arrand, John R

    2010-09-15

    Epstein-Barr Virus (EBV)-encoded RNAs (EBERs) are non-polyadenylated RNA molecules transcribed from the EBV genome by RNA polymerase III (pol III). EBERs are the most abundant viral latent gene products, although the precise mechanisms by which EBV is able to achieve such high levels of EBER expression are not fully understood. Previously EBV has been demonstrated to induce transcription factors associated with EBER expression, including pol III transcription factors and ATF-2. We have recently demonstrated that EBV-encoded nuclear antigen-1 (EBNA1) induces cellular transcription factors, and given these findings, we investigated the role of EBNA1 in induction of EBER-associated transcription factors. Our data confirm that in epithelial cells EBNA1 can enhance cellular pol III transcription. Transient expression of EBNA1 in Ad/AH cells stably expressing the EBERs led to induction of both EBER1 and EBER2 and conversely, expression of a dominant negative EBNA1 led to reduced EBER expression in EBV-infected Ad/AH cells. EBNA1 can induce transcription factors used by EBER genes, including TFIIIC, ATF-2 and c-Myc. A variant chromatin precipitation procedure showed that EBNA1 is associated with the promoters of these genes but not with the promoters of pol III-transcribed genes, including the EBERs themselves. Using shRNA knock-down, we confirm the significance of both ATF-2 and c-Myc in EBER expression. Further, functional induction of a c-Myc fusion protein led to increased EBER expression, providing c-Myc binding sites upstream of EBER1 were intact. In vivo studies confirm elevated levels of the 102 kD subunit of TFIIIC in the tumour cells of EBV-positive nasopharyngeal carcinoma biopsies. Our findings reveal that EBNA1 is able to enhance EBER expression through induction of cellular transcription factors and add to the repertoire of EBNA1's transcription-regulatory properties.

  2. Novel application of Phi29 DNA polymerase: RNA detection and analysis in vitro and in situ by target RNA-primed RCA

    PubMed Central

    Lagunavicius, Arunas; Merkiene, Egle; Kiveryte, Zivile; Savaneviciute, Agne; Zimbaite-Ruskuliene, Vilma; Radzvilavicius, Tomas; Janulaitis, Arvydas

    2009-01-01

    We present a novel Phi29 DNA polymerase application in RCA-based target RNA detection and analysis. The 3′→5′ RNase activity of Phi29 DNA polymerase converts target RNA into a primer and the polymerase uses this newly generated primer for RCA initiation. Therefore, using target RNA-primed RCA, padlock probes may be targeted to inner RNA sequences and their peculiarities can be analyzed directly. We demonstrate that the exoribonucleolytic activity of Phi29 DNA polymerase can be successfully applied in vitro and in situ. These findings expand the potential for detection and analysis of RNA sequences distanced from 3′-end. PMID:19244362

  3. Maf1-mediated regulation of yeast RNA polymerase III is correlated with CCA addition at the 3' end of tRNA precursors.

    PubMed

    Foretek, Dominika; Nuc, Przemysław; Żywicki, Marek; Karlowski, Wojciech M; Kudla, Grzegorz; Boguta, Magdalena

    2016-08-27

    In eukaryotic cells tRNA synthesis is negatively regulated by the protein Maf1, conserved from yeast to humans. Maf1 from yeast Saccharomyces cerevisiae mediates repression of trna transcription when cells are transferred from medium with glucose to medium with glycerol, a non-fermentable carbon source. The strain with deleted gene encoding Maf1 (maf1Δ) is viable but accumulates tRNA precursors. In this study tRNA precursors were analysed by RNA-Seq and Northern hybridization in wild type strain and maf1Δ mutant grown in glucose medium or upon shift to repressive conditions. A negative effect of maf1Δ mutant on the addition of the auxiliary CCA nucleotides to the 3' end of pre-tRNAs was observed in cells shifted to unfavourable growth conditions. This effect was reduced by overexpression of the yeast CCA1 gene encoding ATP(CTP):tRNA nucleotidyltransferase. The CCA sequence at the 3' end is important for export of tRNA precursors from the nucleus and essential for tRNA charging with amino acids. Data presented here indicate that CCA-addition to intron-containing end-processed tRNA precursors is a limiting step in tRNA maturation when there is no Maf1 mediated RNA polymerase III (Pol III) repression. The correlation between CCA synthesis and Pol III regulation by Maf1 could be important in coordination of tRNA transcription, processing and regulation of translation.

  4. Performance characteristics of nested polymerase chain reaction vs real-time polymerase chain reaction methods for detecting Mycobacterium tuberculosis complex in paraffin-embedded human tissues.

    PubMed

    Seo, An Na; Park, Hyo Jin; Lee, Hye Seung; Park, Jung Ok; Chang, Ho Eun; Nam, Kyung Han; Choe, Gheeyoung; Park, Kyoung Un

    2014-09-01

    Nucleic acid amplification tests on formalin-fixed, paraffin-embedded (FFPE) tissue specimens enable Mycobacterium tuberculosis complex (MTB) detection and rapid tuberculosis diagnosis in the absence of microbiologic culture tests. We aimed to evaluate the efficacy of different polymerase chain reaction (PCR) methods for detecting Mycobacterium species in FFPE tissues. We examined 110 FFPE specimens (56 nonmycobacterial cases, 32 MTB, and 22 nontuberculous mycobacteria [NTM] determined by acid-fast bacilli [AFB] culture) to assess five PCR methods: nested PCR (N-PCR) (Seeplex MTB Nested ACE Detection; Seegene, Seoul, South Korea), an in-house real-time PCR (RT-PCR) method, and three commercial RT-PCR methods (AccuPower MTB RT-PCR [Bioneer, Seoul, Korea], artus M tuberculosis TM PCR [Qiagen, Hilden, Germany], and AdvanSure tuberculosis/NTM RT-PCR [LG Life Sciences, Seoul, Korea]). The results of N-PCR, in-house RT-PCR, and AdvanSure RT-PCR correlated well with AFB culture results (concordance rates, 94.3%, 87.5%, and 89.5%, respectively). The sensitivity of N-PCR (87.5%) was higher than that of the RT-PCR methods, although these differences were not statistically significant between N-PCR and the in-house and AdvanSure RT-PCR methods (68.8% and 80.0%, respectively). All the PCR methods had high specificities, ranging from 98.2% to 100%. Only two NTM cases were detected by AdvanSure RT-PCR, implying a very low sensitivity. Well-designed RT-PCR and N-PCR can effectively identify MTB in FFPE specimens. Copyright© by the American Society for Clinical Pathology.

  5. Detection of Food Hazards in Foods: Comparison of Real Time Polymerase Chain Reaction and Cultural Methods

    PubMed Central

    Bonilauri, Paolo; Bardasi, Lia; Leonelli, Roberto; Ramini, Mattia; Luppi, Andrea; Merialdi, Giuseppe

    2016-01-01

    Foodstuffs should not contain microorganisms or their toxins or metabolites in quantities suggesting an unacceptable risk for human health. The detection of food hazards in foods is performed by several tests that produce results dependent on the analytical method used: an analytical reference method, defined as standard, is associated with each microbiological criterion laid down in Regulation 2073/2005/EC, but, analytical methods other than the reference ones, in particular more rapid methods, could be used. Combined screening methods performed by real time-polymerase chain reaction (RT-PCR) are currently validated as alternative methods according to the ISO 16140:2003 and certified by the Association Française de Normalisation. However, the positive results obtained with these alternative methods, the investigated molecular relations that resulted positive have to be confirmed with cultural methods using the same enrichment media in which the molecular screening was performed. Since it is necessary to assess if these testing schemes provide equivalent guarantees of food safety, the aim of this retrospective study is to analyse the data collected, from 2012 to 2014 by Emilia Romagna Region in the field of Piano Regionale Alimenti (Food Regional Plan) during official controls monitoring food samples of animal and other than animal origin. Records performed by combined methods of molecular screening of Salmonella spp., Listeria monocytogenes and thermophilic Campylobacter and cultural confirmation results were gathered together and the results were compared in order to assess the sensitivity of the methods. A total of 10,604 food samples were considered in this study: the comparison of the data revealed that the RT-PCR method detected Salmonella, L. monocytogenes, and thermophilic Campylobacter in 2.18, 3.85 and 3.73% of the samples, respectively, whereas by using cultural method these pathogens were isolated in 0.43, 1.57 and 1.57% of samples, respectively. In

  6. Detection of Food Hazards in Foods: Comparison of Real Time Polymerase Chain Reaction and Cultural Methods.

    PubMed

    Bonilauri, Paolo; Bardasi, Lia; Leonelli, Roberto; Ramini, Mattia; Luppi, Andrea; Giacometti, Federica; Merialdi, Giuseppe

    2016-01-18

    Foodstuffs should not contain microorganisms or their toxins or metabolites in quantities suggesting an unacceptable risk for human health. The detection of food hazards in foods is performed by several tests that produce results dependent on the analytical method used: an analytical reference method, defined as standard, is associated with each microbiological criterion laid down in Regulation 2073/2005/EC, but, analytical methods other than the reference ones, in particular more rapid methods, could be used. Combined screening methods performed by real time-polymerase chain reaction (RT-PCR) are currently validated as alternative methods according to the ISO 16140:2003 and certified by the Association Française de Normalisation. However, the positive results obtained with these alternative methods, the investigated molecular relations that resulted positive have to be confirmed with cultural methods using the same enrichment media in which the molecular screening was performed. Since it is necessary to assess if these testing schemes provide equivalent guarantees of food safety, the aim of this retrospective study is to analyse the data collected, from 2012 to 2014 by Emilia Romagna Region in the field of Piano Regionale Alimenti (Food Regional Plan) during official controls monitoring food samples of animal and other than animal origin. Records performed by combined methods of molecular screening of Salmonella spp., Listeria monocytogenes and thermophilic Campylobacter and cultural confirmation results were gathered together and the results were compared in order to assess the sensitivity of the methods. A total of 10,604 food samples were considered in this study: the comparison of the data revealed that the RT-PCR method detected Salmonella, L. monocytogenes, and thermophilic Campylobacter in 2.18, 3.85 and 3.73% of the samples, respectively, whereas by using cultural method these pathogens were isolated in 0.43, 1.57 and 1.57% of samples, respectively. In

  7. Use of Polymerase Chain Reaction To Detect the Take-All Fungus, Gaeumannomyces graminis, in Infected Wheat Plants.

    PubMed

    Schesser, K; Luder, A; Henson, J M

    1991-02-01

    Gaeumannomyces graminis, the causative agent of take-all disease of wheat, barley, and oats, was detected in infected wheat seedlings by using the polymerase chain reaction to amplify Gaeumannomyces-specific DNA fragments. Nested primers and two rounds of amplification were used to amplify two fragments, approximately 287 and 188 bp in size, from G. graminis-infected wheat seedlings. The use of nested primers greatly decreased the number of nonspecific amplification products. Polymerase chain reaction products were not obtained with DNA from seedlings infected with several other phytopathogenic fungi or with DNA from uninfected seedlings. Amplified products were visualized on agarose gels, and their identities were confirmed by DNA hybridization. This method did not require culturing the fungus and has potential for detecting G. graminis in infested wheat, barley, or oat fields.

  8. Widespread Use of TATA Elements in the Core Promoters for RNA Polymerases III, II, and I in Fission Yeast

    PubMed Central

    Hamada, Mitsuhiro; Huang, Ying; Lowe, Todd M.; Maraia, Richard J.

    2001-01-01

    In addition to directing transcription initiation, core promoters integrate input from distal regulatory elements. Except for rare exceptions, it has been generally found that eukaryotic tRNA and rRNA genes do not contain TATA promoter elements and instead use protein-protein interactions to bring the TATA-binding protein (TBP), to the core promoter. Genomewide analysis revealed TATA elements in the core promoters of tRNA and 5S rRNA (Pol III), U1 to U5 snRNA (Pol II), and 37S rRNA (Pol I) genes in Schizosaccharomyces pombe. Using tRNA-dependent suppression and other in vivo assays, as well as in vitro transcription, we demonstrated an obligatory requirement for upstream TATA elements for tRNA and 5S rRNA expression in S. pombe. The Pol III initiation factor Brf is found in complexes with TFIIIC and Pol III in S. pombe, while TBP is not, consistent with independent recruitment of TBP by TATA. Template commitment assays are consistent with this and confirm that the mechanisms of transcription complex assembly and initiation by Pol III in S. pombe differ substantially from those in other model organisms. The results were extended to large-rRNA synthesis, as mutation of the TATA element in the Pol I promoter also abolishes rRNA expression in fission yeast. A survey of other organisms' genomes reveals that a substantial number of eukaryotes may use widespread TATAs for transcription. These results indicate the presence of TATA-unified transcription systems in contemporary eukaryotes and provide insight into the residual need for TBP by all three Pols in other eukaryotes despite a lack of TATA elements in their promoters. PMID:11564871

  9. Prenatal detection of trisomy 21 and 18 from amniotic fluid by quantitative fluorescent polymerase chain reaction.

    PubMed Central

    Tóth, T; Findlay, I; Papp, C; Tóth-Pál, E; Marton, T; Nagy, B; Quirke, P; Papp, Z

    1998-01-01

    Prenatal diagnosis of fetal trisomies is usually performed by cytogenetic analysis on amniotic fluid. This requires lengthy laboratory procedures and high costs, and is unsuitable for large scale screening of pregnant women. An alternative method, which is both rapid and inexpensive and suitable for diagnosing trisomies even from single fetal cells, is the fluorescent polymerase chain reaction using polymorphic small tandem repeats (STRs). In this paper we present the preliminary results of a larger study comparing parallel prenatal diagnoses of trisomies 21 and 18 using cytogenetics with quantitative fluorescent polymerase chain reaction using STR markers. The results obtained by the two techniques were concordant in all cases. This is the first study reporting significant numbers of prenatal diagnoses using the quantitative fluorescent polymerase chain reaction. We believe that further studies on greater numbers of samples will determine the absolute reliability of this technique. These results also provide a model for diagnosis of trisomy from single fetal cells isolated from maternal blood. PMID:9507392

  10. RPC53 encodes a subunit of Saccharomyces cerevisiae RNA polymerase C (III) whose inactivation leads to a predominantly G1 arrest.

    PubMed Central

    Mann, C; Micouin, J Y; Chiannilkulchai, N; Treich, I; Buhler, J M; Sentenac, A

    1992-01-01

    RPC53 is shown to be an essential gene encoding the C53 subunit specifically associated with yeast RNA polymerase C (III). Temperature-sensitive rpc53 mutants were generated and showed a rapid inhibition of tRNA synthesis after transfer to the restrictive temperature. Unexpectedly, the rpc53 mutants preferentially arrested their cell division in the G1 phase as large, round, unbudded cells. The RPC53 DNA sequence is predicted to code for a hydrophilic M(r)-46,916 protein enriched in charged amino acid residues. The carboxy-terminal 136 amino acids of C53 are significantly similar (25% identical amino acid residues) to the same region of the human BN51 protein. The BN51 cDNA was originally isolated by its ability to complement a temperature-sensitive hamster cell mutant that undergoes a G1 cell division arrest, as is true for the rpc53 mutants. Images PMID:1406624

  11. Detection of clonality by polymerase chain reaction in childhood B-lineage acute lymphoblastic leukemia.

    PubMed

    Januszkiewicz, D A; Nowak, J S

    1994-09-01

    DNA-based PCR with various sets of primers for TCR gamma/delta, and Ig heavy chain (IgH) genes were used to study clonality in childhood B-lineage acute lymphoblastic leukemia. Amplification of the IgH CDR-III was observed in 75 of 120 analyzed cases (62.5%). From all analyzed groups, the IgH gene rearrangement was most often observed in pre-B ALL (85.7%) and was rather rare in null-ALL (34.5%). TCR delta gene rearrangement was the most common, and was observed in 77 patients (64.2%). The typical pattern of rearrangements was defined as an incomplete V delta 2 to D delta 3, V delta 2 to D delta 2, or D delta 3 to D delta 2 recombination product. Rearrangements of TCR gamma gene we observed in 61 cases (50.8%). TCR gamma gene rearrangements were detected predominantly in null-ALL and early B-ALL (55.2% and 60%, respectively) and were rather rare in other groups. Of all eight V segments of V gamma I group, the most frequent gene usage concerns regions V gamma 2, V gamma 4, and psi V gamma 7. We have confirmed that IgH gene amplification, together with TCR gamma and delta gene amplification, provides a rapid, sensitive approach to assessing clonality in ALL almost in 100% of cases.

  12. Devoted to the lagging strand-the subunit of DNA polymerase III holoenzyme contacts SSB to promote processive elongation and sliding clamp assembly.

    PubMed Central

    Kelman, Z; Yuzhakov, A; Andjelkovic, J; O'Donnell, M

    1998-01-01

    Escherichia coli DNA polymerase III holoenzyme contains 10 different subunits which assort into three functional components: a core catalytic unit containing DNA polymerase activity, the beta sliding clamp that encircles DNA for processive replication, and a multisubunit clamp loader apparatus called gamma complex that uses ATP to assemble the beta clamp onto DNA. We examine here the function of the psi subunit of the gamma complex clamp loader. Omission of psi from the holoenzyme prevents contact with single-stranded DNA-binding protein (SSB) and lowers the efficiency of clamp loading and chain elongation under conditions of elevated salt. We also show that the product of a classic point mutant of SSB, SSB-113, lacks strong affinity for psi and is defective in promoting clamp loading and processive replication at elevated ionic strength. SSB-113 carries a single amino acid replacement at the penultimate residue of the C-terminus, indicating the C-terminus as a site of interaction with psi. Indeed, a peptide of the 15 C-terminal residues of SSB is sufficient to bind to psi. These results establish a role for the psi subunit in contacting SSB, thus enhancing the clamp loading and processivity of synthesis of the holoenzyme, presumably by helping to localize the holoenzyme to sites of SSB-coated ssDNA. PMID:9545254

  13. Citrus MAF1, a Repressor of RNA Polymerase III, Binds the Xanthomonas citri Canker Elicitor PthA4 and Suppresses Citrus Canker Development1

    PubMed Central

    Soprano, Adriana Santos; Abe, Valeria Yukari; Smetana, Juliana Helena Costa; Benedetti, Celso Eduardo

    2013-01-01

    Transcription activator-like (TAL) effectors from Xanthomonas species pathogens act as transcription factors in plant cells; however, how TAL effectors activate host transcription is unknown. We found previously that TAL effectors of the citrus canker pathogen Xanthomonas citri, known as PthAs, bind the carboxyl-terminal domain of the sweet orange (Citrus sinensis) RNA polymerase II (Pol II) and inhibit the activity of CsCYP, a cyclophilin associated with the carboxyl-terminal domain of the citrus RNA Pol II that functions as a negative regulator of cell growth. Here, we show that PthA4 specifically interacted with the sweet orange MAF1 (CsMAF1) protein, an RNA polymerase III (Pol III) repressor that controls ribosome biogenesis and cell growth in yeast (Saccharomyces cerevisiae) and human. CsMAF1 bound the human RNA Pol III and rescued the yeast maf1 mutant by repressing tRNAHis transcription. The expression of PthA4 in the maf1 mutant slightly restored tRNAHis synthesis, indicating that PthA4 counteracts CsMAF1 activity. In addition, we show that sweet orange RNA interference plants with reduced CsMAF1 levels displayed a dramatic increase in tRNA transcription and a marked phenotype of cell proliferation during canker formation. Conversely, CsMAF1 overexpression was detrimental to seedling growth, inhibited tRNA synthesis, and attenuated canker development. Furthermore, we found that PthA4 is required to elicit cankers in sweet orange leaves and that depletion of CsMAF1 in X. citri-infected tissues correlates with the development of hyperplastic lesions and the presence of PthA4. Considering that CsMAF1 and CsCYP function as canker suppressors in sweet orange, our data indicate that TAL effectors from X. citri target negative regulators of RNA Pol II and Pol III to coordinately increase the transcription of host genes involved in ribosome biogenesis and cell proliferation. PMID:23898043

  14. Reverse Transcription Polymerase Chain Reaction-based System for Simultaneous Detection of Multiple Lily-infecting Viruses

    PubMed Central

    Kwon, Ji Yeon; Ryu, Ki Hyun; Choi, Sun Hee

    2013-01-01

    A detection system based on a multiplex reverse transcription (RT) polymerase chain reaction (PCR) was developed to simultaneously identify multiple viruses in the lily plant. The most common viruses infecting lily plants are the cucumber mosaic virus (CMV), lily mottle virus (LMoV), lily symptomless virus (LSV). Leaf samples were collected at lily-cultivation facilities located in the Kangwon province of Korea and used to evaluate the detection system. Simplex and multiplex RT-PCR were performed using virus-specific primers to detect single-or mixed viral infections in lily plants. Our results demonstrate the selective detection of 3 different viruses (CMV, LMoV and LSV) by using specific primers as well as the potential of simultaneously detecting 2 or 3 different viruses in lily plants with mixed infections. Three sets of primers for each target virus, and one set of internal control primers were used to evaluate the detection system for efficiency, reliability, and reproducibility. PMID:25288961

  15. Detection of Zaire Ebola virus by real-time reverse transcription-polymerase chain reaction, Sierra Leone, 2014.

    PubMed

    Liu, Licheng; Sun, Yang; Kargbo, Brima; Zhang, Chuntao; Feng, Huahua; Lu, Huijun; Liu, Wenseng; Wang, Chengyu; Hu, Yi; Deng, Yongqiang; Jiang, Jiafu; Kang, Xiaoping; Yang, Honglei; Jiang, Yongqiang; Yang, Yinhui; Kargbo, David; Qian, Jun; Chen, Weijun

    2015-09-15

    During the 2014 Ebola virus disease (EVD) outbreak, a real-time quantitative polymerase chain reaction was established to detect and identify the Zaire Ebola virus. We describe the use of this assay to screen 315 clinical samples from EVD suspected person in Sierra Leone. The detection rate in blood samples was 77.81% (207/266), and there were relatively higher detection rate (79.32% and 81.42%, respectively) during the first two weeks after onset of symptoms. In the two weeks that followed, the detection rate declined to 66.67% and 25.00%, respectively. There was the highest virus load at the first week and then decreased. The detection rate in swab samples was 89.79% (44/49). This may be benefit from the included patients. 46 of 49 swab samples were collected from died patients. Taken together, the results presented here indicate that the assay specifically and sensitively detects Zaire Ebola virus.

  16. The Roles of RNA Polymerase I and III Subunits Polr1c and Polr1d in Craniofacial Development and in Zebrafish Models of Treacher Collins Syndrome

    PubMed Central

    Achilleos, Annita; Neben, Cynthia L.; Merrill, Amy E.; Trainor, Paul A.

    2016-01-01

    Ribosome biogenesis is a global process required for growth and proliferation of all cells, yet perturbation of ribosome biogenesis during human development often leads to tissue-specific defects termed ribosomopathies. Transcription of the ribosomal RNAs (rRNAs) by RNA polymerases (Pol) I and III, is considered a rate limiting step of ribosome biogenesis and mutations in the genes coding for RNA Pol I and III subunits, POLR1C and POLR1D cause Treacher Collins syndrome, a rare congenital craniofacial disorder. Our understanding of the functions of individual RNA polymerase subunits, however, remains poor. We discovered that polr1c and polr1d are dynamically expressed during zebrafish embryonic development, particularly in craniofacial tissues. Consistent with this pattern of activity, polr1c and polr1d homozygous mutant zebrafish exhibit cartilage hypoplasia and cranioskeletal anomalies characteristic of humans with Treacher Collins syndrome. Mechanistically, we discovered that polr1c and polr1d loss-of-function results in deficient ribosome biogenesis, Tp53-dependent neuroepithelial cell death and a deficiency of migrating neural crest cells, which are the primary progenitors of the craniofacial skeleton. More importantly, we show that genetic inhibition of tp53 can suppress neuroepithelial cell death and ameliorate the skeletal anomalies in polr1c and polr1d mutants, providing a potential avenue to prevent the pathogenesis of Treacher Collins syndrome. Our work therefore has uncovered tissue-specific roles for polr1c and polr1d in rRNA transcription, ribosome biogenesis, and neural crest and craniofacial development during embryogenesis. Furthermore, we have established polr1c and polr1d mutant zebrafish as models of Treacher Collins syndrome together with a unifying mechanism underlying its pathogenesis and possible prevention. PMID:27448281

  17. The Roles of RNA Polymerase I and III Subunits Polr1c and Polr1d in Craniofacial Development and in Zebrafish Models of Treacher Collins Syndrome.

    PubMed

    Noack Watt, Kristin E; Achilleos, Annita; Neben, Cynthia L; Merrill, Amy E; Trainor, Paul A

    2016-07-01

    Ribosome biogenesis is a global process required for growth and proliferation of all cells, yet perturbation of ribosome biogenesis during human development often leads to tissue-specific defects termed ribosomopathies. Transcription of the ribosomal RNAs (rRNAs) by RNA polymerases (Pol) I and III, is considered a rate limiting step of ribosome biogenesis and mutations in the genes coding for RNA Pol I and III subunits, POLR1C and POLR1D cause Treacher Collins syndrome, a rare congenital craniofacial disorder. Our understanding of the functions of individual RNA polymerase subunits, however, remains poor. We discovered that polr1c and polr1d are dynamically expressed during zebrafish embryonic development, particularly in craniofacial tissues. Consistent with this pattern of activity, polr1c and polr1d homozygous mutant zebrafish exhibit cartilage hypoplasia and cranioskeletal anomalies characteristic of humans with Treacher Collins syndrome. Mechanistically, we discovered that polr1c and polr1d loss-of-function results in deficient ribosome biogenesis, Tp53-dependent neuroepithelial cell death and a deficiency of migrating neural crest cells, which are the primary progenitors of the craniofacial skeleton. More importantly, we show that genetic inhibition of tp53 can suppress neuroepithelial cell death and ameliorate the skeletal anomalies in polr1c and polr1d mutants, providing a potential avenue to prevent the pathogenesis of Treacher Collins syndrome. Our work therefore has uncovered tissue-specific roles for polr1c and polr1d in rRNA transcription, ribosome biogenesis, and neural crest and craniofacial development during embryogenesis. Furthermore, we have established polr1c and polr1d mutant zebrafish as models of Treacher Collins syndrome together with a unifying mechanism underlying its pathogenesis and possible prevention.

  18. TRE5-A retrotransposition profiling reveals putative RNA polymerase III transcription complex binding sites on the Dictyostelium extrachromosomal rDNA element.

    PubMed

    Spaller, Thomas; Groth, Marco; Glöckner, Gernot; Winckler, Thomas

    2017-01-01

    The amoeba Dictyostelium discoideum has a haploid genome in which two thirds of the DNA encodes proteins. Consequently, the space available for selfish mobile elements to expand without excess damage to the host genome is limited. The non-long terminal repeat retrotransposon TRE5-A maintains an active population in the D. discoideum genome and apparently adapted to this gene-dense environment by targeting positions ~47 bp upstream of tRNA genes that are devoid of protein-coding regions. Because only ~24% of tRNA genes are associated with a TRE5-A element in the reference genome, we evaluated whether TRE5-A retrotransposition is limited to this subset of tRNA genes. We determined that a tagged TRE5-A element (TRE5-Absr) integrated at 384 of 405 tRNA genes, suggesting that expansion of the current natural TRE5-A population is not limited by the availability of targets. We further observed that TRE5-Absr targets the ribosomal 5S gene on the multicopy extrachromosomal DNA element that carries the ribosomal RNA genes, indicating that TRE5-A integration may extend to the entire RNA polymerase III (Pol III) transcriptome. We determined that both natural TRE5-A and cloned TRE5-Absr retrotranspose to locations on the extrachromosomal rDNA element that contain tRNA gene-typical A/B box promoter motifs without displaying any other tRNA gene context. Based on previous data suggesting that TRE5-A targets tRNA genes by locating Pol III transcription complexes, we propose that A/B box loci reflect Pol III transcription complex assembly sites that possess a function in the biology of the extrachromosomal rDNA element.

  19. Detection and analysis of polymerase chain reaction products by mass spectrometry

    SciTech Connect

    Hurst, G.B., Doktycz, M.J., Britt, P.F., Vass, A.A., Buchanan, M.V.

    1997-02-01

    This paper describes recent and ongoing efforts to overcome some of the obstacles to more routine and robust application of MALDI-TOF to analysis of polymerase chain reaction products and other information- bearing nucleic acid molecules. Methods for purifying nucleic acid samples are described, as is the application of delayed extraction TOF mass spectrometry to analysis of short oligonucleotides.

  20. PrimRglo: a multiplexable quantitative real-time polymerase chain reaction system for nucleic acid detection.

    PubMed

    Lai, Richard; Liang, Fang; Pearson, Darnley; Barnett, Graeme; Whiley, David; Sloots, Theo; Barnard, Ross T; Corrie, Simon R

    2012-03-15

    We report the development of a new real-time polymerase chain reaction (PCR) detection system that uses oligonucleotide "tagged" PCR primers, a fluorophore-labeled "universal" detection oligonucleotides, and a complementary quenching oligonucleotide. The fluorescence signal decreases as PCR product accumulates due to the increase in detection/quencher hybrid formation as the tagged primer is consumed. We use plasmids containing the influenza A matrix gene and the porA and ctrA genes of Neisseria meningitidis as targets for developing the system. Cycle threshold (Ct) values were generated, and the sensitivity of the new system (dubbed "PrimRglo") compared favorably with the commonly used SYBR green and Taqman detection systems and, unlike the latter system, does not require the design of a new dual-labeled detection oligonucleotide for each new target sequence.

  1. Development of a rapid polymerase chain reaction-ELISA assay using polystyrene beads for the detection of Toxoplasma gondii DNA.

    PubMed

    Martínez, E; Carmelo, E; Alonso, R; Ortega, A; Piñero, J; del Castillo, A; Valladares, B

    2003-01-01

    To develop a rapid colourimetric assay for the detection of Toxoplasma gondii DNA using polystyrene beads as solid support. A nested-polymerase chain reaction (PCR)-ELISA assay for the detection of T. gondii DNA was standardized by optimizing the hybridization time and probe concentration. Its detection threshold was then determined and compared with Southern blotting hybridization. These were found to be equivalent, but the PCR-ELISA-beads test is easier to perform and the turnaround time is much shorter than with Southern blot. The PCR-ELISA-beads assay is a valuable tool for the detection of T. gondii DNA. Our results demonstrate that this PCR-ELISA assay, using polystyrene beads, can be used as a routine diagnostic test for the detection of T. gondii in clinical laboratories.

  2. The bacteriophage P1 hot gene, encoding a homolog of the E. coli DNA polymerase III theta subunit, is expressed during both lysogenic and lytic growth stages.

    PubMed

    Chikova, Anna K; Schaaper, Roel M

    2007-11-01

    The bacteriophage P1 hot gene product is a homolog of the theta subunit of E. coli DNA polymerase III. Previous studies with hot cloned on a plasmid have shown that Hot protein can substitute for theta, as evidenced by its stabilizing effect on certain dnaQ mutator mutants carrying an unstable pol III proofreading subunit (epsilon subunit). These results are consistent with Hot, like theta, being a replication protein involved in stabilizing the intrinsically unstable epsilon proofreading function. However, the function of hot for the viral life cycle is less clear. In the present study, we show that the hot gene is not essential. Based on its promoter structure, hot has been previously classified as a "late" phage gene, a property that is not easily reconciled with a presumed replication function. Here, we clarify this issue by demonstrating that P1 hot is actively expressed both during the lysogenic state and in the early stages of a lytic induction, in addition to its expression in the late stage of phage development. The results indicate that P1 hot has a complex expression pattern, compatible with a model in which Hot may affect the host replication machinery to benefit overall phage replication.

  3. Enhanced detection of RNA by MMLV reverse transcriptase coupled with thermostable DNA polymerase and DNA/RNA helicase.

    PubMed

    Okano, Hiroyuki; Katano, Yuta; Baba, Misato; Fujiwara, Ayako; Hidese, Ryota; Fujiwara, Shinsuke; Yanagihara, Itaru; Hayashi, Tsukasa; Kojima, Kenji; Takita, Teisuke; Yasukawa, Kiyoshi

    2017-01-01

    Detection of mRNA is a valuable method for monitoring the specific gene expression. In this study, we devised a novel cDNA synthesis method using three enzymes, the genetically engineered thermostable variant of reverse transcriptase (RT), MM4 (E286R/E302K/L435R/D524A) from Moloney murine leukemia virus (MMLV), the genetically engineered variant of family A DNA polymerase with RT activity, K4polL329A from thermophilic Thermotoga petrophila K4, and the DNA/RNA helicase Tk-EshA from a hyperthermophilic archaeon Thermococcus kodakarensis. By optimizing assay conditions for three enzymes using Taguchi's method, 100 to 1000-fold higher sensitivity was achieved for cDNA synthesis than conventional assay condition using only RT. Our results suggest that DNA polymerase with RT activity and DNA/RNA helicase are useful to increase the sensitivity of cDNA synthesis.

  4. A portable reverse transcription recombinase polymerase amplification assay for rapid detection of foot-and-mouth disease virus.

    PubMed

    Abd El Wahed, Ahmed; El-Deeb, Ayman; El-Tholoth, Mohamed; Abd El Kader, Hanaa; Ahmed, Abeer; Hassan, Sayed; Hoffmann, Bernd; Haas, Bernd; Shalaby, Mohamed A; Hufert, Frank T; Weidmann, Manfred

    2013-01-01

    Foot-and-mouth disease (FMD) is a trans-boundary viral disease of livestock, which causes huge economic losses and constitutes a serious infectious threat for livestock farming worldwide. Early diagnosis of FMD helps to diminish its impact by adequate outbreak management. In this study, we describe the development of a real-time reverse transcription recombinase polymerase amplification (RT-RPA) assay for the detection of FMD virus (FMDV). The FMDV RT-RPA design targeted the 3D gene of FMDV and a 260 nt molecular RNA standard was used for assay validation. The RT-RPA assay was fast (4-10 minutes) and the analytical sensitivity was determined at 1436 RNA molecules detected by probit regression analysis. The FMDV RT-RPA assay detected RNA prepared from all seven FMDV serotypes but did not detect classical swine fever virus or swine vesicular disease virus. The FMDV RT-RPA assay was used in the field during the recent FMD outbreak in Egypt. In clinical samples, reverse transcription polymerase chain reaction (RT-PCR) and RT-RPA showed a diagnostic sensitivity of 100% and 98%, respectively. In conclusion, FMDV RT-RPA was quicker and much easier to handle in the field than real-time RT-PCR. Thus RT-RPA could be easily implemented to perform diagnostics at quarantine stations or farms for rapid spot-of-infection detection.

  5. A Portable Reverse Transcription Recombinase Polymerase Amplification Assay for Rapid Detection of Foot-and-Mouth Disease Virus

    PubMed Central

    Abd El Wahed, Ahmed; El-Deeb, Ayman; El-Tholoth, Mohamed; Abd El Kader, Hanaa; Ahmed, Abeer; Hassan, Sayed; Hoffmann, Bernd; Haas, Bernd; Shalaby, Mohamed A.; Hufert, Frank T.; Weidmann, Manfred

    2013-01-01

    Foot-and-mouth disease (FMD) is a trans-boundary viral disease of livestock, which causes huge economic losses and constitutes a serious infectious threat for livestock farming worldwide. Early diagnosis of FMD helps to diminish its impact by adequate outbreak management. In this study, we describe the development of a real-time reverse transcription recombinase polymerase amplification (RT-RPA) assay for the detection of FMD virus (FMDV). The FMDV RT-RPA design targeted the 3D gene of FMDV and a 260 nt molecular RNA standard was used for assay validation. The RT-RPA assay was fast (4–10 minutes) and the analytical sensitivity was determined at 1436 RNA molecules detected by probit regression analysis. The FMDV RT-RPA assay detected RNA prepared from all seven FMDV serotypes but did not detect classical swine fever virus or swine vesicular disease virus. The FMDV RT-RPA assay was used in the field during the recent FMD outbreak in Egypt. In clinical samples, reverse transcription polymerase chain reaction (RT-PCR) and RT-RPA showed a diagnostic sensitivity of 100% and 98%, respectively. In conclusion, FMDV RT-RPA was quicker and much easier to handle in the field than real-time RT-PCR. Thus RT-RPA could be easily implemented to perform diagnostics at quarantine stations or farms for rapid spot-of-infection detection. PMID:23977101

  6. Polymerase chain reaction detection of Leishmania DNA in skin biopsy samples in Sri Lanka where the causative agent of cutaneous leishmaniasis is Leishmania donovani.

    PubMed

    Ranasinghe, Shalindra; Wickremasinghe, Renu; Hulangamuwa, Sanjeeva; Sirimanna, Ganga; Opathella, Nandimithra; Maingon, Rhaiza D C; Chandrasekharan, Vishvanath

    2015-12-01

    Leishmania donovani is the known causative agent of both cutaneous (CL) and visceral leishmaniasis in Sri Lanka. CL is considered to be under-reported partly due to relatively poor sensitivity and specificity of microscopic diagnosis. We compared robustness of three previously described polymerase chain reaction (PCR) based methods to detect Leishmania DNA in 38 punch biopsy samples from patients presented with suspected lesions in 2010. Both, Leishmania genus-specific JW11/JW12 KDNA and LITSR/L5.8S internal transcribed spacer (ITS)1 PCR assays detected 92% (35/38) of the samples whereas a KDNA assay specific forL. donovani (LdF/LdR) detected only 71% (27/38) of samples. All positive samples showed a L. donovani banding pattern upon HaeIII ITS1 PCR-restriction fragment length polymorphism analysis. PCR assay specificity was evaluated in samples containing Mycobacterium tuberculosis, Mycobacterium leprae, and human DNA, and there was no cross-amplification in JW11/JW12 and LITSR/L5.8S PCR assays. The LdF/LdR PCR assay did not amplify M. leprae or human DNA although 500 bp and 700 bp bands were observed in M. tuberculosis samples. In conclusion, it was successfully shown in this study that it is possible to diagnose Sri Lankan CL with high accuracy, to genus and species identification, using Leishmania DNA PCR assays.

  7. Polymerase chain reaction detection of Leishmania DNA in skin biopsy samples in Sri Lanka where the causative agent of cutaneous leishmaniasis is Leishmania donovani

    PubMed Central

    Ranasinghe, Shalindra; Wickremasinghe, Renu; Hulangamuwa, Sanjeeva; Sirimanna, Ganga; Opathella, Nandimithra; Maingon, Rhaiza DC; Chandrasekharan, Vishvanath

    2015-01-01

    Leishmania donovani is the known causative agent of both cutaneous (CL) and visceral leishmaniasis in Sri Lanka. CL is considered to be under-reported partly due to relatively poor sensitivity and specificity of microscopic diagnosis. We compared robustness of three previously described polymerase chain reaction (PCR) based methods to detectLeishmania DNA in 38 punch biopsy samples from patients presented with suspected lesions in 2010. Both, Leishmaniagenus-specific JW11/JW12 KDNA and LITSR/L5.8S internal transcribed spacer (ITS)1 PCR assays detected 92% (35/38) of the samples whereas a KDNA assay specific forL. donovani (LdF/LdR) detected only 71% (27/38) of samples. All positive samples showed a L. donovani banding pattern upon HaeIII ITS1 PCR-restriction fragment length polymorphism analysis. PCR assay specificity was evaluated in samples containing Mycobacterium tuberculosis, Mycobacterium leprae, and human DNA, and there was no cross-amplification in JW11/JW12 and LITSR/L5.8S PCR assays. The LdF/LdR PCR assay did not amplify M. leprae or human DNA although 500 bp and 700 bp bands were observed in M. tuberculosis samples. In conclusion, it was successfully shown in this study that it is possible to diagnose Sri Lankan CL with high accuracy, to genus and species identification, using Leishmania DNA PCR assays. PMID:26676321

  8. Direct detection of RNA in vitro and in situ by target-primed RCA: The impact of E. coli RNase III on the detection efficiency of RNA sequences distanced far from the 3′-end

    PubMed Central

    Merkiene, Egle; Gaidamaviciute, Edita; Riauba, Laurynas; Janulaitis, Arvydas; Lagunavicius, Arunas

    2010-01-01

    We improved the target RNA-primed RCA technique for direct detection and analysis of RNA in vitro and in situ. Previously we showed that the 3′ → 5′ single-stranded RNA exonucleolytic activity of Phi29 DNA polymerase converts the target RNA into a primer and uses it for RCA initiation. However, in some cases, the single-stranded RNA exoribonucleolytic activity of the polymerase is hindered by strong double-stranded structures at the 3′-end of target RNAs. We demonstrate that in such hampered cases, the double-stranded RNA-specific Escherichia coli RNase III efficiently assists Phi29 DNA polymerase in converting the target RNA into a primer. These observations extend the target RNA-primed RCA possibilities to test RNA sequences distanced far from the 3′-end and customize this technique for the inner RNA sequence analysis. PMID:20584897

  9. Identification of a selective polymerase enables detection of N(6)-methyladenosine in RNA.

    PubMed

    Harcourt, Emily M; Ehrenschwender, Thomas; Batista, Pedro J; Chang, Howard Y; Kool, Eric T

    2013-12-26

    N(6)-methyladenosine (m(6)A) is the most abundant mRNA modification and has important links to human health. While recent studies have successfully identified thousands of mammalian RNA transcripts containing the modification, it is extremely difficult to identify the exact location of any specific m(6)A. Here we have identified a polymerase with reverse transcriptase activity (from Thermus thermophilus) that is selective by up to 18-fold for incorporation of thymidine opposite unmodified A over m(6)A. We show that the enzyme can be used to locate and quantify m(6)A in synthetic RNAs by analysis of pausing bands, and have used the enzyme in tandem with a nonselective polymerase to locate the presence and position of m(6)A in high-abundance cellular RNAs. By this approach we demonstrate that the long-undetermined position of m(6)A in mammalian 28S rRNA is nucleotide 4190.

  10. Cys-pair reporters detect a constrained trigger loop in a paused RNA polymerase

    PubMed Central

    Nayak, Dhananjaya; Voss, Michael; Windgassen, Tricia; Mooney, Rachel Anne; Landick, Robert

    2014-01-01

    Transcriptional pausing, which regulates transcript elongation in both prokaryotes and eukaryotes, is thought to involve formation of alternative RNA polymerase conformations in which nucleotide addition is inhibited in part due to restriction of trigger loop (TL) folding. The polymorphous TL must convert from a random coil to a helical hairpin that contacts the NTP substrate to allow rapid nucleotide addition. Understanding the distribution of TL conformations in different enzyme states is made difficult by its small size and sensitive energetics. Here we report a Cys-pair reporter strategy to elucidate the relative occupancies of different TL conformations in E. coli RNA polymerase based on the ability of Cys residues engineered into the TL and surrounding regions to form disulfide bonds. Our results indicate that a paused complex stabilized by a nascent RNA hairpin favors nonproductive TL conformations that persist after NTP binding, but that can be reversed by the elongation factor RfaH. PMID:23769674

  11. Hepatitis B virus X protein induces RNA polymerase III-dependent gene transcription and increases cellular TATA-binding protein by activating the Ras signaling pathway.

    PubMed

    Wang, H D; Trivedi, A; Johnson, D L

    1997-12-01

    Our previous studies have shown that the hepatitis B virus protein, X, activates all three classes of RNA polymerase III (pol III)-dependent promoters by increasing the cellular level of TATA-binding protein (TBP) (H.-D. Wang et al., Mol. Cell. Biol. 15:6720-6728, 1995), a limiting transcription component (A. Trivedi et al., Mol. Cell. Biol. 16:6909-6916, 1996). We have investigated whether these X-mediated events are dependent on the activation of the Ras/Raf-1 signaling pathway. Transient expression of a dominant-negative mutant Ras gene (Ras-ala15) in a Drosophila S-2 stable cell line expressing X (X-S2), or incubation of the cells with a Ras farnesylation inhibitor, specifically blocked both the X-dependent activation of a cotransfected tRNA gene and the increase in cellular TBP levels. Transient expression of a constitutively activated form of Ras (Ras-val12) in control S2 cells produced both an increase in tRNA gene transcription and an increase in cellular TBP levels. These events are not cell type specific since X-mediated gene induction was also shown to be dependent on Ras activation in a stable rat 1A cell line expressing X. Furthermore, increases in RNA pol III-dependent gene activity and TBP levels could be restored in X-S2 cells expressing Ras-ala15 by coexpressing a constitutively activated form of Raf-1. These events are serum dependent, and when the cells are serum deprived, the X-mediated effects are augmented. Together, these results demonstrate that the X-mediated induction of RNA pol III-dependent genes and increase in TBP are both dependent on the activation of the Ras/Raf-1 signaling cascade. In addition, these studies define two new and important consequences mediated by the activation of the Ras signal transduction pathway: an increase in the central transcription factor, TBP, and the induction of RNA pol III-dependent gene activity.

  12. Epstein-Barr virus-encoded EBNA1 enhances RNA polymerase III-dependent EBER expression through induction of EBER-associated cellular transcription factors

    PubMed Central

    2010-01-01

    Background Epstein-Barr Virus (EBV)-encoded RNAs (EBERs) are non-polyadenylated RNA molecules transcribed from the EBV genome by RNA polymerase III (pol III). EBERs are the most abundant viral latent gene products, although the precise mechanisms by which EBV is able to achieve such high levels of EBER expression are not fully understood. Previously EBV has been demonstrated to induce transcription factors associated with EBER expression, including pol III transcription factors and ATF-2. We have recently demonstrated that EBV-encoded nuclear antigen-1 (EBNA1) induces cellular transcription factors, and given these findings, we investigated the role of EBNA1 in induction of EBER-associated transcription factors. Results Our data confirm that in epithelial cells EBNA1 can enhance cellular pol III transcription. Transient expression of EBNA1 in Ad/AH cells stably expressing the EBERs led to induction of both EBER1 and EBER2 and conversely, expression of a dominant negative EBNA1 led to reduced EBER expression in EBV-infected Ad/AH cells. EBNA1 can induce transcription factors used by EBER genes, including TFIIIC, ATF-2 and c-Myc. A variant chromatin precipitation procedure showed that EBNA1 is associated with the promoters of these genes but not with the promoters of pol III-transcribed genes, including the EBERs themselves. Using shRNA knock-down, we confirm the significance of both ATF-2 and c-Myc in EBER expression. Further, functional induction of a c-Myc fusion protein led to increased EBER expression, providing c-Myc binding sites upstream of EBER1 were intact. In vivo studies confirm elevated levels of the 102 kD subunit of TFIIIC in the tumour cells of EBV-positive nasopharyngeal carcinoma biopsies. Conclusions Our findings reveal that EBNA1 is able to enhance EBER expression through induction of cellular transcription factors and add to the repertoire of EBNA1's transcription-regulatory properties. PMID:20843307

  13. Detection of Clostridium botulinum type C cells in the gastrointestinal tracts of Mozambique Tilapia (Oreochromis mossambicus) by polymerase chain reaction.

    PubMed

    Nol, P; Williamson, J L; Rocke, T E; Yuill, T M

    2004-10-01

    We established a method of directly detecting Clostridium botulinum type C cells, while minimizing spore detection, in the intestinal contents of Mozambique tilapia (Oreochromis mossambicus). This technique involved extraction of predominantly cellular DNA from tilapia intestinal tracts and used a polymerase chain reaction assay to detect presence of type C1 toxin gene. We consistently detected C. botulinum type C cells in tilapia gastrointestinal contents at a level of 7.5 x 104 cells per 0.25 g material or 1.9 x 103 cells. This technique is useful for determining prevalence of the potentially active organisms within a given population of fish and may be adapted to other types of C. botulinum and vertebrate populations as well.

  14. The detection of Escherichia coli DNA in the ancient remains of Lindow Man using the polymerase chain reaction.

    PubMed

    Fricker, E J; Spigelman, M; Fricker, C R

    1997-05-01

    The polymerase chain reaction has been applied to the detection of Escherichia coli DNA in the upper gut contents of Lindow Man, an Iron Age bog body dated to ca 300 BC. With sets of primers from the uidA and lacZ genes, E. coli DNA could be detected reproducibly. Initial attempts at detecting DNA from freshly voided faeces from a healthy volunteer were unsuccessful due to inhibition of the reaction. Development of a method, based on guanidine thiocyanate and silica extraction and purification of the DNA fragments, facilitated the detection of the E. coli DNA in both freshly voided faeces and the upper gut contents of Lindow Man. These findings indicate that it may be possible to study the existence of infectious diseases in ancient civilizations and to learn more about the evolution of microbes.

  15. Detection of Clostridium botulinum type C cells in the gastrointestinal tracts of Mozambique tilapia (Oreochromis mossambicus) by polymerase chain reaction

    USGS Publications Warehouse

    Nol, P.; Williamson, J.L.; Rocke, T.E.; Yuill, Thomas M.

    2004-01-01

    We established a method of directly detecting Clostridium botulinum type C cells, while minimizing spore detection, in the intestinal contents of Mozambique tilapia (Oreochromis mossambicus). This technique involved extraction of predominantly cellular DNA from tilapia intestinal tracts and used a polymerase chain reaction assay to detect presence of type C1 toxin gene. We consistently detected C. botulinum type C cells in tilapia gastrointestinal contents at a level of 7.5×104 cells per 0.25 g material or 1.9×103 cells. This technique is useful for determining prevalence of the potentially active organisms within a given population of fish and may be adapted to other types of C. botulinum and vertebrate populations as well.

  16. [Rapid detection of influenza virus A (AH1, AH3) and B by nested-polymerase chain reaction].

    PubMed

    Shimizu, H; Watanabe, S; Imai, M

    1997-06-01

    We applied the Nested-polymerase chain reaction (PCR) for laboratory diagnosis of influenza virus infection. We used three primer sets for detection of influenza virus A (AH1, AH3) and B. The primer sets for each type (AH1, AH3, B) was able to detect specifically each type of influenza. We measured the sensitivity for detection of vaccine strains. The PCR method was able to detect 0.9 PFU/assey of AH1 type, 1.0 PFU/assey of AH3 type and 1.8 PFU/assey of B type. Out of 46 isolation negative but antibody positive cases, 38 cases were positive for PCR (82.6%). This method is sensitive and useful for rapid diagnosis of influenza virus infection.

  17. [Detection of mycobacterial DNA with polymerase chain reaction in eye discharge and gastric juices in a case of scleritis].

    PubMed

    Tanemoto, K; Ishikawa, H; Kigasawa, K; Obazawa, H; Fusegawa, H; Miyachi, H; Ando, Y

    1997-01-01

    We report a case of mycobacterial scleritis in which prompt diagnosis was made by the detection of mycobacterial DNA with polymerase chain reaction (PCR) in eye discharge and gastric juices, when conventional tests were negative. A 77-year-old woman who had a past history of pulmonary tuberculosis visited the outpatient clinic of Tokai University Hospital complaining of pain in her right eye. She was diagnosed as having scleritis and uveitis. There were no indications of active tuberculosis. We examined the gastric juices, sputum, and eye discharge by microscopy, culture, and PCR for detection of mycobacterium. The results of microscopy and culture were negative, but with PCR we detected atypical mycobacterium in eye discharge and gastric juices. After oral treatment with antituberculosis agents, the patient's eye symptoms disappeared. Detecting mycobacterial DNA with PCR could be useful for early diagnosis of mycobacterial scleritis, so that treatment with antituberculosis agents could be started.

  18. Rapid Molecular Detection of Zika Virus in Acute-Phase Urine Samples Using the Recombinase Polymerase Amplification Assay.

    PubMed

    Abd El Wahed, Ahmed; Sanabani, Sabri Saeed; Faye, Oumar; Pessôa, Rodrigo; Patriota, João Veras; Giorgi, Ricardo Rodrigues; Patel, Pranav; Böhlken-Fascher, Susanne; Landt, Olfert; Niedrig, Matthias; Zanotto, Paolo Marinho de Andrade; Czerny, Claus Peter; Sall, Amadou A; Weidmann, Manfred

    2017-01-25

    Currently the detection of Zika virus (ZIKV) in patient samples is done by real-time RT-PCR. Samples collected from rural area are sent to highly equipped laboratories for screening. A rapid point-of-care test is needed to detect the virus, especially at low resource settings. In this report, we describe the development of a reverse transcription isothermal recombinase polymerase amplification (RT-RPA) assay for the identification of ZIKV. RT-RPA assay was portable, sensitive (21 RNA molecules), and rapid (3-15 minutes). No cross-reactivity was detected to other flaviviruses, alphaviruses and arboviruses. Compared to real-time RT-PCR, the diagnostic sensitivity was 92%, while the specificity was 100%. The developed assay is a promising platform for rapid point of need detection of ZIKV in low resource settings and elsewhere (e.g. during mass gathering).

  19. Rapid Molecular Detection of Zika Virus in Acute-Phase Urine Samples Using the Recombinase Polymerase Amplification Assay

    PubMed Central

    Abd El Wahed, Ahmed; Sanabani, Sabri Saeed; Faye, Oumar; Pessôa, Rodrigo; Patriota, João Veras; Giorgi, Ricardo Rodrigues; Patel, Pranav; Böhlken-Fascher, Susanne; Landt, Olfert; Niedrig, Matthias; Zanotto, Paolo Marinho de Andrade; Czerny, Claus Peter; Sall, Amadou A.; Weidmann, Manfred

    2017-01-01

    Background: Currently the detection of Zika virus (ZIKV) in patient samples is done by real-time RT-PCR. Samples collected from rural area are sent to highly equipped laboratories for screening. A rapid point-of-care test is needed to detect the virus, especially at low resource settings. Methodology/Principal Findings: In this report, we describe the development of a reverse transcription isothermal recombinase polymerase amplification (RT-RPA) assay for the identification of ZIKV. RT-RPA assay was portable, sensitive (21 RNA molecules), and rapid (3-15 minutes). No cross-reactivity was detected to other flaviviruses, alphaviruses and arboviruses. Compared to real-time RT-PCR, the diagnostic sensitivity was 92%, while the specificity was 100%. Conclusions/Significance: The developed assay is a promising platform for rapid point of need detection of ZIKV in low resource settings and elsewhere (e.g. during mass gathering). PMID:28239513

  20. Detection of human cytomegalovirus in dental plaque from individual periodontal sites by real-time polymerase chain reaction.

    PubMed

    Combs, Darrin R; Reilly, Elizabeth A; Dawson, Dolphus R; Avdiushko, Sergei A; Danaher, Robert J; Miller, Craig S

    2008-12-01

    The aim was to evaluate three primer-probe sets and real-time polymerase chain reaction (PCR) for the detection of human cytomegalovirus (HCMV) in dental plaque from individual periodontal sites. Fifty subgingival plaque specimens from 13 healthy subjects (on average at least 2 healthy and 2 periodontal disease sites per subject) and 50 saliva specimens from 24 subjects, including 16 controls, were assessed using 3 primer-probe sets (polymerase [POL], glycoprotein B [gB], and US14) and real-time PCR. Kappa statistics were performed to measure agreement between the primer-probe sets. There was excellent agreement between the gB and POL primers in the detection of HCMV (kappa statistic = 0.85 [95% confidence interval 0.71-0.99]), yielding a prevalence of 4% (2 out of 50) at individual periodontal disease sites and a similar rate of 8.8% (3 out of 34) in saliva. Human cytomegalovirus was infrequently detected in dental plaque. Of 3 primer-probe sets evaluated, those targeting the POL and gB genes were more accurate in the detection of HCMV than that targeting US14.

  1. Development of reverse transcription recombinase polymerase amplification assay for avian influenza H5N1 HA gene detection.

    PubMed

    Yehia, Nahed; Arafa, Abdel-Satar; Abd El Wahed, Ahmed; El-Sanousi, Ahmed A; Weidmann, Manfred; Shalaby, Mohamed A

    2015-10-01

    The 2006 outbreaks of H5N1 avian influenza in Egypt interrupted poultry production and caused staggering economic damage. In addition, H5N1 avian influenza viruses represent a significant threat to public health. Therefore, the rapid detection of H5 viruses is very important in order to control the disease. In this study, a qualitative reverse transcription recombinase polymerase amplification (RT-RPA) assay for the detection of hemagglutinin gene of H5 subtype influenza viruses was developed. The results were compared to the real-time reverse transcription polymerase chain reaction (RT-PCR). An in vitro transcribed RNA standard of 970 nucleotides of the hemagglutinin gene was developed and used to determine the assay sensitivity. The developed H5 RT-RPA assay was able to detect one RNA molecule within 7 min, while in real-time RT-PCR, at least 90 min was required. H5 RT-RPA assay did not detect nucleic acid extracted from H5 negative samples or from other pathogens producing respiratory manifestation in poultry. The clinical performance of the H5 RT-RPA assay was tested in 30 samples collected between 2014 and 2015; the sensitivity of H5 RT-RPA and real-time RT-PCR was 100%. In conclusion, H5 RT-RPA was faster than real-time RT-PCR and easily operable in a portable device. Moreover, it had an equivalent sensitivity and specificity.

  2. Comparison of histopathology and real-time polymerase chain reaction (RT-PCR) for detection of Mycobacterium tuberculosis in fistula-in-ano.

    PubMed

    Garg, Pankaj

    2017-07-01

    Histopathology is commonly used to diagnose tuberculosis in fistula-in-ano. The aim was to compare the sensitivity of polymerase chain reaction and histopathology in detecting tuberculosis in fistula-in-ano. The histopathology and polymerase chain-reaction of tissue (fistula tract) was done in all the consecutive operated cases. When pus sample was also available, polymerase chain reaction-pus was also done RESULTS: Three hundred forty seven samples (179 patients) were tested over 2 years (median 6.5 months). The mean age was 38.8 ± 10.7 years, and male/female was 170/9. Histopathology and polymerase chain reaction of tissue (fistula tract) was done in 152 and 165 patients, respectively. Polymerase chain reaction (pus) could be done in 30 patients. Overall, tuberculosis was detected in 20/179 (11.2%) patients. Of these, tuberculosis was detected by histopathology (tissue) in 1/152 (0.7%) and by polymerase chain reaction (tissue) in 14/165 (8.5%) patients. In pus, polymerase chain reaction detected tuberculosis in 6/30 (20%) patients. Both polymerase chain reaction of tissue and pus were positive in one patient. Polymerase chain reaction (tissue) and polymerase chain reaction (pus) were significantly more sensitive than histopathology (tissue) for detecting tuberculosis [histopathology 1/152 vs. polymerase chain reaction (tissue) 14/165, p = 0.0009] [histopathology 1/152 vs. polymerase chain reaction (pus) 6/30, p < 0.0001]. In 20 patients detected to have tuberculosis, four drug anti-tubercular therapy was recommended for 6 months. The therapy was completed in 13 patients and 12/13 (92.3%) were cured. The therapy is continuing in 3/20 patients. Four patients did not take the therapy. None of them was cured. Polymerase chain reaction was significantly more sensitive than histopathology in detecting tuberculosis in fistula-in-ano. Histopathology might be missing out tuberculosis in many patients leading to recurrence of the fistula.

  3. Automatic polymerase chain reaction product detection system for food safety monitoring using zinc finger protein fused to luciferase.

    PubMed

    Yoshida, Wataru; Kezuka, Aki; Murakami, Yoshiyuki; Lee, Jinhee; Abe, Koichi; Motoki, Hiroaki; Matsuo, Takafumi; Shimura, Nobuaki; Noda, Mamoru; Igimi, Shizunobu; Ikebukuro, Kazunori

    2013-11-01

    An automatic polymerase chain reaction (PCR) product detection system for food safety monitoring using zinc finger (ZF) protein fused to luciferase was developed. ZF protein fused to luciferase specifically binds to target double stranded DNA sequence and has luciferase enzymatic activity. Therefore, PCR products that comprise ZF protein recognition sequence can be detected by measuring the luciferase activity of the fusion protein. We previously reported that PCR products from Legionella pneumophila and Escherichia coli (E. coli) O157 genomic DNA were detected by Zif268, a natural ZF protein, fused to luciferase. In this study, Zif268-luciferase was applied to detect the presence of Salmonella and coliforms. Moreover, an artificial zinc finger protein (B2) fused to luciferase was constructed for a Norovirus detection system. In the luciferase activity detection assay, several bound/free separation process is required. Therefore, an analyzer that automatically performed the bound/free separation process was developed to detect PCR products using the ZF-luciferase fusion protein. By means of the automatic analyzer with ZF-luciferase fusion protein, target pathogenic genomes were specifically detected in the presence of other pathogenic genomes. Moreover, we succeeded in the detection of 10 copies of E. coli BL21 without extraction of genomic DNA by the automatic analyzer and E. coli was detected with a logarithmic dependency in the range of 1.0×10 to 1.0×10(6) copies.

  4. A METHOD TO REMOVE ENVIRONMENTAL INHIBITORS PRIOR TO THE DETECTION OF WATERBORNE ENTERIC VIRUSES BY REVERSE TRANSCRIPTION-POLYMERASE CHAIN REACTION

    EPA Science Inventory

    A method was developed to remove environmental inhibitors from sample concentrates prior to detection of human enteric viruses using the reverse transcription-polymerase chain reaction (RT-PCR).Environmental inhibitors, concentrated along with viruses during water sample processi...

  5. A METHOD TO REMOVE ENVIRONMENTAL INHIBITORS PRIOR TO THE DETECTION OF WATERBORNE ENTERIC VIRUSES BY REVERSE TRANSCRIPTION-POLYMERASE CHAIN REACTION

    EPA Science Inventory

    A method was developed to remove environmental inhibitors from sample concentrates prior to detection of human enteric viruses using the reverse transcription-polymerase chain reaction (RT-PCR).Environmental inhibitors, concentrated along with viruses during water sample processi...

  6. Beta*, a UV-inducible smaller form of the beta subunit sliding clamp of DNA polymerase III of Escherichia coli. I. Gene expression and regulation.

    PubMed

    Paz-Elizur, T; Skaliter, R; Blumenstein, S; Livneh, Z

    1996-02-02

    The 40.6-kDa beta subunit of DNA polymerase III of Escherichia coli is a sliding DNA clamp responsible for tethering the polymerase to DNA and endowing it with high processivity (Stukenberg, P. T., Studwell-Vaughan, P. S., and O'Donnell, M. (1991) J. Biol. Chem. 266, 11328-11334). UV irradiation of E. coli induces a smaller 26-kDa form of the beta subunit, termed beta*, that, when overproduced from a plasmid, increases UV resistance of E. coli (Skaliter, R., Paz-Elizur, T., and Livneh, Z. (1996) J. Biol. Chem. 271, 2478-2481). Here we show that this protein is synthesized from a UV-inducible internal gene, termed dnaN*, that is located in-frame inside the coding region of dnaN, encoding the beta subunit. The initiation codon and the Shine-Dalgarno sequence of dnaN* were identified by site-directed mutagenesis. The dnaN* transcript was shown to be induced upon treatment with nalidixic acid, and transcriptional dnaN*-cat gene fusions were UV inducible, suggesting induction of dnaN* at the transcriptional level. Analysis of translational dnaN*-lacZ gene fusions revealed that UV induction was abolished in strains carrying the recA56, lexA3, or delta rpoH mutations, indicating involvement of both SOS and heat shock stress responses in the induction process. Expression of dnaN* represents a strategy of producing several proteins with related functional domains from a single gene.

  7. Real-Time Fluorescent Polymerase Chain Reaction Detection of Phytophthora ramorum and Phytophthora pseudosyringae Using Mitochondrial Gene Regions.

    PubMed

    Tooley, Paul W; Martin, Frank N; Carras, Marie M; Frederick, Reid D

    2006-04-01

    ABSTRACT A real-time fluorescent polymerase chain reaction (PCR) detection method for the sudden oak death pathogen Phytophthora ramorum was developed based on mitochondrial DNA sequence with an ABI Prism 7700 (TaqMan) Sequence Detection System. Primers and probes were also developed for detecting P. pseudosyringae, a newly described species that causes symptoms similar to P. ramorum on certain hosts. The species-specific primer-probe systems were combined in a multiplex assay with a plant primer-probe system to allow plant DNA present in extracted samples to serve as a positive control in each reaction. The lower limit of detection of P. ramorum DNA was 1 fg of genomic DNA, lower than for many other described PCR procedures for detecting Phytophthora species. The assay was also used in a three-way multiplex format to simultaneously detect P. ramorum, P. pseudosyringae, and plant DNA in a single tube. P. ramorum was detected down to a 10(-5) dilution of extracted tissue of artificially infected rhododendron 'Cunningham's White', and the amount of pathogen DNA present in the infected tissue was estimated using a standard curve. The multiplex assay was also used to detect P. ramorum in infected California field samples from several hosts determined to contain the pathogen by other methods. The real-time PCR assay we describe is highly sensitive and specific, and has several advantages over conventional PCR assays used for P. ramorum detection to confirm positive P. ramorum finds in nurseries and elsewhere.

  8. Detection of Norwalk virus in stool specimens by reverse transcriptase-polymerase chain reaction and nonradioactive oligoprobes.

    PubMed Central

    De Leon, R; Matsui, S M; Baric, R S; Herrmann, J E; Blacklow, N R; Greenberg, H B; Sobsey, M D

    1992-01-01

    A reverse transcriptase (RT)-polymerase chain reaction (PCR)-oligoprobe (OP), or RT-PCR-OP, method was developed for the detection of the Norwalk virus, which causes acute, epidemic gastroenteritis, in stool specimens. The Norwalk virus genome regions encoding the following two proteins were amplified by RT-PCR: the RNA polymerase (260-bp product) and a putative immunogenic protein (224-bp product). The resulting DNA fragments (amplicons) were hybridized to a digoxigenin-labeled internal OP specific to each amplicon. The detection limit of Norwalk virus, as determined by the endpoint of RT-PCR amplification for serially diluted, positive stool specimens, was similar to the actual virion titer as estimated by electron microscopy and at least 100-fold greater than the titer determined by radioimmunoassay (RIA). The RT-PCR-OP assay was specific for Norwalk virus and negative for other enteric viruses, including human and animal caliciviruses, hepatitis E virus, Snow Mountain agent, astroviruses, 16 human enteroviruses, and 5 human rotaviruses. Components of fecal specimens that interfere with RT-PCR were removed successfully by Sephadex G-200 gel chromatography. Of 20 stool specimens from human volunteers that were positive for Norwalk virus by RIA, a specific RT-PCR-OP result was obtained in 95% (19 of 20) of the samples by using the immunogenic protein primers and 75% (15 of 20) by using the polymerase primers. Twenty-six stool specimens from asymptomatic children and adults were negative by the Norwalk virus RT-PCR-OP. RT-PCR-OP detected Norwalk virus in the 4 of 21 coded fecal specimens that were also positive by enzyme immunoassay. Two samples that were positive by RIA or enzyme immunoassay were negative by RT-PCR, perhaps because viral RNA was not present or RT-PCR inhibitors were not adequately removed. Images PMID:1280649

  9. [Preparation and detection of anti-influenza A virus polymerase basic protein 1 polyclonal antibody].

    PubMed

    Qin, Yujie; Zhang, Tinghong; Ye, Xin

    2016-01-01

    Influenza A virus is an enveloped virus that belongs to the Orthomyxoviridae family. It has 8 negative RNA segments that encode 16 viral proteins. The viral polymerase consists of 3 proteins (PB 1, PB2 and PA) which plays an important role in the transcription and replication of the influenza A virus. Polymerase basic protein 1 (PB 1) is a critical member of viral polymerase complex. In order to further study the function of PB1, we need to prepare the PB1 antibody with good quality. Therefore, we amplified PB1 conserved region (nt1648-2265) by PCR and cloned it into pET-30a vector, and transformed into Escherichia coli BL2 1. The expression of His tagged PB 1 protein was induced by IPTG, and His-PB 1 proteins were purified by Ni-NTA resin. For preparation of PB 1 protein antiserum, rabbits were immunized with His-PB 1 fusion protein 3 times. Then the titer of PB 1 polyclonal antibody was measured by indirect ELISA. The antibody was purified by membrane affinity purification and subjected to immunoblotting analysis. Data showed that PB1 antibody can recognize PB 1 protein from WSN virus infected or pCMV FLAG-PB 1 transfected cells. Meanwhile, PB 1 antibody can also recognize specifically other subtype strains of influenza A virus such as H9N2 and H3N2. PB 1 polyclonal antibody we generated will be a useful tool to study the biological function of PB1.

  10. Polymerase chain reaction based detection of Mycobacterium tuberculosis complex in lupus vulgaris: a case report.

    PubMed

    Baylan, O; Arca, E; Ozcan, A; Kisa, O; Albay, A; Doganci, L

    2004-09-01

    Lupus vulgaris (LV), the commonest of all forms of cutaneous tuberculosis, can affect the earlobes. Authors present a 20-year-old male patient with LV of the left earlobe initially misdiagnosed as pyoderma and treated superfluously with antibiotics at different intervals over the last 4 years in another hospital. Mycobacteria could not be seen or isolated by stained smears or conventional or radiometric culture methods from the skin biopsy specimens. Suspected clinical diagnosis of our patient was LV. This was supported by positive polymerase chain reaction assay and histological findings. The lesion was treated successfully with anti-tuberculosis chemotherapy, further confirming the diagnosis of LV.

  11. Combining Real-Time Polymerase Chain Reaction Using SYBR Green I Detection and Sequencing to Identify Vertebrate Bloodmeals in Fleas

    PubMed Central

    GRAHAM, CHRISTINE B.; BLACK, WILLIAM C.; BOEGLER, KAREN A.; MONTENIERI, JOHN A.; HOLMES, JENNIFER L.; GAGE, KENNETH L.; EISEN, REBECCA J.

    2015-01-01

    Programs that aim to control vector-borne zoonotic diseases require information on zoonotic hosts and on the feeding behavior of bridging vectors that are capable of transmitting pathogens from those hosts to humans. Here we describe an assay developed to identify bloodmeals in field-collected cat fleas (Ctenocephalides felis Bouché) to assess this species’ potential role as a Yersinia pestis bridging vector in a plague-endemic region of Uganda. Our assay uses a single primer set and SYBR Green I-based real-time polymerase chain reaction to amplify a segment of the 12S mitochondrial ribosomal RNA gene for identification by sequencing. The assay capitalizes on the sensitivity of real-time polymerase chain reaction and the specificity of sequencing and can be used to differentiate vertebrate bloodmeals to the genus or species level without a priori knowledge of the host community. Because real-time assays that detect vertebrate DNA are highly sensitive to human DNA contamination, we analyzed detection in artificially fed and unfed fleas to establish a Ct cutoff that optimized specificity without completely sacrificing sensitivity. Using the established cutoff, our assay detected human, rat, and goat DNA in artificially fed C. felis up to 72 h postfeeding. PMID:23270174

  12. A new, multiplex, quantitative real-time polymerase chain reaction system for nucleic acid detection and quantification.

    PubMed

    Liang, Fang; Arora, Neetika; Zhang, Kang Liang; Yeh, David Che Cheng; Lai, Richard; Pearson, Darnley; Barnett, Graeme; Whiley, David; Sloots, Theo; Corrie, Simon R; Barnard, Ross T

    2013-01-01

    Quantitative real-time polymerase chain reaction (qPCR) has emerged as a powerful investigative and diagnostic tool with potential to generate accurate and reproducible results. qPCR can be designed to fulfil the four key aspects required for the detection of nucleic acids: simplicity, speed, sensitivity, and specificity. This chapter reports the development of a novel real-time multiplex quantitative PCR technology, dubbed PrimRglo™, with a potential for high-degree multiplexing. It combines the capacity to simultaneously detect many viruses, bacteria, or nucleic acids, in a single reaction tube, with the ability to quantitate viral or bacterial load. The system utilizes oligonucleotide-tagged PCR primers, along with complementary fluorophore-labelled and quencher-labelled oligonucleotides. The analytic sensitivity of PrimRglo technology was compared with the widely used Taqman(®) and SYBR green detection systems.

  13. Sensitive Detection of Polyalanine Expansions in PHOX2B by Polymerase Chain Reaction Using Bisulfite-Converted DNA

    PubMed Central

    Horiuchi, Hidekazu; Sasaki, Ayako; Osawa, Motoki; Kijima, Kazuki; Ino, Yukiko; Matoba, Ryoji; Hayasaka, Kiyoshi

    2005-01-01

    Congenital central hypoventilation syndrome, also known as Ondine’s curse, is characterized by idiopathic abnormal control of respiration during sleep. Recent studies indicate that a polyalanine expansion of PHOX2B is relevant to the pathogenesis of this disorder. However, it is difficult to detect the repeated tract because its high GC content inhibits conventional polymerase chain reaction (PCR) amplification. Here, we describe a bisulfite treatment for DNA in which uracil is obtained by deamination of unmethylated cytosine residues. Deamination of DNA permitted direct PCR amplification that yielded a product of 123 bp for the common 20-residue repetitive tract with replacement of C with T by sequencing. It settled allele dropouts accompanied by insufficient amplification of expanded alleles. The defined procedure dramatically improved detection of expansions to 9 of 10 congenital central hypoventilation syndrome patients examined in a previous study. The chemical conversion of DNA before PCR amplification facilitates effective detection of GC-rich polyalanine tracts. PMID:16258163

  14. Multiplex polymerase chain reaction assay for the detection of minute virus of mice and mouse parvovirus infections in laboratory mice.

    PubMed

    Wang, K W; Chueh, L L; Wang, M H; Huang, Y T; Fang, B H; Chang, C Y; Fang, M C; Chou, J Y; Hsieh, S C; Wan, C H

    2013-04-01

    Mouse parvoviruses are among the most prevalent infectious pathogens in contemporary mouse colonies. To improve the efficiency of routine screening for mouse parvovirus infections, a multiplex polymerase chain reaction (PCR) assay targeting the VP gene was developed. The assay detected minute virus of mice (MVM), mouse parvovirus (MPV) and a mouse housekeeping gene (α-actin) and was able to specifically detect MVM and MPV at levels as low as 50 copies. Co-infection with the two viruses with up to 200-fold differences in viral concentrations can easily be detected. The multiplex PCR assay developed here could be a useful tool for monitoring mouse health and the viral contamination of biological materials.

  15. Label-free electrical detection of pyrophosphate generated from DNA polymerase reactions on field-effect devices†

    PubMed Central

    Su, Xing; Wu, Kai; Elibol, Oguz H.; Liu, David J.; Reddy, Bobby; Tsai, Ta-Wei; Dorvel, Brian R.; Daniels, Jonathan S.

    2012-01-01

    We introduce a label-free approach for sensing polymerase reactions on deoxyribonucleic acid (DNA) using a chelator-modified silicon-on-insulator field-effect transistor (SOI-FET) that exhibits selective and reversible electrical response to pyrophosphate anions. The chemical modification of the sensor surface was designed to include rolling-circle amplification (RCA) DNA colonies for locally enhanced pyrophosphate (PPi) signal generation and sensors with immobilized chelators for capture and surface-sensitive detection of diffusible reaction by-products. While detecting arrays of enzymatic base incorporation reactions is typically accomplished using optical fluorescence or chemiluminescence techniques, our results suggest that it is possible to develop scalable and portable PPi-specific sensors and platforms for broad biomedical applications such as DNA sequencing and microbe detection using surface-sensitive electrical readout techniques. PMID:22262038

  16. Rapid detection of infectious hypodermal and hematopoietic necrosis virus (IHHNV) by real-time, isothermal recombinase polymerase amplification assay.

    PubMed

    Xia, Xiaoming; Yu, Yongxin; Hu, Linghao; Weidmann, Manfred; Pan, Yingjie; Yan, Shuling; Wang, Yongjie

    2015-04-01

    Infectious hypodermal and hematopoietic necrosis virus (IHHNV) causes mortality or runt deformity syndrome in penaeid shrimps and is responsible for significant economic losses in the shrimp aquaculture industry. Here, we describe a novel real-time isothermal recombinase polymerase amplification (RPA) assay developed for IHHNV detection. Using IHHNV plasmid standards and DNA samples from a variety of organisms, we evaluated the ability of the IHHNV-RPA assay to detect IHHNV based on analysis of its sensitivity, specificity, rapidity, and reproducibility. Probit analysis of eight independent experimental replicates indicated satisfactory performance of the RPA assay, which is sufficiently sensitive to detect as few as 4 copies of the IHHNV genome within 7 min at 39 °C with 95 % reliability. Therefore, this rapid RPA method has great potential for applications, either in field use or as a point of care diagnostic technique.

  17. Real-Time Polymerase Chain Reaction Detection of Angiostrongylus cantonensis DNA in Cerebrospinal Fluid from Patients with Eosinophilic Meningitis.

    PubMed

    Qvarnstrom, Yvonne; Xayavong, Maniphet; da Silva, Ana Cristina Aramburu; Park, Sarah Y; Whelen, A Christian; Calimlim, Precilia S; Sciulli, Rebecca H; Honda, Stacey A A; Higa, Karen; Kitsutani, Paul; Chea, Nora; Heng, Seng; Johnson, Stuart; Graeff-Teixeira, Carlos; Fox, LeAnne M; da Silva, Alexandre J

    2016-01-01

    Angiostrongylus cantonensis is the most common infectious cause of eosinophilic meningitis. Timely diagnosis of these infections is difficult, partly because reliable laboratory diagnostic methods are unavailable. The aim of this study was to evaluate the usefulness of a real-time polymerase chain reaction (PCR) assay for the detection of A. cantonensis DNA in human cerebrospinal fluid (CSF) specimens. A total of 49 CSF specimens from 33 patients with eosinophilic meningitis were included: A. cantonensis DNA was detected in 32 CSF specimens, from 22 patients. Four patients had intermittently positive and negative real-time PCR results on subsequent samples, indicating that the level of A. cantonensis DNA present in CSF may fluctuate during the course of the illness. Immunodiagnosis and/or supplemental PCR testing supported the real-time PCR findings for 30 patients. On the basis of these observations, this real-time PCR assay can be useful to detect A. cantonensis in the CSF from patients with eosinophilic meningitis.

  18. Rapid method utilizing the polymerase chain reaction for detection of canine parvovirus in feces of diarrheic dogs.

    PubMed

    Uwatoko, K; Sunairi, M; Nakajima, M; Yamaura, K

    1995-03-01

    By using primers based on the sequence of the VP2 gene of canine parovirus (CPV), we established a rapid and specific assay for identification of the virus from fecal specimens based on the polymerase chain reaction (PCR). By use of a pair of primers, a specific 226-bp sequence was amplified by the PCR. All strains of CPV tested gave a specific amplification product by the PCR, while neither porcine parovirus nor host cell did so. The PCR assay can detect fewer particles of CPV than the conventional methods, being able to detect CPV from fecal specimens in a rapid manner, provided that gel filtration of the samples through a spun column was done to remove inhibitory substances from the fecal specimens. These results suggest that the PCR assay can detect the presence of CPV in dogs early enough to prevent secondary infection by CPV in veterinary hospitals.

  19. Detection of loss of heterozygosity in formalin-fixed paraffin-embedded tumor specimens by the polymerase chain reaction.

    PubMed Central

    Bianchi, A. B.; Navone, N. M.; Conti, C. J.

    1991-01-01

    A polymerase chain reaction-based procedure was used for the detection of DNA length polymorphisms generated by naturally occurring genetic deletions or insertions of known sequence. This method consists of a simple one-step assay that does not require any restriction enzyme analysis or Southern blot hybridization, allowing identification in ethidium bromide-stained gels. The procedure described here was used to detect loss of heterozygosity at various loci, including the Hbb beta-globin gene cluster, in chemically induced mouse skin tumors, using a variety of tissue preparations, including microdissection of formalin-fixed, paraffin-embedded specimens, short-term cultures, and fluorescence-activated cell sorting of epithelial populations. This approach may be useful in detecting tumor-specific reduction to homozygosity at polymorphic chromosomal loci, allowing the mapping of putative tumor-suppressor loci involved in carcinogenesis. Images Figure 2 Figure 3 Figure 4 Figure 5 PMID:1992758

  20. Label-free electrical detection of pyrophosphate generated from DNA polymerase reactions on field-effect devices.

    PubMed

    Credo, Grace M; Su, Xing; Wu, Kai; Elibol, Oguz H; Liu, David J; Reddy, Bobby; Tsai, Ta-Wei; Dorvel, Brian R; Daniels, Jonathan S; Bashir, Rashid; Varma, Madoo

    2012-03-21

    We introduce a label-free approach for sensing polymerase reactions on deoxyribonucleic acid (DNA) using a chelator-modified silicon-on-insulator field-effect transistor (SOI-FET) that exhibits selective and reversible electrical response to pyrophosphate anions. The chemical modification of the sensor surface was designed to include rolling-circle amplification (RCA) DNA colonies for locally enhanced pyrophosphate (PPi) signal generation and sensors with immobilized chelators for capture and surface-sensitive detection of diffusible reaction by-products. While detecting arrays of enzymatic base incorporation reactions is typically accomplished using optical fluorescence or chemiluminescence techniques, our results suggest that it is possible to develop scalable and portable PPi-specific sensors and platforms for broad biomedical applications such as DNA sequencing and microbe detection using surface-sensitive electrical readout techniques.

  1. Detection of cashew nut DNA in spiked baked goods using a real-time polymerase chain reaction method.

    PubMed

    Brzezinski, Jennifer L

    2006-01-01

    The detection of potentially allergenic foods, such as tree nuts, in food products is a major concern for the food processing industry. A real-time polymerase chain reaction (PCR) method was designed to determine the presence of cashew DNA in food products. The PCR amplifies a 67 bp fragment of the cashew 2S albumin gene, which is detected with a cashew-specific, dual-labeled TaqMan probe. This reaction will not amplify DNA derived from other tree nut species, such as almond, Brazil nut, hazelnut, and walnut, as well as 4 varieties of peanut. This assay was sensitive enough to detect 5 pg purified cashew DNA as well as cashew DNA in a spiked chocolate cookie sample containing 0.01% (100 mg/kg) cashew.

  2. TATA box-binding protein (TBP) is a constituent of the polymerase I-specific transcription initiation factor TIF-IB (SL1) bound to the rRNA promoter and shows differential sensitivity to TBP-directed reagents in polymerase I, II, and III transcription factors.

    PubMed Central

    Radebaugh, C A; Matthews, J L; Geiss, G K; Liu, F; Wong, J M; Bateman, E; Camier, S; Sentenac, A; Paule, M R

    1994-01-01

    The role of the Acanthamoeba castellanii TATA-binding protein (TBP) in transcription was examined. Specific antibodies against the nonconserved N-terminal domain of TBP were used to verify the presence of TBP in the fundamental transcription initiation factor for RNA polymerase I, TIF-IB, and to demonstrate that TBP is part of the committed initiation complex on the rRNA promoter. The same antibodies inhibit transcription in all three polymerase systems, but they do so differentially. Oligonucleotide competitors were used to evaluate the accessibility of the TATA-binding site in TIF-IB, TFIID, and TFIIIB. The results suggest that insertion of TBP into the polymerase II and III factors is more similar than insertion into the polymerase I factor. Images PMID:8264628

  3. TATA box-binding protein (TBP) is a constituent of the polymerase I-specific transcription initiation factor TIF-IB (SL1) bound to the rRNA promoter and shows differential sensitivity to TBP-directed reagents in polymerase I, II, and III transcription factors.

    PubMed

    Radebaugh, C A; Matthews, J L; Geiss, G K; Liu, F; Wong, J M; Bateman, E; Camier, S; Sentenac, A; Paule, M R

    1994-01-01

    The role of the Acanthamoeba castellanii TATA-binding protein (TBP) in transcription was examined. Specific antibodies against the nonconserved N-terminal domain of TBP were used to verify the presence of TBP in the fundamental transcription initiation factor for RNA polymerase I, TIF-IB, and to demonstrate that TBP is part of the committed initiation complex on the rRNA promoter. The same antibodies inhibit transcription in all three polymerase systems, but they do so differentially. Oligonucleotide competitors were used to evaluate the accessibility of the TATA-binding site in TIF-IB, TFIID, and TFIIIB. The results suggest that insertion of TBP into the polymerase II and III factors is more similar than insertion into the polymerase I factor.

  4. Rapid and sensitive electrochemiluminescence detection of rotavirus by magnetic primer based reverse transcription-polymerase chain reaction.

    PubMed

    Zhan, Fangfang; Zhou, Xiaoming; Xing, Da

    2013-01-25

    A novel method for detection of rotavirus has been developed by integrating magnetic primer based reverse transcription-polymerase chain reaction (RT-PCR) with electrochemiluminescence (ECL) detection. This is realized by accomplishing RT of rotavirus RNA in traditional way and performing PCR of the resulting cDNA fragment on the surface of magnetic particles (MPs). In order to implement PCR on MPs and achieve rapid ECL detection, forward and reverse primers are bounded to MPs and tris-(2,2'-bipyridyl) ruthenium (TBR), respectively. After RT-PCR amplification, the TBR labels are directly enriched onto the surface of MPs. Then the MPs-TBR complexes can be loaded on the electrode surface and analyzed by magnetic ECL platform without any post-modification or post-incubation process. So some laborious manual operations can be avoided to achieve rapid yet sensitive detection. In this study, rotavirus in fecal specimens was successfully detected within 1.5 h. Experimental results showed that the detection limit of the assay was 0.2 pg μL(-1) of rotavirus. The ECL intensity was linearly with the concentration from 0.2 pg μL(-1) to 400 pg μL(-1). What's more, the specificity of this method was confirmed by detecting other fecal specimens of patients with nonrotavirus-associated gastroenteritis. We anticipate that the proposed magnetic primer based RT-PCR with ECL detection strategy will find numerous applications in food safety field and clinical diagnosis.

  5. Silicon inhibition effects on the polymerase chain reaction: a real-time detection approach.

    PubMed

    Wang, Wei; Wang, Hai-Bin; Li, Zhi-Xin; Guo, Zeng-Yuan

    2006-04-01

    In the miniaturization of biochemical analysis systems, biocompatibility of the microfabricated material is a key feature to be considered. A clear insight into interactions between biological reagents and microchip materials will help to build more robust functional bio-microelectromechanical systems (BioMEMS). In the present work, a real-time polymerase chain reaction (PCR) assay was used to study the inhibition effects of silicon and native silicon oxide particles on Hepatitis B Virus (HBV) DNA PCR amplification. Silicon nanoparticles with different surface oxides were added into the PCR mixture to activate possible interactions between the silicon-related materials and the PCR reagents. Ratios of silicon nanoparticle surface area to PCR mixture volume (surface to volume ratio) varied from 4.7 to 235.5 mm2/microL. Using high speed centrifugation, the nanoparticles were pelleted to tube inner surfaces. Supernatant extracts were then used in subsequent PCR experiments. To test whether silicon materials participated in amplifications directly, in some cases, entire PCR mixture containing silicon nanoparticles were used in amplification. Fluorescence histories of PCR amplifications indicated that with the increase in surface to volume ratio, amplification efficiency decreased considerably, and within the studied ranges, the higher the particle surface oxidation, the stronger the silicon inhibition effects on PCR. Adsorption of Taq polymerase (not nucleic acid) on the silicon-related material surface was the primary cause of the inhibition phenomena and silicon did not participate in the amplification process directly. (c) 2005 Wiley Periodicals, Inc.

  6. N-butylamine functionalized graphene oxide for detection of iron(III) by photoluminescence quenching.

    PubMed

    Gholami, Javad; Manteghian, Mehrdad; Badiei, Alireza; Ueda, Hiroshi; Javanbakht, Mehran

    2016-02-01

    An N-butylamine functionalized graphene oxide nanolayer was synthesized and characterized by ultraviolet (UV)-visible spectrometry, Fourier transform infrared spectroscopy, X-ray photoelectron spectroscopy, and transmission electron microscopy. Detection of iron(III) based on photoluminescence spectroscopy was investigated. The N-butylamine functionalized graphene oxide was shown to specifically interact with iron (III), compared with other cationic trace elements including potassium (I), sodium (I), calcium (II), chromium (III), zinc (II), cobalt (II), copper (II), magnesium (II), manganese (II), and molybdenum (VI). The quenching effect of iron (III) on the luminescence emission of N-butylamine functionalized graphene oxide layer was used to detect iron (III). The limit of detection (2.8 × 10(-6)  M) and limit of quantitation (2.9 × 10(-5)  M) were obtained under optimal conditions. Copyright © 2015 John Wiley & Sons, Ltd.

  7. Evaluation of reverse transcriptase polymerase chain reaction for the detection of eastern equine encephalomyelitis virus during vector surveillance.

    PubMed

    Monroy, A M; Scott, T W; Webb, B A

    1996-05-01

    A reverse transcriptase polymerase chain reaction (RT-PCR) assay was evaluated for the detection of eastern equine encephalomyelitis virus (EEEV). EEEV was detected by amplification of a 416-bp PCR product from within the E2 gene. Internal restriction endonuclease digestion and hybridizations to EEEV RNA demonstrated that the PCR product was amplified from EEEV. PCR amplifications from serial dilutions of an EEEV isolate identified by a neutralization test and titered by an infectious assay in cell culture indicated that this RT-PCR assay detected viral RNA at concentrations below 1 plaque forming unit(PFU) per reaction. The performance of the PCR assay in detection of EEEV was compared with an infectious assay detection procedure (IA/IFA) as part of the New Jersey 1993 vector surveillance program. During 1993, 7,007 field-collected Culiseta melanura (Coquillett) were assayed in 522 pools by both RT-PCR and IA/IFA. EEEV was detected in 95 pools by RT-PCR and 17 pools by IA/IFA; all IA/IFA positive pools were also positive by RT-PCR. During the 1993 field season, RT-PCR consistently detected virus at enzootic foci earlier that IA/IFA and in greater numbers of mosquito pools. The data indicated that viral RNA may be present earlier and in more mosquitoes than indicated by IA/IFA.

  8. Electrochemical biosensor for microRNA detection based on poly(U) polymerase mediated isothermal signal amplification.

    PubMed

    Zhou, Yunlei; Yin, Huanshun; Li, Jie; Li, Bingchen; Li, Xue; Ai, Shiyun; Zhang, Xiansheng

    2016-05-15

    MicroRNAs play crucial role in post-transcriptional regulation for gene expression in animals, plants, and viruses. For the better understanding of microRNA and its functions, it is very important to develop effectively analytical method for microRNA detection. Herein, a novel electrochemical biosensor was fabricated for sensitive and selective detection of microRNA based on poly(U) polymerase mediated isothermal signal amplification, where poly(U) polymerase can catalyze the template independent addition of UMP from UTP to the 3' end of RNA. Using this activity, the target microRNA can be successfully labeled with biotin conjugated UMPs at its 3'-end using biotin conjugated UTP (biotin-UTP) as donor. Then, the avidin conjugated alkaline phosphatase can be further captured to the 3'-end of the target microRNA based on the specific interaction between biotin and avidin. Finally, under the catalytic activity of alkaline phosphatase, the substrate of p-nitrophenyl phosphate disodium salt hexahydrate can be hydrolyzed to produce 4-nitrophenol. According to the relationship between the electrochemical signal of p-nitrophenol and the concentration of microRNA-319a, the content of microRNA-319a can be detected. This signal amplification method is simple and sensitive. The developed method can detect as low as 1.7 fM microRNA and produce precise and accurate linear dynamic range from 10 to 1000 fM. The fabricated biosensor was further applied to detect the expression level change of microRNA-319a in rice seedlings after incubation with five kinds of different phytohormones.

  9. Cardiopulmonary Disease Development in Anti-RNA Polymerase III-positive Systemic Sclerosis: Comparative Analyses from an Unselected, Prospective Patient Cohort.

    PubMed

    Hoffmann-Vold, Anna-Maria; Midtvedt, Øyvind; Tennøe, Anders H; Garen, Torhild; Lund, May Brit; Aaløkken, Trond M; Andreassen, Arne K; Elhage, Fadi; Brunborg, Cathrine; Taraldsrud, Eli; Molberg, Øyvind

    2017-04-01

    Extensive skin disease and renal crisis are hallmarks of anti-RNA polymerase III (RNAP)-positive systemic sclerosis (SSc), while lung and heart involvement data are conflicting. Here, the aims were to perform time-course analyses of interstitial lung disease (ILD) and pulmonary hypertension (PH) in the RNAP subset of a prospective unselected SSc cohort and to use the other autoantibody subsets as comparators. The study cohort included 279 patients with SSc from the observational Oslo University Hospital cohort with complete data on (1) SSc-related autoantibodies, (2) paired, serial analyses of lung function and fibrosis by computed tomography, and (3) PH verified by right heart catheterization. RNAP was positive in 33 patients (12%), 79% of which had diffuse cutaneous SSc. Pulmonary findings were heterogeneous; 49% had no signs of fibrosis while 18% had > 20% fibrosis at followup. Forced vital capacity at followup was < 80% in 39% of the RNAP subset, comparable to the antitopoisomerase subset (ATA; 47%), but higher than anticentromere (ACA; 13%). Accumulated frequency of PH in the RNAP subset (12%) was lower than in ACA (18%). At 93% and 78%, the 5- and 10-year survival rates in RNAP were comparable to the ATA and ACA subsets. In this cohort, the RNAP subset was marked by cardiopulmonary heterogeneity, ranging from mild ILD to development of severe ILD in 18%, and PH development in 12%. These data indicate that cardiopulmonary risk stratification early in the disease course is particularly important in RNAP-positive SSc.

  10. Structural Basis for Recognition and Sequestration of UUUOH 3 ' Temini of Nascent RNA Polymerase III Transcripts by La, a Rheumatic Disease Autoantigen

    SciTech Connect

    Teplova,M.; Yuan, Y.; Phan, A.; Malinina, L.; Ilin, S.; Teplov, A.; Patel, D.

    2006-01-01

    The nuclear phosphoprotein La was identified as an autoantigen in patients with systemic lupus erythematosus and Sjogren's syndrome. La binds to and protects the UUUOH 3' terminii of nascent RNA polymerase III transcripts from exonuclease digestion. We report the 1.85 Angstroms crystal structure of the N-terminal domain of human La, consisting of La and RRM1 motifs, bound to r(U1-G2-C3-U4-G5-U6-U7-U8-U9OH). The U7-U8-U9OH 3' end, in a splayed-apart orientation, is sequestered within a basic and aromatic amino acid-lined cleft between the La and RRM1 motifs. The specificity-determining U8 residue bridges both motifs, in part through unprecedented targeting of the {beta} sheet edge, rather than the anticipated face, of the RRM1 motif. Our structural observations, supported by mutation studies of both La and RNA components, illustrate the principles behind RNA sequestration by a rheumatic disease autoantigen, whereby the UUUOH 3' ends of nascent RNA transcripts are protected during downstream processing and maturation events.

  11. Structural basis for recognition and sequestration of UUU(OH) 3' temini of nascent RNA polymerase III transcripts by La, a rheumatic disease autoantigen.

    PubMed

    Teplova, Marianna; Yuan, Yu-Ren; Phan, Anh Tuân; Malinina, Lucy; Ilin, Serge; Teplov, Alexei; Patel, Dinshaw J

    2006-01-06

    The nuclear phosphoprotein La was identified as an autoantigen in patients with systemic lupus erythematosus and Sjogren's syndrome. La binds to and protects the UUU(OH) 3' terminii of nascent RNA polymerase III transcripts from exonuclease digestion. We report the 1.85 angstroms crystal structure of the N-terminal domain of human La, consisting of La and RRM1 motifs, bound to r(U1-G2-C3-U4-G5-U6-U7-U8-U9OH). The U7-U8-U9OH 3' end, in a splayed-apart orientation, is sequestered within a basic and aromatic amino acid-lined cleft between the La and RRM1 motifs. The specificity-determining U8 residue bridges both motifs, in part through unprecedented targeting of the beta sheet edge, rather than the anticipated face, of the RRM1 motif. Our structural observations, supported by mutation studies of both La and RNA components, illustrate the principles behind RNA sequestration by a rheumatic disease autoantigen, whereby the UUU(OH) 3' ends of nascent RNA transcripts are protected during downstream processing and maturation events.

  12. Segmented continuous-flow multiplex polymerase chain reaction microfluidics for high-throughput and rapid foodborne pathogen detection.

    PubMed

    Shu, Bowen; Zhang, Chunsun; Xing, Da

    2014-05-15

    High-throughput and rapid identification of multiple foodborne bacterial pathogens is vital in global public health and food industry. To fulfill this need, we propose a segmented continuous-flow multiplex polymerase chain reaction (SCF-MPCR) on a spiral-channel microfluidic device. The device consists of a disposable polytetrafluoroethylene (PTFE) capillary microchannel coiled on three isothermal blocks. Within the channel, n segmented flow regimes are sequentially generated, and m-plex PCR is individually performed in each regime when each mixture is driven to pass three temperature zones, thus providing a rapid analysis throughput of m×n. To characterize the performance of the microfluidic device, continuous-flow multiplex PCR in a single segmented flow has been evaluated by investigating the effect of key reaction parameters, including annealing temperatures, flow rates, polymerase concentration and amount of input DNA. With the optimized parameters, the genomic DNAs from Salmonella enterica, Listeria monocytogenes, Escherichia coli O157:H7 and Staphylococcus aureus could be amplified simultaneously in 19min, and the limit of detection was low, down to 10(2) copiesμL(-1). As proof of principle, the spiral-channel SCF-MPCR was applied to sequentially amplify four different bacterial pathogens from banana, milk, and sausage, displaying a throughput of 4×3 with no detectable cross-contamination.

  13. Polymerase Chain Reaction (PCR) Versus Bacterial Culture in Detection of Organisms in Otitis Media with Effusion (OME) in Children.

    PubMed

    Aly, Balegh H; Hamad, Mostafa S; Mohey, Mervat; Amen, Sameh

    2012-03-01

    The aim of this study was to compare between polymerase chain reaction (PCR) and bacterial culture in detection of Streptococcus Pneumonia and M. Catarrhalis in otitis media with effusion (OME) in children. Fifty patients having OME were included in this study between 2003 and 2008. Myringotomy and tympanostomy tube insertion were done in every patient and the middle ear effusion samples were aspirated. The samples were subjected to bacteriological study in the form of culture and molecular study in the form of PCR using JM201/202-204 primer probe set for both S. pneumonia and M. catarrhalis. The results of Bacterial cultures are as follows: five cases (10%) were culture positive for S. pneumonia. Six cases (12%) were culture positive for M. catarrhalis. Only one case (2%) showed positively for both S. pneumonia and M. catarrhalis. Polymerase chain reaction test shows that 18 cases (36%) were positive for S. pneumonia, 22 cases (44%) were positive for M. catarrhalis, 6 cases (12%) were positive for both organism and 4 cases (8%) were negative. The difference between the proportion of culture positive and PCR positive specimens for both organisms individually and collectively was significant (P < 0.001). From our study we can conclude that PCR is more accurate than bacterial culture in detection of organisms in middle ear fluid in OME and that M. catarrhalis plays a significant rule in OME as it is the sole organism identified more than the other one by PCR.

  14. Development of a polymerase chain reaction applicable to rapid and sensitive detection of Clonorchis sinensis eggs in human stool samples

    PubMed Central

    Cho, Pyo Yun; Na, Byoung-Kuk; Mi Choi, Kyung; Kim, Jin Su; Cho, Shin-Hyeong; Lee, Won-Ja; Lim, Sung-Bin; Cha, Seok Ho; Park, Yun-Kyu; Pak, Jhang Ho; Lee, Hyeong-Woo; Hong, Sung-Jong; Kim, Tong-Soo

    2013-01-01

    Microscopic examination of eggs of parasitic helminths in stool samples has been the most widely used classical diagnostic method for infections, but tiny and low numbers of eggs in stool samples often hamper diagnosis of helminthic infections with classical microscopic examination. Moreover, it is also difficult to differentiate parasite eggs by the classical method, if they have similar morphological characteristics. In this study, we developed a rapid and sensitive polymerase chain reaction (PCR)-based molecular diagnostic method for detection of Clonorchis sinensis eggs in stool samples. Nine primers were designed based on the long-terminal repeat (LTR) of C. sinensis retrotransposon1 (CsRn1) gene, and seven PCR primer sets were paired. Polymerase chain reaction with each primer pair produced specific amplicons for C. sinensis, but not for other trematodes including Metagonimus yokogawai and Paragonimus westermani. Particularly, three primer sets were able to detect 10 C. sinensis eggs and were applicable to amplify specific amplicons from DNA samples purified from stool of C. sinensis-infected patients. This PCR method could be useful for diagnosis of C. sinensis infections in human stool samples with a high level of specificity and sensitivity. PMID:23916334

  15. Detection of flaviviruses by reverse transcriptase-polymerase chain reaction with the universal primer set.

    PubMed

    Meiyu, F; Huosheng, C; Cuihua, C; Xiaodong, T; Lianhua, J; Yifei, P; Weijun, C; Huiyu, G

    1997-01-01

    Using a universal primer set designed to match the sequence of the NS1 gene of flaviviruses, the virus RNA of dengue (DEN), Japanese encephalitis (JEV), powassan and langat of Flaviviridae were successfully amplified by polymerase chain reaction (PCR) via cDNA; and with different internal primers, the serotypes of the dengue viruses were identified. Of the 78 clinically diagnosed dengue fever patients, 18 patients were positive for DEN 1, 48 patients for DEN 2 and 8 patients concurrently infected with DEN 4. Of the 52 patients admitted with Japanese encephalitis (JE), 45 were determined to be JEV infections. By nested PCR, we completed the identification of flaviviruses within 2 days. The results show that seven primers have a potential value for rapid clinical diagnosis of flavivirus infections.

  16. Construction of an electrode modified with gallium(III) for voltammetric detection of ovalbumin.

    PubMed

    Sugawara, Kazuharu; Okusawa, Makoto; Takano, Yusaku; Kadoya, Toshihiko

    2014-01-01

    Electrodes modified with gallium(III) complexes were constructed to detect ovalbumin (OVA). For immobilization of a gallium(III)-nitrilotriacetate (NTA) complex, the electrode was first covered with collagen film. After the amino groups of the film had reacted with isothiocyanobenzyl-NTA, the gallium(III) was then able to combine with the NTA moieties. Another design featured an electrode cast with a gallium(III)-acetylacetonate (AA) complex. The amount of gallium(III) in the NTA complex was equivalent to one-quarter of the gallium(III) that could be utilized from an AA complex. However, the calibration curves of OVA using gallium(III)-NTA and gallium(III)-AA complexes were linear in the ranges of 7.0 × 10(-11) - 3.0 × 10(-9) M and 5.0 × 10(-10) - 8.0 × 10(-9) M, respectively. The gallium(III) on the electrode with NTA complex had high flexibility due to the existence of a spacer between the NTA and the collagen film, and, therefore, the reactivity of the gallium(III) to OVA was superior to that of the gallium(III)-AA complex with no spacer.

  17. Real-time reverse-transcriptase polymerase chain reaction for the rapid detection of Salmonella using invA primers.

    PubMed

    D'Souza, Doris H; Critzer, Faith J; Golden, David A

    2009-11-01

    Recent outbreaks of Salmonella linked to fresh produce emphasize the need for rapid detection methods to help control the spread of disease. Reverse-transcriptase polymerase chain reaction (RT-PCR) can detect the presence of mRNA (shorter half-life than DNA) with greater potential for detecting viable pathogens. The chromosomally located invA gene required for host invasion by Salmonella is widely used for detection of this pathogen by PCR. Detection of Salmonella was undertaken by real-time RT-PCR (rt-RT-PCR) using newly designed invA gene primers to develop a sensitive and specific assay. Salmonella serovars Typhimurium and Enteritidis were grown (7.68 log(10) CFU/mL) in Luria-Bertani broth overnight at 37 degrees C, and RNA was extracted, followed by rt-RT-PCR with and without SYBR green I and agarose gel electrophoresis. All experiments were replicated at least thrice. Detection for both serovars using traditional RT-PCR was lower ( approximately 10(5) CFU/mL) than rt-RT-PCR (10(3) CFU/mL) by gel electrophoresis. Melt curve analysis showed melt temperatures at 87.5 degrees C with Ct values from 12 to 15 for up to 10(3) CFU/mL and improved to 10(2) CFU/mL after further optimization. Further, addition of RNA internal amplification control constructed using in vitro transcription with a T7 RNA polymerase promoter, to the RT-PCR assay also gave detection limits of 10(2) CFU/mL. Cross-reactivity was not observed against a panel of 21 non-Salmonella bacteria. Heat-inactivated (autoclaved) Salmonella showed faint or no detection by rt-RT-PCR or gel electrophoresis. This method has potential to be applied for the detection of Salmonella serovars in fresh produce and the simultaneous detection of foodborne viral (RNA viruses) and bacterial pathogens in a multiplex format.

  18. A rapid assay for detection of Rose rosette virus using reverse transcription-recombinase polymerase amplification using multiple gene targets.

    PubMed

    Babu, Binoy; Washburn, Brian K; Miller, Steven H; Poduch, Kristina; Sarigul, Tulin; Knox, Gary W; Ochoa-Corona, Francisco M; Paret, Mathews L

    2017-02-01

    Rose rosette disease caused by Rose rosette virus (RRV; genus Emaravirus) is the most economically relevant disease of Knock Out(®) series roses in the U.S. As there are no effective chemical control options for the disease, the most critical disease management strategies include the use of virus free clean plants for propagation and early detection and destruction of infected plants. The current diagnostic techniques for RRV including end-point reverse transcription-polymerase chain reaction (RT-PCR) and real-time PCR (RT-qPCR) are highly sensitive, but limited to diagnostic labs with the equipment and expertise; and is time consuming. To address this limitation, an isothermal reverse transcription-recombinase polymerase amplification (RT-RPA) assay based on multiple gene targets for specific detection of RRV was developed. The assay is highly specific and did not cross react with other viruses belonging to the inclusive and exclusive genus. Dilution assays using the in vitro transcripts showed that the primer sets designed (RPA-267, RPA-131, and RPA-321) are highly sensitive, consistently detecting RRV with a detection limit of 1fg/μL. Testing of the infected plants using the primer sets indicated that the virus could be detected from leaves, stems and petals of roses. The primer pair RPA-267 produced 100% positive detection of the virus from infected leaf tissues, while primer set RPA-131 produced 100% detection from stems and petals. The primer set RPA-321 produced 83%, 87.5% and 75% positive detection from leaves, petals and stem tissues, respectively. In addition, the assay has been efficiently used in the detection of RRV infecting Knock Out(®) roses, collected from different states in the U.S. The assay can be completed in 20min as compared to the end-point RT-PCR assay (3-4h) and RT-qPCR (1.5h). The RT-RPA assay is reliable, rapid, highly sensitive, and can be easily used in diagnostic laboratories for detection of RRV with no need for any special

  19. Rapid detection of Wuchereria bancrofti in mosquitoes by LightCycler polymerase chain reaction and melting curve analysis.

    PubMed

    Lulitanond, Virapong; Intapan, Pewpan M; Pipitgool, Vichit; Choochote, Wej; Maleewong, Wanchai

    2004-11-01

    A LightCycler real-time polymerase chain reaction (PCR) assay was developed to detect Wuchereria bancrofti DNA in blood-fed mosquitoes. The assay is based on fluorescence melting curve analysis of the PCR product generated from a family of repeated DNA elements: the 182 bp SspI repeat, specific to the genus Wuchereria. According to the melting temperature, W. bancrofti infected-mosquitoes were differentiated from Brugia malayi-infected and non-infected mosquitoes as well as from genomic DNA of Dirofilaria immitis and human DNA. The method proved to be 100% sensitive in all W. bancrofti-infected mosquitoes. Melting curve analysis offers a rapid alternative for the specific detection of W. bancrofti in mosquitoes. It is very accurate and sensitive, allows a high throughput and can be performed on very small samples. The method therefore has great potential for application in epidemiological studies.

  20. Detection of parvalbumin, a common fish allergen gene in food, by real-time polymerase chain reaction.

    PubMed

    Sun, Min; Liang, Chengzhu; Gao, Hongwei; Lin, Chao; Deng, Mingjun

    2009-01-01

    Fish, as one of the most common causes of IgE-mediated food hypersensitivity, has recently received increasing attention from the food industry and legislative and regulatory agencies. A real-time polymerase chain reaction assay based on TaqMan-MGB probe technology was developed for the detection of parvalbumin, a major fish allergen gene. The assay had a sensitivity up to 5 pg purified fish DNA and had no cross-reaction with other species, such as cattle, sheep, swine, chicken, shrimp, lobster, crab, squid, clam, rice, soybean, maize, and potato. The coefficient of variation for both intra- and interexperimental variability demonstrated high reproducibility and accuracy. The assay proved to be a potential tool for the detection and label management of fish allergens in food.

  1. Clinical validation of a real-time polymerase chain reaction assay for rapid detection of Acinetobacter baumannii colonization.

    PubMed

    Blanco-Lobo, P; González-Galán, V; García-Quintanilla, M; Valencia, R; Cazalla, A; Martín, C; Alonso, I; Pérez-Romero, P; Cisneros, J M; Aznar, J; McConnell, M J

    2016-09-01

    Real-time polymerase chain reaction (PCR)-based approaches have not been assessed in terms of their ability to detect patients colonized by Acinetobacter baumannii during active surveillance. This prospective, double-blind study demonstrated that a real-time PCR assay had high sensitivity (100%) and specificity (91.2%) compared with conventional culture for detecting A. baumannii in 397 active surveillance samples, and provided results within 3h. Receiver-operator curve analyses demonstrated that the technique has diagnostic accuracy of 97.7% (95% confidence interval 96.0-99.3%). This method could facilitate the rapid implementation of infection control measures for preventing the transmission of A. baumannii.

  2. Evaluation of different DNA extraction procedures for the detection of Salmonella from chicken products by polymerase chain reaction.

    PubMed

    Soumet, C; Ermel, G; Fach, P; Colin, P

    1994-11-01

    Polymerase chain reaction (PCR) was used after a short pre-enrichment culture to detect Salmonella subspecies in chicken fillets. A direct PCR assay performed with chicken meat inoculated with Salmonella Typhimurium produced no PCR products. Six different DNA extraction protocols were tested to recover efficiently Salmonella DNA after a short incubation period. Three of them gave results that were reliable, rapid and sensitive. Successful protocols used Proteinase K and/or a centrifugation step to concentrate the samples. For reliable detection of Salmonella subspecies, a few thousand bacterial cells per ml must be present. To obtain this number of bacterial cells with an inoculation of about one cell in 25 g of ionized food products, it was necessary to incubate samples for at least 10 h before PCR. A larger inoculum of approximately 10 cells in 25 g of ionized food products, required 8 h in culture broth to give positive results by PCR-based assay.

  3. Use of Existing Diagnostic Reverse-Transcription Polymerase Chain Reaction Assays for Detection of Ebola Virus RNA in Semen.

    PubMed

    Pettitt, James; Higgs, Elizabeth S; Adams, Rick D; Jahrling, Peter B; Hensley, Lisa E

    2016-04-15

    Sexual transmission of Ebola virus in Liberia has now been documented and associated with new clusters in regions previously declared Ebola free. Assays that have Emergency Use Authorization (EUA) and are routinely used to detect Ebola virus RNA in whole blood and plasma specimens at the Liberian Institute for Biomedical Research were tested for their suitability in detecting the presence of Ebola virus RNA in semen. Qiagen AVL extraction protocols, as well as the Ebola Zaire Target 1 and major groove binder quantitative reverse-transcription polymerase chain reaction assays, were demonstrably suitable for this purpose and should facilitate epidemiologic investigations, including those involving long-term survivors of Ebola. Published by Oxford University Press for the Infectious Diseases Society of America 2015. This work is written by (a) US Government employee(s) and is in the public domain in the US.

  4. Molecular Detection of Methicillin-Resistant Staphylococcus aureus by Non-Protein Coding RNA-Mediated Monoplex Polymerase Chain Reaction

    PubMed Central

    Soo Yean, Cheryl Yeap; Selva Raju, Kishanraj; Xavier, Rathinam; Subramaniam, Sreeramanan; Gopinath, Subash C. B.; Chinni, Suresh V.

    2016-01-01

    Non-protein coding RNA (npcRNA) is a functional RNA molecule that is not translated into a protein. Bacterial npcRNAs are structurally diversified molecules, typically 50–200 nucleotides in length. They play a crucial physiological role in cellular networking, including stress responses, replication and bacterial virulence. In this study, by using an identified npcRNA gene (Sau-02) in Methicillin-resistant Staphylococcus aureus (MRSA), we identified the Gram-positive bacteria S. aureus. A Sau-02-mediated monoplex Polymerase Chain Reaction (PCR) assay was designed that displayed high sensitivity and specificity. Fourteen different bacteria and 18 S. aureus strains were tested, and the results showed that the Sau-02 gene is specific to S. aureus. The detection limit was tested against genomic DNA from MRSA and was found to be ~10 genome copies. Further, the detection was extended to whole-cell MRSA detection, and we reached the detection limit with two bacteria. The monoplex PCR assay demonstrated in this study is a novel detection method that can replicate other npcRNA-mediated detection assays. PMID:27367909

  5. Reverse transcription recombinase polymerase amplification assay for the rapid detection of type 2 porcine reproductive and respiratory syndrome virus.

    PubMed

    Wang, Jian-Chang; Yuan, Wan-Zhe; Han, Qing-An; Wang, Jin-Feng; Liu, Li-Bing

    2017-05-01

    Porcine reproductive and respiratory syndrome virus (PRRSV) is one of the most important pathogens in pigs, and has tremendous negative economic impact on the swine industry worldwide. PRRSV is classified into the two distinct genotypes: type 1 and type 2, and most of the described PRRSV isolates in China are type 2. Rapid and sensitive detection of PRRSV is of great importance for the disease control and regional eradication programs. Recombinase polymerase amplification (RPA) has emerged as a novel isothermal amplification technology for the molecular diagnosis of infectious diseases. In this study, a fluorescence reverse transcription RPA (RT-RPA) assay was developed to detect the type 2 PRRSV using primers and exo probe specific for the viral nucleocapsid gene. The reaction was performed at 40°C within 20min. The RT-RPA assay could detect both the classical (C-PRRSV) and highly pathogenic PRRSV (HP-PRRSV), but there was no cross-reaction to other pathogens. Using the in vitro transcribed PRRSV RNA as template, the analytical sensitivity of RT-RPA was 690 copies. The assay performance was evaluated by testing 60 field samples and compared to real-time RT-PCR. The detection rate of RT-RPA was 86.6% (52/60), while the detection rate of real-time RT-PCR was 83.3% (50/60). This simple, rapid and reliable method could be potentially applied for rapid detection of PRRSV in point-of-care and rural areas.

  6. Reverse transcription polymerase chain reaction-based method for selectively detecting vegetative cells of toxigenic Clostridium difficile.

    PubMed

    Senoh, Mitsutoshi; Kato, Haru; Murase, Tomoko; Hagiya, Hideharu; Tagashira, Yasuaki; Fukuda, Tadashi; Iwaki, Masaaki; Yamamoto, Akihiko; Shibayama, Keigo

    2014-11-01

    The laboratory diagnostic methods for Clostridium difficile infection (CDI) include toxigenic culture, enzyme immunoassays (EIAs) to detect the toxins of C. difficile, and nucleic acid amplification tests (NAATs) to detect C. difficile toxin genes, but each of these methods has disadvantages; toxigenic cultures require a long time to produce results, EIAs have low sensitivity, and NAATs that target DNA cannot distinguish vegetative cells from spores and dead cells. Here we report a new detection method that uses reverse transcription polymerase chain reaction to target the toxin-gene transcripts. This method was able to specifically detect the vegetative cells of toxigenic C. difficile in fecal samples in spike tests, with a minimum detection limit of 5 × 10(2) colony-forming units per 100 mg of stool specimen. The performance of this method was also demonstrated in a pilot scale evaluation using clinical fecal specimens, which showed that this method may be more sensitive than EIA and requires a shorter time than toxigenic culture. This method could potentially be applied in the clinical laboratory to detect C. difficile in fecal specimens. The ability of this method to discriminate the presence of vegetative cells from spores and dead cells could help to further the understanding of CDI.

  7. Ultrasensitive fluorescence polarization DNA detection by target assisted exonuclease III-catalyzed signal amplification.

    PubMed

    Zhang, Min; Guan, Yi-Meng; Ye, Bang-Ce

    2011-03-28

    Single stranded DNA sequences can be detected by target assisted exonuclease III-catalyzed signal amplification fluorescence polarization (TAECA-FP). The method offers an impressive detection limit of 83 aM within one hour for DNA detection and exhibits high discrimination ability even against a single base mismatch.

  8. Comparison of the novel ResPlex III assay and existing techniques for the detection and subtyping of influenza virus during the influenza season 2006-2007.

    PubMed

    Eggers, M; Roth, B; Schweiger, B; Schmid, M; Gregersen, J-P; Enders, M

    2012-06-01

    Influenza virus is a major cause of disease worldwide. The accurate detection and further subtyping of influenza A viruses are important for epidemiologic surveillance, and subsequent comprehensive characterization of circulating influenza viruses is essential for the selection of an optimal vaccine composition. ResPlex III is a new multiplex reverse transcriptase polymerase chain reaction (RT-PCR)-based method for detecting, typing, and subtyping influenza virus in clinical specimens. The ResPlex III assay was compared with other methods with respect to sensitivity and accuracy, using 450 clinical specimens obtained from subjects throughout Germany during the 2006-2007 influenza season. Samples were analyzed for the presence of influenza virus in Madin-Darby canine kidney (MDCK) cells by rapid cell culture using peroxidase staining and conventional cell culture confirmed by hemagglutination inhibition assay, a rapid diagnostic assay (Directigen Flu A+B test; BD Diagnostic Systems, Heidelberg, Germany), in-house real-time RT-PCR (RRT-PCR), and ResPlex III (Qiagen, Hilden, Germany). ResPlex III had the highest sensitivity for detecting influenza virus in clinical specimens, followed by in-house RRT-PCR (96% compared with ResPlex III). Conventional cell culture in MDCK cells, rapid culture, and quick test assays were substantially less sensitive (55%, 72%, and 39%, respectively). Virus subtyping results were identical using ResPlex III and the standard virological subtyping method, hemagglutination inhibition. ResPlex III is a quick, accurate, and sensitive assay for detecting and typing influenza A and B viruses and subtyping influenza A viruses in clinical specimens, and might be considered for a supplemental role in worldwide seasonal and pandemic influenza surveillance.

  9. The occurrence of antibiotic resistance genes in Taq polymerases and a decontamination method applied to the detection of genetically modified crops.

    PubMed

    Perron, André; Raymond, Philippe; Simard, Robin

    2006-03-01

    Different antibiotic resistance (AR) genes, such as Bla, Tet and NPTII, contaminate commercially available Taq polymerases. The specificity of the AR gene PCR can be increased when using a restriction enzyme-based decontamination of polymerase. The elimination of Taq polymerase contamination allows the use of PCR tests to screen seeds (corn) and processed food for the presence of genetically modified organisms (GMO) based on the detection of AR genes. Without a decontamination procedure for AR genes, PCR screening tests should be interpreted with caution.

  10. Detection of nonauthorized genetically modified organisms using differential quantitative polymerase chain reaction: application to 35S in maize.

    PubMed

    Cankar, Katarina; Chauvensy-Ancel, Valérie; Fortabat, Marie-Noelle; Gruden, Kristina; Kobilinsky, André; Zel, Jana; Bertheau, Yves

    2008-05-15

    Detection of nonauthorized genetically modified organisms (GMOs) has always presented an analytical challenge because the complete sequence data needed to detect them are generally unavailable although sequence similarity to known GMOs can be expected. A new approach, differential quantitative polymerase chain reaction (PCR), for detection of nonauthorized GMOs is presented here. This method is based on the presence of several common elements (e.g., promoter, genes of interest) in different GMOs. A statistical model was developed to study the difference between the number of molecules of such a common sequence and the number of molecules identifying the approved GMO (as determined by border-fragment-based PCR) and the donor organism of the common sequence. When this difference differs statistically from zero, the presence of a nonauthorized GMO can be inferred. The interest and scope of such an approach were tested on a case study of different proportions of genetically modified maize events, with the P35S promoter as the Cauliflower Mosaic Virus common sequence. The presence of a nonauthorized GMO was successfully detected in the mixtures analyzed and in the presence of (donor organism of P35S promoter). This method could be easily transposed to other common GMO sequences and other species and is applicable to other detection areas such as microbiology.

  11. A Field-Deployable Reverse Transcription Recombinase Polymerase Amplification Assay for Rapid Detection of the Chikungunya Virus

    PubMed Central

    Faye, Oumar; Prüger, Pauline; Kaiser, Marco; Thaloengsok, Sasikanya; Ubol, Sukathida; Sakuntabhai, Anavaj; Leparc-Goffart, Isabelle; Hufert, Frank T.; Sall, Amadou A.; Weidmann, Manfred; Niedrig, Matthias

    2016-01-01

    Background Chikungunya virus (CHIKV) is a mosquito-borne virus currently transmitted in about 60 countries. CHIKV causes acute flu-like symptoms and in many cases prolonged musculoskeletal and joint pain. Detection of the infection is mostly done using RT-RCR or ELISA, which are not suitable for point-of-care diagnosis. Methodology/Principal Findings In this study, a reverse transcription recombinase polymerase amplification (RT-RPA) assay for the detection of the CHIKV was developed. The assay sensitivity, specificity, and cross-reactivity were tested. CHIKV RT-RPA assay detected down to 80 genome copies/reaction in a maximum of 15 minutes. It successfully identified 18 isolates representing the three CHIKV genotypes. No cross-reactivity was detected to other alphaviruses and arboviruses except O'nyong'nyong virus, which could be differentiated by a modified RPA primer pair. Seventy-eight samples were screened both by RT-RPA and real-time RT-PCR. The diagnostic sensitivity and specificity of the CHIKV RT-RPA assay were determined at 100%. Conclusions/Significance The developed RT-RPA assay represents a promising method for the molecular detection of CHIKV at point of need. PMID:27685649

  12. Measurement of Microbial DNA Polymerase Activity Enables Detection and Growth Monitoring of Microbes from Clinical Blood Cultures

    PubMed Central

    Zweitzig, Daniel R.; Riccardello, Nichol M.; Morrison, John; Rubino, Jason; Axelband, Jennifer; Jeanmonod, Rebecca; Sodowich, Bruce I.; Kopnitsky, Mark J.; O’Hara, S. Mark

    2013-01-01

    Surveillance of bloodstream infections (BSI) is a high priority within the hospital setting. Broth-based blood cultures are the current gold standard for detecting BSI, however they can require lengthy incubation periods prior to detection of positive samples. We set out to demonstrate the feasibility of using enzymatic template generation and amplification (ETGA)-mediated measurement of DNA polymerase activity to detect microbes from clinical blood cultures. In addition to routine-collected hospital blood cultures, one parallel aerobic blood culture was collected and immediately refrigerated until being transported for ETGA analysis. After refrigeration holding and transport, parallel-collected cultures were placed into a BACTEC incubator and ETGA time-course analysis was performed. Of the 308 clinical blood cultures received, 22 were BACTEC positive, and thus were initially selected for ETGA time course analysis. The ETGA assay detected microbial growth in all 22 parallel-positive blood cultures in less time than a BACTEC incubator and also yielded genomic DNA for qPCR-based organism identification. In summary, feasibility of detecting microbes from clinical blood culture samples using the ETGA blood culture assay was demonstrated. Additional studies are being considered towards development of clinically beneficial versions of this methodology. PMID:24155986

  13. Integrated microfluidic reverse transcription-polymerase chain reaction for rapid detection of food- or waterborne pathogenic rotavirus.

    PubMed

    Li, Yuyuan; Zhang, Chunsun; Xing, Da

    2011-08-15

    The development of microfluidic tools for nucleic acid analysis has become a burgeoning area of research during the postgenome era. Here we have developed a microfluidic device that integrates reverse transcription (RT) and polymerase chain reaction (PCR) with online fluorescence detection to realize a rapid detection system for performing both genetic amplification and product analysis. The microfluidic device mainly comprises a grooved copper heating block for RT and a heated cylinder for amplification. To expedite the analysis process, we combined the continuous-flow PCR with an online fluorescence detection system that allows analysis of amplification products within 1 min. Rotaviruses are worldwide enteric pathogens in humans and animals responsible for a significant burden of disease through person-to-person transmission and exposure to contaminated foods and water. In this study, rotavirus from stool specimens was successfully amplified and detected using the RT-PCR microfluidic system within 1 h, and the limit of detection of the RNA concentration was estimated to be 3.6×10(4) copies μl(-1). Compared with a large-scale apparatus, the integrated microfluidic system presented here can perform rapid nucleic acid amplification and analysis, possibly making it a crucial platform for future diagnosis application. Copyright © 2011 Elsevier Inc. All rights reserved.

  14. Detection of bacteria in normal adult nasal cavity based on polymerase chain reaction-denaturing gradient gel electrophoresis.

    PubMed

    Cho, Jae Hoon; Jung, Min Young; Kim, Jin Kook; Chang, Young-Hyo

    2011-01-01

    This study investigated the bacterial diversity in a normal adult nasal cavity using polymerase chain reaction-denaturing gradient gel electrophoresis (PCR-DGGE) of 16S ribosomal RNA (rRNA) gene fragments and compared the results with those of a culture-based method. We swabbed the inferior turbinate from 19 normal volunteers. The transport media was divided by two, one for bacterial culture and another direct extraction for bacterial DNA. PCR-DGGE was performed from the bacterial DNA and all of the sequences were compared with the reference organism by using the BLAST program (a genome database of GenBank in the National Center for Biotechnology Information, Bethesda, MD). All 224 colonies were obtained from 19 samples by using a culture-based method; however, only 9 kinds of bacteria were detected. Staphylococcus epidermidis was the most frequently detected bacteria, and Staphylococcus aureus was the second most. The detection rates of other bacteria were very low. On the other hand, the PCR-DGGE from direct DNA extraction revealed 34 different bands that corresponded to 23 different kinds of bacteria. There were nine genera, viz., Staphylococcus, Bacillus, Enterobacter, Corynebacterium, Actinobacterium, Hafnia, Moraxella, Dolosigranulum, and Clostridium. Among them, unspecific Staphylococcus species and Enterobacter aerogenes were detected most frequently. Compared with the previous culture-based method, PCR-DGGE can detect much more diversity of bacteria in the nasal cavity.

  15. Detection of parvovirus B19 in donated blood: a model system for screening by polymerase chain reaction.

    PubMed

    McOmish, F; Yap, P L; Jordan, A; Hart, H; Cohen, B J; Simmonds, P

    1993-02-01

    A highly sensitive and rapid method for routinely screening large numbers of donated blood units for parvovirus B19 by the polymerase chain reaction (PCR) was developed. Over a 3-month trial period in Edinburgh, B19 DNA was detected in 6 of 20,000 consecutive units of blood (0.03%), in concentrations ranging from 2.4 x 10(4) to 5 x 10(10) copies of viral DNA per ml. Seroconversion for B19-specific immunoglobulin M and immunoglobulin G and disappearance of circulating B19 DNA occurred in the interval between donation and recall in four of the five implicated donors who could be recalled. B19 DNA was detected in 18 of 27 separate batches of non-heat-treated factor VIII and IX concentrate manufactured from donated plasma unscreened for B19 DNA. Dry-heat treatment at 80 degrees C for 72 h reduced but did not always eliminate detectable B19 from factor VIII concentrates, consistent with recent observations that current methods for virus inactivation during blood product manufacture are insufficient to entirely eliminate B19 infectivity. The methods developed in this study for PCR screening could be applied routinely to prevent transfusion of B19 in blood and blood products and could play an important role in the prevention of iatrogenic transmission of infection. PCR screening could also be used for detection and exclusion of a range of other transmission-associated viruses for which current serological detection methods are only partially effective.

  16. [Adaptation of a sensitive DNA extraction method for detection of Entamoeba histolytica by real-time polymerase chain reaction].

    PubMed

    Pınar, Ahmet; Akyön, Yakut; Alp, Alpaslan; Ergüven, Sibel

    2010-07-01

    This study was aimed to adapt a sensitive DNA extraction protocol in stool samples for real-time polymerase chain reaction (PCR) detection of Entamoeba histolytica which causes important morbidity and mortality worldwide. Stool extraction is a problematic step and has direct effects on PCR sensitivity. In order to improve the sensitivity of E.histolytica detection by real-time PCR, "QIAamp DNA stool minikit (Qiagen, Germany)" was modified by adding an overnight incubation step with proteinase K and sodium dodecyl sulfate (SDS) in this study. Three different extraction methods [(1) original method, (2) cetyltrimethyl-ammonium bromide (CTAB) method, (3) modified method] were evaluated for effects on sensitivity in real-time quantitative PCR (Artus RealArt TM E.histolytica RG PCR Kit, Qiagen Diagnostics, Germany). For this purpose, several concentrations of standard E.histolytica DNA were spiked in parasite-free stool samples and three different extraction protocols were performed. Detection sensitivities of "QIAamp DNA stool minikit" was found 5000 copies/ml and of CTAB method was found 500 copies/ml. Detection sensitivity of the extraction was improved to 5 copies/mL by modified "QIAamp DNA stool minikit" protocol. Since detection sensitivities of nucleic acid extraction protocols from stool samples directly affect the sensitivity of PCR amplification, different extraction protocols for different microorganisms should be evaluated.

  17. Detection of human papillomavirus in juvenile laryngeal papillomatosis using polymerase chain reaction.

    PubMed

    Gómez, M A; Drut, R; Lojo, M M; Drut, R M

    1995-01-01

    We examined the presence and subtypes of human papillomavirus (HPV) in 20 paraffin-embedded samples (from 12 patients) of juvenile laryngeal papillomatosis using the polymerase chain reaction (PCR). The biopsies had been stored for months to 12 years. Due to the great genetic variability of HPV, we selected a conservative sequence of the viral genome (L1 region) to identify the vast majority of the subtypes. Positive results were obtained by one-step PCR amplification with the MY09-11 consensus primers (L1 region) in only 10 of the cases. After a two-step amplification (nested-PCR) with GP5-6 primers the 20 samples proved to be positive demonstrating the higher sensitivity of this method. In order to amplify a highly variable region of the genome (E6), specific primers for HPV types 6 and 11 (H6/11 L1-R2) were used. 7/12 patients were positive for this subtype. Since more that one subtype has been reported in the same sample, the presence of HPV 6-11 sequences does not exclude that other subtypes might be involved. The results of this study show that: 1) HPV is present in JLP. 2) The most frequent HPV subtype involved was from the 6-11 group. 3) PCR can be successfully used in archived tissue routinely processed in a laboratory of pathology.

  18. Use of polymerase chain reaction to detect Brucella abortus biovar 1 in infected goats.

    PubMed

    Leal-Klevezas, D S; Martínez-Vázquez, I O; García-Cantú, J; López-Merino, A; Martínez-Soriano, J P

    2000-07-03

    The polymerase chain reaction (PCR) was used to diagnose goat brucellosis and compare its sensitivity against some of the most commonly used serological and bacteriological techniques. Twenty two female and one male out of 300 clinically healthy, mixed-breed goats were randomly chosen from a ranch located at Marín, Nuevo León, Mexico. Milk and blood samples were taken from each animal and used to obtain both microbiological cultures and DNA of the pathogen, and sera was tested against Rose Bengal antigen (RBT). Results showed that 86% of the blood samples were positive on the PCR test, while 60% were positive on the serological test. The pathogen was isolated from only one blood culture. Sixty four percent of the milk samples were positive on PCR tests, but failed to yield bacteria in culture. Biochemical and PCR specific assay demonstrated that Brucella abortus biovar 1 was associated with the infection. This study demonstrates the higher sensitivity of PCR over RBT and blood culture and its potential towards a rapid identification of Brucella strains.

  19. Detection of bacterial DNA from cholesterol gallstones by nested primers polymerase chain reaction

    PubMed Central

    Wu, Xiao-Ting; Xiao, Lu-Jia; Li, Xing-Quan; Li, Jie-Shou

    1998-01-01

    AIM: To search for bacterial DNA sequences in cholesterol gallstones with negative bacterial culture. METHODS: DNA was extracted from cholesterol gallstones in gallbladders and nested primers polymerase chain reaction (NP-PCR) was used to amplify bacterial gene fragments for identifying the existence of bacteria. The samples of bacterial DNA extracted from potentially causative or unrelated living bacteria were amplified in vitro as the standard markers and comparative 16S ribosomal RNA sequence analysis was made for bacterial identification. RESULTS: The gallbladder gallstones of 30 patients were analyzed and bacterial DNA was found in 26 patients. Among them, gallstones with cholesterol content between 30%-69% were seen in 5 (5/5) patients, 70%-90% in 11 (11/14) patients, and more than 90% in 10 (10/11) patients. There was no difference either in cholesterol and water content of gallstones or in harboring bacterial DNA of gallstones. E. coli-related DNA fragments appeared in the stones of 8 (26.67%) patients; propionibacteria type DNA in 7 (23.33%); and harbored bacterial gene fragments in 2 patients, similar to Streptococcus pyogenes. A more heterogenous sequence collection was found in 7 (23.33%) patients, which could belong to multiple bacterial infections. Two (6.67%) patients had bacterial DNA with low molecular weight which might be related to some unidentified bacteria. CONCLUSION: Most cholesterol gallstones harbor bacterial DNA. It is important to determine whether these microorganisms are innocent bystanders or active participants in cholesterol gallstone formation. PMID:11819284

  20. Detection of antibiotic-related genes from bacterial biocontrol agents with polymerase chain reaction.

    PubMed

    Zhang, Y; Fernando, W G D; de Kievit, T R; Berry, C; Daayf, F; Paulitz, T C

    2006-05-01

    Pseudomonas chlororaphis PA23, Pseudomonas spp. strain DF41, and Bacillus amyloliquefaciens BS6 consistently inhibit infection of canola petals by Sclerotinia sclerotiorum in both greenhouse and field experiments. Bacillus thuringiensis BS8, Bacillus cereus L, and Bacillus mycoides S have shown significant inhibition against S. sclerotiorum on plate assays. The presence of antibiotic biosynthetic or self-resistance genes in these strains was investigated with polymerase chain reaction and, in one case, Southern blotting. Thirty primers were used to amplify (i) antibiotic biosythetic genes encoding phenazine-1-carboxylic acid, 2,4-diacetylphloroglucinol, pyoluteorin, and pyrrolnitrin, and (ii) the zwittermicin A self-resistance gene. Our findings revealed that the fungal antagonist P. chlororaphis PA23 contains biosynthetic genes for phenazine-1-carboxylic acid and pyrrolnitrin. Moreover, production of these compounds was confirmed by high performance liquid chromatography. Pseudomonas spp. DF41 and B. amyloliquefaciens BS6 do not appear to harbour genes for any of the antibiotics tested. Bacillus thuringiensis BS8, B. cereus L, and B. mycoides S contain the zwittermicin A self-resistance gene. This is the first report of zmaR in B. mycoides.

  1. Detecting cooperative sequences in the binding of RNA Polymerase-II

    NASA Astrophysics Data System (ADS)

    Glass, Kimberly; Rozenberg, Julian; Girvan, Michelle; Losert, Wolfgang; Ott, Ed; Vinson, Charles

    2008-03-01

    Regulation of the expression level of genes is a key biological process controlled largely by the 1000 base pair (bp) sequence preceding each gene (the promoter region). Within that region transcription factor binding sites (TFBS), 5-10 bp long sequences, act individually or cooperate together in the recruitment of, and therefore subsequent gene transcription by, RNA Polymerase-II (RNAP). We have measured the binding of RNAP to promoters on a genome-wide basis using Chromatin Immunoprecipitation (ChIP-on-Chip) microarray assays. Using all 8-base pair long sequences as a test set, we have identified the DNA sequences that are enriched in promoters with high RNAP binding values. We are able to demonstrate that virtually all sequences enriched in such promoters contain a CpG dinucleotide, indicating that TFBS that contain the CpG dinucleotide are involved in RNAP binding to promoters. Further analysis shows that the presence of pairs of CpG containing sequences cooperate to enhance the binding of RNAP to the promoter.

  2. Detection of Leishmania braziliensis in naturally infected individual sandflies by the polymerase chain reaction.

    PubMed

    Rodríguez, N; Aguilar, C M; Barrios, M A; Barker, D C

    1999-01-01

    The natural infection of sandflies by Leishmania in wild-caught specimens was studied, using the polymerase chain reaction (PCR)-hybridization technique. The PCR was carried out using 2 oligonucleotides (primers 3J1 and 3J2) derived from a repetitive nuclear DNA sequence. The primers support the enzymatic amplification of a fragment of approximately 500 bp, present in the nuclear DNA of Leishmania braziliensis. The expected band was observed in 5 of 65 sandflies containing flagellates. After hybridization with a species-specific probe, we confirmed natural infection by L. braziliensis. The technique allowed the identification of Lutzomyia gomezi and Lu. panamensis as vectors of L. braziliensis in an endemic area of cutaneous leishmaniasis in Urama, Puerto Cabello district in Venezuela. As far as we are aware, this work constitutes the first report of natural infection of Lu. panamensis with L. braziliensis in the study area. We also demonstrate that PCR-hybridization is a suitable approach to establish the Leishmania-sandfly relationship and will be useful in epidemiological studies of leishmaniasis in endemic areas.

  3. Detection of feline immunodeficiency virus in saliva and plasma by cultivation and polymerase chain reaction.

    PubMed

    Matteucci, D; Baldinotti, F; Mazzetti, P; Pistello, M; Bandecchi, P; Ghilarducci, R; Poli, A; Tozzini, F; Bendinelli, M

    1993-03-01

    The rates of feline immunodeficiency virus (FIV) isolation from saliva, plasma, and peripheral blood mononuclear cells (PBMC) of infected cats were compared; isolation rates were 18, 14, and 81%, respectively, in naturally infected cats and 25, 57, and 100%, respectively, in experimentally infected animals. There was no obvious relationship between isolation rate and clinical stage or between isolation rate and the titer of neutralizing antibody in serum. Virus could be isolated from one salivary gland as early as 1 week postinfection and, on a more regular basis, starting at 3 weeks postinfection, when, however, most other tissues were also positive. Polymerase chain reaction analysis showed that FIV genomes are present in saliva and plasma more frequently than expected on the basis of isolation data. Saliva was also found to contain viral DNA, indicating that it may harbor virus-infected cells as well as free virus. The addition of plasma but not of saliva to PBMC cultures delayed FIV growth. Isolation from plasma may be hampered by FIV neutralizing antibody and by the cytotoxic activity of this fluid for the PBMC used as a cell substrate.

  4. Recombinase polymerase and enzyme-linked immunosorbent assay as a DNA amplification-detection strategy for food analysis.

    PubMed

    Santiago-Felipe, S; Tortajada-Genaro, L A; Puchades, R; Maquieira, A

    2014-02-06

    Polymerase chain reaction in conjunction with enzyme-linked immunosorbent assay (PCR-ELISA) is a well-established technique that provides a suitable rapid, sensitive, and selective method for a broad range of applications. However, the need for precise rapid temperature cycling of PCR is an important drawback that can be overcome by employing isothermal amplification reactions such as recombinase polymerase amplification (RPA). The RPA-ELISA combination is proposed for amplification at a low, constant temperature (40°C) in a short time (40 min), for the hybridisation of labelled products to specific 5'-biotinylated probes/streptavidin in coated microtiter plates at room temperature, and for detection by colorimetric immunoassay. RPA-ELISA was applied to screen common safety threats in foodstuffs, such as allergens (hazelnut, peanut, soybean, tomato, and maize), genetically modified organisms (P35S and TNOS), pathogenic bacteria (Salmonella sp. and Cronobacter sp.), and fungi (Fusarium sp.). Satisfactory sensitivity and reproducibility results were achieved for all the targets. The RPA-ELISA technique does away with thermocycling and provides a suitable sensitive, specific, and cost-effective method for routine applications, and proves particularly useful for resource-limited settings.

  5. Performance of transport and selective media for swine Bordetella bronchiseptica recovery and it comparison to polymerase chain reaction detection

    PubMed Central

    Coutinho, Tania Alen; Bernardi, Mari Lourdes; de Itapema Cardoso, Marisa Ribeiro; Borowski, Sandra Maria; Moreno, Andrea Micke; de Barcellos, David Emilio Santos Neves

    2009-01-01

    Three comparative assays were performed seeking to improve the sensitivity of the diagnosis of Bordetella bronchiseptica infection analyzing swine nasal swabs. An initial assay compared the recovery of B. bronchiseptica from swabs simultaneously inoculated with B. bronchiseptica and some interfering bacteria, immersed into three transport formulations (Amies with charcoal, trypticase soy broth and phosphate buffer according to Soerensen supplemented with 5% of bovine fetal serum) and submitted to different temperatures (10°C and 27°C) and periods of incubation (24, 72 and 120 hours). A subsequent assay compared three selective media (MacConkey agar, modified selective medium G20G and a ceftiofur medium) for their recovery capabilities from clinical specimens. One last assay compared the polymerase chain reaction to the three selective media. In the first assay, the recovery of B. bronchiseptica from transport systems was better at 27°C and the three formulations had good performances at this temperature, but the collection of qualitative and quantitative analysis indicated the advantage of Amies medium for nasal swabs transportation. The second assay indicated that MacConkey agar and modified G20G had similar results and were superior to the ceftiofur medium. In the final assay, polymerase chain reaction presented superior capability of B. bronchiseptica detection to culture procedures. PMID:24031390

  6. Detection of Escherichia coli Enteropathogens by Multiplex Polymerase Chain Reaction from Children's Diarrheal Stools in Two Caribbean–Colombian Cities

    PubMed Central

    Arzuza, Octavio; Urbina, Delfina; Bai, Jing; Guerra, Julio; Montes, Oscar; Puello, Marta; Mendoza, Ketty; Castro, Gregorio Y.

    2010-01-01

    Abstract Acute diarrheal disease is a leading cause of childhood morbidity and mortality in the developing world and Escherichia coli intestinal pathogens are important causative agents. Information on the epidemiology of E. coli intestinal pathogens and their association with diarrheal disease is limited because no diagnostic testing is available in countries with limited resources. To evaluate the prevalence of E. coli intestinal pathogens in a Caribbean–Colombian region, E. coli clinical isolates from children with diarrhea were analyzed by a recently reported two-reaction multiplex polymerase chain reaction (Gomez-Duarte et al., Diagn Microbiol Infect Dis 2009;63:1–9). The phylogenetic group from all E. coli isolates was also typed by a single-reaction multiplex polymerase chain reaction. We found that among 139 E. coli strains analyzed, 20 (14.4%) corresponded to E. coli diarrheagenic pathotypes. Enterotoxigenic, shiga-toxin–producing, enteroaggregative, diffuse adherent, and enteropathogenic E. coli pathotypes were detected, and most of them belonged to the phylogenetic groups A and B1, known to be associated with intestinal pathogens. This is the first report on the molecular characterization of E. coli diarrheogenic isolates in Colombia and the first report on the potential role of E. coli in childhood diarrhea in this geographic area. PMID:19839760

  7. Detection of Escherichia coli enteropathogens by multiplex polymerase chain reaction from children's diarrheal stools in two Caribbean-Colombian cities.

    PubMed

    Gómez-Duarte, Oscar G; Arzuza, Octavio; Urbina, Delfina; Bai, Jing; Guerra, Julio; Montes, Oscar; Puello, Marta; Mendoza, Ketty; Castro, Gregorio Y

    2010-02-01

    Acute diarrheal disease is a leading cause of childhood morbidity and mortality in the developing world and Escherichia coli intestinal pathogens are important causative agents. Information on the epidemiology of E. coli intestinal pathogens and their association with diarrheal disease is limited because no diagnostic testing is available in countries with limited resources. To evaluate the prevalence of E. coli intestinal pathogens in a Caribbean-Colombian region, E. coli clinical isolates from children with diarrhea were analyzed by a recently reported two-reaction multiplex polymerase chain reaction (Gomez-Duarte et al., Diagn Microbiol Infect Dis 2009;63:1-9). The phylogenetic group from all E. coli isolates was also typed by a single-reaction multiplex polymerase chain reaction. We found that among 139 E. coli strains analyzed, 20 (14.4%) corresponded to E. coli diarrheagenic pathotypes. Enterotoxigenic, shiga-toxin-producing, enteroaggregative, diffuse adherent, and enteropathogenic E. coli pathotypes were detected, and most of them belonged to the phylogenetic groups A and B1, known to be associated with intestinal pathogens. This is the first report on the molecular characterization of E. coli diarrheogenic isolates in Colombia and the first report on the potential role of E. coli in childhood diarrhea in this geographic area.

  8. Rapid detection of sacbrood virus in honeybee using ultra-rapid real-time polymerase chain reaction.

    PubMed

    Yoo, Mi-Sun; Thi, Kim Cuc Nguyen; Van Nguyen, Phu; Han, Sang-Hoon; Kwon, Soon-Hwan; Yoon, Byoung-Su

    2012-01-01

    A real-time reverse transcription-polymerase chain reaction (qRT-PCR) assay was developed for the fast and highly sensitive detection of the sacbrood virus (SBV) genome and applied to honeybee samples. Using plasmid DNA containing a partial SBV genome and diluted serially, as few as 1×10(2)copies/μl (correlation co-efficiency >0.99) were detected by the qRT-PCR assay, whereas 1×10(3)copies/μl were detected by the conventional RT-PCR assay. As a rapid detection method, ultra-rapid real-time PCR (URRT-PCR) was carried out with a GenSpector TMC-1000 silicon-glass chip-based thermal cycler, which has a 6μl micro-chamber volume and a fast outstandingly heating/cooling rate. Using this method, 10(3)copies of pBX-SBV3.8 clone were detected within 17 min after 40 PCR cycles, including melting point analysis. To reduce the detection time for SBV, synthesis of the cDNA of the SBV genome from a honeybee sample was attempted for different reaction times and the cDNA was used as the template for URRT-PCR assays. The results indicated that a 5 min reaction time was sufficient to synthesize cDNA as the template for the SBV URRT-PCR assay. This study described a novel PCR-based method that is able to detect an RNA virus in environmental samples within 22 min, including reverse transcription, PCR detection and melting point analysis in real-time.

  9. Accuracy and Significance of Polymerase Chain Reaction Detection of Sentinel Node Metastases in Breast Cancer Patients

    DTIC Science & Technology

    2000-10-01

    specific marker for RT-PCR detection of breast cancer metastases in sentinel lymph nodes. Society of Surgical Oncology Book of Abstracts 1999; 38: P16 ... Cancer Patients PRINCIPAL INVESTIGATOR: Kathryn M. Verbanac, Ph.D. Lorraine Tafra, M.D. CONTRACTING ORGANIZATION: East Carolina University...Detection of Sentinel Node Metastases Breast Cancer Patients in 6. AUTHOR(S) Kathryn Verbanac, Ph.D. Lorraine Tafra, M.D. 5. FUNDING NUMBERS

  10. Polymerase Chain Reaction Detection of Leishmania kDNA from the Urine of Peruvian Patients with Cutaneous and Mucocutaneous Leishmaniasis

    PubMed Central

    Veland, Nicolas; Espinosa, Diego; Valencia, Braulio Mark; Ramos, Ana Pilar; Calderon, Flor; Arevalo, Jorge; Low, Donald E.; Llanos-Cuentas, Alejandro; Boggild, Andrea K.

    2011-01-01

    We hypothesized that Leishmania kDNA may be present in urine of patients with cutaneous leishmaniasis (CL). Urine samples and standard diagnostic specimens were collected from patients with skin lesions. kDNA polymerase chain reaction (PCR) was performed on samples from patients and 10 healthy volunteers from non-endemic areas. Eighty-six of 108 patients were diagnosed with CL and 18 (21%) had detectable Leishmania Viannia kDNA in the urine. Sensitivity and specificity were 20.9% (95% confidence interval [CI] 12.3–29.5%) and 100%. Six of 8 patients with mucocutaneous involvement had detectable kDNA in urine versus 12 of 78 patients with isolated cutaneous disease (P < 0.001). L. (V.) braziliensis (N = 3), L. (V.) guyanensis (N = 6), and L. (V.) peruviana (N = 3) were identified from urine. No healthy volunteer or patient with an alternate diagnosis had detectable kDNA in urine. Sensitivity of urine PCR is sub-optimal for diagnosis. On the basis of these preliminary data in a small number of patients, detectable kDNA in urine may identify less localized forms of infection and inform treatment decisions. PMID:21460009

  11. Detection of genetically modified corn (Bt176) in spiked cow blood samples by polymerase chain reaction and immunoassay methods.

    PubMed

    Petit, Laetitia; Baraige, Fabienne; Bertheau, Yves; Brunschwig, Philippe; Diolez, Annick; Duhem, Koenraad; Duplan, Marie-Noëlle; Fach, Patrick; Kobilinsky, André; Lamart, Stephen; Schattner, Alexandra; Martin, Patrice

    2005-01-01

    The fate of DNA and protein transgenic sequences in products derived from animals fed transgenic crops has recently raised public interest. Sensitive molecular tests targeting the Bt176 genetic construct and the transgenic Cry1Ab protein were developed to determine whether plant sequences, especially transgenic sequences, are present in animal products. A protocol for total DNA extraction and purification from cow whole blood samples was first drawn up and assessed by spiking with known amounts of DNA from Bt176 maize. The limit of detection for transgenic sequences (35S promoter and Bt176-specific junction sequence) was determined by both the polymerase chain reaction-enzyme-linked immunosorbent assay (PCR-ELISA) and the 5'-nuclease PCR assay. Four additional PCR systems were built to substantiate the results. The first detects a mono-copy maize-specific sequence (ADH promoter). Two others target multi-copy sequences from plant nucleus (26S rRNA gene) and chloroplast (psaB gene). The last one, used as a positive control, targets a mono-copy animal sequence (alpha(s1)-casein gene). Both methods detected a minimum spiking at 25 copies of Bt176 maize/mL in 10 mL whole blood samples. The sandwich ELISA kit used detected down to 1 ng transgenic Cry1Ab protein/mL spiked whole blood.

  12. Detection of Helicobacter pylori by polymerase chain reaction in the subgingival biofilm and saliva of non-dyspeptic periodontal patients.

    PubMed

    Souto, Renata; Colombo, Ana Paula Vieira

    2008-01-01

    Helicobacter pylori has been associated with the development of peptic ulcers and gastric cancer. Although the oral cavity may be a source of transmission, it is unknown whether it acts as a permanent reservoir for this bacterium, particularly in the presence of periodontal disease. The purpose of this study was to evaluate the prevalence of H. pylori by polymerase chain reaction (PCR) in the subgingival biofilm and saliva of subjects with periodontitis. Samples were obtained from 56 periodontally healthy subjects and 169 subjects with chronic periodontitis. DNA was extracted from the samples, and the detection of H. pylori was carried out by PCR using the JW22/23 primers. In general, H. pylori was detected in 24% of all samples evaluated. A significantly higher prevalence of H. pylori was observed in subgingival biofilm samples (33.3%) compared to saliva samples (20%) (P <0.05). H. pylori was detected significantly more often in the saliva and subgingival samples from subjects with periodontitis (23.5% and 50%, respectively) compared to samples from periodontally healthy subjects (7.3% and 11.4%, respectively; P <0.05). H. pylori was detected frequently in the oral microbiota of subjects with periodontitis, suggesting that periodontal pocketing and inflammation may favor the colonization by this species.

  13. Electrochemical detection of Piscirickettsia salmonis genomic DNA from salmon samples using solid-phase recombinase polymerase amplification.

    PubMed

    Del Río, Jonathan Sabaté; Svobodova, Marketa; Bustos, Paulina; Conejeros, Pablo; O'Sullivan, Ciara K

    2016-12-01

    Electrochemical detection of solid-phase isothermal recombinase polymerase amplification (RPA) of Piscirickettsia salmonis in salmon genomic DNA is reported. The electrochemical biosensor was constructed by surface functionalization of gold electrodes with a thiolated forward primer specific to the genomic region of interest. Solid-phase RPA and primer elongation were achieved in the presence of the specific target sequence and biotinylated reverse primers. The formation of the subsequent surface-tethered duplex amplicons was electrochemically monitored via addition of streptavidin-linked HRP upon completion of solid-phase RPA. Successful quantitative amplification and detection were achieved in less than 1 h at 37 °C, calibrating with PCR-amplified genomic DNA standards and achieving a limit of detection of 5 · 10(-8) μg ml(-1) (3 · 10(3) copies in 10 μl). The presented system was applied to the analysis of eight real salmon samples, and the method was also compared to qPCR analysis, observing an excellent degree of correlation. Graphical abstract Schematic of use of electrochemical RPA for detection of Psiricketessia salmonis in salmon liver.

  14. Detection of Porphyromonas gingivalis and Treponema denticola in chronic and aggressive periodontitis patients: A comparative polymerase chain reaction study

    PubMed Central

    Kumawat, Ramniwas M.; Ganvir, Sindhu M.; Hazarey, Vinay K.; Qureshi, Asifa; Purohit, Hemant J.

    2016-01-01

    Background: The detection frequency of Porphyromonas gingivalis and Treponema denticola in chronic periodontitis (CP) and aggressive periodontitis (AgP) is not explored well in Indian population. Aim: The study was undertaken to detect P. gingivalis and T. denticola in CP as well as in AgP patients using polymerase chain reaction (PCR), and to determine the relationship between the frequency of these two microorganisms and the severity of clinical periodontal parameters. Materials and Methods: Subgingival plaque samples were collected from ninety participants (thirty CP patients, thirty AgP patients, and thirty healthy participants) and the aforementioned two microorganisms were detected using PCR. Results: However, when CP and AgP were compared for the detection frequency of two microorganisms, no statistically significant difference was noted. A statistically significant increase in the number of bacteria-positive sites increased as the score of plaque index (PI), gingival index (GI), and clinical attachment level of CP and AgP patients increased. Coexistence of P. gingivalis and T. denticola was frequently observed in deep periodontal pockets. Conclusions: Study findings suggest that P. gingivalis and T. denticola are significantly associated with the severity of periodontal tissue destruction. Statistically significant association exists between clinical periodontal parameters such as PI, GI, periodontal pocket depth (PPD), and clinical attachment loss and presence of both the microorganisms. PMID:27994415

  15. Quantitative fucK gene polymerase chain reaction on sputum and nasopharyngeal secretions to detect Haemophilus influenzae pneumonia.

    PubMed

    Abdeldaim, Guma M K; Strålin, Kristoffer; Olcén, Per; Blomberg, Jonas; Mölling, Paula; Herrmann, Björn

    2013-06-01

    A quantitative polymerase chain reaction (PCR) for the fucK gene was developed for specific detection of Haemophilus influenzae. The method was tested on sputum and nasopharyngeal aspirate (NPA) from 78 patients with community-acquired pneumonia (CAP). With a reference standard of sputum culture and/or serology against the patient's own nasopharyngeal isolate, H. influenzae etiology was detected in 20 patients. Compared with the reference standard, fucK PCR (using the detection limit 10(5) DNA copies/mL) on sputum and NPA showed a sensitivity of 95.0% (19/20) in both cases, and specificities of 87.9% (51/58) and 89.5% (52/58), respectively. In a receiver operating characteristic curve analysis, sputum fucK PCR was found to be significantly superior to sputum P6 PCR for detection of H. influenzae CAP. NPA fucK PCR was positive in 3 of 54 adult controls without respiratory symptoms. In conclusion, quantitative fucK real-time PCR provides a sensitive and specific identification of H. influenzae in respiratory secretions.

  16. Integrated Acoustic Separation, Enrichment, and Microchip Polymerase Chain Reaction Detection of Bacteria from Blood for Rapid Sepsis Diagnostics.

    PubMed

    Ohlsson, Pelle; Evander, Mikael; Petersson, Klara; Mellhammar, Lisa; Lehmusvuori, Ari; Karhunen, Ulla; Soikkeli, Minna; Seppä, Titta; Tuunainen, Emilia; Spangar, Anni; von Lode, Piia; Rantakokko-Jalava, Kaisu; Otto, Gisela; Scheding, Stefan; Soukka, Tero; Wittfooth, Saara; Laurell, Thomas

    2016-10-04

    This paper describes an integrated microsystem for rapid separation, enrichment, and detection of bacteria from blood, addressing the unmet clinical need for rapid sepsis diagnostics. The blood sample is first processed in an acoustophoresis chip, where red blood cells are focused to the center of the channel by an acoustic standing wave and sequentially removed. The bacteria-containing plasma proceeds to a glass capillary with a localized acoustic standing wave field where the bacteria are trapped onto suspended polystyrene particles. The trapped bacteria are subsequently washed while held in the acoustic trap and released into a polymer microchip containing dried polymerase chain reaction (PCR) reagents, followed by thermocycling for target sequence amplification. The entire process is completed in less than 2 h. Testing with Pseudomonas putida spiked into whole blood revealed a detection limit of 1000 bacteria/mL for this first-generation analysis system. In samples from septic patients, the system was able to detect Escherichia coli in half of the cases identified by blood culture. This indicates that the current system detects bacteria in patient samples in the upper part of the of clinically relevant bacteria concentration range and that a further developed acoustic sample preparation system may open the door for a new and faster automated method to diagnose sepsis.

  17. Rapid and visual detection of Mycobacterium tuberculosis complex using recombinase polymerase amplification combined with lateral flow strips.

    PubMed

    Ma, Qinglin; Liu, Houming; Ye, Feidi; Xiang, Guangxin; Shan, Wanshui; Xing, Wanli

    2017-08-26

    To definitively diagnose active pulmonary Tuberculosis (TB), Mycobacterium tuberculosis complex (MTBC) bacilli must be identified within clinical specimens from patients. In this study, we introduced a rapid and visual detection method of MTBC using recombinase polymerase amplification (RPA) combined with lateral flow (LF) strips. The LF-RPA assay, read results with naked eyes, could detect as few as 5 genome copies of M. tuberculosis H37Rv (ATCC 27294) per reaction and had no cross-reactions with other control bacteria even using excessive amount of template DNA. The system could work well at a broad range of temperature 25-45 °C and reach detectable level even within 5 min. When testing a total of 137 clinical specimens, the sensitivity and specificity of the LF-RPA assay were 100% (95% CI: 95.94%-100%) and 97.92% (95% CI: 88.93%-99.95%), respectively, compared to culture identification method. Therefore, the LF-RPA system we have demonstrated is a rapid, simple, robust method for MTBC detection which, subject to the availability of a suitable sample extraction method, has the potentiality to diagnose TB at the point-of-care testing. Copyright © 2017 Elsevier Ltd. All rights reserved.

  18. Evaluation of RealStar Reverse Transcription–Polymerase Chain Reaction Kits for Filovirus Detection in the Laboratory and Field

    PubMed Central

    Rieger, Toni; Kerber, Romy; El Halas, Hussein; Pallasch, Elisa; Duraffour, Sophie; Günther, Stephan; Ölschläger, Stephan

    2016-01-01

    Background. Diagnosis of Ebola virus (EBOV) disease (EVD) requires laboratory testing. Methods. The RealStar Filovirus Screen reverse transcription–polymerase chain reaction (RT-PCR) kit and the derived RealStar Zaire Ebolavirus RT-PCR kit were validated using in vitro transcripts, supernatant of infected cell cultures, and clinical specimens from patients with EVD. Results. The Filovirus Screen kit detected EBOV, Sudan virus, Taï Forest virus, Bundibugyo virus, Reston virus, and Marburg virus and differentiated between the genera Ebolavirus and Marburgvirus. The amount of filovirus RNA that could be detected with a probability of 95% ranged from 11 to 67 RNA copies/reaction on a LightCycler 480 II. The Zaire Ebolavirus kit is based on the Filovirus Screen kit but was optimized for detection of EBOV. It has an improved signal-to-noise ratio at low EBOV RNA concentrations and is somewhat more sensitive than the Filovirus kit. Both kits show significantly lower analytical sensitivity on a SmartCycler II. Clinical evaluation revealed that the SmartCycler II, compared with other real-time PCR platforms, decreases the clinical sensitivity of the Filovirus Screen kit to diagnose EVD at an early stage. Conclusions. The Filovirus Screen kit detects all human-pathogenic filoviruses with good analytical sensitivity if performed on an appropriate real-time PCR platform. High analytical sensitivity is important for early diagnosis of EVD. PMID:27549586

  19. Development of a panel of recombinase polymerase amplification assays for detection of common bacterial urinary tract infection pathogens.

    PubMed

    Raja, B; Goux, H J; Marapadaga, A; Rajagopalan, S; Kourentzi, K; Willson, R C

    2017-08-01

    To develop and evaluate the performance of a panel of isothermal real-time recombinase polymerase amplification (RPA) assays for detection of common bacterial urinary tract infection (UTI) pathogens. The panel included RPAs for Escherichia coli, Klebsiella pneumoniae, Proteus mirabilis, Pseudomonas aeruginosa and Enterococcus faecalis. All five RPAs required reaction times of under 12 min to reach their lower limit of detection of 100 genomes per reaction or less, and did not cross-react with high concentrations of nontarget bacterial genomic DNA. In a 50-sample retrospective clinical study, the five-RPA assay panel was found to have a specificity of 100% (95% CI, 78-100%) and a sensitivity of 89% (95% CI, 75-96%) for UTI detection. The analytical and clinical validity of RPA for the rapid and sensitive detection of common UTI pathogens was established. Rapid identification of the causative pathogens of UTIs can be valuable in preventing serious complications by helping avoid the empirical treatment necessitated by traditional urine culture's 48-72-h turnaround time. The routine and widespread use of RPA to supplement or replace culture-based methods could profoundly impact UTI management and the emergence of multidrug-resistant pathogens. © 2017 The Society for Applied Microbiology.

  20. Development of a real-time recombinase polymerase amplification assay for rapid and sensitive detection of porcine circovirus 2.

    PubMed

    Wang, Jianchang; Wang, Jinfeng; Liu, Libing; Yuan, Wanzhe

    2017-08-01

    Porcine diseases associated with porcine circovirus 2 (PCV-2) infection have resulted in significant economic losses worldwide. A real-time recombinase polymerase amplification (RPA) assay was developed to detect PCV-2 using primers and an exo probe specific for the ORF2 gene. The reaction process can be completed in 20 min at 38 °C. The assay only detects PCV-2, as there was no cross-reaction with other pathogens important in pigs. Using the PCV-2 genomic DNA as template, the analytical sensitivity of the real-time RPA was 103 copies. The assay performance was evaluated by testing 38 field samples and compared with real-time PCR. The two assays demonstrated a 100% diagnostic agreement, and PCV-2 DNA was detected in 26 samples. The R(2) value of real-time RPA and real-time PCR was 0.954 by linear regression analysis. The real-time RPA assay provides an alternative tool for rapid, simple, and reliable detection of PCV-2, especially in remote and rural areas.

  1. Direct detection of infectious bursal disease virus from clinical samples by in situ reverse transcriptase-linked polymerase chain reaction.

    PubMed

    Cardoso, Tereza C; Rosa, Ana C G; Astolphi, Rafael D; Vincente, Rafael M; Novais, Juliana B; Hirata, Karina Y; Luvizotto, Maria Cecilia R

    2008-08-01

    The presence of the very virulent (vv) Brazilian strain of infectious bursal disease virus (IBDV) was determined in the bursa of Fabricius, thymus and liver of 2-week-old broilers from a flock with a higher than expected mortality. For this purpose, a direct in situ reverse transcriptase (RT)-linked polymerase chain reaction (PCR) method was developed using specific primers for vvIBDV. Unlabelled forward and reverse biotinylated oligonucleotides were used for RT-PCR in a one-step method and the respective products were revealed by a direct enzymatic reaction. The results were compared with those obtained by standard RT-PCR using general primers for IBDV and virus isolation. The virus isolation, RT-PCR and in situ RT-PCR revealed positive results on the bursa of Fabricius in 86%, 80% and 100%, respectively. The in situ RT-PCR detected vvIBDV in all tested thymus and liver samples, whereas the standard RT-PCR detected virus in 80% and 90% of the samples, respectively. After three consecutive passages on chicken embryonated eggs, IBDV was isolated from 64% of the thymus samples and 30% of the liver samples. In the present study, no classical or antigenic variants of IBDV were detected. The developed in situ RT-PCR assay was able to detect the very virulent strain of IBDV with a higher sensitivity than the conventional RT-PCR and virus isolation.

  2. Development of a rapid detection method to detect tdh gene in Vibrio parahaemolyticus using 2-step ultrarapid real-time polymerase chain reaction.

    PubMed

    Kang, Min-Hee; Kim, Il-Wook; Lee, Dong-Woo; Yoo, Mi-Sun; Han, Sang-Hoon; Yoon, Byoung-Su

    2011-01-01

    Thermostable direct hemolysin encoded by tdh gene has been considered an important virulence factor in pathogenic Vibrio parahaemolyticus. Two-step ultrarapid real-time polymerase chain reaction (URRT PCR) with a microchip was devised to detect V. parahaemolyticus carrying tdh gene. This novel method has a 6-μL reaction volume and extremely reduces running time since one cycle can be completed in 10 s or less. Consequently, 35 cycles of URRT PCR was successfully able to detect up to 100 fg (18 copies) of genomic DNA from pathogenic V. parahaemolyticus carrying tdh gene in 6 min. These results indicate that this method is at present the most rapid detection method for tdh gene and pathogenic V. parahaemolyticus.

  3. Detection of deoxyribonucleic acid (DNA) targets using polymerase chain reaction (PCR) and paper surface-enhanced Raman spectroscopy (SERS) chromatography.

    PubMed

    Hoppmann, Eric P; Yu, Wei W; White, Ian M

    2014-01-01

    Surface-enhanced Raman spectroscopy (SERS) enables multiplex detection of analytes using simple, portable equipment consisting of a single excitation source and detector. Thus, in theory, SERS is ideally suited to replace fluorescence in assays that screen for numerous deoxyribonucleic acid (DNA) targets, but in practice, SERS-based assays have suffered from complexity and elaborate processing steps. Here, we report an assay in which a simple inkjet-fabricated plasmonic paper device enables SERS-based detection of multiple DNA targets within a single polymerase chain reaction (PCR). In prior work, we demonstrated the principles of chromatographic separation and SERS-based detection on inkjet-fabricated plasmonic paper. The present work extends that capability for post-PCR gene sequence detection. In this design, hydrolysis DNA probes with 5' Raman labels are utilized; if the target is present, the probe is hydrolyzed during PCR, freeing the reporter. After applying the PCR sample to a paper SERS device, an on-device chromatographic separation and concentration is conducted to discriminate between hydrolyzed and intact probes. SERS is then used to detect the reporter released by the hydrolyzed probes. This simple separation and detection on paper eliminates the need for complex sample processing steps. In this work, we simultaneously detect the methicillin-resistant Staphylococcus aureus genes mecA and femB to illustrate the concept. We envision that this approach could contribute to the development of multiplex DNA diagnostic tests enabling screening for several target sequences within a single reaction, which is necessary for cases in which sample volume and resources are limited.

  4. Detection of variable DNA repeats in diverse eukaryotic microorganisms by a single set of polymerase chain reaction primers.

    PubMed Central

    Riley, D E; Samadpour, M; Krieger, J N

    1991-01-01

    We cloned and sequenced a variable DNA repeat from Trichomonas vaginalis, a flagellated protozoan parasite. Targeting of this repeat in the polymerase chain reaction resulted in complex and intense product patterns for a wide variety of eukaryotic microorganisms, including the pathogenic protozoan parasites T. vaginalis, Giardia lamblia, Leishmania donovani, three species of Trypanosoma, and four species of Acanthamoeba; the nonpathogenic protozoans, Paramecium tetraurelia and Tetrahymena thermophilia; and a yeast, Saccharomyces cerevisiae. Each microorganism exhibited a distinctive pattern of repeats. For example, a characteristic pattern was exhibited by six clinical T. vaginalis isolates. Eight G. lamblia isolates exhibited either one of two characteristic pattern types. There was no reaction with human DNA or DNA from the prokaryotes Ureaplasma urealyticum and Mycoplasma hominis. This approach may facilitate detection of a wide variety of eukaryotic microorganisms by use of a single primer set and holds promise for the development of typing schemes for both T. vaginalis and G. lamblia. Images PMID:1757544

  5. Nested polymerase chain reaction for detection of Theileria annulata and comparison with conventional diagnostic techniques: its use in epidemiology studies.

    PubMed

    Martín-Sánchez, J; Viseras, J; Adroher, F J; García-Fernández, P

    1999-03-01

    In this work we studied the ability of a nested polymerase chain reaction (PCR) to detect Theileria annulata, the causative agent of Mediterranean theileriosis, in blood samples obtained from cattle on farms in different Spanish regions and its possible use in epidemiology studies. Of the 214 samples analyzed, 78.04%, 69.86%, and 62.26% were found to be positive by nested PCR, indirect immunofluorescent antibody test, and optical microscopy of Giemsa-stained smears, respectively. The three techniques were in agreement in 68.6% of the results. The observation that the prevalence of Mediterranean theileriosis estimated using nested PCR alone (70.3%) and that obtained using all three diagnostic techniques together (80.4%) did not significantly differ verifies the utility of this technique in epidemiology studies.

  6. Biofunctionalization of Polyoxometalates with DNA Primers, Their Use in the Polymerase Chain Reaction (PCR) and Electrochemical Detection of PCR Products.

    PubMed

    Debela, Ahmed M; Ortiz, Mayreli; Beni, Valerio; Thorimbert, Serge; Lesage, Denis; Cole, Richard B; O'Sullivan, Ciara K; Hasenknopf, Bernold

    2015-12-01

    The bioconjugation of polyoxometalates (POMs), which are inorganic metal oxido clusters, to DNA strands to obtain functional labeled DNA primers and their potential use in electrochemical detection have been investigated. Activated monooxoacylated polyoxotungstates [SiW11 O39 {Sn(CH2 )2 CO}](8-) and [P2 W17 O61 {Sn(CH2 )2 CO}](6-) have been used to link to a 5'-NH2 terminated 21-mer DNA forward primer through amide coupling. The functionalized primer was characterized by using a battery of techniques, including electrophoresis, mass spectrometry, as well as IR and Raman spectroscopy. The functionality of the POM-labeled primers was demonstrated through hybridization with a surface-immobilized probe. Finally, the labeled primers were successfully used in the polymerase chain reaction (PCR) and the PCR products were characterized by using electrophoresis. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  7. HIV viral sequences in seronegative people at risk detected by in situ hybridisation and polymerase chain reaction.

    PubMed

    Pezzella, M; Rossi, P; Lombardi, V; Gemelli, V; Mariani Costantini, R; Mirolo, M; Fundaro, C; Moschese, V; Wigzell, H

    1989-03-18

    A study was conducted to assess the occurrence of latent infection with the human immunodeficiency virus (HIV) among seronegative people at high risk of infection. The presence of HIV genomes was analysed by molecular techniques in two seronegative children born to mothers infected with HIV and in three regular sexual partners of seropositive drug addicts. The adults were selected from a seronegative cohort at high risk of infection because of their sexual contacts and the children selected because of impaired growth. HIV retroviral sequences were detected in four of the five subjects directly at the cellular level by in situ hybridisation in peripheral blood mononuclear cells. HIV genomic sequences were confirmed by in vitro amplification of viral DNA with the polymerase chain reaction technique. The existence of a latent viral infection state in these seronegative subjects indicates the unreliability of standard serological analysis in people who have been in regular contact with infected patients.

  8. Detection of Leptospira spp. in wildlife reservoir hosts in Ontario through comparison of immunohistochemical and polymerase chain reaction genotyping methods

    PubMed Central

    Shearer, Karen E.; Harte, Michael J.; Ojkic, Davor; DeLay, Josepha; Campbell, Douglas

    2014-01-01

    A total of 460 kidney samples from wildlife (beavers, coyotes, deer, foxes, opossums, otters, raccoons, skunks) were obtained from road-kill and hunter/trapper donations in Ontario between January 2010 and November 2012. The objectives of the study were to detect Leptospira spp. by immunohistochemistry and polymerase chain reaction (PCR), to map presence of leptospires in wildlife relative to livestock and human populations, and to characterize positive samples by sequencing and comparison to leptospires known to affect domestic animals and humans. The proportion of samples that tested positive ranged from 0% to 42%, with the highest rates in skunks and raccoons. Leptospira spp. were present in kidneys of wildlife across Ontario, particularly in areas of high human density, and areas in which livestock populations are abundant. The PCR was too weak in most samples to permit genotyping and examination of the relationship between the leptospires found in this study and those affecting domestic animals and humans. PMID:24587507

  9. Case Report of Focal Epithelial Hyperplasia (Heck's Disease) with Polymerase Chain Reaction Detection of Human Papillomavirus 13.

    PubMed

    Brehm, Mary A; Gordon, Katie; Firan, Miahil; Rady, Peter; Agim, Nnenna

    2016-05-01

    Focal epithelial hyperplasia (FEH), or Heck's disease, is an uncommon benign proliferation of oral mucosa caused by the human papillomavirus (HPV), particularly subtypes 13 and 32. The disease typically presents in young Native American patients and is characterized by multiple asymptomatic papules and nodules on the oral mucosa, lips, tongue, and gingiva. The factors that determine susceptibility to FEH are unknown, but the ethnic and geographic distribution of FEH suggests that genetic predisposition, particularly having the human lymphocytic antigen DR4 type, may be involved in pathogenesis. We report a case of FEH with polymerase chain reaction detection of HPV13 in a healthy 11-year-old Hispanic girl and discuss the current understanding of disease pathogenesis, susceptibility, and treatment.

  10. Detection of Mycobacterium tuberculosis with nested polymerase chain reaction analysis in enucleated eye ball in Eales' disease.

    PubMed

    Verma, Aditya; Biswas, Jyotirmay; Dhanurekha, L; Gayathri, R; Lily Therese, K

    2016-06-01

    Nested polymerase chain reaction (nPCR) was performed on enucleated eyeball for detection of Mycobacterium tuberculosis (M. tb) genome in a patient with Eales' disease. PCR analysis in all previous studies has been done mainly using aqueous, vitreous and epiretinal membranes from these patients. Paraffin wax embedded tissue section of the enucleated eyeball was analyzed by histopathology and nPCR targeting MPB64 gene and IS6110 region of M. tb genome. Lymphocytic infiltration was seen in the vitreous, iris and the retinal tissue. Ziehl Neelsen stain was negative for acid fast bacilli. Caseation necrosis was not seen in any section. Agarose gel electrophoretogram showed positive results with 200 bp specific amplified product targeting MPB64 gene, whereas nPCR targeting IS6110 region was negative. Since biopsy proven M. tb is extremely difficult in ocular tissues due to extensive necrosis, the nPCR technique aided in the diagnosis.

  11. Isothermal strand-displacement polymerase reaction for visual detection of the Southeast Asian-type deletion of α-thalassemia.

    PubMed

    Yu, Luxin; Wu, Wei; Lie, Puchang; Liu, Yunhua; Zeng, Lingwen

    2013-11-01

    A rapid and reliable screening test for thalassemia carrier couples is the most effective strategy to decrease the risk of conceiving fetuses with severe thalassemia. We present an approach based on the isothermal strand-displacement polymerase reaction and the use of a lateral flow strip for the visual detection of an α-thalassemia Southeast Asian-type deletion. This assay was used to evaluate 86 clinical samples (72 cases of Southeast Asian-type deletions and 14 cases of other types of thalassemia), and the results obtained were 100% consistent with those obtained using conventional gap-PCR. The approach thus provides a simple, sensitive, rapid, and cost-effective method for the diagnosis of thalassemia genotypes. Copyright © 2013 American Society for Investigative Pathology and the Association for Molecular Pathology. Published by Elsevier Inc. All rights reserved.

  12. Polymerase chain reaction assay targeting cytochrome b gene for the detection of dog meat adulteration in meatball formulation.

    PubMed

    Rahman, Md Mahfujur; Ali, Md Eaqub; Hamid, Sharifah Bee Abd; Mustafa, Shuhaimi; Hashim, Uda; Hanapi, Ummi Kalthum

    2014-08-01

    A polymerase chain reaction (PCR) assay for the assessment of dog meat adulteration in meatballs was developed. The assay selectively amplified a 100-bp region of canine mitochondrial cytochrome b gene from pure, raw, processed and mixed backgrounds. The specificity of the assay was tested against 11 animals and 3 plants species, commonly available for meatball formulation. The stability of the assay was proven under extensively autoclaving conditions that breakdown target DNA. A blind test from ready to eat chicken and beef meatballs showed that the assay can repeatedly detect 0.2% canine meat tissues under complex matrices using 0.04 ng of dog DNA extracted from differentially treated meatballs. The simplicity, stability and sensitivity of the assay suggested that it could be used in halal food industry for the authentication of canine derivatives in processed foods.

  13. DOUBLE COMPACT OBJECTS. III. GRAVITATIONAL-WAVE DETECTION RATES

    SciTech Connect

    Dominik, Michal; Belczynski, Krzysztof; Bulik, Tomasz; Berti, Emanuele; O’Shaughnessy, Richard; Mandel, Ilya; Fryer, Christopher; Holz, Daniel E.; Pannarale, Francesco

    2015-06-20

    The unprecedented range of second-generation gravitational-wave (GW) observatories calls for refining the predictions of potential sources and detection rates. The coalescence of double compact objects (DCOs)—i.e., neutron star–neutron star (NS–NS), black hole–neutron star (BH–NS), and black hole–black hole (BH–BH) binary systems—is the most promising source of GWs for these detectors. We compute detection rates of coalescing DCOs in second-generation GW detectors using the latest models for their cosmological evolution, and implementing inspiral-merger-ringdown gravitational waveform models in our signal-to-noise ratio calculations. We find that (1) the inclusion of the merger/ringdown portion of the signal does not significantly affect rates for NS–NS and BH–NS systems, but it boosts rates by a factor of ∼1.5 for BH–BH systems; (2) in almost all of our models BH–BH systems yield by far the largest rates, followed by NS–NS and BH–NS systems, respectively; and (3) a majority of the detectable BH–BH systems were formed in the early universe in low-metallicity environments. We make predictions for the distributions of detected binaries and discuss what the first GW detections will teach us about the astrophysics underlying binary formation and evolution.

  14. Simultaneous detection of Clostridium perfringens and Clostridium colinum by duplex-polymerase chain reaction.

    PubMed

    Roussan, D A; Shaheen, Ibrahem A; Totanji, W S; Khawaldeh, G Y; Al Rifai, R H

    2012-12-01

    In this study, we provide a protocol for detection of Clostridium colinum and Clostridium perfringens by the single-tube duplex-PCR (dPCR) test for simultaneous and specific detection of both bacteria from pure cultures and fecal samples spiked with these pathogens. Specific primers for each pathogen were selected that amplified products of predicted sizes from bacteria in the dPCR as well as in the single-tube PCR (sPCR) assays. The sensitivity and specificity of dPCR assay were compared with those of the sPCR. No product amplification was obtained with DNA from reference strains belonging to the genus Clostridium (except C. colinum and C. perfringens) and isolates belonging to other genera using these primer sets. The dPCR assay was as sensitive as the sPCR assay because bacterial detection limits were similar in both assays. The detection limits of sPCR and dPCR in bacterial suspension were 20 and 25 cfu/mL for C. colinum and C. perfringens, respectively. Meanwhile, in the presence of feces the sensitivity of both assays decreased to a detection limit of 1.25 × 10(4) and 1.94 × 10(4) cfu/g of feces for C. colinum and C. perfringens, respectively. In summary, dPCR assay holds potential to be an economical and rapid diagnostic method for the simultaneous detection of C. colinum and C. perfringens in pure cultures and could be used to screen fecal samples for the presence of these pathogens.

  15. Specific detection of potentially allergenic kiwifruit in foods using polymerase chain reaction.

    PubMed

    Taguchi, Hiromu; Watanabe, Satoshi; Hirao, Takashi; Akiyama, Hiroshi; Sakai, Shinobu; Watanabe, Takahiro; Matsuda, Rieko; Urisu, Atsuo; Maitani, Tamio

    2007-03-07

    Kiwifruit (Actinidia deliciosa and Actinidia chinensis) is allergenic to sensitive patients, and, under Japanese regulations, it is one of the food items that are recommended to be declared on food labeling as much as possible. To develop PCR-based methods for the detection of trace amounts of kiwifruit in foods, two primer pairs targeting the ITS-1 region of the Actinidia spp. were designed using PCR simulation software. On the basis of the known distribution of a major kiwifruit allergen (actinidin) within the Actinidia spp., as well as of reports on clinical and immunological cross-reactivities, one of the primer pairs was designed to detect all Actinidia spp. and the other to detect commercially grown Actinidia spp. (i.e., kiwifruit, Actinidia arguta, and their interspecific hybrids) except for Actinidia polygama. The specificity of the developed methods using the designed primer pairs was verified by performing PCR experiments on 8 Actinidia spp. and 26 other plants including fruits. The methods were considered to be specific enough to yield target-size products only from the target Actinidia spp. and to detect no target-size products from nontarget species. The methods were sensitive enough to detect 5-50 fg of Actinidia spp. DNA spiked in 50 ng of salmon testis DNA used as a carrier (1-10 ppm of kiwifruit DNA) and 1700 ppm (w/w) of fresh kiwifruit puree spiked in a commercial plain yogurt (corresponding to ca. 10 ppm of kiwifruit protein). These methods would be expected to be useful in the detection of hidden kiwifruit and its related species in processed foods.

  16. Method for the detection of specific nucleic acid sequences by polymerase nucleotide incorporation

    DOEpatents

    Castro, Alonso

    2004-06-01

    A method for rapid and efficient detection of a target DNA or RNA sequence is provided. A primer having a 3'-hydroxyl group at one end and having a sequence of nucleotides sufficiently homologous with an identifying sequence of nucleotides in the target DNA is selected. The primer is hybridized to the identifying sequence of nucleotides on the DNA or RNA sequence and a reporter molecule is synthesized on the target sequence by progressively binding complementary nucleotides to the primer, where the complementary nucleotides include nucleotides labeled with a fluorophore. Fluorescence emitted by fluorophores on single reporter molecules is detected to identify the target DNA or RNA sequence.

  17. Polymerase chain reaction detection of bacterial 16S rRNA gene in human blood.

    PubMed

    Moriyama, Kosei; Ando, Chie; Tashiro, Kosuke; Kuhara, Satoru; Okamura, Seiichi; Nakano, Shuji; Takagi, Yasumitsu; Miki, Takeyoshi; Nakashima, Yoshiyuki; Hirakawa, Hideki

    2008-07-01

    Bacterial 16S ribosomal RNA genes (rDNA) were detected in blood samples from two healthy individuals by PCR under conditions involving 30 cycles that did not produce any visible products from negative control saline. Even from control samples, PCR involving 35-40 cycles yielded visible bands. Major clones detected in the blood samples, but not in control, were the Aquabacterium subgroup, Stenotrophomonas subgroup, Budvicia subgroup, Serratia subgroup, Bacillus subgroup and Flavobacteria subgroup. No clone was located within the bacteroides-clostridium-lactobacillus cluster, which is indigenous to gastrointestinal flora.

  18. Specific detection of RT activity in culture supernantants of retrovirus-producing cells, using synthetic DNA as competitor in polymerase enhanced reverse transcriptase assay.

    PubMed

    Voisset, C; Tönjes, R R; Breyton, P; Mandrand, B; Paranhos-Baccalà, G

    2001-05-01

    The polymerase enhanced reverse transcriptase (PERT) assay is a highly sensitive assay for the detection of reverse transcriptase (RT) activity in culture supernatants of retrovirus-producing cells. However, some cellular DNA-dependent DNA polymerases exhibit RT-like activities in this assay. A synthetic DNA competitor which suppresses the RT-like activities of cellular DNA-dependent DNA polymerases was used in a modified PERT assay technique for specific detection of RT activity in culture supernatants of retrovirus-producing cells. We determined the optimum condition of the assay and evaluated its specificity. This improved PERT assay is easy to perform and is able to detect minute amounts of purified RT, as well as RT in crude cell lysates and concentrated culture supernatants.

  19. Detection of Nanophyetus salmincola in water, snails, and fish tissues by quantitative polymerase chain reaction

    USGS Publications Warehouse

    Purcell, Maureen K.; Powers, Rachel L.; Besijn, Bonnie; Hershberger, Paul K.

    2017-01-01

    We report the development and validation of two quantitative PCR (qPCR) assays to detect Nanophyetus salmincola DNA in water samples and in fish and snail tissues. Analytical and diagnostic validation demonstrated good sensitivity, specificity, and repeatability of both qPCR assays. The N. salmincola DNA copy number in kidney tissue was significantly correlated with metacercaria counts based on microscopy. Extraction methods were optimized for the sensitive qPCR detection of N. salmincola DNA in settled water samples. Artificially spiked samples suggested that the 1-cercaria/L threshold corresponded to an estimated log10 copies per liter ≥ 6.0. Significant correlation of DNA copy number per liter and microscopic counts indicated that the estim