Sample records for polymerases

  1. Mammalian proliferating cell nuclear antigen stimulates the processivity of two wheat embryo DNA polymerases.

    PubMed Central

    Laquel, P; Litvak, S; Castroviejo, M

    1993-01-01

    Multiple DNA polymerases have been described in all organisms studied to date. Their specific functions are not easy to determine, except when powerful genetic and/or biochemical tools are available. However, the processivity of a DNA polymerase could reflect the physiological role of the enzyme. In this study, analogies between plant and animal DNA polymerases have been investigated by analyzing the size of the products synthesized by wheat DNA polymerases A, B, CI, and CII as a measure of their processivity. Thus, incubations have been carried out with poly(dA)-oligo(dT) as a template-primer under varying assay conditions. In the presence of MgCl2, DNA polymerase A was highly processive, whereas DNA polymerases B, CI, and CII synthesized much shorter products. With MnCl2 instead of MgCl2, DNA polymerase A was highly processive, DNA polymerases B and CII were moderately processive, and DNA polymerase CI remained strictly distributive. The effect of calf thymus proliferating cell nuclear antigen (PCNA) on wheat polymerases was studied as described for animal DNA polymerases. The high processivity of DNA polymerase A was PCNA independent, whereas both enzyme activity and processivity of wheat DNA polymerases B and CII were significantly stimulated by PCNA. On the other hand, DNA polymerase CI was not stimulated by PCNA and, like animal DNA polymerase beta, was distributive in all cases. From these results, we propose that wheat DNA polymerase A could correspond to a DNA polymerase alpha, DNA polymerases B and CII could correspond to the delta-like enzyme, and DNA polymerase CI could correspond to DNA polymerase beta. PMID:7906418

  2. Polymerase III transcription factor B activity is reduced in extracts of growth-restricted cells.

    PubMed Central

    Tower, J; Sollner-Webb, B

    1988-01-01

    Extracts of cells that are down-regulated for transcription by RNA polymerase I and RNA polymerase III exhibit a reduced in vitro transcriptional capacity. We have recently demonstrated that the down-regulation of polymerase I transcription in extracts of cycloheximide-treated and stationary-phase cells results from a lack of an activated subform of RNA polymerase I which is essential for rDNA transcription. To examine whether polymerase III transcriptional down-regulation occurs by a similar mechanism, the polymerase III transcription factors were isolated and added singly and in pairs to control cell extracts and to extracts of cells that had reduced polymerase III transcriptional activity due to cycloheximide treatment or growth into stationary phase. These down-regulations result from a specific reduction in TFIIIB; TFIIIC and polymerase III activities remain relatively constant. Thus, although transcription by both polymerase III and polymerase I is substantially decreased in extracts of growth-arrested cells, this regulation is brought about by reduction of different kinds of activities: a component of the polymerase III stable transcription complex in the former case and the activated subform of RNA polymerase I in the latter. Images PMID:3352599

  3. RNA polymerase gene, microorganism having said gene and the production of RNA polymerase by the use of said microorganism

    DOEpatents

    Kotani, Hirokazu; Hiraoka, Nobutsugu; Obayashi, Akira

    1991-01-01

    SP6 bacteriophage RNA polymerase is produced by cultivating a new microorganism (particularly new strains of Escherichia coli) harboring a plasmid that carries SP6 bacteriophage RNA polymerase gene and recovering SP6 bacteriophage RNA polymerase from the culture broth. SP6 bacteriophage RNA polymerase gene is provided as are new microorganisms harboring a plasmid that carries SP6 bacteriophage RNA polymerase gene.

  4. Structure of T7 RNA polymerase complexed to the transcriptional inhibitor T7 lysozyme.

    PubMed Central

    Jeruzalmi, D; Steitz, T A

    1998-01-01

    The T7 RNA polymerase-T7 lysozyme complex regulates phage gene expression during infection of Escherichia coli. The 2.8 A crystal structure of the complex reveals that lysozyme binds at a site remote from the polymerase active site, suggesting an indirect mechanism of inhibition. Comparison of the T7 RNA polymerase structure with that of the homologous pol I family of DNA polymerases reveals identities in the catalytic site but also differences specific to RNA polymerase function. The structure of T7 RNA polymerase presented here differs significantly from a previously published structure. Sequence similarities between phage RNA polymerases and those from mitochondria and chloroplasts, when interpreted in the context of our revised model of T7 RNA polymerase, suggest a conserved fold. PMID:9670025

  5. Bypass of a psoralen DNA interstrand cross-link by DNA polymerases beta, iota, and kappa in vitro

    PubMed Central

    Smith, Leigh A.; Makarova, Alena V.; Samson, Laura; Thiesen, Katherine E.; Dhar, Alok; Bessho, Tadayoshi

    2012-01-01

    Repair of DNA inter-strand cross-links in mammalian cells involves several biochemically distinctive processes, including the release of one of the cross-linked strands and translesion DNA synthesis (TLS). In this report, we investigated in vitro TLS activity of psoralen DNA inter-strand cross-link by three DNA repair polymerases, DNA polymerase beta, kappa and iota. DNA polymerase beta is capable of bypassing a psoralen cross-link with a low efficiency. Cell extracts prepared from DNA polymerase beta knockout mouse embryonic fibroblast showed a reduced bypass activity of the psoralen cross-link and purified DNA polymerase beta restored the bypass activity. In addition, DNA polymerase iota mis-incorporated thymine across the psoralen cross-link and DNA polymerase kappa extended these mis-paired primer ends, suggesting that DNA polymerase iota may serve as an inserter and DNA polymerase kappa may play a role as an extender in the repair of psoralen DNA inter-strand cross-links. The results demonstrated here indicate that multiple DNA polymerases could participate in TLS steps in mammalian DNA inter-strand cross-link repair. PMID:23106263

  6. Modified pseudomonas oleovorans phaC1 nucleic acids encoding bispecific polyhydroxyalkanoate polymerase

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Srienc, Friedrich; Jackson, John K.; Somers, David A.

    A genetically engineered Pseudomonas oleovorans phaC1 polyhydroxyalkanoate (PHA) polymerase having tailored substrate specificity is provided. The modified PHA polymerase is preferably a "bispecific" PHA polymerase capable of copolymerizing a short chain length monomer and a medium chain length monomer is provided. Methods for making the modified PHA polymerase and for making nucleic acids encoding the modified PHA polymerase are also disclosed, as are methods of producing PHA using the modified PHA polymerase. The invention further includes methods to assay for altered substrate specificity.

  7. Polymerase chain reaction system using magnetic beads for analyzing a sample that includes nucleic acid

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Nasarabadi, Shanavaz

    2011-01-11

    A polymerase chain reaction system for analyzing a sample containing nucleic acid includes providing magnetic beads; providing a flow channel having a polymerase chain reaction chamber, a pre polymerase chain reaction magnet position adjacent the polymerase chain reaction chamber, and a post pre polymerase magnet position adjacent the polymerase chain reaction chamber. The nucleic acid is bound to the magnetic beads. The magnetic beads with the nucleic acid flow to the pre polymerase chain reaction magnet position in the flow channel. The magnetic beads and the nucleic acid are washed with ethanol. The nucleic acid in the polymerase chain reactionmore » chamber is amplified. The magnetic beads and the nucleic acid are separated into a waste stream containing the magnetic beads and a post polymerase chain reaction mix containing the nucleic acid. The reaction mix containing the nucleic acid flows to an analysis unit in the channel for analysis.« less

  8. Regional specialization in human nuclei: visualization of discrete sites of transcription by RNA polymerase III.

    PubMed Central

    Pombo, A; Jackson, D A; Hollinshead, M; Wang, Z; Roeder, R G; Cook, P R

    1999-01-01

    Mammalian nuclei contain three different RNA polymerases defined by their characteristic locations and drug sensitivities; polymerase I is found in nucleoli, and polymerases II and III in the nucleoplasm. As nascent transcripts made by polymerases I and II are concentrated in discrete sites, the locations of those made by polymerase III were investigated. HeLa cells were lysed with saponin in an improved 'physiological' buffer that preserves transcriptional activity and nuclear ultrastructure; then, engaged polymerases were allowed to extend nascent transcripts in Br-UTP, before the resulting Br-RNA was immunolabelled indirectly with fluorochromes or gold particles. Biochemical analysis showed that approximately 10 000 transcripts were being made by polymerase III at the moment of lysis, while confocal and electron microscopy showed that these transcripts were concentrated in only approximately 2000 sites (diameter approximately 40 nm). Therefore, each site contains approximately five active polymerases. These sites contain specific subunits of polymerase III, but not the hyperphosphorylated form of the largest subunit of polymerase II. The results indicate that the active forms of all three nuclear polymerases are concentrated in their own dedicated transcription sites or 'factories', suggesting that different regions of the nucleus specialize in the transcription of different types of gene. PMID:10205177

  9. A new family of polymerases related to superfamily A DNA polymerases and T7-like DNA-dependent RNA polymerases.

    PubMed

    Iyer, Lakshminarayan M; Abhiman, Saraswathi; Aravind, L

    2008-10-04

    Using sequence profile methods and structural comparisons we characterize a previously unknown family of nucleic acid polymerases in a group of mobile elements from genomes of diverse bacteria, an algal plastid and certain DNA viruses, including the recently reported Sputnik virus. Using contextual information from domain architectures and gene-neighborhoods we present evidence that they are likely to possess both primase and DNA polymerase activity, comparable to the previously reported prim-pol proteins. These newly identified polymerases help in defining the minimal functional core of superfamily A DNA polymerases and related RNA polymerases. Thus, they provide a framework to understand the emergence of both DNA and RNA polymerization activity in this class of enzymes. They also provide evidence that enigmatic DNA viruses, such as Sputnik, might have emerged from mobile elements coding these polymerases.

  10. A new family of polymerases related to superfamily A DNA polymerases and T7-like DNA-dependent RNA polymerases

    PubMed Central

    Iyer, Lakshminarayan M; Abhiman, Saraswathi; Aravind, L

    2008-01-01

    Using sequence profile methods and structural comparisons we characterize a previously unknown family of nucleic acid polymerases in a group of mobile elements from genomes of diverse bacteria, an algal plastid and certain DNA viruses, including the recently reported Sputnik virus. Using contextual information from domain architectures and gene-neighborhoods we present evidence that they are likely to possess both primase and DNA polymerase activity, comparable to the previously reported prim-pol proteins. These newly identified polymerases help in defining the minimal functional core of superfamily A DNA polymerases and related RNA polymerases. Thus, they provide a framework to understand the emergence of both DNA and RNA polymerization activity in this class of enzymes. They also provide evidence that enigmatic DNA viruses, such as Sputnik, might have emerged from mobile elements coding these polymerases. This article was reviewed by Eugene Koonin and Mark Ragan. PMID:18834537

  11. Palm Mutants in DNA Polymerases α and η Alter DNA Replication Fidelity and Translesion Activity

    PubMed Central

    Niimi, Atsuko; Limsirichaikul, Siripan; Yoshida, Shonen; Iwai, Shigenori; Masutani, Chikahide; Hanaoka, Fumio; Kool, Eric T.; Nishiyama, Yukihiro; Suzuki, Motoshi

    2004-01-01

    We isolated active mutants in Saccharomyces cerevisiae DNA polymerase α that were associated with a defect in error discrimination. Among them, L868F DNA polymerase α has a spontaneous error frequency of 3 in 100 nucleotides and 570-fold lower replication fidelity than wild-type (WT) polymerase α. In vivo, mutant DNA polymerases confer a mutator phenotype and are synergistic with msh2 or msh6, suggesting that DNA polymerase α-dependent replication errors are recognized and repaired by mismatch repair. In vitro, L868F DNA polymerase α catalyzes efficient bypass of a cis-syn cyclobutane pyrimidine dimer, extending the 3′ T 26,000-fold more efficiently than the WT. Phe34 is equivalent to residue Leu868 in translesion DNA polymerase η, and the F34L mutant of S. cerevisiae DNA polymerase η has reduced translesion DNA synthesis activity in vitro. These data suggest that high-fidelity DNA synthesis by DNA polymerase α is required for genomic stability in yeast. The data also suggest that the phenylalanine and leucine residues in translesion and replicative DNA polymerases, respectively, might have played a role in the functional evolution of these enzyme classes. PMID:15024063

  12. (1)H, (13)C, and (15)N backbone resonance assignments of the full-length 40 kDa S. acidocaldarius Y-family DNA polymerase, dinB homolog.

    PubMed

    Moro, Sean L; Cocco, Melanie J

    2015-10-01

    The dinB homolog (Dbh) is a member of the Y-family of translesion DNA polymerases, which are specialized to accurately replicate DNA across from a wide variety of lesions in living cells. Lesioned bases block the progression of high-fidelity polymerases and cause detrimental replication fork stalling; Y-family polymerases can bypass these lesions. The active site of the translesion synthesis polymerase is more open than that of a replicative polymerase; consequently Dbh polymerizes with low fidelity. Bypass polymerases also have low processivity. Short extension past the lesion allows the high-fidelity polymerase to switch back onto the site of replication. Dbh and the other Y-family polymerases have been used as structural models to investigate the mechanisms of DNA polymerization and lesion bypass. Many high-resolution crystal structures of Y-family polymerases have been reported. NMR dynamics studies can complement these structures by providing a measure of protein motions. Here we report the (15)N, (1)H, and (13)C backbone resonance assignments at two temperatures (35 and 50 °C) for Sulfolobus acidocaldarius Dbh polymerase. Backbone resonance assignments have been obtained for 86 % of the residues. The polymerase active site is assigned as well as the majority of residues in each of the four domains.

  13. Compartmentalized self-replication: a novel method for the directed evolution of polymerases and other enzymes.

    PubMed

    Ghadessy, Farid J; Holliger, Philipp

    2007-01-01

    Compartmentalized self-replication (CSR) is a novel method for the directed evolution of enzymes and, in particular, polymerases. In its simplest form, CSR consists of a simple feedback loop involving a polymerase that replicates only its own encoding gene (self-replication). Self-replication occurs in discrete, spatially separate, noncommunicating compartments formed by a heat-stable water-in-oil emulsion. Compartmentalization ensures the linkage of phenotype and genotype (i.e., it ensures that each polymerase replicates only its own encoding gene to the exclusion of those in the other compartments). As a result, adaptive gains by the polymerase directly (and proportionally) translate into genetic amplification of the encoding polymerase gene. CSR has proven to be a useful strategy for the directed evolution of polymerases directly from diverse repertoires of polymerase genes. In this chapter, we describe some of the CSR protocols used successfully to evolve variants of T. aquaticus Pol I (Taq) polymerase with novel and useful properties, such as increased thermostability or resistance to the potent inhibitor, heparin, from a repertoire of randomly mutated Taq polymerase genes.

  14. Cloning and expression of autogenes encoding RNA polymerases of T7-like bacteriophages

    DOEpatents

    Studier, F. William; Dubendorff, John W.

    1998-01-01

    This invention relates to the cloning and expression of autogenes encoding RNA polymerases of T7 and T7-like bacteriophages, in which the RNA polymerase gene is transcribed from a promoter which is recognized by the encoded RNA polymerase. Cloning of T7 autogenes was achieved by reducing the activity of the RNA polymerase sufficiently to permit host cell growth. T7 RNA polymerase activity was controlled by combining two independent methods: lac-repression of the recombinant lac operator-T7 promoter in the autogene and inhibition of the polymerase by T7 lysozyme. Expression systems for producing the RNA polymerases of T7 and other T7-like bacteriophages, and expression systems for producing selected gene products are described, as well as other related materials and methods.

  15. Poliovirus RNA polymerase: in vitro enzymatic activities, fidelity of replication, and characterization of a temperature-sensitive RNA-negative mutant

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Stokes, M.A.M.

    1985-01-01

    The in vitro activities of the purified poliovirus RNA polymerase were investigated in this study. The polymerase was shown to be a strict RNA dependent RNA polymerase. It only copied RNA templates but used either a DNA or RNA primer to initiate RNA synthesis. Partially purified polymerase has some DNA polymerase activities. Additional purification of the enzyme and studies with a mutant poliovirus RNA polymerase indicated that the DNA polymerase activities were due to a cellular polymerase. The fidelity of RNA replication in vitro by the purified poliovirus RNA polymerase was studied by measuring the rate of misincorporation of noncomplementarymore » ribonucleotide monophosphates on synthetic homopolymeric RNA templates. The results showed that the ratio of noncomplementary to complementary ribonucleotides incorporated was 1-5 x 10/sup -3/. The viral polymerase of a poliovirus temperature sensitive RNA-negative mutant, Ts 10, was isolated. This study confirmed that the mutant was viable 33/sup 0/, but was RNA negative at 39/sup 0/. Characterization of the Ts 10 polymerase showed it was significantly more sensitive to heat inactivation than was the old-type polymerase. Highly purified poliovirions were found to contain several noncapsid proteins. At least two of these proteins were labeled by (/sup 35/S)methionine infected cells and appeared to be virally encoded proteins. One of these proteins was immunoprecipitated by anti-3B/sup vpg/ antiserum. This protein had the approximate Mr = 50,000 and appeared to be one of the previously identified 3B/sup vpg/ precursor proteins.« less

  16. Pseudomonas aeruginosa phage PaP1 DNA polymerase is an A-family DNA polymerase demonstrating ssDNA and dsDNA 3'-5' exonuclease activity.

    PubMed

    Liu, Binyan; Gu, Shiling; Liang, Nengsong; Xiong, Mei; Xue, Qizhen; Lu, Shuguang; Hu, Fuquan; Zhang, Huidong

    2016-08-01

    Most phages contain DNA polymerases, which are essential for DNA replication and propagation in infected host bacteria. However, our knowledge on phage-encoded DNA polymerases remains limited. This study investigated the function of a novel DNA polymerase of PaP1, which is the lytic phage of Pseudomonas aeruginosa. PaP1 encodes its sole DNA polymerase called Gp90 that was predicted as an A-family DNA polymerase with polymerase and 3'-5' exonuclease activities. The sequence of Gp90 is homologous but not identical to that of other A-family DNA polymerases, such as T7 DNA polymerases (Pol) and DNA Pol I. The purified Gp90 demonstrated a polymerase activity. The processivity of Gp90 in DNA replication and its efficiency in single-dNTP incorporation are similar to those of T7 Pol with processive thioredoxin (T7 Pol/trx). Gp90 can degrade ssDNA and dsDNA in 3'-5' direction at a similar rate, which is considerably lower than that of T7 Pol/trx. The optimized conditions for polymerization were a temperature of 37 °C and a buffer consisting of 40 mM Tris-HCl (pH 8.0), 30 mM MgCl2, and 200 mM NaCl. These studies on DNA polymerase encoded by PaP1 help advance our knowledge on phage-encoded DNA polymerases and elucidate PaP1 propagation in infected P. aeruginosa.

  17. Recent Insight into the Kinetic Mechanisms and Conformational Dynamics of Y-Family DNA Polymerases

    PubMed Central

    2015-01-01

    The kinetic mechanisms by which DNA polymerases catalyze DNA replication and repair have long been areas of active research. Recently discovered Y-family DNA polymerases catalyze the bypass of damaged DNA bases that would otherwise block replicative DNA polymerases and stall replication forks. Unlike DNA polymerases from the five other families, the Y-family DNA polymerases have flexible, solvent-accessible active sites that are able to tolerate various types of damaged template bases and allow for efficient lesion bypass. Their promiscuous active sites, however, also lead to fidelities that are much lower than those observed for other DNA polymerases and give rise to interesting mechanistic properties. Additionally, the Y-family DNA polymerases have several other unique structural features and undergo a set of conformational changes during substrate binding and catalysis different from those observed for replicative DNA polymerases. In recent years, pre-steady-state kinetic methods have been extensively employed to reveal a wealth of information about the catalytic properties of these fascinating noncanonical DNA polymerases. Here, we review many of the recent findings on the kinetic mechanisms of DNA polymerization with undamaged and damaged DNA substrates by the Y-family DNA polymerases, and the conformational dynamics employed by these error-prone enzymes during catalysis. PMID:24716482

  18. Protein Affinity Chromatography with Purified Yeast DNA Polymerase α Detects Proteins that Bind to DNA Polymerase

    NASA Astrophysics Data System (ADS)

    Miles, Jeff; Formosa, Tim

    1992-02-01

    We have overexpressed the POL1 gene of the yeast Saccharomyces cerevisiae and purified the resulting DNA polymerase α polypeptide in an apparently intact form. We attached the purified DNA polymerase covalently to an agarose matrix and used this matrix to chromatograph extracts prepared from yeast cells. At least six proteins bound to the yeast DNA polymerase α matrix that did not bind to a control matrix. We speculate that these proteins might be DNA polymerase α accessory proteins. Consistent with this interpretation, one of the binding proteins, which we have named POB1 (polymerase one binding), is required for normal chromosome transmission. Mutations in this gene cause increased chromosome loss and an abnormal cell morphology, phenotypes that also occur in the presence of mutations in the yeast α or δ polymerase genes. These results suggest that the interactions detected by polymerase affinity chromatography are biologically relevant and may help to illuminate the architecture of the eukaryotic DNA replication machinery.

  19. Cloning and expression of autogenes encoding RNA polymerases of T7-like bacteriophages

    DOEpatents

    Studier, F.W.; Dubendorff, J.W.

    1998-10-20

    This invention relates to the cloning and expression of autogenes encoding RNA polymerases of T7 and T7-like bacteriophages, in which the RNA polymerase gene is transcribed from a promoter which is recognized by the encoded RNA polymerase. Cloning of T7 autogenes was achieved by reducing the activity of the RNA polymerase sufficiently to permit host cell growth. T7 RNA polymerase activity was controlled by combining two independent methods: lac-repression of the recombinant lac operator-T7 promoter in the autogene and inhibition of the polymerase by T7 lysozyme. Expression systems for producing the RNA polymerases of T7 and other T7-like bacteriophages, and expression systems for producing selected gene products are described, as well as other related materials and methods. 12 figs.

  20. Cloning and expression of autogenes encoding RNA polymerases of T7-like bacteriophages

    DOEpatents

    Studier, F.W.; Dubendorff, J.W.

    1998-11-03

    This invention relates to the cloning and expression of autogenes encoding RNA polymerases of T7 and T7-like bacteriophages, in which the RNA polymerase gene is transcribed from a promoter which is recognized by the encoded RNA polymerase. Cloning of T7 autogenes was achieved by reducing the activity of the RNA polymerase sufficiently to permit host cell growth. T7 RNA polymerase activity was controlled by combining two independent methods: lac-repression of the recombinant lac operator-T7 promoter in the autogene and inhibition of the polymerase by T7 lysozyme. Expression systems for producing the RNA polymerases of T7 and other T7-like bacteriophages, and expression systems for producing selected gene products are described, as well as other related materials and methods. 12 figs.

  1. DNA polymerase having modified nucleotide binding site for DNA sequencing

    DOEpatents

    Tabor, Stanley; Richardson, Charles

    1997-01-01

    Modified gene encoding a modified DNA polymerase wherein the modified polymerase incorporates dideoxynucleotides at least 20-fold better compared to the corresponding deoxynucleotides as compared with the corresponding naturally-occurring DNA polymerase.

  2. Comparison of histopathology and real-time polymerase chain reaction (RT-PCR) for detection of Mycobacterium tuberculosis in fistula-in-ano.

    PubMed

    Garg, Pankaj

    2017-07-01

    Histopathology is commonly used to diagnose tuberculosis in fistula-in-ano. The aim was to compare the sensitivity of polymerase chain reaction and histopathology in detecting tuberculosis in fistula-in-ano. The histopathology and polymerase chain-reaction of tissue (fistula tract) was done in all the consecutive operated cases. When pus sample was also available, polymerase chain reaction-pus was also done RESULTS: Three hundred forty seven samples (179 patients) were tested over 2 years (median 6.5 months). The mean age was 38.8 ± 10.7 years, and male/female was 170/9. Histopathology and polymerase chain reaction of tissue (fistula tract) was done in 152 and 165 patients, respectively. Polymerase chain reaction (pus) could be done in 30 patients. Overall, tuberculosis was detected in 20/179 (11.2%) patients. Of these, tuberculosis was detected by histopathology (tissue) in 1/152 (0.7%) and by polymerase chain reaction (tissue) in 14/165 (8.5%) patients. In pus, polymerase chain reaction detected tuberculosis in 6/30 (20%) patients. Both polymerase chain reaction of tissue and pus were positive in one patient. Polymerase chain reaction (tissue) and polymerase chain reaction (pus) were significantly more sensitive than histopathology (tissue) for detecting tuberculosis [histopathology 1/152 vs. polymerase chain reaction (tissue) 14/165, p = 0.0009] [histopathology 1/152 vs. polymerase chain reaction (pus) 6/30, p < 0.0001]. In 20 patients detected to have tuberculosis, four drug anti-tubercular therapy was recommended for 6 months. The therapy was completed in 13 patients and 12/13 (92.3%) were cured. The therapy is continuing in 3/20 patients. Four patients did not take the therapy. None of them was cured. Polymerase chain reaction was significantly more sensitive than histopathology in detecting tuberculosis in fistula-in-ano. Histopathology might be missing out tuberculosis in many patients leading to recurrence of the fistula.

  3. DNA polymerase preference determines PCR priming efficiency.

    PubMed

    Pan, Wenjing; Byrne-Steele, Miranda; Wang, Chunlin; Lu, Stanley; Clemmons, Scott; Zahorchak, Robert J; Han, Jian

    2014-01-30

    Polymerase chain reaction (PCR) is one of the most important developments in modern biotechnology. However, PCR is known to introduce biases, especially during multiplex reactions. Recent studies have implicated the DNA polymerase as the primary source of bias, particularly initiation of polymerization on the template strand. In our study, amplification from a synthetic library containing a 12 nucleotide random portion was used to provide an in-depth characterization of DNA polymerase priming bias. The synthetic library was amplified with three commercially available DNA polymerases using an anchored primer with a random 3' hexamer end. After normalization, the next generation sequencing (NGS) results of the amplified libraries were directly compared to the unamplified synthetic library. Here, high throughput sequencing was used to systematically demonstrate and characterize DNA polymerase priming bias. We demonstrate that certain sequence motifs are preferred over others as primers where the six nucleotide sequences at the 3' end of the primer, as well as the sequences four base pairs downstream of the priming site, may influence priming efficiencies. DNA polymerases in the same family from two different commercial vendors prefer similar motifs, while another commercially available enzyme from a different DNA polymerase family prefers different motifs. Furthermore, the preferred priming motifs are GC-rich. The DNA polymerase preference for certain sequence motifs was verified by amplification from single-primer templates. We incorporated the observed DNA polymerase preference into a primer-design program that guides the placement of the primer to an optimal location on the template. DNA polymerase priming bias was characterized using a synthetic library amplification system and NGS. The characterization of DNA polymerase priming bias was then utilized to guide the primer-design process and demonstrate varying amplification efficiencies among three commercially available DNA polymerases. The results suggest that the interaction of the DNA polymerase with the primer:template junction during the initiation of DNA polymerization is very important in terms of overall amplification bias and has broader implications for both the primer design process and multiplex PCR.

  4. Error Rate Comparison during Polymerase Chain Reaction by DNA Polymerase

    DOE PAGES

    McInerney, Peter; Adams, Paul; Hadi, Masood Z.

    2014-01-01

    As larger-scale cloning projects become more prevalent, there is an increasing need for comparisons among high fidelity DNA polymerases used for PCR amplification. All polymerases marketed for PCR applications are tested for fidelity properties (i.e., error rate determination) by vendors, and numerous literature reports have addressed PCR enzyme fidelity. Nonetheless, it is often difficult to make direct comparisons among different enzymes due to numerous methodological and analytical differences from study to study. We have measured the error rates for 6 DNA polymerases commonly used in PCR applications, including 3 polymerases typically used for cloning applications requiring high fidelity. Error ratemore » measurement values reported here were obtained by direct sequencing of cloned PCR products. The strategy employed here allows interrogation of error rate across a very large DNA sequence space, since 94 unique DNA targets were used as templates for PCR cloning. The six enzymes included in the study, Taq polymerase, AccuPrime-Taq High Fidelity, KOD Hot Start, cloned Pfu polymerase, Phusion Hot Start, and Pwo polymerase, we find the lowest error rates with Pfu , Phusion, and Pwo polymerases. Error rates are comparable for these 3 enzymes and are >10x lower than the error rate observed with Taq polymerase. Mutation spectra are reported, with the 3 high fidelity enzymes displaying broadly similar types of mutations. For these enzymes, transition mutations predominate, with little bias observed for type of transition.« less

  5. Cooperation between Catalytic and DNA-binding Domains Enhances Thermostability and Supports DNA Synthesis at Higher Temperatures by Thermostable DNA Polymerases

    PubMed Central

    Pavlov, Andrey R.; Pavlova, Nadejda V.; Kozyavkin, Sergei A.; Slesarev, Alexei I.

    2012-01-01

    We have previously introduced a general kinetic approach for comparative study of processivity, thermostability, and resistance to inhibitors of DNA polymerases (Pavlov et. al., (2002) Proc. Natl. Acad. Sci. USA 99, 13510–13515). The proposed method was successfully applied to characterize hybrid DNA polymerases created by fusing catalytic DNA polymerase domains with various non-specific DNA binding domains. Here we use the developed kinetic analysis to assess basic parameters of DNA elongation by DNA polymerases and to further study the interdomain interactions in both previously constructed and new chimeric DNA polymerases. We show that connecting Helix-hairpin-Helix (HhH) domains to catalytic polymerase domains can increase thermostability, not only of DNA polymerases from extremely thermophilic species, but also of the enzyme from a faculatative thermophilic bacterium Bacillus stearothermophilus. We also demonstrate that addition of TopoV HhH domains extends efficient DNA synthesis by chimerical polymerases up to 105°C by maintaining processivity of DNA synthesis at high temperatures. We also found that reversible high-temperature structural transitions in DNA polymerases decrease the rates of binding of these enzymes to the templates. Furthermore, activation energies and pre-exponential factors of the Arrhenius equation suggest that the mechanism of electrostatic enhancement of diffusion-controlled association plays a minor role in binding templates to DNA polymerases. PMID:22320201

  6. Directed evolution of polymerase function by compartmentalized self-replication.

    PubMed

    Ghadessy, F J; Ong, J L; Holliger, P

    2001-04-10

    We describe compartmentalized self-replication (CSR), a strategy for the directed evolution of enzymes, especially polymerases. CSR is based on a simple feedback loop consisting of a polymerase that replicates only its own encoding gene. Compartmentalization serves to isolate individual self-replication reactions from each other. In such a system, adaptive gains directly (and proportionally) translate into genetic amplification of the encoding gene. CSR has applications in the evolution of polymerases with novel and useful properties. By using three cycles of CSR, we obtained variants of Taq DNA polymerase with 11-fold higher thermostability than the wild-type enzyme or with a >130-fold increased resistance to the potent inhibitor heparin. Insertion of an extra stage into the CSR cycle before the polymerase reaction allows its application to enzymes other than polymerases. We show that nucleoside diphosphate kinase and Taq polymerase can form such a cooperative CSR cycle based on reciprocal catalysis, whereby nucleoside diphosphate kinase produces the substrates required for the replication of its own gene. We also find that in CSR the polymerase genes themselves evolve toward more efficient replication. Thus, polymerase genes and their encoded polypeptides cooperate to maximize postselection copy number. CSR should prove useful for the directed evolution of enzymes, particularly DNA or RNA polymerases, as well as for the design and study of in vitro self-replicating systems mimicking prebiotic evolution and viral replication.

  7. Analysis of the Mutations in the Active Site of the RNA-Dependent RNA Polymerase of Human Parainfluenza Virus Type 3 (HPIV3)

    PubMed Central

    Malur, Achut G.; Gupta, Neera K.; De, Bishnu P.; Banerjee, Amiya K.

    2002-01-01

    The large protein (L) of the human parainfluenza virus type 3 (HPIV3) is the functional RNA-dependent RNA polymerase, which possesses highly conserved residues QGDNQ located within motif C of domain III comprising the putative polymerase active site. We have characterized the role of the QGDNQ residues as well as the residues flanking this region in the polymerase activity of the L protein by site-directed mutagenesis and examining the polymerase activity of the wild-type and mutant L proteins by an in vivo minigenome replication assay and an in vitro mRNA transcription assay. All mutations in the QGDNQ residues abolished transcription while mutations in the flanking residues gave rise to variable polymerase activities. These observations support the contention that the QGDNQ sequence is absolutely required for the polymerase activity of the HPIV3 RNA-dependent RNA polymerase. PMID:12064576

  8. DNA polymerase gamma from Xenopus laevis. I. The identification of a high molecular weight catalytic subunit by a novel DNA polymerase photolabeling procedure

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Insdorf, N.F.; Bogenhagen, D.F.

    1989-12-25

    DNA polymerase gamma has been purified over 10,000-fold from mitochondria of Xenopus laevis ovaries. We have developed a novel technique which specifically photolabels DNA polymerases. This procedure, the DNA polymerase trap, was used to identify a catalytic subunit of 140,000 Da from X. laevis DNA polymerase gamma. Additional catalytically active polypeptides of 100,000 and 55,000 Da were identified in the highly purified enzyme. These appear to be products of degradation of the 140,000-Da subunit. The DNA polymerase trap, which does not require large amounts of enzyme or renaturation from sodium dodecyl sulfate, is an alternative to the classic activity gel.

  9. New Deoxyribonucleic Acid Polymerase Induced by Bacillus subtilis Bacteriophage PBS2

    PubMed Central

    Price, Alan R.; Cook, Sandra J.

    1972-01-01

    The deoxyribonucleic acid (DNA) of Bacillus subtilis phage PBS2 has been confirmed to contain uracil instead of thymine. PBS2 phage infection of wild-type cells or DNA polymerase-deficient cells results in an increase in the specific activity of DNA polymerase. This induction of DNA polymerase activity is prevented by actinomycin D and chloramphenicol. In contrast to the major B. subtilis DNA polymerase, which prefers deoxythymidine triphosphate (dTTP) to deoxyuridine triphosphate (dUTP), the DNA polymerase in crude extracts of PBS2-infected cells is equally active whether dTTP or dUTP is employed. This phage-induced polymerase may be responsible for the synthesis of uracil-containing DNA during PBS2 phage infection. PMID:4623224

  10. DNA polymerase having modified nucleotide binding site for DNA sequencing

    DOEpatents

    Tabor, S.; Richardson, C.

    1997-03-25

    A modified gene encoding a modified DNA polymerase is disclosed. The modified polymerase incorporates dideoxynucleotides at least 20-fold better compared to the corresponding deoxynucleotides as compared with the corresponding naturally-occurring DNA polymerase. 6 figs.

  11. Family A and B DNA Polymerases in Cancer: Opportunities for Therapeutic Interventions

    PubMed Central

    Shanbhag, Vinit; Sachdev, Shrikesh; Flores, Jacqueline A.; Modak, Mukund J.; Singh, Kamalendra

    2018-01-01

    DNA polymerases are essential for genome replication, DNA repair and translesion DNA synthesis (TLS). Broadly, these enzymes belong to two groups: replicative and non-replicative DNA polymerases. A considerable body of data suggests that both groups of DNA polymerases are associated with cancer. Many mutations in cancer cells are either the result of error-prone DNA synthesis by non-replicative polymerases, or the inability of replicative DNA polymerases to proofread mismatched nucleotides due to mutations in 3′-5′ exonuclease activity. Moreover, non-replicative, TLS-capable DNA polymerases can negatively impact cancer treatment by synthesizing DNA past lesions generated from treatments such as cisplatin, oxaliplatin, etoposide, bleomycin, and radiotherapy. Hence, the inhibition of DNA polymerases in tumor cells has the potential to enhance treatment outcomes. Here, we review the association of DNA polymerases in cancer from the A and B families, which participate in lesion bypass, and conduct gene replication. We also discuss possible therapeutic interventions that could be used to maneuver the role of these enzymes in tumorigenesis. PMID:29301327

  12. DNA polymerase ζ cooperates with polymerases κ and ι in translesion DNA synthesis across pyrimidine photodimers in cells from XPV patients

    PubMed Central

    Ziv, Omer; Geacintov, Nicholas; Nakajima, Satoshi; Yasui, Akira; Livneh, Zvi

    2009-01-01

    Human cells tolerate UV-induced cyclobutane pyrimidine dimers (CPD) by translesion DNA synthesis (TLS), carried out by DNA polymerase η, the POLH gene product. A deficiency in DNA polymerase η due to germ-line mutations in POLH causes the hereditary disease xeroderma pigmentosum variant (XPV), which is characterized by sunlight sensitivity and extreme predisposition to sunlight-induced skin cancer. XPV cells are UV hypermutable due to the activity of mutagenic TLS across CPD, which explains the cancer predisposition of the patients. However, the identity of the backup polymerase that carries out this mutagenic TLS was unclear. Here, we show that DNA polymerase ζ cooperates with DNA polymerases κ and ι to carry out error-prone TLS across a TT CPD. Moreover, DNA polymerases ζ and κ, but not ι, protect XPV cells against UV cytotoxicity, independently of nucleotide excision repair. This presents an extreme example of benefit-risk balance in the activity of TLS polymerases, which provide protection against UV cytotoxicity at the cost of increased mutagenic load. PMID:19564618

  13. DNA polymerase zeta cooperates with polymerases kappa and iota in translesion DNA synthesis across pyrimidine photodimers in cells from XPV patients.

    PubMed

    Ziv, Omer; Geacintov, Nicholas; Nakajima, Satoshi; Yasui, Akira; Livneh, Zvi

    2009-07-14

    Human cells tolerate UV-induced cyclobutane pyrimidine dimers (CPD) by translesion DNA synthesis (TLS), carried out by DNA polymerase eta, the POLH gene product. A deficiency in DNA polymerase eta due to germ-line mutations in POLH causes the hereditary disease xeroderma pigmentosum variant (XPV), which is characterized by sunlight sensitivity and extreme predisposition to sunlight-induced skin cancer. XPV cells are UV hypermutable due to the activity of mutagenic TLS across CPD, which explains the cancer predisposition of the patients. However, the identity of the backup polymerase that carries out this mutagenic TLS was unclear. Here, we show that DNA polymerase zeta cooperates with DNA polymerases kappa and iota to carry out error-prone TLS across a TT CPD. Moreover, DNA polymerases zeta and kappa, but not iota, protect XPV cells against UV cytotoxicity, independently of nucleotide excision repair. This presents an extreme example of benefit-risk balance in the activity of TLS polymerases, which provide protection against UV cytotoxicity at the cost of increased mutagenic load.

  14. Influence of DNA Lesions on Polymerase-Mediated DNA Replication at Single-Molecule Resolution.

    PubMed

    Gahlon, Hailey L; Romano, Louis J; Rueda, David

    2017-11-20

    Faithful replication of DNA is a critical aspect in maintaining genome integrity. DNA polymerases are responsible for replicating DNA, and high-fidelity polymerases do this rapidly and at low error rates. Upon exposure to exogenous or endogenous substances, DNA can become damaged and this can alter the speed and fidelity of a DNA polymerase. In this instance, DNA polymerases are confronted with an obstacle that can result in genomic instability during replication, for example, by nucleotide misinsertion or replication fork collapse. It is important to know how DNA polymerases respond to damaged DNA substrates to understand the mechanism of mutagenesis and chemical carcinogenesis. Single-molecule techniques have helped to improve our current understanding of DNA polymerase-mediated DNA replication, as they enable the dissection of mechanistic details that can otherwise be lost in ensemble-averaged experiments. These techniques have also been used to gain a deeper understanding of how single DNA polymerases behave at the site of the damage in a DNA substrate. In this review, we evaluate single-molecule studies that have examined the interaction between DNA polymerases and damaged sites on a DNA template.

  15. Fluorescence resonance energy transfer analysis of escherichia coli RNA polymerase and polymerase-DNA complexes.

    PubMed

    Heyduk, T; Niedziela-Majka, A

    Fluorescence resonance energy transfer (FRET) is a technique allowing measurements of atomic-scale distances in diluted solutions of macromolecules under native conditions. This feature makes FRET a powerful tool to study complicated biological assemblies. In this report we review the applications of FRET to studies of transcription initiation by Escherichia coli RNA polymerase. The versatility of FRET for studies of a large macromolecular assembly such as RNA polymerase is illustrated by examples of using FRET to address several different aspects of transcription initiation by polymerase. FRET has been used to determine the architecture of polymerase, its complex with single-stranded DNA, and the conformation of promoter fragment bound to polymerase. FRET has been also used as a binding assay to determine the thermodynamics of promoter DNA fragment binding to the polymerase. Functional conformational changes in the specificity subunit of polymerase responsible for the modulation of the promoter binding activity of the enzyme and the mechanistic aspects of the transition from the initiation to the elongation complex were also investigated. Copyright 2002 Wiley Periodicals, Inc.

  16. A nucleotide binding rectification Brownian ratchet model for translocation of Y-family DNA polymerases

    PubMed Central

    2011-01-01

    Y-family DNA polymerases are characterized by low-fidelity synthesis on undamaged DNA and ability to catalyze translesion synthesis over the damaged DNA. Their translocation along the DNA template is an important event during processive DNA synthesis. In this work we present a Brownian ratchet model for this translocation, where the directed translocation is rectified by the nucleotide binding to the polymerase. Using the model, different features of the available structures for Dpo4, Dbh and polymerase ι in binary and ternary forms can be easily explained. Other dynamic properties of the Y-family polymerases such as the fast translocation event upon dNTP binding for Dpo4 and the considerable variations of the processivity among the polymerases can also be well explained by using the model. In addition, some predicted results of the DNA synthesis rate versus the external force acting on Dpo4 and Dbh polymerases are presented. Moreover, we compare the effect of the external force on the DNA synthesis rate of the Y-family polymerase with that of the replicative DNA polymerase. PMID:21699732

  17. RNA binding and replication by the poliovirus RNA polymerase

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Oberste, M.S.

    1988-01-01

    RNA binding and RNA synthesis by the poliovirus RNA-dependent RNA polymerase were studied in vitro using purified polymerase. Templates for binding and RNA synthesis studies were natural RNAs, homopolymeric RNAs, or subgenomic poliovirus-specific RNAs synthesized in vitro from cDNA clones using SP6 or T7 RNA polymerases. The binding of the purified polymerase to poliovirion and other RNAs was studied using a protein-RNA nitrocellulose filter binding assay. A cellular poly(A)-binding protein was found in the viral polymerase preparations, but was easily separated from the polymerase by chromatography on poly(A) Sepharose. The binding of purified polymerase to {sup 32}P-labeled ribohomopolymeric RNAs wasmore » examined, and the order of binding observed was poly(G) >>> poly(U) > poly(C) > poly(A). The K{sub a} for polymerase binding to poliovirion RNA and to a full-length negative strand transcript was about 1 {times} 10{sup 9} M{sup {minus}1}. The polymerase binds to a subgenomic RNAs which contain the 3{prime} end of the genome with a K{sub a} similar to that for virion RNA, but binds less well to 18S rRNA, globin mRNA, and subgenomic RNAs which lack portions of the 3{prime} noncoding region.« less

  18. Cloning and expression of autogenes encoding RNA poly,erases of T7-like bacteriophages

    DOEpatents

    Studier, F. William; Dubendorff, John W.

    1998-01-01

    This invention relates to the cloning and expression of autogenes encoding RNA polymerases of T7 and T7-like bacteriophages, in which the RNA polymerase gene is transcribed from a promoter which is recognized by the encoded RNA polymerase. Cloning of T7 autogenes was achieved by reducing the activity of the RNA polymerase sufficiently to permit host cell growth. T7 RNA polymerase activity was controlled by combining two independent methods: lac-repression of the recombinant lac operator-T7 promoter in the autogene and inhibition of the polymerase by T7 lysozyme. Expression systems for producing the RNA polymerases of T7 and other T7-like bacteriophages, and expression systems for producing selected gene products are described, as well as other related materials and methods.

  19. Initiation, extension, and termination of RNA synthesis by a paramyxovirus polymerase.

    PubMed

    Jordan, Paul C; Liu, Cheng; Raynaud, Pauline; Lo, Michael K; Spiropoulou, Christina F; Symons, Julian A; Beigelman, Leo; Deval, Jerome

    2018-02-01

    Paramyxoviruses represent a family of RNA viruses causing significant human diseases. These include measles virus, the most infectious virus ever reported, in addition to parainfluenza virus, and other emerging viruses. Paramyxoviruses likely share common replication machinery but their mechanisms of RNA biosynthesis activities and details of their complex polymerase structures are unknown. Mechanistic and functional details of a paramyxovirus polymerase would have sweeping implications for understanding RNA virus replication and for the development of new antiviral medicines. To study paramyxovirus polymerase structure and function, we expressed an active recombinant Nipah virus (NiV) polymerase complex assembled from the multifunctional NiV L protein bound to its phosphoprotein cofactor. NiV is an emerging highly pathogenic virus that causes severe encephalitis and has been declared a global public health concern due to its high mortality rate. Using negative-stain electron microscopy, we demonstrated NiV polymerase forms ring-like particles resembling related RNA polymerases. We identified conserved sequence elements driving recognition of the 3'-terminal genomic promoter by NiV polymerase, and leading to initiation of RNA synthesis, primer extension, and transition to elongation mode. Polyadenylation resulting from NiV polymerase stuttering provides a mechanistic basis for transcription termination. It also suggests a divergent adaptation in promoter recognition between pneumo- and paramyxoviruses. The lack of available antiviral therapy for NiV prompted us to identify the triphosphate forms of R1479 and GS-5734, two clinically relevant nucleotide analogs, as substrates and inhibitors of NiV polymerase activity by delayed chain termination. Overall, these findings provide low-resolution structural details and the mechanism of an RNA polymerase from a previously uncharacterized virus family. This work illustrates important functional differences yet remarkable similarities between the polymerases of nonsegmented negative-strand RNA viruses.

  20. Genetic and codon usage bias analyses of polymerase genes of equine influenza virus and its relation to evolution.

    PubMed

    Bera, Bidhan Ch; Virmani, Nitin; Kumar, Naveen; Anand, Taruna; Pavulraj, S; Rash, Adam; Elton, Debra; Rash, Nicola; Bhatia, Sandeep; Sood, Richa; Singh, Raj Kumar; Tripathi, Bhupendra Nath

    2017-08-23

    Equine influenza is a major health problem of equines worldwide. The polymerase genes of influenza virus have key roles in virus replication, transcription, transmission between hosts and pathogenesis. Hence, the comprehensive genetic and codon usage bias of polymerase genes of equine influenza virus (EIV) were analyzed to elucidate the genetic and evolutionary relationships in a novel perspective. The group - specific consensus amino acid substitutions were identified in all polymerase genes of EIVs that led to divergence of EIVs into various clades. The consistent amino acid changes were also detected in the Florida clade 2 EIVs circulating in Europe and Asia since 2007. To study the codon usage patterns, a total of 281,324 codons of polymerase genes of EIV H3N8 isolates from 1963 to 2015 were systemically analyzed. The polymerase genes of EIVs exhibit a weak codon usage bias. The ENc-GC3s and Neutrality plots indicated that natural selection is the major influencing factor of codon usage bias, and that the impact of mutation pressure is comparatively minor. The methods for estimating host imposed translation pressure suggested that the polymerase acidic (PA) gene seems to be under less translational pressure compared to polymerase basic 1 (PB1) and polymerase basic 2 (PB2) genes. The multivariate statistical analysis of polymerase genes divided EIVs into four evolutionary diverged clusters - Pre-divergent, Eurasian, Florida sub-lineage 1 and 2. Various lineage specific amino acid substitutions observed in all polymerase genes of EIVs and especially, clade 2 EIVs underwent major variations which led to the emergence of a phylogenetically distinct group of EIVs originating from Richmond/1/07. The codon usage bias was low in all the polymerase genes of EIVs that was influenced by the multiple factors such as the nucleotide compositions, mutation pressure, aromaticity and hydropathicity. However, natural selection was the major influencing factor in defining the codon usage patterns and evolution of polymerase genes of EIVs.

  1. Effect of pH on the Misincorporation Rate of DNA Polymerase η.

    PubMed

    Nishimoto, Naomi; Suzuki, Motoshi; Izuta, Shunji

    2016-01-01

    The many known eukaryotic DNA polymerases are classified into four families; A, B, X, and Y. Among them, DNA polymerase η, a Y family polymerase, is a low fidelity enzyme that contributes to translesional synthesis and somatic hypermutation. Although a high mutation frequency is observed in immunoglobulin genes, translesional synthesis occurs with a high accuracy. We determined whether the misincorporation rate of DNA polymerase η varies with ambient conditions. It has been reported that DNA polymerase η is unable to exclude water molecules from the active site. This finding suggests that some ions affect hydrogen bond formation at the active site. We focused on the effect of pH and evaluated the misincorporation rate of deoxyguanosine triphosphate (dGTP) opposite template T by DNA polymerase η at various pH levels with a synthetic template-primer. The misincorporation rate of dGTP by DNA polymerase η drastically increased at pH 8.0-9.0 compared with that at pH 6.5-7.5. Kinetic analysis revealed that the Km value for dGTP on the misincorporation opposite template T was markedly affected by pH. However, this drastic change was not seen with the low fidelity DNA polymerase α.

  2. Uracil recognition by replicative DNA polymerases is limited to the archaea, not occurring with bacteria and eukarya.

    PubMed

    Wardle, Josephine; Burgers, Peter M J; Cann, Isaac K O; Darley, Kate; Heslop, Pauline; Johansson, Erik; Lin, Li-Jung; McGlynn, Peter; Sanvoisin, Jonathan; Stith, Carrie M; Connolly, Bernard A

    2008-02-01

    Family B DNA polymerases from archaea such as Pyrococcus furiosus, which live at temperatures approximately 100 degrees C, specifically recognize uracil in DNA templates and stall replication in response to this base. Here it is demonstrated that interaction with uracil is not restricted to hyperthermophilic archaea and that the polymerase from mesophilic Methanosarcina acetivorans shows identical behaviour. The family B DNA polymerases replicate the genomes of archaea, one of the three fundamental domains of life. This publication further shows that the DNA replicating polymerases from the other two domains, bacteria (polymerase III) and eukaryotes (polymerases delta and epsilon for nuclear DNA and polymerase gamma for mitochondrial) are also unable to recognize uracil. Uracil occurs in DNA as a result of deamination of cytosine, either in G:C base-pairs or, more rapidly, in single stranded regions produced, for example, during replication. The resulting G:U mis-pairs/single stranded uracils are promutagenic and, unless repaired, give rise to G:C to A:T transitions in 50% of the progeny. The confinement of uracil recognition to polymerases of the archaeal domain is discussed in terms of the DNA repair pathways necessary for the elimination of uracil.

  3. Homology between DNA polymerases of poxviruses, herpesviruses, and adenoviruses: nucleotide sequence of the vaccinia virus DNA polymerase gene.

    PubMed Central

    Earl, P L; Jones, E V; Moss, B

    1986-01-01

    A 5400-base-pair segment of the vaccinia virus genome was sequenced and an open reading frame of 938 codons was found precisely where the DNA polymerase had been mapped by transfer of a phosphonoacetate-resistance marker. A single nucleotide substitution changing glycine at position 347 to aspartic acid accounts for the drug resistance of the mutant vaccinia virus. The 5' end of the DNA polymerase mRNA was located 80 base pairs before the methionine codon initiating the open reading frame. Correspondence between the predicted Mr 108,577 polypeptide and the 110,000 purified enzyme indicates that little or no proteolytic processing occurs. Extensive homology, extending over 435 amino acids, was found upon comparing the DNA polymerase of vaccinia virus and DNA polymerase of Epstein-Barr virus. A highly conserved sequence of 14 amino acids in the carboxyl-terminal regions of the above DNA polymerases is also present at a similar location in adenovirus DNA polymerase. This structure, which is predicted to form a turn flanked by beta-pleated sheets, may form part of an essential binding or catalytic site that accounts for its presence in DNA polymerases of poxviruses, herpesviruses, and adenoviruses. Images PMID:3012524

  4. T7-RNA Polymerase

    NASA Technical Reports Server (NTRS)

    1997-01-01

    T7-RNA Polymerase grown on STS-81. Structure-Function Relationships of RNA Polymerase: DNA-dependent RNA polymerase is the key enzyme responsible for the biosynthesis of RNA, a process known as transcription. Principal Investigator's include Dr. Dan Carter, Dr. B.C. Wang, and Dr. John Rose of New Century Pharmaceuticals.

  5. The Proliferating Cell Nuclear Antigen (PCNA)-interacting Protein (PIP) Motif of DNA Polymerase η Mediates Its Interaction with the C-terminal Domain of Rev1*

    PubMed Central

    Boehm, Elizabeth M.; Powers, Kyle T.; Kondratick, Christine M.; Spies, Maria; Houtman, Jon C. D.; Washington, M. Todd

    2016-01-01

    Y-family DNA polymerases, such as polymerase η, polymerase ι, and polymerase κ, catalyze the bypass of DNA damage during translesion synthesis. These enzymes are recruited to sites of DNA damage by interacting with the essential replication accessory protein proliferating cell nuclear antigen (PCNA) and the scaffold protein Rev1. In most Y-family polymerases, these interactions are mediated by one or more conserved PCNA-interacting protein (PIP) motifs that bind in a hydrophobic pocket on the front side of PCNA as well as by conserved Rev1-interacting region (RIR) motifs that bind in a hydrophobic pocket on the C-terminal domain of Rev1. Yeast polymerase η, a prototypical translesion synthesis polymerase, binds both PCNA and Rev1. It possesses a single PIP motif but not an RIR motif. Here we show that the PIP motif of yeast polymerase η mediates its interactions both with PCNA and with Rev1. Moreover, the PIP motif of polymerase η binds in the hydrophobic pocket on the Rev1 C-terminal domain. We also show that the RIR motif of human polymerase κ and the PIP motif of yeast Msh6 bind both PCNA and Rev1. Overall, these findings demonstrate that PIP motifs and RIR motifs have overlapping specificities and can interact with both PCNA and Rev1 in structurally similar ways. These findings also suggest that PIP motifs are a more versatile protein interaction motif than previously believed. PMID:26903512

  6. Helix–hairpin–helix motifs confer salt resistance and processivity on chimeric DNA polymerases

    PubMed Central

    Pavlov, Andrey R.; Belova, Galina I.; Kozyavkin, Sergei A.; Slesarev, Alexei I.

    2002-01-01

    Helix–hairpin–helix (HhH) is a widespread motif involved in sequence-nonspecific DNA binding. The majority of HhH motifs function as DNA-binding modules with typical occurrence of one HhH motif or one or two (HhH)2 domains in proteins. We recently identified 24 HhH motifs in DNA topoisomerase V (Topo V). Although these motifs are dispensable for the topoisomerase activity of Topo V, their removal narrows the salt concentration range for topoisomerase activity tenfold. Here, we demonstrate the utility of Topo V's HhH motifs for modulating DNA-binding properties of the Stoffel fragment of TaqDNA polymerase and Pfu DNA polymerase. Different HhH cassettes fused with either NH2 terminus or COOH terminus of DNA polymerases broaden the salt concentration range of the polymerase activity significantly (up to 0.5 M NaCl or 1.8 M potassium glutamate). We found that anions play a major role in the inhibition of DNA polymerase activity. The resistance of initial extension rates and the processivity of chimeric polymerases to salts depend on the structure of added HhH motifs. Regardless of the type of the construct, the thermal stability of chimeric Taq polymerases increases under the optimal ionic conditions, as compared with that of TaqDNA polymerase or its Stoffel fragment. Our approach to raise the salt tolerance, processivity, and thermostability of Taq and Pfu DNA polymerases may be applied to all pol1- and polB-type polymerases, as well as to other DNA processing enzymes. PMID:12368475

  7. Design principles of a microtubule polymerase

    PubMed Central

    Geyer, Elisabeth A; Miller, Matthew P; Brautigam, Chad A; Biggins, Sue

    2018-01-01

    Stu2/XMAP215 microtubule polymerases use multiple tubulin-binding TOG domains and a lattice-binding basic region to processively promote faster elongation. How the domain composition and organization of these proteins dictate polymerase activity, end localization, and processivity is unknown. We show that polymerase activity does not require different kinds of TOGs, nor are there strict requirements for how the TOGs are linked. We identify an unexpected antagonism between the tubulin-binding TOGs and the lattice-binding basic region: lattice binding by the basic region is weak when at least two TOGs engage tubulins, strong when TOGs are empty. End-localization of Stu2 requires unpolymerized tubulin, at least two TOGs, and polymerase competence. We propose a ‘ratcheting’ model for processivity: transfer of tubulin from TOGs to the lattice activates the basic region, retaining the polymerase at the end for subsequent rounds of tubulin binding and incorporation. These results clarify design principles of the polymerase. PMID:29897335

  8. Inhibition of RNA-Dependent DNA Polymerase of Avian Myeloblastosis Virus by Pyran Copolymer

    PubMed Central

    Papas, Takis S.; Pry, Thomas W.; Chirigos, Michael A.

    1974-01-01

    Pyran copolymer, a known immunostimulator, was found to be a potent inhibitor of purified DNA polymerase (deoxynucleosidetriphosphate: DNA deoxynucleotidyltransferase; EC 2.7.7.7) isolated from avian myeloblastosis virus. Unlike other inhibitors, pyran showed unique features of inhibition. It interacts with the polymerase at a region other than the template site. The inhibitory effect was overcome only by excess enzyme and not affected by excess template. The degree of inhibition was not template specific for the templates tested: 70S RNA from avian myeloblastosis virus, synthetic hybrid poly(rA)·oligo(dT)10, synthetic copolymer poly(dA-dT), and activated calf-thymus DNA. The observed rate of inhibition by pyran was shown to vary with the different polymerases tested. Inhibition was shown with all oncornaviral polymerases and, to a lesser extent, with mammalian polymerases. However, two of the three bacterial polymerases, by contrast, showed a marked activation. PMID:4131275

  9. General misincorporation frequency: Re-evaluation of the fidelity of DNA polymerases.

    PubMed

    Yang, Jie; Li, Bianbian; Liu, Xiaoying; Tang, Hong; Zhuang, Xiyao; Yang, Mingqi; Xu, Ying; Zhang, Huidong; Yang, Chun

    2018-02-19

    DNA replication in cells is performed in the presence of four dNTPs and four rNTPs. In this study, we re-evaluated the fidelity of DNA polymerases using the general misincorporation frequency consisting of three incorrect dNTPs and four rNTPs but not using the traditional special misincorporation frequency with only the three incorrect dNTPs. We analyzed both the general and special misincorporation frequencies of nucleotide incorporation opposite dG, rG, or 8-oxoG by Pseudomonas aeruginosa phage 1 (PaP1) DNA polymerase Gp90 or Sulfolobus solfataricus DNA polymerase Dpo4. Both misincorporation frequencies of other DNA polymerases published were also summarized and analyzed. The general misincorporation frequency is obviously higher than the special misincorporation frequency for many DNA polymerases, indicating the real fidelity of a DNA polymerase should be evaluated using the general misincorporation frequency. Copyright © 2018 Elsevier Inc. All rights reserved.

  10. Cloning and expression of the gene for bacteriophage T7 RNA polymerase

    DOEpatents

    Studier, F. William; Davanloo, Parichehre; Rosenberg, Alan H.; Moffatt, Barbara A.; Dunn, John J.

    1999-02-09

    This application describes a means to clone a functional gene for bacteriophage T7 RNA polymerase. Active T7 RNA polymerase is produced from the cloned gene, and a plasmid has been constructed that can produce the active enzyme in large amounts. T7 RNA polymerase transcribes DNA very efficiently and is highly selective for a relatively long promoter sequence. This enzyme is useful for synthesizing large amounts of RNA in vivo or in vitro, and is capable of producing a single RNA selectively from a complex mixture of DNAs. The procedure used to obtain a clone of the R7 RNA polymerase gene can be applied to other T7-like phages to obtain clones that produce RNA polymerases having different promoter specificities, different bacterial hosts, or other desirable properties. T7 RNA polymerase is also used in a system for selective, high-level synthesis of RNAs and proteins in suitable host cells.

  11. Cloning and expression of the gene for bacteriophage T7 RNA polymerase

    DOEpatents

    Studier, F. William; Davanloo, Parichehre; Rosenberg, Alan H.; Moffatt, Barbara A.; Dunn, John J.

    1997-12-02

    This application describes a means to clone a functional gene for bacteriophage T7 RNA polymerase. Active T7 RNA polymerase is produced from the cloned gene, and a plasmid has been constructed that can produce the active enzyme in large amounts. T7 RNA polymerase transcribes DNA very efficiently and is highly selective for a relatively long promoter sequence. This enzyme is useful for synthesizing large amounts of RNA in vivo or in vitro, and is capable of producing a single RNA selectively from a complex mixture of DNAs. The procedure used to obtain a clone of the R7 RNA polymerase gene can be applied to other T7-like phages to obtain clones that produce RNA polymerases having different promoter specificities, different bacterial hosts, or other desirable properties. T7 RNA polymerase is also used in a system for selective, high-level synthesis of RNAs and proteins in suitable host cells.

  12. Cloning and expression of the gene for bacteriophage T7 RNA polymerase

    DOEpatents

    Studier, F. William; Davanloo, Parichehre; Rosenberg, Alan H.; Moffatt, Barbara A.; Dunn, John J.

    1990-01-01

    This application describes a means to clone a functional gene for bacteriophage T7 RNA polymerase. Active T7 RNA polymerase is produced from the cloned gene, and a plasmid has been constructed that can produce the active enzyme in large amounts. T7 RNA polymerase transcribes DNA very efficiently and is highly selective for a relatively long promoter sequence. This enzyme is useful for synthesizing large amounts of RNA in vivo or in vitro, and is capable of producing a single RNA selectively from a complex mixture of DNAs. The procedure used to obtain a clone of the T7 RNA polymerase gene can be applied to other T7-like phages to obtain clones that produce RNA polymerases having different promoter specificities, different bacterial hosts, or other desirable properties. T7 RNA polymerase is also used in a system for selective, high-level synthesis of RNAs and proteins in suitable host cells.

  13. Development of an on-site rapid real-time polymerase chain reaction system and the characterization of suitable DNA polymerases for TaqMan probe technology.

    PubMed

    Furutani, Shunsuke; Naruishi, Nahoko; Hagihara, Yoshihisa; Nagai, Hidenori

    2016-08-01

    On-site quantitative analyses of microorganisms (including viruses) by the polymerase chain reaction (PCR) system are significantly influencing medical and biological research. We have developed a remarkably rapid and portable real-time PCR system that is based on microfluidic approaches. Real-time PCR using TaqMan probes consists of a complex reaction. Therefore, in a rapid real-time PCR, the optimum DNA polymerase must be estimated by using actual real-time PCR conditions. In this study, we compared the performance of three DNA polymerases in actual PCR conditions using our rapid real-time PCR system. Although KAPA2G Fast HS DNA Polymerase has the highest enzymatic activity among them, SpeedSTAR HS DNA Polymerase exhibited better performance to rapidly increase the fluorescence signal in an actual real-time PCR using TaqMan probes. Furthermore, we achieved rapid detection of Escherichia coli in 7 min by using SpeedSTAR HS DNA Polymerase with the same sensitivity as that of a conventional thermal cycler.

  14. HSP90 and its R2TP/Prefoldin-like cochaperone are involved in the cytoplasmic assembly of RNA polymerase II.

    PubMed

    Boulon, Séverine; Pradet-Balade, Bérengère; Verheggen, Céline; Molle, Dorothée; Boireau, Stéphanie; Georgieva, Marya; Azzag, Karim; Robert, Marie-Cécile; Ahmad, Yasmeen; Neel, Henry; Lamond, Angus I; Bertrand, Edouard

    2010-09-24

    RNA polymerases are key multisubunit cellular enzymes. Microscopy studies indicated that RNA polymerase I assembles near its promoter. However, the mechanism by which RNA polymerase II is assembled from its 12 subunits remains unclear. We show here that RNA polymerase II subunits Rpb1 and Rpb3 accumulate in the cytoplasm when assembly is prevented and that nuclear import of Rpb1 requires the presence of all subunits. Using MS-based quantitative proteomics, we characterized assembly intermediates. These included a cytoplasmic complex containing subunits Rpb1 and Rpb8 associated with the HSP90 cochaperone hSpagh (RPAP3) and the R2TP/Prefoldin-like complex. Remarkably, HSP90 activity stabilized incompletely assembled Rpb1 in the cytoplasm. Our data indicate that RNA polymerase II is built in the cytoplasm and reveal quality-control mechanisms that link HSP90 to the nuclear import of fully assembled enzymes. hSpagh also bound the free RPA194 subunit of RNA polymerase I, suggesting a general role in assembling RNA polymerases. Copyright © 2010 Elsevier Inc. All rights reserved.

  15. HSP90 and Its R2TP/Prefoldin-like Cochaperone Are Involved in the Cytoplasmic Assembly of RNA Polymerase II

    PubMed Central

    Boireau, Stéphanie; Georgieva, Marya; Azzag, Karim; Robert, Marie-Cécile; Ahmad, Yasmeen; Neel, Henry; Lamond, Angus I.; Bertrand, Edouard

    2015-01-01

    SUMMARY RNA polymerases are key multisubunit cellular enzymes. Microscopy studies indicated that RNA polymerase I assembles near its promoter. However, the mechanism by which RNA polymerase II is assembled from its 12 subunits remains unclear. We show here that RNA polymerase II subunits Rpb1 and Rpb3 accumulate in the cytoplasm when assembly is prevented and that nuclear import of Rpb1 requires the presence of all subunits. Using MS-based quantitative proteomics, we characterized assembly intermediates. These included a cytoplasmic complex containing subunits Rpb1 and Rpb8 associated with the HSP90 cochaperone hSpagh (RPAP3) and the R2TP/Prefoldin-like complex. Remarkably, HSP90 activity stabilized incompletely assembled Rpb1 in the cytoplasm. Our data indicate that RNA polymerase II is built in the cytoplasm and reveal quality-control mechanisms that link HSP90 to the nuclear import of fully assembled enzymes. hSpagh also bound the free RPA194 subunit of RNA polymerase I, suggesting a general role in assembling RNA polymerases. PMID:20864038

  16. Multiple two-polymerase mechanisms in mammalian translesion DNA synthesis.

    PubMed

    Livneh, Zvi; Ziv, Omer; Shachar, Sigal

    2010-02-15

    The encounter of replication forks with DNA lesions may lead to fork arrest and/or the formation of single-stranded gaps. A major strategy to cope with these replication irregularities is translesion DNA synthesis (TLS), in which specialized error-prone DNA polymerases bypass the blocking lesions. Recent studies suggest that TLS across a particular DNA lesion may involve as many as four different TLS polymerases, acting in two-polymerase reactions in which insertion by a particular polymerase is followed by extension by another polymerase. Insertion determines the accuracy and mutagenic specificity of the TLS reaction, and is carried out by one of several polymerases such as poleta, polkappa or poliota. In contrast, extension is carried out primarily by polzeta. In cells from XPV patients, which are deficient in TLS across cyclobutane pyrimidine dimers (CPD) due to a deficiency in poleta, TLS is carried out by at least two backup reactions each involving two polymerases: One reaction involves polkappa and polzeta, and the other poliota and polzeta. These mechanisms may also assist poleta in normal cells under an excessive amount of UV lesions.

  17. Oligomerization of the E. coli Core RNA Polymerase: Formation of (α2ββ'ω)2–DNA Complexes and Regulation of the Oligomerization by Auxiliary Subunits

    PubMed Central

    Kansara, Seema G.; Sukhodolets, Maxim V.

    2011-01-01

    In this work, using multiple, dissimilar physico-chemical techniques, we demonstrate that the Escherichia coli RNA polymerase core enzyme obtained through a classic purification procedure forms stable (α2ββ'ω)2 complexes in the presence or absence of short DNA probes. Multiple control experiments indicate that this self-association is unlikely to be mediated by RNA polymerase-associated non-protein molecules. We show that the formation of (α2ββ'ω)2 complexes is subject to regulation by known RNA polymerase interactors, such as the auxiliary SWI/SNF subunit of RNA polymerase RapA, as well as NusA and σ70. We also demonstrate that the separation of the core RNA polymerase and RNA polymerase holoenzyme species during Mono Q chromatography is likely due to oligomerization of the core enzyme. We have analyzed the oligomeric state of the polymerase in the presence or absence of DNA, an aspect that was missing from previous studies. Importantly, our work demonstrates that RNA polymerase oligomerization is compatible with DNA binding. Through in vitro transcription and in vivo experiments (utilizing a RapAR599/Q602 mutant lacking transcription-stimulatory function), we demonstrate that the formation of tandem (α2ββ'ω)2–DNA complexes is likely functionally significant and beneficial for the transcriptional activity of the polymerase. Taken together, our findings suggest a novel structural aspect of the E. coli elongation complex. We hypothesize that transcription by tandem RNA polymerase complexes initiated at hypothetical bidirectional “origins of transcription” may explain recurring switches of the direction of transcription in bacterial genomes. PMID:21533049

  18. 9 CFR 147.30 - Laboratory procedure recommended for the polymerase chain reaction (PCR) test for Mycoplasma...

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... the polymerase chain reaction (PCR) test for Mycoplasma gallisepticum and M. synoviae. 147.30 Section... Examination Procedures § 147.30 Laboratory procedure recommended for the polymerase chain reaction (PCR) test... should consist of the following sequences: ER12JA07.005 (c) Polymerase chain reaction. (1) Treat each...

  19. 9 CFR 147.30 - Laboratory procedure recommended for the polymerase chain reaction (PCR) test for Mycoplasma...

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... the polymerase chain reaction (PCR) test for Mycoplasma gallisepticum and M. synoviae. 147.30 Section... Examination Procedures § 147.30 Laboratory procedure recommended for the polymerase chain reaction (PCR) test... should consist of the following sequences: ER12JA07.005 (c) Polymerase chain reaction. (1) Treat each...

  20. DOE Office of Scientific and Technical Information (OSTI.GOV)

    McInerney, Peter; Adams, Paul; Hadi, Masood Z.

    As larger-scale cloning projects become more prevalent, there is an increasing need for comparisons among high fidelity DNA polymerases used for PCR amplification. All polymerases marketed for PCR applications are tested for fidelity properties (i.e., error rate determination) by vendors, and numerous literature reports have addressed PCR enzyme fidelity. Nonetheless, it is often difficult to make direct comparisons among different enzymes due to numerous methodological and analytical differences from study to study. We have measured the error rates for 6 DNA polymerases commonly used in PCR applications, including 3 polymerases typically used for cloning applications requiring high fidelity. Error ratemore » measurement values reported here were obtained by direct sequencing of cloned PCR products. The strategy employed here allows interrogation of error rate across a very large DNA sequence space, since 94 unique DNA targets were used as templates for PCR cloning. The six enzymes included in the study, Taq polymerase, AccuPrime-Taq High Fidelity, KOD Hot Start, cloned Pfu polymerase, Phusion Hot Start, and Pwo polymerase, we find the lowest error rates with Pfu , Phusion, and Pwo polymerases. Error rates are comparable for these 3 enzymes and are >10x lower than the error rate observed with Taq polymerase. Mutation spectra are reported, with the 3 high fidelity enzymes displaying broadly similar types of mutations. For these enzymes, transition mutations predominate, with little bias observed for type of transition.« less

  1. Selective affinity chromatography of DNA polymerases with associated 3' to 5' exonuclease activities.

    PubMed

    Lee, M Y; Whyte, W A

    1984-05-01

    The use of 5'-AMP as a ligand for the affinity chromatography of DNA polymerases with intrinsic 3' to 5' exonuclease activities was investigated. The basis for this is that 5'-AMP would be expected to act as a ligand for the associated 3' to 5' exonuclease. The requirements for binding of Escherichia coli DNA polymerase I, T4 DNA polymerase, and calf thymus DNA polymerase delta, all of which have associated 3' to 5' exonuclease activities, to several commercially available 5'-AMP supports with different linkages of 5'-AMP to either agarose or cellulose were examined. The DNA polymerases which possessed 3' to 5' exonuclease activities were bound to agarose types in which the 5'-phosphoryl group and the 3'-hydroxyl group of the AMP were unsubstituted. Bound enzyme could be eluted by either an increase in ionic strength or competitive binding of nucleoside 5'-monophosphates. Magnesium was found to reinforce the binding of the enzyme to these affinity supports. DNA polymerase alpha, which does not have an associated 3' to 5' exonuclease activity, did not bind to any of these columns. These differences can be used to advantage for the purification of DNA polymerases that have associated 3' to 5' exonuclease activities, as well as a means for establishing the association of 3' to 5' exonuclease activities with DNA polymerases.

  2. Both High-Fidelity Replicative and Low-Fidelity Y-Family Polymerases Are Involved in DNA Rereplication

    PubMed Central

    Sekimoto, Takayuki; Oda, Tsukasa; Kurashima, Kiminori; Hanaoka, Fumio

    2014-01-01

    DNA rereplication is a major form of aberrant replication that causes genomic instabilities, such as gene amplification. However, little is known about which DNA polymerases are involved in the process. Here, we report that low-fidelity Y-family polymerases (Y-Pols), Pol η, Pol ι, Pol κ, and REV1, significantly contribute to DNA synthesis during rereplication, while the replicative polymerases, Pol δ and Pol ε, play an important role in rereplication, as expected. When rereplication was induced by depletion of geminin, these polymerases were recruited to rereplication sites in human cell lines. This finding was supported by RNA interference (RNAi)-mediated knockdown of the polymerases, which suppressed rereplication induced by geminin depletion. Interestingly, epistatic analysis indicated that Y-Pols collaborate in a common pathway, independently of replicative polymerases. We also provide evidence for a catalytic role for Pol η and the involvement of Pol η and Pol κ in cyclin E-induced rereplication. Collectively, our findings indicate that, unlike normal S-phase replication, rereplication induced by geminin depletion and oncogene activation requires significant contributions of both Y-Pols and replicative polymerases. These findings offer important mechanistic insights into cancer genomic instability. PMID:25487575

  3. Influenza Polymerase Can Adopt an Alternative Configuration Involving a Radical Repacking of PB2 Domains.

    PubMed

    Thierry, Eric; Guilligay, Delphine; Kosinski, Jan; Bock, Thomas; Gaudon, Stephanie; Round, Adam; Pflug, Alexander; Hengrung, Narin; El Omari, Kamel; Baudin, Florence; Hart, Darren J; Beck, Martin; Cusack, Stephen

    2016-01-07

    Influenza virus polymerase transcribes or replicates the segmented RNA genome (vRNA) into respectively viral mRNA or full-length copies and initiates RNA synthesis by binding the conserved 3' and 5' vRNA ends (the promoter). In recent structures of promoter-bound polymerase, the cap-binding and endonuclease domains are configured for cap snatching, which generates capped transcription primers. Here, we present a FluB polymerase structure with a bound complementary cRNA 5' end that exhibits a major rearrangement of the subdomains within the C-terminal two-thirds of PB2 (PB2-C). Notably, the PB2 nuclear localization signal (NLS)-containing domain translocates ∼90 Å to bind to the endonuclease domain. FluA PB2-C alone and RNA-free FluC polymerase are similarly arranged. Biophysical and cap-dependent endonuclease assays show that in solution the polymerase explores different conformational distributions depending on which RNA is bound. The inherent flexibility of the polymerase allows it to adopt alternative conformations that are likely important during polymerase maturation into active progeny RNPs. Copyright © 2016 The Authors. Published by Elsevier Inc. All rights reserved.

  4. Discovery of cyanophage genomes which contain mitochondrial DNA polymerase.

    PubMed

    Chan, Yi-Wah; Mohr, Remus; Millard, Andrew D; Holmes, Antony B; Larkum, Anthony W; Whitworth, Anna L; Mann, Nicholas H; Scanlan, David J; Hess, Wolfgang R; Clokie, Martha R J

    2011-08-01

    DNA polymerase γ is a family A DNA polymerase responsible for the replication of mitochondrial DNA in eukaryotes. The origins of DNA polymerase γ have remained elusive because it is not present in any known bacterium, though it has been hypothesized that mitochondria may have inherited the enzyme by phage-mediated nonorthologous displacement. Here, we present an analysis of two full-length homologues of this gene, which were found in the genomes of two bacteriophages, which infect the chlorophyll-d containing cyanobacterium Acaryochloris marina. Phylogenetic analyses of these phage DNA polymerase γ proteins show that they branch deeply within the DNA polymerase γ clade and therefore share a common origin with their eukaryotic homologues. We also found homologues of these phage polymerases in the environmental Community Cyberinfrastructure for Advanced Microbial Ecology Research and Analysis (CAMERA) database, which fell in the same clade. An analysis of the CAMERA assemblies containing the environmental homologues together with the filter fraction metadata indicated some of these assemblies may be of bacterial origin. We also show that the phage-encoded DNA polymerase γ is highly transcribed as the phage genomes are replicated. These findings provide data that may assist in reconstructing the evolution of mitochondria.

  5. A bacteriophage T7 RNA polymerase/promoter system for controlled exclusive expression of specific genes.

    PubMed Central

    Tabor, S; Richardson, C C

    1985-01-01

    The RNA polymerase gene of bacteriophage T7 has been cloned into the plasmid pBR322 under the inducible control of the lambda PL promoter. After induction, T7 RNA polymerase constitutes 20% of the soluble protein of Escherichia coli, a 200-fold increase over levels found in T7-infected cells. The overproduced enzyme has been purified to homogeneity. During extraction the enzyme is sensitive to a specific proteolysis, a reaction that can be prevented by a modification of lysis conditions. The specificity of T7 RNA polymerase for its own promoters, combined with the ability to inhibit selectively the host RNA polymerase with rifampicin, permits the exclusive expression of genes under the control of a T7 RNA polymerase promoter. We describe such a coupled system and its use to express high levels of phage T7 gene 5 protein, a subunit of T7 DNA polymerase. Images PMID:3156376

  6. Mass spectrometry of Escherichia coli RNA polymerase: interactions of the core enzyme with sigma70 and Rsd protein.

    PubMed

    Ilag, Leopold L; Westblade, Lars F; Deshayes, Caroline; Kolb, Annie; Busby, Stephen J W; Robinson, Carol V

    2004-02-01

    The E. coli RNA polymerase core enzyme is a multisubunit complex of 388,981 Da. To initiate transcription at promoters, the core enzyme associates with a sigma subunit to form holo RNA polymerase. Here we have used nanoflow electrospray mass spectrometry, coupled with tandem mass spectrometry, to probe the interaction of the RNA polymerase core enzyme with the most abundant sigma factor, sigma70. The results show remarkably well-resolved spectra for both the core and holo RNA polymerases. The regulator of sigma70, Rsd protein, has previously been identified as a protein that binds to free sigma70. We show that Rsd also interacts with core enzyme. In addition, by adding increasing amounts of Rsd, we show that sigma70 is displaced from holo RNA polymerase, resulting in complexes of Rsd with core and sigma70. The results argue for a model in which Rsd not only sequesters sigma70, but is also an effector of core RNA polymerase.

  7. Cloning and expression of the gene for bacteriophage T7 RNA polymerase

    DOEpatents

    Studier, F.W.; Davanloo, P.; Rosenberg, A.H.; Moffatt, B.A.; Dunn, J.J.

    1997-12-02

    This application describes a means to clone a functional gene for bacteriophage T7 RNA polymerase. Active T7 RNA polymerase is produced from the cloned gene, and a plasmid has been constructed that can produce the active enzyme in large amounts. T7 RNA polymerase transcribes DNA very efficiently and is highly selective for a relatively long promoter sequence. This enzyme is useful for synthesizing large amounts of RNA in vivo or in vitro, and is capable of producing a single RNA selectively from a complex mixture of DNAs. The procedure used to obtain a clone of the R7 RNA polymerase gene can be applied to other T7-like phages to obtain clones that produce RNA polymerases having different promoter specificities, different bacterial hosts, or other desirable properties. T7 RNA polymerase is also used in a system for selective, high-level synthesis of RNAs and proteins in suitable host cells. 10 figs.

  8. Cloning and expression of the gene for bacteriophage T7 RNA polymerase

    DOEpatents

    Studier, F.W.; Davanloo, P.; Rosenberg, A.H.; Moffatt, B.A.; Dunn, J.J.

    1999-02-09

    This application describes a means to clone a functional gene for bacteriophage T7 RNA polymerase. Active T7 RNA polymerase is produced from the cloned gene, and a plasmid has been constructed that can produce the active enzyme in large amounts. T7 RNA polymerase transcribes DNA very efficiently and is highly selective for a relatively long promoter sequence. This enzyme is useful for synthesizing large amounts of RNA in vivo or in vitro, and is capable of producing a single RNA selectively from a complex mixture of DNAs. The procedure used to obtain a clone of the R7 RNA polymerase gene can be applied to other T7-like phages to obtain clones that produce RNA polymerases having different promoter specificities, different bacterial hosts, or other desirable properties. T7 RNA polymerase is also used in a system for selective, high-level synthesis of RNAs and proteins in suitable host cells. 10 figs.

  9. Human DNA polymerase θ grasps the primer terminus to mediate DNA repair

    DOE PAGES

    Zahn, Karl E.; Averill, April M.; Aller, Pierre; ...

    2015-03-16

    DNA polymerase θ protects against genomic instability via an alternative end-joining repair pathway for DNA double-strand breaks. Polymerase θ is overexpressed in breast, lung and oral cancers, and reduction of its activity in mammalian cells increases sensitivity to double-strand break–inducing agents, including ionizing radiation. Reported in this paper are crystal structures of the C-terminal polymerase domain from human polymerase θ, illustrating two potential modes of dimerization. One structure depicts insertion of ddATP opposite an abasic-site analog during translesion DNA synthesis. The second structure describes a cognate ddGTP complex. Polymerase θ uses a specialized thumb subdomain to establish unique upstream contactsmore » to the primer DNA strand, including an interaction with the 3'-terminal phosphate from one of five distinctive insertion loops. Finally, these observations demonstrate how polymerase θ grasps the primer to bypass DNA lesions or extend poorly annealed DNA termini to mediate end-joining.« less

  10. Cloning and expression of the gene for bacteriophage T7 RNA polymerase

    DOEpatents

    Studier, F.W.; Davanloo, P.; Rosenberg, A.H.

    1984-03-30

    This application describes a means to clone a functional gene for bacteriophage T7 RNA polymerase. Active T7 RNA polymerase is produced from the cloned gene, and a plasmid has been constructed that can produce the active enzyme in large amounts. T7 RNA polymerase transcribes DNA very efficiently and is highly selective for a relatively long promoter sequence. This enzyme is useful for synthesizing large amounts of RNA in vivo or in vitro, and is capable of producing a single RNA selectively from a complex mixture of DNAs. The procedure used to obtain a clone of the T7 RNA polymerase gene can be applied to other T7-like phages to obtain clones that produce RNA polymerases having different promoter specificities, different bacterial hosts, or other desirable properties.

  11. An Evolutionary/Biochemical Connection Between Promoter- and Primer-Dependent Polymerases Revealed by Selective Evolution of Ligands by Exponential Enrichment (SELEX).

    PubMed

    Fenstermacher, Katherine J; Achuthan, Vasudevan; Schneider, Thomas D; DeStefano, Jeffrey J

    2018-01-16

    DNA polymerases (DNAPs) recognize 3' recessed termini on duplex DNA and carry out nucleotide catalysis. Unlike promoter-specific RNA polymerases (RNAPs), no sequence specificity is required for binding or initiation of catalysis. Despite this, previous results indicate that viral reverse transcriptases bind much more tightly to DNA primers that mimic the polypurine tract. In the current report, primer sequences that bind with high affinity to Taq and Klenow polymerases were identified using a modified Selective Evolution of Ligands by Exponential Enrichment (SELEX) approach. Two Taq -specific primers that bound ∼10 (Taq1) and over 100 (Taq2) times more stably than controls to Taq were identified. Taq1 contained 8 nucleotides (5' -CACTAAAG-3') that matched the phage T3 RNAP "core" promoter. Both primers dramatically outcompeted primers with similar binding thermodynamics in PCR reactions. Similarly, exonuclease minus Klenow polymerase also selected a high affinity primer that contained a related core promoter sequence from phage T7 RNAP (5' -ACTATAG-3'). For both Taq and Klenow, even small modifications to the sequence resulted in large losses in binding affinity suggesting that binding was highly sequence-specific. The results are discussed in the context of possible effects on multi-primer (multiplex) PCR assays, molecular information theory, and the evolution of RNAPs and DNAPs. Importance This work further demonstrates that primer-dependent DNA polymerases can have strong sequence biases leading to dramatically tighter binding to specific sequences. These may be related to biological function, or be a consequences of the structural architecture of the enzyme. New sequence specificity for Taq and Klenow polymerases were uncovered and among them were sequences that contained the core promoter elements from T3 and T7 phage RNA polymerase promoters. This suggests the intriguing possibility that phage RNA polymerases exploited intrinsic binding affinities of ancestral DNA polymerases to develop their promotors. Conversely, DNA polymerases could have evolved from related RNA polymerases and retained the intrinsic binding preference despite there being no clear function for such a preference in DNA biology. Copyright © 2018 American Society for Microbiology.

  12. Directed evolution of DNA polymerase, RNA polymerase and reverse transcriptase activity in a single polypeptide.

    PubMed

    Ong, Jennifer L; Loakes, David; Jaroslawski, Szymon; Too, Kathleen; Holliger, Philipp

    2006-08-18

    DNA polymerases enable key technologies in modern biology but for many applications, native polymerases are limited by their stringent substrate recognition. Here we describe short-patch compartmentalized self-replication (spCSR), a novel strategy to expand the substrate spectrum of polymerases in a targeted way. spCSR is based on the previously described CSR, but unlike CSR only a short region (a "patch") of the gene under investigation is diversified and replicated. This allows the selection of polymerases under conditions where catalytic activity and processivity are compromised to the extent that full self-replication is inefficient. We targeted two specific motifs involved in substrate recognition in the active site of DNA polymerase I from Thermus aquaticus (Taq) and selected for incorporation of both ribonucleotide- (NTP) and deoxyribonucleotide-triphosphates (dNTPs) using spCSR. This allowed the isolation of multiple variants of Taq with apparent dual substrate specificity. They were able to synthesize RNA, while still retaining essentially wild-type (wt) DNA polymerase activity as judged by PCR. One such mutant (AA40: E602V, A608V, I614M, E615G) was able to incorporate both NTPs and dNTPs with the same catalytic efficiency as the wt enzyme incorporates dNTPs. AA40 allowed the generation of mixed RNA-DNA amplification products in PCR demonstrating DNA polymerase, RNA polymerase as well as reverse transcriptase activity within the same polypeptide. Furthermore, AA40 displayed an expanded substrate spectrum towards other 2'-substituted nucleotides and was able to synthesize nucleic acid polymers in which each base bore a different 2'-substituent. Our results suggest that spCSR will be a powerful strategy for the generation of polymerases with altered substrate specificity for applications in nano- and biotechnology and in the enzymatic synthesis of antisense and RNAi probes.

  13. Comprehensive analysis of DNA polymerase III α subunits and their homologs in bacterial genomes

    PubMed Central

    Timinskas, Kęstutis; Balvočiūtė, Monika; Timinskas, Albertas; Venclovas, Česlovas

    2014-01-01

    The analysis of ∼2000 bacterial genomes revealed that they all, without a single exception, encode one or more DNA polymerase III α-subunit (PolIIIα) homologs. Classified into C-family of DNA polymerases they come in two major forms, PolC and DnaE, related by ancient duplication. While PolC represents an evolutionary compact group, DnaE can be further subdivided into at least three groups (DnaE1-3). We performed an extensive analysis of various sequence, structure and surface properties of all four polymerase groups. Our analysis suggests a specific evolutionary pathway leading to PolC and DnaE from the last common ancestor and reveals important differences between extant polymerase groups. Among them, DnaE1 and PolC show the highest conservation of the analyzed properties. DnaE3 polymerases apparently represent an ‘impaired’ version of DnaE1. Nonessential DnaE2 polymerases, typical for oxygen-using bacteria with large GC-rich genomes, have a number of features in common with DnaE3 polymerases. The analysis of polymerase distribution in genomes revealed three major combinations: DnaE1 either alone or accompanied by one or more DnaE2s, PolC + DnaE3 and PolC + DnaE1. The first two combinations are present in Escherichia coli and Bacillus subtilis, respectively. The third one (PolC + DnaE1), found in Clostridia, represents a novel, so far experimentally uncharacterized, set. PMID:24106089

  14. DNA polymerases in the rat pituitary gland. Effect of oestrogens and sulpiride.

    PubMed

    Jahn, G A; Kalbermann, L E; Machiavelli, G; Szijan, I; Burdman, J A

    1980-06-01

    Changes in the activity of DNA polymerase and [3H]thymidine incorporation into the DNA of the anterior pituitary gland were studied in oestrogenized male and pregnant rats. The activities of DNA polymerases alpha and beta, extracted in Tris--HCl or in sodium phosphate buffer were characterized according to their optimum pH and sensitivity to N-ethyl-maleimide. In the Tris-soluble fraction DNA polymerase activity is almost exclusively alpha, while in the phosphate soluble fraction it is a mixture of alpha and beta. The administration of oestrogens to male rats increases [3H]thymidine incorporation and enhances the activity of DNA polymerases in the Tris-soluble fraction, while the activity of the phosphate-soluble enzyme does not change. Sulpiride administration results in a further increment of [3H]thymidine incorporation and of DNA polymerase activity in the Tris-soluble fraction. In pregnant rats sulpiride also produces an increment of DNA polymerase activity only in the Tris-soluble fraction. Thus, the activity of the Tris-soluble fraction from APG behaves as DNA polymerase alpha. This activity changes in parallel with [3H]thymidine incorporation into DNA which is an indication of cell proliferation in the gland. This is discussed with respect to a negative feedback mechanism between intracellular prolactin concentration and DNA synthesis in the APG.

  15. Role of the C-terminal residue of the DNA polymerase of bacteriophage T7.

    PubMed

    Kumar, J K; Tabor, S; Richardson, C C

    2001-09-14

    The crystal structure of the DNA polymerase encoded by gene 5 of bacteriophage T7, in a complex with its processivity factor, Escherichia coli thioredoxin, a primer-template, and an incoming deoxynucleoside triphosphate reveals a putative hydrogen bond between the C-terminal residue, histidine 704 of gene 5 protein, and an oxygen atom on the penultimate phosphate diester of the primer strand. Elimination of this electrostatic interaction by replacing His(704) with alanine renders the phage nonviable, and no DNA synthesis is observed in vivo. Polymerase activity of the genetically altered enzyme on primed M13 DNA is only 12% of the wild-type enzyme, and its processivity is drastically reduced. Kinetic parameters for binding a primer-template (K(D)(app)), nucleotide binding (K(m)), and k(off) for dissociation of the altered polymerase from a primer-template are not significantly different from that of wild-type T7 DNA polymerase. However, the decrease in polymerase activity is concomitant with increased hydrolytic activity, judging from the turnover of nucleoside triphosphate into the corresponding nucleoside monophosphate (percentage of turnover, 65%) during DNA synthesis. Biochemical data along with structural observations imply that the terminal amino acid residue of T7 DNA polymerase plays a critical role in partitioning DNA between the polymerase and exonuclease sites.

  16. [DNA-dependent DNA polymerase induced by herpes virus papio (HVP) in producing cells].

    PubMed

    D'iachenko, A G; Beriia, L Ia; Matsenko, L D; Kakubava, V V; Kokosh, L V

    1980-11-01

    A new DNA polymerase was found in the cells of suspension lymphoblastoid cultures, which produce lymphotropic baboon herpes virus (HVP). The enzyme was isolated in a partially purified form. In some properties the enzyme differs from other cellular DNA polymerases. The HVP-induced DNA polymerase has the molecular weight of 1,6 x 10(5) and sedimentation coefficient of about 8S. The enzyme is resistant to high salt concentrations and N-ethylmaleimide, but shows a pronounced sensitivity to phosphonoacetate. The enzyme effectively copies "activated" DNA and synthetic deoxyribohomopolymers. The attempts to detect the DNA polymerase activity in HVP virions were unsuccessful.

  17. DNA-polymerase induced by Herpesvirus papio (HVP) in cells of lymphoblastoid cultures derived from lymphomatous baboons. Report V.

    PubMed

    Djachenko, A G; Lapin, B A

    1981-01-01

    A new DNA-polymerase was found in the cells of suspension lymphoblastoid cultures which produce lymphotropic baboon herpesvirus (HVP). This enzyme was isolated in a partially purified form. Some of its properties vary from those of other cellular DNA-polymerases. HVP-induced DNA-polymerase has a molecule weight of 160,000 and sedimentation coefficient of about 8 S. The enzyme is resistant to high salt concentration and N-ethylmaleimide, but it is very sensitive to phosphonoacetate. It effectively copies "activated" DNA and synthetic deoxyribohomopolymers. Attempts to reveal the DNA-polymerase activity in HVP virions were unsuccessful.

  18. DNA Polymerase in Virions of a Reptilian Type C Virus

    PubMed Central

    Twardzik, Daniel R.; Papas, Takis S.; Portugal, Frank H.

    1974-01-01

    A study was made of the DNA polymerase of reptilian type C virus isolated from Russell's viper spleen cells. Simultaneous detection experiments demonstrated the presence of 70S RNA and RNA-dependent DNA polymerase activity in reptilian type C virions. The endogenous activity was dependent on the addition of all four deoxynucleotide triphosphates and demonstrated an absolute requirement for a divalent cation. The reptilian viral DNA polymerase elutes from phosphocellulose at 0.22 M salt. In this respect, it is similar to the avian (avian myeloblastosis virus; AMV) viral enzyme but is different from the mammalian (Rauscher leukemia virus; RLV) viral enzyme which elutes at 0.4 M salt. The molecular weight of the viper DNA polymerase as estimated from glycerol gradient centrifugation is 109,000. It is a smaller enzyme than the AMV DNA polymerase (180,000 daltons) and somewhat larger than the RLV enzyme (70,000 daltons). A comparison of other properties of the type C reptilian DNA polymerase with the enzyme found in other type C oncogenic viruses is made. PMID:4129837

  19. Evolution of thermophilic DNA polymerases for the recognition and amplification of C2ʹ-modified DNA

    NASA Astrophysics Data System (ADS)

    Chen, Tingjian; Hongdilokkul, Narupat; Liu, Zhixia; Adhikary, Ramkrishna; Tsuen, Shujian S.; Romesberg, Floyd E.

    2016-06-01

    The PCR amplification of oligonucleotides enables the evolution of sequences called aptamers that bind specific targets with antibody-like affinity. However, in many applications the use of these aptamers is limited by nuclease-mediated degradation. In contrast, oligonucleotides that are modified at their sugar C2ʹ positions with methoxy or fluorine substituents are stable to nucleases, but they cannot be synthesized by natural polymerases. Here we report the development of a polymerase-evolution system and its use to evolve thermostable polymerases that efficiently interconvert C2ʹ-OMe-modified oligonucleotides and their DNA counterparts via ‘transcription’ and ‘reverse transcription’ or, more importantly, that PCR-amplify partially C2ʹ-OMe- or C2ʹ-F-modified oligonucleotides. A mechanistic analysis demonstrates that the ability to amplify the modified oligonucleotides evolved by optimizing interdomain interactions that stabilize the catalytically competent closed conformation of the polymerase. The evolved polymerases should find practical applications and the developed evolution system should be a powerful tool for tailoring polymerases to have other types of novel function.

  20. A domain of the Klenow fragment of Escherichia coli DNA polymerase I has polymerase but no exonuclease activity.

    PubMed

    Freemont, P S; Ollis, D L; Steitz, T A; Joyce, C M

    1986-09-01

    The Klenow fragment of DNA polymerase I from Escherichia coli has two enzymatic activities: DNA polymerase and 3'-5' exonuclease. The crystal structure showed that the fragment is folded into two distinct domains. The smaller domain has a binding site for deoxynucleoside monophosphate and a divalent metal ion that is thought to identify the 3'-5' exonuclease active site. The larger C-terminal domain contains a deep cleft that is believed to bind duplex DNA. Several lines of evidence suggested that the large domain also contains the polymerase active site. To test this hypothesis, we have cloned the DNA coding for the large domain into an expression system and purified the protein product. We find that the C-terminal domain has polymerase activity (albeit at a lower specific activity than the native Klenow fragment) but no measurable 3'-5' exonuclease activity. These data are consistent with the hypothesis that each of the three enzymatic activities of DNA polymerase I from E. coli resides on a separate protein structural domain.

  1. The replisome uses mRNA as a primer after colliding with RNA polymerase.

    PubMed

    Pomerantz, Richard T; O'Donnell, Mike

    2008-12-11

    Replication forks are impeded by DNA damage and protein-nucleic acid complexes such as transcribing RNA polymerase. For example, head-on collision of the replisome with RNA polymerase results in replication fork arrest. However, co-directional collision of the replisome with RNA polymerase has little or no effect on fork progression. Here we examine co-directional collisions between a replisome and RNA polymerase in vitro. We show that the Escherichia coli replisome uses the RNA transcript as a primer to continue leading-strand synthesis after the collision with RNA polymerase that is displaced from the DNA. This action results in a discontinuity in the leading strand, yet the replisome remains intact and bound to DNA during the entire process. These findings underscore the notable plasticity by which the replisome operates to circumvent obstacles in its path and may explain why the leading strand is synthesized discontinuously in vivo.

  2. Translesion synthesis across the (6-4) photoproduct and its Dewar valence isomer by the Y-family and engineered DNA polymerases.

    PubMed

    Yamamoto, Junpei; Loakes, David; Masutani, Chikahide; Simmyo, Shizu; Urabe, Kumiko; Hanaoka, Fumio; Holliger, Philipp; Iwai, Shigenori

    2008-01-01

    We analyzed the translesion synthesis across the UV-induced lesions, the (6-4) photoproduct and its Dewar valence isomer, by using human DNA polymerases eta and iota in vitro. The primer extension experiments revealed that pol eta tended to incorporate dG opposite the 3' component of both lesions, but the incorporation efficiency for the Dewar isomer was higher than that for the (6-4) photoproduct. On the other hand, pol iota was likely to incorporate dA opposite the 3' components of the (6-4) photoproduct and its Dewar isomer with a similar efficiency. Elongation after the incorporation opposite the UV lesions was not observed for these Y-family polymerases. We further analyzed the bypass ability of an engineered polymerase developed from Thermus DNA polymerase for the amplification of ancient DNA. This polymerase could bypass the Dewar isomer more efficiently than the (6-4) photoproduct.

  3. TATA box-binding protein (TBP) is a constituent of the polymerase I-specific transcription initiation factor TIF-IB (SL1) bound to the rRNA promoter and shows differential sensitivity to TBP-directed reagents in polymerase I, II, and III transcription factors.

    PubMed

    Radebaugh, C A; Matthews, J L; Geiss, G K; Liu, F; Wong, J M; Bateman, E; Camier, S; Sentenac, A; Paule, M R

    1994-01-01

    The role of the Acanthamoeba castellanii TATA-binding protein (TBP) in transcription was examined. Specific antibodies against the nonconserved N-terminal domain of TBP were used to verify the presence of TBP in the fundamental transcription initiation factor for RNA polymerase I, TIF-IB, and to demonstrate that TBP is part of the committed initiation complex on the rRNA promoter. The same antibodies inhibit transcription in all three polymerase systems, but they do so differentially. Oligonucleotide competitors were used to evaluate the accessibility of the TATA-binding site in TIF-IB, TFIID, and TFIIIB. The results suggest that insertion of TBP into the polymerase II and III factors is more similar than insertion into the polymerase I factor.

  4. Deep-sea vent phage DNA polymerase specifically initiates DNA synthesis in the absence of primers.

    PubMed

    Zhu, Bin; Wang, Longfei; Mitsunobu, Hitoshi; Lu, Xueling; Hernandez, Alfredo J; Yoshida-Takashima, Yukari; Nunoura, Takuro; Tabor, Stanley; Richardson, Charles C

    2017-03-21

    A DNA polymerase is encoded by the deep-sea vent phage NrS-1. NrS-1 has a unique genome organization containing genes that are predicted to encode a helicase and a single-stranded DNA (ssDNA)-binding protein. The gene for an unknown protein shares weak homology with the bifunctional primase-polymerases (prim-pols) from archaeal plasmids but is missing the zinc-binding domain typically found in primases. We show that this gene product has efficient DNA polymerase activity and is processive in DNA synthesis in the presence of the NrS-1 helicase and ssDNA-binding protein. Remarkably, this NrS-1 DNA polymerase initiates DNA synthesis from a specific template DNA sequence in the absence of any primer. The de novo DNA polymerase activity resides in the N-terminal domain of the protein, whereas the C-terminal domain enhances DNA binding.

  5. Interactions between the cyclic AMP receptor protein and the alpha subunit of RNA polymerase at the Escherichia coli galactose operon P1 promoter.

    PubMed

    Attey, A; Belyaeva, T; Savery, N; Hoggett, J; Fujita, N; Ishihama, A; Busby, S

    1994-10-25

    DNAase I footprinting has been used to study open complexes between Escherichia coli RNA polymerase and the galactose operon P1 promoter, both in the absence and the presence of CRP (the cyclic AMP receptor protein, a transcription activator). From the effects of deletion of the C-terminal part of the RNA polymerase alpha subunit, we deduce that alpha binds at the upstream end of both the binary RNA polymerase-galP1 and ternary RNA polymerase-CRP-galP1 complexes. Disruption of the alpha-upstream contact suppresses open complex formation at galP1 at lower temperatures. In ternary RNA polymerase-CRP-galP1 complexes, alpha appears to make direct contact with Activating Region 1 in CRP. DNAase I footprinting has been used to detect and quantify interactions between purified alpha and CRP bound at galP1.

  6. Interactions between the cyclic AMP receptor protein and the alpha subunit of RNA polymerase at the Escherichia coli galactose operon P1 promoter.

    PubMed Central

    Attey, A; Belyaeva, T; Savery, N; Hoggett, J; Fujita, N; Ishihama, A; Busby, S

    1994-01-01

    DNAase I footprinting has been used to study open complexes between Escherichia coli RNA polymerase and the galactose operon P1 promoter, both in the absence and the presence of CRP (the cyclic AMP receptor protein, a transcription activator). From the effects of deletion of the C-terminal part of the RNA polymerase alpha subunit, we deduce that alpha binds at the upstream end of both the binary RNA polymerase-galP1 and ternary RNA polymerase-CRP-galP1 complexes. Disruption of the alpha-upstream contact suppresses open complex formation at galP1 at lower temperatures. In ternary RNA polymerase-CRP-galP1 complexes, alpha appears to make direct contact with Activating Region 1 in CRP. DNAase I footprinting has been used to detect and quantify interactions between purified alpha and CRP bound at galP1. Images PMID:7971267

  7. Binding of the cyclic AMP receptor protein of Escherichia coli to RNA polymerase.

    PubMed Central

    Pinkney, M; Hoggett, J G

    1988-01-01

    Fluorescence polarization studies were used to study the interaction of a fluorescein-labelled conjugate of the Escherichia coli cyclic AMP receptor protein (F-CRP) and RNA polymerase. Under conditions of physiological ionic strength, F-CRP binds to RNA polymerase holoenzyme in a cyclic AMP-dependent manner; the dissociation constant was about 3 microM in the presence of cyclic AMP and about 100 microM in its absence. Binding to core RNA polymerase under the same conditions was weak (Kdiss. approx. 80-100 microM) and independent of cyclic AMP. Competition experiments established that native CRP and F-CRP compete for the same binding site on RNA polymerase holoenzyme and that the native protein binds about 3 times more strongly than does F-CRP. Analytical ultracentrifuge studies showed that CRP binds predominantly to the monomeric rather than the dimeric form of RNA polymerase. PMID:2839152

  8. Binding of the cyclic AMP receptor protein of Escherichia coli to RNA polymerase.

    PubMed

    Pinkney, M; Hoggett, J G

    1988-03-15

    Fluorescence polarization studies were used to study the interaction of a fluorescein-labelled conjugate of the Escherichia coli cyclic AMP receptor protein (F-CRP) and RNA polymerase. Under conditions of physiological ionic strength, F-CRP binds to RNA polymerase holoenzyme in a cyclic AMP-dependent manner; the dissociation constant was about 3 microM in the presence of cyclic AMP and about 100 microM in its absence. Binding to core RNA polymerase under the same conditions was weak (Kdiss. approx. 80-100 microM) and independent of cyclic AMP. Competition experiments established that native CRP and F-CRP compete for the same binding site on RNA polymerase holoenzyme and that the native protein binds about 3 times more strongly than does F-CRP. Analytical ultracentrifuge studies showed that CRP binds predominantly to the monomeric rather than the dimeric form of RNA polymerase.

  9. Each Monomer of the Dimeric Accessory Protein for Human Mitochondrial DNA Polymerase Has a Distinct Role in Conferring Processivity*

    PubMed Central

    Lee, Young-Sam; Lee, Sujin; Demeler, Borries; Molineux, Ian J.; Johnson, Kenneth A.; Yin, Y. Whitney

    2010-01-01

    The accessory protein polymerase (pol) γB of the human mitochondrial DNA polymerase stimulates the synthetic activity of the catalytic subunit. pol γB functions by both accelerating the polymerization rate and enhancing polymerase-DNA interaction, thereby distinguishing itself from the accessory subunits of other DNA polymerases. The molecular basis for the unique functions of human pol γB lies in its dimeric structure, where the pol γB monomer proximal to pol γA in the holoenzyme strengthens the interaction with DNA, and the distal pol γB monomer accelerates the reaction rate. We further show that human pol γB exhibits a catalytic subunit- and substrate DNA-dependent dimerization. By duplicating the monomeric pol γB of lower eukaryotes, the dimeric mammalian proteins confer additional processivity to the holoenzyme polymerase. PMID:19858216

  10. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Zahn, Karl E.; Averill, April M.; Aller, Pierre

    DNA polymerase θ protects against genomic instability via an alternative end-joining repair pathway for DNA double-strand breaks. Polymerase θ is overexpressed in breast, lung and oral cancers, and reduction of its activity in mammalian cells increases sensitivity to double-strand break–inducing agents, including ionizing radiation. Reported in this paper are crystal structures of the C-terminal polymerase domain from human polymerase θ, illustrating two potential modes of dimerization. One structure depicts insertion of ddATP opposite an abasic-site analog during translesion DNA synthesis. The second structure describes a cognate ddGTP complex. Polymerase θ uses a specialized thumb subdomain to establish unique upstream contactsmore » to the primer DNA strand, including an interaction with the 3'-terminal phosphate from one of five distinctive insertion loops. Finally, these observations demonstrate how polymerase θ grasps the primer to bypass DNA lesions or extend poorly annealed DNA termini to mediate end-joining.« less

  11. Isolation and characterization of high affinity aptamers against DNA polymerase iota.

    PubMed

    Lakhin, Andrei V; Kazakov, Andrei A; Makarova, Alena V; Pavlov, Yuri I; Efremova, Anna S; Shram, Stanislav I; Tarantul, Viacheslav Z; Gening, Leonid V

    2012-02-01

    Human DNA-polymerase iota (Pol ι) is an extremely error-prone enzyme and the fidelity depends on the sequence context of the template. Using the in vitro systematic evolution of ligands by exponential enrichment (SELEX) procedure, we obtained an oligoribonucleotide with a high affinity to human Pol ι, named aptamer IKL5. We determined its dissociation constant with homogenous preparation of Pol ι and predicted its putative secondary structure. The aptamer IKL5 specifically inhibits DNA-polymerase activity of the purified enzyme Pol ι, but did not inhibit the DNA-polymerase activities of human DNA polymerases beta and kappa. IKL5 suppressed the error-prone DNA-polymerase activity of Pol ι also in cellular extracts of the tumor cell line SKOV-3. The aptamer IKL5 is useful for studies of the biological role of Pol ι and as a potential drug to suppress the increase of the activity of this enzyme in malignant cells.

  12. Compartmentalized self-replication (CSR) selection of Thermococcus litoralis Sh1B DNA polymerase for diminished uracil binding.

    PubMed

    Tubeleviciute, Agne; Skirgaila, Remigijus

    2010-08-01

    The thermostable archaeal DNA polymerase Sh1B from Thermococcus litoralis has a typical uracil-binding pocket, which in nature plays an essential role in preventing the accumulation of mutations caused by cytosine deamination to uracil and subsequent G-C base pair transition to A-T during the genomic DNA replication. The uracil-binding pocket recognizes and binds uracil base in a template strand trapping the polymerase. Since DNA replication stops, the repair systems have a chance to correct the promutagenic event. Archaeal family B DNA polymerases are employed in various PCR applications. Contrary to nature, in PCR the uracil-binding property of archaeal polymerases is disadvantageous and results in decreased DNA amplification yields and lowered sensitivity. Furthermore, in diagnostics qPCR, RT-qPCR and end-point PCR are performed using dNTP mixtures, where dTTP is partially or fully replaced by dUTP. Uracil-DNA glycosylase treatment and subsequent heating of the samples is used to degrade the DNA containing uracil and prevent carryover contamination, which is the main concern in diagnostic laboratories. A thermostable archaeal DNA polymerase with the abolished uracil binding would be a highly desirable and commercially interesting product. An attempt to disable uracil binding in DNA polymerase Sh1B from T. litoralis by generating site-specific mutants did not yield satisfactory results. However, a combination of random mutagenesis of the whole polymerase gene and compartmentalized self-replication was successfully used to select variants of thermostable Sh1B polymerase capable of performing PCR with dUTP instead of dTTP.

  13. Lesion bypass activity of DNA polymerase θ (POLQ) is an intrinsic property of the pol domain and depends on unique sequence inserts.

    PubMed

    Hogg, Matthew; Seki, Mineaki; Wood, Richard D; Doublié, Sylvie; Wallace, Susan S

    2011-01-21

    DNA polymerase θ (POLQ, polθ) is a large, multidomain DNA polymerase encoded in higher eukaryotic genomes. It is important for maintaining genetic stability in cells and helping protect cells from DNA damage caused by ionizing radiation. POLQ contains an N-terminal helicase-like domain, a large central domain of indeterminate function, and a C-terminal polymerase domain with sequence similarity to the A-family of DNA polymerases. The enzyme has several unique properties, including low fidelity and the ability to insert and extend past abasic sites and thymine glycol lesions. It is not known whether the abasic site bypass activity is an intrinsic property of the polymerase domain or whether helicase activity is also required. Three "insertion" sequence elements present in POLQ are not found in any other A-family DNA polymerase, and it has been proposed that they may lend some unique properties to POLQ. Here, we analyzed the activity of the DNA polymerase in the absence of each sequence insertion. We found that the pol domain is capable of highly efficient bypass of abasic sites in the absence of the helicase-like or central domains. Insertion 1 increases the processivity of the polymerase but has little, if any, bearing on the translesion synthesis properties of the enzyme. However, removal of insertions 2 and 3 reduces activity on undamaged DNA and completely abrogates the ability of the enzyme to bypass abasic sites or thymine glycol lesions. Copyright © 2010 Elsevier Ltd. All rights reserved.

  14. C-terminal phenylalanine of bacteriophage T7 single-stranded DNA-binding protein is essential for strand displacement synthesis by T7 DNA polymerase at a nick in DNA.

    PubMed

    Ghosh, Sharmistha; Marintcheva, Boriana; Takahashi, Masateru; Richardson, Charles C

    2009-10-30

    Single-stranded DNA-binding protein (gp2.5), encoded by gene 2.5 of bacteriophage T7, plays an essential role in DNA replication. Not only does it remove impediments of secondary structure in the DNA, it also modulates the activities of the other replication proteins. The acidic C-terminal tail of gp2.5, bearing a C-terminal phenylalanine, physically and functionally interacts with the helicase and DNA polymerase. Deletion of the phenylalanine or substitution with a nonaromatic amino acid gives rise to a dominant lethal phenotype, and the altered gp2.5 has reduced affinity for T7 DNA polymerase. Suppressors of the dominant lethal phenotype have led to the identification of mutations in gene 5 that encodes the T7 DNA polymerase. The altered residues in the polymerase are solvent-exposed and lie in regions that are adjacent to the bound DNA. gp2.5 lacking the C-terminal phenylalanine has a lower affinity for gp5-thioredoxin relative to the wild-type gp2.5, and this affinity is partially restored by the suppressor mutations in DNA polymerase. gp2.5 enables T7 DNA polymerase to catalyze strand displacement DNA synthesis at a nick in DNA. The resulting 5'-single-stranded DNA tail provides a loading site for T7 DNA helicase. gp2.5 lacking the C-terminal phenylalanine does not support this event with wild-type DNA polymerase but does to a limited extent with T7 DNA polymerase harboring the suppressor mutations.

  15. Investigation of Influenza Virus Polymerase Activity in Pig Cells

    PubMed Central

    Moncorgé, Olivier; Long, Jason S.; Cauldwell, Anna V.; Zhou, Hongbo; Lycett, Samantha J.

    2013-01-01

    Reassortant influenza viruses with combinations of avian, human, and/or swine genomic segments have been detected frequently in pigs. As a consequence, pigs have been accused of being a “mixing vessel” for influenza viruses. This implies that pig cells support transcription and replication of avian influenza viruses, in contrast to human cells, in which most avian influenza virus polymerases display limited activity. Although influenza virus polymerase activity has been studied in human and avian cells for many years by use of a minigenome assay, similar investigations in pig cells have not been reported. We developed the first minigenome assay for pig cells and compared the activities of polymerases of avian or human influenza virus origin in pig, human, and avian cells. We also investigated in pig cells the consequences of some known mammalian host range determinants that enhance influenza virus polymerase activity in human cells, such as PB2 mutations E627K, D701N, G590S/Q591R, and T271A. The two typical avian influenza virus polymerases used in this study were poorly active in pig cells, similar to what is seen in human cells, and mutations that adapt the avian influenza virus polymerase for human cells also increased activity in pig cells. In contrast, a different pattern was observed in avian cells. Finally, highly pathogenic avian influenza virus H5N1 polymerase activity was tested because this subtype has been reported to replicate only poorly in pigs. H5N1 polymerase was active in swine cells, suggesting that other barriers restrict these viruses from becoming endemic in pigs. PMID:23077313

  16. Systematic analysis of enzymatic DNA polymerization using oligo-DNA templates and triphosphate analogs involving 2',4'-bridged nucleosides.

    PubMed

    Kuwahara, Masayasu; Obika, Satoshi; Nagashima, Jun-ichi; Ohta, Yuki; Suto, Yoshiyuki; Ozaki, Hiroaki; Sawai, Hiroaki; Imanishi, Takeshi

    2008-08-01

    In order to systematically analyze the effects of nucleoside modification of sugar moieties in DNA polymerase reactions, we synthesized 16 modified templates containing 2',4'-bridged nucleotides and three types of 2',4'-bridged nucleoside-5'-triphospates with different bridging structures. Among the five types of thermostable DNA polymerases used, Taq, Phusion HF, Vent(exo-), KOD Dash and KOD(exo-), the KOD Dash and KOD(exo-) DNA polymerases could smoothly read through the modified templates containing 2'-O,4'-C-methylene-linked nucleotides at intervals of a few nucleotides, even at standard enzyme concentrations for 5 min. Although the Vent(exo-) DNA polymerase also read through these modified templates, kinetic study indicates that the KOD(exo-) DNA polymerase was found to be far superior to the Vent(exo-) DNA polymerase in accurate incorporation of nucleotides. When either of the DNA polymerase was used, the presence of 2',4'-bridged nucleotides on a template strand substantially decreased the reaction rates of nucleotide incorporations. The modified templates containing sequences of seven successive 2',4'-bridged nucleotides could not be completely transcribed by any of the DNA polymerases used; yields of longer elongated products decreased in the order of steric bulkiness of the modified sugars. Successive incorporation of 2',4'-bridged nucleotides into extending strands using 2',4'-bridged nucleoside-5'-triphospates was much more difficult. These data indicate that the sugar modification would have a greater effect on the polymerase reaction when it is adjacent to the elongation terminus than when it is on the template as well, as in base modification.

  17. Subunit Compositions of the RNA-Silencing Enzymes Pol IV and Pol V Reveal Their Origins as Specialized Forms of RNA Polymerase II

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ream, Thomas S.; Haag, J. R.; Wierzbicki, A. T.

    2009-01-30

    In addition to RNA polymerases I, II and III, which are multi-subunit RNA polymerases found in all eukaryotes, plants have catalytic subunits for two additional nuclear RNA polymerases, abbreviated as Pol IV and Pol V (formerly Pol IVa and Pol IVb, respectively). Pol IV and Pol V play non-redundant roles in siRNA-directed DNA methylation and gene silencing pathways.

  18. DNA synthesis involving a complexes form of DNA polymerase I in extracts of Escherichia coli.

    PubMed Central

    Hendler, R W; Pereira, M; Scharff, R

    1975-01-01

    DNA polymerase I (EC 2.7.7.7; deoxynucleosidetriphosphate:DNA deoxynucleotidyltransferase) has been recovered as a complex of about 390,000 molecular weight. The complex displays an ATP-stimulated DNA-synthesizing activity that prefers native to heat-denatured DNA. Genetic evidence indicates that the recBC enzyme is associated with the polymerase in the complex. Preliminary evidence for complexes involving DNA polymerases II and III is also presented. PMID:1094453

  19. KlenTaq polymerase replicates unnatural base pairs by inducing a Watson-Crick geometry.

    PubMed

    Betz, Karin; Malyshev, Denis A; Lavergne, Thomas; Welte, Wolfram; Diederichs, Kay; Dwyer, Tammy J; Ordoukhanian, Phillip; Romesberg, Floyd E; Marx, Andreas

    2012-07-01

    Many candidate unnatural DNA base pairs have been developed, but some of the best-replicated pairs adopt intercalated structures in free DNA that are difficult to reconcile with known mechanisms of polymerase recognition. Here we present crystal structures of KlenTaq DNA polymerase at different stages of replication for one such pair, dNaM-d5SICS, and show that efficient replication results from the polymerase itself, inducing the required natural-like structure.

  20. Human DNA polymerase η accommodates RNA for strand extension.

    PubMed

    Su, Yan; Egli, Martin; Guengerich, F Peter

    2017-11-03

    Ribonucleotides are the natural analogs of deoxyribonucleotides, which can be misinserted by DNA polymerases, leading to the most abundant DNA lesions in genomes. During replication, DNA polymerases tolerate patches of ribonucleotides on the parental strands to different extents. The majority of human DNA polymerases have been reported to misinsert ribonucleotides into genomes. However, only PrimPol, DNA polymerase α, telomerase, and the mitochondrial human DNA polymerase (hpol) γ have been shown to tolerate an entire RNA strand. Y-family hpol η is known for translesion synthesis opposite the UV-induced DNA lesion cyclobutane pyrimidine dimer and was recently found to incorporate ribonucleotides into DNA. Here, we report that hpol η is able to bind DNA/DNA, RNA/DNA, and DNA/RNA duplexes with similar affinities. In addition, hpol η, as well as another Y-family DNA polymerase, hpol κ, accommodates RNA as one of the two strands during primer extension, mainly by inserting dNMPs opposite unmodified templates or DNA lesions, such as 8-oxo-2'-deoxyguanosine or cyclobutane pyrimidine dimer, even in the presence of an equal amount of the DNA/DNA substrate. The discovery of this RNA-accommodating ability of hpol η redefines the traditional concept of human DNA polymerases and indicates potential new functions of hpol η in vivo . © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

  1. The steady-state level and stability of TLS polymerase eta are cell cycle dependent in the yeast S. cerevisiae.

    PubMed

    Plachta, Michal; Halas, Agnieszka; McIntyre, Justyna; Sledziewska-Gojska, Ewa

    2015-05-01

    Polymerase eta (Pol eta) is a ubiquitous translesion DNA polymerase that is capable of bypassing UV-induced pyrimidine dimers in an error-free manner. However, this specialized polymerase is error prone when synthesizing through an undamaged DNA template. In Saccharomyces cerevisiae, both depletion and overproduction of Pol eta result in mutator phenotypes. Therefore, regulation of the cellular abundance of this enzyme is of particular interest. However, based on the investigation of variously tagged forms of Pol eta, mutually contradictory conclusions have been reached regarding the stability of this polymerase in yeast. Here, we optimized a protocol for the detection of untagged yeast Pol eta and established that the half-life of the native enzyme is 80 ± 14 min in asynchronously growing cultures. Experiments with synchronized cells indicated that the cellular abundance of this translesion polymerase changes throughout the cell cycle. Accordingly, we show that the stability of Pol eta, but not its mRNA level, is cell cycle stage dependent. The half-life of the polymerase is more than fourfold shorter in G1-arrested cells than in those at G2/M. Our results, in concert with previous data for Rev1, indicate that cell cycle regulation is a general property of Y family TLS polymerases in S. cerevisiae. Copyright © 2015 Elsevier B.V. All rights reserved.

  2. Generation and characterization of a recombinant Rift Valley fever virus expressing a V5 epitope-tagged RNA-dependent RNA polymerase.

    PubMed

    Brennan, Benjamin; Li, Ping; Elliott, Richard M

    2011-12-01

    The viral RNA-dependent RNA polymerase (RdRp; L protein) of Rift Valley fever virus (RVFV; family Bunyaviridae) is a 238 kDa protein that is crucial for the life cycle of the virus, as it catalyses both transcription of viral mRNAs and replication of the tripartite genome. Despite its importance, little is known about the intracellular distribution of the polymerase or its other roles during infection, primarily because of lack of specific antibodies that recognize L protein. To begin to address these questions we investigated whether the RVFV (MP12 strain) polymerase could tolerate insertion of the V5 epitope, as has been previously demonstrated for the Bunyamwera virus L protein. Insertion of the 14 aa epitope into the polymerase sequence at aa 1852 resulted in a polymerase that retained functionality in a minigenome assay, and we were able to rescue recombinant viruses that expressed the modified L protein by reverse genetics. The L protein could be detected in infected cells by Western blotting with anti-V5 antibodies. Examination of recombinant virus-infected cells by immunofluorescence revealed a punctate perinuclear or cytoplasmic distribution of the polymerase that co-localized with the nucleocapsid protein. The generation of RVFV expressing a tagged RdRp will allow detailed examination of the role of the viral polymerase in the virus life cycle.

  3. BLM helicase facilitates RNA polymerase I-mediated ribosomal RNA transcription

    PubMed Central

    Grierson, Patrick M.; Lillard, Kate; Behbehani, Gregory K.; Combs, Kelly A.; Bhattacharyya, Saumitri; Acharya, Samir; Groden, Joanna

    2012-01-01

    Bloom's syndrome (BS) is an autosomal recessive disorder that is invariably characterized by severe growth retardation and cancer predisposition. The Bloom's syndrome helicase (BLM), mutations of which lead to BS, localizes to promyelocytic leukemia protein bodies and to the nucleolus of the cell, the site of RNA polymerase I-mediated ribosomal RNA (rRNA) transcription. rRNA transcription is fundamental for ribosome biogenesis and therefore protein synthesis, cellular growth and proliferation; its inhibition limits cellular growth and proliferation as well as bodily growth. We report that nucleolar BLM facilitates RNA polymerase I-mediated rRNA transcription. Immunofluorescence studies demonstrate the dependance of BLM nucleolar localization upon ongoing RNA polymerase I-mediated rRNA transcription. In vivo protein co-immunoprecipitation demonstrates that BLM interacts with RPA194, a subunit of RNA polymerase I. 3H-uridine pulse-chase assays demonstrate that BLM expression is required for efficient rRNA transcription. In vitro helicase assays demonstrate that BLM unwinds GC-rich rDNA-like substrates that form in the nucleolus and normally inhibit progression of the RNA polymerase I transcription complex. These studies suggest that nucleolar BLM modulates rDNA structures in association with RNA polymerase I to facilitate RNA polymerase I-mediated rRNA transcription. Given the intricate relationship between rDNA metabolism and growth, our data may help in understanding the etiology of proportional dwarfism in BS. PMID:22106380

  4. BLM helicase facilitates RNA polymerase I-mediated ribosomal RNA transcription.

    PubMed

    Grierson, Patrick M; Lillard, Kate; Behbehani, Gregory K; Combs, Kelly A; Bhattacharyya, Saumitri; Acharya, Samir; Groden, Joanna

    2012-03-01

    Bloom's syndrome (BS) is an autosomal recessive disorder that is invariably characterized by severe growth retardation and cancer predisposition. The Bloom's syndrome helicase (BLM), mutations of which lead to BS, localizes to promyelocytic leukemia protein bodies and to the nucleolus of the cell, the site of RNA polymerase I-mediated ribosomal RNA (rRNA) transcription. rRNA transcription is fundamental for ribosome biogenesis and therefore protein synthesis, cellular growth and proliferation; its inhibition limits cellular growth and proliferation as well as bodily growth. We report that nucleolar BLM facilitates RNA polymerase I-mediated rRNA transcription. Immunofluorescence studies demonstrate the dependance of BLM nucleolar localization upon ongoing RNA polymerase I-mediated rRNA transcription. In vivo protein co-immunoprecipitation demonstrates that BLM interacts with RPA194, a subunit of RNA polymerase I. (3)H-uridine pulse-chase assays demonstrate that BLM expression is required for efficient rRNA transcription. In vitro helicase assays demonstrate that BLM unwinds GC-rich rDNA-like substrates that form in the nucleolus and normally inhibit progression of the RNA polymerase I transcription complex. These studies suggest that nucleolar BLM modulates rDNA structures in association with RNA polymerase I to facilitate RNA polymerase I-mediated rRNA transcription. Given the intricate relationship between rDNA metabolism and growth, our data may help in understanding the etiology of proportional dwarfism in BS.

  5. RNA Polymerase in Mumps Virion

    PubMed Central

    Bernard, Jacqueline P.; Northrop, Robert L.

    1974-01-01

    Mumps virions of the Enders' strain were examined for polymerase activity in vitro. An RNA-dependent RNA polymerase was found to be associated with the virion. The general properties of the reaction appear to be similar to those described for other paramyxoviruses. PMID:4836602

  6. The translesion DNA polymerases Pol ζ and Rev1 are activated independently of PCNA ubiquitination upon UV radiation in mutants of DNA polymerase δ

    PubMed Central

    Ma, Emilie; Veaute, Xavier; Coïc, Eric

    2017-01-01

    Replicative DNA polymerases cannot insert efficiently nucleotides at sites of base lesions. This function is taken over by specialized translesion DNA synthesis (TLS) polymerases to allow DNA replication completion in the presence of DNA damage. In eukaryotes, Rad6- and Rad18-mediated PCNA ubiquitination at lysine 164 promotes recruitment of TLS polymerases, allowing cells to efficiently cope with DNA damage. However, several studies showed that TLS polymerases can be recruited also in the absence of PCNA ubiquitination. We hypothesized that the stability of the interactions between DNA polymerase δ (Pol δ) subunits and/or between Pol δ and PCNA at the primer/template junction is a crucial factor to determine the requirement of PCNA ubiquitination. To test this hypothesis, we used a structural mutant of Pol δ in which the interaction between Pol3 and Pol31 is inhibited. We found that in yeast, rad18Δ-associated UV hypersensitivity is suppressed by pol3-ct, a mutant allele of the POL3 gene that encodes the catalytic subunit of replicative Pol δ. pol3-ct suppressor effect was specifically dependent on the Rev1 and Pol ζ TLS polymerases. This result strongly suggests that TLS polymerases could rely much less on PCNA ubiquitination when Pol δ interaction with PCNA is partially compromised by mutations. In agreement with this model, we found that the pol3-FI allele suppressed rad18Δ-associated UV sensitivity as observed for pol3-ct. This POL3 allele carries mutations within a putative PCNA Interacting Peptide (PIP) motif. We then provided molecular and genetic evidence that this motif could contribute to Pol δ-PCNA interaction indirectly, although it is not a bona fide PIP. Overall, our results suggest that the primary role of PCNA ubiquitination is to allow TLS polymerases to outcompete Pol δ for PCNA access upon DNA damage. PMID:29281621

  7. Comparison between qualitative and real-time polymerase chain reaction to evaluate minimal residual disease in children with acute lymphoblastic leukemia.

    PubMed

    Paula, Francisco Danilo Ferreira; Elói-Santos, Silvana Maria; Xavier, Sandra Guerra; Ganazza, Mônica Aparecida; Jotta, Patricia Yoshioka; Yunes, José Andrés; Viana, Marcos Borato; Assumpção, Juliana Godoy

    2015-01-01

    Minimal residual disease is an important independent prognostic factor that can identify poor responders among patients with acute lymphoblastic leukemia. The aim of this study was to analyze minimal residual disease using immunoglobulin (Ig) and T-cell receptor (TCR) gene rearrangements by conventional polymerase chain reaction followed by homo-heteroduplex analysis and to compare this with real-time polymerase chain reaction at the end of the induction period in children with acute lymphoblastic leukemia. Seventy-four patients diagnosed with acute lymphoblastic leukemia were enrolled. Minimal residual disease was evaluated by qualitative polymerase chain reaction in 57 and by both tests in 44. The Kaplan-Meier and multivariate Cox methods and the log-rank test were used for statistical analysis. Nine patients (15.8%) were positive for minimal residual disease by qualitative polymerase chain reaction and 11 (25%) by real-time polymerase chain reaction considering a cut-off point of 1×10(-3) for precursor B-cell acute lymphoblastic leukemia and 1×10(-2) for T-cell acute lymphoblastic leukemia. Using the qualitative method, the 3.5-year leukemia-free survival was significantly higher in children negative for minimal residual disease compared to those with positive results (84.1%±5.6% versus 41.7%±17.3%, respectively; p-value=0.004). There was no significant association between leukemia-free survival and minimal residual disease by real-time polymerase chain reaction. Minimal residual disease by qualitative polymerase chain reaction was the only variable significantly correlated to leukemia-free survival. Given the difficulties in the implementation of minimal residual disease monitoring by real-time polymerase chain reaction in most treatment centers in Brazil, the qualitative polymerase chain reaction strategy may be a cost-effective alternative. Copyright © 2015 Associação Brasileira de Hematologia, Hemoterapia e Terapia Celular. Published by Elsevier Editora Ltda. All rights reserved.

  8. Differential binding of ppGpp and pppGpp to E. coli RNA polymerase: photo-labeling and mass spectral studies.

    PubMed

    Syal, Kirtimaan; Chatterji, Dipankar

    2015-12-01

    (p)ppGpp, a secondary messenger, is induced under stress and shows pleiotropic response. It binds to RNA polymerase and regulates transcription in Escherichia coli. More than 25 years have passed since the first discovery was made on the direct interaction of ppGpp with E. coli RNA polymerase. Several lines of evidence suggest different modes of ppGpp binding to the enzyme. Earlier cross-linking experiments suggested that the β-subunit of RNA polymerase is the preferred site for ppGpp, whereas recent crystallographic studies pinpoint the interface of β'/ω-subunits as the site of action. With an aim to validate the binding domain and to follow whether tetra- and pentaphosphate guanosines have different location on RNA polymerase, this work was initiated. RNA polymerase was photo-labeled with 8-azido-ppGpp/8-azido-pppGpp, and the product was digested with trypsin and subjected to mass spectrometry analysis. We observed three new peptides in the trypsin digest of the RNA polymerase labeled with 8-azido-ppGpp, of which two peptides correspond to the same pocket on β'-subunit as predicted by X-ray structural analysis, whereas the third peptide was mapped on the β-subunit. In the case of 8-azido-pppGpp-labeled RNA polymerase, we have found only one cross-linked peptide from the β'-subunit. However, we were unable to identify any binding site of pppGpp on the β-subunit. Interestingly, we observed that pppGpp at high concentration competes out ppGpp bound to RNA polymerase more efficiently, whereas ppGpp cannot titrate out pppGpp. The competition between tetraphosphate guanosine and pentaphosphate guanosine for E. coli RNA polymerase was followed by gel-based assay as well as by a new method known as DRaCALA assay. © 2015 The Molecular Biology Society of Japan and Wiley Publishing Asia Pty Ltd.

  9. Wheat DNA Primase (RNA Primer Synthesis in Vitro, Structural Studies by Photochemical Cross-Linking, and Modulation of Primase Activity by DNA Polymerases).

    PubMed Central

    Laquel, P.; Litvak, S.; Castroviejo, M.

    1994-01-01

    DNA primase synthesizes short RNA primers used by DNA polymerases to initiate DNA synthesis. Two proteins of approximately 60 and 50 kD were recognized by specific antibodies raised against yeast primase subunits, suggesting a high degree of analogy between wheat and yeast primase subunits. Gel-filtration chromatography of wheat primase showed two active forms of 60 and 110 to 120 kD. Ultraviolet-induced cross-linking with radioactive oligothymidilate revealed a highly labeled protein of 60 kD. After limited trypsin digestion of wheat (Triticum aestivum L.) primase, a major band of 48 kD and two minor bands of 38 and 17 kD were observed. In the absence of DNA polymerases, the purified primase synthesizes long RNA products. The size of the RNA product synthesized by wheat primase is considerably reduced by the presence of DNA polymerases, suggesting a modulatory effect of the association between these two enzymes. Lowering the primase concentration in the assay also favored short RNA primer synthesis. Several properties of the wheat DNA primase using oligoadenylate [oligo(rA)]-primed or unprimed polythymidilate templates were studied. The ability of wheat primase, without DNA polymerases, to elongate an oligo(rA) primer to long RNA products depends on the primer size, temperature, and the divalent cation concentration. Thus, Mn2+ ions led to long RNA products in a very wide range of concentrations, whereas with Mg2+ long products were observed around 15 mM. We studied the ability of purified wheat DNA polymerases to initiate DNA synthesis from an RNA primer: wheat DNA polymerase A showed the highest activity, followed by DNA polymerases B and CII, whereas DNA polymerase CI was unable to initiate DNA synthesis from an RNA primer. Results are discussed in terms of understanding the role of these polymerases in DNA replication in plants. PMID:12232187

  10. Pyrovanadolysis: a Pyrophosphorolysis-like Reaction Mediated by Pyrovanadate MN2plus and DNA Polymerase of Bacteriophage T7

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    B Akabayov; A Kulczyk; S Akabayov

    2011-12-31

    DNA polymerases catalyze the 3'-5'-pyrophosphorolysis of a DNA primer annealed to a DNA template in the presence of pyrophosphate (PP{sub i}). In this reversal of the polymerization reaction, deoxynucleotides in DNA are converted to deoxynucleoside 5'-triphosphates. Based on the charge, size, and geometry of the oxygen connecting the two phosphorus atoms of PP{sub i}, a variety of compounds was examined for their ability to carry out a reaction similar to pyrophosphorolysis. We describe a manganese-mediated pyrophosphorolysis-like activity using pyrovanadate (VV) catalyzed by the DNA polymerase of bacteriophage T7. We designate this reaction pyrovanadolysis. X-ray absorption spectroscopy reveals a shorter Mn-Vmore » distance of the polymerase-VV complex than the Mn-P distance of the polymerase-PP{sub i} complex. This structural arrangement at the active site accounts for the enzymatic activation by Mn-VV. We propose that the Mn{sup 2+}, larger than Mg{sup 2+}, fits the polymerase active site to mediate binding of VV into the active site of the polymerase. Our results may be the first documentation that vanadium can substitute for phosphorus in biological processes.« less

  11. Translation of the first upstream ORF in the hepatitis B virus pregenomic RNA modulates translation at the core and polymerase initiation codons

    PubMed Central

    Chen, Augustine; Kao, Y. F.; Brown, Chris M.

    2005-01-01

    The human hepatitis B virus (HBV) has a compact genome encoding four major overlapping coding regions: the core, polymerase, surface and X. The polymerase initiation codon is preceded by the partially overlapping core and four or more upstream initiation codons. There is evidence that several mechanisms are used to enable the synthesis of the polymerase protein, including leaky scanning and ribosome reinitiation. We have examined the first AUG in the pregenomic RNA, it precedes that of the core. It initiates an uncharacterized short upstream open reading frame (uORF), highly conserved in all HBV subtypes, we designated the C0 ORF. This arrangement suggested that expression of the core and polymerase may be affected by this uORF. Initiation at the C0 ORF was confirmed in reporter constructs in transfected cells. The C0 ORF had an inhibitory role in downstream expression from the core initiation site in HepG2 cells and in vitro, but also stimulated reinitiation at the polymerase start when in an optimal context. Our results indicate that the C0 ORF is a determinant in balancing the synthesis of the core and polymerase proteins. PMID:15731337

  12. A Polymerase With Potential: The Fe-S Cluster in Human DNA Primase.

    PubMed

    Holt, Marilyn E; Salay, Lauren E; Chazin, Walter J

    2017-01-01

    Replication of DNA in eukaryotes is primarily executed by the combined action of processive DNA polymerases δ and ɛ. These enzymes cannot initiate synthesis of new DNA without the presence of a primer on the template ssDNA. The primers on both the leading and lagging strands are generated by DNA polymerase α-primase (pol-prim). DNA primase is a DNA-dependent RNA polymerase that synthesizes the first ~10 nucleotides and then transfers the substrate to polymerase α to complete primer synthesis. The mechanisms governing the coordination and handoff between primase and polymerase α are largely unknown. Isolated DNA primase contains a [4Fe-4S] 2+ cluster that has been shown to serve as a redox switch modulating DNA binding affinity. This discovery suggests a mechanism for modulating the priming activity of primase and handoff to polymerase α. In this chapter, we briefly discuss the current state of knowledge of primase structure and function, including the role of its iron-sulfur cluster. This is followed by providing the methods for expressing, purifying, and biophysically/structurally characterizing primase and its iron-sulfur cluster-containing domain, p58C. © 2017 Elsevier Inc. All rights reserved.

  13. Structure of human DNA polymerase iota and the mechanism of DNA synthesis.

    PubMed

    Makarova, A V; Kulbachinskiy, A V

    2012-06-01

    Cellular DNA polymerases belong to several families and carry out different functions. Highly accurate replicative DNA polymerases play the major role in cell genome replication. A number of new specialized DNA polymerases were discovered at the turn of XX-XXI centuries and have been intensively studied during the last decade. Due to the special structure of the active site, these enzymes efficiently perform synthesis on damaged DNA but are characterized by low fidelity. Human DNA polymerase iota (Pol ι) belongs to the Y-family of specialized DNA polymerases and is one of the most error-prone enzymes involved in DNA synthesis. In contrast to other DNA polymerases, Pol ι is able to use noncanonical Hoogsteen interactions for nucleotide base pairing. This allows it to incorporate nucleotides opposite various lesions in the DNA template that impair Watson-Crick interactions. Based on the data of X-ray structural analysis of Pol ι in complexes with various DNA templates and dNTP substrates, we consider the structural peculiarities of the Pol ι active site and discuss possible mechanisms that ensure the unique behavior of the enzyme on damaged and undamaged DNA.

  14. Antiviral activity of double-stranded RNA-binding protein PACT against influenza A virus mediated via suppression of viral RNA polymerase.

    PubMed

    Chan, Chi-Ping; Yuen, Chun-Kit; Cheung, Pak-Hin Hinson; Fung, Sin-Yee; Lui, Pak-Yin; Chen, Honglin; Kok, Kin-Hang; Jin, Dong-Yan

    2018-03-07

    PACT is a double-stranded RNA-binding protein that has been implicated in host-influenza A virus (IAV) interaction. PACT facilitates the action of RIG-I in the activation of the type I IFN response, which is suppressed by the viral nonstructural protein NS1. PACT is also known to interact with the IAV RNA polymerase subunit PA. Exactly how PACT exerts its antiviral activity during IAV infection remains to be elucidated. In the current study, we demonstrated the interplay between PACT and IAV polymerase. Induction of IFN-β by the IAV RNP complex was most robust when both RIG-I and PACT were expressed. PACT-dependent activation of IFN-β production was suppressed by the IAV polymerase subunits, polymerase acidic protein, polymerase basic protein 1 (PB1), and PB2. PACT associated with PA, PB1, and PB2. Compromising PACT in IAV-infected A549 cells resulted in the augmentation of viral RNA (vRNA) transcription and replication and IFN-β production. Furthermore, vRNA replication was boosted by knockdown of PACT in both A549 cells and IFN-deficient Vero cells. Thus, the antiviral activity of PACT is mediated primarily via its interaction with and inhibition of IAV polymerase. Taken together, our findings reveal a new facet of the host-IAV interaction in which the interplay between PACT and IAV polymerase affects the outcome of viral infection and antiviral response.-Chan, C.-P., Yuen, C.-K., Cheung, P.-H. H., Fung, S.-Y., Lui, P.-Y., Chen, H., Kok, K.-H., Jin, D.-Y. Antiviral activity of double-stranded RNA-binding protein PACT against influenza A virus mediated via suppression of viral RNA polymerase.

  15. Evolving a polymerase for hydrophobic base analogues.

    PubMed

    Loakes, David; Gallego, José; Pinheiro, Vitor B; Kool, Eric T; Holliger, Philipp

    2009-10-21

    Hydrophobic base analogues (HBAs) have shown great promise for the expansion of the chemical and coding potential of nucleic acids but are generally poor polymerase substrates. While extensive synthetic efforts have yielded examples of HBAs with favorable substrate properties, their discovery has remained challenging. Here we describe a complementary strategy for improving HBA substrate properties by directed evolution of a dedicated polymerase using compartmentalized self-replication (CSR) with the archetypal HBA 5-nitroindole (d5NI) and its derivative 5-nitroindole-3-carboxamide (d5NIC) as selection substrates. Starting from a repertoire of chimeric polymerases generated by molecular breeding of DNA polymerase genes from the genus Thermus, we isolated a polymerase (5D4) with a generically enhanced ability to utilize HBAs. The selected polymerase. 5D4 was able to form and extend d5NI and d5NIC (d5NI(C)) self-pairs as well as d5NI(C) heteropairs with all four bases with efficiencies approaching, or exceeding, those of the cognate Watson-Crick pairs, despite significant distortions caused by the intercalation of the d5NI(C) heterocycles into the opposing strand base stack, as shown by nuclear magnetic resonance spectroscopy (NMR). Unlike Taq polymerase, 5D4 was also able to extend HBA pairs such as Pyrene: varphi (abasic site), d5NI: varphi, and isocarbostyril (ICS): 7-azaindole (7AI), allowed bypass of a chemically diverse spectrum of HBAs, and enabled PCR amplification with primers comprising multiple d5NI(C)-substitutions, while maintaining high levels of catalytic activity and fidelity. The selected polymerase 5D4 promises to expand the range of nucleobase analogues amenable to replication and should find numerous applications, including the synthesis and replication of nucleic acid polymers with expanded chemical and functional diversity.

  16. C-terminal Phenylalanine of Bacteriophage T7 Single-stranded DNA-binding Protein Is Essential for Strand Displacement Synthesis by T7 DNA Polymerase at a Nick in DNA*

    PubMed Central

    Ghosh, Sharmistha; Marintcheva, Boriana; Takahashi, Masateru; Richardson, Charles C.

    2009-01-01

    Single-stranded DNA-binding protein (gp2.5), encoded by gene 2.5 of bacteriophage T7, plays an essential role in DNA replication. Not only does it remove impediments of secondary structure in the DNA, it also modulates the activities of the other replication proteins. The acidic C-terminal tail of gp2.5, bearing a C-terminal phenylalanine, physically and functionally interacts with the helicase and DNA polymerase. Deletion of the phenylalanine or substitution with a nonaromatic amino acid gives rise to a dominant lethal phenotype, and the altered gp2.5 has reduced affinity for T7 DNA polymerase. Suppressors of the dominant lethal phenotype have led to the identification of mutations in gene 5 that encodes the T7 DNA polymerase. The altered residues in the polymerase are solvent-exposed and lie in regions that are adjacent to the bound DNA. gp2.5 lacking the C-terminal phenylalanine has a lower affinity for gp5-thioredoxin relative to the wild-type gp2.5, and this affinity is partially restored by the suppressor mutations in DNA polymerase. gp2.5 enables T7 DNA polymerase to catalyze strand displacement DNA synthesis at a nick in DNA. The resulting 5′-single-stranded DNA tail provides a loading site for T7 DNA helicase. gp2.5 lacking the C-terminal phenylalanine does not support this event with wild-type DNA polymerase but does to a limited extent with T7 DNA polymerase harboring the suppressor mutations. PMID:19726688

  17. Significant contribution of the 3′→5′ exonuclease activity to the high fidelity of nucleotide incorporation catalyzed by human DNA polymerase ϵ

    PubMed Central

    Zahurancik, Walter J.; Klein, Seth J.; Suo, Zucai

    2014-01-01

    Most eukaryotic DNA replication is performed by A- and B-family DNA polymerases which possess a faithful polymerase activity that preferentially incorporates correct over incorrect nucleotides. Additionally, many replicative polymerases have an efficient 3′→5′ exonuclease activity that excises misincorporated nucleotides. Together, these activities contribute to overall low polymerase error frequency (one error per 106–108 incorporations) and support faithful eukaryotic genome replication. Eukaryotic DNA polymerase ϵ (Polϵ) is one of three main replicative DNA polymerases for nuclear genomic replication and is responsible for leading strand synthesis. Here, we employed pre-steady-state kinetic methods and determined the overall fidelity of human Polϵ (hPolϵ) by measuring the individual contributions of its polymerase and 3′→5′ exonuclease activities. The polymerase activity of hPolϵ has a high base substitution fidelity (10−4–10−7) resulting from large decreases in both nucleotide incorporation rate constants and ground-state binding affinities for incorrect relative to correct nucleotides. The 3′→5′ exonuclease activity of hPolϵ further enhances polymerization fidelity by an unprecedented 3.5 × 102 to 1.2 × 104-fold. The resulting overall fidelity of hPolϵ (10−6–10−11) justifies hPolϵ to be a primary enzyme to replicate human nuclear genome (0.1–1.0 error per round). Consistently, somatic mutations in hPolϵ, which decrease its exonuclease activity, are connected with mutator phenotypes and cancer formation. PMID:25414327

  18. Competitive fitness during feast and famine: how SOS DNA polymerases influence physiology and evolution in Escherichia coli.

    PubMed

    Corzett, Christopher H; Goodman, Myron F; Finkel, Steven E

    2013-06-01

    Escherichia coli DNA polymerases (Pol) II, IV, and V serve dual roles by facilitating efficient translesion DNA synthesis while simultaneously introducing genetic variation that can promote adaptive evolution. Here we show that these alternative polymerases are induced as cells transition from exponential to long-term stationary-phase growth in the absence of induction of the SOS regulon by external agents that damage DNA. By monitoring the relative fitness of isogenic mutant strains expressing only one alternative polymerase over time, spanning hours to weeks, we establish distinct growth phase-dependent hierarchies of polymerase mutant strain competitiveness. Pol II confers a significant physiological advantage by facilitating efficient replication and creating genetic diversity during periods of rapid growth. Pol IV and Pol V make the largest contributions to evolutionary fitness during long-term stationary phase. Consistent with their roles providing both a physiological and an adaptive advantage during stationary phase, the expression patterns of all three SOS polymerases change during the transition from log phase to long-term stationary phase. Compared to the alternative polymerases, Pol III transcription dominates during mid-exponential phase; however, its abundance decreases to <20% during long-term stationary phase. Pol IV transcription dominates as cells transition out of exponential phase into stationary phase and a burst of Pol V transcription is observed as cells transition from death phase to long-term stationary phase. These changes in alternative DNA polymerase transcription occur in the absence of SOS induction by exogenous agents and indicate that cell populations require appropriate expression of all three alternative DNA polymerases during exponential, stationary, and long-term stationary phases to attain optimal fitness and undergo adaptive evolution.

  19. The origin and early evolution of nucleic acid polymerases

    NASA Technical Reports Server (NTRS)

    Lazcano, A.; Cappello, R.; Valverde, V.; Llaca, V.; Oro, J.

    1992-01-01

    The hypothesis that vestiges of the ancestral RNA-dependent RNA polymerase involved in the replication of RNA genomes of Archean cells are present in the eubacterial RNA-polymerase beta-prime subunit and its homologues is discussed. It is shown that, in the DNA-dependent RNA polymerases from three cellular lineages, a very conserved sequence of eight amino acids, also found in a small RNA-binding site previously described for the E. coli polynucleotide phosphorylase and the S1 ribosomal protein, is present. The optimal conditions for the replicase activity of the avian-myeloblastosis-virus reverse transcriptase are presented. The evolutionary significance of the in vitro modifications of substrate and template specificities of RNA polymerases and reverse transcriptases is discussed.

  20. DNA Polymerase Eta and Chemotherapeutic Agents

    PubMed Central

    2011-01-01

    Abstract The discovery of human DNA polymerase eta (pol η) has a major impact on the fields of DNA replication/repair fields. Since the discovery of human pol η, a number of new DNA polymerases with the ability to bypass various DNA lesions have been discovered. Among these polymerases, pol η is the most extensively studied lesion bypass polymerase with a defined major biological function, that is, to replicate across the cyclobutane pyrimidine dimers introduced by UV irradiation. Cyclobutane pyrimidine dimer is a major DNA lesion that causes distortion of DNA structure and block the replicative DNA polymerases during DNA replication process. Genetic defects in the pol η gene, Rad30, results in a disease called xeroderma pigmentosum variant. This review focuses on the overall properties of pol η and the mechanism that involved in regulating its activity in cells. In addition, the role of pol η in the action of DNA-targeting anticancer compounds is also discussed. Antioxid. Redox Signal. 14, 2521–2529. PMID:21050139

  1. Hybrid Methods Reveal Multiple Flexibly Linked DNA Polymerases within the Bacteriophage T7 Replisome

    DOE PAGES

    Wallen, Jamie R.; Zhang, Hao; Weis, Caroline; ...

    2017-01-03

    The physical organization of DNA enzymes at a replication fork enables efficient copying of two antiparallel DNA strands, yet dynamic protein interactions within the replication complex complicate replisome structural studies. We employed a combination of crystallographic, native mass spectrometry and small-angle X-ray scattering experiments to capture alternative structures of a model replication system encoded by bacteriophage T7. then, the two molecules of DNA polymerase bind the ring-shaped primase-helicase in a conserved orientation and provide structural insight into how the acidic C-terminal tail of the primase-helicase contacts the DNA polymerase to facilitate loading of the polymerase onto DNA. A third DNA polymerasemore » binds the ring in an offset manner that may enable polymerase exchange during replication. Alternative polymerase binding modes are also detected by small-angle X-ray scattering with DNA substrates present. The collective results unveil complex motions within T7 replisome higher-order structures that are underpinned by multivalent protein-protein interactions with functional implications.« less

  2. The uncoupling of catalysis and translocation in the viral RNA-dependent RNA polymerase

    PubMed Central

    Shu, Bo; Gong, Peng

    2017-01-01

    ABSTRACT The nucleotide addition cycle of nucleic acid polymerases includes 2 major events: the pre-chemistry active site closure leading to the addition of one nucleotide to the product chain; the post-chemistry translocation step moving the polymerase active site one position downstream on its template. In viral RNA-dependent RNA polymerases (RdRPs), structural and biochemical evidences suggest that these 2 events are not tightly coupled, unlike the situation observed in A-family polymerases such as the bacteriophage T7 RNA polymerase. Recently, an RdRP translocation intermediate crystal structure of enterovirus 71 shed light on how translocation may be controlled by elements within RdRP catalytic motifs, and a series of poliovirus apo RdRP crystal structures explicitly suggest that a motif B loop may assist the movement of the template strand in late stages of transcription. Implications of RdRP catalysis-translocation uncoupling and the remaining challenges to further elucidate RdRP translocation mechanism are also discussed. PMID:28277928

  3. Hybrid Methods Reveal Multiple Flexibly Linked DNA Polymerases within the Bacteriophage T7 Replisome

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Wallen, Jamie R.; Zhang, Hao; Weis, Caroline

    The physical organization of DNA enzymes at a replication fork enables efficient copying of two antiparallel DNA strands, yet dynamic protein interactions within the replication complex complicate replisome structural studies. We employed a combination of crystallographic, native mass spectrometry and small-angle X-ray scattering experiments to capture alternative structures of a model replication system encoded by bacteriophage T7. then, the two molecules of DNA polymerase bind the ring-shaped primase-helicase in a conserved orientation and provide structural insight into how the acidic C-terminal tail of the primase-helicase contacts the DNA polymerase to facilitate loading of the polymerase onto DNA. A third DNA polymerasemore » binds the ring in an offset manner that may enable polymerase exchange during replication. Alternative polymerase binding modes are also detected by small-angle X-ray scattering with DNA substrates present. The collective results unveil complex motions within T7 replisome higher-order structures that are underpinned by multivalent protein-protein interactions with functional implications.« less

  4. Shared active site architecture between archaeal PolD and multi-subunit RNA polymerases revealed by X-ray crystallography.

    PubMed

    Sauguet, Ludovic; Raia, Pierre; Henneke, Ghislaine; Delarue, Marc

    2016-08-22

    Archaeal replicative DNA polymerase D (PolD) constitute an atypical class of DNA polymerases made of a proofreading exonuclease subunit (DP1) and a larger polymerase catalytic subunit (DP2), both with unknown structures. We have determined the crystal structures of Pyrococcus abyssi DP1 and DP2 at 2.5 and 2.2 Å resolution, respectively, revealing a catalytic core strikingly different from all other known DNA polymerases (DNAPs). Rather, the PolD DP2 catalytic core has the same 'double-psi β-barrel' architecture seen in the RNA polymerase (RNAP) superfamily, which includes multi-subunit transcriptases of all domains of life, homodimeric RNA-silencing pathway RNAPs and atypical viral RNAPs. This finding bridges together, in non-viral world, DNA transcription and DNA replication within the same protein superfamily. This study documents further the complex evolutionary history of the DNA replication apparatus in different domains of life and proposes a classification of all extant DNAPs.

  5. Shared active site architecture between archaeal PolD and multi-subunit RNA polymerases revealed by X-ray crystallography

    PubMed Central

    Sauguet, Ludovic; Raia, Pierre; Henneke, Ghislaine; Delarue, Marc

    2016-01-01

    Archaeal replicative DNA polymerase D (PolD) constitute an atypical class of DNA polymerases made of a proofreading exonuclease subunit (DP1) and a larger polymerase catalytic subunit (DP2), both with unknown structures. We have determined the crystal structures of Pyrococcus abyssi DP1 and DP2 at 2.5 and 2.2 Å resolution, respectively, revealing a catalytic core strikingly different from all other known DNA polymerases (DNAPs). Rather, the PolD DP2 catalytic core has the same ‘double-psi β-barrel' architecture seen in the RNA polymerase (RNAP) superfamily, which includes multi-subunit transcriptases of all domains of life, homodimeric RNA-silencing pathway RNAPs and atypical viral RNAPs. This finding bridges together, in non-viral world, DNA transcription and DNA replication within the same protein superfamily. This study documents further the complex evolutionary history of the DNA replication apparatus in different domains of life and proposes a classification of all extant DNAPs. PMID:27548043

  6. Both DNA Polymerases δ and ε Contact Active and Stalled Replication Forks Differently

    PubMed Central

    Yu, Chuanhe; Gan, Haiyun

    2017-01-01

    ABSTRACT Three DNA polymerases, polymerases α, δ, and ε (Pol α, Pol δ, and Pol ε), are responsible for eukaryotic genome duplication. When DNA replication stress is encountered, DNA synthesis stalls until the stress is ameliorated. However, it is not known whether there is a difference in the association of each polymerase with active and stalled replication forks. Here, we show that each DNA polymerase has a distinct pattern of association with active and stalled replication forks. Pol α is enriched at extending Okazaki fragments of active and stalled forks. In contrast, although Pol δ contacts the nascent lagging strands of active and stalled forks, it binds to only the matured (and not elongating) Okazaki fragments of stalled forks. Pol ε has greater contact with the nascent single-stranded DNA (ssDNA) of the leading strand on active forks than on stalled forks. We propose that the configuration of DNA polymerases at stalled forks facilitates the resumption of DNA synthesis after stress removal. PMID:28784720

  7. Species difference in ANP32A underlies influenza A virus polymerase host restriction

    PubMed Central

    Long, Jason S.; Giotis, Efstathios S.; Moncorgé, Olivier; Frise, Rebecca; Mistry, Bhakti; James, Joe; Morisson, Mireille; Iqbal, Munir; Vignal, Alain; Skinner, Michael A.; Barclay, Wendy S.

    2015-01-01

    Influenza pandemics occur unpredictably when zoonotic influenza viruses with novel antigenicity acquire the ability to transmit amongst humans 1. Incompatibilities between avian virus components and the human host limit host range breaches. Barriers include receptor preference, virion stability and poor activity of the avian virus RNA-dependent RNA polymerase in human cells 2. Mutants of the heterotrimeric viral polymerase components, particularly PB2 protein, are selected during mammalian adaptation, but their mode of action is unknown 3–6. We show that a species-specific difference in host protein ANP32A accounts for the suboptimal function of avian virus polymerase in mammalian cells. Avian ANP32A possesses an additional 33 amino acids between the LRR and LCAR domains. In mammalian cells, avian ANP32A rescued the suboptimal function of avian virus polymerase to levels similar to mammalian adapted polymerase. Deletion of the avian-specific sequence from chicken ANP32A abrogated this activity whereas its insertion into human ANP32A, or closely related ANP32B, supported avian virus polymerase function. Substitutions, such as PB2 E627K, rapidly selected upon infection of humans with avian H5N1 or H7N9 influenza viruses, adapt the viral polymerase for the shorter mammalian ANP32A. Thus ANP32A represents an essential host partner co-opted to support influenza virus replication and is a candidate host target for novel antivirals. PMID:26738596

  8. Multisubunit DNA-Dependent RNA Polymerases from Vaccinia Virus and Other Nucleocytoplasmic Large-DNA Viruses: Impressions from the Age of Structure.

    PubMed

    Mirzakhanyan, Yeva; Gershon, Paul D

    2017-09-01

    The past 17 years have been marked by a revolution in our understanding of cellular multisubunit DNA-dependent RNA polymerases (MSDDRPs) at the structural level. A parallel development over the past 15 years has been the emerging story of the giant viruses, which encode MSDDRPs. Here we link the two in an attempt to understand the specialization of multisubunit RNA polymerases in the domain of life encompassing the large nucleocytoplasmic DNA viruses (NCLDV), a superclade that includes the giant viruses and the biochemically well-characterized poxvirus vaccinia virus. The first half of this review surveys the recently determined structural biology of cellular RNA polymerases for a microbiology readership. The second half discusses a reannotation of MSDDRP subunits from NCLDV families and the apparent specialization of these enzymes by virus family and by subunit with regard to subunit or domain loss, subunit dissociability, endogenous control of polymerase arrest, and the elimination/customization of regulatory interactions that would confer higher-order cellular control. Some themes are apparent in linking subunit function to structure in the viral world: as with cellular RNA polymerases I and III and unlike cellular RNA polymerase II, the viral enzymes seem to opt for speed and processivity and seem to have eliminated domains associated with higher-order regulation. The adoption/loss of viral RNA polymerase proofreading functions may have played a part in matching intrinsic mutability to genome size. Copyright © 2017 American Society for Microbiology.

  9. A PCR method based on 18S rRNA gene for detection of malaria parasite in Balochistan.

    PubMed

    Shahwani, Zubeda; Aleem, Abdul; Ahmed, Nazeer; Mushtaq, Muhammad; Afridi, Sarwat

    2016-12-01

    To establish a polymerase chain reaction method based on 18S ribosomal ribonucleic acid gene for the detection of plasmodium deoxyribonucleic acid in patients suffering from malaria symptoms. This cross-sectional study was conducted from September 2013 to October 2014 in district Quetta of Pakistan's Balochistan province. Blood samples were collected from patients suffering from general symptoms of malaria. A polymerase chain reaction-based technique was applied for the diagnosis of malaria and detection of responsible species in the patients who were suspected to carry the parasite. Performance of this polymerase chain reaction method was compared against the microscopy results. Parasite number was also calculated for microscopy positive samples.All samples after the genomic deoxyribonucleic acid isolation were subjected to polymerase chain reaction amplification and agarose gel electrophoresis. Of the 200 samples, 114(57%) were confirmed as positive and 86(43%) as negative for malaria by microscopy. Polymerase chain reaction identified 124(62%) samples as positive and 76(38%) as negative for malaria. The comparative analysis of both diagnostic methods confirmed 109(54.5%) samples as positive by both techniques. Besides, 5(6.58%) samples were identified as false positive and 15(12.1%) samples as false negative by polymerase chain reaction. Sensitivity, specificity and positive predictive values for polymerase chain reaction in comparison to microscopy were 87.98%, 93.42% and 96%, respectively. Polymerase chain reaction-based methods in malaria diagnosis and species identification were found to be more effective than other techniques.

  10. Structural insight into recruitment of translesion DNA polymerase Dpo4 to sliding clamp PCNA

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Xing, G.; Kirouac, K.; Shin, Y.J.

    2009-09-16

    DNA polymerases are co-ordinated by sliding clamps (PCNA/{beta}-clamp) in translesion synthesis. It is unclear how these enzymes assemble on PCNA with geometric and functional compatibility. We report the crystal structure of a full-length Y-family polymerase, Dpo4, in complex with heterodimeric PCNA1-PCNA2 at 2.05 {angstrom} resolution. Dpo4 exhibits an extended conformation that differs from the Dpo4 structures in apo- or DNA-bound form. Two hinges have been identified in Dpo4, which render the multidomain polymerase flexible conformations and orientations relative to PCNA. Dpo4 binds specifically to PCNA1 on the conserved ligand binding site. The C-terminal peptide of Dpo4 becomes structured with amore » 3{sub 10} helix and dominates the specific binding. The Y-family polymerase also contacts PCNA1 with its finger, thumb and little finger domains, which are conformation-dependent protein-protein interactions that diversify the binding mode of Dpo4 on PCNA. The structure reveals a molecular model in which substrate/partner binding-coupled multiple conformations of a Y-family polymerase facilitate its recruitment and co-ordination on the sliding clamp. The conformational flexibility would turn the error-prone Y-family polymerase off when more efficient high-fidelity DNA polymerases work on undamaged DNA and turn it onto DNA templates to perform translesion synthesis when replication forks are stalled by DNA lesions.« less

  11. Problem-Solving Test: Real-Time Polymerase Chain Reaction

    ERIC Educational Resources Information Center

    Szeberenyi, Jozsef

    2009-01-01

    Terms to be familiar with before you start to solve the test: polymerase chain reaction, DNA amplification, electrophoresis, breast cancer, "HER2" gene, genomic DNA, "in vitro" DNA synthesis, template, primer, Taq polymerase, 5[prime][right arrow]3[prime] elongation activity, 5[prime][right arrow]3[prime] exonuclease activity, deoxyribonucleoside…

  12. Polymerase Gamma Disease through the Ages

    ERIC Educational Resources Information Center

    Saneto, Russell P.; Naviaux, Robert K.

    2010-01-01

    The most common group of mitochondrial disease is due to mutations within the mitochondrial DNA polymerase, polymerase gamma 1 ("POLG"). This gene product is responsible for replication and repair of the small mitochondrial DNA genome. The structure-function relationship of this gene product produces a wide variety of diseases that at times, seems…

  13. Fixing the model for transcription: the DNA moves, not the polymerase.

    PubMed

    Papantonis, Argyris; Cook, Peter R

    2011-01-01

    The traditional model for transcription sees active polymerases tracking along their templates. An alternative (controversial) model has active enzymes immobilized in "factories." Recent evidence supports the idea that the DNA moves, not the polymerase, and points to alternative explanations of how regulatory motifs like enhancers and silencers work.

  14. Purine inhibitors of protein kinases, G proteins and polymerases

    DOEpatents

    Gray, Nathanael S.; Schultz, Peter; Kim, Sung-Hou; Meijer, Laurent

    2001-07-03

    The present invention relates to purine analogs that inhibit, inter alia, protein kinases, G-proteins and polymerases. In addition, the present invention relates to methods of using such purine analogs to inhibit protein kinases, G-proteins, polymerases and other cellular processes and to treat cellular proliferative diseases.

  15. Contributions of in vitro transcription to the understanding of human RNA polymerase III transcription

    PubMed Central

    Dumay-Odelot, Hélène; Durrieu-Gaillard, Stéphanie; El Ayoubi, Leyla; Parrot, Camila; Teichmann, Martin

    2014-01-01

    Human RNA polymerase III transcribes small untranslated RNAs that contribute to the regulation of essential cellular processes, including transcription, RNA processing and translation. Analysis of this transcription system by in vitro transcription techniques has largely contributed to the discovery of its transcription factors and to the understanding of the regulation of human RNA polymerase III transcription. Here we review some of the key steps that led to the identification of transcription factors and to the definition of minimal promoter sequences for human RNA polymerase III transcription. PMID:25764111

  16. The evolution of the protein synthesis system. I - A model of a primitive protein synthesis system

    NASA Technical Reports Server (NTRS)

    Mizutani, H.; Ponnamperuma, C.

    1977-01-01

    A model is developed to describe the evolution of the protein synthesis system. The model is comprised of two independent autocatalytic systems, one including one gene (A-gene) and two activated amino acid polymerases (O and A-polymerases), and the other including the addition of another gene (N-gene) and a nucleotide polymerase. Simulation results have suggested that even a small enzymic activity and polymerase specificity could lead the system to the most accurate protein synthesis, as far as permitted by transitions to systems with higher accuracy.

  17. Picornaviral Polymerase Structure, Function, and Fidelity Modulation

    PubMed Central

    Peersen, Olve B.

    2017-01-01

    Like all positive strand RNA viruses, the picornaviruses replicate their genomes using a virally encoded RNA-dependent RNA polymerase enzyme known as 3Dpol. Over the past decade we have made tremendous advances in our understanding of 3Dpol structure and function, including the discovery of a novel mechanism for closing the active site that allows these viruses to easily fine tune replication fidelity and quasispecies distributions. This review summarizes current knowledge of picornaviral polymerase structure and how the enzyme interacts with RNA and other viral proteins to form stable and processive elongation complexes. The picornaviral RdRPs are among the smallest viral polymerases, but their fundamental molecular mechanism for catalysis appears to be generally applicable as a common feature of all positive strand RNA virus polymerases. PMID:28163093

  18. 3D structure of the influenza virus polymerase complex: Localization of subunit domains

    PubMed Central

    Area, Estela; Martín-Benito, Jaime; Gastaminza, Pablo; Torreira, Eva; Valpuesta, José M.; Carrascosa, José L.; Ortín, Juan

    2004-01-01

    The 3D structure of the influenza virus polymerase complex was determined by electron microscopy and image processing of recombinant ribonucleoproteins (RNPs). The RNPs were generated by in vivo amplification using cDNAs of the three polymerase subunits, the nucleoprotein, and a model virus-associated RNA containing 248 nt. The polymerase structure obtained is very compact, with no apparent boundaries among subunits. The position of specific regions of the PB1, PB2, and PA subunits was determined by 3D reconstruction of either RNP–mAb complexes or tagged RNPs. This structural model is available for the polymerase of a negative-stranded RNA virus and provides a general delineation of the complex and its interaction with the template-associated nucleoprotein monomers in the RNP. PMID:14691253

  19. Heat-mediated activation of affinity-immobilized Taq DNA polymerase.

    PubMed

    Nilsson, J; Bosnes, M; Larsen, F; Nygren, P A; Uhlén, M; Lundeberg, J

    1997-04-01

    A novel strategy for heat-mediated activation of recombinant Taq DNA polymerase is described. A serum albumin binding protein tag is used to affinity-immobilize an E. coli-expressed Taq DNA polymerase fusion protein onto a solid support coated with human serum albumin (HSA). Analysis of heat-mediated elution showed that elevated temperatures (> 70 degrees C) were required to significantly release the fusion protein from the solid support. A primer-extension assay showed that immobilization of the fusion protein resulted in little or no extension product. In contrast, fusion protein released from the HSA ligand by heat showed high polymerase activity. Thus, a heat-mediated release and reactivation of the Taq DNA polymerase fusion protein from the solid support can be obtained to allow for hot-start PCR with improved amplification performance.

  20. Determination of human DNA polymerase utilization for the repair of a model ionizing radiation-induced DNA strand break lesion in a defined vector substrate

    NASA Technical Reports Server (NTRS)

    Winters, T. A.; Russell, P. S.; Kohli, M.; Dar, M. E.; Neumann, R. D.; Jorgensen, T. J.

    1999-01-01

    Human DNA polymerase and DNA ligase utilization for the repair of a major class of ionizing radiation-induced DNA lesion [DNA single-strand breaks containing 3'-phosphoglycolate (3'-PG)] was examined using a novel, chemically defined vector substrate containing a single, site-specific 3'-PG single-strand break lesion. In addition, the major human AP endonuclease, HAP1 (also known as APE1, APEX, Ref-1), was tested to determine if it was involved in initiating repair of 3'-PG-containing single-strand break lesions. DNA polymerase beta was found to be the primary polymerase responsible for nucleotide incorporation at the lesion site following excision of the 3'-PG blocking group. However, DNA polymerase delta/straightepsilon was also capable of nucleotide incorporation at the lesion site following 3'-PG excision. In addition, repair reactions catalyzed by DNA polymerase beta were found to be most effective in the presence of DNA ligase III, while those catalyzed by DNA polymerase delta/straightepsilon appeared to be more effective in the presence of DNA ligase I. Also, it was demonstrated that the repair initiating 3'-PG excision reaction was not dependent upon HAP1 activity, as judged by inhibition of HAP1 with neutralizing HAP1-specific polyclonal antibody.

  1. High-throughput Screening Identification of Poliovirus RNA-dependent RNA Polymerase Inhibitors

    PubMed Central

    Campagnola, Grace; Gong, Peng; Peersen, Olve B.

    2011-01-01

    Viral RNA-dependent RNA polymerase (RdRP) enzymes are essential for the replication of positive-strand RNA viruses and established targets for the development of selective antiviral therapeutics. In this work we have carried out a high-throughput screen of 154,267 compounds to identify poliovirus polymerase inhibitors using a fluorescence based RNA elongation assay. Screening and subsequent validation experiments using kinetic methods and RNA product analysis resulted in the identification of seven inhibitors that affect the RNA binding, initiation, or elongation activity of the polymerase. X-ray crystallography data show clear density for five of the compounds in the active site of the poliovirus polymerase elongation complex. The inhibitors occupy the NTP binding site by stacking on the priming nucleotide and interacting with the templating base, yet competition studies show fairly weak IC50 values in the low μM range. A comparison with nucleotide bound structures suggests that weak binding is likely due to the lack of a triphosphate group on the inhibitors. Consequently, the inhibitors are primarily effective at blocking polymerase initiation and do not effectively compete with NTP binding during processive elongation. These findings are discussed in the context of the polymerase elongation complex structure and allosteric control of the viral RdRP catalytic cycle. PMID:21722674

  2. Single-stranded DNA-binding Protein in Vitro Eliminates the Orientation-dependent Impediment to Polymerase Passage on CAG/CTG Repeats*

    PubMed Central

    Delagoutte, Emmanuelle; Goellner, Geoffrey M.; Guo, Jie; Baldacci, Giuseppe; McMurray, Cynthia T.

    2008-01-01

    Small insertions and deletions of trinucleotide repeats (TNRs) can occur by polymerase slippage and hairpin formation on either template or newly synthesized strands during replication. Although not predicted by a slippage model, deletions occur preferentially when 5′-CTG is in the lagging strand template and are highly favored over insertion events in rapidly replicating cells. The mechanism for the deletion bias and the orientation dependence of TNR instability is poorly understood. We report here that there is an orientation-dependent impediment to polymerase progression on 5′-CAG and 5′-CTG repeats that can be relieved by the binding of single-stranded DNA-binding protein. The block depends on the primary sequence of the TNR but does not correlate with the thermodynamic stability of hairpins. The orientation-dependent block of polymerase passage is the strongest when 5′-CAG is the template. We propose a “template-push” model in which the slow speed of DNA polymerase across the 5′-CAG leading strand template creates a threat to helicase-polymerase coupling. To prevent uncoupling, the TNR template is pushed out and by-passed. Hairpins do not cause the block, but appear to occur as a consequence of polymerase pass-over. PMID:18263578

  3. Adaptive Mutations in Influenza A/California/07/2009 Enhance Polymerase Activity and Infectious Virion Production.

    PubMed

    Slaine, Patrick D; MacRae, Cara; Kleer, Mariel; Lamoureux, Emily; McAlpine, Sarah; Warhuus, Michelle; Comeau, André M; McCormick, Craig; Hatchette, Todd; Khaperskyy, Denys A

    2018-05-18

    Mice are not natural hosts for influenza A viruses (IAVs), but they are useful models for studying antiviral immune responses and pathogenesis. Serial passage of IAV in mice invariably causes the emergence of adaptive mutations and increased virulence. Here, we report the adaptation of IAV reference strain A/California/07/2009(H1N1) (also known as CA/07) in outbred Swiss Webster mice. Serial passage led to increased virulence and lung titers, and dissemination of the virus to brains. We adapted a deep-sequencing protocol to identify and enumerate adaptive mutations across all genome segments. Among mutations that emerged during mouse-adaptation, we focused on amino acid substitutions in polymerase subunits: polymerase basic-1 (PB1) T156A and F740L and polymerase acidic (PA) E349G. These mutations were evaluated singly and in combination in minigenome replicon assays, which revealed that PA E349G increased polymerase activity. By selectively engineering three PB1 and PA mutations into the parental CA/07 strain, we demonstrated that these mutations in polymerase subunits decreased the production of defective viral genome segments with internal deletions and dramatically increased the release of infectious virions from mouse cells. Together, these findings increase our understanding of the contribution of polymerase subunits to successful host adaptation.

  4. The effect of main urine inhibitors on the activity of different DNA polymerases in loop-mediated isothermal amplification.

    PubMed

    Jevtuševskaja, Jekaterina; Krõlov, Katrin; Tulp, Indrek; Langel, Ülo

    2017-04-01

    The use of rapid amplification methods to detect pathogens in biological samples is mainly limited by the amount of pathogens present in the sample and the presence of inhibiting substances. Inhibitors can affect the amplification efficiency by either binding to the polymerase, interacting with the DNA, or interacting with the polymerase during primer extension. Amplification is performed using DNA polymerase enzymes and even small changes in their activity can influence the sensitivity and robustness of molecular assays Methods: The main purpose of this research was to examine which compounds present in urine inhibit polymerases with strand displacement activity. To quantify the inhibition, we employed quantitative loop-mediated isothermal amplification Results: The authors found that the presence of BSA, Mg 2+, and urea at physiologically relevant concentrations, as well as acidic or alkaline conditions did not affect the activity of any of the tested polymerases. However, addition of salt significantly affected the activity of the tested polymerases. These findings may aid in the development of more sensitive, robust, cost effective isothermal amplification based molecular assays suitable for both point-of-care testing and on-site screening of pathogens directly from unprocessed urine which avoid the need for long and tedious DNA purification steps prior to amplification.

  5. Role of disulfide bridges in archaeal family-B DNA polymerases.

    PubMed

    Killelea, Tom; Connolly, Bernard A

    2011-06-14

    The family-B DNA polymerases obtained from the order Thermococcales, for example, Pyrococcus furiosus (Pfu-Pol) are commonly used in the polymerase chain reaction (PCR) because of their high thermostability and low error rates. Most of these polymerases contain four cysteines, arranged as two disulfide bridges. With Pfu-Pol C429-C443 forms one of the disulfides (DB1) and C507-C510 (DB2) the other. Although the disulfides are well conserved in the enzymes from the hyperthermophilic Thermococcales, they are less prevalent in euryarchaeal polymerases from other orders, and tend to be only found in other hyperthermophiles. Here, we report on the effects of deleting the disulfide bridges by mutating the relevant cysteines to serines. A variety of techniques, including differential scanning calorimetry and differential scanning fluorimetry, have shown that both disulfides make a contribution to thermostability, with DB1 being more important than DB2. However, even when both disulfides are removed, sufficient thermostability remains for normal (identical to the wild type) performance in PCR and quantitative (real-time) PCR. Therefore, polymerases totally lacking cysteine are fully compatible with most PCR-based applications. This observation opens the way to further engineering of polymerases by introduction of a single cysteine followed by appropriate chemical modification. Copyright © 2011 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  6. Looking for inhibitors of the dengue virus NS5 RNA-dependent RNA-polymerase using a molecular docking approach

    PubMed Central

    Galiano, Vicente; Garcia-Valtanen, Pablo; Micol, Vicente; Encinar, José Antonio

    2016-01-01

    The dengue virus (DENV) nonstructural protein 5 (NS5) contains both an N-terminal methyltransferase domain and a C-terminal RNA-dependent RNA polymerase domain. Polymerase activity is responsible for viral RNA synthesis by a de novo initiation mechanism and represents an attractive target for antiviral therapy. The incidence of DENV has grown rapidly and it is now estimated that half of the human population is at risk of becoming infected with this virus. Despite this, there are no effective drugs to treat DENV infections. The present in silico study aimed at finding new inhibitors of the NS5 RNA-dependent RNA polymerase of the four serotypes of DENV. We used a chemical library comprising 372,792 nonnucleotide compounds (around 325,319 natural compounds) to perform molecular docking experiments against a binding site of the RNA template tunnel of the virus polymerase. Compounds with high negative free energy variation (ΔG <−10.5 kcal/mol) were selected as putative inhibitors. Additional filters for favorable druggability and good absorption, distribution, metabolism, excretion, and toxicity were applied. Finally, after the screening process was completed, we identified 39 compounds as lead DENV polymerase inhibitor candidates. Potentially, these compounds could act as efficient DENV polymerase inhibitors in vitro and in vivo. PMID:27784988

  7. The yeast Saccharomyces cerevisiae DNA polymerase IV: possible involvement in double strand break DNA repair.

    PubMed

    Leem, S H; Ropp, P A; Sugino, A

    1994-08-11

    We identified and purified a new DNA polymerase (DNA polymerase IV), which is similar to mammalian DNA polymerase beta, from Saccharomyces cerevisiae and suggested that it is encoded by YCR14C (POLX) on chromosome III. Here, we provided a direct evidence that the purified DNA polymerase IV is indeed encoded by POLX. Strains harboring a pol4 deletion mutation exhibit neither mitotic growth defect nor a meiosis defect, suggesting that DNA polymerase IV participates in nonessential functions in DNA metabolism. The deletion strains did not exhibit UV-sensitivity. However, they did show weak sensitivity to MMS-treatment and exhibited a hyper-recombination phenotype when intragenic recombination was measured during meiosis. Furthermore, MAT alpha pol4 delta segregants had a higher frequency of illegitimate mating with a MAT alpha tester strain than that of wild-type cells. These results suggest that DNA polymerase IV participates in a double-strand break repair pathway. A 3.2kb of the POL4 transcript was weakly expressed in mitotically growing cells. During meiosis, a 2.2 kb POL4 transcript was greatly induced, while the 3.2 kb transcript stayed at constant levels. This induction was delayed in a swi4 delta strain during meiosis, while no effect was observed in a swi6 delta strain.

  8. Intergenic Transcriptional Interference Is Blocked by RNA Polymerase III Transcription Factor TFIIIB in Saccharomyces cerevisiae

    PubMed Central

    Korde, Asawari; Rosselot, Jessica M.; Donze, David

    2014-01-01

    The major function of eukaryotic RNA polymerase III is to transcribe transfer RNA, 5S ribosomal RNA, and other small non-protein-coding RNA molecules. Assembly of the RNA polymerase III complex on chromosomal DNA requires the sequential binding of transcription factor complexes TFIIIC and TFIIIB. Recent evidence has suggested that in addition to producing RNA transcripts, chromatin-assembled RNA polymerase III complexes may mediate additional nuclear functions that include chromatin boundary, nucleosome phasing, and general genome organization activities. This study provides evidence of another such “extratranscriptional” activity of assembled RNA polymerase III complexes, which is the ability to block progression of intergenic RNA polymerase II transcription. We demonstrate that the RNA polymerase III complex bound to the tRNA gene upstream of the Saccharomyces cerevisiae ATG31 gene protects the ATG31 promoter against readthrough transcriptional interference from the upstream noncoding intergenic SUT467 transcription unit. This protection is predominately mediated by binding of the TFIIIB complex. When TFIIIB binding to this tRNA gene is weakened, an extended SUT467–ATG31 readthrough transcript is produced, resulting in compromised ATG31 translation. Since the ATG31 gene product is required for autophagy, strains expressing the readthrough transcript exhibit defective autophagy induction and reduced fitness under autophagy-inducing nitrogen starvation conditions. Given the recent discovery of widespread pervasive transcription in all forms of life, protection of neighboring genes from intergenic transcriptional interference may be a key extratranscriptional function of assembled RNA polymerase III complexes and possibly other DNA binding proteins. PMID:24336746

  9. Influence of PCR reagents on DNA polymerase extension rates measured on real-time PCR instruments.

    PubMed

    Montgomery, Jesse L; Wittwer, Carl T

    2014-02-01

    Radioactive DNA polymerase activity methods are cumbersome and do not provide initial extension rates. A simple extension rate assay would enable study of basic assumptions about PCR and define the limits of rapid PCR. A continuous assay that monitors DNA polymerase extension using noncovalent DNA dyes on common real-time PCR instruments was developed. Extension rates were measured in nucleotides per second per molecule of polymerase. To initiate the reaction, a nucleotide analog was heat activated at 95 °C for 5 min, the temperature decreased to 75 °C, and fluorescence monitored until substrate exhaustion in 30-90 min. The assay was linear with time for over 40% of the reaction and for polymerase concentrations over a 100-fold range (1-100 pmol/L). Extension rates decreased continuously with increasing monovalent cation concentrations (lithium, sodium, potassium, cesium, and ammonium). Melting-temperature depressors had variable effects. DMSO increased rates up to 33%, whereas glycerol had little effect. Betaine, formamide, and 1,2-propanediol decreased rates with increasing concentrations. Four common noncovalent DNA dyes inhibited polymerase extension. Heat-activated nucleotide analogs were 92% activated after 5 min, and hot start DNA polymerases were 73%-90% activated after 20 min. Simple DNA extension rate assays can be performed on real-time PCR instruments. Activity is decreased by monovalent cations, DNA dyes, and most melting temperature depressors. Rational inclusion of PCR components on the basis of their effects on polymerase extension is likely to be useful in PCR, particularly rapid-cycle or fast PCR.

  10. Pre-Steady State Kinetic Investigation of the Incorporation of Anti-Hepatitis B Nucleotide Analogs Catalyzed by Non-Canonical Human DNA Polymerases

    PubMed Central

    Brown, Jessica A.; Pack, Lindsey R.; Fowler, Jason D.; Suo, Zucai

    2011-01-01

    Antiviral nucleoside analogs have been developed to inhibit the enzymatic activities of the hepatitis B virus (HBV) polymerase, thereby preventing the replication and production of HBV. However, the usage of these analogs can be limited by drug toxicity because the 5′-triphosphates of these nucleoside analogs (nucleotide analogs) are potential substrates for human DNA polymerases to incorporate into host DNA. Although they are poor substrates for human replicative DNA polymerases, it remains to be established whether these nucleotide analogs are substrates for the recently discovered human X- and Y-family DNA polymerases. Using pre-steady state kinetic techniques, we have measured the substrate specificity values for human DNA polymerases β, λ, η, ι, κ, and Rev1 incorporating the active forms of the following anti-HBV nucleoside analogs approved for clinical use: adefovir, tenofovir, lamivudine, telbivudine, and entecavir. Compared to the incorporation of a natural nucleotide, most of the nucleotide analogs were incorporated less efficiently (2 to >122,000) by the six human DNA polymerases. In addition, the potential for entecavir and telbivudine, two drugs which possess a 3′-hydroxyl, to become embedded into human DNA was examined by primer extension and DNA ligation assays. These results suggested that telbivudine functions as a chain terminator while entecavir was efficiently extended by the six enzymes and was a substrate for human DNA ligase I. Our findings suggested that incorporation of anti-HBV nucleotide analogs catalyzed by human X- and Y-family polymerases may contribute to clinical toxicity. PMID:22132702

  11. A structural role for the PHP domain in E. coli DNA polymerase III.

    PubMed

    Barros, Tiago; Guenther, Joel; Kelch, Brian; Anaya, Jordan; Prabhakar, Arjun; O'Donnell, Mike; Kuriyan, John; Lamers, Meindert H

    2013-05-14

    In addition to the core catalytic machinery, bacterial replicative DNA polymerases contain a Polymerase and Histidinol Phosphatase (PHP) domain whose function is not entirely understood. The PHP domains of some bacterial replicases are active metal-dependent nucleases that may play a role in proofreading. In E. coli DNA polymerase III, however, the PHP domain has lost several metal-coordinating residues and is likely to be catalytically inactive. Genomic searches show that the loss of metal-coordinating residues in polymerase PHP domains is likely to have coevolved with the presence of a separate proofreading exonuclease that works with the polymerase. Although the E. coli Pol III PHP domain has lost metal-coordinating residues, the structure of the domain has been conserved to a remarkable degree when compared to that of metal-binding PHP domains. This is demonstrated by our ability to restore metal binding with only three point mutations, as confirmed by the metal-bound crystal structure of this mutant determined at 2.9 Å resolution. We also show that Pol III, a large multi-domain protein, unfolds cooperatively and that mutations in the degenerate metal-binding site of the PHP domain decrease the overall stability of Pol III and reduce its activity. While the presence of a PHP domain in replicative bacterial polymerases is strictly conserved, its ability to coordinate metals and to perform proofreading exonuclease activity is not, suggesting additional non-enzymatic roles for the domain. Our results show that the PHP domain is a major structural element in Pol III and its integrity modulates both the stability and activity of the polymerase.

  12. Endogenous overexpression of an active phosphorylated form of DNA polymerase β under oxidative stress in Trypanosoma cruzi.

    PubMed

    Rojas, Diego A; Urbina, Fabiola; Moreira-Ramos, Sandra; Castillo, Christian; Kemmerling, Ulrike; Lapier, Michel; Maya, Juan Diego; Solari, Aldo; Maldonado, Edio

    2018-02-01

    Trypanosoma cruzi is exposed during its life to exogenous and endogenous oxidative stress, leading to damage of several macromolecules such as DNA. There are many DNA repair pathways in the nucleus and mitochondria (kinetoplast), where specific protein complexes detect and eliminate damage to DNA. One group of these proteins is the DNA polymerases. In particular, Tc DNA polymerase β participates in kinetoplast DNA replication and repair. However, the mechanisms which control its expression under oxidative stress are still unknown. Here we describe the effect of oxidative stress on the expression and function of Tc DNA polymerase β To this end parasite cells (epimastigotes and trypomastigotes) were exposed to peroxide during short periods of time. Tc DNA polymerase β which was associated physically with kinetoplast DNA, showed increased protein levels in response to peroxide damage in both parasite forms analyzed. Two forms of DNA polymerase β were identified and overexpressed after peroxide treatment. One of them was phosphorylated and active in DNA synthesis after renaturation on polyacrylamide electrophoresis gel. This phosphorylated form showed 3-4-fold increase in both parasite forms. Our findings indicate that these increments in protein levels are not under transcriptional control because the level of Tc DNA polymerase β mRNA is maintained or slightly decreased during the exposure to oxidative stress. We propose a mechanism where a DNA repair pathway activates a cascade leading to the increment of expression and phosphorylation of Tc DNA polymerase β in response to oxidative damage, which is discussed in the context of what is known in other trypanosomes which lack transcriptional control.

  13. The C-terminal region of translesion synthesis DNA polymerase η is partially unstructured and has high conformational flexibility

    PubMed Central

    Powers, Kyle T; Washington, M Todd

    2018-01-01

    Abstract Eukaryotic DNA polymerase η catalyzes translesion synthesis of thymine dimers and 8-oxoguanines. It is comprised of a polymerase domain and a C-terminal region, both of which are required for its biological function. The C-terminal region mediates interactions with proliferating cell nuclear antigen (PCNA) and other translesion synthesis proteins such as Rev1. This region contains a ubiquitin-binding/zinc-binding (UBZ) motif and a PCNA-interacting protein (PIP) motif. Currently little structural information is available for this region of polymerase η. Using a combination of approaches—including genetic complementation assays, X-ray crystallography, Langevin dynamics simulations, and small-angle X-ray scattering—we show that the C-terminal region is partially unstructured and has high conformational flexibility. This implies that the C-terminal region acts as a flexible tether linking the polymerase domain to PCNA thereby increasing its local concentration. Such tethering would facilitate the sampling of translesion synthesis polymerases to ensure that the most appropriate one is selected to bypass the lesion. PMID:29385534

  14. Purification of Xenopus laevis mitochondrial RNA polymerase and identification of a dissociable factor required for specific transcription

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Bogenhagen, D.F.; Insdorf, N.F.

    1988-07-01

    The Xenopus laevis mitochondrial RNA (mtRNA) polymerase was purified to near homogeneity with an overall yield approaching 50%. The major polypeptides in the final fraction were a doublet of proteins of approximately 140 kilodaltons that copurified with the mtRNA polymerase activity. It appeared likely that the smaller polypeptide is a breakdown product of the larger one. The highly purified polymerase was active in nonspecific transcription but required a dissociable factor for specific transcription of X. laevis mtDNA. The factor could be resolved from mtRNA polymerase by hydrophobic chromatography and had a sedimentation coefficient of 3.0 S. The transcription factor elutedmore » from both the hydrophobic column and a Mono Q anion-exchange column as a single symmetrical peak. The mtRNA polymerase and this factor together are necessary and sufficient for active transcription from four promoters located in a noncoding region of the mtDNA genome between the gene for tRNA/sup Phe/ and the displacement loop.« less

  15. Lesion bypass by S. cerevisiae Pol ζ alone

    PubMed Central

    Stone, Jana E.; Kumar, Dinesh; Binz, Sara K.; Inase, Aki; Iwai, Shigenori; Chabes, Andrei; Burgers, Peter M.; Kunkel, Thomas A.

    2011-01-01

    DNA polymerase zeta (Pol ζ) participates in translesion synthesis (TLS) of DNA adducts that stall replication fork progression. Previous studies have led to the suggestion that the primary role of Pol ζ in TLS is to extend primers created when another DNA polymerase inserts nucleotides opposite lesions. Here we test the non-exclusive possibility that Pol ζ can sometimes perform TLS in the absence of any other polymerase. To do so, we quantified the efficiency with which S. cerevisiae Pol ζ bypasses abasic sites, cis-syn cyclobutane pyrimidine dimers and (6-4) photoproducts. In reactions containing dNTP concentrations that mimic those induced by DNA damage, a Pol ζ derivative with phenylalanine substituted for leucine 979 at the polymerase active site bypasses all three lesions at efficiencies between 27–73%. Wild-type Pol ζ also bypasses these lesions, with efficiencies that are lower and depend on the sequence context in which the lesion resides. The results are consistent with the hypothesis that, in addition to extending aberrant termini created by other DNA polymerases, Pol ζ has the potential to be the sole DNA polymerase involved in TLS. PMID:21622032

  16. Ubiquitin mediates the physical and functional interaction between human DNA polymerases η and ι

    PubMed Central

    McIntyre, Justyna; Vidal, Antonio E.; McLenigan, Mary P.; Bomar, Martha G.; Curti, Elena; McDonald, John P.; Plosky, Brian S.; Ohashi, Eiji; Woodgate, Roger

    2013-01-01

    Human DNA polymerases η and ι are best characterized for their ability to facilitate translesion DNA synthesis (TLS). Both polymerases (pols) co-localize in ‘replication factories’ in vivo after cells are exposed to ultraviolet light and this co-localization is mediated through a physical interaction between the two TLS pols. We have mapped the polη-ι interacting region to their respective ubiquitin-binding domains (UBZ in polη and UBM1 and UBM2 in polι), and demonstrate that ubiquitination of either TLS polymerase is a prerequisite for their physical and functional interaction. Importantly, while monoubiquitination of polη precludes its ability to interact with proliferating cell nuclear antigen (PCNA), it enhances its interaction with polι. Furthermore, a polι-ubiquitin chimera interacts avidly with both polη and PCNA. Thus, the ubiquitination status of polη, or polι plays a key regulatory function in controlling the protein partners with which each polymerase interacts, and in doing so, determines the efficiency of targeting the respective polymerase to stalled replication forks where they facilitate TLS. PMID:23248005

  17. Pre-Steady-State Kinetic Analysis of Truncated and Full-Length Saccharomyces cerevisiae DNA Polymerase Eta

    PubMed Central

    Brown, Jessica A.; Zhang, Likui; Sherrer, Shanen M.; Taylor, John-Stephen; Burgers, Peter M. J.; Suo, Zucai

    2010-01-01

    Understanding polymerase fidelity is an important objective towards ascertaining the overall stability of an organism's genome. Saccharomyces cerevisiae DNA polymerase η (yPolη), a Y-family DNA polymerase, is known to efficiently bypass DNA lesions (e.g., pyrimidine dimers) in vivo. Using pre-steady-state kinetic methods, we examined both full-length and a truncated version of yPolη which contains only the polymerase domain. In the absence of yPolη's C-terminal residues 514–632, the DNA binding affinity was weakened by 2-fold and the base substitution fidelity dropped by 3-fold. Thus, the C-terminus of yPolη may interact with DNA and slightly alter the conformation of the polymerase domain during catalysis. In general, yPolη discriminated between a correct and incorrect nucleotide more during the incorporation step (50-fold on average) than the ground-state binding step (18-fold on average). Blunt-end additions of dATP or pyrene nucleotide 5′-triphosphate revealed the importance of base stacking during the binding of incorrect incoming nucleotides. PMID:20798853

  18. The polymerase subunit of a dsRNA virus plays a central role in the regulation of viral RNA metabolism.

    PubMed

    Makeyev, E V; Bamford, D H

    2000-11-15

    Bacteriophage φ6 has a three-segmented double-stranded (ds) RNA genome, which resides inside a polymerase complex particle throughout the entire life cycle of the virus. The polymerase subunit P2, a minor constituent of the polymerase complex, has previously been reported to replicate both φ6-specific and heterologous single-stranded (ss) RNAs, giving rise to dsRNA products. In this study, we show that the enzyme is also able to use dsRNA templates to perform semi-conservative RNA transcription in vitro without the assistance of other proteins. The polymerase synthesizes predominantly plus-sense copies of φ6 dsRNA, medium and small segments being more efficient templates than the large one. This distribution of the test-tube reaction products faithfully mimics viral transcription in vivo. Experiments with chimeric ssRNAs and dsRNAs show that short terminal nucleotide sequences can account for the difference in efficiency of RNA synthesis. Taken together, these results suggest a model explaining important aspects of viral RNA metabolism regulation in terms of enzymatic properties of the polymerase subunit.

  19. DNA and RNA polymerase activity in a Moniliophthora perniciosa mitochondrial plasmid and self-defense against oxidative stress.

    PubMed

    Andrade, B S; Villela-Dias, C; Gomes, D S; Micheli, F; Góes-Neto, A

    2013-06-13

    Moniliophthora perniciosa (Stahel) Aime and Phillips-Mora is a hemibiotrophic basidiomycete (Agaricales, Tricholomataceae) that causes witches' broom disease in cocoa (Theobroma cacao L.). This pathogen carries a stable integrated invertron-type linear plasmid in its mitochondrial genome that encodes viral-like DNA and RNA polymerases related to fungal senescence and longevity. After culturing the fungus and obtaining its various stages of development in triplicate, we carried out total RNA extraction and subsequent complementary DNA synthesis. To analyze DNA and RNA polymerase expression levels, we performed real-time reverse transcriptase polymerase chain reaction for various fungal phases of development. Our results showed that DNA and RNA polymerase gene expression in the primordium phase of M. perniciosa is related to a potential defense mechanism against T. cacao oxidative attack.

  20. The structural basis for RNA specificity and Ca2+ inhibition of an RNA-dependent RNA polymerase.

    PubMed

    Salgado, Paula S; Makeyev, Eugene V; Butcher, Sarah J; Bamford, Dennis H; Stuart, David I; Grimes, Jonathan M

    2004-02-01

    The RNA-dependent RNA polymerase of bacteriophage phi6 transcribes mRNA from the three segments of the dsRNA viral genome. We have cocrystallized RNA oligonucleotides with the polymerase, revealing the mode of binding of RNA templates. This binding is somewhat different from that previously seen for DNA oligomers, leading to additional RNA-protein hydrogen bonds, consistent with a preference for RNA. Activation of the RNA/polymerase complex by the addition of substrate and Mg2+ initiates a single round of reaction within the crystal to form a dead-end complex that partially collapses within the enzyme active site. By replacing Mg2+ with Ca2+, we have been able to capture the inhibited complex which shows distortion that explains the structural basis for the inhibition of such polymerases by Ca2+.

  1. Adaptive Mutations in Influenza A/California/07/2009 Enhance Polymerase Activity and Infectious Virion Production

    PubMed Central

    Slaine, Patrick D.; MacRae, Cara; Kleer, Mariel; Lamoureux, Emily; McAlpine, Sarah; Warhuus, Michelle; Comeau, André M.; Hatchette, Todd

    2018-01-01

    Mice are not natural hosts for influenza A viruses (IAVs), but they are useful models for studying antiviral immune responses and pathogenesis. Serial passage of IAV in mice invariably causes the emergence of adaptive mutations and increased virulence. Here, we report the adaptation of IAV reference strain A/California/07/2009(H1N1) (also known as CA/07) in outbred Swiss Webster mice. Serial passage led to increased virulence and lung titers, and dissemination of the virus to brains. We adapted a deep-sequencing protocol to identify and enumerate adaptive mutations across all genome segments. Among mutations that emerged during mouse-adaptation, we focused on amino acid substitutions in polymerase subunits: polymerase basic-1 (PB1) T156A and F740L and polymerase acidic (PA) E349G. These mutations were evaluated singly and in combination in minigenome replicon assays, which revealed that PA E349G increased polymerase activity. By selectively engineering three PB1 and PA mutations into the parental CA/07 strain, we demonstrated that these mutations in polymerase subunits decreased the production of defective viral genome segments with internal deletions and dramatically increased the release of infectious virions from mouse cells. Together, these findings increase our understanding of the contribution of polymerase subunits to successful host adaptation. PMID:29783694

  2. A meiotic DNA polymerase from a mushroom, Agaricus bisporus.

    PubMed Central

    Takami, K; Matsuda, S; Sono, A; Sakaguchi, K

    1994-01-01

    A meiotic DNA polymerase [DNA nucleotidyltransferase (DNA-directed), EC 2.7.7.7], which likely has a role in meiotic DNA repair, was isolated from a mushroom, Agaricus bisporus. The purified fraction displays three bands in SDS/PAGE, at molecular masses of 72 kDa, 65 kDa and 36 kDa. Optimal activity is at pH 7.0-8.0 in the presence of 5 mM Mg2+ and 50 mM KCl and at 28-30 degrees C, which is the temperature for meiosis. This enzyme is resistant to N-ethylmaleimide and sensitive to 2',3'-dideoxythymidine 5'-triphosphate, suggesting that it is a beta-like DNA polymerase. These characteristics are similar to those of Coprinus DNA polymerase beta [Sakaguchi and Lu (1982) Mol. Cell. Biol. 2, 752-757]. In Western-blot analysis, the antiserum against the Coprinus polymerase reacts only with the 65 kDa band, which coincides with the molecular mass of the Coprinus polymerase. Western-blot analysis also showed that the antiserum could react with crude extracts not only from the Agaricales family, to which Agaricus and Coprinus belong, but also from different mushroom families and Saccharomyces. The Agaricus polymerase activity can be found only in the meiotic-cell-rich fraction, but the enzyme is also present in the somatic cells in an inactive state. Images Figure 2 Figure 5 Figure 6 PMID:8172591

  3. A Structural Overview of RNA-Dependent RNA Polymerases from the Flaviviridae Family

    PubMed Central

    Wu, Jiqin; Liu, Weichi; Gong, Peng

    2015-01-01

    RNA-dependent RNA polymerases (RdRPs) from the Flaviviridae family are representatives of viral polymerases that carry out RNA synthesis through a de novo initiation mechanism. They share a ≈ 600-residue polymerase core that displays a canonical viral RdRP architecture resembling an encircled right hand with palm, fingers, and thumb domains surrounding the active site. Polymerase catalytic motifs A–E in the palm and motifs F/G in the fingers are shared by all viral RdRPs with sequence and/or structural conservations regardless of the mechanism of initiation. Different from RdRPs carrying out primer-dependent initiation, Flaviviridae and other de novo RdRPs utilize a priming element often integrated in the thumb domain to facilitate primer-independent initiation. Upon the transition to the elongation phase, this priming element needs to undergo currently unresolved conformational rearrangements to accommodate the growth of the template-product RNA duplex. In the genera of Flavivirus and Pestivirus, the polymerase module in the C-terminal part of the RdRP protein may be regulated in cis by the N-terminal region of the same polypeptide. Either being a methyltransferase in Flavivirus or a functionally unclarified module in Pestivirus, this region could play auxiliary roles for the canonical folding and/or the catalysis of the polymerase, through defined intra-molecular interactions. PMID:26062131

  4. Molecular dynamics simulations suggest changes in electrostatic interactions as a potential mechanism through which serine phosphorylation inhibits DNA Polymerase β's activity.

    PubMed

    Homouz, Dirar; Joyce-Tan, Kwee Hong; Shahir Shamsir, Mohd; Moustafa, Ibrahim M; Idriss, Haitham

    2018-01-01

    DNA polymerase β is a 39kDa enzyme that is a major component of Base Excision Repair in human cells. The enzyme comprises two major domains, a 31kDa domain responsible for the polymerase activity and an 8kDa domain, which bind ssDNA and has a deoxyribose phosphate (dRP) lyase activity. DNA polymerase β was shown to be phosphorylated in vitro with protein kinase C (PKC) at serines 44 and 55 (S44 and S55), resulting in loss of its polymerase enzymic activity, but not its ability to bind ssDNA. In this study, we investigate the potential phosphorylation-induced structural changes for DNA polymerase β using molecular dynamics. The simulations show drastic conformational changes of the polymerase structure as a result of S44 phosphorylation. Phosphorylation-induced conformational changes transform the closed (active) enzyme structure into an open one. Further analysis of the results points to a key hydrogen bond and newly formed salt bridges as potential drivers of these structural fluctuations. The changes observed with S44/55 and S55 phosphorylation were less dramatic than S44 and the integrity of the H-bond was not compromised. Thus the phosphorylation of S44 is likely the major contributor to structural fluctuations that lead to loss of enzymatic activity. Copyright © 2017. Published by Elsevier Inc.

  5. Functional Architecture of T7 RNA Polymerase Transcription Complexes

    PubMed Central

    Nayak, Dhananjaya; Guo, Qing; Sousa, Rui

    2007-01-01

    Summary T7 RNA polymerase is the best-characterized member of a widespread family of single-subunit RNA polymerases. Crystal structures of T7 RNA polymerase initiation and elongation complexes have provided a wealth of detailed information on RNA polymerase interactions with the promoter and transcription bubble, but the absence of DNA downstream of the melted region of the template in the initiation complex structure, and the absence of DNA upstream of the transcription bubble in the elongation complex structure means that our picture of the functional architecture of T7 RNA polymerase transcription complexes remains incomplete. Here we use the site-specifically tethered chemical nucleases and functional characterization of directed T7 RNAP mutants to both reveal the architecture of the duplex DNA that flanks the transcription bubble in the T7 RNAP initiation and elongation complexes, and to define the function of the interactions made by these duplex elements. We find that downstream duplex interactions made with a cluster of lysines (K711/K713/K714) are present during both elongation and initiation where they contribute to stabilizing a bend in the downstream DNA that is important for promoter opening. The upstream DNA in the elongation complex is also found to be sharply bent at the upstream edge of the transcription bubble, thereby allowing formation of upstream duplex:polymerase interactions that contribute to elongation complex stability. PMID:17580086

  6. Yeast Cells Expressing the Human Mitochondrial DNA Polymerase Reveal Correlations between Polymerase Fidelity and Human Disease Progression*

    PubMed Central

    Qian, Yufeng; Kachroo, Aashiq H.; Yellman, Christopher M.; Marcotte, Edward M.; Johnson, Kenneth A.

    2014-01-01

    Mutations in the human mitochondrial polymerase (polymerase-γ (Pol-γ)) are associated with various mitochondrial disorders, including mitochondrial DNA (mtDNA) depletion syndrome, Alpers syndrome, and progressive external opthamalplegia. To correlate biochemically quantifiable defects resulting from point mutations in Pol-γ with their physiological consequences, we created “humanized” yeast, replacing the yeast mtDNA polymerase (MIP1) with human Pol-γ. Despite differences in the replication and repair mechanism, we show that the human polymerase efficiently complements the yeast mip1 knockouts, suggesting common fundamental mechanisms of replication and conserved interactions between the human polymerase and other components of the replisome. We also examined the effects of four disease-related point mutations (S305R, H932Y, Y951N, and Y955C) and an exonuclease-deficient mutant (D198A/E200A). In haploid cells, each mutant results in rapid mtDNA depletion, increased mutation frequency, and mitochondrial dysfunction. Mutation frequencies measured in vivo equal those measured with purified enzyme in vitro. In heterozygous diploid cells, wild-type Pol-γ suppresses mutation-associated growth defects, but continuous growth eventually leads to aerobic respiration defects, reduced mtDNA content, and depolarized mitochondrial membranes. The severity of the Pol-γ mutant phenotype in heterozygous diploid humanized yeast correlates with the approximate age of disease onset and the severity of symptoms observed in humans. PMID:24398692

  7. Bacillus subtilis DNA polymerases, PolC and DnaE, are required for both leading and lagging strand synthesis in SPP1 origin-dependent DNA replication

    PubMed Central

    Seco, Elena M.

    2017-01-01

    Abstract Firmicutes have two distinct replicative DNA polymerases, the PolC leading strand polymerase, and PolC and DnaE synthesizing the lagging strand. We have reconstituted in vitro Bacillus subtilis bacteriophage SPP1 θ-type DNA replication, which initiates unidirectionally at oriL. With this system we show that DnaE is not only restricted to lagging strand synthesis as previously suggested. DnaG primase and DnaE polymerase are required for initiation of DNA replication on both strands. DnaE and DnaG synthesize in concert a hybrid RNA/DNA ‘initiation primer’ on both leading and lagging strands at the SPP1 oriL region, as it does the eukaryotic Pol α complex. DnaE, as a RNA-primed DNA polymerase, extends this initial primer in a reaction modulated by DnaG and one single-strand binding protein (SSB, SsbA or G36P), and hands off the initiation primer to PolC, a DNA-primed DNA polymerase. Then, PolC, stimulated by DnaG and the SSBs, performs the bulk of DNA chain elongation at both leading and lagging strands. Overall, these modulations by the SSBs and DnaG may contribute to the mechanism of polymerase switch at Firmicutes replisomes. PMID:28575448

  8. 9 CFR 147.31 - Laboratory procedures recommended for the real-time polymerase chain reaction test for Mycoplasma...

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... the real-time polymerase chain reaction test for Mycoplasma gallisepticum (MGLP ReTi). 147.31 Section... Examination Procedures § 147.31 Laboratory procedures recommended for the real-time polymerase chain reaction.... Following incubation, 100 µl of 100 percent ethanol is added to lysate. Wash and centrifuge following...

  9. 9 CFR 147.31 - Laboratory procedures recommended for the real-time polymerase chain reaction test for Mycoplasma...

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... the real-time polymerase chain reaction test for Mycoplasma gallisepticum (MGLP ReTi). 147.31 Section... Examination Procedures § 147.31 Laboratory procedures recommended for the real-time polymerase chain reaction.... Following incubation, 100 µl of 100 percent ethanol is added to lysate. Wash and centrifuge following...

  10. 9 CFR 147.31 - Laboratory procedures recommended for the real-time polymerase chain reaction test for Mycoplasma...

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... the real-time polymerase chain reaction test for Mycoplasma gallisepticum (MGLP ReTi). 147.31 Section... Examination Procedures § 147.31 Laboratory procedures recommended for the real-time polymerase chain reaction.... Following incubation, 100 µl of 100 percent ethanol is added to lysate. Wash and centrifuge following...

  11. DNA Polymerases η and ζ Combine to Bypass O(2)-[4-(3-Pyridyl)-4-oxobutyl]thymine, a DNA Adduct Formed from Tobacco Carcinogens.

    PubMed

    Gowda, A S Prakasha; Spratt, Thomas E

    2016-03-21

    4-(Methylnitrosamino)-1-(3-pyridyl)-1-butanone (NNK) and N'-nitrosonornicotine (NNN) are important human carcinogens in tobacco products. They are metabolized to produce a variety 4-(3-pyridyl)-4-oxobutyl (POB) DNA adducts including O(2)-[4-(3-pyridyl)-4-oxobut-1-yl]thymidine (O(2)-POB-dT), the most abundant POB adduct in NNK- and NNN-treated rodents. To evaluate the mutagenic properties of O(2)-POB-dT, we measured the rate of insertion of dNTPs opposite and extension past O(2)-POB-dT and O(2)-Me-dT by purified human DNA polymerases η, κ, ι, and yeast polymerase ζ in vitro. Under conditions of polymerase in excess, polymerase η was most effective at the insertion of dNTPs opposite O(2)-alkyl-dTs. The time courses were biphasic suggesting the formation of inactive DNA-polymerase complexes. The kpol parameter was reduced approximately 100-fold in the presence of the adduct for pol η, κ, and ι. Pol η was the most reactive polymerase for the adducts due to a higher burst amplitude. For all three polymerases, the nucleotide preference was dATP > dTTP ≫ dGTP and dCTP. Yeast pol ζ was most effective in bypassing the adducts; the kcat/Km values were reduced only 3-fold in the presence of the adducts. The identity of the nucleotide opposite the O(2)-alkyl-dT did not significantly affect the ability of pol ζ to bypass the adducts. The data support a model in which pol η inserts ATP or dTTP opposite O(2)-POB-dT, and then, pol ζ extends past the adduct.

  12. How a low-fidelity DNA polymerase chooses non-Watson-Crick from Watson-Crick incorporation.

    PubMed

    Wu, Wen-Jin; Su, Mei-I; Wu, Jian-Li; Kumar, Sandeep; Lim, Liang-Hin; Wang, Chun-Wei Eric; Nelissen, Frank H T; Chen, Ming-Chuan Chad; Doreleijers, Jurgen F; Wijmenga, Sybren S; Tsai, Ming-Daw

    2014-04-02

    A dogma for DNA polymerase catalysis is that the enzyme binds DNA first, followed by MgdNTP. This mechanism contributes to the selection of correct dNTP by Watson-Crick base pairing, but it cannot explain how low-fidelity DNA polymerases overcome Watson-Crick base pairing to catalyze non-Watson-Crick dNTP incorporation. DNA polymerase X from the deadly African swine fever virus (Pol X) is a half-sized repair polymerase that catalyzes efficient dG:dGTP incorporation in addition to correct repair. Here we report the use of solution structures of Pol X in the free, binary (Pol X:MgdGTP), and ternary (Pol X:DNA:MgdGTP with dG:dGTP non-Watson-Crick pairing) forms, along with functional analyses, to show that Pol X uses multiple unprecedented strategies to achieve the mutagenic dG:dGTP incorporation. Unlike high fidelity polymerases, Pol X can prebind purine MgdNTP tightly and undergo a specific conformational change in the absence of DNA. The prebound MgdGTP assumes an unusual syn conformation stabilized by partial ring stacking with His115. Upon binding of a gapped DNA, also with a unique mechanism involving primarily helix αE, the prebound syn-dGTP forms a Hoogsteen base pair with the template anti-dG. Interestingly, while Pol X prebinds MgdCTP weakly, the correct dG:dCTP ternary complex is readily formed in the presence of DNA. H115A mutation disrupted MgdGTP binding and dG:dGTP ternary complex formation but not dG:dCTP ternary complex formation. The results demonstrate the first solution structural view of DNA polymerase catalysis, a unique DNA binding mode, and a novel mechanism for non-Watson-Crick incorporation by a low-fidelity DNA polymerase.

  13. Molecular Basis for the Selective Inhibition of Respiratory Syncytial Virus RNA Polymerase by 2'-Fluoro-4'-Chloromethyl-Cytidine Triphosphate

    PubMed Central

    Deval, Jerome; Hong, Jin; Wang, Guangyi; Taylor, Josh; Smith, Lucas K.; Fung, Amy; Stevens, Sarah K.; Liu, Hong; Jin, Zhinan; Dyatkina, Natalia; Prhavc, Marija; Stoycheva, Antitsa D.; Serebryany, Vladimir; Liu, Jyanwei; Smith, David B.; Tam, Yuen; Zhang, Qingling; Moore, Martin L.; Fearns, Rachel; Chanda, Sushmita M.; Blatt, Lawrence M.; Symons, Julian A.; Beigelman, Leo

    2015-01-01

    Respiratory syncytial virus (RSV) causes severe lower respiratory tract infections, yet no vaccines or effective therapeutics are available. ALS-8176 is a first-in-class nucleoside analog prodrug effective in RSV-infected adult volunteers, and currently under evaluation in hospitalized infants. Here, we report the mechanism of inhibition and selectivity of ALS-8176 and its parent ALS-8112. ALS-8176 inhibited RSV replication in non-human primates, while ALS-8112 inhibited all strains of RSV in vitro and was specific for paramyxoviruses and rhabdoviruses. The antiviral effect of ALS-8112 was mediated by the intracellular formation of its 5'-triphosphate metabolite (ALS-8112-TP) inhibiting the viral RNA polymerase. ALS-8112 selected for resistance-associated mutations within the region of the L gene of RSV encoding the RNA polymerase. In biochemical assays, ALS-8112-TP was efficiently recognized by the recombinant RSV polymerase complex, causing chain termination of RNA synthesis. ALS-8112-TP did not inhibit polymerases from host or viruses unrelated to RSV such as hepatitis C virus (HCV), whereas structurally related molecules displayed dual RSV/HCV inhibition. The combination of molecular modeling and enzymatic analysis showed that both the 2'F and the 4'ClCH2 groups contributed to the selectivity of ALS-8112-TP. The lack of antiviral effect of ALS-8112-TP against HCV polymerase was caused by Asn291 that is well-conserved within positive-strand RNA viruses. This represents the first comparative study employing recombinant RSV and HCV polymerases to define the selectivity of clinically relevant nucleotide analogs. Understanding nucleotide selectivity towards distant viral RNA polymerases could not only be used to repurpose existing drugs against new viral infections, but also to design novel molecules. PMID:26098424

  14. A structural role for the PHP domain in E. coli DNA polymerase III

    PubMed Central

    2013-01-01

    Background In addition to the core catalytic machinery, bacterial replicative DNA polymerases contain a Polymerase and Histidinol Phosphatase (PHP) domain whose function is not entirely understood. The PHP domains of some bacterial replicases are active metal-dependent nucleases that may play a role in proofreading. In E. coli DNA polymerase III, however, the PHP domain has lost several metal-coordinating residues and is likely to be catalytically inactive. Results Genomic searches show that the loss of metal-coordinating residues in polymerase PHP domains is likely to have coevolved with the presence of a separate proofreading exonuclease that works with the polymerase. Although the E. coli Pol III PHP domain has lost metal-coordinating residues, the structure of the domain has been conserved to a remarkable degree when compared to that of metal-binding PHP domains. This is demonstrated by our ability to restore metal binding with only three point mutations, as confirmed by the metal-bound crystal structure of this mutant determined at 2.9 Å resolution. We also show that Pol III, a large multi-domain protein, unfolds cooperatively and that mutations in the degenerate metal-binding site of the PHP domain decrease the overall stability of Pol III and reduce its activity. Conclusions While the presence of a PHP domain in replicative bacterial polymerases is strictly conserved, its ability to coordinate metals and to perform proofreading exonuclease activity is not, suggesting additional non-enzymatic roles for the domain. Our results show that the PHP domain is a major structural element in Pol III and its integrity modulates both the stability and activity of the polymerase. PMID:23672456

  15. Pre-steady-state Kinetic Analysis of a Family D DNA Polymerase from Thermococcus sp. 9°N Reveals Mechanisms for Archaeal Genomic Replication and Maintenance*

    PubMed Central

    Schermerhorn, Kelly M.; Gardner, Andrew F.

    2015-01-01

    Family D DNA polymerases (polDs) have been implicated as the major replicative polymerase in archaea, excluding the Crenarchaeota branch, and bear little sequence homology to other DNA polymerase families. Here we report a detailed kinetic analysis of nucleotide incorporation and exonuclease activity for a Family D DNA polymerase from Thermococcus sp. 9°N. Pre-steady-state single-turnover nucleotide incorporation assays were performed to obtain the kinetic parameters, kpol and Kd, for correct nucleotide incorporation, incorrect nucleotide incorporation, and ribonucleotide incorporation by exonuclease-deficient polD. Correct nucleotide incorporation kinetics revealed a relatively slow maximal rate of polymerization (kpol ∼2.5 s−1) and especially tight nucleotide binding (Kd(dNTP) ∼1.7 μm), compared with DNA polymerases from Families A, B, C, X, and Y. Furthermore, pre-steady-state nucleotide incorporation assays revealed that polD prevents the incorporation of incorrect nucleotides and ribonucleotides primarily through reduced nucleotide binding affinity. Pre-steady-state single-turnover assays on wild-type 9°N polD were used to examine 3′-5′ exonuclease hydrolysis activity in the presence of Mg2+ and Mn2+. Interestingly, substituting Mn2+ for Mg2+ accelerated hydrolysis rates >40-fold (kexo ≥110 s−1 versus ≥2.5 s−1). Preference for Mn2+ over Mg2+ in exonuclease hydrolysis activity is a property unique to the polD family. The kinetic assays performed in this work provide critical insight into the mechanisms that polD employs to accurately and efficiently replicate the archaeal genome. Furthermore, despite the unique properties of polD, this work suggests that a conserved polymerase kinetic pathway is present in all known DNA polymerase families. PMID:26160179

  16. Endogenous overexpression of an active phosphorylated form of DNA polymerase β under oxidative stress in Trypanosoma cruzi

    PubMed Central

    Moreira-Ramos, Sandra; Castillo, Christian; Kemmerling, Ulrike; Lapier, Michel; Maya, Juan Diego; Solari, Aldo

    2018-01-01

    Trypanosoma cruzi is exposed during its life to exogenous and endogenous oxidative stress, leading to damage of several macromolecules such as DNA. There are many DNA repair pathways in the nucleus and mitochondria (kinetoplast), where specific protein complexes detect and eliminate damage to DNA. One group of these proteins is the DNA polymerases. In particular, Tc DNA polymerase β participates in kinetoplast DNA replication and repair. However, the mechanisms which control its expression under oxidative stress are still unknown. Here we describe the effect of oxidative stress on the expression and function of Tc DNA polymerase β To this end parasite cells (epimastigotes and trypomastigotes) were exposed to peroxide during short periods of time. Tc DNA polymerase β which was associated physically with kinetoplast DNA, showed increased protein levels in response to peroxide damage in both parasite forms analyzed. Two forms of DNA polymerase β were identified and overexpressed after peroxide treatment. One of them was phosphorylated and active in DNA synthesis after renaturation on polyacrylamide electrophoresis gel. This phosphorylated form showed 3-4-fold increase in both parasite forms. Our findings indicate that these increments in protein levels are not under transcriptional control because the level of Tc DNA polymerase β mRNA is maintained or slightly decreased during the exposure to oxidative stress. We propose a mechanism where a DNA repair pathway activates a cascade leading to the increment of expression and phosphorylation of Tc DNA polymerase β in response to oxidative damage, which is discussed in the context of what is known in other trypanosomes which lack transcriptional control. PMID:29432450

  17. Poliovirus RNA synthesis in vitro: structural elements and antibody inhibition

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Semler, B.L.; Hanecak, R.; Dorner, L.F.

    1983-01-01

    The poliovirus RNA polymerase complex has been analyzed by immunoautoradiography using antibody probes derived from purified replicase (P3) region viral polypeptides. Antibody preparations made against the polio RNA polymerase, P3-4b, detected a previously unreported cellular protein that copurifies with the RNA polymerase. An IgG fraction purified from rabbit antiserum to polypeptide P3-2, a precursor fo the RNA polymerase, specifically inhibits poliovirus RNA synthesis in vitro. The authors have also immunoprecipitated a 60,000-dalton protein (P3-4a) with antiserum to protein P3-4b and have determined the precise genomic map position of this protein by automated Edman degradation. Protein P3-4a originates by cleavage ofmore » the RNA polymerase precursor at a glutamine-glucine amino acid pair not previously reported to be a viral cleavage site.« less

  18. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Zhao, Baoyu; Yi, Guanghui; Du, Fenglei

    The recent outbreak of Zika virus (ZIKV) has infected over 1 million people in over 30 countries. ZIKV replicates its RNA genome using virally encoded replication proteins. Nonstructural protein 5 (NS5) contains a methyltransferase for RNA capping and a polymerase for viral RNA synthesis. Here we report the crystal structures of full-length NS5 and its polymerase domain at 3.0 Å resolution. The NS5 structure has striking similarities to the NS5 protein of the related Japanese encephalitis virus. The methyltransferase contains in-line pockets for substrate binding and the active site. Key residues in the polymerase are located in similar positions tomore » those of the initiation complex for the hepatitis C virus polymerase. The polymerase conformation is affected by the methyltransferase, which enables a more efficiently elongation of RNA synthesis in vitro. Altogether, our results will contribute to future studies on ZIKV infection and the development of inhibitors of ZIKV replication.« less

  19. Escherichia coli DnaE Polymerase Couples Pyrophosphatase Activity to DNA Replication

    PubMed Central

    Lapenta, Fabio; Montón Silva, Alejandro; Brandimarti, Renato; Lanzi, Massimiliano; Gratani, Fabio Lino; Vellosillo Gonzalez, Perceval; Perticarari, Sofia; Hochkoeppler, Alejandro

    2016-01-01

    DNA Polymerases generate pyrophosphate every time they catalyze a step of DNA elongation. This elongation reaction is generally believed as thermodynamically favoured by the hydrolysis of pyrophosphate, catalyzed by inorganic pyrophosphatases. However, the specific action of inorganic pyrophosphatases coupled to DNA replication in vivo was never demonstrated. Here we show that the Polymerase-Histidinol-Phosphatase (PHP) domain of Escherichia coli DNA Polymerase III α subunit features pyrophosphatase activity. We also show that this activity is inhibited by fluoride, as commonly observed for inorganic pyrophosphatases, and we identified 3 amino acids of the PHP active site. Remarkably, E. coli cells expressing variants of these catalytic residues of α subunit feature aberrant phenotypes, poor viability, and are subject to high mutation frequencies. Our findings indicate that DNA Polymerases can couple DNA elongation and pyrophosphate hydrolysis, providing a mechanism for the control of DNA extension rate, and suggest a promising target for novel antibiotics. PMID:27050298

  20. Affinity Isolation and I-DIRT Mass Spectrometric Analysis of the Escherichia coli O157:H7 Sakai RNA Polymerase Complex▿

    PubMed Central

    Lee, David J.; Busby, Stephen J. W.; Westblade, Lars F.; Chait, Brian T.

    2008-01-01

    Bacteria contain a single multisubunit RNA polymerase that is responsible for the synthesis of all RNA. Previous studies of the Escherichia coli K-12 laboratory strain identified a group of effector proteins that interact directly with RNA polymerase to modulate the efficiency of transcription initiation, elongation, or termination. Here we used a rapid affinity isolation technique to isolate RNA polymerase from the pathogenic Escherichia coli strain O157:H7 Sakai. We analyzed the RNA polymerase enzyme complex using mass spectrometry and identified associated proteins. Although E. coli O157:H7 Sakai contains more than 1,600 genes not present in the K-12 strain, many of which are predicted to be involved in transcription regulation, all of the identified proteins in this study were encoded on the “core” E. coli genome. PMID:18083804

  1. Affinity isolation and I-DIRT mass spectrometric analysis of the Escherichia coli O157:H7 Sakai RNA polymerase complex.

    PubMed

    Lee, David J; Busby, Stephen J W; Westblade, Lars F; Chait, Brian T

    2008-02-01

    Bacteria contain a single multisubunit RNA polymerase that is responsible for the synthesis of all RNA. Previous studies of the Escherichia coli K-12 laboratory strain identified a group of effector proteins that interact directly with RNA polymerase to modulate the efficiency of transcription initiation, elongation, or termination. Here we used a rapid affinity isolation technique to isolate RNA polymerase from the pathogenic Escherichia coli strain O157:H7 Sakai. We analyzed the RNA polymerase enzyme complex using mass spectrometry and identified associated proteins. Although E. coli O157:H7 Sakai contains more than 1,600 genes not present in the K-12 strain, many of which are predicted to be involved in transcription regulation, all of the identified proteins in this study were encoded on the "core" E. coli genome.

  2. 9 CFR 147.31 - Laboratory procedures recommended for the real-time polymerase chain reaction test for Mycoplasma...

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... the real-time polymerase chain reaction test for Mycoplasma gallisepticum (MGLP ReTi). 147.31 Section... Examination Procedures § 147.31 Laboratory procedures recommended for the real-time polymerase chain reaction... lp gene. (c) MGLP ReTi. Primers and probe should be utilized in a 25 µl reaction containing 12.5 µl...

  3. 9 CFR 147.31 - Laboratory procedures recommended for the real-time polymerase chain reaction test for Mycoplasma...

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... the real-time polymerase chain reaction test for Mycoplasma gallisepticum (MGLP ReTi). 147.31 Section... Examination Procedures § 147.31 Laboratory procedures recommended for the real-time polymerase chain reaction... lp gene. (c) MGLP ReTi. Primers and probe should be utilized in a 25 µl reaction containing 12.5 µl...

  4. Purine inhibitors of protein kinases, G proteins and polymerases

    DOEpatents

    Gray, Nathanael S.; Schultz, Peter; Kim, Sung-Hou; Meijer, Laurent

    2004-10-12

    The present invention relates to 2-N-substituted 6-(4-methoxybenzylamino)-9-isopropylpurines that inhibit, inter alia, protein kinases, G-proteins and polymerases. In addition, the present invention relates to methods of using such 2-N-substituted 6-(4-methoxybenzylamino)-9-isopropylpurines to inhibit protein kinases, G-proteins, polymerases and other cellular processes and to treat cellular proliferative diseases.

  5. The chemical structure of DNA sequence signals for RNA transcription

    NASA Technical Reports Server (NTRS)

    George, D. G.; Dayhoff, M. O.

    1982-01-01

    The proposed recognition sites for RNA transcription for E. coli NRA polymerase, bacteriophage T7 RNA polymerase, and eukaryotic RNA polymerase Pol II are evaluated in the light of the requirements for efficient recognition. It is shown that although there is good experimental evidence that specific nucleic acid sequence patterns are involved in transcriptional regulation in bacteria and bacterial viruses, among the sequences now available, only in the case of the promoters recognized by bacteriophage T7 polymerase does it seem likely that the pattern is sufficient. It is concluded that the eukaryotic pattern that is investigated is not restrictive enough to serve as a recognition site.

  6. Inhibiting poly(ADP-ribose) polymerase: a potential therapy against oligodendrocyte death

    PubMed Central

    Veto, Sara; Acs, Peter; Bauer, Jan; Lassmann, Hans; Berente, Zoltan; Setalo, Gyorgy; Borgulya, Gabor; Sumegi, Balazs; Komoly, Samuel; Gallyas, Ferenc; Illes, Zsolt

    2010-01-01

    Oligodendrocyte loss and demyelination are major pathological hallmarks of multiple sclerosis. In pattern III lesions, inflammation is minor in the early stages, and oligodendrocyte apoptosis prevails, which appears to be mediated at least in part through mitochondrial injury. Here, we demonstrate poly(ADP-ribose) polymerase activation and apoptosis inducing factor nuclear translocation within apoptotic oligodendrocytes in such multiple sclerosis lesions. The same morphological and molecular pathology was observed in an experimental model of primary demyelination, induced by the mitochondrial toxin cuprizone. Inhibition of poly(ADP-ribose) polymerase in this model attenuated oligodendrocyte depletion and decreased demyelination. Poly(ADP-ribose) polymerase inhibition suppressed c-Jun N-terminal kinase and p38 mitogen-activated protein kinase phosphorylation, increased the activation of the cytoprotective phosphatidylinositol-3 kinase-Akt pathway and prevented caspase-independent apoptosis inducing factor-mediated apoptosis. Our data indicate that poly(ADP-ribose) polymerase activation plays a crucial role in the pathogenesis of pattern III multiple sclerosis lesions. Since poly(ADP-ribose) polymerase inhibition was also effective in the inflammatory model of multiple sclerosis, it may target all subtypes of multiple sclerosis, either by preventing oligodendrocyte death or attenuating inflammation. PMID:20157013

  7. Isolation and characterization of a virus-specific ribonucleoprotein complex from reticuloendotheliosis virus-transformed chicken bone marrow cells.

    PubMed Central

    Wong, T C; Kang, C Y

    1978-01-01

    Chicken bone marrow cells transformed by reticuloendotheliosis virus (REV) produce in the cytoplasm a ribonucleoprotein (RNP) complex which has a sedimentation value of approximately 80 to 100S and a density of 1.23 g/cm3. This RNP complex is not derived from the mature virion. An endogenous RNA-directed DNA polymerase activity is associated with the RNP complex. The enzyme activity was completely neutralized by anti-REV DNA polymerase antibody but not by anti-avian myeloblastosis virus DNA polymerase antibody. The DNA product from the endogenous RNA-directed DNA polymerase reaction of the RNP complex hybridized to REV RNA but not to avian leukosis virus RNA. The RNA extracted from the RNP hybridized only to REV-specific complementary DNA synthesized from an endogenous DNA polymerase reaction of purified REV. The size of the RNA in the RNP is 30 to 35S, which represents the subunit size of the genomic RNA. No 60S mature genomic RNA was found within the RNP complex. The significance of finding the endogenous DNA polymerase activity in the viral RNP in infected cells and the maturation process of 60S virion RNA of REV are discussed. PMID:81319

  8. Structural explanation for the role of Mn2+ in the activity of phi6 RNA-dependent RNA polymerase.

    PubMed

    Poranen, Minna M; Salgado, Paula S; Koivunen, Minni R L; Wright, Sam; Bamford, Dennis H; Stuart, David I; Grimes, Jonathan M

    2008-11-01

    The biological role of manganese (Mn(2+)) has been a long-standing puzzle, since at low concentrations it activates several polymerases whilst at higher concentrations it inhibits. Viral RNA polymerases possess a common architecture, reminiscent of a closed right hand. The RNA-dependent RNA polymerase (RdRp) of bacteriophage 6 is one of the best understood examples of this important class of polymerases. We have probed the role of Mn(2+) by biochemical, biophysical and structural analyses of the wild-type enzyme and of a mutant form with an altered Mn(2+)-binding site (E491 to Q). The E491Q mutant has much reduced affinity for Mn(2+), reduced RNA binding and a compromised elongation rate. Loss of Mn(2+) binding structurally stabilizes the enzyme. These data and a re-examination of the structures of other viral RNA polymerases clarify the role of manganese in the activation of polymerization: Mn(2+) coordination of a catalytic aspartate is necessary to allow the active site to properly engage with the triphosphates of the incoming NTPs. The structural flexibility caused by Mn(2+) is also important for the enzyme dynamics, explaining the requirement for manganese throughout RNA polymerization.

  9. Nucleoprotein of influenza B virus binds to its type A counterpart and disrupts influenza A viral polymerase complex formation

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Jaru-ampornpan, Peera, E-mail: peera.jar@biotec.or.th; Narkpuk, Jaraspim; Wanitchang, Asawin

    Highlights: •FluB nucleoprotein (BNP) can bind to FluA nucleoprotein (ANP). •BNP–ANP interaction inhibits FluA polymerase activity. •BNP binding prevents ANP from forming a functional FluA polymerase complex. •Nuclear localization of BNP is necessary for FluA polymerase inhibition. •Viral RNA is not required for the BNP–ANP interaction. -- Abstract: Upon co-infection with influenza B virus (FluB), influenza A virus (FluA) replication is substantially impaired. Previously, we have shown that the nucleoprotein of FluB (BNP) can inhibit FluA polymerase machinery, retarding the growth of FluA. However, the molecular mechanism underlying this inhibitory action awaited further investigation. Here, we provide evidence that BNPmore » hinders the proper formation of FluA polymerase complex by competitively binding to the nucleoprotein of FluA. To exert this inhibitory effect, BNP must be localized in the nucleus. The interaction does not require the presence of the viral RNA but needs an intact BNP RNA-binding motif. The results highlight the novel role of BNP as an anti-influenza A viral agent and provide insights into the mechanism of intertypic interference.« less

  10. ε, a new subunit of RNA polymerase found in gram-positive bacteria.

    PubMed

    Keller, Andrew N; Yang, Xiao; Wiedermannová, Jana; Delumeau, Olivier; Krásný, Libor; Lewis, Peter J

    2014-10-01

    RNA polymerase in bacteria is a multisubunit protein complex that is essential for gene expression. We have identified a new subunit of RNA polymerase present in the high-A+T Firmicutes phylum of Gram-positive bacteria and have named it ε. Previously ε had been identified as a small protein (ω1) that copurified with RNA polymerase. We have solved the structure of ε by X-ray crystallography and show that it is not an ω subunit. Rather, ε bears remarkable similarity to the Gp2 family of phage proteins involved in the inhibition of host cell transcription following infection. Deletion of ε shows no phenotype and has no effect on the transcriptional profile of the cell. Determination of the location of ε within the assembly of RNA polymerase core by single-particle analysis suggests that it binds toward the downstream side of the DNA binding cleft. Due to the structural similarity of ε with Gp2 and the fact they bind similar regions of RNA polymerase, we hypothesize that ε may serve a role in protection from phage infection. Copyright © 2014, American Society for Microbiology. All Rights Reserved.

  11. Quercetin derivatives as non-nucleoside inhibitors for dengue polymerase: molecular docking, molecular dynamics simulation, and binding free energy calculation.

    PubMed

    Anusuya, Shanmugam; Gromiha, M Michael

    2017-10-01

    Dengue is an important public health problem in tropical and subtropical regions of the world. Neither vaccine nor an antiviral medication is available to treat dengue. This insists the need of drug discovery for dengue. In order to find a potent lead molecule, RNA-dependent RNA polymerase which is essential for dengue viral replication is chosen as a drug target. As Quercetin showed antiviral activity against several viruses, quercetin derivatives developed by combinatorial library synthesis and mined from PubChem databases were screened for a potent anti-dengue viral agent. Our study predicted Quercetin 3-(6″-(E)-p-coumaroylsophoroside)-7-rhamnoside as a dengue polymerase inhibitor. The results were validated by molecular dynamics simulation studies which reveal water bridges and hydrogen bonds as major contributors for the stability of the polymerase-lead complex. Interactions formed by this compound with residues Trp795, Arg792 and Glu351 are found to be essential for the stability of the polymerase-lead complex. Our study demonstrates Quercetin 3-(6″-(E)-p-coumaroylsophoroside)-7-rhamnoside as a potent non-nucleoside inhibitor for dengue polymerase.

  12. Primer-independent RNA sequencing with bacteriophage phi6 RNA polymerase and chain terminators.

    PubMed

    Makeyev, E V; Bamford, D H

    2001-05-01

    Here we propose a new general method for directly determining RNA sequence based on the use of the RNA-dependent RNA polymerase from bacteriophage phi6 and the chain terminators (RdRP sequencing). The following properties of the polymerase render it appropriate for this application: (1) the phi6 polymerase can replicate a number of single-stranded RNA templates in vitro. (2) In contrast to the primer-dependent DNA polymerases utilized in the sequencing procedure by Sanger et al. (Proc Natl Acad Sci USA, 1977, 74:5463-5467), it initiates nascent strand synthesis without a primer, starting the polymerization on the very 3'-terminus of the template. (3) The polymerase can incorporate chain-terminating nucleotide analogs into the nascent RNA chain to produce a set of base-specific termination products. Consequently, 3' proximal or even complete sequence of many target RNA molecules can be rapidly deduced without prior sequence information. The new technique proved useful for sequencing several synthetic ssRNA templates. Furthermore, using genomic segments of the bluetongue virus we show that RdRP sequencing can also be applied to naturally occurring dsRNA templates. This suggests possible uses of the method in the RNA virus research and diagnostics.

  13. Repair of Clustered Damage and DNA Polymerase Iota.

    PubMed

    Belousova, E A; Lavrik, O I

    2015-08-01

    Multiple DNA lesions occurring within one or two turns of the DNA helix known as clustered damage are a source of double-stranded DNA breaks, which represent a serious threat to the cells. Repair of clustered lesions is accomplished in several steps. If a clustered lesion contains oxidized bases, an individual DNA lesion is repaired by the base excision repair (BER) mechanism involving a specialized DNA polymerase after excising DNA damage. Here, we investigated DNA synthesis catalyzed by DNA polymerase iota using damaged DNA templates. Two types of DNA substrates were used as model DNAs: partial DNA duplexes containing breaks of different length, and DNA duplexes containing 5-formyluracil (5-foU) and uracil as a precursor of apurinic/apyrimidinic sites (AP) in opposite DNA strands. For the first time, we showed that DNA polymerase iota is able to catalyze DNA synthesis using partial DNA duplexes having breaks of different length as substrates. In addition, we found that DNA polymerase iota could catalyze DNA synthesis during repair of clustered damage via the BER system by using both undamaged and 5-foU-containing templates. We found that hPCNA (human proliferating cell nuclear antigen) increased efficacy of DNA synthesis catalyzed by DNA polymerase iota.

  14. N7-platinated ribonucleotides are not incorporated by RNA polymerases. New perspectives for a rational design of platinum antitumor drugs.

    PubMed

    Benedetti, Michele; Romano, Alessandro; De Castro, Federica; Girelli, Chiara R; Antonucci, Daniela; Migoni, Danilo; Verri, Tiziano; Fanizzi, Francesco P

    2016-10-01

    In this work, we assessed the capacity of RNA polymerases to use platinated ribonucleotides as substrates for RNA synthesis by testing the incorporation of the model compound [Pt(dien)(N7-5'-GTP)] (dien=diethylenetriamine; GTP=5'-guanosine triphosphate) into a natural RNA sequence. The yield of in vitro transcription operated by T7 RNA polymerase, on the LacZ (Escherichia coli gene encoding for β-galactosidase) sequence, decreases progressively with decreasing the concentration of natural GTP, in favor of the platinated nucleotide, [Pt(dien)(N7-5'-GTP)]. Comparison of the T7 RNA polymerase transcription activities for [Pt(dien)(N7-5'-GTP)] compound incorporation reaction test, with respect to the effect of a decreasing concentration of natural GTP, showed no major differences. A specific inhibitory effect of compound [Pt(dien)(N7-5'-GTP)] (which may pair the complementary base on the DNA strand, without being incorporated in the RNA by the T7 RNA polymerase) was evidenced. Our findings therefore suggest that RNA polymerases, unlike DNA polymerases, are unable to incorporate N7-platinated nucleotides into newly synthesized nucleic acids. In this respect, specifically designed N7-platinated nucleotides based compounds could be used in alternative to the classical platinum based drugs. This approach may offer a possible strategy to target specifically DNA, without affecting RNA, and is potentially able to better modulate pharmacological activity. Copyright © 2016 Elsevier Inc. All rights reserved.

  15. Isothermal recombinase polymerase amplification assay applied to the detection of group B streptococci in vaginal/anal samples.

    PubMed

    Daher, Rana K; Stewart, Gale; Boissinot, Maurice; Bergeron, Michel G

    2014-04-01

    Group B streptococcal infections are the leading cause of sepsis and meningitis in newborns. A rapid and reliable method for the detection of this pathogen at the time of delivery is needed for the early treatment of neonates. Isothermal amplification techniques such as recombinase polymerase amplification have advantages relative to PCR in terms of the speed of reaction and simplicity. We studied the clinical performance of recombinase polymerase amplification for the screening of group B streptococci in vaginal/anal samples from 50 pregnant women. We also compared the limit of detection and the analytical specificity of this isothermal assay to real-time PCR (RT-PCR). Compared to RT-PCR, the recombinase polymerase amplification assay showed a clinical sensitivity of 96% and a clinical specificity of 100%. The limit of detection was 98 genome copies and the analytical specificity was 100% for a panel of 15 bacterial and/or fungal strains naturally found in the vaginal/anal flora. Time-to-result for the recombinase polymerase amplification assay was <20 min compared to 45 min for the RT-PCR assay; a positive sample could be detected as early as 8 min. We demonstrate the potential of isothermal recombinase polymerase amplification assay as a clinically useful molecular diagnostic tool that is simple and faster than PCR/RT-PCR. Recombinase polymerase amplification offers great potential for nucleic acid-based diagnostics at the point of care.

  16. RNA polymerase activity is associated with viral particles isolated from Leishmania braziliensis subsp. guyanensis.

    PubMed Central

    Widmer, G; Keenan, M C; Patterson, J L

    1990-01-01

    Viral particles purified from species of the protozoan parasite Leishmania braziliensis subsp. guyanensis by centrifugation in CsCl gradients were examined for the presence of viral polymerase. We demonstrated that RNA-dependent RNA polymerase is associated with viral particles. Viral transcription was studied in vitro with pulse-chase experiments and by assaying the RNase sensitivity of the viral transcripts. Viral polymerase synthesized full-length transcripts within 1 h. Double-strained, genome-length, and single-stranded RNAs were produced in this system. The nature of the RNA extracted from virions was also tested by RNase protection assays; both single-stranded and double-stranded RNAs were found. Images PMID:2370680

  17. Comparison of specific binding sites for Escherichia coli RNA polymerase with naturally occurring hairpin regions in single-stranded DNA of coliphage M13. [Aspergillus oryzae

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Niyogi, S.K.; Mitra, S.

    Escherichia coli RNA polymerase binds specifically to the single-stranded circular DNA of coliphage M13 in the presence of a saturating concentration of the bacterial DNA binding protein presumably as an essential step in the synthesis of the RNA primer required for synthesizing the complementary DNA strand in parental replicative-form DNA. The RNA polymerase-protected DNA regions were isolated after extensive digestion with pancreatic DNase, S1 endonuclease of Aspergillus oryzae, and exonuclease I of E. coli. The physicochemical properties of the RNA polymerase-protected segments (called PI and PII) were compared with those of the naturally occurring hairpin regions.

  18. Eukaryotic RNA polymerase subunit RPB8 is a new relative of the OB family.

    PubMed

    Krapp, S; Kelly, G; Reischl, J; Weinzierl, R O; Matthews, S

    1998-02-01

    RNA polymerase II subunit RPB8 is an essential subunit that is highly conserved throughout eukaryotic evolution and is present in all three types of nuclear RNA polymerases. We report the first high resolution structural insight into eukaryotic RNA polymerase architecture with the solution structure of RPB8 from Saccharomyces cerevisiae. It consists of an eight stranded, antiparallel beta-barrel, four short helical regions and a large, unstructured omega-loop. The strands are connected in classic Greek-key fashion. The overall topology is unusual and contains a striking C2 rotational symmetry. Furthermore, it is most likely a novel associate of the oligonucleotide/oligosaccharide (OB) binding protein class.

  19. X-ray Crystal Structures Elucidate the Nucleotidyl Transfer Reaction of Transcript Initiation Using Two Nucleotides

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    M Gleghorn; E Davydova; R Basu

    2011-12-31

    We have determined the X-ray crystal structures of the pre- and postcatalytic forms of the initiation complex of bacteriophage N4 RNA polymerase that provide the complete set of atomic images depicting the process of transcript initiation by a single-subunit RNA polymerase. As observed during T7 RNA polymerase transcript elongation, substrate loading for the initiation process also drives a conformational change of the O helix, but only the correct base pairing between the +2 substrate and DNA base is able to complete the O-helix conformational transition. Substrate binding also facilitates catalytic metal binding that leads to alignment of the reactive groupsmore » of substrates for the nucleotidyl transfer reaction. Although all nucleic acid polymerases use two divalent metals for catalysis, they differ in the requirements and the timing of binding of each metal. In the case of bacteriophage RNA polymerase, we propose that catalytic metal binding is the last step before the nucleotidyl transfer reaction.« less

  20. Modulating the DNA polymerase β reaction equilibrium to dissect the reverse reaction

    PubMed Central

    Shock, David D.; Freudenthal, Bret D.; Beard, William A.; Wilson, Samuel H.

    2017-01-01

    DNA polymerases catalyze efficient and high fidelity DNA synthesis. While this reaction favors nucleotide incorporation, polymerases also catalyze a reverse reaction, pyrophosphorolysis, removing the DNA primer terminus and generating deoxynucleoside triphosphates. Since pyrophosphorolysis can influence polymerase fidelity and sensitivity to chain-terminating nucleosides, we analyzed pyrophosphorolysis with human DNA polymerase β and found the reaction to be inefficient. The lack of a thio-elemental effect indicated that it was limited by a non-chemical step. Utilizing a pyrophosphate analog, where the bridging oxygen is replaced with an imido-group (PNP), increased the rate of the reverse reaction and displayed a large thio-elemental effect indicating that chemistry was now rate determining. Time-lapse crystallography with PNP captured structures consistent with a chemical equilibrium that favored the reverse reaction. These results highlight the importance of the bridging atom between the β- and γ-phosphates of the incoming nucleotide in reaction chemistry, enzyme conformational changes, and overall reaction equilibrium. PMID:28759020

  1. Visualizing polynucleotide polymerase machines at work

    PubMed Central

    Steitz, Thomas A

    2006-01-01

    The structures of T7 RNA polymerase (T7 RNAP) captured in the initiation and elongation phases of transcription, that of φ29 DNA polymerase bound to a primer protein and those of the multisubunit RNAPs bound to initiating factors provide insights into how these proteins can initiate RNA synthesis and synthesize 6–10 nucleotides while remaining bound to the site of initiation. Structural insight into the translocation of the product transcript and the separation of the downstream duplex DNA is provided by the structures of the four states of nucleotide incorporation. Single molecule and biochemical studies show a distribution of primer terminus positions that is altered by the binding of NTP and PPi ligands. This article reviews the insights that imaging the structure of polynucleotide polymerases at different steps of the polymerization reaction has provided on the mechanisms of the polymerization reaction. Movies are shown that allow the direct visualization of the conformational changes that the polymerases undergo during the different steps of polymerization. PMID:16900098

  2. Structure of a preternary complex involving a prokaryotic NHEJ DNA polymerase.

    PubMed

    Brissett, Nigel C; Martin, Maria J; Pitcher, Robert S; Bianchi, Julie; Juarez, Raquel; Green, Andrew J; Fox, Gavin C; Blanco, Luis; Doherty, Aidan J

    2011-01-21

    In many prokaryotes, a specific DNA primase/polymerase (PolDom) is required for nonhomologous end joining (NHEJ) repair of DNA double-strand breaks (DSBs). Here, we report the crystal structure of a catalytically active conformation of Mycobacterium tuberculosis PolDom, consisting of a polymerase bound to a DNA end with a 3' overhang, two metal ions, and an incoming nucleotide but, significantly, lacking a primer strand. This structure represents a polymerase:DNA complex in a preternary intermediate state. This polymerase complex occurs in solution, stabilizing the enzyme on DNA ends and promoting nucleotide extension of short incoming termini. We also demonstrate that the invariant Arg(220), contained in a conserved loop (loop 2), plays an essential role in catalysis by regulating binding of a second metal ion in the active site. We propose that this NHEJ intermediate facilitates extension reactions involving critically short or noncomplementary DNA ends, thus promoting break repair and minimizing sequence loss during DSB repair. Copyright © 2011 Elsevier Inc. All rights reserved.

  3. Structure-activity relationship of uridine-based nucleoside phosphoramidate prodrugs for inhibition of dengue virus RNA-dependent RNA polymerase.

    PubMed

    Wang, Gang; Lim, Siew Pheng; Chen, Yen-Liang; Hunziker, Jürg; Rao, Ranga; Gu, Feng; Seh, Cheah Chen; Ghafar, Nahdiyah Abdul; Xu, Haoying; Chan, Katherine; Lin, Xiaodong; Saunders, Oliver L; Fenaux, Martijn; Zhong, Weidong; Shi, Pei-Yong; Yokokawa, Fumiaki

    2018-05-03

    To identify a potent and selective nucleoside inhibitor of dengue virus RNA-dependent RNA polymerase, a series of 2'- and/or 4'-ribose sugar modified uridine nucleoside phosphoramidate prodrugs and their corresponding triphosphates were synthesized and evaluated. Replacement of 2'-OH with 2'-F led to be a poor substrate for both dengue virus and human mitochondrial RNA polymerases. Instead of 2'-fluorination, the introduction of fluorine at the ribose 4'-position was found not to affect the inhibition of the dengue virus polymerase with a reduction in uptake by mitochondrial RNA polymerase. 2'-C-ethynyl-4'-F-uridine phosphoramidate prodrug displayed potent anti-dengue virus activity in the primary human peripheral blood mononuclear cell-based assay with no significant cytotoxicity in human hepatocellular liver carcinoma cell lines and no mitochondrial toxicity in the cell-based assay using human prostate cancer cell lines. Copyright © 2018 Elsevier Ltd. All rights reserved.

  4. Inhibition of herpes simplex virus DNA polymerase by purine ribonucleoside monophosphates.

    PubMed

    Frank, K B; Cheng, Y C

    1986-02-05

    Purine ribonucleoside monophosphates were found to inhibit chain elongation catalyzed by herpes simplex virus (HSV) DNA polymerase when DNA template-primer concentrations were rate-limiting. Inhibition was fully competitive with DNA template-primer during chain elongation; however, DNA polymerase-associated exonuclease activity was inhibited noncompetitively with respect to DNA. Combinations of 5'-GMP and phosphonoformate were kinetically mutually exclusive in dual inhibitor studies. Pyrimidine nucleoside monophosphates and deoxynucleoside monophosphates were less inhibitory than purine riboside monophosphates. The monophosphates of 9-beta-D-arabinofuranosyladenine, Virazole (1-beta-D-ribofuranosyl-1,2,4-triazole-3-carboxamide), 9-(2-hydroxyethoxymethyl)guanine, and 9-(1,3-dihydroxy-2-propoxymethyl)guanine exerted little or no inhibition. In contrast to HSV DNA polymerase, human DNA polymerase alpha was not inhibited by purine ribonucleoside monophosphates. These studies suggest the possibility of a physiological role of purine ribonucleoside monophosphates as regulators of herpesvirus DNA synthesis and a new approach to developing selective anti-herpesvirus compounds.

  5. Stochastic resetting in backtrack recovery by RNA polymerases

    NASA Astrophysics Data System (ADS)

    Roldán, Édgar; Lisica, Ana; Sánchez-Taltavull, Daniel; Grill, Stephan W.

    2016-06-01

    Transcription is a key process in gene expression, in which RNA polymerases produce a complementary RNA copy from a DNA template. RNA polymerization is frequently interrupted by backtracking, a process in which polymerases perform a random walk along the DNA template. Recovery of polymerases from the transcriptionally inactive backtracked state is determined by a kinetic competition between one-dimensional diffusion and RNA cleavage. Here we describe backtrack recovery as a continuous-time random walk, where the time for a polymerase to recover from a backtrack of a given depth is described as a first-passage time of a random walker to reach an absorbing state. We represent RNA cleavage as a stochastic resetting process and derive exact expressions for the recovery time distributions and mean recovery times from a given initial backtrack depth for both continuous and discrete-lattice descriptions of the random walk. We show that recovery time statistics do not depend on the discreteness of the DNA lattice when the rate of one-dimensional diffusion is large compared to the rate of cleavage.

  6. Mapping DNA polymerase errors by single-molecule sequencing

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lee, David F.; Lu, Jenny; Chang, Seungwoo

    Genomic integrity is compromised by DNA polymerase replication errors, which occur in a sequence-dependent manner across the genome. Accurate and complete quantification of a DNA polymerase's error spectrum is challenging because errors are rare and difficult to detect. We report a high-throughput sequencing assay to map in vitro DNA replication errors at the single-molecule level. Unlike previous methods, our assay is able to rapidly detect a large number of polymerase errors at base resolution over any template substrate without quantification bias. To overcome the high error rate of high-throughput sequencing, our assay uses a barcoding strategy in which each replicationmore » product is tagged with a unique nucleotide sequence before amplification. Here, this allows multiple sequencing reads of the same product to be compared so that sequencing errors can be found and removed. We demonstrate the ability of our assay to characterize the average error rate, error hotspots and lesion bypass fidelity of several DNA polymerases.« less

  7. Molecular events during translocation and proofreading extracted from 200 static structures of DNA polymerase.

    PubMed

    Ren, Zhong

    2016-09-06

    DNA polymerases in family B are workhorses of DNA replication that carry out the bulk of the job at a high speed with high accuracy. A polymerase in this family relies on a built-in exonuclease for proofreading. It has not been observed at the atomic resolution how the polymerase advances one nucleotide space on the DNA template strand after a correct nucleotide is incorporated, that is, a process known as translocation. It is even more puzzling how translocation is avoided after the primer strand is excised by the exonuclease and returned back to the polymerase active site once an error occurs. The structural events along the bifurcate pathways of translocation and proofreading have been unwittingly captured by hundreds of structures in Protein Data Bank. This study analyzes all available structures of a representative member in family B and reveals the orchestrated event sequence during translocation and proofreading. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

  8. Bypass of a Nick by the Replisome of Bacteriophage T7*

    PubMed Central

    Zhu, Bin; Lee, Seung-Joo; Richardson, Charles C.

    2011-01-01

    DNA polymerase and DNA helicase are essential components of DNA replication. The helicase unwinds duplex DNA to provide single-stranded templates for DNA synthesis by the DNA polymerase. In bacteriophage T7, movement of either the DNA helicase or the DNA polymerase alone terminates upon encountering a nick in duplex DNA. Using a minicircular DNA, we show that the helicase·polymerase complex can bypass a nick, albeit at reduced efficiency of 7%, on the non-template strand to continue rolling circle DNA synthesis. A gap in the non-template strand cannot be bypassed. The efficiency of bypass synthesis depends on the DNA sequence downstream of the nick. A nick on the template strand cannot be bypassed. Addition of T7 single-stranded DNA-binding protein to the complex stimulates nick bypass 2-fold. We propose that the association of helicase with the polymerase prevents dissociation of the helicase upon encountering a nick, allowing the helicase to continue unwinding of the duplex downstream of the nick. PMID:21701044

  9. Bypass of a nick by the replisome of bacteriophage T7.

    PubMed

    Zhu, Bin; Lee, Seung-Joo; Richardson, Charles C

    2011-08-12

    DNA polymerase and DNA helicase are essential components of DNA replication. The helicase unwinds duplex DNA to provide single-stranded templates for DNA synthesis by the DNA polymerase. In bacteriophage T7, movement of either the DNA helicase or the DNA polymerase alone terminates upon encountering a nick in duplex DNA. Using a minicircular DNA, we show that the helicase · polymerase complex can bypass a nick, albeit at reduced efficiency of 7%, on the non-template strand to continue rolling circle DNA synthesis. A gap in the non-template strand cannot be bypassed. The efficiency of bypass synthesis depends on the DNA sequence downstream of the nick. A nick on the template strand cannot be bypassed. Addition of T7 single-stranded DNA-binding protein to the complex stimulates nick bypass 2-fold. We propose that the association of helicase with the polymerase prevents dissociation of the helicase upon encountering a nick, allowing the helicase to continue unwinding of the duplex downstream of the nick.

  10. Structure and function of the Zika virus full-length NS5 protein

    DOE PAGES

    Zhao, Baoyu; Yi, Guanghui; Du, Fenglei; ...

    2017-03-27

    The recent outbreak of Zika virus (ZIKV) has infected over 1 million people in over 30 countries. ZIKV replicates its RNA genome using virally encoded replication proteins. Nonstructural protein 5 (NS5) contains a methyltransferase for RNA capping and a polymerase for viral RNA synthesis. Here we report the crystal structures of full-length NS5 and its polymerase domain at 3.0 Å resolution. The NS5 structure has striking similarities to the NS5 protein of the related Japanese encephalitis virus. The methyltransferase contains in-line pockets for substrate binding and the active site. Key residues in the polymerase are located in similar positions tomore » those of the initiation complex for the hepatitis C virus polymerase. The polymerase conformation is affected by the methyltransferase, which enables a more efficiently elongation of RNA synthesis in vitro. Altogether, our results will contribute to future studies on ZIKV infection and the development of inhibitors of ZIKV replication.« less

  11. A plasmid-based lacZα gene assay for DNA polymerase fidelity measurement

    PubMed Central

    Keith, Brian J.; Jozwiakowski, Stanislaw K.; Connolly, Bernard A.

    2013-01-01

    A significantly improved DNA polymerase fidelity assay, based on a gapped plasmid containing the lacZα reporter gene in a single-stranded region, is described. Nicking at two sites flanking lacZα, and removing the excised strand by thermocycling in the presence of complementary competitor DNA, is used to generate the gap. Simple methods are presented for preparing the single-stranded competitor. The gapped plasmid can be purified, in high amounts and in a very pure state, using benzoylated–naphthoylated DEAE–cellulose, resulting in a low background mutation frequency (∼1 × 10−4). Two key parameters, the number of detectable sites and the expression frequency, necessary for measuring polymerase error rates have been determined. DNA polymerase fidelity is measured by gap filling in vitro, followed by transformation into Escherichia coli and scoring of blue/white colonies and converting the ratio to error rate. Several DNA polymerases have been used to fully validate this straightforward and highly sensitive system. PMID:23098700

  12. Mapping DNA polymerase errors by single-molecule sequencing

    DOE PAGES

    Lee, David F.; Lu, Jenny; Chang, Seungwoo; ...

    2016-05-16

    Genomic integrity is compromised by DNA polymerase replication errors, which occur in a sequence-dependent manner across the genome. Accurate and complete quantification of a DNA polymerase's error spectrum is challenging because errors are rare and difficult to detect. We report a high-throughput sequencing assay to map in vitro DNA replication errors at the single-molecule level. Unlike previous methods, our assay is able to rapidly detect a large number of polymerase errors at base resolution over any template substrate without quantification bias. To overcome the high error rate of high-throughput sequencing, our assay uses a barcoding strategy in which each replicationmore » product is tagged with a unique nucleotide sequence before amplification. Here, this allows multiple sequencing reads of the same product to be compared so that sequencing errors can be found and removed. We demonstrate the ability of our assay to characterize the average error rate, error hotspots and lesion bypass fidelity of several DNA polymerases.« less

  13. Replication of N[superscript 2],3-Ethenoguanine by DNA Polymerases

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Zhao, Linlin; Christov, Plamen P.; Kozekov, Ivan D.

    2014-10-02

    The unstable DNA adduct N2,3-ethenoguanine, a product of both exposure to the carcinogen vinyl chloride and of oxidative stress, was built into an oligonucleotide, using an isostere strategy to stabilize the glycosidic bond. This modification was then used to examine the cause of mutations by DNA polymerases, in terms of both the biochemistry of the lesion and a structure of the lesion within a polymerase.

  14. Increased expression of LD1 genes transcribed by RNA polymerase I in Leishmania donovani as a result of duplication into the rRNA gene locus

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lodes, M.J.; Merlin, G.; DeVos, T.

    1995-12-01

    This report investigates the duplication of two LD1 genes into the rRNA locus and the resultant transcription by RNA polymerase I, which has a faster transcription rate than that of RNA polymerase II. This was conducted using a 2.2-Mb chromosome in Leishmania donovani. 55 refs., 6 figs.

  15. The expanding polymerase universe.

    PubMed

    Goodman, M F; Tippin, B

    2000-11-01

    Over the past year, the number of known prokaryotic and eukaryotic DNA polymerases has exploded. Many of these newly discovered enzymes copy aberrant bases in the DNA template over which 'respectable' polymerases fear to tread. The next step is to unravel their functions, which are thought to range from error-prone copying of DNA lesions, somatic hypermutation and avoidance of skin cancer, to restarting stalled replication forks and repairing double-stranded DNA breaks.

  16. A Transient Kinetic Approach to Investigate Nucleoside Inhibitors of Mitochondrial DNA polymerase γ

    PubMed Central

    Anderson, Karen S.

    2010-01-01

    Nucleoside analogs play an essential role in treating human immunodeficiency virus (HIV) infection since the beginning of the AIDS epidemic and work by inhibition of HIV-1 reverse transcriptase (RT), a viral polymerase essential for DNA replication. Today, over 90% of all regimens for HIV treatment contain at least one nucleoside. Long-term use of nucleoside analogs has been associated with adverse effects including mitochondrial toxicity due to inhibition of the mitochondrial polymerase, DNA polymerase gamma (mtDNA pol ©). In this review, we describe our efforts to delineate the molecular mechanism of nucleoside inhibition of HIV-1 RT and mtDNA pol © based upon a transient kinetic approach using rapid chemical quench methodology. Using transient kinetic methods, the maximum rate of polymerization (kpol), the dissociation constant for the ground state binding (Kd), and the incorporation efficiency (kpol/Kd) can be determined for the nucleoside analogs and their natural substrates. This analysis allowed us to develop an understanding of the structure activity relationships that allow correlation between the structural and stereochemical features of the nucleoside analog drugs with their mechanistic behavior toward the viral polymerase, RT, and the host cell polymerase, mtDNA pol γ. An in-depth understanding of the mechanisms of inhibition of these enzymes is imperative in overcoming problems associated with toxicity. PMID:20573564

  17. A fluorescence-based alkaline phosphatase-coupled polymerase assay for identification of inhibitors of dengue virus RNA-dependent RNA polymerase.

    PubMed

    Niyomrattanakit, Pornwaratt; Abas, Siti Nurdiana; Lim, Chin Chin; Beer, David; Shi, Pei-Yong; Chen, Yen-Liang

    2011-02-01

    The flaviviral RNA-dependent RNA polymerase (RdRp) is an attractive drug target. To discover new inhibitors of dengue virus RdRp, the authors have developed a fluorescence-based alkaline phosphatase-coupled polymerase assay (FAPA) for high-throughput screening (HTS). A modified nucleotide analogue (2'-[2-benzothiazoyl]-6'-hydroxybenzothiazole) conjugated adenosine triphosphate (BBT-ATP) and 3'UTR-U(30) RNA were used as substrates. After the polymerase reaction, treatment with alkaline phosphatase liberates the BBT fluorophore from the polymerase reaction by-product, BBT(PPi), which can be detected at excitation and emission wavelengths of 422 and 566 nm, respectively. The assay was evaluated by examining the time dependency, assay reagent effects, reaction kinetics, and signal stability and was validated with 3'dATP and an adenosine-nucleotide triphosphate inhibitor, giving IC(50) values of 0.13 µM and 0.01 µM, respectively. A pilot screen of a diverse compound library of 40,572 compounds at 20 µM demonstrated good performance with an average Z factor of 0.81. The versatility and robustness of FAPA were evaluated with another substrate system, BBT-GTP paired with 3'UTR-C(30) RNA. The FAPA method presented here can be readily adapted for other nucleotide-dependent enzymes that generate PPi.

  18. Nuclear DNA polymerase beta from Leishmania infantum. Cloning, molecular analysis and developmental regulation

    PubMed Central

    Taladriz, Soraya; Hanke, Tobias; Ramiro, María J.; García-Díaz, Miguel; Lacoba, Mario García de; Blanco, Luis; Larraga, Vicente

    2001-01-01

    We have identified a novel polymerase beta (Pol β)-like enzyme from Leishmania infantum, a parasite protozoon causing disease in humans. This protein, named Li Pol β, shows a nuclear localization that contrasts with the mitochondrial localization of Pol β from Crithidia fasciculata, a closely related parasite, the only polymerase β described so far in Trypanosomatidae. Li Pol β, that belongs to the DNA polymerase X family, displays an evolutionarily conserved Pol β-type DNA polymerase core, in which most of the key residues involved in DNA binding, nucleotide binding, dRPase and polymerization catalysis are conserved. In agreement with this, Li Pol β, overproduced in Escherichia coli, displayed intrinsic DNA polymerase activity. Cell synchronization experiments showed a correlation between both Li Pol β mRNA and protein levels along the parasite cell cycle. Analysis of these parameters at the different growth phases of the parasite, from the proliferative (non-infective) logarithmic phase to the non-dividing (highly infectious) stationary phase, showed high levels of Li Pol β at the infective phase of the parasite. The data suggest a role of Li Pol β in base excision repair in L.infantum, a parasite usually affected by oxygen stress environments into the macrophage host cells. PMID:11557814

  19. New insights into the promoterless transcription of DNA coligo templates by RNA polymerase III.

    PubMed

    Lama, Lodoe; Seidl, Christine I; Ryan, Kevin

    2014-01-01

    Chemically synthesized DNA can carry small RNA sequence information but converting that information into small RNA is generally thought to require large double-stranded promoters in the context of plasmids, viruses and genes. We previously found evidence that circularized oligodeoxynucleotides (coligos) containing certain sequences and secondary structures can template the synthesis of small RNA by RNA polymerase III in vitro and in human cells. By using immunoprecipitated RNA polymerase III we now report corroborating evidence that this enzyme is the sole polymerase responsible for coligo transcription. The immobilized polymerase enabled experiments showing that coligo transcripts can be formed through transcription termination without subsequent 3' end trimming. To better define the determinants of productive transcription, a structure-activity relationship study was performed using over 20 new coligos. The results show that unpaired nucleotides in the coligo stem facilitate circumtranscription, but also that internal loops and bulges should be kept small to avoid secondary transcription initiation sites. A polymerase termination sequence embedded in the double-stranded region of a hairpin-encoding coligo stem can antagonize transcription. Using lessons learned from new and old coligos, we demonstrate how to convert poorly transcribed coligos into productive templates. Our findings support the possibility that coligos may prove useful as chemically synthesized vectors for the ectopic expression of small RNA in human cells.

  20. The Structure of a High Fidelity DNA Polymerase Bound to a Mismatched Nucleotide Reveals an “Ajar” Intermediate Conformation in the Nucleotide Selection Mechanism*

    PubMed Central

    Wu, Eugene Y.; Beese, Lorena S.

    2011-01-01

    To achieve accurate DNA synthesis, DNA polymerases must rapidly sample and discriminate against incorrect nucleotides. Here we report the crystal structure of a high fidelity DNA polymerase I bound to DNA primer-template caught in the act of binding a mismatched (dG:dTTP) nucleoside triphosphate. The polymerase adopts a conformation in between the previously established “open” and “closed” states. In this “ajar” conformation, the template base has moved into the insertion site but misaligns an incorrect nucleotide relative to the primer terminus. The displacement of a conserved active site tyrosine in the insertion site by the template base is accommodated by a distinctive kink in the polymerase O helix, resulting in a partially open ternary complex. We suggest that the ajar conformation allows the template to probe incoming nucleotides for complementarity before closure of the enzyme around the substrate. Based on solution fluorescence, kinetics, and crystallographic analyses of wild-type and mutant polymerases reported here, we present a three-state reaction pathway in which nucleotides either pass through this intermediate conformation to the closed conformation and catalysis or are misaligned within the intermediate, leading to destabilization of the closed conformation. PMID:21454515

  1. Effect of 2',3'-dideoxythymidine-5'-triphosphate on HeLa cell in vitro DNA synthesis: evidence that DNA polymerase alpha is the only polymerase required for cellular DNA replication.

    PubMed Central

    Waqar, M A; Evans, M J; Huberman, J A

    1978-01-01

    We have studied the effects of the nucleotide analogue, 2',3'-dideoxythymidine-5'-triphosphate (ddTTP) on replicative DNA synthesis in HeLa cell lysates. As previously demonstrated (1), such lysates carry out extensive DNA synthesis in vitro, at rates and in a fashion similar to in vivo DNA replication. We report here that all aspects of DNA synthesis in such lysates (total dNTP incorporation, elongation of continuous nascent strands, and the initiation, elongation, and joining of Okazaki pieces) are only slightly inhibited by concentrations of ddTTP as high as 100-500 micrometer when the dTTP concentration is maintained at 10 micrometer. This finding is consistent with the report by Edenberg, Anderson, and DePamphilis (2) that all aspects of replicative in vitro simian virus 40 DNA synthesis are also resistant to ddTTP. We also find, in agreement with Edenberg, Anderson, and DePamphilis (2), that DNA synthesis catalyzed by DNA polymerases beta or gamma is easily inhibited by ddTTP, while synthesis catalyzed by DNA polymerase alpha is very resistant. These observations suggest that DNA polymerase alpha may be the only DNA polymerase required for all aspects of cellular DNA synthesis. PMID:673840

  2. Promoter-proximal rDNA terminator augments initiation by preventing disruption of the stable transcription complex caused by polymerase read-in

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Henderson, S.L.; Ryan, K.; Sollner-Webb, B.

    1989-02-01

    We have examined the mechanism by which transcriptional initiation at the mouse rDNA promoter is augmented by the RNA polymerase I terminator element that resides just upstream of it. Using templates in which terminator elements are instead positioned at the opposite side of the plasmid rather than proximal to the promoter, or conditions where transcription is terminated elsewhere in the plasmid by UV-induced lesions, we show that the terminator's stimulatory effect is not position dependent. Mouse terminator elements therefore do not stimulate via the previously postulated 'read-through enhancement' model in which terminated polymerases are handed off to an adjacent promotermore » in a concerted reaction. The position independence and orientation dependence of the terminator also makes it unlikely that the terminator functions as a promoter element or as an enhancer. Instead, terminators serve to augment initiation by preventing polymerases from reading completely around the plasmid and through the promoter from upstream, an event which we show interferes with subsequent rounds of initiation. Notably, this transcriptional interference arises because polymerase passage across a promoter disrupts the otherwise stable transcription complex, specifically releasing the bound transcription factor D. These liberated D molecules can then bind to other templates and activate their expression. The rDNA transcriptional interference is not due to a steric impediment to the binding of new polymerase molecules, and it does not similarly liberate the initiation-competent polymerase (factor C). These studies have also convincingly demonstrated that multiple rounds of transcription are obtained from rDNA template molecules in vitro.« less

  3. DNA polymerase catalysis in the absence of Watson-Crick hydrogen bonds

    PubMed Central

    Potapova, Olga; Chan, Chikio; DeLucia, Angela M.; Helquist, Sandra A.; Kool, Eric T.; Grindley, Nigel D. F.; Joyce, Catherine M.

    2008-01-01

    We report the first pre-steady-state kinetic studies of DNA replication in the absence of hydrogen bonds. We have used nonpolar nucleotide analogues that mimic the shape of a Watson-Crick base pair in order to investigate the kinetic consequences of a lack of hydrogen bonds in the polymerase reaction catalyzed by the Klenow fragment of DNA Polymerase I from Escherichia coli. With a thymine isostere lacking hydrogen bonding ability in the nascent pair, the efficiency (kpol/Kd) of the polymerase reaction is decreased by 30-fold, affecting ground state (Kd) and transition state (kpol) approximately equally. When both thymine and adenine analogues in the nascent pair lack hydrogen bonding ability, the efficiency of the polymerase reaction is decreased by about 1000-fold, with most the decrease attributable to the transition state. Reactions using nonpolar analogues at the primer terminal base pair demonstrated the requirement for a hydrogen bond between the polymerase and the minor groove of the primer-terminal base. The R668A mutation of Klenow fragment abolished this requirement, identifying R668 as the probable hydrogen bond donor. Detailed examination of the kinetic data suggested that Klenow fragment has an extremely low tolerance of even minor deviations of the analogue base pairs from ideal Watson-Crick geometry. Consistent with this idea, some analogue pairings were better tolerated by Klenow fragment mutants having more spacious active sites. By contrast, the Y-family polymerase Dbh was much less sensitive to changes in base pair dimensions, and more dependent on hydrogen bonding between base-paired partners. PMID:16411765

  4. Poly(ADP-ribose) polymerase-independent potentiation of nitrosourea cytotoxicity by 3-aminobenzamide in human malignant glioma cells.

    PubMed

    Winter, S; Weller, M

    2000-06-16

    Poly(ADP-ribose) polymerase is a zinc-finger DNA-binding protein that detects specifically DNA strand breaks generated by genotoxic agents and is thought to be involved in DNA repair. Here, we examined the effects of 3-aminobenzamide, a poly(ADP-ribose) polymerase inhibitor, on the chemosensitivity of human malignant glioma cells. 3-Aminobenzamide selectively potentiated the cytotoxicity of the nitrosoureas, nimustine, carmustine and lomustine in 10 of 12 human malignant glioma cell lines. In contrast, 3-aminobenzamide did not modulate the cytotoxic effects of doxorubicine, teniposide, vincristine, camptothecin or cytarabine. The nitrosoureas did not induce poly(ADP-ribose) polymerase activity in the glioma cells. Ectopic expression of truncated poly(ADP-ribose) polymerase containing the poly(ADP-ribose) polymerase DNA-binding domain, which acts as a dominant-negative mutant, in LN-18 or LN-229 cells did not alter the 3-aminobenzamide effect on nitrosourea-mediated cytotoxicity. Thus, 3-aminobenzamide may target another nicotinamide adenine dinucleotide (NAD)-requiring enzyme, but not poly(ADP-ribose) polymerase, when enhancing nitrosourea cytotoxicity in human malignant glioma cells. Carmustine cytotoxicity was associated with a G2/M arrest. Coexposure to carmustine and 3-aminobenzamide overcame this G2/M arrest in T98G cells, which are sensitized to carmustine by 3-aminobenzamide, but not in U251MG cells, which are refractory to 3-aminobenzamide-mediated sensitization to carmustine. Thus, 3-aminobenzamide-mediated sensitization to carmustine cytotoxicity may result from interference with the stable G2/M arrest response to carmustine in human glioma cells.

  5. Investigation of specific interactions between T7 promoter and T7 RNA polymerase by force spectroscopy using atomic force microscope.

    PubMed

    Zhang, Xiaojuan; Yao, Zhixuan; Duan, Yanting; Zhang, Xiaomei; Shi, Jinsong; Xu, Zhenghong

    2018-01-11

    The specific recognition and binding of promoter and RNA polymerase is the first step of transcription initiation in bacteria and largely determines transcription activity. Therefore, direct analysis of the interaction between promoter and RNA polymerase in vitro may be a new strategy for promoter characterization, to avoid interference due to the cell's biophysical condition and other regulatory elements. In the present study, the specific interaction between T7 promoter and T7 RNA polymerase was studied as a model system using force spectroscopy based on atomic force microscope (AFM). The specific interaction between T7 promoter and T7 RNA polymerase was verified by control experiments, and the rupture force in this system was measured as 307.2 ± 6.7 pN. The binding between T7 promoter mutants with various promoter activities and T7 RNA polymerase was analyzed. Interaction information including rupture force, rupture distance and binding percentage were obtained in vitro , and reporter gene expression regulated by these promoters was also measured according to a traditional promoter activity characterization method in vivo Using correlation analysis, it was found that the promoter strength characterized by reporter gene expression was closely correlated with rupture force and the binding percentage by force spectroscopy. These results indicated that the analysis of the interaction between promoter and RNA polymerase using AFM-based force spectroscopy was an effective and valid approach for the quantitative characterization of promoters. © 2018 The Author(s). Published by Portland Press Limited on behalf of the Biochemical Society.

  6. Upstream regulatory elements are necessary and sufficient for transcription of a U6 RNA gene by RNA polymerase III.

    PubMed Central

    Das, G; Henning, D; Wright, D; Reddy, R

    1988-01-01

    Whereas the genes coding for trimethyl guanosine-capped snRNAs are transcribed by RNA polymerase II, the U6 RNA genes are transcribed by RNA polymerase III. In this study, we have analyzed the cis-regulatory elements involved in the transcription of a mouse U6 snRNA gene in vitro and in frog oocytes. Transcriptional analysis of mutant U6 gene constructs showed that, unlike most known cases of polymerase III transcription, intragenic sequences except the initiation nucleotide are dispensable for efficient and accurate transcription of U6 gene in vitro. Transcription of 5' deletion mutants in vitro and in frog oocytes showed that the upstream region, within 79 bp from the initiation nucleotide, contains elements necessary for U6 gene transcription. Transcription studies were carried out in frog oocytes with U6 genes containing 5' distal sequence; these studies revealed that the distal element acts as an orientation-dependent enhancer when present upstream to the gene, while it is orientation-independent but distance-dependent enhancer when placed down-stream to the U6 gene. Analysis of 3' deletion mutants showed that the transcription termination of U6 RNA is dependent on a T cluster present on the 3' end of the gene, thus providing further support to other lines of evidence that U6 genes are transcribed by RNA polymerase III. These observations suggest the involvement of a composite of components of RNA polymerase II and III transcription machineries in the transcription of U6 genes by RNA polymerase III. Images PMID:3366121

  7. U6 small nuclear RNA is transcribed by RNA polymerase III.

    PubMed Central

    Kunkel, G R; Maser, R L; Calvet, J P; Pederson, T

    1986-01-01

    A DNA fragment homologous to U6 small nuclear RNA was isolated from a human genomic library and sequenced. The immediate 5'-flanking region of the U6 DNA clone had significant homology with a potential mouse U6 gene, including a "TATA box" at a position 26-29 nucleotides upstream from the transcription start site. Although this sequence element is characteristic of RNA polymerase II promoters, the U6 gene also contained a polymerase III "box A" intragenic control region and a typical run of five thymines at the 3' terminus (noncoding strand). The human U6 DNA clone was accurately transcribed in a HeLa cell S100 extract lacking polymerase II activity. U6 RNA transcription in the S100 extract was resistant to alpha-amanitin at 1 microgram/ml but was completely inhibited at 200 micrograms/ml. A comparison of fingerprints of the in vitro transcript and of U6 RNA synthesized in vivo revealed sequence congruence. U6 RNA synthesis in isolated HeLa cell nuclei also displayed low sensitivity to alpha-amanitin, in contrast to U1 and U2 RNA transcription, which was inhibited greater than 90% at 1 microgram/ml. In addition, U6 RNA synthesized in isolated nuclei was efficiently immunoprecipitated by an antibody against the La antigen, a protein known to bind most other RNA polymerase III transcripts. These results establish that, in contrast to the polymerase II-directed transcription of mammalian genes for U1-U5 small nuclear RNAs, human U6 RNA is transcribed by RNA polymerase III. Images PMID:3464970

  8. Light-dependent, plastome-wide association of the plastid-encoded RNA polymerase with chloroplast DNA.

    PubMed

    Finster, Sabrina; Eggert, Erik; Zoschke, Reimo; Weihe, Andreas; Schmitz-Linneweber, Christian

    2013-12-01

    Plastid genes are transcribed by two types of RNA polymerases: a plastid-encoded eubacterial-type RNA polymerase (PEP) and nuclear-encoded phage-type RNA polymerases (NEPs). To investigate the spatio-temporal expression of PEP, we tagged its α-subunit with a hemagglutinin epitope (HA). Transplastomic tobacco plants were generated and analyzed for the distribution of the tagged polymerase in plastid sub-fractions, and associated genes were identified under various light conditions. RpoA:HA was detected as early as the 3rd day after imbibition, and was constitutively expressed in green tissue over 60 days of plant development. We found that the tagged polymerase subunit preferentially associated with the plastid membranes, and was less abundant in the soluble stroma fraction. Attachment of RpoA:HA to the membrane fraction during early seedling development was independent of DNA, but at later stages of development, DNA appears to facilitate attachment of the polymerase to membranes. To survey PEP-dependent transcription units, we probed for nucleic acids enriched in RpoA:HA precipitates using a tobacco chloroplast whole-genome tiling array. The most strongly co-enriched DNA fragments represent photosynthesis genes (e.g. psbA, psbC, psbD and rbcL), whose expression is known to be driven by PEP promoters, while NEP-dependent genes were less abundant in RpoA:HA precipitates. Additionally, we demonstrate that the association of PEP with photosynthesis-related genes was reduced during the dark period, indicating that plastome-wide PEP-DNA association is a light-dependent process. © 2013 The Authors The Plant Journal © 2013 John Wiley & Sons Ltd.

  9. Structure and Function of the N-Terminal Domain of the Vesicular Stomatitis Virus RNA Polymerase

    PubMed Central

    Qiu, Shihong; Ogino, Minako; Luo, Ming

    2015-01-01

    ABSTRACT Viruses have various mechanisms to duplicate their genomes and produce virus-specific mRNAs. Negative-strand RNA viruses encode their own polymerases to perform each of these processes. For the nonsegmented negative-strand RNA viruses, the polymerase is comprised of the large polymerase subunit (L) and the phosphoprotein (P). L proteins from members of the Rhabdoviridae, Paramyxoviridae, and Filoviridae share sequence and predicted secondary structure homology. Here, we present the structure of the N-terminal domain (conserved region I) of the L protein from a rhabdovirus, vesicular stomatitis virus, at 1.8-Å resolution. The strictly and strongly conserved residues in this domain cluster in a single area of the protein. Serial mutation of these residues shows that many of the amino acids are essential for viral transcription but not for mRNA capping. Three-dimensional alignments show that this domain shares structural homology with polymerases from other viral families, including segmented negative-strand RNA and double-stranded RNA (dsRNA) viruses. IMPORTANCE Negative-strand RNA viruses include a diverse set of viral families that infect animals and plants, causing serious illness and economic impact. The members of this group of viruses share a set of functionally conserved proteins that are essential to their replication cycle. Among this set of proteins is the viral polymerase, which performs a unique set of reactions to produce genome- and subgenome-length RNA transcripts. In this article, we study the polymerase of vesicular stomatitis virus, a member of the rhabdoviruses, which has served in the past as a model to study negative-strand RNA virus replication. We have identified a site in the N-terminal domain of the polymerase that is essential to viral transcription and that shares sequence homology with members of the paramyxoviruses and the filoviruses. Newly identified sites such as that described here could prove to be useful targets in the design of new therapeutics against negative-strand RNA viruses. PMID:26512087

  10. Amino Acid Substitutions in PB1 of Avian Influenza Viruses Influence Pathogenicity and Transmissibility in Chickens

    PubMed Central

    Suzuki, Yasushi; Uchida, Yuko; Tanikawa, Taichiro; Maeda, Naohiro; Takemae, Nobuhiro

    2014-01-01

    ABSTRACT Amino acid substitutions were introduced into avian influenza virus PB1 in order to characterize the interaction between polymerase activity and pathogenicity. Previously, we used recombinant viruses containing the hemagglutinin (HA) and neuraminidase (NA) genes from the highly pathogenic avian influenza virus (HPAIV) H5N1 strain and other internal genes from two low-pathogenicity avian influenza viruses isolated from chicken and wild-bird hosts (LP and WB, respectively) to demonstrate that the pathogenicity of highly pathogenic avian influenza viruses (HPAIVs) of subtype H5N1 in chickens is regulated by the PB1 gene (Y. Uchida et al., J. Virol. 86:2686–2695, 2012, doi:http://dx.doi.org/10.1128/JVI.06374-11). In the present study, we introduced a C38Y substitution into WB PB1 and demonstrated that this substitution increased both polymerase activity in DF-1 cells in vitro and the pathogenicity of the recombinant viruses in chickens. The V14A substitution in LP PB1 reduced polymerase activity but did not affect pathogenicity in chickens. Interestingly, the V14A substitution reduced viral shedding and transmissibility. These studies demonstrate that increased polymerase activity correlates directly with enhanced pathogenicity, while decreased polymerase activity does not always correlate with pathogenicity and requires further analysis. IMPORTANCE We identified 2 novel amino acid substitutions in the avian influenza virus PB1 gene that affect the characteristics of highly pathogenic avian influenza viruses (HPAIVs) of the H5N1 subtype, such as viral replication and polymerase activity in vitro and pathogenicity and transmissibly in chickens. An amino acid substitution at residue 38 in PB1 directly affected pathogenicity in chickens and was associated with changes in polymerase activity in vitro. A substitution at residue 14 reduced polymerase activity in vitro, while its effects on pathogenicity and transmissibility depended on the constellation of internal genes. PMID:25031333

  11. Role of ART-27, a Novel Androgen Receptor Coactivator, in Normal Prostate and Prostate Cancer

    DTIC Science & Technology

    2005-04-01

    associates with pro- teins that include RBP5, a subunit shared by RNA polymerases I, II , and Ill, an RBP5 binding protein called unconventional prefoldin ...of a large multiprotein complex that contains RNA polymerase II subunit 5, a subunit shared by all three RNA polymerases; unconventional prefoldin ...dithiothreitol; GRIP, glucocorticoid re- ceptor Interacting p rotein; HA, hemagglutinin; MMTV, mouse mamm ary tumor virus ; PAIS, partial AIS; SDS

  12. Slow Joining of Newly Replicated DNA Chains in DNA Polymerase I-Deficient Escherichia coli Mutants*

    PubMed Central

    Okazaki, Reiji; Arisawa, Mikio; Sugino, Akio

    1971-01-01

    In Escherichia coli mutants deficient in DNA polymerase I, newly replicated short DNA is joined at about 10% of the rate in the wild-type strains. It is postulated that DNA polymerase I normally functions in filling gaps between the nascent short segments synthesized by the replication complex. Possible implications of the finding are discussed in relation to other abnormal properties of these mutants. PMID:4943548

  13. JPRS Report, Science and Technology USSR: Life Sciences.

    DTIC Science & Technology

    1990-07-16

    4 1 VETERINARY MEDICINE Primary Structure of RNA Polymerase Gene of Foot-and-Mouth Disease Virus ( FMDV ...neering were used to obtain cDNA corresponding to the Primary Structure of RNA Polymerase Gene of RNA polymerase gene to FMDV A 2 2 , with a map of the...Foot-and-Mouth Disease Virus ( FMDV ) A22 primary nucleotide sequence of the cDNA provided. 18400538F Moscow BIOORGANICHESKA YA Analysis of the data

  14. Scanning the Human Genome for Novel Therapeutic Targets for Breast Cancer

    DTIC Science & Technology

    2006-04-01

    action of this class of non-coding regulatory RNAs13,14. MicroRNAs are transcribed by RNA polymerase II as long primary polyadenylated transcripts...Artificial miRNAs can be expressed from both RNA polymerase II and III promoters resulting in silencing to varying degrees. At present there...the highest levels of mature microRNA in RISC and generally effective silencing. These structures can be transcribed by either RNA polymerase II or

  15. Refolding Active Human DNA Polymerase ν from Inclusion Bodies

    PubMed Central

    Arana, Mercedes E.; Powell, Gary K.; Edwards, Lori L.; Kunkel, Thomas A.; Petrovich, Robert M.

    2017-01-01

    Human DNA polymerase ν (Pol ν) is a conserved family A DNA polymerase of uncertain biological function. Physical and biochemical characterization aimed at understanding Pol ν function is hindered by the fact that, when over-expressed in E. coli, Pol ν is largely insoluble, and the small amount of soluble protein is difficult to purify. Here we describe the use of high hydrostatic pressure to refold Pol ν from inclusion bodies, in soluble and active form. The refolded Pol ν has properties comparable to those of the small amount of Pol ν that was purified from the soluble fraction. The approach described here may be applicable to other DNA polymerases that are expressed as insoluble inclusion bodies in E. coli. PMID:19853037

  16. Non coding extremities of the seven influenza virus type C vRNA segments: effect on transcription and replication by the type C and type A polymerase complexes

    PubMed Central

    Crescenzo-Chaigne, Bernadette; Barbezange, Cyril; van der Werf, Sylvie

    2008-01-01

    Background The transcription/replication of the influenza viruses implicate the terminal nucleotide sequences of viral RNA, which comprise sequences at the extremities conserved among the genomic segments as well as variable 3' and 5' non-coding (NC) regions. The plasmid-based system for the in vivo reconstitution of functional ribonucleoproteins, upon expression of viral-like RNAs together with the nucleoprotein and polymerase proteins has been widely used to analyze transcription/replication of influenza viruses. It was thus shown that the type A polymerase could transcribe and replicate type A, B, or C vRNA templates whereas neither type B nor type C polymerases were able to transcribe and replicate type A templates efficiently. Here we studied the importance of the NC regions from the seven segments of type C influenza virus for efficient transcription/replication by the type A and C polymerases. Results The NC sequences of the seven genomic segments of the type C influenza virus C/Johannesburg/1/66 strain were found to be more variable in length than those of the type A and B viruses. The levels of transcription/replication of viral-like vRNAs harboring the NC sequences of the respective type C virus segments flanking the CAT reporter gene were comparable in the presence of either type C or type A polymerase complexes except for the NS and PB2-like vRNAs. For the NS-like vRNA, the transcription/replication level was higher after introduction of a U residue at position 6 in the 5' NC region as for all other segments. For the PB2-like vRNA the CAT expression level was particularly reduced with the type C polymerase. Analysis of mutants of the 5' NC sequence in the PB2-like vRNA, the shortest 5' NC sequence among the seven segments, showed that additional sequences within the PB2 ORF were essential for the efficiency of transcription but not replication by the type C polymerase complex. Conclusion In the context of a PB2-like reporter vRNA template, the sequence upstream the polyU stretch plays a role in the transcription/replication process by the type C polymerase complex. PMID:18973655

  17. Molecular Dynamics Study of the Opening Mechanism for DNA Polymerase I

    PubMed Central

    Miller, Bill R.; Parish, Carol A.; Wu, Eugene Y.

    2014-01-01

    During DNA replication, DNA polymerases follow an induced fit mechanism in order to rapidly distinguish between correct and incorrect dNTP substrates. The dynamics of this process are crucial to the overall effectiveness of catalysis. Although X-ray crystal structures of DNA polymerase I with substrate dNTPs have revealed key structural states along the catalytic pathway, solution fluorescence studies indicate that those key states are populated in the absence of substrate. Herein, we report the first atomistic simulations showing the conformational changes between the closed, open, and ajar conformations of DNA polymerase I in the binary (enzyme∶DNA) state to better understand its dynamics. We have applied long time-scale, unbiased molecular dynamics to investigate the opening process of the fingers domain in the absence of substrate for B. stearothermophilis DNA polymerase in silico. These simulations are biologically and/or physiologically relevant as they shed light on the transitions between states in this important enzyme. All closed and ajar simulations successfully transitioned into the fully open conformation, which is known to be the dominant binary enzyme-DNA conformation from solution and crystallographic studies. Furthermore, we have detailed the key stages in the opening process starting from the open and ajar crystal structures, including the observation of a previously unknown key intermediate structure. Four backbone dihedrals were identified as important during the opening process, and their movements provide insight into the recognition of dNTP substrate molecules by the polymerase binary state. In addition to revealing the opening mechanism, this study also demonstrates our ability to study biological events of DNA polymerase using current computational methods without biasing the dynamics. PMID:25474643

  18. DNA polymerases eta and kappa exchange with the polymerase delta holoenzyme to complete common fragile site synthesis.

    PubMed

    Barnes, Ryan P; Hile, Suzanne E; Lee, Marietta Y; Eckert, Kristin A

    2017-09-01

    Common fragile sites (CFSs) are inherently unstable genomic loci that are recurrently altered in human tumor cells. Despite their instability, CFS are ubiquitous throughout the human genome and associated with large tumor suppressor genes or oncogenes. CFSs are enriched with repetitive DNA sequences, one feature postulated to explain why these loci are inherently difficult to replicate, and sensitive to replication stress. We have shown that specialized DNA polymerases (Pols) η and κ replicate CFS-derived sequences more efficiently than the replicative Pol δ. However, we lacked an understanding of how these enzymes cooperate to ensure efficient CFS replication. Here, we designed a model of lagging strand replication with RFC loaded PCNA that allows for maximal activity of the four-subunit human Pol δ holoenzyme, Pol η, and Pol κ in polymerase mixing assays. We discovered that Pol η and κ are both able to exchange with Pol δ stalled at repetitive CFS sequences, enhancing Normalized Replication Efficiency. We used this model to test the impact of PCNA mono-ubiquitination on polymerase exchange, and found no change in polymerase cooperativity in CFS replication compared with unmodified PCNA. Finally, we modeled replication stress in vitro using aphidicolin and found that Pol δ holoenzyme synthesis was significantly inhibited in a dose-dependent manner, preventing any replication past the CFS. Importantly, Pol η and κ were still proficient in rescuing this stalled Pol δ synthesis, which may explain, in part, the CFS instability phenotype of aphidicolin-treated Pol η and Pol κ-deficient cells. In total, our data support a model wherein Pol δ stalling at CFSs allows for free exchange with a specialized polymerase that is not driven by PCNA. Copyright © 2017 Elsevier B.V. All rights reserved.

  19. DNA Polymerase κ Is a Key Cellular Factor for the Formation of Covalently Closed Circular DNA of Hepatitis B Virus

    PubMed Central

    Qi, Yonghe; Gao, Zhenchao; Peng, Bo; Yan, Huan; Tang, Dingbin; Song, Zilin; He, Wenhui; Sun, Yinyan; Guo, Ju-Tao; Li, Wenhui

    2016-01-01

    Hepatitis B virus (HBV) infection of hepatocytes begins by binding to its cellular receptor sodium taurocholate cotransporting polypeptide (NTCP), followed by the internalization of viral nucleocapsid into the cytoplasm. The viral relaxed circular (rc) DNA genome in nucleocapsid is transported into the nucleus and converted into covalently closed circular (ccc) DNA to serve as a viral persistence reservoir that is refractory to current antiviral therapies. Host DNA repair enzymes have been speculated to catalyze the conversion of rcDNA to cccDNA, however, the DNA polymerase(s) that fills the gap in the plus strand of rcDNA remains to be determined. Here we conducted targeted genetic screening in combination with chemical inhibition to identify the cellular DNA polymerase(s) responsible for cccDNA formation, and exploited recombinant HBV with capsid coding deficiency which infects HepG2-NTCP cells with similar efficiency of wild-type HBV to assure cccDNA synthesis is exclusively from de novo HBV infection. We found that DNA polymerase κ (POLK), a Y-family DNA polymerase with maximum activity in non-dividing cells, substantially contributes to cccDNA formation during de novo HBV infection. Depleting gene expression of POLK in HepG2-NTCP cells by either siRNA knockdown or CRISPR/Cas9 knockout inhibited the conversion of rcDNA into cccDNA, while the diminished cccDNA formation in, and hence the viral infection of, the knockout cells could be effectively rescued by ectopic expression of POLK. These studies revealed that POLK is a crucial host factor required for cccDNA formation during a de novo HBV infection and suggest that POLK may be a potential target for developing antivirals against HBV. PMID:27783675

  20. Plastid RNA polymerases: orchestration of enzymes with different evolutionary origins controls chloroplast biogenesis during the plant life cycle.

    PubMed

    Pfannschmidt, Thomas; Blanvillain, Robert; Merendino, Livia; Courtois, Florence; Chevalier, Fabien; Liebers, Monique; Grübler, Björn; Hommel, Elisabeth; Lerbs-Mache, Silva

    2015-12-01

    Chloroplasts are the sunlight-collecting organelles of photosynthetic eukaryotes that energetically drive the biosphere of our planet. They are the base for all major food webs by providing essential photosynthates to all heterotrophic organisms including humans. Recent research has focused largely on an understanding of the function of these organelles, but knowledge about the biogenesis of chloroplasts is rather limited. It is known that chloroplasts develop from undifferentiated precursor plastids, the proplastids, in meristematic cells. This review focuses on the activation and action of plastid RNA polymerases, which play a key role in the development of new chloroplasts from proplastids. Evolutionarily, plastids emerged from the endosymbiosis of a cyanobacterium-like ancestor into a heterotrophic eukaryote. As an evolutionary remnant of this process, they possess their own genome, which is expressed by two types of plastid RNA polymerase, phage-type and prokaryotic-type RNA polymerase. The protein subunits of these polymerases are encoded in both the nuclear and plastid genomes. Their activation and action therefore require a highly sophisticated regulation that controls and coordinates the expression of the components encoded in the plastid and nucleus. Stoichiometric expression and correct assembly of RNA polymerase complexes is achieved by a combination of developmental and environmentally induced programmes. This review highlights the current knowledge about the functional coordination between the different types of plastid RNA polymerases and provides working models of their sequential expression and function for future investigations. © The Author 2015. Published by Oxford University Press on behalf of the Society for Experimental Biology. All rights reserved. For permissions, please email: journals.permissions@oup.com.

  1. DNA Polymerase κ Is a Key Cellular Factor for the Formation of Covalently Closed Circular DNA of Hepatitis B Virus.

    PubMed

    Qi, Yonghe; Gao, Zhenchao; Xu, Guangwei; Peng, Bo; Liu, Chenxuan; Yan, Huan; Yao, Qiyan; Sun, Guoliang; Liu, Yang; Tang, Dingbin; Song, Zilin; He, Wenhui; Sun, Yinyan; Guo, Ju-Tao; Li, Wenhui

    2016-10-01

    Hepatitis B virus (HBV) infection of hepatocytes begins by binding to its cellular receptor sodium taurocholate cotransporting polypeptide (NTCP), followed by the internalization of viral nucleocapsid into the cytoplasm. The viral relaxed circular (rc) DNA genome in nucleocapsid is transported into the nucleus and converted into covalently closed circular (ccc) DNA to serve as a viral persistence reservoir that is refractory to current antiviral therapies. Host DNA repair enzymes have been speculated to catalyze the conversion of rcDNA to cccDNA, however, the DNA polymerase(s) that fills the gap in the plus strand of rcDNA remains to be determined. Here we conducted targeted genetic screening in combination with chemical inhibition to identify the cellular DNA polymerase(s) responsible for cccDNA formation, and exploited recombinant HBV with capsid coding deficiency which infects HepG2-NTCP cells with similar efficiency of wild-type HBV to assure cccDNA synthesis is exclusively from de novo HBV infection. We found that DNA polymerase κ (POLK), a Y-family DNA polymerase with maximum activity in non-dividing cells, substantially contributes to cccDNA formation during de novo HBV infection. Depleting gene expression of POLK in HepG2-NTCP cells by either siRNA knockdown or CRISPR/Cas9 knockout inhibited the conversion of rcDNA into cccDNA, while the diminished cccDNA formation in, and hence the viral infection of, the knockout cells could be effectively rescued by ectopic expression of POLK. These studies revealed that POLK is a crucial host factor required for cccDNA formation during a de novo HBV infection and suggest that POLK may be a potential target for developing antivirals against HBV.

  2. Hinge residue I174 is critical for proper dNTP selection by DNA polymerase beta.

    PubMed

    Yamtich, Jen; Starcevic, Daniela; Lauper, Julia; Smith, Elenoe; Shi, Idina; Rangarajan, Sneha; Jaeger, Joachim; Sweasy, Joann B

    2010-03-23

    DNA polymerase beta (pol beta) is the key gap-filling polymerase in base excision repair, the DNA repair pathway responsible for repairing up to 20000 endogenous lesions per cell per day. Pol beta is also widely used as a model polymerase for structure and function studies, and several structural regions have been identified as being critical for the fidelity of the enzyme. One of these regions is the hydrophobic hinge, a network of hydrophobic residues located between the palm and fingers subdomains. Previous work by our lab has shown that hinge residues Y265, I260, and F272 are critical for polymerase fidelity by functioning in discrimination of the correct from incorrect dNTP during ground state binding. Our work aimed to elucidate the role of hinge residue I174 in polymerase fidelity. To study this residue, we conducted a genetic screen to identify mutants with a substitution at residue I174 that resulted in a mutator polymerase. We then chose the mutator mutant I174S for further study and found that it follows the same general kinetic pathway as and has an overall protein folding similar to that of wild-type (WT) pol beta. Using single-turnover kinetic analysis, we found that I174S exhibits decreased fidelity when inserting a nucleotide opposite a template base G, and this loss of fidelity is due primarily to a loss of discrimination during ground state dNTP binding. Molecular dynamics simulations show that mutation of residue I174 to serine results in an overall tightening of the hinge region, resulting in aberrant protein dynamics and fidelity. These results point to the hinge region as being critical in the maintenance of the proper geometry of the dNTP binding pocket.

  3. Selective Modification of Adenovirus Replication Can Be Achieved through Rational Mutagenesis of the Adenovirus Type 5 DNA Polymerase

    PubMed Central

    Capella, Cristina; Beltejar, Michael-John; Brown, Caitlin; Fong, Vincent; Daddacha, Waaqo; Kim, Baek

    2012-01-01

    Mutations that reduce the efficiency of deoxynucleoside (dN) triphosphate (dNTP) substrate utilization by the HIV-1 DNA polymerase prevent viral replication in resting cells, which contain low dNTP concentrations, but not in rapidly dividing cells such as cancer cells, which contain high levels of dNTPs. We therefore tested whether mutations in regions of the adenovirus type 5 (Ad5) DNA polymerase that interact with the dNTP substrate or DNA template could alter virus replication. The majority of the mutations created, including conservative substitutions, were incompatible with virus replication. Five replication-competent mutants were recovered from 293 cells, but four of these mutants failed to replicate in A549 lung carcinoma cells and Wi38 normal lung cells. Purified polymerase proteins from these viruses exhibited only a 2- to 4-fold reduction in their dNTP utilization efficiency but nonetheless could not be rescued, even when intracellular dNTP concentrations were artificially raised by the addition of exogenous dNs to virus-infected A549 cells. The fifth mutation (I664V) reduced biochemical dNTP utilization by the viral polymerase by 2.5-fold. The corresponding virus replicated to wild-type levels in three different cancer cell lines but was significantly impaired in all normal cell lines in which it was tested. Efficient replication and virus-mediated cell killing were rescued by the addition of exogenous dNs to normal lung fibroblasts (MRC5 cells), confirming the dNTP-dependent nature of the polymerase defect. Collectively, these data provide proof-of-concept support for the notion that conditionally replicating, tumor-selective adenovirus vectors can be created by modifying the efficiency with which the viral DNA polymerase utilizes dNTP substrates. PMID:22811532

  4. The tobacco mosaic virus RNA polymerase complex contains a plant protein related to the RNA-binding subunit of yeast eIF-3.

    PubMed Central

    Osman, T A; Buck, K W

    1997-01-01

    A sucrose density gradient-purified, membrane-bound tobacco mosaic virus (tomato strain L) (TMV-L) RNA polymerase containing endogenous RNA template was efficiently solubilized with sodium taurodeoxycholate. Solubilization resulted in an increase in the synthesis of positive-strand, 6.4-kb genome-length single-stranded RNA (ssRNA) and a decrease in the production of 6.4-kbp double-stranded RNA (dsRNA) to levels close to the limits of detection. The solubilized TMV-L RNA polymerase was purified by chromatography on columns of DEAE-Bio-Gel and High Q. Analysis by sodium dodecyl sulfate-polyacrylamide gel electrophoresis and silver staining showed that purified RNA polymerase preparations consistently contained proteins with molecular masses of 183, 126, 56, 54, and 50 kDa, which were not found in equivalent material from healthy plants. Western blotting showed that the two largest of these proteins are the TMV-L-encoded 183- and 126-kDa replication proteins and that the 56-kDa protein is related to the 54.6-kDa GCD10 protein, the RNA-binding subunit of yeast eIF-3. The 126-, 183-, and 56-kDa proteins were coimmunoaffinity selected by antibodies against the TMV-L 126-kDa protein and by antibodies against the GCD10 protein. Antibody-linked polymerase assays showed that active TMV-L RNA polymerase bound to antibodies against the TMV-L 126-kDa protein and to antibodies against the GCD10 protein. Synthesis of genome-length ssRNA and dsRNA by a template-dependent, membrane-bound RNA polymerase was inhibited by antibodies against the GCD10 protein, and this inhibition was reversed by prior addition of GCD10 protein. PMID:9223501

  5. Model of transcriptional activation by MarA in Escherichia coli.

    PubMed

    Wall, Michael E; Markowitz, David A; Rosner, Judah L; Martin, Robert G

    2009-12-01

    The AraC family transcription factor MarA activates approximately 40 genes (the marA/soxS/rob regulon) of the Escherichia coli chromosome resulting in different levels of resistance to a wide array of antibiotics and to superoxides. Activation of marA/soxS/rob regulon promoters occurs in a well-defined order with respect to the level of MarA; however, the order of activation does not parallel the strength of MarA binding to promoter sequences. To understand this lack of correspondence, we developed a computational model of transcriptional activation in which a transcription factor either increases or decreases RNA polymerase binding, and either accelerates or retards post-binding events associated with transcription initiation. We used the model to analyze data characterizing MarA regulation of promoter activity. The model clearly explains the lack of correspondence between the order of activation and the MarA-DNA affinity and indicates that the order of activation can only be predicted using information about the strength of the full MarA-polymerase-DNA interaction. The analysis further suggests that MarA can activate without increasing polymerase binding and that activation can even involve a decrease in polymerase binding, which is opposite to the textbook model of activation by recruitment. These findings are consistent with published chromatin immunoprecipitation assays of interactions between polymerase and the E. coli chromosome. We find that activation involving decreased polymerase binding yields lower latency in gene regulation and therefore might confer a competitive advantage to cells. Our model yields insights into requirements for predicting the order of activation of a regulon and enables us to suggest that activation might involve a decrease in polymerase binding which we expect to be an important theme of gene regulation in E. coli and beyond.

  6. The 3'-to-5' exonuclease activity of vaccinia virus DNA polymerase is essential and plays a role in promoting virus genetic recombination.

    PubMed

    Gammon, Don B; Evans, David H

    2009-05-01

    Poxviruses are subjected to extraordinarily high levels of genetic recombination during infection, although the enzymes catalyzing these reactions have never been identified. However, it is clear that virus-encoded DNA polymerases play some unknown yet critical role in virus recombination. Using a novel, antiviral-drug-based strategy to dissect recombination and replication reactions, we now show that the 3'-to-5' proofreading exonuclease activity of the viral DNA polymerase plays a key role in promoting recombination reactions. Linear DNA substrates were prepared containing the dCMP analog cidofovir (CDV) incorporated into the 3' ends of the molecules. The drug blocked the formation of concatemeric recombinant molecules in vitro in a process that was catalyzed by the proofreading activity of vaccinia virus DNA polymerase. Recombinant formation was also blocked when CDV-containing recombination substrates were transfected into cells infected with wild-type vaccinia virus. These inhibitory effects could be overcome if CDV-containing substrates were transfected into cells infected with CDV-resistant (CDV(r)) viruses, but only when resistance was linked to an A314T substitution mutation mapping within the 3'-to-5' exonuclease domain of the viral polymerase. Viruses encoding a CDV(r) mutation in the polymerase domain still exhibited a CDV-induced recombination deficiency. The A314T substitution also enhanced the enzyme's capacity to excise CDV molecules from the 3' ends of duplex DNA and to recombine these DNAs in vitro, as judged from experiments using purified mutant DNA polymerase. The 3'-to-5' exonuclease activity appears to be an essential virus function, and our results suggest that this might be because poxviruses use it to promote genetic exchange.

  7. Study of Pure Proteins, Nucleic Acids and their Complexes from Extreme Halobacteria of the Dead Sea: RNA Polymerase-DNA Interaction

    DTIC Science & Technology

    1988-10-10

    identify by block number) FIELD GROUP S OUP - Archaebacteria , Halobacteria, Proteins Nucleic Acids, 08 RNA Polymerase-DNA Interactionsi R soimal operons...objectives of our program are to isolate and characterize a fully active DNA dependent RNA polymerase from the extremely halophilic archaebacteria from...Woese and his colleagues to suggest that all living organisms can be classified into three phylogenetic kingdoms : the eukaryotes, the eubacterla and

  8. Prostate Cell Specific Regulation of Androgen Receptor Phosphorylation in Vivo

    DTIC Science & Technology

    2009-11-01

    includes both Rpb5, a subunit shared by RNA polymerase (Pol) I, II , and III, and the corepressor, Unconventional prefoldin Rpb5-Interactor (URI/C19orf2...complex that contains RNA polymerase II subunit 5, a subunit shared by all three RNA polymerases; unconventional prefoldin RPB5-in- teractor (URI), which...sequence of ART-27 is conserved throughout evolution from worms to humans and its predicted protein structure is homologous to the prefoldin -a family of

  9. Transcription elongation. Heterogeneous tracking of RNA polymerase and its biological implications.

    PubMed

    Imashimizu, Masahiko; Shimamoto, Nobuo; Oshima, Taku; Kashlev, Mikhail

    2014-01-01

    Regulation of transcription elongation via pausing of RNA polymerase has multiple physiological roles. The pausing mechanism depends on the sequence heterogeneity of the DNA being transcribed, as well as on certain interactions of polymerase with specific DNA sequences. In order to describe the mechanism of regulation, we introduce the concept of heterogeneity into the previously proposed alternative models of elongation, power stroke and Brownian ratchet. We also discuss molecular origins and physiological significances of the heterogeneity.

  10. Techniques used to study the DNA polymerase reaction pathway

    PubMed Central

    Joyce, Catherine M.

    2009-01-01

    Summary A minimal reaction pathway for DNA polymerases was established over 20 years ago using chemical quench methods. Since that time there has been considerable interest in noncovalent steps in the reaction pathway, conformational changes involving the polymerase or its DNA substrate that may play a role in substrate specificity. Fluorescence-based assays have been devised in order to study these conformational transitions and the results obtained have added new detail to the reaction pathway. PMID:19665596

  11. Conformational transitions in DNA polymerase I revealed by single-molecule FRET

    PubMed Central

    Santoso, Yusdi; Joyce, Catherine M.; Potapova, Olga; Le Reste, Ludovic; Hohlbein, Johannes; Torella, Joseph P.; Grindley, Nigel D. F.; Kapanidis, Achillefs N.

    2010-01-01

    The remarkable fidelity of most DNA polymerases depends on a series of early steps in the reaction pathway which allow the selection of the correct nucleotide substrate, while excluding all incorrect ones, before the enzyme is committed to the chemical step of nucleotide incorporation. The conformational transitions that are involved in these early steps are detectable with a variety of fluorescence assays and include the fingers-closing transition that has been characterized in structural studies. Using DNA polymerase I (Klenow fragment) labeled with both donor and acceptor fluorophores, we have employed single-molecule fluorescence resonance energy transfer to study the polymerase conformational transitions that precede nucleotide addition. Our experiments clearly distinguish the open and closed conformations that predominate in Pol-DNA and Pol-DNA-dNTP complexes, respectively. By contrast, the unliganded polymerase shows a broad distribution of FRET values, indicating a high degree of conformational flexibility in the protein in the absence of its substrates; such flexibility was not anticipated on the basis of the available crystallographic structures. Real-time observation of conformational dynamics showed that most of the unliganded polymerase molecules sample the open and closed conformations in the millisecond timescale. Ternary complexes formed in the presence of mismatched dNTPs or complementary ribonucleotides show unique FRET species, which we suggest are relevant to kinetic checkpoints that discriminate against these incorrect substrates. PMID:20080740

  12. DNA polymerase θ contributes to the generation of C/G mutations during somatic hypermutation of Ig genes

    PubMed Central

    Masuda, Keiji; Ouchida, Rika; Takeuchi, Arata; Saito, Takashi; Koseki, Haruhiko; Kawamura, Kiyoko; Tagawa, Masatoshi; Tokuhisa, Takeshi; Azuma, Takachika; O-Wang, Jiyang

    2005-01-01

    Somatic hypermutation of Ig variable region genes is initiated by activation-induced cytidine deaminase; however, the activity of multiple DNA polymerases is required to ultimately introduce mutations. DNA polymerase η (Polη) has been implicated in mutations at A/T, but polymerases involved in C/G mutations have not been identified. We have generated mutant mice expressing DNA polymerase (Polθ) specifically devoid of polymerase activity. Compared with WT mice, Polq-inactive (Polq, the gene encoding Polθ) mice exhibited a reduced level of serum IgM and IgG1. The mutant mice mounted relatively normal primary and secondary immune responses to a T-dependent antigen, but the production of high-affinity specific antibodies was partially impaired. Analysis of the JH4 intronic sequences revealed a slight reduction in the overall mutation frequency in Polq-inactive mice. Remarkably, although mutations at A/T were unaffected, mutations at C/G were significantly decreased, indicating an important, albeit not exclusive, role for Polθ activity. The reduction of C/G mutations was particularly focused on the intrinsic somatic hypermutation hotspots and both transitions and transversions were similarly reduced. These findings, together with the recent observation that Polθ efficiently catalyzes the bypass of abasic sites, lead us to propose that Polθ introduces mutations at C/G by replicating over abasic sites generated via uracil-DNA glycosylase. PMID:16172387

  13. Hydrogen peroxide-induced injury of cells and its prevention by inhibitors of poly(ADP-ribose) polymerase.

    PubMed Central

    Schraufstatter, I U; Hyslop, P A; Hinshaw, D B; Spragg, R G; Sklar, L A; Cochrane, C G

    1986-01-01

    H2O2, in concentrations achieved in the proximity of stimulated leukocytes, induces injury and lysis of target cells. This may be an important aspect of inflammatory injury of tissues. Cell lysis in two target cells, the murine macrophage-like tumor cell line P388D1 and human peripheral lymphocytes, was found to be associated with activation of poly(ADP-ribose) polymerase (EC 2.4.2.30), a nuclear enzyme. This enzyme is activated under various conditions of DNA damage. Poly(ADP-ribose) polymerase utilizes nicotinamide adenine dinucleotide (NAD) as substrate and has been previously shown to consume NAD during exposure of cells to oxidants that was associated with inhibition of glycolysis, a decrease in cellular ATP, and cell death. In the current studies, inhibition of poly(ADP-ribose) polymerase by 3-aminobenzamide, nicotinamide, or theophylline in cells exposed to lethal concentrations of H2O2 prevented the sequence of events that eventually led to cell lysis--i.e., the decrease in NAD, followed by depletion of ATP, influx of extracellular Ca2+, actin polymerization and, finally, cell death. DNA damage, the initial stimulus for poly(ADP-ribose) polymerase activation, occurred despite the inhibition of this enzyme. Cells exposed to oxidant in the presence of the poly(ADP-ribose) polymerase inhibitor 3-aminobenzamide failed to demonstrate repair of DNA strand breaks. PMID:2941760

  14. DNA replication initiator Cdc6 also regulates ribosomal DNA transcription initiation.

    PubMed

    Huang, Shijiao; Xu, Xiaowei; Wang, Guopeng; Lu, Guoliang; Xie, Wenbing; Tao, Wei; Zhang, Hongyin; Jiang, Qing; Zhang, Chuanmao

    2016-04-01

    RNA-polymerase-I-dependent ribosomal DNA (rDNA) transcription is fundamental to rRNA processing, ribosome assembly and protein synthesis. However, how this process is initiated during the cell cycle is not fully understood. By performing a proteomic analysis of transcription factors that bind RNA polymerase I during rDNA transcription initiation, we identified that the DNA replication initiator Cdc6 interacts with RNA polymerase I and its co-factors, and promotes rDNA transcription in G1 phase in an ATPase-activity-dependent manner. We further showed that Cdc6 is targeted to the nucleolus during late mitosis and G1 phase in a manner that is dependent on B23 (also known as nucleophosmin, NPM1), and preferentially binds to the rDNA promoter through its ATP-binding domain. Overexpression of Cdc6 increases rDNA transcription, whereas knockdown of Cdc6 results in a decreased association of both RNA polymerase I and the RNA polymerase I transcription factor RRN3 with rDNA, and a reduction of rDNA transcription. Furthermore, depletion of Cdc6 impairs the interaction between RRN3 and RNA polymerase I. Taken together, our data demonstrate that Cdc6 also serves as a regulator of rDNA transcription initiation, and indicate a mechanism by which initiation of rDNA transcription and DNA replication can be coordinated in cells. © 2016. Published by The Company of Biologists Ltd.

  15. New insights into the promoterless transcription of DNA coligo templates by RNA polymerase III

    PubMed Central

    Lama, Lodoe; Seidl, Christine I; Ryan, Kevin

    2014-01-01

    Chemically synthesized DNA can carry small RNA sequence information but converting that information into small RNA is generally thought to require large double-stranded promoters in the context of plasmids, viruses and genes. We previously found evidence that circularized oligodeoxynucleotides (coligos) containing certain sequences and secondary structures can template the synthesis of small RNA by RNA polymerase III in vitro and in human cells. By using immunoprecipitated RNA polymerase III we now report corroborating evidence that this enzyme is the sole polymerase responsible for coligo transcription. The immobilized polymerase enabled experiments showing that coligo transcripts can be formed through transcription termination without subsequent 3′ end trimming. To better define the determinants of productive transcription, a structure-activity relationship study was performed using over 20 new coligos. The results show that unpaired nucleotides in the coligo stem facilitate circumtranscription, but also that internal loops and bulges should be kept small to avoid secondary transcription initiation sites. A polymerase termination sequence embedded in the double-stranded region of a hairpin-encoding coligo stem can antagonize transcription. Using lessons learned from new and old coligos, we demonstrate how to convert poorly transcribed coligos into productive templates. Our findings support the possibility that coligos may prove useful as chemically synthesized vectors for the ectopic expression of small RNA in human cells. PMID:25764216

  16. Quantum dots for a high-throughput Pfu polymerase based multi-round polymerase chain reaction (PCR).

    PubMed

    Sang, Fuming; Zhang, Zhizhou; Yuan, Lin; Liu, Deli

    2018-02-26

    Multi-round PCR is an important technique for obtaining enough target DNA from rare DNA resources, and is commonly used in many fields including forensic science, ancient DNA analysis and cancer research. However, multi-round PCR is often aborted, largely due to the accumulation of non-specific amplification during repeated amplifications. Here, we developed a Pfu polymerase based multi-round PCR technique assisted by quantum dots (QDs). Different PCR assays, DNA polymerases (Pfu and Taq), DNA sizes and GC amounts were compared in this study. In the presence of QDs, PCR specificity could be retained even in the ninth-round amplification. Moreover, the longer and more complex the targets were, the earlier the abortion happened in multi-round PCR. However, no obvious enhancement of specificity was found in multi-round PCR using Taq DNA polymerase. Significantly, the fidelity of Pfu polymerase based multi-round PCR was not sacrificed in the presence of QDs. Besides, pre-incubation at 50 °C for an hour had no impact on multi-round PCR performance, which further authenticated the hot start effect of QDs modulated in multi-round PCR. The findings of this study demonstrated that a cost-effective and promising multi-round PCR technique for large-scale and high-throughput sample analysis could be established with high specificity, sensibility and accuracy.

  17. Molecular typing of Lactobacillus brevis isolates from Korean food using repetitive element-polymerase chain reaction.

    PubMed

    Kaur, Jasmine; Sharma, Anshul; Lee, Sulhee; Park, Young-Seo

    2018-06-01

    Lactobacillus brevis is a part of a large family of lactic acid bacteria that are present in cheese, sauerkraut, sourdough, silage, cow manure, feces, and the intestinal tract of humans and rats. It finds its use in food fermentation, and so is considered a "generally regarded as safe" organism. L. brevis strains are extensively used as probiotics and hence, there is a need for identifying and characterizing these strains. For identification and discrimination of the bacterial species at the subspecific level, repetitive element-polymerase chain reaction method is a reliable genomic fingerprinting tool. The objective of the present study was to characterize 13 strains of L. brevis isolated from various fermented foods using repetitive element-polymerase chain reaction. Repetitive element-polymerase chain reaction was performed using three primer sets, REP, Enterobacterial Repetitive Intergenic Consensus (ERIC), and (GTG) 5 , which produced different fingerprinting patterns that enable us to distinguish between the closely related strains. Fingerprinting patterns generated band range in between 150 and 5000 bp with REP, 200-7500 bp with ERIC, and 250-2000 bp with (GTG) 5 primers, respectively. The Jaccard's dissimilarity matrices were used to obtain dendrograms by the unweighted neighbor-joining method using genetic dissimilarities based on repetitive element-polymerase chain reaction fingerprinting data. Repetitive element-polymerase chain reaction proved to be a rapid and easy method that can produce reliable results in L. brevis species.

  18. Biochemical and genetic analysis of the role of the viral polymerase in enterovirus recombination.

    PubMed

    Woodman, Andrew; Arnold, Jamie J; Cameron, Craig E; Evans, David J

    2016-08-19

    Genetic recombination in single-strand, positive-sense RNA viruses is a poorly understand mechanism responsible for generating extensive genetic change and novel phenotypes. By moving a critical cis-acting replication element (CRE) from the polyprotein coding region to the 3' non-coding region we have further developed a cell-based assay (the 3'CRE-REP assay) to yield recombinants throughout the non-structural coding region of poliovirus from dually transfected cells. We have additionally developed a defined biochemical assay in which the only protein present is the poliovirus RNA dependent RNA polymerase (RdRp), which recapitulates the strand transfer events of the recombination process. We have used both assays to investigate the role of the polymerase fidelity and nucleotide turnover rates in recombination. Our results, of both poliovirus intertypic and intratypic recombination in the CRE-REP assay and using a range of polymerase variants in the biochemical assay, demonstrate that RdRp fidelity is a fundamental determinant of recombination frequency. High fidelity polymerases exhibit reduced recombination and low fidelity polymerases exhibit increased recombination in both assays. These studies provide the basis for the analysis of poliovirus recombination throughout the non-structural region of the virus genome and provide a defined biochemical assay to further dissect this important evolutionary process. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

  19. The structure of a protein primer-polymerase complex in the initiation of genome replication.

    PubMed

    Ferrer-Orta, Cristina; Arias, Armando; Agudo, Rubén; Pérez-Luque, Rosa; Escarmís, Cristina; Domingo, Esteban; Verdaguer, Nuria

    2006-02-22

    Picornavirus RNA replication is initiated by the covalent attachment of a UMP molecule to the hydroxyl group of a tyrosine in the terminal protein VPg. This reaction is carried out by the viral RNA-dependent RNA polymerase (3D). Here, we report the X-ray structure of two complexes between foot-and-mouth disease virus 3D, VPg1, the substrate UTP and divalent cations, in the absence and in the presence of an oligoadenylate of 10 residues. In both complexes, VPg fits the RNA binding cleft of the polymerase and projects the key residue Tyr3 into the active site of 3D. This is achieved by multiple interactions with residues of motif F and helix alpha8 of the fingers domain and helix alpha13 of the thumb domain of the polymerase. The complex obtained in the presence of the oligoadenylate showed the product of the VPg uridylylation (VPg-UMP). Two metal ions and the catalytic aspartic acids of the polymerase active site, together with the basic residues of motif F, have been identified as participating in the priming reaction.

  20. Utilization of RNA polymerase I promoter and terminator sequences to develop a DNA transfection system for the study of hepatitis C virus internal ribosomal entry site-dependent translation.

    PubMed

    Oem, Jae-Ku; Xiang, Zhonghua; Zhou, Yan; Babiuk, Lorne A; Liu, Qiang

    2007-09-01

    Hepatitis C virus (HCV) causes severe liver diseases in a large population worldwide. HCV protein translation is controlled by an internal ribosomal entry site (IRES) within the 5'-untranslated region (UTR). HCV IRES-dependent translation is critical for HCV-associated pathogenesis. To develop a plasmid DNA transfection system by using RNA polymerase I promoter and terminator sequences for studying HCV IRES-dependent translation. A gene cassette containing HCV 5'-UTR, Renilla luciferase reporter gene, and HCV 3'-UTR was inserted between RNA polymerase I promoter and terminator sequences. HCV IRES-directed translation was determined by luciferase assay after transfection. Transfection of the RNA polymerase I-HCV IRES plasmid into human hepatoma Huh-7 and HepG2 cells resulted in luciferase gene expression. Deletion of the IIIf domain in HCV IRES dramatically reduced luciferase activity. Our results indicated that the plasmid vector system-based on RNA polymerase I promoter and terminator sequences represents an effective approach for the study of HCV IRES-dependent translation.

  1. Engineered split in Pfu DNA polymerase fingers domain improves incorporation of nucleotide gamma-phosphate derivative.

    PubMed

    Hansen, Connie J; Wu, Lydia; Fox, Jeffrey D; Arezi, Bahram; Hogrefe, Holly H

    2011-03-01

    Using compartmentalized self-replication (CSR), we evolved a version of Pyrococcus furiosus (Pfu) DNA polymerase that tolerates modification of the γ-phosphate of an incoming nucleotide. A Q484R mutation in α-helix P of the fingers domain, coupled with an unintended translational termination-reinitiation (split) near the finger tip, dramatically improve incorporation of a bulky γ-phosphate-O-linker-dabcyl substituent. Whether synthesized by coupled translation from a bicistronic (-1 frameshift) clone, or reconstituted from separately expressed and purified fragments, split Pfu mutant behaves identically to wild-type DNA polymerase with respect to chromatographic behavior, steady-state kinetic parameters (for dCTP), and PCR performance. Although naturally-occurring splits have been identified previously in the finger tip region of T4 gp43 variants, this is the first time a split (in combination with a point mutation) has been shown to broaden substrate utilization. Moreover, this latest example of a split hyperthermophilic archaeal DNA polymerase further illustrates the modular nature of the Family B DNA polymerase structure.

  2. Direct measurement of the poliovirus RNA polymerase error frequency in vitro

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ward, C.D.; Stokes, M.A.M.; Flanegan, J.B.

    1988-02-01

    The fidelity of RNA replication by the poliovirus-RNA-dependent RNA polymerase was examined by copying homopolymeric RNA templates in vitro. The poliovirus RNA polymerase was extensively purified and used to copy poly(A), poly(C), or poly(I) templates with equimolar concentrations of noncomplementary and complementary ribonucleotides. The error frequency was expressed as the amount of a noncomplementary nucleotide incorporated divided by the total amount of complementary and noncomplementary nucleotide incorporated. The polymerase error frequencies were very high, depending on the specific reaction conditions. The activity of the polymerase on poly(U) and poly(G) was too low to measure error frequencies on these templates. Amore » fivefold increase in the error frequency was observed when the reaction conditions were changed from 3.0 mM Mg{sup 2+} (pH 7.0) to 7.0 mM Mg{sup 2+} (pH 8.0). This increase in the error frequency correlates with an eightfold increase in the elongation rate that was observed under the same conditions in a previous study.« less

  3. Phylogenetic analysis of DNA and RNA polymerases from a Moniliophthora perniciosa mitochondrial plasmid reveals probable lateral gene transfer.

    PubMed

    Andrade, B S; Góes-Neto, A

    2015-10-30

    The filamentous fungus Moniliophthora perniciosa is a hemibiotrophic basidiomycete that causes witches' broom disease of cacao (Theobroma cacao L.). Many fungal mitochondrial plasmids are DNA and RNA polymerase-encoding invertrons with terminal inverted repeats and 5'-linked proteins. The aim of this study was to carry out comparative and phylogenetic analyses of DNA and RNA polymerases for all known linear mitochondrial plasmids in fungi. We performed these analyses at both gene and protein levels and assessed differences between fungal and viral polymerases in order to test the lateral gene transfer (LGT) hypothesis. We analyzed all mitochondrial plasmids of the invertron type within the fungal clade, including five from Ascomycota, seven from Basidiomycota, and one from Chytridiomycota. All phylogenetic analyses generated similar tree topologies regardless of the methods and datasets used. It is likely that DNA and RNA polymerase genes were inserted into the mitochondrial genomes of the 13 fungal species examined in our study as a result of different LGT events. These findings are important for a better understanding of the evolutionary relationships between fungal mitochondrial plasmids.

  4. AFM study of Escherichia coli RNA polymerase σ⁷⁰ subunit aggregation.

    PubMed

    Dubrovin, Evgeniy V; Koroleva, Olga N; Khodak, Yulia A; Kuzmina, Natalia V; Yaminsky, Igor V; Drutsa, Valeriy L

    2012-01-01

    The self-assembly of Escherichia coli RNA polymerase σ⁷⁰ subunit was investigated using several experimental approaches. A novel rodlike shape was reported for σ⁷⁰ subunit aggregates. Atomic force microscopy reveals that these aggregates, or σ⁷⁰ polymers, have a straight rodlike shape 5.4 nm in diameter and up to 300 nm in length. Atomic force microscopy data, Congo red binding assay, and sodium dodecyl sulfate gel electrophoresis confirm the amyloid nature of observed aggregates. The process of formation of rodlike structures proceeds spontaneously under nearly physiological conditions. E. coli RNA polymerase σ⁷⁰ subunit may be an interesting object for investigation of amyloidosis as well as for biotechnological applications that exploit self-assembled bionanostructures. Polymerization of σ⁷⁰ subunit may be a competitive process with its three-dimensional crystallization and association with core RNA polymerase. In this basic science study, the self-assembly of Escherichia coli RNA polymerase σ⁷⁰( subunit was investigated using atomic force microscopy and other complementary approaches. 2012 Elsevier Inc. All rights reserved.

  5. African swine fever virus encodes two genes which share significant homology with the two largest subunits of DNA-dependent RNA polymerases.

    PubMed Central

    Yáñez, R J; Boursnell, M; Nogal, M L; Yuste, L; Viñuela, E

    1993-01-01

    A random sequencing strategy applied to two large SalI restriction fragments (SB and SD) of the African swine fever virus (ASFV) genome revealed that they might encode proteins similar to the two largest RNA polymerase subunits of eukaryotes, poxviruses and Escherichia coli. After further mapping by dot-blot hybridization, two large open reading frames (ORFs) were completely sequenced. The first ORF (NP1450L) encodes a protein of 1450 amino acids with extensive similarity to the largest subunit of RNA polymerases. The second one (EP1242L) codes for a protein of 1242 amino acids similar to the second largest RNA polymerase subunit. Proteins NP1450L and EP1242L are more similar to the corresponding subunits of eukaryotic RNA polymerase II than to those of vaccinia virus, the prototype poxvirus, which shares many functional characteristics with ASFV. ORFs NP1450L and EP1242L are mainly expressed late in ASFV infection, after the onset of DNA replication. Images PMID:8506138

  6. Requirement for XLF/Cernunnos in alignment-based gap filling by DNA polymerases lambda and mu for nonhomologous end joining in human whole-cell extracts.

    PubMed

    Akopiants, Konstantin; Zhou, Rui-Zhe; Mohapatra, Susovan; Valerie, Kristoffer; Lees-Miller, Susan P; Lee, Kyung-Jong; Chen, David J; Revy, Patrick; de Villartay, Jean-Pierre; Povirk, Lawrence F

    2009-07-01

    XLF/Cernunnos is a core protein of the nonhomologous end-joining pathway of DNA double-strand break repair. To better define the role of Cernunnos in end joining, whole-cell extracts were prepared from Cernunnos-deficient human cells. These extracts effected little joining of DNA ends with cohesive 5' or 3' overhangs, and no joining at all of partially complementary 3' overhangs that required gap filling prior to ligation. Assays in which gap-filled but unligated intermediates were trapped using dideoxynucleotides revealed that there was no gap filling on aligned DSB ends in the Cernunnos-deficient extracts. Recombinant Cernunnos protein restored gap filling and end joining of partially complementary overhangs, and stimulated joining of cohesive ends more than twentyfold. XLF-dependent gap filling was nearly eliminated by immunodepletion of DNA polymerase lambda, but was restored by addition of either polymerase lambda or polymerase mu. Thus, Cernunnos is essential for gap filling by either polymerase during nonhomologous end joining, suggesting that it plays a major role in aligning the two DNA ends in the repair complex.

  7. Single molecular biology: coming of age in DNA replication.

    PubMed

    Liu, Xiao-Jing; Lou, Hui-Qiang

    2017-09-20

    DNA replication is an essential process of the living organisms. To achieve precise and reliable replication, DNA polymerases play a central role in DNA synthesis. Previous investigations have shown that the average rates of DNA synthesis on the leading and lagging strands in a replisome must be similar to avoid the formation of significant gaps in the nascent strands. The underlying mechanism has been assumed to be coordination between leading- and lagging-strand polymerases. However, Kowalczykowski's lab members recently performed single molecule techniques in E. coli and showed the real-time behavior of a replisome. The leading- and lagging-strand polymerases function stochastically and independently. Furthermore, when a DNA polymerase is paused, the helicase slows down in a self-regulating fail-safe mechanism, akin to a ''dead-man's switch''. Based on the real-time single-molecular observation, the authors propose that leading- and lagging-strand polymerases synthesize DNA stochastically within a Gaussian distribution. Along with the development and application of single-molecule techniques, we will witness a new age of DNA replication and other biological researches.

  8. Fructose bisphosphate aldolase is involved in the control of RNA polymerase III-directed transcription.

    PubMed

    Cieśla, Małgorzata; Mierzejewska, Jolanta; Adamczyk, Małgorzata; Farrants, Ann-Kristin Östlund; Boguta, Magdalena

    2014-06-01

    Yeast Fba1 (fructose 1,6-bisphosphate aldolase) is a glycolytic enzyme essential for viability. The overproduction of Fba1 enables overcoming of a severe growth defect caused by a missense mutation rpc128-1007 in a gene encoding the C128 protein, the second largest subunit of the RNA polymerase III complex. The suppression of the growth phenotype by Fba1 is accompanied by enhanced de novo tRNA transcription in rpc128-1007 cells. We inactivated residues critical for the catalytic activity of Fba1. Overproduction of inactive aldolase still suppressed the rpc128-1007 phenotype, indicating that the function of this glycolytic enzyme in RNA polymerase III transcription is independent of its catalytic activity. Yeast Fba1 was determined to interact with the RNA polymerase III complex by coimmunoprecipitation. Additionally, a role of aldolase in control of tRNA transcription was confirmed by ChIP experiments. The results indicate a novel direct relationship between RNA polymerase III transcription and aldolase. Copyright © 2014 Elsevier B.V. All rights reserved.

  9. Studies of the Interaction of Influenza Virus RNA Polymerase PAN with Endonuclease Inhibitors.

    PubMed

    Dong, Li-Hua; Cao, Xiao-Rong

    2018-06-01

    Influenza virus is a major causative agent of respiratory viral infections, and RNA polymerase catalyzes its replication and transcription activities in infected cell nuclei. Since it is highly conserved in all virus strains, RNA polymerase becomes a key target of anti-influenza virus agents. Although experimental studies have revealed the good inhibitory activity of endonuclease inhibitors to RNA polymerase, the mechanism is still unclear. In this study, the docking and molecular dynamics simulations have been performed to explore the interaction of three kinds of endonuclease inhibitors with the subunit (PA N ) of RNA polymerase. Our calculations indicate that all these endonuclease inhibitors can bind to the binding pocket of PA N , in which the electronegative oxygen atoms of the inhibitors form a chelated structure with the two Mn 2+ cations of the active center. The most important interaction between these inhibitors and PA N is electrostatic interaction. The electron density of the chelate oxygen atoms determines the magnitude of the electrostatic energy, and the chelated structure and orientation of inhibitors depend largely on the distance between the chelate oxygen atoms.

  10. A Two-State Model for the Dynamics of the Pyrophosphate Ion Release in Bacterial RNA Polymerase

    PubMed Central

    Da, Lin-Tai; Pardo Avila, Fátima; Wang, Dong; Huang, Xuhui

    2013-01-01

    The dynamics of the PPi release during the transcription elongation of bacterial RNA polymerase and its effects on the Trigger Loop (TL) opening motion are still elusive. Here, we built a Markov State Model (MSM) from extensive all-atom molecular dynamics (MD) simulations to investigate the mechanism of the PPi release. Our MSM has identified a simple two-state mechanism for the PPi release instead of a more complex four-state mechanism observed in RNA polymerase II (Pol II). We observed that the PPi release in bacterial RNA polymerase occurs at sub-microsecond timescale, which is ∼3-fold faster than that in Pol II. After escaping from the active site, the (Mg-PPi)2− group passes through a single elongated metastable region where several positively charged residues on the secondary channel provide favorable interactions. Surprisingly, we found that the PPi release is not coupled with the TL unfolding but correlates tightly with the side-chain rotation of the TL residue R1239. Our work sheds light on the dynamics underlying the transcription elongation of the bacterial RNA polymerase. PMID:23592966

  11. Base modifications affecting RNA polymerase and reverse transcriptase fidelity.

    PubMed

    Potapov, Vladimir; Fu, Xiaoqing; Dai, Nan; Corrêa, Ivan R; Tanner, Nathan A; Ong, Jennifer L

    2018-06-20

    Ribonucleic acid (RNA) is capable of hosting a variety of chemically diverse modifications, in both naturally-occurring post-transcriptional modifications and artificial chemical modifications used to expand the functionality of RNA. However, few studies have addressed how base modifications affect RNA polymerase and reverse transcriptase activity and fidelity. Here, we describe the fidelity of RNA synthesis and reverse transcription of modified ribonucleotides using an assay based on Pacific Biosciences Single Molecule Real-Time sequencing. Several modified bases, including methylated (m6A, m5C and m5U), hydroxymethylated (hm5U) and isomeric bases (pseudouridine), were examined. By comparing each modified base to the equivalent unmodified RNA base, we can determine how the modification affected cumulative RNA polymerase and reverse transcriptase fidelity. 5-hydroxymethyluridine and N6-methyladenosine both increased the combined error rate of T7 RNA polymerase and reverse transcriptases, while pseudouridine specifically increased the error rate of RNA synthesis by T7 RNA polymerase. In addition, we examined the frequency, mutational spectrum and sequence context of reverse transcription errors on DNA templates from an analysis of second strand DNA synthesis.

  12. Human REV3 DNA Polymerase Zeta Localizes to Mitochondria and Protects the Mitochondrial Genome.

    PubMed

    Singh, Bhupendra; Li, Xiurong; Owens, Kjerstin M; Vanniarajan, Ayyasamy; Liang, Ping; Singh, Keshav K

    2015-01-01

    To date, mitochondrial DNA polymerase γ (POLG) is the only polymerase known to be present in mammalian mitochondria. A dogma in the mitochondria field is that there is no other polymerase present in the mitochondria of mammalian cells. Here we demonstrate localization of REV3 DNA polymerase in the mammalian mitochondria. We demonstrate localization of REV3 in the mitochondria of mammalian tissue as well as cell lines. REV3 associates with POLG and mitochondrial DNA and protects the mitochondrial genome from DNA damage. Inactivation of Rev3 leads to reduced mitochondrial membrane potential, reduced OXPHOS activity, and increased glucose consumption. Conversely, inhibition of the OXPHOS increases expression of Rev3. Rev3 expression is increased in human primary breast tumors and breast cancer cell lines. Inactivation of Rev3 decreases cell migration and invasion, and localization of Rev3 in mitochondria increases survival and the invasive potential of cancer cells. Taken together, we demonstrate that REV3 functions in mammalian mitochondria and that mitochondrial REV3 is associated with the tumorigenic potential of cells.

  13. A two-way street: regulatory interplay between RNA polymerase and nascent RNA structure

    PubMed Central

    Zhang, Jinwei; Landick, Robert

    2016-01-01

    The vectorial (5′-to-3′ at varying velocity) synthesis of RNA by cellular RNA polymerases creates a rugged kinetic landscape, demarcated by frequent, sometimes long-lived pauses. In addition to myriad gene-regulatory roles, these pauses temporally and spatially program the co-transcriptional, hierarchical folding of biologically active RNAs. Conversely, these RNA structures, which form inside or near the RNA exit channel, interact with the polymerase and adjacent protein factors to influence RNA synthesis by modulating pausing, termination, antitermination, and slippage. Here we review the evolutionary origin, mechanistic underpinnings, and regulatory consequences of this interplay between RNA polymerase and nascent RNA structure. We categorize and attempt to rationalize the extensive linkage between the transcriptional machinery and its product, and provide a framework for future studies. PMID:26822487

  14. DNA Polymerase III Star Requires ATP to Start Synthesis on a Primed DNA†

    PubMed Central

    Wickner, William; Kornberg, Arthur

    1973-01-01

    DNA polymerase III star replicates a ϕX174 single-stranded, circular DNA primed with a fragment of RNA. This reaction proceeds in two stages. In stage I, a complex is formed requiring DNA polymerase III star, ATP, spermidine, copolymerase III*, and RNA-primed ϕX174 single-stranded, circular DNA. The complex, isolated by gel filtration, contains ADP and inorganic phosphate (the products of a specific ATP cleavage) as well as spermidine, polymerase III star, and copolymerase III star. In stage II, the chain grows upon addition of deoxynucleoside triphosphates; ADP and inorganic phosphate are discharged and chain elongation is resistant to antibody to copolymerase III star. Thus ATP and copolymerase III star are required to initiate chain growth but not to sustain it. Images PMID:4519657

  15. Interaction of sigma 70 with Escherichia coli RNA polymerase core enzyme studied by surface plasmon resonance.

    PubMed

    Ferguson, A L; Hughes, A D; Tufail, U; Baumann, C G; Scott, D J; Hoggett, J G

    2000-09-22

    The interaction between the core form of bacterial RNA polymerases and sigma factors is essential for specific promoter recognition, and for coordinating the expression of different sets of genes in response to varying cellular needs. The interaction between Escherichia coli core RNA polymerase and sigma 70 has been investigated by surface plasmon resonance. The His-tagged form of sigma 70 factor was immobilised on a Ni2+-NTA chip for monitoring its interaction with core polymerase. The binding constant for the interaction was found to be 1.9x10(-7) M, and the dissociation rate constant for release of sigma from core, in the absence of DNA or transcription, was 4x10(-3) s(-1), corresponding to a half-life of about 200 s.

  16. Exploring the limits of ultrafast polymerase chain reaction using liquid for thermal heat exchange: A proof of principle

    NASA Astrophysics Data System (ADS)

    Maltezos, George; Johnston, Matthew; Taganov, Konstantin; Srichantaratsamee, Chutatip; Gorman, John; Baltimore, David; Chantratita, Wasun; Scherer, Axel

    2010-12-01

    Thermal ramp rate is a major limiting factor in using real-time polymerase chain reaction (PCR) for routine diagnostics. We explored the limits of speed by using liquid for thermal exchange rather than metal as in traditional devices, and by testing different polymerases. In a clinical setting, our system equaled or surpassed state-of-the-art devices for accuracy in amplifying DNA/RNA of avian influenza, cytomegalovirus, and human immunodeficiency virus. Using Thermococcus kodakaraensis polymerase and optimizing both electrical and chemical systems, we obtained an accurate, 35 cycle amplification of an 85-base pair fragment of E. coli O157:H7 Shiga toxin gene in as little as 94.1 s, a significant improvement over a typical 1 h PCR amplification.

  17. Encephalomyocarditis Virus Ribonucleic Acid Polymerase Associated with 150S Cytoplasmic Particles

    PubMed Central

    Bases, Robert; Tarikas, Helgi

    1969-01-01

    Cytoplasmic particles which sedimented at 150S were the smallest structures containing detectable viral ribonucleic acid polymerase in mouse cells infected with encephalomyocarditis virus. PMID:4307906

  18. Kinetics and thermodynamics of DNA polymerases with exonuclease proofreading

    NASA Astrophysics Data System (ADS)

    Gaspard, Pierre

    2016-04-01

    Kinetic theory and thermodynamics are applied to DNA polymerases with exonuclease activity, taking into account the dependence of the rates on the previously incorporated nucleotide. The replication fidelity is shown to increase significantly thanks to this dependence at the basis of the mechanism of exonuclease proofreading. In particular, this dependence can provide up to a 100-fold lowering of the error probability under physiological conditions. Theory is compared with numerical simulations for the DNA polymerases of T7 viruses and human mitochondria.

  19. Backbone assignment of the little finger domain of a Y-family DNA polymerase.

    PubMed

    Ma, Dejian; Fowler, Jason D; Suo, Zucai

    2011-10-01

    Sulfolobus solfataricus DNA polymerase IV (Dpo4), a prototype Y-family DNA polymerase, contains a unique little finger domain besides a catalytic core. Here, we report the chemical shift assignments for the backbone nitrogens, α and β carbons, and amide protons of the little finger domain of Dpo4. This work and our published backbone assignment for the catalytic core provide the basis for investigating the conformational dynamics of Dpo4 during catalysis using solution NMR spectroscopy.

  20. Genetics Home Reference: Pol III-related leukodystrophy

    MedlinePlus

    ... two largest parts (subunits) of an enzyme called RNA polymerase III. This enzyme is involved in the production (synthesis) of ribonucleic acid (RNA), a chemical cousin of DNA. The RNA polymerase ...

  1. A New Family of Capsule Polymerases Generates Teichoic Acid-Like Capsule Polymers in Gram-Negative Pathogens.

    PubMed

    Litschko, Christa; Oldrini, Davide; Budde, Insa; Berger, Monika; Meens, Jochen; Gerardy-Schahn, Rita; Berti, Francesco; Schubert, Mario; Fiebig, Timm

    2018-05-29

    Group 2 capsule polymers represent crucial virulence factors of Gram-negative pathogenic bacteria. They are synthesized by enzymes called capsule polymerases. In this report, we describe a new family of polymerases that combine glycosyltransferase and hexose- and polyol-phosphate transferase activity to generate complex poly(oligosaccharide phosphate) and poly(glycosylpolyol phosphate) polymers, the latter of which display similarity to wall teichoic acid (WTA), a cell wall component of Gram-positive bacteria. Using modeling and multiple-sequence alignment, we showed homology between the predicted polymerase domains and WTA type I biosynthesis enzymes, creating a link between Gram-negative and Gram-positive cell wall biosynthesis processes. The polymerases of the new family are highly abundant and found in a variety of capsule-expressing pathogens such as Neisseria meningitidis , Actinobacillus pleuropneumoniae , Haemophilus influenzae , Bibersteinia trehalosi , and Escherichia coli with both human and animal hosts. Five representative candidates were purified, their activities were confirmed using nuclear magnetic resonance (NMR) spectroscopy, and their predicted folds were validated by site-directed mutagenesis. IMPORTANCE Bacterial capsules play an important role in the interaction between a pathogen and the immune system of its host. During the last decade, capsule polymerases have become attractive tools for the production of capsule polymers applied as antigens in glycoconjugate vaccine formulations. Conventional production of glycoconjugate vaccines requires the cultivation of the pathogen and thus the highest biosafety standards, leading to tremendous costs. With regard to animal husbandry, where vaccines could avoid the extensive use of antibiotics, conventional production is not sufficiently cost-effective. In contrast, enzymatic synthesis of capsule polymers is pathogen-free and fast, offers high stereo- and regioselectivity, and works with high efficacy. The new capsule polymerase family described here vastly increases the toolbox of enzymes available for biotechnology purposes. Representatives are abundantly found in human pathogens but also in animal pathogens, paving the way for the exploitation of polymerases for the development of a new generation of vaccines for animal husbandry. Copyright © 2018 Litschko et al.

  2. A novel variant of DNA polymerase ζ, Rev3ΔC, highlights differential regulation of Pol32 as a subunit of polymerase δ versus ζ in Saccharomyces cerevisiae

    PubMed Central

    Siebler, Hollie M.; Lada, Artem G.; Baranovskiy, Andrey G.; Tahirov, Tahir H.; Pavlov, Youri I.

    2014-01-01

    Unrepaired DNA lesions often stall replicative DNA polymerases and are bypassed by translesion synthesis (TLS) to prevent replication fork collapse. Mechanisms of TLS are lesion- and species-specific, with a prominent role of specialized DNA polymerases with relaxed active sites. After nucleotide(s) are incorporated across from the altered base(s), the aberrant primer termini are typically extended by DNA polymerase ζ (pol ζ). As a result, pol ζ is responsible for most DNA damage-induced mutations. The mechanisms of sequential DNA polymerase switches in vivo remain unclear. The major replicative DNA polymerase δ (pol δ) shares two accessory subunits, called Pol31/Pol32 in yeast, with pol ζ. Inclusion of Pol31/Pol32 in the pol δ/pol ζ holoenzymes requires a [4Fe–4S] cluster in C-termini of the catalytic subunits. Disruption of this cluster in Pol ζ or deletion of POL32 attenuates induced mutagenesis. Here we describe a novel mutation affecting the catalytic subunit of pol ζ, rev3ΔC, which provides insight into the regulation of pol switches. Strains with Rev3ΔC, lacking the entire C-terminal domain and therefore the platform for Pol31/Pol32 binding, are partially proficient in Pol32-dependent UV-induced mutagenesis. This suggests an additional role of Pol32 in TLS, beyond being a pol ζ subunit, related to pol δ. In search for members of this regulatory pathway, we examined the effects of Maintenance of Genome Stability 1 (Mgs1) protein on mutagenesis in the absence of Rev3–Pol31/Pol32 interaction. Mgs1 may compete with Pol32 for binding to PCNA. Mgs1 overproduction suppresses induced mutagenesis, but had no effect on UV-mutagenesis in the rev3ΔC strain, suggesting that Mgs1 exerts its inhibitory effect by acting specifically on Pol32 bound to pol ζ. The evidence for differential regulation of Pol32 in pol δ and pol ζ emphasizes the complexity of polymerase switches. PMID:24819597

  3. Genetics Home Reference: UV-sensitive syndrome

    MedlinePlus

    ... damaged, the enzyme that carries out gene transcription (RNA polymerase) gets stuck, and the process stalls. Researchers ... the CSB, CSA, and UVSSA proteins help remove RNA polymerase from the damaged site, so the DNA ...

  4. Genetics Home Reference: Ewing sarcoma

    MedlinePlus

    ... FLI-1, is associated with both TFIID and RNA polymerase II: interactions between two members of the ... EWS and hTAFII68, and subunits of TFIID and RNA polymerase II complexes. Mol Cell Biol. 1998 Mar; ...

  5. Domain structure, localization, and function of DNA polymerase η, defective in xeroderma pigmentosum variant cells

    PubMed Central

    Kannouche, Patricia; Broughton, Bernard C.; Volker, Marcel; Hanaoka, Fumio; Mullenders, Leon H.F.; Lehmann, Alan R.

    2001-01-01

    DNA polymerase η carries out translesion synthesis past UV photoproducts and is deficient in xeroderma pigmentosum (XP) variants. We report that polη is mostly localized uniformly in the nucleus but is associated with replication foci during S phase. Following treatment of cells with UV irradiation or carcinogens, it accumulates at replication foci stalled at DNA damage. The C-terminal third of polη is not required for polymerase activity. However, the C-terminal 70 aa are needed for nuclear localization and a further 50 aa for relocalization into foci. Polη truncations lacking these domains fail to correct the defects in XP-variant cells. Furthermore, we have identified mutations in two XP variant patients that leave the polymerase motifs intact but cause loss of the localization domains. PMID:11157773

  6. The Eukaryotic Replisome Goes Under the Microscope

    DOE PAGES

    O'Donnell, Mike; Li, Huilin

    2016-03-21

    The machinery at the eukaryotic replication fork has seen many new structural advances using EM and crystallography. Recent structures of eukaryotic replisome components include the Mcm2-7 complex, the CMG helicase, DNA polymerases, a Ctf4 trimer hub and the first look at a core replisome of 20 different proteins containing the helicase, primase, leading polymerase and a lagging strand polymerase. The eukaryotic core replisome shows an unanticipated architecture, with one polymerase sitting above the helicase and the other below. Additionally, structures of Mcm2 bound to an H3/H4 tetramer suggest a direct role of the replisome in handling nucleosomes, which are importantmore » to DNA organization and gene regulation. This review provides a summary of some of the many recent advances in the structure of the eukaryotic replisome.« less

  7. Single molecule imaging of RNA polymerase II using atomic force microscopy

    NASA Astrophysics Data System (ADS)

    Rhodin, Thor; Fu, Jianhua; Umemura, Kazuo; Gad, Mohammed; Jarvis, Suzi; Ishikawa, Mitsuru

    2003-03-01

    An atomic force microscopy (AFM) study of the shape, orientation and surface topology of RNA polymerase II supported on silanized freshly cleaved mica was made. The overall aim is to define the molecular topology of RNA polymerase II in appropriate fluids to help clarify the relationship of conformational features to biofunctionality. A Nanoscope III atomic force microscope was used in the tapping mode with oxide-sharpened (8-10 nm) Si 3N 4 probes in aqueous zinc chloride buffer. The main structural features observed by AFM were compared to those derived from electron-density plots based on X-ray crystallographic studies. The conformational features included a bilobal silhouette with an inverted umbrella-shaped crater connected to a reaction site. These studies provide a starting point for constructing a 3D-AFM profiling analysis of proteins such as RNA polymerase complexes.

  8. Effect of Escherichia coli DNA binding protein on the transcription of single-stranded phage M13 DNA by Escherichia coli RNA polymerase

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Niyogi, S.K.; Ratrie, H. III; Datta, A.K.

    E. coli DNA binding protein strongly inhibits the transcription of single-stranded rather than double-stranded phage M13 DNA by E. coli RNA polymerase. This inhibition cannot be significantly overcome by increasing the concentration of RNA polymerase. Nor does the order of addition of binding protein affect its inhibitory property: inhibition is evident whether binding protein is added before or after the formation of the RNA polymerase--DNA complex. Inhibition is also observed if binding protein is added at various times after initiation of RNA synthesis. Maximal inhibition occurs at a binding protein-to-DNA ratio (w/w) of about 8:1. This corresponds to one bindingmore » protein molecule covering about 30 nucleotides, in good agreement with values obtained by physical measurements.« less

  9. Transient expression and activity of human DNA polymerase iota in loach embryos.

    PubMed

    Makarova, Irina V; Kazakov, Andrey A; Makarova, Alena V; Khaidarova, Nella V; Kozikova, Larisa V; Nenasheva, Valentina V; Gening, Leonid V; Tarantul, Vyacheslav Z; Andreeva, Ludmila E

    2012-02-01

    Human DNA polymerase iota (Pol ι) is a Y-family DNA polymerase with unusual biochemical properties and not fully understood functions. Pol ι preferentially incorporates dGTP opposite template thymine. This property can be used to monitor Pol ι activity in the presence of other DNA polymerases, e.g. in cell extracts of tissues and tumors. We have now confirmed the specificity and sensitivity of the method of Pol ι activity detection in cell extracts using an animal model of loach Misgurnus fossilis embryos transiently expressing human Pol ι. The overexpression of Pol ι was shown to be accompanied by an increase in abnormalities in development and the frequency of pycnotic nuclei in fish embryos. Further analysis of fish embryos with constitutive or regulated Pol ι expression may provide insights into Pol ι functions in vertebrate animals.

  10. Identification of dengue viral RNA-dependent RNA polymerase inhibitor using computational fragment-based approaches and molecular dynamics study.

    PubMed

    Anusuya, Shanmugam; Velmurugan, Devadasan; Gromiha, M Michael

    2016-07-01

    Dengue is a major public health concern in tropical and subtropical countries of the world. There are no specific drugs available to treat dengue. Even though several candidates targeted both viral and host proteins to overcome dengue infection, they have not yet entered into the later stages of clinical trials. In order to design a drug for dengue fever, newly emerged fragment-based drug designing technique was applied. RNA-dependent RNA polymerase, which is essential for dengue viral replication is chosen as a drug target for dengue drug discovery. A cascade of methods, fragment screening, fragment growing, and fragment linking revealed the compound [2-(4-carbamoylpiperidin-1-yl)-2-oxoethyl]8-(1,3-benzothiazol-2-yl)naphthalene-1-carboxylate as a potent dengue viral polymerase inhibitor. Both strain energy and binding free energy calculations predicted that this could be a better inhibitor than the existing ones. Molecular dynamics simulation studies showed that the dengue polymerase-lead complex is stable and their interactions are consistent throughout the simulation. The hydrogen-bonded interactions formed by the residues Arg792, Thr794, Ser796, and Asn405 are the primary contributors for the stability and the rigidity of the polymerase-lead complex. This might keep the polymerase in closed conformation and thus inhibits viral replication. Hence, this might be a promising lead molecule for dengue drug designing. Further optimization of this lead molecule would result in a potent drug for dengue.

  11. Roles of Saccharomyces cerevisiae DNA polymerases Poleta and Polzeta in response to irradiation by simulated sunlight.

    PubMed

    Kozmin, Stanislav G; Pavlov, Youri I; Kunkel, Thomas A; Sage, Evelyne

    2003-08-01

    Sunlight causes lesions in DNA that if unrepaired and inaccurately replicated by DNA polymerases yield mutations that result in skin cancer in humans. Two enzymes involved in translesion synthesis (TLS) of UV-induced photolesions are DNA polymerase eta (Poleta) and polymerase zeta (Polzeta), encoded by the RAD30A and REV3 genes, respectively. Previous studies have investigated the TLS roles of these polymerases in human and yeast cells irradiated with monochromatic, short wavelength UVC radiation (254 nm). However, less is known about cellular responses to solar radiation, which is of higher and mixed wavelengths (310-1100 nm) and produces a different spectrum of DNA lesions, including Dewar photoproducts and oxidative lesions. Here we report on the comparative cytotoxic and mutagenic effects of simulated sunlight (SSL) and UVC radiation on yeast wild-type, rad30Delta, rev3Delta and rev3Delta rad30Delta strains. The results with SSL support several previous interpretations on the roles of these two polymerases in TLS of photodimers and (6-4) photoproducts derived from studies with UVC. They further suggest that Poleta participates in the non-mutagenic bypass of SSL-dependent cytosine-containing Dewar photoproducts and 8-oxoguanine, while Polzeta is mainly responsible for the mutagenic bypass of all types of Dewar photoproducts. They also suggest that in the absence of Polzeta, Poleta contributes to UVC- and SSL-induced mutagenesis, possibly by the bypass of photodimers containing deaminated cytosine.

  12. Probing Conformational Changes of Human DNA Polymerase λ Using Mass Spectrometry-Based Protein Footprinting

    PubMed Central

    Fowler, Jason D.; Brown, Jessica A.; Kvaratskhelia, Mamuka; Suo, Zucai

    2009-01-01

    SUMMARY Crystallographic studies of the C-terminal, DNA polymerase β-like domain of human DNA polymerase lambda (fPolλ) suggested that the catalytic cycle might not involve a large protein domain rearrangement as observed with several replicative DNA polymerases and DNA polymerase β. To examine solution-phase protein conformation changes in fPolλ, which also contains a breast cancer susceptibility gene 1 C-terminal domain and a Proline-rich domain at its N-terminus, we used a mass spectrometry - based protein footprinting approach. In parallel experiments, surface accessibility maps for Arg residues were compared for the free fPolλ versus the binary complex of enzyme•gapped DNA and the ternary complex of enzyme•gapped DNA•dNTP. These experiments suggested that fPolλ does not undergo major conformational changes during the catalysis in the solution phase. Furthermore, the mass spectrometry-based protein footprinting experiments revealed that active site residue R386 was shielded from the surface only in the presence of both a gapped DNA substrate and an incoming nucleotide dNTP. Site-directed mutagenesis and pre-steady state kinetic studies confirmed the importance of R386 for the enzyme activity, and indicated the key role for its guanidino group in stabilizing the negative charges of an incoming nucleotide and the leaving pyrophosphate product. We suggest that such interactions could be shared by and important for catalytic functions of other DNA polymerases. PMID:19467241

  13. Characterization of DNA polymerase X from Thermus thermophilus HB8 reveals the POLXc and PHP domains are both required for 3'-5' exonuclease activity.

    PubMed

    Nakane, Shuhei; Nakagawa, Noriko; Kuramitsu, Seiki; Masui, Ryoji

    2009-04-01

    The X-family DNA polymerases (PolXs) comprise a highly conserved DNA polymerase family found in all kingdoms. Mammalian PolXs are known to be involved in several DNA-processing pathways including repair, but the cellular functions of bacterial PolXs are less known. Many bacterial PolXs have a polymerase and histidinol phosphatase (PHP) domain at their C-termini in addition to a PolX core (POLXc) domain, and possess 3'-5' exonuclease activity. Although both domains are highly conserved in bacteria, their molecular functions, especially for a PHP domain, are unknown. We found Thermus thermophilus HB8 PolX (ttPolX) has Mg(2+)/Mn(2+)-dependent DNA/RNA polymerase, Mn(2+)-dependent 3'-5' exonuclease and DNA-binding activities. We identified the domains of ttPolX by limited proteolysis and characterized their biochemical activities. The POLXc domain was responsible for the polymerase and DNA-binding activities but exonuclease activity was not detected for either domain. However, the POLXc and PHP domains interacted with each other and a mixture of the two domains had Mn(2+)-dependent 3'-5' exonuclease activity. Moreover, site-directed mutagenesis revealed catalytically important residues in the PHP domain for the 3'-5' exonuclease activity. Our findings provide a molecular insight into the functional domain organization of bacterial PolXs, especially the requirement of the PHP domain for 3'-5' exonuclease activity.

  14. PCR performance of a thermostable heterodimeric archaeal DNA polymerase

    PubMed Central

    Killelea, Tom; Ralec, Céline; Bossé, Audrey; Henneke, Ghislaine

    2014-01-01

    DNA polymerases are versatile tools used in numerous important molecular biological core technologies like the ubiquitous polymerase chain reaction (PCR), cDNA cloning, genome sequencing, and nucleic acid based diagnostics. Taking into account the multiple DNA amplification techniques in use, different DNA polymerases must be optimized for each type of application. One of the current tendencies is to reengineer or to discover new DNA polymerases with increased performance and broadened substrate spectra. At present, there is a great demand for such enzymes in applications, e.g., forensics or paleogenomics. Current major limitations hinge on the inability of conventional PCR enzymes, such as Taq, to amplify degraded or low amounts of template DNA. Besides, a wide range of PCR inhibitors can also impede reactions of nucleic acid amplification. Here we looked at the PCR performances of the proof-reading D-type DNA polymerase from P. abyssi, Pab-polD. Fragments, 3 kilobases in length, were specifically PCR-amplified in its optimized reaction buffer. Pab-polD showed not only a greater resistance to high denaturation temperatures than Taq during cycling, but also a superior tolerance to the presence of potential inhibitors. Proficient proof-reading Pab-polD enzyme could also extend a primer containing up to two mismatches at the 3' primer termini. Overall, we found valuable biochemical properties in Pab-polD compared to the conventional Taq, which makes the enzyme ideally suited for cutting-edge PCR-applications. PMID:24847315

  15. SUMO Modification Stabilizes Enterovirus 71 Polymerase 3D To Facilitate Viral Replication

    PubMed Central

    Liu, Yan; Shu, Bo; Meng, Jin; Zhang, Yuan; Zheng, Caishang; Ke, Xianliang; Gong, Peng; Hu, Qinxue; Wang, Hanzhong

    2016-01-01

    ABSTRACT Accumulating evidence suggests that viruses hijack cellular proteins to circumvent the host immune system. Ubiquitination and SUMOylation are extensively studied posttranslational modifications (PTMs) that play critical roles in diverse biological processes. Cross talk between ubiquitination and SUMOylation of both host and viral proteins has been reported to result in distinct functional consequences. Enterovirus 71 (EV71), an RNA virus belonging to the family Picornaviridae, is a common cause of hand, foot, and mouth disease. Little is known concerning how host PTM systems interact with enteroviruses. Here, we demonstrate that the 3D protein, an RNA-dependent RNA polymerase (RdRp) of EV71, is modified by small ubiquitin-like modifier 1 (SUMO-1) both during infection and in vitro. Residues K159 and L150/D151/L152 were responsible for 3D SUMOylation as determined by bioinformatics prediction combined with site-directed mutagenesis. Also, primer-dependent polymerase assays indicated that mutation of SUMOylation sites impaired 3D polymerase activity and virus replication. Moreover, 3D is ubiquitinated in a SUMO-dependent manner, and SUMOylation is crucial for 3D stability, which may be due to the interplay between the two PTMs. Importantly, increasing the level of SUMO-1 in EV71-infected cells augmented the SUMOylation and ubiquitination levels of 3D, leading to enhanced replication of EV71. These results together suggested that SUMO and ubiquitin cooperatively regulated EV71 infection, either by SUMO-ubiquitin hybrid chains or by ubiquitin conjugating to the exposed lysine residue through SUMOylation. Our study provides new insight into how a virus utilizes cellular pathways to facilitate its replication. IMPORTANCE Infection with enterovirus 71 (EV71) often causes neurological diseases in children, and EV71 is responsible for the majority of fatalities. Based on a better understanding of interplay between virus and host cell, antiviral drugs against enteroviruses may be developed. As a dynamic cellular process of posttranslational modification, SUMOylation regulates global cellular protein localization, interaction, stability, and enzymatic activity. However, little is known concerning how SUMOylation directly influences virus replication by targeting viral polymerase. Here, we found that EV71 polymerase 3D was SUMOylated during EV71 infection and in vitro. Moreover, the SUMOylation sites were determined, and in vitro polymerase assays indicated that mutations at SUMOylation sites could impair polymerase synthesis. Importantly, 3D is ubiquitinated in a SUMOylation-dependent manner that enhances the stability of the viral polymerase. Our findings indicate that the two modifications likely cooperatively enhance virus replication. Our study may offer a new therapeutic strategy against virus replication. PMID:27630238

  16. Germline and somatic polymerase ε and δ mutations define a new class of hypermutated colorectal and endometrial cancers

    PubMed Central

    Briggs, Sarah; Tomlinson, Ian

    2013-01-01

    Polymerases ϵ and δ are the main enzymes that replicate eukaryotic DNA. Accurate replication occurs through Watson–Crick base pairing and also through the action of the polymerases' exonuclease (proofreading) domains. We have recently shown that germline exonuclease domain mutations (EDMs) of POLE and POLD1 confer a high risk of multiple colorectal adenomas and carcinoma (CRC). POLD1 mutations also predispose to endometrial cancer (EC). These mutations are associated with high penetrance and dominant inheritance, although the phenotype can be variable. We have named the condition polymerase proofreading-associated polyposis (PPAP). Somatic POLE EDMs have also been found in sporadic CRCs and ECs, although very few somatic POLD1 EDMs have been detected. Both the germline and the somatic DNA polymerase EDMs cause an ‘ultramutated’, apparently microsatellite-stable, type of cancer, sometimes leading to over a million base substitutions per tumour. Here, we present the evidence for POLE and POLD1 as important contributors to the pathogenesis of CRC and EC, and highlight some of the key questions in this emerging field. Copyright © 2013 Pathological Society of Great Britain and Ireland. Published by John Wiley & Sons, Ltd PMID:23447401

  17. Altered minor-groove hydrogen bonds in DNA block transcription elongation by T7 RNA polymerase.

    PubMed

    Tanasova, Marina; Goeldi, Silvan; Meyer, Fabian; Hanawalt, Philip C; Spivak, Graciela; Sturla, Shana J

    2015-05-26

    DNA transcription depends upon the highly efficient and selective function of RNA polymerases (RNAPs). Modifications in the template DNA can impact the progression of RNA synthesis, and a number of DNA adducts, as well as abasic sites, arrest or stall transcription. Nonetheless, data are needed to understand why certain modifications to the structure of DNA bases stall RNA polymerases while others are efficiently bypassed. In this study, we evaluate the impact that alterations in dNTP/rNTP base-pair geometry have on transcription. T7 RNA polymerase was used to study transcription over modified purines and pyrimidines with altered H-bonding capacities. The results suggest that introducing wobble base-pairs into the DNA:RNA heteroduplex interferes with transcriptional elongation and stalls RNA polymerase. However, transcriptional stalling is not observed if mismatched base-pairs do not H-bond. Together, these studies show that RNAP is able to discriminate mismatches resulting in wobble base-pairs, and suggest that, in cases of modifications with minor steric impact, DNA:RNA heteroduplex geometry could serve as a controlling factor for initiating transcription-coupled DNA repair. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  18. Poly(A) polymerase contains multiple functional domains.

    PubMed Central

    Raabe, T; Murthy, K G; Manley, J L

    1994-01-01

    Poly(A) polymerase (PAP) contains regions of similarity with several known protein domains. Through site-directed mutagenesis, we provide evidence that PAP contains a functional ribonucleoprotein-type RNA binding domain (RBD) that is responsible for primer binding, making it the only known polymerase to contain such a domain. The RBD is adjacent to, and probably overlaps with, an apparent catalytic region responsible for polymerization. Despite the presence of sequence similarities, this catalytic domain appears to be distinct from the conserved polymerase module found in a large number of RNA-dependent polymerases. PAP contains two nuclear localization signals (NLSs) in its C terminus, each by itself similar to the consensus bipartite NLS found in many nuclear proteins. Mutagenesis experiments indicate that both signals, which are separated by nearly 140 residues, play important roles in directing PAP exclusively to the nucleus. Surprisingly, basic amino acids in the N-terminal-most NLS are also essential for AAUAAA-dependent polyadenylation but not for nonspecific poly(A) synthesis, suggesting that this region of PAP is involved in interactions both with nuclear targeting proteins and with nuclear polyadenylation factors. The serine/threonine-rich C terminus is multiply phosphorylated, including at sites affected by mutations in either NLS. Images PMID:8164653

  19. Identification of two essential aspartates for polymerase activity in parainfluenza virus L protein by a minireplicon system expressing secretory luciferase.

    PubMed

    Matsumoto, Yusuke; Ohta, Keisuke; Yumine, Natsuko; Goto, Hideo; Nishio, Machiko

    2015-11-01

    Gene expression of nonsegmented negative-strand RNA viruses (nsNSVs) such as parainfluenza viruses requires the RNA synthesis activity of their polymerase L protein; however, the detailed mechanism of this process is poorly understood. In this study, a parainfluenza minireplicon assay expressing secretory Gaussia luciferase (Gluc) was established to analyze large protein (L) activity. Measurement of Gluc expression in the culture medium of cells transfected with the minigenome and viral polymerase components enabled quick and concise calculation of L activity. By comparing the amino acid sequences in conserved region III (CRIII), a putative polymerase-active domain of the L protein, two strictly conserved aspartates were identified in all families of nsNSV. A series of L mutants from human parainfluenza virus type 2 and parainfluenza virus type 5 showed that these aspartates are necessary for reporter gene expression. It was also confirmed that these aspartates are important for the production of viral mRNA and antigenome cRNA, but not for a polymerase-complex formation. These findings suggest that these two aspartates are key players in the nucleotidyl transfer reaction using two metal ions. © 2015 The Societies and Wiley Publishing Asia Pty Ltd.

  20. DNA Polymerases λ and β: The Double-Edged Swords of DNA Repair.

    PubMed

    Mentegari, Elisa; Kissova, Miroslava; Bavagnoli, Laura; Maga, Giovanni; Crespan, Emmanuele

    2016-08-31

    DNA is constantly exposed to both endogenous and exogenous damages. More than 10,000 DNA modifications are induced every day in each cell's genome. Maintenance of the integrity of the genome is accomplished by several DNA repair systems. The core enzymes for these pathways are the DNA polymerases. Out of 17 DNA polymerases present in a mammalian cell, at least 13 are specifically devoted to DNA repair and are often acting in different pathways. DNA polymerases β and λ are involved in base excision repair of modified DNA bases and translesion synthesis past DNA lesions. Polymerase λ also participates in non-homologous end joining of DNA double-strand breaks. However, recent data have revealed that, depending on their relative levels, the cell cycle phase, the ratio between deoxy- and ribo-nucleotide pools and the interaction with particular auxiliary proteins, the repair reactions carried out by these enzymes can be an important source of genetic instability, owing to repair mistakes. This review summarizes the most recent results on the ambivalent properties of these enzymes in limiting or promoting genetic instability in mammalian cells, as well as their potential use as targets for anticancer chemotherapy.

  1. High-fidelity DNA replication in Mycobacterium tuberculosis relies on a trinuclear zinc center.

    PubMed

    Baños-Mateos, Soledad; van Roon, Anne-Marie M; Lang, Ulla F; Maslen, Sarah L; Skehel, J Mark; Lamers, Meindert H

    2017-10-11

    High-fidelity DNA replication depends on a proofreading 3'-5' exonuclease that is associated with the replicative DNA polymerase. The replicative DNA polymerase DnaE1 from the major pathogen Mycobacterium tuberculosis (Mtb) uses its intrinsic PHP-exonuclease that is distinct from the canonical DEDD exonucleases found in the Escherichia coli and eukaryotic replisomes. The mechanism of the PHP-exonuclease is not known. Here, we present the crystal structure of the Mtb DnaE1 polymerase. The PHP-exonuclease has a trinuclear zinc center, coordinated by nine conserved residues. Cryo-EM analysis reveals the entry path of the primer strand in the PHP-exonuclease active site. Furthermore, the PHP-exonuclease shows a striking similarity to E. coli endonuclease IV, which provides clues regarding the mechanism of action. Altogether, this work provides important insights into the PHP-exonuclease and reveals unique properties that make it an attractive target for novel anti-mycobacterial drugs.The polymerase and histidinol phosphatase (PHP) domain in the DNA polymerase DnaE1 is essential for mycobacterial high-fidelity DNA replication. Here, the authors determine the DnaE1 crystal structure, which reveals the PHP-exonuclease mechanism that can be exploited for antibiotic development.

  2. RNA Pol IV and V in Gene Silencing: Rebel Polymerases Evolving Away From Pol II’s Rules

    PubMed Central

    Zhou, Ming; Law, Julie A.

    2015-01-01

    Noncoding RNAs regulate gene expression at both the transcriptional and post-transcriptional levels, and play critical roles in development, imprinting and the maintenance of genome integrity in eukaryotic organisms [1–3]. Therefore, it is important to understand how the production of such RNAs are controlled. In addition to the three canonical DNA dependent RNA polymerases (Pol) Pol I, II and III, two non-redundant plant-specific RNA polymerases, Pol IV and Pol V, have been identified and shown to generate noncoding RNAs that are required for transcriptional gene silencing via the RNA-directed DNA methylation (RdDM) pathway. Thus, somewhat paradoxically, transcription is required for gene silencing. This paradox extends beyond plants, as silencing pathways in yeast, fungi, flies, worms, and mammals also require transcriptional machinery [4,5]. As plants have evolved specialized RNA polymerases to carry out gene silencing in a manner that is separate from the essential roles of Pol II, their characterization offers unique insight into how RNA polymerases facilitate gene silencing. In this review, we focus on the mechanisms of Pol IV and Pol V function, including their compositions, their transcripts, and their modes of recruitment to chromatin. PMID:26344361

  3. RNA Polymerase Collision versus DNA Structural Distortion: Twists and Turns Can Cause Break Failure

    PubMed Central

    Pannunzio, Nicholas R.; Lieber, Michael R.

    2016-01-01

    Summary The twisting of DNA due to the movement of RNA polymerases is the basis of numerous classic experiments in molecular biology. Recent mouse genetic models indicate that chromosomal breakage is common at sites of transcriptional turbulence. Two key studies on this point mapped breakpoints to sites of either convergent or divergent transcription, but arrived at different conclusions as to which is more detrimental and why. The issue turns on whether DNA strand separation is the basis for the chromosomal instability or collision of RNA polymerases? PMID:27153532

  4. Method for detection of Stachybotrys chartarum in pure culture and field samples using quantitative polymerase chain reaction

    DOEpatents

    Cruz-Perez, Patricia; Buttner, Mark P.

    2004-05-11

    A method for detecting the fungus Stachybotrys chartarum includes isolating DNA from a sample suspected of containing the fungus Stachybotrys chartarum. The method further includes subjecting the DNA to polymerase chain reaction amplification utilizing at least one of several primers, the several primers each including one of the base sequences 5'GTTGCTTCGGCGGGAAC3', 5'TTTGCGTTTGCCACTCAGAG3', 5'ACCTATCGTTGCTTCGGCG3', and 5'GCGTTTGCCACTCAGAGAATACT3'. The method additionally includes detecting the fungus Stachybotrys chartarum by visualizing the product of the polymerase chain reaction.

  5. Structure of a Complete Mediator-RNA Polymerase II Pre-Initiation Complex.

    PubMed

    Robinson, Philip J; Trnka, Michael J; Bushnell, David A; Davis, Ralph E; Mattei, Pierre-Jean; Burlingame, Alma L; Kornberg, Roger D

    2016-09-08

    A complete, 52-protein, 2.5 million dalton, Mediator-RNA polymerase II pre-initiation complex (Med-PIC) was assembled and analyzed by cryo-electron microscopy and by chemical cross-linking and mass spectrometry. The resulting complete Med-PIC structure reveals two components of functional significance, absent from previous structures, a protein kinase complex and the Mediator-activator interaction region. It thereby shows how the kinase and its target, the C-terminal domain of the polymerase, control Med-PIC interaction and transcription. Copyright © 2016 Elsevier Inc. All rights reserved.

  6. A Crystallographic Study of the Role of Sequence Context in Thymine Glycol Bypass by a Replicative DNA Polymerase Serendipitously Sheds Light on the Exonuclease Complex

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Aller, Pierre; Duclos, Stéphanie; Wallace, Susan S.

    2012-06-27

    Thymine glycol (Tg) is the most common oxidation product of thymine and is known to be a strong block to replicative DNA polymerases. A previously solved structure of the bacteriophage RB69 DNA polymerase (RB69 gp43) in complex with Tg in the sequence context 5'-G-Tg-G shed light on how Tg blocks primer elongation: The protruding methyl group of the oxidized thymine displaces the adjacent 5'-G, which can no longer serve as a template for primer elongation [Aller, P., Rould, M. A., Hogg, M, Wallace, S. S. and Doublie S. (2007). A structural rationale for stalling of a replicative DNA polymerase atmore » the most common oxidative thymine lesion, thymine glycol. Proc. Natl. Acad. Sci. USA, 104, 814-818.]. Several studies showed that in the sequence context 5'-C-Tg-purine, Tg is more likely to be bypassed by Klenow fragment, an A-family DNA polymerase. We set out to investigate the role of sequence context in Tg bypass in a B-family polymerase and to solve the crystal structures of the bacteriophage RB69 DNA polymerase in complex with Tg-containing DNA in the three remaining sequence contexts: 5'-A-Tg-G, 5'-T-Tg-G, and 5'-C-Tg-G. A combination of several factors - including the associated exonuclease activity, the nature of the 3' and 5' bases surrounding Tg, and the cis-trans interconversion of Tg - influences Tg bypass. We also visualized for the first time the structure of a well-ordered exonuclease complex, allowing us to identify and confirm the role of key residues (Phe123, Met256, and Tyr257) in strand separation and in the stabilization of the primer strand in the exonuclease site.« less

  7. Localized cerebral energy failure in DNA polymerase gamma-associated encephalopathy syndromes.

    PubMed

    Tzoulis, Charalampos; Neckelmann, Gesche; Mørk, Sverre J; Engelsen, Bernt E; Viscomi, Carlo; Moen, Gunnar; Ersland, Lars; Zeviani, Massimo; Bindoff, Laurence A

    2010-05-01

    Mutations in the catalytic subunit of the mitochondrial DNA-polymerase gamma cause a wide spectrum of clinical disease ranging from infantile hepato-encephalopathy to juvenile/adult-onset spinocerebellar ataxia and late onset progressive external ophthalmoplegia. Several of these syndromes are associated with an encephalopathy that characteristically shows episodes of rapid neurological deterioration and the development of acute cerebral lesions. The purpose of this study was to investigate the nature, distribution and natural evolution of central nervous system lesions in polymerase gamma associated encephalopathy focusing particularly on lesions identified by magnetic resonance imaging. We compared radiological, electrophysiological and pathological findings where available to study potential mechanisms underlying the episodes of exacerbation and acute cerebral lesions. We studied a total of 112 magnetic resonance tomographies and 11 computed tomographies in 32 patients with polymerase gamma-encephalopathy, including multiple serial examinations performed during both the chronic and acute phases of the disease and, in several cases, magnetic resonance spectroscopy and serial diffusion weighted studies. Data from imaging, electroencephalography and post-mortem examination were compared in order to study the underlying disease process. Our findings show that magnetic resonance imaging in polymerase gamma-related encephalopathies has high sensitivity and can identify patterns that are specific for individual syndromes. One form of chronic polymerase gamma-encephalopathy, that is associated with the c.1399G > A and c.2243G > C mutations, is characterized by progressive cerebral and cerebellar atrophy and focal lesions of the thalamus, deep cerebellar structures and medulla oblongata. Acute encephalopathies, both infantile and later onset, show similar pictures with cortical stroke-like lesions occurring during episodes of exacerbation. These lesions can occur both with and without electroencephalographic evidence of concurrent epileptic activity, and have diffusion, spectroscopic and histological profiles strongly suggestive of neuronal energy failure. We suggest therefore that both infantile and later onset polymerase gamma related encephalopathies are part of a continuum.

  8. Transcription Profiling of Bacillus subtilis Cells Infected with AR9, a Giant Phage Encoding Two Multisubunit RNA Polymerases.

    PubMed

    Lavysh, Daria; Sokolova, Maria; Slashcheva, Marina; Förstner, Konrad U; Severinov, Konstantin

    2017-02-14

    Bacteriophage AR9 is a recently sequenced jumbo phage that encodes two multisubunit RNA polymerases. Here we investigated the AR9 transcription strategy and the effect of AR9 infection on the transcription of its host, Bacillus subtilis Analysis of whole-genome transcription revealed early, late, and continuously expressed AR9 genes. Alignment of sequences upstream of the 5' ends of AR9 transcripts revealed consensus sequences that define early and late phage promoters. Continuously expressed AR9 genes have both early and late promoters in front of them. Early AR9 transcription is independent of protein synthesis and must be determined by virion RNA polymerase injected together with viral DNA. During infection, the overall amount of host mRNAs is significantly decreased. Analysis of relative amounts of host transcripts revealed notable differences in the levels of some mRNAs. The physiological significance of up- or downregulation of host genes for AR9 phage infection remains to be established. AR9 infection is significantly affected by rifampin, an inhibitor of host RNA polymerase transcription. The effect is likely caused by the antibiotic-induced killing of host cells, while phage genome transcription is solely performed by viral RNA polymerases. IMPORTANCE Phages regulate the timing of the expression of their own genes to coordinate processes in the infected cell and maximize the release of viral progeny. Phages also alter the levels of host transcripts. Here we present the results of a temporal analysis of the host and viral transcriptomes of Bacillus subtilis infected with a giant phage, AR9. We identify viral promoters recognized by two virus-encoded RNA polymerases that are a unique feature of the phiKZ-related group of phages to which AR9 belongs. Our results set the stage for future analyses of highly unusual RNA polymerases encoded by AR9 and other phiKZ-related phages. Copyright © 2017 Lavysh et al.

  9. The rate of polymerase release upon filling the gap between Okazaki fragments is inadequate to support cycling during lagging strand synthesis.

    PubMed

    Dohrmann, Paul R; Manhart, Carol M; Downey, Christopher D; McHenry, Charles S

    2011-11-18

    Upon completion of synthesis of an Okazaki fragment, the lagging strand replicase must recycle to the next primer at the replication fork in under 0.1 s to sustain the physiological rate of DNA synthesis. We tested the collision model that posits that cycling is triggered by the polymerase encountering the 5'-end of the preceding Okazaki fragment. Probing with surface plasmon resonance, DNA polymerase III holoenzyme initiation complexes were formed on an immobilized gapped template. Initiation complexes exhibit a half-life of dissociation of approximately 15 min. Reduction in gap size to 1 nt increased the rate of dissociation 2.5-fold, and complete filling of the gap increased the off-rate an additional 3-fold (t(1/2)~2 min). An exogenous primed template and ATP accelerated dissociation an additional 4-fold in a reaction that required complete filling of the gap. Neither a 5'-triphosphate nor a 5'-RNA terminated oligonucleotide downstream of the polymerase accelerated dissociation further. Thus, the rate of polymerase release upon gap completion and collision with a downstream Okazaki fragment is 1000-fold too slow to support an adequate rate of cycling and likely provides a backup mechanism to enable polymerase release when the other cycling signals are absent. Kinetic measurements indicate that addition of the last nucleotide to fill the gap is not the rate-limiting step for polymerase release and cycling. Modest (approximately 7 nt) strand displacement is observed after the gap between model Okazaki fragments is filled. To determine the identity of the protein that senses gap filling to modulate affinity of the replicase for the template, we performed photo-cross-linking experiments with highly reactive and non-chemoselective diazirines. Only the α subunit cross-linked, indicating that it serves as the sensor. Copyright © 2011 Elsevier Ltd. All rights reserved.

  10. Catching the waves: Following the leading edge of elongating RNA polymerase II

    PubMed Central

    Henriques, Telmo; Adelman, Karen

    2013-01-01

    By precisely tracking the waves of elongating RNA polymerase II (Pol II) during gene activation, Danko et al. (2013) discovered a surprising diversity of elongation rates among and along human genes. PMID:23622514

  11. Problem-Solving Test: Pyrosequencing

    ERIC Educational Resources Information Center

    Szeberenyi, Jozsef

    2013-01-01

    Terms to be familiar with before you start to solve the test: Maxam-Gilbert sequencing, Sanger sequencing, gel electrophoresis, DNA synthesis reaction, polymerase chain reaction, template, primer, DNA polymerase, deoxyribonucleoside triphosphates, orthophosphate, pyrophosphate, nucleoside monophosphates, luminescence, acid anhydride bond,…

  12. Close encounters: Moving along bumps, breaks, and bubbles on expanded trinucleotide tracts

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Polyzos, Aris A.; McMurray, Cynthia T.

    2017-06-09

    Expansion of simple triplet repeats (TNR) underlies greater than 30 severe degenerative diseases. There is a good understanding of the major pathways generating an expansion, and the associated polymerases that operate during gap filling synthesis at these “difficult to copy” sequences. However, the mechanism by which a TNR is repaired depends on the type of lesion, the structural features imposed by the lesion, the assembled replication/repair complex, and the polymerase that encounters it. The relationships among these parameters are exceptionally complex and how they direct pathway choice is poorly understood. In this review, we consider the properties of polymerases, andmore » how encounters with GC-rich or abnormal structures might influence polymerase choice and the success of replication and repair. Insights over the last three years have highlighted new mechanisms that provide interesting choices to consider in protecting genome stability.« less

  13. Transcriptional bursting is intrinsically caused by interplay between RNA polymerases on DNA

    NASA Astrophysics Data System (ADS)

    Fujita, Keisuke; Iwaki, Mitsuhiro; Yanagida, Toshio

    2016-12-01

    Cell-to-cell variability plays a critical role in cellular responses and decision-making in a population, and transcriptional bursting has been broadly studied by experimental and theoretical approaches as the potential source of cell-to-cell variability. Although molecular mechanisms of transcriptional bursting have been proposed, there is little consensus. An unsolved key question is whether transcriptional bursting is intertwined with many transcriptional regulatory factors or is an intrinsic characteristic of RNA polymerase on DNA. Here we design an in vitro single-molecule measurement system to analyse the kinetics of transcriptional bursting. The results indicate that transcriptional bursting is caused by interplay between RNA polymerases on DNA. The kinetics of in vitro transcriptional bursting is quantitatively consistent with the gene-nonspecific kinetics previously observed in noisy gene expression in vivo. Our kinetic analysis based on a cellular automaton model confirms that arrest and rescue by trailing RNA polymerase intrinsically causes transcriptional bursting.

  14. Uranyl mediated photofootprinting reveals strong E. coli RNA polymerase--DNA backbone contacts in the +10 region of the DeoP1 promoter open complex.

    PubMed Central

    Jeppesen, C; Nielsen, P E

    1989-01-01

    Employing a newly developed uranyl photofootprinting technique (Nielsen et al. (1988) FEBS Lett. 235, 122), we have analyzed the structure of the E. coli RNA polymerase deoP1 promoter open complex. The results show strong polymerase DNA backbone contacts in the -40, -10, and most notably in the +10 region. These results suggest that unwinding of the -12 to +3 region of the promoter in the open complex is mediated through polymerase DNA backbone contacts on both sides of this region. The pattern of bases that are hyperreactive towards KMnO4 or uranyl within the -12 to +3 region furthermore argues against a model in which this region is simply unwound and/or single stranded. The results indicate specific protein contacts and/or a fixed DNA conformation within the -12 to +3 region. Images PMID:2503811

  15. Characterization of human translesion DNA synthesis across a UV-induced DNA lesion

    PubMed Central

    Hedglin, Mark; Pandey, Binod; Benkovic, Stephen J

    2016-01-01

    Translesion DNA synthesis (TLS) during S-phase uses specialized TLS DNA polymerases to replicate a DNA lesion, allowing stringent DNA synthesis to resume beyond the offending damage. Human TLS involves the conjugation of ubiquitin to PCNA clamps encircling damaged DNA and the role of this post-translational modification is under scrutiny. A widely-accepted model purports that ubiquitinated PCNA recruits TLS polymerases such as pol η to sites of DNA damage where they may also displace a blocked replicative polymerase. We provide extensive quantitative evidence that the binding of pol η to PCNA and the ensuing TLS are both independent of PCNA ubiquitination. Rather, the unique properties of pols η and δ are attuned to promote an efficient and passive exchange of polymerases during TLS on the lagging strand. DOI: http://dx.doi.org/10.7554/eLife.19788.001 PMID:27770570

  16. Replication of pea enation mosaic virus RNA in isolated pea nuclei

    PubMed Central

    Powell, C. A.; Zoeten, G. A. de

    1977-01-01

    Isolated nuclei from healthy pea plants were primed with pea enation mosaic virus (PEMV), southern bean mosaic virus (SBMV), radish mosaic virus (RdMV), tobacco mosaic virus (TMV), PEMV RNA, SBMV RNA, RdMV RNA, or TMV RNA. RNA replication occurred only with PEMV RNA and not with intact PEMV or any of the other viruses or RNAs, as judged by ensuing actinomycin D-insensitive polymerase activity. Molecular hybridization experiments showed that some of the product of the polymerase was PEMV-specific (-)RNA. The substrate and ionic requirements of this polymerase were the same as those for the RNA-dependent RNA polymerase present in nuclei isolated from PEMV-infected pea plants. No virus particles could be recovered from nuclei primed with PEMV RNA. These results are discussed in relation to the possible mechanism for in vivo infection of pea cells. PMID:16592421

  17. Characterization of an Avipoxvirus From a Bald Eagle ( Haliaeetus leucocephalus ) Using Novel Consensus PCR Protocols for the rpo147 and DNA-Dependent DNA Polymerase Genes.

    PubMed

    Stephen, Alexa A; Leone, Angelique M; Toplon, David E; Archer, Linda L; Wellehan, James F X

    2016-12-01

    A juvenile female bald eagle ( Haliaeetus leucocephalus ) was presented with emaciation and proliferative periocular lesions. The eagle did not respond to supportive therapy and was euthanatized. Histopathologic examination of the skin lesions revealed plaques of marked epidermal hyperplasia parakeratosis, marked acanthosis and spongiosis, and eosinophilic intracytoplasmic inclusion bodies. Novel polymerase chain reaction (PCR) assays were done to amplify and sequence DNA polymerase and rpo147 genes. The 4b gene was also analyzed by a previously developed assay. Bayesian and maximum likelihood phylogenetic analyses of the obtained sequences found it to be poxvirus of the genus Avipoxvirus and clustered with other raptor isolates. Better phylogenetic resolution was found in rpo147 rather than the commonly used DNA polymerase. The novel consensus rpo147 PCR assay will create more accurate phylogenic trees and allow better insight into poxvirus history.

  18. A Mechanistic Model for Cooperative Behavior of Co-transcribing RNA Polymerases

    PubMed Central

    Heberling, Tamra; Davis, Lisa; Gedeon, Jakub; Morgan, Charles; Gedeon, Tomáš

    2016-01-01

    In fast-transcribing prokaryotic genes, such as an rrn gene in Escherichia coli, many RNA polymerases (RNAPs) transcribe the DNA simultaneously. Active elongation of RNAPs is often interrupted by pauses, which has been observed to cause RNAP traffic jams; yet some studies indicate that elongation seems to be faster in the presence of multiple RNAPs than elongation by a single RNAP. We propose that an interaction between RNAPs via the torque produced by RNAP motion on helically twisted DNA can explain this apparent paradox. We have incorporated the torque mechanism into a stochastic model and simulated transcription both with and without torque. Simulation results illustrate that the torque causes shorter pause durations and fewer collisions between polymerases. Our results suggest that the torsional interaction of RNAPs is an important mechanism in maintaining fast transcription times, and that transcription should be viewed as a cooperative group effort by multiple polymerases. PMID:27517607

  19. Recombinase polymerase amplification: Emergence as a critical molecular technology for rapid, low-resource diagnostics.

    PubMed

    James, Ameh; Macdonald, Joanne

    2015-01-01

    Isothermal molecular diagnostics are bridging the technology gap between traditional diagnostics and polymerase chain reaction-based methods. These new techniques enable timely and accurate testing, especially in settings where there is a lack of infrastructure to support polymerase chain reaction facilities. Despite this, there is a significant lack of uptake of these technologies in developing countries where they are highly needed. Among these novel isothermal technologies, recombinase polymerase amplification (RPA) holds particular potential for use in developing countries. This rapid nucleic acid amplification approach is fast, highly sensitive and specific, and amenable to countries with a high burden of infectious diseases. Implementation of RPA technology in developing countries is critically required to assess limitations and potentials of the diagnosis of infectious disease, and may help identify impediments that prevent adoption of new molecular technologies in low resource- and low skill settings. This review focuses on approaching diagnosis of infectious disease with RPA.

  20. Biological Characterization of Novel Inhibitors of the Gram-Positive DNA Polymerase IIIC Enzyme

    PubMed Central

    Kuhl, Alexander; Svenstrup, Niels; Ladel, Christoph; Otteneder, Michael; Binas, Annegret; Schiffer, Guido; Brands, Michael; Lampe, Thomas; Ziegelbauer, Karl; Rübsamen-Waigmann, Helga; Haebich, Dieter; Ehlert, Kerstin

    2005-01-01

    Novel N-3-alkylated 6-anilinouracils have been identified as potent and selective inhibitors of bacterial DNA polymerase IIIC, the enzyme essential for the replication of chromosomal DNA in gram-positive bacteria. A nonradioactive assay measuring the enzymatic activity of the DNA polymerase IIIC in gram-positive bacteria has been assembled. The 6-anilinouracils described inhibited the polymerase IIIC enzyme at concentrations in the nanomolar range in this assay and displayed good in vitro activity (according to their MICs) against staphylococci, streptococci, and enterococci. The MICs of the most potent derivatives were about 4 μg/ml for this panel of bacteria. The 50% effective dose of the best compound (6-[(3-ethyl-4-methylphenyl)amino]-3-{[1-(isoxazol-5-ylcarbonyl)piperidin-4-yl]methyl}uracil) was 10 mg/kg of body weight after intravenous application in a staphylococcal sepsis model in mice, from which in vivo pharmacokinetic data were also acquired. PMID:15728893

  1. Role of a GAG Hinge in the Nucleotide-induced Conformational Change Governing Nucleotide Specificity by T7 DNA Polymerase*

    PubMed Central

    Jin, Zhinan; Johnson, Kenneth A.

    2011-01-01

    A nucleotide-induced change in DNA polymerase structure governs the kinetics of polymerization by high fidelity DNA polymerases. Mutation of a GAG hinge (G542A/G544A) in T7 DNA polymerase resulted in a 1000-fold slower rate of conformational change, which then limited the rate of correct nucleotide incorporation. Rates of misincorporation were comparable to that seen for wild-type enzyme so that the net effect of the mutation was a large decrease in fidelity. We demonstrate that a presumably modest change from glycine to alanine 20 Å from the active site can severely restrict the flexibility of the enzyme structure needed to recognize and incorporate correct substrates with high specificity. These results emphasize the importance of the substrate-induced conformational change in governing nucleotide selectivity by accelerating the incorporation of correct base pairs but not mismatches. PMID:20978284

  2. Dynamics of Leading-strand Lesion Skipping by the Replisome

    PubMed Central

    Yeeles, Joseph T.P.; Marians, Kenneth J.

    2013-01-01

    SUMMARY The E. coli replisome stalls transiently when it encounters a lesion in the leading-strand template, skipping over the damage by reinitiating replication at a new primer synthesized downstream by the primase. We report here that template unwinding and lagging-strand synthesis continue downstream of the lesion at a reduced rate after replisome stalling, that one replisome is capable of skipping multiple lesions, and that the rate limiting steps of replication restart involve the synthesis and activation of the new primer downstream. We also find little support for the concept that polymerase uncoupling, where extensive lagging-strand synthesis proceeds downstream in the absence of leading-strand synthesis, involves physical separation of the leading-strand polymerase from the replisome. Instead, our data indicate that extensive uncoupled replication likely results from a failure of the leading-strand polymerase still associated with the DNA helicase and the lagging-strand polymerase that are proceeding downstream to reinitiate synthesis. PMID:24268579

  3. The use of real-time polymerase chain reaction for rapid diagnosis of skeletal tuberculosis.

    PubMed

    Kobayashi, Naomi; Fraser, Thomas G; Bauer, Thomas W; Joyce, Michael J; Hall, Gerri S; Tuohy, Marion J; Procop, Gary W

    2006-07-01

    We identified Mycobacterium tuberculosis DNA using real-time polymerase chain reaction on a specimen from an osteolytic lesion of a femoral condyle, in which the frozen section demonstrated granulomas. The process was much more rapid than is possible with culture. The rapid detection of M tuberculosis and the concomitant exclusion of granulomatous disease caused by nontuberculous mycobacteria or systemic fungi are necessary to appropriately treat skeletal tuberculosis. The detection and identification of M tuberculosis by culture may require several weeks using traditional methods. The real-time polymerase chain reaction method used has been shown to be rapid and reliable, and is able to detect and differentiate both tuberculous and nontuberculous mycobacteria. Real-time polymerase chain reaction may become a diagnostic standard for the evaluation of clinical specimens for the presence of mycobacteria; this case demonstrates the potential utility of this assay for the rapid diagnosis of skeletal tuberculosis.

  4. Integrating T7 RNA Polymerase and Its Cognate Transcriptional Units for a Host-Independent and Stable Expression System in Single Plasmid.

    PubMed

    Liang, Xiao; Li, Chenmeng; Wang, Wenya; Li, Qiang

    2018-05-18

    Metabolic engineering and synthetic biology usually require universal expression systems for stable and efficient gene expression in various organisms. In this study, a host-independent and stable T7 expression system had been developed by integrating T7 RNA polymerase and its cognate transcriptional units in single plasmid. The expression of T7 RNA polymerase was restricted below its lethal threshold using a T7 RNA polymerase antisense gene cassette, which allowed long periods of cultivation and protein production. In addition, by designing ribosome binding sites, we further tuned the expression capacity of this novel T7 system within a wide range. This host-independent expression system efficiently expressed genes in five different Gram-negative strains and one Gram-positive strain and was also shown to be applicable in a real industrial d- p-hydroxyphenylglycine production system.

  5. Massively parallel polymerase cloning and genome sequencing of single cells using nanoliter microwells

    PubMed Central

    Gole, Jeff; Gore, Athurva; Richards, Andrew; Chiu, Yu-Jui; Fung, Ho-Lim; Bushman, Diane; Chiang, Hsin-I; Chun, Jerold; Lo, Yu-Hwa; Zhang, Kun

    2013-01-01

    Genome sequencing of single cells has a variety of applications, including characterizing difficult-to-culture microorganisms and identifying somatic mutations in single cells from mammalian tissues. A major hurdle in this process is the bias in amplifying the genetic material from a single cell, a procedure known as polymerase cloning. Here we describe the microwell displacement amplification system (MIDAS), a massively parallel polymerase cloning method in which single cells are randomly distributed into hundreds to thousands of nanoliter wells and simultaneously amplified for shotgun sequencing. MIDAS reduces amplification bias because polymerase cloning occurs in physically separated nanoliter-scale reactors, facilitating the de novo assembly of near-complete microbial genomes from single E. coli cells. In addition, MIDAS allowed us to detect single-copy number changes in primary human adult neurons at 1–2 Mb resolution. MIDAS will further the characterization of genomic diversity in many heterogeneous cell populations. PMID:24213699

  6. Recombinase polymerase amplification-based assay to diagnose Giardia in stool samples.

    PubMed

    Crannell, Zachary Austin; Cabada, Miguel Mauricio; Castellanos-Gonzalez, Alejandro; Irani, Ayesha; White, Arthur Clinton; Richards-Kortum, Rebecca

    2015-03-01

    Giardia duodenalis is one of the most commonly identified parasites in stool samples. Although relatively easy to treat, giardiasis can be difficult to detect as it presents similar to other diarrheal diseases. Here, we present a recombinase polymerase amplification-based Giardia (RPAG) assay to detect the presence of Giardia in stool samples. The RPAG assay was characterized on the bench top using stool samples spiked with Giardia cysts where it showed a limit-of-detection nearly as low as the gold standard polymerase chain reaction assay. The RPAG assay was then tested in the highlands of Peru on 104 stool samples collected from the surrounding communities where it showed 73% sensitivity and 95% specificity against a polymerase chain reaction and microscopy composite gold standard. Further improvements in clinical sensitivity will be needed for the RPAG assay to have clinical relevance. © The American Society of Tropical Medicine and Hygiene.

  7. Recombinase Polymerase Amplification-Based Assay to Diagnose Giardia in Stool Samples

    PubMed Central

    Crannell, Zachary Austin; Cabada, Miguel Mauricio; Castellanos-Gonzalez, Alejandro; Irani, Ayesha; White, Arthur Clinton; Richards-Kortum, Rebecca

    2015-01-01

    Giardia duodenalis is one of the most commonly identified parasites in stool samples. Although relatively easy to treat, giardiasis can be difficult to detect as it presents similar to other diarrheal diseases. Here, we present a recombinase polymerase amplification-based Giardia (RPAG) assay to detect the presence of Giardia in stool samples. The RPAG assay was characterized on the bench top using stool samples spiked with Giardia cysts where it showed a limit-of-detection nearly as low as the gold standard polymerase chain reaction assay. The RPAG assay was then tested in the highlands of Peru on 104 stool samples collected from the surrounding communities where it showed 73% sensitivity and 95% specificity against a polymerase chain reaction and microscopy composite gold standard. Further improvements in clinical sensitivity will be needed for the RPAG assay to have clinical relevance. PMID:25510713

  8. RNA primer–primase complexes serve as the signal for polymerase recycling and Okazaki fragment initiation in T4 phage DNA replication

    PubMed Central

    Spiering, Michelle M.; Hanoian, Philip; Gannavaram, Swathi; Benkovic, Stephen J.

    2017-01-01

    The opposite strand polarity of duplex DNA necessitates that the leading strand is replicated continuously whereas the lagging strand is replicated in discrete segments known as Okazaki fragments. The lagging-strand polymerase sometimes recycles to begin the synthesis of a new Okazaki fragment before finishing the previous fragment, creating a gap between the Okazaki fragments. The mechanism and signal that initiate this behavior—that is, the signaling mechanism—have not been definitively identified. We examined the role of RNA primer–primase complexes left on the lagging ssDNA from primer synthesis in initiating early lagging-strand polymerase recycling. We show for the T4 bacteriophage DNA replication system that primer–primase complexes have a residence time similar to the timescale of Okazaki fragment synthesis and the ability to block a holoenzyme synthesizing DNA and stimulate the dissociation of the holoenzyme to trigger polymerase recycling. The collision with primer–primase complexes triggering the early termination of Okazaki fragment synthesis has distinct advantages over those previously proposed because this signal requires no transmission to the lagging-strand polymerase through protein or DNA interactions, the mechanism for rapid dissociation of the holoenzyme is always collision, and no unique characteristics need to be assigned to either identical polymerase in the replisome. We have modeled repeated cycles of Okazaki fragment initiation using a collision with a completed Okazaki fragment or primer–primase complexes as the recycling mechanism. The results reproduce experimental data, providing insights into events related to Okazaki fragment initiation and the overall functioning of DNA replisomes. PMID:28507156

  9. RNA polymerases react differently at d(ApG) and d(GpG) adducts in DNA modified by cis-diamminedichloroplatinum(II)

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Corda, Y.; Job, D.; Anin, M.F.

    1992-02-25

    Two duplexes (20-mers) were constructed containing either a single cis-(Pt(NH{sub 3}){sub 2}(d(GpG))) or cis-(Pt(NH{sub 3}){sub 2}(d(ApG))) intrastrand cross-link, the major DNA adducts of the antitumor drug cis-diamminedichloroplatinum(II). These synthetic duplexes were multimerized and the resultant polymers used as templates in single-step addition reactions of condensation of a single nucleoside triphosphate substrate to a dinucleotide primer (abortive elongation reaction) catalyzed by prokaryotic or eukaryotic RNA polymerases. Primer-substrate combinations were selected so as to direct trinucleotide product formation within the platinated bases of the templates. Transcription experiments established that cis-DDP-DNA adducts formed at d(ApG) or d(GpG) sites are not an absolute blockmore » to formation of a single phosphodiester bond by either Escherichia coli RNA polymerase or wheat germ RNA polymerase II. Furthermore, the kinetic data indicate that single-step addition reactions are much more impeded at the platinated d(GpG) than at the platinated d(ApG) site and that the mechanisms of inhibition of RNA polymerase activity are different at the two platinated sites. In particular, binding affinity between E. coli RNA polymerase and the d(GpG)-containing platinated template is lowered, as the apparent K{sub m} of enzyme for the platinated polymer is increased by a factor of 4-5. These results are discussed in reaction to the distortions induced in DNA by the two adducts.« less

  10. Roles of Saccharomyces cerevisiae DNA polymerases Polη and Polζ in response to irradiation by simulated sunlight

    PubMed Central

    Kozmin, Stanislav G.; Pavlov, Youri I.; Kunkel, Thomas A.; Sage, Evelyne

    2003-01-01

    Sunlight causes lesions in DNA that if unrepaired and inaccurately replicated by DNA polymerases yield mutations that result in skin cancer in humans. Two enzymes involved in translesion synthesis (TLS) of UV-induced photolesions are DNA polymerase η (Polη) and polymerase ζ (Polζ), encoded by the RAD30A and REV3 genes, respectively. Previous studies have investigated the TLS roles of these polymerases in human and yeast cells irradiated with monochromatic, short wavelength UVC radiation (254 nm). However, less is known about cellular responses to solar radiation, which is of higher and mixed wavelengths (310–1100 nm) and produces a different spectrum of DNA lesions, including Dewar photoproducts and oxidative lesions. Here we report on the comparative cytotoxic and mutagenic effects of simulated sunlight (SSL) and UVC radiation on yeast wild-type, rad30Δ, rev3Δ and rev3Δ rad30Δ strains. The results with SSL support several previous interpretations on the roles of these two polymerases in TLS of photodimers and (6–4) photoproducts derived from studies with UVC. They further suggest that Polη participates in the non-mutagenic bypass of SSL-dependent cytosine-containing Dewar photoproducts and 8-oxoguanine, while Polζ is mainly responsible for the mutagenic bypass of all types of Dewar photoproducts. They also suggest that in the absence of Polζ, Polη contributes to UVC- and SSL-induced mutagenesis, possibly by the bypass of photodimers containing deaminated cytosine. PMID:12888515

  11. Probing the interaction of archaeal DNA polymerases with deaminated bases using X-ray crystallography and non-hydrogen bonding isosteric base analogues.

    PubMed

    Killelea, Tom; Ghosh, Samantak; Tan, Samuel S; Heslop, Pauline; Firbank, Susan J; Kool, Eric T; Connolly, Bernard A

    2010-07-13

    Archaeal family-B DNA polymerases stall replication on encountering the pro-mutagenic bases uracil and hypoxanthine. This publication describes an X-ray crystal structure of Thermococcus gorgonarius polymerase in complex with a DNA containing hypoxanthine in the single-stranded region of the template, two bases ahead of the primer-template junction. Full details of the specific recognition of hypoxanthine are revealed, allowing a comparison with published data that describe uracil binding. The two bases are recognized by the same pocket, in the N-terminal domain, and make very similar protein-DNA interactions. Specificity for hypoxanthine (and uracil) arises from a combination of polymerase-base hydrogen bonds and shape fit between the deaminated bases and the pocket. The structure with hypoxanthine at position 2 explains the stimulation of the polymerase 3'-5' proofreading exonuclease, observed with deaminated bases at this location. A beta-hairpin element, involved in partitioning the primer strand between the polymerase and exonuclease active sites, inserts between the two template bases at the extreme end of the double-stranded DNA. This denatures the two complementary primer bases and directs the resulting 3' single-stranded extension toward the exonuclease active site. Finally, the relative importance of hydrogen bonding and shape fit in determining selectivity for deaminated bases has been examined using nonpolar isosteres. Affinity for both 2,4-difluorobenzene and fluorobenzimidazole, non-hydrogen bonding shape mimics of uracil and hypoxanthine, respectively, is strongly diminished, suggesting polar protein-base contacts are important. However, residual interaction with 2,4-difluorobenzene is seen, confirming a role for shape recognition.

  12. RNA primer-primase complexes serve as the signal for polymerase recycling and Okazaki fragment initiation in T4 phage DNA replication.

    PubMed

    Spiering, Michelle M; Hanoian, Philip; Gannavaram, Swathi; Benkovic, Stephen J

    2017-05-30

    The opposite strand polarity of duplex DNA necessitates that the leading strand is replicated continuously whereas the lagging strand is replicated in discrete segments known as Okazaki fragments. The lagging-strand polymerase sometimes recycles to begin the synthesis of a new Okazaki fragment before finishing the previous fragment, creating a gap between the Okazaki fragments. The mechanism and signal that initiate this behavior-that is, the signaling mechanism-have not been definitively identified. We examined the role of RNA primer-primase complexes left on the lagging ssDNA from primer synthesis in initiating early lagging-strand polymerase recycling. We show for the T4 bacteriophage DNA replication system that primer-primase complexes have a residence time similar to the timescale of Okazaki fragment synthesis and the ability to block a holoenzyme synthesizing DNA and stimulate the dissociation of the holoenzyme to trigger polymerase recycling. The collision with primer-primase complexes triggering the early termination of Okazaki fragment synthesis has distinct advantages over those previously proposed because this signal requires no transmission to the lagging-strand polymerase through protein or DNA interactions, the mechanism for rapid dissociation of the holoenzyme is always collision, and no unique characteristics need to be assigned to either identical polymerase in the replisome. We have modeled repeated cycles of Okazaki fragment initiation using a collision with a completed Okazaki fragment or primer-primase complexes as the recycling mechanism. The results reproduce experimental data, providing insights into events related to Okazaki fragment initiation and the overall functioning of DNA replisomes.

  13. Vault-poly-ADP-ribose polymerase in the Octopus vulgaris brain: a regulatory factor of actin polymerization dynamic.

    PubMed

    De Maio, Anna; Natale, Emiliana; Rotondo, Sergio; Di Cosmo, Anna; Faraone-Mennella, Maria Rosaria

    2013-09-01

    Our previous behavioural, biochemical and immunohistochemical analyses conducted in selected regions (supra/sub oesophageal masses) of the Octopus vulgaris brain detected a cytoplasmic poly-ADP-ribose polymerase (more than 90% of total enzyme activity). The protein was identified as the vault-free form of vault-poly-ADP-ribose polymerase. The present research extends and integrates the biochemical characterization of poly-ADP-ribosylation system, namely, reaction product, i.e., poly-ADP-ribose, and acceptor proteins, in the O. vulgaris brain. Immunochemical analyses evidenced that the sole poly-ADP-ribose acceptor was the octopus cytoskeleton 50-kDa actin. It was present in both free, endogenously poly-ADP-ribosylated form (70kDa) and in complex with V-poly-ADP-ribose polymerase and poly-ADP-ribose (260kDa). The components of this complex, alkali and high salt sensitive, were purified and characterized. The kind and the length of poly-ADP-ribose corresponded to linear chains of 30-35 ADP-ribose units, in accordance with the features of the polymer synthesized by the known vault-poly-ADP-ribose polymerase. In vitro experiments showed that V-poly-ADP-ribose polymerase activity of brain cytoplasmic fraction containing endogenous actin increased upon the addition of commercial actin and was highly reduced by ATP. Anti-actin immunoblot of the mixture in the presence and absence of ATP showed that the poly-ADP-ribosylation of octopus actin is a dynamic process balanced by the ATP-dependent polymerization of the cytoskeleton protein, a fundamental mechanism for synaptic plasticity. © 2013 Elsevier Inc. All rights reserved.

  14. Real-time single-molecule electronic DNA sequencing by synthesis using polymer-tagged nucleotides on a nanopore array

    PubMed Central

    Fuller, Carl W.; Kumar, Shiv; Porel, Mintu; Chien, Minchen; Bibillo, Arek; Stranges, P. Benjamin; Dorwart, Michael; Tao, Chuanjuan; Li, Zengmin; Guo, Wenjing; Shi, Shundi; Korenblum, Daniel; Trans, Andrew; Aguirre, Anne; Liu, Edward; Harada, Eric T.; Pollard, James; Bhat, Ashwini; Cech, Cynthia; Yang, Alexander; Arnold, Cleoma; Palla, Mirkó; Hovis, Jennifer; Chen, Roger; Morozova, Irina; Kalachikov, Sergey; Russo, James J.; Kasianowicz, John J.; Davis, Randy; Roever, Stefan; Church, George M.; Ju, Jingyue

    2016-01-01

    DNA sequencing by synthesis (SBS) offers a robust platform to decipher nucleic acid sequences. Recently, we reported a single-molecule nanopore-based SBS strategy that accurately distinguishes four bases by electronically detecting and differentiating four different polymer tags attached to the 5′-phosphate of the nucleotides during their incorporation into a growing DNA strand catalyzed by DNA polymerase. Further developing this approach, we report here the use of nucleotides tagged at the terminal phosphate with oligonucleotide-based polymers to perform nanopore SBS on an α-hemolysin nanopore array platform. We designed and synthesized several polymer-tagged nucleotides using tags that produce different electrical current blockade levels and verified they are active substrates for DNA polymerase. A highly processive DNA polymerase was conjugated to the nanopore, and the conjugates were complexed with primer/template DNA and inserted into lipid bilayers over individually addressable electrodes of the nanopore chip. When an incoming complementary-tagged nucleotide forms a tight ternary complex with the primer/template and polymerase, the tag enters the pore, and the current blockade level is measured. The levels displayed by the four nucleotides tagged with four different polymers captured in the nanopore in such ternary complexes were clearly distinguishable and sequence-specific, enabling continuous sequence determination during the polymerase reaction. Thus, real-time single-molecule electronic DNA sequencing data with single-base resolution were obtained. The use of these polymer-tagged nucleotides, combined with polymerase tethering to nanopores and multiplexed nanopore sensors, should lead to new high-throughput sequencing methods. PMID:27091962

  15. A computational approach for predicting off-target toxicity of antiviral ribonucleoside analogues to mitochondrial RNA polymerase.

    PubMed

    Freedman, Holly; Winter, Philip; Tuszynski, Jack; Tyrrell, D Lorne; Houghton, Michael

    2018-06-22

    In the development of antiviral drugs that target viral RNA-dependent RNA polymerases, off-target toxicity caused by the inhibition of the human mitochondrial RNA polymerase (POLRMT) is a major liability. Therefore, it is essential that all new ribonucleoside analogue drugs be accurately screened for POLRMT inhibition. A computational tool that can accurately predict NTP binding to POLRMT could assist in evaluating any potential toxicity and in designing possible salvaging strategies. Using the available crystal structure of POLRMT bound to an RNA transcript, here we created a model of POLRMT with an NTP molecule bound in the active site. Furthermore, we implemented a computational screening procedure that determines the relative binding free energy of an NTP analogue to POLRMT by free energy perturbation (FEP), i.e. a simulation in which the natural NTP molecule is slowly transformed into the analogue and back. In each direction, the transformation was performed over 40 ns of simulation on our IBM Blue Gene Q supercomputer. This procedure was validated across a panel of drugs for which experimental dissociation constants were available, showing that NTP relative binding free energies could be predicted to within 0.97 kcal/mol of the experimental values on average. These results demonstrate for the first time that free-energy simulation can be a useful tool for predicting binding affinities of NTP analogues to a polymerase. We expect that our model, together with similar models of viral polymerases, will be very useful in the screening and future design of NTP inhibitors of viral polymerases that have no mitochondrial toxicity. © 2018 Freedman et al.

  16. Engineered Polymerases Enable Novel Sequencing Applications (7th Annual SFAF Meeting, 2012)

    ScienceCinema

    Appel, Maryke

    2018-01-15

    Maryke Appel on "Engineered polymerases provide improved NGS library amplification and enable novel sequencing applications" at the 2012 Sequencing, Finishing, Analysis in the Future Meeting held June 5-7, 2012 in Santa Fe, New Mexico.

  17. Molecular modeling and residue interaction network studies on the mechanism of binding and resistance of the HCV NS5B polymerase mutants to VX-222 and ANA598.

    PubMed

    Xue, Weiwei; Jiao, Pingzu; Liu, Huanxiang; Yao, Xiaojun

    2014-04-01

    Hepatitis C virus (HCV) NS5B protein is an RNA-dependent RNA polymerase (RdRp) with essential functions in viral genome replication and represents a promising therapeutic target to develop direct-acting antivirals (DAAs). Multiple nonnucleoside inhibitors (NNIs) binding sites have been identified within the polymerase. VX-222 and ANA598 are two NNIs targeting thumb II site and palm I site of HCV NS5B polymerase, respectively. These two molecules have been shown to be very effective in phase II clinical trials. However, the emergence of resistant HCV replicon variants (L419M, M423T, I482L mutants to VX-222 and M414T, M414L, G554D mutants to ANA598) has significantly decreased their efficacy. To elucidate the molecular mechanism about how these mutations influenced the drug binding mode and decreased drug efficacy, we studied the binding modes of VX-222 and ANA598 to wild-type and mutant polymerase by molecular modeling approach. Molecular dynamics (MD) simulations results combined with binding free energy calculations indicated that the mutations significantly altered the binding free energy and the interaction for the drugs to polymerase. The further per-residue binding free energy decomposition analysis revealed that the mutations decreased the interactions with several key residues, such as L419, M423, L474, S476, I482, L497, for VX-222 and L384, N411, M414, Y415, Q446, S556, G557 for ANA598. These were the major origins for the resistance to these two drugs. In addition, by analyzing the residue interaction network (RIN) of the complexes between the drugs with wild-type and the mutant polymerase, we found that the mutation residues in the networks involved in the drug resistance possessed a relatively lower size of topology centralities. The shift of betweenness and closeness values of binding site residues in the mutant polymerase is relevant to the mechanism of drug resistance of VX-222 and ANA598. These results can provide an atomic-level understanding about the mechanisms of drug resistance conferred by the studied mutations and will be helpful to design more potent inhibitors which could effectively overcome drug resistance of antivirus agents. Copyright © 2014 Elsevier B.V. All rights reserved.

  18. Sequence of events in measles virus replication: role of phosphoprotein-nucleocapsid interactions.

    PubMed

    Brunel, Joanna; Chopy, Damien; Dosnon, Marion; Bloyet, Louis-Marie; Devaux, Patricia; Urzua, Erica; Cattaneo, Roberto; Longhi, Sonia; Gerlier, Denis

    2014-09-01

    The genome of nonsegmented negative-strand RNA viruses is tightly embedded within a nucleocapsid made of a nucleoprotein (N) homopolymer. To ensure processive RNA synthesis, the viral polymerase L in complex with its cofactor phosphoprotein (P) binds the nucleocapsid that constitutes the functional template. Measles virus P and N interact through two binding sites. While binding of the P amino terminus with the core of N (NCORE) prevents illegitimate encapsidation of cellular RNA, the interaction between their C-terminal domains, P(XD) and N(TAIL) is required for viral RNA synthesis. To investigate the binding dynamics between the two latter domains, the P(XD) F497 residue that makes multiple hydrophobic intramolecular interactions was mutated. Using a quantitative mammalian protein complementation assay and recombinant viruses, we found that an increase in P(XD)-to-N(TAIL) binding strength is associated with a slower transcript accumulation rate and that abolishing the interaction renders the polymerase nonfunctional. The use of a newly developed system allowing conditional expression of wild-type or mutated P genes, revealed that the loss of the P(XD)-N(TAIL) interaction results in reduced transcription by preformed transcriptases, suggesting reduced engagement on the genomic template. These intracellular data indicate that the viral polymerase entry into and progression along its genomic template relies on a protein-protein interaction that serves as a tightly controlled dynamic anchor. Mononegavirales have a unique machinery to replicate RNA. Processivity of their polymerase is only achieved when the genome template is entirely embedded into a helical homopolymer of nucleoproteins that constitutes the nucleocapsid. The polymerase binds to the nucleocapsid template through the phosphoprotein. How the polymerase complex enters and travels along the nucleocapsid template to ensure uninterrupted synthesis of up to ∼ 6,700-nucleotide messenger RNAs from six to ten consecutive genes is unknown. Using a quantitative protein complementation assay and a biGene-biSilencing system allowing conditional expression of two P genes copies, the role of the P-to-N interaction in polymerase function was further characterized. We report here a dynamic protein anchoring mechanism that differs from all other known polymerases that rely only onto a sustained and direct binding to their nucleic acid template. Copyright © 2014, American Society for Microbiology. All Rights Reserved.

  19. Kaposi's Sarcoma-Associated Herpesvirus Hijacks RNA Polymerase II To Create a Viral Transcriptional Factory

    PubMed Central

    Chen, Christopher Phillip; Lyu, Yuanzhi; Chuang, Frank; Nakano, Kazushi; Izumiya, Chie; Jin, Di; Campbell, Mel

    2017-01-01

    ABSTRACT Locally concentrated nuclear factors ensure efficient binding to DNA templates, facilitating RNA polymerase II recruitment and frequent reutilization of stable preinitiation complexes. We have uncovered a mechanism for effective viral transcription by focal assembly of RNA polymerase II around Kaposi's sarcoma-associated herpesvirus (KSHV) genomes in the host cell nucleus. Using immunofluorescence labeling of latent nuclear antigen (LANA) protein, together with fluorescence in situ RNA hybridization (RNA-FISH) of the intron region of immediate early transcripts, we visualized active transcription of viral genomes in naturally infected cells. At the single-cell level, we found that not all episomes were uniformly transcribed following reactivation stimuli. However, those episomes that were being transcribed would spontaneously aggregate to form transcriptional “factories,” which recruited a significant fraction of cellular RNA polymerase II. Focal assembly of “viral transcriptional factories” decreased the pool of cellular RNA polymerase II available for cellular gene transcription, which consequently impaired cellular gene expression globally, with the exception of selected ones. The viral transcriptional factories localized with replicating viral genomic DNAs. The observed colocalization of viral transcriptional factories with replicating viral genomic DNA suggests that KSHV assembles an “all-in-one” factory for both gene transcription and DNA replication. We propose that the assembly of RNA polymerase II around viral episomes in the nucleus may be a previously unexplored aspect of KSHV gene regulation by confiscation of a limited supply of RNA polymerase II in infected cells. IMPORTANCE B cells infected with Kaposi's sarcoma-associated herpesvirus (KSHV) harbor multiple copies of the KSHV genome in the form of episomes. Three-dimensional imaging of viral gene expression in the nucleus allows us to study interactions and changes in the physical distribution of these episomes following stimulation. The results showed heterogeneity in the responses of individual KSHV episomes to stimuli within a single reactivating cell; those episomes that did respond to stimulation, aggregated within large domains that appear to function as viral transcription factories. A significant portion of cellular RNA polymerase II was trapped in these factories and served to transcribe viral genomes, which coincided with an overall decrease in cellular gene expression. Our findings uncover a strategy of KSHV gene regulation through focal assembly of KSHV episomes and a molecular mechanism of late gene expression. PMID:28331082

  20. Polymerase chain reaction system

    DOEpatents

    Benett, William J.; Richards, James B.; Stratton, Paul L.; Hadley, Dean R.; Milanovich, Fred P.; Belgrader, Phil; Meyer, Peter L.

    2004-03-02

    A portable polymerase chain reaction DNA amplification and detection system includes one or more chamber modules. Each module supports a duplex assay of a biological sample. Each module has two parallel interrogation ports with a linear optical system. The system is capable of being handheld.

  1. Pea chloroplast DNA encodes homologues of Escherichia coli ribosomal subunit S2 and the beta'-subunit of RNA polymerase.

    PubMed Central

    Cozens, A L; Walker, J E

    1986-01-01

    The nucleotide sequence has been determined of a segment of 4680 bases of the pea chloroplast genome. It adjoins a sequence described elsewhere that encodes subunits of the F0 membrane domain of the ATP-synthase complex. The sequence contains a potential gene encoding a protein which is strongly related to the S2 polypeptide of Escherichia coli ribosomes. It also encodes an incomplete protein which contains segments that are homologous to the beta'-subunit of E. coli RNA polymerase and to yeast RNA polymerases II and III. PMID:3530249

  2. T7 RNA Polymerase Functions In Vitro without Clustering

    PubMed Central

    Finan, Kieran; Torella, Joseph P.; Kapanidis, Achillefs N.; Cook, Peter R.

    2012-01-01

    Many nucleic acid polymerases function in clusters known as factories. We investigate whether the RNA polymerase (RNAP) of phage T7 also clusters when active. Using ‘pulldowns’ and fluorescence correlation spectroscopy we find that elongation complexes do not interact in vitro with a Kd<1 µM. Chromosome conformation capture also reveals that genes located 100 kb apart on the E. coli chromosome do not associate more frequently when transcribed by T7 RNAP. We conclude that if clustering does occur in vivo, it must be driven by weak interactions, or mediated by a phage-encoded protein. PMID:22768341

  3. Detection of a putative novel adenovirus by PCR amplification, sequencing and phylogenetic characterisation of two gene fragments from formalin-fixed paraffin-embedded tissues of a cat diagnosed with disseminated adenovirus disease.

    PubMed

    Lakatos, Béla; Hornyák, Ákos; Demeter, Zoltán; Forgách, Petra; Kennedy, Frances; Rusvai, Miklós

    2017-12-01

    Adenoviral nucleic acid was detected by polymerase chain reaction (PCR) in formalin-fixed paraffin-embedded tissue samples of a cat that had suffered from disseminated adenovirus infection. The identity of the amplified products from the hexon and DNA-dependent DNA polymerase genes was confirmed by DNA sequencing. The sequences were clearly distinguishable from corresponding hexon and polymerase sequences of other mastadenoviruses, including human adenoviruses. These results suggest the possible existence of a distinct feline adenovirus.

  4. Full-Genome Sequence of a Reassortant H1N2 Influenza A Virus Isolated from Pigs in Brazil.

    PubMed

    Schmidt, Candice; Cibulski, Samuel Paulo; Muterle Varela, Ana Paula; Mengue Scheffer, Camila; Wendlant, Adrieli; Quoos Mayer, Fabiana; Lopes de Almeida, Laura; Franco, Ana Cláudia; Roehe, Paulo Michel

    2014-12-18

    In this study, the full-genome sequence of a reassortant H1N2 swine influenza virus is reported. The isolate has the hemagglutinin (HA) and neuraminidase (NA) genes from human lineage (H1-δ cluster and N2), and the internal genes (polymerase basic 1 [PB1], polymerase basic 2 [PB2], polymerase acidic [PA], nucleoprotein [NP], matrix [M], and nonstructural [NS]) are derived from human 2009 pandemic H1N1 (H1N1pdm09) virus. Copyright © 2014 Schmidt et al.

  5. Time-lapse crystallography snapshots of a double-strand break repair polymerase in action.

    PubMed

    Jamsen, Joonas A; Beard, William A; Pedersen, Lars C; Shock, David D; Moon, Andrea F; Krahn, Juno M; Bebenek, Katarzyna; Kunkel, Thomas A; Wilson, Samuel H

    2017-08-15

    DNA polymerase (pol) μ is a DNA-dependent polymerase that incorporates nucleotides during gap-filling synthesis in the non-homologous end-joining pathway of double-strand break repair. Here we report time-lapse X-ray crystallography snapshots of catalytic events during gap-filling DNA synthesis by pol μ. Unique catalytic intermediates and active site conformational changes that underlie catalysis are uncovered, and a transient third (product) metal ion is observed in the product state. The product manganese coordinates phosphate oxygens of the inserted nucleotide and PP i . The product metal is not observed during DNA synthesis in the presence of magnesium. Kinetic analyses indicate that manganese increases the rate constant for deoxynucleoside 5'-triphosphate insertion compared to magnesium. The likely product stabilization role of the manganese product metal in pol μ is discussed. These observations provide insight on structural attributes of this X-family double-strand break repair polymerase that impact its biological function in genome maintenance.DNA polymerase (pol) μ functions in DNA double-strand break repair. Here the authors use time-lapse X-ray crystallography to capture the states of pol µ during the conversion from pre-catalytic to product complex and observe a third transiently bound metal ion in the product state.

  6. Kinetics of Mismatch Formation opposite Lesions by the Replicative DNA Polymerase from Bacteriophage RB69

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Hogg, Matthew; Rudnicki, Jean; Midkiff, John

    2010-04-12

    The fidelity of DNA replication is under constant threat from the formation of lesions within the genome. Oxidation of DNA bases leads to the formation of altered DNA bases such as 8-oxo-7,8-dihydroguanine, commonly called 8-oxoG, and 2-hydroxyadenenine, or 2-OHA. In this work we have examined the incorporation kinetics opposite these two oxidatively derived lesions as well as an abasic site analogue by the replicative DNA polymerase from bacteriophage RB69. We compared the kinetic parameters for both wild type and the low fidelity L561A variant. While nucleotide incorporation rates (k{sub pol}) were generally higher for the variant, the presence of amore » lesion in the templating position reduced the ability of both the wild-type and variant DNA polymerases to form ternary enzyme-DNA-dNTP complexes. Thus, the L561A substitution does not significantly affect the ability of the RB69 DNA polymerase to recognize damaged DNA; instead, the mutation increases the probability that nucleotide incorporation will occur. We have also solved the crystal structure of the L561A variant forming an 8-oxoG {center_dot} dATP mispair and show that the propensity for forming this mispair depends on an enlarged polymerase active site.« less

  7. Activation mechanism of a noncanonical RNA-dependent RNA polymerase.

    PubMed

    Garriga, Damià; Navarro, Aitor; Querol-Audí, Jordi; Abaitua, Fernando; Rodríguez, José F; Verdaguer, Núria

    2007-12-18

    Two lineages of viral RNA-dependent RNA polymerases (RDRPs) differing in the organization (canonical vs. noncanonical) of the palm subdomain have been identified. Phylogenetic analyses indicate that both lineages diverged at a very early stage of the evolution of the enzyme [Gorbalenya AE, Pringle FM, Zeddam JL, Luke BT, Cameron CE, Kalmakoff J, Hanzlik TN, Gordon KH, Ward VK (2002) J Mol Biol 324:47-62]. Here, we report the x-ray structure of a noncanonical birnaviral RDRP, named VP1, in its free form, bound to Mg(2+) ions, and bound to a peptide representing the polymerase-binding motif of the regulatory viral protein VP3. The structure of VP1 reveals that the noncanonical connectivity of the palm subdomain maintains the geometry of the catalytic residues found in canonical polymerases but results in a partial blocking of the active site cavity. The VP1-VP3 peptide complex shows a mode of polymerase activation in which VP3 binding promotes a conformational change that removes the steric blockade of the VP1 active site, facilitating the accommodation of the template and incoming nucleotides for catalysis. The striking structural similarities between birnavirus (dsRNA) and the positive-stranded RNA picornavirus and calicivirus RDRPs provide evidence supporting the existence of functional and evolutionary relationships between these two virus groups.

  8. Design and characterization of a nanopore-coupled polymerase for single-molecule DNA sequencing by synthesis on an electrode array

    PubMed Central

    Stranges, P. Benjamin; Palla, Mirkó; Kalachikov, Sergey; Nivala, Jeff; Dorwart, Michael; Trans, Andrew; Kumar, Shiv; Porel, Mintu; Chien, Minchen; Tao, Chuanjuan; Morozova, Irina; Li, Zengmin; Shi, Shundi; Aberra, Aman; Arnold, Cleoma; Yang, Alexander; Aguirre, Anne; Harada, Eric T.; Korenblum, Daniel; Pollard, James; Bhat, Ashwini; Gremyachinskiy, Dmitriy; Bibillo, Arek; Chen, Roger; Davis, Randy; Russo, James J.; Fuller, Carl W.; Roever, Stefan; Ju, Jingyue; Church, George M.

    2016-01-01

    Scalable, high-throughput DNA sequencing is a prerequisite for precision medicine and biomedical research. Recently, we presented a nanopore-based sequencing-by-synthesis (Nanopore-SBS) approach, which used a set of nucleotides with polymer tags that allow discrimination of the nucleotides in a biological nanopore. Here, we designed and covalently coupled a DNA polymerase to an α-hemolysin (αHL) heptamer using the SpyCatcher/SpyTag conjugation approach. These porin–polymerase conjugates were inserted into lipid bilayers on a complementary metal oxide semiconductor (CMOS)-based electrode array for high-throughput electrical recording of DNA synthesis. The designed nanopore construct successfully detected the capture of tagged nucleotides complementary to a DNA base on a provided template. We measured over 200 tagged-nucleotide signals for each of the four bases and developed a classification method to uniquely distinguish them from each other and background signals. The probability of falsely identifying a background event as a true capture event was less than 1.2%. In the presence of all four tagged nucleotides, we observed sequential additions in real time during polymerase-catalyzed DNA synthesis. Single-polymerase coupling to a nanopore, in combination with the Nanopore-SBS approach, can provide the foundation for a low-cost, single-molecule, electronic DNA-sequencing platform. PMID:27729524

  9. Inhibition of host cell RNA polymerase III-mediated transcription by poliovirus: Inactivation of specific transcription factors

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Fradkin, L.G.; Yoshinaga, S.K.; Berk, A.J.

    1987-11-01

    The inhibition of transcription by RNA polymerase III in poliovirus-infected cells was studied. Experiments utilizing two different cell lines showed that the initiation step of transcription by RNA polymerase III was impaired by infection of these cells with the virus. The observed inhibition of transcription was not due to shut-off of host cell protein synthesis by poliovirus. Among four distinct components required for accurate transcription in vitro from cloned DNA templates, activities of RNA polymerase III and transcription factor TFIIIA were not significantly affected by virus infection. The activity of transcription factor TFIIIC, the limiting component required for transcription ofmore » RNA polymerase III genes, was severely inhibited in infected cells, whereas that of transcription factor TFIIIB was inhibited to a lesser extent. The sequence-specific DNA-binding of TFIIIC to the adenovirus VA1 gene internal promoted, however, was not altered by infection of cells with the virus. The authors conclude that (i) at least two transcription factors, TFIIIB and TFIIIC, are inhibited by infection of cells with poliovirtus, (ii) inactivation of TFIIIC does not involve destruction of its DNA-binding domain, and (iii) sequence-specific DNA binding by TFIIIC may be necessary but is not sufficient for the formation of productive transcription complexes.« less

  10. Continuous in vitro evolution of bacteriophage RNA polymerase promoters

    NASA Technical Reports Server (NTRS)

    Breaker, R. R.; Banerji, A.; Joyce, G. F.

    1994-01-01

    Rapid in vitro evolution of bacteriophage T7, T3, and SP6 RNA polymerase promoters was achieved by a method that allows continuous enrichment of DNAs that contain functional promoter elements. This method exploits the ability of a special class of nucleic acid molecules to replicate continuously in the presence of both a reverse transcriptase and a DNA-dependent RNA polymerase. Replication involves the synthesis of both RNA and cDNA intermediates. The cDNA strand contains an embedded promoter sequence, which becomes converted to a functional double-stranded promoter element, leading to the production of RNA transcripts. Synthetic cDNAs, including those that contain randomized promoter sequences, can be used to initiate the amplification cycle. However, only those cDNAs that contain functional promoter sequences are able to produce RNA transcripts. Furthermore, each RNA transcript encodes the RNA polymerase promoter sequence that was responsible for initiation of its own transcription. Thus, the population of amplifying molecules quickly becomes enriched for those templates that encode functional promoters. Optimal promoter sequences for phage T7, T3, and SP6 RNA polymerase were identified after a 2-h amplification reaction, initiated in each case with a pool of synthetic cDNAs encoding greater than 10(10) promoter sequence variants.

  11. Amino acid substitutions affecting aspartic acid 605 and valine 606 decrease the interaction strength between the influenza virus RNA polymerase PB2 '627' domain and the viral nucleoprotein.

    PubMed

    Hsia, Ho-Pan; Yang, Yin-Hua; Szeto, Wun-Chung; Nilsson, Benjamin E; Lo, Chun-Yeung; Ng, Andy Ka-Leung; Fodor, Ervin; Shaw, Pang-Chui

    2018-01-01

    The influenza virus RNA genome is transcribed and replicated in the context of the viral ribonucleoprotein (vRNP) complex by the viral RNA polymerase. The nucleoprotein (NP) is the structural component of the vRNP providing a scaffold for the viral RNA. In the vRNP as well as during transcription and replication the viral polymerase interacts with NP but it is unclear which parts of the polymerase and NP mediate these interactions. Previously the C-terminal '627' domain (amino acids 538-693) of PB2 was shown to interact with NP. Here we report that a fragment encompassing amino acids 146-185 of NP is sufficient to mediate this interaction. Using NMR chemical shift perturbation assays we show that amino acid region 601 to 607 of the PB2 '627' domain interacts with this fragment of NP. Substitutions of these PB2 amino acids resulted in diminished RNP activity and surface plasmon resonance assays showed that amino acids D605 was essential for the interaction with NP and V606 may also play a partial role in the interaction. Collectively these results reveal a possible interaction surface between NP and the PB2 subunit of the RNA polymerase complex.

  12. Specific Inhibition of Herpes Simplex Virus DNA Polymerase by Helical Peptides Corresponding to the Subunit Interface

    NASA Astrophysics Data System (ADS)

    Digard, Paul; Williams, Kevin P.; Hensley, Preston; Brooks, Ian S.; Dahl, Charles E.; Coen, Donald M.

    1995-02-01

    The herpes simplex virus DNA polymerase consists of two subunits-a catalytic subunit and an accessory subunit, UL42, that increases processivity. Mutations affecting the extreme C terminus of the catalytic subunit specifically disrupt subunit interactions and ablate virus replication, suggesting that new antiviral drugs could be rationally designed to interfere with polymerase heterodimerization. To aid design, we performed circular dichroism (CD) spectroscopy and analytical ultracentrifugation studies, which revealed that a 36-residue peptide corresponding to the C terminus of the catalytic subunit folds into a monomeric structure with partial α-helical character. CD studies of shorter peptides were consistent with a model where two separate regions of α-helix interact to form a hairpin-like structure. The 36-residue peptide and a shorter peptide corresponding to the C-terminal 18 residues blocked UL42-dependent long-chain DNA synthesis at concentrations that had no effect on synthesis by the catalytic subunit alone or by calf thymus DNA polymerase δ and its processivity factor. These peptides, therefore, represent a class of specific inhibitors of herpes simplex virus DNA polymerase that act by blocking accessory-subunit-dependent synthesis. These peptides or their structures may form the basis for the synthesis of clinically effective drugs.

  13. Comparative molecular dynamics studies of heterozygous open reading frames of DNA polymerase eta (η) in pathogenic yeast Candida albicans

    NASA Astrophysics Data System (ADS)

    Satpati, Suresh; Manohar, Kodavati; Acharya, Narottam; Dixit, Anshuman

    2017-01-01

    Genomic instability in Candida albicans is believed to play a crucial role in fungal pathogenesis. DNA polymerases contribute significantly to stability of any genome. Although Candida Genome database predicts presence of S. cerevisiae DNA polymerase orthologs; functional and structural characterizations of Candida DNA polymerases are still unexplored. DNA polymerase eta (Polη) is unique as it promotes efficient bypass of cyclobutane pyrimidine dimers. Interestingly, C. albicans is heterozygous in carrying two Polη genes and the nucleotide substitutions were found only in the ORFs. As allelic differences often result in functional differences of the encoded proteins, comparative analyses of structural models and molecular dynamic simulations were performed to characterize these orthologs of DNA Polη. Overall structures of both the ORFs remain conserved except subtle differences in the palm and PAD domains. The complementation analysis showed that both the ORFs equally suppressed UV sensitivity of yeast rad30 deletion strain. Our study has predicted two novel molecular interactions, a highly conserved molecular tetrad of salt bridges and a series of π-π interactions spanning from thumb to PAD. This study suggests these ORFs as the homologues of yeast Polη, and due to its heterogeneity in C. albicans they may play a significant role in pathogenicity.

  14. Purification and characterization of chromatin-bound DNA-dependent RNA polymerase I from parsley (Petroselinum crispum). Influence of nucleoside triphosphates.

    PubMed Central

    Grossmann, K; Friedrich, H; Seitz, U

    1980-01-01

    The isolation and purification of DNA-dependent RNA polymerase I (EC 2.7.7.6) from parsley (Petroselinum crispum) callus cells grown in suspension culture is described. The enzyme was solubilized from isolated chromatin. Purification was achieved by using DEAE- and phospho-cellulose in batches, followed by column chromatography on DEAE- and phospho-cellulose (two columns) and density-gradient centrifugation. The highly purified enzyme was stable over several months. The properties of purified parsley RNA polymerase I were investigated. Optimum concentration for Mn2+ was 1 mM, and for Mg2+ 4-6 mM, Mn2+ was slightly more stimulatory than Mg2+. The enzyme was most active at low ionic strengths [10-20 mM-(NH4)SO4]. The influence of various phosphates was tested: pyrophosphate inhibited RNA polymerase at low concentrations, whereas orthophosphate had no effect on the enzyme activity. ADP was slightly inhibitory, and AMP had no effect on the enzyme reaction. Nucleoside triphosphates and bivalent cations in equimolar concentrations in the range 4-11 mM did not influence the RNA synthesis in vitro. Free nucleoside triphosphates in excess of this 1:1 ratio inhibited the enzyme activity, unlike free bivalent cations, which stimulated RNA polymerase I. PMID:7470092

  15. Comparison of Polymerase Subunits from Double-Stranded RNA Bacteriophages

    PubMed Central

    Yang, Hongyan; Makeyev, Eugene V.; Bamford, Dennis H.

    2001-01-01

    The family Cystoviridae comprises several bacteriophages with double-stranded RNA (dsRNA) genomes. We have previously purified the catalytic polymerase subunit (Pol) of one of the Cystoviridae members, bacteriophage φ6, and shown that the protein can catalyze RNA synthesis in vitro. In this reaction, both bacteriophage-specific and heterologous RNAs can serve as templates, but those containing 3′ termini from the φ6 minus strands are favored. This provides a molecular basis for the observation that only plus strands, not minus strands, are transcribed from φ6 dsRNA segments in vivo. To test whether such a regulatory mechanism is also found in other dsRNA viruses, we purified recombinant Pol subunits from the φ6-related bacteriophages φ8 and φ13 and assayed their polymerase activities in vitro. The enzymes catalyze template-dependent RNA synthesis using both single-stranded-RNA (ssRNA) and dsRNA templates. However, they differ from each other as well as from φ6 Pol in certain biochemical properties. Notably, each polymerase demonstrates a distinct preference for ssRNAs bearing short 3′-terminal sequences from the virus-specific minus strands. This suggests that, in addition to other factors, RNA transcription in Cystoviridae is controlled by the template specificity of the polymerase subunit. PMID:11602748

  16. Early effects of oestradiol-17β on the chromatin and activity of the deoxyribonucleic acid-dependent ribonucleic acid polymerases (I and II) of the rat uterus

    PubMed Central

    Glasser, S. R.; Chytil, F.; Spelsberg, T. C.

    1972-01-01

    Oestradiol-17β (1.0μg) was injected intravenously into ovariectomized rats. The earliest detectable hormonal response in isolated uterine nuclei was an increase (10–15min) in RNA polymerase II activity (DNA-like RNA synthesis), which reached a peak at 30min and then decreased to control values (by 1–2h) before displaying a second increase over control activity from 2 to 12h. The next response to oestradiol-17β was an increase (30–60min) in polymerase I activity (rRNA synthesis) and template capacity of the chromatin. The concentrations of acidic chromatin proteins did not begin to increase until 1h after injection of oestradiol-17β and histone concentrations showed no significant changes during the 8h period after administration. The early (15min) increase in RNA synthesis in `high-salt conditions' can be completely eliminated by α-amanitin, an inhibitor of the RNA polymerase II. The exact nature of this early increase in endogenous polymerase II activity remains to be determined, e.g. whether it is caused by the increased availability of transcribable DNA of the chromatin or via direct hormonal activation of the enzyme per se. PMID:4656807

  17. Modeling RNA polymerase interaction in mitochondria of chordates

    PubMed Central

    2012-01-01

    Background In previous work, we introduced a concept, a mathematical model and its computer realization that describe the interaction between bacterial and phage type RNA polymerases, protein factors, DNA and RNA secondary structures during transcription, including transcription initiation and termination. The model accurately reproduces changes of gene transcription level observed in polymerase sigma-subunit knockout and heat shock experiments in plant plastids. The corresponding computer program and a user guide are available at http://lab6.iitp.ru/en/rivals. Here we apply the model to the analysis of transcription and (partially) translation processes in the mitochondria of frog, rat and human. Notably, mitochondria possess only phage-type polymerases. We consider the entire mitochondrial genome so that our model allows RNA polymerases to complete more than one circle on the DNA strand. Results Our model of RNA polymerase interaction during transcription initiation and elongation accurately reproduces experimental data obtained for plastids. Moreover, it also reproduces evidence on bulk RNA concentrations and RNA half-lives in the mitochondria of frog, human with or without the MELAS mutation, and rat with normal (euthyroid) or hyposecretion of thyroid hormone (hypothyroid). The transcription characteristics predicted by the model include: (i) the fraction of polymerases terminating at a protein-dependent terminator in both directions (the terminator polarization), (ii) the binding intensities of the regulatory protein factor (mTERF) with the termination site and, (iii) the transcription initiation intensities (initiation frequencies) of all promoters in all five conditions (frog, healthy human, human with MELAS syndrome, healthy rat, and hypothyroid rat with aberrant mtDNA methylation). Using the model, absolute levels of all gene transcription can be inferred from an arbitrary array of the three transcription characteristics, whereas, for selected genes only relative RNA concentrations have been experimentally determined. Conversely, these characteristics and absolute transcription levels can be obtained using relative RNA concentrations and RNA half-lives known from various experimental studies. In this case, the “inverse problem” is solved with multi-objective optimization. Conclusions In this study, we demonstrate that our model accurately reproduces all relevant experimental data available for plant plastids, as well as the mitochondria of chordates. Using experimental data, the model is applied to estimate binding intensities of phage-type RNA polymerases to their promoters as well as predicting terminator characteristics, including polarization. In addition, one can predict characteristics of phage-type RNA polymerases and the transcription process that are difficult to measure directly, e.g., the association between the promoter’s nucleotide composition and the intensity of polymerase binding. To illustrate the application of our model in functional predictions, we propose a possible mechanism for MELAS syndrome development in human involving a decrease of Phe-tRNA, Val-tRNA and rRNA concentrations in the cell. In addition, we describe how changes in methylation patterns of the mTERF binding site and three promoters in hypothyroid rat correlate with changes in intensities of the mTERF binding and transcription initiations. Finally, we introduce an auxiliary model to describe the interaction between polysomal mRNA and ribonucleases. PMID:22873568

  18. Binding sites for abundant nuclear factors modulate RNA polymerase I-dependent enhancer function in Saccharomyces cerevisiae.

    PubMed

    Kang, J J; Yokoi, T J; Holland, M J

    1995-12-01

    The 190-base pair (bp) rDNA enhancer within the intergenic spacer sequences of Saccharomyces cerevisiae rRNA cistrons activates synthesis of the 35S-rRNA precursor about 20-fold in vivo (Mestel,, R., Yip, M., Holland, J. P., Wang, E., Kang, J., and Holland, M. J. (1989) Mol. Cell. Biol. 9, 1243-1254). We now report identification and analysis of transcriptional activities mediated by three cis-acting sites within a 90-bp portion of the rDNA enhancer designated the modulator region. In vivo, these sequences mediated termination of transcription by RNA polymerase I and potentiated the activity of the rDNA enhancer element. Two trans-acting factors, REB1 and REB2, bind independently to sites within the modulator region (Morrow, B. E., Johnson, S. P., and Warner, J. R. (1989) J. Biol. Chem. 264, 9061-9068). We show that REB2 is identical to the ABF1 protien. Site-directed mutagenesis of REB1 and ABF1 binding sites demonstrated uncoupling of RNA polymerase I-dependent termination from transcriptional activation in vivo. We conclude that REB1 and ABF1 are required for RNA polymerase I-dependent termination and enhancer function, respectively, Since REB1 and ABF1 proteins also regulate expression of class II genes and other nuclear functions, our results suggest further similarities between RNA polymerase I and II regulatory mechanisms. Two rDNA enhancers flanking a rDNA minigene stimulated RNA polymerase I transcription in a "multiplicative" fashion. Deletion mapping analysis showed that similar cis-acting sequences were required for enhancer function when positioned upstream or downstream from a rDNA minigene.

  19. Structural Mechanism of Replication Stalling on a Bulky Amino-Polycyclic Aromatic Hydrocarbon DNA Adduct by a Y Family DNA Polymerase

    PubMed Central

    Kirouac, Kevin N.; Basu, Ashis K.; Ling, Hong

    2013-01-01

    Polycyclic aromatic hydrocarbons and their nitro derivatives are culprits of the detrimental health effects of environmental pollution. These hydrophobic compounds metabolize to reactive species and attach to DNA producing bulky lesions, such as N-[deoxyguanosine-8-yl]-1-aminopyrene (APG), in genomic DNA. The bulky adducts block DNA replication by high-fidelity polymerases and compromise replication fidelities and efficiencies by specialized lesion bypass polymerases. Here we present three crystal structures of the DNA polymerase Dpo4, a model translesion DNA polymerase of the Y family, in complex with APG-lesion-containing DNA in pre-insertion and extension stages. APG is captured in two conformations in the pre-insertion complex; one is highly exposed to the solvent, whereas the other is harbored in a shallow cleft between the finger and unique Y family little finger domain. In contrast, APG is in a single conformation at the extension stage, in which the pyrene ring is sandwiched between the little finger domain and a base from the turning back single-stranded template strand. Strikingly, a nucleotide intercalates the DNA helix to form a quaternary complex with Dpo4, DNA, and an incoming nucleotide, which stabilizes the distorted DNA structure at the extension stage. The unique APG DNA conformations in Dpo4 inhibit DNA translocation through the polymerase active site for APG bypass. We also modeled an insertion complex that illustrates a solvent-exposed pyrene ring contributing to an unstable insertion state. The structural work combined with our lesion replication assays provides a novel structural mechanism on bypass of DNA adducts containing polycyclic aromatic hydrocarbon moieties. PMID:23876706

  20. Structural mechanism of replication stalling on a bulky amino-polycyclic aromatic hydrocarbon DNA adduct by a y family DNA polymerase.

    PubMed

    Kirouac, Kevin N; Basu, Ashis K; Ling, Hong

    2013-11-15

    Polycyclic aromatic hydrocarbons and their nitro derivatives are culprits of the detrimental health effects of environmental pollution. These hydrophobic compounds metabolize to reactive species and attach to DNA producing bulky lesions, such as N-[deoxyguanosine-8-yl]-1-aminopyrene (APG), in genomic DNA. The bulky adducts block DNA replication by high-fidelity polymerases and compromise replication fidelities and efficiencies by specialized lesion bypass polymerases. Here we present three crystal structures of the DNA polymerase Dpo4, a model translesion DNA polymerase of the Y family, in complex with APG-lesion-containing DNA in pre-insertion and extension stages. APG is captured in two conformations in the pre-insertion complex; one is highly exposed to the solvent, whereas the other is harbored in a shallow cleft between the finger and unique Y family little finger domain. In contrast, APG is in a single conformation at the extension stage, in which the pyrene ring is sandwiched between the little finger domain and a base from the turning back single-stranded template strand. Strikingly, a nucleotide intercalates the DNA helix to form a quaternary complex with Dpo4, DNA, and an incoming nucleotide, which stabilizes the distorted DNA structure at the extension stage. The unique APG DNA conformations in Dpo4 inhibit DNA translocation through the polymerase active site for APG bypass. We also modeled an insertion complex that illustrates a solvent-exposed pyrene ring contributing to an unstable insertion state. The structural work combined with our lesion replication assays provides a novel structural mechanism on bypass of DNA adducts containing polycyclic aromatic hydrocarbon moieties. © 2013.

  1. Plasticity in Structural and Functional Interactions between the Phosphoprotein and Nucleoprotein of Measles Virus*

    PubMed Central

    Shu, Yaoling; Habchi, Johnny; Costanzo, Stéphanie; Padilla, André; Brunel, Joanna; Gerlier, Denis; Oglesbee, Michael; Longhi, Sonia

    2012-01-01

    The measles virus (MeV) phosphoprotein (P) tethers the polymerase to the nucleocapsid template for transcription and genome replication. Binding of P to nucleocapsid is mediated by the X domain of P (XD) and a conserved sequence (Box-2) within the C-terminal domain of the nucleoprotein (NTAIL). XD binding induces NTAIL α-helical folding, which in turn has been proposed to stabilize the polymerase-nucleocapsid complex, with cycles of binding and release required for transcription and genome replication. The current work directly assessed the relationships among XD-induced NTAIL folding, XD-NTAIL binding affinity, and polymerase activity. Amino acid substitutions that abolished XD-induced NTAIL α-helical folding were created within Box-2 of Edmonston MeV NTAIL. Polymerase activity in minireplicons was maintained despite a 35-fold decrease in XD-NTAIL binding affinity or reduction/loss of XD-induced NTAIL alpha-helical folding. Recombinant infectious virus was recovered for all mutants, and transcriptase elongation rates remained within a 1.7-fold range of parent virus. Box-2 mutations did however impose a significant cost to infectivity, reflected in an increase in the amount of input genome required to match the infectivity of parent virus. Diminished infectivity could not be attributed to changes in virion protein composition or production of defective interfering particles, where changes from parent virus were within a 3-fold range. The results indicated that MeV polymerase activity, but not infectivity, tolerates amino acid changes in the XD-binding region of the nucleoprotein. Selectional pressure for conservation of the Box-2 sequence may thus reflect a role in assuring the fidelity of polymerase functions or the assembly of viral particles required for optimal infectivity. PMID:22318731

  2. Plasticity in structural and functional interactions between the phosphoprotein and nucleoprotein of measles virus.

    PubMed

    Shu, Yaoling; Habchi, Johnny; Costanzo, Stéphanie; Padilla, André; Brunel, Joanna; Gerlier, Denis; Oglesbee, Michael; Longhi, Sonia

    2012-04-06

    The measles virus (MeV) phosphoprotein (P) tethers the polymerase to the nucleocapsid template for transcription and genome replication. Binding of P to nucleocapsid is mediated by the X domain of P (XD) and a conserved sequence (Box-2) within the C-terminal domain of the nucleoprotein (N(TAIL)). XD binding induces N(TAIL) α-helical folding, which in turn has been proposed to stabilize the polymerase-nucleocapsid complex, with cycles of binding and release required for transcription and genome replication. The current work directly assessed the relationships among XD-induced N(TAIL) folding, XD-N(TAIL) binding affinity, and polymerase activity. Amino acid substitutions that abolished XD-induced N(TAIL) α-helical folding were created within Box-2 of Edmonston MeV N(TAIL). Polymerase activity in minireplicons was maintained despite a 35-fold decrease in XD-N(TAIL) binding affinity or reduction/loss of XD-induced N(TAIL) alpha-helical folding. Recombinant infectious virus was recovered for all mutants, and transcriptase elongation rates remained within a 1.7-fold range of parent virus. Box-2 mutations did however impose a significant cost to infectivity, reflected in an increase in the amount of input genome required to match the infectivity of parent virus. Diminished infectivity could not be attributed to changes in virion protein composition or production of defective interfering particles, where changes from parent virus were within a 3-fold range. The results indicated that MeV polymerase activity, but not infectivity, tolerates amino acid changes in the XD-binding region of the nucleoprotein. Selectional pressure for conservation of the Box-2 sequence may thus reflect a role in assuring the fidelity of polymerase functions or the assembly of viral particles required for optimal infectivity.

  3. Independent Structural Domains in Paramyxovirus Polymerase Protein*

    PubMed Central

    Dochow, Melanie; Krumm, Stefanie A.; Crowe, James E.; Moore, Martin L.; Plemper, Richard K.

    2012-01-01

    All enzymatic activities required for genomic replication and transcription of nonsegmented negative strand RNA viruses (or Mononegavirales) are believed to be concentrated in the viral polymerase (L) protein. However, our insight into the organization of these different enzymatic activities into a bioactive tertiary structure remains rudimentary. Fragments of Mononegavirales polymerases analyzed to date cannot restore bioactivity through trans-complementation, unlike the related L proteins of segmented NSVs. We investigated the domain organization of phylogenetically diverse Paramyxovirus L proteins derived from measles virus (MeV), Nipah virus (NiV), and respiratory syncytial virus (RSV). Through a comprehensive in silico and experimental analysis of domain intersections, we defined MeV L position 615 as an interdomain candidate in addition to the previously reported residue 1708. Only position 1708 of MeV and the homologous positions in NiV and RSV L also tolerated the insertion of epitope tags. Splitting of MeV L at residue 1708 created fragments that were unable to physically interact and trans-complement, but strikingly, these activities were reconstituted by the addition of dimerization tags to the fragments. Equivalently split fragments of NiV, RSV, and MeV L oligomerized with comparable efficiency in all homo- and heterotypic combinations, but only the homotypic pairs were able to trans-complement. These results demonstrate that synthesis as a single polypeptide is not required for the Mononegavirales polymerases to adopt a proper tertiary conformation. Paramyxovirus polymerases are composed of at least two truly independent folding domains that lack a traditional interface but require molecular compatibility for bioactivity. The functional probing of the L domain architecture through trans-complementation is anticipated to be applicable to all Mononegavirales polymerases. PMID:22215662

  4. DNA polymerase θ (POLQ) can extend from mismatches and from bases opposite a (6–4) photoproduct

    PubMed Central

    Seki, Mineaki; Wood, Richard D.

    2007-01-01

    DNA polymerase θ (pol θ) is a nuclear A-family DNA polymerase encoded by the POLQ gene in vertebrate cells. The biochemical properties of pol θ and of Polq-defective mice have suggested that pol θ participates in DNA damage tolerance. For example, pol θ was previously found to be proficient not only in incorporation of a nucleotide opposite a thymine glycol or an abasic site, but also extends a polynucleotide chain efficiently from the base opposite the lesion. We carried out experiments to determine whether this ability to extend from non-standard termini is a more general property of the enzyme. Pol θ extended relatively efficiently from matched termini as well as termini with A:G, A:T, and A:C mismatches, with less descrimination than a well-studied A family DNA polymerase, exonuclease-free pol I from E. coli. Although pol θ was unable to, by itself, bypass a cyclobutane pyrimidine dimer or a (6–4) photoproduct, it could perform some extension from primers with bases placed across from these lesions. When pol θ was combined with DNA polymerase ι , an enzyme that can insert a base opposite a UV-induced (6–4) photoproduct, complete bypass of a (6–4) photoproduct was possible. These data show that in addition to its ability to insert nucleotides opposite some DNA lesions, pol θ is proficient at extension of unpaired termini. These results show the potential of pol θ to act as an extender after incorporation of nucleotides by other DNA polymerases, and aid in understanding the role of pol θ in somatic mutagenesis and genome instability. PMID:17920341

  5. DNA polymerase theta (POLQ) can extend from mismatches and from bases opposite a (6-4) photoproduct.

    PubMed

    Seki, Mineaki; Wood, Richard D

    2008-01-01

    DNA polymerase theta (pol theta) is a nuclear A-family DNA polymerase encoded by the POLQ gene in vertebrate cells. The biochemical properties of pol theta and of Polq-defective mice have suggested that pol theta participates in DNA damage tolerance. For example, pol theta was previously found to be proficient not only in incorporation of a nucleotide opposite a thymine glycol or an abasic site, but also extends a polynucleotide chain efficiently from the base opposite the lesion. We carried out experiments to determine whether this ability to extend from non-standard termini is a more general property of the enzyme. Pol theta extended relatively efficiently from matched termini as well as termini with A:G, A:T and A:C mismatches, with less descrimination than a well-studied A-family DNA polymerase, exonuclease-free pol I from E. coli. Although pol theta was unable to, by itself, bypass a cyclobutane pyrimidine dimer or a (6-4) photoproduct, it could perform some extension from primers with bases placed across from these lesions. When pol theta was combined with DNA polymerase iota, an enzyme that can insert a base opposite a UV-induced (6-4) photoproduct, complete bypass of a (6-4) photoproduct was possible. These data show that in addition to its ability to insert nucleotides opposite some DNA lesions, pol theta is proficient at extension of unpaired termini. These results show the potential of pol theta to act as an extender after incorporation of nucleotides by other DNA polymerases, and aid in understanding the role of pol theta in somatic mutagenesis and genome instability.

  6. Extension of base mispairs by Taq DNA polymerase: implications for single nucleotide discrimination in PCR.

    PubMed Central

    Huang, M M; Arnheim, N; Goodman, M F

    1992-01-01

    Thermus aquaticus (Taq) DNA polymerase was used to measure the extension efficiency for all configurations of matched and mismatched base pairs at template-primer 3'-termini. The transition mispairs, A(primer).C, C.A, G.T, and T.G were extended 10(-3) to 10(-4)-fold less efficiently than their correctly paired counterparts. Relative efficiencies for extending transversion mispairs were 10(-4) to 10(-5) for T.C and T.T, about 10(-6) for A.A, and less than 10(-6) for G.A, A.G, G.G and C.C. The transversion mispair C(primer).T was extended with high efficiency, about 10(-2) compared to a correct A.T basepair. The unexpected ease of extending the C.T mismatch was not likely to have been caused by primer-template misalignment. Taq polymerase was observed to bind with similar affinities to each of the correctly paired and mispaired primer-template 3'-ends. Thus, the failure of Taq polymerase to extend mismatches efficiently appears to be an intrinsic property of the enzyme and not due to an inability to bind to 3'-terminal mispairs. For almost all of the mispairs, C.T being the exception, Taq polymerase exhibits about 100 to 1000-fold greater discrimination against mismatch extension compared to avian myeloblastosis reverse transcriptase and HIV-1 reverse transcriptase which extend most mismatched basepairs permissively. Relative mismatch extension efficiencies for Taq polymerase were measured at 45 degrees C, 55 degrees C and 70 degrees C and found to be independent of temperature. The mispair extension data should be important in designing experiments using PCR to distinguish between sequences that vary by a single nucleotide. Images PMID:1408758

  7. Detecting DNA methylation of the BCL2, CDKN2A and NID2 genes in urine using a nested methylation specific polymerase chain reaction assay to predict bladder cancer.

    PubMed

    Scher, Michael B; Elbaum, Michael B; Mogilevkin, Yakov; Hilbert, David W; Mydlo, Jack H; Sidi, A Ami; Adelson, Martin E; Mordechai, Eli; Trama, Jason P

    2012-12-01

    Detection of methylated DNA has been shown to be a good biomarker for bladder cancer. Bladder cancer has the highest recurrence rate of any cancer and, as such, patients are regularly monitored using invasive diagnostic techniques. As urine is easily attainable, bladder cancer is an optimal cancer to detect using DNA methylation. DNA methylation is highly specific in cancer detection. However, it is difficult to detect because of the limited amount of DNA present in the urine of patients with bladder cancer. Therefore, an improved, sensitive and noninvasive diagnostic test is needed. We developed a highly specific and sensitive nested methylation specific polymerase chain reaction assay to detect the presence of bladder cancer in small volumes of patient urine. The genes assayed for DNA methylation are BCL2, CDKN2A and NID2. The regions surrounding the DNA methylation sites were amplified in a methylation independent first round polymerase chain reaction and the amplification product from the first polymerase chain reaction was used in a real-time methylation specific polymerase chain reaction. Urine samples were collected from patients receiving treatment at Wolfson Medical Center in Holon, Israel. In a pilot clinical study using patient urine samples we were able to differentiate bladder cancer from other urogenital malignancies and nonmalignant conditions with a sensitivity of 80.9% and a specificity of 86.4%. We developed a novel methylation specific polymerase chain reaction assay for the detection and monitoring of bladder cancer using DNA extracted from patient urine. The assay may also be combined with other diagnostic tests to improve accuracy. Copyright © 2012 American Urological Association Education and Research, Inc. Published by Elsevier Inc. All rights reserved.

  8. Multiple Natural Substitutions in Avian Influenza A Virus PB2 Facilitate Efficient Replication in Human Cells.

    PubMed

    Mänz, Benjamin; de Graaf, Miranda; Mögling, Ramona; Richard, Mathilde; Bestebroer, Theo M; Rimmelzwaan, Guus F; Fouchier, Ron A M

    2016-07-01

    A strong restriction of the avian influenza A virus polymerase in mammalian cells generally limits viral host-range switching. Although substitutions like E627K in the PB2 polymerase subunit can facilitate polymerase activity to allow replication in mammals, many human H5N1 and H7N9 viruses lack this adaptive substitution. Here, several previously unknown, naturally occurring, adaptive substitutions in PB2 were identified by bioinformatics, and their enhancing activity was verified using in vitro assays. Adaptive substitutions enhanced polymerase activity and virus replication in mammalian cells for avian H5N1 and H7N9 viruses but not for a partially human-adapted H5N1 virus. Adaptive substitutions toward basic amino acids were frequent and were mostly clustered in a putative RNA exit channel in a polymerase crystal structure. Phylogenetic analysis demonstrated divergent dependency of influenza viruses on adaptive substitutions. The novel adaptive substitutions found in this study increase basic understanding of influenza virus host adaptation and will help in surveillance efforts. Influenza viruses from birds jump the species barrier into humans relatively frequently. Such influenza virus zoonoses may pose public health risks if the virus adapts to humans and becomes a pandemic threat. Relatively few amino acid substitutions-most notably in the receptor binding site of hemagglutinin and at positions 591 and 627 in the polymerase protein PB2-have been identified in pandemic influenza virus strains as determinants of host adaptation, to facilitate efficient virus replication and transmission in humans. Here, we show that substantial numbers of amino acid substitutions are functionally compensating for the lack of the above-mentioned mutations in PB2 and could facilitate influenza virus emergence in humans. Copyright © 2016, American Society for Microbiology. All Rights Reserved.

  9. Discovery of Novel Hepatitis C Virus NS5B Polymerase Inhibitors by Combining Random Forest, Multiple e-Pharmacophore Modeling and Docking

    PubMed Central

    Wei, Yu; Li, Jinlong; Qing, Jie; Huang, Mingjie; Wu, Ming; Gao, Fenghua; Li, Dongmei; Hong, Zhangyong; Kong, Lingbao; Huang, Weiqiang; Lin, Jianping

    2016-01-01

    The NS5B polymerase is one of the most attractive targets for developing new drugs to block Hepatitis C virus (HCV) infection. We describe the discovery of novel potent HCV NS5B polymerase inhibitors by employing a virtual screening (VS) approach, which is based on random forest (RB-VS), e-pharmacophore (PB-VS), and docking (DB-VS) methods. In the RB-VS stage, after feature selection, a model with 16 descriptors was used. In the PB-VS stage, six energy-based pharmacophore (e-pharmacophore) models from different crystal structures of the NS5B polymerase with ligands binding at the palm I, thumb I and thumb II regions were used. In the DB-VS stage, the Glide SP and XP docking protocols with default parameters were employed. In the virtual screening approach, the RB-VS, PB-VS and DB-VS methods were applied in increasing order of complexity to screen the InterBioScreen database. From the final hits, we selected 5 compounds for further anti-HCV activity and cellular cytotoxicity assay. All 5 compounds were found to inhibit NS5B polymerase with IC50 values of 2.01–23.84 μM and displayed anti-HCV activities with EC50 values ranging from 1.61 to 21.88 μM, and all compounds displayed no cellular cytotoxicity (CC50 > 100 μM) except compound N2, which displayed weak cytotoxicity with a CC50 value of 51.3 μM. The hit compound N2 had the best antiviral activity against HCV, with a selective index of 32.1. The 5 hit compounds with new scaffolds could potentially serve as NS5B polymerase inhibitors through further optimization and development. PMID:26845440

  10. Heat Shock Protein 70 Modulates Influenza A Virus Polymerase Activity*

    PubMed Central

    Manzoor, Rashid; Kuroda, Kazumichi; Yoshida, Reiko; Tsuda, Yoshimi; Fujikura, Daisuke; Miyamoto, Hiroko; Kajihara, Masahiro; Kida, Hiroshi; Takada, Ayato

    2014-01-01

    The role of heat shock protein 70 (Hsp70) in virus replication has been discussed for many viruses. The known suppressive role of Hsp70 in influenza virus replication is based on studies conducted in cells with various Hsp70 expression levels. In this study, we determined the role of Hsp70 in influenza virus replication in HeLa and HEK293T cells, which express Hsp70 constitutively. Co-immunoprecipitation and immunofluorescence studies revealed that Hsp70 interacted with PB2 or PB1 monomers and PB2/PB1 heterodimer but not with the PB1/PA heterodimer or PB2/PB1/PA heterotrimer and translocated into the nucleus with PB2 monomers or PB2/PB1 heterodimers. Knocking down Hsp70 resulted in reduced virus transcription and replication activities. Reporter gene assay, immunofluorescence assay, and Western blot analysis of nuclear and cytoplasmic fractions from infected cells demonstrated that the increase in viral polymerase activity during the heat shock phase was accompanied with an increase in Hsp70 and viral polymerases levels in the nuclei, where influenza virus replication takes place, whereas a reduction in viral polymerase activity was accompanied with an increase in cytoplasmic relocation of Hsp70 along with viral polymerases. Moreover, significantly higher levels of viral genomic RNA (vRNA) were observed during the heat shock phase than during the recovery phase. Overall, for the first time, these findings suggest that Hsp70 may act as a chaperone for influenza virus polymerase, and the modulatory effect of Hsp70 appears to be a sequel of shuttling of Hsp70 between nuclear and cytoplasmic compartments. PMID:24474693

  11. High sensitive RNA detection by one-step RT-PCR using the genetically engineered variant of DNA polymerase with reverse transcriptase activity from hyperthermophilies.

    PubMed

    Okano, Hiroyuki; Baba, Misato; Kawato, Katsuhiro; Hidese, Ryota; Yanagihara, Itaru; Kojima, Kenji; Takita, Teisuke; Fujiwara, Shinsuke; Yasukawa, Kiyoshi

    2018-03-01

    One-step RT-PCR has not been widely used even though some thermostable DNA polymerases with reverse transcriptase (RT) activity were developed from bacterial and archaeal polymerases, which is owing to low cDNA synthesis activity from RNA. In the present study, we developed highly-sensitive one-step RT-PCR using the single variant of family A DNA polymerase with RT activity, K4pol L329A (L329A), from the hyperthermophilic bacterium Thermotoga petrophila K4 or the 16-tuple variant of family B DNA polymerase with RT activity, RTX, from the hyperthermophilic archaeon Thermococcus kodakarensis. Optimization of reaction condition revealed that the activities for cDNA synthesis and PCR of K4pol L329A and RTX were highly affected by the concentrations of MgCl 2 and Mn(OCOCH 3 ) 2 as well as those of K4pol L329A or RTX. Under the optimized condition, 300 copies/μl of target RNA in 10 μl reaction volumes were successfully detected by the one-step RT-PCR with K4pol L329A or RTX, which was almost equally sensitive enough compared with the current RT-PCR condition using retroviral RT and thermostable DNA polymerase. Considering that K4pol L329A and RTX are stable even at 90-100°C, our results suggest that the one-step RT-PCR with K4pol L329A or RTX is more advantageous than the current one. Copyright © 2017 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.

  12. Probing the interaction of archaeal DNA polymerases with deaminated bases using X-ray crystallography and non-hydrogen bonding isosteric base analogues†

    PubMed Central

    Killelea, Tom; Ghosh, Samantak; Tan, Samuel S.; Heslop, Pauline; Firbank, Susan; Kool, Eric T.; Connolly, Bernard A.

    2010-01-01

    Archaeal family-B DNA polymerases stall replication on encountering the pro-mutagenic bases uracil and hypoxanthine. This publication describes an X-ray crystal structure of Thermococcus gorgonarius polymerase in complex with a DNA containing hypoxanthine in the single-stranded region of the template, two bases ahead of the primer-template junction. Full details of the specific recognition of hypoxanthine are revealed, allowing a comparison with published data that describes uracil binding. The two bases are recognized by the same pocket, in the N-terminal domain, and make very similar protein-DNA interactions. Specificity for hypoxanthine (and uracil) arises from a combination of polymerase-base hydrogen bonds and shape fit between the deaminated bases and the pocket. The structure with hypoxanthine at the +2 position explains the stimulation of the polymerase 3′-5′ proof reading exonuclease, observed with deaminated bases at this location. A β hairpin element, involved in partitioning the primer strand between the polymerase and exonuclease active sites, inserts between the two template bases at the extreme end of the double stranded DNA. This denatures the two complementary primer bases and directs the resulting 3′ single-stranded extension towards the exonuclease active site. Finally the relative importance of hydrogen bonding and shape fit in determining selectivity for deaminated bases has been examined using non-polar isosteres. Affinity for both 2,4 difluorobenzene and fluorobenzimidazole, non-hydrogen bonding shape mimics of uracil and hypoxanthine respectively, is strongly diminished, suggesting polar protein-base contacts are important. However, residual interaction with 2,4 difluorobenzene is seen, confirming a role for shape recognition. PMID:20527806

  13. Plasimids containing the gene for DNA polymerase I from Streptococcus pneumoniae

    DOEpatents

    Lacks, Sanford A.; Martinez, Susana; Lopez, Paloma; Espinosa, Manuel

    1991-01-01

    A method is disclosed for cloning the gene which encodes a DNA polymerase-exonuclease of Streptococcus pneumoniae. Plasmid pSM22, the vector containing the pneumocccal polA gene, facilitates the expression of 50-fold greater amounts of the PolI enzyme.

  14. Rapid isothermal detection of Phytophthora species on plant samples using recombinase polymerase amplification

    USDA-ARS?s Scientific Manuscript database

    Recently several isothermal amplification techniques have been developed that are extremely tolerant towards inhibitors present in many plant extracts. Recombinase polymerase amplification (RPA) assays for the genus Phytophthora have been developed which provide a simple and rapid method to macerate...

  15. Polymerase chain reaction-based detection of B-cell monoclonality in cytologic specimens.

    PubMed

    Chen, Y T; Mercer, G O; Chen, Y

    1993-11-01

    Thirty-seven cytologic cell blocks were evaluated for B-cell monoclonality by polymerase chain reaction (PCR), 16 of them cytologically positive for lymphoma, and 21 suspicious for lymphoma but morphologically nondiagnostic. Of 37 specimens, 13 (35%) showed B-cell monoclonality, including six of 16 cytologically positive samples and seven of 21 cytologically suspicious ones. Of these 13 positive samples, seven were positive using crude lysates as substrates, and six additional positive samples were identified only when DNAs were purified and concentrated. Analysis of the DNAs further revealed poor polymerase chain reaction amplifiability and low DNA yield in many samples, indicating that cell block materials are suboptimal for this assay. We concluded that B-cell monoclonality can be detected in ethanol-fixed cytologic samples, and usage of unembedded material will likely improve the sensitivity. In specimens cytologically suspicious for lymphoma, polymerase chain reaction-based identification of monoclonal B-cell population supports the diagnosis of B-cell lymphoma and is a potentially useful test in solving this diagnostic dilemma.

  16. Backtracking dynamics of RNA polymerase: pausing and error correction.

    PubMed

    Sahoo, Mamata; Klumpp, Stefan

    2013-09-18

    Transcription by RNA polymerases is frequently interrupted by pauses. One mechanism of such pauses is backtracking, where the RNA polymerase translocates backward with respect to both the DNA template and the RNA transcript, without shortening the transcript. Backtracked RNA polymerases move in a diffusive fashion and can return to active transcription either by diffusive return to the position where backtracking was initiated or by cleaving the transcript. The latter process also provides a mechanism for proofreading. Here we present some exact results for a kinetic model of backtracking and analyse its impact on the speed and the accuracy of transcription. We show that proofreading through backtracking is different from the classical (Hopfield-Ninio) scheme of kinetic proofreading. Our analysis also suggests that, in addition to contributing to the accuracy of transcription, backtracking may have a second effect: it attenuates the slow down of transcription that arises as a side effect of discriminating between correct and incorrect nucleotides based on the stepping rates.

  17. Backtracking dynamics of RNA polymerase: pausing and error correction

    NASA Astrophysics Data System (ADS)

    Sahoo, Mamata; Klumpp, Stefan

    2013-09-01

    Transcription by RNA polymerases is frequently interrupted by pauses. One mechanism of such pauses is backtracking, where the RNA polymerase translocates backward with respect to both the DNA template and the RNA transcript, without shortening the transcript. Backtracked RNA polymerases move in a diffusive fashion and can return to active transcription either by diffusive return to the position where backtracking was initiated or by cleaving the transcript. The latter process also provides a mechanism for proofreading. Here we present some exact results for a kinetic model of backtracking and analyse its impact on the speed and the accuracy of transcription. We show that proofreading through backtracking is different from the classical (Hopfield-Ninio) scheme of kinetic proofreading. Our analysis also suggests that, in addition to contributing to the accuracy of transcription, backtracking may have a second effect: it attenuates the slow down of transcription that arises as a side effect of discriminating between correct and incorrect nucleotides based on the stepping rates.

  18. In vitro transcription activities of Pol IV, Pol V and RDR2 reveal coupling of Pol IV and RDR2 for dsRNA synthesis in plant RNA silencing

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Haag, Jeremy R.; Ream, Thomas S.; Marasco, Michelle

    2012-12-14

    In Arabidopsis, RNA-dependent DNA methylation and transcriptional silencing involves three nuclear RNA polymerases that are biochemically undefined: the presumptive DNA-dependent RNA polymerases, Pol IV and Pol V and the putative RNA-dependent RNA polymerase, RDR2. Here, we demonstrate their RNA polymerase activities in vitro. Unlike Pol II, Pols IV and V require an RNA primer, are insensitive to alpha-amanitin and differ in their ability to displace non-template DNA during transcription. Biogenesis of 24 nt small interfering RNAs (siRNAs) requires both Pol IV and RDR2, which physically associate in vivo. Pol IV does not require RDR2 for activity, but RDR2 is nonfunctionalmore » in the absence of associated Pol IV, suggesting that their coupling explains the channeling of Pol IV transcripts into double-stranded RNAs that are then diced into 24 nt siRNAs.« less

  19. Subunit Compositions of the RNA-Silencing Enzymes Pol IV and Pol V Reveal Their Origins as Specialized Forms of RNA Polymerase II

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ream, Thomas S.; Haag, J. R.; Wierzbicki, A. T.

    2009-01-30

    In addition to RNA polymerases I, II, and III, the essential RNA polymerases present in all eukaryotes, plants have two additional nuclear RNA polymerases, abbreviated as Pol IV and Pol V, that play nonredundant roles in siRNA-directed DNA methylation and gene silencing. We show that Arabidopsis Pol IV and Pol V are composed of subunits that are paralogous or identical to the 12 subunits of Pol II. Four subunits of Pol IV are distinct from their Pol II paralogs, six subunits of Pol V are distinct from their Pol II paralogs, and four subunits differ between Pol IV and Polmore » V. Importantly, the subunit differences occur in key positions relative to the template entry and RNA exit paths. Our findings support the hypothesis that Pol IV and Pol V are Pol II-like enzymes that evolved specialized roles in the production of noncoding transcripts for RNA silencing and genome defense.« less

  20. DNA polymerase η mutational signatures are found in a variety of different types of cancer.

    PubMed

    Rogozin, Igor B; Goncearenco, Alexander; Lada, Artem G; De, Subhajyoti; Yurchenko, Vyacheslav; Nudelman, German; Panchenko, Anna R; Cooper, David N; Pavlov, Youri I

    2018-01-01

    DNA polymerase (pol) η is a specialized error-prone polymerase with at least two quite different and contrasting cellular roles: to mitigate the genetic consequences of solar UV irradiation, and promote somatic hypermutation in the variable regions of immunoglobulin genes. Misregulation and mistargeting of pol η can compromise genome integrity. We explored whether the mutational signature of pol η could be found in datasets of human somatic mutations derived from normal and cancer cells. A substantial excess of single and tandem somatic mutations within known pol η mutable motifs was noted in skin cancer as well as in many other types of human cancer, suggesting that somatic mutations in A:T bases generated by DNA polymerase η are a common feature of tumorigenesis. Another peculiarity of pol ηmutational signatures, mutations in YCG motifs, led us to speculate that error-prone DNA synthesis opposite methylated CpG dinucleotides by misregulated pol η in tumors might constitute an additional mechanism of cytosine demethylation in this hypermutable dinucleotide.

  1. Focal adhesion kinase (FAK) regulates polymerase activity of multiple influenza A virus subtypes.

    PubMed

    Elbahesh, Husni; Bergmann, Silke; Russell, Charles J

    2016-12-01

    Influenza A viruses (IAVs) cause numerous pandemics and yearly epidemics resulting in ~500,000 annual deaths globally. IAV modulates cellular signaling pathways at every step of the infection cycle. Focal adhesion kinase (FAK) has been shown to play a critical role in endosomal trafficking of influenza A viruses, yet it is unclear how FAK kinase activity regulates IAV replication. Using mini-genomes derived from H1N1, H5N1 and H7N9 viruses, we dissected RNA replication by IAVs independent of viral entry or release. Our results show FAK activity promotes efficient IAV polymerase activity and inhibiting FAK activity with a chemical inhibitor or a kinase-dead mutant significantly reduces IAV polymerase activity. Using co-immunoprecipitations and proximity ligation assays, we observed interactions between FAK and the viral nucleoprotein, supporting a direct role of FAK in IAV replication. Altogether, the data indicates that FAK kinase activity is important in promoting IAV replication by regulating its polymerase activity. Copyright © 2016 Elsevier Inc. All rights reserved.

  2. Purification and properties of poliovirus RNA polymerase expressed in Escherichia coli

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Plotch, S.J.; Palant, O.; Gluzman, Y.

    1989-01-01

    A cDNA clone encoding the RNA polymerase of poliovirus has been expressed in Escherichia coli under the transcriptional control of a T7 bacteriophage promoter. This poliovirus enzyme was designed to contain only a single additional amino acid, the N-terminal methionine. The recombinant enzyme has been purified to near homogeneity, and polyclonal antibodies have been prepared against it. The enzyme exhibits poly(A)-dependent oligo(U)-primed ply(U) polymerase activity as well as RNA polymerase activity. In the presence of an oligo(U) primer, the enzyme catalyzes the synthesis of a full-length copy of either poliovirus or globin RNA templates. In the absence of added primer,more » RNA products up to twice the length of the template are synthesized. When incubated in the presence of a single nucleoside triphosphate, (..cap alpha..-/sup 32/P)UTP, the enzyme catalyzes the incorporation of radioactive label into template RNA. These results are discussed in light of previously proposed models of poliovirus RNA synthesis in vitro.« less

  3. Complementation between polymerase- and exonuclease-deficient mitochondrial DNA polymerase mutants in genomically engineered flies

    PubMed Central

    Bratic, Ana; Kauppila, Timo E. S.; Macao, Bertil; Grönke, Sebastian; Siibak, Triinu; Stewart, James B.; Baggio, Francesca; Dols, Jacqueline; Partridge, Linda; Falkenberg, Maria; Wredenberg, Anna; Larsson, Nils-Göran

    2015-01-01

    Replication errors are the main cause of mitochondrial DNA (mtDNA) mutations and a compelling approach to decrease mutation levels would therefore be to increase the fidelity of the catalytic subunit (POLγA) of the mtDNA polymerase. Here we genomically engineer the tamas locus, encoding fly POLγA, and introduce alleles expressing exonuclease- (exo−) and polymerase-deficient (pol−) POLγA versions. The exo− mutant leads to accumulation of point mutations and linear deletions of mtDNA, whereas pol− mutants cause mtDNA depletion. The mutant tamas alleles are developmentally lethal but can complement each other in trans resulting in viable flies with clonally expanded mtDNA mutations. Reconstitution of human mtDNA replication in vitro confirms that replication is a highly dynamic process where POLγA goes on and off the template to allow complementation during proofreading and elongation. The created fly models are valuable tools to study germ line transmission of mtDNA and the pathophysiology of POLγA mutation disease. PMID:26554610

  4. Meeting report for "OddPols" 2014: the odds invite an even.

    PubMed

    Roy-Engel, Astrid M

    2015-02-01

    The Ninth International Biennial Conference on RNA Polymerases I and III (the "OddPols") was held on June 19-21, 2014 at the University of Michigan, Ann Arbor, USA. Sponsored by New England Biolabs, the Cayman Chemical Company, the Rackham Graduate School and the University of Michigan Health System, and organized by David Engelke, Craig Pikaard, Lawrence Rothblum, Andrzej Wierzbicki and Astrid Engel. This year at the conference, the "odds" were increased by expanding the usual topics on the advances in RNA polymerases I and III research to include presentations on RNA polymerase IV and V. The keynote speaker, Craig Pikaard, opened the meeting with his presentation entitled "Five nuclear multisubunit RNA polymerases". The meeting drew attendees from fourteen countries that shared their research discoveries through oral and poster presentations. The talks were organized into 11 sessions covering seven distinct topics. Here we present some of the highlights from the meeting using summaries provided by the participants. Copyright © 2014 Elsevier B.V. All rights reserved.

  5. Transcription in Yeast: Separation and Properties of Multiple RNA Polymerases

    PubMed Central

    Adman, Ray; Schultz, Loren D.; Hall, Benjamin D.

    1972-01-01

    Four peaks of DNA-directed RNA polymerase activity are resolved by salt gradient elution of a sonicated yeast cell extract on DEAE-Sephadex. The enzymes, which are named IA, IB, II, and III in order of elution, all appear to come from cell nuclei. Only enzyme II is sensitive to α-amanitin. All enzymes are more active with Mn++ than with Mg++ as divalent ion. Enzymes IB and II have salt optima in the range 0.05-0.10 M (NH4)2SO4, whereas enzyme III is maximally active at 0.20-0.25 M (NH4)2SO4. With optimal salt concentration and saturating DNA, the template preference ratio, activity on native calfthymus DNA divided by activity on denatured calf-thymus DNA, is 2.2 for IB, 0.4 for II, and 3.5 for III. None of the yeast polymerases was inhibited by rifamycin SV. Rifamycin AF/013 effectively inhibited polymerases IB, II, and III. PMID:4558656

  6. A role for the RNA pol II–associated PAF complex in AID-induced immune diversification

    PubMed Central

    Willmann, Katharina L.; Milosevic, Sara; Pauklin, Siim; Schmitz, Kerstin-Maike; Rangam, Gopinath; Simon, Maria T.; Maslen, Sarah; Skehel, Mark; Robert, Isabelle; Heyer, Vincent; Schiavo, Ebe; Reina-San-Martin, Bernardo

    2012-01-01

    Antibody diversification requires the DNA deaminase AID to induce DNA instability at immunoglobulin (Ig) loci upon B cell stimulation. For efficient cytosine deamination, AID requires single-stranded DNA and needs to gain access to Ig loci, with RNA pol II transcription possibly providing both aspects. To understand these mechanisms, we isolated and characterized endogenous AID-containing protein complexes from the chromatin of diversifying B cells. The majority of proteins associated with AID belonged to RNA polymerase II elongation and chromatin modification complexes. Besides the two core polymerase subunits, members of the PAF complex, SUPT5H, SUPT6H, and FACT complex associated with AID. We show that AID associates with RNA polymerase-associated factor 1 (PAF1) through its N-terminal domain, that depletion of PAF complex members inhibits AID-induced immune diversification, and that the PAF complex can serve as a binding platform for AID on chromatin. A model is emerging of how RNA polymerase II elongation and pausing induce and resolve AID lesions. PMID:23008333

  7. Polymerase/DNA interactions and enzymatic activity: multi-parameter analysis with electro-switchable biosurfaces

    NASA Astrophysics Data System (ADS)

    Langer, Andreas; Schräml, Michael; Strasser, Ralf; Daub, Herwin; Myers, Thomas; Heindl, Dieter; Rant, Ulrich

    2015-07-01

    The engineering of high-performance enzymes for future sequencing and PCR technologies as well as the development of many anticancer drugs requires a detailed analysis of DNA/RNA synthesis processes. However, due to the complex molecular interplay involved, real-time methodologies have not been available to obtain comprehensive information on both binding parameters and enzymatic activities. Here we introduce a chip-based method to investigate polymerases and their interactions with nucleic acids, which employs an electrical actuation of DNA templates on microelectrodes. Two measurement modes track both the dynamics of the induced switching process and the DNA extension simultaneously to quantitate binding kinetics, dissociation constants and thermodynamic energies. The high sensitivity of the method reveals previously unidentified tight binding states for Taq and Pol I (KF) DNA polymerases. Furthermore, the incorporation of label-free nucleotides can be followed in real-time and changes in the DNA polymerase conformation (finger closing) during enzymatic activity are observable.

  8. Lack of detection of feline leukemia and feline sarcoma viruses in diffuse iris melanomas of cats by immunohistochemistry and polymerase chain reaction.

    PubMed

    Cullen, Cheryl L; Haines, Deborah M; Jackson, Marion L; Grahn, Bruce H

    2002-07-01

    Diffuse iris melanoma was confirmed by light-microscopic examination in 10 formalin-fixed, paraffin-embedded globes from 10 cats. To determine if feline leukemia virus or a replication defective feline leukemia virus, feline sarcoma virus, was present in these anterior uveal melanomas, immunohistochemistry and polymerase chain reaction for feline leukemia virus were utilized. Immunohistochemical staining for feline leukemia virus glycoprotein 70 was performed on all 10 tumors using an avidin-biotin complex technique. The DNA was extracted from each specimen and a 166-base pair region of the feline leukemia virus long terminal repeat was targeted by polymerase chain reaction. Immunohistochemical staining for feline leukemia virus glycoprotein 70 and polymerase chain reaction amplification of a feline leukemia virus long terminal repeat region were negative in all cases. Feline leukemia virus/feline sarcoma virus was not detected in any neoplasms and therefore was unlikely to play a role in the tumorigenesis of these feline diffuse iris melanomas.

  9. Non-nucleosidic inhibition of Herpes simplex virus DNA polymerase: mechanistic insights into the anti-herpetic mode of action of herbal drug withaferin A.

    PubMed

    Grover, Abhinav; Agrawal, Vibhuti; Shandilya, Ashutosh; Bisaria, Virendra S; Sundar, Durai

    2011-01-01

    Herpes Simplex Virus 1 and 2 causes several infections in humans including cold sores and encephalitis. Previous antiviral studies on herpes viruses have focussed on developing nucleoside analogues that can inhibit viral polymerase and terminate the replicating viral DNA. However, these drugs bear an intrinsic non-specificity as they can also inhibit cellular polymerase apart from the viral one. The present study is an attempt to elucidate the action mechanism of naturally occurring withaferin A in inhibiting viral DNA polymerase, thus providing an evidence for its development as a novel anti-herpetic drug. Withaferin A was found to bind very similarly to that of the previously reported 4-oxo-DHQ inhibitor. Withaferin A was observed binding to the residues Gln 617, Gln 618, Asn 815 and Tyr 818, all of which are crucial to the proper functioning of the polymerase. A comparison of the conformation obtained from docking and the molecular dynamics simulations shows that substantial changes in the binding conformations have occurred. These results indicate that the initial receptor-ligand interaction observed after docking can be limited due to the receptor rigid docking algorithm and that the conformations and interactions observed after simulation runs are more energetically favoured. We have performed docking and molecular dynamics simulation studies to elucidate the binding mechanism of prospective herbal drug withaferin A onto the structure of DNA polymerase of Herpes simplex virus. Our docking simulations results give high binding affinity of the ligand to the receptor. Long de novo MD simulations for 10 ns performed allowed us to evaluate the dynamic behaviour of the system studied and corroborate the docking results, as well as identify key residues in the enzyme-inhibitor interactions. The present MD simulations support the hypothesis that withaferin A is a potential ligand to target/inhibit DNA polymerase of the Herpes simplex virus. Results of these studies will also guide the design of selective inhibitors of DNA POL with high specificity and potent activity in order to strengthen the therapeutic arsenal available today against the dangerous biological warfare agent represented by Herpes Simplex Virus.

  10. Quantitative Analysis of the Mutagenic Potential of 1-Aminopyrene-DNA Adduct Bypass Catalyzed by Y-Family DNA Polymerases

    PubMed Central

    Sherrer, Shanen M.; Taggart, David J.; Pack, Lindsey R.; Malik, Chanchal K.; Basu, Ashis K.; Suo, Zucai

    2012-01-01

    N- (deoxyguanosin-8-yl)-1-aminopyrene (dGAP) is the predominant nitro polyaromatic hydrocarbon product generated from the air pollutant 1-nitropyrene reacting with DNA. Previous studies have shown that dGAP induces genetic mutations in bacterial and mammalian cells. One potential source of these mutations is the error-prone bypass of dGAP lesions catalyzed by the low-fidelity Y-family DNA polymerases. To provide a comparative analysis of the mutagenic potential of the translesion DNA synthesis (TLS) of dGAP, we employed short oligonucleotide sequencing assays (SOSAs) with the model Y-family DNA polymerase from Sulfolobus solfataricus, DNA Polymerase IV (Dpo4), and the human Y-family DNA polymerases eta (hPolη), kappa (hPolκ), and iota (hPolι). Relative to undamaged DNA, all four enzymes generated far more mutations (base deletions, insertions, and substitutions) with a DNA template containing a site-specifically placed dGAP. Opposite dGAP and at an immediate downstream template position, the most frequent mutations made by the three human enzymes were base deletions and the most frequent base substitutions were dAs for all enzymes. Based on the SOSA data, Dpo4 was the least error-prone Y-family DNA polymerase among the four enzymes during the TLS of dGAP. Among the three human Y-family enzymes, hPolκ made the fewest mutations at all template positions except opposite the lesion site. hPolκ was significantly less error-prone than hPolι and hPolη during the extension of dGAP bypass products. Interestingly, the most frequent mutations created by hPolι at all template positions were base deletions. Although hRev1, the fourth human Y-family enzyme, could not extend dGAP bypass products in our standing start assays, it preferentially incorporated dCTP opposite the bulky lesion. Collectively, these mutagenic profiles suggest that hPolkk and hRev1 are the most suitable human Y-family DNA polymerases to perform TLS of dGAP in humans. PMID:22917544

  11. Non-nucleosidic inhibition of Herpes simplex virus DNA polymerase: mechanistic insights into the anti-herpetic mode of action of herbal drug withaferin A

    PubMed Central

    2011-01-01

    Background Herpes Simplex Virus 1 and 2 causes several infections in humans including cold sores and encephalitis. Previous antiviral studies on herpes viruses have focussed on developing nucleoside analogues that can inhibit viral polymerase and terminate the replicating viral DNA. However, these drugs bear an intrinsic non-specificity as they can also inhibit cellular polymerase apart from the viral one. The present study is an attempt to elucidate the action mechanism of naturally occurring withaferin A in inhibiting viral DNA polymerase, thus providing an evidence for its development as a novel anti-herpetic drug. Results Withaferin A was found to bind very similarly to that of the previously reported 4-oxo-DHQ inhibitor. Withaferin A was observed binding to the residues Gln 617, Gln 618, Asn 815 and Tyr 818, all of which are crucial to the proper functioning of the polymerase. A comparison of the conformation obtained from docking and the molecular dynamics simulations shows that substantial changes in the binding conformations have occurred. These results indicate that the initial receptor-ligand interaction observed after docking can be limited due to the receptor rigid docking algorithm and that the conformations and interactions observed after simulation runs are more energetically favoured. Conclusions We have performed docking and molecular dynamics simulation studies to elucidate the binding mechanism of prospective herbal drug withaferin A onto the structure of DNA polymerase of Herpes simplex virus. Our docking simulations results give high binding affinity of the ligand to the receptor. Long de novo MD simulations for 10 ns performed allowed us to evaluate the dynamic behaviour of the system studied and corroborate the docking results, as well as identify key residues in the enzyme-inhibitor interactions. The present MD simulations support the hypothesis that withaferin A is a potential ligand to target/inhibit DNA polymerase of the Herpes simplex virus. Results of these studies will also guide the design of selective inhibitors of DNA POL with high specificity and potent activity in order to strengthen the therapeutic arsenal available today against the dangerous biological warfare agent represented by Herpes Simplex Virus. PMID:22373101

  12. Unlocking the sugar "steric gate" of DNA polymerases.

    PubMed

    Brown, Jessica A; Suo, Zucai

    2011-02-22

    To maintain genomic stability, ribonucleotide incorporation during DNA synthesis is controlled predominantly at the DNA polymerase level. A steric clash between the 2'-hydroxyl of an incoming ribonucleotide and a bulky active site residue, known as the "steric gate", establishes an effective mechanism for most DNA polymerases to selectively insert deoxyribonucleotides. Recent kinetic, structural, and in vivo studies have illuminated novel features about ribonucleotide exclusion and the mechanistic consequences of ribonucleotide misincorporation on downstream events, such as the bypass of a ribonucleotide in a DNA template and the subsequent extension of the DNA lesion bypass product. These important findings are summarized in this review.

  13. A novel gammaherpesvirus in a large flying fox (Pteropus vampyrus) with blepharitis.

    PubMed

    Paige Brock, A; Cortés-Hinojosa, Galaxia; Plummer, Caryn E; Conway, Julia A; Roff, Shannon R; Childress, April L; Wellehan, James F X

    2013-05-01

    A novel gammaherpesvirus was identified in a large flying fox (Pteropus vampyrus) with conjunctivitis, blepharitis, and meibomianitis by nested polymerase chain reaction and sequencing. Polymerase chain reaction amplification and sequencing of 472 base pairs of the DNA-dependent DNA polymerase gene were used to identify a novel herpesvirus. Bayesian and maximum likelihood phylogenetic analyses indicated that the virus is a member of the genus Percavirus in the subfamily Gammaherpesvirinae. Additional research is needed regarding the association of this virus with conjunctivitis and other ocular pathology. This virus may be useful as a biomarker of stress and may be a useful model of virus recrudescence in Pteropus spp.

  14. Electron Microscopic Analysis of the Products of DNA Synthesis by DNA Polymerases from Calf Thymus and Herpes Simplex Virus Type I

    DTIC Science & Technology

    1988-10-03

    DNA replication showed an average of 2.5 primers per M13 DNA circle. The measurement of the double stranded length from individual replicative intermediates by electron microscopy was within the accuracy of 10% standard deviation. The product length distribution obtained from the HSV-1 DNA polymerase catalyzed replication of M13 DNA primed with a specific pentadecamer and in the presence of E. Coli SSB protein showed a near Poisson distribution. Replication of the same primer-template system or DNA primase primed M13 DNA template by calf thymus DNA polymerase a showed a

  15. Kinetics and thermodynamics of exonuclease-deficient DNA polymerases

    NASA Astrophysics Data System (ADS)

    Gaspard, Pierre

    2016-04-01

    A kinetic theory is developed for exonuclease-deficient DNA polymerases, based on the experimental observation that the rates depend not only on the newly incorporated nucleotide, but also on the previous one, leading to the growth of Markovian DNA sequences from a Bernoullian template. The dependencies on nucleotide concentrations and template sequence are explicitly taken into account. In this framework, the kinetic and thermodynamic properties of DNA replication, in particular, the mean growth velocity, the error probability, and the entropy production are calculated analytically in terms of the rate constants and the concentrations. Theory is compared with numerical simulations for the DNA polymerases of T7 viruses and human mitochondria.

  16. Plasmids containing the gene for DNA polymerase I from Streptococcus pneumoniae

    DOEpatents

    Lacks, S.A.; Martinez, S.; Lopez, P.; Espinosa, M.

    1991-03-26

    A method is disclosed for cloning the gene which encodes a DNA polymerase-exonuclease of Streptococcus pneumoniae. Plasmid pSM22, the vector containing the pneumocccal polA gene, facilitates the expression of 50-fold greater amounts of the PolI enzyme. 1 figure.

  17. Polymerase Chain Reaction for Detection of Systemic Plant Pathogens

    USDA-ARS?s Scientific Manuscript database

    This chapter outlines the advances and application of the polymerase chain reaction (PCR) since its development in 1984 and its enhancements and applications to detection of viruses, viroids and phytoplasma in pome and stone fruits. PCR is probably the most rapidly and widely adopted technology eve...

  18. Problem-Solving Test: Conditional Gene Targeting Using the Cre/loxP Recombination System

    ERIC Educational Resources Information Center

    Szeberényi, József

    2013-01-01

    Terms to be familiar with before you start to solve the test: gene targeting, knock-out mutation, bacteriophage, complementary base-pairing, homologous recombination, deletion, transgenic organisms, promoter, polyadenylation element, transgene, DNA replication, RNA polymerase, Shine-Dalgarno sequence, restriction endonuclease, polymerase chain…

  19. Multifunctionality of a picornavirus polymerase domain: nuclear localization signal and nucleotide recognition.

    PubMed

    Ferrer-Orta, Cristina; de la Higuera, Ignacio; Caridi, Flavia; Sánchez-Aparicio, María Teresa; Moreno, Elena; Perales, Celia; Singh, Kamalendra; Sarafianos, Stefan G; Sobrino, Francisco; Domingo, Esteban; Verdaguer, Nuria

    2015-07-01

    The N-terminal region of the foot-and-mouth disease virus (FMDV) 3D polymerase contains the sequence MRKTKLAPT (residues 16 to 24) that acts as a nuclear localization signal. A previous study showed that substitutions K18E and K20E diminished the transport to the nucleus of 3D and 3CD and severely impaired virus infectivity. These residues have also been implicated in template binding, as seen in the crystal structures of different 3D-RNA elongation complexes. Here, we report the biochemical and structural characterization of different mutant polymerases harboring substitutions at residues 18 and 20, in particular, K18E, K18A, K20E, K20A, and the double mutant K18A K20A (KAKA). All mutant enzymes exhibit low RNA binding activity, low processivity, and alterations in nucleotide recognition, including increased incorporation of ribavirin monophosphate (RMP) relative to the incorporation of cognate nucleotides compared with the wild-type enzyme. The structural analysis shows an unprecedented flexibility of the 3D mutant polymerases, including both global rearrangements of the closed-hand architecture and local conformational changes at loop β9-α11 (within the polymerase motif B) and at the template-binding channel. Specifically, in 3D bound to RNA, both K18E and K20E induced the opening of new pockets in the template channel where the downstream templating nucleotide at position +2 binds. The comparisons of free and RNA-bound enzymes suggest that the structural rearrangements may occur in a concerted mode to regulate RNA replication, processivity, and fidelity. Thus, the N-terminal region of FMDV 3D that acts as a nuclear localization signal (NLS) and in template binding is also involved in nucleotide recognition and can affect the incorporation of nucleotide analogues. The study documents multifunctionality of a nuclear localization signal (NLS) located at the N-terminal region of the foot-and-mouth disease viral polymerase (3D). Amino acid substitutions at this polymerase region can impair the transport of 3D to the nucleus, reduce 3D binding to RNA, and alter the relative incorporation of standard nucleoside monophosphate versus ribavirin monophosphate. Structural data reveal that the conformational changes in this region, forming part of the template channel entry, would be involved in nucleotide discrimination. The results have implications for the understanding of viral polymerase function and for lethal mutagenesis mechanisms. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

  20. Multifunctionality of a Picornavirus Polymerase Domain: Nuclear Localization Signal and Nucleotide Recognition

    PubMed Central

    Ferrer-Orta, Cristina; de la Higuera, Ignacio; Caridi, Flavia; Sánchez-Aparicio, María Teresa; Moreno, Elena; Perales, Celia; Singh, Kamalendra; Sarafianos, Stefan G.; Sobrino, Francisco; Domingo, Esteban

    2015-01-01

    ABSTRACT The N-terminal region of the foot-and-mouth disease virus (FMDV) 3D polymerase contains the sequence MRKTKLAPT (residues 16 to 24) that acts as a nuclear localization signal. A previous study showed that substitutions K18E and K20E diminished the transport to the nucleus of 3D and 3CD and severely impaired virus infectivity. These residues have also been implicated in template binding, as seen in the crystal structures of different 3D-RNA elongation complexes. Here, we report the biochemical and structural characterization of different mutant polymerases harboring substitutions at residues 18 and 20, in particular, K18E, K18A, K20E, K20A, and the double mutant K18A K20A (KAKA). All mutant enzymes exhibit low RNA binding activity, low processivity, and alterations in nucleotide recognition, including increased incorporation of ribavirin monophosphate (RMP) relative to the incorporation of cognate nucleotides compared with the wild-type enzyme. The structural analysis shows an unprecedented flexibility of the 3D mutant polymerases, including both global rearrangements of the closed-hand architecture and local conformational changes at loop β9-α11 (within the polymerase motif B) and at the template-binding channel. Specifically, in 3D bound to RNA, both K18E and K20E induced the opening of new pockets in the template channel where the downstream templating nucleotide at position +2 binds. The comparisons of free and RNA-bound enzymes suggest that the structural rearrangements may occur in a concerted mode to regulate RNA replication, processivity, and fidelity. Thus, the N-terminal region of FMDV 3D that acts as a nuclear localization signal (NLS) and in template binding is also involved in nucleotide recognition and can affect the incorporation of nucleotide analogues. IMPORTANCE The study documents multifunctionality of a nuclear localization signal (NLS) located at the N-terminal region of the foot-and-mouth disease viral polymerase (3D). Amino acid substitutions at this polymerase region can impair the transport of 3D to the nucleus, reduce 3D binding to RNA, and alter the relative incorporation of standard nucleoside monophosphate versus ribavirin monophosphate. Structural data reveal that the conformational changes in this region, forming part of the template channel entry, would be involved in nucleotide discrimination. The results have implications for the understanding of viral polymerase function and for lethal mutagenesis mechanisms. PMID:25903341

  1. HSP90 Chaperoning in Addition to Phosphoprotein Required for Folding but Not for Supporting Enzymatic Activities of Measles and Nipah Virus L Polymerases

    PubMed Central

    Bloyet, Louis-Marie; Welsch, Jérémy; Enchery, François; Mathieu, Cyrille; de Breyne, Sylvain

    2016-01-01

    ABSTRACT Nonsegmented negative-stranded RNA viruses, or members of the order Mononegavirales, share a conserved gene order and the use of elaborate transcription and replication machinery made up of at least four molecular partners. These partners have coevolved with the acquisition of the permanent encapsidation of the entire genome by the nucleoprotein (N) and the use of this N-RNA complex as a template for the viral polymerase composed of the phosphoprotein (P) and the large enzymatic protein (L). Not only is P required for polymerase function, but it also stabilizes the L protein through an unknown underlying molecular mechanism. By using NVP-AUY922 and/or 17-dimethylaminoethylamino-17-demethoxygeldanamycin as specific inhibitors of cellular heat shock protein 90 (HSP90), we found that efficient chaperoning of L by HSP90 requires P in the measles, Nipah, and vesicular stomatitis viruses. While the production of P remains unchanged in the presence of HSP90 inhibitors, the production of soluble and functional L requires both P and HSP90 activity. Measles virus P can bind the N terminus of L in the absence of HSP90 activity. Both HSP90 and P are required for the folding of L, as evidenced by a luciferase reporter insert fused within measles virus L. HSP90 acts as a true chaperon; its activity is transient and dispensable for the activity of measles and Nipah virus polymerases of virion origin. That the cellular chaperoning of a viral polymerase into a soluble functional enzyme requires the assistance of another viral protein constitutes a new paradigm that seems to be conserved within the Mononegavirales order. IMPORTANCE Viruses are obligate intracellular parasites that require a cellular environment for their replication. Some viruses particularly depend on the cellular chaperoning apparatus. We report here that for measles virus, successful chaperoning of the viral L polymerase mediated by heat shock protein 90 (HSP90) requires the presence of the viral phosphoprotein (P). Indeed, while P protein binds to the N terminus of L independently of HSP90 activity, both HSP90 and P are required to produce stable, soluble, folded, and functional L proteins. Once formed, the mature P+L complex no longer requires HSP90 to exert its polymerase functions. Such a new paradigm for the maturation of a viral polymerase appears to be conserved in several members of the Mononegavirales order, including the Nipah and vesicular stomatitis viruses. PMID:27170753

  2. HSP90 Chaperoning in Addition to Phosphoprotein Required for Folding but Not for Supporting Enzymatic Activities of Measles and Nipah Virus L Polymerases.

    PubMed

    Bloyet, Louis-Marie; Welsch, Jérémy; Enchery, François; Mathieu, Cyrille; de Breyne, Sylvain; Horvat, Branka; Grigorov, Boyan; Gerlier, Denis

    2016-08-01

    Nonsegmented negative-stranded RNA viruses, or members of the order Mononegavirales, share a conserved gene order and the use of elaborate transcription and replication machinery made up of at least four molecular partners. These partners have coevolved with the acquisition of the permanent encapsidation of the entire genome by the nucleoprotein (N) and the use of this N-RNA complex as a template for the viral polymerase composed of the phosphoprotein (P) and the large enzymatic protein (L). Not only is P required for polymerase function, but it also stabilizes the L protein through an unknown underlying molecular mechanism. By using NVP-AUY922 and/or 17-dimethylaminoethylamino-17-demethoxygeldanamycin as specific inhibitors of cellular heat shock protein 90 (HSP90), we found that efficient chaperoning of L by HSP90 requires P in the measles, Nipah, and vesicular stomatitis viruses. While the production of P remains unchanged in the presence of HSP90 inhibitors, the production of soluble and functional L requires both P and HSP90 activity. Measles virus P can bind the N terminus of L in the absence of HSP90 activity. Both HSP90 and P are required for the folding of L, as evidenced by a luciferase reporter insert fused within measles virus L. HSP90 acts as a true chaperon; its activity is transient and dispensable for the activity of measles and Nipah virus polymerases of virion origin. That the cellular chaperoning of a viral polymerase into a soluble functional enzyme requires the assistance of another viral protein constitutes a new paradigm that seems to be conserved within the Mononegavirales order. Viruses are obligate intracellular parasites that require a cellular environment for their replication. Some viruses particularly depend on the cellular chaperoning apparatus. We report here that for measles virus, successful chaperoning of the viral L polymerase mediated by heat shock protein 90 (HSP90) requires the presence of the viral phosphoprotein (P). Indeed, while P protein binds to the N terminus of L independently of HSP90 activity, both HSP90 and P are required to produce stable, soluble, folded, and functional L proteins. Once formed, the mature P+L complex no longer requires HSP90 to exert its polymerase functions. Such a new paradigm for the maturation of a viral polymerase appears to be conserved in several members of the Mononegavirales order, including the Nipah and vesicular stomatitis viruses. Copyright © 2016, American Society for Microbiology. All Rights Reserved.

  3. Direct detection of Streptococcus mutans in human dental plaque by polymerase chain reaction.

    PubMed

    Igarashi, T; Yamamoto, A; Goto, N

    1996-10-01

    Streptococcus mutans is an etiological agent in human dental caries. A method for the detection of S. mutans directly from human dental plaque by polymerase chain reaction has been developed. Oligonucleotide primers specific for a portion of the dextranase gene (dexA) of S. mutans Ingbritt (serotype c) were designed to amplify a 1272-bp DNA fragment by polymerase chain reaction. The present method specifically detected S. mutans (serotypes c, e and f), but none of the other mutans streptococci: S. cricetus (serotype a), S. rattus (serotype b), S. sobrinus (serotypes d and g), and S. downei (serotype h), other gram-positive bacteria (16 strains of 12 species of cocci and 18 strains of 12 species of bacilli) nor gram-negative bacteria (1 strain of 1 species of cocci and 20 strains of 18 species of bacilli). The method was capable of detecting 1 pg of the chromosomal DNA purified from S. mutans Ingbritt and as few as 12 colony-forming units of S. mutans cells. The S. mutans cells in human dental plaque were also directly detected. Seventy clinical isolates of S. mutans isolated from the dental plaque of 8 patients were all positive by the polymerase chain reaction. These results suggest that the dexA polymerase chain reaction is suitable for the specific detection and identification of S. mutans.

  4. The POLD3 subunit of DNA polymerase δ can promote translesion synthesis independently of DNA polymerase ζ

    PubMed Central

    Hirota, Kouji; Yoshikiyo, Kazunori; Guilbaud, Guillaume; Tsurimoto, Toshiki; Murai, Junko; Tsuda, Masataka; Phillips, Lara G.; Narita, Takeo; Nishihara, Kana; Kobayashi, Kaori; Yamada, Kouich; Nakamura, Jun; Pommier, Yves; Lehmann, Alan; Sale, Julian E.; Takeda, Shunichi

    2015-01-01

    The replicative DNA polymerase Polδ consists of a catalytic subunit POLD1/p125 and three regulatory subunits POLD2/p50, POLD3/p66 and POLD4/p12. The ortholog of POLD3 in Saccharomyces cerevisiae, Pol32, is required for a significant proportion of spontaneous and UV-induced mutagenesis through its additional role in translesion synthesis (TLS) as a subunit of DNA polymerase ζ. Remarkably, chicken DT40 B lymphocytes deficient in POLD3 are viable and able to replicate undamaged genomic DNA with normal kinetics. Like its counterpart in yeast, POLD3 is required for fully effective TLS, its loss resulting in hypersensitivity to a variety of DNA damaging agents, a diminished ability to maintain replication fork progression after UV irradiation and a significant decrease in abasic site-induced mutagenesis in the immunoglobulin loci. However, these defects appear to be largely independent of Polζ, suggesting that POLD3 makes a significant contribution to TLS independently of Polζ in DT40 cells. Indeed, combining polη, polζ and pold3 mutations results in synthetic lethality. Additionally, we show in vitro that POLD3 promotes extension beyond an abasic by the Polδ holoenzyme suggesting that while POLD3 is not required for normal replication, it may help Polδ to complete abasic site bypass independently of canonical TLS polymerases. PMID:25628356

  5. Roles of PCNA ubiquitination and TLS polymerases κ and η in the bypass of methyl methanesulfonate-induced DNA damage

    PubMed Central

    Wit, Niek; Buoninfante, Olimpia Alessandra; van den Berk, Paul C.M.; Jansen, Jacob G.; Hogenbirk, Marc A.; de Wind, Niels; Jacobs, Heinz

    2015-01-01

    Translesion synthesis (TLS) provides a highly conserved mechanism that enables DNA synthesis on a damaged template. TLS is performed by specialized DNA polymerases of which polymerase (Pol) κ is important for the cellular response to DNA damage induced by benzo[a]pyrene-7,8-dihydrodiol-9,10-epoxide (BPDE), ultraviolet (UV) light and the alkylating agent methyl methanesulfonate (MMS). As TLS polymerases are intrinsically error-prone, tight regulation of their activity is required. One level of control is provided by ubiquitination of the homotrimeric DNA clamp PCNA at lysine residue 164 (PCNA-Ub). We here show that Polκ can function independently of PCNA modification and that Polη can function as a backup during TLS of MMS-induced lesions. Compared to cell lines deficient for PCNA modification (PcnaK164R) or Polκ, double mutant cell lines display hypersensitivity to MMS but not to BPDE or UV-C. Double mutant cells also displayed delayed post-replicative TLS, accumulate higher levels of replication stress and delayed S-phase progression. Furthermore, we show that Polη and Polκ are redundant in the DNA damage bypass of MMS-induced DNA damage. Taken together, we provide evidence for PCNA-Ub-independent activation of Polκ and establish Polη as an important backup polymerase in the absence of Polκ in response to MMS-induced DNA damage. PMID:25505145

  6. Regulation of yeast DNA polymerase δ-mediated strand displacement synthesis by 5′-flaps

    PubMed Central

    Koc, Katrina N.; Stodola, Joseph L.; Burgers, Peter M.; Galletto, Roberto

    2015-01-01

    The strand displacement activity of DNA polymerase δ is strongly stimulated by its interaction with proliferating cell nuclear antigen (PCNA). However, inactivation of the 3′–5′ exonuclease activity is sufficient to allow the polymerase to carry out strand displacement even in the absence of PCNA. We have examined in vitro the basic biochemical properties that allow Pol δ-exo− to carry out strand displacement synthesis and discovered that it is regulated by the 5′-flaps in the DNA strand to be displaced. Under conditions where Pol δ carries out strand displacement synthesis, the presence of long 5′-flaps or addition in trans of ssDNA suppress this activity. This suggests the presence of a secondary DNA binding site on the enzyme that is responsible for modulation of strand displacement activity. The inhibitory effect of a long 5′-flap can be suppressed by its interaction with single-stranded DNA binding proteins. However, this relief of flap-inhibition does not simply originate from binding of Replication Protein A to the flap and sequestering it. Interaction of Pol δ with PCNA eliminates flap-mediated inhibition of strand displacement synthesis by masking the secondary DNA site on the polymerase. These data suggest that in addition to enhancing the processivity of the polymerase PCNA is an allosteric modulator of other Pol δ activities. PMID:25813050

  7. DNA Polymerase α Subunit Residues and Interactions Required for Efficient Initiation Complex Formation Identified by a Genetic Selection.

    PubMed

    Lindow, Janet C; Dohrmann, Paul R; McHenry, Charles S

    2015-07-03

    Biophysical and structural studies have defined many of the interactions that occur between individual components or subassemblies of the bacterial replicase, DNA polymerase III holoenzyme (Pol III HE). Here, we extended our knowledge of residues and interactions that are important for the first step of the replicase reaction: the ATP-dependent formation of an initiation complex between the Pol III HE and primed DNA. We exploited a genetic selection using a dominant negative variant of the polymerase catalytic subunit that can effectively compete with wild-type Pol III α and form initiation complexes, but cannot elongate. Suppression of the dominant negative phenotype was achieved by secondary mutations that were ineffective in initiation complex formation. The corresponding proteins were purified and characterized. One class of mutant mapped to the PHP domain of Pol III α, ablating interaction with the ϵ proofreading subunit and distorting the polymerase active site in the adjacent polymerase domain. Another class of mutation, found near the C terminus, interfered with τ binding. A third class mapped within the known β-binding domain, decreasing interaction with the β2 processivity factor. Surprisingly, mutations within the β binding domain also ablated interaction with τ, suggesting a larger τ binding site than previously recognized. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

  8. Ada protein-RNA polymerase sigma subunit interaction and alpha subunit-promoter DNA interaction are necessary at different steps in transcription initiation at the Escherichia coli Ada and aidB promoters.

    PubMed

    Landini, P; Bown, J A; Volkert, M R; Busby, S J

    1998-05-22

    The methylated form of the Ada protein (meAda) binds the ada and aidB promoters between 60 and 40 base pairs upstream from the transcription start and activates transcription of the Escherichia coli ada and aidB genes. This region is also a binding site for the alpha subunit of RNA polymerase and resembles the rrnB P1 UP element in A/T content and location relative to the core promoter. In this report, we show that deletion of the C-terminal domain of the alpha subunit severely decreases meAda-independent binding of RNA polymerase to ada and aidB, affecting transcription initiation at these promoters. We provide evidence that meAda activates transcription by direct interaction with the C-terminal domain of RNA polymerase sigma70 subunit (amino acids 574-613). Several negatively charged residues in the sigma70 C-terminal domain are important for transcription activation by meAda; in particular, a glutamic acid to valine substitution at position 575 has a dramatic effect on meAda-dependent transcription. Based on these observations, we propose that the role of the alpha subunit at ada and aidB is to allow initial binding of RNA polymerase to the promoters. However, transcription initiation is dependent on meAda-sigma70 interaction.

  9. A Novel RNA Polymerase I Transcription Initiation Factor, TIF-IE, Commits rRNA Genes by Interaction with TIF-IB, Not by DNA Binding

    PubMed Central

    Al-Khouri, Anna Maria; Paule, Marvin R.

    2002-01-01

    In the small, free-living amoeba Acanthamoeba castellanii, rRNA transcription requires, in addition to RNA polymerase I, a single DNA-binding factor, transcription initiation factor IB (TIF-IB). TIF-IB is a multimeric protein that contains TATA-binding protein (TBP) and four TBP-associated factors that are specific for polymerase I transcription. TIF-IB is required for accurate and promoter-specific initiation of rRNA transcription, recruiting and positioning the polymerase on the start site by protein-protein interaction. In A. castellanii, partially purified TIF-IB can form a persistent complex with the ribosomal DNA (rDNA) promoter while homogeneous TIF-IB cannot. An additional factor, TIF-IE, is required along with homogeneous TIF-IB for the formation of a stable complex on the rDNA core promoter. We show that TIF-IE by itself, however, does not bind to the rDNA promoter and thus differs in its mechanism from the upstream binding factor and upstream activating factor, which carry out similar complex-stabilizing functions in vertebrates and yeast, respectively. In addition to its presence in impure TIF-IB, TIF-IE is found in highly purified fractions of polymerase I, with which it associates. Renaturation of polypeptides excised from sodium dodecyl sulfate-polyacrylamide gels showed that a 141-kDa polypeptide possesses all the known activities of TIF-IE. PMID:11784852

  10. A novel RNA polymerase I transcription initiation factor, TIF-IE, commits rRNA genes by interaction with TIF-IB, not by DNA binding.

    PubMed

    Al-Khouri, Anna Maria; Paule, Marvin R

    2002-02-01

    In the small, free-living amoeba Acanthamoeba castellanii, rRNA transcription requires, in addition to RNA polymerase I, a single DNA-binding factor, transcription initiation factor IB (TIF-IB). TIF-IB is a multimeric protein that contains TATA-binding protein (TBP) and four TBP-associated factors that are specific for polymerase I transcription. TIF-IB is required for accurate and promoter-specific initiation of rRNA transcription, recruiting and positioning the polymerase on the start site by protein-protein interaction. In A. castellanii, partially purified TIF-IB can form a persistent complex with the ribosomal DNA (rDNA) promoter while homogeneous TIF-IB cannot. An additional factor, TIF-IE, is required along with homogeneous TIF-IB for the formation of a stable complex on the rDNA core promoter. We show that TIF-IE by itself, however, does not bind to the rDNA promoter and thus differs in its mechanism from the upstream binding factor and upstream activating factor, which carry out similar complex-stabilizing functions in vertebrates and yeast, respectively. In addition to its presence in impure TIF-IB, TIF-IE is found in highly purified fractions of polymerase I, with which it associates. Renaturation of polypeptides excised from sodium dodecyl sulfate-polyacrylamide gels showed that a 141-kDa polypeptide possesses all the known activities of TIF-IE.

  11. Regulating RNA polymerase pausing and transcription elongation in embryonic stem cells

    PubMed Central

    Min, Irene M.; Waterfall, Joshua J.; Core, Leighton J.; Munroe, Robert J.; Schimenti, John; Lis, John T.

    2011-01-01

    Transitions between pluripotent stem cells and differentiated cells are executed by key transcription regulators. Comparative measurements of RNA polymerase distribution over the genome's primary transcription units in different cell states can identify the genes and steps in the transcription cycle that are regulated during such transitions. To identify the complete transcriptional profiles of RNA polymerases with high sensitivity and resolution, as well as the critical regulated steps upon which regulatory factors act, we used genome-wide nuclear run-on (GRO-seq) to map the density and orientation of transcriptionally engaged RNA polymerases in mouse embryonic stem cells (ESCs) and mouse embryonic fibroblasts (MEFs). In both cell types, progression of a promoter-proximal, paused RNA polymerase II (Pol II) into productive elongation is a rate-limiting step in transcription of ∼40% of mRNA-encoding genes. Importantly, quantitative comparisons between cell types reveal that transcription is controlled frequently at paused Pol II's entry into elongation. Furthermore, “bivalent” ESC genes (exhibiting both active and repressive histone modifications) bound by Polycomb group complexes PRC1 (Polycomb-repressive complex 1) and PRC2 show dramatically reduced levels of paused Pol II at promoters relative to an average gene. In contrast, bivalent promoters bound by only PRC2 allow Pol II pausing, but it is confined to extremely 5′ proximal regions. Altogether, these findings identify rate-limiting targets for transcription regulation during cell differentiation. PMID:21460038

  12. Modeling qRT-PCR dynamics with application to cancer biomarker quantification.

    PubMed

    Chervoneva, Inna; Freydin, Boris; Hyslop, Terry; Waldman, Scott A

    2017-01-01

    Quantitative reverse transcription polymerase chain reaction (qRT-PCR) is widely used for molecular diagnostics and evaluating prognosis in cancer. The utility of mRNA expression biomarkers relies heavily on the accuracy and precision of quantification, which is still challenging for low abundance transcripts. The critical step for quantification is accurate estimation of efficiency needed for computing a relative qRT-PCR expression. We propose a new approach to estimating qRT-PCR efficiency based on modeling dynamics of polymerase chain reaction amplification. In contrast, only models for fluorescence intensity as a function of polymerase chain reaction cycle have been used so far for quantification. The dynamics of qRT-PCR efficiency is modeled using an ordinary differential equation model, and the fitted ordinary differential equation model is used to obtain effective polymerase chain reaction efficiency estimates needed for efficiency-adjusted quantification. The proposed new qRT-PCR efficiency estimates were used to quantify GUCY2C (Guanylate Cyclase 2C) mRNA expression in the blood of colorectal cancer patients. Time to recurrence and GUCY2C expression ratios were analyzed in a joint model for survival and longitudinal outcomes. The joint model with GUCY2C quantified using the proposed polymerase chain reaction efficiency estimates provided clinically meaningful results for association between time to recurrence and longitudinal trends in GUCY2C expression.

  13. Structural basis for the D-stereoselectivity of human DNA polymerase β

    PubMed Central

    Vyas, Rajan; Reed, Andrew J.; Raper, Austin T.; Zahurancik, Walter J.; Wallenmeyer, Petra C.

    2017-01-01

    Abstract Nucleoside reverse transcriptase inhibitors (NRTIs) with L-stereochemistry have long been an effective treatment for viral infections because of the strong D-stereoselectivity exhibited by human DNA polymerases relative to viral reverse transcriptases. The D-stereoselectivity of DNA polymerases has only recently been explored structurally and all three DNA polymerases studied to date have demonstrated unique stereochemical selection mechanisms. Here, we have solved structures of human DNA polymerase β (hPolβ), in complex with single-nucleotide gapped DNA and L-nucleotides and performed pre-steady-state kinetic analysis to determine the D-stereoselectivity mechanism of hPolβ. Beyond a similar 180° rotation of the L-nucleotide ribose ring seen in other studies, the pre-catalytic ternary crystal structures of hPolβ, DNA and L-dCTP or the triphosphate forms of antiviral drugs lamivudine ((-)3TC-TP) and emtricitabine ((-)FTC-TP) provide little structural evidence to suggest that hPolβ follows the previously characterized mechanisms of D-stereoselectivity. Instead, hPolβ discriminates against L-stereochemistry through accumulation of several active site rearrangements that lead to a decreased nucleotide binding affinity and incorporation rate. The two NRTIs escape some of the active site selection through the base and sugar modifications but are selected against through the inability of hPolβ to complete thumb domain closure. PMID:28402499

  14. Conformational Dynamics of Thermus aquaticus DNA Polymerase I during Catalysis

    PubMed Central

    Suo, Zucai

    2014-01-01

    Despite the fact that DNA polymerases have been investigated for many years and are commonly used as tools in a number of molecular biology assays, many details of the kinetic mechanism they use to catalyze DNA synthesis remain unclear. Structural and kinetic studies have characterized a rapid, pre-catalytic open-to-close conformational change of the Finger domain during nucleotide binding for many DNA polymerases including Thermus aquaticus DNA polymerase I (Taq Pol), a thermostable enzyme commonly used for DNA amplification in PCR. However, little has been done to characterize the motions of other structural domains of Taq Pol or any other DNA polymerase during catalysis. Here, we used stopped-flow Förster resonance energy transfer (FRET) to investigate the conformational dynamics of all five structural domains of the full-length Taq Pol relative to the DNA substrate during nucleotide binding and incorporation. Our study provides evidence for a rapid conformational change step induced by dNTP binding and a subsequent global conformational transition involving all domains of Taq Pol during catalysis. Additionally, our study shows that the rate of the global transition was greatly increased with the truncated form of Taq Pol lacking the N-terminal domain. Finally, we utilized a mutant of Taq Pol containing a de novo disulfide bond to demonstrate that limiting protein conformational flexibility greatly reduced the polymerization activity of Taq Pol. PMID:24931550

  15. Identification of Critical Residues for the Tight Binding of Both Correct and Incorrect Nucleotides to Human DNA Polymerase λ

    PubMed Central

    Brown, Jessica A.; Pack, Lindsey R.; Sherrer, Shanen M.; Kshetry, Ajay K.; Newmister, Sean A.; Fowler, Jason D.; Taylor, John-Stephen; Suo, Zucai

    2010-01-01

    DNA polymerase λ (Pol λ) is a novel X-family DNA polymerase that shares 34% sequence identity with DNA polymerase β (Pol β). Pre-steady state kinetic studies have shown that the Pol λ•DNA complex binds both correct and incorrect nucleotides 130-fold tighter on average than the Pol β•DNA complex, although, the base substitution fidelity of both polymerases is 10−4 to 10−5. To better understand Pol λ’s tight nucleotide binding affinity, we created single- and double-substitution mutants of Pol λ to disrupt interactions between active site residues and an incoming nucleotide or a template base. Single-turnover kinetic assays showed that Pol λ binds to an incoming nucleotide via cooperative interactions with active site residues (R386, R420, K422, Y505, F506, A510, and R514). Disrupting protein interactions with an incoming correct or incorrect nucleotide impacted binding with each of the common structural moieties in the following order: triphosphate ≫ base > ribose. In addition, the loss of Watson-Crick hydrogen bonding between the nucleotide and template base led to a moderate increase in the Kd. The fidelity of Pol λ was maintained predominantly by a single residue, R517, which has minor groove interactions with the DNA template. PMID:20851705

  16. Roles of exonucleases and translesion synthesis DNA polymerases during mitotic gap repair in yeast

    PubMed Central

    Guo, Xiaoge; Jinks-Robertson, Sue

    2013-01-01

    Transformation-based gap-repair assays have long been used to model the repair of mitotic double-strand breaks (DSBs) by homologous recombination in yeast. In the current study, we examine genetic requirements of two key processes involved in DSB repair: (1) the processive 5′-end resection that is required to efficiently engage a repair template and (2) the filling of resected ends by DNA polymerases. The specific gap-repair assay used allows repair events resolved as crossover versus noncrossover products to be distinguished, as well as the extent of heteroduplex DNA formed during recombination to be measured. To examine end resection, the efficiency and outcome of gap repair were monitored in the absence of the Exo1 exonuclease and the Sgs1 helicase. We found that either Exo1 or Sgs1 presence is sufficient to inhibit gap-repair efficiency over 10-fold, consistent with resection-mediated destruction of the introduced plasmid. In terms of DNA polymerase requirements for gap repair, we focused specifically on potential roles of the Pol ζ and Pol η translesion synthesis DNA polymerases. We found that both Pol ζ and Pol η are necessary for efficient gap repair and that each functions independently of the other. These polymerases may be either in the initiation of DNA synthesis from the an invading end, or in a gap-filling process that is required to complete recombination. PMID:24210827

  17. E2F mediates induction of the Sp1-controlled promoter of the human DNA polymerase ɛ B-subunit gene POLE2

    PubMed Central

    Huang, Deqi; Jokela, Maarit; Tuusa, Jussi; Skog, Sven; Poikonen, Kari; Syväoja, Juhani E.

    2001-01-01

    The B-subunits of replicative DNA polymerases from Archaea to humans belong to the same protein family, suggesting that they share a common fundamental function. We report here the gene structure for the B-subunit of human DNA polymerase ɛ (POLE2), whose expression and transcriptional regulation is typical for replication proteins with some unique features. The 75 bp core promoter region, located within exon 1, contains an Sp1 element that is a critical determinant of promoter activity as shown by the luciferase reporter, electrophoretic mobility shift and DNase I footprinting assays. Two overlapping E2F elements adjacent to the Sp1 element are essential for full promoter activity and serum response. Binding sites for E2F1 and NF-1 reside immediately downstream from the core promoter region. Our results suggest that human POLE2 is regulated by two E2F–pocket protein complexes, one associated with Sp1 and the other with NF-1. So far, only one replicative DNA polymerase B-subunit gene promoter, POLA2 encoding the B-subunit of DNA polymerase α, has been characterized. Mitogenic activation of the POLE2 promoter by an E2F-mediated mechanism resembles that of POLA2, but the regulation of basal promoter activity is different between these two genes. PMID:11433027

  18. Identification of amino acid residues involved in the dRP-lyase activity of human Pol ι.

    PubMed

    Miropolskaya, Nataliya; Petushkov, Ivan; Kulbachinskiy, Andrey; Makarova, Alena V

    2017-08-31

    Besides X-family DNA polymerases (first of all, Pol β) several other human DNA polymerases from Y- and A- families were shown to possess the dRP-lyase activity and could serve as backup polymerases in base excision repair (Pol ι, Rev1, Pol γ and Pol θ). However the exact position of the active sites and the amino acid residues involved in the dRP-lyase activity in Y- and A- family DNA polymerases are not known. Here we carried out functional analysis of fifteen amino acid residues possibly involved in the dRP-lyase activity of human Pol ι. We show that substitutions of residues Q59, K60 and K207 impair the dRP-lyase activity of Pol ι while residues in the HhH motif of the thumb domain are dispensable for this activity. While both K60G and K207A substitutions decrease Schiff-base intermediate formation during dRP group cleavage, the latter substitution also strongly affects the DNA polymerase activity of Pol ι, suggesting that it may impair DNA binding. These data are consistent with an important role of the N-terminal region in the dRP-lyase activity of Pol ι, with possible involvement of residues from the finger domain in the dRP group cleavage.

  19. T7 RNA polymerase-driven inducible cell lysis for DNA transfer from Escherichia coli to Bacillus subtilis.

    PubMed

    Juhas, Mario; Ajioka, James W

    2017-11-01

    The majority of the good DNA editing techniques have been developed in Escherichia coli; however, Bacillus subtilis is better host for a plethora of synthetic biology and biotechnology applications. Reliable and efficient systems for the transfer of synthetic DNA between E. coli and B. subtilis are therefore of the highest importance. Using synthetic biology approaches, such as streamlined lambda Red recombineering and Gibson Isothermal Assembly, we integrated genetic circuits pT7L123, Repr-ts-1 and pLT7pol encoding the lysis genes of bacteriophages MS2, ΦX174 and lambda, the thermosensitive repressor and the T7 RNA polymerase into the E. coli chromosome. In this system, T7 RNA polymerase regulated by the thermosensitive repressor drives the expression of the phage lysis genes. We showed that T7 RNA polymerase significantly increases efficiency of cell lysis and transfer of the plasmid and bacterial artificial chromosome-encoded DNA from the lysed E. coli into B. subtilis. The T7 RNA polymerase-driven inducible cell lysis system is suitable for the efficient cell lysis and transfer of the DNA engineered in E. coli to other naturally competent hosts, such as B. subtilis. © 2017 The Authors. Microbial Biotechnology published by John Wiley & Sons Ltd and Society for Applied Microbiology.

  20. Localized Cerebral Energy Failure in DNA Polymerase Gamma-Associated Encephalopathy Syndromes

    ERIC Educational Resources Information Center

    Tzoulis, Charalampos; Neckelmann, Gesche; Mork, Sverre J.; Engelsen, Bernt E.; Viscomi, Carlo; Moen, Gunnar; Ersland, Lars; Zeviani, Massimo; Bindoff, Laurence A.

    2010-01-01

    Mutations in the catalytic subunit of the mitochondrial DNA-polymerase gamma cause a wide spectrum of clinical disease ranging from infantile hepato-encephalopathy to juvenile/adult-onset spinocerebellar ataxia and late onset progressive external ophthalmoplegia. Several of these syndromes are associated with an encephalopathy that…

  1. INTERNAL AMPLIFICATION CONTROL FOR USE IN QUANTITATIVE POLYMERASE CHAIN REACTION FECAL INDICATOR BACTERIA ASSAYS

    EPA Science Inventory

    Quantitative polymerase chain reaction (QPCR) can be used as a rapid method for detecting fecal indicator bacteria. Because false negative results can be caused by PCR inhibitors that co-extract with the DNA samples, an internal amplification control (IAC) should be run with eac...

  2. Plasmids containing the gene for DNA polymerase I from Streptococcus pneumoniae

    DOEpatents

    Lacks, S.A.; Martinez, S.; Lopez, P.; Espinosa, M.

    1987-08-28

    A method is disclosed for cloning the gene which encodes a DNA polymerase-exonuclease of /und Streptococcus/ /und pneumoniae/. Plasmid pSM22, the vector containing the pneumococcal polA gene, facilitates the expression of 50-fold greater amounts of the PolI enzyme. 1 fig., 1 tab.

  3. Designing Polymerase Chain Reaction (PCR) Primer Multiplexes in the Forensic Laboratory

    ERIC Educational Resources Information Center

    Elkins, Kelly M.

    2011-01-01

    The polymerase chain reaction (PCR) is a common experiment in upper-level undergraduate biochemistry, molecular biology, and forensic laboratory courses as reagents and thermocyclers have become more affordable for institutions. Typically, instructors design PCR primers to amplify the region of interest and the students prepare their samples for…

  4. Polymerase Chain Reaction (PCR)-based methods for detection and identification of mycotoxigenic Penicillium species using conserved genes

    USDA-ARS?s Scientific Manuscript database

    Polymerase chain reaction amplification of conserved genes and sequence analysis provides a very powerful tool for the identification of toxigenic as well as non-toxigenic Penicillium species. Sequences are obtained by amplification of the gene fragment, sequencing via capillary electrophoresis of d...

  5. Polymerase chain reaction amplification as a diagnostic tool in culture-negative multiple-valve endocarditis.

    PubMed

    Madershahian, Navid; Strauch, Justus T; Breuer, Martin; Bruhin, Raimund; Straube, Eberhard; Wahlers, Thorsten

    2005-03-01

    We report a case of culture-negative infectious endocarditis in a 17-year-old boy in which the etiologic diagnosis could only be provided by polymerase chain reaction amplification and sequencing of the bacterial 16S rRNA gene from valve tissue.

  6. A METHOD TO REMOVE ENVIRONMENTAL INHIBITORS PRIOR TO THE DETECTION OF WATERBORNE ENTERIC VIRUSES BY REVERSE TRANSCRIPTION-POLYMERASE CHAIN REACTION

    EPA Science Inventory

    A method was developed to remove environmental inhibitors from sample concentrates prior to detection of human enteric viruses using the reverse transcription-polymerase chain reaction (RT-PCR).Environmental inhibitors, concentrated along with viruses during water sample processi...

  7. A link between transcription fidelity and pausing in vivo.

    PubMed

    Gamba, Pamela; James, Katherine; Zenkin, Nikolay

    2017-03-15

    Pausing by RNA polymerase is a major mechanism that regulates transcription elongation but can cause conflicts with fellow RNA polymerases and other cellular machineries. Here, we summarize our recent finding that misincorporation could be a major source of transcription pausing in vivo, and discuss the role of misincorporation-induced pausing.

  8. FUNGAL SPECIATION USING QUANTITATIVE POLYMERASE CHAIN REACTION (QPCR) IN PATIENTS WITH AND WITHOUT CHRONIC RHINOSINUSITIS

    EPA Science Inventory

    Objectives/Hypothesis: 1. to determine the mycology of the middle meatus using an endoscopically guided brush sampling technique and polymerase chain reaction laboratory processing of nasal mucous. 2. To compare the mycology of the middle meatus in patients with sinus disease to...

  9. Developing Inhibitors of Translesion DNA Synthesis as Therapeutic Agents Against Lung Cancer

    DTIC Science & Technology

    2014-10-01

    pol eta when replicating damaged DNA. 1S. SUBJECT TERMS: Mutagenesis, DNA polymerases, nucleoside analogs, chemotherapeutic agents 16. SECURITY ...such as polymerase eta, iota , and kappa that are involved in replicating damaged DNA. Our kinetic data obtained under Task 1B indicates that pol eta

  10. A novel mechanism of sugar selection utilized by a human X-family DNA polymerase.

    PubMed

    Brown, Jessica A; Fiala, Kevin A; Fowler, Jason D; Sherrer, Shanen M; Newmister, Sean A; Duym, Wade W; Suo, Zucai

    2010-01-15

    During DNA synthesis, most DNA polymerases and reverse transcriptases select against ribonucleotides via a steric clash between the ribose 2'-hydroxyl group and the bulky side chain of an active-site residue. In this study, we demonstrated that human DNA polymerase lambda used a novel sugar selection mechanism to discriminate against ribonucleotides, whereby the ribose 2'-hydroxyl group was excluded mostly by a backbone segment and slightly by the side chain of Y505. Such steric clash was further demonstrated to be dependent on the size and orientation of the substituent covalently attached at the ribonucleotide C2'-position. Copyright 2009 Elsevier Ltd. All rights reserved.

  11. The mechanism of nucleosome traversal by RNA polymerase II

    PubMed Central

    2011-01-01

    RNA polymerase II traverses nucleosomes rapidly and efficiently in the cell but it has not been possible to duplicate this process in the test tube. A single nucleosome has generally been found to provide a strong barrier to transcript elongation in vitro. Recent studies have shown that effective transcript elongation can occur on nucleosomal templates in vitro, but this depends on both facilitated uncoiling of DNA from the octamer surface and the presence of transcription factors that maintain polymerase in the transcriptionally competent state. These findings indicate that the efficiency and rate of transcription through chromatin could be regulated through controlled DNA uncoiling. These studies also demonstrate that nucleosome traversal need not result in nucleosome displacement. PMID:21519186

  12. A movie of the RNA polymerase nucleotide addition cycle.

    PubMed

    Brueckner, Florian; Ortiz, Julio; Cramer, Patrick

    2009-06-01

    During gene transcription, RNA polymerase (Pol) passes through repetitive cycles of adding a nucleotide to the growing mRNA chain. Here we obtained a movie of the nucleotide addition cycle by combining structural information on different functional states of the Pol II elongation complex (EC). The movie illustrates the two-step loading of the nucleoside triphosphate (NTP) substrate, closure of the active site for catalytic nucleotide incorporation, and the presumed two-step translocation of DNA and RNA, which is accompanied by coordinated conformational changes in the polymerase bridge helix and trigger loop. The movie facilitates teaching and a mechanistic analysis of transcription and can be downloaded from http://www.lmb.uni-muenchen.de/cramer/pr-materials.

  13. DISCUSSION OF "DETECTION OF CRYPTOSPORIDIUM PARVUM IN SECONDARY EFFLUENTS USING A MOST PROBABLE NUMBER-POLYMERASE CHAIN REACTION ASSAY"

    EPA Science Inventory

    The emphasis of this paper is to show that most probable number-polymerase chain reaction (MPNPCR) assay can be used to detect Cryptosporidium parvum in WWTP effluents as an alternative to immunfluorescent assay (IFA). I am concerned, however, that the paper suggests that all WW...

  14. Attenuation of foot-and-mouth disease virus by engineered viral polymerase fidelity

    USDA-ARS?s Scientific Manuscript database

    The foot-and-mouth disease virus (FMDV) RNA dependent RNA polymerase (RdRp or 3Dpol) catalyzes viral RNA synthesis. The 3Dpol is a low fidelity enzyme incapable of proofreading which results in a high mutation frequencies that allow the virus to rapidly adapt to different environments. In this study...

  15. Using the Polymerase Chain Reaction in an Undergraduate Laboratory to Produce "DNA Fingerprints."

    ERIC Educational Resources Information Center

    Phelps, Tara L.; And Others

    1996-01-01

    Presents a laboratory exercise that demonstrates the sensitivity of the Polymerase Chain Reaction as well as its potential application to forensic analysis during a criminal investigation. Can also be used to introduce, review, and integrate population and molecular genetics topics such as genotypes, multiple alleles, allelic and genotypic…

  16. Determining Annealing Temperatures for Polymerase Chain Reaction

    ERIC Educational Resources Information Center

    Porta, Angela R.; Enners, Edward

    2012-01-01

    The polymerase chain reaction (PCR) is a common technique used in high school and undergraduate science teaching. Students often do not fully comprehend the underlying principles of the technique and how optimization of the protocol affects the outcome and analysis. In this molecular biology laboratory, students learn the steps of PCR with an…

  17. Transcription factor-based biosensor

    DOEpatents

    Dietrich, Jeffrey A; Keasling, Jay D

    2013-10-08

    The present invention provides for a system comprising a BmoR transcription factor, a .sigma..sup.54-RNA polymerase, and a pBMO promoter operatively linked to a reporter gene, wherein the pBMO promoter is capable of expression of the reporter gene with an activated form of the BmoR and the .sigma..sup.54-RNA polymerase.

  18. A multiplex real-time polymerase chain reaction assay differentiates between Bolbphorus damnificus and Bolbophorus type II sp

    USDA-ARS?s Scientific Manuscript database

    A duplex quantitative real-time polymerase chain reaction (qPCR) assay was developed to differentiate between Bolbophorus damnificus and Bolbophorus type II species cercariae. Both trematode species are prevalent throughout the commercial catfish industry,.as both infect the ram’s horn snail, Plano...

  19. Polymerase matters: non-proofreading enzymes inflate fungal community richness estimates by up to 15 %

    Treesearch

    Alena K. Oliver; Shawn P. Brown; Mac A. Callaham; Ari Jumpponen

    2015-01-01

    Rare taxa overwhelm metabarcoding data generated using next-generation sequencing (NGS). Low frequency Operational Taxonomic Units (OTUs) may be artifacts generated by PCR-amplification errors resulting from polymerase mispairing. We analyzed two Internal Transcribed Spacer 2 (ITS2) MiSeq libraries generated with proofreading (ThermoScientific Phusion

  20. Real-time isothermal detection of Shiga toxin-producing Escherichia coli using recombinase polymerase amplification

    USDA-ARS?s Scientific Manuscript database

    Shiga toxin (Stx) producing E. coli (STEC) are a major family of foodborne pathogens of immense public health, zoonotic and economic significance in the US and worldwide. To date, there are no published reports on use of recombinase polymerase amplification (RPA) for STEC detection. The primary goal...

  1. Interaction of aurintricarboxylic acid (ATA) with four nucleic acid binding proteins DNase I, RNase A, reverse transcriptase and Taq polymerase

    NASA Astrophysics Data System (ADS)

    Ghosh, Utpal; Giri, Kalyan; Bhattacharyya, Nitai P.

    2009-12-01

    In the investigation of interaction of aurintricarboxylic acid (ATA) with four biologically important proteins we observed inhibition of enzymatic activity of DNase I, RNase A, M-MLV reverse transcriptase and Taq polymerase by ATA in vitro assay. As the telomerase reverse transcriptase (TERT) is the main catalytic subunit of telomerase holoenzyme, we also monitored effect of ATA on telomerase activity in vivo and observed dose-dependent inhibition of telomerase activity in Chinese hamster V79 cells treated with ATA. Direct association of ATA with DNase I ( Kd = 9.019 μM)), RNase A ( Kd = 2.33 μM) reverse transcriptase ( Kd = 0.255 μM) and Taq polymerase ( Kd = 81.97 μM) was further shown by tryptophan fluorescence quenching studies. Such association altered the three-dimensional conformation of DNase I, RNase A and Taq polymerase as detected by circular dichroism. We propose ATA inhibits enzymatic activity of the four proteins through interfering with DNA or RNA binding to the respective proteins either competitively or allosterically, i.e. by perturbing three-dimensional structure of enzymes.

  2. Mitochondrial Genes of Dinoflagellates Are Transcribed by a Nuclear-Encoded Single-Subunit RNA Polymerase.

    PubMed

    Teng, Chang Ying; Dang, Yunkun; Danne, Jillian C; Waller, Ross F; Green, Beverley R

    2013-01-01

    Dinoflagellates are a large group of algae that contribute significantly to marine productivity and are essential photosynthetic symbionts of corals. Although these algae have fully-functioning mitochondria and chloroplasts, both their organelle genomes have been highly reduced and the genes fragmented and rearranged, with many aberrant transcripts. However, nothing is known about their RNA polymerases. We cloned and sequenced the gene for the nuclear-encoded mitochondrial polymerase (RpoTm) of the dinoflagellate Heterocapsa triquetra and showed that the protein presequence targeted a GFP construct into yeast mitochondria. The gene belongs to a small gene family, which includes a variety of 3'-truncated copies that may have originated by retroposition. The catalytic C-terminal domain of the protein shares nine conserved sequence blocks with other single-subunit polymerases and is predicted to have the same fold as the human enzyme. However, the N-terminal (promoter binding/transcription initiation) domain is not well-conserved. In conjunction with the degenerate nature of the mitochondrial genome, this suggests a requirement for novel accessory factors to ensure the accurate production of functional mRNAs.

  3. Mechanisms of mutagenesis: DNA replication in the presence of DNA damage

    PubMed Central

    Liu, Binyan; Xue, Qizhen; Tang, Yong; Cao, Jia; Guengerich, F. Peter; Zhang, Huidong

    2017-01-01

    Environmental mutagens cause DNA damage that disturbs replication and produces mutations, leading to cancer and other diseases. We discuss mechanisms of mutagenesis resulting from DNA damage, from the level of DNA replication by a single polymerase to the complex DNA replisome of some typical model organisms (including bacteriophage T7, T4, Sulfolobus solfataricus, E. coli, yeast and human). For a single DNA polymerase, DNA damage can affect replication in three major ways: reducing replication fidelity, causing frameshift mutations, and blocking replication. For the DNA replisome, protein interactions and the functions of accessory proteins can yield rather different results even with a single DNA polymerase. The mechanism of mutation during replication performed by the DNA replisome is a long-standing question. Using new methods and techniques, the replisomes of certain organisms and human cell extracts can now be investigated with regard to the bypass of DNA damage. In this review, we consider the molecular mechanism of mutagenesis resulting from DNA damage in replication at the levels of single DNA polymerases and complex DNA replisomes, including translesion DNA synthesis. PMID:27234563

  4. The C-terminal priming domain is strongly associated with the main body of bacteriophage ϕ6 RNA-dependent RNA polymerase.

    PubMed

    Sarin, L Peter; Wright, Sam; Chen, Qing; Degerth, Linda H; Stuart, David I; Grimes, Jonathan M; Bamford, Dennis H; Poranen, Minna M

    2012-10-10

    Double-stranded RNA viruses encode a single protein species containing RNA-dependent RNA polymerase (RdRP) motifs. This protein is responsible for RNA transcription and replication. The architecture of viral RdRPs resembles that of a cupped right hand with fingers, palm and thumb domains. Those using de novo initiation have a flexible structural elaboration that constitutes the priming platform. Here we investigate the properties of the C-terminal priming domain of bacteriophage ϕ6 to get insights into the role of an extended loop connecting this domain to the main body of the polymerase. Proteolyzed ϕ6 RdRP that possesses a nick in the hinge region of this loop was better suited for de novo initiation. The clipped C-terminus remained associated with the main body of the polymerase via the anchor helix. The structurally flexible hinge region appeared to be involved in the control of priming platform movement. Moreover, we detected abortive initiation products for a bacteriophage RdRP. Copyright © 2012 Elsevier Inc. All rights reserved.

  5. Evidence that the respiratory syncytial virus polymerase complex associates with lipid rafts in virus-infected cells: a proteomic analysis

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    McDonald, Terence P.; Pitt, Andrew R.; Brown, Gaie

    2004-12-05

    The interaction between the respiratory syncytial virus (RSV) polymerase complex and lipid rafts was examined in HEp2 cells. Lipid-raft membranes were prepared from virus-infected cells and their protein content was analysed by Western blotting and mass spectrometry. This analysis revealed the presence of the N, P, L, M2-1 and M proteins. However, these proteins appeared to differ from one another in their association with these structures, with the M2-1 protein showing a greater partitioning into raft membranes compared to that of the N, P or M proteins. Determination of the polymerase activity profile of the gradient fractions revealed that 95%more » of the detectable viral enzyme activity was associated with lipid-raft membranes. Furthermore, analysis of virus-infected cells by confocal microscopy suggested an association between these proteins and the raft-lipid, GM1. Together, these results provide evidence that the RSV polymerase complex is able to associate with lipid rafts in virus-infected cells.« less

  6. Emergence of a replicating species from an in vitro RNA evolution reaction

    NASA Technical Reports Server (NTRS)

    Breaker, R. R.; Joyce, G. F.

    1994-01-01

    The technique of self-sustained sequence replication allows isothermal amplification of DNA and RNA molecules in vitro. This method relies on the activities of a reverse transcriptase and a DNA-dependent RNA polymerase to amplify specific nucleic acid sequences. We have modified this protocol to allow selective amplification of RNAs that catalyze a particular chemical reaction. During an in vitro RNA evolution experiment employing this modified system, a unique class of "selfish" RNAs emerged and replicated to the exclusion of the intended RNAs. Members of this class of selfish molecules, termed RNA Z, amplify efficiently despite their inability to catalyze the target chemical reaction. Their amplification requires the action of both reverse transcriptase and RNA polymerase and involves the synthesis of both DNA and RNA replication intermediates. The proposed amplification mechanism for RNA Z involves the formation of a DNA hairpin that functions as a template for transcription by RNA polymerase. This arrangement links the two strands of the DNA, resulting in the production of RNA transcripts that contain an embedded RNA polymerase promoter sequence.

  7. Structure of Hepatitis C Virus Polymerase in Complex with Primer-Template RNA

    PubMed Central

    Murakami, Eisuke; Lam, Angela M.; Grice, Rena L.; Du, Jinfa; Sofia, Michael J.; Furman, Philip A.; Otto, Michael J.

    2012-01-01

    The replication of the hepatitis C viral (HCV) genome is accomplished by the NS5B RNA-dependent RNA polymerase (RdRp), for which mechanistic understanding and structure-guided drug design efforts have been hampered by its propensity to crystallize in a closed, polymerization-incompetent state. The removal of an autoinhibitory β-hairpin loop from genotype 2a HCV NS5B increases de novo RNA synthesis by >100-fold, promotes RNA binding, and facilitated the determination of the first crystallographic structures of HCV polymerase in complex with RNA primer-template pairs. These crystal structures demonstrate the structural realignment required for primer-template recognition and elongation, provide new insights into HCV RNA synthesis at the molecular level, and may prove useful in the structure-based design of novel antiviral compounds. Additionally, our approach for obtaining the RNA primer-template-bound structure of HCV polymerase may be generally applicable to solving RNA-bound complexes for other viral RdRps that contain similar regulatory β-hairpin loops, including bovine viral diarrhea virus, dengue virus, and West Nile virus. PMID:22496223

  8. Exploratory Study of RNA Polymerase II Using Dynamic Atomic Force Microscopy

    NASA Astrophysics Data System (ADS)

    Rhodin, Thor; Umemura, Kazuo; Gad, Mohammed; Jarvis, Suzanne; Ishikawa, Mitsuru; Fu, Jianhua

    2002-03-01

    An exploratory study of the microtopological dimensions and shape features of yeast RNA polymerase II (y-poly II) on freshly cleaved mica was made in phosphate aqueous buffer solution at room temperature following previous work by Hansma and others. The molecules were imaged by stabilization on freshly cleaved mica at a limiting resolution of 10 Å and scanned using dynamical atomic force microscopy with a 10 nm multi-wall carbon nanotube in the resonance frequency modulation mode. They indicated microtopological shape and dimensional features similar to those predicted by electron density plots derived from the X-ray crystallographic model. It is concluded that this is considered primarily a feasibility study with definitive conclusions subject to more detailed systematic measurements of the 3D microtopology. These measurements appear to establish validity of the noncontact atomic force microscopy (nc-AFM) approach into defining the primary microtopology and biochemical functionality of RNA polymerase II. Further nc-AFM studies at higher resolution using dynamical nc-AFM will be required to clearly define the detailed 3D microtopology of RNA polymerase II in anaerobic aqueous environments for both static and dynamic conditions.

  9. The amino terminal extension of mammalian mitochondrial RNA polymerase ensures promoter specific transcription initiation

    PubMed Central

    Posse, Viktor; Hoberg, Emily; Dierckx, Anke; Shahzad, Saba; Koolmeister, Camilla; Larsson, Nils-Göran; Wilhelmsson, L. Marcus; Hällberg, B. Martin; Gustafsson, Claes M.

    2014-01-01

    Mammalian mitochondrial transcription is executed by a single subunit mitochondrial RNA polymerase (Polrmt) and its two accessory factors, mitochondrial transcription factors A and B2 (Tfam and Tfb2m). Polrmt is structurally related to single-subunit phage RNA polymerases, but it also contains a unique N-terminal extension (NTE) of unknown function. We here demonstrate that the NTE functions together with Tfam to ensure promoter-specific transcription. When the NTE is deleted, Polrmt can initiate transcription in the absence of Tfam, both from promoters and non-specific DNA sequences. Additionally, when in presence of Tfam and a mitochondrial promoter, the NTE-deleted mutant has an even higher transcription activity than wild-type polymerase, indicating that the NTE functions as an inhibitory domain. Our studies lead to a model according to which Tfam specifically recruits wild-type Polrmt to promoter sequences, relieving the inhibitory effect of the NTE, as a first step in transcription initiation. In the second step, Tfb2m is recruited into the complex and transcription is initiated. PMID:24445803

  10. Escherichia coli DNA contamination in AmpliTaq Gold polymerase interferes with TaqMan analysis of lacZ.

    PubMed

    Koponen, Jonna K; Turunen, Anna-Mari; Ylä-Herttuala, Seppo

    2002-03-01

    Real-time PCR is a powerful method for the quantification of gene expression in biological samples. This method uses TaqMan chemistry based on the 5' -exonuclease activity of the AmpliTaq Gold DNA polymerase which releases fluorescence from hybridized probes during synthesis of each new PCR product. Many gene therapy studies use lacZ, encoding Escherichia coli beta-galactosidase, as a marker gene. Our results demonstrate that E. coli DNA contamination in AmpliTaq Gold polymerase interferes with TaqMan analysis of lacZ gene expression and decreases sensitivity of the method below the level required for biodistribution and long-term gene expression studies. In biodistribution analyses the contamination can lead to false-negative results by masking low-level lacZ expression in target and ectopic tissues, and false-positive results if sufficient controls are not used. We conclude that, to get reliable TaqMan results with lacZ, adequate controls should be included in each run to rule out contamination from AmpliTaq Gold polymerase.

  11. Mechanisms of mutagenesis: DNA replication in the presence of DNA damage.

    PubMed

    Liu, Binyan; Xue, Qizhen; Tang, Yong; Cao, Jia; Guengerich, F Peter; Zhang, Huidong

    2016-01-01

    Environmental mutagens cause DNA damage that disturbs replication and produces mutations, leading to cancer and other diseases. We discuss mechanisms of mutagenesis resulting from DNA damage, from the level of DNA replication by a single polymerase to the complex DNA replisome of some typical model organisms (including bacteriophage T7, T4, Sulfolobus solfataricus, Escherichia coli, yeast and human). For a single DNA polymerase, DNA damage can affect replication in three major ways: reducing replication fidelity, causing frameshift mutations, and blocking replication. For the DNA replisome, protein interactions and the functions of accessory proteins can yield rather different results even with a single DNA polymerase. The mechanism of mutation during replication performed by the DNA replisome is a long-standing question. Using new methods and techniques, the replisomes of certain organisms and human cell extracts can now be investigated with regard to the bypass of DNA damage. In this review, we consider the molecular mechanism of mutagenesis resulting from DNA damage in replication at the levels of single DNA polymerases and complex DNA replisomes, including translesion DNA synthesis. Copyright © 2016 Elsevier B.V. All rights reserved.

  12. Marker-Dependent Recombination in T4 Bacteriophage. IV. Recombinational Effects of Antimutator T4 DNA Polymerase

    PubMed Central

    Shcherbakov, V. P.; Plugina, L. A.; Kudryashova, E. A.

    1995-01-01

    Recombinational effects of the antimutator allele tsL42 of gene 43 of phage T4, encoding DNA polymerase, were studied in crosses between rIIB mutants. Recombination under tsL42-restricted conditions differed from the normal one in several respects: (1) basic recombination was enhanced, especially within very short distances; (2) mismatch repair tracts were shortened, while the contribution of mismatch repair to recombination was not changed; (3) marker interference at very short distances was augmented. We infer that the T4 DNA polymerase is directly involved in mismatch repair, performing both excision of a nonmatched single strand (by its 3' -> 5' exonuclease) and filling the resulting gap. A pathway for the mismatch repair was substantiated; it includes sequential action of endo VII (gp49) -> 3'->5' exonuclease (gp43) -> DNA polymerase (gp43) -> DNA ligase (gp30). It is argued that the marker interference at very short distances may result from the same sequence of events during the final processing of recombinational intermediates. PMID:7635281

  13. Functional analysis of H. sapiens DNA polymerase γ spacer mutation W748S with and without common variant E1143G

    PubMed Central

    Palin, Eino JH; Lesonen, Annamari; Farr, Carol L; Euro, Liliya; Suomalainen, Anu; Kaguni, Laurie S

    2010-01-01

    Mitochondrial DNA polymerase, POLG, is the sole DNA polymerase found in animal mitochondria. In humans, POLGα W748S in cis with an E1143G mutation has been linked to a new type of recessive ataxia, MIRAS, which is the most common inherited ataxia in Finland. We investigated the biochemical phenotypes of the W748S amino acid change, using recombinant human POLG. We measured processive and non-processive DNA polymerase activity, DNA binding affinity, enzyme processivity, and subunit interaction with recombinant POLGβ. In addition, we studied the effects of the W748S and E1143G mutations in primary human cell cultures using retroviral transduction. Here, we examined cell viability, mitochondrial DNA copy number, and products of mitochondrial translation. Our results indicate that the W748S mutant POLGα does not exhibit a clear biochemical phenotype, making it indistinguishable from wild type POLGα and as such, fail to replicate previously published results. Furthermore, results from the cell models were concurrent with the findings from patients, and support our biochemical findings. PMID:20153822

  14. Activation of RNA polymerase III transcription of human Alu repetitive elements by adenovirus type 5: requirement for the E1b 58-kilodalton protein and the products of E4 open reading frames 3 and 6.

    PubMed Central

    Panning, B; Smiley, J R

    1993-01-01

    We found that transcription of endogenous human Alu elements by RNA polymerase III was strongly stimulated following infection of HeLa cells with adenovirus type 5, leading to the accumulation of high levels of Alu transcripts initiated from Alu polymerase III promoters. In contrast to previously reported cases of adenovirus-induced activation of polymerase III transcription, induction required the E1b 58-kDa protein and the products of E4 open reading frames 3 and 6 in addition to the 289-residue E1a protein. In addition, E1a function was not required at high multiplicities of infection, suggesting that E1a plays an indirect role in Alu activation. These results suggest previously unsuspected regulatory properties of the adenovirus E1b and E4 gene products and provide a novel approach to the study of the biology of the most abundant class of dispersed repetitive DNA in the human genome. Images PMID:7684492

  15. Engineering of a DNA Polymerase for Direct m6 A Sequencing.

    PubMed

    Aschenbrenner, Joos; Werner, Stephan; Marchand, Virginie; Adam, Martina; Motorin, Yuri; Helm, Mark; Marx, Andreas

    2018-01-08

    Methods for the detection of RNA modifications are of fundamental importance for advancing epitranscriptomics. N 6 -methyladenosine (m 6 A) is the most abundant RNA modification in mammalian mRNA and is involved in the regulation of gene expression. Current detection techniques are laborious and rely on antibody-based enrichment of m 6 A-containing RNA prior to sequencing, since m 6 A modifications are generally "erased" during reverse transcription (RT). To overcome the drawbacks associated with indirect detection, we aimed to generate novel DNA polymerase variants for direct m 6 A sequencing. Therefore, we developed a screen to evolve an RT-active KlenTaq DNA polymerase variant that sets a mark for N 6 -methylation. We identified a mutant that exhibits increased misincorporation opposite m 6 A compared to unmodified A. Application of the generated DNA polymerase in next-generation sequencing allowed the identification of m 6 A sites directly from the sequencing data of untreated RNA samples. © 2017 The Authors. Published by Wiley-VCH Verlag GmbH & Co. KGaA.

  16. [The severity of gestational diabetes mellitus affects microvascular dysfunction measured three years after pregnancy that may be related to increased oxidative stress].

    PubMed

    Horváth, Eszter Mária; Mágenheim, Rita; Domján, Beatrix Annamária; Ferencz, Viktória; Tänczer, Tímea; Szabó, Eszter; Benkő, Rita; Szabó, Csaba; Tabák, Ádám; Somogyi, Anikó

    2015-11-22

    Oxidative-nitrative stress and poly(ADP-ribose) polymerase activation observed in gestational diabetes may play role in the increased cardiovascular risk in later life. The present study aimed to examine the influence of the severity of previous gestational diabetes (insulin need) on vascular function three years after delivery. Furthermore, the authors investigated the relation of vascular function with oxidative-nitrative stress and poly(ADP-ribose) polymerase activation. Macrovascular function was measured by applanation tonometry; microvascular reactivity was assessed by provocation tests during Laser-Doppler flowmetry in 40 women who had gestational diabetes 3 years before the study. Oxidative-nitrative stress and poly(ADP-ribose) polymerase activity in blood components were determined by colorimetry and immunohistochemistry. Three years after insulin treated gestational diabetes impaired microvascular function and increased oxidative stress was observed compared to mild cases. The severity of previous gestational diabetes affects microvascular dysfunction that is accompanied by elevated oxidative stress. Nitrative stress and poly(ADP-ribose) polymerase activity correlates with certain vascular factors not related to the severity of the disease.

  17. DNA polymerase V activity is autoregulated by a novel intrinsic DNA-dependent ATPase

    PubMed Central

    Erdem, Aysen L; Jaszczur, Malgorzata; Bertram, Jeffrey G; Woodgate, Roger; Cox, Michael M; Goodman, Myron F

    2014-01-01

    Escherichia coli DNA polymerase V (pol V), a heterotrimeric complex composed of UmuD′2C, is marginally active. ATP and RecA play essential roles in the activation of pol V for DNA synthesis including translesion synthesis (TLS). We have established three features of the roles of ATP and RecA. (1) RecA-activated DNA polymerase V (pol V Mut), is a DNA-dependent ATPase; (2) bound ATP is required for DNA synthesis; (3) pol V Mut function is regulated by ATP, with ATP required to bind primer/template (p/t) DNA and ATP hydrolysis triggering dissociation from the DNA. Pol V Mut formed with an ATPase-deficient RecA E38K/K72R mutant hydrolyzes ATP rapidly, establishing the DNA-dependent ATPase as an intrinsic property of pol V Mut distinct from the ATP hydrolytic activity of RecA when bound to single-stranded (ss)DNA as a nucleoprotein filament (RecA*). No similar ATPase activity or autoregulatory mechanism has previously been found for a DNA polymerase. DOI: http://dx.doi.org/10.7554/eLife.02384.001 PMID:24843026

  18. Evaluation of immunomagnetic separation for the detection of Salmonella in surface waters by polymerase chain reaction.

    PubMed

    Hsu, Chao-Yu; Hsu, Bing-Mu; Chang, Tien-Yu; Hsu, Tsui-Kang; Shen, Shu-Min; Chiu, Yi-Chou; Wang, Hung-Jen; Ji, Wen-Tsai; Fan, Cheng-Wei; Chen, Jyh-Larng

    2014-09-19

    Salmonella spp. is associated with fecal pollution and capable of surviving for long periods in aquatic environments. Instead of the traditional, time-consuming biochemical detection, polymerase chain reaction (PCR) allows rapid identification of Salmonella directly concentrated from water samples. However, prevalence of Salmonella may be underestimated because of the vulnerability of PCR to various environmental chemicals like humic acid, compounded by the fact that various DNA polymerases have different susceptibility to humic acid. Because immunomagnetic separation (IMS) theoretically could isolate Salmonella from other microbes and facilitate removal of aquatic PCR inhibitors of different sizes, this study aims to compare the efficiency of conventional PCR combined with immunomagnetic separation (IMS) for Salmonella detection within a moderately polluted watershed. In our study, the positive rate was increased from 17.6% to 47% with nearly ten-fold improvement in the detection limit. These results suggest the sensitivity of Salmonella detection could be enhanced by IMS, particularly in low quality surface waters. Due to its effects on clearance of aquatic pollutants, IMS may be suitable for most DNA polymerases for Salmonella detection.

  19. Identification of Poly(ADP-Ribose) Polymerase as a Transcriptional Coactivator of the Human T-Cell Leukemia Virus Type 1 Tax Protein

    PubMed Central

    Anderson, Mark G.; Scoggin, Kirsten E. S.; Simbulan-Rosenthal, Cynthia M.; Steadman, Jennifer A.

    2000-01-01

    Human T-cell leukemia virus type 1 (HTLV-1) encodes a transcriptional activator, Tax, whose activity is believed to contribute significantly to cellular transformation. Tax stimulates transcription from the proviral promoter as well as from promoters for a variety of cellular genes. The mechanism through which Tax communicates to the general transcription factors and RNA polymerase II has not been completely determined. We investigated whether Tax could function directly through the general transcription factors and RNA polymerase II or if other intermediary factors or coactivators were required. Our results show that a system consisting of purified recombinant TFIIA, TFIIB, TFIIE, TFIIF, CREB, and Tax, along with highly purified RNA polymerase II, affinity-purified epitope-tagged TFIID, and semipurified TFIIH, supports basal transcription of the HTLV-1 promoter but is not responsive to Tax. Two additional activities were required for Tax to stimulate transcription. We demonstrate that one of these activities is poly(ADP-ribose) polymerase (PARP), a molecule that has been previously identified to be the transcriptional coactivator PC1. PARP functions as a coactivator in our assays at molar concentrations approximately equal to those of the DNA and equal to or less than those of the transcription factors in the assay. We further demonstrate that PARP stimulates Tax-activated transcription in vivo, demonstrating that this biochemical approach has functionally identified a novel target for the retroviral transcriptional activator Tax. PMID:10666246

  20. The p21 and PCNA partnership: a new twist for an old plot.

    PubMed

    Prives, Carol; Gottifredi, Vanesa

    2008-12-15

    The contribution of error-prone DNA polymerases to the DNA damage response has been a subject of great interest in the last decade. Error-prone polymerases are required for translesion DNA synthesis (TLS), a process that involves synthesis past a DNA lesion. Under certain circumstances, TLS polymerases can achieve bypass with good efficiency and fidelity. However, they can also in some cases be mutagenic, and so negative regulators of TLS polymerases would have the important function of inhibiting their recruitment to undamaged DNA templates. Recent work from Livneh's and our groups have provided evidence regarding the role of the cyclin kinase inhibitor p21 as a negative regulator of TLS. Interestingly, both the cyclin dependent kinase (CDK) and proliferating cell nuclear antigen (PCNA) binding domains of p21 are involved in different aspects of the modulation of TLS, affecting both the interaction between PCNA and the TLS-specific pol eta as well as PCNA ubiquitination status. In line with this, p21 was shown to reduce the efficiency but increase the accuracy of TLS. Hence, in absence of DNA damage p21 may work to impede accidental loading of pol eta to undamaged DNA and avoid consequential mutagenesis. After UV irradiation, when TLS plays a decisive role, p21 is progressively degraded. This might allow gradual release of replication fork blockage by TLS polymerases. For these reasons, in higher eukaryotes p21 might represent a key regulator of the equilibrium between mutagenesis and cell survival.

  1. Reversible stalling of transcription elongation complexes by high pressure.

    PubMed

    Erijman, L; Clegg, R M

    1998-07-01

    We have investigated the effect of high hydrostatic pressure on the stability of RNA polymerase molecules during transcription. RNA polymerase molecules participating in stalled or active ternary transcribing complexes do not dissociate from the template DNA and nascent RNA at pressures up to 180 MPa. A lower limit for the free energy of stabilization of an elongating ternary complex relative to the quaternary structure of the free RNAP molecules is estimated to be 20 kcal/mol. The rate of elongation decreases at high pressure; transcription completely halts at sufficiently high pressure. The overall rate of elongation has an apparent activation volume (DeltaVdouble dagger) of 55-65 ml . mol-1 (at 35 degrees C). The pressure-stalled transcripts are stable and resume elongation at the prepressure rate upon decompression. The efficiency of termination decreases at the rho-independent terminator tR2 after the transcription reaction has been exposed to high pressure. This suggests that high pressure modifies the ternary complex such that termination is affected in a manner different from that of elongation. The solvent and temperature dependence of the pressure-induced inhibition show evidence for major conformational changes in the core polymerase enzyme during RNA synthesis. It is proposed that the inhibition of the elongation phase of the transcription reaction at elevated pressures is related to a reduction of the partial specific volume of the RNA polymerase molecule; under high pressure, the RNA polymerase molecule does not have the necessary structural flexibility required for the protein to translocate.

  2. Roles of PCNA ubiquitination and TLS polymerases κ and η in the bypass of methyl methanesulfonate-induced DNA damage.

    PubMed

    Wit, Niek; Buoninfante, Olimpia Alessandra; van den Berk, Paul C M; Jansen, Jacob G; Hogenbirk, Marc A; de Wind, Niels; Jacobs, Heinz

    2015-01-01

    Translesion synthesis (TLS) provides a highly conserved mechanism that enables DNA synthesis on a damaged template. TLS is performed by specialized DNA polymerases of which polymerase (Pol) κ is important for the cellular response to DNA damage induced by benzo[a]pyrene-7,8-dihydrodiol-9,10-epoxide (BPDE), ultraviolet (UV) light and the alkylating agent methyl methanesulfonate (MMS). As TLS polymerases are intrinsically error-prone, tight regulation of their activity is required. One level of control is provided by ubiquitination of the homotrimeric DNA clamp PCNA at lysine residue 164 (PCNA-Ub). We here show that Polκ can function independently of PCNA modification and that Polη can function as a backup during TLS of MMS-induced lesions. Compared to cell lines deficient for PCNA modification (Pcna(K164R)) or Polκ, double mutant cell lines display hypersensitivity to MMS but not to BPDE or UV-C. Double mutant cells also displayed delayed post-replicative TLS, accumulate higher levels of replication stress and delayed S-phase progression. Furthermore, we show that Polη and Polκ are redundant in the DNA damage bypass of MMS-induced DNA damage. Taken together, we provide evidence for PCNA-Ub-independent activation of Polκ and establish Polη as an important backup polymerase in the absence of Polκ in response to MMS-induced DNA damage. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.

  3. Crystal Structure of Poliovirus 3CD Protein: Virally Encoded Protease and Precursor to the RNA-Dependent RNA Polymerase

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Marcotte,L.; Wass, A.; Gohara, D.

    2007-01-01

    Poliovirus 3CD is a multifunctional protein that serves as a precursor to the protease 3Cpro and the viral polymerase 3Dpol and also plays a role in the control of viral replication. Although 3CD is a fully functional protease, it lacks polymerase activity. We have solved the crystal structures of 3CD at a 3.4- Angstroms resolution and the G64S fidelity mutant of 3Dpol at a 3.0- Angstroms resolution. In the 3CD structure, the 3C and 3D domains are joined by a poorly ordered polypeptide linker, possibly to facilitate its cleavage, in an arrangement that precludes intramolecular proteolysis. The polymerase active sitemore » is intact in both the 3CD and the 3Dpol G64S structures, despite the disruption of a network proposed to position key residues in the active site. Therefore, changes in molecular flexibility may be responsible for the differences in fidelity and polymerase activities. Extensive packing contacts between symmetry-related 3CD molecules and the approach of the 3C domain's N terminus to the VPg binding site suggest how 3Dpol makes biologically relevant interactions with the 3C, 3CD, and 3BCD proteins that control the uridylylation of VPg during the initiation of viral replication. Indeed, mutations designed to disrupt these interfaces have pronounced effects on the uridylylation reaction in vitro.« less

  4. Development of sandwich-form biosensor to detect Mycobacterium tuberculosis complex in clinical sputum specimens.

    PubMed

    Shojaei, Taha Roodbar; Mohd Salleh, Mohamad Amran; Tabatabaei, Meisam; Ekrami, Alireza; Motallebi, Roya; Rahmani-Cherati, Tavoos; Hajalilou, Abdollah; Jorfi, Raheleh

    2014-01-01

    Mycobacterium tuberculosis, the causing agent of tuberculosis, comes second only after HIV on the list of infectious agents slaughtering many worldwide. Due to the limitations behind the conventional detection methods, it is therefore critical to develop new sensitive sensing systems capable of quick detection of the infectious agent. In the present study, the surface modified cadmium-telluride quantum dots and gold nanoparticles conjunct with two specific oligonucleotides against early secretory antigenic target 6 were used to develop a sandwich-form fluorescence resonance energy transfer-based biosensor to detect M. tuberculosis complex and differentiate M. tuberculosis and M. bovis Bacille Calmette-Guerin simultaneously. The sensitivity and specificity of the newly developed biosensor were 94.2% and 86.6%, respectively, while the sensitivity and specificity of polymerase chain reaction and nested polymerase chain reaction were considerably lower, 74.2%, 73.3% and 82.8%, 80%, respectively. The detection limits of the sandwich-form fluorescence resonance energy transfer-based biosensor were far lower (10 fg) than those of the polymerase chain reaction and nested polymerase chain reaction (100 fg). Although the cost of the developed nanobiosensor was slightly higher than those of the polymerase chain reaction-based techniques, its unique advantages in terms of turnaround time, higher sensitivity and specificity, as well as a 10-fold lower detection limit would clearly recommend this test as a more appropriate and cost-effective tool for large scale operations. Copyright © 2014 Elsevier Editora Ltda. All rights reserved.

  5. Structural Transformation of Wireframe DNA Origami via DNA Polymerase Assisted Gap-Filling.

    PubMed

    Agarwal, Nayan P; Matthies, Michael; Joffroy, Bastian; Schmidt, Thorsten L

    2018-03-27

    The programmability of DNA enables constructing nanostructures with almost any arbitrary shape, which can be decorated with many functional materials. Moreover, dynamic structures can be realized such as molecular motors and walkers. In this work, we have explored the possibility to synthesize the complementary sequences to single-stranded gap regions in the DNA origami scaffold cost effectively by a DNA polymerase rather than by a DNA synthesizer. For this purpose, four different wireframe DNA origami structures were designed to have single-stranded gap regions. This reduced the number of staple strands needed to determine the shape and size of the final structure after gap filling. For this, several DNA polymerases and single-stranded binding (SSB) proteins were tested, with T4 DNA polymerase being the best fit. The structures could be folded in as little as 6 min, and the subsequent optimized gap-filling reaction was completed in less than 3 min. The introduction of flexible gap regions results in fully collapsed or partially bent structures due to entropic spring effects. Finally, we demonstrated structural transformations of such deformed wireframe DNA origami structures with DNA polymerases including the expansion of collapsed structures and the straightening of curved tubes. We anticipate that this approach will become a powerful tool to build DNA wireframe structures more material-efficiently, and to quickly prototype and test new wireframe designs that can be expanded, rigidified, or mechanically switched. Mechanical force generation and structural transitions will enable applications in structural DNA nanotechnology, plasmonics, or single-molecule biophysics.

  6. Interactions of Escherichia coli σ70 within the transcription elongation complex

    PubMed Central

    Daube, Shirley S.; von Hippel, Peter H.

    1999-01-01

    A functional transcription elongation complex can be formed without passing through a promoter by adding a complementary RNA primer and core Escherichia coli RNA polymerase in trans to an RNA-primed synthetic bubble-duplex DNA framework. This framework consists of a double-stranded DNA sequence with an internal noncomplementary DNA “bubble” containing a hybridized RNA primer. On addition of core polymerase and the requisite NTPs, the RNA primer is extended in a process that manifests most of the properties of in vitro transcription elongation. This synthetic elongation complex can also be assembled by using holo rather than core RNA polymerase, and in this study we examine the interactions and fate of the σ70 specificity subunit of the holopolymerase in the assembly process. We show that the addition of holopolymerase to the bubble-duplex construct triggers the dissociation of the sigma factor from some complexes, whereas in others the RNA oligomer is released into solution instead. These results are consistent with an allosteric competition between σ70 and the nascent RNA strand within the elongation complex and suggest that both cannot be bound to the core polymerase simultaneously. However, the dissociation of σ70 from the complex can also be stimulated by binding of the holopolymerase to the DNA bubble duplex in the absence of a hybridized RNA primer, suggesting that the binding of the core polymerase to the bubble-duplex construct also triggers a conformational change that additionally weakens the sigma–core interaction. PMID:10411885

  7. The steric gate of DNA polymerase ι regulates ribonucleotide incorporation and deoxyribonucleotide fidelity.

    PubMed

    Donigan, Katherine A; McLenigan, Mary P; Yang, Wei; Goodman, Myron F; Woodgate, Roger

    2014-03-28

    Accurate DNA synthesis in vivo depends on the ability of DNA polymerases to select dNTPs from a nucleotide pool dominated by NTPs. High fidelity replicative polymerases have evolved to efficiently exclude NTPs while copying long stretches of undamaged DNA. However, to bypass DNA damage, cells utilize specialized low fidelity polymerases to perform translesion DNA synthesis (TLS). Of interest is human DNA polymerase ι (pol ι), which has been implicated in TLS of oxidative and UV-induced lesions. Here, we evaluate the ability of pol ι to incorporate NTPs during DNA synthesis. pol ι incorporates and extends NTPs opposite damaged and undamaged template bases in a template-specific manner. The Y39A "steric gate" pol ι mutant is considerably more active in the presence of Mn(2+) compared with Mg(2+) and exhibits a marked increase in NTP incorporation and extension, and surprisingly, it also exhibits increased dNTP base selectivity. Our results indicate that a single residue in pol ι is able to discriminate between NTPs and dNTPs during DNA synthesis. Because wild-type pol ι incorporates NTPs in a template-specific manner, certain DNA sequences may be "at risk" for elevated mutagenesis during pol ι-dependent TLS. Molecular modeling indicates that the constricted active site of wild-type pol ι becomes more spacious in the Y39A variant. Therefore, the Y39A substitution not only permits incorporation of ribonucleotides but also causes the enzyme to favor faithful Watson-Crick base pairing over mutagenic configurations.

  8. The prefoldin bud27 mediates the assembly of the eukaryotic RNA polymerases in an rpb5-dependent manner.

    PubMed

    Mirón-García, María Carmen; Garrido-Godino, Ana Isabel; García-Molinero, Varinia; Hernández-Torres, Francisco; Rodríguez-Navarro, Susana; Navarro, Francisco

    2013-01-01

    The unconventional prefoldin URI/RMP, in humans, and its orthologue in yeast, Bud27, have been proposed to participate in the biogenesis of the RNA polymerases. However, this role of Bud27 has not been confirmed and is poorly elucidated. Our data help clarify the mechanisms governing biogenesis of the three eukaryotic RNA pols. We show evidence that Bud27 is the first example of a protein that participates in the biogenesis of the three eukaryotic RNA polymerases and the first example of a protein modulating their assembly instead of their nuclear transport. In addition we demonstrate that the role of Bud27 in RNA pols biogenesis depends on Rpb5. In fact, lack of BUD27 affects growth and leads to a substantial accumulation of the three RNA polymerases in the cytoplasm, defects offset by the overexpression of RPB5. Supporting this, our data demonstrate that the lack of Bud27 affects the correct assembly of Rpb5 and Rpb6 to the three RNA polymerases, suggesting that this process occurs in the cytoplasm and is a required step prior to nuclear import. Also, our data support the view that Rpb5 and Rpb6 assemble somewhat later than the rest of the complexes. Furthermore, Bud27 Rpb5-binding but not PFD-binding domain is necessary for RNA polymerases biogenesis. In agreement, we also demonstrate genetic interactions between BUD27, RPB5, and RPB6. Bud27 shuttles between the nucleus and the cytoplasm in an Xpo1-independent manner, and also independently of microtubule polarization and possibly independently of its association with the RNA pols. Our data also suggest that the role of Bud27 in RNA pols biogenesis is independent of the chaperone prefoldin (PFD) complex and of Iwr1. Finally, the role of URI seems to be conserved in humans, suggesting conserved mechanisms in RNA pols biogenesis.

  9. 3D-QSAR and molecular docking studies on designing inhibitors of the hepatitis C virus NS5B polymerase

    NASA Astrophysics Data System (ADS)

    Li, Wenlian; Si, Hongzong; Li, Yang; Ge, Cuizhu; Song, Fucheng; Ma, Xiuting; Duan, Yunbo; Zhai, Honglin

    2016-08-01

    Viral hepatitis C infection is one of the main causes of the hepatitis after blood transfusion and hepatitis C virus (HCV) infection is a global health threat. The HCV NS5B polymerase, an RNA dependent RNA polymerase (RdRp) and an essential role in the replication of the virus, has no functional equivalent in mammalian cells. So the research and development of efficient NS5B polymerase inhibitors provides a great strategy for antiviral therapy against HCV. A combined three-dimensional quantitative structure-activity relationship (QSAR) modeling was accomplished to profoundly understand the structure-activity correlation of a train of indole-based inhibitors of the HCV NS5B polymerase to against HCV. A comparative molecular similarity indices analysis (COMSIA) model as the foundation of the maximum common substructure alignment was developed. The optimum model exhibited statistically significant results: the cross-validated correlation coefficient q2 was 0.627 and non-cross-validated r2 value was 0.943. In addition, the results of internal validations of bootstrapping and Y-randomization confirmed the rationality and good predictive ability of the model, as well as external validation (the external predictive correlation coefficient rext2 = 0.629). The information obtained from the COMSIA contour maps enables the interpretation of their structure-activity relationship. Furthermore, the molecular docking study of the compounds for 3TYV as the protein target revealed important interactions between active compounds and amino acids, and several new potential inhibitors with higher activity predicted were designed basis on our analyses and supported by the simulation of molecular docking. Meanwhile, the OSIRIS Property Explorer was introduced to help select more satisfactory compounds. The satisfactory results from this study may lay a reliable theoretical base for drug development of hepatitis C virus NS5B polymerase inhibitors.

  10. Biochemical analysis of active site mutations of human polymerase η.

    PubMed

    Suarez, Samuel C; Beardslee, Renee A; Toffton, Shannon M; McCulloch, Scott D

    2013-01-01

    DNA polymerase η (pol η) plays a critical role in suppressing mutations caused by the bypass of cis-syn cyclobutane pyrimidine dimers (CPD) that escape repair. There is evidence this is also the case for the oxidative lesion 7,8-dihydro-8-oxo-guanine (8-oxoG). Both of these lesions cause moderate to severe blockage of synthesis when encountered by replicative polymerases, while pol η displays little no to pausing during translesion synthesis. However, since lesion bypass does not remove damaged DNA from the genome and can possibly be accompanied by errors in synthesis during bypass, the process is often called 'damage tolerance' to delineate it from classical DNA repair pathways. The fidelity of lesion bypass is therefore of importance when determining how pol η suppresses mutations after DNA damage. As pol η has been implicated in numerous in vivo pathways other than lesion bypass, we wanted to better understand the molecular mechanisms involved in the relatively low-fidelity synthesis displayed by pol η. To that end, we have created a set of mutant pol η proteins each containing a single amino acid substitution in the active site and closely surrounding regions. We determined overall DNA synthesis ability as well as the efficiency and fidelity of bypass of thymine-thymine CPD (T-T CPD) and 8-oxoG containing DNA templates. Our results show that several amino acids are critical for normal polymerase function, with changes in overall activity and fidelity being observed. Of the mutants that retain polymerase activity, we demonstrate that amino acids Q38, Y52, and R61 play key roles in determining polymerase fidelity, with substation of alanine causing both increases and decreases in fidelity. Remarkably, the Q38A mutant displays increased fidelity during synthesis opposite 8-oxoG but decreased fidelity during synthesis opposite a T-T CPD. Copyright © 2013 Elsevier B.V. All rights reserved.

  11. The Prefoldin Bud27 Mediates the Assembly of the Eukaryotic RNA Polymerases in an Rpb5-Dependent Manner

    PubMed Central

    Mirón-García, María Carmen; Garrido-Godino, Ana Isabel; García-Molinero, Varinia; Hernández-Torres, Francisco; Rodríguez-Navarro, Susana; Navarro, Francisco

    2013-01-01

    The unconventional prefoldin URI/RMP, in humans, and its orthologue in yeast, Bud27, have been proposed to participate in the biogenesis of the RNA polymerases. However, this role of Bud27 has not been confirmed and is poorly elucidated. Our data help clarify the mechanisms governing biogenesis of the three eukaryotic RNA pols. We show evidence that Bud27 is the first example of a protein that participates in the biogenesis of the three eukaryotic RNA polymerases and the first example of a protein modulating their assembly instead of their nuclear transport. In addition we demonstrate that the role of Bud27 in RNA pols biogenesis depends on Rpb5. In fact, lack of BUD27 affects growth and leads to a substantial accumulation of the three RNA polymerases in the cytoplasm, defects offset by the overexpression of RPB5. Supporting this, our data demonstrate that the lack of Bud27 affects the correct assembly of Rpb5 and Rpb6 to the three RNA polymerases, suggesting that this process occurs in the cytoplasm and is a required step prior to nuclear import. Also, our data support the view that Rpb5 and Rpb6 assemble somewhat later than the rest of the complexes. Furthermore, Bud27 Rpb5-binding but not PFD-binding domain is necessary for RNA polymerases biogenesis. In agreement, we also demonstrate genetic interactions between BUD27, RPB5, and RPB6. Bud27 shuttles between the nucleus and the cytoplasm in an Xpo1-independent manner, and also independently of microtubule polarization and possibly independently of its association with the RNA pols. Our data also suggest that the role of Bud27 in RNA pols biogenesis is independent of the chaperone prefoldin (PFD) complex and of Iwr1. Finally, the role of URI seems to be conserved in humans, suggesting conserved mechanisms in RNA pols biogenesis. PMID:23459708

  12. On the early emergence of reverse transcription: theoretical basis and experimental evidence

    NASA Technical Reports Server (NTRS)

    Lazcano, A.; Valverde, V.; Hernandez, G.; Gariglio, P.; Fox, G. E.; Oro, J.

    1992-01-01

    Reverse transcriptase (RT) was first discovered as an essential catalyst in the biological cycle of retroviruses. However, in the past years evidence has accumulated showing that RTs are involved in a surprisingly large number of RNA-mediated transpositional events that include both viral and nonviral genetic entities. Although it is probable that some RT-bearing genetic elements like the different types of AIDS viruses and the mammalian LINE family have arisen in recent geological times, the possibility that reverse transcription first took place in the early Archean is supported by (1) the hypothesis that RNA preceded DNA as cellular genetic material; (2) the existence of homologous regions of the subunit tau of the E. coli DNA polymerase III with the simian immunodeficiency virus RT, the hepatitis B virus RT, and the beta' subunit of the E. coli RNA polymerase (McHenry et al. 1988); (3) the presence of several conserved motifs, including a 14-amino-acid segment that consists of an Asp-Asp pair flanked by hydrophobic amino acids, which are found in all RTs and in most cellular and viral RNA polymerases. However, whether extant RTs descend from the primitive polymerase involved in the RNA-to-DNA transition remains unproven. Substrate specificity of the AMV and HIV-1 RTs can be modified in the presence of Mn2+, a cation which allows them to add ribonucleotides to an oligo (dG) primer in a template-dependent reaction. This change in specificity is comparable to that observed under similar conditions in other nucleic acid polymerases. This experimentally induced change in RT substrate specificity may explain previous observations on the misincorporation of ribonucleotides by the Maloney murine sarcoma virus RT in the minus and plus DNA of this retrovirus (Chen and Temin 1980). Our results also suggest that HIV-infected macrophages and T-cell cells may contain mixed polynucleotides containing both ribo- and deoxyribonucleotides. The evolutionary significance of these changes in substrate specificities of nucleic acid polymerases is also discussed.

  13. NMR Structure and Dynamics of the C-terminal Domain from Human Rev1 and its Complex with Rev1 Interacting Region of DNA Polymerase η

    PubMed Central

    Pozhidaeva, Alexandra; Pustovalova, Yulia; D'Souza, Sanjay; Bezsonova, Irina; Walker, Graham C.; Korzhnev, Dmitry M.

    2013-01-01

    Rev1 is a translesion synthesis (TLS) DNA polymerase essential for DNA damage tolerance in eukaryotes. In the process of TLS stalled high-fidelity replicative DNA polymerases are temporarily replaced by specialized TLS enzymes that can bypass sites of DNA damage (lesions), thus allowing replication to continue or postreplicational gaps to be filled. Despite its limited catalytic activity, human Rev1 plays a key role in TLS by serving as a scaffold that provides an access of Y-family TLS polymerases polη, ι, and κ to their cognate DNA lesions and facilitates their subsequent exchange to polζ that extends the distorted DNA primer-template. Rev1 interaction with the other major human TLS polymerases, polη, ι, κ and the regulatory subunit Rev7 of polζ, is mediated by Rev1 C-terminal domain (Rev1-CT). We used NMR spectroscopy to determine the spatial structure of the Rev1-CT domain (residues 1157-1251) and its complex with Rev1 interacting region (RIR) from polη (residues 524-539). The domain forms a four-helix bundle with a well-structured N-terminal β-hairpin docking against helices 1 and 2, creating a binding pocket for the two conserved Phe residues of the RIR motif that upon binding folds into an α-helix. NMR spin-relaxation and NMR relaxation dispersion measurements suggest that free Rev1-CT and Rev1-CT/polη-RIR complex exhibit μs-ms conformational dynamics encompassing the RIR binding site, which might facilitate selection of the molecular configuration optimal for binding. These results offer new insights into the control of TLS in human cells by providing a structural basis for understanding the recognition of the Rev1-CT by Y-family DNA polymerases. PMID:22691049

  14. Rapid Diagnosis of Infection in the Critically Ill, a Multicenter Study of Molecular Detection in Bloodstream Infections, Pneumonia, and Sterile Site Infections*

    PubMed Central

    Brealey, David; Libert, Nicolas; Abidi, Nour Elhouda; O’Dwyer, Michael; Zacharowski, Kai; Mikaszewska-Sokolewicz, Malgorzata; Schrenzel, Jacques; Simon, François; Wilks, Mark; Picard-Maureau, Marcus; Chalfin, Donald B.; Ecker, David J.; Sampath, Rangarajan; Singer, Mervyn

    2015-01-01

    Objective: Early identification of causative microorganism(s) in patients with severe infection is crucial to optimize antimicrobial use and patient survival. However, current culture-based pathogen identification is slow and unreliable such that broad-spectrum antibiotics are often used to insure coverage of all potential organisms, carrying risks of overtreatment, toxicity, and selection of multidrug-resistant bacteria. We compared the results obtained using a novel, culture-independent polymerase chain reaction/electrospray ionization-mass spectrometry technology with those obtained by standard microbiological testing and evaluated the potential clinical implications of this technique. Design: Observational study. Setting: Nine ICUs in six European countries. Patients: Patients admitted between October 2013 and June 2014 with suspected or proven bloodstream infection, pneumonia, or sterile fluid and tissue infection were considered for inclusion. Interventions: None. Measurements and Main Results: We tested 616 bloodstream infection, 185 pneumonia, and 110 sterile fluid and tissue specimens from 529 patients. From the 616 bloodstream infection samples, polymerase chain reaction/electrospray ionization-mass spectrometry identified a pathogen in 228 cases (37%) and culture in just 68 (11%). Culture was positive and polymerase chain reaction/electrospray ionization-mass spectrometry negative in 13 cases, and both were negative in 384 cases, giving polymerase chain reaction/electrospray ionization-mass spectrometry a sensitivity of 81%, specificity of 69%, and negative predictive value of 97% at 6 hours from sample acquisition. The distribution of organisms was similar with both techniques. Similar observations were made for pneumonia and sterile fluid and tissue specimens. Independent clinical analysis of results suggested that polymerase chain reaction/electrospray ionization-mass spectrometry technology could potentially have resulted in altered treatment in up to 57% of patients. Conclusions: Polymerase chain reaction/electrospray ionization-mass spectrometry provides rapid pathogen identification in critically ill patients. The ability to rule out infection within 6 hours has potential clinical and economic benefits. PMID:26327198

  15. Co-operation between Polymerases and Nucleotide Synthetases in the RNA World.

    PubMed

    Kim, Ye Eun; Higgs, Paul G

    2016-11-01

    It is believed that life passed through an RNA World stage in which replication was sustained by catalytic RNAs (ribozymes). The two most obvious types of ribozymes are a polymerase, which uses a neighbouring strand as a template to make a complementary sequence to the template, and a nucleotide synthetase, which synthesizes monomers for use by the polymerase. When a chemical source of monomers is available, the polymerase can survive on its own. When the chemical supply of monomers is too low, nucleotide production by the synthetase is essential and the two ribozymes can only survive when they are together. Here we consider a computational model to investigate conditions under which coexistence and cooperation of these two types of ribozymes is possible. The model considers six types of strands: the two functional sequences, the complementary strands to these sequences (which are required as templates), and non-functional mutants of the two sequences (which act as parasites). Strands are distributed on a two-dimensional lattice. Polymerases replicate strands on neighbouring sites and synthetases produce monomers that diffuse in the local neighbourhood. We show that coexistence of unlinked polymerases and synthetases is possible in this spatial model under conditions in which neither sequence could survive alone; hence, there is a selective force for increasing complexity. Coexistence is dependent on the relative lengths of the two functional strands, the strand diffusion rate, the monomer diffusion rate, and the rate of deleterious mutations. The sensitivity of this two-ribozyme system suggests that evolution of a system of many types of ribozymes would be difficult in a purely spatial model with unlinked genes. We therefore speculate that linkage of genes onto mini-chromosomes and encapsulation of strands in protocells would have been important fairly early in the history of life as a means of enabling more complex systems to evolve.

  16. The fidelity of replication of the three-base-pair set adenine/thymine, hypoxanthine/cytosine and 6-thiopurine/5-methyl-2-pyrimidinone with T7 DNA polymerase

    PubMed Central

    2004-01-01

    With the goal of constructing a genetic alphabet consisting of a set of three base pairs, the fidelity of replication of the three base pairs TH (5-methyl-2-pyrimidinone)/HS (6-thiopurine; thiohypoxanthine), C/H (hypoxanthine) and T/A was evaluated using T7 DNA polymerase, a polymerase with a strong 3′→5′ exonuclease activity. An evaluation of the suitability of a new base pair for replication should include both the contribution of the fidelity of a polymerase activity and the contribution of proofreading by a 3′→5′ exonuclease activity. Using a steady-state kinetics method that included the contribution of the 3′→5′ exonuclease activity, the fidelity of replication was determined. The method determined the ratio of the apparent rate constant for the addition of a deoxynucleotide to the primer across from a template base by the polymerase activity and the rate constant for removal of the added deoxynucleotide from the primer by the 3′→5′ exonuclease activity. This ratio was designated the eni (efficiency of net incorporation). The eni of the base pair C/H was equal to or greater than the eni of T/A. The eni of the base pair TH/HS was 0.1 times that of A/T for TH in the template and 0.01 times that of A/T for HS in the template. The ratio of the eni of a mismatched deoxynucleotide to the eni of a matched deoxynucleotide was a measure of the error frequency. The error frequencies were as follows: thymine or TH opposite a template hypoxanthine, 2×10−6; HS opposite a template cytosine, <3×10−4. The remaining 24 mismatched combinations of bases gave no detectable net incorporation. Two mismatches, hypoxanthine opposite a template thymine or a template TH, showed trace incorporation in the presence of a standard dNTP complementary to the next template base. T7 DNA polymerase extended the primer beyond each of the matched base pairs of the set. The level of fidelity of replication of the three base pairs with T7 DNA polymerase suggests that they are adequate for a three-base-pair alphabet for DNA replication. PMID:15078225

  17. 5',5'''-P1, P4 diadenosine tetraphosphate (Ap4A): a putative initiator of DNA replication.

    PubMed

    Baril, E F; Coughlin, S A; Zamecnik, P C

    1985-01-01

    The proposal that Ap4A acts as an inducer of DNA replication is based primarily on two pieces of evidence (7). The intracellular levels of Ap4A increase ten- to 1000-fold as cells progress into S phase and the introduction of Ap4A into nonproliferating cells stimulated DNA synthesis. There is also some additional suggestive evidence such as the binding of Ap4A to a protein that is associated with multiprotein forms of the replicative DNA polymerase alpha and the ability of this enzyme to use Ap4A as a primer for DNA synthesis in vitro with single-stranded DNA templates. These observations have stimulated interest in the cellular metabolism of Ap4A. This is well since there is a great need for additional experimentation in order to clearly establish Ap4A as an inducer of DNA replication. Microinjection experiments of Ap4A into quiescent cells are needed in order to ascertain if Ap4A will stimulate DNA replication and possibly cell division in intact cells. Studies of the effects of nonhydrolyzable analogs of Ap4A on DNA replication in intact quiescent cells could also prove valuable. Although Ap4A can function as a primer for in vitro DNA synthesis by DNA polymerase alpha this may not be relevant in regard to its in vivo role in DNA replication. Ap4A in vivo could interact with key protein(s) in DNA replication and in this way act as an effector molecule in the initiation of DNA replication. In this regard the interaction of Ap4A with a protein associated with a multiprotein form of DNA polymerase alpha isolated from S-phase cells is of interest. More experiments are required to determine if there is a specific target protein(s) for Ap4A in vivo and what its role in DNA replication is. The cofractionation of tryptophanyl-tRNA synthetase with the replicative DNA polymerase alpha from animal and plant cells is of interest. The DNA polymerase alpha from synchronized animal cells also interacted with Ap4A. Although the plant cell alpha-like DNA polymerase did not interact with Ap4A this DNA polymerase was not a multiprotein form of polymerase alpha and the synchrony of the wheat germ embryos was not known. A possible tie between protein-synthesizing systems and the regulation of proteins involved in DNA replication may exist. The requirement of protein synthesis for the initiation of DNA replication has long been known. Also, it is well established that many temperature-sensitive mutants for tRNA synthetases are also DNA-synthesizing mutants. More investigation in this area may be warranted.(ABSTRACT TRUNCATED AT 400 WORDS)

  18. Comparison of Enterococcus quantitative polymerase chain reaction analysis results from midwest U.S. river samples using EPA Method 1611 and Method 1609 PCR reagents

    EPA Science Inventory

    The U.S. Environmental Protection Agency (EPA) has provided recommended beach advisory values in its 2012 recreational water quality criteria (RWQC) for states wishing to use quantitative polymerase chain reaction (qPCR) for the monitoring of Enterococcus fecal indicator bacteria...

  19. Identification of Brucella spp. by using the polymerase chain reaction.

    PubMed Central

    Herman, L; De Ridder, H

    1992-01-01

    The application of two synthetic oligonucleotides as probes and as primers in the polymerase chain reaction is presented for a specific, sensitive, and quick identification of Brucella spp. The specific oligonucleotide sequences were chosen on the basis of a 16S rRNA sequence alignment between Brucella abortus and Agrobacterium tumefaciens. Images PMID:1377903

  20. Detection of Listeria monocytogenes by using the polymerase chain reaction

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Bessesen, M.T.; Luo, Q.; Blaser, M.J.

    1990-09-01

    A method was developed for detection of Listeria monocytogens by polymerase chain reaction amplification followed by agarose gel electrophoresis or dot blot analysis with {sup 32}P-labeled internal probe. The technique identified 95 of 95 L. monocytogenes strains, 0 of 12 Listeria strains of other species, and 0 of 12 non-Listeria strains.

  1. Measuring ribonucleotide incorporation into DNA in vitro and in vivo.

    PubMed

    Clausen, Anders R; Williams, Jessica S; Kunkel, Thomas A

    2015-01-01

    Ribonucleotides are incorporated into genomes by DNA polymerases, they can be removed, and if not removed, they can have deleterious and beneficial consequences. Here, we describe an assay to quantify stable ribonucleotide incorporation by DNA polymerases in vitro, and an assay to probe for ribonucleotides in each of the two DNA strands of the yeast nuclear genome.

  2. Mechanism of histone survival during transcription by RNA polymerase II

    PubMed Central

    Kulaeva, Olga I

    2010-01-01

    Transcription of eukaryotic genes by RNA polymerase II is typically accompanied by minimal exchange of histones H3/H4 carrying various covalent modifications. In vitro studies suggest that histone survival is accompanied by the formation of a small transient DNA loop on the surface of the histone octamer including a molecule of transcribing enzyme. PMID:21326897

  3. Carborane-linked 2'-deoxyuridine 5'-O-triphosphate as building block for polymerase synthesis of carborane-modified DNA.

    PubMed

    Balintová, Jana; Simonova, Anna; Białek-Pietras, Magdalena; Olejniczak, Agnieszka; Lesnikowski, Zbigniew J; Hocek, Michal

    2017-11-01

    5-[(p-Carborane-2-yl)ethynyl]-2'-deoxyuridine 5'-O-triphosphate was synthesized and used as a good substrate in enzymatic construction of carborane-modified DNA or oligonucleotides containing up to 21 carborane moieties in primer extension reactions by DNA polymerases. Copyright © 2017 Elsevier Ltd. All rights reserved.

  4. Development of a rapid diagnostic assay for the detection of tomato chlorotic dwarf viroid based on isothermal reverse-transcription-recombinase polymerase amplification

    USDA-ARS?s Scientific Manuscript database

    A molecular diagnostic assay utilizing reverse transcription-recombinase polymerase amplification (RT-RPA) at an isothermal constant temperature of 39 °C and target-specific primers and probe were developed for the rapid, sensitive, and specific detection of tomato chlorotic dwarf viroid (TCDVd) in ...

  5. Purification and Characterization of Taq Polymerase: A 9-Week Biochemistry Laboratory Project for Undergraduate Students

    ERIC Educational Resources Information Center

    Bellin, Robert M.; Bruno, Mary K.; Farrow, Melissa A.

    2010-01-01

    We have developed a 9-week undergraduate laboratory series focused on the purification and characterization of "Thermus aquaticus" DNA polymerase (Taq). Our aim was to provide undergraduate biochemistry students with a full-semester continuing project simulating a research-like experience, while having each week's procedure focus on a single…

  6. Fluorochrome-functionalized magnetic nanoparticles for high-sensitivity monitoring of the polymerase chain reaction by magnetic resonance.

    PubMed

    Alcantara, David; Guo, Yanyan; Yuan, Hushan; Goergen, Craig J; Chen, Howard H; Cho, Hoonsung; Sosnovik, David E; Josephson, Lee

    2012-07-09

    Easy to find: magnetic nanoparticles bearing fluorochromes (red) that intercalate with DNA (green) form microaggregates with DNA generated by the polymerase chain reaction (PCR). These aggregates can be detected at low cycle numbers by magnetic resonance (MR). Copyright © 2012 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  7. 9 CFR 145.33 - Terminology and classification; flocks and products.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    .... Such action shall not be taken until a thorough investigation has been made by the Service and the.... gallisepticum as provided in § 145.14(b), or by a polymerase chain reaction (PCR)-based procedure approved by...(b) or by a polymerase chain reaction (PCR)-based procedure approved by the Department. If fewer than...

  8. Getting it Right: How DNA Polymerases Select the Right Nucleotide.

    PubMed

    Ludmann, Samra; Marx, Andreas

    2016-01-01

    All living organisms are defined by their genetic code encrypted in their DNA. DNA polymerases are the enzymes that are responsible for all DNA syntheses occurring in nature. For DNA replication, repair and recombination these enzymes have to read the parental DNA and recognize the complementary nucleotide out of a pool of four structurally similar deoxynucleotide triphosphates (dNTPs) for a given template. The selection of the nucleotide is in accordance with the Watson-Crick rule. In this process the accuracy of DNA synthesis is crucial for the maintenance of the genome stability. However, to spur evolution a certain degree of freedom must be allowed. This brief review highlights the mechanistic basis for selecting the right nucleotide by DNA polymerases.

  9. Mechanical Properties of Transcription

    NASA Astrophysics Data System (ADS)

    Sevier, Stuart A.; Levine, Herbert

    2017-06-01

    The mechanical properties of transcription have recently been shown to play a central role in gene expression. However, a full physical characterization of this central biological process is lacking. In this Letter, we introduce a simple description of the basic physical elements of transcription where RNA elongation, RNA polymerase rotation, and DNA supercoiling are coupled. The resulting framework describes the relative amount of RNA polymerase rotation and DNA supercoiling that occurs during RNA elongation. Asymptotic behavior is derived and can be used to experimentally extract unknown mechanical parameters of transcription. Mechanical limits to transcription are incorporated through the addition of a DNA supercoiling-dependent RNA polymerase velocity. This addition can lead to transcriptional stalling and resulting implications for gene expression, chromatin structure and genome organization are discussed.

  10. Trypanosome RNA polymerases and transcription factors: sensible trypanocidal drug targets?

    PubMed

    Vanhamme, Luc

    2008-11-01

    Trypanosomes and Leishmaniae are the agents of several important parasitic diseases threatening hundreds of million human beings worldwide. As they diverged early in evolution, they display original molecular characteristics. These peculiarities are each defining putative specific targets for anti-parasitic drugs. Transcription displays its lot of unique characteristics in trypanosomes and will be taken as an example to uncover these targets. Unique features of transcription in trypanosomes include constitutive and poly-cistronic transcription by RNA polymerase II as well as transcription of protein-coding genes by RNA polymerase I. It is becoming clear that these unique mechanisms are performed by dedicated molecular players. The first of them have been recently characterized. They are reviewed and their suitability as drug targets is commented.

  11. Geographic variation in marine turtle fibropapillomatosis

    USGS Publications Warehouse

    Greenblatt, R.J.; Work, Thierry M.; Dutton, P.; Sutton, C.A.; Spraker, T.R.; Casey, R.N.; Diez, C.E.; Parker, Dana C.; St. Ledger, J.; Balazs, G.H.; Casey, J.W.

    2005-01-01

    We document three examples of fibropapillomatosis by histology, quantitative polymerase chain reaction (qPCR), and sequence analysis from three different geographic areas. Tumors compatible in morphology with fibropapillomatosis were seen in green turtles from Puerto Rico and San Diego (California) and in a hybrid loggerhead/ hawksbill turtle from Florida Bay (Florida). Tumors were confirmed as fibropapillomas on histology, although severity of disease varied between cases. Polymerase chain reaction (PCR) analyses revealed infection with the fibropapilloma-associated turtle herpesvirus (FPTHV) in all cases, albeit at highly variable copy numbers per cell. Alignment of a portion of the polymerase gene from each fibropapilloma-associated turtle herpesvirus isolate demonstrated geographic variation in sequence. These cases illustrate geographic variation in both the pathology and the virology of fibropapillomatosis.

  12. Geographic variation in marine turtle fibropapillomatosis.

    PubMed

    Greenblatt, Rebecca J; Work, Thierry M; Dutton, Peter; Sutton, Claudia A; Spraker, Terry R; Casey, Rufina N; Diez, Carlos E; Parker, Denise; St Leger, Judy; Balazs, George H; Casey, James W

    2005-09-01

    We document three examples of fibropapillomatosis by histology, quantitative polymerase chain reaction (qPCR), and sequence analysis from three different geographic areas. Tumors compatible in morphology with fibropapillomatosis were seen in green turtles from Puerto Rico and San Diego (California) and in a hybrid loggerhead/ hawksbill turtle from Florida Bay (Florida). Tumors were confirmed as fibropapillomas on histology, although severity of disease varied between cases. Polymerase chain reaction (PCR) analyses revealed infection with the fibropapilloma-associated turtle herpesvirus (FPTHV) in all cases, albeit at highly variable copy numbers per cell. Alignment of a portion of the polymerase gene from each fibropapilloma-associated turtle herpesvirus isolate demonstrated geographic variation in sequence. These cases illustrate geographic variation in both the pathology and the virology of fibropapillomatosis.

  13. Intrinsic Flexibility of Ubiquitin on Proliferating Cell Nuclear Antigen (PCNA) in Translesion Synthesis*

    PubMed Central

    Hibbert, Richard G.; Sixma, Titia K.

    2012-01-01

    Ubiquitin conjugation provides a crucial signaling role in hundreds of cellular pathways; however, a structural understanding of ubiquitinated substrates is lacking. One important substrate is monoubiquitinated PCNA (PCNA-Ub), which signals for recruitment of damage-tolerant polymerases in the translesion synthesis (TLS) pathway of DNA damage avoidance. We use a novel and efficient enzymatic method to produce PCNA-Ub at high yield with a native isopeptide bond and study its Usp1/UAF1-dependent deconjugation. In solution we find that the ubiquitin moiety is flexible relative to the PCNA, with its hydrophobic patch mostly accessible for recruitment of TLS polymerases, which promotes the interaction with polymerase η. The studies are a prototype for the nature of the ubiquitin modification. PMID:22989887

  14. Coordinated Gene Regulation in the Initial Phase of Salt Stress Adaptation*

    PubMed Central

    Vanacloig-Pedros, Elena; Bets-Plasencia, Carolina; Pascual-Ahuir, Amparo; Proft, Markus

    2015-01-01

    Stress triggers complex transcriptional responses, which include both gene activation and repression. We used time-resolved reporter assays in living yeast cells to gain insights into the coordination of positive and negative control of gene expression upon salt stress. We found that the repression of “housekeeping” genes coincides with the transient activation of defense genes and that the timing of this expression pattern depends on the severity of the stress. Moreover, we identified mutants that caused an alteration in the kinetics of this transcriptional control. Loss of function of the vacuolar H+-ATPase (vma1) or a defect in the biosynthesis of the osmolyte glycerol (gpd1) caused a prolonged repression of housekeeping genes and a delay in gene activation at inducible loci. Both mutants have a defect in the relocation of RNA polymerase II complexes at stress defense genes. Accordingly salt-activated transcription is delayed and less efficient upon partially respiratory growth conditions in which glycerol production is significantly reduced. Furthermore, the loss of Hog1 MAP kinase function aggravates the loss of RNA polymerase II from housekeeping loci, which apparently do not accumulate at inducible genes. Additionally the Def1 RNA polymerase II degradation factor, but not a high pool of nuclear polymerase II complexes, is needed for efficient stress-induced gene activation. The data presented here indicate that the finely tuned transcriptional control upon salt stress is dependent on physiological functions of the cell, such as the intracellular ion balance, the protective accumulation of osmolyte molecules, and the RNA polymerase II turnover. PMID:25745106

  15. Regulation and Modulation of Human DNA Polymerase δ Activity and Function

    PubMed Central

    Wang, Xiaoxiao; Zhang, Sufang; Zhang, Zhongtao; Lee, Ernest Y. C.

    2017-01-01

    This review focuses on the regulation and modulation of human DNA polymerase δ (Pol δ). The emphasis is on the mechanisms that regulate the activity and properties of Pol δ in DNA repair and replication. The areas covered are the degradation of the p12 subunit of Pol δ, which converts it from a heterotetramer (Pol δ4) to a heterotrimer (Pol δ3), in response to DNA damage and also during the cell cycle. The biochemical mechanisms that lead to degradation of p12 are reviewed, as well as the properties of Pol δ4 and Pol δ3 that provide insights into their functions in DNA replication and repair. The second focus of the review involves the functions of two Pol δ binding proteins, polymerase delta interaction protein 46 (PDIP46) and polymerase delta interaction protein 38 (PDIP38), both of which are multi-functional proteins. PDIP46 is a novel activator of Pol δ4, and the impact of this function is discussed in relation to its potential roles in DNA replication. Several new models for the roles of Pol δ3 and Pol δ4 in leading and lagging strand DNA synthesis that integrate a role for PDIP46 are presented. PDIP38 has multiple cellular localizations including the mitochondria, the spliceosomes and the nucleus. It has been implicated in a number of cellular functions, including the regulation of specialized DNA polymerases, mitosis, the DNA damage response, mouse double minute 2 homolog (Mdm2) alternative splicing and the regulation of the NADPH oxidase 4 (Nox4). PMID:28737709

  16. Quality control mechanisms exclude incorrect polymerases from the eukaryotic replication fork

    PubMed Central

    Schauer, Grant D.; O’Donnell, Michael E.

    2017-01-01

    The eukaryotic genome is primarily replicated by two DNA polymerases, Pol ε and Pol δ, that function on the leading and lagging strands, respectively. Previous studies have established recruitment mechanisms whereby Cdc45-Mcm2-7-GINS (CMG) helicase binds Pol ε and tethers it to the leading strand, and PCNA (proliferating cell nuclear antigen) binds tightly to Pol δ and recruits it to the lagging strand. The current report identifies quality control mechanisms that exclude the improper polymerase from a particular strand. We find that the replication factor C (RFC) clamp loader specifically inhibits Pol ε on the lagging strand, and CMG protects Pol ε against RFC inhibition on the leading strand. Previous studies show that Pol δ is slow and distributive with CMG on the leading strand. However, Saccharomyces cerevisiae Pol δ–PCNA is a rapid and processive enzyme, suggesting that CMG may bind and alter Pol δ activity or position it on the lagging strand. Measurements of polymerase binding to CMG demonstrate Pol ε binds CMG with a Kd value of 12 nM, but Pol δ binding CMG is undetectable. Pol δ, like bacterial replicases, undergoes collision release upon completing replication, and we propose Pol δ–PCNA collides with the slower CMG, and in the absence of a stabilizing Pol δ–CMG interaction, the collision release process is triggered, ejecting Pol δ on the leading strand. Hence, by eviction of incorrect polymerases at the fork, the clamp machinery directs quality control on the lagging strand and CMG enforces quality control on the leading strand. PMID:28069954

  17. Identification of an Unfolding Intermediate for a DNA Lesion Bypass Polymerase

    PubMed Central

    Sherrer, Shanen M.; Maxwell, Brian A.; Pack, Lindsey R.; Fiala, Kevin A.; Fowler, Jason D.; Zhang, Jun; Suo, Zucai

    2012-01-01

    Sulfolobus solfataricusDNA Polymerase IV (Dpo4), a prototype Y-family DNA polymerase, has been well characterized biochemically and biophysically at 37 °C or lower temperatures. However, the physiological temperature of the hyperthermophile S. solfataricus is approximately 80 °C. With such a large discrepancy in temperature, the in vivo relevance of these in vitro studies of Dpo4 has been questioned. Here, we employed circular dichroism spectroscopy and fluorescence-based thermal scanning to investigate the secondary structural changes of Dpo4 over a temperature range from 26 to 119 °C. Dpo4 was shown to display a high melting temperature characteristic of hyperthermophiles. Unexpectedly, the Little Finger domain of Dpo4, which is only found in the Y-family DNA polymerases, was shown to be more thermostable than the polymerase core. More interestingly, Dpo4 exhibited a three-state cooperative unfolding profile with an unfolding intermediate. The linker region between the Little Finger and Thumb domains of Dpo4 was found to be a source of structural instability. Through site-directed mutagenesis, the interactions between the residues in the linker region and the Palm domain were identified to play a critical role in the formation of the unfolding intermediate. Notably, the secondary structure of Dpo4 was not altered when the temperature was increased from 26 to 87.5 °C. Thus, in addition to providing structural insights into the thermal stability and an unfolding intermediate of Dpo4, our work also validated the relevance of the in vitro studies of Dpo4 performed at temperatures significantly lower than 80 °C. PMID:22667759

  18. The Steric Gate of DNA Polymerase ι Regulates Ribonucleotide Incorporation and Deoxyribonucleotide Fidelity*

    PubMed Central

    Donigan, Katherine A.; McLenigan, Mary P.; Yang, Wei; Goodman, Myron F.; Woodgate, Roger

    2014-01-01

    Accurate DNA synthesis in vivo depends on the ability of DNA polymerases to select dNTPs from a nucleotide pool dominated by NTPs. High fidelity replicative polymerases have evolved to efficiently exclude NTPs while copying long stretches of undamaged DNA. However, to bypass DNA damage, cells utilize specialized low fidelity polymerases to perform translesion DNA synthesis (TLS). Of interest is human DNA polymerase ι (pol ι), which has been implicated in TLS of oxidative and UV-induced lesions. Here, we evaluate the ability of pol ι to incorporate NTPs during DNA synthesis. pol ι incorporates and extends NTPs opposite damaged and undamaged template bases in a template-specific manner. The Y39A “steric gate” pol ι mutant is considerably more active in the presence of Mn2+ compared with Mg2+ and exhibits a marked increase in NTP incorporation and extension, and surprisingly, it also exhibits increased dNTP base selectivity. Our results indicate that a single residue in pol ι is able to discriminate between NTPs and dNTPs during DNA synthesis. Because wild-type pol ι incorporates NTPs in a template-specific manner, certain DNA sequences may be “at risk” for elevated mutagenesis during pol ι-dependent TLS. Molecular modeling indicates that the constricted active site of wild-type pol ι becomes more spacious in the Y39A variant. Therefore, the Y39A substitution not only permits incorporation of ribonucleotides but also causes the enzyme to favor faithful Watson-Crick base pairing over mutagenic configurations. PMID:24532793

  19. Single-molecule FRET reveals a corkscrew RNA structure for the polymerase-bound influenza virus promoter.

    PubMed

    Tomescu, Alexandra I; Robb, Nicole C; Hengrung, Narin; Fodor, Ervin; Kapanidis, Achillefs N

    2014-08-12

    The influenza virus is a major human and animal pathogen responsible for seasonal epidemics and occasional pandemics. The genome of the influenza A virus comprises eight segments of single-stranded, negative-sense RNA with highly conserved 5' and 3' termini. These termini interact to form a double-stranded promoter structure that is recognized and bound by the viral RNA-dependent RNA polymerase (RNAP); however, no 3D structural information for the influenza polymerase-bound promoter exists. Functional studies have led to the proposal of several 2D models for the secondary structure of the bound promoter, including a corkscrew model in which the 5' and 3' termini form short hairpins. We have taken advantage of an insect-cell system to prepare large amounts of active recombinant influenza virus RNAP, and used this to develop a highly sensitive single-molecule FRET assay to measure distances between fluorescent dyes located on the promoter and map its structure both with and without the polymerase bound. These advances enabled the direct analysis of the influenza promoter structure in complex with the viral RNAP, and provided 3D structural information that is in agreement with the corkscrew model for the influenza virus promoter RNA. Our data provide insights into the mechanisms of promoter binding by the influenza RNAP and have implications for the understanding of the regulatory mechanisms involved in the transcription of viral genes and replication of the viral RNA genome. In addition, the simplicity of this system should translate readily to the study of any virus polymerase-promoter interaction.

  20. Reducing nontemplated 3' nucleotide addition to polynucleotide transcripts

    DOEpatents

    Kao, C. Cheng

    2000-01-01

    Non-template 3' nucleotide addition to a transcript is reduced by transcribing a transcript from a template comprising an ultimate and/or penultimate 5' ribose having a C'2 substituent such as methoxy, which reduces non-template 3' nucleotide addition to the transcript. The methods are shown to be applicable to a wide variety of polymerases, including Taq, T7 RNA polymerase, etc.

Top