The effects of polymorphisms in 7 candidate genes on resistance to Salmonella Enteritidis in native chickens.

PubMed

Tohidi, R; Idris, I B; Malar Panandam, J; Hair Bejo, M

2013-04-01

Salmonella enterica serovar Enteritidis infection is a common concern in poultry production for its negative effects on growth as well as food safety for humans. Identification of molecular markers that are linked to resistance to Salmonella Enteritidis may lead to appropriate solutions to control Salmonella infection in chickens. This study investigated the association of candidate genes with resistance to Salmonella Enteritidis in young chickens. Two native breeds of Malaysian chickens, namely, Village Chickens and Red Junglefowl, were evaluated for bacterial colonization after Salmonella Enteritidis inoculation. Seven candidate genes were selected on the basis of their physiological role in immune response, as determined by prior studies in other genetic lines: natural resistance-associated protein 1 (NRAMP1), transforming growth factor β3 (TGFβ3), transforming growth factor β4 (TGFβ4), inhibitor of apoptosis protein 1 (IAP1), caspase 1 (CASP1), lipopolysaccharide-induced tumor necrosis factor (TNF) α factor (LITAF), and TNF-related apoptosis-inducing ligand (TRAIL). Polymerase chain reaction-RFLP was used to identify polymorphisms in the candidate genes; all genes exhibited polymorphisms in at least one breed. The NRAMP1-SacI polymorphism correlated with the differences in Salmonella Enteritidis load in the cecum (P = 0.002) and spleen (P = 0.01) of Village Chickens. Polymorphisms in the restriction sites of TGFβ3-BsrI, TGFβ4-MboII, and TRAIL-StyI were associated with Salmonella Enteritidis burden in the cecum, spleen, and liver of Village Chickens and Red Junglefowl (P < 0.05). These results indicate that the NRAMP1, TGFβ3, TGFβ4, and TRAIL genes are potential candidates for use in selection programs for increasing genetic resistance against Salmonella Enteritidis in native Malaysian chickens.

A Family-Based Association Analysis and Meta-Analysis of the Reading Disabilities Candidate Gene DYX1C1

PubMed Central

Tran, C.; Gagnon, F.; Wigg, K.G.; Feng, Y.; Gomez, L.; Cate-Carter, T.D.; Kerr, E.N.; Field, L.L.; Kaplan, B.J.; Lovett, M.W.; Barr, C.L.

2017-01-01

Reading disabilities (RD) have a significant genetic basis and have shown linkage to multiple regions including chromosome 15q. Dyslexia susceptibility 1 candidate gene 1 (DYX1C1) on chromosome 15q21 was originally proposed as a candidate gene with two potentially functional polymorphisms at the −3G/A and 1249G/T positions showing association with RD. However, subsequent studies have yielded mixed results. We performed a literature review and meta-analysis of the −3G/A and 1249G/T polymorphisms, including new unpublished data from two family-based samples. Ten markers in DYX1C1 were genotyped in the two independently ascertained samples. Single marker and −3G/A:1249G/T haplotype analyses were performed for RD in both samples, and quantitative trait analyses using standardized reading-related measures was performed in one of the samples. For the meta-analysis, we used a random-effects model to summarize studies that tested for association between −3G/A or 1249G/T and RD. No significant association was found between the DYX1C1 SNPs and RD or any of the reading-related measures tested after correction for the number of tests performed. The previously reported risk haplotype (−3A:1249T) was not biased in transmission. A total of 9 and 10 study samples were included in the meta-analysis of the −3G/A and 1249G/T polymorphisms, respectively. Neither polymorphism reached statistical significance, but the heterogeneity for the 1249G/T polymorphism was high. The results of this study do not provide evidence for association between the putatively functional SNPs −3G/A and 1249G/T and RD. PMID:23341075

Clinical application of antidepressant pharmacogenetics: considerations for the design of future studies.

PubMed

Fabbri, Chiara; Serretti, Alessandro

2018-06-12

A frustrating inertia has affected the development of clinical applications of antidepressant pharmacogenetics and personalized treatments of depression are still lacking 20 years after the first findings. Candidate gene studies provided replicated findings for some polymorphisms, but each of them shows at best a small effect on antidepressant efficacy and the cumulative effect of different polymorphisms is unclear. Further, no candidate was immune by at least some negative studies. These considerations give rise to some concerns about the clinical benefits of currently available pharmacogenetic tests since they are based on the results of candidate gene studies. Clinical guidelines in fact suggest that only polymorphisms that alter cytochrome 2D6 or 2C19 enzymatic activity probably provide useful clinical indications, while variants in genes involved in antidepressant pharmacodynamics have no recommended clinical applications. The present review discusses possible strategies to facilitate the identification of genetic biomarkers with clinical usefulness in guiding antidepressant treatments. These include analysis methods for the study of the polygenic/omnigenic nature of antidepressant response, the prioritization of polymorphisms on the basis of functional considerations, the incorporation of clinical-demographic predictors in pharmacogenetic studies (e.g. mixed polygenic and clinical risk scores), the application of methodological improvements to the design of future studies in order to maximize the comparability of results and improve power. Copyright © 2018. Published by Elsevier B.V.

Polymorphisms in the AOX2 gene are associated with the rooting ability of olive cuttings.

PubMed

Hedayati, Vahideh; Mousavi, Amir; Razavi, Khadijeh; Cultrera, Nicolò; Alagna, Fiammetta; Mariotti, Roberto; Hosseini-Mazinani, Mehdi; Baldoni, Luciana

2015-07-01

Different rooting ability candidate genes were tested on an olive cross progeny. Our results demonstrated that only the AOX2 gene was strongly induced. OeAOX2 was fully characterised and correlated to phenotypical traits. The formation of adventitious roots is a key step in the vegetative propagation of trees crop species, and this ability is under strict genetic control. While numerous studies have been carried out to identify genes controlling adventitious root formation, only a few loci have been characterised. In this work, candidate genes that were putatively involved in rooting ability were identified in olive (Olea europaea L.) by similarity with orthologs identified in other plant species. The mRNA levels of these genes were analysed by real-time PCR during root induction in high- (HR) and low-rooting (LR) individuals. Interestingly, alternative oxidase 2 (AOX2), which was previously reported to be a functional marker for rooting in olive cuttings, showed a strong induction in HR individuals. From the OeAOX2 full-length gene, alleles and effective polymorphisms were distinguished and analysed in the cross progeny, which were segregated based on rooting. The results revealed a possible correlation between two single nucleotide polymorphisms of OeAOX2 gene and rooting ability.

Replication and validation of genetic polymorphisms associated with survival after allogeneic blood or marrow transplant

PubMed Central

Karaesmen, Ezgi; Rizvi, Abbas A.; Preus, Leah M.; McCarthy, Philip L.; Pasquini, Marcelo C.; Onel, Kenan; Zhu, Xiaochun; Spellman, Stephen; Haiman, Christopher A.; Stram, Daniel O.; Pooler, Loreall; Sheng, Xin; Zhu, Qianqian; Yan, Li; Liu, Qian; Hu, Qiang; Webb, Amy; Brock, Guy; Clay-Gilmour, Alyssa I.; Battaglia, Sebastiano; Tritchler, David; Liu, Song; Hahn, Theresa

2017-01-01

Multiple candidate gene-association studies of non-HLA single-nucleotide polymorphisms (SNPs) and outcomes after blood or marrow transplant (BMT) have been conducted. We identified 70 publications reporting 45 SNPs in 36 genes significantly associated with disease-related mortality, progression-free survival, transplant-related mortality, and/or overall survival after BMT. Replication and validation of these SNP associations were performed using DISCOVeRY-BMT (Determining the Influence of Susceptibility COnveying Variants Related to one-Year mortality after BMT), a well-powered genome-wide association study consisting of 2 cohorts, totaling 2888 BMT recipients with acute myeloid leukemia, acute lymphoblastic leukemia, or myelodysplastic syndrome, and their HLA-matched unrelated donors, reported to the Center for International Blood and Marrow Transplant Research. Gene-based tests were used to assess the aggregate effect of SNPs on outcome. None of the previously reported significant SNPs replicated at P < .05 in DISCOVeRY-BMT. Validation analyses showed association with one previously reported donor SNP at P < .05 and survival; more associations would be anticipated by chance alone. No gene-based tests were significant at P < .05. Functional annotation with publicly available data shows these candidate SNPs most likely do not have biochemical function; only 13% of candidate SNPs correlate with gene expression or are predicted to impact transcription factor binding. Of these, half do not impact the candidate gene of interest; the other half correlate with expression of multiple genes. These findings emphasize the peril of pursing candidate approaches and the importance of adequately powered tests of unbiased genome-wide associations with BMT clinical outcomes given the ultimate goal of improving patient outcomes. PMID:28811306

Genome-wide generation and use of informative intron-spanning and intron-length polymorphism markers for high-throughput genetic analysis in rice

PubMed Central

Badoni, Saurabh; Das, Sweta; Sayal, Yogesh K.; Gopalakrishnan, S.; Singh, Ashok K.; Rao, Atmakuri R.; Agarwal, Pinky; Parida, Swarup K.; Tyagi, Akhilesh K.

2016-01-01

We developed genome-wide 84634 ISM (intron-spanning marker) and 16510 InDel-fragment length polymorphism-based ILP (intron-length polymorphism) markers from genes physically mapped on 12 rice chromosomes. These genic markers revealed much higher amplification-efficiency (80%) and polymorphic-potential (66%) among rice accessions even by a cost-effective agarose gel-based assay. A wider level of functional molecular diversity (17–79%) and well-defined precise admixed genetic structure was assayed by 3052 genome-wide markers in a structured population of indica, japonica, aromatic and wild rice. Six major grain weight QTLs (11.9–21.6% phenotypic variation explained) were mapped on five rice chromosomes of a high-density (inter-marker distance: 0.98 cM) genetic linkage map (IR 64 x Sonasal) anchored with 2785 known/candidate gene-derived ISM and ILP markers. The designing of multiple ISM and ILP markers (2 to 4 markers/gene) in an individual gene will broaden the user-preference to select suitable primer combination for efficient assaying of functional allelic variation/diversity and realistic estimation of differential gene expression profiles among rice accessions. The genomic information generated in our study is made publicly accessible through a user-friendly web-resource, “Oryza ISM-ILP marker” database. The known/candidate gene-derived ISM and ILP markers can be enormously deployed to identify functionally relevant trait-associated molecular tags by optimal-resource expenses, leading towards genomics-assisted crop improvement in rice. PMID:27032371

Restriction site polymorphism-based candidate gene mapping for seedling drought tolerance in cowpea [Vigna unguiculata (L.) Walp.].

PubMed

Muchero, Wellington; Ehlers, Jeffrey D; Roberts, Philip A

2010-02-01

Quantitative trait loci (QTL) studies provide insight into the complexity of drought tolerance mechanisms. Molecular markers used in these studies also allow for marker-assisted selection (MAS) in breeding programs, enabling transfer of genetic factors between breeding lines without complete knowledge of their exact nature. However, potential for recombination between markers and target genes limit the utility of MAS-based strategies. Candidate gene mapping offers an alternative solution to identify trait determinants underlying QTL of interest. Here, we used restriction site polymorphisms to investigate co-location of candidate genes with QTL for seedling drought stress-induced premature senescence identified previously in cowpea. Genomic DNA isolated from 113 F(2:8) RILs of drought-tolerant IT93K503-1 and drought susceptible CB46 genotypes was digested with combinations of EcoR1 and HpaII, Mse1, or Msp1 restriction enzymes and amplified with primers designed from 13 drought-responsive cDNAs. JoinMap 3.0 and MapQTL 4.0 software were used to incorporate polymorphic markers onto the AFLP map and to analyze their association with the drought response QTL. Seven markers co-located with peaks of previously identified QTL. Isolation, sequencing, and blast analysis of these markers confirmed their significant homology with drought or other abiotic stress-induced expressed sequence tags (EST) from cowpea and other plant systems. Further, homology with coding sequences for a multidrug resistance protein 3 and a photosystem I assembly protein ycf3 was revealed in two of these candidates. These results provide a platform for the identification and characterization of genetic trait determinants underlying seedling drought tolerance in cowpea.

An ADAM33 Polymorphism Associates with Progression of Preschool Wheeze into Childhood Asthma: A Prospective Case-Control Study with Replication in a Birth Cohort Study

PubMed Central

Klaassen, Ester M. M.; Penders, John; Jöbsis, Quirijn; van de Kant, Kim D. G.; Thijs, Carel; Mommers, Monique; van Schayck, Constant P.; van Eys, Guillaume; Koppelman, Gerard H.; Dompeling, Edward

2015-01-01

Background The influence of asthma candidate genes on the development from wheeze to asthma in young children still needs to be defined. Objective To link genetic variants in asthma candidate genes to progression of wheeze to persistent wheeze into childhood asthma. Materials and Methods In a prospective study, children with recurrent wheeze from the ADEM (Asthma DEtection and Monitoring) study were followed until the age of six. At that age a classification (transient wheeze or asthma) was based on symptoms, lung function and medication use. In 198 children the relationship between this classification and 30 polymorphisms in 16 asthma candidate genes was assessed by logistic regression. In case of an association based on a p<0.10, replication analysis was performed in an independent birth cohort study (KOALA study, n = 248 included for the present analysis). Results In the ADEM study, the minor alleles of ADAM33 rs511898 and rs528557 and the ORMDL3/GSDMB rs7216389 polymorphisms were negatively associated, whereas the minor alleles of IL4 rs2243250 and rs2070874 polymorphisms were positively associated with childhood asthma. When replicated in the KOALA study, ADAM33 rs528557 showed a negative association of the CG/GG-genotype with progression of recurrent wheeze into childhood asthma (0.50 (0.26-0.97) p = 0.04) and no association with preschool wheeze. Conclusion Polymorphisms in ADAM33, ORMDL3/GSDMB and IL4 were associated with childhood asthma in a group of children with recurrent wheeze. The replication of the negative association of the CG/GG-genotype of rs528557 ADAM33 with childhood asthma in an independent birth cohort study confirms that a compromised ADAM33 gene may be implicated in the progression of wheeze into childhood asthma. PMID:25768087

Single nucleotide polymorphisms in bone turnover-related genes in Koreans: ethnic differences in linkage disequilibrium and haplotype

PubMed Central

Kim, Kyung-Seon; Kim, Ghi-Su; Hwang, Joo-Yeon; Lee, Hye-Ja; Park, Mi-Hyun; Kim, Kwang-joong; Jung, Jongsun; Cha, Hyo-Soung; Shin, Hyoung Doo; Kang, Jong-Ho; Park, Eui Kyun; Kim, Tae-Ho; Hong, Jung-Min; Koh, Jung-Min; Oh, Bermseok; Kimm, Kuchan; Kim, Shin-Yoon; Lee, Jong-Young

2007-01-01

Background Osteoporosis is defined as the loss of bone mineral density that leads to bone fragility with aging. Population-based case-control studies have identified polymorphisms in many candidate genes that have been associated with bone mass maintenance or osteoporotic fracture. To investigate single nucleotide polymorphisms (SNPs) that are associated with osteoporosis, we examined the genetic variation among Koreans by analyzing 81 genes according to their function in bone formation and resorption during bone remodeling. Methods We resequenced all the exons, splice junctions and promoter regions of candidate osteoporosis genes using 24 unrelated Korean individuals. Using the common SNPs from our study and the HapMap database, a statistical analysis of deviation in heterozygosity depicted. Results We identified 942 variants, including 888 SNPs, 43 insertion/deletion polymorphisms, and 11 microsatellite markers. Of the SNPs, 557 (63%) had been previously identified and 331 (37%) were newly discovered in the Korean population. When compared SNPs in the Korean population with those in HapMap database, 1% (or less) of SNPs in the Japanese and Chinese subpopulations and 20% of those in Caucasian and African subpopulations were significantly differentiated from the Hardy-Weinberg expectations. In addition, an analysis of the genetic diversity showed that there were no significant differences among Korean, Han Chinese and Japanese populations, but African and Caucasian populations were significantly differentiated in selected genes. Nevertheless, in the detailed analysis of genetic properties, the LD and Haplotype block patterns among the five sub-populations were substantially different from one another. Conclusion Through the resequencing of 81 osteoporosis candidate genes, 118 unknown SNPs with a minor allele frequency (MAF) > 0.05 were discovered in the Korean population. In addition, using the common SNPs between our study and HapMap, an analysis of genetic diversity and deviation in heterozygosity was performed and the polymorphisms of the above genes among the five populations were substantially differentiated from one another. Further studies of osteoporosis could utilize the polymorphisms identified in our data since they may have important implications for the selection of highly informative SNPs for future association studies. PMID:18036257

A case-based evaluation of SRD5A1, SRD5A2, AR, and ADRA1A as candidate genes for severity of BPH.

PubMed

Klotsman, M; Weinberg, C R; Davis, K; Binnie, C G; Hartmann, K E

2004-01-01

In men with a clinical diagnosis of benign prostatic hyperplasia (BPH), polytomous logistic regression analysis was conducted to evaluate associations between two silent polymorphisms in SRD5A1 (codon positions 30 and 116), two polymorphisms in SRD5A2 (Val89Leu substitution and C to T transition in intron 1), a trinucleotide (CAG)n repeat in androgen receptor (AR), and an Arg492Cys substitution in ADRA1A and clinical parameters that characterize severity of BPH. Candidate gene selection was based on two mechanistic pathways targeted by pharmacotherapy for BPH: (1) androgen metabolic loci contributing to prostate growth (static obstruction); and (2) factors affecting smooth muscle tone (dynamic obstruction). Polymorphisms in SRD5A2 were not associated with severity of BPH; however, SRD5A1 polymorphisms were associated with severity of BPH. The process(es) in which these silent single-nucleotide polymorphisms (SNPs) influence BPH phenotypes is unknown and additional studies will be needed to assess whether these SNPs have direct functional consequences. The characterization of additional molecular factors that contribute to static and dynamic obstruction may help predict response to pharmacotherapy and serve to identify novel drug targets for the clinical management of BPH.

Candidate gene association studies in syndromic and non-syndromic cleft lip and palate

DOE Office of Scientific and Technical Information (OSTI.GOV)

Daack-Hirsch, S.; Basart, A.; Frischmeyer, P.

1994-09-01

Using ongoing case ascertainment through a birth defects registry, we have collected 219 nuclear families with non-syndromic cleft lip and/or palate and 111 families with a collection of syndromic forms. Syndromic cases include 24 with recognized forms and 72 with unrecognized syndromes. Candidate gene studies as well as genome-wide searches for evidence of microdeletions and isodisomy are currently being carried out. Candidate gene association studies, to date, have made use of PCR-based polymorphisms for TGFA, MSX1, CLPG13 (a CA repeat associated with a human homologue of a locus that results in craniofacial dysmorphogenesis in the mouse) and an STRP foundmore » in a Van der Woude syndrome microdeletion. Control tetranucleotide repeats, which insure that population-based differences are not responsible for any observed associations, are also tested. Studies of the syndromic cases have included the same list of candidate genes searching for evidence of microdeletions and a genome-wide search using tri- and tetranucleotide polymorphic markers to search for isodisomy or structural rearrangements. Significant associations have previously been identified for TGFA, and, in this report, identified for MSX1 and nonsyndromic cleft palate only (p = 0.04, uncorrected). Preliminary results of the genome-wide scan for isodisomy has returned no true positives and there has been no evidence for microdeletion cases.« less

Association of genetic variants and expression levels of porcine FABP4 and FABP5 genes.

PubMed

Ballester, M; Puig-Oliveras, A; Castelló, A; Revilla, M; Fernández, A I; Folch, J M

2017-12-01

The FABP4 and FABP5 genes, coding for fatty acid transport proteins, have long been studied as positional candidate genes for SSC4 QTL affecting fat deposition and composition traits in pigs. Polymorphisms in these genes, FABP4:g.2634_2635insC and FABP5:g.3000T>G, have previously been associated with fatness traits in an Iberian by Landrace cross (IBMAP). The aim of the present work was to evaluate the functional implication of these genetic variants. For this purpose, FABP4 and FABP5 mRNA expression levels in 114 BC1_LD animals (25% Iberian × 75% Landrace) were analyzed using real-time quantitative PCR in backfat and muscle. FABP4 gene expression in backfat, but not in muscle, was associated with FABP4:g.2634_2635insC. In contrast, FABP5:g.3000T>G was not associated with gene expression levels. An expression-based genome-wide association study highlighted the FABP4:g.2634_2635insC polymorphism as the polymorphism most associated with FABP4 gene expression in backfat. Furthermore, other genomic regions associated in trans with the mRNA expression of FABP4 in backfat and FABP5 in muscle were also identified. Finally, two putative transcription binding sites for PPARG and NR4A2 may be affected by the FABP4:g.2634_2635insC polymorphism, modifying FABP4 gene expression. Our results reinforce FABP4 as a candidate gene for fatness traits on SSC4. © 2017 Stichting International Foundation for Animal Genetics.

DNA sequence variation and selection of tag single-nucleotide polymorphisms at candidate genes for drought-stress response in Pinus taeda L.

PubMed

González-Martínez, Santiago C; Ersoz, Elhan; Brown, Garth R; Wheeler, Nicholas C; Neale, David B

2006-03-01

Genetic association studies are rapidly becoming the experimental approach of choice to dissect complex traits, including tolerance to drought stress, which is the most common cause of mortality and yield losses in forest trees. Optimization of association mapping requires knowledge of the patterns of nucleotide diversity and linkage disequilibrium and the selection of suitable polymorphisms for genotyping. Moreover, standard neutrality tests applied to DNA sequence variation data can be used to select candidate genes or amino acid sites that are putatively under selection for association mapping. In this article, we study the pattern of polymorphism of 18 candidate genes for drought-stress response in Pinus taeda L., an important tree crop. Data analyses based on a set of 21 putatively neutral nuclear microsatellites did not show population genetic structure or genomewide departures from neutrality. Candidate genes had moderate average nucleotide diversity at silent sites (pi(sil) = 0.00853), varying 100-fold among single genes. The level of within-gene LD was low, with an average pairwise r2 of 0.30, decaying rapidly from approximately 0.50 to approximately 0.20 at 800 bp. No apparent LD among genes was found. A selective sweep may have occurred at the early-response-to-drought-3 (erd3) gene, although population expansion can also explain our results and evidence for selection was not conclusive. One other gene, ccoaomt-1, a methylating enzyme involved in lignification, showed dimorphism (i.e., two highly divergent haplotype lineages at equal frequency), which is commonly associated with the long-term action of balancing selection. Finally, a set of haplotype-tagging SNPs (htSNPs) was selected. Using htSNPs, a reduction of genotyping effort of approximately 30-40%, while sampling most common allelic variants, can be gained in our ongoing association studies for drought tolerance in pine.

Investigation of previously implicated genetic variants in chronic tic disorders: a transmission disequilibrium test approach.

PubMed

Abdulkadir, Mohamed; Londono, Douglas; Gordon, Derek; Fernandez, Thomas V; Brown, Lawrence W; Cheon, Keun-Ah; Coffey, Barbara J; Elzerman, Lonneke; Fremer, Carolin; Fründt, Odette; Garcia-Delgar, Blanca; Gilbert, Donald L; Grice, Dorothy E; Hedderly, Tammy; Heyman, Isobel; Hong, Hyun Ju; Huyser, Chaim; Ibanez-Gomez, Laura; Jakubovski, Ewgeni; Kim, Young Key; Kim, Young Shin; Koh, Yun-Joo; Kook, Sodahm; Kuperman, Samuel; Leventhal, Bennett; Ludolph, Andrea G; Madruga-Garrido, Marcos; Maras, Athanasios; Mir, Pablo; Morer, Astrid; Müller-Vahl, Kirsten; Münchau, Alexander; Murphy, Tara L; Plessen, Kerstin J; Roessner, Veit; Shin, Eun-Young; Song, Dong-Ho; Song, Jungeun; Tübing, Jennifer; van den Ban, Els; Visscher, Frank; Wanderer, Sina; Woods, Martin; Zinner, Samuel H; King, Robert A; Tischfield, Jay A; Heiman, Gary A; Hoekstra, Pieter J; Dietrich, Andrea

2018-04-01

Genetic studies in Tourette syndrome (TS) are characterized by scattered and poorly replicated findings. We aimed to replicate findings from candidate gene and genome-wide association studies (GWAS). Our cohort included 465 probands with chronic tic disorder (93% TS) and both parents from 412 families (some probands were siblings). We assessed 75 single nucleotide polymorphisms (SNPs) in 465 parent-child trios; 117 additional SNPs in 211 trios; and 4 additional SNPs in 254 trios. We performed SNP and gene-based transmission disequilibrium tests and compared nominally significant SNP results with those from a large independent case-control cohort. After quality control 71 SNPs were available in 371 trios; 112 SNPs in 179 trios; and 3 SNPs in 192 trios. 17 were candidate SNPs implicated in TS and 2 were implicated in obsessive-compulsive disorder (OCD) or autism spectrum disorder (ASD); 142 were tagging SNPs from eight monoamine neurotransmitter-related genes (including dopamine and serotonin); 10 were top SNPs from TS GWAS; and 13 top SNPs from attention-deficit/hyperactivity disorder, OCD, or ASD GWAS. None of the SNPs or genes reached significance after adjustment for multiple testing. We observed nominal significance for the candidate SNPs rs3744161 (TBCD) and rs4565946 (TPH2) and for five tagging SNPs; none of these showed significance in the independent cohort. Also, SLC1A1 in our gene-based analysis and two TS GWAS SNPs showed nominal significance, rs11603305 (intergenic) and rs621942 (PICALM). We found no convincing support for previously implicated genetic polymorphisms. Targeted re-sequencing should fully appreciate the relevance of candidate genes.

Association of candidate gene polymorphisms with clinical subtypes of preterm birth in a Latin American population.

PubMed

Gimenez, Lucas G; Momany, Allison M; Poletta, Fernando A; Krupitzki, Hugo B; Gili, Juan A; Busch, Tamara D; Saleme, Cesar; Cosentino, Viviana R; Pawluk, Mariela S; Campaña, Hebe; Gadow, Enrique C; Murray, Jeffrey C; Lopez-Camelo, Jorge S

2017-09-01

BackgroundPreterm birth (PTB) is the leading cause of neonatal mortality and morbidity. PTB is often classified according to clinical presentation as follows: idiopathic (PTB-I), preterm premature rupture of membranes (PTB-PPROM), and medically induced (PTB-M). The aim of this study was to evaluate the associations between specific candidate genes and clinical subtypes of PTB.MethodsTwenty-four single-nucleotide polymorphisms (SNPs) were genotyped in 18 candidate genes in 709 infant triads. Of them, 243 were PTB-I, 256 were PTB-PPROM, and 210 were PTB-M. These data were analyzed with a Family-Based Association.ResultsPTB was nominally associated with rs2272365 in PON1, rs883319 in KCNN3, rs4458044 in CRHR1, and rs610277 in F3. Regarding clinical subtypes analysis, three SNPs were associated with PTB-I (rs2272365 in PON1, rs10178458 in COL4A3, and rs4458044 in CRHR1), rs610277 in F3 was associated with PTB-PPROM, and rs883319 in KCNN3 and rs610277 in F3 were associated with PTB-M.ConclusionOur study identified polymorphisms potentially associated with specific clinical subtypes of PTB in this Latin American population. These results could suggest a specific role of such genes in the mechanisms involved in each clinical subtype. Further studies are required to confirm our results and to determine the role of these genes in the pathophysiology of clinical subtypes.

Robust and Comprehensive Analysis of 20 Osteoporosis Candidate Genes by Very High-Density Single-Nucleotide Polymorphism Screen Among 405 White Nuclear Families Identified Significant Association and Gene–Gene Interaction

PubMed Central

Xiong, Dong-Hai; Shen, Hui; Zhao, Lan-Juan; Xiao, Peng; Yang, Tie-Lin; Guo, Yan; Wang, Wei; Guo, Yan-Fang; Liu, Yong-Jun; Recker, Robert R; Deng, Hong-Wen

2007-01-01

Many “novel” osteoporosis candidate genes have been proposed in recent years. To advance our knowledge of their roles in osteoporosis, we screened 20 such genes using a set of high-density SNPs in a large family-based study. Our efforts led to the prioritization of those osteoporosis genes and the detection of gene–gene interactions. Introduction We performed large-scale family-based association analyses of 20 novel osteoporosis candidate genes using 277 single nucleotide polymorphisms (SNPs) for the quantitative trait BMD variation and the qualitative trait osteoporosis (OP) at three clinically important skeletal sites: spine, hip, and ultradistal radius (UD). Materials and Methods One thousand eight hundred seventy-three subjects from 405 white nuclear families were genotyped and analyzed with an average density of one SNP per 4 kb across the 20 genes. We conducted association analyses by SNP- and haplotype-based family-based association test (FBAT) and performed gene–gene interaction analyses using multianalytic approaches such as multifactor-dimensionality reduction (MDR) and conditional logistic regression. Results and Conclusions We detected four genes (DBP, LRP5, CYP17, and RANK) that showed highly suggestive associations (10,000-permutation derived empirical global p ≤ 0.01) with spine BMD/OP; four genes (CYP19, RANK, RANKL, and CYP17) highly suggestive for hip BMD/OP; and four genes (CYP19, BMP2, RANK, and TNFR2) highly suggestive for UD BMD/OP. The associations between BMP2 with UD BMD and those between RANK with OP at the spine, hip, and UD also met the experiment-wide stringent criterion (empirical global p ≤ 0.0007). Sex-stratified analyses further showed that some of the significant associations in the total sample were driven by either male or female subjects. In addition, we identified and validated a two-locus gene–gene interaction model involving GCR and ESR2, for which prior biological evidence exists. Our results suggested the prioritization of osteoporosis candidate genes from among the many proposed in recent years and revealed the significant gene–gene interaction effects influencing osteoporosis risk. PMID:17002564

No Evidence That Schizophrenia Candidate Genes Are More Associated With Schizophrenia Than Noncandidate Genes.

PubMed

Johnson, Emma C; Border, Richard; Melroy-Greif, Whitney E; de Leeuw, Christiaan A; Ehringer, Marissa A; Keller, Matthew C

2017-11-15

A recent analysis of 25 historical candidate gene polymorphisms for schizophrenia in the largest genome-wide association study conducted to date suggested that these commonly studied variants were no more associated with the disorder than would be expected by chance. However, the same study identified other variants within those candidate genes that demonstrated genome-wide significant associations with schizophrenia. As such, it is possible that variants within historic schizophrenia candidate genes are associated with schizophrenia at levels above those expected by chance, even if the most-studied specific polymorphisms are not. The present study used association statistics from the largest schizophrenia genome-wide association study conducted to date as input to a gene set analysis to investigate whether variants within schizophrenia candidate genes are enriched for association with schizophrenia. As a group, variants in the most-studied candidate genes were no more associated with schizophrenia than were variants in control sets of noncandidate genes. While a small subset of candidate genes did appear to be significantly associated with schizophrenia, these genes were not particularly noteworthy given the large number of more strongly associated noncandidate genes. The history of schizophrenia research should serve as a cautionary tale to candidate gene investigators examining other phenotypes: our findings indicate that the most investigated candidate gene hypotheses of schizophrenia are not well supported by genome-wide association studies, and it is likely that this will be the case for other complex traits as well. Copyright © 2017 Society of Biological Psychiatry. Published by Elsevier Inc. All rights reserved.

Polymorphisms in candidate genes for type 2 diabetes mellitus in a Mexican population with metabolic syndrome findings.

PubMed

Sánchez-Corona, J; Flores-Martínez, S E; Machorro-Lazo, M V; Galaviz-Hernández, C; Morán-Moguel, M C; Perea, F J; Mújica-López, K I; Vargas-Ancona, L; Laviada-Molina, H A; Fernández, V; Pardío, J; Arroyo, P; Barrera, H; Hanson, R L

2004-01-01

The metabolic or insulin resistance syndrome, characterized by hypertension, dyslipidemia, glucose intolerance and hyperinsulinemia, may have genetic determinants. The insulin gene (INS), insulin receptor gene (INSR) and insulin receptor substrate 1 gene (IRS1) have been proposed as candidate genes. We examined eight polymorphisms in these genes in 163 individuals from Yucatan, Mexico; this population has a high prevalence of obesity, type 2 diabetes mellitus and dyslipidemia. Subjects were evaluated for body mass index (BMI) and blood pressure. Blood samples were collected to determine glucose, insulin, triglycerides and cholesterol levels, as well as for DNA isolation. Restriction fragment length polymorphisms in INS, INSR and IRS1 were identified by polymerase chain reaction and digestion with selected restriction enzymes. Among the eight polymorphisms analyzed, the PstI polymorphism in INS was significantly associated with hypertriglyceridemia and with the presence of at least one abnormality related to the metabolic syndrome (P=0.007 and 0.004, respectively). The MaeIII polymorphism in INS was associated with fasting hyperinsulinemia (P=0.045). In multilocus analyses including both INS polymorphisms, significant associations were seen with hypertriglyceridemia (P=0.006), hypercholesterolemia (P=0.031) and with presence of at least one metabolic abnormality (P=0.009). None of the polymorphisms in INSR or IRS1 was associated with any of these traits. These findings suggest that the insulin gene may be an important determinant of metabolic syndrome, and particularly of dyslipidemia, in this population.

Case-control approach application for finding a relationship between candidate genes and clinical mastitis in Holstein dairy cattle.

PubMed

Bagheri, Masoumeh; Moradi-Sharhrbabak, M; Miraie-Ashtiani, R; Safdari-Shahroudi, M; Abdollahi-Arpanahi, R

2016-02-01

Mastitis is a major source of economic loss in dairy herds. The objective of this research was to evaluate the association between genotypes within SLC11A1 and CXCR1 candidate genes and clinical mastitis in Holstein dairy cattle using the selective genotyping method. The data set contained clinical mastitis records of 3,823 Holstein cows from two Holstein dairy herds located in two different regions in Iran. Data included the number of cases of clinical mastitis per lactation. Selective genotyping was based on extreme values for clinical mastitis residuals (CMR) from mixed model analyses. Two extreme groups consisting of 135 cows were formed (as cases and controls), and genotyped for the two candidate genes, namely, SLC11A1 and CXCR1, using polymerase chain reaction-single strand conformation polymorphism (PCR-SSCP) and polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP), respectively. Associations between single nucleotide polymorphism (SNP) genotypes with CMR and breeding values for milk and protein yield were carried out by applying logistic regression analyses, i.e. estimating the probability of the heterogeneous genotype in the dependency of values for CMR and breeding values (BVs). The sequencing results revealed a novel mutation in 1139 bp of exon 11 of the SLC11A1 gene and this SNP had a significant association with CMR (P < 0.05). PCR-RFLP analysis leads to three banding patterns for CXCR1c.735C>G and these genotypes had significant relationships with CMR. Overall, the results showed that SLC11A1 and CXCR1 are valuable candidate genes for the improvement of mastitis resistance as well as production traits in dairy cattle populations.

Association of candidate genes with drought tolerance traits in diverse perennial ryegrass accessions

PubMed Central

Jiang, Yiwei

2013-01-01

Drought is a major environmental stress limiting growth of perennial grasses in temperate regions. Plant drought tolerance is a complex trait that is controlled by multiple genes. Candidate gene association mapping provides a powerful tool for dissection of complex traits. Candidate gene association mapping of drought tolerance traits was conducted in 192 diverse perennial ryegrass (Lolium perenne L.) accessions from 43 countries. The panel showed significant variations in leaf wilting, leaf water content, canopy and air temperature difference, and chlorophyll fluorescence under well-watered and drought conditions across six environments. Analysis of 109 simple sequence repeat markers revealed five population structures in the mapping panel. A total of 2520 expression-based sequence readings were obtained for a set of candidate genes involved in antioxidant metabolism, dehydration, water movement across membranes, and signal transduction, from which 346 single nucleotide polymorphisms were identified. Significant associations were identified between a putative LpLEA3 encoding late embryogenesis abundant group 3 protein and a putative LpFeSOD encoding iron superoxide dismutase and leaf water content, as well as between a putative LpCyt Cu-ZnSOD encoding cytosolic copper-zinc superoxide dismutase and chlorophyll fluorescence under drought conditions. Four of these identified significantly associated single nucleotide polymorphisms from these three genes were also translated to amino acid substitutions in different genotypes. These results indicate that allelic variation in these genes may affect whole-plant response to drought stress in perennial ryegrass. PMID:23386684

Gene Presence-Absence Polymorphism in Castrating Anther-Smut Fungi: Recent Gene Gains and Phylogeographic Structure.

PubMed

Hartmann, Fanny E; Rodríguez de la Vega, Ricardo C; Brandenburg, Jean-Tristan; Carpentier, Fantin; Giraud, Tatiana

2018-04-01

Gene presence-absence polymorphisms segregating within species are a significant source of genetic variation but have been little investigated to date in natural populations. In plant pathogens, the gain or loss of genes encoding proteins interacting directly with the host, such as secreted proteins, probably plays an important role in coevolution and local adaptation. We investigated gene presence-absence polymorphism in populations of two closely related species of castrating anther-smut fungi, Microbotryum lychnidis-dioicae (MvSl) and M. silenes-dioicae (MvSd), from across Europe, on the basis of Illumina genome sequencing data and high-quality genome references. We observed presence-absence polymorphism for 186 autosomal genes (2% of all genes) in MvSl, and only 51 autosomal genes in MvSd. Distinct genes displayed presence-absence polymorphism in the two species. Genes displaying presence-absence polymorphism were frequently located in subtelomeric and centromeric regions and close to repetitive elements, and comparison with outgroups indicated that most were present in a single species, being recently acquired through duplications in multiple-gene families. Gene presence-absence polymorphism in MvSl showed a phylogeographic structure corresponding to clusters detected based on SNPs. In addition, gene absence alleles were rare within species and skewed toward low-frequency variants. These findings are consistent with a deleterious or neutral effect for most gene presence-absence polymorphism. Some of the observed gene loss and gain events may however be adaptive, as suggested by the putative functions of the corresponding encoded proteins (e.g., secreted proteins) or their localization within previously identified selective sweeps. The adaptive roles in plant and anther-smut fungi interactions of candidate genes however need to be experimentally tested in future studies.

Gene Presence–Absence Polymorphism in Castrating Anther-Smut Fungi: Recent Gene Gains and Phylogeographic Structure

PubMed Central

Rodríguez de la Vega, Ricardo C; Brandenburg, Jean-Tristan; Carpentier, Fantin; Giraud, Tatiana

2018-01-01

Abstract Gene presence–absence polymorphisms segregating within species are a significant source of genetic variation but have been little investigated to date in natural populations. In plant pathogens, the gain or loss of genes encoding proteins interacting directly with the host, such as secreted proteins, probably plays an important role in coevolution and local adaptation. We investigated gene presence–absence polymorphism in populations of two closely related species of castrating anther-smut fungi, Microbotryum lychnidis-dioicae (MvSl) and M. silenes-dioicae (MvSd), from across Europe, on the basis of Illumina genome sequencing data and high-quality genome references. We observed presence–absence polymorphism for 186 autosomal genes (2% of all genes) in MvSl, and only 51 autosomal genes in MvSd. Distinct genes displayed presence–absence polymorphism in the two species. Genes displaying presence–absence polymorphism were frequently located in subtelomeric and centromeric regions and close to repetitive elements, and comparison with outgroups indicated that most were present in a single species, being recently acquired through duplications in multiple-gene families. Gene presence–absence polymorphism in MvSl showed a phylogeographic structure corresponding to clusters detected based on SNPs. In addition, gene absence alleles were rare within species and skewed toward low-frequency variants. These findings are consistent with a deleterious or neutral effect for most gene presence–absence polymorphism. Some of the observed gene loss and gain events may however be adaptive, as suggested by the putative functions of the corresponding encoded proteins (e.g., secreted proteins) or their localization within previously identified selective sweeps. The adaptive roles in plant and anther-smut fungi interactions of candidate genes however need to be experimentally tested in future studies. PMID:29722826

Sex, Drugs, and Rock ‘N’ Roll: Hypothesizing Common Mesolimbic Activation as a Function of Reward Gene Polymorphisms

PubMed Central

Blum, Kenneth; Werner, Tonia; Carnes, Stefanie; Carnes, Patrick; Bowirrat, Abdalla; Giordano, John; Marlene-Oscar-Berman; Gold, Mark

2014-01-01

The nucleus accumbens, a site within the ventral striatum, plays a prominent role in mediating the reinforcing effects of drugs of abuse, food, sex, and other addictions. Indeed, it is generally believed that this structure mandates motivated behaviors such as eating, drinking, and sexual activity, which are elicited by natural rewards and other strong incentive stimuli. This article focuses on sex addiction, but we hypothesize that there is a common underlying mechanism of action for the powerful effects that all addictions have on human motivation. That is, biological drives may have common molecular genetic antecedents, which if impaired, lead to aberrant behaviors. Based on abundant scientific support, we further hypothesize that dopaminergic genes, and possibly other candidate neurotransmitter-related gene polymorphisms, affect both hedonic and anhedonic behavioral outcomes. Genotyping studies already have linked gene polymorphic associations with alcohol and drug addictions and obesity, and we anticipate that future genotyping studies of sex addicts will provide evidence for polymorphic associations with specific clustering of sexual typologies based on clinical instrument assessments. We recommend that scientists and clinicians embark on research coupling the use of neuroimaging tools with dopaminergic agonistic agents to target specific gene polymorphisms systematically for normalizing hyper- or hypo-sexual behaviors. PMID:22641964

Prolactin receptor gene polymorphism and the risk of recurrent pregnancy loss: a case-control study.

PubMed

Kim, Jin Ju; Choi, Young Min; Lee, Sung Ki; Yang, Kwang Moon; Paik, Eun Chan; Jeong, Hyeon Jeong; Jun, Jong Kwan; Han, Ae Ra; Hwang, Kyu Ri; Hong, Min A

2018-02-01

Since the first study was published reporting the candidate association between the prolactin receptor gene intron C/T polymorphism (rs37389) and recurrent miscarriage, no replication study has been performed. In this study, we investigated the role of the prolactin receptor gene C/T polymorphism in 311 Korean women with recurrent pregnancy loss and 314 controls. Genotyping for prolactin receptor gene intron C/T polymorphism was performed using a TaqMan assay. The significance of difference in the genotype distribution was assessed using a chi-square test, and continuous variables were compared using a Student's t-test. The genotype distribution of the prolactin receptor gene C/T polymorphism in the recurrent pregnancy loss group did not differ from that in the control group (CC/CT/TT rates were 49.8%/41.5%/8.7% and 52.5%/37.6%/9.9% for the recurrent pregnancy loss patient and control groups, respectively, p = .587). When the analysis was restricted to patients with three or more consecutive spontaneous miscarriages or patients without prior live birth, there were also no differences in the genotype distribution between these subgroups and controls. In conclusion, the findings of the current study suggest that the prolactin receptor gene intron C/T polymorphism is not a major determinant of the development of recurrent pregnancy loss. Impact statement What is already known: Many studies have investigated whether there is a genetic component for the risk of recurrent pregnancy loss. Recently, one study investigated whether genetic polymorphisms involved in the regulation of the hypothalamic-pituitary-ovarian axis would be associated with recurrent miscarriage. Among 35 polymorphisms in 20 candidate genes, genotype distribution with regard to the prolactin receptor gene intron C/T polymorphism (rs37389) differed between the recurrent miscarriage and the control groups. Since this study reporting the candidate association between the prolactin receptor gene and recurrent miscarriage, no replication study has been performed. What the results of this study add: The genotype distribution of the prolactin receptor gene C/T polymorphism in the recurrent miscarriage group did not differ from that in the control group. What the implications are of these findings: Our study may be useful in that it is the first replication study since the initial report of the association of prolactin receptor gene polymorphism with recurrent miscarriage. Although no association was found, the potential role of prolactin in pregnancy loss needs to be further investigated because prolactin and its receptor have been postulated to play an important role in the maintenance of normal pregnancy.

Association of MAP4K4 gene single nucleotide polymorphism with mastitis and milk traits in Chinese Holstein cattle.

PubMed

Bhattarai, Dinesh; Chen, Xing; Ur Rehman, Zia; Hao, Xingjie; Ullah, Farman; Dad, Rahim; Talpur, Hira Sajjad; Kadariya, Ishwari; Cui, Lu; Fan, Mingxia; Zhang, Shujun

2017-02-01

The objective of the studies presented in this Research Communication was to investigate the association of single nucleotide polymorphisms present in the MAP4K4 gene with different milk traits in dairy cows. Based on previous QTL fine mapping results on bovine chromosome 11, the MAP4K4 gene was selected as a candidate gene to evaluate its effect on somatic cell count and milk traits in ChineseHolstein cows. Milk production traits including milk yield, fat percentage, and protein percentage of each cow were collected using 305 d lactation records. Association between MAP4K4 genotype and different traits and Somatic Cell Score (SCS) was performed using General Linear Regression Model of R. Two SNPs at exon 18 (c.2061T > G and c.2196T > C) with genotype TT in both SNPs were found significantly higher for somatic SCS. We found the significant effect of exon 18 (c.2061T > G) on protein percentage, milk yield and SCS. We identified SNPs at different location of MAP4K4 gene of the cattle and several of them were significantly associated with the somatic cell score and other different milk traits. Thus, MAP4K4 gene could be a useful candidate gene for selection of dairy cattle against mastitis and the identified polymorphisms might potentially be strong genetic markers.

Association study of interleukin-4 polymorphisms with paranoid schizophrenia in the Polish population: a critical approach.

PubMed

Fila-Danilow, Anna; Kucia, Krzysztof; Kowalczyk, Malgorzata; Owczarek, Aleksander; Paul-Samojedny, Monika; Borkowska, Paulina; Suchanek, Renata; Kowalski, Jan

2012-08-01

Changes in immunological system are one of dysfunctions reported in schizophrenia. Some changes based on an imbalance between Th1 and Th2 cytokines results from cytokine gene polymorphisms. Interleukin-4 gene (IL4) is considered as a potential candidate gene in schizophrenia association studies. The aim of the current case-control study was to examine whether the -590C/T (rs2243250) and -33C/T (rs2070874) IL4 gene polymorphisms are implicated in paranoid schizophrenia development in the Polish population. Genotyping of polymorphisms was performed by using PCR-RFLP technique. The genotypes and alleles distribution of both SNPs were analysed in patients (n = 182) and healthy individuals constituted the control group (n = 215). The connection between some clinical variables and studied polymorphisms has been examined as well. We did not revealed any association between the -590C/T and -33C/T polymorphisms and paranoid schizophrenia. In case of both SNPs the homozygous TT genotype was extremely rare. Both polymorphic sites of the IL4 gene were found to be in a very strong linkage disequilibrium. However we did not identify a haplotype predispose to paranoid schizophrenia. No associations were also observed between the clinical course and psychopathology of the disease and the genotypes of both analysed polymorphisms. Our results suggest that the polymorphisms -590C/T in IL4 gene promoter region and -33C/T in the 5'-UTR are not involved in the pathophysiology of paranoid schizophrenia in Polish residents.

Association of Genetic Loci with Sleep Apnea in European Americans and African-Americans: The Candidate Gene Association Resource (CARe)

PubMed Central

Patel, Sanjay R.; Goodloe, Robert; De, Gourab; Kowgier, Matthew; Weng, Jia; Buxbaum, Sarah G.; Cade, Brian; Fulop, Tibor; Gharib, Sina A.; Gottlieb, Daniel J.; Hillman, David; Larkin, Emma K.; Lauderdale, Diane S.; Li, Li; Mukherjee, Sutapa; Palmer, Lyle; Zee, Phyllis; Zhu, Xiaofeng; Redline, Susan

2012-01-01

Although obstructive sleep apnea (OSA) is known to have a strong familial basis, no genetic polymorphisms influencing apnea risk have been identified in cross-cohort analyses. We utilized the National Heart, Lung, and Blood Institute (NHLBI) Candidate Gene Association Resource (CARe) to identify sleep apnea susceptibility loci. Using a panel of 46,449 polymorphisms from roughly 2,100 candidate genes on a customized Illumina iSelect chip, we tested for association with the apnea hypopnea index (AHI) as well as moderate to severe OSA (AHI≥15) in 3,551 participants of the Cleveland Family Study and two cohorts participating in the Sleep Heart Health Study. Among 647 African-Americans, rs11126184 in the pleckstrin (PLEK) gene was associated with OSA while rs7030789 in the lysophosphatidic acid receptor 1 (LPAR1) gene was associated with AHI using a chip-wide significance threshold of p-value<2×10−6. Among 2,904 individuals of European ancestry, rs1409986 in the prostaglandin E2 receptor (PTGER3) gene was significantly associated with OSA. Consistency of effects between rs7030789 and rs1409986 in LPAR1 and PTGER3 and apnea phenotypes were observed in independent clinic-based cohorts. Novel genetic loci for apnea phenotypes were identified through the use of customized gene chips and meta-analyses of cohort data with replication in clinic-based samples. The identified SNPs all lie in genes associated with inflammation suggesting inflammation may play a role in OSA pathogenesis. PMID:23155414

Molecular insight into the association between cartilage regeneration and ear wound healing in genetic mouse models: targeting new genes in regeneration.

PubMed

Rai, Muhammad Farooq; Schmidt, Eric J; McAlinden, Audrey; Cheverud, James M; Sandell, Linda J

2013-11-06

Tissue regeneration is a complex trait with few genetic models available. Mouse strains LG/J and MRL are exceptional healers. Using recombinant inbred strains from a large (LG/J, healer) and small (SM/J, nonhealer) intercross, we have previously shown a positive genetic correlation between ear wound healing, knee cartilage regeneration, and protection from osteoarthritis. We hypothesize that a common set of genes operates in tissue healing and articular cartilage regeneration. Taking advantage of archived histological sections from recombinant inbred strains, we analyzed expression of candidate genes through branched-chain DNA technology directly from tissue lysates. We determined broad-sense heritability of candidates, Pearson correlation of candidates with healing phenotypes, and Ward minimum variance cluster analysis for strains. A bioinformatic assessment of allelic polymorphisms within and near candidate genes was also performed. The expression of several candidates was significantly heritable among strains. Although several genes correlated with both ear wound healing and cartilage healing at a marginal level, the expression of four genes representing DNA repair (Xrcc2, Pcna) and Wnt signaling (Axin2, Wnt16) pathways was significantly positively correlated with both phenotypes. Cluster analysis accurately classified healers and nonhealers for seven out of eight strains based on gene expression. Specific sequence differences between LG/J and SM/J were identified as potential causal polymorphisms. Our study suggests a common genetic basis between tissue healing and osteoarthritis susceptibility. Mapping genetic variations causing differences in diverse healing responses in multiple tissues may reveal generic healing processes in pursuit of new therapeutic targets designed to induce or enhance regeneration and, potentially, protection from osteoarthritis.

Polymorphism within thyroid hormone responsive (THRSP) associated with weaning-to-oestrus interval in swine

USDA-ARS?s Scientific Manuscript database

The objective of this study was to assess polymorphisms within lipogenic-related candidate genes for association with the reproductive traits; age at puberty (AP), ovulation rate (OR), and weaning-to-estrus interval (WEI). Variations within the anorectic gene Cocaine- and Amphetamine-Regulated Trans...

Nucleotide polymorphisms in a pine ortholog of the Arabidopsis degrading enzyme cellulase KORRIGAN are associated with early growth performance in Pinus pinaster.

PubMed

Cabezas, José Antonio; González-Martínez, Santiago C; Collada, Carmen; Guevara, María Angeles; Boury, Christophe; de María, Nuria; Eveno, Emmanuelle; Aranda, Ismael; Garnier-Géré, Pauline H; Brach, Jean; Alía, Ricardo; Plomion, Christophe; Cervera, María Teresa

2015-09-01

We have carried out a candidate-gene-based association genetic study in Pinus pinaster Aiton and evaluated the predictive performance for genetic merit gain of the most significantly associated genes and single nucleotide polymorphisms (SNPs). We used a second generation 384-SNP array enriched with candidate genes for growth and wood properties to genotype mother trees collected in 20 natural populations covering most of the European distribution of the species. Phenotypic data for total height, polycyclism, root-collar diameter and biomass were obtained from a replicated provenance-progeny trial located in two sites with contrasting environments (Atlantic vs Mediterranean climate). General linear models identified strong associations between growth traits (total height and polycyclism) and four SNPs from the korrigan candidate gene, after multiple testing corrections using false discovery rate. The combined genomic breeding value predictions assessed for the four associated korrigan SNPs by ridge regression-best linear unbiased prediction (RR-BLUP) and cross-validation accounted for up to 8 and 15% of the phenotypic variance for height and polycyclic growth, respectively, and did not improve adding SNPs from other growth-related candidate genes. For root-collar diameter and total biomass, they accounted for 1.6 and 1.1% of the phenotypic variance, respectively, but increased to 15 and 4.1% when other SNPs from lp3.1, lp3.3 and cad were included in RR-BLUP models. These results point towards a desirable integration of candidate-gene studies as a means to pre-select relevant markers, and aid genomic selection in maritime pine breeding programs. © The Author 2015. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

Selection signatures in four lignin genes from switchgrass populations divergently selected for in vitro dry matter digestibility

DOE Office of Scientific and Technical Information (OSTI.GOV)

Chen, Shiyu; Kaeppler, Shawn M.; Vogel, Kenneth P.

Switchgrass is undergoing development as a dedicated cellulosic bioenergy crop. Fermentation of lignocellulosic biomass to ethanol in a bioenergy system or to volatile fatty acids in a livestock production system is strongly and negatively influenced by lignification of cell walls. This study detects specific loci that exhibit selection signatures across switchgrass breeding populations that differ in in vitro dry matter digestibility (IVDMD), ethanol yield, and lignin concentration. Allele frequency changes in candidate genes were used to detect loci under selection. Out of the 183 polymorphisms identified in the four candidate genes, twenty-five loci in the intron regions and four locimore » in coding regions were found to display a selection signature. All loci in the coding regions are synonymous substitutions. Selection in both directions were observed on polymorphisms that appeared to be under selection. Genetic diversity and linkage disequilibrium within the candidate genes were low. The recurrent divergent selection caused excessive moderate allele frequencies in the cycle 3 reduced lignin population as compared to the base population. As a result, this study provides valuable insight on genetic changes occurring in short-term selection in the polyploid populations, and discovered potential markers for breeding switchgrass with improved biomass quality.« less

Selection signatures in four lignin genes from switchgrass populations divergently selected for in vitro dry matter digestibility

DOE PAGES

Chen, Shiyu; Kaeppler, Shawn M.; Vogel, Kenneth P.; ...

2016-11-28

Switchgrass is undergoing development as a dedicated cellulosic bioenergy crop. Fermentation of lignocellulosic biomass to ethanol in a bioenergy system or to volatile fatty acids in a livestock production system is strongly and negatively influenced by lignification of cell walls. This study detects specific loci that exhibit selection signatures across switchgrass breeding populations that differ in in vitro dry matter digestibility (IVDMD), ethanol yield, and lignin concentration. Allele frequency changes in candidate genes were used to detect loci under selection. Out of the 183 polymorphisms identified in the four candidate genes, twenty-five loci in the intron regions and four locimore » in coding regions were found to display a selection signature. All loci in the coding regions are synonymous substitutions. Selection in both directions were observed on polymorphisms that appeared to be under selection. Genetic diversity and linkage disequilibrium within the candidate genes were low. The recurrent divergent selection caused excessive moderate allele frequencies in the cycle 3 reduced lignin population as compared to the base population. As a result, this study provides valuable insight on genetic changes occurring in short-term selection in the polyploid populations, and discovered potential markers for breeding switchgrass with improved biomass quality.« less

Inflammatory gene polymorphisms and risk of postoperative myocardial infarction after cardiac surgery.

PubMed

Podgoreanu, M V; White, W D; Morris, R W; Mathew, J P; Stafford-Smith, M; Welsby, I J; Grocott, H P; Milano, C A; Newman, M F; Schwinn, D A

2006-07-04

The inflammatory response triggered by cardiac surgery with cardiopulmonary bypass (CPB) is a primary mechanism in the pathogenesis of postoperative myocardial infarction (PMI), a multifactorial disorder with significant inter-patient variability poorly predicted by clinical and procedural factors. We tested the hypothesis that candidate gene polymorphisms in inflammatory pathways contribute to risk of PMI after cardiac surgery. We genotyped 48 polymorphisms from 23 candidate genes in a prospective cohort of 434 patients undergoing elective cardiac surgery with CPB. PMI was defined as creatine kinase-MB isoenzyme level > or = 10x upper limit of normal at 24 hours postoperatively. A 2-step analysis strategy was used: marker selection, followed by model building. To minimize false-positive associations, we adjusted for multiple testing by permutation analysis, Bonferroni correction, and controlling the false discovery rate; 52 patients (12%) experienced PMI. After adjusting for multiple comparisons and clinical risk factors, 3 polymorphisms were found to be independent predictors of PMI (adjusted P<0.05; false discovery rate <10%). These gene variants encode the proinflammatory cytokine interleukin 6 (IL6 -572G>C; odds ratio [OR], 2.47), and 2 adhesion molecules: intercellular adhesion molecule-1 (ICAM1 Lys469Glu; OR, 1.88), and E-selectin (SELE 98G>T; OR, 0.16). The inclusion of genotypic information from these polymorphisms improved prediction models for PMI based on traditional risk factors alone (C-statistic 0.764 versus 0.703). Functional genetic variants in cytokine and leukocyte-endothelial interaction pathways are independently associated with severity of myonecrosis after cardiac surgery. This may aid in preoperative identification of high-risk cardiac surgical patients and development of novel cardioprotective strategies.

Effects of bovine SMO gene polymorphisms on the body measurement and meat quality traits of Qinchuan cattle.

PubMed

Zhang, Y R; Li, Y K; Fu, C Z; Wang, J L; Wang, H B; Zan, L S

2014-10-07

Beef cattle breeding programs focus on improving important economic traits, including growth rates, and meat quantity and quality. Molecular marker-assisted selection based on genetic variation represents a potential method for breeding genetically improved livestock with better economic traits. Smoothened (SMO) protein is a signal transducer that contributes to the regulation of both osteogenesis and adipogenesis through the hedgehog pathway. In this study, we detected polymorphisms in the bovine SMO gene of Qinchuan cattle, and we analyzed their associations with body measurement traits (BMTs) and meat quality traits (MQTs). Using DNA sequencing and polymerase chain reaction-restriction fragment length polymorphism, 3 novel single nucleotide polymorphisms were identified in the SMO gene of 562 cattle: 1 G > C mutation on exon 9 (G21234C) and 2 C > T mutations on exon 11 (C22424T and C22481T). Association analysis showed that polymorphisms on both the G21234C and C22424T loci significantly affected certain BMTs and MQTs (P < 0.05 or P < 0.01), whereas those on the C22481T locus did not (P > 0.05). Therefore, the SMO gene could be used as a candidate gene to alter BMTs and MQTs in Qinchuan cattle or for marker-assisted selection to breed cattle with superior BMTs and MQTs.

Association analysis of nine candidate gene polymorphisms in Indian patients with type 2 diabetic retinopathy.

PubMed

Balasubbu, Suganthalakshmi; Sundaresan, Periasamy; Rajendran, Anand; Ramasamy, Kim; Govindarajan, Gowthaman; Perumalsamy, Namperumalsamy; Hejtmancik, J Fielding

2010-11-10

Diabetic retinopathy (DR) is classically defined as a microvasculopathy that primarily affects the small blood vessels of the inner retina as a complication of diabetes mellitus (DM).It is a multifactorial disease with a strong genetic component. The aim of this study is to investigate the association of a set of nine candidate genes with the development of diabetic retinopathy in a South Indian cohort who have type 2 diabetes mellitus (T2DM). Seven candidate genes (RAGE, PEDF, AKR1B1, EPO, HTRA1, ICAM and HFE) were chosen based on reported association with DR in the literature. Two more, CFH and ARMS2, were chosen based on their roles in biological pathways previously implicated in DR. Fourteen single nucleotide polymorphisms (SNPs) and one dinucleotide repeat polymorphism, previously reported to show association with DR or other related diseases, were genotyped in 345 DR and 356 diabetic patients without retinopathy (DNR). The genes which showed positive association in this screening set were tested further in additional sets of 100 DR and 90 DNR additional patients from the Aravind Eye Hospital. Those which showed association in the secondary screen were subjected to a combined analysis with the 100 DR and 100 DNR subjects previously recruited and genotyped through the Sankara Nethralaya Hospital, India. Genotypes were evaluated using a combination of direct sequencing, TaqMan SNP genotyping, RFLP analysis, and SNaPshot PCR assays. Chi-square and Fisher exact tests were used to analyze the genotype and allele frequencies. Among the nine loci (15 polymorphisms) screened, SNP rs2070600 (G82S) in the RAGE gene, showed significant association with DR (allelic P = 0.016, dominant model P = 0.012), compared to DNR. SNP rs2070600 further showed significant association with DR in the confirmation cohort (P = 0.035, dominant model P = 0.032). Combining the two cohorts gave an allelic P < 0.003 and dominant P = 0.0013). Combined analysis with the Sankara Nethralaya cohort gave an allelic P = 0.0003 and dominant P = 0.00011 with an OR = 0.49 (0.34 - 0.70) for the minor allele. In HTRA1, rs11200638 (G>A), showed marginal significance with DR (P = 0.055) while rs10490924 in LOC387715 gave a P = 0.07. No statistical significance was observed for SNPs in the other 7 genes studied. This study confirms significant association of one polymorphism only (rs2070600 in RAGE) with DR in an Indian population which had T2DM.

Lack of association between temporal lobe epilepsy and a novel polymorphism in the alpha 2 subunit gene (ATP1A2) of the sodium potassium transporting ATPase.

PubMed

Buono, R J; Ferraro, T N; O'Connor, M J; Sperling, M R; Abbey, M; Finanger, E; Lohoff, F; Mulholland, N; Berrettini, W H

2000-02-07

Genetic linkage studies in rodents and humans have identified specific chromosomal regions harboring seizure susceptibility genes. We have identified a novel polymorphism in the human alpha 2 subunit gene (ATP1A2) of the sodium potassium transporting ATPase (NaK-pump), a candidate gene for human temporal lobe epilepsy (TLE) based on its chromosomal location and function in ion homeostasis. The polymorphism consists of a four base pair insertion 12 base pairs upstream of the start of exon 2. We performed an association study between this polymorphism and TLE. Our study did not find a significant difference in the frequency of this polymorphism between TLE patients and controls, indicating that this variation is not a major susceptibility factor. However, since the number of patients studied so far is small and the functional consequence of the polymorphism is unknown, the variation may yet be found to play a minor role in increased risk for seizure susceptibility. In contrast to the findings in TLE patients and controls, we did find a significant difference in the frequency of the variation between African Americans and persons of European descent. This finding demonstrates the potential effect of population stratification on studies of this type and supports the growing use of parental and familial samples for controls in association studies. Further study of this polymorphism is warranted as it may be involved in other disease processes for which there are known ethnic-specific susceptibilities. Am. J. Med. Genet. (Neuropsychiatr. Genet.) 96:79-83, 2000. Copyright 2000 Wiley-Liss, Inc.

Genetic susceptibility to renal scar formation after urinary tract infection: a systematic review and meta-analysis of candidate gene polymorphisms.

PubMed

Zaffanello, Marco; Tardivo, Stefano; Cataldi, Luigi; Fanos, Vassilios; Biban, Paolo; Malerba, Giovanni

2011-07-01

Identifying patients who may develop renal scarring after urinary tract infections (UTI) remains challenging, as clinical determinants explain only a portion of individual risk. An additional factor that likely affects risk is individual genetic variability. We searched for peer-reviewed articles from 1980 to December 2009 in electronic databases that reported results showing an association between gene polymorphims and renal scaring after UTI. Two independent researchers screened articles using predetermined criteria. Studies were assessed for methodological quality using an aggregate scoring system. The 18 studies ultimately included in the review had investigated 16 polymorphisms in nine genes in association with renal scarring formation after UTI. Based on the predetermined criteria for assessing the quality of the studies, 12 studies (67%) were identified as being of poor quality design. A meta-analysis of cumulative studies showed on association between renal scarring formation after UTI and the angiotensin converting enzyme insertion/deletion polymorphism [ACE I/D; recessive model for D allele; odds ratio (OR) 1.73, 95% confidence interval (CI) 1.09-2.74, P = 0.02] or transforming growth factor (TGF)-β1 c.-509 T > C polymorphism (dominant model for T allele; OR 2.24, 95% CI 1.34-3.76, P = 0.002). However, heterogeneity among studies was large, indicating a strong difference that cannot only be explained by differences in study design. The studies reviewed in this article support a modest involvement of the vasomotor and inflammatory genes in the development of renal scarring after UTIs. This review also shows that only few possible candidate genes have been investigated for an association with renal scarring, raising the hypothesis that some gene polymorphisms may exert their effects through an interaction with as yet uninvestigated factors that may be related to geographic and/or socio-economic differences.

Lipoprotein lipase variants interact with polyunsaturated fatty acids to modulate obesity traits in Puerto Ricans

USDA-ARS?s Scientific Manuscript database

Lipoprotein lipase (LPL) is a candidate gene for obesity based on its role in triglyceride hydrolysis and the partitioning of fatty acids towards storage or oxidation. Whether dietary fatty acids modify LPL associated obesity risk is unknown. We examined five single nucleotide polymorphisms (SNPs) (...

Genetic polymorphisms of Th2 interleukins, history of asthma or eczema and childhood acute lymphoid leukaemia: Findings from the ESCALE study (SFCE).

PubMed

Bonaventure, A; Orsi, L; Rudant, J; Goujon-Bellec, S; Leverger, G; Baruchel, A; Bertrand, Y; Nelken, B; Pasquet, M; Michel, G; Sirvent, N; Chastagner, P; Ducassou, S; Thomas, C; Besse, C; Hémon, D; Clavel, J

2018-06-05

Previous studies on the putative role of allergy in the aetiology of childhood leukaemia have reported contradictory results. The present study aimed to analyse the relation between a medical history of asthma or eczema and childhood acute lymphoid leukaemia (ALL) in light of potential candidate gene-environment interactions. Analyses were based on a subset of 434 cases of ALL and 442 controls successfully genotyped and of European ancestry children enrolled in a French population-based case-control study conducted in 2003-2004. Information about medical history was obtained during a standardized interview with the mothers. Candidate polymorphisms in genes of the Th2 cytokines IL4, IL10, IL13 and IL4-receptor, were genotyped or imputed. None of the variant alleles were directly associated with childhood acute lymphoid leukaemia. A medical history of asthma or eczema was reported more often in the control group (OR = 0.7 [0.5-1.0]). This association was mostly seen in the group of children not carrying the IL13-rs20541 variant allele (Interaction Odds Ratio IOR 1.9, p-interaction = 0.07) and in those carrying the IL10 triple variant haplotype (IOR 0.5, p-interaction = 0.04). No interaction was observed with the candidate polymorphisms in IL4 and IL4R. This study provides a new insight into the relationship between allergic symptoms and childhood acute lymphoid leukaemia, by suggesting this inverse association could be limited to children carrying certain genetic polymorphisms. If confirmed, these results could help better understand the biological mechanisms involved in the development of childhood acute lymphoid leukaemia. Copyright © 2018. Published by Elsevier Ltd.

Candidate genes have sex-specific effects on timing of spring migration and moult speed in a long-distance migratory bird.

PubMed

Bazzi, Gaia; Podofillini, Stefano; Gatti, Emanuele; Gianfranceschi, Luca; Cecere, Jacopo G; Spina, Fernando; Saino, Nicola; Rubolini, Diego

2017-10-01

The timing of major life-history events, such as migration and moult, is set by endogenous circadian and circannual clocks, that have been well characterized at the molecular level. Conversely, the genetic sources of variation in phenology and in other behavioral traits have been sparsely addressed. It has been proposed that inter-individual variability in the timing of seasonal events may arise from allelic polymorphism at phenological candidate genes involved in the signaling cascade of the endogenous clocks. In this study of a long-distance migratory passerine bird, the willow warbler Phylloscopus trochilus , we investigated whether allelic variation at 5 polymorphic loci of 4 candidate genes ( Adcyap1 , Clock , Creb1 , and Npas2 ), predicted 2 major components of the annual schedule, namely timing of spring migration across the central Mediterranean sea and moult speed, the latter gauged from ptilochronological analyses of tail feathers moulted in the African winter quarters. We identified a novel Clock gene locus ( Clock region 3) showing polyQ polymorphism, which was however not significantly associated with any phenotypic trait. Npas2 allele size predicted male (but not female) spring migration date, with males bearing longer alleles migrating significantly earlier than those bearing shorter alleles. Creb1 allele size significantly predicted male (but not female) moult speed, longer alleles being associated with faster moult. All other genotype-phenotype associations were statistically non-significant. These findings provide new evidence for a role of candidate genes in modulating the phenology of different circannual activities in long-distance migratory birds, and for the occurrence of sex-specific candidate gene effects.

Transforming growth factor-β and toll-like receptor-4 polymorphisms are not associated with fibrosis in haemochromatosis

PubMed Central

Wood, Marnie J; Powell, Lawrie W; Dixon, Jeannette L; Subramaniam, V Nathan; Ramm, Grant A

2013-01-01

AIM: To investigate the role of genetic polymorphisms in the progression of hepatic fibrosis in hereditary haemochromatosis. METHODS: A cohort of 245 well-characterised C282Y homozygous patients with haemochromatosis was studied, with all subjects having liver biopsy data and DNA available for testing. This study assessed the association of eight single nucleotide polymorphisms (SNPs) in a total of six genes including toll-like receptor 4 (TLR4), transforming growth factor-beta (TGF-β), oxoguanine DNA glycosylase, monocyte chemoattractant protein 1, chemokine C-C motif receptor 2 and interleukin-10 with liver disease severity. Genotyping was performed using high resolution melt analysis and sequencing. The results were analysed in relation to the stage of hepatic fibrosis in multivariate analysis incorporating other cofactors including alcohol consumption and hepatic iron concentration. RESULTS: There were significant associations between the cofactors of male gender (P = 0.0001), increasing age (P = 0.006), alcohol consumption (P = 0.0001), steatosis (P = 0.03), hepatic iron concentration (P < 0.0001) and the presence of hepatic fibrosis. Of the candidate gene polymorphisms studied, none showed a significant association with hepatic fibrosis in univariate or multivariate analysis incorporating cofactors. We also specifically studied patients with hepatic iron loading above threshold levels for cirrhosis and compared the genetic polymorphisms between those with no fibrosis vs cirrhosis however there was no significant effect from any of the candidate genes studied. Importantly, in this large, well characterised cohort of patients there was no association between SNPs for TGF-β or TLR4 and the presence of fibrosis, cirrhosis or increasing fibrosis stage in multivariate analysis. CONCLUSION: In our large, well characterised group of haemochromatosis subjects we did not demonstrate any relationship between candidate gene polymorphisms and hepatic fibrosis or cirrhosis. PMID:24409064

Transforming growth factor-β and toll-like receptor-4 polymorphisms are not associated with fibrosis in haemochromatosis.

PubMed

Wood, Marnie J; Powell, Lawrie W; Dixon, Jeannette L; Subramaniam, V Nathan; Ramm, Grant A

2013-12-28

To investigate the role of genetic polymorphisms in the progression of hepatic fibrosis in hereditary haemochromatosis. A cohort of 245 well-characterised C282Y homozygous patients with haemochromatosis was studied, with all subjects having liver biopsy data and DNA available for testing. This study assessed the association of eight single nucleotide polymorphisms (SNPs) in a total of six genes including toll-like receptor 4 (TLR4), transforming growth factor-beta (TGF-β), oxoguanine DNA glycosylase, monocyte chemoattractant protein 1, chemokine C-C motif receptor 2 and interleukin-10 with liver disease severity. Genotyping was performed using high resolution melt analysis and sequencing. The results were analysed in relation to the stage of hepatic fibrosis in multivariate analysis incorporating other cofactors including alcohol consumption and hepatic iron concentration. There were significant associations between the cofactors of male gender (P = 0.0001), increasing age (P = 0.006), alcohol consumption (P = 0.0001), steatosis (P = 0.03), hepatic iron concentration (P < 0.0001) and the presence of hepatic fibrosis. Of the candidate gene polymorphisms studied, none showed a significant association with hepatic fibrosis in univariate or multivariate analysis incorporating cofactors. We also specifically studied patients with hepatic iron loading above threshold levels for cirrhosis and compared the genetic polymorphisms between those with no fibrosis vs cirrhosis however there was no significant effect from any of the candidate genes studied. Importantly, in this large, well characterised cohort of patients there was no association between SNPs for TGF-β or TLR4 and the presence of fibrosis, cirrhosis or increasing fibrosis stage in multivariate analysis. In our large, well characterised group of haemochromatosis subjects we did not demonstrate any relationship between candidate gene polymorphisms and hepatic fibrosis or cirrhosis.

Candidate genes for COPD in two large data sets.

PubMed

Bakke, P S; Zhu, G; Gulsvik, A; Kong, X; Agusti, A G N; Calverley, P M A; Donner, C F; Levy, R D; Make, B J; Paré, P D; Rennard, S I; Vestbo, J; Wouters, E F M; Anderson, W; Lomas, D A; Silverman, E K; Pillai, S G

2011-02-01

Lack of reproducibility of findings has been a criticism of genetic association studies on complex diseases, such as chronic obstructive pulmonary disease (COPD). We selected 257 polymorphisms of 16 genes with reported or potential relationships to COPD and genotyped these variants in a case-control study that included 953 COPD cases and 956 control subjects. We explored the association of these polymorphisms to three COPD phenotypes: a COPD binary phenotype and two quantitative traits (post-bronchodilator forced expiratory volume in 1 s (FEV₁) % predicted and FEV₁/forced vital capacity (FVC)). The polymorphisms significantly associated to these phenotypes in this first study were tested in a second, family-based study that included 635 pedigrees with 1,910 individuals. Significant associations to the binary COPD phenotype in both populations were seen for STAT1 (rs13010343) and NFKBIB/SIRT2 (rs2241704) (p<0.05). Single-nucleotide polymorphisms rs17467825 and rs1155563 of the GC gene were significantly associated with FEV₁ % predicted and FEV₁/FVC, respectively, in both populations (p<0.05). This study has replicated associations to COPD phenotypes in the STAT1, NFKBIB/SIRT2 and GC genes in two independent populations, the associations of the former two genes representing novel findings.

Evaluation of androgen receptor gene as a candidate gene in female androgenetic alopecia.

PubMed

el-Samahy, May H; Shaheen, Maha A; Saddik, Dina E B; Abdel-Fattah, Nermeen S A; el-Sawi, Mohammad A; Mahran, Manal Z; Shehab, Abeer A A

2009-06-01

Genetic polymorphisms of the androgen receptor (AR) gene have been studied in male androgenetic alopecia (AGA); however, little is known about gene polymorphism and female AGA. To evaluate the AR gene as a candidate gene for female AGA. Thirty premenopausal Egyptian female patients with AGA (mean age, 32.3 +/- 7 years) and 11 age- and sex-matched controls were included. All subjects underwent laboratory and pelvic ultrasound evaluation to exclude other precipitating cause(s) of hair loss. Scalp biopsy was taken and the AR gene was evaluated using polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP). According to Ludwig's classification, all patients had type II AGA. Statistical analysis showed no statistically significant difference in genotype (chi(2) = 5.513, P > or = 0.05) or allele frequency (chi(2) = 1.312, P > or = 0.05) between patients and controls. There was also no statistically significant difference between the genotype and allele frequency with disease duration. In contrast with male AGA, no association was found between type II AGA in Egyptian women and the AR gene. Therefore, the genetic study of this gene does not serve as a biomarker for the identification of women with a predisposition to AGA.

Analysis of polymorphic patterns in candidate genes in Israeli patients with prostate cancer.

PubMed

Figer, Arie; Friedman, Tal; Manguoglu, Ayse Esra; Flex, Dov; Vazina, Amnon; Novikov, Ilia; Shtrieker, Avi; Sidi, A Ami; Tichler, Thomas; Sapir, Einat Even; Baniel, Jack; Friedman, Eitan

2003-10-01

The precise genes involved in conferring prostate cancer risk in sporadic and familial cases are not fully known. To evaluate the genetic profile within several candidate genes of unselected prostate cancer cases and to correlate this profile with disease parameters. Jewish Israeli prostate cancer patients (n = 224) were genotyped for polymorphisms within candidate genes: p53, ER, VDR, GSTT1, CYP1A1, GSTP1, GSTM1, EPHX and HPC2/ELAC2, followed by analysis of the genotype with relevant clinical and pathologic parameters. The EPHX gene His113 allele was detected in 21.4% (33/154) of patients in whom disease was diagnosed above 61 years, compared with 5.7% (4/70) in earlier onset disease (P < 0.001). Within the group of late-onset disease, the same allele was noted in 5.5% (2/36) with grade I tumors compared with 18% (34/188) with grade II and up (P = 0.004). All other tested polymorphisms were not associated with a distinct clinical or pathologic feature in a statistically significant manner. In Israeli prostate cancer patients, the EPHX His113 allele is seemingly associated with a more advanced, late-onset disease. These preliminary data need to be confirmed by a larger and more ethnically diverse study.

Integration of QTL and bioinformatic tools to identify candidate genes for triglycerides in mice[S

PubMed Central

Leduc, Magalie S.; Hageman, Rachael S.; Verdugo, Ricardo A.; Tsaih, Shirng-Wern; Walsh, Kenneth; Churchill, Gary A.; Paigen, Beverly

2011-01-01

To identify genetic loci influencing lipid levels, we performed quantitative trait loci (QTL) analysis between inbred mouse strains MRL/MpJ and SM/J, measuring triglyceride levels at 8 weeks of age in F2 mice fed a chow diet. We identified one significant QTL on chromosome (Chr) 15 and three suggestive QTL on Chrs 2, 7, and 17. We also carried out microarray analysis on the livers of parental strains of 282 F2 mice and used these data to find cis-regulated expression QTL. We then narrowed the list of candidate genes under significant QTL using a “toolbox” of bioinformatic resources, including haplotype analysis; parental strain comparison for gene expression differences and nonsynonymous coding single nucleotide polymorphisms (SNP); cis-regulated eQTL in livers of F2 mice; correlation between gene expression and phenotype; and conditioning of expression on the phenotype. We suggest Slc25a7 as a candidate gene for the Chr 7 QTL and, based on expression differences, five genes (Polr3 h, Cyp2d22, Cyp2d26, Tspo, and Ttll12) as candidate genes for Chr 15 QTL. This study shows how bioinformatics can be used effectively to reduce candidate gene lists for QTL related to complex traits. PMID:21622629

Dopaminergic Polymorphisms and Educational Achievement: Results from a Longitudinal Sample of Americans

ERIC Educational Resources Information Center

Beaver, Kevin M.; Wright, John Paul; DeLisi, Matt; Vaughn, Michael G.

2012-01-01

Although educational attainment has been found to be moderately heritable, research has yet to explore candidate genes for it. Drawing on data from the National Longitudinal Study of Adolescent Health, in the current study, we examined the association between polymorphisms in three dopaminergic genes (DAT1, DRD2, and DRD4), a dopamine index, and…

An Efficient Strategy Combining SSR Markers- and Advanced QTL-seq-driven QTL Mapping Unravels Candidate Genes Regulating Grain Weight in Rice

PubMed Central

Daware, Anurag; Das, Sweta; Srivastava, Rishi; Badoni, Saurabh; Singh, Ashok K.; Agarwal, Pinky; Parida, Swarup K.; Tyagi, Akhilesh K.

2016-01-01

Development and use of genome-wide informative simple sequence repeat (SSR) markers and novel integrated genomic strategies are vital to drive genomics-assisted breeding applications and for efficient dissection of quantitative trait loci (QTLs) underlying complex traits in rice. The present study developed 6244 genome-wide informative SSR markers exhibiting in silico fragment length polymorphism based on repeat-unit variations among genomic sequences of 11 indica, japonica, aus, and wild rice accessions. These markers were mapped on diverse coding and non-coding sequence components of known cloned/candidate genes annotated from 12 chromosomes and revealed a much higher amplification (97%) and polymorphic potential (88%) along with wider genetic/functional diversity level (16–74% with a mean 53%) especially among accessions belonging to indica cultivar group, suggesting their utility in large-scale genomics-assisted breeding applications in rice. A high-density 3791 SSR markers-anchored genetic linkage map (IR 64 × Sonasal) spanning 2060 cM total map-length with an average inter-marker distance of 0.54 cM was generated. This reference genetic map identified six major genomic regions harboring robust QTLs (31% combined phenotypic variation explained with a 5.7–8.7 LOD) governing grain weight on six rice chromosomes. One strong grain weight major QTL region (OsqGW5.1) was narrowed-down by integrating traditional QTL mapping with high-resolution QTL region-specific integrated SSR and single nucleotide polymorphism markers-based QTL-seq analysis and differential expression profiling. This led us to delineate two natural allelic variants in two known cis-regulatory elements (RAV1AAT and CARGCW8GAT) of glycosyl hydrolase and serine carboxypeptidase genes exhibiting pronounced seed-specific differential regulation in low (Sonasal) and high (IR 64) grain weight mapping parental accessions. Our genome-wide SSR marker resource (polymorphic within/between diverse cultivar groups) and integrated genomic strategy can efficiently scan functionally relevant potential molecular tags (markers, candidate genes and alleles) regulating complex agronomic traits (grain weight) and expedite marker-assisted genetic enhancement in rice. PMID:27833617

Single nucleotide polymorphisms in candidate genes related to daughter pregnancy rate in Holstein cows

USDA-ARS?s Scientific Manuscript database

ABSTRACT: Previously, a candidate gene approach identified 40 SNPs associated with daughter pregnancy rate (DPR) in dairy bulls. We evaluated 39 of these SNPs for relationship to DPR in a separate population of Holstein cows grouped on their predicted transmitting ability for DPR: <= -1 (n=1266) a...

Refining the Candidate Environment: Interpersonal Stress, the Serotonin Transporter Polymorphism, and Gene-Environment Interactions in Major Depression.

PubMed

Vrshek-Schallhorn, Suzanne; Mineka, Susan; Zinbarg, Richard E; Craske, Michelle G; Griffith, James W; Sutton, Jonathan; Redei, Eva E; Wolitzky-Taylor, Kate; Hammen, Constance; Adam, Emma K

2014-05-01

Meta-analytic evidence supports a gene-environment (G×E) interaction between life stress and the serotonin transporter polymorphism (5-HTTLPR) on depression, but few studies have examined factors that influence detection of this effect, despite years of inconsistent results. We propose that the "candidate environment" (akin to a candidate gene) is key. Theory and evidence implicate major stressful life events (SLEs)-particularly major interpersonal SLEs-as well as chronic family stress. Participants ( N = 400) from the Youth Emotion Project (which began with 627 high school juniors oversampled for high neuroticism) completed up to five annual diagnostic and life stress interviews and provided DNA samples. A significant G×E effect for major SLEs and S -carrier genotype was accounted for significantly by major interpersonal SLEs but not significantly by major non-interpersonal SLEs. S -carrier genotype and chronic family stress also significantly interacted. Identifying such candidate environments may facilitate future G×E research in depression and psychopathology more broadly.

Revisiting genome wide association studies (GWAS) in coeliac disease: replication study in Spanish population and expression analysis of candidate genes.

PubMed

Plaza-Izurieta, Leticia; Castellanos-Rubio, Ainara; Irastorza, Iñaki; Fernández-Jimenez, Nora; Gutierrez, Galder; Bilbao, Jose Ramon

2011-07-01

Recent genome wide association studies (GWAS) on coeliac disease (CD) have identified risk loci harbouring genes that fit the accepted pathogenic model and are considered aetiological candidates. Using Taqman single nucleotide polymorphism (SNP) and expression assays, the study genotyped 11 SNPs tagging eight GWAS regions (1q31, 2q11-2q12, 3p21, 3q25-3q26, 3q28, 4q27, 6q25 and 12q24) in a Spanish cohort of 1094 CD patients and 540 controls, and performed expression analyses of candidate genes (RGS1, IL18R1/IL18RAP, CCR3, IL12A/SCHIP1, LPP, IL2/IL21-KIAA1109, TAGAP, and SH2B3) in intestinal mucosa from 29 CD children and eight controls. Polymorphisms in 1q31, 2q11-2q12, and 3q25 showed association in our cohort, and also 3q28 and 4q27 when combined with a previous study. Expression levels of IL12A, IL18RAP, IL21, KIAA1109, LPP, SCHIP1, and SH2B3 were affected by disease status, but the correlation between genotype and mRNA levels was observed only in IL12A, LPP, SCHIP1, and SH2B3. Expression differences between treated CD patients and controls along with SNP expression associations suggest a possible primary role for these four genes and their variants in pathogenesis. The lack of SNP effect in the remaining genes is probably a consequence of arbitrary candidate gene selection within association signals that are not based on functional studies.

Serotonergic gene polymorphisms (5-HTTLPR, 5HTR1A, 5HTR2A), and population differences in aggression: traditional (Hadza and Datoga) and industrial (Russians) populations compared.

PubMed

Butovskaya, Marina L; Butovskaya, Polina R; Vasilyev, Vasiliy A; Sukhodolskaya, Jane M; Fekhredtinova, Dania I; Karelin, Dmitri V; Fedenok, Julia N; Mabulla, Audax Z P; Ryskov, Alexey P; Lazebny, Oleg E

2018-04-16

Current knowledge on genetic basis of aggressive behavior is still contradictory. This may be due to the fact that the majority of studies targeting associations between candidate genes and aggression are conducted on industrial societies and mainly dealing with various types of psychopathology and disorders. Because of that, our study was carried on healthy adult individuals of both sex (n = 853). Three populations were examined: two traditional (Hadza and Datoga) and one industrial (Russians), and the association of aggression with the following polymorphisms 5-HTTLPR, rs6295 (5HTR1A gene), and rs6311 (5HTR2A gene) were tested. Aggression was measured as total self-ratings on Buss-Perry Aggression Questionnaire. Distributions of allelic frequencies of 5-HTTLPR and 5HTR1A polymorphisms were significantly different among the three populations. Consequently, the association analyses for these two candidate genes were carried out separately for each population, while for the 5HTR2A polymorphism, it was conducted on the pooled data that made possible to introduce ethnic factor in the ANOVA model. The traditional biometrical approach revealed no sex differences in total aggression in all three samples. The three-way ANOVA (μ + 5-HTTLPR + 5HTR1A + 5HTR2A +ε) with measures of self-reported total aggression as dependent variable revealed significant effect of the second serotonin receptor gene polymorphism for the Hadza sample. For the Datoga, the interaction effect between 5-HTTLPR and 5HTR1A was significant. No significant effects of the used polymorphisms were obtained for Russians. The results of two-way ANOVA with ethnicity and the 5HTR2A polymorphism as main effects and their interactions revealed the highly significant effect of ethnicity, 5HTR2A polymorphism, and their interaction on total aggression. Our data provided obvious confirmation for the necessity to consider the population origin, as well as cultural background of tested individuals, while searching for associations between genes and behavior, and demonstrated the role of cultural attitudes towards the use of in-group aggression. Our data partly explained the reasons for disagreement in results of different teams, searching for candidate-gene associations with behavior without considerations of culturally desirable norms. Previous studies suggested that the 5HTR2A gene polymorphism associates with aggression and criminality. Our data extended these findings, demonstrating the role of rs6311 (5HTR2A gene) in aggression in adult healthy men and women from our samples. We found that G-allele carriers were rated higher on total aggression.

Association between polymorphisms in prostanoid receptor genes and aspirin-intolerant asthma.

PubMed

Kim, Sang-Heon; Kim, Yoon-Keun; Park, Heung-Woo; Jee, Young-Koo; Kim, Sang-Hoon; Bahn, Joon-Woo; Chang, Yoon-Seok; Kim, Seung-Hyun; Ye, Young-Min; Shin, Eun-Soon; Lee, Jong-Eun; Park, Hae-Sim; Min, Kyung-Up

2007-04-01

Genetic predisposition is linked to the pathogenesis of aspirin-intolerant asthma. Most candidate gene approaches have focused on leukotriene-related pathways, whereas there have been relatively few studies evaluating the effects of polymorphisms in prostanoid receptor genes on the development of aspirin-intolerant asthma. Therefore, we investigated the potential association between prostanoid receptor gene polymorphisms and the aspirin-intolerant asthma phenotype. We screened for genetic variations in the prostanoid receptor genes PTGER1, PTGER2, PTGER3, PTGER4, PTGDR, PTGIR, PTGFR, and TBXA2R using direct sequencing, and selected 32 tagging single nucleotide polymorphisms among the 77 polymorphisms with frequencies >0.02 based on linkage disequilibrium for genotyping. We compared the genotype distributions and allele frequencies of three participant groups (108 patients with aspirin-intolerant asthma, 93 patients with aspirin-tolerant asthma, and 140 normal controls). Through association analyses studies of the 32 single nucleotide polymorphisms, the following single nucleotide polymorphisms were found to have significant associations with the aspirin-intolerant asthma phenotype: -616C>G (P=0.038) and -166G>A (P=0.023) in PTGER2; -1709T>A (P=0.043) in PTGER3; -1254A>G (P=0.018) in PTGER4; 1915T>C (P=0.015) in PTGIR; and -4684C>T (P=0.027), and 795T>C (P=0.032) in TBXA2R. In the haplotype analysis of each gene, the frequency of PTGIR ht3[G-G-C-C], which includes 1915T>C, differed significantly between the aspirin-intolerant asthma patients and aspirin-tolerant asthma patients (P=0.015). These findings suggest that genetic polymorphisms in PTGER2, PTGER3, PTGER4, PTGIR, and TBXA2R play important roles in the pathogenesis of aspirin-intolerant asthma.

Cytokine gene polymorphisms and atopic disease in two European cohorts. (ECRHS-Basel and SAPALDIA)

PubMed Central

Imboden, M; Nieters, A; Bircher, AJ; Brutsche, M; Becker, N; Wjst, M; Ackermann-Liebrich, U; Berger, W; Probst-Hensch, NM

2006-01-01

Background Atopy and allergic phenotypes are biologically characterized by an imbalanced T helper cell response skewed towards a type 2 (TH2) immune response associated with elevated serum immunoglobulin E (IgE) levels. Polymorphisms in cytokine genes might modulate regulation of the TH1/TH2 balance. We thus aimed at reproducing our previous findings from a European study population on the association of various cytokine polymorphisms with self-reported hay fever as well as increased total and specific IgE levels in two comparable study populations. Methods Two prospective Caucasian cohorts were used. In the Basel center of the European Community Respiratory Health Survey (ECRHS, n = 418) ten distinct cytokine polymorphisms of putative functional relevance were genotyped. In the Swiss cohort Study on Air Pollution And Lung Disease In Adults (SAPALDIA, n = 6003) two cytokine polymorphisms were genotyped. The associations of these polymorphisms with atopy were estimated by covariance and logistic regression analysis. Results We confirmed IL4, IL10, IL6 and IL18 as candidate genes for atopic health outcomes. In the large, well-characterized SAPALDIA cohort the IL6(-174G>C) and IL18(-137G>C) polymorphisms were associated with circulating total IgE concentrations in subjects with hay fever. The IL18(-137G>C) polymorphism was also associated with the prevalence of hay fever. Conclusion Comprehensive characterization of genetic variation in extended cytokine candidate gene regions is now needed. Large study networks must follow to investigate the association of risk patterns defined by genetic predisposing and environmental risk factors with specific atopic phenotypes. PMID:16759385

A Family-Based Association Study of CYP11A1 and CYP11B1 Gene Polymorphisms With Autism in Chinese Trios.

PubMed

Deng, Hong-Zhu; You, Cong; Xing, Yu; Chen, Kai-Yun; Zou, Xiao-Bing

2016-05-01

Autism spectrum disorder is a group of neurodevelopmental disorders with the higher prevalence in males. Our previous studies have indicated lower progesterone levels in the children with autism spectrum disorder, suggesting involvement of the cytochrome P-450scc gene (CYP11A1) and cytochrome P-45011beta gene (CYP11B1) as candidate genes in autism spectrum disorder. The aim of this study was to investigate the family-based genetic association between single-nucleotide polymorphisms, rs2279357 in the CYP11A1 gene and rs4534 and rs4541 in the CYP11B1 gene and autism spectrum disorder in Chinese children, which were selected according to the location in the coding region and 5' and 3' regions and minor allele frequencies of greater than 0.05 in the Chinese populations. The transmission disequilibrium test and case-control association analyses were performed in 100 Chinese Han autism spectrum disorder family trios. The genotype and allele frequency of the 3 single-nucleotide polymorphisms had no statistical difference between the children with autism spectrum disorder and their parents (P> .05). Transmission disequilibrium test analysis showed transmission disequilibrium of CYP11A1 gene rs2279357 single-nucleotide polymorphisms (χ(2)= 5.038,P< .001). Our findings provide further support for the hypothesis that a susceptibility gene for autism spectrum disorder exists within or near the CYP11A1 gene in the Han Chinese population. © The Author(s) 2015.

No association between polymorphisms in the DDC gene and paranoid schizophrenia in a northern Chinese population.

PubMed

Zhang, Boyu; Jia, Yanbin; Yuan, Yanbo; Yu, Xin; Xu, Qi; Shen, Yucun; Shen, Yan

2004-09-01

Several lines of evidence suggest that dysfunctions of neurotransmitters are associated with schizophrenia. DOPA decarboxylase (DDC) is an enzyme involved directly in the synthesis of dopamine and serotonin, and indirectly in the synthesis of noradrenaline. Therefore, the DDC gene can be considered a candidate gene for schizophrenia. We performed an association study between three single nucleotide polymorphisms in the DDC gene and paranoid schizophrenia. However, in our study no significant differences were found in the genotype distributions and allele frequencies between 80 paranoid schizophrenics and 108 controls for any of the polymorphisms. Neither did the haplotypes of the single nucleotide polymorphisms show any association with paranoid schizophrenia. Therefore, we conclude that the polymorphisms studied do not play a major role in paranoid schizophrenia pathogenesis in the population investigated.

Scanning the genome for gene single nucleotide polymorphisms involved in adaptive population differentiation in white spruce

PubMed Central

Namroud, Marie-Claire; Beaulieu, Jean; Juge, Nicolas; Laroche, Jérôme; Bousquet, Jean

2008-01-01

Conifers are characterized by a large genome size and a rapid decay of linkage disequilibrium, most often within gene limits. Genome scans based on noncoding markers are less likely to detect molecular adaptation linked to genes in these species. In this study, we assessed the effectiveness of a genome-wide single nucleotide polymorphism (SNP) scan focused on expressed genes in detecting local adaptation in a conifer species. Samples were collected from six natural populations of white spruce (Picea glauca) moderately differentiated for several quantitative characters. A total of 534 SNPs representing 345 expressed genes were analysed. Genes potentially under natural selection were identified by estimating the differentiation in SNP frequencies among populations (FST) and identifying outliers, and by estimating local differentiation using a Bayesian approach. Both average expected heterozygosity and population differentiation estimates (HE = 0.270 and FST = 0.006) were comparable to those obtained with other genetic markers. Of all genes, 5.5% were identified as outliers with FST at the 95% confidence level, while 14% were identified as candidates for local adaptation with the Bayesian method. There was some overlap between the two gene sets. More than half of the candidate genes for local adaptation were specific to the warmest population, about 20% to the most arid population, and 15% to the coldest and most humid higher altitude population. These adaptive trends were consistent with the genes’ putative functions and the divergence in quantitative traits noted among the populations. The results suggest that an approach separating the locus and population effects is useful to identify genes potentially under selection. These candidates are worth exploring in more details at the physiological and ecological levels. PMID:18662225

Identification and characterization of single nucleotide polymorphisms in 6 growth-correlated genes in porcine by denaturing high performance liquid chromatography.

PubMed

Liu, Dewu; Zhang, Yushan; Du, Yinjun; Yang, Guanfu; Zhang, Xiquan

2007-06-01

The growth-correlated genes that are part of the neuroendocrine growth axis play crucial roles in the regulation of growth and development of pig. The identification of genetic polymorphisms in these genes will enable the scientist to evaluate the biological relevance of such polymorphisms and to gain a better understanding of quantitative traits like growth. In the present study, seven pairs of primers were designed to obtain unknown sequences of growth-correlated genes, and other 25 pairs of primers were designed to identify single nucleotide polymorphisms (SNP) using the denaturing high-performance liquid chromatography (DHPLC) technology in four pig breeds (Duroc, Landrace, Lantang and Wuzhishan), significantly differing in growth and development characteristics. A total of 101 polymorphisms were discovered in 10,707 base pairs (bp) from six genes of the ghrelin (GHRL), leptin (LEP), insulin-like growth factor II (IGF-II), insulin-like growth factor binding protein 2 (IGFBP-2), insulin-like growth factor binding protein 3 (IGFBP-3), and somatostatin (SS). The observed average distances between the SNP in the 5'UTR, coding regions, introns and 3'UTR were 134, 521, 81 and 92 bp, respectively. Four SNPs were found in the coding regions of IGF-II, IGFBP-2 and LEP, respectively. Two synonymous mutations were obtained in IGF-II and LEP genes respectively, and two non-synonymous were found in IGFBP-2 and LEP genes, respectively. Seven other mutations were also observed. Thirty-two PCR-RFLP markers were found among 101 polymorphisms of the six genes. The SNP discovered in this study would provide suitable markers for association studies of candidate genes with growth related traits in pig.

Association of candidate gene polymorphisms with clinical subtypes of preterm birth in a Latin American population

PubMed Central

Gimenez, Lucas G.; Momany, Allison M.; Poletta, Fernando A.; Krupitzki, Hugo B.; Gili, Juan A.; Busch, Tamara D.; Saleme, Cesar; Cosentino, Viviana R.; Pawluk, Mariela S.; Campaña, Hebe; Gadow, Enrique C.; Murray, Jeffrey C.; Lopez-Camelo, Jorge S.

2017-01-01

Background Preterm birth (PTB) is the leading cause of neonatal mortality and morbidity. PTB is often classified according to clinical presentation: Idiopathic (PTB-I), preterm premature rupture of membranes (PTB-PPROM), and medically induced (PTB-M). The aim of this study was to evaluate the associations between specific candidate genes and clinical subtypes of PTB. Methods 24 SNPs were genotyped in 18 candidate genes in 709 infant triads. Of them, 243 were PTB-I, 256 PTB-PPROM, and 210 PTB-M. These data were analyzed with a Family-Based Association. Results PTB was nominally associated with rs2272365 in PON1, rs883319 in KCNN3, rs4458044 in CRHR1, and rs610277 in F3. Regarding clinical subtypes analysis, 3 SNPs were associated with PTB-I (rs2272365 in PON1, rs10178458 in COL4A3, and rs4458044 in CRHR1), rs610277 in F3 was associated with PTB-PPROM, and rs883319 in KCNN3 and rs610277 in F3 were associated with PTB-M. Conclusions Our study identified polymorphisms potentially associated with specific clinical subtypes of PTB in this Latin American population. These results could suggest a specific role of such genes in the mechanisms involved in each clinical subtype. Further studies are required to confirm our results and to determine the role of these genes in the pathophysiology of clinical subtypes. PMID:28426651

Population-based case-control study of DRD2 gene polymorphisms and alcoholism.

PubMed

Bhaskar, L V K S; Thangaraj, K; Non, A L; Singh, Lalji; Rao, V R

2010-10-01

Several independent lines of evidence for genetic contributions to vulnerability to alcoholism exist. Dopamine is thought to play a major role in the mechanism of reward and reinforcement in response to alcohol. D2 dopamine receptor (DRD2) gene has been among the stronger candidate genes implicated in alcoholism. In this study, alcohol use was assessed in 196 randomly selected Kota individuals of Nilgiri Hills, South India. Six DRD2 SNPs were assessed in 81 individuals with alcoholism and 151 controls to evaluate the association between single nucleotide polymorphisms (SNPs) and alcoholism. Of the three models (dominant, recessive, and additive) tested for association between alcoholism and DRD2 SNPs, only the additive model shows association for three loci (rs1116313, TaqID, and rs2734835). Of six studied polymorphisms, five are in strong linkage disequilibrium forming onesingle haplotype block. Though the global haplotype analysis with these five SNPs was not significant, haplotype analysis using all six SNPs yielded a global P value of .033, even after adjusting for age. These findings support the importance of dopamine receptor gene polymorphisms in alcoholism. Further studies to replicate these findings in different populations are needed to confirm these results.

Associations of polymorphisms in the Pit-1 gene with growth and carcass traits in Angus beef cattle.

PubMed

Zhao, Q; Davis, M E; Hines, H C

2004-08-01

The Pit-1 gene was studied as a candidate for genetic markers of growth and carcass traits. Angus beef cattle that were divergently selected for high- or low-blood serum IGF-I concentration were used in this study. The single-strand conformation polymorphism method was used to identify polymorphism in the Pit-1 gene including regions from intron 2 to exon 6. Two polymorphisms, Pit1I3H (HinfI) and Pit1I3NL (NlaIII), were detected in intron 3 of the Pit-1 gene. One polymorphism, Pit1I4N (BstNI), was found in intron 4, and a single nucleotide polymorphism, Pit1I5, was found in intron 5. The previously reported polymorphism in exon 6, Pit1E6H (HinfI), was also studied in 416 Angus beef cattle. Associations of the polymorphisms with growth traits, carcass traits, and IGF-I concentration were analyzed using a general linear model procedure. No significant associations were observed between these polymorphisms and growth and carcass traits.

Multilocus patterns of polymorphism and selection across the X chromosome of Caenorhabditis remanei.

PubMed

Cutter, Asher D

2008-03-01

Natural selection and neutral processes such as demography, mutation, and gene conversion all contribute to patterns of polymorphism within genomes. Identifying the relative importance of these varied components in evolution provides the principal challenge for population genetics. To address this issue in the nematode Caenorhabditis remanei, I sampled nucleotide polymorphism at 40 loci across the X chromosome. The site-frequency spectrum for these loci provides no evidence for population size change, and one locus presents a candidate for linkage to a target of balancing selection. Selection for codon usage bias leads to the non-neutrality of synonymous sites, and despite its weak magnitude of effect (N(e)s approximately 0.1), is responsible for profound patterns of diversity and divergence in the C. remanei genome. Although gene conversion is evident for many loci, biased gene conversion is not identified as a significant evolutionary process in this sample. No consistent association is observed between synonymous-site diversity and linkage-disequilibrium-based estimators of the population recombination parameter, despite theoretical predictions about background selection or widespread genetic hitchhiking, but genetic map-based estimates of recombination are needed to rigorously test for a diversity-recombination relationship. Coalescent simulations also illustrate how a spurious correlation between diversity and linkage-disequilibrium-based estimators of recombination can occur, due in part to the presence of unbiased gene conversion. These results illustrate the influence that subtle natural selection can exert on polymorphism and divergence, in the form of codon usage bias, and demonstrate the potential of C. remanei for detecting natural selection from genomic scans of polymorphism.

Strong Impact of TGF-β1 Gene Polymorphisms on Breast Cancer Risk in Indian Women: A Case-Control and Population-Based Study

PubMed Central

Rajender, Singh; Tamang, Rakesh; Rajkumar, Raja; Saini, Karan Singh; Megu, Kaling; Goel, Madhu Mati; Surekha, Daminani; Rao, Digumarthi Raghunatha; Rao, Lakshmi; Ramachandra, Lingadakai; Kumar, Sandeep; Kumar, Surender; Vishnupriya, Satti; Satyamoorthy, Kapaettu; Negi, Mahendra Pal Singh; Thangaraj, Kumarasamy; Konwar, Rituraj

2013-01-01

Introduction TGF-β1 is a multi-functional cytokine that plays an important role in breast carcinogenesis. Critical role of TGF-β1 signaling in breast cancer progression is well documented. Some TGF-β1 polymorphisms influence its expression; however, their impact on breast cancer risk is not clear. Methods We analyzed 1222 samples in a candidate gene-based genetic association study on two distantly located and ethnically divergent case-control groups of Indian women, followed by a population-based genetic epidemiology study analyzing these polymorphisms in other Indian populations. The c.29C>T (Pro10Leu, rs1982073 or rs1800470) and c.74G>C (Arg25Pro, rs1800471) polymorphisms in the TGF-β1 gene were analyzed using direct DNA sequencing, and peripheral level of TGF-β1 were measured by ELISA. Results c.29C>T substitution increased breast cancer risk, irrespective of ethnicity and menopausal status. On the other hand, c.74G>C substitution reduced breast cancer risk significantly in the north Indian group (p = 0.0005) and only in the pre-menopausal women. The protective effect of c.74G>C polymorphism may be ethnicity-specific, as no association was seen in south Indian group. The polymorphic status of c.29C>T was comparable among Indo-Europeans, Dravidians, and Tibeto-Burmans. Interestingly, we found that Tibeto-Burmans lack polymorphism at c.74G>C locus as true for the Chinese populations. However, the Brahmins of Nepal (Indo-Europeans) showed polymorphism in 2.08% of alleles. Mean TGF-β1 was significantly elevated in patients in comparison to controls (p<0.001). Conclusion c.29C>T and c.74G>C polymorphisms in the TGF-β1 gene significantly affect breast cancer risk, which correlates with elevated TGF-β1 level in the patients. The c.29C>T locus is polymorphic across ethnically different populations, but c.74G>C locus is monomorphic in Tibeto-Burmans and polymorphic in other Indian populations. PMID:24146803

Genome-wide association studies and epistasis analyses of candidate genes related to age at menarche and age at natural menopause in a Korean population.

PubMed

Pyun, Jung-A; Kim, Sunshin; Cho, Nam H; Koh, InSong; Lee, Jong-Young; Shin, Chol; Kwack, KyuBum

2014-05-01

The aim of this study was to identify polymorphisms and gene-gene interactions that are significantly associated with age at menarche and age at menopause in a Korean population. A total of 3,452 and 1,827 women participated in studies of age at menarche and age at natural menopause, respectively. Linear regression analyses adjusted for residence area were used to perform genome-wide association studies (GWAS), candidate gene association studies, and interactions between the candidate genes for age at menarche and age at natural menopause. In GWAS, four single nucleotide polymorphisms (SNPs; rs7528241, rs1324329, rs11597068, and rs6495785) were strongly associated with age at natural menopause (lowest P = 9.66 × 10). However, GWAS of age at menarche did not reveal any strong associations. In candidate gene association studies, SNPs with P < 0.01 were selected to test their synergistic interactions. For age at natural menopause, there was a significant interaction between intronic SNPs on ADAM metallopeptidase with thrombospondin type I motif 9 (ADAMTS9) and SMAD family member 3 (SMAD3) genes (P = 9.52 × 10). For age at menarche, there were three significant interactions between three intronic SNPs on follicle-stimulating hormone receptor (FSHR) gene and one SNP located at the 3' flanking region of insulin-like growth factor 2 receptor (IGF2R) gene (lowest P = 1.95 × 10). Novel SNPs and synergistic interactions between candidate genes are significantly associated with age at menarche and age at natural menopause in a Korean population.

Genome-wide association links candidate genes to resistance to Plum Pox Virus in apricot (Prunus armeniaca).

PubMed

Mariette, Stéphanie; Wong Jun Tai, Fabienne; Roch, Guillaume; Barre, Aurélien; Chague, Aurélie; Decroocq, Stéphane; Groppi, Alexis; Laizet, Yec'han; Lambert, Patrick; Tricon, David; Nikolski, Macha; Audergon, Jean-Marc; Abbott, Albert G; Decroocq, Véronique

2016-01-01

In fruit tree species, many important traits have been characterized genetically by using single-family descent mapping in progenies segregating for the traits. However, most mapped loci have not been sufficiently resolved to the individual genes due to insufficient progeny sizes for high resolution mapping and the previous lack of whole-genome sequence resources of the study species. To address this problem for Plum Pox Virus (PPV) candidate resistance gene identification in Prunus species, we implemented a genome-wide association (GWA) approach in apricot. This study exploited the broad genetic diversity of the apricot (Prunus armeniaca) germplasm containing resistance to PPV, next-generation sequence-based genotyping, and the high-quality peach (Prunus persica) genome reference sequence for single nucleotide polymorphism (SNP) identification. The results of this GWA study validated previously reported PPV resistance quantitative trait loci (QTL) intervals, highlighted other potential resistance loci, and resolved each to a limited set of candidate genes for further study. This work substantiates the association genetics approach for resolution of QTL to candidate genes in apricot and suggests that this approach could simplify identification of other candidate genes for other marked trait intervals in this germplasm. © 2015 INRA, UMR 1332 BFP New Phytologist © 2015 New Phytologist Trust.

Mapping a candidate gene (MdMYB10) for red flesh and foliage colour in apple

PubMed Central

Chagné, David; Carlisle, Charmaine M; Blond, Céline; Volz, Richard K; Whitworth, Claire J; Oraguzie, Nnadozie C; Crowhurst, Ross N; Allan, Andrew C; Espley, Richard V; Hellens, Roger P; Gardiner, Susan E

2007-01-01

Background Integrating plant genomics and classical breeding is a challenge for both plant breeders and molecular biologists. Marker-assisted selection (MAS) is a tool that can be used to accelerate the development of novel apple varieties such as cultivars that have fruit with anthocyanin through to the core. In addition, determining the inheritance of novel alleles, such as the one responsible for red flesh, adds to our understanding of allelic variation. Our goal was to map candidate anthocyanin biosynthetic and regulatory genes in a population segregating for the red flesh phenotypes. Results We have identified the Rni locus, a major genetic determinant of the red foliage and red colour in the core of apple fruit. In a population segregating for the red flesh and foliage phenotype we have determined the inheritance of the Rni locus and DNA polymorphisms of candidate anthocyanin biosynthetic and regulatory genes. Simple Sequence Repeats (SSRs) and Single Nucleotide Polymorphisms (SNPs) in the candidate genes were also located on an apple genetic map. We have shown that the MdMYB10 gene co-segregates with the Rni locus and is on Linkage Group (LG) 09 of the apple genome. Conclusion We have performed candidate gene mapping in a fruit tree crop and have provided genetic evidence that red colouration in the fruit core as well as red foliage are both controlled by a single locus named Rni. We have shown that the transcription factor MdMYB10 may be the gene underlying Rni as there were no recombinants between the marker for this gene and the red phenotype in a population of 516 individuals. Associating markers derived from candidate genes with a desirable phenotypic trait has demonstrated the application of genomic tools in a breeding programme of a horticultural crop species. PMID:17608951

Polymorphisms in genes encoding dopamine signalling pathway and risk of alcohol dependence: a systematic review.

PubMed

Bhaskar, Lakkakula V K S; Kumar, Shanmugasundaram Arun

2014-04-01

Alcohol dependence (AD) is one of the major elements that significantly influence drinking pattern that provoke the alcohol-induced organ damage. The structural and neurophysiologic abnormalities in the frontal lobes of chronic alcoholics were revealed by magnetic resonance imaging scans. It is well known that candidate genes involved in dopaminergic pathway are of immense interest to the researchers engaged in a wide range of addictive disorders. Dopaminergic pathway gene polymorphisms are being extensively studied with respect to addictive and behavioral disorders. From the broad literature available, the current review summarizes the specific polymorphisms of dopaminergic genes that play a role in alcohol dependence. No evidence indicating any strong association between AD and polymorphisms of dopamine pathway genes has emerged from the literature. Further studies are warranted, considering a range of alcohol-related traits to determine the genes that influence alcohol dependence.

Association of polymorphisms in growth hormone and leptin candidate genes with live weight traits of Brahman cattle.

PubMed

Hernández, N; Martínez-González, J C; Parra-Bracamonte, G M; Sifuentes-Rincón, A M; López-Villalobos, N; Morris, S T; Briones-Encinia, F; Ortega-Rivas, E; Pacheco-Contreras, V I; L A Meza-García, And

2016-09-02

Polymorphisms in candidate genes can produce significant and favorable changes in the phenotype, and therefore are useful for the identification of the best combination of favorable variants for marker-assisted selection. In the present study, an assessment to evaluate the effect of 11 single nucleotide polymorphisms (SNPs) in candidate genes on live weight traits of registered Brahman cattle was performed. Data from purebred bulls were used in this assessment. The dataset included birth (BW), weaning (WW), and yearling (YW) weights. A panel of 11 SNP markers, selected by their formerly reported or apparent direct and indirect association with live weight traits, was included in an assessment previously confirming their minimum allele frequency (<0.05). Live weights were adjusted BW (aBW), WW (aWW), and YW (aYW) using a generalized linear model, which included the fixed effects of herd and season of birth and the random effect of the sire and year of birth. An SNP in a growth hormone gene (GH4.1) was significantly related to aWW (P = 0.035) with an estimate substitution effect of 3.97 kg (P = 0.0210). In addition, a leptin SNP (LEPg.978) was significantly associated with aYW (P = 0.003) with an estimate substitution effect of 9.57 kg (P = 0.0007). The results suggest that markers GH4.1 and LEPg.978 can be considered as candidate loci for assisted genetic improvement programs in Mexican Brahman cattle.

Identification and association analysis of several hundred single nucleotide polymorphisms within candidate genes for back fat thickness in Italian Large White pigs using a selective genotyping approach.

PubMed

Fontanesi, L; Galimberti, G; Calò, D G; Fronza, R; Martelli, P L; Scotti, E; Colombo, M; Schiavo, G; Casadio, R; Buttazzoni, L; Russo, V

2012-08-01

Combining different approaches (resequencing of portions of 54 obesity candidate genes, literature mining for pig markers associated with fat deposition or related traits in 77 genes, and in silico mining of porcine expressed sequence tags and other sequences available in databases), we identified and analyzed 736 SNP within candidate genes to identify markers associated with back fat thickness (BFT) in Italian Large White sows. Animals were chosen using a selective genotyping approach according to their EBV for BFT (276 with most negative and 279 with most positive EBV) within a population of ≈ 12,000 pigs. Association analysis between the SNP and BFT has been carried out using the MAX test proposed for case-control studies. The designed assays were successful for 656 SNP: 370 were excluded (low call rate or minor allele frequency <5%), whereas the remaining 286 in 212 genes were taken for subsequent analyses, among which 64 showed a P(nominal) value <0.1. To deal with the multiple testing problem in a candidate gene approach, we applied the proportion of false positives (PFP) method. Thirty-eight SNP were significant (P(PFP) < 0.20). The most significant SNP was the IGF2 intron3-g.3072G>A polymorphism (P(nominal) < 1.0E-50). The second most significant SNP was the MC4R c.1426A>G polymorphism (P(nominal) = 8.0E-05). The third top SNP (P(nominal) = 6.2E-04) was the intronic TBC1D1 g.219G>A polymorphic site, in agreement with our previous results obtained in an independent study. The list of significant markers also included SNP in additional genes (ABHD16A, ABHD5, ACP2, ALMS1, APOA2, ATP1A2, CALR, COL14A1, CTSF, DARS, DECR1, ENPP1, ESR1, GH1, GHRL, GNMT, IKBKB, JAK3, MTTP, NFKBIA, NT5E, PLAT, PPARG, PPP2R5D, PRLR, RRAGD, RFC2, SDHD, SERPINF1, UBE2H, VCAM1, and WAT). Functional relationships between genes were obtained using the Ingenuity Pathway Analysis (IPA) Knowledge Base. The top scoring pathway included 19 genes with a P(nominal) < 0.1, 2 of which (IKBKB and NFKBIA) are involved in the hypothalamic IKKβ/NFκB program that could represent a key axis to affect fat deposition traits in pigs. These results represent a starting point to plan marker-assisted selection in Italian Large White nuclei for BFT. Because of similarities between humans and pigs, this study might also provide useful clues to investigate genetic factors affecting human obesity.

Construction of a high-density genetic map by specific locus amplified fragment sequencing (SLAF-seq) and its application to Quantitative Trait Loci (QTL) analysis for boll weight in upland cotton (Gossypium hirsutum.).

PubMed

Zhang, Zhen; Shang, Haihong; Shi, Yuzhen; Huang, Long; Li, Junwen; Ge, Qun; Gong, Juwu; Liu, Aiying; Chen, Tingting; Wang, Dan; Wang, Yanling; Palanga, Koffi Kibalou; Muhammad, Jamshed; Li, Weijie; Lu, Quanwei; Deng, Xiaoying; Tan, Yunna; Song, Weiwu; Cai, Juan; Li, Pengtao; Rashid, Harun or; Gong, Wankui; Yuan, Youlu

2016-04-11

Upland Cotton (Gossypium hirsutum) is one of the most important worldwide crops it provides natural high-quality fiber for the industrial production and everyday use. Next-generation sequencing is a powerful method to identify single nucleotide polymorphism markers on a large scale for the construction of a high-density genetic map for quantitative trait loci mapping. In this research, a recombinant inbred lines population developed from two upland cotton cultivars 0-153 and sGK9708 was used to construct a high-density genetic map through the specific locus amplified fragment sequencing method. The high-density genetic map harbored 5521 single nucleotide polymorphism markers which covered a total distance of 3259.37 cM with an average marker interval of 0.78 cM without gaps larger than 10 cM. In total 18 quantitative trait loci of boll weight were identified as stable quantitative trait loci and were detected in at least three out of 11 environments and explained 4.15-16.70 % of the observed phenotypic variation. In total, 344 candidate genes were identified within the confidence intervals of these stable quantitative trait loci based on the cotton genome sequence. These genes were categorized based on their function through gene ontology analysis, Kyoto Encyclopedia of Genes and Genomes analysis and eukaryotic orthologous groups analysis. This research reported the first high-density genetic map for Upland Cotton (Gossypium hirsutum) with a recombinant inbred line population using single nucleotide polymorphism markers developed by specific locus amplified fragment sequencing. We also identified quantitative trait loci of boll weight across 11 environments and identified candidate genes within the quantitative trait loci confidence intervals. The results of this research would provide useful information for the next-step work including fine mapping, gene functional analysis, pyramiding breeding of functional genes as well as marker-assisted selection.

Evidence for association between Disrupted-in-schizophrenia 1 (DISC1) gene polymorphisms and autism in Chinese Han population: a family-based association study

PubMed Central

2011-01-01

Background Disrupted-in-Schizophrenia 1 (DISC1) gene is one of the most promising candidate genes for major mental disorders. In a previous study, a Finnish group demonstrated that DISC1 polymorphisms were associated with autism and Asperger syndrome. However, the results were not replicated in Korean population. To determine whether DISC1 is associated with autism in Chinese Han population, we performed a family-based association study between DISC1 polymorphisms and autism. Methods We genotyped seven tag single nucleotide polymorphisms (SNPs) in DISC1, spanning 338 kb, in 367 autism trios (singleton and their biological parents) including 1,101 individuals. Single SNP association and haplotype association analysis were performed using the family-based association test (FBAT) and Haploview software. Results We found three SNPs showed significant associations with autism (rs4366301: G > C, Z = 2.872, p = 0.004; rs11585959: T > C, Z = 2.199, p = 0.028; rs6668845: A > G, Z = 2.326, p = 0.02). After the Bonferroni correction, SNP rs4366301, which located in the first intron of DISC1, remained significant. When haplotype were constructed with two-markers, three haplotypes displayed significant association with autism. These results were still significant after using the permutation method to obtain empirical p values. Conclusions Our study provided evidence that the DISC1 may be the susceptibility gene of autism. It suggested DISC1 might play a role in the pathogenesis of autism. PMID:21569632

High-density polymorphisms analysis of 23 candidate genes for association with bone mineral density.

PubMed

Giroux, Sylvie; Elfassihi, Latifa; Clément, Valérie; Bussières, Johanne; Bureau, Alexandre; Cole, David E C; Rousseau, François

2010-11-01

Osteoporosis is a bone disease characterized by low bone mineral density (BMD), a highly heritable and polygenic trait. Women are more prone than men to develop osteoporosis due to a lower peak bone mass and accelerated bone loss at menopause. Peak bone mass has been convincingly shown to be due to genetic factors with heritability up to 80%. Menopausal bone loss has been shown to have around 38% to 49% heritability depending on the site studied. To have more statistical power to detect small genetic effects we focused on premenopausal women. We studied 23 candidate genes, some involved in calcium and vitamin-D regulation and others because estrogens strongly induced their gene expression in mice where it was correlated with humerus trabecular bone density. High-density polymorphisms were selected to cover the entire gene variability and 231 polymorphisms were genotyped in a first sample of 709 premenopausal women. Positive associations were retested in a second, independent, sample of 673 premenopausal women. Ten polymorphisms remained associated with BMD in the combined samples and one was further associated in a large sample of postmenopausal women (1401 women). This associated polymorphism was located in the gene CSF3R (granulocyte colony stimulating factor receptor) that had never been associated with BMD before. The results reported in this study suggest a role for CSF3R in the determination of bone density in women. Copyright © 2010 Elsevier Inc. All rights reserved.

A multicenter matched case-control analysis on seven polymorphisms from HMGB1 and RAGE genes in predicting hepatocellular carcinoma risk.

PubMed

Wang, Dan; Qi, Xiaoying; Liu, Fang; Yang, Chuanhua; Jiang, Wenguo; Wei, Xiaodan; Li, Xuri; Mi, Jia; Tian, Geng

2017-07-25

Based on 540 hepatocellular carcinoma patients and 540 age- and gender-matched controls, we tested the hypothesis that high mobility group protein box1 (HMGB1) and the receptor for advanced glycation end products (RAGE) genes are two potential candidate susceptibility genes for hepatocellular carcinoma in a multicenter hospital-based case-control analysis. The genotypes of seven widely-studied polymorphisms were determined, and their distributions respected the Hardy-Weinberg equilibrium. The mutant alleles of two polymorphisms, rs1045411 in HMGB1 gene and rs2070600 in RAGE gene, had significantly higher frequencies in patients than in controls (P < 0.001), with the power to detect this significance of being over 99.9%. Moreover, the above two polymorphisms increased the risk of developing hepatocellular carcinoma significantly, particularly for rs2070600 under the additive (odds ratio [OR] = 1.77; 95% confidence interval [CI]: 1.34-2.32; P < 0.001) and dominant (OR = 1.75; 95% CI: 1.23-2.50; P = 0.002) models after adjusting for body mass index, smoking and drinking. Haplotype analysis showed that the T-C-T haplotype (rs1045411-rs2249825-rs1415125) in HMGB1 gene was associated with a 2.47-fold (95% CI: 1.41-4.34; P = 0.002) increased risk of hepatocellular carcinoma compared with the commonest C-C-T haplotype after adjustment. In RAGE gene, the T-T-A-G (rs1800625-rs1800624-rs2070600-rs184003) (adjusted OR; 95% CI; P: 1.75; 1.02-3.03; 0.045) and T-T-A-T (adjusted OR; 95% CI; P: 1.95; 1.01-3.76; 0.048) haplotypes were associated with a marginally increased risk of hepatocellular carcinoma compared with the commonest T-T-G-G haplotype. In summary, we identified two risk-associated polymorphisms (rs1045411 and rs2070600), and more importantly a joint impact of seven polymorphisms from the HMGB1/RAGE axis in susceptibility to hepatocellular carcinoma.

Associations between serotonin-related gene polymorphisms and panic disorder.

PubMed

Maron, Eduard; Lang, Aavo; Tasa, Gunnar; Liivlaid, Liivi; Tõru, Innar; Must, Anne; Vasar, Veiko; Shlik, Jakov

2005-06-01

Studies suggest that vulnerability to panic attacks and panic disorder (PD) may be related to a deficient serotonin (5-HT) neurotransmission. In the present case-control study we investigated possible associations between PD phenotype and five candidate polymorphisms including 5-HT transporter (5-HTTLPR and VNTR), monoamine oxidase A (MAOA promoter region), tryptophan hydroxylase 1 (TPH1 218A/C) and 5-HT1B receptor (5-HT1BR 861G/C) genes. The study sample consisted of 158 patients with PD and 215 healthy control subjects. The analysis showed higher frequencies of LL genotype (p = 0.016) and L allele variant (p = 0.007) of 5-HTTLPR in the patients. No significant associations were observed between PD and other candidate gene polymorphisms. However, a higher frequency of longer allele genotypes of the MAOA promoter region was observed in female PD patients with agoraphobia than in female controls (p = 0.016). These findings indicate that genetic variants conceivably related to lower 5-HT neurotransmission may be involved in the development of PD.

Single Nucleotide Polymorphisms in IL8 and TLR4 Genes as Candidates for Digital Dermatitis Resistance/Susceptibility in Holstein Cattle.

PubMed

El-Shafaey, El-Sayed; Ateya, Ahmed; Ramadan, Hazem; Saleh, Rasha; Elseady, Yousef; Abo El Fadl, Eman; El-Khodery, Sabry

2017-04-03

Relatedness between single nucleotide polymorphisms in IL8 and TLR4 genes and digital dermatitis resistance/susceptibility was investigated in seventy Holstein dairy cows. Animals were assigned into two groups, affected group (n = 35) and resistant group (n = 35) based on clinical signs and previous history of farm clinical records. Blood samples were collected for DNA extraction to ampliy fragments of 267-bp and 382-bp for IL8 and TLR4 genes, respectively. PCR-DNA sequencing revealed three SNPs in each of IL8 and TLR4 genes. The identified SNPs associated with digital dermatitis resistance were C94T, A220G, and T262A for IL8 and C118T for TLR4. However, the G349C and C355A SNPs in TLR4 gene were associated with digital dermatitis susceptibility. Chi-square analysis for comparison the distribution of all identified SNPs in both IL8 and TLR4 genes between resistant and affected animals showed no significant variation among the identified SNPs in IL8 gene. Meanwhile, there was a significant variation in case of TLR4 gene. As a pilot study, the present results revealed that identified SNPs in IL8 and TLR4 genes can be used as a genetic marker and predisposing factor for resistance/susceptibility to digital dermatitis in dairy cows. However, TLR4 gene may be a potential candidate for such disease.

Apolipoprotein gene polymorphisms as cause of cholesterol QTLs in mice.

PubMed

Suto, Jun-ichi

2005-06-01

Quantitative trait locus (QTL) analyses of plasma cholesterol levels were carried out in three sets of F(2) mice that were formed in a 'round-robin' manner from C57BL/6J, KK (-A(y)), and RR strains. Six QTLs were identified on chromosomes 1 (Cq1, Cq2, and Cq6), 3 (Cq3), and 9 (Cq4 and Cq5); of these, Cq2 colocalized with Cq6, and Cq4 colocalized with Cq5. The major candidate gene for Cq2 and Cq6 is Apoa2, and that for Cq4 and Cq5 is Apoa4. The adequacy of polymorphisms in candidate genes as cause of QTLs was investigated in this study. For Apoa2, three different alleles (Apoa2(a), Apoa2(b), and Apoa2(c)) are known. Since there was no significant physiologic difference between Apoa2(a) and Apoa2(c) alleles, previous hypothesis that Apoa2(b) was different from Apoa2(a) and Apoa2(c) in the ability to increase cholesterol levels was further supported. Presumably, G-to-A substitution at nucleotide 84 and/or C-to-T substitution at nucleotide 182 are crucial to make the Apoa2(b) unique. On the other hand, for Apoa4, the most striking polymorphism was the number of Glu-Gln-Ala/Val-Gln repeats in carboxyl end; however, this might not be responsible for QTLs. Instead, a silent mutation, C-to-T substitution at nucleotide 771, was shown to be completely correlated with the occurrence of QTLs in a total of six F(2) intercrosses. Provisionally, but reasonably, these base substitutions are qualified as primary causes that constitute QTL effect. The potential strategy for identifying genes and base substitutions underlying QTLs is discussed.

COL5A1: Genetic mapping and exclusion as candidate gene in families with nail-patella syndrome, tuberous sclerosis 1, hereditary hemorrhagic telangiectasia, and Ehlers-Danlos syndrome type II

DOE Office of Scientific and Technical Information (OSTI.GOV)

Greenspan, D.S.; Northrup, H.; Au, K.S.

1995-02-10

COL5A1, the gene for the {alpha}1 chain of type V collagen, has been considered a candidate gene for certain diseases based on chromosomal location and/or disease phenotype. We have employed 3{prime}-untranslated region RFLPs to exclude COL5A1 as a candidate gene in families with tuberous sclerosis 1, Ehlers-Danlos syndrome type H, and nail-patella syndrome. In addition, we describe a polymorphic simple sequence repeat (SSR) within a COL5A1 intron. This SSR is used to exclude COL5A1 as a candidate gene in hereditary hemorrhagic telangiectasia (Osler-Rendu-Weber disease) and to add COL5A1 to the existing map of {open_quotes}index{close_quotes} markers of chromosome 9 by evaluationmore » of the COL5A1 locus on the CEPH 40-family reference pedigree set. This genetic mapping places COL5A1 between markers D9S66 and D9S67. 14 refs., 1 fig., 2 tabs.« less

Genome-Wide Association Study Identifying Candidate Genes Influencing Important Agronomic Traits of Flax (Linum usitatissimum L.) Using SLAF-seq

PubMed Central

Xie, Dongwei; Dai, Zhigang; Yang, Zemao; Sun, Jian; Zhao, Debao; Yang, Xue; Zhang, Liguo; Tang, Qing; Su, Jianguang

2018-01-01

Flax (Linum usitatissimum L.) is an important cash crop, and its agronomic traits directly affect yield and quality. Molecular studies on flax remain inadequate because relatively few flax genes have been associated with agronomic traits or have been identified as having potential applications. To identify markers and candidate genes that can potentially be used for genetic improvement of crucial agronomic traits, we examined 224 specimens of core flax germplasm; specifically, phenotypic data for key traits, including plant height, technical length, number of branches, number of fruits, and 1000-grain weight were investigated under three environmental conditions before specific-locus amplified fragment sequencing (SLAF-seq) was employed to perform a genome-wide association study (GWAS) for these five agronomic traits. Subsequently, the results were used to screen single nucleotide polymorphism (SNP) loci and candidate genes that exhibited a significant correlation with the important agronomic traits. Our analyses identified a total of 42 SNP loci that showed significant correlations with the five important agronomic flax traits. Next, candidate genes were screened in the 10 kb zone of each of the 42 SNP loci. These SNP loci were then analyzed by a more stringent screening via co-identification using both a general linear model (GLM) and a mixed linear model (MLM) as well as co-occurrences in at least two of the three environments, whereby 15 final candidate genes were obtained. Based on these results, we determined that UGT and PL are candidate genes for plant height, GRAS and XTH are candidate genes for the number of branches, Contig1437 and LU0019C12 are candidate genes for the number of fruits, and PHO1 is a candidate gene for the 1000-seed weight. We propose that the identified SNP loci and corresponding candidate genes might serve as a biological basis for improving crucial agronomic flax traits. PMID:29375606

Genome-Wide Association Study Identifying Candidate Genes Influencing Important Agronomic Traits of Flax (Linum usitatissimum L.) Using SLAF-seq.

PubMed

Xie, Dongwei; Dai, Zhigang; Yang, Zemao; Sun, Jian; Zhao, Debao; Yang, Xue; Zhang, Liguo; Tang, Qing; Su, Jianguang

2017-01-01

Flax ( Linum usitatissimum L.) is an important cash crop, and its agronomic traits directly affect yield and quality. Molecular studies on flax remain inadequate because relatively few flax genes have been associated with agronomic traits or have been identified as having potential applications. To identify markers and candidate genes that can potentially be used for genetic improvement of crucial agronomic traits, we examined 224 specimens of core flax germplasm; specifically, phenotypic data for key traits, including plant height, technical length, number of branches, number of fruits, and 1000-grain weight were investigated under three environmental conditions before specific-locus amplified fragment sequencing (SLAF-seq) was employed to perform a genome-wide association study (GWAS) for these five agronomic traits. Subsequently, the results were used to screen single nucleotide polymorphism (SNP) loci and candidate genes that exhibited a significant correlation with the important agronomic traits. Our analyses identified a total of 42 SNP loci that showed significant correlations with the five important agronomic flax traits. Next, candidate genes were screened in the 10 kb zone of each of the 42 SNP loci. These SNP loci were then analyzed by a more stringent screening via co-identification using both a general linear model (GLM) and a mixed linear model (MLM) as well as co-occurrences in at least two of the three environments, whereby 15 final candidate genes were obtained. Based on these results, we determined that UGT and PL are candidate genes for plant height, GRAS and XTH are candidate genes for the number of branches, Contig1437 and LU0019C12 are candidate genes for the number of fruits, and PHO1 is a candidate gene for the 1000-seed weight. We propose that the identified SNP loci and corresponding candidate genes might serve as a biological basis for improving crucial agronomic flax traits.

Genetic influences on insight problem solving: the role of catechol-O-methyltransferase (COMT) gene polymorphisms

PubMed Central

Jiang, Weili; Shang, Siyuan; Su, Yanjie

2015-01-01

People may experience an “aha” moment, when suddenly realizing a solution of a puzzling problem. This experience is called insight problem solving. Several findings suggest that catecholamine-related genes may contribute to insight problem solving, among which the catechol-O-methyltransferase (COMT) gene is the most promising candidate. The current study examined 753 healthy individuals to determine the associations between 7 candidate single nucleotide polymorphisms on the COMT gene and insight problem-solving performance, while considering gender differences. The results showed that individuals carrying A allele of rs4680 or T allele of rs4633 scored significantly higher on insight problem-solving tasks, and the COMT gene rs5993883 combined with gender interacted with correct solutions of insight problems, specifically showing that this gene only influenced insight problem-solving performance in males. This study presents the first investigation of the genetic impact on insight problem solving and provides evidence that highlights the role that the COMT gene plays in insight problem solving. PMID:26528222

Genetic influences on insight problem solving: the role of catechol-O-methyltransferase (COMT) gene polymorphisms.

PubMed

Jiang, Weili; Shang, Siyuan; Su, Yanjie

2015-01-01

People may experience an "aha" moment, when suddenly realizing a solution of a puzzling problem. This experience is called insight problem solving. Several findings suggest that catecholamine-related genes may contribute to insight problem solving, among which the catechol-O-methyltransferase (COMT) gene is the most promising candidate. The current study examined 753 healthy individuals to determine the associations between 7 candidate single nucleotide polymorphisms on the COMT gene and insight problem-solving performance, while considering gender differences. The results showed that individuals carrying A allele of rs4680 or T allele of rs4633 scored significantly higher on insight problem-solving tasks, and the COMT gene rs5993883 combined with gender interacted with correct solutions of insight problems, specifically showing that this gene only influenced insight problem-solving performance in males. This study presents the first investigation of the genetic impact on insight problem solving and provides evidence that highlights the role that the COMT gene plays in insight problem solving.

Computational Analysis of Candidate Disease Genes and Variants for Salt-Sensitive Hypertension in Indigenous Southern Africans

PubMed Central

Tiffin, Nicki; Meintjes, Ayton; Ramesar, Rajkumar; Bajic, Vladimir B.; Rayner, Brian

2010-01-01

Multiple factors underlie susceptibility to essential hypertension, including a significant genetic and ethnic component, and environmental effects. Blood pressure response of hypertensive individuals to salt is heterogeneous, but salt sensitivity appears more prevalent in people of indigenous African origin. The underlying genetics of salt-sensitive hypertension, however, are poorly understood. In this study, computational methods including text- and data-mining have been used to select and prioritize candidate aetiological genes for salt-sensitive hypertension. Additionally, we have compared allele frequencies and copy number variation for single nucleotide polymorphisms in candidate genes between indigenous Southern African and Caucasian populations, with the aim of identifying candidate genes with significant variability between the population groups: identifying genetic variability between population groups can exploit ethnic differences in disease prevalence to aid with prioritisation of good candidate genes. Our top-ranking candidate genes include parathyroid hormone precursor (PTH) and type-1angiotensin II receptor (AGTR1). We propose that the candidate genes identified in this study warrant further investigation as potential aetiological genes for salt-sensitive hypertension. PMID:20886000

Single Nucleotide Polymorphism in Gene Encoding Transcription Factor Prep1 Is Associated with HIV-1-Associated Dementia

PubMed Central

van Manen, Daniëlle; Bunnik, Evelien M.; van Sighem, Ard I.; Sieberer, Margit; Boeser-Nunnink, Brigitte; de Wolf, Frank; Schuitemaker, Hanneke; Portegies, Peter; Kootstra, Neeltje A.; van 't Wout, Angélique B.

2012-01-01

Background Infection with HIV-1 may result in severe cognitive and motor impairment, referred to as HIV-1-associated dementia (HAD). While its prevalence has dropped significantly in the era of combination antiretroviral therapy, milder neurocognitive disorders persist with a high prevalence. To identify additional therapeutic targets for treating HIV-associated neurocognitive disorders, several candidate gene polymorphisms have been evaluated, but few have been replicated across multiple studies. Methods We here tested 7 candidate gene polymorphisms for association with HAD in a case-control study consisting of 86 HAD cases and 246 non-HAD AIDS patients as controls. Since infected monocytes and macrophages are thought to play an important role in the infection of the brain, 5 recently identified single nucleotide polymorphisms (SNPs) affecting HIV-1 replication in macrophages in vitro were also tested. Results The CCR5 wt/Δ32 genotype was only associated with HAD in individuals who developed AIDS prior to 1991, in agreement with the observed fading effect of this genotype on viral load set point. A significant difference in genotype distribution among all cases and controls irrespective of year of AIDS diagnosis was found only for a SNP in candidate gene PREP1 (p = 1.2×10−5). Prep1 has recently been identified as a transcription factor preferentially binding the −2,518 G allele in the promoter of the gene encoding MCP-1, a protein with a well established role in the etiology of HAD. Conclusion These results support previous findings suggesting an important role for MCP-1 in the onset of HIV-1-associated neurocognitive disorders. PMID:22347417

Mice, humans and haplotypes--the hunt for disease genes in SLE.

PubMed

Rigby, R J; Fernando, M M A; Vyse, T J

2006-09-01

Defining the polymorphisms that contribute to the development of complex genetic disease traits is a challenging, although increasingly tractable problem. Historically, the technical difficulties in conducting association studies across the entire human genome are such that murine models have been used to generate candidate genes for analysis in human complex diseases, such as SLE. In this article we discuss the advantages and disadvantages of this approach and specifically address some assumptions made in the transition from studying one species to another, using lupus as an example. These issues include differences in genetic structure and genetic organisation which are a reflection on the population history. Clearly there are major differences in the histories of the human population and inbred laboratory strains of mice. Both human and murine genomes do exhibit structure at the genetic level. That is to say, they comprise haplotypes which are genomic regions that carry runs of polymorphisms that are not independently inherited. Haplotypes therefore reduce the number of combinations of the polymorphisms in the DNA in that region and facilitate the identification of disease susceptibility genes in both mice and humans. There are now novel means of generating candidate genes in SLE using mutagenesis (with ENU) in mice and identifying mice that generate antinuclear autoimmunity. In addition, murine models still provide a valuable means of exploring the functional consequences of genetic variation. However, advances in technology are such that human geneticists can now screen large fractions of the human genome for disease associations using microchip technologies that provide information on upwards of 100,000 different polymorphisms. These approaches are aimed at identifying haplotypes that carry disease susceptibility mutations and rely less on the generation of candidate genes.

Fine Mapping Identifies SmFAS Encoding an Anthocyanidin Synthase as a Putative Candidate Gene for Flower Purple Color in Solanum melongena L.

PubMed Central

Chen, Mengqiang; Xu, Mengyun; Xiao, Yao; Cui, Dandan; Qin, Yongqiang; Wu, Jiaqi; Wang, Wenyi; Wang, Guoping

2018-01-01

Anthocyanins are the main pigments in flowers and fruits. These pigments are responsible for the red, red-purple, violet, and purple color in plants, and act as insect and animal attractants. In this study, phenotypic analysis of the purple flower color in eggplant indicated that the flower color is controlled by a single dominant gene, FAS. Using an F2 mapping population derived from a cross between purple-flowered ‘Blacknite’ and white-flowered ‘Small Round’, Flower Anthocyanidin Synthase (FAS) was fine mapped to an approximately 165.6-kb region between InDel marker Indel8-11 and Cleaved Amplified Polymorphic Sequences (CAPS) marker Efc8-32 on Chromosome 8. On the basis of bioinformatic analysis, 29 genes were subsequently located in the FAS target region, among which were two potential Anthocyanidin Synthase (ANS) gene candidates. Allelic sequence comparison results showed that one ANS gene (Sme2.5_01638.1_g00003.1) was conserved in promoter and coding sequences without any nucleotide change between parents, whereas four single-nucleotide polymorphisms were detected in another ANS gene (Sme2.5_01638.1_g00005.1). Crucially, a single base pair deletion at site 438 resulted in premature termination of FAS, leading to the loss of anthocyanin accumulation. In addition, FAS displayed strong expression in purple flowers compared with white flowers and other tissues. Collectively, our results indicate that Sme2.5_01638.1_g00005.1 is a good candidate gene for FAS, which controls anthocyanidin synthase in eggplant flowers. The present study provides information for further potential facilitate genetic engineering for improvement of anthocyanin levels in plants. PMID:29522465

Family-based association testing strongly implicates DRD2 as a risk gene for schizophrenia in Han Chinese from Taiwan

PubMed Central

Glatt, SJ; Faraone, SV; Lasky-Su, JA; Kanazawa, T; Hwu, H-G; Tsuang, MT

2009-01-01

The gene that codes for dopamine receptor D2 (DRD2 on chromosome 11q23) has long been a prime functional and positional candidate risk gene for schizophrenia. Collectively, prior case–control studies found a reliable effect of the Ser311Cys DRD2 polymorphism (rs1801028) on risk for schizophrenia, but few other polymorphisms in the gene had ever been evaluated and no adequately powered family-based association study has been performed to date. Our objective was to test 21 haplotype-tagging and all three known nonsynonymous single-nucleotide polymorphisms (SNPs) in DRD2 for association with schizophrenia in a family-based study of 2408 Han Chinese, including 1214 affected individuals from 616 families. We did not find a significant effect of rs1801028, but we did find significant evidence for association of schizophrenia with two multi-marker haplotypes spanning blocks of strong linkage disequilibrium (LD) and nine individual SNPs (Ps < 0.05). Importantly, two SNPs (rs1079727 and rs2283265) and both multi-marker haplotypes spanning entire LD blocks (including one that contained rs1801028) remained significant after correcting for multiple testing. These results further add to the body of data implicating DRD2 as a schizophrenia risk gene; however, a causal variant(s) in DRD2 remains to be elucidated by further fine mapping of the gene, with particular attention given to the area surrounding the third through fifth exons. PMID:18332877

Linkage study of nonsyndromic cleft lip with or without cleft palate using candidate genes and mapped polymorphic markers

DOE Office of Scientific and Technical Information (OSTI.GOV)

Stein, J.D.; Nelson, L.D.; Conner, B.J.

1994-09-01

Nonsyndromic cleft lip with or without cleft palate (CL(P)) involves fusion or growth failure of facial primordia during development. Complex segregation analysis of clefting populations suggest that an autosomal dominant gene may play a role in this common craniofacial disorder. We have ascertained 16 multigenerational families with CL(P) and tested linkage to 29 candidate genes and 139 mapped short tandem repeat markers. The candidate genes were selected based on their expression in craniofacial development or were identified through murine models. These include: TGF{alpha}, TGF{beta}1, TGF{beta}2, TGF{beta}3, EGF, EGFR, GRAS, cMyc, FGFR, Jun, JunB, PDFG{alpha}, PDGF{beta}, IGF2R, GCR Hox7, Hox8, Hox2B,more » twirler, 5 collagen and 3 extracellular matrix genes. Linkage was tested assuming an autosomal dominant model with sex-specific decreased penetrance. Linkage to all of the candidate loci was excluded in 11 families. RARA was tested and was not informative. However, haplotype analysis of markers flanking RARA on 17q allowed exclusion of this candidate locus. We have previously excluded linkage to 61 STR markers in 11 families. Seventy-eight mapped short tandem repeat markers have recently been tested in 16 families and 30 have been excluded. The remaining are being analyzed and an exclusion map is being developed based on the entire study results.« less

[Detection of novel genetic markers of susceptibility to preeclampsia based on an analysis of the regulatory genes in the placental tissue].

PubMed

Serebrova, V N; Trifonova, E A; Gabidulina, T V; Bukharina, I Yu; Agarkova, T A; Evtushenko, I D; Maksimova, N R; Stepanov, V A

2016-01-01

Regulatory single nucleotide polymorphisms (rSNPs) are the least-studied group of SNP; however, they play an essential role in the development of human pathology by altering the level of candidate genes expression. In this work, we analyzed 29 rSNPs in 17 new candidate genes associated with preeclampsia (PE) according to the analysis of the transcriptome in placental tissue. Three ethnic groups have been studied (yakut, russian, and buryat). We have detected significant associations of PE with eight rSNPs in six differentially expressed genes, i.e., rs10423795 in the LHB gene; rs3771787 in the HK2 gene; rs72959687 in the INHA gene; rs12678229, rs2227262, and rs3802252 in the NDRG1 gene; rs34845949 in the SASH1 gene; and rs66707428 in the PPP1R12C gene. We used a new approach to detecting genetic markers of multifactorial diseases in the case of PE based on a combination of genomic, transcriptomic, and bioinformatic approaches. This approach proved its efficiency and may be applied to detecting new potential genetic markers in genes involved in disease pathogenesis, which reduces missing heritability in multifactorial diseases.

Photoreceptor dysplasia (pd) in miniature schnauzer dogs: evaluation of candidate genes by molecular genetic analysis.

PubMed

Zhang, Q; Baldwin, V J; Acland, G M; Parshall, C J; Haskel, J; Aguirre, G D; Ray, K

1999-01-01

Photoreceptor dysplasia (pd) is one of a group of at least six distinct autosomal and one X-linked retinal disorders identified in dogs which are collectively known as progressive retinal atrophy (PRA). It is an early onset retinal disease identified in miniature schnauzer dogs, and pedigree analysis and breeding studies have established autosomal recessive inheritance of the disease. Using a gene-based approach, a number of retina-expressed genes, including some members of the phototransduction pathway, have been causally implicated in retinal diseases of humans and other animals. Here we examined seven such potential candidate genes (opsin, RDS/peripherin, ROM1, rod cGMP-gated cation channel alpha-subunit, and three subunits of transducin) for their causal association with the pd locus by testing segregation of intragenic markers with the disease locus, or, in the absence of informative polymorphisms, sequencing of the coding regions of the genes. Based on these results, we have conclusively excluded four photoreceptor-specific genes as candidates for pd by linkage analysis. For three other photoreceptor-specific genes, we did not find any mutation in the coding sequences of the genes and have excluded them provisionally. Formal exclusion would require investigation of the levels of expression of the candidate genes in pd-affected dogs relative to age-matched controls. At present we are building suitable informative pedigrees for the disease locus with a sufficient number of meiosis to be useful for genomewide screening. This should identify markers linked to the disease locus and eventually permit progress toward the identification of the photoreceptor dysplasia gene and the disease-causing mutation.

Targeted capture and resequencing of 1040 genes reveal environmentally driven functional variation in grey wolves.

PubMed

Schweizer, Rena M; Robinson, Jacqueline; Harrigan, Ryan; Silva, Pedro; Galverni, Marco; Musiani, Marco; Green, Richard E; Novembre, John; Wayne, Robert K

2016-01-01

In an era of ever-increasing amounts of whole-genome sequence data for individuals and populations, the utility of traditional single nucleotide polymorphisms (SNPs) array-based genome scans is uncertain. We previously performed a SNP array-based genome scan to identify candidate genes under selection in six distinct grey wolf (Canis lupus) ecotypes. Using this information, we designed a targeted capture array for 1040 genes, including all exons and flanking regions, as well as 5000 1-kb nongenic neutral regions, and resequenced these regions in 107 wolves. Selection tests revealed striking patterns of variation within candidate genes relative to noncandidate regions and identified potentially functional variants related to local adaptation. We found 27% and 47% of candidate genes from the previous SNP array study had functional changes that were outliers in sweed and bayenv analyses, respectively. This result verifies the use of genomewide SNP surveys to tag genes that contain functional variants between populations. We highlight nonsynonymous variants in APOB, LIPG and USH2A that occur in functional domains of these proteins, and that demonstrate high correlation with precipitation seasonality and vegetation. We find Arctic and High Arctic wolf ecotypes have higher numbers of genes under selection, which highlight their conservation value and heightened threat due to climate change. This study demonstrates that combining genomewide genotyping arrays with large-scale resequencing and environmental data provides a powerful approach to discern candidate functional variants in natural populations. © 2015 John Wiley & Sons Ltd.

Candidate genes associated with testicular development, sperm quality, and hormone levels of inhibin, luteinizing hormone, and insulin-like growth factor 1 in Brahman bulls.

PubMed

Fortes, Marina R S; Reverter, Antonio; Hawken, Rachel J; Bolormaa, Sunduimijid; Lehnert, Sigrid A

2012-09-01

Bull fertility is an important target for genetic improvement, and early prediction using genetic markers is therefore a goal for livestock breeding. We performed genome-wide association studies to identify genes associated with fertility traits measured in young bulls. Data from 1118 Brahman bulls were collected for six traits: blood hormone levels of inhibin (IN) at 4 mo, luteinizing hormone (LH) following a gonadotropin-releasing hormone challenge at 4 mo, and insulin-like growth factor 1 (IGF1) at 6 mo, scrotal circumference (SC) at 12 mo, ability to produce sperm (Sperm) at 18 mo, and percentage of normal sperm (PNS) at 24 mo. All the bulls were genotyped with the BovineSNP50 chip. Sires and dams of the bull population (n = 304) were genotyped with the high-density chip (∼800 000 polymorphisms) to allow for imputation, thereby contributing detail on genome regions of interest. Polymorphism associations were discovered for all traits, except for Sperm. Chromosome 2 harbored polymorphisms associated with IN. For LH, associated polymorphisms were located in five different chromosomes. A region of chromosome 14 contained polymorphisms associated with IGF1 and SC. Regions of the X chromosome showed associations with SC and PNS. Associated polymorphisms yielded candidate genes in chromosomes 2, 14, and X. These findings will contribute to the development of genetic markers to help select cattle with improved fertility and will lead to better annotation of gene function in the context of reproductive biology.

Pharmacogenetic study focused on fluoxetine pharmacodynamics in children and adolescent patients: impact of the serotonin pathway.

PubMed

Mas, Sergi; Blázquez, Ana; Rodríguez, Natalia; Boloc, Daniel; Lafuente, Amalia; Arnaiz, Joan A; Lázaro, Luisa; Gassó, Patricia

2016-11-01

Pharmacogenetic studies of fluoxetine in children and adolescents are scarce. After reporting the effect of genetic variants in genes related to the fluoxetine pharmacokinetics on clinical response in a pediatric population, we now evaluate the impact of genetic markers involved in its pharmacodynamics. The assessment was performed in 83 patients after 12 weeks of fluoxetine treatment. The genetic association analysis included a total of 316 validated single nucleotide polymorphisms in 45 candidate genes involved in six different pathways. Clinical improvement after treatment with fluoxetine in our pediatric population was associated significantly with two polymorphisms located in genes related to the serotonergic system: the 5-hydroxytryptamine receptor 1B (HTR1B) and the tryptophan 5-hydroxylase 2 (TPH2). Although a wide range of candidate genes related to different pathways were assessed, the results show that genetic markers directly related to serotonin have an important effect on fluoxetine response.

Type 2 diabetes mellitus: association study of five candidate genes in an Indian population of Guadeloupe, genetic contribution of FABP2 polymorphism.

PubMed

Boullu-Sanchis, S; Leprêtre, F; Hedelin, G; Donnet, J P; Schaffer, P; Froguel, P; Pinget, M

1999-06-01

We studied by PCR-RFLP 6 polymorphisms in these 5 candidate genes: Ala54Thr in the fatty acid binding protein 2 gene (FABP2), A to G substitution in the uncoupling protein type 1 gene (UCP1), Asp905Tyr in the protein phosphatase type 1 gene (PP1G), Trp64Arg in the human beta 3 adrenergic receptor gene (beta 3AR) and 2 RFLP sites of the vitamin D receptor (VDR) gene (VDRTaq1 and VDRApa1). This study was conducted among 89 cases and 100 controls matched according to age, gender and absence of first degree family link (11 triplets with 2 controls for 1 case and 78 pairs with 1 control for 1 case). Cases and controls were taken among a sample of 429 individuals selected for the study of the prevalence of diabetes in this ethnic group from Guadeloupe. By conditional logistic regression analysis, there was a significant relation (p = 0.02) between the Ala54Thr FABP2 polymorphism and Type 2 DM. Multivariate analysis discriminate the FABP2 polymorphism (p = 0.10), a triglyceridemia over 2 g/l (p < 10(-3)) and high blood pressure (p = 10(-2)) as variables associated with Type 2 DM in this population. These findings suggest that FABP2 does not represent a major gene for Type 2 DM in this migrant Indian population living in Guadeloupe, but seems to be related to the metabolic insulin resistance syndrome.

Genetic association of angiogenesis- and hypoxia-related gene polymorphisms with osteonecrosis of the femoral head

PubMed Central

Hong, Jung Min; Kim, Tae-Ho; Kim, Hyun-Ju; Park, Eui-Kyun

2010-01-01

Multiple factors have been implicated in the development of osteonecrosis of the femoral head (ONFH). In particular, non-traumatic ONFH is directly or indirectly related to injury of the vascular supply to the femoral head. Thus, hypoxia in the femoral head caused by impaired blood flow may be an important risk factor for ONFH. In this study, we investigated whether genetic variations of angiogenesis- and hypoxia-related genes contribute to an increased risk for the development of ONFH. Candidate genes were selected based on known hypoxia and angiogenesis pathways. An association study was performed using an Affymetrix Targeted Genotyping 3K Chip array with 460 ONFH patients and 300 control subjects. We showed that single nucleotide polymorphisms (SNPs) in the genes TF, VEGFC, IGFBP3, and ACE were associated with an increased risk of ONFH. On the other hand, SNPs in the KDR and NRP1 genes were associated with protection against ONFH. The most important finding was that one SNP (rs2453839) in the IGFBP3 gene was significantly associated with a higher risk of ONFH (P = 0.0061, OR 7.74). In subgroup analysis, most candidate gene variations that were associated with ONFH occurred in the idiopathic subgroup. Among other SNPs, ACE SNPs were associated with steroid-induced ONFH (P = 0.0018-0.0037, OR > 3). Collectively, our findings suggest that genetic variations in angiogenesis- and hypoxia-related genes may help to identify susceptibility factors for the development of ONFH in the Korean population. PMID:20215856

Neuropsychological performance measures as intermediate phenotypes for attention-deficit/hyperactivity disorder: A multiple mediation analysis

PubMed Central

KAMRADT, JACLYN M.; NIGG, JOEL T.; FRIDERICI, KAREN H.; NIKOLAS, MOLLY A.

2016-01-01

Genetic influences on dopaminergic neurotransmission have been implicated in attention-deficit hyperactivity disorder (ADHD) and are theorized to impact cognitive functioning via alterations in frontal–striatal circuitry. Neuropsychological functioning has been proposed to account for the potential associations between dopamine candidate genes and ADHD. However, to date, this mediation hypothesis has not been directly tested. Participants were 498 youth ages 6–17 years (mean M = 10.8 years, SD = 2.4 years, 55.0% male). All youth completed a multistage, multiple-informant assessment procedure to identify ADHD and non-ADHD cases, as well as a comprehensive neuropsychological battery. Youth provided a saliva sample for DNA analyses; the 480 base pair variable number of tandem repeat polymorphism of the dopamine active transporter 1 gene (DAT1) and the 120 base pair promoter polymorphism of the dopamine receptor D4 gene (DRD4) were genotyped. Multiple mediation analysis revealed significant indirect associations between DAT1 genotype and inattention, hyperactivity–impulsivity, and oppositionality, with specific indirect effects through response inhibition. The results highlight the role of neurocognitive task performance, particularly response inhibition, as a potential intermediate phenotype for ADHD, further elucidating the relationship between genetic polymorphisms and externalizing psychopathology. PMID:27049476

Relationships among calpastatin single nucleotide polymorphisms, calpastatin expression and tenderness in pork longissimus

USDA-ARS?s Scientific Manuscript database

Genome scans in the pig have identified a region on chromosome 2 (SSC2) associated with tenderness. Calpastatin is a likely positional candidate gene in this region because of its inhibitory role in the calpain system that is involved in postmortem tenderization. Novel single nucleotide polymorphism...

Utilizing Gene Tree Variation to Identify Candidate Effector Genes in Zymoseptoria tritici

PubMed Central

McDonald, Megan C.; McGinness, Lachlan; Hane, James K.; Williams, Angela H.; Milgate, Andrew; Solomon, Peter S.

2016-01-01

Zymoseptoria tritici is a host-specific, necrotrophic pathogen of wheat. Infection by Z. tritici is characterized by its extended latent period, which typically lasts 2 wks, and is followed by extensive host cell death, and rapid proliferation of fungal biomass. This work characterizes the level of genomic variation in 13 isolates, for which we have measured virulence on 11 wheat cultivars with differential resistance genes. Between the reference isolate, IPO323, and the 13 Australian isolates we identified over 800,000 single nucleotide polymorphisms, of which ∼10% had an effect on the coding regions of the genome. Furthermore, we identified over 1700 probable presence/absence polymorphisms in genes across the Australian isolates using de novo assembly. Finally, we developed a gene tree sorting method that quickly identifies groups of isolates within a single gene alignment whose sequence haplotypes correspond with virulence scores on a single wheat cultivar. Using this method, we have identified < 100 candidate effector genes whose gene sequence correlates with virulence toward a wheat cultivar carrying a major resistance gene. PMID:26837952

A public platform for the verification of the phenotypic effect of candidate genes for resistance to aflatoxin accumulation and Aspergillus flavus infection in maize.

PubMed

Warburton, Marilyn L; Williams, William Paul; Hawkins, Leigh; Bridges, Susan; Gresham, Cathy; Harper, Jonathan; Ozkan, Seval; Mylroie, J Erik; Shan, Xueyan

2011-07-01

A public candidate gene testing pipeline for resistance to aflatoxin accumulation or Aspergillus flavus infection in maize is presented here. The pipeline consists of steps for identifying, testing, and verifying the association of selected maize gene sequences with resistance under field conditions. Resources include a database of genetic and protein sequences associated with the reduction in aflatoxin contamination from previous studies; eight diverse inbred maize lines for polymorphism identification within any maize gene sequence; four Quantitative Trait Loci (QTL) mapping populations and one association mapping panel, all phenotyped for aflatoxin accumulation resistance and associated phenotypes; and capacity for Insertion/Deletion (InDel) and SNP genotyping in the population(s) for mapping. To date, ten genes have been identified as possible candidate genes and put through the candidate gene testing pipeline, and results are presented here to demonstrate the utility of the pipeline.

Association of Cytokine Candidate Genes with Severity of Pain and Co-Occurring Symptoms in Breast Cancer Patients Receiving Chemotherapy

DTIC Science & Technology

2013-10-01

identify common genetic variations (i.e., single nucleotide polymorphisms [ SNPs ] and haplotypes) in cytokine genes, as well demographic, clinical, and...Center. The purpose of the proposed project is to identify common genetic variations (i.e., single nucleotide polymorphisms [ SNPs ] and haplotypes) in...research team continues to meet monthly to discuss progress with regards to recruitment, enrollment, and data collection. Training in Genetics In year

[Antipsychotic-induced weight gain--pharmacogenetic studies].

PubMed

Olajossy-Hilkesberger, Luiza; Godlewska, Beata; Marmurowska-Michałowskal, Halina; Olajossy, Marcin; Landowski, Jerzy

2006-01-01

Drug-naive patients with schizophrenia often present metabolic abnormalities and obesity. Weight gain may be the side effect of treatment with many antipsychotic drugs. Genetic effects, besides many other factors, are known to influence obesity in patients with schizophrenia treated with antipsychotics. Numerous studies of several genes' polymorphisms have been performed. -759C/T polymorphism of 5HT2C gene attracted most attention. In 5 independent studies of this polymorphism the association between T allele with the lower AP-induced weight gain was detected. No associations could be detected between weight gain and other polymorphisms of serotonergic system genes as well as histaminergic system genes. Studies of adrenergic and dopaminergic system have neither produced any unambiguous results. Analysis of the newest candidate genes (SAP-25, leptin gene) confirmed the role of genetic factors in AP-induced weight gain. It is worth emphasising, that the studies have been conducted in relatively small and heterogenic groups and that various treatment strategies were used.

Major histocompatibility complex and other allergy-related candidate genes associated with insect bite hypersensitivity in Icelandic horses.

PubMed

Klumplerova, Marie; Vychodilova, Leona; Bobrova, Olga; Cvanova, Michaela; Futas, Jan; Janova, Eva; Vyskocil, Mirko; Vrtkova, Irena; Putnova, Lenka; Dusek, Ladislav; Marti, Eliane; Horin, Petr

2013-04-01

Insect bite hypersensitivity (IBH) is an allergic dermatitis of horses caused by bites of insects. IBH is a multifactorial disease with contribution of genetic and environmental factors. Candidate gene association analysis of IBH was performed in a group of 89 Icelandic horses all born in Iceland and imported to Europe. Horses were classified in IBH-affected and non-affected based on clinical signs and history of recurrent dermatitis, and on the results of an in vitro sulfidoleukotriene (sLT)-release assay with Culicoides nubeculosus and Simulium vittatum extract. Different genetic markers were tested for association with IBH by the Fisher's exact test. The effect of the major histocompatibility complex (MHC) gene region was studied by genotyping five microsatellites spanning the MHC region (COR112, COR113, COR114, UM011 and UMN-JH34-2), and exon 2 polymorphisms of the class II Eqca-DRA gene. Associations with Eqca-DRA and COR113 were identified (p < 0.05). In addition, a panel of 20 single nucleotide polymorphisms (SNPs) in 17 candidate allergy-related genes was tested. During the initial screen, no marker from the panel was significantly (p < 0.05) associated with IBH. Five SNPs associated with IBH at p < 0.10 were therefore used for analysis of combined genotypes. Out of them, SNPs located in the genes coding for the CD14 receptor (CD14), interleukin 23 receptor (IL23R), thymic stromal lymphopoietin (TSLP) and transforming growth factor beta 3 (TGFB3) molecules were associated with IBH as parts of complex genotypes. These results are supported by similar associations and by expression data from different horse populations and from human studies.

Genomic association for sexual precocity in beef heifers using pre-selection of genes and haplotype reconstruction

PubMed Central

Barbero, Marina M. D.; Oliveira, Henrique N.; de Camargo, Gregório M. F.; Fernandes Júnior, Gerardo A.; Aspilcueta-Borquis, Rusbel R.; Souza, Fabio R. P.; Boligon, Arione A.; Melo, Thaise P.; Regatieri, Inaê C.; Feitosa, Fabieli L. B.; Fonseca, Larissa F. S.; Magalhães, Ana F. B.; Costa, Raphael B.; Albuquerque, Lucia G.

2018-01-01

Reproductive traits are of the utmost importance for any livestock farming, but are difficult to measure and to interpret since they are influenced by various factors. The objective of this study was to detect associations between known polymorphisms in candidate genes related to sexual precocity in Nellore heifers, which could be used in breeding programs. Records of 1,689 precocious and non-precocious heifers from farms participating in the Conexão Delta G breeding program were analyzed. A subset of single nucleotide polymorphisms (SNP) located in the region of the candidate genes at a distance of up to 5 kb from the boundaries of each gene, were selected from the panel of 777,000 SNPs of the High-Density Bovine SNP BeadChip. Linear mixed models were used for statistical analysis of early heifer pregnancy, relating the trait with isolated SNPs or with haplotype groups. The model included the contemporary group (year and month of birth) as fixed effect and parent of the animal (sire effect) as random effect. The fastPHASE® and GenomeStudio® were used for reconstruction of the haplotypes and for analysis of linkage disequilibrium based on r2 statistics. A total of 125 candidate genes and 2,024 SNPs forming haplotypes were analyzed. Statistical analysis after Bonferroni correction showed that nine haplotypes exerted a significant effect (p<0.05) on sexual precocity. Four of these haplotypes were located in the Pregnancy-associated plasma protein-A2 gene (PAPP-A2), two in the Estrogen-related receptor gamma gene (ESRRG), and one each in the Pregnancy-associated plasma protein-A gene (PAPP-A), Kell blood group complex subunit-related family (XKR4) and mannose-binding lectin genes (MBL-1) genes. Although the present results indicate that the PAPP-A2, PAPP-A, XKR4, MBL-1 and ESRRG genes influence sexual precocity in Nellore heifers, further studies are needed to evaluate their possible use in breeding programs. PMID:29293544

Genomic association for sexual precocity in beef heifers using pre-selection of genes and haplotype reconstruction.

PubMed

Takada, Luciana; Barbero, Marina M D; Oliveira, Henrique N; de Camargo, Gregório M F; Fernandes Júnior, Gerardo A; Aspilcueta-Borquis, Rusbel R; Souza, Fabio R P; Boligon, Arione A; Melo, Thaise P; Regatieri, Inaê C; Feitosa, Fabieli L B; Fonseca, Larissa F S; Magalhães, Ana F B; Costa, Raphael B; Albuquerque, Lucia G

2018-01-01

Reproductive traits are of the utmost importance for any livestock farming, but are difficult to measure and to interpret since they are influenced by various factors. The objective of this study was to detect associations between known polymorphisms in candidate genes related to sexual precocity in Nellore heifers, which could be used in breeding programs. Records of 1,689 precocious and non-precocious heifers from farms participating in the Conexão Delta G breeding program were analyzed. A subset of single nucleotide polymorphisms (SNP) located in the region of the candidate genes at a distance of up to 5 kb from the boundaries of each gene, were selected from the panel of 777,000 SNPs of the High-Density Bovine SNP BeadChip. Linear mixed models were used for statistical analysis of early heifer pregnancy, relating the trait with isolated SNPs or with haplotype groups. The model included the contemporary group (year and month of birth) as fixed effect and parent of the animal (sire effect) as random effect. The fastPHASE® and GenomeStudio® were used for reconstruction of the haplotypes and for analysis of linkage disequilibrium based on r2 statistics. A total of 125 candidate genes and 2,024 SNPs forming haplotypes were analyzed. Statistical analysis after Bonferroni correction showed that nine haplotypes exerted a significant effect (p<0.05) on sexual precocity. Four of these haplotypes were located in the Pregnancy-associated plasma protein-A2 gene (PAPP-A2), two in the Estrogen-related receptor gamma gene (ESRRG), and one each in the Pregnancy-associated plasma protein-A gene (PAPP-A), Kell blood group complex subunit-related family (XKR4) and mannose-binding lectin genes (MBL-1) genes. Although the present results indicate that the PAPP-A2, PAPP-A, XKR4, MBL-1 and ESRRG genes influence sexual precocity in Nellore heifers, further studies are needed to evaluate their possible use in breeding programs.

Secretome Characterization and Correlation Analysis Reveal Putative Pathogenicity Mechanisms and Identify Candidate Avirulence Genes in the Wheat Stripe Rust Fungus Puccinia striiformis f. sp. tritici.

PubMed

Xia, Chongjing; Wang, Meinan; Cornejo, Omar E; Jiwan, Derick A; See, Deven R; Chen, Xianming

2017-01-01

Stripe (yellow) rust, caused by Puccinia striiformis f. sp. tritici ( Pst ), is one of the most destructive diseases of wheat worldwide. Planting resistant cultivars is an effective way to control this disease, but race-specific resistance can be overcome quickly due to the rapid evolving Pst population. Studying the pathogenicity mechanisms is critical for understanding how Pst virulence changes and how to develop wheat cultivars with durable resistance to stripe rust. We re-sequenced 7 Pst isolates and included additional 7 previously sequenced isolates to represent balanced virulence/avirulence profiles for several avirulence loci in seretome analyses. We observed an uneven distribution of heterozygosity among the isolates. Secretome comparison of Pst with other rust fungi identified a large portion of species-specific secreted proteins, suggesting that they may have specific roles when interacting with the wheat host. Thirty-two effectors of Pst were identified from its secretome. We identified candidates for Avr genes corresponding to six Yr genes by correlating polymorphisms for effector genes to the virulence/avirulence profiles of the 14 Pst isolates. The putative AvYr76 was present in the avirulent isolates, but absent in the virulent isolates, suggesting that deleting the coding region of the candidate avirulence gene has produced races virulent to resistance gene Yr76 . We conclude that incorporating avirulence/virulence phenotypes into correlation analysis with variations in genomic structure and secretome, particularly presence/absence polymorphisms of effectors, is an efficient way to identify candidate Avr genes in Pst . The candidate effector genes provide a rich resource for further studies to determine the evolutionary history of Pst populations and the co-evolutionary arms race between Pst and wheat. The Avr candidates identified in this study will lead to cloning avirulence genes in Pst , which will enable us to understand molecular mechanisms underlying Pst -wheat interactions, to determine the effectiveness of resistance genes and further to develop durable resistance to stripe rust.

SNPs in stress-responsive rice genes: validation, genotyping, functional relevance and population structure

PubMed Central

2012-01-01

Background Single nucleotide polymorphism (SNP) validation and large-scale genotyping are required to maximize the use of DNA sequence variation and determine the functional relevance of candidate genes for complex stress tolerance traits through genetic association in rice. We used the bead array platform-based Illumina GoldenGate assay to validate and genotype SNPs in a select set of stress-responsive genes to understand their functional relevance and study the population structure in rice. Results Of the 384 putative SNPs assayed, we successfully validated and genotyped 362 (94.3%). Of these 325 (84.6%) showed polymorphism among the 91 rice genotypes examined. Physical distribution, degree of allele sharing, admixtures and introgression, and amino acid replacement of SNPs in 263 abiotic and 62 biotic stress-responsive genes provided clues for identification and targeted mapping of trait-associated genomic regions. We assessed the functional and adaptive significance of validated SNPs in a set of contrasting drought tolerant upland and sensitive lowland rice genotypes by correlating their allelic variation with amino acid sequence alterations in catalytic domains and three-dimensional secondary protein structure encoded by stress-responsive genes. We found a strong genetic association among SNPs in the nine stress-responsive genes with upland and lowland ecological adaptation. Higher nucleotide diversity was observed in indica accessions compared with other rice sub-populations based on different population genetic parameters. The inferred ancestry of 16% among rice genotypes was derived from admixed populations with the maximum between upland aus and wild Oryza species. Conclusions SNPs validated in biotic and abiotic stress-responsive rice genes can be used in association analyses to identify candidate genes and develop functional markers for stress tolerance in rice. PMID:22921105

Using RNA-Seq for gene identification, polymorphism detection and transcript profiling in two alfalfa genotypes with divergent cell wall composition in stems

PubMed Central

2011-01-01

Background Alfalfa, [Medicago sativa (L.) sativa], a widely-grown perennial forage has potential for development as a cellulosic ethanol feedstock. However, the genomics of alfalfa, a non-model species, is still in its infancy. The recent advent of RNA-Seq, a massively parallel sequencing method for transcriptome analysis, provides an opportunity to expand the identification of alfalfa genes and polymorphisms, and conduct in-depth transcript profiling. Results Cell walls in stems of alfalfa genotype 708 have higher cellulose and lower lignin concentrations compared to cell walls in stems of genotype 773. Using the Illumina GA-II platform, a total of 198,861,304 expression sequence tags (ESTs, 76 bp in length) were generated from cDNA libraries derived from elongating stem (ES) and post-elongation stem (PES) internodes of 708 and 773. In addition, 341,984 ESTs were generated from ES and PES internodes of genotype 773 using the GS FLX Titanium platform. The first alfalfa (Medicago sativa) gene index (MSGI 1.0) was assembled using the Sanger ESTs available from GenBank, the GS FLX Titanium EST sequences, and the de novo assembled Illumina sequences. MSGI 1.0 contains 124,025 unique sequences including 22,729 tentative consensus sequences (TCs), 22,315 singletons and 78,981 pseudo-singletons. We identified a total of 1,294 simple sequence repeats (SSR) among the sequences in MSGI 1.0. In addition, a total of 10,826 single nucleotide polymorphisms (SNPs) were predicted between the two genotypes. Out of 55 SNPs randomly selected for experimental validation, 47 (85%) were polymorphic between the two genotypes. We also identified numerous allelic variations within each genotype. Digital gene expression analysis identified numerous candidate genes that may play a role in stem development as well as candidate genes that may contribute to the differences in cell wall composition in stems of the two genotypes. Conclusions Our results demonstrate that RNA-Seq can be successfully used for gene identification, polymorphism detection and transcript profiling in alfalfa, a non-model, allogamous, autotetraploid species. The alfalfa gene index assembled in this study, and the SNPs, SSRs and candidate genes identified can be used to improve alfalfa as a forage crop and cellulosic feedstock. PMID:21504589

Identification of Candidate Genes Responsible for Stem Pith Production Using Expression Analysis in Solid-Stemmed Wheat.

PubMed

Oiestad, A J; Martin, J M; Cook, J; Varella, A C; Giroux, M J

2017-07-01

The wheat stem sawfly (WSS) is an economically important pest of wheat in the Northern Great Plains. The primary means of WSS control is resistance associated with the single quantitative trait locus (QTL) , which controls most stem solidness variation. The goal of this study was to identify stem solidness candidate genes via RNA-seq. This study made use of 28 single nucleotide polymorphism (SNP) makers derived from expressed sequence tags (ESTs) linked to contained within a 5.13 cM region. Allele specific expression of EST markers was examined in stem tissue for solid and hollow-stemmed pairs of two spring wheat near isogenic lines (NILs) differing for the QTL. Of the 28 ESTs, 13 were located within annotated genes and 10 had detectable stem expression. Annotated genes corresponding to four of the ESTs were differentially expressed between solid and hollow-stemmed NILs and represent possible stem solidness gene candidates. Further examination of the 5.13 cM region containing the 28 EST markers identified 260 annotated genes. Twenty of the 260 linked genes were up-regulated in hollow NIL stems, while only seven genes were up-regulated in solid NIL stems. An -methyltransferase within the region of interest was identified as a candidate based on differential expression between solid and hollow-stemmed NILs and putative function. Further study of these candidate genes may lead to the identification of the gene(s) controlling stem solidness and an increased ability to select for wheat stem solidness and manage WSS. Copyright © 2017 Crop Science Society of America.

Germline Mutations and Polymorphisms in the Origins of Cancers in Women

PubMed Central

Hirshfield, Kim M.; Rebbeck, Timothy R.; Levine, Arnold J.

2010-01-01

Several female malignancies including breast, ovarian, and endometrial cancers can be characterized based on known somatic and germline mutations. Initiation and propagation of tumors reflect underlying genomic alterations such as mutations, polymorphisms, and copy number variations found in genes of multiple cellular pathways. The contributions of any single genetic variation or mutation in a population depend on its frequency and penetrance as well as tissue-specific functionality. Genome wide association studies, fluorescence in situ hybridization, comparative genomic hybridization, and candidate gene studies have enumerated genetic contributors to cancers in women. These include p53, BRCA1, BRCA2, STK11, PTEN, CHEK2, ATM, BRIP1, PALB2, FGFR2, TGFB1, MDM2, MDM4 as well as several other chromosomal loci. Based on the heterogeneity within a specific tumor type, a combination of genomic alterations defines the cancer subtype, biologic behavior, and in some cases, response to therapeutics. Consideration of tumor heterogeneity is therefore important in the critical analysis of gene associations in cancer. PMID:20111735

Single nucleotide polymorphisms in multiple sclerosis: disease susceptibility and treatment response biomarkers.

PubMed

Pravica, Vera; Popadic, Dusan; Savic, Emina; Markovic, Milos; Drulovic, Jelena; Mostarica-Stojkovic, Marija

2012-04-01

Multiple sclerosis (MS) is a chronic inflammatory demyelinating and neurodegenerative disease of the central nervous system characterized by unpredictable and variable clinical course. Etiology of MS involves both genetic and environmental factors. New technologies identified genetic polymorphisms associated with MS susceptibility among which immunologically relevant genes are significantly overrepresented. Although individual genes contribute only a small part to MS susceptibility, they might be used as biomarkers, thus helping to identify accurate diagnosis, predict clinical disease course and response to therapy. This review focuses on recent progress in research on MS genetics with special emphasis on the possibility to use single nucleotide polymorphism of candidate genes as biomarkers of susceptibility to disease and response to therapy.

Candidate gene association mapping of Sclerotinia stalk rot resistance in sunflower (Helianthus annuus L.) uncovers the importance of COI1 homologs.

PubMed

Talukder, Zahirul I; Hulke, Brent S; Qi, Lili; Scheffler, Brian E; Pegadaraju, Venkatramana; McPhee, Kevin; Gulya, Thomas J

2014-01-01

Functional markers for Sclerotinia basal stalk rot resistance in sunflower were obtained using gene-level information from the model species Arabidopsis thaliana. Sclerotinia stalk rot, caused by Sclerotinia sclerotiorum, is one of the most destructive diseases of sunflower (Helianthus annuus L.) worldwide. Markers for genes controlling resistance to S. sclerotiorum will enable efficient marker-assisted selection (MAS). We sequenced eight candidate genes homologous to Arabidopsis thaliana defense genes known to be associated with Sclerotinia disease resistance in a sunflower association mapping population evaluated for Sclerotinia stalk rot resistance. The total candidate gene sequence regions covered a concatenated length of 3,791 bp per individual. A total of 187 polymorphic sites were detected for all candidate gene sequences, 149 of which were single nucleotide polymorphisms (SNPs) and 38 were insertions/deletions. Eight SNPs in the coding regions led to changes in amino acid codons. Linkage disequilibrium decay throughout the candidate gene regions declined on average to an r (2) = 0.2 for genetic intervals of 120 bp, but extended up to 350 bp with r (2) = 0.1. A general linear model with modification to account for population structure was found the best fitting model for this population and was used for association mapping. Both HaCOI1-1 and HaCOI1-2 were found to be strongly associated with Sclerotinia stalk rot resistance and explained 7.4 % of phenotypic variation in this population. These SNP markers associated with Sclerotinia stalk rot resistance can potentially be applied to the selection of favorable genotypes, which will significantly improve the efficiency of MAS during the development of stalk rot resistant cultivars.

A polymorphic region in the human transcription factor AP-2beta gene is associated with specific personality traits.

PubMed

Damberg, M; Garpenstrand, H; Alfredsson, J; Ekblom, J; Forslund, K; Rylander, G; Oreland, L

2000-03-01

Transcription factor AP-2beta is implicated in playing an important role during embryonic development of different parts of the brain, eg, midbrain, hindbrain, spinal cord, dorsal and cranial root ganglia.1,2 The gene encoding AP-2beta contains a polymorphic region which includes a tetranucleotide repeat of [CAAA] four or five times, located in intron 2 between nucleotides 12593 and 12612.3 Since the midbrain contains structures important for variables such as mood and personality, we have investigated if the AP-2beta genotype is associated with personality traits estimated by the Karolinska Scales of Personality (KSP). Identification of transcription factor genes as candidate genes in psychiatric disorders is a novel approach to further elucidate the genetic factors that, together with environmental factors, are involved in the expression of specific psychiatric phenotypes. The AP-2beta genotype and KSP scores were determined for 137 Caucasian volunteers (73 females and 64 males). The personality traits muscular tension, guilt, somatic anxiety, psychastenia and indirect aggression were significantly associated with the specific AP-2beta genotype, albeit with significant difference between genders. Based on this result the human AP-2beta gene seems to be an important candidate gene for personality disorders. Moreover, the present results suggest that the structure of the intron 2 region of the AP-2beta gene is one factor that contributes to development of the constitutional component of specific personality traits.

Single nucleotide polymorphisms/haplotypes associated with multiple rubella-specific immune response outcomes post-MMR immunization in healthy children.

PubMed

Ovsyannikova, Inna G; Salk, Hannah M; Larrabee, Beth R; Pankratz, V Shane; Poland, Gregory A

2015-10-01

The observed heterogeneity in rubella-specific immune response phenotypes post-MMR vaccination is thought to be explained, in part, by inter-individual genetic variation. In this study, single nucleotide polymorphisms (SNPs) and multiple haplotypes in several candidate genes were analyzed for associations with more than one rubella-specific immune response outcome, including secreted IFN-γ, secreted IL-6, and neutralizing antibody titers. Overall, we identified 23 SNPs in 10 different genes that were significantly associated with at least two rubella-specific immune responses. Of these SNPs, we detected eight in the PVRL3 gene, five in the PVRL1 gene, one in the TRIM22 gene, two in the IL10RB gene, two in the TLR4 gene, and five in other genes (PVR, ADAR, ZFP57, MX1, and BTN2A1/BTN3A3). The PVRL3 gene haplotype GACGGGGGCAGCAAAAAGAAGAGGAAAGAACAA was significantly associated with both higher IFN-γ secretion (t-statistic 4.43, p < 0.0001) and higher neutralizing antibody titers (t-statistic 3.14, p = 0.002). Our results suggest that there is evidence of multigenic associations among identified gene SNPs and that polymorphisms in these candidate genes contribute to the overall observed differences between individuals in response to live rubella virus vaccine. These results will aid our understanding of mechanisms behind rubella-specific immune response to MMR vaccine and influence the development of vaccines in the future.

Analysis of monoamine oxidase A (MAOA) promoter polymorphism in Finnish male alcoholics.

PubMed

Saito, Takuya; Lachman, Herbert M; Diaz, Libna; Hallikainen, Tero; Kauhanen, Jussi; Salonen, Jukka T; Ryynänen, Olli-Pekka; Karvonen, Matti K; Syvälahti, Erkka; Pohjalainen, Tiina; Hietala, Jarmo; Tiihonen, Jari

2002-03-15

Alterations in monoamine oxidase A (MAOA) expression and enzyme activity may be associated with alcoholism and impulsive behavior. Therefore, functional polymorphisms in the MAOA gene would be good candidates to consider in the interindividual differences that exist in the susceptibility to alcoholism. One variant that has been considered as a candidate in alcoholism is a repeat polymorphism in the MAOA gene promoter. We analyzed a cohort of Finnish males with either type 1 or type 2 alcoholism, as well as controls, for differences in the distribution of MAOA promoter alleles. Based on other studies, we postulated that type 2 alcoholism, which is associated with antisocial behavior, but not type 1 alcoholism, would be correlated with the inheritance of the low promoter activity allele. However, we failed to find a difference in allele distribution in type 1 and type 2 alcoholics. In addition, there was no difference in the allele distribution when each group of alcoholics was compared with controls. However, when both groups of alcoholics were pooled and compared with controls, the difference in allele distribution reached a trend towards significance. Our results suggest a minimal association between the MAOA low activity promoter alleles and alcoholism, regardless of the presence or absence of antisocial behavior. Interestingly, approximately 3% of type 2 alcoholics were found to be heterozygous for the MAOA promoter polymorphism. Since MAOA is X-linked, the heterozygotes are probable cases of Klinefelter's syndrome (47,XXY) suggesting that X-chromosome aneuploidy may increase the risk for developing type 2 alcoholism.

Synaptosome-Associated Protein 25 (SNAP25) Gene Association Analysis Revealed Risk Variants for ASD, in Iranian Population.

PubMed

Safari, Mohammad Reza; Omrani, Mir Davood; Noroozi, Rezvan; Sayad, Arezou; Sarrafzadeh, Shaghayegh; Komaki, Alireza; Manjili, Fateme Asadzadeh; Mazdeh, Mehrdokht; Ghaleiha, Ali; Taheri, Mohammad

2017-03-01

Autism spectrum disorder (ASD) is a common, complex neurological condition, affecting approximately 1% of people worldwide. Monogenic neurodevelopmental disorders which showed autistic behavior patterns have suggested synaptic dysfunction, as a key mechanism in the pathophysiology of ASD. Subsequently, genes involved in synaptic signaling have been investigated with a priority for candidate gene studies. A synaptosomal-associated protein 25 (SNAP25) gene plays a crucial role in the central nervous system, contributing to exocytosis by targeting and fusion of vesicles to the cell membrane. Studies have shown a correlation between aberrant expression of the SNAP25 and a variety of brain diseases. Single nucleotide polymorphisms (SNPs) in this gene are associated with several psychiatric diseases, such as bipolar, schizophrenia, and attention-deficit/hyperactivity disorder. The aim of the present study was to investigate whether polymorphisms (rs3746544 and rs1051312) in the regulatory 3'-untranslated region (3'UTR) of the SNAP25 gene have an association with ASD in unrelated Iranian case (N = 524)-control (N = 472) samples. We observed robust association of the rs3746544 SNP and ASD patients, in both allele and haplotype-based analyses. Our results supported the previous observations and indicated a possible role for SNAP25 polymorphisms as susceptibility genetic factors involved in developing ASD.

Association studies of 23 positional/functional candidate genes on chromosome 10 in late-onset Alzheimer's disease.

PubMed

Morgan, A R; Turic, D; Jehu, L; Hamilton, G; Hollingworth, P; Moskvina, V; Jones, L; Lovestone, S; Brayne, C; Rubinsztein, D C; Lawlor, B; Gill, M; O'Donovan, M C; Owen, M J; Williams, J

2007-09-05

Late-onset Alzheimer's disease (LOAD) is a common neurodegenerative disorder, with a complex etiology. APOE is the only confirmed susceptibility gene for LOAD. Others remain yet to be found. Evidence from linkage studies suggests that a gene (or genes) conferring susceptibility for LOAD resides on chromosome 10. We studied 23 positional/functional candidate genes from our linkage region on chromosome 10 (APBB1IP, ALOX5, AD037, SLC18A3, DKK1, ZWINT, ANK3, UBE2D1, CDC2, SIRT1, JDP1, NET7, SUPV3L1, NEN3, SAR1, SGPL1, SEC24C, CAMK2G, PP3CB, SNCG, CH25H, PLCE1, ANXV111) in the MRC genetic resource for LOAD. These candidates were screened for sequence polymorphisms in a sample of 14 LOAD subjects and detected polymorphisms tested for association with LOAD in a three-stage design involving two stages of genotyping pooled DNA samples followed by a third stage in which markers showing evidence for association in the first stages were subjected to individual genotyping. One hundred and twenty polymorphisms were identified and tested in stage 1 (4 case + 4 control pools totaling 366 case and 366 control individuals). Single nucleotide polymorphisms (SNPs) showing evidence of association with LOAD were then studied in stage 2 (8 case + 4 control pools totaling 1,001 case and 1,001 control individuals). Five SNPs, in four genes, showed evidence for association (P < 0.1) at stage 2 and were individually genotyped in the complete dataset, comprising 1,160 LOAD cases and 1,389 normal controls. Two SNPs in SGPL1 demonstrated marginal evidence of association, with uncorrected P values of 0.042 and 0.056, suggesting that variation in SGPL1 may confer susceptibility to LOAD. Copyright 2007 Wiley-Liss, Inc.

Genome-wide association study identifies phospholipase C zeta 1 (PLCz1) as a stallion fertility locus in Hanoverian warmblood horses.

PubMed

Schrimpf, Rahel; Dierks, Claudia; Martinsson, Gunilla; Sieme, Harald; Distl, Ottmar

2014-01-01

A consistently high level of stallion fertility plays an economically important role in modern horse breeding. We performed a genome-wide association study for estimated breeding values of the paternal component of the pregnancy rate per estrus cycle (EBV-PAT) in Hanoverian stallions. A total of 228 Hanoverian stallions were genotyped using the Equine SNP50 Beadchip. The most significant association was found on horse chromosome 6 for a single nucleotide polymorphism (SNP) within phospholipase C zeta 1 (PLCz1). In the close neighbourhood to PLCz1 is located CAPZA3 (capping protein (actin filament) muscle Z-line, alpha 3). The gene PLCz1 encodes a protein essential for spermatogenesis and oocyte activation through sperm induced Ca2+-oscillation during fertilization. We derived equine gene models for PLCz1 and CAPZA3 based on cDNA and genomic DNA sequences. The equine PLCz1 had four different transcripts of which two contained a premature termination codon. Sequencing all exons and their flanking sequences using genomic DNA samples from 19 Hanoverian stallions revealed 47 polymorphisms within PLCz1 and one SNP within CAPZA3. Validation of these 48 polymorphisms in 237 Hanoverian stallions identified three intronic SNPs within PLCz1 as significantly associated with EBV-PAT. Bioinformatic analysis suggested regulatory effects for these SNPs via transcription factor binding sites or microRNAs. In conclusion, non-coding polymorphisms within PLCz1 were identified as conferring stallion fertility and PLCz1 as candidate locus for male fertility in Hanoverian warmblood. CAPZA3 could be eliminated as candidate gene for fertility in Hanoverian stallions.

Genetic, comparative genomic, and expression analyses of the Mc1r locus in the polychromatic Midas cichlid fish (Teleostei, Cichlidae Amphilophus sp.) species group.

PubMed

Henning, Frederico; Renz, Adina Josepha; Fukamachi, Shoji; Meyer, Axel

2010-05-01

Natural populations of the Midas cichlid species in several different crater lakes in Nicaragua exhibit a conspicuous color polymorphism. Most individuals are dark and the remaining have a gold coloration. The color morphs mate assortatively and sympatric population differentiation has been shown based on neutral molecular data. We investigated the color polymorphism using segregation analysis and a candidate gene approach. The segregation patterns observed in a mapping cross between a gold and a dark individual were consistent with a single dominant gene as a cause of the gold phenotype. This suggests that a simple genetic architecture underlies some of the speciation events in the Midas cichlids. We compared the expression levels of several candidate color genes Mc1r, Ednrb1, Slc45a2, and Tfap1a between the color morphs. Mc1r was found to be up regulated in the gold morph. Given its widespread association in color evolution and role on melanin synthesis, the Mc1r locus was further investigated using sequences derived from a genomic library. Comparative analysis revealed conserved synteny in relation to the majority of teleosts and highlighted several previously unidentified conserved non-coding elements (CNEs) in the upstream and downstream regions in the vicinity of Mc1r. The identification of the CNEs regions allowed the comparison of sequences from gold and dark specimens of natural populations. No polymorphisms were found between in the population sample and Mc1r showed no linkage to the gold phenotype in the mapping cross, demonstrating that it is not causally related to the color polymorphism in the Midas cichlid.

Genome-Wide Association Study Identifies Phospholipase C zeta 1 (PLCz1) as a Stallion Fertility Locus in Hanoverian Warmblood Horses

PubMed Central

Schrimpf, Rahel; Dierks, Claudia; Martinsson, Gunilla; Sieme, Harald; Distl, Ottmar

2014-01-01

A consistently high level of stallion fertility plays an economically important role in modern horse breeding. We performed a genome-wide association study for estimated breeding values of the paternal component of the pregnancy rate per estrus cycle (EBV-PAT) in Hanoverian stallions. A total of 228 Hanoverian stallions were genotyped using the Equine SNP50 Beadchip. The most significant association was found on horse chromosome 6 for a single nucleotide polymorphism (SNP) within phospholipase C zeta 1 (PLCz1). In the close neighbourhood to PLCz1 is located CAPZA3 (capping protein (actin filament) muscle Z-line, alpha 3). The gene PLCz1 encodes a protein essential for spermatogenesis and oocyte activation through sperm induced Ca2+-oscillation during fertilization. We derived equine gene models for PLCz1 and CAPZA3 based on cDNA and genomic DNA sequences. The equine PLCz1 had four different transcripts of which two contained a premature termination codon. Sequencing all exons and their flanking sequences using genomic DNA samples from 19 Hanoverian stallions revealed 47 polymorphisms within PLCz1 and one SNP within CAPZA3. Validation of these 48 polymorphisms in 237 Hanoverian stallions identified three intronic SNPs within PLCz1 as significantly associated with EBV-PAT. Bioinformatic analysis suggested regulatory effects for these SNPs via transcription factor binding sites or microRNAs. In conclusion, non-coding polymorphisms within PLCz1 were identified as conferring stallion fertility and PLCz1 as candidate locus for male fertility in Hanoverian warmblood. CAPZA3 could be eliminated as candidate gene for fertility in Hanoverian stallions. PMID:25354211

Association of polymorphisms in nicotinic acetylcholine receptor alpha 4 subunit gene (CHRNA4), mu-opioid receptor gene (OPRM1), and ethanol-metabolizing enzyme genes with alcoholism in Korean patients.

PubMed

Kim, Soon Ae; Kim, Jong-Woo; Song, Ji-Young; Park, Sunny; Lee, Hee Jae; Chung, Joo-Ho

2004-01-01

Findings obtained from several studies indicate that ethanol enhances the activity of alpha4beta2 neuronal nicotinic acetylcholine receptor and support the possibility that a polymorphism of the nicotinic acetylcholine receptor alpha4 subunit gene (CHRNA4) modulates enhancement of nicotinic receptor function by ethanol. To identify the association between the CfoI polymorphism of the CHRNA4 and alcoholism, we examined distribution of genotypes and allele frequencies in Korean patients diagnosed with alcoholism (n = 127) and Korean control subjects without alcoholism (n = 185) with polymerase chain reaction-restriction fragment length polymorphism methods. We were able to detect the association between the CfoI polymorphism of the CHRNA4 and alcoholism in Korean patients (genotype P = .023; allele frequency P = .047). The genotypes and allele frequencies of known polymorphisms in other alcoholism candidate genes, such as alcohol metabolism-related genes [alcohol dehydrogenase 2 (ADH2), aldehyde dehydrogenase 2 (ALDH2), alcohol dehydrogenase 3 (ADH3), and cytochrome P450 2E1 (CYP2E1)] and mu-opioid receptor gene (OPRM1), were studied. The polymorphisms of ADH2, ALDH2, and CYP2E1 were significantly different in Korean patients with alcoholism and Korean control subjects without alcoholism, but ADH3 and OPRM1 did not differ between the two groups.

Association studies on the bovine lipoprotein lipase gene polymorphism with growth and carcass quality traits in Qinchuan cattle.

PubMed

Gui, Linsheng; Jia, Cuiling; Zhang, Yaran; Zhao, Chunping; Zan, Linsen

2016-04-01

Lipoprotein lipase (LPL) is considered as an essential enzyme in lipid deposition and tissue metabolism. It has been proposed to be a lead candidate gene for genetic markers of lipid deposition and energy balance. In this paper, polymorphisms in the LPL gene were investigated in 554 Chinese Qinchuan cattle by PCR-RFLP and DNA sequencing. Seven single nucleotide polymorphisms (SNPs) were identified, which included one mutation (g.91C > T) in the 5'untranslated region (UTR), four synonymous mutations (g.17015A > G, g.18362G > A, g.18377T > C and g.19873T > C) and two mutations (g.25225A > G and g.25316T > G) in the 3'UTR. The frequencies of SNP g.18377T > C and g.25316T > G were skewed from Hardy-Weinberg equilibrium in all the samples (chi-square test, P < 0.05). An association analysis showed that five loci (except for g.91C > T and g.18377T > C) were significantly correlated with some growth and carcass quality traits. These results demonstrate that LPL might be a potential candidate gene for marker-assisted selection (MAS). Copyright © 2016. Published by Elsevier Ltd.

Meta-analysis of genetic studies from journals published in China of ischemic stroke in the Han Chinese population.

PubMed

Xu, Xiaowei; Li, Jiejie; Sheng, Wenli; Liu, Lin

2008-01-01

The aim of this study was to confirm the nature and number of genes contributing to stroke risk and qualify the genetic risk of each susceptibility gene in the Han Chinese population. After collecting all case-control studies related to DNA polymorphism of any candidate gene for ischemic stroke in Han Chinese, strict selection criteria and exclusion criteria were determined and different effect models were used according to the difference in heterogeneity. Meta-analyses were carried out by Revman 4.0 software and the publication bias was further evaluated through calculation of fail-safe numbers in the included gene polymorphisms. Seventy-six studies were included in the meta-analyses which were all published in mainland China and referred to 6 candidate genes and 7 polymorphisms. Among the gene polymorphisms tested in the study, association of gene polymorphisms with increasing risk of ischemic stroke was confirmed in 6 polymorphisms including angiotensin-converting enzyme insertion/deletion (ACE I/D; OR = 1.87, 95% CI = 1.45-2.42), methylenetetrahydrofolate reductase (MTHFR) C677T (OR = 1.55, 95% CI = 1.26-1.90), plasminogen activator inhibitor 1 (PAI-1) 4G/5G (OR = 1.79, 95% CI = 1.20-2.67), beta-fibrinogen (beta-Fg) -455A/G (OR = 1.48, 95% CI = 1.14-1.92), beta-Fg -148T/C (OR = 1.72, 95% CI = 1.42-2.07), apolipoprotein E (ApoE) epsilon2-4 (OR = 2.39, 95% CI = 1.94-2.95). Because of the obvious publication bias, the association between paraoxonase 1 (PON-1) polymorphisms and stroke risk was not established although the OR of the meta-analysis suggested a positive result (OR = 1.14, 95% CI = 1.01-1.35). ACE D/I, MTHFR C677T, beta-Fg -455A/G, beta-Fg -148T/C, PAI-1 4G/5G, and ApoE epsilon2-4 were associated with risk of ischemic stroke in Han Chinese. (c) 2008 S. Karger AG, Basel

Association and linkage studies of candidate genes involved in GABAergic neurotransmission in lithium-responsive bipolar disorder.

PubMed Central

Duffy, A; Turecki, G; Grof, P; Cavazzoni, P; Grof, E; Joober, R; Ahrens, B; Berghöfer, A; Müller-Oerlinghausen, B; Dvoráková, M; Libigerová, E; Vojtĕchovský, M; Zvolský, P; Nilsson, A; Licht, R W; Rasmussen, N A; Schou, M; Vestergaard, P; Holzinger, A; Schumann, C; Thau, K; Robertson, C; Rouleau, G A; Alda, M

2000-01-01

OBJECTIVE: To test for genetic linkage and association with GABAergic candidate genes in lithium-responsive bipolar disorder. DESIGN: Polymorphisms located in genes that code for GABRA3, GABRA5 and GABRB3 subunits of the GABAA receptor were investigated using association and linkage strategies. PARTICIPANTS: A total of 138 patients with bipolar 1 disorder with a clear response to lithium prophylaxis, selected from specialized lithium clinics in Canada and Europe that are part of the International Group for the Study of Lithium-Treated Patients, and 108 psychiatrically healthy controls. Families of 24 probands were suitable for linkage analysis. OUTCOME MEASURES: The association between the candidate genes and patients with bipolar disorder versus that of controls and genetic linkage within families. RESULTS: There was no significant association or linkage found between lithium-responsive bipolar disorder and the GABAergic candidate genes investigated. CONCLUSIONS: This study does not support a major role for the GABAergic candidate genes tested in lithium-responsive bipolar disorder. PMID:11022400

Single nucleotide polymorphisms in candidate genes associated with fertilizing ability of sperm and subsequent embryonic development in cattle

USDA-ARS?s Scientific Manuscript database

Fertilization and development of the preimplantation embryo is under genetic control. The goal of the current study was to test 434 single nucleotide polymorphisms (SNPs) for association with genetic variation in fertilization and early embryonic development. The approach was to produce embryos from...

Integrative Annotation of 21,037 Human Genes Validated by Full-Length cDNA Clones

PubMed Central

Imanishi, Tadashi; Itoh, Takeshi; Suzuki, Yutaka; O'Donovan, Claire; Fukuchi, Satoshi; Koyanagi, Kanako O; Barrero, Roberto A; Tamura, Takuro; Yamaguchi-Kabata, Yumi; Tanino, Motohiko; Yura, Kei; Miyazaki, Satoru; Ikeo, Kazuho; Homma, Keiichi; Kasprzyk, Arek; Nishikawa, Tetsuo; Hirakawa, Mika; Thierry-Mieg, Jean; Thierry-Mieg, Danielle; Ashurst, Jennifer; Jia, Libin; Nakao, Mitsuteru; Thomas, Michael A; Mulder, Nicola; Karavidopoulou, Youla; Jin, Lihua; Kim, Sangsoo; Yasuda, Tomohiro; Lenhard, Boris; Eveno, Eric; Suzuki, Yoshiyuki; Yamasaki, Chisato; Takeda, Jun-ichi; Gough, Craig; Hilton, Phillip; Fujii, Yasuyuki; Sakai, Hiroaki; Tanaka, Susumu; Amid, Clara; Bellgard, Matthew; Bonaldo, Maria de Fatima; Bono, Hidemasa; Bromberg, Susan K; Brookes, Anthony J; Bruford, Elspeth; Carninci, Piero; Chelala, Claude; Couillault, Christine; de Souza, Sandro J.; Debily, Marie-Anne; Devignes, Marie-Dominique; Dubchak, Inna; Endo, Toshinori; Estreicher, Anne; Eyras, Eduardo; Fukami-Kobayashi, Kaoru; R. Gopinath, Gopal; Graudens, Esther; Hahn, Yoonsoo; Han, Michael; Han, Ze-Guang; Hanada, Kousuke; Hanaoka, Hideki; Harada, Erimi; Hashimoto, Katsuyuki; Hinz, Ursula; Hirai, Momoki; Hishiki, Teruyoshi; Hopkinson, Ian; Imbeaud, Sandrine; Inoko, Hidetoshi; Kanapin, Alexander; Kaneko, Yayoi; Kasukawa, Takeya; Kelso, Janet; Kersey, Paul; Kikuno, Reiko; Kimura, Kouichi; Korn, Bernhard; Kuryshev, Vladimir; Makalowska, Izabela; Makino, Takashi; Mano, Shuhei; Mariage-Samson, Regine; Mashima, Jun; Matsuda, Hideo; Mewes, Hans-Werner; Minoshima, Shinsei; Nagai, Keiichi; Nagasaki, Hideki; Nagata, Naoki; Nigam, Rajni; Ogasawara, Osamu; Ohara, Osamu; Ohtsubo, Masafumi; Okada, Norihiro; Okido, Toshihisa; Oota, Satoshi; Ota, Motonori; Ota, Toshio; Otsuki, Tetsuji; Piatier-Tonneau, Dominique; Poustka, Annemarie; Ren, Shuang-Xi; Saitou, Naruya; Sakai, Katsunaga; Sakamoto, Shigetaka; Sakate, Ryuichi; Schupp, Ingo; Servant, Florence; Sherry, Stephen; Shiba, Rie; Shimizu, Nobuyoshi; Shimoyama, Mary; Simpson, Andrew J; Soares, Bento; Steward, Charles; Suwa, Makiko; Suzuki, Mami; Takahashi, Aiko; Tamiya, Gen; Tanaka, Hiroshi; Taylor, Todd; Terwilliger, Joseph D; Unneberg, Per; Veeramachaneni, Vamsi; Watanabe, Shinya; Wilming, Laurens; Yasuda, Norikazu; Yoo, Hyang-Sook; Stodolsky, Marvin; Makalowski, Wojciech; Go, Mitiko; Nakai, Kenta; Takagi, Toshihisa; Kanehisa, Minoru; Sakaki, Yoshiyuki; Quackenbush, John; Okazaki, Yasushi; Hayashizaki, Yoshihide; Hide, Winston; Chakraborty, Ranajit; Nishikawa, Ken; Sugawara, Hideaki; Tateno, Yoshio; Chen, Zhu; Oishi, Michio; Tonellato, Peter; Apweiler, Rolf; Okubo, Kousaku; Wagner, Lukas; Wiemann, Stefan; Strausberg, Robert L; Isogai, Takao; Auffray, Charles; Nomura, Nobuo; Sugano, Sumio

2004-01-01

The human genome sequence defines our inherent biological potential; the realization of the biology encoded therein requires knowledge of the function of each gene. Currently, our knowledge in this area is still limited. Several lines of investigation have been used to elucidate the structure and function of the genes in the human genome. Even so, gene prediction remains a difficult task, as the varieties of transcripts of a gene may vary to a great extent. We thus performed an exhaustive integrative characterization of 41,118 full-length cDNAs that capture the gene transcripts as complete functional cassettes, providing an unequivocal report of structural and functional diversity at the gene level. Our international collaboration has validated 21,037 human gene candidates by analysis of high-quality full-length cDNA clones through curation using unified criteria. This led to the identification of 5,155 new gene candidates. It also manifested the most reliable way to control the quality of the cDNA clones. We have developed a human gene database, called the H-Invitational Database (H-InvDB; http://www.h-invitational.jp/). It provides the following: integrative annotation of human genes, description of gene structures, details of novel alternative splicing isoforms, non-protein-coding RNAs, functional domains, subcellular localizations, metabolic pathways, predictions of protein three-dimensional structure, mapping of known single nucleotide polymorphisms (SNPs), identification of polymorphic microsatellite repeats within human genes, and comparative results with mouse full-length cDNAs. The H-InvDB analysis has shown that up to 4% of the human genome sequence (National Center for Biotechnology Information build 34 assembly) may contain misassembled or missing regions. We found that 6.5% of the human gene candidates (1,377 loci) did not have a good protein-coding open reading frame, of which 296 loci are strong candidates for non-protein-coding RNA genes. In addition, among 72,027 uniquely mapped SNPs and insertions/deletions localized within human genes, 13,215 nonsynonymous SNPs, 315 nonsense SNPs, and 452 indels occurred in coding regions. Together with 25 polymorphic microsatellite repeats present in coding regions, they may alter protein structure, causing phenotypic effects or resulting in disease. The H-InvDB platform represents a substantial contribution to resources needed for the exploration of human biology and pathology. PMID:15103394

Candidate gene association study conditioning on individual ancestry in patients with type 2 diabetes and metabolic syndrome from Mexico City.

PubMed

Cruz, M; Valladares-Salgado, A; Garcia-Mena, J; Ross, K; Edwards, M; Angeles-Martinez, J; Ortega-Camarillo, C; de la Peña, J Escobedo; Burguete-Garcia, A I; Wacher-Rodarte, N; Ambriz, R; Rivera, R; D'artote, A L; Peralta, J; Parra, Esteban J; Kumate, J

2010-05-01

Type 2 diabetes (T2D) is influenced by diverse environmental and genetic risk factors. Metabolic syndrome (MS) increases the risk of cardiovascular disease and diabetes. We analysed 14 cases of polymorphisms located in 10 candidate loci, in a sample of patients with T2D and controls from Mexico City. We analysed the association of 14 polymorphisms located within 10 genes (TCF7L2, ENPP1, ADRB3, KCNJ11, LEPR, PPARgamma, FTO, CDKAL1, SIRT1 and HHEX) with T2D and MS. The analysis included 519 subjects with T2D defined according to the ADA criteria, 389 with MS defined according to the AHA/NHLBI criteria and 547 controls. Association was tested with the program ADMIXMAP including individual ancestry, age, sex, education and in some cases body mass index (BMI), in a logistic regression model. The two markers located within the TCF7L2 gene showed strong associations with T2D (rs7903146, T allele, odd ratio (OR) = 1.76, p = 0.001 and rs12255372, T allele, OR = 1.78, p = 0.002), but did not show significant association with MS. The non-synonymous rs4994 polymorphism of the ADRB3 gene was associated with T2D (Trp allele, OR = 0.62, p = 0.001) and MS (Trp allele, OR = 0.74, p = 0.018). Nominally significant associations were also observed between T2D and the SIRT1 rs3758391 SNP and MS and the HHEX rs5015480 polymorphism. Variants located within the gene TCF7L2 are strongly associated with T2D but not with MS, providing support to previous evidence indicating that polymorphisms at the TCF7L2 gene increase T2D risk. In contrast, the non-synonymous ADRB3 rs4994 polymorphism is associated with T2D and MS.

Peroxisome proliferator-activated receptor gamma co-activator 1 gene Gly482Ser polymorphism is associated with the response of low-density lipoprotein cholesterol concentrations to exercise training in elderly Japanese.

PubMed

Tobina, Takuro; Mori, Yukari; Doi, Yukiko; Nakayama, Fuki; Kiyonaga, Akira; Tanaka, Hiroaki

2017-09-01

Muscle peroxisome proliferator-activated receptor gamma co-activator 1 (PGC-1)α gene expression is influenced by the Gly482Ser gene polymorphism, which is a candidate genetic risk factor for diabetes mellitus and obesity. This study investigated the effects of PGC-1 gene Gly482Ser polymorphisms on alterations in glucose and lipid metabolism induced by exercise training. A 12-week intervention study was performed for 119 participants who were more than 65 years of age and completed exercise training at lactate threshold intensity. Total cholesterol and low-density lipoprotein cholesterol were significantly reduced in Gly/Gly but not in Gly/Ser and Ser/Ser participants after exercise. The Gly/Gly genotype of the PGC-1 gene Gly482Ser polymorphism influences the effects of moderate-intensity exercise training on low-density lipoprotein cholesterol and total cholesterol concentrations in older people.

Lack of association of the G22A polymorphism of the ADA gene in patients with ankylosing spondylitis.

PubMed

Camargo, U; Toledo, R A; Cintra, J R; Nunes, D P T; Acayaba de Toledo, R; Brandão de Mattos, C C; Mattos, L C

2012-05-07

Genes located outside the HLA region (6p21) have been considered as candidates for susceptibility to ankylosing spondylitis. We tested the hypothesis that the G22A polymorphism of the adenosine deaminase gene (ADA; 20q13.11) is associated with ankylosing spondylitis in 166 Brazilian subjects genotyped for the HLA*27 gene (47 patients and 119 controls matched for gender, age and geographic origin). The HLA-B*27 gene and the G22A ADA polymorphism were identified by PCR with sequence-specific oligonucleotide probes and PCR-RFLP, respectively. There were no significant differences in frequencies of ADA genotypes [odds ratio (OR) = 1.200, 95% confidence interval (CI) = 0.3102-4.643, P > 0.8] and ADA*01 and ADA*02 alleles (OR = 1.192, 95%CI = 0.3155-4.505, P > 0.8) in patients versus controls. We conclude that the G22A polymorphism is not associated with ankylosing spondylitis.

Genetic modification of the association between peripubertal dioxin exposure and pubertal onset in a cohort of Russian boys.

PubMed

Humblet, Olivier; Korrick, Susan A; Williams, Paige L; Sergeyev, Oleg; Emond, Claude; Birnbaum, Linda S; Burns, Jane S; Altshul, Larisa M; Patterson, Donald G; Turner, Wayman E; Lee, Mary M; Revich, Boris; Hauser, Russ

2013-01-01

Exposure to dioxins has been associated with delayed pubertal onset in both epidemiologic and animal studies. Whether genetic polymorphisms may modify this association is currently unknown. Identifying such genes could provide insight into mechanistic pathways. This is one of the first studies to assess genetic susceptibility to dioxins. We evaluated whether common polymorphisms in genes affecting either molecular responses to dioxin exposure or pubertal onset influence the association between peripubertal serum dioxin concentration and male pubertal onset. In this prospective cohort of Russian adolescent boys (n = 392), we assessed gene-environment interactions for 337 tagging single-nucleotide polymorphisms (SNPs) from 46 candidate genes and two intergenic regions. Dioxins were measured in the boys' serum at age 8-9 years. Pubertal onset was based on testicular volume and on genitalia staging. Statistical approaches for controlling for multiple testing were used, both with and without prescreening for marginal genetic associations. After accounting for multiple testing, two tag SNPs in the glucocorticoid receptor (GR/NR3C1) gene and one in the estrogen receptor-α (ESR1) gene were significant (q < 0.2) modifiers of the association between peripubertal serum dioxin concentration and male pubertal onset defined by genitalia staging, although not by testicular volume. The results were sensitive to whether multiple comparison adjustment was applied to all gene-environment tests or only to those with marginal genetic associations. Common genetic polymorphisms in the glucocorticoid receptor and estrogen receptor-α genes may modify the association between peripubertal serum dioxin concentration and pubertal onset. Further studies are warranted to confirm these findings.

Canine candidate genes for dilated cardiomyopathy: annotation of and polymorphic markers for 14 genes

PubMed Central

Wiersma, Anje C; Leegwater, Peter AJ; van Oost, Bernard A; Ollier, William E; Dukes-McEwan, Joanna

2007-01-01

Background Dilated cardiomyopathy is a myocardial disease occurring in humans and domestic animals and is characterized by dilatation of the left ventricle, reduced systolic function and increased sphericity of the left ventricle. Dilated cardiomyopathy has been observed in several, mostly large and giant, dog breeds, such as the Dobermann and the Great Dane. A number of genes have been identified, which are associated with dilated cardiomyopathy in the human, mouse and hamster. These genes mainly encode structural proteins of the cardiac myocyte. Results We present the annotation of, and marker development for, 14 of these genes of the dog genome, i.e. α-cardiac actin, caveolin 1, cysteine-rich protein 3, desmin, lamin A/C, LIM-domain binding factor 3, myosin heavy polypeptide 7, phospholamban, sarcoglycan δ, titin cap, α-tropomyosin, troponin I, troponin T and vinculin. A total of 33 Single Nucleotide Polymorphisms were identified for these canine genes and 11 polymorphic microsatellite repeats were developed. Conclusion The presented polymorphisms provide a tool to investigate the role of the corresponding genes in canine Dilated Cardiomyopathy by linkage analysis or association studies. PMID:17949487

Canine candidate genes for dilated cardiomyopathy: annotation of and polymorphic markers for 14 genes.

PubMed

Wiersma, Anje C; Leegwater, Peter Aj; van Oost, Bernard A; Ollier, William E; Dukes-McEwan, Joanna

2007-10-19

Dilated cardiomyopathy is a myocardial disease occurring in humans and domestic animals and is characterized by dilatation of the left ventricle, reduced systolic function and increased sphericity of the left ventricle. Dilated cardiomyopathy has been observed in several, mostly large and giant, dog breeds, such as the Dobermann and the Great Dane. A number of genes have been identified, which are associated with dilated cardiomyopathy in the human, mouse and hamster. These genes mainly encode structural proteins of the cardiac myocyte. We present the annotation of, and marker development for, 14 of these genes of the dog genome, i.e. alpha-cardiac actin, caveolin 1, cysteine-rich protein 3, desmin, lamin A/C, LIM-domain binding factor 3, myosin heavy polypeptide 7, phospholamban, sarcoglycan delta, titin cap, alpha-tropomyosin, troponin I, troponin T and vinculin. A total of 33 Single Nucleotide Polymorphisms were identified for these canine genes and 11 polymorphic microsatellite repeats were developed. The presented polymorphisms provide a tool to investigate the role of the corresponding genes in canine Dilated Cardiomyopathy by linkage analysis or association studies.

HapMap-based study on the association between MPO and GSTP1 gene polymorphisms and lung cancer susceptibility in Chinese Han population

PubMed Central

Gu, Jun-dong; Hua, Feng; Mei, Chao-rong; Zheng, De-jie; Wang, Guo-fan; Zhou, Qing-hua

2014-01-01

Aim: Myeloperoxidase (MPO) and glutathione S-transferase pi 1 (GSTP1) are important carcinogen-metabolizing enzymes. The aim of this study was to investigate the association between the common polymorphisms of MPO and GSTP1 genes and lung cancer risk in Chinese Han population. Methods: A total of 266 subjects with lung cancer and 307 controls without personal history of the disease were recruited in this case control study. The tagSNPs approach was used to assess the common polymorphisms of MOP and GSTP1 genes and lung cancer risk according to the disequilibrium information from the HapMap project. The tagSNP rs7208693 was selected as the polymorphism site for MPO, while the haplotype-tagging SNPs rs1695, rs4891, rs762803 and rs749174 were selected as the polymorphism sites for GSTP1. The gene polymorphisms were confirmed using real-time PCR, cloning and sequencing. Results: The four GSTP1 haplotype-tagging SNPs rs1695, rs4891, rs762803 and rs749174, but not the MPO tagSNP rs7208693, exhibited an association with lung cancer susceptibility in smokers in the overall population and in the studied subgroups. When Phase 2 software was used to reconstruct the haplotype for GSTP1, the haplotype CACA (rs749174+rs1695 + rs762803+rs4891) exhibited an increased risk of lung cancer among smokers (adjust odds ratio 1.53; 95%CI 1.04–2.25, P=0.033). Furthermore, diplotype analyses demonstrated that the significant association between the risk haplotype and lung cancer. The risk haplotypes co-segregated with one or more biologically functional polymorphisms and corresponded to a recessive inheritance model. Conclusion: The common polymorphisms of the GSTP1 gene may be the candidates for SNP markers for lung cancer susceptibility in Chinese Han population. PMID:24786234

Reelin gene polymorphisms in the Indian population: a possible paternal 5'UTR-CGG-repeat-allele effect on autism.

PubMed

Dutta, Shruti; Guhathakurta, Subhrangshu; Sinha, Swagata; Chatterjee, Anindita; Ahmed, Shabina; Ghosh, Saurabh; Gangopadhyay, Prasanta K; Singh, Manoranjan; Usha, Rajamma

2007-01-05

Autism is a neurodevelopmental disorder with high heritability factor and the reelin gene, which codes for an extracellular matrix protein involved with neuronal migration and lamination is being investigated as a positional and functional candidate gene for autism. It is located on chromosome 7q22 within the autism susceptible locus (AUTS1); identified in earlier genome scans and several investigations have been carried out on various ethnic groups to assess possible association and linkage of the gene with autism. However, the findings are still inconclusive. In the present study which represents the first report of such a study on the Indian population, genotyping analyses of CGG repeat polymorphism at 5'UTR, two single nucleotide polymorphisms (SNP) at exon 6 and exon 50 were performed in 73 autistic subjects, 129 parents, and 80 controls. The allelic distributions of the repeat polymorphism and exon 50 T/C SNP were quite different from earlier reports in other populations. Allelic and genotypic distribution of the markers did not show any differences between the cases and controls. While our preliminary data on family-based association studies on 58 trios showed no preferential transmission of any allele from the parents to the affected offspring, TDT and HHRR analyses revealed significant paternal transmission distortions for 10- and > or =11-repeat alleles of CGG repeat polymorphism. Thus, the present study suggests that 5'UTR of reelin gene may have a role in the susceptibility towards autism with the paternal transmission and non-transmission respectively of 10- and > or =11-repeat alleles, to the affected offspring.

Glucocorticoid Receptor Polymorphisms and Outcomes in Pediatric Septic Shock.

PubMed

Cvijanovich, Natalie Z; Anas, Nick; Allen, Geoffrey L; Thomas, Neal J; Bigham, Michael T; Weiss, Scott L; Fitzgerald, Julie; Checchia, Paul A; Meyer, Keith; Quasney, Michael; Gedeit, Rainer; Freishtat, Robert J; Nowak, Jeffrey; Raj, Shekhar S; Gertz, Shira; Grunwell, Jocelyn R; Opoka, Amy; Wong, Hector R

2017-04-01

Polymorphisms of the glucocorticoid receptor gene are associated with outcome and corticosteroid responsiveness among patients with inflammatory disorders. We conducted a candidate gene association study to test the hypothesis that these polymorphisms are associated with outcome and corticosteroid responsiveness among children with septic shock. We genotyped 482 children with septic shock for the presence of two glucocorticoid receptor polymorphisms (rs56149945 and rs41423247) associated with increased sensitivity and one glucocorticoid receptor polymorphism (rs6198) associated with decreased sensitivity to corticosteroids. The primary outcome variable was complicated course, defined as 28-day mortality or the persistence of two or more organ failures 7 days after a septic shock diagnosis. We used logistic regression to test for an association between corticosteroid exposure and outcome, within genotype group, and adjusted for illness severity. Multiple PICUs in the United States. Standard care. There were no differences in outcome when comparing the various genotype groups. Among patients homozygous for the wild-type glucocorticoid receptor allele, corticosteroids were independently associated with increased odds of complicated course (odds ratio, 2.30; 95% CI, 1.01-5.21; p = 0.047). Based on these glucocorticoid receptor polymorphisms, we could not detect a beneficial effect of corticosteroids among any genotype group. Among children homozygous for the wild-type allele, corticosteroids were independently associated with increased odds of poor outcome.

"Contrasting patterns of selection at Pinus pinaster Ait. Drought stress candidate genes as revealed by genetic differentiation analyses".

PubMed

Eveno, Emmanuelle; Collada, Carmen; Guevara, M Angeles; Léger, Valérie; Soto, Alvaro; Díaz, Luis; Léger, Patrick; González-Martínez, Santiago C; Cervera, M Teresa; Plomion, Christophe; Garnier-Géré, Pauline H

2008-02-01

The importance of natural selection for shaping adaptive trait differentiation among natural populations of allogamous tree species has long been recognized. Determining the molecular basis of local adaptation remains largely unresolved, and the respective roles of selection and demography in shaping population structure are actively debated. Using a multilocus scan that aims to detect outliers from simulated neutral expectations, we analyzed patterns of nucleotide diversity and genetic differentiation at 11 polymorphic candidate genes for drought stress tolerance in phenotypically contrasted Pinus pinaster Ait. populations across its geographical range. We compared 3 coalescent-based methods: 2 frequentist-like, including 1 approach specifically developed for biallelic single nucleotide polymorphisms (SNPs) here and 1 Bayesian. Five genes showed outlier patterns that were robust across methods at the haplotype level for 2 of them. Two genes presented higher F(ST) values than expected (PR-AGP4 and erd3), suggesting that they could have been affected by the action of diversifying selection among populations. In contrast, 3 genes presented lower F(ST) values than expected (dhn-1, dhn2, and lp3-1), which could represent signatures of homogenizing selection among populations. A smaller proportion of outliers were detected at the SNP level suggesting the potential functional significance of particular combinations of sites in drought-response candidate genes. The Bayesian method appeared robust to low sample sizes, flexible to assumptions regarding migration rates, and powerful for detecting selection at the haplotype level, but the frequentist-like method adapted to SNPs was more efficient for the identification of outlier SNPs showing low differentiation. Population-specific effects estimated in the Bayesian method also revealed populations with lower immigration rates, which could have led to favorable situations for local adaptation. Outlier patterns are discussed in relation to the different genes' putative involvement in drought tolerance responses, from published results in transcriptomics and association mapping in P. pinaster and other related species. These genes clearly constitute relevant candidates for future association studies in P. pinaster.

Modification of the association between early adversity and obsessive-compulsive disorder by polymorphisms in the MAOA, MAOB and COMT genes.

PubMed

McGregor, N W; Hemmings, S M J; Erdman, L; Calmarza-Font, I; Stein, D J; Lochner, C

2016-12-30

The monoamine oxidases (MAOA/B) and catechol-O-methyltransferase (COMT) enzymes break down regulatory components within serotonin and dopamine pathways, and polymorphisms within these genes are candidates for OCD susceptibility. Childhood trauma has been linked OCD psychopathology, but little attention has been paid to the interactions between genes and environment in OCD aetiology. This pilot study investigated gene-by-environment interactions between childhood trauma and polymorphisms in the MAOA, MAOB and COMT genes in OCD. Ten polymorphisms (MAOA: 3 variants, MAOB: 4 variants, COMT: 3 variants) were genotyped in a cohort of OCD patients and controls. Early-life trauma was assessed using the Childhood Trauma Questionnaire (CTQ). Gene-by-gene (GxG) and gene-by-environment interactions (GxE) of the variants and childhood trauma were assessed using logistic regression models. Significant GxG interactions were found between rs362204 (COMT) and two independent polymorphisms in the MAOB gene (rs1799836 and rs6651806). Haplotype associations for OCD susceptibility were found for MAOB. Investigation of GxE interactions indicated that the sexual abuse sub-category was significantly associated with all three genes in haplotype x environment interaction analyses. Preliminary findings indicate that polymorphisms within the MAOB and COMT genes interact resulting in risk for OCD. Childhood trauma interacts with haplotypes in COMT, MAOA and MAOB, increasing risk for OCD. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

TGIF1 is a potential candidate gene for high myopia in ethnic Kashmiri population.

PubMed

Ahmed, Ishfaq; Rasool, Shabhat; Jan, Tariq; Qureshi, Tariq; Naykoo, Niyaz A; Andrabi, Khurshid I

2014-03-01

High myopia is a complex disorder that imposes serious consequences on ocular health. Linkage analysis has identified several genetic loci with a series of potential candidate genes that reveal an ambiguous pattern of association with high myopia due to population heterogeneity. We have accordingly chosen to examine the prospect of association of one such gene [transforming growth β-induced factor 1 (TGIF1)] in population that is purely ethnic (Kashmiri) and represents a homogeneous cohort from Northern India. Cases with high myopia with a spherical equivalent of ≥-6 diopters (D) and emmetropic controls with spherical equivalent within ±0.5 D in one or both eyes represented by a sample size of 212 ethnic Kashmiri subjects and 239 matched controls. Genomic DNA was genotyped for sequence variations in TGIF1 gene and allele frequencies tested for Hardy-Weinberg disequilibrium. Potential association was evaluated using χ(2) or Fisher's exact test. Two previously reported missense variations C > T, rs4468717 (first base of codon 143) changing proline to serine and rs2229333 (second base of codon 143) changing proline to leucine were identified in exon 10 of TGIF1. Both variations exhibited possibly significant (p < 0.05) association with the disease phenotype. Since the variant allele frequency of both the single-nucleotide polymorphisms in cases is higher than controls with odds ratio greater than 1.Therefore, variant allele of both the single-nucleotide polymorphisms represents the possible risk factor for myopia in the Kashmiri population. In silico predictions show that substitutions are likely to have an impact on the structure and functional properties of the protein, making it imperative to understand their functional consequences in relation to high myopia. TGIF1 is a relevant candidate gene with potential to contribute in the genesis of high myopia.

[Genetic aspects of the Stroop test].

PubMed

Nánási, Tibor; Katonai, Enikő Rózsa; Sasvári-Székely, Mária; Székely, Anna

2012-12-01

Impairment of executive control functions in depression is well documented, and performance on the Stroop Test is one of the most widely used markers to measure the decline. This tool provides reliable quantitative phenotype data that can be used efficiently in candidate gene studies investigating inherited components of executive control. Aim of the present review is to summarize research on genetic factors of Stroop performance. Interestingly, only a few such candidate gene studies have been carried out to date. Twin studies show a 30-60% heritability estimate for the Stroop test, suggesting a significant genetic component. A single genome-wide association study has been carried out on Stroop performance, and it did not show any significant association with any of the tested polymorphisms after correction for multiple testing. Candidate gene studies to date pointed to the polymorphisms of several neurotransmitter systems (dopamine, serotonin, acetylcholine) and to the role of the APOE ε4 allele. Surprisingly, little is known about the genetic role of neurothrophic factors and survival factors. In conclusion, further studies are needed for clarifying the genetic background of Stroop performance, characterizing attentional functions.

Introgression of Novel Traits from a Wild Wheat Relative Improves Drought Adaptation in Wheat1[W

PubMed Central

Placido, Dante F.; Campbell, Malachy T.; Folsom, Jing J.; Cui, Xinping; Kruger, Greg R.; Baenziger, P. Stephen; Walia, Harkamal

2013-01-01

Root architecture traits are an important component for improving water stress adaptation. However, selection for aboveground traits under favorable environments in modern cultivars may have led to an inadvertent loss of genes and novel alleles beneficial for adapting to environments with limited water. In this study, we elucidate the physiological and molecular consequences of introgressing an alien chromosome segment (7DL) from a wild wheat relative species (Agropyron elongatum) into cultivated wheat (Triticum aestivum). The wheat translocation line had improved water stress adaptation and higher root and shoot biomass compared with the control genotypes, which showed significant drops in root and shoot biomass during stress. Enhanced access to water due to higher root biomass enabled the translocation line to maintain more favorable gas-exchange and carbon assimilation levels relative to the wild-type wheat genotypes during water stress. Transcriptome analysis identified candidate genes associated with root development. Two of these candidate genes mapped to the site of translocation on chromosome 7DL based on single-feature polymorphism analysis. A brassinosteroid signaling pathway was predicted to be involved in the novel root responses observed in the A. elongatum translocation line, based on the coexpression-based gene network generated by seeding the network with the candidate genes. We present an effective and highly integrated approach that combines root phenotyping, whole-plant physiology, and functional genomics to discover novel root traits and the underlying genes from a wild related species to improve drought adaptation in cultivated wheat. PMID:23426195

SNP discovery and marker development for disease resistance candidate genes in common carp (Cyprinus carpio)

USDA-ARS?s Scientific Manuscript database

Single nucleotide polymorphisms (SNPs) in immune response genes have been reported as markers of susceptibility to infectious diseases in human and livestock. A disease caused by cyprinid herpes virus 3 (CyHV-3) is highly contagious and virulent in common carp. With the aim to investigate the gene...

Association between IL-10a SNPs and resistance to cyprinid herpesvirus-3 infection in common carp (Cyprinus carpio)

USDA-ARS?s Scientific Manuscript database

Analysis of gene polymorphisms and disease association is essential for assessing putative candidate genes affecting susceptibility or resistance to disease. In this paper, we report the results of an association analysis between SNPs in common carp innate immune response genes and resistance to Cy...

Characterization of Heterobasidion occidentale transcriptomes reveals candidate genes and DNA polymorphisms for virulence variations.

PubMed

Liu, Jun-Jun; Shamoun, Simon Francis; Leal, Isabel; Kowbel, Robert; Sumampong, Grace; Zamany, Arezoo

2018-05-01

Characterization of genes involved in differentiation of pathogen species and isolates with variations of virulence traits provides valuable information to control tree diseases for meeting the challenges of sustainable forest health and phytosanitary trade issues. Lack of genetic knowledge and genomic resources hinders novel gene discovery, molecular mechanism studies and development of diagnostic tools in the management of forest pathogens. Here, we report on transcriptome profiling of Heterobasidion occidentale isolates with contrasting virulence levels. Comparative transcriptomic analysis identified orthologous groups exclusive to H. occidentale and its isolates, revealing biological processes involved in the differentiation of isolates. Further bioinformatics analyses identified an H. occidentale secretome, CYPome and other candidate effectors, from which genes with species- and isolate-specific expression were characterized. A large proportion of differentially expressed genes were revealed to have putative activities as cell wall modification enzymes and transcription factors, suggesting their potential roles in virulence and fungal pathogenesis. Next, large numbers of simple sequence repeats (SSRs) and single nucleotide polymorphisms (SNPs) were detected, including more than 14 000 interisolate non-synonymous SNPs. These polymorphic loci and species/isolate-specific genes may contribute to virulence variations and provide ideal DNA markers for development of diagnostic tools and investigation of genetic diversity. © 2018 The Authors. Microbial Biotechnology published by John Wiley & Sons Ltd and Society for Applied Microbiology.

Fine-mapping of qGW4.05, a major QTL for kernel weight and size in maize.

PubMed

Chen, Lin; Li, Yong-xiang; Li, Chunhui; Wu, Xun; Qin, Weiwei; Li, Xin; Jiao, Fuchao; Zhang, Xiaojing; Zhang, Dengfeng; Shi, Yunsu; Song, Yanchun; Li, Yu; Wang, Tianyu

2016-04-12

Kernel weight and size are important components of grain yield in cereals. Although some information is available concerning the map positions of quantitative trait loci (QTL) for kernel weight and size in maize, little is known about the molecular mechanisms of these QTLs. qGW4.05 is a major QTL that is associated with kernel weight and size in maize. We combined linkage analysis and association mapping to fine-map and identify candidate gene(s) at qGW4.05. QTL qGW4.05 was fine-mapped to a 279.6-kb interval in a segregating population derived from a cross of Huangzaosi with LV28. By combining the results of regional association mapping and linkage analysis, we identified GRMZM2G039934 as a candidate gene responsible for qGW4.05. Candidate gene-based association mapping was conducted using a panel of 184 inbred lines with variable kernel weights and kernel sizes. Six polymorphic sites in the gene GRMZM2G039934 were significantly associated with kernel weight and kernel size. The results of linkage analysis and association mapping revealed that GRMZM2G039934 is the most likely candidate gene for qGW4.05. These results will improve our understanding of the genetic architecture and molecular mechanisms underlying kernel development in maize.

Fine-scale genetic mapping of a hybrid sterility factor between Drosophila simulans and D. mauritiana: the varied and elusive functions of "speciation genes".

PubMed

Araripe, Luciana O; Montenegro, Horácio; Lemos, Bernardo; Hartl, Daniel L

2010-12-14

Hybrid male sterility (HMS) is a usual outcome of hybridization between closely related animal species. It arises because interactions between alleles that are functional within one species may be disrupted in hybrids. The identification of genes leading to hybrid sterility is of great interest for understanding the evolutionary process of speciation. In the current work we used marked P-element insertions as dominant markers to efficiently locate one genetic factor causing a severe reduction in fertility in hybrid males of Drosophila simulans and D. mauritiana. Our mapping effort identified a region of 9 kb on chromosome 3, containing three complete and one partial coding sequences. Within this region, two annotated genes are suggested as candidates for the HMS factor, based on the comparative molecular characterization and public-source information. Gene Taf1 is partially contained in the region, but yet shows high polymorphism with four fixed non-synonymous substitutions between the two species. Its molecular functions involve sequence-specific DNA binding and transcription factor activity. Gene agt is a small, intronless gene, whose molecular function is annotated as methylated-DNA-protein-cysteine S-methyltransferase activity. High polymorphism and one fixed non-synonymous substitution suggest this is a fast evolving gene. The gene trees of both genes perfectly separate D. simulans and D. mauritiana into monophyletic groups. Analysis of gene expression using microarray revealed trends that were similar to those previously found in comparisons between whole-genome hybrids and parental species. The identification following confirmation of the HMS candidate gene will add another case study leading to understanding the evolutionary process of hybrid incompatibility.

A novel single nucleotide polymorphism in exon 7 of LPL gene and its association with carcass traits and visceral fat deposition in yak (Bos grunniens) steers.

PubMed

Ding, X Z; Liang, C N; Guo, X; Xing, C F; Bao, P J; Chu, M; Pei, J; Zhu, X S; Yan, P

2012-01-01

Lipoprotein lipase (LPL) is considered as a key enzyme in the lipid deposition and metabolism in tissues. It is assumed to be a major candidate gene for genetic markers in lipid deposition. Therefore, the polymorphisms of the LPL gene and associations with carcass traits and viscera fat content were examined in 398 individuals from five yak (Bos grunniens) breeds using PCR-SSCP analysis and DNA sequencing. A novel nucleotide polymorphism (SNP)-C→T (nt19913) was identified located in exon 7 in the coding region of the LPL gene, which replacement was responsible for a Phe-to-Ser substitution at amino acid. Two alleles (A and B) and three genotypes designed as AA, AB and BB were detected in the PCR products. The frequencies of allele A were 0.7928, 0.7421, 0.7357, 0.6900 and 0.7083 for Tianzhu white yak (WY), Gannan yak (GY), Qinghai-Plateau yak (PY), Xinjiang yak (XY) and Datong yak (DY), respectively. The SNP loci was in Hardy-Weinberg equilibrium in five yak populations (P>0.05). Polymorphism of LPL gene was shown to be associated with carcass traits and lipid deposition. Least squares analysis revealed that there was a significant effect on live-weight (LW) (P<0.01), average daily weight gain (ADG) and carcass weight (P<0.05). Individuals with genotype BB had lower mean values than those with genotype AA and AB for loin eye area and viscera fat weight (% of LW) in 25-36 months (P<0.05). The results indicated that LPL gene is a strong candidate gene that affects carcass traits and fat deposition in yak.

Association Study of 60 Candidate Genes with Antipsychotic-induced Weight Gain in Schizophrenia Patients.

PubMed

Ryu, S; Huh, I-S; Cho, E-Y; Cho, Y; Park, T; Yoon, S C; Joo, Y H; Hong, K S

2016-03-01

This study aimed to investigate the association of multiple candidate genes with weight gain and appetite change during antipsychotic treatment. A total of 233 single nucleotide polymorphisms (SNPs) within 60 candidate genes were genotyped. BMI changes for up to 8 weeks in 84 schizophrenia patients receiving antipsychotic medication were analyzed using a linear mixed model. In addition, we assessed appetite change during antipsychotic treatment in a different group of 46 schizophrenia patients using the Drug-Related Eating Behavior Questionnaire. No SNP showed a statistically significant association with BMI or appetite change after correction for multiple testing. We observed trends of association (P<0.05) between 19 SNPs of 11 genes and weight gain, and between 7 SNPs of 5 genes and appetite change. In particular, rs696217 in GHRL showed suggestive evidence of association with not only weight gain (P=0.001) but also appetite change (P=0.042). Patients carrying the GG genotype of rs696217 exhibited higher increase in both BMI and appetite compared to patients carrying the GT/TT genotype. Our findings suggested the involvement of a GHRL polymorphism in weight gain, which was specifically mediated by appetite change, during antipsychotic treatment in schizophrenia patients. © Georg Thieme Verlag KG Stuttgart · New York.

Prevalence, Patterns, and Genetic Association Analysis of Modic Vertebral Endplate Changes.

PubMed

Kanna, Rishi Mugesh; Shanmuganathan, Rajasekaran; Rajagopalan, Veera Ranjani; Natesan, Senthil; Muthuraja, Raveendran; Cheung, Kenneth Man Chee; Chan, Danny; Kao, Patrick Yu Ping; Yee, Anita; Shetty, Ajoy Prasad

2017-08-01

A prospective genetic association study. The etiology of Modic changes (MCs) is unclear. Recently, the role of genetic factors in the etiology of MCs has been evaluated. However, studies with a larger patient subset are lacking, and candidate genes involved in other disc degeneration phenotypes have not been evaluated. We studied the prevalence of MCs and genetic association of 41 candidate genes in a large Indian cohort. MCs are vertebral endplate signal changes predominantly observed in the lumbar spine. A significant association between MCs and lumbar disc degeneration and nonspecific low back pain has been described, with the etiopathogenesis implicating various mechanical, infective, and biochemical factors. We studied 809 patients using 1.5-T magnetic resonance imaging to determine the prevalence, patterns, distribution, and type of lumbar MCs. Genetic association analysis of 71 single nucleotide polymorphisms (SNPs) of 41 candidate genes was performed based on the presence or absence of MCs. SNPs were genotyped using the Sequenome platform, and an association test was performed using PLINK software. The mean age of the study population (n=809) was 36.7±10.8 years. Based on the presence of MCs, the cohort was divided into 702 controls and 107 cases (prevalence, 13%). MCs were more commonly present in the lower (149/251, 59.4%) than in the upper (102/251, 40.6%) endplates. L4-5 endplates were the most commonly affected levels (30.7%). Type 2 MCs were the most commonly observed pattern (n=206, 82%). The rs2228570 SNP of VDR ( p =0.02) and rs17099008 SNP of MMP20 ( p =0.03) were significantly associated with MCs. Genetic polymorphisms of SNPs of VDR and MMP20 were significantly associated with MCs. Understanding the etiopathogenetic mechanisms of MCs is important for planning preventive and therapeutic strategies.

Common genetic variants related to genomic integrity and risk of papillary thyroid cancer

PubMed Central

Neta, Gila; Brenner, Alina V.; Sturgis, Erich M.; Pfeiffer, Ruth M.; Hutchinson, Amy A.; Aschebrook-Kilfoy, Briseis; Yeager, Meredith; Xu, Li; Wheeler, William; Abend, Michael; Ron, Elaine; Tucker, Margaret A.; Chanock, Stephen J.; Sigurdson, Alice J.

2011-01-01

DNA damage is an important mechanism in carcinogenesis, so genes related to maintaining genomic integrity may influence papillary thyroid cancer (PTC) risk. Candidate gene studies targeting some of these genes have identified only a few polymorphisms associated with risk of PTC. Here, we expanded the scope of previous candidate studies by increasing the number and coverage of genes related to maintenance of genomic integrity. We evaluated 5077 tag single-nucleotide polymorphisms (SNPs) from 340 candidate gene regions hypothesized to be involved in DNA repair, epigenetics, tumor suppression, apoptosis, telomere function and cell cycle control and signaling pathways in a case–control study of 344 PTC cases and 452 matched controls. We estimated odds ratios for associations of single SNPs with PTC risk and combined P values for SNPs in the same gene region or pathway to obtain gene region-specific or pathway-specific P values using adaptive rank-truncated product methods. Nine SNPs had P values <0.0005, three of which were in HDAC4 and were inversely related to PTC risk. After multiple comparisons adjustment, no SNPs remained associated with PTC risk. Seven gene regions were associated with PTC risk at P < 0.01, including HUS1, ALKBH3, HDAC4, BAK1, FAF1_CDKN2C, DACT3 and FZD6. Our results suggest a possible role of genes involved in maintenance of genomic integrity in relation to risk of PTC. PMID:21642358

Identifying positive selection candidate loci for high-altitude adaptation in Andean populations

PubMed Central

2009-01-01

High-altitude environments (>2,500 m) provide scientists with a natural laboratory to study the physiological and genetic effects of low ambient oxygen tension on human populations. One approach to understanding how life at high altitude has affected human metabolism is to survey genome-wide datasets for signatures of natural selection. In this work, we report on a study to identify selection-nominated candidate genes involved in adaptation to hypoxia in one highland group, Andeans from the South American Altiplano. We analysed dense microarray genotype data using four test statistics that detect departures from neutrality. Using a candidate gene, single nucleotide polymorphism-based approach, we identified genes exhibiting preliminary evidence of recent genetic adaptation in this population. These included genes that are part of the hypoxia-inducible transcription factor (HIF) pathway, a biochemical pathway involved in oxygen homeostasis, as well as three other genomic regions previously not known to be associated with high-altitude phenotypes. In addition to identifying selection-nominated candidate genes, we also tested whether the HIF pathway shows evidence of natural selection. Our results indicate that the genes of this biochemical pathway as a group show no evidence of having evolved in response to hypoxia in Andeans. Results from particular HIF-targeted genes, however, suggest that genes in this pathway could play a role in Andean adaptation to high altitude, even if the pathway as a whole does not show higher relative rates of evolution. These data suggest a genetic role in high-altitude adaptation and provide a basis for genotype/phenotype association studies that are necessary to confirm the role of putative natural selection candidate genes and gene regions in adaptation to altitude. PMID:20038496

Indel-seq: a fast-forward genetics approach for identification of trait-associated putative candidate genomic regions and its application in pigeonpea (Cajanus cajan).

PubMed

Singh, Vikas K; Khan, Aamir W; Saxena, Rachit K; Sinha, Pallavi; Kale, Sandip M; Parupalli, Swathi; Kumar, Vinay; Chitikineni, Annapurna; Vechalapu, Suryanarayana; Sameer Kumar, Chanda Venkata; Sharma, Mamta; Ghanta, Anuradha; Yamini, Kalinati Narasimhan; Muniswamy, Sonnappa; Varshney, Rajeev K

2017-07-01

Identification of candidate genomic regions associated with target traits using conventional mapping methods is challenging and time-consuming. In recent years, a number of single nucleotide polymorphism (SNP)-based mapping approaches have been developed and used for identification of candidate/putative genomic regions. However, in the majority of these studies, insertion-deletion (Indel) were largely ignored. For efficient use of Indels in mapping target traits, we propose Indel-seq approach, which is a combination of whole-genome resequencing (WGRS) and bulked segregant analysis (BSA) and relies on the Indel frequencies in extreme bulks. Deployment of Indel-seq approach for identification of candidate genomic regions associated with fusarium wilt (FW) and sterility mosaic disease (SMD) resistance in pigeonpea has identified 16 Indels affecting 26 putative candidate genes. Of these 26 affected putative candidate genes, 24 genes showed effect in the upstream/downstream of the genic region and two genes showed effect in the genes. Validation of these 16 candidate Indels in other FW- and SMD-resistant and FW- and SMD-susceptible genotypes revealed a significant association of five Indels (three for FW and two for SMD resistance). Comparative analysis of Indel-seq with other genetic mapping approaches highlighted the importance of the approach in identification of significant genomic regions associated with target traits. Therefore, the Indel-seq approach can be used for quick and precise identification of candidate genomic regions for any target traits in any crop species. © 2016 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.

The AGT Gene M235T Polymorphism and Response of Power-Related Variables to Aerobic Training

PubMed Central

Aleksandra, Zarębska; Zbigniew, Jastrzębski; Waldemar, Moska; Agata, Leońska-Duniec; Mariusz, Kaczmarczyk; Marek, Sawczuk; Agnieszka, Maciejewska-Skrendo; Piotr, Żmijewski; Krzysztof, Ficek; Grzegorz, Trybek; Ewelina, Lulińska-Kuklik; Semenova, Ekaterina A.; Ahmetov, Ildus I.; Paweł, Cięszczyk

2016-01-01

The C allele of the M235T (rs699) polymorphism of the AGT gene correlates with higher levels of angiotensin II and has been associated with power and strength sport performance. The aim of the study was to investigate whether or not selected power-related variables and their response to a 12-week program of aerobic dance training are modulated by the AGT M235T genotype in healthy participants. Two hundred and one Polish Caucasian women aged 21 ± 1 years met the inclusion criteria and were included in the study. All women completed a 12-week program of low and high impact aerobics. Wingate peak power and total work capacity, 5 m, 10 m, and 30 m running times and jump height and jump power were determined before and after the training programme. All power-related variables improved significantly in response to aerobic dance training. We found a significant association between the M235T polymorphism and jump-based variables (squat jump (SJ) height, p = 0.005; SJ power, p = 0.015; countermovement jump height, p = 0.025; average of 10 countermovement jumps with arm swing (ACMJ) height, p = 0.001; ACMJ power, p = 0.035). Specifically, greater improvements were observed in the C allele carriers in comparison with TT homozygotes. In conclusion, aerobic dance, one of the most commonly practiced adult fitness activities in the world, provides sufficient training stimuli for augmenting the explosive strength necessary to increase vertical jump performance. The AGT gene M235T polymorphism seems to be not only a candidate gene variant for power/strength related phenotypes, but also a genetic marker for predicting response to training. Key points Aerobic dance provides sufficient training stimuli for the improvement of explosive power. The AGT gene M235T polymorphism is associated with individual variation in the change of power-related phenotypes in response to aerobic dance training. The C allele carriers of the AGT gene M235T polymorphism show greater improvements of jump-based variables in comparison with TT homozygotes. PMID:27928207

Functionally Relevant Microsatellite Markers From Chickpea Transcription Factor Genes for Efficient Genotyping Applications and Trait Association Mapping

PubMed Central

Kujur, Alice; Bajaj, Deepak; Saxena, Maneesha S.; Tripathi, Shailesh; Upadhyaya, Hari D.; Gowda, C.L.L.; Singh, Sube; Jain, Mukesh; Tyagi, Akhilesh K.; Parida, Swarup K.

2013-01-01

We developed 1108 transcription factor gene-derived microsatellite (TFGMS) and 161 transcription factor functional domain-associated microsatellite (TFFDMS) markers from 707 TFs of chickpea. The robust amplification efficiency (96.5%) and high intra-specific polymorphic potential (34%) detected by markers suggest their immense utilities in efficient large-scale genotyping applications, including construction of both physical and functional transcript maps and understanding population structure. Candidate gene-based association analysis revealed strong genetic association of TFFDMS markers with three major seed and pod traits. Further, TFGMS markers in the 5′ untranslated regions of TF genes showing differential expression during seed development had higher trait association potential. The significance of TFFDMS markers was demonstrated by correlating their allelic variation with amino acid sequence expansion/contraction in the functional domain and alteration of secondary protein structure encoded by genes. The seed weight-associated markers were validated through traditional bi-parental genetic mapping. The determination of gene-specific linkage disequilibrium (LD) patterns in desi and kabuli based on single nucleotide polymorphism-microsatellite marker haplotypes revealed extended LD decay, enhanced LD resolution and trait association potential of genes. The evolutionary history of a strong seed-size/weight-associated TF based on natural variation and haplotype sharing among desi, kabuli and wild unravelled useful information having implication for seed-size trait evolution during chickpea domestication. PMID:23633531

COL5A1: Fine genetic mapping, intron/exon organization, and exclusion as candidate gene in families with tuberous sclerosis complex 1, hereditary hemorrhagic telangiectasia, and Ehlers-Danlos syndrome type II

DOE Office of Scientific and Technical Information (OSTI.GOV)

Greenspan, D.S.; Papenberg, K.A.; Marchuk, D.A.

1994-09-01

Type V collagen is the only fibrillar collagen which has yet to be implicated in the pathogenesis of genetic diseases in humans or mice. To begin examining the possible role of type V collagen in genetic disease, we have previously mapped COL5A1, the gene for the {alpha}1 chain of type V collagen, to 9q23.2{r_arrow}q34.3 and described two restriction site polymorphisms which allowed us to exclude COL5A1 as candidate gene for nail-patella syndrome. We have now used these polymorphisms to exclude COL5A1 as candidate gene for tuberous sclerosis complex 1 and Ehlers-Danlos syndrome type II. In addition, we describe a CAmore » repeat, with observed heterozygosity of about 0.5, in a COL5A1 intron, which has allowed us to exclude COL5A1 as a candidate gene in hereditary hemorrhagic telangiectasia and to place COL5A1 on the CEPH family genetic map between markers D9S66 and D9S67. We have also determined the entire intron/exon organization of COL5A1, which will facilitate characterization of mutations in genetic diseases with which COL5A1 may be linked in future studies.« less

Report from the Maryland epidemiology schizophrenia linkage study: No evidence for linkage between schizophrenia and a number of candidate and other genomic regions using a complex dominant model

DOE Office of Scientific and Technical Information (OSTI.GOV)

Karayiorgou, M.; Hwang, J.; Elango, R.

Our collaborative group has undertaken a linkage study of schizophrenia, using a systematic sample of patients admitted to Maryland hospitals. An initial sample of 39 families, each having two or more affecteds, was available for genotyping candidate genes, candidate regions, and highly polymorphic markers randomly distributed throughout the genome. We used a single complex dominant model (with a disease gene frequency of 0.005 and age-dependent penetrance for affected phenotype: for under 35, penetrance = .45; for 35 and older, penetrance = .85). We report here 130 markers which met the exclusion criteria of LOD score < -2.00 at theta >more » 0.01 in at least 10 informative families, and no evidence for heterogeneity. We also report here markers that were tested as candidates for linkage to the schizophrenic phenotype. They were selected based on the following criteria: (a) proximity to reported chromosomal rearrangements (both 5q and 11q), (b) suggestions of linkage from other families (5q), or (c) presence of a candidate gene (5q, 11q, 3q: dopamine receptors 1, 2, and 3, respectively). We also tested for mutations of codon 717 in exon 17 of the amyloid precursor protein (APP) gene and were unable to detect the C to T substitution in our schizophrenic group. 48 refs., 2 tabs.« less

Polymorphisms in the oxytocin receptor gene are associated with the development of psychopathy.

PubMed

Dadds, Mark R; Moul, Caroline; Cauchi, Avril; Dobson-Stone, Carol; Hawes, David J; Brennan, John; Urwin, Ruth; Ebstein, Richard E

2014-02-01

The co-occurrence of child conduct problems (CPs) and callous-unemotional (CU) traits confers risk for psychopathy. The oxytocin (OXT) system is a likely candidate for involvement in the development of psychopathy. We tested variations in the OXT receptor gene (OXTR) in CP children and adolescents with varying levels of CU traits. Two samples of Caucasian children, aged 4-16 years, who met DSM criteria for disruptive behavior problems and had no features of autism spectrum disorder, were stratified into low versus high CU traits. Measures were the frequencies of nine candidate OXTR polymorphisms (single nucleotide polymorphisms). In Sample 1, high CU traits were associated with single nucleotide polymorphism rs1042778 in the 3' untranslated region of OXTR and the CGCT haplotype of rs2268490, rs2254298, rs237889, and rs13316193. The association of rs1042778 was replicated in the second rural sample and held across gender and child versus adolescent age groups. We conclude that polymorphic variation of the OXTR characterizes children with high levels of CU traits and CPs. The results are consistent with a hypothesized role of OXT in the developmental antecedents of psychopathy, particularly the differential amygdala activation model of psychopathic traits, and add genetic evidence that high CU traits specify a distinct subgroup within CP children.

An Angiopoietin-2 gene polymorphism in unexplained intrauterine fetal death: a multi-center study.

PubMed

Huber, Ambros; Grimm, Christoph; Pietrowski, Detlef; Zeillinger, Robert; Bettendorf, Hertha; Husslein, Peter; Hefler, Lukas

2005-02-01

Angiopoietin-2 (Ang-2) is a potent regulator of angiogenesis and vascular tone. As vascular processes have been proposed to be involved in the pathogenesis of pregnancy associated complications such as late unexplained intrauterine fetal death (IUFD), we determined whether a common G/A polymorphism of the Ang-2 gene (ANGPT2) is associated with this condition. In a multicenter case-control study, we evaluated the common G/A polymorphism within exon 4 of the ANGPT2 gene using PCR in 90 women with IUFD and 90 healthy women with at least one uncomplicated full term pregnancy and no history of IUFD. Genotype (p=0.2; OR=1.4 [0.8-2.6]) and allele frequencies (p=0.1; OR=1.4 [0.9-2.1]) of the ANGPT2 polymorphism did not differ between women with IUFD and healthy women. A multivariate regression analysis with smoking habits and preexisting diabetes as covariates did not change the results. We are the first to report on a common polymorphism of the ANGPT2 gene in patients with late IUFD. The investigated ANGPT2 poylmorphism does not seem to be a candidate gene for IUFD in Caucasian women.

Genetic polymorphisms in 85 DNA repair genes and bladder cancer risk.

PubMed

Michiels, Stefan; Laplanche, Agnès; Boulet, Thomas; Dessen, Philippe; Guillonneau, Bertrand; Méjean, Arnaud; Desgrandchamps, François; Lathrop, Mark; Sarasin, Alain; Benhamou, Simone

2009-05-01

Several defense mechanisms have been developed and maintained during the evolution to protect human cells against damage produced from exogenous or endogenous sources. We examined the associations between bladder cancer and a panel of 652 polymorphisms from 85 genes involved in maintenance of genetic stability [base excision repair, nucleotide excision repair, double-strand break repair (DSBR) and mismatch repair, as well as DNA synthesis and cell cycle regulation pathways] in 201 incident bladder cancer cases and 326 hospital controls. Score statistics were used to test differences in haplotype frequencies between cases and controls in an unconditional logistic regression model. To account for multiple testing, we associated to each P-value the expected proportion of false discoveries (q-value). Haplotype analysis revealed significant associations (P < 0.01) between bladder cancer and two genes (POLB and FANCA) with an associated q-value of 24%. A permutation test was also used to determine whether, in each pathway analyzed, there are more variants whose allelic frequencies are different between cases and controls as compared with what would be expected by chance. Differences were found for cell cycle regulation (P = 0.02) and to a lesser extent for DSBR (P = 0.05) pathways. These results hint to a few potential candidate genes; however, our study was limited by the small sample size and therefore low statistical power to detect associations. It is anticipated that genome-wide association studies will open new perspectives for interpretation of the results of extensive candidate gene studies such as ours.

A lack of association between polymorphisms of three positional candidate genes (CLASP2 , UBP1, and FBXL2) and canine disorder of sexual development (78,XX; SRY -negative).

PubMed

Salamon, Sylwia; Nowacka-Woszuk, Joanna; Szczerbal, Izabela; Dzimira, Stanisław; Nizanski, Wojciech; Ochota, Malgorzata; Switonski, Marek

2014-01-01

A disorder of sexual development (DSD) of dogs with a female karyotype, missing SRY gene, and presence of testicles or ovotestes is quite commonly diagnosed. It is suggested that this disorder is caused by an autosomal recessive mutation; however, other models of inheritance have not been definitely ruled out. In an earlier study it was hypothesized that the mutation may reside in a pericentromeric region of canine chromosome 23 (CFA23). Three positional candidate genes (CLASP2, UBP1, and FBXL2) were selected in silico in the search for polymorphisms in 7 testicular or ovotesticular XX DSD dogs, 8 XX DSD dogs of unknown cause (SRY-negative, with enlarged clitoris and unknown histology of gonads), and 29 normal female dogs as a control group. Among the 15 molecularly studied dogs with enlarged clitoris there were 3 new cases of testicular or ovotesticular XX DSD and 4 new cases of XX DSD with unknown cause (histology of the gonads unknown). Altogether, 11 (including 10 novel) polymorphisms in 5'- and 3'-flanking regions of the studied genes were found. The distribution analysis of these polymorphisms showed no association with the DSD phenotypes. Thus, it was concluded that the presence of the causative mutation for testicular or ovotesticular XX DSD in the pericentromeric region of CFA23 is unlikely. © 2014 S. Karger AG, Basel.

Heat shock protein 70 gene polymorphisms are associated with paranoid schizophrenia in the Polish population.

PubMed

Kowalczyk, Malgorzata; Owczarek, Aleksander; Suchanek, Renata; Paul-Samojedny, Monika; Fila-Danilow, Anna; Borkowska, Paulina; Kucia, Krzysztof; Kowalski, Jan

2014-03-01

HSP70 genes have been considered as promising schizophrenia candidate genes based on their protective role in the central nervous system under stress conditions. In this study, we analyzed the potential implication of HSPA1A +190G/C, HSPA1B +1267A/G, and HSPA1L +2437T/C polymorphisms in the susceptibility to paranoid schizophrenia in a homogenous Caucasian Polish population. In addition, we investigated the association of the polymorphisms with the clinical variables of the disease. Two hundred and three patients with paranoid schizophrenia and 243 healthy controls were enrolled in the study. Polymorphisms of HSPA1A, -1B, and -1L genes were genotyped using the PCR-RFLP technique. Analyses were conducted in entire groups and in subgroups that were stratified according to gender. There were significant differences in the genotype and allele frequencies of HSPA1A polymorphism between the patients and controls. The +190CC genotype and +190C allele were over-represented in the patients and significantly increased the risk for developing schizophrenia (OR = 3.45 and OR = 1.61, respectively). Interestingly, such a risk was higher for females with the +190CC genotype than for males with the +190CC genotype (OR = 5.78 vs. OR = 2.76). We also identified the CGT haplotype as a risk haplotype for schizophrenia and demonstrated the effects of HSPA1A and HSPA1B genotypes on the psychopathology and age of onset. Our study provided the first evidence that the HSPA1A polymorphism may potentially increase the risk of developing paranoid schizophrenia. Further independent analyses in different populations to evaluate the role of gender are needed to replicate these results.

Insulin‐degrading enzyme is genetically associated with Alzheimer's disease in the Finnish population

PubMed Central

Vepsäläinen, Saila; Parkinson, Michele; Helisalmi, Seppo; Mannermaa, Arto; Soininen, Hilkka; Tanzi, Rudolph E; Bertram, Lars; Hiltunen, Mikko

2007-01-01

The gene for insulin‐degrading enzyme (IDE), which is located at chromosome 10q24, has been previously proposed as a candidate gene for late‐onset Alzheimer's disease (AD) based on its ability to degrade amyloid β‐protein. Genotyping of single nucleotide polymorphisms (SNPs) in the IDE gene in Finnish patients with AD and controls revealed SNPs rs4646953 and rs4646955 to be associated with AD, conferring an approximately two‐fold increased risk. Single locus findings were corroborated by the results obtained from haplotype analyses. This suggests that genetic alterations in or near the IDE gene may increase the risk for developing AD. PMID:17496198

Folate-mediated one-carbon metabolism genes and interactions with nutritional factors on colorectal cancer risk: Women's Health Initiative Observational Study.

PubMed

Cheng, Ting-Yuan David; Makar, Karen W; Neuhouser, Marian L; Miller, Joshua W; Song, Xiaoling; Brown, Elissa C; Beresford, Shirley A A; Zheng, Yingye; Poole, Elizabeth M; Galbraith, Rachel L; Duggan, David J; Habermann, Nina; Bailey, Lynn B; Maneval, David R; Caudill, Marie A; Toriola, Adetunji T; Green, Ralph; Ulrich, Cornelia M

2015-10-15

Investigations of folate-mediated one-carbon metabolism (FOCM) genes and gene-nutrient interactions with respect to colorectal cancer (CRC) risk are limited to candidate polymorphisms and dietary folate. This study comprehensively investigated associations between genetic variants in FOCM and CRC risk and whether the FOCM nutrient status modified these associations. Two hundred eighty-eight candidate and tagging single-nucleotide polymorphisms (SNPs) in 30 FOCM genes were genotyped for 821 incident CRC case-control matched pairs in the Women's Health Initiative Observational Study cohort. FOCM biomarkers (red blood cell [RBC] folate, plasma folate, pyridoxal-5'-phosphate [PLP], vitamin B12, and homocysteine) and self-reported alcohol consumption were measured at the baseline. Conditional logistic regression was implemented; effect modification was examined on the basis of known enzyme-nutrient relations. Statistically significant associations were observed between CRC risk and functionally defined candidate SNPs of methylenetetrahydrofolate dehydrogenase 1 (MTHFD1; K134R), 5-methyltetrahydrofolate-homocysteine methyltransferase reductase (MTRR; P450R), and PR domain containing 2 with ZNF domain (PRDM2; S450N) and a literature candidate SNP of thymidylate synthase (TYMS; g.676789A>T; nominal P < .05). In addition, suggestive associations were noted for tagging SNPs in cystathionine-β-synthase (CBS), dihydrofolate reductase (DHFR), DNA (cytosine-5-)-methyltransferase 3β (DNMT3B), methionine adenosyltransferase I α (MAT1A), MTHFD1, and MTRR (nominal P < .05; adjusted P, not significant). Significant interactions between nutrient biomarkers and candidate polymorphisms were observed for 1) plasma/RBC folate and folate hydrolase 1 (FOLH1), paraoxonase 1 (PON1), transcobalamin II (TCN2), DNMT1, and DNMT3B; 2) plasma PLP and TYMS TS3; 3) plasma B12 and betaine-homocysteine S-methyltransferase 2 (BHMT2); and 4) homocysteine and methylenetetrahydrofolate reductase (MTHFR) and alanyl-transfer RNA synthetase (AARS). Genetic variants in FOCM genes are associated with CRC risk among postmenopausal women. FOCM nutrients continue to emerge as effect modifiers of genetic influences on CRC risk. © 2015 American Cancer Society.

Whole-Genome SNP Association in the Horse: Identification of a Deletion in Myosin Va Responsible for Lavender Foal Syndrome

PubMed Central

Brooks, Samantha A.; Gabreski, Nicole; Miller, Donald; Brisbin, Abra; Brown, Helen E.; Streeter, Cassandra; Mezey, Jason; Cook, Deborah; Antczak, Douglas F.

2010-01-01

Lavender Foal Syndrome (LFS) is a lethal inherited disease of horses with a suspected autosomal recessive mode of inheritance. LFS has been primarily diagnosed in a subgroup of the Arabian breed, the Egyptian Arabian horse. The condition is characterized by multiple neurological abnormalities and a dilute coat color. Candidate genes based on comparative phenotypes in mice and humans include the ras-associated protein RAB27a (RAB27A) and myosin Va (MYO5A). Here we report mapping of the locus responsible for LFS using a small set of 36 horses segregating for LFS. These horses were genotyped using a newly available single nucleotide polymorphism (SNP) chip containing 56,402 discriminatory elements. The whole genome scan identified an associated region containing these two functional candidate genes. Exon sequencing of the MYO5A gene from an affected foal revealed a single base deletion in exon 30 that changes the reading frame and introduces a premature stop codon. A PCR–based Restriction Fragment Length Polymorphism (PCR–RFLP) assay was designed and used to investigate the frequency of the mutant gene. All affected horses tested were homozygous for this mutation. Heterozygous carriers were detected in high frequency in families segregating for this trait, and the frequency of carriers in unrelated Egyptian Arabians was 10.3%. The mapping and discovery of the LFS mutation represents the first successful use of whole-genome SNP scanning in the horse for any trait. The RFLP assay can be used to assist breeders in avoiding carrier-to-carrier matings and thus in preventing the birth of affected foals. PMID:20419149

Development and application of microsatellites in candidate genes related to wood properties in the Chinese white poplar (Populus tomentosa Carr.).

PubMed

Du, Qingzhang; Gong, Chenrui; Pan, Wei; Zhang, Deqiang

2013-02-01

Gene-derived simple sequence repeats (genic SSRs), also known as functional markers, are often preferred over random genomic markers because they represent variation in gene coding and/or regulatory regions. We characterized 544 genic SSR loci derived from 138 candidate genes involved in wood formation, distributed throughout the genome of Populus tomentosa, a key ecological and cultivated wood production species. Of these SSRs, three-quarters were located in the promoter or intron regions, and dinucleotide (59.7%) and trinucleotide repeat motifs (26.5%) predominated. By screening 15 wild P. tomentosa ecotypes, we identified 188 polymorphic genic SSRs with 861 alleles, 2-7 alleles for each marker. Transferability analysis of 30 random genic SSRs, testing whether these SSRs work in 26 genotypes of five genus Populus sections (outgroup, Salix matsudana), showed that 72% of the SSRs could be amplified in Turanga and 100% could be amplified in Leuce. Based on genotyping of these 26 genotypes, a neighbour-joining analysis showed the expected six phylogenetic groupings. In silico analysis of SSR variation in 220 sequences that are homologous between P. tomentosa and Populus trichocarpa suggested that genic SSR variations between relatives were predominantly affected by repeat motif variations or flanking sequence mutations. Inheritance tests and single-marker associations demonstrated the power of genic SSRs in family-based linkage mapping and candidate gene-based association studies, as well as marker-assisted selection and comparative genomic studies of P. tomentosa and related species.

Association of ACE gene A2350G and I/D polymorphisms with essential hypertension in the northernmost province of China.

PubMed

Sun, Feifei; He, Ning; Zhang, Keyong; Wu, Nan; Zhao, Jingbo; Qiu, Changchun

2018-01-01

Angiotensin converting enzyme (ACE) gene, as a strong candidate gene for essential hypertension(EH), has been extensively studied. In this study, we carried out a population-based case-control study to explore whether ACE gene I/D and A2350G polymorphisms could consider to be risk factors for EH. A total of 2040 subjeces were recruited from Chinese Han in this study, out of which 1010 were cases and 1030 were normotensive individuals. ACE gene A2350G and I/D polymorphisms were amplified by polymerase chain reaction (PCR) and A2350G polymorphism was detected after restriction enzyme digestion with BstuI. Besides, we choosed 10% samples randomly sequencing to verify the accuracy of results. Genotype and allele frequencies distribution of I/D and A2350G in EH and control groups were significantly different. After grouped by sex or age, there were still statistical significances for two polymorphisms. In dominant and recessive model of A2350G, we found significant differences between two groups, respectively. For ACE I/D polymorphism, we observed that the existence of dramatical difference in dominant model between two groups, while in recessive model, marginally significant difference was found. Among the four haplotypes composed by ACE gene A2350G and I/D, haplotype G-D reached the statistical significance in two groups, and exhibited to be a risk factor for the development of EH, whose P < 0.001 and OR 95%CI = 1.639(1.435-1.872), while the other haplotypes were the protective factors and decreased the susceptibility to EH(P < 0.05). ACE gene A2350G and I/D polymorphisms were associated with increasing the risk of suffering from EH in the northernmost province of China individuals, with D allele and G allele individuals had a higher risk of EH(OR = 1.443, 95%CI = 1.273-1.636 and OR = 1.481, 95%CI = 1.303-1.684).

Maternal and offspring genetic variants of AKR1C3 and the risk of childhood leukemia

PubMed Central

Liu, Chen-yu; Hsu, Yi-Hsiang; Pan, Pi-Chen; Wu, Ming-Tsang; Ho, Chi-Kung; Su, Li; Xu, Xin; Li, Yi; Christiani, David C.

2008-01-01

The aldo-keto reductase 1C3 (AKR1C3) gene located on chromosome 10p15-p14, a regulator of myeloid cell proliferation and differentiation, represents an important candidate gene for studying human carcinogenesis. In a prospectively enrolled population-based case–control study of Han Chinese conducted in Kaohsiung in southern Taiwan, a total of 114 leukemia cases and 221 controls <20 years old were recruited between November 1997 and December 2005. The present study set out to evaluate the association between childhood leukemia and both maternal and offspring's genotypes. To do so, we conducted a systematic assessment of common single-nucleotide polymorphisms (SNPs) at the 5′ flanking 10 kb to 3′ UTR of AKR1C3 gene. Gln5His and three tagSNPs (rs2245191, rs10508293 and rs3209896) and one multimarker (rs2245191, rs10508293 and rs3209896) were selected with average 90% coverage of untagged SNPs by using the HapMap II data set. Odds ratios and 95% confidence intervals were adjusted for age and gender. After correcting for multiple comparisons, we observed that risk of developing childhood leukemia is significantly associated with rs10508293 polymorphism on intron 4 of the AKR1C3 gene in both offspring alone and in the combined maternal and offspring genotypes (nominal P < 0.0001, permutation P < 0.005). The maternal methylenetetrahydrofolate reductase A1298C polymorphism was found to be an effect modifier of the maternal intron 4 polymorphism of the AKR1C3 gene (rs10508293) and the childhood leukemia risk. In conclusion, this study suggests that AKR1C3 polymorphisms may be important predictive markers for childhood leukemia susceptibility. PMID:18339682

One novel SNP of growth hormone gene and its associations with growth and carcass traits in ducks.

PubMed

Wu, Y; Pan, A L; Pi, J S; Pu, Y J; Du, J P; Liang, Z H; Shen, J

2012-08-01

In this study, the growth hormone (GH) gene was studied as a candidate gene for growth and carcass traits of three duck populations (Cherry Valley duck, Muscovy duck and Jingjiang duck). Three pairs of primers were designed to detect single nucleotide polymorphisms of introns 2, 3 and 4 of the GH gene by polymerase chain reaction-restriction fragment length polymorphism and sequencing methods. Only the products amplified from intron 2 displayed polymorphism. The results showed one novel polymorphism: a variation in intron 2 of GH gene (C172T, JN408701 and JN408702). It was associated with some growth and carcass traits in three duck populations including birth weight, 8-week weight, carcass weight, breast muscle weight, leg muscle weight, eviscerated weight, lean meat rate, dressing percentage, etc. And the TT and CT genotypes were associated with superior growth and carcass traits in carcass weight, dressing percentage and percentage of eviscerated weight. Therefore, the variation in intron 2 of GH may be a molecular marker for superior growth and carcass traits in above duck populations.

Genetic mapping of the female mimic morph locus in the ruff

PubMed Central

2013-01-01

Background Ruffs (Aves: Philomachus pugnax) possess a genetic polymorphism for male mating behaviour resulting in three permanent alternative male reproductive morphs: (i) territorial ‘Independents’, (ii) non-territorial ‘Satellites’, and (iii) female-mimicking ‘Faeders’. Development into independent or satellite morphs has previously been shown to be due to a single-locus, two-allele autosomal Mendelian mode of inheritance at the Satellite locus. Here, we use linkage analysis to map the chromosomal location of the Faeder locus, which controls development into the Faeder morph, and draw further conclusions about candidate genes, assuming shared synteny with other birds. Results Segregation data on the Faeder locus were obtained from captive-bred pedigrees comprising 64 multi-generation families (N = 381). There was no evidence that the Faeder locus was linked to the Satellite locus, but it was linked with microsatellite marker Ppu020. Comparative mapping of ruff microsatellite markers against the chicken (Gallus gallus) and zebra finch (Taeniopygia guttata) genomes places the Ppu020 and Faeder loci on a region of chromosome 11 that includes the Melanocortin-1 receptor (MC1R) gene, which regulates colour polymorphisms in numerous birds and other vertebrates. Melanin-based colouration varies with life-history strategies in ruffs and other species, thus the MC1R gene is a strong candidate to play a role in alternative male morph determination. Conclusion Two unlinked loci appear to control behavioural development in ruffs. The Faeder locus is linked to Ppu020, which, assuming synteny, is located on avian chromosome 11. MC1R is a candidate gene involved in alternative male morph determination in ruffs. PMID:24256185

Gene Variations in the Protein C and Fibrinolytic Pathway: Relevance for Severity and Outcome in Pediatric Sepsis.

PubMed

Boeddha, Navin P; Emonts, Marieke; Cnossen, Marjon H; de Maat, Moniek P; Leebeek, Frank W; Driessen, Gertjan J; Hazelzet, Jan A

2017-02-01

The host response to infection involves complex interplays between inflammation, coagulation, and fibrinolysis. Deregulation of hemostasis and fibrinolysis are major causes of critical illness and important determinants of outcome in severe sepsis. The hemostatic responses to infection vary widely between individuals, and are in part explained by polymorphisms in genes responsible for the protein C and fibrinolytic pathway. This review gives an overview of genetic polymorphisms in the protein C and fibrinolytic pathway associated with susceptibility and severity of pediatric sepsis. In addition, genetic polymorphisms associated with adult sepsis and other pediatric thromboembolic disorders are discussed, as these polymorphisms might be candidates for future molecular genetic research in pediatric sepsis. Thieme Medical Publishers 333 Seventh Avenue, New York, NY 10001, USA.

Polymorphism of SLC25A32, the folate transporter gene, is associated with plasma folate levels and bone fractures in Japanese postmenopausal women.

PubMed

Urano, Tomohiko; Shiraki, Masataka; Saito, Mitsuru; Sasaki, Noriko; Ouchi, Yasuyoshi; Inoue, Satoshi

2014-10-01

Elevation of homocysteine is associated with an increased risk for bone fractures. We previously reported that the methylenetetrahydrofolate reductase (MTHFR) gene polymorphism is associated with homocysteine levels and fracture. The association between the fracture and folate levels or their related gene polymorphisms is not completely clear. We speculated that the SLC25A32 gene, the mitochondrial inner membrane folate transporter, also could be implicated in the regulation of folate metabolism and fracture. A total of 851 Japanese postmenopausal women participated in the association study between the single nucleotide polymorphism genotype and plasma homocysteine or folate. We also tested the association between the candidate single nucleotide polymorphism and 663 postmenopausal women. The AA genotype of rs2241777 single nucleotide polymorphism at the 3'UTR region in the SLC25A32 gene was associated with lower plasma folate concentration compared with the other genotypes in 851 postmenopausal women. A total of 674 postmenopausal ambulatory Japanese women were followed up for 5.5 ± 0.1 years (mean ± SE). The AA genotype groups also showed an apparently higher rate and earlier onset of incident fractures than the other genotypes. A total of 407 participants had >70% young-adult mean bone mineral density at the start of the observation. These results show that the SLC25A32 gene polymorphism could be a risk factor for lower folate concentration and future fracture. © 2013 Japan Geriatrics Society.

New genetic signatures associated with cancer cachexia as defined by low skeletal muscle index and weight loss

PubMed Central

Johns, Neil; Stretch, Cynthia; Tan, Benjamin H.L.; Solheim, Tora S.; Sørhaug, Sveinung; Stephens, Nathan A.; Gioulbasanis, Ioannis; Skipworth, Richard J.E.; Deans, D.A. Christopher; Vigano, Antonio; Ross, James A.; Bathe, Oliver F.; Tremblay, Michel L.; Kaasa, Stein; Strasser, Florian; Gagnon, Bruno; Baracos, Vickie E.; Damaraju, Sambasivarao

2016-01-01

Background Cachexia affects the majority with advanced cancer. Based on current demographic and clinical factors, it is not possible to predict who will develop cachexia or not. Such variation may, in part, be due to genotype. It has recently been proposed to extend the diagnostic criteria for cachexia to include a direct measure of low skeletal muscle index (LSMI) in addition to weight loss (WL). We aimed to explore our panel of candidate single nucleotide polymorphism (SNPs) for association with WL +/− computerized tomography‐defined LSMI. We also explored whether the transcription in muscle of identified genes was altered according to such cachexia phenotype Methods A retrospective cohort study design was used. Analysis explored associations of candidate SNPs with WL (n = 1276) and WL + LSMI (n = 943). Human muscle transcriptome (n = 134) was analysed using an Agilent platform. Results Single nucleotide polymorphisms in the following genes showed association with WL alone: GCKR, LEPR, SELP, ACVR2B, TLR4, FOXO3, IGF1, CPN1, APOE, FOXO1, and GHRL. SNPs in LEPR, ACVR2B, TNF, and ACE were associated with concurrent WL + LSMI. There was concordance between muscle‐specific expression for ACVR2B, FOXO1 and 3, LEPR, GCKR, and TLR4 genes and LSMI and/or WL (P < 0.05). Conclusions The rs1799964 in the TNF gene and rs4291 in the ACE gene are new associations when the definition of cachexia is based on a combination of WL and LSMI. These findings focus attention on pro‐inflammatory cytokines and the renin–angiotensin system as biomarkers/mediators of muscle wasting in cachexia. PMID:27897403

The Influence of Genetics on Cystic Fibrosis Phenotypes

PubMed Central

Knowles, Michael R.; Drumm, Mitchell

2012-01-01

Technological advances in genetics have made feasible and affordable large studies to identify genetic variants that cause or modify a trait. Genetic studies have been carried out to assess variants in candidate genes, as well as polymorphisms throughout the genome, for their associations with heritable clinical outcomes of cystic fibrosis (CF), such as lung disease, meconium ileus, and CF-related diabetes. The candidate gene approach has identified some predicted relationships, while genome-wide surveys have identified several genes that would not have been obvious disease-modifying candidates, such as a methionine sulfoxide transferase gene that influences intestinal obstruction, or a region on chromosome 11 proximate to genes encoding a transcription factor and an apoptosis controller that associates with lung function. These unforeseen associations thus provide novel insight into disease pathophysiology, as well as suggesting new therapeutic strategies for CF. PMID:23209180

Association between polymorphisms of the insulin-degrading enzyme gene and late-onset Alzheimer disease.

PubMed

Wang, Shitao; He, Feiyan; Wang, Ying

2015-06-01

The insulin-degrading enzyme (IDE) gene is a strong positional and biological candidate for late-onset Alzheimer disease (LOAD) susceptibility, with recent studies independently demonstrating an association between IDE gene variants and LOAD. However, previous data have been controversial. To investigate the relationship between IDE gene polymorphisms and LOAD risk, a case-control association study of 406 Han Chinese participants in Xinjiang, China, was undertaken. The LOAD and control groups consisted of 202 and 204 participants, respectively. The single-nucleotide polymorphisms rs1887922 and rs1999764 of the IDE gene were linked to LOAD incidence. The presence of the CT+CC genotype of rs1999764 had a protective effect compared to the TT genotype (adjusted P=.0001; odds ratio [OR]=0.226; 95% confidence interval [CI]=0.116-0.441), while the CT+CC genotype of rs1887922 was associated with increased LOAD risk (adjusted P=.0001; OR=3.640; 95% CI=1.889-7.016). Moreover, the effects of rs1887922 and rs1999764 were associated with LOAD risk independent of the apolipoprotein E ∊4 polymorphism and were more significant in men and women, respectively. These results demonstrate that the polymorphisms rs1887922 and rs1999764 of the IDE gene are associated with LOAD susceptibility in the Xinjiang Han population. © The Author(s) 2014.

Sequence analysis of three canine adipokine genes revealed an association between TNF polymorphisms and obesity in Labrador dogs.

PubMed

Mankowska, M; Stachowiak, M; Graczyk, A; Ciazynska, P; Gogulski, M; Nizanski, W; Switonski, M

2016-04-01

Obesity is an emerging health problem in purebred dogs. Due to their crucial role in energy homeostasis control, genes encoding adipokines are considered candidate genes, and their variants may be associated with predisposition to obesity. Searching for polymorphism was carried out in three adipokine genes (TNF, RETN and IL6). The study was performed on 260 dogs, including lean (n = 109), overweight (n = 88) and obese (n = 63) dogs. The largest cohort was represented by Labrador Retrievers (n = 136). Altogether, 24 novel polymorphisms were identified: 12 in TNF (including one missense SNP), eight in RETN (including one missense SNP) and four in IL6. Distributions of five common SNPs (two in TNF, two in RETN and one in IL6) were further analyzed with regard to body condition score. Two SNPs in the non-coding parts of TNF (c.-40A>C and c.233+14G>A) were associated with obesity in Labrador dogs. The obtained results showed that the studied adipokine genes are highly polymorphic and two polymorphisms in the TNF gene may be considered as markers predisposing Labrador dogs to obesity. © 2015 Stichting International Foundation for Animal Genetics.

Mutation spectrum in BBS genes guided by homozygosity mapping in an Indian cohort.

PubMed

Sathya Priya, C; Sen, P; Umashankar, V; Gupta, N; Kabra, M; Kumaramanickavel, G; Stoetzel, C; Dollfus, H; Sripriya, S

2015-02-01

Bardet-Biedl syndrome (BBS), a ciliopathy disorder with pleiotropic effect manifests primarily as retinal degeneration along with renal insufficiency, polydactyly and obesity. In this study, we have performed homozygosity mapping using NspI 250K affymetrix gene chip followed by mutation screening of the candidate genes located in the homozygous blocks. These regions are prioritized based on the block length and candidature of the genes in BBS and other ciliopathies. Gene alterations in known BBS (22) and other ciliopathy genes such as ALMS1 (2) were seen in 24 of 30 families (80%). Mutations in BBS3 gene, inclusive of a novel recurrent mutation (p.I91T) accounted for 18% of the identified variations. Disease associated polymorphisms p.S70N (BBS2), rs1545 and rs1547 (BBS6) were also observed. This is the first study in Indian BBS patients and homozygosity mapping has proved to be an effective tool in prioritizing the candidate genes in consanguineous pedigrees. The study reveals a different mutation profile in the ciliopathy genes in Indian population and implication of novel loci/genes in 20% of the study group. © 2014 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

Characterization of the canine desmin (DES) gene and evaluation as a candidate gene for dilated cardiomyopathy in the Dobermann.

PubMed

Stabej, Polona; Imholz, Sandra; Versteeg, Serge A; Zijlstra, Carla; Stokhof, Arnold A; Domanjko-Petric, Aleksandra; Leegwater, Peter A J; van Oost, Bernard A

2004-10-13

Canine-dilated cardiomyopathy (DCM) in dogs is a disease of the myocardium associated with dilatation and impaired contraction of the ventricles and is suspected to have a genetic cause. A missense mutation in the desmin gene (DES) causes DCM in a human family. Human DCM closely resembles the canine disease. In the present study, we evaluated whether DES gene mutations are responsible for DCM in Dobermann dogs. We have isolated bacterial artificial chromosome clones (BACs) containing the canine DES gene and determined the chromosomal location by fluorescence in situ hybridization (FISH). Using data deposited in the NCBI trace archive and GenBank, the canine DES gene DNA sequence was assembled and seven single nucleotide polymorphisms (SNPs) were identified. From the canine DES gene BAC clones, a polymorphic microsatellite marker was isolated. The microsatellite marker and four informative desmin SNPs were typed in a Dobermann family with frequent DCM occurrence, but the disease phenotype did not associate with a desmin haplotype. We concluded that mutations in the DES gene do not play a role in Dobermann DCM. Availability of the microsatellite marker, SNPs and DNA sequence reported in this study enable fast evaluation of the DES gene as a DCM candidate gene in other dog breeds with DCM occurrence.

Longevity candidate genes and their association with personality traits in the elderly

PubMed Central

Luciano, Michelle; Lopez, Lorna M.; de Moor, Marleen H.M.; Harris, Sarah E.; Davies, Gail; Nutile, Teresa; Krueger, Robert F.; Esko, Tõnu; Schlessinger, David; Toshiko, Tanaka; Derringer, Jaime L.; Realo, Anu; Hansell, Narelle K.; Pergadia, Michele L.; Pesonen, Anu-Katriina; Sanna, Serena; Terracciano, Antonio; Madden, Pamela A.F.; Penninx, Brenda; Spinhoven, Philip; Hartman, Catherine; Oostra, Ben A.; Janssens, A. Cecile J.W.; Eriksson, Johan G; Starr, John M.; Cannas, Alessandra; Ferrucci, Luigi; Metspalu, Andres; Wright, Margeret J.; Heath, Andrew C.; van Duijn, Cornelia M.; Bierut, Laura J.; Raikkonen, Katri; Martin, Nicholas G.; Ciullo, Marina; Rujescu, Dan; Boomsma, Dorret I.; Deary, Ian J.

2013-01-01

Human longevity and personality traits are both heritable and are consistently linked at the phenotypic level. We test the hypothesis that candidate genes influencing longevity in lower organisms are associated with variance in the five major dimensions of human personality (measured by the NEO-FFI and IPIP inventories) plus related mood states of anxiety and depression. Seventy single nucleotide polymorphisms (SNPs) in six brain expressed, longevity candidate genes (AFG3L2, FRAP1, MAT1A, MAT2A, SYNJ1 and SYNJ2) were typed in over one thousand 70-year old participants from the Lothian Birth Cohort of 1936 (LBC1936). No SNPs were associated with the personality and psychological distress traits at a Bonferroni corrected level of significance (p < 0.0002), but there was an over-representation of nominally significant (p < 0.05) SNPs in the synaptojanin-2 (SYNJ2) gene associated with agreeableness and symptoms of depression. Eight SNPs which showed nominally significant association across personality measurement instruments were tested in an extremely large replication sample of 17 106 participants. SNP rs350292, in SYNJ2, was significant: the minor allele was associated with an average decrease in NEO agreeableness scale scores of 0.25 points, and 0.67 points in the restricted analysis of elderly cohorts (most aged > 60 years). Because we selected a specific set of longevity genes based on functional genomics findings, further research on other longevity gene candidates is warranted to discover whether they are relevant candidates for personality and psychological distress traits. PMID:22213687

Characterization of the Gray Whale Eschrichtius robustus Genome and a Genotyping Array Based on Single-Nucleotide Polymorphisms in Candidate Genes.

PubMed

DeWoody, J Andrew; Fernandez, Nadia B; Brüniche-Olsen, Anna; Antonides, Jennifer D; Doyle, Jacqueline M; San Miguel, Phillip; Westerman, Rick; Vertyankin, Vladimir V; Godard-Codding, Céline A J; Bickham, John W

2017-06-01

Genetic and genomic approaches have much to offer in terms of ecology, evolution, and conservation. To better understand the biology of the gray whale Eschrichtius robustus (Lilljeborg, 1861), we sequenced the genome and produced an assembly that contains ∼95% of the genes known to be highly conserved among eukaryotes. From this assembly, we annotated 22,711 genes and identified 2,057,254 single-nucleotide polymorphisms (SNPs). Using this assembly, we generated a curated list of candidate genes potentially subject to strong natural selection, including genes associated with osmoregulation, oxygen binding and delivery, and other aspects of marine life. From these candidate genes, we queried 92 autosomal protein-coding markers with a panel of 96 SNPs that also included 2 sexing and 2 mitochondrial markers. Genotyping error rates, calculated across loci and across 69 intentional replicate samples, were low (0.021%), and observed heterozygosity was 0.33 averaged over all autosomal markers. This level of variability provides substantial discriminatory power across loci (mean probability of identity of 1.6 × 10 -25 and mean probability of exclusion >0.999 with neither parent known), indicating that these markers provide a powerful means to assess parentage and relatedness in gray whales. We found 29 unique multilocus genotypes represented among our 36 biopsies (indicating that we inadvertently sampled 7 whales twice). In total, we compiled an individual data set of 28 western gray whales (WGSs) and 1 presumptive eastern gray whale (EGW). The lone EGW we sampled was no more or less related to the WGWs than expected by chance alone. The gray whale genomes reported here will enable comparative studies of natural selection in cetaceans, and the SNP markers should be highly informative for future studies of gray whale evolution, population structure, demography, and relatedness.

Gene-Environment Interactions in Asthma: Genetic and Epigenetic Effects.

PubMed

Lee, Jong-Uk; Kim, Jeong Dong; Park, Choon-Sik

2015-07-01

Over the past three decades, a large number of genetic studies have been aimed at finding genetic variants associated with the risk of asthma, applying various genetic and genomic approaches including linkage analysis, candidate gene polymorphism studies, and genome-wide association studies (GWAS). However, contrary to general expectation, even single nucleotide polymorphisms (SNPs) discovered by GWAS failed to fully explain the heritability of asthma. Thus, application of rare allele polymorphisms in well defined phenotypes and clarification of environmental factors have been suggested to overcome the problem of 'missing' heritability. Such factors include allergens, cigarette smoke, air pollutants, and infectious agents during pre- and post-natal periods. The first and simplest interaction between a gene and the environment is a candidate interaction of both a well known gene and environmental factor in a direct physical or chemical interaction such as between CD14 and endotoxin or between HLA and allergens. Several GWAS have found environmental interactions with occupational asthma, aspirin exacerbated respiratory disease, tobacco smoke-related airway dysfunction, and farm-related atopic diseases. As one of the mechanisms behind gene-environment interaction is epigenetics, a few studies on DNA CpG methylation have been reported on subphenotypes of asthma, pitching the exciting idea that it may be possible to intervene at the junction between the genome and the environment. Epigenetic studies are starting to include data from clinical samples, which will make them another powerful tool for re-search on gene-environment interactions in asthma.

An analysis of Methylenetetrahydrofolate reductase and Glutathione S-transferase omega-1 genes as modifiers of the cerebral response to ischemia

PubMed Central

Peddareddygari, Leema Reddy; Dutra, Ana Virginia; Levenstien, Mark A; Sen, Souvik; Grewal, Raji P

2009-01-01

Background Cerebral ischemia involves a series of reactions which ultimately influence the final volume of a brain infarction. We hypothesize that polymorphisms in genes encoding proteins involved in these reactions could act as modifiers of the cerebral response to ischemia and impact the resultant stroke volume. The final volume of a cerebral infarct is important as it correlates with the morbidity and mortality associated with non-lacunar ischemic strokes. Methods The proteins encoded by the methylenetetrahydrofolate reductase (MTHFR) and glutathione S-transferase omega-1 (GSTO-1) genes are, through oxidative mechanisms, key participants in the cerebral response to ischemia. On the basis of these biological activities, they were selected as candidate genes for further investigation. We analyzed the C677T polymorphism in the MTHFR gene and the C419A polymorphism in the GSTO-1 gene in 128 patients with non-lacunar ischemic strokes. Results We found no significant association of either the MTHFR (p = 0.72) or GSTO-1 (p = 0.58) polymorphisms with cerebral infarct volume. Conclusion Our study shows no major gene effect of either the MTHFR or GSTO-1 genes as a modifier of ischemic stroke volume. However, given the relatively small sample size, a minor gene effect is not excluded by this investigation. PMID:19624857

Androgen receptor repeat length polymorphism associated with male-to-female transsexualism.

PubMed

Hare, Lauren; Bernard, Pascal; Sánchez, Francisco J; Baird, Paul N; Vilain, Eric; Kennedy, Trudy; Harley, Vincent R

2009-01-01

There is a likely genetic component to transsexualism, and genes involved in sex steroidogenesis are good candidates. We explored the specific hypothesis that male-to-female transsexualism is associated with gene variants responsible for undermasculinization and/or feminization. Specifically, we assessed the role of disease-associated repeat length polymorphisms in the androgen receptor (AR), estrogen receptor beta (ERbeta), and aromatase (CYP19) genes. Subject-control analysis included 112 male-to-female transsexuals and 258 non-transsexual males. Associations and interactions were investigated between CAG repeat length in the AR gene, CA repeat length in the ERbeta gene, and TTTA repeat length in the CYP19 gene and male-to-female transsexualism. A significant association was identified between transsexualism and the AR allele, with transsexuals having longer AR repeat lengths than non-transsexual male control subjects (p=.04). No associations for transsexualism were evident in repeat lengths for CYP19 or ERbeta genes. Individuals were then classified as short or long for each gene polymorphism on the basis of control median polymorphism lengths in order to further elucidate possible combined effects. No interaction associations between the three genes and transsexualism were identified. This study provides evidence that male gender identity might be partly mediated through the androgen receptor.

Androgen Receptor Repeat Length Polymorphism Associated with Male-to-Female Transsexualism

PubMed Central

Hare, Lauren; Bernard, Pascal; Sánchez, Francisco J.; Baird, Paul N.; Vilain, Eric; Kennedy, Trudy; Harley, Vincent R.

2012-01-01

Background There is a likely genetic component to transsexualism, and genes involved in sex steroidogenesis are good candidates. We explored the specific hypothesis that male-to-female transsexualism is associated with gene variants responsible for undermasculinization and/or feminization. Specifically, we assessed the role of disease-associated repeat length polymorphisms in the androgen receptor (AR), estrogen receptor β (ERβ), and aromatase (CYP19) genes. Methods Subject-control analysis included 112 male-to-female transsexuals and 258 non-transsexual males. Associations and interactions were investigated between CAG repeat length in the AR gene, CA repeat length in the ERβ gene, and TTTA repeat length in the CYP19 gene and male-to-female transsexualism. Results A significant association was identified between transsexualism and the AR allele, with transsexuals having longer AR repeat lengths than non-transsexual male control subjects (p = .04). No associations for transsexualism were evident in repeat lengths for CYP19 or ERβ genes. Individuals were then classified as short or long for each gene polymorphism on the basis of control median polymorphism lengths in order to further elucidate possible combined effects. No interaction associations between the three genes and transsexualism were identified. Conclusions This study provides evidence that male gender identity might be partly mediated through the androgen receptor. PMID:18962445

[Obesity studies in candidate genes].

PubMed

Ochoa, María del Carmen; Martí, Amelia; Martínez, J Alfredo

2004-04-17

There are more than 430 chromosomic regions with gene variants involved in body weight regulation and obesity development. Polymorphisms in genes related to energy expenditure--uncoupling proteins (UCPs), related to adipogenesis and insulin resistance--hormone-sensitive lipase (HLS), peroxisome proliferator-activated receptor gamma (PPAR gamma), beta adrenergic receptors (ADRB2,3), and alfa tumor necrosis factor (TNF-alpha), and related to food intake--ghrelin (GHRL)--appear to be associated with obesity phenotypes. Obesity risk depends on two factors: a) genetic variants in candidate genes, and b) biographical exposure to environmental risk factors. It is necessary to perform new studies, with appropriate control groups and designs, in order to reach relevant conclusions with regard to gene/environmental (diet, lifestyle) interactions.

Impact of DNA repair genes polymorphism (XPD and XRCC1) on the risk of breast cancer in Egyptian female patients.

PubMed

Hussien, Yousry Mostafa; Gharib, Amal F; Awad, Hanan A; Karam, Rehab A; Elsawy, Wael H

2012-02-01

The genes involved in DNA repair system play a crucial role in the protection against mutations. It has been hypothesized that functional deficiencies in highly conserved DNA repair processes resulting from polymorphic variation may increase genetic susceptibility to breast cancer (BC). The aim of the present study was to evaluate the association of genetic polymorphisms in 2 DNA repair genes, XPD (Asp312Asn) and XRCC1 (A399G), with BC susceptibility. We further investigated the potential combined effect of these DNA repair variants on BC risk. Both XPD (xeroderma pigmentosum group D) and XRCC1 (X-ray repair cross-complementing group 1) polymorphisms were characterized in 100 BC Egyptian females and 100 healthy women who had no history of any malignancy by amplification refractory mutation system-polymerase chain reaction (ARMS-PCR) method and PCR with confronting two-pair primers (PCR-CTPP), using DNA from peripheral blood in a case control study. Our results revealed that the frequencies of AA genotype of XPD codon 312 polymorphism were significantly higher in the BC patients than in the normal individuals (P ≤ 0.003), and did not observe any association between the XRCC1 Arg399Gln polymorphism and risk of developing BC. Also, no association between both XPD Asp312Asn and XRCC1 A399G polymorphisms and the clinical characteristics of disease. Finally, the combination of AA(XPD) + AG(XRCC1) were significantly associated with BC risk. Our results suggested that, XPD gene is an important candidate gene for susceptibility to BC. Also, gene-gene interaction between XPD(AA) + XRCC1(AG) polymorphism may be associated with increased risk of BC in Egyptian women.

Detection of genomic signatures of recent selection in commercial broiler chickens.

PubMed

Fu, Weixuan; Lee, William R; Abasht, Behnam

2016-08-26

Identification of the genomic signatures of recent selection may help uncover causal polymorphisms controlling traits relevant to recent decades of selective breeding in livestock. In this study, we aimed at detecting signatures of recent selection in commercial broiler chickens using genotype information from single nucleotide polymorphisms (SNPs). A total of 565 chickens from five commercial purebred lines, including three broiler sire (male) lines and two broiler dam (female) lines, were genotyped using the 60K SNP Illumina iSelect chicken array. To detect genomic signatures of recent selection, we applied two methods based on population comparison, cross-population extended haplotype homozygosity (XP-EHH) and cross-population composite likelihood ratio (XP-CLR), and further analyzed the results to find genomic regions under recent selection in multiple purebred lines. A total of 321 candidate selection regions spanning approximately 1.45 % of the chicken genome in each line were detected by consensus of results of both XP-EHH and XP-CLR methods. To minimize false discovery due to genetic drift, only 42 of the candidate selection regions that were shared by 2 or more purebred lines were considered as high-confidence selection regions in the study. Of these 42 regions, 20 were 50 kb or less while 4 regions were larger than 0.5 Mb. In total, 91 genes could be found in the 42 regions, among which 19 regions contained only 1 or 2 genes, and 9 regions were located at gene deserts. Our results provide a genome-wide scan of recent selection signatures in five purebred lines of commercial broiler chickens. We found several candidate genes for recent selection in multiple lines, such as SOX6 (Sex Determining Region Y-Box 6) and cTR (Thyroid hormone receptor beta). These genes may have been under recent selection due to their essential roles in growth, development and reproduction in chickens. Furthermore, our results suggest that in some candidate regions, the same or opposite alleles have been under recent selection in multiple lines. Most of the candidate genes in the selection regions are novel, and as such they should be of great interest for future research into the genetic architecture of traits relevant to modern broiler breeding.

No Association of BDNF, COMT, MAOA, SLC6A3, and SLC6A4 Genes and Depressive Symptoms in a Sample of Healthy Colombian Subjects.

PubMed

González-Giraldo, Yeimy; Camargo, Andrés; López-León, Sandra; Forero, Diego A

2015-01-01

Background. Major depressive disorder (MDD) is the second cause of years lived with disability around the world. A large number of studies have been carried out to identify genetic risk factors for MDD and related endophenotypes, mainly in populations of European and Asian descent, with conflicting results. The main aim of the current study was to analyze the possible association of five candidate genes and depressive symptoms in a Colombian sample of healthy subjects. Methods and Materials. The Spanish adaptation of the Hospital Anxiety and Depression Scale (HADS) was applied to one hundred eighty-eight healthy Colombian subjects. Five functional polymorphisms were genotyped using PCR-based assays: BDNF-Val66Met (rs6265), COMT-Val158Met (rs4680), SLC6A4-HTTLPR (rs4795541), MAOA-uVNTR, and SLC6A3-VNTR (rs28363170). Result. We did not find significant associations with scores of depressive symptoms, derived from the HADS, for any of the five candidate genes (nominal p values >0.05). In addition, we did not find evidence of significant gene-gene interactions. Conclusion. This work is one of the first studies of candidate genes for depressive symptoms in a Latin American sample. Study of additional genetic and epigenetic variants, taking into account other pathophysiological theories, will help to identify novel candidates for MDD in populations around the world.

Analysis of the QTL for sleep homeostasis in mice: Homer1a is a likely candidate.

PubMed

Mackiewicz, M; Paigen, B; Naidoo, N; Pack, A I

2008-03-14

Electroencephalographic oscillations in the frequency range of 0.5-4 Hz, characteristic of slow-wave sleep (SWS), are often referred to as the delta oscillation or delta power. Delta power reflects sleep intensity and correlates with the homeostatic response to sleep loss. A published survey of inbred strains of mice demonstrated that the time course of accumulation of delta power varied among inbred strains, and the segregation of the rebound of delta power in BxD recombinant inbred strains identified a genomic region on chromosome 13 referred to as the delta power in SWS (or Dps1). The quantitative trait locus (QTL) contains genes that modify the accumulation of delta power after sleep deprivation. Here, we narrow the QTL using interval-specific haplotype analysis and present a comprehensive annotation of the remaining genes in the Dps1 region with sequence comparisons to identify polymorphisms within the coding and regulatory regions. We established the expression pattern of selected genes located in the Dps1 interval in sleep and wakefulness in B6 and D2 parental strains. Taken together, these steps reduced the number of potential candidate genes that may underlie the accumulation of delta power after sleep deprivation and explain the Dps1 QTL. The strongest candidate gene is Homer1a, which is supported by expression differences between sleep and wakefulness and the SNP polymorphism in the upstream regulatory regions.

An SNP within the Angiotensin-Converting Enzyme Distinguishes between Sprint and Distance Performing Alaskan Sled Dogs in a Candidate Gene Analysis

PubMed Central

Huson, Heather J.; Byers, Alexandra M.; Runstadler, Jonathan

2011-01-01

The Alaskan sled dog offers a unique mechanism for studying the genetics of elite athletic performance. They are a group of mixed breed dogs, comprised of multiple common breeds, and a unique breed entity seen only as a part of the sled dog mix. Alaskan sled dogs are divided into 2 primary groups as determined by their racing skills. Distance dogs are capable of running over 1000 miles in 10 days, whereas sprint dogs run much shorter distances, approximately 30 miles, but in faster times, that is, 18–25 mph. Finding the genes that distinguish these 2 types of performers is likely to illuminate genetic contributors to human athletic performance. In this study, we tested for association between polymorphisms in 2 candidate genes; angiotensin-converting enzyme (ACE) and myostatin (MSTN) and enhanced speed and endurance performance in 174 Alaskan sled dogs. We observed 81 novel genetic variants within the ACE gene and 4 within the MSTN gene, including a polymorphism within the ACE gene that significantly (P value 2.38 × 10−5) distinguished the sprint versus distance populations. PMID:21846742

Cracking the genomic piggy bank: identifying secrets of the pig genome.

PubMed

Mote, B E; Rothschild, M F

2006-01-01

Though researchers are uncovering valuable information about the pig genome at unprecedented speed, the porcine genome community is barely scratching the surface as to understanding interactions of the biological code. The pig genetic linkage map has nearly 5,000 loci comprised of genes, microsatellites, and amplified fragment length polymorphism markers. Likewise, the physical map is becoming denser with nearly 6,000 markers. The long awaited sequencing efforts are providing multidimensional benefits with sequence available for comparative genomics and identifying single nucleotide polymorphisms for use in linkage and trait association studies. Scientists are using exotic and commercial breeds for quantitative trait loci scans. Additionally, candidate gene studies continue to identify chromosomal regions or genes associated with economically important traits such as growth rate, leanness, feed intake, meat quality, litter size, and disease resistance. The commercial pig industry is actively incorporating these markers in marker-assisted selection along with traditional performance information to improve said traits. Researchers are utilizing novel tools including pig microarrays along with advanced bioinformatics to identify new candidate genes, understand gene function, and piece together gene networks involved in important biological processes. Advances in pig genomics and implications to the pork industry as well as human health are reviewed.

Using Drosophila melanogaster as a Model for Genotoxic Chemical Mutational Studies with a New Program, SnpSift

PubMed Central

Cingolani, Pablo; Patel, Viral M.; Coon, Melissa; Nguyen, Tung; Land, Susan J.; Ruden, Douglas M.; Lu, Xiangyi

2012-01-01

This paper describes a new program SnpSift for filtering differential DNA sequence variants between two or more experimental genomes after genotoxic chemical exposure. Here, we illustrate how SnpSift can be used to identify candidate phenotype-relevant variants including single nucleotide polymorphisms, multiple nucleotide polymorphisms, insertions, and deletions (InDels) in mutant strains isolated from genome-wide chemical mutagenesis of Drosophila melanogaster. First, the genomes of two independently isolated mutant fly strains that are allelic for a novel recessive male-sterile locus generated by genotoxic chemical exposure were sequenced using the Illumina next-generation DNA sequencer to obtain 20- to 29-fold coverage of the euchromatic sequences. The sequencing reads were processed and variants were called using standard bioinformatic tools. Next, SnpEff was used to annotate all sequence variants and their potential mutational effects on associated genes. Then, SnpSift was used to filter and select differential variants that potentially disrupt a common gene in the two allelic mutant strains. The potential causative DNA lesions were partially validated by capillary sequencing of polymerase chain reaction-amplified DNA in the genetic interval as defined by meiotic mapping and deletions that remove defined regions of the chromosome. Of the five candidate genes located in the genetic interval, the Pka-like gene CG12069 was found to carry a separate pre-mature stop codon mutation in each of the two allelic mutants whereas the other four candidate genes within the interval have wild-type sequences. The Pka-like gene is therefore a strong candidate gene for the male-sterile locus. These results demonstrate that combining SnpEff and SnpSift can expedite the identification of candidate phenotype-causative mutations in chemically mutagenized Drosophila strains. This technique can also be used to characterize the variety of mutations generated by genotoxic chemicals. PMID:22435069

CYBRD1 as a modifier gene that modulates iron phenotype in HFE p.C282Y homozygous patients.

PubMed

Pelucchi, Sara; Mariani, Raffaella; Calza, Stefano; Fracanzani, Anna Ludovica; Modignani, Giulia Litta; Bertola, Francesca; Busti, Fabiana; Trombini, Paola; Fraquelli, Mirella; Forni, Gian Luca; Girelli, Domenico; Fargion, Silvia; Specchia, Claudia; Piperno, Alberto

2012-12-01

Most patients with hereditary hemochromatosis in the Caucasian population are homozygous for the p.C282Y mutation in the HFE gene. The penetrance and expression of hereditary hemochromatosis differ largely among cases of homozygous p.C282Y. Genetic factors might be involved in addition to environmental factors. In the present study, we analyzed 50 candidate genes involved in iron metabolism and evaluated the association between 214 single nucleotide polymorphisms in these genes and three phenotypic outcomes of iron overload (serum ferritin, iron removed and transferrin saturation) in a large group of 296 p.C282Y homozygous Italians. Polymorphisms were tested for genetic association with each single outcome using linear regression models adjusted for age, sex and alcohol consumption. We found a series of 17 genetic variants located in different genes with possible additive effects on the studied outcomes. In order to evaluate whether the selected polymorphisms could provide a predictive signature for adverse phenotype, we re-evaluated data by dividing patients in two extreme phenotype classes based on the three phenotypic outcomes. We found that only a small improvement in prediction could be achieved by adding genetic information to clinical data. Among the selected polymorphisms, a significant association was observed between rs3806562, located in the 5'UTR of CYBRD1, and transferrin saturation. This variant belongs to the same haplotype block that contains the CYBRD1 polymorphism rs884409, found to be associated with serum ferritin in another population of p.C282Y homozygotes, and able to modulate promoter activity. A luciferase assay indicated that rs3806562 does not have a significant functional role, suggesting that it is a genetic marker linked to the putative genetic modifier rs884409. While our results support the hypothesis that polymorphisms in genes regulating iron metabolism may modulate penetrance of HFE-hereditary hemochromatosis, with emphasis on CYBRD1, they strengthen the notion that none of these polymorphisms alone is a major modifier of the phenotype of hereditary hemochromatosis.

CYBRD1 as a modifier gene that modulates iron phenotype in HFE p.C282Y homozygous patients

PubMed Central

Pelucchi, Sara; Mariani, Raffaella; Calza, Stefano; Fracanzani, Anna Ludovica; Modignani, Giulia Litta; Bertola, Francesca; Busti, Fabiana; Trombini, Paola; Fraquelli, Mirella; Forni, Gian Luca; Girelli, Domenico; Fargion, Silvia; Specchia, Claudia; Piperno, Alberto

2012-01-01

Background Most patients with hereditary hemochromatosis in the Caucasian population are homozygous for the p.C282Y mutation in the HFE gene. The penetrance and expression of hereditary hemochromatosis differ largely among cases of homozygous p.C282Y. Genetic factors might be involved in addition to environmental factors. Design and Methods: In the present study, we analyzed 50 candidate genes involved in iron metabolism and evaluated the association between 214 single nucleotide polymorphisms in these genes and three phenotypic outcomes of iron overload (serum ferritin, iron removed and transferrin saturation) in a large group of 296 p.C282Y homozygous Italians. Polymorphisms were tested for genetic association with each single outcome using linear regression models adjusted for age, sex and alcohol consumption. Results We found a series of 17 genetic variants located in different genes with possible additive effects on the studied outcomes. In order to evaluate whether the selected polymorphisms could provide a predictive signature for adverse phenotype, we re-evaluated data by dividing patients in two extreme phenotype classes based on the three phenotypic outcomes. We found that only a small improvement in prediction could be achieved by adding genetic information to clinical data. Among the selected polymorphisms, a significant association was observed between rs3806562, located in the 5'UTR of CYBRD1, and transferrin saturation. This variant belongs to the same haplotype block that contains the CYBRD1 polymorphism rs884409, found to be associated with serum ferritin in another population of p.C282Y homozygotes, and able to modulate promoter activity. A luciferase assay indicated that rs3806562 does not have a significant functional role, suggesting that it is a genetic marker linked to the putative genetic modifier rs884409. Conclusions While our results support the hypothesis that polymorphisms in genes regulating iron metabolism may modulate penetrance of HFE-hereditary hemochromatosis, with emphasis on CYBRD1, they strengthen the notion that none of these polymorphisms alone is a major modifier of the phenotype of hereditary hemochromatosis. PMID:22773607

Genome-wide association study using high-density single nucleotide polymorphism arrays and whole-genome sequences for clinical mastitis traits in dairy cattle.

PubMed

Sahana, G; Guldbrandtsen, B; Thomsen, B; Holm, L-E; Panitz, F; Brøndum, R F; Bendixen, C; Lund, M S

2014-11-01

Mastitis is a mammary disease that frequently affects dairy cattle. Despite considerable research on the development of effective prevention and treatment strategies, mastitis continues to be a significant issue in bovine veterinary medicine. To identify major genes that affect mastitis in dairy cattle, 6 chromosomal regions on Bos taurus autosome (BTA) 6, 13, 16, 19, and 20 were selected from a genome scan for 9 mastitis phenotypes using imputed high-density single nucleotide polymorphism arrays. Association analyses using sequence-level variants for the 6 targeted regions were carried out to map causal variants using whole-genome sequence data from 3 breeds. The quantitative trait loci (QTL) discovery population comprised 4,992 progeny-tested Holstein bulls, and QTL were confirmed in 4,442 Nordic Red and 1,126 Jersey cattle. The targeted regions were imputed to the sequence level. The highest association signal for clinical mastitis was observed on BTA 6 at 88.97 Mb in Holstein cattle and was confirmed in Nordic Red cattle. The peak association region on BTA 6 contained 2 genes: vitamin D-binding protein precursor (GC) and neuropeptide FF receptor 2 (NPFFR2), which, based on known biological functions, are good candidates for affecting mastitis. However, strong linkage disequilibrium in this region prevented conclusive determination of the causal gene. A different QTL on BTA 6 located at 88.32 Mb in Holstein cattle affected mastitis. In addition, QTL on BTA 13 and 19 were confirmed to segregate in Nordic Red cattle and QTL on BTA 16 and 20 were confirmed in Jersey cattle. Although several candidate genes were identified in these targeted regions, it was not possible to identify a gene or polymorphism as the causal factor for any of these regions. Copyright © 2014 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

A low-density SNP array for analyzing differential selection in freshwater and marine populations of threespine stickleback (Gasterosteus aculeatus).

PubMed

Ferchaud, Anne-Laure; Pedersen, Susanne H; Bekkevold, Dorte; Jian, Jianbo; Niu, Yongchao; Hansen, Michael M

2014-10-06

The threespine stickleback (Gasterosteus aculeatus) has become an important model species for studying both contemporary and parallel evolution. In particular, differential adaptation to freshwater and marine environments has led to high differentiation between freshwater and marine stickleback populations at the phenotypic trait of lateral plate morphology and the underlying candidate gene Ectodysplacin (EDA). Many studies have focused on this trait and candidate gene, although other genes involved in marine-freshwater adaptation may be equally important. In order to develop a resource for rapid and cost efficient analysis of genetic divergence between freshwater and marine sticklebacks, we generated a low-density SNP (Single Nucleotide Polymorphism) array encompassing markers of chromosome regions under putative directional selection, along with neutral markers for background. RAD (Restriction site Associated DNA) sequencing of sixty individuals representing two freshwater and one marine population led to the identification of 33,993 SNP markers. Ninety-six of these were chosen for the low-density SNP array, among which 70 represented SNPs under putatively directional selection in freshwater vs. marine environments, whereas 26 SNPs were assumed to be neutral. Annotation of these regions revealed several genes that are candidates for affecting stickleback phenotypic variation, some of which have been observed in previous studies whereas others are new. We have developed a cost-efficient low-density SNP array that allows for rapid screening of polymorphisms in threespine stickleback. The array provides a valuable tool for analyzing adaptive divergence between freshwater and marine stickleback populations beyond the well-established candidate gene Ectodysplacin (EDA).

Lack of association between ENAM gene polymorphism and dental caries in primary and permanent teeth in Czech children.

PubMed

Borilova Linhartova, Petra; Deissova, Tereza; Musilova, Kristina; Zackova, Lenka; Kukletova, Martina; Kukla, Lubomir; Izakovicova Holla, Lydie

2018-05-01

The enamelin gene (ENAM) polymorphism (rs12640848) was recently associated with dental caries in primary teeth in Polish children. The aims of the present study were to prove this association in primary dentition and to find a possible effect of this variant on caries development in permanent dentition in Czech children. This study comprised 905 Czech children. Totally, 187 children aged 2-6 years with primary dentition [78 healthy subjects (with decayed/missing/filled teeth, dmft = 0) and 109 patients with early childhood caries (ECC; dmft ≥ 1)] were included in this case-control study. In addition, 177 subjects aged 13-15 years without caries (DMFT = 0) and 541 children with dental caries (DMFT ≥ 1) in permanent dentition were selected from the ELSPAC study. Genotype determination of the ENAM polymorphism (rs12640848) was based on the TaqMan method. No significant differences in the allele or genotype frequencies between the caries-free children and those affected by dental caries were observed in both primary and permanent dentitions. Lack of association between the ENAM polymorphism (rs12640848) and dental caries in Czech children was detected. Although ENAM is considered as a candidate gene for dental caries, the presence of the ENAM variant (rs12640848) cannot be used as a risk factor of this multifactorial disease in the Czech population.

Association of MTHFR polymorphisms and chromosomal abnormalities in leukemia.

PubMed

Sinthuwiwat, Thivaratana; Poowasanpetch, Phanasit; Wongngamrungroj, Angsana; Soonklang, Kamonwan; Promso, Somying; Auewarakul, Chirayu; Tocharoentanaphol, Chintana

2012-01-01

Genetic variation in MTHFR gene might explain the interindividual differences in the reduction of DNA repaired and the increase of chromosome breakage and damage. Nowadays, chromosomal rearrangement is recognized as a major cause of lymphoid malignancies. In addition, the association of MTHFR polymorphisms with aneuploidy was found in several studies, making the MTHFR gene as a good candidate for leukemia etiology. Therefore, in this study, we investigated the common sequence variation, 677C>T and 1298A>C in the MTHFR gene of 350 fixed cell specimens archived after chromosome analysis. The distribution of the MTHFR polymorphisms frequency was compared in leukemic patients with structural chromosome abnormality and chromosome aneuploidy, as well as in those with no evidence of chromosome abnormalities. We observed a significant decrease in the distribution of T allele in 677C>T polymorphisms among patients with chromosomal abnormalities including both structural aberration and aneuploidy. The same significance result also found in patients with structural aberration when compare with the normal karyotype patients. Suggesting that polymorphism in the MTHFR gene was involved in chromosome abnormalities of leukemia. However, further investigation on the correlation with the specific types of chromosomal aberrations is needed.

Interleukin gene polymorphisms and breast cancer: a case control study and systematic literature review

PubMed Central

Balasubramanian, SP; Azmy, IAF; Higham, SE; Wilson, AG; Cross, SS; Cox, A; Brown, NJ; Reed, MW

2006-01-01

Background Interleukins and cytokines play an important role in the pathogenesis of many solid cancers. Several single nucleotide polymorphisms (SNPs) identified in cytokine genes are thought to influence the expression or function of these proteins and many have been evaluated for their role in inflammatory disease and cancer predisposition. The aim of this study was to evaluate any role of specific SNPs in the interleukin genes IL1A, IL1B, IL1RN, IL4R, IL6 and IL10 in predisposition to breast cancer susceptibility and severity. Methods Candidate single nucleotide polymorphisms (SNPs) in key cytokine genes were genotyped in breast cancer patients and in appropriate healthy volunteers who were similar in age, race and sex. Genotyping was performed using a high throughput allelic discrimination method. Data on clinico-pathological details and survival were collected. A systematic review of Medline English literature was done to retrieve previous studies of these polymorphisms in breast cancer. Results None of the polymorphisms studied showed any overall predisposition to breast cancer susceptibility, severity or to time to death or occurrence of distant metastases. The results of the systematic review are summarised. Conclusion Polymorphisms within key interleukin genes (IL1A, IL1B, IL1RN, IL4R, IL6 and IL10 do not appear to play a significant overall role in breast cancer susceptibility or severity. PMID:16842617

Effects of vertebral number variations on carcass traits and genotyping of Vertnin candidate gene in Kazakh sheep.

PubMed

Zhang, Zhifeng; Sun, Yawei; Du, Wei; He, Sangang; Liu, Mingjun; Tian, Changyan

2017-09-01

The vertebral number is associated with body length and carcass traits, which represents an economically important trait in farm animals. The variation of vertebral number has been observed in a few mammalian species. However, the variation of vertebral number and quantitative trait loci in sheep breeds have not been well addressed. In our investigation, the information including gender, age, carcass weight, carcass length and the number of thoracic and lumbar vertebrae from 624 China Kazakh sheep was collected. The effect of vertebral number variation on carcass weight and carcass length was estimated by general linear model. Further, the polymorphic sites of Vertnin ( VRTN ) gene were identified by sequencing, and the association of the genotype and vertebral number variation was analyzed by the one-way analysis of variance model. The variation of thoracolumbar vertebrae number in Kazakh sheep (18 to 20) was smaller than that in Texel sheep (17 to 21). The individuals with 19 thoracolumbar vertebrae (T13L6) were dominant in Kazakh sheep (79.2%). The association study showed that the numbers of thoracolumbar vertebrae were positively correlated with the carcass length and carcass weight, statistically significant with carcass length. To investigate the association of thoracolumbar vertebrae number with VRTN gene, we genotyped the VRTN gene. A total of 9 polymorphic sites were detected and only a single nucleotide polymorphism (SNP) (rs426367238) was suggested to associate with thoracic vertebral number statistically. The variation of thoracolumbar vertebrae number positively associated with the carcass length and carcass weight, especially with the carcass length. VRTN gene polymorphism of the SNP (rs426367238) with significant effect on thoracic vertebral number could be as a candidate marker to further evaluate its role in influence of thoracolumbar vertebral number.

Whole genome re-sequencing of date palms yields insights into diversification of a fruit tree crop.

PubMed

Hazzouri, Khaled M; Flowers, Jonathan M; Visser, Hendrik J; Khierallah, Hussam S M; Rosas, Ulises; Pham, Gina M; Meyer, Rachel S; Johansen, Caryn K; Fresquez, Zoë A; Masmoudi, Khaled; Haider, Nadia; El Kadri, Nabila; Idaghdour, Youssef; Malek, Joel A; Thirkhill, Deborah; Markhand, Ghulam S; Krueger, Robert R; Zaid, Abdelouahhab; Purugganan, Michael D

2015-11-09

Date palms (Phoenix dactylifera) are the most significant perennial crop in arid regions of the Middle East and North Africa. Here, we present a comprehensive catalogue of approximately seven million single nucleotide polymorphisms in date palms based on whole genome re-sequencing of a collection of 62 cultivars. Population structure analysis indicates a major genetic divide between North Africa and the Middle East/South Asian date palms, with evidence of admixture in cultivars from Egypt and Sudan. Genome-wide scans for selection suggest at least 56 genomic regions associated with selective sweeps that may underlie geographic adaptation. We report candidate mutations for trait variation, including nonsense polymorphisms and presence/absence variation in gene content in pathways for key agronomic traits. We also identify a copia-like retrotransposon insertion polymorphism in the R2R3 myb-like orthologue of the oil palm virescens gene associated with fruit colour variation. This analysis documents patterns of post-domestication diversification and provides a genomic resource for this economically important perennial tree crop.

Whole genome re-sequencing of date palms yields insights into diversification of a fruit tree crop

PubMed Central

Hazzouri, Khaled M.; Flowers, Jonathan M.; Visser, Hendrik J.; Khierallah, Hussam S. M.; Rosas, Ulises; Pham, Gina M.; Meyer, Rachel S.; Johansen, Caryn K.; Fresquez, Zoë A.; Masmoudi, Khaled; Haider, Nadia; El Kadri, Nabila; Idaghdour, Youssef; Malek, Joel A.; Thirkhill, Deborah; Markhand, Ghulam S.; Krueger, Robert R.; Zaid, Abdelouahhab; Purugganan, Michael D.

2015-01-01

Date palms (Phoenix dactylifera) are the most significant perennial crop in arid regions of the Middle East and North Africa. Here, we present a comprehensive catalogue of approximately seven million single nucleotide polymorphisms in date palms based on whole genome re-sequencing of a collection of 62 cultivars. Population structure analysis indicates a major genetic divide between North Africa and the Middle East/South Asian date palms, with evidence of admixture in cultivars from Egypt and Sudan. Genome-wide scans for selection suggest at least 56 genomic regions associated with selective sweeps that may underlie geographic adaptation. We report candidate mutations for trait variation, including nonsense polymorphisms and presence/absence variation in gene content in pathways for key agronomic traits. We also identify a copia-like retrotransposon insertion polymorphism in the R2R3 myb-like orthologue of the oil palm virescens gene associated with fruit colour variation. This analysis documents patterns of post-domestication diversification and provides a genomic resource for this economically important perennial tree crop. PMID:26549859

Study of five novel non-synonymous polymorphisms in human brain-expressed genes in a Colombian sample.

PubMed

Ojeda, Diego A; Forero, Diego A

2014-10-01

Non-synonymous single nucleotide polymorphisms (nsSNPs) in brain-expressed genes represent interesting candidates for genetic research in neuropsychiatric disorders. To study novel nsSNPs in brain-expressed genes in a sample of Colombian subjects. We applied an approach based on in silico mining of available genomic data to identify and select novel nsSNPs in brain-expressed genes. We developed novel genotyping assays, based in allele-specific PCR methods, for these nsSNPs and genotyped them in 171 Colombian subjects. Five common nsSNPs (rs6855837; p.Leu395Ile, rs2305160; p.Thr394Ala, rs10503929; p.Met289Thr, rs2270641; p.Thr4Pro and rs3822659; p.Ser735Ala) were studied, located in the CLOCK, NPAS2, NRG1, SLC18A1 and WWC1 genes. We reported allele and genotype frequencies in a sample of South American healthy subjects. There is previous experimental evidence, arising from genome-wide expression and association studies, for the involvement of these genes in several neuropsychiatric disorders and endophenotypes, such as schizophrenia, mood disorders or memory performance. Frequencies for these nsSNPSs in the Colombian samples varied in comparison to different HapMap populations. Future study of these nsSNPs in brain-expressed genes, a synaptogenomics approach, will be important for a better understanding of neuropsychiatric diseases and endophenotypes in different populations.

Using Single-nucleotide Polymorphisms and Genetic Mapping to find Candidate Genes that Influence Varroa-Specific Hygiene

USDA-ARS?s Scientific Manuscript database

Varroa-sensitive hygienic (VSH) behavior is one of two behaviors identified that are most important for controlling the growth of Varroa mite populations in bee hives. A study was conducted to map quantitative trait loci (QTL) that influence VSH so that resistance genes could be identified. Crosses ...

The Influence of Genetic and Environmental Factors among MDMA Users in Cognitive Performance

PubMed Central

Cuyàs, Elisabet; Verdejo-García, Antonio; Fagundo, Ana Beatriz; Khymenets, Olha; Rodríguez, Joan; Cuenca, Aida; de Sola Llopis, Susana; Langohr, Klaus; Peña-Casanova, Jordi; Torrens, Marta; Martín-Santos, Rocío; Farré, Magí; de la Torre, Rafael

2011-01-01

This study is aimed to clarify the association between MDMA cumulative use and cognitive dysfunction, and the potential role of candidate genetic polymorphisms in explaining individual differences in the cognitive effects of MDMA. Gene polymorphisms related to reduced serotonin function, poor competency of executive control and memory consolidation systems, and high enzymatic activity linked to bioactivation of MDMA to neurotoxic metabolites may contribute to explain variations in the cognitive impact of MDMA across regular users of this drug. Sixty ecstasy polydrug users, 110 cannabis users and 93 non-drug users were assessed using cognitive measures of Verbal Memory (California Verbal Learning Test, CVLT), Visual Memory (Rey-Osterrieth Complex Figure Test, ROCFT), Semantic Fluency, and Perceptual Attention (Symbol Digit Modalities Test, SDMT). Participants were also genotyped for polymorphisms within the 5HTT, 5HTR2A, COMT, CYP2D6, BDNF, and GRIN2B genes using polymerase chain reaction and TaqMan polymerase assays. Lifetime cumulative MDMA use was significantly associated with poorer performance on visuospatial memory and perceptual attention. Heavy MDMA users (>100 tablets lifetime use) interacted with candidate gene polymorphisms in explaining individual differences in cognitive performance between MDMA users and controls. MDMA users carrying COMT val/val and SERT s/s had poorer performance than paired controls on visuospatial attention and memory, and MDMA users with CYP2D6 ultra-rapid metabolizers performed worse than controls on semantic fluency. Both MDMA lifetime use and gene-related individual differences influence cognitive dysfunction in ecstasy users. PMID:22110616

The CIDEA gene V115F polymorphism is associated with obesity in Swedish subjects.

PubMed

Dahlman, Ingrid; Kaaman, Maria; Jiao, Hong; Kere, Juha; Laakso, Markku; Arner, Peter

2005-10-01

The cell death-inducing DFFA (DNA fragmentation factor-alpha)-like effector A (CIDEA) gene is implicated as an important regulator of body weight in mice and humans and is therefore a candidate gene for human obesity. Here, we characterize common CIDEA gene polymorphisms and investigate them for association with obesity in two independent Swedish samples; the first comprised 981 women and the second 582 men. Both samples display a large variation in BMI. The only detected coding polymorphism encodes an exon 4 V115F amino acid substitution, which is associated with BMI in both sexes (P = 0.021 for women, P = 0.023 for men, and P = 0.0015 for joint analysis). These results support a role for CIDEA alleles in human obesity. CIDEA-deficient mice display higher metabolic rate, and the gene cross-talks with tumor necrosis factor-alpha (TNF-alpha) in fat cells. We hypothesize that CIDEA alleles regulate human obesity through impact on basal metabolic rate and adipocyte TNF-alpha signaling.

Opioid system genes in alcoholism: a case-control study in Croatian population.

PubMed

Cupic, B; Stefulj, J; Zapletal, E; Matosic, A; Bordukalo-Niksic, T; Cicin-Sain, L; Gabrilovac, J

2013-10-01

Due to their involvement in dependence pathways, opioid system genes represent strong candidates for association studies investigating alcoholism. In this study, single nucleotide polymorphisms within the genes for mu (OPRM1) and kappa (OPRK1) opioid receptors and precursors of their ligands - proopiomelanocortin (POMC), coding for beta-endorphin and prodynorphin (PDYN) coding for dynorphins, were analyzed in a case-control study that included 354 male alcohol-dependent and 357 male control subjects from Croatian population. Analysis of allele and genotype frequencies of the selected polymorphisms of the genes OPRM1/POMC and OPRK1/PDYN revealed no differences between the tested groups. The same was true when alcohol-dependent persons were subdivided according to the Cloninger's criteria into type-1 and type-2 groups, known to differ in the extent of genetic control. Thus, the data obtained suggest no association of the selected polymorphisms of the genes OPRM1/POMC and OPRK1/PDYN with alcoholism in Croatian population. Copyright © 2013 Elsevier Ltd. All rights reserved.

Association of the G-250A promoter polymorphism in the hepatic lipase gene with the risk of type 2 diabetes mellitus.

PubMed

Ou, Lei; Yao, Li; Guo, Yihong; Fan, Suzhen

2013-02-01

Variants in hepatic lipase (HL) gene which is a lipolytic enzyme involved in the metabolism of plasma lipoprotein and regulating lipid and lipoprotein metabolism are potential candidate genes for type 2 diabetes. Association of the polymorphisms in the promoter region of the HL gene (LIPC) to the plasma HDL-C concentration has been investigated. In this study, we investigated whether the G-250A polymorphism of LIPC is associated with type 2 diabetes in Chinese Han population. A total of 130 patients with type 2 diabetes and 133 healthy subjects as control were randomly selected from January 2008 to January 2011 in endocrine wards of Zhengzhou People's Hospital. The G-250A polymorphisms were studied by polymerase chain reaction and restriction fragment length polymorphism. A logistic regression analysis was performed to determine the association between the rare allele and type 2 diabetes mellitus. The frequency of the -250A allele was 0.297 in the T2DM group and 0.388 in the control group (P<0.05), with the difference remaining significant. Patients who are carrying of the -250A allele in the promoter of the LIPC gene are susceptible to type 2 diabetes mellitus in Chinese Han population. Copyright © 2012 Elsevier Masson SAS. All rights reserved.

Gene expression underlying adaptive variation in Heliconius wing patterns: non-modular regulation of overlapping cinnabar and vermilion prepatterns.

PubMed

Reed, Robert D; McMillan, W Owen; Nagy, Lisa M

2008-01-07

Geographical variation in the mimetic wing patterns of the butterfly Heliconius erato is a textbook example of adaptive polymorphism; however, little is known about how this variation is controlled developmentally. Using microarrays and qPCR, we identified and compared expression of candidate genes potentially involved with a red/yellow forewing band polymorphism in H. erato. We found that transcripts encoding the pigment synthesis enzymes cinnabar and vermilion showed pattern- and polymorphism-related expression patterns, respectively. cinnabar expression was associated with the forewing band regardless of pigment colour, providing the first gene expression pattern known to be correlated with a major Heliconius colour pattern. In contrast, vermilion expression changed spatially over time in red-banded butterflies, but was not expressed at detectable levels in yellow-banded butterflies, suggesting that regulation of this gene may be involved with the red/yellow polymorphism. Furthermore, we found that the yellow pigment, 3-hydroxykynurenine, is incorporated into wing scales from the haemolymph rather than being synthesized in situ. We propose that some aspects of Heliconius colour patterns are determined by spatio-temporal overlap of pigment gene transcription prepatterns and speculate that evolutionary changes in vermilion regulation may in part underlie an adaptive colour pattern polymorphism.

CRAWview: for viewing splicing variation, gene families, and polymorphism in clusters of ESTs and full-length sequences.

PubMed

Chou, A; Burke, J

1999-05-01

DNA sequence clustering has become a valuable method in support of gene discovery and gene expression analysis. Our interest lies in leveraging the sequence diversity within clusters of expressed sequence tags (ESTs) to model gene structure for the study of gene variants that arise from, among other things, alternative mRNA splicing, polymorphism, and divergence after gene duplication, fusion, and translocation events. In previous work, CRAW was developed to discover gene variants from assembled clusters of ESTs. Most importantly, novel gene features (the differing units between gene variants, for example alternative exons, polymorphisms, transposable elements, etc.) that are specialized to tissue, disease, population, or developmental states can be identified when these tools collate DNA source information with gene variant discrimination. While the goal is complete automation of novel feature and gene variant detection, current methods are far from perfect and hence the development of effective tools for visualization and exploratory data analysis are of paramount importance in the process of sifting through candidate genes and validating targets. We present CRAWview, a Java based visualization extension to CRAW. Features that vary between gene forms are displayed using an automatically generated color coded index. The reporting format of CRAWview gives a brief, high level summary report to display overlap and divergence within clusters of sequences as well as the ability to 'drill down' and see detailed information concerning regions of interest. Additionally, the alignment viewing and editing capabilities of CRAWview make it possible to interactively correct frame-shifts and otherwise edit cluster assemblies. We have implemented CRAWview as a Java application across windows NT/95 and UNIX platforms. A beta version of CRAWview will be freely available to academic users from Pangea Systems (http://www.pangeasystems.com). Contact :

Shared heritability of attention-deficit/hyperactivity disorder and autism spectrum disorder.

PubMed

Rommelse, Nanda N J; Franke, Barbara; Geurts, Hilde M; Hartman, Catharina A; Buitelaar, Jan K

2010-03-01

Attention-deficit/hyperactivity disorder (ADHD) and autism spectrum disorder (ASD) are both highly heritable neurodevelopmental disorders. Evidence indicates both disorders co-occur with a high frequency, in 20-50% of children with ADHD meeting criteria for ASD and in 30-80% of ASD children meeting criteria for ADHD. This review will provide an overview on all available studies [family based, twin, candidate gene, linkage, and genome wide association (GWA) studies] shedding light on the role of shared genetic underpinnings of ADHD and ASD. It is concluded that family and twin studies do provide support for the hypothesis that ADHD and ASD originate from partly similar familial/genetic factors. Only a few candidate gene studies, linkage studies and GWA studies have specifically addressed this co-occurrence, pinpointing to some promising pleiotropic genes, loci and single nucleotide polymorphisms (SNPs), but the research field is in urgent need for better designed and powered studies to tackle this complex issue. We propose that future studies examining shared familial etiological factors for ADHD and ASD use a family-based design in which the same phenotypic (ADHD and ASD), candidate endophenotypic, and environmental measurements are obtained from all family members. Multivariate multi-level models are probably best suited for the statistical analysis.

Inflammatory Pathway Genes Associated with Inter-Individual Variability in the Trajectories of Morning and Evening Fatigue in Patients Receiving Chemotherapy

PubMed Central

Wright, Fay; Hammer, Marilyn; Paul, Steven M.; Aouizerat, Bradley E.; Kober, Kord M.; Conley, Yvette P.; Cooper, Bruce A.; Dunn, Laura B.; Levine, Jon D.; Melkus, Gail DEramo; Miaskowski, Christine

2017-01-01

Fatigue, a highly prevalent and distressing symptom during chemotherapy (CTX), demonstrates diurnal and interindividual variability in severity. Little is known about the associations between variations in genes involved in inflammatory processes and morning and evening fatigue severity during CTX. The purposes of this study, in a sample of oncology patients (N=543) with breast, gastrointestinal (GI), gynecological (GYN), or lung cancer who received two cycles of CTX, were to determine whether variations in genes involved in inflammatory processes were associated with inter-individual variability in initial levels as well as in the trajectories of morning and evening fatigue. Patients completed the Lee Fatigue Scale to determine morning and evening fatigue severity a total of six times over two cycles of CTX. Using a whole exome array, 309 single nucleotide polymorphisms among the 64 candidate genes that passed all quality control filters were evaluated using hierarchical linear modeling (HLM). Based on the results of the HLM analyses, the final SNPs were evaluated for their potential impact on protein function using two bioinformational tools. The following inflammatory pathways were represented: chemokines (3 genes); cytokines (12 genes); inflammasome (11 genes); Janus kinase/signal transducers and activators of transcription (JAK/STAT, 10 genes); mitogen-activated protein kinase/jun amino-terminal kinases (MAPK/JNK, 3 genes); nuclear factor-kappa beta (NFkB, 18 genes); and NFkB and MAP/JNK (7 genes). After controlling for self-reported and genomic estimates of race and ethnicity, polymorphisms in six genes from the cytokine (2 genes); inflammasome (2 genes); and NFkB (2 genes) pathways were associated with both morning and evening fatigue. Polymorphisms in six genes from the inflammasome (1 gene); JAK/STAT (1 gene); and NFkB (4 genes) pathways were associated with only morning fatigue. Polymorphisms in three genes from the inflammasome (2 genes) and the NFkB (1 gene) pathways were associated with only evening fatigue. Taken together, these findings add to the growing body of evidence that suggests that morning and evening fatigue are distinct symptoms. PMID:28110208

The leukemia inhibitory factor receptor gene is not involved in the etiology of pituitary dwarfism in German shepherd dogs.

PubMed

Hanson, J M; Mol, J A; Leegwater, P A J; Kooistra, H S; Meij, B P

2006-12-01

Pituitary dwarfism in German shepherd dogs is characterized by combined pituitary hormone deficiency (CPHD) and intrapituitary cyst formation. Activation of the leukemia inhibitory factor (LIF)-LIF receptor (LIFR) signal transduction pathway results in a similar phenotype in (transgenic) mice. We therefore assessed the role of the LIFR in the etiology of pituitary dwarfism in German shepherd dogs. A polymorphic microsatellite marker (UULIFR) was used to analyze the segregation of the LIFR gene in 22 German shepherd dogs from 4 pedigrees, each including one dwarf. There was no allelic association between UULIFR and the dwarfism phenotype. Based on our findings LIFR was excluded as a candidate gene for CPHD.

Pharmacogenetics of risperidone therapy in autism: association analysis of eight candidate genes with drug efficacy and adverse drug reactions.

PubMed

Correia, C T; Almeida, J P; Santos, P E; Sequeira, A F; Marques, C E; Miguel, T S; Abreu, R L; Oliveira, G G; Vicente, A M

2010-10-01

Little has been reported on the factors, genetic or other, that underlie the variability in individual response, particularly for autism. In this study we simultaneously explored the effects of multiple candidate genes on clinical improvement and occurrence of adverse drug reactions, in 45 autistic patients who received monotherapy with risperidone up to 1 year. Candidate genes involved in the pharmacokinetics (CYP2D6 and ABCB1) and pharmacodynamics (HTR2A, HTR2C, DRD2, DRD3, HTR6) of the drug, and the brain-derived neurotrophic factor (BDNF) gene, were analysed. Using the generalized estimating equation method these genes were tested for association with drug efficacy, assessed with the Autism Treatment Evaluation Checklist, and with safety and tolerability measures, such as prolactin levels, body mass index (BMI), waist circumference and neurological adverse effects, including extrapyramidal movements. Our results confirm that risperidone therapy was very effective in reducing some autism symptoms and caused few serious adverse effects. After adjusting for confounding factors, the HTR2A c.-1438G>A, DRD3 Ser9Gly, HTR2C c.995G>A and ABCB1 1236C>T polymorphisms were predictors for clinical improvement with risperidone therapy. The HTR2A c.-1438G>A, HTR2C c.68G>C (p.C33S), HTR6 c.7154-2542C>T and BDNF c.196G>A (p.V66M) polymorphisms influenced prolactin elevation. HTR2C c.68G>C and CYP2D6 polymorphisms were associated with risperidone-induced increase in BMI or waist circumference. We thus identified for the first time several genes implicated in risperidone efficacy and safety in autism patients. Although association results require replication, given the small sample size, the study makes a preliminary contribution to the personalized therapy of risperidone in autism.

Genetic polymorphisms for estimating risk of atrial fibrillation: a literature-based meta-analysis

PubMed Central

Smith, J. Gustav; Almgren, Peter; Engström, Gunnar; Hedblad, Bo; Platonov, Pyotr G.; Newton-Cheh, Christopher; Melander, Olle

2013-01-01

Objectives Genome-wide association studies have recently identified genetic polymorphisms associated with common, etiologically complex diseases, for which direct-to-consumer genetic testing with provision of absolute genetic risk estimates is marketed by commercial companies. Polymorphisms associated with atrial fibrillation (AF) have shown relatively large risk estimates but the robustness of such estimates across populations and study designs has not been studied. Design A systematic literature review with meta-analysis and assessment of between-study heterogeneity was performed for single nucleotide polymorphisms (SNPs) in the six genetic regions associated with AF in genome-wide or candidate gene studies. Results Data from 18 samples of European ancestry (n=12,100 cases; 115,702 controls) were identified for the SNP on chromosome 4q25 (rs220733), 16 samples (n=12,694 cases; 132,602 controls) for the SNP on 16q22 (rs2106261) and 4 samples (n=5,272 cases; 59,725 controls) for the SNP in KCNH2 (rs1805123). Only the discovery studies were identified for SNPs on 1q21 and in GJA5 and IL6R, why no meta-analyses were performed for those SNPs. In overall random-effects meta-analyses, association with AF was observed for both SNPs from genome-wide studies on 4q25 (OR 1.67, 95% CI=1.50–1.86, p=2×10−21) and 16q22 (OR 1.21, 95% CI=1.13–1.29, p=1×10−8), but not the SNP in KCNH2 from candidate gene studies (p=0.15). There was substantial effect heterogeneity across case-control and cross-sectional studies for both polymorphisms (I2=0.50–0.78, p<0.05), but not across prospective cohort studies (I2=0.39, p=0.15). Both polymorphisms were robustly associated with AF for each study design individually (p<0.05). Conclusions In meta-analyses including up to 150,000 individuals, polymorphisms in two genetic regions were robustly associated with AF across all study designs but with substantial context-dependency of risk estimates. PMID:22690879

Identification and Evolutionary Analysis of Potential Candidate Genes in a Human Eating Disorder.

PubMed

Sabbagh, Ubadah; Mullegama, Saman; Wyckoff, Gerald J

2016-01-01

The purpose of this study was to find genes linked with eating disorders and associated with both metabolic and neural systems. Our operating hypothesis was that there are genetic factors underlying some eating disorders resting in both those pathways. Specifically, we are interested in disorders that may rest in both sleep and metabolic function, generally called Night Eating Syndrome (NES). A meta-analysis of the Gene Expression Omnibus targeting the mammalian nervous system, sleep, and obesity studies was performed, yielding numerous genes of interest. Through a text-based analysis of the results, a number of potential candidate genes were identified. VGF, in particular, appeared to be relevant both to obesity and, broadly, to brain or neural development. VGF is a highly connected protein that interacts with numerous targets via proteolytically digested peptides. We examined VGF from an evolutionary perspective to determine whether other available evidence supported a role for the gene in human disease. We conclude that some of the already identified variants in VGF from human polymorphism studies may contribute to eating disorders and obesity. Our data suggest that there is enough evidence to warrant eGWAS and GWAS analysis of these genes in NES patients in a case-control study.

Effect of the g.-723G-->T polymorphism in the bovine myogenic factor 5 (Myf5) gene promoter region on gene transcript level in the longissimus dorsi muscle and on meat traits of Polish Holstein-Friesian cattle.

PubMed

Robakowska-Hyzorek, Dagmara; Oprzadek, Jolanta; Zelazowska, Beata; Olbromski, Rafał; Zwierzchowski, Lech

2010-06-01

Myogenic factor 5 (Myf5), a product of the Myf5 gene, belongs to the MRF family of basic helix-loop-helix transcription factors that regulate myogenesis. Their roles in muscle growth and development make their genes candidates for molecular markers of meat production in livestock, but nucleotide sequence polymorphism has not been thoroughly studied in MRF genes. We detected four single nucleotide polymorphisms (SNPs) within exon 1 of the Myf5 gene, encoding the NH-terminal transactivation domain of the Myf5 protein. Three of these mutations change the amino acid sequence. The distribution of these SNPs was highly skewed in cattle populations; most of the mutations were found in only a few or even single individuals. Of the nine SNPs found in the promoter region of Myf5, one (transversion g.-723G-->T) was represented by all three genotypes distributed in the cattle populations studied. This polymorphism showed an influence on Myf5 gene expression in the longissimus dorsi muscle and was associated with sirloin weight and fat weight in sirloin in carcasses of Holstein-Friesian cattle.

Identification and prioritization of NUAK1 and PPP1CC as positional candidate loci for skeletal muscle strength phenotypes

PubMed Central

Windelinckx, An; De Mars, Gunther; Huygens, Wim; Peeters, Maarten W.; Vincent, Barbara; Wijmenga, Cisca; Lambrechts, Diether; Aerssens, Jeroen; Vlietinck, Robert; Beunen, Gaston

2011-01-01

Muscle strength is an important determinant in elite sports performance as well as in the activities of daily living. Muscle metabolism also plays a role in the genesis, and therefore prevention, of common pathological conditions and chronic diseases. Even though heritability estimates between 31 and 78% suggest a significant genetic component in muscle strength, only a limited number of genes influencing muscle strength have been identified. This study aimed to identify and prioritize positional candidate genes within a skeletal muscle strength quantitative trait locus on chromosome 12q22-23 for follow-up. A two-staged gene-centered fine-mapping approach using 122 single nucleotide polymorphisms (SNPs) in stage 1 identified a familybased association (n = 500) between several tagSNPs located in the ATPase, Ca2+ transporting, cardiac muscle, slow twitch 2 (ATP2A2; rs3026468), the NUAK family, SNF1-like kinase, 1 (NUAK1; rs10861553 and rs3741886), and the protein phosphatase 1, catalytic subunit, gamma isoform (PPP1CC; rs1050587 and rs7901769) genes and knee torque production (P values up to 0.00092). In stage 2, family-based association tests on additional putatively functional SNPs (e.g., exonic SNPs, SNPs in transcription factor binding sites or in conserved regions) in an enlarged sample (n = 536; 464 individuals overlap with stage 1) did not identify additional associations with muscle strength characteristics. Further in-depth analyses will be necessary to elucidate the exact role of ATP2A2, PPP1CC, and NUAK1 in muscle strength and to find out which functional polymorphisms are at the base of the interindividual strength differences. PMID:21750233

QTL analysis of citrus tristeza virus-citradia interaction.

PubMed

Asins, M J; Bernet, G P; Ruiz, C; Cambra, M; Guerri, J; Carbonell, E A

2004-02-01

Citrus tristeza virus (CTV) has caused the death of millions of trees grafted on sour orange ( Citrus aurantium). However, this rootstock is very well adapted to the Mediterranean, semi-arid conditions. The aim of the present research is to genetically analyze the accumulation of CTV in a progeny derived from the cross between C. aurantium and Poncirus trifoliata, both resistant to CTV isolate T-346. Graft propagation of 104 hybrids was done on healthy sweet orange as a rootstock. Three months later, each rootstock was graft inoculated with two patches of infected tissue (isolate T-346). One, 2, and sometimes, 3 and 4 years after inoculation, hybrids and infected patches were tested for CTV by tissue-blot immuno-assay. Additionally, CTV multiplication was evaluated every year as the optical density of double-antibody sandwich enzyme-linked immuno-sorbent assay reactions. Linkage maps for P. trifoliata based on 63 markers, and for C. aurantium based on 157 markers, were used. Most molecular markers were microsatellites and IRAP (inter-retrotransposon amplified polymorphisms). Some analogues of resistance and expressed sequences were also included for candidate gene analysis. Resistance against CTV was analyzed as a quantitative trait (CTV accumulation) by QTL (quantitative trait loci) analysis to avoid the assumption of monogenic control. Three major resistance QTLs were detected where the P. trifoliata resistance gene, Ctv-R, had been previously located in other progenies. Up to five minor QTLs were detected ( Ctv-A(1) to Ctv-A(5)). A significant epistatic interaction involving Ctv-R(1) and Ctv-A(1) was also found. An analogue of a resistance gene is a candidate for Ctv-A(3), and two expressed sequences are candidates for Ctv-A(1) and Ctv-A(5). Single-strand conformational polymorphism analysis of CTV genes QTL P20 and P25 (coat protein) in susceptible hybrids, was carried out to test whether or not any QTL accumulation was a defeated resistance gene. Since the same haplotype of the virus was visualized independently on the CTV titer, differences in the amount of virions are not explained through the selection of CTV genotypes by the host, but through differences among citradias in CTV replication and/or movement.

Gene-gene interactions among genetic variants from obesity candidate genes for nonobese and obese populations in type 2 diabetes.

PubMed

Lin, Eugene; Pei, Dee; Huang, Yi-Jen; Hsieh, Chang-Hsun; Wu, Lawrence Shih-Hsin

2009-08-01

Recent studies indicate that obesity may play a key role in modulating genetic predispositions to type 2 diabetes (T2D). This study examines the main effects of both single-locus and multilocus interactions among genetic variants in Taiwanese obese and nonobese individuals to test the hypothesis that obesity-related genes may contribute to the etiology of T2D independently and/or through such complex interactions. We genotyped 11 single nucleotide polymorphisms for 10 obesity candidate genes including adrenergic beta-2-receptor surface, adrenergic beta-3-receptor surface, angiotensinogen, fat mass and obesity associated gene, guanine nucleotide binding protein beta polypeptide 3 (GNB3), interleukin 6 receptor, proprotein convertase subtilisin/kexin type 1 (PCSK1), uncoupling protein 1, uncoupling protein 2, and uncoupling protein 3. There were 389 patients diagnosed with T2D and 186 age- and sex-matched controls. Single-locus analyses showed significant main effects of the GNB3 and PCSK1 genes on the risk of T2D among the nonobese group (p = 0.002 and 0.047, respectively). Further, interactions involving GNB3 and PCSK1 were suggested among the nonobese population using the generalized multifactor dimensionality reduction method (p = 0.001). In addition, interactions among angiotensinogen, fat mass and obesity associated gene, GNB3, and uncoupling protein 3 genes were found in a significant four-locus generalized multifactor dimensionality reduction model among the obese population (p = 0.001). The results suggest that the single nucleotide polymorphisms from the obesity candidate genes may contribute to the risk of T2D independently and/or in an interactive manner according to the presence or absence of obesity.

Contribution of NKX2-3 Polymorphisms to Inflammatory Bowel Diseases: A Meta-Analysis of 35358 subjects

PubMed Central

Lu, XiaoCheng; Tang, Linjun; Li, Kai; Zheng, JinYu; Zhao, Penglai; Tao, Yi; Li, Li-Xin

2014-01-01

Polymorphisms in NKX2-3 gene have been inconsistently associated with Crohn's disease (CD) and ulcerative colitis (UC). To generate large-scale evidence on whether NKX2-3 polymorphisms are associated with CD or UC susceptibility we have conducted a meta-analysis of 17 studies involving 17329 patients and 18029 controls. A significantly increased CD or UC risk was observed in persons carrying a G allele at rs10883365 polymorphism (A/G) compared with those with a A allele. (OR = 1.226, 95%CI: 1.177–1.277 and OR = 1.274, 95%CI: 1.175–1.382 respectively). In the subgroup analysis, a significantly increased CD risk was found in both Europeans and Asians. For rs11190140 polymorphism (C/T) and CD risk, the risk estimate for the allele contrast was OR = 1.201 (1.136–1.269). This meta-analysis provided a robust result that persons with a G or T allele may have a moderately increased risk of CD, and suggested that rs10883365 polymorphism was also a candidate gene polymorphism for UC susceptibility. PMID:24473197

A combinatorial approach of comprehensive QTL-based comparative genome mapping and transcript profiling identified a seed weight-regulating candidate gene in chickpea

PubMed Central

Bajaj, Deepak; Upadhyaya, Hari D.; Khan, Yusuf; Das, Shouvik; Badoni, Saurabh; Shree, Tanima; Kumar, Vinod; Tripathi, Shailesh; Gowda, C. L. L.; Singh, Sube; Sharma, Shivali; Tyagi, Akhilesh K.; Chattopdhyay, Debasis; Parida, Swarup K.

2015-01-01

High experimental validation/genotyping success rate (94–96%) and intra-specific polymorphic potential (82–96%) of 1536 SNP and 472 SSR markers showing in silico polymorphism between desi ICC 4958 and kabuli ICC 12968 chickpea was obtained in a 190 mapping population (ICC 4958 × ICC 12968) and 92 diverse desi and kabuli genotypes. A high-density 2001 marker-based intra-specific genetic linkage map comprising of eight LGs constructed is comparatively much saturated (mean map-density: 0.94 cM) in contrast to existing intra-specific genetic maps in chickpea. Fifteen robust QTLs (PVE: 8.8–25.8% with LOD: 7.0–13.8) associated with pod and seed number/plant (PN and SN) and 100 seed weight (SW) were identified and mapped on 10 major genomic regions of eight LGs. One of 126.8 kb major genomic region harbouring a strong SW-associated robust QTL (Caq'SW1.1: 169.1–171.3 cM) has been delineated by integrating high-resolution QTL mapping with comprehensive marker-based comparative genome mapping and differential expression profiling. This identified one potential regulatory SNP (G/A) in the cis-acting element of candidate ERF (ethylene responsive factor) TF (transcription factor) gene governing seed weight in chickpea. The functionally relevant molecular tags identified have potential to be utilized for marker-assisted genetic improvement of chickpea. PMID:25786576

Single nucleotide polymorphisms in CETP, SLC46A1, SLC19A1, CD36, BCOM1, APOA5, and ABCA1 are significant predictors of plasma HDL in healthy adults

USDA-ARS?s Scientific Manuscript database

In a marker-trait association study we estimated the statistical significance of 65 single nucleotide polymorphisms (SNP) in 23 candidate genes on HDL levels of two independent Caucasian populations. Each population consisted of men and women and their HDL levels were adjusted for gender and body we...

Polymorphism of the ACE gene and the risk of obstructive sleep apnoea.

PubMed

Chmielewska, Izabela; Mlak, Radosław; Krawczyk, Paweł; Czukiewska, Ewa; Milanowski, Janusz

2013-01-01

Obstructive sleep apnoea/hypopnea syndrome (OSA) is characterized by obstruction of the upper airway during sleep, resulting in repetitive breathing pauses accompanied by oxygen desaturation and arousal from sleep. Among the candidate genes affecting the risk of OSA, genes whose polymorphisms influence the development of diseases with similar pathogenesis such as OSA could be listed: APOE, genes for leptin and leptin receptor, TNFA1, ADRB2 and ACE (gene for angiotensin-converting enzyme). Until now there has been a confirmed relationship between ACE gene polymorphism and cardiovascular diseases, but its effect on the incidence of OSA is debatable. The aim of this study was to investigate the effect of ACE gene insertion/deletion (I/D) polymorphism on the risk of OSA. Fifty-five patients with confirmed diagnose of OSA and qualified to CPAP therapy entered the study. The control group included 50 subjects who did not complain of any sleep related symptoms. Diagnose of OSA was set on the basis of full overnight polysomnography together with Epworth Sleepiness Scale according to American Academy of Sleep Medicine guidelines. DNA was isolated from peripheral blood leukocytes with Qiagen DNA mini Kit. ACE gene polymorphism was determined in genomic DNA using allele specific polymerase chain reaction. Different sizes of PCR products were observed on agarose gel electrophoresis. There were non-significant differences in the frequency of ACE genotypes. However, allele D had significantly lower prevalence in the study group than in the control group. (χ(2) = 4.25 p = 0.04). Moreover, I allele carriers had a threefold greater risk of developing OSA (HR = 2.748, 95% CI = 1.029-7.340, p < 0.05). Analysis of ACE gene polymorphism might be useful to determine the risk of developing OSA in clinically predisposed patients.

Immunogenetic Factors Affecting Susceptibility of Humans and Rodents to Hantaviruses and the Clinical Course of Hantaviral Disease in Humans

PubMed Central

Charbonnel, Nathalie; Pagès, Marie; Sironen, Tarja; Henttonen, Heikki; Vapalahti, Olli; Mustonen, Jukka; Vaheri, Antti

2014-01-01

We reviewed the associations of immunity-related genes with susceptibility of humans and rodents to hantaviruses, and with severity of hantaviral diseases in humans. Several class I and class II HLA haplotypes were linked with severe or benign hantavirus infections, and these haplotypes varied among localities and hantaviruses. The polymorphism of other immunity-related genes including the C4A gene and a high-producing genotype of TNF gene associated with severe PUUV infection. Additional genes that may contribute to disease or to PUUV infection severity include non-carriage of the interleukin-1 receptor antagonist (IL-1RA) allele 2 and IL-1β (-511) allele 2, polymorphisms of plasminogen activator inhibitor (PAI-1) and platelet GP1a. In addition, immunogenetic studies have been conducted to identify mechanisms that could be linked with the persistence/clearance of hantaviruses in reservoirs. Persistence was associated during experimental infections with an upregulation of anti-inflammatory responses. Using natural rodent population samples, polymorphisms and/or expression levels of several genes have been analyzed. These genes were selected based on the literature of rodent or human/hantavirus interactions (some Mhc class II genes, Tnf promoter, and genes encoding the proteins TLR4, TLR7, Mx2 and β3 integrin). The comparison of genetic differentiation estimated between bank vole populations sampled over Europe, at neutral and candidate genes, has allowed to evidence signatures of selection for Tnf, Mx2 and the Drb Mhc class II genes. Altogether, these results corroborated the hypothesis of an evolution of tolerance strategies in rodents. We finally discuss the importance of these results from the medical and epidemiological perspectives. PMID:24859344

Genetic neuropathology of obsessive psychiatric syndromes

PubMed Central

Jaffe, A E; Deep-Soboslay, A; Tao, R; Hauptman, D T; Kaye, W H; Arango, V; Weinberger, D R; Hyde, T M; Kleinman, J E

2014-01-01

Anorexia nervosa (AN), bulimia nervosa (BN) and obsessive-compulsive disorder (OCD) are complex psychiatric disorders with shared obsessive features, thought to arise from the interaction of multiple genes of small effect with environmental factors. Potential candidate genes for AN, BN and OCD have been identified through clinical association and neuroimaging studies; however, recent genome-wide association studies of eating disorders (ED) so far have failed to report significant findings. In addition, few, if any, studies have interrogated postmortem brain tissue for evidence of expression quantitative trait loci (eQTLs) associated with candidate genes, which has particular promise as an approach to elucidating molecular mechanisms of association. We therefore selected single-nucleotide polymorphisms (SNPs) based on candidate gene studies for AN, BN and OCD from the literature, and examined the association of these SNPs with gene expression across the lifespan in prefrontal cortex of a nonpsychiatric control cohort (N=268). Several risk-predisposing SNPs were significantly associated with gene expression among control subjects. We then measured gene expression in the prefrontal cortex of cases previously diagnosed with obsessive psychiatric disorders, for example, ED (N=15) and OCD/obsessive-compulsive personality disorder or tics (OCD/OCPD/Tic; N=16), and nonpsychiatric controls (N=102) and identified 6 and 286 genes that were differentially expressed between ED compared with controls and OCD cases compared with controls, respectively (false discovery rate (FDR) <5%). However, none of the clinical risk SNPs were among the eQTLs and none were significantly associated with gene expression within the broad obsessive cohort, suggesting larger sample sizes or other brain regions may be required to identify candidate molecular mechanisms of clinical association in postmortem brain data sets. PMID:25180571

Genetic neuropathology of obsessive psychiatric syndromes.

PubMed

Jaffe, A E; Deep-Soboslay, A; Tao, R; Hauptman, D T; Kaye, W H; Arango, V; Weinberger, D R; Hyde, T M; Kleinman, J E

2014-09-02

Anorexia nervosa (AN), bulimia nervosa (BN) and obsessive-compulsive disorder (OCD) are complex psychiatric disorders with shared obsessive features, thought to arise from the interaction of multiple genes of small effect with environmental factors. Potential candidate genes for AN, BN and OCD have been identified through clinical association and neuroimaging studies; however, recent genome-wide association studies of eating disorders (ED) so far have failed to report significant findings. In addition, few, if any, studies have interrogated postmortem brain tissue for evidence of expression quantitative trait loci (eQTLs) associated with candidate genes, which has particular promise as an approach to elucidating molecular mechanisms of association. We therefore selected single-nucleotide polymorphisms (SNPs) based on candidate gene studies for AN, BN and OCD from the literature, and examined the association of these SNPs with gene expression across the lifespan in prefrontal cortex of a nonpsychiatric control cohort (N=268). Several risk-predisposing SNPs were significantly associated with gene expression among control subjects. We then measured gene expression in the prefrontal cortex of cases previously diagnosed with obsessive psychiatric disorders, for example, ED (N=15) and OCD/obsessive-compulsive personality disorder or tics (OCD/OCPD/Tic; N=16), and nonpsychiatric controls (N=102) and identified 6 and 286 genes that were differentially expressed between ED compared with controls and OCD cases compared with controls, respectively (false discovery rate (FDR) <5%). However, none of the clinical risk SNPs were among the eQTLs and none were significantly associated with gene expression within the broad obsessive cohort, suggesting larger sample sizes or other brain regions may be required to identify candidate molecular mechanisms of clinical association in postmortem brain data sets.

Validation of candidate genes associated with cardiovascular risk factors in psychiatric patients

PubMed Central

Windemuth, Andreas; de Leon, Jose; Goethe, John W.; Schwartz, Harold I.; Woolley, Stephen; Susce, Margaret; Kocherla, Mohan; Bogaard, Kali; Holford, Theodore R.; Seip, Richard L.; Ruaño, Gualberto

2016-01-01

The purpose of this study was to identify genetic variants predictive of cardiovascular risk factors in a psychiatric population treated with second generation antipsychotics (SGA). 924 patients undergoing treatment for severe mental illness at four US hospitals were genotyped at 1.2 million single nucleotide polymorphisms. Patients were assessed for fasting serum lipid (low density lipoprotein cholesterol [LDLc], high density lipoprotein cholesterol [HDLc], and triglycerides) and obesity phenotypes (body mass index, BMI). Thirteen candidate genes from previous studies of the same phenotypes in non-psychiatric populations were tested for association. We confirmed 8 of the 13 candidate genes at the 95% confidence level. An increased genetic effect size was observed for triglycerides in the psychiatric population compared to that in the cardiovascular population. PMID:21851846

Promoter Polymorphisms in the Nitric Oxide Synthase 3 Gene Are Associated With Ischemic Stroke Susceptibility in Young Black Women

PubMed Central

Howard, Timothy D.; Giles, Wayne H.; Xu, Jianfeng; Wozniak, Marcella A.; Malarcher, Ann M.; Lange, Leslie A.; Macko, Richard F.; Basehore, Monica J.; Meyers, Deborah A.; Cole, John W.; Kittner, Steven J.

2006-01-01

Background and Purpose Endothelial nitric oxide exerts a variety of protective effects on endothelial cells and blood vessels, and therefore the nitric oxide synthase 3 gene (NOS3) is a logical candidate gene for stroke susceptibility. Methods We used the population-based Stroke Prevention in Young Women case-control study to assess the association of five NOS3 polymorphisms in 110 cases (46% black) with ischemic stroke and 206 controls (38% black), 15 to 44 years of age. Polymorphisms included 3 single nucleotide polymorphisms (SNPs) in the promoter region (−1468 T>A, −922 G>A, −786 T>C), 1 SNP in exon 7 (G894T), and 1 insertion/deletion polymorphism within intron 4. Results Significant associations with both the −922 G>A and −786 T>C SNPs with ischemic stroke were observed in the black, but not the white, population. This association was attributable to an increased prevalence of the −922 A allele (OR=3.0, 95% CI=1.3 to 6.8; P=0.005) and the −786 T allele (OR=2.9, 95% CI=1.3 to 6.4; P=0.005) in cases versus controls. These 2 SNPs were in strong linkage disequilibrium (D′=1.0), making it impossible to determine, within the confines of this genetic study, whether 1 or both of these polymorphisms are functionally related to NOS3 expression. Two sets of haplotypes were also identified, 1 of which may confer an increased susceptibility to stroke in blacks, whereas the other appears to be protective. Conclusion Promoter variants in NOS3 may be associated with ischemic stroke susceptibility among young black women. PMID:16100023

Promoter polymorphisms in the nitric oxide synthase 3 gene are associated with ischemic stroke susceptibility in young black women.

PubMed

Howard, Timothy D; Giles, Wayne H; Xu, Jianfeng; Wozniak, Marcella A; Malarcher, Ann M; Lange, Leslie A; Macko, Richard F; Basehore, Monica J; Meyers, Deborah A; Cole, John W; Kittner, Steven J

2005-09-01

Endothelial nitric oxide exerts a variety of protective effects on endothelial cells and blood vessels, and therefore the nitric oxide synthase 3 gene (NOS3) is a logical candidate gene for stroke susceptibility. We used the population-based Stroke Prevention in Young Women case-control study to assess the association of five NOS3 polymorphisms in 110 cases (46% black) with ischemic stroke and 206 controls (38% black), 15 to 44 years of age. Polymorphisms included 3 single nucleotide polymorphisms (SNPs) in the promoter region (-1468 T>A, -922 G>A, -786 T>C), 1 SNP in exon 7 (G894T), and 1 insertion/deletion polymorphism within intron 4. Significant associations with both the -922 G>A and -786 T>C SNPs with ischemic stroke were observed in the black, but not the white, population. This association was attributable to an increased prevalence of the -922 A allele (OR=3.0, 95% CI=1.3 to 6.8; P=0.005) and the -786 T allele (OR=2.9, 95% CI=1.3 to 6.4; P=0.005) in cases versus controls. These 2 SNPs were in strong linkage disequilibrium (D'=1.0), making it impossible to determine, within the confines of this genetic study, whether 1 or both of these polymorphisms are functionally related to NOS3 expression. Two sets of haplotypes were also identified, 1 of which may confer an increased susceptibility to stroke in blacks, whereas the other appears to be protective. Promoter variants in NOS3 may be associated with ischemic stroke susceptibility among young black women.

Genetic variation in cell death genes and risk of non-Hodgkin lymphoma.

PubMed

Schuetz, Johanna M; Daley, Denise; Graham, Jinko; Berry, Brian R; Gallagher, Richard P; Connors, Joseph M; Gascoyne, Randy D; Spinelli, John J; Brooks-Wilson, Angela R

2012-01-01

Non-Hodgkin lymphomas are a heterogeneous group of solid tumours that constitute the 5(th) highest cause of cancer mortality in the United States and Canada. Poor control of cell death in lymphocytes can lead to autoimmune disease or cancer, making genes involved in programmed cell death of lymphocytes logical candidate genes for lymphoma susceptibility. We tested for genetic association with NHL and NHL subtypes, of SNPs in lymphocyte cell death genes using an established population-based study. 17 candidate genes were chosen based on biological function, with 123 SNPs tested. These included tagSNPs from HapMap and novel SNPs discovered by re-sequencing 47 cases in genes for which SNP representation was judged to be low. The main analysis, which estimated odds ratios by fitting data to an additive logistic regression model, used European ancestry samples that passed quality control measures (569 cases and 547 controls). A two-tiered approach for multiple testing correction was used: correction for number of tests within each gene by permutation-based methodology, followed by correction for the number of genes tested using the false discovery rate. Variant rs928883, near miR-155, showed an association (OR per A-allele: 2.80 [95% CI: 1.63-4.82]; p(F) = 0.027) with marginal zone lymphoma that is significant after correction for multiple testing. This is the first reported association between a germline polymorphism at a miRNA locus and lymphoma.

Assessment of Alzheimer’s disease case–control associations using family-based methods

PubMed Central

Schjeide, Brit-Maren M.; McQueen, Matthew B.; Mullin, Kristina; DiVito, Jason; Hogan, Meghan F.; Parkinson, Michele; Hooli, Basavaraj; Lange, Christoph; Blacker, Deborah; Tanzi, Rudolph E.

2009-01-01

The genetics of Alzheimer’s disease (AD) is heterogeneous and remains only ill-defined. We have recently created a freely available and continuously updated online database (AlzGene; http://www.alzgene.org) for which we collect all published genetic association studies in AD and perform systematic meta-analyses on all polymorphisms with sufficient genotype data. In this study, we tested 27 genes (ACE, BDNF, CH25H, CHRNB2, CST3, CTSD, DAPK1, GALP, hCG2039140, IL1B, LMNA, LOC439999, LOC651924, MAPT, MTHFR, MYH13, PCK1, PGBD1, PRNP, PSEN1, SORCS1, SORL1, TF, TFAM, TNK1, GWA_14q32.13, and GWA_7p15.2), all showing significant association with AD risk in the AlzGene meta-analyses, in a large collection of family-based samples comprised of 4,180 subjects from over 1,300 pedigrees. Overall, we observe significant association with risk for AD and polymorphisms in ACE, CHRNB2, TF, and an as yet uncharacterized locus on chromosome 7p15.2 [rs1859849]. For all four loci, the association was observed with the same alleles as in the AlzGene meta-analyses. The convergence of case–control and family-based findings suggests that these loci currently represent the most promising AD gene candidates. Further fine-mapping and functional analyses are warranted to elucidate the potential biochemical mechanisms and epidemiological relevance of these genes. PMID:18830724

HTR1A Polymorphisms and Clinical Efficacy of Antipsychotic Drug Treatment in Schizophrenia: A Meta-Analysis

PubMed Central

Fabbri, Chiara; Kato, Masaki; Koshikawa, Yosuke; Tajika, Aran; Kinoshita, Toshihiko; Serretti, Alessandro

2016-01-01

Background: This meta-analysis was conducted to evaluate whether HTR1A gene polymorphisms impact the efficacy of antipsychotic drugs in patients with schizophrenia. Methods: Candidate gene studies that were published in English up to August 6, 2015 were identified by a literature search of PubMed, Web of Science, and Google scholar. Data were pooled from individual clinical trials considering overall symptoms, positive symptoms and negative symptoms, and standard mean differences were calculated by applying a random-effects model. Results: The present meta-analysis included a total of 1281 patients from 10 studies. Three polymorphisms of HTR1A (rs6295, rs878567, and rs1423691) were selected for the analysis. In the pooled data from all studies, none of these HTR1A polymorphisms correlated significantly with either overall symptoms or positive symptoms. However, C allele carriers of the rs6295 polymorphism showed a significantly greater negative symptoms improvement than G allele carriers (P=.04, standardized mean difference =-0.14, 95％CI = 0.01 to 0.28). Conclusions: The results of our present analysis indicate that the HTR1A rs6295 polymorphism may impact negative symptoms improvement but not on either overall symptoms or positive symptoms improvement. However, this meta-analysis was based on a small number of studies and patients, and the effect size on negative symptoms was small. Given this limitation, the results should be confirmed by further investigations. PMID:26568455

Genome-wide scan for visceral leishmaniasis in mixed-breed dogs identifies candidate genes involved in T helper cells and macrophage signaling

USDA-ARS?s Scientific Manuscript database

We conducted a genome-wide scan for visceral leishmaniasis in mixed-breed dogs from a highly endemic area in Brazil using 149,648 single nucleotide polymorphism (SNP) markers genotyped in 20 cases and 28 controls. Using a mixed model approach, we found two candidate loci on canine autosomes 1 and 2....

How immunogenetically different are domestic pigs from wild boars: a perspective from single-nucleotide polymorphisms of 19 immunity-related candidate genes.

PubMed

Chen, Shanyuan; Gomes, Rui; Costa, Vânia; Santos, Pedro; Charneca, Rui; Zhang, Ya-ping; Liu, Xue-hong; Wang, Shao-qing; Bento, Pedro; Nunes, Jose-Luis; Buzgó, József; Varga, Gyula; Anton, István; Zsolnai, Attila; Beja-Pereira, Albano

2013-10-01

The coexistence of wild boars and domestic pigs across Eurasia makes it feasible to conduct comparative genetic or genomic analyses for addressing how genetically different a domestic species is from its wild ancestor. To test whether there are differences in patterns of genetic variability between wild and domestic pigs at immunity-related genes and to detect outlier loci putatively under selection that may underlie differences in immune responses, here we analyzed 54 single-nucleotide polymorphisms (SNPs) of 19 immunity-related candidate genes on 11 autosomes in three pairs of wild boar and domestic pig populations from China, Iberian Peninsula, and Hungary. Our results showed no statistically significant differences in allele frequency and heterozygosity across SNPs between three pairs of wild and domestic populations. This observation was more likely due to the widespread and long-lasting gene flow between wild boars and domestic pigs across Eurasia. In addition, we detected eight coding SNPs from six genes as outliers being under selection consistently by three outlier tests (BayeScan2.1, FDIST2, and Arlequin3.5). Among four non-synonymous outlier SNPs, one from TLR4 gene was identified as being subject to positive (diversifying) selection and three each from CD36, IFNW1, and IL1B genes were suggested as under balancing selection. All of these four non-synonymous variants were predicted as being benign by PolyPhen-2. Our results were supported by other independent lines of evidence for positive selection or balancing selection acting on these four immune genes (CD36, IFNW1, IL1B, and TLR4). Our study showed an example applying a candidate gene approach to identify functionally important mutations (i.e., outlier loci) in wild and domestic pigs for subsequent functional experiments.

Genetic dissection of ozone tolerance in rice (Oryza sativa L.) by a genome-wide association study

PubMed Central

Ueda, Yoshiaki; Frimpong, Felix; Qi, Yitao; Matthus, Elsa; Wu, Linbo; Höller, Stefanie; Kraska, Thorsten; Frei, Michael

2015-01-01

Tropospheric ozone causes various negative effects on plants and affects the yield and quality of agricultural crops. Here, we report a genome-wide association study (GWAS) in rice (Oryza sativa L.) to determine candidate loci associated with ozone tolerance. A diversity panel consisting of 328 accessions representing all subgroups of O. sativa was exposed to ozone stress at 60 nl l–1 for 7h every day throughout the growth season, or to control conditions. Averaged over all genotypes, ozone significantly affected biomass-related traits (plant height –1.0%, shoot dry weight –15.9%, tiller number –8.3%, grain weight –9.3%, total panicle weight –19.7%, single panicle weight –5.5%) and biochemical/physiological traits (symptom formation, SPAD value –4.4%, foliar lignin content +3.4%). A wide range of genotypic variance in response to ozone stress were observed in all phenotypes. Association mapping based on more than 30 000 single-nucleotide polymorphism (SNP) markers yielded 16 significant markers throughout the genome by applying a significance threshold of P<0.0001. Furthermore, by determining linkage disequilibrium blocks associated with significant SNPs, we gained a total of 195 candidate genes for these traits. The following sequence analysis revealed a number of novel polymorphisms in two candidate genes for the formation of visible leaf symptoms, a RING and an EREBP gene, both of which are involved in cell death and stress defence reactions. This study demonstrated substantial natural variation of responses to ozone in rice and the possibility of using GWAS in elucidating the genetic factors underlying ozone tolerance. PMID:25371505

Val158Met polymorphism in the COMT gene is associated with hypersomnia and mental health-related quality of life in a Colombian sample.

PubMed

Jiménez, Karen M; Pereira-Morales, Angela J; Forero, Diego A

2017-03-22

The identification of genes that are risk factors for major depressive disorder remains a main task for global psychiatric research. The Catechol-O-methyltransferase (COMT) gene has been an important candidate risk factor for several psychiatric disorders. Previous studies have shown that a functional polymorphism (Val158Met) in this gene has an effect on several brain circuits and endophenotypes of psychiatric relevance. The aim of this study was to explore the association of a functional polymorphism in the COMT gene with psychological distress, sleep problems and health-related quality of life. Two hundred seventy young Colombian subjects (mean age: 21.3 years; range: 18-57 years) completed the Patient Health Questionnaire-9, the Perceived Stress Scale, the Oviedo Sleep Questionnaire and the 12-Item Short-Form Health Survey and were genotyped for the Val158Met polymorphism (rs4680) in the COMT gene. A linear regression analysis, adjusting for potential confounding factors, was carried out. Subjects that were Met carriers (Val/Met and Met/Met genotypes) showed higher scores for hypersomnia (p=0.001) and lower scores for mental health-related quality of life (p=0.007), these associations remained significant after correcting for multiple testing. These findings support the hypothesis of a broad effect of the Val158Met polymorphism in the COMT gene on several dimensions of behavior and neuropsychiatric symptoms. Copyright © 2017 Elsevier B.V. All rights reserved.

Polymorphism of Cyp1a1 (T6235C) is not a significant risk factor of osteoporosis in postmenopausal Indonesian woman

NASA Astrophysics Data System (ADS)

Auerkari, EI; Budhy, LW; Kiranahayu, R.; Djamal, NZ; Kusdhany, LS; Rahardjo, TBW; Talbot, Christopher

2018-05-01

Osteoporosis is an increasingly common disease resulting in reduced bone mineral density (BMD) and elevated likelihood of bone fracture, and particularly affected are postmenopausal women with additional risk factors including genetic predisposition. The CYP1A1, is one of the candidate genes that have been suggested to be associated with the pathogenesis of osteoporosis. This work aimed to evaluate the distribution of a selected polymorphism of this gene (T6235C) with respect to the BMD status in postmenopausal Indonesian women. The results show that osteoporosis is associated with age and menopause, as expected, but not with the tested polymorphism of CYP1A1 in the Indonesian sample population. It is suggested that other P450 cytochrome enzymes and their polymorphisms could provide more significant indicators of the future health of postmenopausal women.

Discovering genetic variants in Crohn's disease by exploring genomic regions enriched of weak association signals.

PubMed

D'Addabbo, Annarita; Palmieri, Orazio; Maglietta, Rosalia; Latiano, Anna; Mukherjee, Sayan; Annese, Vito; Ancona, Nicola

2011-08-01

A meta-analysis has re-analysed previous genome-wide association scanning definitively confirming eleven genes and further identifying 21 new loci. However, the identified genes/loci still explain only the minority of genetic predisposition of Crohn's disease. To identify genes weakly involved in disease predisposition by analysing chromosomal regions enriched of single nucleotide polymorphisms with modest statistical association. We utilized the WTCCC data set evaluating 1748 CD and 2938 controls. The identification of candidate genes/loci was performed by a two-step procedure: first of all chromosomal regions enriched of weak association signals were localized; subsequently, weak signals clustered in gene regions were identified. The statistical significance was assessed by non parametric permutation tests. The cytoband enrichment analysis highlighted 44 regions (P≤0.05) enriched with single nucleotide polymorphisms significantly associated with the trait including 23 out of 31 previously confirmed and replicated genes. Importantly, we highlight further 20 novel chromosomal regions carrying approximately one hundred genes/loci with modest association. Amongst these we find compelling functional candidate genes such as MAPT, GRB2 and CREM, LCT, and IL12RB2. Our study suggests a different statistical perspective to discover genes weakly associated with a given trait, although further confirmatory functional studies are needed. Copyright © 2011 Editrice Gastroenterologica Italiana S.r.l. All rights reserved.

Epstein-Barr virus-induced gene 3 (EBI3) polymorphisms and expression are associated with susceptibility to pulmonary tuberculosis.

PubMed

Zheng, Ruijuan; Liu, Haipeng; Song, Peng; Feng, Yonghong; Qin, Lianhua; Huang, Xiaochen; Chen, Jianxia; Yang, Hua; Liu, Zhonghua; Cui, Zhenglin; Hu, Zhongyi; Ge, Baoxue

2015-07-01

Tuberculosis (TB) remains a major global health problem and host genetic factors play a critical role in susceptibility and resistance to TB. The aim of this study was to identify novel candidate genes associated with TB susceptibility. We performed a population-based case-control study to genotype 13 tag SNPs spanning Epstein-Barr virus-induced gene 3 (EBI3), colony stimulating factor 2 (CSF2), IL-4, interferon beta 1 (IFNB1), chemokine (C-X-C motif) ligand 14 (CXCL14) and myeloid differentiation primary response gene 88 (Myd88) genes in 435 pulmonary TB patients and 375 health donors from China. We observed that EBI3 gene rs4740 polymorphism was associated with susceptibility to pulmonary tuberculosis (PTB) and the allele G was associated with a protective effect against PTB. Furthermore, EBI3 deficiency led to reduced bacterial burden and histopathological impairment in the lung of mice infected with Mycobacterium bovis BCG. Meanwhile, higher abundance of EBI3 was observed in the granuloma of PTB patients and in the lung tissue of BCG-infected mice. Of note, the expression of EBI3 in macrophages was remarkably induced by mycobacteria infection at both mRNA and protein level. In conclusion, EBI3 gene rs4740 polymorphism is closely associated with susceptibility to PTB and the elevation and enrichment of EBI3 in the lung which at least partially derived from macrophages may contribute to the exacerbation of mycobacterial infection. Copyright © 2015 Elsevier Ltd. All rights reserved.

Food searching behaviour of a Lepidoptera pest species is modulated by the foraging gene polymorphism.

PubMed

Chardonnet, Floriane; Capdevielle-Dulac, Claire; Chouquet, Bastien; Joly, Nicolas; Harry, Myriam; Le Ru, Bruno; Silvain, Jean-François; Kaiser, Laure

2014-10-01

The extent of damage to crop plants from pest insects depends on the foraging behaviour of the insect's feeding stage. Little is known, however, about the genetic and molecular bases of foraging behaviour in phytophagous pest insects. The foraging gene (for), a candidate gene encoding a PKG-I, has an evolutionarily conserved function in feeding strategies. Until now, for had never been studied in Lepidoptera, which includes major pest species. The cereal stem borer Sesamia nonagrioides is therefore a relevant species within this order with which to study conservation of and polymorphism in the for gene, and its role in foraging - a behavioural trait that is directly associated with plant injuries. Full sequencing of for cDNA in S. nonagrioides revealed a high degree of conservation with other insect taxa. Activation of PKG by a cGMP analogue increased larval foraging activity, measured by how frequently larvae moved between food patches in an actimeter. We found one non-synonymous allelic variation in a natural population that defined two allelic variants. These variants presented significantly different levels of foraging activity, and the behaviour was positively correlated to gene expression levels. Our results show that for gene function is conserved in this species of Lepidoptera, and describe an original case of a single nucleotide polymorphism associated with foraging behaviour variation in a pest insect. By illustrating how variation in this single gene can predict phenotype, this work opens new perspectives into the evolutionary context of insect adaptation to plants, as well as pest management. © 2014. Published by The Company of Biologists Ltd.

BDNF val66met polymorphism is associated with age at onset and intensity of symptoms of paranoid schizophrenia in a Polish population.

PubMed

Suchanek, Renata; Owczarek, Aleksander; Paul-Samojedny, Monika; Kowalczyk, Małgorzata; Kucia, Krzysztof; Kowalski, Jan

2013-01-01

The brain-derived neurotrophic factor (BDNF) is one of the candidate genes for schizophrenia. There is evidence that val66met polymorphism may be involved in the pathophysiology of schizophrenia. The authors genotyped val66met (rs6265) polymorphism of the BDNF gene in 208 inpatients with paranoid schizophrenia and 254 control subjects in a Polish population. There was no association between val66met polymorphism and development of paranoid schizophrenia in either men or women. However, an association was found between this polymorphism and age at onset and psychopathology of paranoid schizophrenia. Men with the val/met genotype had an earlier age at onset, and the val/val genotype predisposed to more severe symptoms, particularly on the General Psychopathology Scale of the Positive and Negative Symptoms Scale (PANSS-G). The analysis of PANSS single items has shown that patients with the val/met genotype had higher scores on a hallucinatory behavior item than those with other genotypes.

No association between apolipoprotein E or N-acetyltransferase 2 gene polymorphisms and age-related hearing loss.

PubMed

Dawes, Piers; Platt, Hazel; Horan, Michael; Ollier, William; Munro, Kevin; Pendleton, Neil; Payton, Antony

2015-01-01

Age-related hearing loss has a genetic component, but there have been limited genetic studies in this field. Both N-acetyltransferase 2 and apolipoprotein E genes have previously been associated. However, these studies have either used small sample sizes, examined a limited number of polymorphisms, or have produced conflicting results. Here we use a haplotype tagging approach to determine association with age-related hearing loss and investigate epistasis between these two genes. Candidate gene association study of a continuous phenotype. We investigated haplotype tagging single nucleotide polymorphisms in the N-acetyltransferase 2 gene and the presence/absence of the apolipoprotein E ε4 allele for association with age-related hearing loss in a cohort of 265 Caucasian elderly volunteers from Greater Manchester, United Kingdom. Hearing phenotypes were generated using principal component analysis of the hearing threshold levels for the better ear (severity, slope, and concavity). Genotype data for the N-acetyltransferase 2 gene was obtained from existing genome-wide association study data from the Illumina 610-Quadv1 chip. Apolipoprotein E genotyping was performed using Sequenom technology. Linear regression analysis was performed using Plink and Stata software. No significant associations (P value, > 0.05) were observed between the N-acetyltransferase 2 or apolipoprotein E gene polymorphisms and any hearing factor. No significant association was observed for epistasis analysis of apolipoprotein E ε4 and the N-acetyltransferase 2 single nucleotide polymorphism rs1799930 (NAT2*6A). We found no evidence to support that either N-acetyltransferase 2 or apolipoprotein E gene polymorphisms are associated with age-related hearing loss in a cohort of 265 elderly volunteers. © 2014 The American Laryngological, Rhinological and Otological Society, Inc.

A Polymorphism in the Retinol Binding Protein 4 Gene is Not Associated with Gestational Diabetes Mellitus in Several Different Ethnic Groups

PubMed Central

Urschitz, Johann; Sultan, Omar; Ward, Kenneth

2011-01-01

Objective Various Asian and Pacifific Islander groups have higher prevalence rates of type 2 diabetes and gestational diabetes. This increased incidence is likely to include genetic factors. Single nucleotide polymorphisms in the retinol binding protein 4 gene have been linked to the occurrence of type 2 diabetes. Hypothesizing a link between retinol binding protein 4 and gestational diabetes, we performed a candidate gene study to look for an association between an important retinol binding protein gene polymorphism (rs3758539) and gestational diabetes. Study Design Blood was collected from Caucasian, Asian, and Pacific Islander women diagnosed with gestational diabetes and from ethnically matched non-diabetic controls. DNA was extracted and real time PCR technology (TaqMan, Applied Biosystems) used to screen for the rs3758539 single nucleotide polymorphism located 5′ of exon 1 of the retinol binding protein 4 gene. Results Genotype and allele frequencies in the controls and gestational diabetes cases were tested using chi-square contingency tests. Genotype frequencies were in Hardy-Weinberg equilibrium. There was no association between the rs3758539 retinol binding protein 4 single nucleotide polymorphism and gestational diabetes in the Caucasian, Filipino, or Pacific Islander groups. Conclusion Interestingly, the rs3758539 retinol binding protein 4 single nucleotide polymorphism was not found to be associated with gestational diabetes. The absence of association suggests that gestational and type 2 diabetes may have more divergent molecular pathophysiology than previously suspected. PMID:21886308

Clock gene polymorphism and scheduling of migration: a geolocator study of the barn swallow Hirundo rustica

PubMed Central

Bazzi, Gaia; Ambrosini, Roberto; Caprioli, Manuela; Costanzo, Alessandra; Liechti, Felix; Gatti, Emanuele; Gianfranceschi, Luca; Podofillini, Stefano; Romano, Andrea; Romano, Maria; Scandolara, Chiara; Saino, Nicola; Rubolini, Diego

2015-01-01

Circannual rhythms often rely on endogenous seasonal photoperiodic timers involving ‘clock’ genes, and Clock gene polymorphism has been associated to variation in phenology in some bird species. In the long-distance migratory barn swallow Hirundo rustica, individuals bearing the rare Clock allele with the largest number of C-terminal polyglutamine repeats found in this species (Q8) show a delayed reproduction and moult later. We explored the association between Clock polymorphism and migration scheduling, as gauged by light-level geolocators, in two barn swallow populations (Switzerland; Po Plain, Italy). Genetic polymorphism was low: 91% of the 64 individuals tracked year-round were Q7/Q7 homozygotes. We compared the phenology of the rare genotypes with the phenotypic distribution of Q7/Q7 homozygotes within each population. In Switzerland, compared to Q7/Q7, two Q6/Q7 males departed earlier from the wintering grounds and arrived earlier to their colony in spring, while a single Q7/Q8 female was delayed for both phenophases. On the other hand, in the Po Plain, three Q6/Q7 individuals had a similar phenology compared to Q7/Q7. The Swiss data are suggestive for a role of genetic polymorphism at a candidate phenological gene in shaping migration traits, and support the idea that Clock polymorphism underlies phenological variation in birds. PMID:26197782

Prevalence, Patterns, and Genetic Association Analysis of Modic Vertebral Endplate Changes

PubMed Central

Kanna, Rishi Mugesh; Rajagopalan, Veera Ranjani; Natesan, Senthil; Muthuraja, Raveendran; Cheung, Kenneth Man Chee; Chan, Danny; Kao, Patrick Yu Ping; Yee, Anita; Shetty, Ajoy Prasad

2017-01-01

Study Design A prospective genetic association study. Purpose The etiology of Modic changes (MCs) is unclear. Recently, the role of genetic factors in the etiology of MCs has been evaluated. However, studies with a larger patient subset are lacking, and candidate genes involved in other disc degeneration phenotypes have not been evaluated. We studied the prevalence of MCs and genetic association of 41 candidate genes in a large Indian cohort. Overview of Literature MCs are vertebral endplate signal changes predominantly observed in the lumbar spine. A significant association between MCs and lumbar disc degeneration and nonspecific low back pain has been described, with the etiopathogenesis implicating various mechanical, infective, and biochemical factors. Methods We studied 809 patients using 1.5-T magnetic resonance imaging to determine the prevalence, patterns, distribution, and type of lumbar MCs. Genetic association analysis of 71 single nucleotide polymorphisms (SNPs) of 41 candidate genes was performed based on the presence or absence of MCs. SNPs were genotyped using the Sequenome platform, and an association test was performed using PLINK software. Results The mean age of the study population (n=809) was 36.7±10.8 years. Based on the presence of MCs, the cohort was divided into 702 controls and 107 cases (prevalence, 13%). MCs were more commonly present in the lower (149/251, 59.4%) than in the upper (102/251, 40.6%) endplates. L4–5 endplates were the most commonly affected levels (30.7%). Type 2 MCs were the most commonly observed pattern (n=206, 82%). The rs2228570 SNP of VDR (p=0.02) and rs17099008 SNP of MMP20 (p=0.03) were significantly associated with MCs. Conclusions Genetic polymorphisms of SNPs of VDR and MMP20 were significantly associated with MCs. Understanding the etiopathogenetic mechanisms of MCs is important for planning preventive and therapeutic strategies. PMID:28874978

Xanthine urolithiasis in a cat: a case report and evaluation of a candidate gene for xanthine dehydrogenase.

PubMed

Tsuchida, Shuichi; Kagi, Akiko; Koyama, Hidekazu; Tagawa, Masahiro

2007-12-01

Xanthine urolithiasis was found in a 4-year-old spayed female Himalayan cat with a 10-month history of intermittent haematuria and dysuria. Ultrasonographs indicated the existence of several calculi in the bladder that were undetectable by survey radiographic examination. Four bladder stones were removed by cystotomy. The stones were spherical brownish-yellow and their surface was smooth and glossy. Quantitative mineral analysis showed a representative urolith to be composed of more than 95% xanthine. Ultrasonographic examination of the bladder 4.5 months postoperatively indicated the recurrence of urolithiasis. Analysis of purine concentration in urine and blood showed that the cat excreted excessive amounts of xanthine. In order to test the hypothesis that xanthinuria was caused by a homozygote of the inherited mutant allele of a gene responsible for deficiency of enzyme activity in purine degradation pathway, the allele composition of xanthine dehydrogenase (XDH) gene (one of the candidate genes for hereditary xanthinuria) was evaluated. The cat with xanthinuria was a heterozygote of the polymorphism. A single nucleotide polymorphism analysis of the cat XDH gene strongly indicated that the XDH gene of the patient cat was composed of two kinds of alleles and ruled out the hypothesis that the cat inherited the same recessive XDH allele suggesting no activity from a single ancestor.

Allelic association of sequence variants in the herpes virus entry mediator-B gene (PVRL2) with the severity of multiple sclerosis.

PubMed

Schmidt, S; Pericak-Vance, M A; Sawcer, S; Barcellos, L F; Hart, J; Sims, J; Prokop, A M; van der Walt, J; DeLoa, C; Lincoln, R R; Oksenberg, J R; Compston, A; Hauser, S L; Haines, J L; Gregory, S G

2006-07-01

Discrepant findings have been reported regarding an association of the apolipoprotein E (APOE) gene with the clinical course of multiple sclerosis (MS). To resolve these discrepancies, we examined common sequence variation in six candidate genes residing in a 380-kb genomic region surrounding and including the APOE locus for an association with MS severity. We genotyped at least three polymorphisms in each of six candidate genes in 1,540 Caucasian MS families (729 single-case and multiple-case families from the United States, 811 single-case families from the UK). By applying the quantitative transmission/disequilibrium test to a recently proposed MS severity score, the only statistically significant (P=0.003) association with MS severity was found for an intronic variant in the Herpes Virus Entry Mediator-B Gene PVRL2. Additional genotyping extended the association to a 16.6 kb block spanning intron 1 to intron 2 of the gene. Sequencing of PVRL2 failed to identify variants with an obvious functional role. In conclusion, the analysis of a very large data set suggests that genetic polymorphisms in PVRL2 may influence MS severity and supports the possibility that viral factors may contribute to the clinical course of MS, consistent with previous reports.

The candidate histocompatibility locus of a Basal chordate encodes two highly polymorphic proteins.

PubMed

Nydam, Marie L; Netuschil, Nikolai; Sanders, Erin; Langenbacher, Adam; Lewis, Daniel D; Taketa, Daryl A; Marimuthu, Arumugapradeep; Gracey, Andrew Y; De Tomaso, Anthony W

2013-01-01

The basal chordate Botryllus schlosseri undergoes a natural transplantation reaction governed by a single, highly polymorphic locus called the fuhc. Our initial characterization of this locus suggested it encoded a single gene alternatively spliced into two transcripts: a 555 amino acid-secreted form containing the first half of the gene, and a full-length, 1008 amino acid transmembrane form, with polymorphisms throughout the ectodomain determining outcome. We have now found that the locus encodes two highly polymorphic genes which are separated by a 227 bp intergenic region: first, the secreted form as previously described, and a second gene encoding a 531 amino acid membrane-bound gene containing three extracellular immunoglobulin domains. While northern blotting revealed only these two mRNAs, both PCR and mRNA-seq detect a single capped and polyadenylated transcript that encodes processed forms of both genes linked by the intergenic region, as well as other transcripts in which exons of the two genes are spliced together. These results might suggest that the two genes are expressed as an operon, during which both genes are co-transcribed and then trans-spliced into two separate messages. This type of transcriptional regulation has been described in tunicates previously; however, the membrane-bound gene does not encode a typical Splice Leader (SL) sequence at the 5' terminus that usually accompanies trans-splicing. Thus, the presence of stable transcripts encoding both genes may suggest a novel mechanism of regulation, or conversely may be rare but stable transcripts in which the two mRNAs are linked due to a small amount of read-through by RNA polymerase. Both genes are highly polymorphic and co-expressed on tissues involved in histocompatibility. In addition, polymorphisms on both genes correlate with outcome, although we have found a case in which it appears that the secreted form may be major allorecognition determinant.

Genetic risk factors of systemic lupus erythematosus in the Malaysian population: a minireview.

PubMed

Chai, Hwa Chia; Phipps, Maude Elvira; Chua, Kek Heng

2012-01-01

SLE is an autoimmune disease that is not uncommon in Malaysia. In contrast to Malays and Indians, the Chinese seem to be most affected. SLE is characterized by deficiency of body's immune response that leads to production of autoantibodies and failure of immune complex clearance. This minireview attempts to summarize the association of several candidate genes with risk for SLE in the Malaysian population and discuss the genetic heterogeneity that exists locally in Asians and in comparison with SLE in Caucasians. Several groups of researchers have been actively investigating genes that are associated with SLE susceptibility in the Malaysian population by screening possible reported candidate genes across the SLE patients and healthy controls. These candidate genes include MHC genes and genes encoding complement components, TNF, FcγR, T-cell receptors, and interleukins. However, most of the polymorphisms investigated in these genes did not show significant associations with susceptibility to SLE in the Malaysian scenario, except for those occurring in MHC genes and genes coding for TNF-α, IL-1β, IL-1RN, and IL-6.

Genetic Risk Factors of Systemic Lupus Erythematosus in the Malaysian Population: A Minireview

PubMed Central

Chai, Hwa Chia; Phipps, Maude Elvira; Chua, Kek Heng

2012-01-01

SLE is an autoimmune disease that is not uncommon in Malaysia. In contrast to Malays and Indians, the Chinese seem to be most affected. SLE is characterized by deficiency of body's immune response that leads to production of autoantibodies and failure of immune complex clearance. This minireview attempts to summarize the association of several candidate genes with risk for SLE in the Malaysian population and discuss the genetic heterogeneity that exists locally in Asians and in comparison with SLE in Caucasians. Several groups of researchers have been actively investigating genes that are associated with SLE susceptibility in the Malaysian population by screening possible reported candidate genes across the SLE patients and healthy controls. These candidate genes include MHC genes and genes encoding complement components, TNF, FcγR, T-cell receptors, and interleukins. However, most of the polymorphisms investigated in these genes did not show significant associations with susceptibility to SLE in the Malaysian scenario, except for those occurring in MHC genes and genes coding for TNF-α, IL-1β, IL-1RN, and IL-6. PMID:21941582

Assessment of Tools for Marker-Assisted Selection in a Marine Commercial Species: Significant Association between MSTN-1 Gene Polymorphism and Growth Traits

PubMed Central

Sánchez-Ramos, Irma; Cross, Ismael; Mácha, Jaroslav; Martínez-Rodríguez, Gonzalo; Krylov, Vladimir; Rebordinos, Laureana

2012-01-01

Growth is a priority trait from the point of view of genetic improvement. Molecular markers linked to quantitative trait loci (QTL) have been regarded as useful for marker-assisted selection in complex traits as growth. Polymorphisms have been studied in five candidate genes influencing growth in gilthead seabream (Sparus aurata): the growth hormone (GH), insulin-like growth factor-1 (IGF-1), myostatin (MSTN-1), prolactin (PRL), and somatolactin (SL) genes. Specimens evaluated were from a commercial broodstock comprising 131 breeders (from which 36 males and 44 females contributed to the progeny). In all samples eleven gene fragments, covering more than 13,000 bp, generated by PCR-RFLP, were analyzed; tests were made for significant associations between these markers and growth traits. ANOVA results showed a significant association between MSTN-1 gene polymorphism and growth traits. Pairwise tests revealed several RFLPs in the MSTN-1 gene with significant heterogeneity of genotypes among size groups. PRL and MSTN-1 genes presented linkage disequilibrium. The MSTN-1 gene was mapped in the centromeric region of a medium-size acrocentric chromosome pair. PMID:22666112

Mining candidate genes associated with powdery mildew resistance in cucumber via super-BSA by specific length amplified fragment (SLAF) sequencing.

PubMed

Zhang, Peng; Zhu, Yuqiang; Wang, Lili; Chen, Liping; Zhou, Shengjun

2015-12-14

Powdery mildew (PM) is the most common fungal disease of cucumber and other cucurbit crops, while breeding the PM-resistant materials is the effective way to defense this disease, and the recent development of modern genetics and genomics make us aware of that studying the resistance genes is the essential way to breed the PM high-resistance plant. With the ever increasing throughput of next-generation sequencing (NGS), the development of specific length amplified fragment sequencing (SLAF-seq) as a high-resolution strategy for large-scale de novo SNP discovery is gradually applied for functional gene mining. Here we combined the bulked segregant analysis (BSA) with SLAF-seq to identify candidate genes associated with PM resistance in cucumber. A segregating population comprising 251 F2 individuals was developed using H136 (female parent) as susceptible parent and BK2 (male parent) as resistance donor. After PMR test, total genomic DNA was prepared from each plant. Systemic genomic analysis of the GC content, repeat sequence, etc. was carried out by prediction software SLAF_Predict to establish condition to ensure the uniformity and density of the molecular markers. After samples were gel purified, SLAFs were generated at Biomarker Technologies Corporation in Beijing. Based on SLAF tags and the PMR test result, the hot region were annotated. A total of 73,100 high-quality SLAF tags with an average depth of 99.11× were sequenced. Among these, 5,355 polymorphic tags were identified with a polymorphism rate of 7.34 %, including 7.09 % SNPs and other polymorphism types. Finally, 140 associated SLAFs were identified, and two main Hot Regions were detected on chromosome 1 and 6, which contained five genes invovled in defense response, toxin metabolism, cell stress response, and injury response in cucumber. Associated markers identified by super-BSA in this study, could not only speed up the study of the PMR genes, but also provide a feasible solution for breeding the marker-assisted PMR cucumber. Moreover, this study could also be extended to any other species with reference genome.

DNA sequence polymorphisms in a panel of eight candidate bovine imprinted genes and their association with performance traits in Irish Holstein-Friesian cattle.

PubMed

Magee, David A; Sikora, Klaudia M; Berkowicz, Erik W; Berry, Donagh P; Howard, Dawn J; Mullen, Michael P; Evans, Ross D; Spillane, Charles; MacHugh, David E

2010-10-13

Studies in mice and humans have shown that imprinted genes, whereby expression from one of the two parentally inherited alleles is attenuated or completely silenced, have a major effect on mammalian growth, metabolism and physiology. More recently, investigations in livestock species indicate that genes subject to this type of epigenetic regulation contribute to, or are associated with, several performance traits, most notably muscle mass and fat deposition. In the present study, a candidate gene approach was adopted to assess 17 validated single nucleotide polymorphisms (SNPs) and their association with a range of performance traits in 848 progeny-tested Irish Holstein-Friesian artificial insemination sires. These SNPs are located proximal to, or within, the bovine orthologs of eight genes (CALCR, GRB10, PEG3, PHLDA2, RASGRF1, TSPAN32, ZIM2 and ZNF215) that have been shown to be imprinted in cattle or in at least one other mammalian species (i.e. human/mouse/pig/sheep). Heterozygosities for all SNPs analysed ranged from 0.09 to 0.46 and significant deviations from Hardy-Weinberg proportions (P ≤ 0.01) were observed at four loci. Phenotypic associations (P ≤ 0.05) were observed between nine SNPs proximal to, or within, six of the eight analysed genes and a number of performance traits evaluated, including milk protein percentage, somatic cell count, culled cow and progeny carcass weight, angularity, body conditioning score, progeny carcass conformation, body depth, rump angle, rump width, animal stature, calving difficulty, gestation length and calf perinatal mortality. Notably, SNPs within the imprinted paternally expressed gene 3 (PEG3) gene cluster were associated (P ≤ 0.05) with calving, calf performance and fertility traits, while a single SNP in the zinc finger protein 215 gene (ZNF215) was associated with milk protein percentage (P ≤ 0.05), progeny carcass weight (P ≤ 0.05), culled cow carcass weight (P ≤ 0.01), angularity (P ≤ 0.01), body depth (P ≤ 0.01), rump width (P ≤ 0.01) and animal stature (P ≤ 0.01). Of the eight candidate bovine imprinted genes assessed, DNA sequence polymorphisms in six of these genes (CALCR, GRB10, PEG3, RASGRF1, ZIM2 and ZNF215) displayed associations with several of the phenotypes included for analyses. The genotype-phenotype associations detected here are further supported by the biological function of these six genes, each of which plays important roles in mammalian growth, development and physiology. The associations between SNPs within the imprinted PEG3 gene cluster and traits related to calving, calf performance and gestation length suggest that this domain on chromosome 18 may play a role regulating pre-natal growth and development and fertility. SNPs within the bovine ZNF215 gene were associated with bovine growth and body conformation traits and studies in humans have revealed that the human ZNF215 ortholog belongs to the imprinted gene cluster associated with Beckwith-Wiedemann syndrome--a genetic disorder characterised by growth abnormalities. Similarly, the data presented here suggest that the ZNF215 gene may have an important role in regulating bovine growth. Collectively, our results support previous work showing that (candidate) imprinted genes/loci contribute to heritable variation in bovine performance traits and suggest that DNA sequence polymorphisms within these genes/loci represents an important reservoir of genomic markers for future genetic improvement of dairy and beef cattle populations.

DNA sequence polymorphisms in a panel of eight candidate bovine imprinted genes and their association with performance traits in Irish Holstein-Friesian cattle

PubMed Central

2010-01-01

Background Studies in mice and humans have shown that imprinted genes, whereby expression from one of the two parentally inherited alleles is attenuated or completely silenced, have a major effect on mammalian growth, metabolism and physiology. More recently, investigations in livestock species indicate that genes subject to this type of epigenetic regulation contribute to, or are associated with, several performance traits, most notably muscle mass and fat deposition. In the present study, a candidate gene approach was adopted to assess 17 validated single nucleotide polymorphisms (SNPs) and their association with a range of performance traits in 848 progeny-tested Irish Holstein-Friesian artificial insemination sires. These SNPs are located proximal to, or within, the bovine orthologs of eight genes (CALCR, GRB10, PEG3, PHLDA2, RASGRF1, TSPAN32, ZIM2 and ZNF215) that have been shown to be imprinted in cattle or in at least one other mammalian species (i.e. human/mouse/pig/sheep). Results Heterozygosities for all SNPs analysed ranged from 0.09 to 0.46 and significant deviations from Hardy-Weinberg proportions (P ≤ 0.01) were observed at four loci. Phenotypic associations (P ≤ 0.05) were observed between nine SNPs proximal to, or within, six of the eight analysed genes and a number of performance traits evaluated, including milk protein percentage, somatic cell count, culled cow and progeny carcass weight, angularity, body conditioning score, progeny carcass conformation, body depth, rump angle, rump width, animal stature, calving difficulty, gestation length and calf perinatal mortality. Notably, SNPs within the imprinted paternally expressed gene 3 (PEG3) gene cluster were associated (P ≤ 0.05) with calving, calf performance and fertility traits, while a single SNP in the zinc finger protein 215 gene (ZNF215) was associated with milk protein percentage (P ≤ 0.05), progeny carcass weight (P ≤ 0.05), culled cow carcass weight (P ≤ 0.01), angularity (P ≤ 0.01), body depth (P ≤ 0.01), rump width (P ≤ 0.01) and animal stature (P ≤ 0.01). Conclusions Of the eight candidate bovine imprinted genes assessed, DNA sequence polymorphisms in six of these genes (CALCR, GRB10, PEG3, RASGRF1, ZIM2 and ZNF215) displayed associations with several of the phenotypes included for analyses. The genotype-phenotype associations detected here are further supported by the biological function of these six genes, each of which plays important roles in mammalian growth, development and physiology. The associations between SNPs within the imprinted PEG3 gene cluster and traits related to calving, calf performance and gestation length suggest that this domain on chromosome 18 may play a role regulating pre-natal growth and development and fertility. SNPs within the bovine ZNF215 gene were associated with bovine growth and body conformation traits and studies in humans have revealed that the human ZNF215 ortholog belongs to the imprinted gene cluster associated with Beckwith-Wiedemann syndrome--a genetic disorder characterised by growth abnormalities. Similarly, the data presented here suggest that the ZNF215 gene may have an important role in regulating bovine growth. Collectively, our results support previous work showing that (candidate) imprinted genes/loci contribute to heritable variation in bovine performance traits and suggest that DNA sequence polymorphisms within these genes/loci represents an important reservoir of genomic markers for future genetic improvement of dairy and beef cattle populations. PMID:20942903

Association between estrogen receptora gene (ESR1) PvuII (T/C) and XbaI (A/G) polymorphisms and premature ovarian failure risk: evidence from a meta-analysis.

PubMed

He, Meirong; Shu, Jingcheng; Huang, Xing; Tang, Hui

2015-02-01

Genetic factors are important in the pathogenesis of Premature ovarian failure (POF). Notably, estrogen receptor-a (ESR1) has been suggested as a possible candidate gene for POF; however, published studies of ESR1 gene polymorphisms have been hampered by small sample sizes and inconclusive or ambiguous results. The aim of this meta analysis is to investigate the associations between two novel common ESR1 polymorphisms (intron 1 polymorphisms PvuII-rs2234693: T.C and XbaI-rs9340799: A.G) and POF. A comprehensive search was conducted to identify all studies on the association of ESR1 gene polymorphisms with POF up to August 2014. Pooled odds ratio (OR) and corresponding 95 % confidence interval (CI) were calculated using fixed-or random-effects model in the meta-analysis. Three studies covering 1396 subjects were identified. Pooled data showed significant association between ESR1 gene PvuII polymorphism and risk of POF: [allele model: Cvs. T, OR = 0.735, 95%CI: 0.624 ~ 0.865, p = 0.001; co-dominant models: CCvs.TT, OR = 0.540, 95%CI: 0.382 ~ 0.764, p = 0.001, CTvs.TT, OR = 0.735, 95%CI: 0.555 ~ 0.972, p = 0.031; dominant model: CT + CCvs.TT, OR = 0.618, 95%CI: 0.396 ~ 0.966, p = 0.035; recessive model: CCvs.TT + CT, OR = 0.659, 95%CI: 0.502 ~ 0.864, p = 0.003]. Subgroup analyses showed a significant association in all models in Asian population, but no significant association in any model in European population. For the XbaI polymorphism, overall, no significant association was observed under any genetic models. However, under dominant model, ESR1 gene XbaI polymorphism is significantly association with risk of POF in Asian population. The present meta-analysis suggests that ESR1gene PvuII polymorphism is significantly associated with an increased risk of POF. And ESR1gene XbaI polymorphism is not association with risk of POF overall. However, under dominant model, ESR1gene XbaI polymorphism is significantly association with risk of POF in Asian population. Further large and well-designed studies are needed to confirm the association.

Generational Association Studies of Dopaminergic Genes in Reward Deficiency Syndrome (RDS) Subjects: Selecting Appropriate Phenotypes for Reward Dependence Behaviors

PubMed Central

Blum, Kenneth; Chen, Amanda L. C.; Oscar-Berman, Marlene; Chen, Thomas J. H.; Lubar, Joel; White, Nancy; Lubar, Judith; Bowirrat, Abdalla; Braverman, Eric; Schoolfield, John; Waite, Roger L.; Downs, Bernard W.; Madigan, Margaret; Comings, David E.; Davis, Caroline; Kerner, Mallory M.; Knopf, Jennifer; Palomo, Tomas; Giordano, John J.; Morse, Siobhan A.; Fornari, Frank; Barh, Debmalya; Femino, John; Bailey, John A.

2011-01-01

Abnormal behaviors involving dopaminergic gene polymorphisms often reflect an insufficiency of usual feelings of satisfaction, or Reward Deficiency Syndrome (RDS). RDS results from a dysfunction in the “brain reward cascade,” a complex interaction among neurotransmitters (primarily dopaminergic and opioidergic). Individuals with a family history of alcoholism or other addictions may be born with a deficiency in the ability to produce or use these neurotransmitters. Exposure to prolonged periods of stress and alcohol or other substances also can lead to a corruption of the brain reward cascade function. We evaluated the potential association of four variants of dopaminergic candidate genes in RDS (dopamine D1 receptor gene [DRD1]; dopamine D2 receptor gene [DRD2]; dopamine transporter gene [DAT1]; dopamine beta-hydroxylase gene [DBH]). Methodology: We genotyped an experimental group of 55 subjects derived from up to five generations of two independent multiple-affected families compared to rigorously screened control subjects (e.g., N = 30 super controls for DRD2 gene polymorphisms). Data related to RDS behaviors were collected on these subjects plus 13 deceased family members. Results: Among the genotyped family members, the DRD2 Taq1 and the DAT1 10/10 alleles were significantly (at least p < 0.015) more often found in the RDS families vs. controls. The TaqA1 allele occurred in 100% of Family A individuals (N = 32) and 47.8% of Family B subjects (11 of 23). No significant differences were found between the experimental and control positive rates for the other variants. Conclusions: Although our sample size was limited, and linkage analysis is necessary, the results support the putative role of dopaminergic polymorphisms in RDS behaviors. This study shows the importance of a nonspecific RDS phenotype and informs an understanding of how evaluating single subset behaviors of RDS may lead to spurious results. Utilization of a nonspecific “reward” phenotype may be a paradigm shift in future association and linkage studies involving dopaminergic polymorphisms and other neurotransmitter gene candidates. PMID:22408582

Localization of a new autosomal dominant retinitis pigmentosa gene on chromosome 17p screeningof candidate genes

DOE Office of Scientific and Technical Information (OSTI.GOV)

Greenberg, J.; Goliath, R.; Shugart, Y.Y.

1994-09-01

A new gene locus for autosomal dominant retinitis pigmentosa (ADRP) on 17p has been identified in a large South African (SA) family consisting of 28 living affected individuals in 4 successive generations. This is the first ADRP gene to be reported from SA. The human recoverin (RCVN) gene, which codes for a retinal-specific protein important in recovery to the dark state after visual excitation, has been mapped to 17p13.1 and was considered as a prime candidate gene for the disorder in this family. Mutation screening (using 8 different electrophoretic conditions to resolve heteroduplexes and SSCPs) did not produce any evidencemore » of RCVN being involved in the pathogenesis of ADRP in this SA family. In addition, a mobility shift detected within exon 1 of the RCVN gene did not track with the ADRP phenotype. RP patients from 77 SA families and 30 normal individuals are being examined to establish the frequency of this polymorphism in the SA population. Highly polymorphic markers from 17p13 are now being sought in order to establish the minimum region containing this novel ADRP-SA gene. Two additional recently described retinal-expressed cDNAs, guanylyl cyclase and pigment epithelium-derived factor, which map to 17p13.1, will be tested for tight linkage to ADRP-SA.« less

Combining Genotype, Phenotype, and Environment to Infer Potential Candidate Genes.

PubMed

Talbot, Benoit; Chen, Ting-Wen; Zimmerman, Shawna; Joost, Stéphane; Eckert, Andrew J; Crow, Taylor M; Semizer-Cuming, Devrim; Seshadri, Chitra; Manel, Stéphanie

2017-03-01

Population genomic analysis can be an important tool in understanding local adaptation. Identification of potential adaptive loci in such analyses is usually based on the survey of a large genomic dataset in combination with environmental variables. Phenotypic data are less commonly incorporated into such studies, although combining a genome scan analysis with a phenotypic trait analysis can greatly improve the insights obtained from each analysis individually. Here, we aimed to identify loci potentially involved in adaptation to climate in 283 Loblolly pine (Pinus taeda) samples from throughout the species' range in the southeastern United States. We analyzed associations between phenotypic, molecular, and environmental variables from datasets of 3082 single nucleotide polymorphism (SNP) loci and 3 categories of phenotypic traits (gene expression, metabolites, and whole-plant traits). We found only 6 SNP loci that displayed potential signals of local adaptation. Five of the 6 identified SNPs are linked to gene expression traits for lignin development, and 1 is linked with whole-plant traits. We subsequently compared the 6 candidate genes with environmental variables and found a high correlation in only 3 of them (R2 > 0.2). Our study highlights the need for a combination of genotypes, phenotypes, and environmental variables, and for an appropriate sampling scheme and study design, to improve confidence in the identification of potential candidate genes. © The American Genetic Association 2016. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

Sensitivity to House Dust Mites Allergens with Atopic Asthma and Its Relationship with CD14 C(-159T) Polymorphism in Patients of West Bengal, India.

PubMed

Ghosh, Amlan; Dutta, Shampa; Podder, Sanjoy; Mondal, Priti; Laha, Arghya; Saha, Nimai Chandra; Moitra, Saibal; Saha, Goutam Kumar

2018-01-10

India is the home to around 15-20 million asthmatics, and asthma prevalence is increasing in Indian metropolitan area, including Kolkata, West Bengal. Complex interactions of genetic and environmental factors are involved in asthma. Genome-wide search for susceptible loci regulating IgE response (atopy) have identified a candidate gene CD14 which is most important in the context of allergic responses of respiratory system. This study was aimed to investigate the role of house dust and house dust mites in development of bronchial asthma and to explore the possible association of candidate gene CD14 with disease manifestation among Kolkata patient population. Skin-prick test was done among 950 asthmatic patients against 8 aeroallergens, including house dust and house dust mites and total serum IgE and allergen-specific IgE were measured. Polymerase chain reaction-restriction fragment length polymorphism was done in patients and nonasthmatic control (n = 255 in each) to characterize a functional polymorphism, C(-159)T, of CD14, a positional candidate gene for allergy. We identified house dust as the most common aeroallergen sensitizer among atopic patients in Kolkata followed by Dermatophagoides pteronyssinus and Dermatophagoides farinae Hughes (Acari: Pyroglyphidae) mites. Patient's sera contain significantly higher IgE level than that of control. Allergen-specific IgE antibody test revealed that 76.36% patients had specific IgE antibody against D. pteronyssinus mite. There was a significant difference in the distribution of alleles and genotypes for CD14 polymorphism with an increase in disease severity. So, in Kolkata, house dust mite is a common aeroallergen and D. pteronyssinus is predominant among mites. The present study revealed that bronchial asthma has a genetic background. © The Author(s) 2017. Published by Oxford University Press on behalf of Entomological Society of America. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

Obstructive heart defects associated with candidate genes, maternal obesity, and folic acid supplementation.

PubMed

Tang, Xinyu; Cleves, Mario A; Nick, Todd G; Li, Ming; MacLeod, Stewart L; Erickson, Stephen W; Li, Jingyun; Shaw, Gary M; Mosley, Bridget S; Hobbs, Charlotte A

2015-06-01

Right-sided and left-sided obstructive heart defects (OHDs) are subtypes of congenital heart defects, in which the heart valves, arteries, or veins are abnormally narrow or blocked. Previous studies have suggested that the development of OHDs involved a complex interplay between genetic variants and maternal factors. Using the data from 569 OHD case families and 1,644 control families enrolled in the National Birth Defects Prevention Study (NBDPS) between 1997 and 2008, we conducted an analysis to investigate the genetic effects of 877 single nucleotide polymorphisms (SNPs) in 60 candidate genes for association with the risk of OHDs, and their interactions with maternal use of folic acid supplements, and pre-pregnancy obesity. Applying log-linear models based on the hybrid design, we identified a SNP in methylenetetrahydrofolate reductase (MTHFR) gene (C677T polymorphism) with a main genetic effect on the occurrence of OHDs. In addition, multiple SNPs in betaine-homocysteine methyltransferase (BHMT and BHMT2) were also identified to be associated with the occurrence of OHDs through significant main infant genetic effects and interaction effects with maternal use of folic acid supplements. We also identified multiple SNPs in glutamate-cysteine ligase, catalytic subunit (GCLC) and DNA (cytosine-5-)-methyltransferase 3 beta (DNMT3B) that were associated with elevated risk of OHDs among obese women. Our findings suggested that the risk of OHDs was closely related to a combined effect of variations in genes in the folate, homocysteine, or glutathione/transsulfuration pathways, maternal use of folic acid supplements and pre-pregnancy obesity. © 2015 Wiley Periodicals, Inc.

High-resolution genetic mapping of allelic variants associated with cell wall chemistry in Populus.

PubMed

Muchero, Wellington; Guo, Jianjun; DiFazio, Stephen P; Chen, Jin-Gui; Ranjan, Priya; Slavov, Gancho T; Gunter, Lee E; Jawdy, Sara; Bryan, Anthony C; Sykes, Robert; Ziebell, Angela; Klápště, Jaroslav; Porth, Ilga; Skyba, Oleksandr; Unda, Faride; El-Kassaby, Yousry A; Douglas, Carl J; Mansfield, Shawn D; Martin, Joel; Schackwitz, Wendy; Evans, Luke M; Czarnecki, Olaf; Tuskan, Gerald A

2015-01-23

QTL cloning for the discovery of genes underlying polygenic traits has historically been cumbersome in long-lived perennial plants like Populus. Linkage disequilibrium-based association mapping has been proposed as a cloning tool, and recent advances in high-throughput genotyping and whole-genome resequencing enable marker saturation to levels sufficient for association mapping with no a priori candidate gene selection. Here, multiyear and multienvironment evaluation of cell wall phenotypes was conducted in an interspecific P. trichocarpa x P. deltoides pseudo-backcross mapping pedigree and two partially overlapping populations of unrelated P. trichocarpa genotypes using pyrolysis molecular beam mass spectrometry, saccharification, and/ or traditional wet chemistry. QTL mapping was conducted using a high-density genetic map with 3,568 SNP markers. As a fine-mapping approach, chromosome-wide association mapping targeting a QTL hot-spot on linkage group XIV was performed in the two P. trichocarpa populations. Both populations were genotyped using the 34 K Populus Infinium SNP array and whole-genome resequencing of one of the populations facilitated marker-saturation of candidate intervals for gene identification. Five QTLs ranging in size from 0.6 to 1.8 Mb were mapped on linkage group XIV for lignin content, syringyl to guaiacyl (S/G) ratio, 5- and 6-carbon sugars using the mapping pedigree. Six candidate loci exhibiting significant associations with phenotypes were identified within QTL intervals. These associations were reproducible across multiple environments, two independent genotyping platforms, and different plant growth stages. cDNA sequencing for allelic variants of three of the six loci identified polymorphisms leading to variable length poly glutamine (PolyQ) stretch in a transcription factor annotated as an ANGUSTIFOLIA C-terminus Binding Protein (CtBP) and premature stop codons in a KANADI transcription factor as well as a protein kinase. Results from protoplast transient expression assays suggested that each of the polymorphisms conferred allelic differences in the activation of cellulose, hemicelluloses, and lignin pathway marker genes. This study illustrates the utility of complementary QTL and association mapping as tools for gene discovery with no a priori candidate gene selection. This proof of concept in a perennial organism opens up opportunities for discovery of novel genetic determinants of economically important but complex traits in plants.

HomSI: a homozygous stretch identifier from next-generation sequencing data.

PubMed

Görmez, Zeliha; Bakir-Gungor, Burcu; Sagiroglu, Mahmut Samil

2014-02-01

In consanguineous families, as a result of inheriting the same genomic segments through both parents, the individuals have stretches of their genomes that are homozygous. This situation leads to the prevalence of recessive diseases among the members of these families. Homozygosity mapping is based on this observation, and in consanguineous families, several recessive disease genes have been discovered with the help of this technique. The researchers typically use single nucleotide polymorphism arrays to determine the homozygous regions and then search for the disease gene by sequencing the genes within this candidate disease loci. Recently, the advent of next-generation sequencing enables the concurrent identification of homozygous regions and the detection of mutations relevant for diagnosis, using data from a single sequencing experiment. In this respect, we have developed a novel tool that identifies homozygous regions using deep sequence data. Using *.vcf (variant call format) files as an input file, our program identifies the majority of homozygous regions found by microarray single nucleotide polymorphism genotype data. HomSI software is freely available at www.igbam.bilgem.tubitak.gov.tr/softwares/HomSI, with an online manual.

Associations of candidate genes to age-related macular degeneration among racial/ethnic groups in the multi-ethnic study of atherosclerosis.

PubMed

Klein, Ronald; Li, Xiaohui; Kuo, Jane Z; Klein, Barbara E K; Cotch, Mary Frances; Wong, Tien Y; Taylor, Kent D; Rotter, Jerome I

2013-11-01

To describe the relationships of selected candidate genes to the prevalence of early age-related macular degeneration (AMD) in a cohort of whites, blacks, Hispanics, and Chinese Americans. Cross-sectional study. setting: Multicenter study. study population: A total of 2456 persons aged 45-84 years with genotype information and fundus photographs. procedures: Twelve of 2862 single nucleotide polymorphisms (SNPs) from 11 of 233 candidate genes for cardiovascular disease were selected for analysis based on screening with marginal unadjusted P value <.001 within 1 or more racial/ethnic groups. Logistic regression models tested for association in case-control samples. main outcome measure: Prevalence of early AMD. Early AMD was present in 4.0% of the cohort and varied from 2.4% in blacks to 6.0% in whites. The odds ratio increased from 2.3 for 1 to 10.0 for 4 risk alleles in a joint effect analysis of Age-Related Maculopathy Susceptibility 2 rs10490924 and Complement Factor H Y402H (P for trend = 4.2×10(-7)). Frequencies of each SNP varied among the racial/ethnic groups. Adjusting for age and other factors, few statistically significant associations of the 12 SNPs with AMD were consistent across all groups. In a multivariate model, most candidate genes did not attenuate the comparatively higher odds of AMD in whites. The higher frequency of risk alleles for several SNPs in Chinese Americans may partially explain their AMD frequency's approaching that of whites. The relationships of 11 candidate genes to early AMD varied among 4 racial/ethnic groups, and partially explained the observed variations in early AMD prevalence among them. Copyright © 2013 Elsevier Inc. All rights reserved.

Genome comparison of two Magnaporthe oryzae field isolates reveals genome variations and potential virulence effectors

PubMed Central

2013-01-01

Background Rice blast caused by the fungus Magnaporthe oryzae is an important disease in virtually every rice growing region of the world, which leads to significant annual decreases of grain quality and yield. To prevent disease, resistance genes in rice have been cloned and introduced into susceptible cultivars. However, introduced resistance can often be broken within few years of release, often due to mutation of cognate avirulence genes in fungal field populations. Results To better understand the pattern of mutation of M. oryzae field isolates under natural selection forces, we used a next generation sequencing approach to analyze the genomes of two field isolates FJ81278 and HN19311, as well as the transcriptome of FJ81278. By comparing the de novo genome assemblies of the two isolates against the finished reference strain 70–15, we identified extensive polymorphisms including unique genes, SNPs (single nucleotide polymorphism) and indels, structural variations, copy number variations, and loci under strong positive selection. The 1.75 MB of isolate-specific genome content carrying 118 novel genes from FJ81278, and 0.83 MB from HN19311 were also identified. By analyzing secreted proteins carrying polymorphisms, in total 256 candidate virulence effectors were found and 6 were chosen for functional characterization. Conclusions We provide results from genome comparison analysis showing extensive genome variation, and generated a list of M. oryzae candidate virulence effectors for functional characterization. PMID:24341723

Regional Anesthesia and Valproate Sodium for the Prevention of Chronic Post-Amputation Pain

DTIC Science & Technology

2013-10-01

revised documents August Non-perishable Supplies ordered & received DUKE IRB approved study via expedited review September Submitted all revisions...2013 February March April May June July August September October HRPO request for revised, addtn’l docs VA approved protocol...A few candidate gene polymorphisms have been linked to pain susceptibility, including catechol-O-methyltranferase ( COMT ). This gene modulates

Use of single nucleotide polymorphisms in candidate genes associated with daughter pregnancy rate for prediction of genetic merit for reproduction in Holstein cows

USDA-ARS?s Scientific Manuscript database

We evaluated 69 SNPs in genes previously related to fertility and production traits for relationship to daughter pregnancy rate (DPR), cow conception rate (CCR) and heifer conception rate (HCR) in a separate population of Holstein cows grouped according to their predicted transmitting ability for DP...

A polymorphism in a gene encoding Perilipin 4 is associated with height but not with bone measures in individuals from the Framingham Osteoporosis Study

USDA-ARS?s Scientific Manuscript database

There is increasing interest in identifying new pathways and candidate genes that confer susceptibility to osteoporosis. There is evidence that adipogenesis and osteogenesis may be related, including a common bone marrow progenitor cell for both adipocytes and osteoblasts. Perilipin 1 (PLIN1) and Pe...

Polymorphisms of Leptin-b Gene Associated with Growth Traits in Orange-Spotted Grouper (Epinephelus coioides)

PubMed Central

Huang, Hai; Wei, Yun; Meng, Zining; Zhang, Yong; Liu, Xiaochun; Guo, Liang; Luo, Jian; Chen, Guohua; Lin, Haoran

2014-01-01

In mammals, leptin has been demonstrated to perform important roles in many physiological activities and to influence development, growth, metabolism and reproduction. However, in fish, its function is still unclear. Duplicate leptin genes, leptin-a and leptin-b, have been identified in the orange-spotted grouper. In the present study, the polymorphisms in the leptin-b gene of the orange-spotted grouper were detected, and the relation between these polymorphisms and 12 growth traits were analyzed. Six polymorphisms (including 3 single nucleotide polymorphisms (c.14G>A, c.93A>G, c.149G>A) in exon 1, 2 SNPs (c.181A>G, c.193G>A) in intron 1, and 1 SNP (c.360C>T) in exon 2) were identified and genotyped from 200 different individuals. The results revealed that the SNP c.149G>A was significantly associated with growth traits, that the heterozygous mutation genotype GA having negative effects on growth traits. However, the other five SNPs (c.14G>A, c.93A>G, c.181A>G, c.193G>A, c.360C>T) did not show significant associations with all the growth traits. Compared with our findings in leptin-a gene, the results suggested that the leptin-a hormone has more important physiological effects in fish bodies than the leptin-b type. Moreover, leptin genes were supposed to be one class of major candidate genes of regulating growth traits in the orange-spotted grouper. PMID:25003640

The relationship between CA repeat polymorphism of the IGF-1 gene and the structure of motor skills in young athletes.

PubMed

Karpowicz, Krzysztof; Krych, Katarzyna; Karpowicz, Małgorzata; Nowak, Witold; Gronek, Piotr

2018-01-01

The map of candidate genes that can potentially affect physical fitness becomes larger every year, and they are associated with such aspects as respiratory and cardiovascular stability; body build and composition - especially muscle mass and strength; carbohydrate and lipid metabolism; response to training; and exercise intolerance.The aim of this study was to analyze the relationship between the CA repeat polymorphism of the P1 promoter of the IGF1 gene and the structure of motor skills in the two groups of Polish young athletes in 2007-2009. In this study, 350 young sportsmen representing different sports disciplines were examined (age = 15.5 ± 0.5 years), by genotyping the IGF1 gene and determining the structure of motor skills using the International Physical Fitness Test (IPFT) battery. The multiple stepwise regression was used to determine the impact of the investigated motor skills on the indicator of the overall physical fitness, measured by the total score of the International Physical Fitness Test (IPFT). The analysis showed some regularity related to the character of the IGF1 gene polymorphism. It can be concluded that the two groups of young boys athletes practicing various sports disciplines (kinds of physical exercise) displayed similar associations between CA repeat polymorphism of the P1 promoter of the IGF1 gene and the level of motor effects. Our results suggest that this polymorphism may be a genetic marker of the physical performance phenotype. We demonstrated that CA repeat polymorphism of the P1 promoter of the IGF1 gene was associated with strength predispositions in the homozygous and non-carriers groups. In the group who were heterozygous it was speed-strength aptitudes.

A 34K SNP genotyping array for Populus trichocarpa: design, application to the study of natural populations and transferability to other Populus species.

PubMed

Geraldes, A; Difazio, S P; Slavov, G T; Ranjan, P; Muchero, W; Hannemann, J; Gunter, L E; Wymore, A M; Grassa, C J; Farzaneh, N; Porth, I; McKown, A D; Skyba, O; Li, E; Fujita, M; Klápště, J; Martin, J; Schackwitz, W; Pennacchio, C; Rokhsar, D; Friedmann, M C; Wasteneys, G O; Guy, R D; El-Kassaby, Y A; Mansfield, S D; Cronk, Q C B; Ehlting, J; Douglas, C J; Tuskan, G A

2013-03-01

Genetic mapping of quantitative traits requires genotypic data for large numbers of markers in many individuals. For such studies, the use of large single nucleotide polymorphism (SNP) genotyping arrays still offers the most cost-effective solution. Herein we report on the design and performance of a SNP genotyping array for Populus trichocarpa (black cottonwood). This genotyping array was designed with SNPs pre-ascertained in 34 wild accessions covering most of the species latitudinal range. We adopted a candidate gene approach to the array design that resulted in the selection of 34 131 SNPs, the majority of which are located in, or within 2 kb of, 3543 candidate genes. A subset of the SNPs on the array (539) was selected based on patterns of variation among the SNP discovery accessions. We show that more than 95% of the loci produce high quality genotypes and that the genotyping error rate for these is likely below 2%. We demonstrate that even among small numbers of samples (n = 10) from local populations over 84% of loci are polymorphic. We also tested the applicability of the array to other species in the genus and found that the number of polymorphic loci decreases rapidly with genetic distance, with the largest numbers detected in other species in section Tacamahaca. Finally, we provide evidence for the utility of the array to address evolutionary questions such as intraspecific studies of genetic differentiation, species assignment and the detection of natural hybrids. © 2013 Blackwell Publishing Ltd.

APOE polymorphism as a potential determinant of functional fitness in the elderly regardless of nutritional status.

PubMed

Snejdrlova, Michaela; Kalvach, Zdenek; Topinkova, Eva; Vrablik, Michal; Prochazkova, Renata; Kvasilova, Marie; Lanska, Vera; Zlatohlavek, Lukas; Prusikova, Martina; Ceska, Richard

2011-01-01

Life expectancy is determined by a combination of genetic predisposition (~25%) and environmental influences (~75%). Nevertheless a stronger genetic influence is anticipated in long-living individuals. Apolipoprotein E (APOE) gene belongs among the most studied candidate genes of longevity. We evaluated the relation of APOE polymorphism and fitness status in the elderly. We examined a total number of 128 subjects, over 80 years of age. Using a battery of functional tests their fitness status was assessed and the subjects were stratified into 5 functional categories according to Spirduso´s classification. Biochemistry analysis was performed by enzymatic method using automated analyzers. APOE gene polymorphism was analysed performed using PCR-RFLP. APOE4 allele carriers had significantly worse fitness status compared to non-carriers (p=0.025). Multiple logistic regression analysis showed the APOE4 carriers had higher risk (p=0.05) of functional unfitness compared to APOE2/E3 individuals. APOE gene polymorphism seems be an important genetic contributor to frailty development in the elderly. While APOE2 carriers tend to remain functionally fit till higher age, the functional status of APOE4 carriers deteriorates more rapidly. © 2011 Neuroendocrinology Letters

A genome-wide association study of corneal astigmatism: The CREAM Consortium.

PubMed

Shah, Rupal L; Li, Qing; Zhao, Wanting; Tedja, Milly S; Tideman, J Willem L; Khawaja, Anthony P; Fan, Qiao; Yazar, Seyhan; Williams, Katie M; Verhoeven, Virginie J M; Xie, Jing; Wang, Ya Xing; Hess, Moritz; Nickels, Stefan; Lackner, Karl J; Pärssinen, Olavi; Wedenoja, Juho; Biino, Ginevra; Concas, Maria Pina; Uitterlinden, André; Rivadeneira, Fernando; Jaddoe, Vincent W V; Hysi, Pirro G; Sim, Xueling; Tan, Nicholas; Tham, Yih-Chung; Sensaki, Sonoko; Hofman, Albert; Vingerling, Johannes R; Jonas, Jost B; Mitchell, Paul; Hammond, Christopher J; Höhn, René; Baird, Paul N; Wong, Tien-Yin; Cheng, Chinfsg-Yu; Teo, Yik Ying; Mackey, David A; Williams, Cathy; Saw, Seang-Mei; Klaver, Caroline C W; Guggenheim, Jeremy A; Bailey-Wilson, Joan E

2018-01-01

To identify genes and genetic markers associated with corneal astigmatism. A meta-analysis of genome-wide association studies (GWASs) of corneal astigmatism undertaken for 14 European ancestry (n=22,250) and 8 Asian ancestry (n=9,120) cohorts was performed by the Consortium for Refractive Error and Myopia. Cases were defined as having >0.75 diopters of corneal astigmatism. Subsequent gene-based and gene-set analyses of the meta-analyzed results of European ancestry cohorts were performed using VEGAS2 and MAGMA software. Additionally, estimates of single nucleotide polymorphism (SNP)-based heritability for corneal and refractive astigmatism and the spherical equivalent were calculated for Europeans using LD score regression. The meta-analysis of all cohorts identified a genome-wide significant locus near the platelet-derived growth factor receptor alpha ( PDGFRA ) gene: top SNP: rs7673984, odds ratio=1.12 (95% CI:1.08-1.16), p=5.55×10 -9 . No other genome-wide significant loci were identified in the combined analysis or European/Asian ancestry-specific analyses. Gene-based analysis identified three novel candidate genes for corneal astigmatism in Europeans-claudin-7 ( CLDN7 ), acid phosphatase 2, lysosomal ( ACP2 ), and TNF alpha-induced protein 8 like 3 ( TNFAIP8L3 ). In addition to replicating a previously identified genome-wide significant locus for corneal astigmatism near the PDGFRA gene, gene-based analysis identified three novel candidate genes, CLDN7 , ACP2 , and TNFAIP8L3 , that warrant further investigation to understand their role in the pathogenesis of corneal astigmatism. The much lower number of genetic variants and genes demonstrating an association with corneal astigmatism compared to published spherical equivalent GWAS analyses suggest a greater influence of rare genetic variants, non-additive genetic effects, or environmental factors in the development of astigmatism.

Family-based association study of 5-HT(2A) receptor T102C polymorphism and suicidal behavior in Ashkenazi inpatient adolescents.

PubMed

Zalsman, Gil; Frisch, Amos; Baruch-Movshovits, Ruth; Sher, Leo; Michaelovsky, Elena; King, Robert A; Fischel, Tsvi; Hermesh, Haggai; Goldberg, Pablo; Gorlyn, Marianne; Misgav, Sagit; Apter, Alan; Tyano, Sam; Weizman, Abraham

2005-01-01

Suicidal behavior runs in families and is partially genetically determined. Since greater serotonin 5-HT(2A) receptor binding has been reported in postmortem brain and platelets of suicide victims, the 5-HT(2A) receptor gene polymorphism T102C became one of the candidate sites in the study of suicide and impulsive-aggressive traits. However, studies that examined the association of this polymorphism with suicidality have contradictory results. This study used a family-based method and one homogenous ethnic group to overcome ethnic stratification in order to test this association. Thirty families of inpatient adolescents from Jewish Ashkenazi origin, with a recent suicide attempt, were genotyped. All subjects were interviewed for clinical diagnosis, depressive and impulsive-aggressive traits and demographic data. Allele frequencies were assessed using the Haplotype Relative Risk method for trios. No difference was found in allelic distribution between transmitted and non-transmitted alleles. There was no significant association of genotype with any of the clinical traits These preliminary results suggest that the 5-HT(2A) T102C polymorphism is unlikely to be associated with suicidal behavior and related traits in adolescent suicide attempters.

Selection for long and short sleep duration in Drosophila melanogaster reveals the complex genetic network underlying natural variation in sleep

PubMed Central

2017-01-01

Why do some individuals need more sleep than others? Forward mutagenesis screens in flies using engineered mutations have established a clear genetic component to sleep duration, revealing mutants that convey very long or short sleep. Whether such extreme long or short sleep could exist in natural populations was unknown. We applied artificial selection for high and low night sleep duration to an outbred population of Drosophila melanogaster for 13 generations. At the end of the selection procedure, night sleep duration diverged by 9.97 hours in the long and short sleeper populations, and 24-hour sleep was reduced to 3.3 hours in the short sleepers. Neither long nor short sleeper lifespan differed appreciably from controls, suggesting little physiological consequences to being an extreme long or short sleeper. Whole genome sequence data from seven generations of selection revealed several hundred thousand changes in allele frequencies at polymorphic loci across the genome. Combining the data from long and short sleeper populations across generations in a logistic regression implicated 126 polymorphisms in 80 candidate genes, and we confirmed three of these genes and a larger genomic region with mutant and chromosomal deficiency tests, respectively. Many of these genes could be connected in a single network based on previously known physical and genetic interactions. Candidate genes have known roles in several classic, highly conserved developmental and signaling pathways—EGFR, Wnt, Hippo, and MAPK. The involvement of highly pleiotropic pathway genes suggests that sleep duration in natural populations can be influenced by a wide variety of biological processes, which may be why the purpose of sleep has been so elusive. PMID:29240764

Selection for long and short sleep duration in Drosophila melanogaster reveals the complex genetic network underlying natural variation in sleep.

PubMed

Harbison, Susan T; Serrano Negron, Yazmin L; Hansen, Nancy F; Lobell, Amanda S

2017-12-01

Why do some individuals need more sleep than others? Forward mutagenesis screens in flies using engineered mutations have established a clear genetic component to sleep duration, revealing mutants that convey very long or short sleep. Whether such extreme long or short sleep could exist in natural populations was unknown. We applied artificial selection for high and low night sleep duration to an outbred population of Drosophila melanogaster for 13 generations. At the end of the selection procedure, night sleep duration diverged by 9.97 hours in the long and short sleeper populations, and 24-hour sleep was reduced to 3.3 hours in the short sleepers. Neither long nor short sleeper lifespan differed appreciably from controls, suggesting little physiological consequences to being an extreme long or short sleeper. Whole genome sequence data from seven generations of selection revealed several hundred thousand changes in allele frequencies at polymorphic loci across the genome. Combining the data from long and short sleeper populations across generations in a logistic regression implicated 126 polymorphisms in 80 candidate genes, and we confirmed three of these genes and a larger genomic region with mutant and chromosomal deficiency tests, respectively. Many of these genes could be connected in a single network based on previously known physical and genetic interactions. Candidate genes have known roles in several classic, highly conserved developmental and signaling pathways-EGFR, Wnt, Hippo, and MAPK. The involvement of highly pleiotropic pathway genes suggests that sleep duration in natural populations can be influenced by a wide variety of biological processes, which may be why the purpose of sleep has been so elusive.

[The association of polymorphisms in SLC18A1, TPH1 and RELN genes with risk of paranoid schizophrenia].

PubMed

Galaktionova, D Iu; Gareeva, A E; Khusnutdinova, E K; Nasedkina, T V

2014-01-01

We have developed a biochip for the analysis of polymorphisms in candidate genes for schizophrenia: DISC1, RELN, ZNF804A, PLXNA2, COMT, SLC18A41, CACNA1C, ANK3, TPH1, PLAA and SNAP-25. Using biochip the allele and genotype frequencies in 198 patients with schizophrenia and 192 healthy individuals have been obtained. For SLC18A1 polymorphism rs2270641 A>C, the frequencies of A allele (p = 0.007) and AA genotype (p = 0.002) were lower in patients compared with healthy individuals. A significant association was found between AA genotype (p = 0.036) of the TPH1 polymorphism rs1800532 C>A and schizophrenia. The C allele (p = 0.039) of the RELNpolymorphism rs7341475 C>T were lower in patients with schizophrenia compared with healthy individuals in a tatar population. Genotype AA of the TPH1 polymorphism rs1800532 C>A were more frequent in patients with schizophrenia compared with healthy individuals. Ithas been shown that the C allele (p = 0.0001) and GC (p = = 0.0001) genotype of the PLXNA2 polymorphism rs1327175 G>C are associated with the family history in patients with paranoid schizophrenia. The obtained data suggest that SLC18A1, TPH1 and RELN gene polymorphisms are associated with the risk of paranoid schizophrenia.

Association Studies of 22 Candidate SNPs with Late-Onset Alzheimer's Disease

PubMed Central

Figgins, Jessica A.; Minster, Ryan L.; Demirci, F. Yesim; DeKosky, Steven T.; Kamboh, M. Ilyas

2009-01-01

Alzheimer's disease (AD) is a complex and multifactorial disease with the possible involvement of several genes. With the exception of the APOE gene as a susceptibility marker, no other genes have been shown consistently to be associated with late-onset AD (LOAD). A recent genome-wide association study of 17,343 gene-based putative functional single nucleotide polymorphisms (SNPs) found 19 significant variants, including 3 linked to APOE, showing association with LOAD (Hum Mol Genet 2007; 16:865–873). We have set out to replicate the 16 new significant associations in a large case-control cohort of American Whites. Additionally, we examined six variants present in positional and/or biological candidate genes for AD. We genotyped the 22 SNPs in up to 1,009 Caucasian Americans with LOAD and up to 1,010 age-matched healthy Caucasian Americans, using 5′ nuclease assays. We did not observe a statistically significant association between the SNPs and the risk of AD, either individually or stratified by APOE. Our data suggest that the association of the studied variants with LOAD risk, if it exists, is not statistically significant in our sample. PMID:18780302

Scanning of selection signature provides a glimpse into important economic traits in goats (Capra hircus).

PubMed

Guan, Dailu; Luo, Nanjian; Tan, Xiaoshan; Zhao, Zhongquan; Huang, Yongfu; Na, Risu; Zhang, Jiahua; Zhao, Yongju

2016-10-31

Goats (Capra hircus) are one of the oldest livestock domesticated species, and have been used for their milk, meat, hair and skins over much of the world. Detection of selection footprints in genomic regions can provide potential insights for understanding the genetic mechanism of specific phenotypic traits and better guide in animal breeding. The study presented here has generated 192.747G raw data and identified more than 5.03 million single-nucleotide polymorphisms (SNPs) and 334,151 Indels (insertions and deletions). In addition, we identified 155 and 294 candidate regions harboring 86 and 97 genes based on allele frequency differences in Dazu black goats (DBG) and Inner Mongolia cashmere goats (IMCG), respectively. Populations differentiation reflected by Fst values detected 368 putative selective sweep regions including 164 genes. The top 1% regions of both low heterozygosity and high genetic differentiation contained 239 (135 genes) and 176 (106 genes) candidate regions in DBG and IMCG, respectively. These genes were related to reproductive and productive traits, such as "neurohypophyseal hormone activity" and "adipocytokine signaling pathway". These findings may be conducive to molecular breeding and the long-term preservation of the valuable genetic resources for this species.

Investigating the potential genetic association between RANBP9 polymorphisms and the risk of schizophrenia.

PubMed

Bae, Joon Seol; Kim, Jason Yongha; Park, Byung-Lae; Cheong, Hyun Sub; Kim, Jeong-Hyun; Namgoong, Suhg; Kim, Ji-On; Park, Chul Soo; Kim, Bong-Jo; Lee, Cheol-Soon; Lee, Migyung; Choi, Woo Hyuk; Shin, Tae-Min; Hwang, Jaeuk; Shin, Hyoung Doo; Woo, Sung-Il

2015-04-01

Schizophrenia is a serious mental disorder that is affected by genetic and environmental factors. As the disease has a high heritability rate, genetic studies identifying candidate genes for schizophrenia have been conducted in various populations. The gene for human Ran‑binding protein 9 (RANBP9) is a newly discovered candidate gene for schizophrenia. As RANBP9 is a small guanosine‑5'‑triphosphate‑binding protein that interacts with the disrupted in schizophrenia 1 protein, it is considered to be an important molecule in the pathogenesis of schizophrenia. However, to date, no study has examined the possible association between the genetic variations of RANBP9 and the risk of schizophrenia. In the present study, it was hypothesized that RANBP9 variations may influence the risk of schizophrenia. In order to investigate the association between RANBP9 polymorphisms and the risk of schizophrenia and smooth pursuit eye movement (SPEM) abnormalities, a case‑control association analysis was performed. Using a TaqMan assay, five single‑nucleotide polymorphisms and an insertion/deletion variation within the start codon region of RANBP9 were genotyped. Five major haplotypes were identified in 449 patients with schizophrenia and 393 unrelated healthy individuals as controls (total, n=842). However, the association analyses revealed no associations between all genetic variants and schizophrenia and SPEM abnormality. To the best of our knowledge, this is the first study to investigate an association between RANBP9 polymorphisms and schizophrenia and SPEM abnormality. The findings of allele frequencies and association results in this study may aid in further genetic etiological studies in schizophrenia in various populations.

Polymorphisms in the ghrelin gene and their associations with milk yield and quality in water buffaloes.

PubMed

Gil, F M M; de Camargo, G M F; Pablos de Souza, F R; Cardoso, D F; Fonseca, P D S; Zetouni, L; Braz, C U; Aspilcueta-Borquis, R R; Tonhati, H

2013-05-01

Ghrelin is a gastrointestinal hormone that acts in releasing growth hormone and influences the body general metabolism. It has been proposed as a candidate gene for traits such as growth, carcass quality, and milk production of livestock because it influences feed intake. In this context, the aim of this study was to verify the existence of polymorphisms in the ghrelin gene and their associations with milk, fat and protein yield, and percentage in water buffaloes (Bubalus bubalis). A group of 240 animals was studied. Five primer pairs were used and 11 single nucleotide polymorphisms (SNP) were found in the ghrelin gene by sequencing. The animals were genotyped for 8 SNP by PCR-RFLP. The SNP g.960G>A and g.778C>T were associated with fat yield and the SNP g.905T>C was associated with fat yield and percentage and protein percentage. These SNP are located in intronic regions of DNA and may be in noncoding RNA sites or affect transcriptional efciency. The ghrelin gene in buffaloes influences milk fat and protein synthesis. The polymorphisms observed can be used as molecular markers to assist selection. Copyright © 2013 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

New genetic signatures associated with cancer cachexia as defined by low skeletal muscle index and weight loss.

PubMed

Johns, Neil; Stretch, Cynthia; Tan, Benjamin H L; Solheim, Tora S; Sørhaug, Sveinung; Stephens, Nathan A; Gioulbasanis, Ioannis; Skipworth, Richard J E; Deans, D A Christopher; Vigano, Antonio; Ross, James A; Bathe, Oliver F; Tremblay, Michel L; Kaasa, Stein; Strasser, Florian; Gagnon, Bruno; Baracos, Vickie E; Damaraju, Sambasivarao; Fearon, Kenneth C H

2017-02-01

Cachexia affects the majority with advanced cancer. Based on current demographic and clinical factors, it is not possible to predict who will develop cachexia or not. Such variation may, in part, be due to genotype. It has recently been proposed to extend the diagnostic criteria for cachexia to include a direct measure of low skeletal muscle index (LSMI) in addition to weight loss (WL). We aimed to explore our panel of candidate single nucleotide polymorphism (SNPs) for association with WL +/- computerized tomography-defined LSMI. We also explored whether the transcription in muscle of identified genes was altered according to such cachexia phenotype METHODS: A retrospective cohort study design was used. Analysis explored associations of candidate SNPs with WL (n = 1276) and WL + LSMI (n = 943). Human muscle transcriptome (n = 134) was analysed using an Agilent platform. Single nucleotide polymorphisms in the following genes showed association with WL alone: GCKR, LEPR, SELP, ACVR2B, TLR4, FOXO3, IGF1, CPN1, APOE, FOXO1, and GHRL. SNPs in LEPR, ACVR2B, TNF, and ACE were associated with concurrent WL + LSMI. There was concordance between muscle-specific expression for ACVR2B, FOXO1 and 3, LEPR, GCKR, and TLR4 genes and LSMI and/or WL (P < 0.05). The rs1799964 in the TNF gene and rs4291 in the ACE gene are new associations when the definition of cachexia is based on a combination of WL and LSMI. These findings focus attention on pro-inflammatory cytokines and the renin-angiotensin system as biomarkers/mediators of muscle wasting in cachexia. © 2016 The Authors. Journal of Cachexia, Sarcopenia and Muscle published by John Wiley & Sons Ltd on behalf of the Society on Sarcopenia, Cachexia and Wasting Disorders.

TGFB1 Functional Gene Polymorphisms (C-509T and T869C) in the Maternal Susceptibility to Pre-eclampsia in South Indian Women.

PubMed

Deepthi, Goske; Chaithri, Ponnaluri Kamakshi; Latha, Prasanna; Rani, Vital Usha; Rahman, Police Fazul; Jahan, Parveen

2015-10-01

Pre-eclampsia (PE), a pregnancy-specific vascular disorder characterized by hypertension and proteinuria, is hypothesized to be the result of inadequate placental angiogenesis with attendant systemic inflammation. The pleiotropic cytokine, Transforming Growth Factor-β1 (TGF-β1), is considered to be a key candidate gene in the molecular pathogenesis of PE by virtue of its ability to not only regulate angiogenesis and apoptosis of target cells, but also by acting as a master controller of Th1/Th2 cytokine balance and production of the anti-inflammatory peripheral regulatory T cells (FOXP3+ Tregs). Based on this presumption, we screened a total of 469 pregnant women from South India that include 239 patients with PE and 230 healthy controls for the two functional polymorphisms of TGFB1 gene (C-509T and T869C). The genotype frequencies of these two polymorphisms differed significantly between the PE and control groups (P = 0.01 and P = 0.002, for the TGFB1 C-509T and T869C polymorphisms, respectively). Under the over-dominant model, the CT genotype of the TGFB1 C509T polymorphism showed a high protective effect (P = 3e-04), while the TT genotype of the same variant appeared to be the predisposing genotype (P = 0.003). The T-T and C-C haplotypes were found to be the risk haplotypes blocks towards PE (OR = 4.72; P = 0.031, OR = 5.39; P = 0.03), respectively. Strong linkage disequilibrium was seen between the two polymorphisms. Our investigations revealed a significant influence of TGFB1 C-509T and T869C polymorphisms on the PE risk in South Indian women. The study represents one of the first of its kind from the Indian subcontinent. © 2015 The Foundation for the Scandinavian Journal of Immunology.

Epidermal growth factor gene is a newly identified candidate gene for gout

PubMed Central

Han, Lin; Cao, Chunwei; Jia, Zhaotong; Liu, Shiguo; Liu, Zhen; Xin, Ruosai; Wang, Can; Li, Xinde; Ren, Wei; Wang, Xuefeng; Li, Changgui

2016-01-01

Chromosome 4q25 has been identified as a genomic region associated with gout. However, the associations of gout with the genes in this region have not yet been confirmed. Here, we performed two-stage analysis to determine whether variations in candidate genes in the 4q25 region are associated with gout in a male Chinese Han population. We first evaluated 96 tag single nucleotide polymorphisms (SNPs) in eight inflammatory/immune pathway- or glucose/lipid metabolism-related genes in the 4q25 region in 480 male gout patients and 480 controls. The SNP rs12504538, located in the elongation of very-long-chain-fatty-acid-like family member 6 gene (Elovl6), was found to be associated with gout susceptibility (Padjusted = 0.00595). In the second stage of analysis, we performed fine mapping analysis of 93 tag SNPs in Elovl6 and in the epidermal growth factor gene (EGF) and its flanking regions in 1017 male patients gout and 1897 healthy male controls. We observed a significant association between the T allele of EGF rs2298999 and gout (odds ratio = 0.77, 95% confidence interval = 0.67–0.88, Padjusted = 6.42 × 10−3). These results provide the first evidence for an association between the EGF rs2298999 C/T polymorphism and gout. Our findings should be validated in additional populations. PMID:27506295

Epidermal growth factor gene is a newly identified candidate gene for gout.

PubMed

Han, Lin; Cao, Chunwei; Jia, Zhaotong; Liu, Shiguo; Liu, Zhen; Xin, Ruosai; Wang, Can; Li, Xinde; Ren, Wei; Wang, Xuefeng; Li, Changgui

2016-08-10

Chromosome 4q25 has been identified as a genomic region associated with gout. However, the associations of gout with the genes in this region have not yet been confirmed. Here, we performed two-stage analysis to determine whether variations in candidate genes in the 4q25 region are associated with gout in a male Chinese Han population. We first evaluated 96 tag single nucleotide polymorphisms (SNPs) in eight inflammatory/immune pathway- or glucose/lipid metabolism-related genes in the 4q25 region in 480 male gout patients and 480 controls. The SNP rs12504538, located in the elongation of very-long-chain-fatty-acid-like family member 6 gene (Elovl6), was found to be associated with gout susceptibility (Padjusted = 0.00595). In the second stage of analysis, we performed fine mapping analysis of 93 tag SNPs in Elovl6 and in the epidermal growth factor gene (EGF) and its flanking regions in 1017 male patients gout and 1897 healthy male controls. We observed a significant association between the T allele of EGF rs2298999 and gout (odds ratio = 0.77, 95% confidence interval = 0.67-0.88, Padjusted = 6.42 × 10(-3)). These results provide the first evidence for an association between the EGF rs2298999 C/T polymorphism and gout. Our findings should be validated in additional populations.

Whole-Genome Resequencing of Experimental Populations Reveals Polygenic Basis of Egg-Size Variation in Drosophila melanogaster

PubMed Central

Jha, Aashish R.; Miles, Cecelia M.; Lippert, Nodia R.; Brown, Christopher D.; White, Kevin P.; Kreitman, Martin

2015-01-01

Complete genome resequencing of populations holds great promise in deconstructing complex polygenic traits to elucidate molecular and developmental mechanisms of adaptation. Egg size is a classic adaptive trait in insects, birds, and other taxa, but its highly polygenic architecture has prevented high-resolution genetic analysis. We used replicated experimental evolution in Drosophila melanogaster and whole-genome sequencing to identify consistent signatures of polygenic egg-size adaptation. A generalized linear-mixed model revealed reproducible allele frequency differences between replicated experimental populations selected for large and small egg volumes at approximately 4,000 single nucleotide polymorphisms (SNPs). Several hundred distinct genomic regions contain clusters of these SNPs and have lower heterozygosity than the genomic background, consistent with selection acting on polymorphisms in these regions. These SNPs are also enriched among genes expressed in Drosophila ovaries and many of these genes have well-defined functions in Drosophila oogenesis. Additional genes regulating egg development, growth, and cell size show evidence of directional selection as genes regulating these biological processes are enriched for highly differentiated SNPs. Genetic crosses performed with a subset of candidate genes demonstrated that these genes influence egg size, at least in the large genetic background. These findings confirm the highly polygenic architecture of this adaptive trait, and suggest the involvement of many novel candidate genes in regulating egg size. PMID:26044351

Identification of KIF3A as a Novel Candidate Gene for Childhood Asthma Using RNA Expression and Population Allelic Frequencies Differences

PubMed Central

Butsch Kovacic, Melinda; Biagini Myers, Jocelyn M.; Wang, Ning; Martin, Lisa J.; Lindsey, Mark; Ericksen, Mark B.; He, Hua; Patterson, Tia L.; Baye, Tesfaye M.; Torgerson, Dara; Roth, Lindsey A.; Gupta, Jayanta; Sivaprasad, Umasundari; Gibson, Aaron M.; Tsoras, Anna M.; Hu, Donglei; Eng, Celeste; Chapela, Rocío; Rodríguez-Santana, José R.; Rodríguez-Cintrón, William; Avila, Pedro C.; Beckman, Kenneth; Seibold, Max A.; Gignoux, Chris; Musaad, Salma M.; Chen, Weiguo; Burchard, Esteban González; Khurana Hershey, Gurjit K.

2011-01-01

Background Asthma is a chronic inflammatory disease with a strong genetic predisposition. A major challenge for candidate gene association studies in asthma is the selection of biologically relevant genes. Methodology/Principal Findings Using epithelial RNA expression arrays, HapMap allele frequency variation, and the literature, we identified six possible candidate susceptibility genes for childhood asthma including ADCY2, DNAH5, KIF3A, PDE4B, PLAU, SPRR2B. To evaluate these genes, we compared the genotypes of 194 predominantly tagging SNPs in 790 asthmatic, allergic and non-allergic children. We found that SNPs in all six genes were nominally associated with asthma (p<0.05) in our discovery cohort and in three independent cohorts at either the SNP or gene level (p<0.05). Further, we determined that our selection approach was superior to random selection of genes either differentially expressed in asthmatics compared to controls (p = 0.0049) or selected based on the literature alone (p = 0.0049), substantiating the validity of our gene selection approach. Importantly, we observed that 7 of 9 SNPs in the KIF3A gene more than doubled the odds of asthma (OR = 2.3, p<0.0001) and increased the odds of allergic disease (OR = 1.8, p<0.008). Our data indicate that KIF3A rs7737031 (T-allele) has an asthma population attributable risk of 18.5%. The association between KIF3A rs7737031 and asthma was validated in 3 independent populations, further substantiating the validity of our gene selection approach. Conclusions/Significance Our study demonstrates that KIF3A, a member of the kinesin superfamily of microtubule associated motors that are important in the transport of protein complexes within cilia, is a novel candidate gene for childhood asthma. Polymorphisms in KIF3A may in part be responsible for poor mucus and/or allergen clearance from the airways. Furthermore, our study provides a promising framework for the identification and evaluation of novel candidate susceptibility genes. PMID:21912604

A noncoding melanophilin gene (MLPH) SNP at the splice donor of exon 1 represents a candidate causal mutation for coat color dilution in dogs.

PubMed

Drögemüller, Cord; Philipp, Ute; Haase, Bianca; Günzel-Apel, Anne-Rose; Leeb, Tosso

2007-01-01

Coat color dilution in several breeds of dog is characterized by a specific pigmentation phenotype and sometimes accompanied by hair loss and recurrent skin inflammation, the so-called color dilution alopecia or black hair follicular dysplasia. Coat color dilution (d) is inherited as a Mendelian autosomal recessive trait. In a previous study, MLPH polymorphisms showed perfect cosegregation with the dilute phenotype within breeds. However, different dilute haplotypes were found in different breeds, and no single polymorphism was identified in the coding sequence that was likely to be causative for the dilute phenotype. We resequenced the 5'-region of the canine MLPH gene and identified a strong candidate single nucleotide polymorphism within the nontranslated exon 1, which showed perfect association to the dilute phenotype in 65 dilute dogs from 7 different breeds. The A/G polymorphism is located at the last nucleotide of exon 1 and the mutant A-allele is predicted to reduce splicing efficiency 8-fold. An MLPH mRNA expression study using quantitative reverse transcriptase-polymerase chain reaction confirmed that dd animals had only about approximately 25% of the MLPH transcript compared with DD animals. These results provide preliminary evidence that the reported regulatory MLPH mutation might represent a causal mutation for coat color dilution in dogs.

Transcription Factor Binding Site Polymorphism in the Motilin Gene Associated with Left-Sided Displacement of the Abomasum in German Holstein Cattle

PubMed Central

Mömke, Stefanie; Sickinger, Marlene; Rehage, Jürgen; Doll, Klaus; Distl, Ottmar

2012-01-01

Left-sided displacement of the abomasum (LDA) is a common disease in many dairy cattle breeds. A genome-wide screen for QTL for LDA in German Holstein (GH) cows indicated motilin (MLN) as a candidate gene on bovine chromosome 23. Genomic DNA sequence analysis of MLN revealed a total of 32 polymorphisms. All informative polymorphisms used for association analyses in a random sample of 1,136 GH cows confirmed MLN as a candidate for LDA. A single nucleotide polymorphism (FN298674:g.90T>C) located within the first non-coding exon of bovine MLN affects a NKX2-5 transcription factor binding site and showed significant associations (ORallele = 0.64; −log10Pallele = 6.8, −log10Pgenotype = 7.0) with LDA. An expression study gave evidence of a significantly decreased MLN expression in cows carrying the mutant allele (C). In individuals heterozygous or homozygous for the mutation, MLN expression was decreased by 89% relative to the wildtype. FN298674:g.90T>C may therefore play a role in bovine LDA via the motility of the abomasum. This MLN SNP appears useful to reduce the incidence of LDA in German Holstein cattle and provides a first step towards a deeper understanding of the genetics of LDA. PMID:22536407

Analysis of Ethnic Admixture in Prostate Cancer

DTIC Science & Technology

2006-12-01

low penetrant genes have been identified as potential PCA suscept- ibility genes. These candidate genes include SRD5A2 (MIM 607306), CYP3A4 (MIM 124010...progression [13]. The CDH1gene is located at 16q22.1 and consists of 16 exons spanning approximately 100 kb of genomic DNA. Several polymorphisms, germline and...upstreamof theATGstart site and all 16 exons of CDH1 were screened for DNA sequence variation by denaturing high-performance liquid chro- matography

DNA polymorphism analysis of candidate genes for type 2 diabetes mellitus in a Mexican ethnic group.

PubMed

Flores-Martínez, S E; Islas-Andrade, S; Machorro-Lazo, M V; Revilla, M C; Juárez, R E; Mújica-López, K I; Morán-Moguel, M C; López-Cardona, M G; Sánchez-Corona, J

2004-01-01

Type 2 diabetes mellitus is a complex metabolic disorder resulting from the action and interaction of many genetic and environmental factors. It has been reported that polymorphisms in genes involved in the metabolism of glucose are associated with the susceptibility to develop type 2 diabetes mellitus. Although the risk of developing type 2 diabetes mellitus increases with age, as well as with obesity and hypertension, its prevalence and incidence are different among geographical regions and ethnic groups. In Mexico, a higher prevalence and incidence has been described in the south of the country, and differences between urban and rural communities have been observed. We studied 73 individuals from Santiago Jamiltepec, a small indigenous community from Oaxaca State, Mexico. This population has shown a high prevalence of type 2 diabetes mellitus, and the aim of this study was to analyze the relationship between the Pst I (insulin gene), Nsi I (insulin receptor gene) and Gly972Arg (insulin receptor substrate 1 gene) polymorphisms and type 2 diabetes mellitus, obesity and hypertension in this population. Clinical evaluation consisted of BMI and blood pressure measurements, and biochemical assays consisted of determination of fasting plasma insulin and glucose levels. PCR and restriction enzyme digestion analysis were applied to genomic DNA to identify the three polymorphisms. From statistical analysis carried out here, individually, the Pst I, Nsi I and Gly972Arg polymorphisms were not associated with the type 2 diabetes, obese or hypertensive phenotypes in this population. Nevertheless, there was an association between the Nsi I and Pst I polymorphisms and increased serum insulin levels.

Association analyses of vitamin D-binding protein gene with compression strength index variation in Caucasian nuclear families.

PubMed

Xu, X-H; Xiong, D-H; Liu, X-G; Guo, Y; Chen, Y; Zhao, J; Recker, R R; Deng, H-W

2010-01-01

This study was conducted to test whether there exists an association between vitamin D-binding protein (DBP) gene and compression strength index (CSI) phenotype. Candidate gene association analyses were conducted in total sample, male subgroup, and female subgroup, respectively. Two single-nucleotide polymorphisms (SNPs) with significant association results were found in males, suggesting the importance of DBP gene polymorphisms on the variation in CSI especially in Caucasian males. CSI of the femoral neck (FN) is a newly developed phenotype integrating information about bone size, body size, and bone mineral density. It is considered to have the potential to improve the performance of risk assessment for hip fractures because it is based on a combination of phenotypic traits influencing hip fractures rather than a single trait. CSI is under moderate genetic determination (with a heritability of approximately 44% found in this study), but the relevant genetic study is still rather scarce. Based on the known physiological role of DBP in bone biology and the relatively high heritability of CSI, we tested 12 SNPs of the DBP gene for association with CSI variation in 405 Caucasian nuclear families comprising 1,873 subjects from the Midwestern US. Association analyses were performed in the total sample, male and female subgroups, respectively. Significant associations with CSI were found with two SNPs (rs222029, P = 0.0019; rs222020, P = 0.0042) for the male subgroup. Haplotype-based association tests corroborated the single-SNP results. Our findings suggest that the DBP gene might be one of the genetic factors influencing CSI phenotype in Caucasians, especially in males.

Adaptation to climate through flowering phenology: a case study in Medicago truncatula.

PubMed

Burgarella, Concetta; Chantret, Nathalie; Gay, Laurène; Prosperi, Jean-Marie; Bonhomme, Maxime; Tiffin, Peter; Young, Nevin D; Ronfort, Joelle

2016-07-01

Local climatic conditions likely constitute an important selective pressure on genes underlying important fitness-related traits such as flowering time, and in many species, flowering phenology and climatic gradients strongly covary. To test whether climate shapes the genetic variation on flowering time genes and to identify candidate flowering genes involved in the adaptation to environmental heterogeneity, we used a large Medicago truncatula core collection to examine the association between nucleotide polymorphisms at 224 candidate genes and both climate variables and flowering phenotypes. Unlike genome-wide studies, candidate gene approaches are expected to enrich for the number of meaningful trait associations because they specifically target genes that are known to affect the trait of interest. We found that flowering time mediates adaptation to climatic conditions mainly by variation at genes located upstream in the flowering pathways, close to the environmental stimuli. Variables related to the annual precipitation regime reflected selective constraints on flowering time genes better than the other variables tested (temperature, altitude, latitude or longitude). By comparing phenotype and climate associations, we identified 12 flowering genes as the most promising candidates responsible for phenological adaptation to climate. Four of these genes were located in the known flowering time QTL region on chromosome 7. However, climate and flowering associations also highlighted largely distinct gene sets, suggesting different genetic architectures for adaptation to climate and flowering onset. © 2016 John Wiley & Sons Ltd.

[Association of estrogen receptor gene polymorphism with cerebral infarction, a case-control study].

PubMed

Zhang, Yan; Xie, Ruping; Wang, Yinhua; Chen, Dafang; Wang, Guoying; Xu, Xiping

2002-11-10

To explore the association between estrogen receptor (ER) gene PvuII and XbaI polymorphisms and cerebral infarction among Chinese Han people. Samples of peripheral blood white cell were extracted among 234 patients with cerebral infarction, aged 63.9 +/- 10.3, and 259 controls without cerebrovascular disease, aged 59.2 +/- 9.2, all of Chinese Han nationality. PCR-RFLP and genotyping of ER PvuII and XbaI polymorphisms were performed. Multiple Logistic regression analysis was made to explore the risk factors for cerebral infarction. After adjustment for major confounders including age, gender, smoking, alcohol drinking, education, history of hypertension, diabetes mellitus, coronary artery disease and hyperlipoidemia, multiple Logistic regression analysis showed that: (1) The Pp genotype of ER PvuII polymorphism increased the risk of cerebral infarction significantly (OR = 1.97, 95% CI: 1.21 - 3.21); (2) The ER XbaI polymorphism was not in association with cerebral infarction significantly; (3) The PPXx/Ppxx genotypes increased the risk of cerebral infarction significantly (OR = 1.67, 2.52 and 2.18 respectively, P < 0.05) before or after all subjects were stratified by the history of hypertension or hyperlipoidemia; and (4) The positive interaction between the ER PvuII polymorphism and the presence of hypertension or diabetes or hyperlipoidemia could increase the risk of cerebral infarction significantly. ER gene may be one of the genetic candidate genes for cerebral infarction among Chinese Han population.

Genome-wide association study reveals a QTL and strong candidate genes for umbilical hernia in pigs on SSC14.

PubMed

Grindflek, Eli; Hansen, Marianne H S; Lien, Sigbjørn; van Son, Maren

2018-05-29

Umbilical hernia is one of the most prevalent congenital defect in pigs, causing economic losses and substantial animal welfare problems. Identification and implementation of genomic regions controlling umbilical hernia in breeding is of great interest to reduce incidences of hernia in commercial pig production. The aim of this study was to identify such regions and possibly identify causative variation affecting umbilical hernia in pigs. A case/control material consisting of 739 Norwegian Landrace pigs was collected and applied in a GWAS study with a genome-wide distributed panel of 60 K SNPs. Additionally candidate genes were sequenced to detect additional polymorphisms that were used for single SNP and haplotype association analyses in 453 of the pigs. The GWAS in this report detected a highly significant region affecting umbilical hernia around 50 Mb on SSC14 (P < 0.0001) explaining up to 8.6% of the phenotypic variance of the trait. The region is rather broad and includes 62 significant SNPs in high linkage disequilibrium with each other. Targeted sequencing of candidate genes within the region revealed polymorphisms within the Leukemia inhibitory factor (LIF) and Oncostatin M (OSM) that were significantly associated with umbilical hernia (P < 0.001). A highly significant QTL for umbilical hernia in Norwegian Landrace pigs was detected around 50 Mb on SSC14. Resequencing of candidate genes within the region revealed SNPs within LIF and OSM highly associated with the trait. However, because of extended LD within the region, studies in other populations and functional studies are needed to determine whether these variants are causal or not. Still without this knowledge, SNPs within the region can be used as genetic markers to reduce incidences of umbilical hernia in Norwegian Landrace pigs.

Development and molecular characterization of genic molecular markers for grain protein and calcium content in finger millet (Eleusine coracana (L.) Gaertn.).

PubMed

Nirgude, M; Babu, B Kalyana; Shambhavi, Y; Singh, U M; Upadhyaya, H D; Kumar, Anil

2014-03-01

Finger millet (Eleusine coracana (L.) Gaertn), holds immense agricultural and economic importance for its high nutraceuticals quality. Finger millets seeds are rich source of calcium and its proteins are good source of essential amino acids. In the present study, we developed 36 EST-SSR primers for the opaque2 modifiers and 20 anchored-SSR primers for calcium transporters and calmodulin for analysis of the genetic diversity of 103 finger millet genotypes for grain protein and calcium contents. Out of the 36 opaque2 modifiers primers, 15 were found polymorphic and were used for the diversity analysis. The highest PIC value was observed with the primer FMO2E33 (0.26), while the lowest was observed FMO2E27 (0.023) with an average value of 0.17. The gene diversity was highest for the primer FMO2E33 (0.33), however it was lowest for FMO2E27 (0.024) at average value of 0.29. The percentage polymorphism shown by opaque2 modifiers primers was 68.23%. The diversity analysis by calcium transporters and calmodulin based anchored SSR loci revealed that the highest PIC was observed with the primer FMCA8 (0.30) and the lowest was observed for FMCA5 (0.023) with an average value of 0.18. The highest gene diversity was observed for primer FMCA8 (0.37), while lowest for FMCA5 (0.024) at an average of 0.21. The opaque2 modifiers specific EST-SSRs could able to differentiate the finger millet genotypes into high, medium and low protein containing genotypes. However, calcium dependent candidate gene based EST-SSRs could broadly differentiate the genotypes based on the calcium content with a few exceptions. A significant negative correlation between calcium and protein content was observed. The present study resulted in identification of highly polymorphic primers (FMO2E30, FMO2E33, FMO2-18 and FMO2-14) based on the parameters such as percentage of polymorphism, PIC values, gene diversity and number of alleles.

Novel polymorphisms of the APOA2 gene and its promoter region affect body traits in cattle.

PubMed

Zhou, Yang; Li, Caixia; Cai, Hanfang; Xu, Yao; Lan, Xianyong; Lei, Chuzhao; Chen, Hong

2013-12-01

Apolipoprotein A-II (APOA2) is one of the major constituents of high-density lipoprotein and plays a critical role in lipid metabolism and obesity. However, similar research for the bovine APOA2 gene is lacking. In this study, polymorphisms of the bovine APOA2 gene and its promoter region were detected in 1021 cows from four breeds by sequencing and PCR-RFLP methods. Totally, we detected six novel mutations which included one mutation in the promoter region, two mutations in the exons and three mutations in the introns. There were four polymorphisms within APOA2 gene were analyzed. The allele A, T, T and G frequencies of the four loci were predominant in the four breeds when in separate or combinations analysis which suggested cows with those alleles to be more adapted to the steppe environment. The association analysis indicated three SVs in Nangyang cows, two SVs in Qinchun cows and the 9 haplotypes in Nangyang cows were significantly associated with body traits (P<0.05 or P<0.01). The results of this study suggested the bovine APOA2 gene may be a strong candidate gene for body traits in the cattle breeding program. © 2013.

Association of Adiponectin rs1501299 and rs266729 Gene Polymorphisms With Nonalcoholic Fatty Liver Disease

PubMed Central

Hashemi, Mohammad; Hanafi Bojd, Hamideh; Eskandari Nasab, Ebrahim; Bahari, Ali; Hashemzehi, Noor Allah; Shafieipour, Sara; Narouie, Behzad; Taheri, Mohsen; Ghavami, Saeid

2013-01-01

Background Genetic and environmental factors are important for the development of nonalcoholic fatty liver disease (NAFLD). Adiponectin is a white and brown adipose tissue hormone, and have been found to play essential roles in the regulation of energy homoeostasis. Recent reports have identified a possible role of adiponectin in NAFLD via PPARγ pathway. Objectives The present study was designed to find out the impact of adiponectin rs1501299 (276G/T) and rs266729 (-11377C/G) gene polymorphisms in NAFLD. Patients and Methods Eighty-three patients with diagnosis of NAFLD, and 93 healthy subjects were included in the study. Tetra ARMS-PCR was designed to detect single nucleotide polymorphisms. Results A significant difference was found between NAFLD and control group regarding the rs266729 polymorphism (χ2 = 7.35, P = 0.025). The rs266729 polymorphism increased the risk of NAFLD in codominant (CC vs. CG: OR = 2.18, 95% CI = 1.16 - 4.12, P = 0.016) and dominant (CC vs. CG/GG: OR = 2.31, 95% CI = 1.25 - 4.27; P = 0.008) inheritance tested models. The G allele increased the risk of NAFLD (OR = 1.63, 95% CI = 1.03 - 2.57, P = 0.037) in comparison with C allele. No significant difference was found between the groups concerning adiponectin rs1501299 gene polymorphism (χ2 = 0.70, P = 0.697). Conclusions adiponectin rs266729 polymorphism might be a candidate gene, which determines the susceptibility to NAFLD. Larger studies are necessary to confirm these findings in various populations. PMID:23922565

The AVPR1A Gene and Its Single Nucleotide Polymorphism rs10877969: A Literature Review of Associations with Health Conditions and Pain.

PubMed

Roach, Keesha L; Hershberger, Patricia E; Rutherford, Julienne N; Molokie, Robert E; Wang, Zaijie Jim; Wilkie, Diana J

2018-03-01

Pain is the quintessential symptom for individuals suffering from sickle cell disease (SCD). Although the degree of suffering and the cost of treatment are staggering, SCD continues to be grossly understudied, including a lack of data for pain-related genes and prevalence of polymorphisms in this population. This lack of data adds to the inadequacy of pain therapy in this population. Pain genetics investigators have recently examined allele frequencies of single-nucleotide polymorphisms from candidate genes in people who have SCD. One of the genes identified was the arginine vasopressin receptor 1A gene (AVPR1A) and its associated single-nucleotide polymorphism (SNP) rs10877969. Progress in explaining pain-related polymorphisms associated with SCD can be facilitated by understanding the literature. The purpose of this literature review was to describe mechanisms of the polymorphic gene AVPR1A and the phenotypic variations associated with its SNPs relative to health conditions and pain. Published studies were included if the research addressed AVPR1A and was a full article in a peer-reviewed journal, in the English language, a human or animal study, and published 2009 to present. Abstracts were included if they were in English and provided information not found in a full article. The results of this review revealed that AVPR1A is associated with behavioral phenotypes, which include pair bonding, autism spectrum disorder, musical aptitude, infidelity, altruism, monogamy, mating, substance abuse, and alcohol preference. In addition, there were associations with pain, stress pain by sex, and sickle cell pain. Summary of this literature could provide insights into future pain research of this SNP in people with SCD. Copyright © 2018 American Society for Pain Management Nursing. Published by Elsevier Inc. All rights reserved.

The AGT Gene M235T Polymorphism and Response of Power-Related Variables to Aerobic Training.

PubMed

Aleksandra, Zarębska; Zbigniew, Jastrzębski; Waldemar, Moska; Agata, Leońska-Duniec; Mariusz, Kaczmarczyk; Marek, Sawczuk; Agnieszka, Maciejewska-Skrendo; Piotr, Żmijewski; Krzysztof, Ficek; Grzegorz, Trybek; Ewelina, Lulińska-Kuklik; Semenova, Ekaterina A; Ahmetov, Ildus I; Paweł, Cięszczyk

2016-12-01

The C allele of the M235T (rs699) polymorphism of the AGT gene correlates with higher levels of angiotensin II and has been associated with power and strength sport performance. The aim of the study was to investigate whether or not selected power-related variables and their response to a 12-week program of aerobic dance training are modulated by the AGT M235T genotype in healthy participants. Two hundred and one Polish Caucasian women aged 21 ± 1 years met the inclusion criteria and were included in the study. All women completed a 12-week program of low and high impact aerobics. Wingate peak power and total work capacity, 5 m, 10 m, and 30 m running times and jump height and jump power were determined before and after the training programme. All power-related variables improved significantly in response to aerobic dance training. We found a significant association between the M235T polymorphism and jump-based variables (squat jump (SJ) height, p = 0.005; SJ power, p = 0.015; countermovement jump height, p = 0.025; average of 10 countermovement jumps with arm swing (ACMJ) height, p = 0.001; ACMJ power, p = 0.035). Specifically, greater improvements were observed in the C allele carriers in comparison with TT homozygotes. In conclusion, aerobic dance, one of the most commonly practiced adult fitness activities in the world, provides sufficient training stimuli for augmenting the explosive strength necessary to increase vertical jump performance. The AGT gene M235T polymorphism seems to be not only a candidate gene variant for power/strength related phenotypes, but also a genetic marker for predicting response to training.

Candidate genes for aggression and antisocial behavior: a meta-analysis of association studies of the 5HTTLPR and MAOA-uVNTR.

PubMed

Ficks, Courtney A; Waldman, Irwin D

2014-09-01

Variation in central serotonin levels due to genetic mutations or experimental modifications has been associated with the manifestation of aggression in humans and animals. Many studies have examined whether common variants in serotonergic genes are implicated in aggressive or antisocial behaviors (ASB) in human samples. The two most commonly studied polymorphisms have been the serotonin transporter linked polymorphic region of the serotonin transporter gene (5HTTLPR) and the 30 base pair variable number of tandem repeats of the monoamine oxidase A gene (MAOA-uVNTR). Despite the aforementioned theoretical justification for these polymorphisms, findings across studies have been mixed and are thus difficult to interpret. A meta-analysis of associations of the 5HTTLPR and MAOA-uVNTR with ASB was conducted to determine: (1) the overall magnitude of effects for each polymorphism, (2) the extent of heterogeneity in effect sizes across studies and the likelihood of publication bias, and (3) whether sample-level or study-level characteristics could explain observed heterogeneity across studies. Both the 5HTTLPR and the MAOA-uVNTR were significantly associated with ASB across studies. There was also significant and substantial heterogeneity in the effect sizes for both markers, but this heterogeneity was not explained by any sample-level or study-level characteristics examined. We did not find any evidence for publication bias across studies for the MAOA-uVNTR, but there was evidence for an oversampling of statistically significant effect sizes for the 5HTTLPR. These findings provide support for the modest role of common serotonergic variants in ASB. Implications regarding the role of serotonin in antisocial behavior and the conceptualization of antisocial and aggressive phenotypes are discussed.

Molecular Signatures of Chronic Pain Subtypes

DTIC Science & Technology

2013-01-01

on August 4, 2011. Our project coordinator was in touch with Ms. Lesnow on December 21. We were asked to provide a breakdown of costs for the...49]. A few candidate gene polymorphisms have been linked to pain susceptibility, including catechol-O-methyltranferase ( COMT ). This gene modulates...nociceptive and inflammatory pain and has been linked to temporomandibular joint pain syndromes [50]. Even studies of COMT , however, have demonstrated

Expression of a putative dioxygenase gene adjacent to an insertion mutation is involved in the short internodes of columnar apples (Malus × domestica).

PubMed

Okada, Kazuma; Wada, Masato; Moriya, Shigeki; Katayose, Yuichi; Fujisawa, Hiroko; Wu, Jianzhong; Kanamori, Hiroyuki; Kurita, Kanako; Sasaki, Harumi; Fujii, Hiroshi; Terakami, Shingo; Iwanami, Hiroshi; Yamamoto, Toshiya; Abe, Kazuyuki

2016-11-01

Determining the molecular mechanism of fruit tree architecture is important for tree management and fruit production. An apple mutant 'McIntosh Wijcik', which was discovered as a bud mutation from 'McIntosh', exhibits a columnar growth phenotype that is controlled by a single dominant gene, Co. In this study, the mutation and the Co gene were analyzed. Fine mapping narrowed the Co region to a 101 kb region. Sequence analysis of the Co region and the original wild-type co region identified an insertion mutation of an 8202 bp long terminal repeat (LTR) retroposon in the Co region. Segregation analysis using a DNA marker based on the insertion polymorphism showed that the LTR retroposon was closely associated with the columnar growth phenotype. RNA-seq and RT-PCR analysis identified a promising Co candidate gene (91071-gene) within the Co region that is specifically expressed in 'McIntosh Wijcik' but not in 'McIntosh'. The 91071-gene was located approximately 16 kb downstream of the insertion mutation and is predicted to encode a 2-oxoglutarate-dependent dioxygenase involved in an unknown reaction. Overexpression of the 91071-gene in transgenic tobaccos and apples resulted in phenotypes with short internodes, like columnar apples. These data suggested that the 8202 bp retroposon insertion in 'McIntosh Wijcik' is associated with the short internodes of the columnar growth phenotype via upregulated expression of the adjacent 91071-gene. Furthermore, the DNA marker based on the insertion polymorphism could be useful for the marker-assisted selection of columnar apples.

Genome-wide detection and characterization of positive selection in human populations.

PubMed

Sabeti, Pardis C; Varilly, Patrick; Fry, Ben; Lohmueller, Jason; Hostetter, Elizabeth; Cotsapas, Chris; Xie, Xiaohui; Byrne, Elizabeth H; McCarroll, Steven A; Gaudet, Rachelle; Schaffner, Stephen F; Lander, Eric S; Frazer, Kelly A; Ballinger, Dennis G; Cox, David R; Hinds, David A; Stuve, Laura L; Gibbs, Richard A; Belmont, John W; Boudreau, Andrew; Hardenbol, Paul; Leal, Suzanne M; Pasternak, Shiran; Wheeler, David A; Willis, Thomas D; Yu, Fuli; Yang, Huanming; Zeng, Changqing; Gao, Yang; Hu, Haoran; Hu, Weitao; Li, Chaohua; Lin, Wei; Liu, Siqi; Pan, Hao; Tang, Xiaoli; Wang, Jian; Wang, Wei; Yu, Jun; Zhang, Bo; Zhang, Qingrun; Zhao, Hongbin; Zhao, Hui; Zhou, Jun; Gabriel, Stacey B; Barry, Rachel; Blumenstiel, Brendan; Camargo, Amy; Defelice, Matthew; Faggart, Maura; Goyette, Mary; Gupta, Supriya; Moore, Jamie; Nguyen, Huy; Onofrio, Robert C; Parkin, Melissa; Roy, Jessica; Stahl, Erich; Winchester, Ellen; Ziaugra, Liuda; Altshuler, David; Shen, Yan; Yao, Zhijian; Huang, Wei; Chu, Xun; He, Yungang; Jin, Li; Liu, Yangfan; Shen, Yayun; Sun, Weiwei; Wang, Haifeng; Wang, Yi; Wang, Ying; Xiong, Xiaoyan; Xu, Liang; Waye, Mary M Y; Tsui, Stephen K W; Xue, Hong; Wong, J Tze-Fei; Galver, Luana M; Fan, Jian-Bing; Gunderson, Kevin; Murray, Sarah S; Oliphant, Arnold R; Chee, Mark S; Montpetit, Alexandre; Chagnon, Fanny; Ferretti, Vincent; Leboeuf, Martin; Olivier, Jean-François; Phillips, Michael S; Roumy, Stéphanie; Sallée, Clémentine; Verner, Andrei; Hudson, Thomas J; Kwok, Pui-Yan; Cai, Dongmei; Koboldt, Daniel C; Miller, Raymond D; Pawlikowska, Ludmila; Taillon-Miller, Patricia; Xiao, Ming; Tsui, Lap-Chee; Mak, William; Song, You Qiang; Tam, Paul K H; Nakamura, Yusuke; Kawaguchi, Takahisa; Kitamoto, Takuya; Morizono, Takashi; Nagashima, Atsushi; Ohnishi, Yozo; Sekine, Akihiro; Tanaka, Toshihiro; Tsunoda, Tatsuhiko; Deloukas, Panos; Bird, Christine P; Delgado, Marcos; Dermitzakis, Emmanouil T; Gwilliam, Rhian; Hunt, Sarah; Morrison, Jonathan; Powell, Don; Stranger, Barbara E; Whittaker, Pamela; Bentley, David R; Daly, Mark J; de Bakker, Paul I W; Barrett, Jeff; Chretien, Yves R; Maller, Julian; McCarroll, Steve; Patterson, Nick; Pe'er, Itsik; Price, Alkes; Purcell, Shaun; Richter, Daniel J; Sabeti, Pardis; Saxena, Richa; Schaffner, Stephen F; Sham, Pak C; Varilly, Patrick; Altshuler, David; Stein, Lincoln D; Krishnan, Lalitha; Smith, Albert Vernon; Tello-Ruiz, Marcela K; Thorisson, Gudmundur A; Chakravarti, Aravinda; Chen, Peter E; Cutler, David J; Kashuk, Carl S; Lin, Shin; Abecasis, Gonçalo R; Guan, Weihua; Li, Yun; Munro, Heather M; Qin, Zhaohui Steve; Thomas, Daryl J; McVean, Gilean; Auton, Adam; Bottolo, Leonardo; Cardin, Niall; Eyheramendy, Susana; Freeman, Colin; Marchini, Jonathan; Myers, Simon; Spencer, Chris; Stephens, Matthew; Donnelly, Peter; Cardon, Lon R; Clarke, Geraldine; Evans, David M; Morris, Andrew P; Weir, Bruce S; Tsunoda, Tatsuhiko; Johnson, Todd A; Mullikin, James C; Sherry, Stephen T; Feolo, Michael; Skol, Andrew; Zhang, Houcan; Zeng, Changqing; Zhao, Hui; Matsuda, Ichiro; Fukushima, Yoshimitsu; Macer, Darryl R; Suda, Eiko; Rotimi, Charles N; Adebamowo, Clement A; Ajayi, Ike; Aniagwu, Toyin; Marshall, Patricia A; Nkwodimmah, Chibuzor; Royal, Charmaine D M; Leppert, Mark F; Dixon, Missy; Peiffer, Andy; Qiu, Renzong; Kent, Alastair; Kato, Kazuto; Niikawa, Norio; Adewole, Isaac F; Knoppers, Bartha M; Foster, Morris W; Clayton, Ellen Wright; Watkin, Jessica; Gibbs, Richard A; Belmont, John W; Muzny, Donna; Nazareth, Lynne; Sodergren, Erica; Weinstock, George M; Wheeler, David A; Yakub, Imtaz; Gabriel, Stacey B; Onofrio, Robert C; Richter, Daniel J; Ziaugra, Liuda; Birren, Bruce W; Daly, Mark J; Altshuler, David; Wilson, Richard K; Fulton, Lucinda L; Rogers, Jane; Burton, John; Carter, Nigel P; Clee, Christopher M; Griffiths, Mark; Jones, Matthew C; McLay, Kirsten; Plumb, Robert W; Ross, Mark T; Sims, Sarah K; Willey, David L; Chen, Zhu; Han, Hua; Kang, Le; Godbout, Martin; Wallenburg, John C; L'Archevêque, Paul; Bellemare, Guy; Saeki, Koji; Wang, Hongguang; An, Daochang; Fu, Hongbo; Li, Qing; Wang, Zhen; Wang, Renwu; Holden, Arthur L; Brooks, Lisa D; McEwen, Jean E; Guyer, Mark S; Wang, Vivian Ota; Peterson, Jane L; Shi, Michael; Spiegel, Jack; Sung, Lawrence M; Zacharia, Lynn F; Collins, Francis S; Kennedy, Karen; Jamieson, Ruth; Stewart, John

2007-10-18

With the advent of dense maps of human genetic variation, it is now possible to detect positive natural selection across the human genome. Here we report an analysis of over 3 million polymorphisms from the International HapMap Project Phase 2 (HapMap2). We used 'long-range haplotype' methods, which were developed to identify alleles segregating in a population that have undergone recent selection, and we also developed new methods that are based on cross-population comparisons to discover alleles that have swept to near-fixation within a population. The analysis reveals more than 300 strong candidate regions. Focusing on the strongest 22 regions, we develop a heuristic for scrutinizing these regions to identify candidate targets of selection. In a complementary analysis, we identify 26 non-synonymous, coding, single nucleotide polymorphisms showing regional evidence of positive selection. Examination of these candidates highlights three cases in which two genes in a common biological process have apparently undergone positive selection in the same population:LARGE and DMD, both related to infection by the Lassa virus, in West Africa;SLC24A5 and SLC45A2, both involved in skin pigmentation, in Europe; and EDAR and EDA2R, both involved in development of hair follicles, in Asia.

Genetics of osteoporosis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Urano, Tomohiko; Inoue, Satoshi, E-mail: INOUE-GER@h.u-tokyo.ac.jp; Department of Anti-Aging Medicine, Graduate School of Medicine, The University of Tokyo, Tokyo 113-8655

Highlights: • Single-nucleotide polymorphisms (SNPs) associated with osteoporosis were identified. • SNPs mapped close to or within VDR and ESR1 are associated with bone mineral density. • WNT signaling pathway plays a pivotal role in regulating bone mineral density. • Genetic studies will be useful for identification of new therapeutic targets. - Abstract: Osteoporosis is a skeletal disease characterized by low bone mineral density (BMD) and microarchitectural deterioration of bone tissue, which increases susceptibility to fractures. BMD is a complex quantitative trait with normal distribution and seems to be genetically controlled (in 50–90% of the cases), according to studies onmore » twins and families. Over the last 20 years, candidate gene approach and genome-wide association studies (GWAS) have identified single-nucleotide polymorphisms (SNPs) that are associated with low BMD, osteoporosis, and osteoporotic fractures. These SNPs have been mapped close to or within genes including those encoding nuclear receptors and WNT-β-catenin signaling proteins. Understanding the genetics of osteoporosis will help identify novel candidates for diagnostic and therapeutic targets.« less

Hexose-6-phosphate dehydrogenase: a new risk gene for multiple sclerosis

PubMed Central

Alcina, Antonio; Ramagopalan, Sreeram V; Fernández, Óscar; Catalá-Rabasa, Antonio; Fedetz, María; Ndagire, Dorothy; Leyva, Laura; Arnal, Carmen; Delgado, Concepción; Lucas, Miguel; Izquierdo, Guillermo; Ebers, George C; Matesanz, Fuencisla

2010-01-01

A recent genome-wide association study (GWAS) performed by the The Wellcome Trust Case–Control Consortium based on 12 374 nonsynonymous single-nucleotide polymorphisms (SNPs) provided evidence for several genes involved in multiple sclerosis (MS) susceptibility. In this study, we aimed at verifying the association of 19 SNPs with MS, with P-values ≤0.005, in an independent cohort of 732 patients and 974 controls, all Caucasian from the South of Spain. We observed an association of the rs17368528 polymorphism with MS (P=0.04, odds ratio (OR)=0.801, 95% confidence interval (CI)=0.648–0.990). The association of this polymorphism with MS was further validated in an independent set of 1318 patients from the Canadian Collaborative Project (P=0.04, OR=0.838, 95% CI=0.716–0.964). This marker is located on chromosome 1p36.22, which is 1 Mb away from the MS-associated kinesin motor protein KIF1B, although linkage disequilibrium was not observed between these two markers. The rs17368528 SNP results in an amino-acid substitution (proline to leucine) in the fifth exon of the hexose-6-phosphate dehydrogenase (H6PD) gene, in which some variants have been reported to attenuate or abolish H6PD activity, in individuals with cortisone reductase deficiency. This study corroborates the association of one locus determined by GWAS and points to H6PD as a new candidate gene for MS. PMID:19935835

Identification of Immunity Related Genes to Study the Physalis peruviana – Fusarium oxysporum Pathosystem

PubMed Central

Enciso-Rodríguez, Felix E.; González, Carolina; Rodríguez, Edwin A.; López, Camilo E.; Landsman, David; Barrero, Luz Stella; Mariño-Ramírez, Leonardo

2013-01-01

The Cape gooseberry ( Physalis peruviana L) is an Andean exotic fruit with high nutritional value and appealing medicinal properties. However, its cultivation faces important phytosanitary problems mainly due to pathogens like Fusarium oxysporum, Cercosporaphysalidis and Alternaria spp. Here we used the Cape gooseberry foliar transcriptome to search for proteins that encode conserved domains related to plant immunity including: NBS (Nucleotide Binding Site), CC (Coiled-Coil), TIR (Toll/Interleukin-1 Receptor). We identified 74 immunity related gene candidates in P . peruviana which have the typical resistance gene (R-gene) architecture, 17 Receptor like kinase (RLKs) candidates related to PAMP-Triggered Immunity (PTI), eight (TIR-NBS-LRR, or TNL) and nine (CC–NBS-LRR, or CNL) candidates related to Effector-Triggered Immunity (ETI) genes among others. These candidate genes were categorized by molecular function (98%), biological process (85%) and cellular component (79%) using gene ontology. Some of the most interesting predicted roles were those associated with binding and transferase activity. We designed 94 primers pairs from the 74 immunity-related genes (IRGs) to amplify the corresponding genomic regions on six genotypes that included resistant and susceptible materials. From these, we selected 17 single band amplicons and sequenced them in 14 F. oxysporum resistant and susceptible genotypes. Sequence polymorphisms were analyzed through preliminary candidate gene association, which allowed the detection of one SNP at the PpIRG-63 marker revealing a nonsynonymous mutation in the predicted LRR domain suggesting functional roles for resistance. PMID:23844210

Identification of immunity related genes to study the Physalis peruviana--Fusarium oxysporum pathosystem.

PubMed

Enciso-Rodríguez, Felix E; González, Carolina; Rodríguez, Edwin A; López, Camilo E; Landsman, David; Barrero, Luz Stella; Mariño-Ramírez, Leonardo

2013-01-01

The Cape gooseberry (Physalisperuviana L) is an Andean exotic fruit with high nutritional value and appealing medicinal properties. However, its cultivation faces important phytosanitary problems mainly due to pathogens like Fusarium oxysporum, Cercosporaphysalidis and Alternaria spp. Here we used the Cape gooseberry foliar transcriptome to search for proteins that encode conserved domains related to plant immunity including: NBS (Nucleotide Binding Site), CC (Coiled-Coil), TIR (Toll/Interleukin-1 Receptor). We identified 74 immunity related gene candidates in P. peruviana which have the typical resistance gene (R-gene) architecture, 17 Receptor like kinase (RLKs) candidates related to PAMP-Triggered Immunity (PTI), eight (TIR-NBS-LRR, or TNL) and nine (CC-NBS-LRR, or CNL) candidates related to Effector-Triggered Immunity (ETI) genes among others. These candidate genes were categorized by molecular function (98%), biological process (85%) and cellular component (79%) using gene ontology. Some of the most interesting predicted roles were those associated with binding and transferase activity. We designed 94 primers pairs from the 74 immunity-related genes (IRGs) to amplify the corresponding genomic regions on six genotypes that included resistant and susceptible materials. From these, we selected 17 single band amplicons and sequenced them in 14 F. oxysporum resistant and susceptible genotypes. Sequence polymorphisms were analyzed through preliminary candidate gene association, which allowed the detection of one SNP at the PpIRG-63 marker revealing a nonsynonymous mutation in the predicted LRR domain suggesting functional roles for resistance.

Do estrogen receptor alpha polymorphisms have any impact on the outcome in an ART program?

PubMed

Anagnostou, Elli; Malamas, Fotodotis; Mavrogianni, Despina; Dinopoulou, Vasiliki; Drakakis, Peter; Kallianidis, Konstantinos; Loutradis, Dimitris

2013-04-01

To investigate two of the most studied estrogen receptor alpha polymorphisms (PvuII and XbaI) in combination, in order to evaluate their impact on an ART program outcome. 203 normally ovulating women who underwent IVF or ICSI treatment were genotyped for PvuII and XbaI polymorphisms in ESR1 intron 1 using Real-Time PCR. The relationship between the presence of polymorphic alleles and the ovulation induction parameters and outcome was examined. Women were grouped according to the number of polymorphic alleles they carried in two groups (0-2 versus 3-4 polymorphic alleles). The presence of 3 or more polymorphic alleles was associated with significantly lower E2 levels on the day of hCG administration and a significantly lower rate of good quality embryos. There is an association between ESR1 polymorphisms and some ART parameters such as the level of E2 on the day of hCG administration and the quality of the embryos. These results underline the importance of ESR1 as a candidate gene for the prediction of ovarian response to IVF/ICSI protocols. Future research work concerning several more genes is necessary for a better evaluation of patients before entering an IVF/ICSI program.

Fine mapping of the Darier's disease locus on chromosome 12q.

PubMed

Richard, G; Wright, A R; Harris, S; Doyle, S Z; Korge, B; Mazzanti, C; Tanaka, T; Harth, W; McBride, O W; Compton, J G; Bale, S J; DiGiovanna, J J

1994-11-01

Darier's disease (DD) is an autosomal dominant genodermatosis characterized by epidermal acantholysis and dyskeratosis. We have performed genetic linkage studies in 10 families with DD (34 affected) by analyzing 14 polymorphic microsatellite markers. Our results confirm recent reports mapping the DD gene to chromosome 12q23-q24.1. Haplotype analysis of recombinant chromosomes in our families, along with previously reported data, narrow the location of the DD gene to a 5 cM interval flanked by the loci D12S354 and D12S84/D12S105. This localization allowed exclusion of two known genes, PLA2A and PAH, as candidate loci for DD. Three other gene loci (PPP1C, PMCH, PMCA1), mapping in 12q21-q24, remain potential candidates.

Serotonin Transporter Gene (SLC6A4) Polymorphism and Mucosal Serotonin Levels in Southeastern Iranian Patients with Irritable Bowel Syndrome

PubMed Central

Mohammadi, Mojgan; Tahmasebi Abdar, Hossein; Mollaei, Hamid Reza; Hajghani, Hossein; Baneshi, Mohammad Reza; Hayatbakhsh, Mohammad Mahdi

2017-01-01

BACKGROUND Irritable bowel syndrome (IBS) is a digestive system disorder with an unknown etiology. Serotonin has a key role in the secretion and motility of the intestine. Polymorphism in serotonin re-uptake transporter (SERT or SLC6A4) gene may have a functional role in the gut of patients with IBS. The aims of the present study were to investigate the association between SLC6A4 gene polymorphism and IBS and to detect the correlation between rectal serotonin levels and IBS sub-types. METHODS SLC6A4 gene polymorphism in 131 patients with IBS and 211 healthy controls were analysed using the quantitative polymerase chain reaction high-resolution melting (qPCR-HRM) curve technique. Serotonin was measured in rectal biopsies of patients with IBS using the enzyme-linked immunosorbent assay (ELISA) method. RESULTS The patients were categorized into three groups: IBS with diarrhoea (IBS-D): 70 patients, IBS with constipation (IBS-C): 18 patients, and IBS with mixed symptoms (IBS-M): 43 patients. The frequency of SLC6A4 s/s and l/s genotypes was significantly higher in IBS-C than IBS-D, IBS-M, and controls (p=0.036). Serotonin levels were similar in IBS sub-types. CONCLUSION SLC6A4 polymorphism is a possible candidate gene associated with the pathogenesis of IBS-C. Although serotonin levels did not differ in rectal biopsies of IBS sub-types, further investigation is recommended. PMID:28316763

Evolution of disease response genes in loblolly pine: insights from candidate genes.

PubMed

Ersoz, Elhan S; Wright, Mark H; González-Martínez, Santiago C; Langley, Charles H; Neale, David B

2010-12-06

Host-pathogen interactions that may lead to a competitive co-evolution of virulence and resistance mechanisms present an attractive system to study molecular evolution because strong, recent (or even current) selective pressure is expected at many genomic loci. However, it is unclear whether these selective forces would act to preserve existing diversity, promote novel diversity, or reduce linked neutral diversity during rapid fixation of advantageous alleles. In plants, the lack of adaptive immunity places a larger burden on genetic diversity to ensure survival of plant populations. This burden is even greater if the generation time of the plant is much longer than the generation time of the pathogen. Here, we present nucleotide polymorphism and substitution data for 41 candidate genes from the long-lived forest tree loblolly pine, selected primarily for their prospective influences on host-pathogen interactions. This dataset is analyzed together with 15 drought-tolerance and 13 wood-quality genes from previous studies. A wide range of neutrality tests were performed and tested against expectations from realistic demographic models. Collectively, our analyses found that axr (auxin response factor), caf1 (chromatin assembly factor) and gatabp1 (gata binding protein 1) candidate genes carry patterns consistent with directional selection and erd3 (early response to drought 3) displays patterns suggestive of a selective sweep, both of which are consistent with the arm-race model of disease response evolution. Furthermore, we have identified patterns consistent with diversifying selection at erf1-like (ethylene responsive factor 1), ccoaoemt (caffeoyl-CoA-O-methyltransferase), cyp450-like (cytochrome p450-like) and pr4.3 (pathogen response 4.3), expected under the trench-warfare evolution model. Finally, a drought-tolerance candidate related to the plant cell wall, lp5, displayed patterns consistent with balancing selection. In conclusion, both arms-race and trench-warfare models seem compatible with patterns of polymorphism found in different disease-response candidate genes, indicating a mixed strategy of disease tolerance evolution for loblolly pine, a major tree crop in southeastern United States.

[Relationship between interleukin-17A gene polymorphisms and the susceptibility to childhood asthma].

PubMed

Zhong, Fang-Fang; Zou, Yan; Liu, Chun-Yan; Liu, Wen-Jun

2016-12-01

To explore the relationship between polymorphisms of interleukin-17A (IL-17A) gene promoter (-197G/A and -692C/T) and the susceptibility to childhood asthma, to further identify the candidate genes for asthma, and to provide a basis for early prevention of asthma in high-risk children. Sixty-five outpatients or inpatients with childhood asthma between August 2013 and August 2015 were assigned to asthma group. Seventy healthy children within the same period were assigned to control group. Using peripheral venous blood from the two groups, PCR with sequence-specific primers was carried out to determine single nucleotide polymorphisms at positions -197G/A and -692C/T in IL-17A gene promoter. A statistical analysis was used to evaluate differences in genotype and allele frequencies between the two groups. Compared with the control group, the asthma group had significantly higher frequencies of TT genotype (29% vs 16%; P=0.012) and T allele (52% vs 42%; P=0.039) at position -692C/T of IL-17A gene. Children with T allele had 1.413-fold higher risk of childhood asthma than those with C allele (OR=1.413, 95%CI: 1.015-1.917). There were no significant differences in genotype and allele frequencies at position -197G/A in IL-17A gene between the two groups (p>0.05). Polymorphisms at position -692C/T in IL-17A gene promoter is associated with the susceptibility to childhood asthma. Children with -692T allele are more susceptible to childhood asthma. There is no significant relationship between polymorphisms at position -197G/A in IL-17A gene promoter and the susceptibility to childhood asthma.

Dog obesity--the need for identifying predisposing genetic markers.

PubMed

Switonski, M; Mankowska, M

2013-12-01

Incidence of overweight and obesity in dogs exceeds 30%, and several breeds are predisposed to this heritable phenotype. Rapid progress of canine genomics and advanced knowledge on the genetic background of human obesity bring a unique opportunity to perform such studies in dogs. Natural candidate genes for obesity are these encoding adipokines. Extended studies in humans indicated that polymorphisms of three of them, i.e. ADIPOQ, IL1 and TNF, are associated with predisposition to obesity. On the other hand, the use of genome-wide association studies revealed an association between human obesity and polymorphism of more than 50 other genes. Until now only few preliminary reports on polymorphism of canine FTO, MC4R, MC3R and PPARG genes have been published. Since the dog is a valuable model organism for human diseases one can foresee that such studies may also contribute to an in-depth understanding of human obesity pathogenesis. Copyright © 2013 Elsevier Ltd. All rights reserved.

Association of the oxytocin receptor (OXTR) gene polymorphisms with autism spectrum disorder (ASD) in the Japanese population.

PubMed

Liu, Xiaoxi; Kawamura, Yoshiya; Shimada, Takafumi; Otowa, Takeshi; Koishi, Shinko; Sugiyama, Toshiro; Nishida, Hisami; Hashimoto, Ohiko; Nakagami, Ryoichi; Tochigi, Mamoru; Umekage, Tadashi; Kano, Yukiko; Miyagawa, Taku; Kato, Nobumasa; Tokunaga, Katsushi; Sasaki, Tsukasa

2010-03-01

The oxytocin receptor (OXTR) gene, which is located on chromosome 3p25.3, has been implicated as a candidate gene for susceptibility of autism spectrum disorder (ASD). Positive associations between OXTR and ASD have been reported in earlier studies. However, the results were inconsistent and demand further studies. In this study, we investigated the associations between OXTR and ASD in a Japanese population by analyzing 11 single-nucleotide polymorphisms (SNPs) using both family-based association test (FBAT) and population-based case-control test. No significant signal was detected in the FBAT test. However, significant differences were observed in allelic frequencies of four SNPs, including rs2254298 between patients and controls. The risk allele of rs2254298 was 'A', which was consistent with the previous study in Chinese, and not with the observations in Caucasian. The difference in the risk allele of this SNP in previous studies might be attributable to an ethnic difference in the linkage disequilibrium structure between the Asians and Caucasians. In addition, haplotype analysis exhibits a significant association between a five-SNP haplotype and ASD, including rs22542898. In conclusion, our study might support that OXTR has a significant role in conferring the risk of ASD in the Japanese population.

Comprehensive analysis of Arabidopsis expression level polymorphisms with simple inheritance

PubMed Central

Plantegenet, Stephanie; Weber, Johann; Goldstein, Darlene R; Zeller, Georg; Nussbaumer, Cindy; Thomas, Jérôme; Weigel, Detlef; Harshman, Keith; Hardtke, Christian S

2009-01-01

In Arabidopsis thaliana, gene expression level polymorphisms (ELPs) between natural accessions that exhibit simple, single locus inheritance are promising quantitative trait locus (QTL) candidates to explain phenotypic variability. It is assumed that such ELPs overwhelmingly represent regulatory element polymorphisms. However, comprehensive genome-wide analyses linking expression level, regulatory sequence and gene structure variation are missing, preventing definite verification of this assumption. Here, we analyzed ELPs observed between the Eil-0 and Lc-0 accessions. Compared with non-variable controls, 5′ regulatory sequence variation in the corresponding genes is indeed increased. However, ∼42% of all the ELP genes also carry major transcription unit deletions in one parent as revealed by genome tiling arrays, representing a >4-fold enrichment over controls. Within the subset of ELPs with simple inheritance, this proportion is even higher and deletions are generally more severe. Similar results were obtained from analyses of the Bay-0 and Sha accessions, using alternative technical approaches. Collectively, our results suggest that drastic structural changes are a major cause for ELPs with simple inheritance, corroborating experimentally observed indel preponderance in cloned Arabidopsis QTL. PMID:19225455

Beyond the usual suspects: a multidimensional genetic exploration of infant attachment disorganization and security.

PubMed

Pappa, Irene; Szekely, Eszter; Mileva-Seitz, Viara R; Luijk, Maartje P C M; Bakermans-Kranenburg, Marian J; van IJzendoorn, Marinus H; Tiemeier, Henning

2015-01-01

Although the environmental influences on infant attachment disorganization and security are well-studied, little is known about their heritability. Candidate gene studies have shown small, often non-replicable effects. In this study, we gathered the largest sample (N = 657) of ethnically homogenous, 14-month-old children with both observed attachment and genome-wide data. First, we used a Genome-Wide Association Study (GWAS) approach to identify single nucleotide polymorphisms (SNPs) associated with attachment disorganization and security. Second, we annotated them into genes (Versatile Gene-based Association Study) and functional pathways. Our analyses provide evidence of novel genes (HDAC1, ZNF675, BSCD1) and pathways (synaptic transmission, cation transport) associated with attachment disorganization. Similar analyses identified a novel gene (BECN1) but no distinct pathways associated with attachment security. The results of this first extensive, exploratory study on the molecular-genetic basis of infant attachment await replication in large, independent samples.

Genetic structure of seven Mexican indigenous populations based on five polymarker loci.

PubMed

Buentello-Malo, Leonora; Peñaloza-Espinosa, Rosenda I; Loeza, Francisco; Salamanca-Gomez, Fabio; Cerda-Flores, Ricardo M

2003-01-01

This descriptive study investigates the genetic structure of seven Mexican indigenous populations (Mixteca Alta, Mixteca Baja, Otomies, Purepecha, Nahuas-Guerrero, Nahuas-Xochimilco, and Tzeltales) on the basis of five PCR-based polymorphic DNA loci: LDLR, GYPA, HBGG, D7S8, and GC. Genetic distance and diversity analyses indicate that these Mexican indigenous are similar and that more than 96% of the total gene diversity (H(T)) can be attributed to individual variation within populations. Mixteca-Alta, Mixteca-Baja, and Nahuas-Xochimilco show indications of higher admixture with European-derived persons. The demonstration of a relative genetic homogeneity of Mexican Indians for the markers studied suggests that this population is suitable for studying disease-marker associations in the search for candidate genes of complex diseases. Copyright 2002 Wiley-Liss, Inc.

Interactions between RASA2, CADM1, HIF1AN gene polymorphisms and body fatness with breast cancer: a population-based case-control study in China.

PubMed

Zhu, Zheng; Teng, Zhimei; van Duijnhoven, Fränzel J B; Dong, Meihua; Qian, Yun; Yu, Hao; Yang, Jie; Han, Renqiang; Su, Jian; Du, Wencong; Huang, Xingyu; Zhou, Jinyi; Yu, Xiaojin; Kampman, Ellen; Wu, Ming

2017-11-17

Genome-wide association studies (GWAS) have indicated that gene polymorphisms in alleles of RAS p21 protein activator 2 (RASA2), cell adhesion molecule 1 (CADM1) and hypoxia inducible factor 1 alpha subunit inhibitor (HIF1AN) are associated with the risk of obesity. In this study, we explored the interactions between candidate SNPs of RASA2 (rs16851483), CADM1 (rs12286929) and HIF1AN (rs17094222) and body fatness for breast cancer risk. Unconditional logistic regression models were applied to measure the associations of related factors with breast cancer by odds ratios (ORs) and 95% confidence intervals (CIs). It was observed that cases had a statistically higher body mass index (BMI ≥ 28 kg/m 2 , OR = 1.77), waist circumference (WC ≥ 90cm, OR = 2.89) and waist-to-hip ratio (WHR ≥ 0.9, OR = 3.41) as compared to controls. Significant differences were also found in the genotype distributions of RASA2 rs16851483 T/T homozygote and CADM1 rs12286929 G/A heterozygote between cases and controls, with an OR of 1.68 (95% CI: 1.10-2.56) and 0.80 (95% CI: 0.64-0.99), respectively. Furthermore, significant interactions were observed between polymorphisms of three genes and body fatness for the risk of breast cancer based on both additive and multiplicative scales. These results of our study suggest that body fatness possibly plays an important role in the development of breast cancer and this risk might be modified by specific genotypes of some potential genes, especially for obese women in China.

A comprehensive resource of drought- and salinity- responsive ESTs for gene discovery and marker development in chickpea (Cicer arietinum L.)

PubMed Central

2009-01-01

Background Chickpea (Cicer arietinum L.), an important grain legume crop of the world is seriously challenged by terminal drought and salinity stresses. However, very limited number of molecular markers and candidate genes are available for undertaking molecular breeding in chickpea to tackle these stresses. This study reports generation and analysis of comprehensive resource of drought- and salinity-responsive expressed sequence tags (ESTs) and gene-based markers. Results A total of 20,162 (18,435 high quality) drought- and salinity- responsive ESTs were generated from ten different root tissue cDNA libraries of chickpea. Sequence editing, clustering and assembly analysis resulted in 6,404 unigenes (1,590 contigs and 4,814 singletons). Functional annotation of unigenes based on BLASTX analysis showed that 46.3% (2,965) had significant similarity (≤1E-05) to sequences in the non-redundant UniProt database. BLASTN analysis of unique sequences with ESTs of four legume species (Medicago, Lotus, soybean and groundnut) and three model plant species (rice, Arabidopsis and poplar) provided insights on conserved genes across legumes as well as novel transcripts for chickpea. Of 2,965 (46.3%) significant unigenes, only 2,071 (32.3%) unigenes could be functionally categorised according to Gene Ontology (GO) descriptions. A total of 2,029 sequences containing 3,728 simple sequence repeats (SSRs) were identified and 177 new EST-SSR markers were developed. Experimental validation of a set of 77 SSR markers on 24 genotypes revealed 230 alleles with an average of 4.6 alleles per marker and average polymorphism information content (PIC) value of 0.43. Besides SSR markers, 21,405 high confidence single nucleotide polymorphisms (SNPs) in 742 contigs (with ≥ 5 ESTs) were also identified. Recognition sites for restriction enzymes were identified for 7,884 SNPs in 240 contigs. Hierarchical clustering of 105 selected contigs provided clues about stress- responsive candidate genes and their expression profile showed predominance in specific stress-challenged libraries. Conclusion Generated set of chickpea ESTs serves as a resource of high quality transcripts for gene discovery and development of functional markers associated with abiotic stress tolerance that will be helpful to facilitate chickpea breeding. Mapping of gene-based markers in chickpea will also add more anchoring points to align genomes of chickpea and other legume species. PMID:19912666

Genomic analysis of differentiation between soil types reveals candidate genes for local adaptation in Arabidopsis lyrata.

PubMed

Turner, Thomas L; von Wettberg, Eric J; Nuzhdin, Sergey V

2008-09-11

Serpentine soil, which is naturally high in heavy metal content and has low calcium to magnesium ratios, comprises a difficult environment for most plants. An impressive number of species are endemic to serpentine, and a wide range of non-endemic plant taxa have been shown to be locally adapted to these soils. Locating genomic polymorphisms which are differentiated between serpentine and non-serpentine populations would provide candidate loci for serpentine adaptation. We have used the Arabidopsis thaliana tiling array, which has 2.85 million probes throughout the genome, to measure genetic differentiation between populations of Arabidopsis lyrata growing on granitic soils and those growing on serpentinic soils. The significant overrepresentation of genes involved in ion transport and other functions provides a starting point for investigating the molecular basis of adaptation to soil ion content, water retention, and other ecologically and economically important variables. One gene in particular, calcium-exchanger 7, appears to be an excellent candidate gene for adaptation to low CaratioMg ratio in A. lyrata.

No evidence of an MHC-based female mating preference in great reed warblers.

PubMed

Westerdahl, Helena

2004-08-01

Female mate-choice based on genetic compatibility is an area of growing interest. The major histocompatibility complex (MHC) genes are likely candidates for such mate-choice since these highly polymorphic genes may both increase offspring viability and also provide direct cues for mate-choice. In great reed warblers, females actively choose a breeding partner out of a handful of males that they visit and evaluate; thus, female preference for compatible or heterozygous MHC genes could have evolved. Here, I investigate whether great reed warbler females preferentially mate with males with dissimilar MHC class I alleles or with males that are heterozygous at MHC class I. Despite favourable conditions, a thorough screening method and a large sample size, there was no evidence of an MHC-based female mating preference based on either genetic compatibility or heterozygosity in this population. Power analyses of the data sets revealed that relatively small differences (15% and 8%, respectively) between true and random pairs should have been detected. Copyright 2004 Blackwell Publishing Ltd

Pharmacogenetics and Metabolism from Science to Implementation in Clinical Practice: The Example of Dihydropyrimidine Dehydrogenase.

PubMed

Del Re, Marzia; Restante, Giuliana; Di Paolo, Antonello; Crucitta, Stefania; Rofi, Eleonora; Danesi, Romano

2017-01-01

Fluoropyrimidines are widely used in the treatment of solid tumors and remain the backbone of many combination chemotherapy regimens. Despite their clinical benefit, they are associated with frequent gastrointestinal and hematological toxicities, which often lead to treatment discontinuation. Fluoropyrimidines undergo complex anabolic and catabolic biotransformation. Enzymes involved in this pathway include dihydropyrimidine dehydrogenase (DPD), which breaks down 5-FU and its prodrugs. Candidate gene approaches have demonstrated associations between 5-FU treatment outcomes and germline polymorphisms in DPD. The aim of this review is to report and discuss the latest results on fluoropyrimidine pharmacogenetics. Literature from PubMed databases and bibliography from retrieved publications have been analyzed according to terms such DPD, DPYD, fluoropyrimdines, polymorphisms, toxicity, pharmacogenetics. To date, many sequence variations have been identified within DPYD gene, although the majority of these have no functional consequences on enzymatic activity. Nowadays, there is a general agreement on the clinical significance of the importance of DPD deficiency in patients who suffer from severe, life-threatening drug toxicity although preemptive testing is not applied to all patients. Considering the published literature, clinicians are strongly encouraged to consider testing for DPD poor metabolizer variants as a rational pre-treatment screening for patients candidate to a fluoropyrimidine-based regimens, in order to prevent toxicities and personalise treatments. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.

DNA Repair Mechanism Gene, XRCC1A ( Arg194Trp) but not XRCC3 ( Thr241Met) Polymorphism Increased the Risk of Breast Cancer in Premenopausal Females: A Case-Control Study in Northeastern Region of India.

PubMed

Devi, K Rekha; Ahmed, Jishan; Narain, Kanwar; Mukherjee, Kaustab; Majumdar, Gautam; Chenkual, Saia; Zonunmawia, Jason C

2017-12-01

X-ray repair cross complementary group gene is one of the most studied candidate gene involved in different types of cancers. Studies have shown that X-ray repair cross complementary genes are significantly associated with increased risk of breast cancer in females. Moreover, studies have revealed that X-ray repair cross complementary gene polymorphism significantly varies between and within different ethnic groups globally. The present case-control study was aimed to investigate the association of X-ray repair cross complementary 1A (Arg194Trp) and X-ray repair cross complementary 3 (Thr241Met) polymorphism with the risk of breast cancer in females from northeastern region of India. The present case-control study includes histopathologically confirmed and newly diagnosed 464 cases with breast cancer and 534 apparently healthy neighborhood community controls. Information on sociodemographic factors and putative risk factors were collected from each study participant by conducting face-to-face interviews. Genotyping of X-ray repair cross complementary 1A (Arg194Trp) and X-ray repair cross complementary 3 (Thr241Met) was carried out by polymerase chain reaction-restriction fragment length polymorphism. For statistical analysis, both univariate and multivariate logistic regression analyses were performed. We also performed stratified analysis to find out the association of X-ray repair cross complementary genes with the risk of breast cancer stratified based on menstrual status. This study revealed that tryptophan allele (R/W-W/W genotype) in X-ray repair cross complementary 1A (Arg194Trp) gene significantly increased the risk of breast cancer (adjusted odds ratio = 1.44, 95% confidence interval = 1.06-1.97, P < .05 for R/W-W/W genotype). Moreover, it was found that tryptophan allele (W/W genotype) at codon 194 of X-ray repair cross complementary 1A (Arg194Trp) gene significantly increased the risk of breast cancer in premenopausal females (crude odds ratio = 1.66, 95% confidence interval = 1.11-2.46, P < .05 for R/W-W/W genotype). The present study did not reveal any significant association of X-ray repair cross complementary 3 (Thr241Met) polymorphism with the risk of breast cancer. The present study has explored that X-ray repair cross complementary 1A (Arg194Trp) gene polymorphism is significantly associated with the increased risk of breast cancer in premenopausal females from northeastern region of India which may be beneficial for prognostic purposes.

DNA Repair Mechanism Gene, XRCC1A (Arg194Trp) but not XRCC3 (Thr241Met) Polymorphism Increased the Risk of Breast Cancer in Premenopausal Females: A Case–Control Study in Northeastern Region of India

PubMed Central

Ahmed, Jishan; Narain, Kanwar; Mukherjee, Kaustab; Majumdar, Gautam; Chenkual, Saia; Zonunmawia, Jason C.

2017-01-01

X-ray repair cross complementary group gene is one of the most studied candidate gene involved in different types of cancers. Studies have shown that X-ray repair cross complementary genes are significantly associated with increased risk of breast cancer in females. Moreover, studies have revealed that X-ray repair cross complementary gene polymorphism significantly varies between and within different ethnic groups globally. The present case–control study was aimed to investigate the association of X-ray repair cross complementary 1A (Arg194Trp) and X-ray repair cross complementary 3 (Thr241Met) polymorphism with the risk of breast cancer in females from northeastern region of India. The present case–control study includes histopathologically confirmed and newly diagnosed 464 cases with breast cancer and 534 apparently healthy neighborhood community controls. Information on sociodemographic factors and putative risk factors were collected from each study participant by conducting face-to-face interviews. Genotyping of X-ray repair cross complementary 1A (Arg194Trp) and X-ray repair cross complementary 3 (Thr241Met) was carried out by polymerase chain reaction-restriction fragment length polymorphism. For statistical analysis, both univariate and multivariate logistic regression analyses were performed. We also performed stratified analysis to find out the association of X-ray repair cross complementary genes with the risk of breast cancer stratified based on menstrual status. This study revealed that tryptophan allele (R/W-W/W genotype) in X-ray repair cross complementary 1A (Arg194Trp) gene significantly increased the risk of breast cancer (adjusted odds ratio = 1.44, 95% confidence interval = 1.06-1.97, P < .05 for R/W-W/W genotype). Moreover, it was found that tryptophan allele (W/W genotype) at codon 194 of X-ray repair cross complementary 1A (Arg194Trp) gene significantly increased the risk of breast cancer in premenopausal females (crude odds ratio = 1.66, 95% confidence interval = 1.11-2.46, P < .05 for R/W-W/W genotype). The present study did not reveal any significant association of X-ray repair cross complementary 3 (Thr241Met) polymorphism with the risk of breast cancer. The present study has explored that X-ray repair cross complementary 1A (Arg194Trp) gene polymorphism is significantly associated with the increased risk of breast cancer in premenopausal females from northeastern region of India which may be beneficial for prognostic purposes. PMID:29332455

Convergence of genome-wide association and candidate gene studies for alcoholism.

PubMed

Olfson, Emily; Bierut, Laura Jean

2012-12-01

Genome-wide association (GWA) studies have led to a paradigm shift in how researchers study the genetics underlying disease. Many GWA studies are now publicly available and can be used to examine whether or not previously proposed candidate genes are supported by GWA data. This approach is particularly important for the field of alcoholism because the contribution of many candidate genes remains controversial. Using the Human Genome Epidemiology (HuGE) Navigator, we selected candidate genes for alcoholism that have been frequently examined in scientific articles in the past decade. Specific candidate loci as well as all the reported single nucleotide polymorphisms (SNPs) in candidate genes were examined in the Study of Addiction: Genetics and Environment (SAGE), a GWA study comparing alcohol-dependent and nondependent subjects. Several commonly reported candidate loci, including rs1800497 in DRD2, rs698 in ADH1C, rs1799971 in OPRM1, and rs4680 in COMT, are not replicated in SAGE (p > 0.05). Among candidate loci available for analysis, only rs279858 in GABRA2 (p = 0.0052, OR = 1.16) demonstrated a modest association. Examination of all SNPs reported in SAGE in over 50 candidate genes revealed no SNPs with large frequency differences between cases and controls, and the lowest p-value of any SNP was 0.0006. We provide evidence that several extensively studied candidate loci do not have a strong contribution to risk of developing alcohol dependence in European and African ancestry populations. Owing to the lack of coverage, we were unable to rule out the contribution of other variants, and these genes and particular loci warrant further investigation. Our analysis demonstrates that publicly available GWA results can be used to better understand which if any of previously proposed candidate genes contribute to disease. Furthermore, we illustrate how examining the convergence of candidate gene and GWA studies can help elucidate the genetic architecture of alcoholism and more generally complex diseases. Copyright © 2012 by the Research Society on Alcoholism.

Genetic variation may influence obesity only under conditions of diet: analysis of three candidate genes.

PubMed

Aberle, Jens; Flitsch, Jörg; Beck, Nicola Alessia; Mann, Oliver; Busch, Philipp; Peitsmeier, Philipp; Beil, Frank Ulrich

2008-11-01

Under the hypothesis of obesity as a polygenetic disease numerous genes have been associated with an obese phenotype and metabolic co-morbidities. The cannabinoid receptor 1 (CB 1) is part of an underinvestigated system that participates in appetite control. Previous publications suggest that the endocannabinoid systems interact with the better understood leptin-melanocortin axis. Neuropeptide Y (NPY) is a player in the latter. Finally resistin has been shown to influence NPY expression in the brain. In a cohort of 1721 caucasion men and women with a BMI of 25kg/m(2) or more we therefore investigated three candidate polymorphisms at baseline and following 3 months low fat caloric restriction diet by polymerase chain reaction and restriction digestion: the 1359 G/A variant of the cannabinoid receptor 1 (CB1), the L7P variation in neuropeptide Y (NPY) and the -420C>G polymorphism in resistin. Comparing groups according to genotype for each gene separately revealed significant results at baseline only for the CB1 gene. However, upon dieting significant data was found for all 3 genes. Carriers of at least one A allele in CB1 lost more weight and reduced LDL cholesterol more than wildtype patients. LL homocygotes in NPY had a greater reduction in glucose, triglycerides, and LDL cholesterol whereas in resistin carriers of the G allele had a greater reduction in weight and triglycerides. Creating two groups defined by NPY and resistin genotype, respectively, with similar BMI values resulted in significant differences concerning weight loss and metabolic improvement. In conclusion, genetic polymorphisms associated with obesity may become relevant only under the condition of a low calory diet. The presence of a certain genotype may then be beneficial for obesity treatment.

Gene mapping study for constitutive skin color in an isolated Mongolian population.

PubMed

Paik, Seung Hwan; Kim, Hyun-Jin; Son, Ho-Young; Lee, Seungbok; Im, Sun-Wha; Ju, Young Seok; Yeon, Je Ho; Jo, Seong Jin; Eun, Hee Chul; Seo, Jeong-Sun; Kwon, Oh Sang; Kim, Jong-Il

2012-03-31

To elucidate the genes responsible for constitutive human skin color, we measured the extent of skin pigmentation in the buttock, representative of lifelong non-sun-exposed skin, and conducted a gene mapping study on skin color in an isolated Mongolian population composed of 344 individuals from 59 families who lived in Dashbalbar, Mongolia. The heritability of constitutive skin color was 0.82, indicating significant genetic association on this trait. Through the linkage analysis using 1,039 short tandem repeat (STR) microsatellite markers, we identified a novel genomic region regulating constitutive skin color on 11q24.2 with an logarithm of odds (LOD) score of 3.39. In addition, we also found other candidate regions on 17q23.2, 6q25.1, and 13q33.2 (LOD ≥ 2). Family-based association tests on these regions with suggestive linkage peaks revealed ten and two significant single nucleotide polymorphisms (SNPs) on the linkage regions of chromosome 11 and 17, respectively. We were able to discover four possible candidate genes that would be implicated to regulate human skin color: ETS1, UBASH3B, ASAM, and CLTC.

Gene mapping study for constitutive skin color in an isolated Mongolian population

PubMed Central

Paik, Seung Hwan; Kim, Hyun-Jin; Son, Ho-Young; Lee, Seungbok; Im, Sun-Wha; Ju, Young Seok; Yeon, Je Ho; Jo, Seong Jin; Eun, Hee Chul; Seo, Jeong-Sun

2012-01-01

To elucidate the genes responsible for constitutive human skin color, we measured the extent of skin pigmentation in the buttock, representative of lifelong non-sun-exposed skin, and conducted a gene mapping study on skin color in an isolated Mongolian population composed of 344 individuals from 59 families who lived in Dashbalbar, Mongolia. The heritability of constitutive skin color was 0.82, indicating significant genetic association on this trait. Through the linkage analysis using 1,039 short tandem repeat (STR) microsatellite markers, we identified a novel genomic region regulating constitutive skin color on 11q24.2 with an logarithm of odds (LOD) score of 3.39. In addition, we also found other candidate regions on 17q23.2, 6q25.1, and 13q33.2 (LOD ≥ 2). Family-based association tests on these regions with suggestive linkage peaks revealed ten and two significant single nucleotide polymorphisms (SNPs) on the linkage regions of chromosome 11 and 17, respectively. We were able to discover four possible candidate genes that would be implicated to regulate human skin color: ETS1, UBASH3B, ASAM, and CLTC. PMID:22198297

The Associations between RNA Splicing Complex Gene SF3A1 Polymorphisms and Colorectal Cancer Risk in a Chinese Population.

PubMed

Chen, Xiaohua; Du, Hua; Liu, Binjian; Zou, Li; Chen, Wei; Yang, Yang; Zhu, Ying; Gong, Yajie; Tian, Jianbo; Li, Feng; Zhong, Shan

2015-01-01

Aberrant alternative splicing included alterations in components of the mRNA splicing machinery often occurred in colon cancer. However, the role of SF3A1, one key component of the mRNA splicing machinery, on colorectal cancer (CRC) risk was still not elucidated. We performed a hospital-based case-control study containing 801 CRC patients and 817 cancer-free controls to examine the association between SF3A1 polymorphisms and CRC risk in a Chinese population. Four candidate SNPs (rs10376, rs5753073, rs2839998 and rs2074733) were selected based on bioinformatics analysis and previous findings. The results showed no significant associations between these SNPs and CRC risk (P > 0.05). Besides, the stratified analysis based on the smoking and alcohol use status obtained no statistically significant results. Our study was the first one to investigate the association between SF3A1 polymorphisms and CRC risk. The results suggested these four SNPs in SF3A1 were not associated with CRC risk in a Chinese population, however, further more studies are needed to confirm our findings.

The genetic basis for variation in resistance to infection in the Drosophila melanogaster genetic reference panel

PubMed Central

Wang, Jonathan B.

2017-01-01

Individuals vary extensively in the way they respond to disease but the genetic basis of this variation is not fully understood. We found substantial individual variation in resistance and tolerance to the fungal pathogen Metarhizium anisopliae Ma549 using the Drosophila melanogaster Genetic Reference Panel (DGRP). In addition, we found that host defense to Ma549 was correlated with defense to the bacterium Pseudomonas aeruginosa Pa14, and several previously published DGRP phenotypes including oxidative stress sensitivity, starvation stress resistance, hemolymph glucose levels, and sleep indices. We identified polymorphisms associated with differences between lines in both their mean survival times and microenvironmental plasticity, suggesting that lines differ in their ability to adapt to variable pathogen exposures. The majority of polymorphisms increasing resistance to Ma549 were sex biased, located in non-coding regions, had moderately large effect and were rare, suggesting that there is a general cost to defense. Nevertheless, host defense was not negatively correlated with overall longevity and fecundity. In contrast to Ma549, minor alleles were concentrated in the most Pa14-susceptible as well as the most Pa14-resistant lines. A pathway based analysis revealed a network of Pa14 and Ma549-resistance genes that are functionally connected through processes that encompass phagocytosis and engulfment, cell mobility, intermediary metabolism, protein phosphorylation, axon guidance, response to DNA damage, and drug metabolism. Functional testing with insertional mutagenesis lines indicates that 12/13 candidate genes tested influence susceptibility to Ma549. Many candidate genes have homologs identified in studies of human disease, suggesting that genes affecting variation in susceptibility are conserved across species. PMID:28257468

Evaluation of Candidate Genes for Cholinesterase Activity in Farmworkers Exposed to Organophosphorus Pesticides: Association of Single Nucleotide Polymorphisms in BCHE

PubMed Central

Howard, Timothy D.; Hsu, Fang-Chi; Grzywacz, Joseph G.; Chen, Haiying; Quandt, Sara A.; Vallejos, Quirina M.; Whalley, Lara E.; Cui, Wei; Padilla, Stephanie; Arcury, Thomas A.

2010-01-01

Background Organophosphate pesticides act as cholinesterase inhibitors. For those with agricultural exposure to these chemicals, risk of potential exposure-related health effects may be modified by genetic variability in cholinesterase metabolism. Cholinesterase activity is a useful, indirect measurement of pesticide exposure, especially in high-risk individuals such as farmworkers. To understand fully the links between pesticide exposure and potential human disease, analyses must be able to consider genetic variability in pesticide metabolism. Objectives We studied participants in the Community Participatory Approach to Measuring Farmworker Pesticide Exposure (PACE3) study to determine whether cholinesterase levels are associated with single-nucleotide polymorphisms (SNPs) involved in pesticide metabolism. Methods Cholinesterase levels were measured from blood samples taken from 287 PACE3 participants at up to four time points during the 2007 growing season. We performed association tests of cholinesterase levels and 256 SNPs in 30 candidate genes potentially involved in pesticide metabolism. A false discovery rate (FDR) p-value was used to account for multiple testing. Results Thirty-five SNPs were associated (unadjusted p < 0.05) based on at least one of the genetic models tested (general, additive, dominant, and recessive). The strongest evidence of association with cholinesterase levels was observed with two SNPs, rs2668207 and rs2048493, in the butyrylcholinesterase (BCHE) gene (FDR adjusted p = 0.15 for both; unadjusted p = 0.00098 and 0.00068, respectively). In participants with at least one minor allele, cholinesterase levels were lower by 4.3–9.5% at all time points, consistent with an effect that is independent of pesticide exposure. Conclusions Common genetic variation in the BCHE gene may contribute to subtle changes in cholinesterase levels. PMID:20529763

Associated analysis of single nucleotide polymorphisms found on exon 3 of the IGF-1 gene with Tibetan miniature pig growth traits.

PubMed

Yue, M; Tian, Y G; Wang, Y J; Gu, Y; Bayaer, N; Hu, Q; Gu, W W

2014-02-27

The IGF-1 gene is an important regulating factor that has a growth-promoting effect on growth hormone. The IGF-1 gene promotes muscle cell differentiation in the muscle cell formation process. The IGF-1 gene also regulates the growth of skeletal muscle during skeletal muscle growth. In addition, the IGF-1 gene plays an important role in the formation of mammals and poultry embryos, and the process of postnatal growth. The IGF-1 gene has been implicated as a candidate gene for the regulation of pig growth traits. We analyzed exon 3 of the IGF-1 gene polymorphism in Tibetan miniature pigs (N = 128) by polymerase chain reaction-single-strand conformation polymorphism and DNA sequencing. One single nucleotide polymorphism (T40C) was found on exon 3 of the IGF-1 gene. Statistical analysis of genotype frequencies revealed that the T allele was dominant in Tibetan miniature pigs at the T40C locus. The association analysis showed that the IGF-1 mutation had an effect on the body weight, body length, and chest circumference of pigs aged 6-8 months. In addition, the IGF-1 mutation had an effect on body weight in pigs aged 9-11 months (P < 0.05). We speculated that the pigs with the TT genotype grow more rapidly compared to those with the TC genotype. The TC genotype of the Tibetan miniature pig has a smaller body type. This information provides a theoretical basis for the genetic background of Tibetan miniature pigs.

Distribution and linkage disequilibrium analysis of polymorphisms of GH1 gene in different populations of pigs associated with body size.

PubMed

Cheng, Yunyun; Liu, Songcai; Su, Dan; Lu, Chao; Zhang, Xin; Wu, Qingyan; Li, Siming; Fu, Haoyu; Yu, Hao; Hao, Linlin

2016-03-01

Growth hormone (GH) has been considered as a candidate gene for growth and body size in pigs. In this study, polymorphisms of the GH1 gene were evaluated for associations with body size traits in 190 pig individuals. Seventeen single-nucleotide polymorphisms (SNPs) were identified in GH1 gene of the large pig breeds and miniature pig breeds using direct sequencing and genotyped by allele-specific PCR approach. Notably, six (g.237A>G, g.283T>C, g.309A>G, g.318A>G, g.540A>G and g.544A>G) of them were significantly associated with body size, of which three loci (g.283T>C, g.309A>G, g.318A>G) located in the signal-peptide coding region of GH1 gene compose a CGG haplotype for large pigs and TAA haplotype for miniature pigs (P <0.001), two loci (g.540A>G and g.544A>G) located in the second intron of GH1 gene compose a GG haplotype for large pigs and AA haplotype for miniature pigs (P < 0.001). Our results demonstrate that these SNPs in GH1 gene are associated with the body size of pigs providing genetic basis for pig breeding with the improved economic benefits.

Signatures of positive selection in East African Shorthorn Zebu: A genome-wide single nucleotide polymorphism analysis

PubMed Central

Bahbahani, Hussain; Clifford, Harry; Wragg, David; Mbole-Kariuki, Mary N; Van Tassell, Curtis; Sonstegard, Tad; Woolhouse, Mark; Hanotte, Olivier

2015-01-01

The small East African Shorthorn Zebu (EASZ) is the main indigenous cattle across East Africa. A recent genome wide SNP analysis revealed an ancient stable African taurine x Asian zebu admixture. Here, we assess the presence of candidate signatures of positive selection in their genome, with the aim to provide qualitative insights about the corresponding selective pressures. Four hundred and twenty-five EASZ and four reference populations (Holstein-Friesian, Jersey, N’Dama and Nellore) were analysed using 46,171 SNPs covering all autosomes and the X chromosome. Following FST and two extended haplotype homozygosity-based (iHS and Rsb) analyses 24 candidate genome regions within 14 autosomes and the X chromosome were revealed, in which 18 and 4 were previously identified in tropical-adapted and commercial breeds, respectively. These regions overlap with 340 bovine QTL. They include 409 annotated genes, in which 37 were considered as candidates. These genes are involved in various biological pathways (e.g. immunity, reproduction, development and heat tolerance). Our results support that different selection pressures (e.g. environmental constraints, human selection, genome admixture constrains) have shaped the genome of EASZ. We argue that these candidate regions represent genome landmarks to be maintained in breeding programs aiming to improve sustainable livestock productivity in the tropics. PMID:26130263

Association of TRPV4 gene polymorphisms with chronic obstructive pulmonary disease.

PubMed

Zhu, Guohua; Gulsvik, Amund; Bakke, Per; Ghatta, Srinivas; Anderson, Wayne; Lomas, David A; Silverman, Edwin K; Pillai, Sreekumar G

2009-06-01

Chronic obstructive pulmonary disease (COPD) is characterized by airway epithelial damage, bronchoconstriction, parenchymal destruction and mucus hypersecretion. Upon activation by a broad range of stimuli, transient receptor potential vanilloid 4 (TRPV4) functions to control airway epithelial cell volume and epithelial and endothelial permeability; it also triggers bronchial smooth muscle contraction and participates in autoregulation of mucociliary transport. These functions of TRPV4 may be important for the regulation of COPD pathogenesis, so TRPV4 is a candidate gene for COPD. We genotyped 20 single nucleotide polymorphisms (SNPs) in TRPV4, and tested qualitative COPD and quantitative FEV(1) and FEV(1)/(F)VC phenotypes in two independent large populations. The family population had 606 pedigrees including 1891 individuals, and the case-control sample included 953 COPD cases and 956 controls. Family-based association tests were performed in the family data. Logistic regression and linear models were used in the case-control data to replicate the association results. In the family data, seven out of 20 SNPs tested were associated with COPD (2.5 x 10(-4) < or = P < or = 0.04) and six SNPs were associated with FEV(1)/VC (0.02 < or = P < or = 0.03) from family-based association tests (PBAT) analysis. Four out of the seven SNPs associated with COPD demonstrated replicated associations with the same effect directions in the case-control population (0.02 < or = P < or = 0.03). Significant haplotype associations supported the results of single SNP analyses. Thus, polymorphisms in the TRPV4 gene are associated with COPD.

5' UTR polymorphism of dopamine receptor D1 (DRD1) associated with severity and temperament of alcoholism.

PubMed

Kim, Dai-Jin; Park, Byung Lae; Yoon, Sujung; Lee, Hae-Kook; Joe, Keun-Ho; Cheon, Young-Hoon; Gwon, Do-Hoon; Cho, Sung-Nam; Lee, Hye Won; NamGung, Suk; Shin, Hyoung Doo

2007-06-15

Multiple dopamine receptors in the dopaminergic system may be prime candidates for genetic influence on alcohol abuse and dependence due to their involvement in reward and reinforcing mechanisms. Genetic polymorphisms in dopamine receptor genes are believed to influence the development and/or severity of alcoholism. To examine the genetic effects of the Dopamine Receptor D1 (DRD) gene family (DRD1-DRD5) in the Korean population, 11 polymorphisms in the DRD gene family were genotyped and analyzed in 535 alcohol-dependent subjects and 273 population controls. Although none of the polymorphisms of DRD1-5 genes were found to be associated with the risk of alcoholism, one 5' UTR polymorphism in the DRD1 (DRD1-48A>G) gene was significantly associated with severity of alcohol-related problem, as measured by the Alcohol Use Disorders Identification Test (AUDIT) in a gene dose-dependent manner, i.e., 24.37 (+/-8.19) among patients with -48A/A genotype, 22.37 (+/-9.49) among those with -48A/G genotype, and 17.38 (+/-8.28) among those with -48G/G genotype (P=0.002). The genetic effects of DRD1-48A>G were further analyzed with other phenotypes among alcohol-dependent subjects. Interestingly, the DRD1-48A>A genotype was also found to be associated with novelty seeking (NC), harm avoidance (HA), and persistence (P) (P =0.01, 0.02, and 0.003, respectively). The information derived from this study could be valuable for understanding the genetic factors involved in alcoholic phenotypes and genetic distribution of the DRD gene family, and could facilitate further investigation in other ethnic groups.

RAPD and SSR Polymorphisms in Mutant Lines of Transgenic Wheat Mediated by Low Energy Ion Beam

NASA Astrophysics Data System (ADS)

Wang, Tiegu; Huang, Qunce; Feng, Weisen

2007-10-01

Two types of markers-random amplified polymorphic DNA (RAPD) and simple sequence repeat DNA (SSR)-have been used to characterize the genetic diversity among nine mutant lines of transgenic wheat intermediated by low energy ion beam and their four receptor cultivars. The objectives of this study were to analyze RAPD-based and SSR-based genetic variance among transgenic wheat lines and with their receptors, and to find specific genetic markers of special traits of transgenic wheat lines. 170 RAPD primers were amplified to 733 fragments in all the experimental materials. There were 121 polymorphic fragments out of the 733 fragments with a ratio of polymorphic fragments of 16.5%. 29 SSR primer pairs were amplified to 83 fragments in all the experiment materials. There were 57 polymorphic fragments out of the 83 fragments with a ratio of polymorphic fragments of 68.7%. The dendrograms were prepared based on a genetic distance matrix using the UPGMA (Unweighted Pair-group Method with Arithmetic averaging) algorithm, which corresponded well to the results of the wheat pedigree analysis and separated the 13 genotypes into four groups. Association analysis between RAPD and SSR markers with the special traits of transgenic wheat mutant lines discovered that three RAPD markers, s1, opt-16, and f14, were significantly associated with the muticate trait, while three SSR markers, Rht8 (Xgwm261), Rht-B1b, and Rht-D1b, highly associated with the dwarf trait. These markers will be useful for marker-assistant breeding and can be used as candidate markers for further gene mapping and cloning.

Whole-Genome Resequencing of Experimental Populations Reveals Polygenic Basis of Egg-Size Variation in Drosophila melanogaster.

PubMed

Jha, Aashish R; Miles, Cecelia M; Lippert, Nodia R; Brown, Christopher D; White, Kevin P; Kreitman, Martin

2015-10-01

Complete genome resequencing of populations holds great promise in deconstructing complex polygenic traits to elucidate molecular and developmental mechanisms of adaptation. Egg size is a classic adaptive trait in insects, birds, and other taxa, but its highly polygenic architecture has prevented high-resolution genetic analysis. We used replicated experimental evolution in Drosophila melanogaster and whole-genome sequencing to identify consistent signatures of polygenic egg-size adaptation. A generalized linear-mixed model revealed reproducible allele frequency differences between replicated experimental populations selected for large and small egg volumes at approximately 4,000 single nucleotide polymorphisms (SNPs). Several hundred distinct genomic regions contain clusters of these SNPs and have lower heterozygosity than the genomic background, consistent with selection acting on polymorphisms in these regions. These SNPs are also enriched among genes expressed in Drosophila ovaries and many of these genes have well-defined functions in Drosophila oogenesis. Additional genes regulating egg development, growth, and cell size show evidence of directional selection as genes regulating these biological processes are enriched for highly differentiated SNPs. Genetic crosses performed with a subset of candidate genes demonstrated that these genes influence egg size, at least in the large genetic background. These findings confirm the highly polygenic architecture of this adaptive trait, and suggest the involvement of many novel candidate genes in regulating egg size. © The Author 2015. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

X-linked infantile spinal muscular atrophy: clinical definition and molecular mapping.

PubMed

Dressman, Devin; Ahearn, Mary Ellen; Yariz, Kemal O; Basterrecha, Hugo; Martínez, Francisco; Palau, Francesc; Barmada, M Michael; Clark, Robin Dawn; Meindl, Alfons; Wirth, Brunhilde; Hoffman, Eric P; Baumbach-Reardon, Lisa

2007-01-01

X-linked infantile spinal-muscular atrophy (XL-SMA) is a rare disorder, which presents with the clinical characteristics of hypotonia, areflexia, and multiple congenital contractures (arthrogryposis) associated with loss of anterior horn cells and death in infancy. We have previously reported a single family with XL-SMA that mapped to Xp11.3-q11.2. Here we report further clinical description of XL-SMA plus an additional seven unrelated (XL-SMA) families from North America and Europe that show linkage data consistent with the same region. We first investigated linkage to the candidate disease gene region using microsatellite repeat markers. We further saturated the candidate disease gene region using polymorphic microsatellite repeat markers and single nucleotide polymorphisms in an effort to narrow the critical region. Two-point and multipoint linkage analysis was performed using the Allegro software package. Linkage analysis of all XL-SMA families displayed linkage consistent with the original XL-SMA region. The addition of new families and new markers has narrowed the disease gene interval for a XL-SMA locus between SNP FLJ22843 near marker DXS 8080 and SNP ARHGEF9 which is near DXS7132 (Xp11.3-Xq11.1).

A possible genetic association with chronic fatigue in primary Sjögren's syndrome: a candidate gene study.

PubMed

Norheim, Katrine Brække; Le Hellard, Stephanie; Nordmark, Gunnel; Harboe, Erna; Gøransson, Lasse; Brun, Johan G; Wahren-Herlenius, Marie; Jonsson, Roland; Omdal, Roald

2014-02-01

Fatigue is prevalent and disabling in primary Sjögren's syndrome (pSS). Results from studies in chronic fatigue syndrome (CFS) indicate that genetic variation may influence fatigue. The aim of this study was to investigate single nucleotide polymorphism (SNP) variations in pSS patients with high and low fatigue. A panel of 85 SNPs in 12 genes was selected based on previous studies in CFS. A total of 207 pSS patients and 376 healthy controls were genotyped. One-hundred and ninety-three patients and 70 SNPs in 11 genes were available for analysis after quality control. Patients were dichotomized based on fatigue visual analogue scale (VAS) scores, with VAS <50 denominated "low fatigue" (n = 53) and VAS ≥50 denominated "high fatigue" (n = 140). We detected signals of association with pSS for one SNP in SLC25A40 (unadjusted p = 0.007) and two SNPs in PKN1 (both p = 0.03) in our pSS case versus control analysis. The association with SLC25A40 was stronger when only pSS high fatigue patients were analysed versus controls (p = 0.002). One SNP in PKN1 displayed an association in the case-only analysis of pSS high fatigue versus pSS low fatigue (p = 0.005). This candidate gene study in pSS did reveal a trend for associations between genetic variation in candidate genes and fatigue. The results will need to be replicated. More research on genetic associations with fatigue is warranted, and future trials should include larger cohorts and multicentre collaborations with sharing of genetic material to increase the statistical power.

CLC-2 single nucleotide polymorphisms (SNPs) as potential modifiers of cystic fibrosis disease severity

PubMed Central

Blaisdell, Carol J; Howard, Timothy D; Stern, Augustus; Bamford, Penelope; Bleecker, Eugene R; Stine, O Colin

2004-01-01

Background Cystic fibrosis (CF) lung disease manifest by impaired chloride secretion leads to eventual respiratory failure. Candidate genes that may modify CF lung disease severity include alternative chloride channels. The objectives of this study are to identify single nucleotide polymorphisms (SNPs) in the airway epithelial chloride channel, CLC-2, and correlate these polymorphisms with CF lung disease. Methods The CLC-2 promoter, intron 1 and exon 20 were examined for SNPs in adult CF dF508/dF508 homozygotes with mild and severe lung disease (forced expiratory volume at one second (FEV1) > 70% and < 40%). Results PCR amplification of genomic CLC-2 and sequence analysis revealed 1 polymorphism in the hClC -2 promoter, 4 in intron 1, and none in exon 20. Fisher's analysis within this data set, did not demonstrate a significant relationship between the severity of lung disease and SNPs in the CLC-2 gene. Conclusions CLC-2 is not a key modifier gene of CF lung phenotype. Further studies evaluating other phenotypes associated with CF may be useful in the future to assess the ability of CLC-2 to modify CF disease severity. PMID:15507145

Potential genetic polymorphisms predicting polycystic ovary syndrome.

PubMed

Chen, Yao; Fang, Shu-Ying

2018-05-01

Polycystic ovary syndrome (PCOS) is a heterogenous endocrine disorder with typical symptoms of oligomenorrhoea, hyperandrogenism, hirsutism, obesity, insulin resistance and increased risk of type 2 diabetes mellitus. Extensive evidence indicates that PCOS is a genetic disease and numerous biochemical pathways have been linked with its pathogenesis. A number of genes from these pathways have been investigated, which include those involved with steroid hormone biosynthesis and metabolism, action of gonadotropin and gonadal hormones, folliculogenesis, obesity and energy regulation, insulin secretion and action and many others. In this review, we summarize the historical and recent findings in genetic polymorphisms of PCOS from the relevant publications and outline some genetic polymorphisms that are potentially associated with the risk of PCOS. This information could uncover candidate genes associating with PCOS, which will be valuable for the development of novel diagnostic and treatment platforms for PCOS patients. © 2018 The authors.

Dissecting Vancomycin-Intermediate Resistance in Staphylococcus aureus Using Genome-Wide Association

PubMed Central

Alam, Md Tauqeer; Petit, Robert A.; Crispell, Emily K.; Thornton, Timothy A.; Conneely, Karen N.; Jiang, Yunxuan; Satola, Sarah W.; Read, Timothy D.

2014-01-01

Vancomycin-intermediate Staphylococcus aureus (VISA) is currently defined as having minimal inhibitory concentration (MIC) of 4–8 µg/ml. VISA evolves through changes in multiple genetic loci with at least 16 candidate genes identified in clinical and in vitro-selected VISA strains. We report a whole-genome comparative analysis of 49 vancomycin-sensitive S. aureus and 26 VISA strains. Resistance to vancomycin was determined by broth microdilution, Etest, and population analysis profile-area under the curve (PAP-AUC). Genome-wide association studies (GWAS) of 55,977 single-nucleotide polymorphisms identified in one or more strains found one highly significant association (P = 8.78E-08) between a nonsynonymous mutation at codon 481 (H481) of the rpoB gene and increased vancomycin MIC. Additionally, we used a database of public S. aureus genome sequences to identify rare mutations in candidate genes associated with VISA. On the basis of these data, we proposed a preliminary model called ECM+RMCG for the VISA phenotype as a benchmark for future efforts. The model predicted VISA based on the presence of a rare mutation in a set of candidate genes (walKR, vraSR, graSR, and agrA) and/or three previously experimentally verified mutations (including the rpoB H481 locus) with an accuracy of 81% and a sensitivity of 73%. Further, the level of resistance measured by both Etest and PAP-AUC regressed positively with the number of mutations present in a strain. This study demonstrated 1) the power of GWAS for identifying common genetic variants associated with antibiotic resistance in bacteria and 2) that rare mutations in candidate gene, identified using large genomic data sets, can also be associated with resistance phenotypes. PMID:24787619

SLCO1B1 Polymorphisms are Associated With Drug Intolerance in Childhood Leukemia Maintenance Therapy.

PubMed

Eldem, İrem; Yavuz, Duygu; Cumaoğullari, Özge; İleri, Talia; Ünal İnce, Elif; Ertem, Mehmet; Doğanay Erdoğan, Beyza; Bindak, Recep; Özdağ, Hilal; Şatiroğlu-Tufan, N Lale; Uysal, L Zümrüt

2018-04-20

Therapy discontinuations and toxicities occur because of significant interindividual variations in 6-mercaptopurine (6-MP) and methotrexate (MTX) response during maintenance therapy of childhood acute lymphoblastic leukemia (ALL). 6-MP/MTX intolerance in some of the patients cannot be explained by thiopurine S-methyl transferase (TPMT) gene variants. In this study, we aimed to investigate candidate pharmacogenetic determinants of 6-MP and MTX intolerance in Turkish ALL children. In total, 48 children with ALL who had completed or were receiving maintenance therapy according to Children's Oncology Group (COG) protocols were enrolled. Fifteen single-nucleotide polymorphisms in 8 candidate genes that were related to drug toxicity or had a role in the 6-MP/MTX metabolism (TPMT, ITPA, MTHFR, IMPDH2, PACSIN2, SLCO1B1, ABCC4, and PYGL) were genotyped by competitive allele-specific PCR (KASP). Drug doses during maintenance therapy were modified according to the protocol. The median drug dose intensity was 50% (28% to 92%) for 6-MP and 58% (27% to 99%) for MTX in the first year of maintenance therapy, which were lower than that scheduled in all patients. Among the analyzed polymorphisms, variant alleles in SLCO1B1 rs4149056 and rs11045879 were found to be associated with lower 6-MP/MTX tolerance. SLCO1B1 rs4149056 and rs11045879 polymorphisms may be important genetic markers to individualize 6-MP/MTX doses.

Polymorphisms of genes related to the hypothalamic-pituitary-adrenal axis influence the cortisol awakening response as well as self-perceived stress.

PubMed

Li-Tempel, Ting; Larra, Mauro F; Winnikes, Ulrike; Tempel, Tobias; DeRijk, Roel H; Schulz, André; Schächinger, Hartmut; Meyer, Jobst; Schote, Andrea B

2016-09-01

The hypothalamus-pituitary-adrenal (HPA) axis is a crucial endocrine system for coping with stress. A reliable and stable marker for the basal state of that system is the cortisol awakening response (CAR). We examined the influence of variants of four relevant candidate genes; the mineralocorticoid receptor gene (MR), the glucocorticoid receptor gene (GR), the serotonin transporter gene (5-HTT) and the gene encoding the brain-derived neurotrophic factor (BDNF) on CAR and self-perceived stress in 217 healthy subjects. We found that polymorphisms of GR influenced both, the basal state of the HPA axis as well as self-perceived stress. MR only associated with self-perceived stress and 5-HTT only with CAR. BDNF did not affected any of the investigated indices. In summary, we suggest that GR variants together with the CAR and supplemented with self reports on perceived stress might be useful indicators for the basal HPA axis activity. Copyright © 2016 Elsevier B.V. All rights reserved.

Genetic polymorphisms and weight loss in obesity: a randomised trial of hypo-energetic high- versus low-fat diets.

PubMed

Sørensen, Thorkild I A; Boutin, Philippe; Taylor, Moira A; Larsen, Lesli H; Verdich, Camilla; Petersen, Liselotte; Holst, Claus; Echwald, Søren M; Dina, Christian; Toubro, Søren; Petersen, Martin; Polak, Jan; Clément, Karine; Martínez, J Alfredo; Langin, Dominique; Oppert, Jean-Michel; Stich, Vladimir; Macdonald, Ian; Arner, Peter; Saris, Wim H M; Pedersen, Oluf; Astrup, Arne; Froguel, Philippe

2006-06-01

To study if genes with common single nucleotide polymorphisms (SNPs) associated with obesity-related phenotypes influence weight loss (WL) in obese individuals treated by a hypo-energetic low-fat or high-fat diet. Randomised, parallel, two-arm, open-label multi-centre trial. Eight clinical centres in seven European countries. 771 obese adult individuals. 10-wk dietary intervention to hypo-energetic (-600 kcal/d) diets with a targeted fat energy of 20%-25% or 40%-45%, completed in 648 participants. WL during the 10 wk in relation to genotypes of 42 SNPs in 26 candidate genes, probably associated with hypothalamic regulation of appetite, efficiency of energy expenditure, regulation of adipocyte differentiation and function, lipid and glucose metabolism, or production of adipocytokines, determined in 642 participants. Compared with the noncarriers of each of the SNPs, and after adjusting for gender, age, baseline weight and centre, heterozygotes showed WL differences that ranged from -0.6 to 0.8 kg, and homozygotes, from -0.7 to 3.1 kg. Genotype-dependent additional WL on low-fat diet ranged from 1.9 to -1.6 kg in heterozygotes, and from 3.8 kg to -2.1 kg in homozygotes relative to the noncarriers. Considering the multiple testing conducted, none of the associations was statistically significant. Polymorphisms in a panel of obesity-related candidate genes play a minor role, if any, in modulating weight changes induced by a moderate hypo-energetic low-fat or high-fat diet.

DNA methylation polymorphism in flue-cured tobacco and candidate markers for tobacco mosaic virus resistance.

PubMed

Zhao, Jie-hong; Zhang, Ji-shun; Wang, Yi; Wang, Ren-gang; Wu, Chun; Fan, Long-jiang; Ren, Xue-liang

2011-11-01

DNA methylation plays an important role in the epigenetic regulation of gene expression during plant growth, development, and polyploidization. However, there is still no distinct evidence in tobacco regarding the distribution of the methylation pattern and whether it contributes to qualitative characteristics. We studied the levels and patterns of methylation polymorphism at CCGG sites in 48 accessions of allotetraploid flue-cured tobacco, Nicotiana tabacum, using a methylation-sensitive amplified polymorphism (MSAP) technique. The results showed that methylation existed at a high level among tobacco accessions, among which 49.3% sites were methylated and 69.9% allelic sites were polymorphic. A cluster analysis revealed distinct patterns of geography-specific groups. In addition, three polymorphic sites significantly related to tobacco mosaic virus (TMV) resistance were explored. This suggests that tobacco breeders should pay more attention to epigenetic traits.

Candidate gene polymorphisms study between human African trypanosomiasis clinical phenotypes in Guinea.

PubMed

Kaboré, Justin Windingoudi; Ilboudo, Hamidou; Noyes, Harry; Camara, Oumou; Kaboré, Jacques; Camara, Mamadou; Koffi, Mathurin; Lejon, Veerle; Jamonneau, Vincent; MacLeod, Annette; Hertz-Fowler, Christiane; Belem, Adrien Marie Gaston; Matovu, Enock; Bucheton, Bruno; Sidibe, Issa

2017-08-01

Human African trypanosomiasis (HAT), a lethal disease induced by Trypanosoma brucei gambiense, has a range of clinical outcomes in its human host in West Africa: an acute form progressing rapidly to second stage, spontaneous self-cure and individuals able to regulate parasitaemia at very low levels, have all been reported from endemic foci. In order to test if this clinical diversity is influenced by host genetic determinants, the association between candidate gene polymorphisms and HAT outcome was investigated in populations from HAT active foci in Guinea. Samples were collected from 425 individuals; comprising of 232 HAT cases, 79 subjects with long lasting positive and specific serology but negative parasitology and 114 endemic controls. Genotypes of 28 SNPs in eight genes passed quality control and were used for an association analysis. IL6 rs1818879 allele A (p = 0.0001, OR = 0.39, CI95 = [0.24-0.63], BONF = 0.0034) was associated with a lower risk of progressing from latent infection to active disease. MIF rs36086171 allele G seemed to be associated with an increased risk (p = 0.0239, OR = 1.65, CI95 = [1.07-2.53], BONF = 0.6697) but did not remain significant after Bonferroni correction. Similarly MIF rs12483859 C allele seems be associated with latent infections (p = 0.0077, OR = 1.86, CI95 = [1.18-2.95], BONF = 0.2157). We confirmed earlier observations that APOL1 G2 allele (DEL) (p = 0.0011, OR = 2.70, CI95 = [1.49-4.91], BONF = 0.0301) is associated with a higher risk and APOL1 G1 polymorphism (p = 0.0005, OR = 0.45, CI95 = [0.29-0.70], BONF = 0.0129) with a lower risk of developing HAT. No associations were found with other candidate genes. Our data show that host genes are involved in modulating Trypanosoma brucei gambiense infection outcome in infected individuals from Guinea with IL6 rs1818879 being associated with a lower risk of progressing to active HAT. These results enhance our understanding of host-parasite interactions and, ultimately, may lead to the development of new control tools.

Polymorphisms in the Myostatin-1 gene and their association with growth traits in Ancherythroculter nigrocauda

NASA Astrophysics Data System (ADS)

Sun, Yanhong; Li, Qing; Wang, Guiying; Zhu, Dongmei; Chen, Jian; Li, Pei; Tong, Jingou

2017-05-01

Myostatin ( MSTN) is a member of the transforming growth factor-β gene superfamily that negatively regulates skeletal muscle development and growth. In the present study, partial genomic fragments of Myostatin-1 ( MSTN-1) in two commercial hatchery populations of Ancherythroculter nigrocauda, an economically important freshwater fish, were screened for single nucleotide polymorphisms (SNPs) and then genotyped by direct sequencing of PCR products. Five SNPs were identified in intron 1 and exon 2, including a non-synonymous mutation causing an amino acid change (Val to Ile) at position 180. Association analyses based on 300 individuals revealed that the g.1129T>C SNP locus was significantly associated with total length (TL), body length (BL), body height (BH) and body weight (BW) in 6- and 18-month-old populations, while the g.1289G>A locus was significantly associated with BH and BW in the 6-month-old population. Haplotype analyses revealed that fish with the genotype combinations TC/TC or TC/GA showed better growth performance. Our results suggest that g.1129T>C and g.1289G>A have positive effects on growth traits and may be candidate gene markers for marker-assisted selection in A. nigrocauda.

Investigation of the association of two candidate genes (H-FABP and PSMC1) with growth and carcass traits in Qinchuan beef cattle from China.

PubMed

Liang, W; Zhang, H L; Liu, Y; Lu, B C; Liu, X; Li, Q; Cao, Y

2014-03-17

Growth and carcass traits are economically important quality characteristics of beef cattle and are complex quantitative traits that are controlled by multiple genes. In this study, 2 candidate genes, H-FABP (encoding the heart fatty acid-binding protein) and PSMC1 (encoding the proteasome 26S subunit of ATPase 1) were investigated in Qinchuan beef cattle of China. PCR-SSCP and DNA sequencing methods were used to detect mutations in the H-FABP and PSMC1 genes in Qinchuan cattle, and a T>C mutation in exon 1 of H-FABP and a T>C mutation in exon 9 of PSMC1 were identified. The association of these 2 single nucleotide polymorphisms with growth and carcass traits of Qinchuan cattle was analyzed. The T>C mutation in H-FABP was significantly associated with body length and dressing percentage (P < 0.05) and the T>C mutation in PSMC1 with body length and hip width (P < 0.05), indicating that both of the 2 mutations in H-FABP and PSMC1 had effects on growth and carcass traits in the Qinchuan beef cattle breed. Thus, the results of our study suggest that the H-FABP and PSMC1 gene polymorphisms could be used as genetic markers in marker-assisted selection for improving Qinchuan beef cattle.

Genome-wide association study discovered genetic variation and candidate genes of fibre quality traits in Gossypium hirsutum L.

PubMed

Sun, Zhengwen; Wang, Xingfen; Liu, Zhengwen; Gu, Qishen; Zhang, Yan; Li, Zhikun; Ke, Huifeng; Yang, Jun; Wu, Jinhua; Wu, Liqiang; Zhang, Guiyin; Zhang, Caiying; Ma, Zhiying

2017-08-01

Genetic improvement of fibre quality is one of the main breeding goals for the upland cotton, Gossypium hirsutum, but there are difficulties with precise selection of traits. Therefore, it is important to improve the understanding of the genetic basis of phenotypic variation. In this study, we conducted phenotyping and genetic variation analyses of 719 diverse accessions of upland cotton based on multiple environment tests and a recently developed Cotton 63K Illumina Infinium SNP array and performed a genome-wide association study (GWAS) of fibre quality traits. A total of 10 511 polymorphic SNPs distributed in 26 chromosomes were screened across the cotton germplasms, and forty-six significant SNPs associated with five fibre quality traits were detected. These significant SNPs were scattered over 15 chromosomes and were involved in 612 unique candidate genes, many related to polysaccharide biosynthesis, signal transduction and protein translocation. Two major haplotypes for fibre length and strength were identified on chromosomes Dt11 and At07. Furthermore, by combining GWAS and transcriptome analysis, we identified 163 and 120 fibre developmental genes related to length and strength, respectively, of which a number of novel genes and 19 promising genes were screened. These results provide new insight into the genetic basis of fibre quality in G. hirsutum and provide candidate SNPs and genes to accelerate the improvement of upland cotton. © 2017 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.

Variants in the human intestinal fatty acid binding protein 2 gene in obese subjects.

PubMed

Sipiläinen, R; Uusitupa, M; Heikkinen, S; Rissanen, A; Laakso, M

1997-08-01

Fatty acid binding protein 2 gene (FABP2) has been proposed to be an important candidate gene for insulin resistance; therefore, it also could be a promising candidate gene for obesity. We screened the whole coding region of the FABP2 gene in 40 obese nondiabetic Finnish subjects. Furthermore, we investigated the effects of the codon 54 polymorphism of this gene (Ala-->Thr) on insulin levels and basal metabolic rate in 170 obese subjects. The frequencies of the variants found in exon 4 (GTA-->GTG) and 3'-noncoding region (GCGCA-->GCACA), as well as the allele frequencies for the variable lengths of the ATT repeat sequence in intron 2 did not differ between the obese subjects and nonobese controls. The frequency of threonine-encoding allele in codon 54 of the FABP2 gene did not differ between obese and control subjects (28 vs. 29%, respectively). In the obese group there were no differences in gender distribution, age, weight, body mass index, lean body mass, percentage of body fat, waist circumference, and waist-to-hip ratio among the individuals homozygous for Ala54, heterozygous for Thr54, and homozygous for Thr54-encoding alleles. Similarly, fasting serum insulin, glucose, lipids and lipoprotein concentrations, basal metabolic rate (adjusted for lean body mass and age), respiratory quotient, and rates of glucose and lipid oxidation did not differ among the groups. We conclude that obesity is not associated with specific variants in the FABP2 gene. Furthermore, the codon 54 Ala to Thr polymorphism of this gene does not influence insulin levels or basal metabolic rate in obese Finns.

Population-Based Resequencing of Experimentally Evolved Populations Reveals the Genetic Basis of Body Size Variation in Drosophila melanogaster

PubMed Central

Turner, Thomas L.; Stewart, Andrew D.; Fields, Andrew T.; Rice, William R.; Tarone, Aaron M.

2011-01-01

Body size is a classic quantitative trait with evolutionarily significant variation within many species. Locating the alleles responsible for this variation would help understand the maintenance of variation in body size in particular, as well as quantitative traits in general. However, successful genome-wide association of genotype and phenotype may require very large sample sizes if alleles have low population frequencies or modest effects. As a complementary approach, we propose that population-based resequencing of experimentally evolved populations allows for considerable power to map functional variation. Here, we use this technique to investigate the genetic basis of natural variation in body size in Drosophila melanogaster. Significant differentiation of hundreds of loci in replicate selection populations supports the hypothesis that the genetic basis of body size variation is very polygenic in D. melanogaster. Significantly differentiated variants are limited to single genes at some loci, allowing precise hypotheses to be formed regarding causal polymorphisms, while other significant regions are large and contain many genes. By using significantly associated polymorphisms as a priori candidates in follow-up studies, these data are expected to provide considerable power to determine the genetic basis of natural variation in body size. PMID:21437274

Association of SNPs in dopamine and serotonin pathway genes and their interacting genes with temperament traits in Charolais cows.

PubMed

Garza-Brenner, E; Sifuentes-Rincón, A M; Randel, R D; Paredes-Sánchez, F A; Parra-Bracamonte, G M; Arellano Vera, W; Rodríguez Almeida, F A; Segura Cabrera, A

2017-08-01

Cattle temperament is a complex trait, and molecular studies aimed at defining this trait are scarce. We used an interaction networks approach to identify new genes (interacting genes) and to estimate their effects and those of 19 dopamine- and serotonin-related genes on the temperament traits of Charolais cattle. The genes proopiomelanocortin (POMC), neuropeptide Y (NPY), solute carrier family 18, member 2 (SLC18A2) and FBJ murine osteosarcoma viral oncogene homologue (FOSFBJ) were identified as new candidates. Their potential to be associated with temperament was estimated according to their reported biological activities, which included interactions with neural activity, receptor function, targeting or synthesis of neurotransmitters and association with behaviour. Pen score (PS) and exit velocity (EV) measures were determined from 412 Charolais cows to calculate their temperament score (TS). Based on the TS, calm (n = 55; TS, 1.09 ± 0.33) and temperamental (n = 58; TS, 2.27 ± 0.639) cows were selected and genotyped using a 248 single-nucleotide variation (SNV) panel. Of the 248 variations in the panel, only 151 were confirmed to be polymorphic (single-nucleotide polymorphisms; SNPs) in the tested population. Single-marker association analyses between genotypes and temperament measures (EV, PS and/or TS) indicated significant associations of six SNPs from four candidate genes. The markers rs109576799 and rs43696138, located in the DRD3 and HTR2A genes, respectively, were significantly associated with both EV and TS traits. Four markers, rs110365063 and rs137756569 from the POMC gene and rs110365063 and rs135155082 located in SLC18A2 and DRD2, respectively, were associated with PS. The variant rs110365063 located in bovine SLC18A2 causes a change in the amino acid sequence from Ala to Thr. Further studies are needed to confirm the association of genetic profile with cattle temperament; however, our study represents important progress in understanding the regulation of cattle temperament by different genes with divergent functions.

Association analyses of vitamin D-binding protein gene with compression strength index variation in Caucasian nuclear families

PubMed Central

Xu, X.-H.; Xiong, D.-H.; Liu, X.-G.; Guo, Y.; Chen, Y.; Zhao, J.; Recker, R. R.; Deng, H.-W.

2010-01-01

Summary This study was conducted to test whether there exists an association between vitamin D-binding protein (DBP) gene and compression strength index (CSI) phenotype. Candidate gene association analyses were conducted in total sample, male subgroup, and female subgroup, respectively. Two single-nucleotide polymorphisms (SNPs) with significant association results were found in males, suggesting the importance of DBP gene polymorphisms on the variation in CSI especially in Caucasian males. Introduction CSI of the femoral neck (FN) is a newly developed phenotype integrating information about bone size, body size, and bone mineral density. It is considered to have the potential to improve the performance of risk assessment for hip fractures because it is based on a combination of phenotypic traits influencing hip fractures rather than a single trait. CSI is under moderate genetic determination (with a heritability of ~44% found in this study), but the relevant genetic study is still rather scarce. Methods Based on the known physiological role of DBP in bone biology and the relatively high heritability of CSI, we tested 12 SNPs of the DBP gene for association with CSI variation in 405 Caucasian nuclear families comprising 1,873 subjects from the Midwestern US. Association analyses were performed in the total sample, male and female subgroups, respectively. Results Significant associations with CSI were found with two SNPs (rs222029, P=0.0019; rs222020, P=0.0042) for the male subgroup. Haplotype-based association tests corroborated the single-SNP results. Conclusions Our findings suggest that the DBP gene might be one of the genetic factors influencing CSI phenotype in Caucasians, especially in males. PMID:19543766

Two functional serotonin polymorphisms moderate the effect of food reinforcement on BMI

PubMed Central

Carr, Katelyn A.; Lin, Henry; Fletcher, Kelly D.; Sucheston, Lara; Singh, Prashant K.; Salis, Robbert; Erbe, Richard; Faith, Myles; Allison, David; Stice, Eric; Epstein, Leonard H.

2014-01-01

Food reinforcement, or the motivation to eat, has been associated with increased energy intake, greater body weight and prospective weight gain. Much of the previous research on the reinforcing value of food has focused on the role of dopamine, but it may be worthwhile to examine genetic polymorphisms in the serotonin and opioid systems as these neurotransmitters have been shown to be related to reinforcement processes and to influence energy intake. We examined the relationship among 44 candidate genetic polymorphisms in the dopamine, serotonin and opioid systems, and food reinforcement and body mass index (BMI) in a sample of 245 individuals. Polymorphisms in the Monoamine oxidase A (MAOA-LPR) and serotonin receptor 2A genes (rs6314) moderated the effect of food reinforcement on BMI, accounting for an additional 5-10% variance and revealed a potential role of the single nucleotide polymorphism, rs6314 in the serotonin 2A receptor as a differential susceptibility factor for obesity. Differential susceptibility describes a factor that can confer either risk or protection depending on a second variable, such that rs6314 is predictive of both high and low BMI based on the level of food reinforcement, while the diathesis stress or dual-gain model influences only one end of the outcome measure. The interaction with MAOA-LPR better fit the dual-risk or diathesis stress model, with the 3.5R/4R allele conferring protection for individuals low in food reinforcement. These results provide new insight into genes theoretically involved in obesity and support the hypothesis that genetics moderate the association between food reinforcement on BMI. PMID:23544600

Gender, body mass index, and PPARγ polymorphism are good indicators in hyperuricemia prediction for Han Chinese.

PubMed

Lee, Ming-Fen; Liou, Tsan-Hon; Wang, Weu; Pan, Wen-Harn; Lee, Wei-Jei; Hsu, Chung-Tan; Wu, Suh-Fen; Chen, Hsin-Hung

2013-01-01

Hyperuricemia is closely associated with obesity and metabolic abnormalities, which is also an independent risk factor for cardiovascular diseases. The PPARγ gene, which is linked to obesity and metabolic abnormalities in Han Chinese, might be considered a top candidate gene that is involved in hyperuricemia. This study recruited 457 participants, aged 20-40 years old, to investigate the associations of the PPARγ gene and metabolic parameters with hyperuricemia. Three tag-single nucleotide polymorphisms, rs2292101, rs4684846, and rs1822825, of the PPARγ gene were selected to explore their association with hyperuricemia. Risk genotypes on rs1822825 of the PPARγ gene exhibited statistical significance with hyperuricemia (odds ratio: 1.9; 95% confidence interval: 1.05-3.57). Although gender, body mass index (BMI), serum total cholesterol concentration, or protein intake per day were statistically associated with hyperuricemia, the combination of BMI, gender, and rs1822825, rather than that of age, serum lipid profile, blood pressure, and protein intake per day, satisfied the predictability for hyperuricemia (sensitivity: 69.3%; specificity: 83.7%) in Taiwan-born obese Han Chinese. BMI, gender, and the rs1822825 polymorphism in the PPARγ gene appeared good biomarkers in hyperuricemia; therefore, these powerful indicators may be included in the prediction of hyperuricemia to increase the accuracy of the analysis.

Association of single-nucleotide polymorphisms of the tau gene with late-onset Parkinson disease.

PubMed

Martin, E R; Scott, W K; Nance, M A; Watts, R L; Hubble, J P; Koller, W C; Lyons, K; Pahwa, R; Stern, M B; Colcher, A; Hiner, B C; Jankovic, J; Ondo, W G; Allen, F H; Goetz, C G; Small, G W; Masterman, D; Mastaglia, F; Laing, N G; Stajich, J M; Ribble, R C; Booze, M W; Rogala, A; Hauser, M A; Zhang, F; Gibson, R A; Middleton, L T; Roses, A D; Haines, J L; Scott, B L; Pericak-Vance, M A; Vance, J M

2001-11-14

The human tau gene, which promotes assembly of neuronal microtubules, has been associated with several rare neurologic diseases that clinically include parkinsonian features. We recently observed linkage in idiopathic Parkinson disease (PD) to a region on chromosome 17q21 that contains the tau gene. These factors make tau a good candidate for investigation as a susceptibility gene for idiopathic PD, the most common form of the disease. To investigate whether the tau gene is involved in idiopathic PD. Among a sample of 1056 individuals from 235 families selected from 13 clinical centers in the United States and Australia and from a family ascertainment core center, we tested 5 single-nucleotide polymorphisms (SNPs) within the tau gene for association with PD, using family-based tests of association. Both affected (n = 426) and unaffected (n = 579) family members were included; 51 individuals had unclear PD status. Analyses were conducted to test individual SNPs and SNP haplotypes within the tau gene. Family-based tests of association, calculated using asymptotic distributions. Analysis of association between the SNPs and PD yielded significant evidence of association for 3 of the 5 SNPs tested: SNP 3, P =.03; SNP 9i, P =.04; and SNP 11, P =.04. The 2 other SNPs did not show evidence of significant association (SNP 9ii, P =.11, and SNP 9iii, P =.87). Strong evidence of association was found with haplotype analysis, with a positive association with one haplotype (P =.009) and a negative association with another haplotype (P =.007). Substantial linkage disequilibrium (P<.001) was detected between 4 of the 5 SNPs (SNPs 3, 9i, 9ii, and 11). This integrated approach of genetic linkage and positional association analyses implicates tau as a susceptibility gene for idiopathic PD.

Beyond main effects of gene-sets: harsh parenting moderates the association between a dopamine gene-set and child externalizing behavior.

PubMed

Windhorst, Dafna A; Mileva-Seitz, Viara R; Rippe, Ralph C A; Tiemeier, Henning; Jaddoe, Vincent W V; Verhulst, Frank C; van IJzendoorn, Marinus H; Bakermans-Kranenburg, Marian J

2016-08-01

In a longitudinal cohort study, we investigated the interplay of harsh parenting and genetic variation across a set of functionally related dopamine genes, in association with children's externalizing behavior. This is one of the first studies to employ gene-based and gene-set approaches in tests of Gene by Environment (G × E) effects on complex behavior. This approach can offer an important alternative or complement to candidate gene and genome-wide environmental interaction (GWEI) studies in the search for genetic variation underlying individual differences in behavior. Genetic variants in 12 autosomal dopaminergic genes were available in an ethnically homogenous part of a population-based cohort. Harsh parenting was assessed with maternal (n = 1881) and paternal (n = 1710) reports at age 3. Externalizing behavior was assessed with the Child Behavior Checklist (CBCL) at age 5 (71 ± 3.7 months). We conducted gene-set analyses of the association between variation in dopaminergic genes and externalizing behavior, stratified for harsh parenting. The association was statistically significant or approached significance for children without harsh parenting experiences, but was absent in the group with harsh parenting. Similarly, significant associations between single genes and externalizing behavior were only found in the group without harsh parenting. Effect sizes in the groups with and without harsh parenting did not differ significantly. Gene-environment interaction tests were conducted for individual genetic variants, resulting in two significant interaction effects (rs1497023 and rs4922132) after correction for multiple testing. Our findings are suggestive of G × E interplay, with associations between dopamine genes and externalizing behavior present in children without harsh parenting, but not in children with harsh parenting experiences. Harsh parenting may overrule the role of genetic factors in externalizing behavior. Gene-based and gene-set analyses offer promising new alternatives to analyses focusing on single candidate polymorphisms when examining the interplay between genetic and environmental factors.

Oxytocin and Vasopressin Receptor Gene Polymorphisms: Role in Social and Psychiatric Traits

PubMed Central

Aspé-Sánchez, Mauricio; Moreno, Macarena; Rivera, Maria Ignacia; Rossi, Alejandra; Ewer, John

2016-01-01

Oxytocin (OXT) and arginine-vasopressin (AVP) are two phylogenetically conserved neuropeptides that have been implicated in a wide range of social behaviors. Although a large body of research, ranging from rodents to humans, has reported on the effects of OXT and AVP administration on affiliative and trust behaviors, and has highlighted the genetic contributions of OXT and AVP receptor polymorphisms to both social behaviors and to diseases related to social deficits, the consequences of peptide administration on psychiatric symptoms, and the impact of receptor polymorphisms on receptor function, are still unclear. Despite the exciting advances that these reports have brought to social neuroscience, they remain preliminary and suffer from the problems that are inherent to monogenetic linkage and association studies. As an alternative, some studies are using polygenic approaches, and consider the contributions of other genes and pathways, including those involving DA, 5-HT, and reelin, in addition to OXT and AVP; a handful of report are also using genome-wide association studies. This review summarizes findings on the associations between OXT and AVP receptor polymorphism, social behavior, and psychiatric diseases. In addition, we discuss reports on the interactions of OXT and AVP receptor genes and genes involved in other pathways (such as those of dopamine, serotonin, and reelin), as well as research that has shed some light on the impact of gene polymorphisms on the volume, connectivity, and activation of specific neural structures, differential receptor expression, and plasma levels of the OXT and AVP peptides. We hope that this effort will be helpful for understanding the studies performed so far, and for encouraging the inclusion of other candidate genes not explored to date. PMID:26858594

GDNF Gene Is Associated With Tourette Syndrome in a Family Study

PubMed Central

Huertas-Fernández, Ismael; Gómez-Garre, Pilar; Madruga-Garrido, Marcos; Bernal-Bernal, Inmaculada; Bonilla-Toribio, Marta; Martín-Rodríguez, Juan Francisco; Cáceres-Redondo, María Teresa; Vargas-González, Laura; Carrillo, Fátima; Pascual, Alberto; Tischfield, Jay A.; King, Robert A.; Heiman, Gary A.; Mir, Pablo

2016-01-01

Background Tourette syndrome is a disorder characterized by persistent motor and vocal tics, and frequently accompanied by the comorbidities attention deficit hyperactivity disorder and obsessive-compulsive disorder. Impaired synaptic neurotransmission has been implicated in its pathogenesis. Our aim was to investigate the association of 28 candidate genes, including genes related to synaptic neurotransmission and neurotrophic factors, with Tourette syndrome. Methods We genotyped 506 polymorphisms in a discovery cohort from the United States composed of 112 families and 47 unrelated singletons with Tourette syndrome (201 cases and 253 controls). Genes containing significant polymorphisms were imputed to fine-map the signal(s) to potential causal variants. Allelic analyses in Tourette syndrome cases were performed to check the role in attention deficit hyperactivity disorder and obsessive-compulsive disorder comorbidities. Target polymorphisms were further studied in a replication cohort from southern Spain composed of 37 families and three unrelated singletons (44 cases and 73 controls). Results The polymorphism rs3096140 in glial cell line–derived neurotrophic factor gene (GDNF) was significant in the discovery cohort after correction (P = 1.5 × 10−4). No linkage disequilibrium was found between rs3096140 and other functional variants in the gene. We selected rs3096140 as target polymorphism, and the association was confirmed in the replication cohort (P = 0.01). No association with any comorbidity was found. Conclusions As a conclusion, a common genetic variant in GDNF is associated with Tourette syndrome. A defect in the production of GDNF could compromise the survival of parvalbumin interneurons, thus altering the excitatory/inhibitory balance in the corticostriatal circuitry. Validation of this variant in other family cohorts is necessary. PMID:26096985

GDNF gene is associated with tourette syndrome in a family study.

PubMed

Huertas-Fernández, Ismael; Gómez-Garre, Pilar; Madruga-Garrido, Marcos; Bernal-Bernal, Inmaculada; Bonilla-Toribio, Marta; Martín-Rodríguez, Juan Francisco; Cáceres-Redondo, María Teresa; Vargas-González, Laura; Carrillo, Fátima; Pascual, Alberto; Tischfield, Jay A; King, Robert A; Heiman, Gary A; Mir, Pablo

2015-07-01

Tourette syndrome is a disorder characterized by persistent motor and vocal tics, and frequently accompanied by the comorbidities attention deficit hyperactivity disorder and obsessive-compulsive disorder. Impaired synaptic neurotransmission has been implicated in its pathogenesis. Our aim was to investigate the association of 28 candidate genes, including genes related to synaptic neurotransmission and neurotrophic factors, with Tourette syndrome. We genotyped 506 polymorphisms in a discovery cohort from the United States composed of 112 families and 47 unrelated singletons with Tourette syndrome (201 cases and 253 controls). Genes containing significant polymorphisms were imputed to fine-map the signal(s) to potential causal variants. Allelic analyses in Tourette syndrome cases were performed to check the role in attention deficit hyperactivity disorder and obsessive-compulsive disorder comorbidities. Target polymorphisms were further studied in a replication cohort from southern Spain composed of 37 families and three unrelated singletons (44 cases and 73 controls). The polymorphism rs3096140 in glial cell line-derived neurotrophic factor gene (GDNF) was significant in the discovery cohort after correction (P = 1.5 × 10(-4) ). No linkage disequilibrium was found between rs3096140 and other functional variants in the gene. We selected rs3096140 as target polymorphism, and the association was confirmed in the replication cohort (P = 0.01). No association with any comorbidity was found. As a conclusion, a common genetic variant in GDNF is associated with Tourette syndrome. A defect in the production of GDNF could compromise the survival of parvalbumin interneurons, thus altering the excitatory/inhibitory balance in the corticostriatal circuitry. Validation of this variant in other family cohorts is necessary. © 2015 International Parkinson and Movement Disorder Society.

Association of vitamin D receptor gene polymorphism (TaqI and Apa1) with bone mineral density in North Indian postmenopausal women.

PubMed

Ahmad, Israr; Jafar, Tabrez; Mahdi, Farzana; Ameta, Keerti; Arshad, Md; Das, Siddharth Kumar; Waliullah, Shah; Rizvi, Imran; Mahdi, Abbas Ali

2018-06-15

Vitamin D receptor (VDR) gene has an important role as a candidate gene for the regulation of bone mass in osteoporosis. However, its association with bone mineral density (BMD) is controversial and has not been established in different ethnic populations. To enhance the understanding of VDR gene polymorphism in the context of BMD, we investigated the plausible genetic association of TaqI and ApaI polymorphism with BMD in North Indian postmenopausal women with osteoporosis.254 osteoporotic women (Age 55.82 ± 6.91) and 254 postmenopausal non osteoporotic women (Age 54.76 ± 6.26) were included in the study. VDR TaqI and ApaI polymorphism were determined by PCR (polymerase chain reaction) and RFLP (restriction fragment length polymorphism). BMD was assessed by dual energy X-ray absorptiometry (DXA) at the lumbar spine (L 1 -L 4 ), hip, forearm and femoral neck. The average BMD with TT genotype was significantly lower at lumbar spine, hip and forearm. The Frequency of TT genotype and t allele was significantly high in osteoporotic women when compared with controls. The average BMD with Aa genotype was higher in ApaI. Furthermore, comparison of frequency distribution of genotype and allele for VDR ApaI between osteoporotic patients and controls did not show any significant difference. Our findings revealed that TaqI gene TT genotype was associated with low BMD in North Indian osteoporotic women. Moreover, TT genotype and t allele associated significantly with osteoporosis in postmenopausal women. Therefore, VDR TaqI gene is an important determinant of risk factor for osteoporosis. Copyright © 2018 Elsevier B.V. All rights reserved.

Oxytocin and Vasopressin Receptor Gene Polymorphisms: Role in Social and Psychiatric Traits.

PubMed

Aspé-Sánchez, Mauricio; Moreno, Macarena; Rivera, Maria Ignacia; Rossi, Alejandra; Ewer, John

2015-01-01

Oxytocin (OXT) and arginine-vasopressin (AVP) are two phylogenetically conserved neuropeptides that have been implicated in a wide range of social behaviors. Although a large body of research, ranging from rodents to humans, has reported on the effects of OXT and AVP administration on affiliative and trust behaviors, and has highlighted the genetic contributions of OXT and AVP receptor polymorphisms to both social behaviors and to diseases related to social deficits, the consequences of peptide administration on psychiatric symptoms, and the impact of receptor polymorphisms on receptor function, are still unclear. Despite the exciting advances that these reports have brought to social neuroscience, they remain preliminary and suffer from the problems that are inherent to monogenetic linkage and association studies. As an alternative, some studies are using polygenic approaches, and consider the contributions of other genes and pathways, including those involving DA, 5-HT, and reelin, in addition to OXT and AVP; a handful of report are also using genome-wide association studies. This review summarizes findings on the associations between OXT and AVP receptor polymorphism, social behavior, and psychiatric diseases. In addition, we discuss reports on the interactions of OXT and AVP receptor genes and genes involved in other pathways (such as those of dopamine, serotonin, and reelin), as well as research that has shed some light on the impact of gene polymorphisms on the volume, connectivity, and activation of specific neural structures, differential receptor expression, and plasma levels of the OXT and AVP peptides. We hope that this effort will be helpful for understanding the studies performed so far, and for encouraging the inclusion of other candidate genes not explored to date.

“Soldier's Heart”: A Genetic Basis for Elevated Cardiovascular Disease Risk Associated with Post-traumatic Stress Disorder

PubMed Central

Pollard, Harvey B.; Shivakumar, Chittari; Starr, Joshua; Eidelman, Ofer; Jacobowitz, David M.; Dalgard, Clifton L.; Srivastava, Meera; Wilkerson, Matthew D.; Stein, Murray B.; Ursano, Robert J.

2016-01-01

“Soldier's Heart,” is an American Civil War term linking post-traumatic stress disorder (PTSD) with increased propensity for cardiovascular disease (CVD). We have hypothesized that there might be a quantifiable genetic basis for this linkage. To test this hypothesis we identified a comprehensive set of candidate risk genes for PTSD, and tested whether any were also independent risk genes for CVD. A functional analysis algorithm was used to identify associated signaling networks. We identified 106 PTSD studies that report one or more polymorphic variants in 87 candidate genes in 83,463 subjects and controls. The top upstream drivers for these PTSD risk genes are predicted to be the glucocorticoid receptor (NR3C1) and Tumor Necrosis Factor alpha (TNFA). We find that 37 of the PTSD candidate risk genes are also candidate independent risk genes for CVD. The association between PTSD and CVD is significant by Fisher's Exact Test (P = 3 × 10−54). We also find 15 PTSD risk genes that are independently associated with Type 2 Diabetes Mellitus (T2DM; also significant by Fisher's Exact Test (P = 1.8 × 10−16). Our findings offer quantitative evidence for a genetic link between post-traumatic stress and cardiovascular disease, Computationally, the common mechanism for this linkage between PTSD and CVD is innate immunity and NFκB-mediated inflammation. PMID:27721742

"Soldier's Heart": A Genetic Basis for Elevated Cardiovascular Disease Risk Associated with Post-traumatic Stress Disorder.

PubMed

Pollard, Harvey B; Shivakumar, Chittari; Starr, Joshua; Eidelman, Ofer; Jacobowitz, David M; Dalgard, Clifton L; Srivastava, Meera; Wilkerson, Matthew D; Stein, Murray B; Ursano, Robert J

2016-01-01

"Soldier's Heart," is an American Civil War term linking post-traumatic stress disorder (PTSD) with increased propensity for cardiovascular disease (CVD). We have hypothesized that there might be a quantifiable genetic basis for this linkage. To test this hypothesis we identified a comprehensive set of candidate risk genes for PTSD, and tested whether any were also independent risk genes for CVD. A functional analysis algorithm was used to identify associated signaling networks. We identified 106 PTSD studies that report one or more polymorphic variants in 87 candidate genes in 83,463 subjects and controls. The top upstream drivers for these PTSD risk genes are predicted to be the glucocorticoid receptor (NR3C1) and Tumor Necrosis Factor alpha (TNFA). We find that 37 of the PTSD candidate risk genes are also candidate independent risk genes for CVD. The association between PTSD and CVD is significant by Fisher's Exact Test ( P = 3 × 10 -54 ). We also find 15 PTSD risk genes that are independently associated with Type 2 Diabetes Mellitus (T2DM; also significant by Fisher's Exact Test ( P = 1.8 × 10 -16 ). Our findings offer quantitative evidence for a genetic link between post-traumatic stress and cardiovascular disease, Computationally, the common mechanism for this linkage between PTSD and CVD is innate immunity and NFκB-mediated inflammation.

Genome-wide gene-based analysis suggests an association between Neuroligin 1 (NLGN1) and post-traumatic stress disorder.

PubMed

Kilaru, V; Iyer, S V; Almli, L M; Stevens, J S; Lori, A; Jovanovic, T; Ely, T D; Bradley, B; Binder, E B; Koen, N; Stein, D J; Conneely, K N; Wingo, A P; Smith, A K; Ressler, K J

2016-05-24

Post-traumatic stress disorder (PTSD) develops in only some people following trauma exposure, but the mechanisms differentially explaining risk versus resilience remain largely unknown. PTSD is heritable but candidate gene studies and genome-wide association studies (GWAS) have identified only a modest number of genes that reliably contribute to PTSD. New gene-based methods may help identify additional genes that increase risk for PTSD development or severity. We applied gene-based testing to GWAS data from the Grady Trauma Project (GTP), a primarily African American cohort, and identified two genes (NLGN1 and ZNRD1-AS1) that associate with PTSD after multiple test correction. Although the top SNP from NLGN1 did not replicate, we observed gene-based replication of NLGN1 with PTSD in the Drakenstein Child Health Study (DCHS) cohort from Cape Town. NLGN1 has previously been associated with autism, and it encodes neuroligin 1, a protein involved in synaptogenesis, learning, and memory. Within the GTP dataset, a single nucleotide polymorphism (SNP), rs6779753, underlying the gene-based association, associated with the intermediate phenotypes of higher startle response and greater functional magnetic resonance imaging activation of the amygdala, orbitofrontal cortex, right thalamus and right fusiform gyrus in response to fearful faces. These findings support a contribution of the NLGN1 gene pathway to the neurobiological underpinnings of PTSD.

Genome-wide gene-based analysis suggests an association between Neuroligin 1 (NLGN1) and post-traumatic stress disorder

PubMed Central

Kilaru, V; Iyer, S V; Almli, L M; Stevens, J S; Lori, A; Jovanovic, T; Ely, T D; Bradley, B; Binder, E B; Koen, N; Stein, D J; Conneely, K N; Wingo, A P; Smith, A K; Ressler, K J

2016-01-01

Post-traumatic stress disorder (PTSD) develops in only some people following trauma exposure, but the mechanisms differentially explaining risk versus resilience remain largely unknown. PTSD is heritable but candidate gene studies and genome-wide association studies (GWAS) have identified only a modest number of genes that reliably contribute to PTSD. New gene-based methods may help identify additional genes that increase risk for PTSD development or severity. We applied gene-based testing to GWAS data from the Grady Trauma Project (GTP), a primarily African American cohort, and identified two genes (NLGN1 and ZNRD1-AS1) that associate with PTSD after multiple test correction. Although the top SNP from NLGN1 did not replicate, we observed gene-based replication of NLGN1 with PTSD in the Drakenstein Child Health Study (DCHS) cohort from Cape Town. NLGN1 has previously been associated with autism, and it encodes neuroligin 1, a protein involved in synaptogenesis, learning, and memory. Within the GTP dataset, a single nucleotide polymorphism (SNP), rs6779753, underlying the gene-based association, associated with the intermediate phenotypes of higher startle response and greater functional magnetic resonance imaging activation of the amygdala, orbitofrontal cortex, right thalamus and right fusiform gyrus in response to fearful faces. These findings support a contribution of the NLGN1 gene pathway to the neurobiological underpinnings of PTSD. PMID:27219346

Demographically-Based Evaluation of Genomic Regions under Selection in Domestic Dogs

PubMed Central

Freedman, Adam H.; Schweizer, Rena M.; Ortega-Del Vecchyo, Diego; Han, Eunjung; Davis, Brian W.; Gronau, Ilan; Silva, Pedro M.; Galaverni, Marco; Fan, Zhenxin; Marx, Peter; Lorente-Galdos, Belen; Ramirez, Oscar; Hormozdiari, Farhad; Alkan, Can; Vilà, Carles; Squire, Kevin; Geffen, Eli; Kusak, Josip; Boyko, Adam R.; Parker, Heidi G.; Lee, Clarence; Tadigotla, Vasisht; Siepel, Adam; Bustamante, Carlos D.; Harkins, Timothy T.; Nelson, Stanley F.; Marques-Bonet, Tomas; Ostrander, Elaine A.; Wayne, Robert K.; Novembre, John

2016-01-01

Controlling for background demographic effects is important for accurately identifying loci that have recently undergone positive selection. To date, the effects of demography have not yet been explicitly considered when identifying loci under selection during dog domestication. To investigate positive selection on the dog lineage early in the domestication, we examined patterns of polymorphism in six canid genomes that were previously used to infer a demographic model of dog domestication. Using an inferred demographic model, we computed false discovery rates (FDR) and identified 349 outlier regions consistent with positive selection at a low FDR. The signals in the top 100 regions were frequently centered on candidate genes related to brain function and behavior, including LHFPL3, CADM2, GRIK3, SH3GL2, MBP, PDE7B, NTAN1, and GLRA1. These regions contained significant enrichments in behavioral ontology categories. The 3rd top hit, CCRN4L, plays a major role in lipid metabolism, that is supported by additional metabolism related candidates revealed in our scan, including SCP2D1 and PDXC1. Comparing our method to an empirical outlier approach that does not directly account for demography, we found only modest overlaps between the two methods, with 60% of empirical outliers having no overlap with our demography-based outlier detection approach. Demography-aware approaches have lower-rates of false discovery. Our top candidates for selection, in addition to expanding the set of neurobehavioral candidate genes, include genes related to lipid metabolism, suggesting a dietary target of selection that was important during the period when proto-dogs hunted and fed alongside hunter-gatherers. PMID:26943675

Identifying disease polymorphisms from case-control genetic association data.

PubMed

Park, L

2010-12-01

In case-control association studies, it is typical to observe several associated polymorphisms in a gene region. Often the most significantly associated polymorphism is considered to be the disease polymorphism; however, it is not clear whether it is the disease polymorphism or there is more than one disease polymorphism in the gene region. Currently, there is no method that can handle these problems based on the linkage disequilibrium (LD) relationship between polymorphisms. To distinguish real disease polymorphisms from markers in LD, a method that can detect disease polymorphisms in a gene region has been developed. Relying on the LD between polymorphisms in controls, the proposed method utilizes model-based likelihood ratio tests to find disease polymorphisms. This method shows reliable Type I and Type II error rates when sample sizes are large enough, and works better with re-sequenced data. Applying this method to fine mapping using re-sequencing or dense genotyping data would provide important information regarding the genetic architecture of complex traits.

Identification of gene-specific polymorphisms and association with capsaicin pathway metabolites in Capsicum annuum L. collections.

PubMed

Reddy, Umesh K; Almeida, Aldo; Abburi, Venkata L; Alaparthi, Suresh Babu; Unselt, Desiree; Hankins, Gerald; Park, Minkyu; Choi, Doil; Nimmakayala, Padma

2014-01-01

Pepper (Capsicum annuum L.) is an economically important crop with added nutritional value. Production of capsaicin is an important quantitative trait with high environmental variance, so the development of markers regulating capsaicinoid accumulation is important for pepper breeding programs. In this study, we performed association mapping at the gene level to identify single nucleotide polymorphisms (SNPs) associated with capsaicin pathway metabolites in a diverse Capsicum annuum collection during two seasons. The genes Pun1, CCR, KAS and HCT were sequenced and matched with the whole-genome sequence draft of pepper to identify SNP locations and for further characterization. The identified SNPs for each gene underwent candidate gene association mapping. Association mapping results revealed Pun1 as a key regulator of major metabolites in the capsaicin pathway mainly affecting capsaicinoids and precursors for acyl moieties of capsaicinoids. Six different SNPs in the promoter sequence of Pun1 were found associated with capsaicin in plants from both seasons. Our results support that CCR is an important control point for the flux of p-coumaric acid to specific biosynthesis pathways. KAS was found to regulate the major precursors for acyl moieties of capsaicinoids and may play a key role in capsaicinoid production. Candidate gene association mapping of Pun1 suggested that the accumulation of capsaicinoids depends on the expression of Pun1, as revealed by the most important associated SNPs found in the promoter region of Pun1.

Identification of Gene-Specific Polymorphisms and Association with Capsaicin Pathway Metabolites in Capsicum annuum L. Collections

PubMed Central

Abburi, Venkata L.; Alaparthi, Suresh Babu; Unselt, Desiree; Hankins, Gerald; Park, Minkyu; Choi, Doil

2014-01-01

Pepper (Capsicum annuum L.) is an economically important crop with added nutritional value. Production of capsaicin is an important quantitative trait with high environmental variance, so the development of markers regulating capsaicinoid accumulation is important for pepper breeding programs. In this study, we performed association mapping at the gene level to identify single nucleotide polymorphisms (SNPs) associated with capsaicin pathway metabolites in a diverse Capsicum annuum collection during two seasons. The genes Pun1, CCR, KAS and HCT were sequenced and matched with the whole-genome sequence draft of pepper to identify SNP locations and for further characterization. The identified SNPs for each gene underwent candidate gene association mapping. Association mapping results revealed Pun1 as a key regulator of major metabolites in the capsaicin pathway mainly affecting capsaicinoids and precursors for acyl moieties of capsaicinoids. Six different SNPs in the promoter sequence of Pun1 were found associated with capsaicin in plants from both seasons. Our results support that CCR is an important control point for the flux of p-coumaric acid to specific biosynthesis pathways. KAS was found to regulate the major precursors for acyl moieties of capsaicinoids and may play a key role in capsaicinoid production. Candidate gene association mapping of Pun1 suggested that the accumulation of capsaicinoids depends on the expression of Pun1, as revealed by the most important associated SNPs found in the promoter region of Pun1. PMID:24475113

Candidate gene analysis for Alzheimer's disease in adults with Down syndrome.

PubMed

Lee, Joseph H; Lee, Annie J; Dang, Lam-Ha; Pang, Deborah; Kisselev, Sergey; Krinsky-McHale, Sharon J; Zigman, Warren B; Luchsinger, José A; Silverman, Wayne; Tycko, Benjamin; Clark, Lorraine N; Schupf, Nicole

2017-08-01

Individuals with Down syndrome (DS) overexpress many genes on chromosome 21 due to trisomy and have high risk of dementia due to the Alzheimer's disease (AD) neuropathology. However, there is a wide range of phenotypic differences (e.g., age at onset of AD, amyloid β levels) among adults with DS, suggesting the importance of factors that modify risk within this particularly vulnerable population, including genotypic variability. Previous genetic studies in the general population have identified multiple genes that are associated with AD. This study examined the contribution of polymorphisms in these genes to the risk of AD in adults with DS ranging from 30 to 78 years of age at study entry (N = 320). We used multiple logistic regressions to estimate the likelihood of AD using single-nucleotide polymorphisms (SNPs) in candidate genes, adjusting for age, sex, race/ethnicity, level of intellectual disability and APOE genotype. This study identified multiple SNPs in APP and CST3 that were associated with AD at a gene-wise level empirical p-value of 0.05, with odds ratios in the range of 1.5-2. SNPs in MARK4 were marginally associated with AD. CST3 and MARK4 may contribute to our understanding of potential mechanisms where CST3 may contribute to the amyloid pathway by inhibiting plaque formation, and MARK4 may contribute to the regulation of the transition between stable and dynamic microtubules. Copyright © 2017 Elsevier Inc. All rights reserved.

An R2R3-type MYB transcription factor, GmMYB29, regulates isoflavone biosynthesis in soybean

PubMed Central

Liu, Shulin; Zhou, Xiaoqiong; Zhang, Huairen; Wang, Chun-e; Yang, Wenming; Tian, Zhixi; Cheng, Hao; Yu, Deyue

2017-01-01

Isoflavones comprise a group of secondary metabolites produced almost exclusively by plants in the legume family, including soybean [Glycine max (L.) Merr.]. They play vital roles in plant defense and have many beneficial effects on human health. Isoflavone content is a complex quantitative trait controlled by multiple genes, and the genetic mechanisms underlying isoflavone biosynthesis remain largely unknown. Via a genome-wide association study (GWAS), we identified 28 single nucleotide polymorphisms (SNPs) that are significantly associated with isoflavone concentrations in soybean. One of these 28 SNPs was located in the 5’-untranslated region (5’-UTR) of an R2R3-type MYB transcription factor, GmMYB29, and this gene was thus selected as a candidate gene for further analyses. A subcellular localization study confirmed that GmMYB29 was located in the nucleus. Transient reporter gene assays demonstrated that GmMYB29 activated the IFS2 (isoflavone synthase 2) and CHS8 (chalcone synthase 8) gene promoters. Overexpression and RNAi-mediated silencing of GmMYB29 in soybean hairy roots resulted in increased and decreased isoflavone content, respectively. Moreover, a candidate-gene association analysis revealed that 11 natural GmMYB29 polymorphisms were significantly associated with isoflavone contents, and regulation of GmMYB29 expression could partially contribute to the observed phenotypic variation. Taken together, these results provide important genetic insights into the molecular mechanisms underlying isoflavone biosynthesis in soybean. PMID:28489859

Association of High Myopia with Crystallin Beta A4 (CRYBA4) Gene Polymorphisms in the Linkage-Identified MYP6 Locus

PubMed Central

Ho, Daniel W. H.; Yap, Maurice K. H.; Ng, Po Wah; Fung, Wai Yan; Yip, Shea Ping

2012-01-01

Background Myopia is the most common ocular disorder worldwide and imposes tremendous burden on the society. It is a complex disease. The MYP6 locus at 22 q12 is of particular interest because many studies have detected linkage signals at this interval. The MYP6 locus is likely to contain susceptibility gene(s) for myopia, but none has yet been identified. Methodology/Principal Findings Two independent subject groups of southern Chinese in Hong Kong participated in the study an initial study using a discovery sample set of 342 cases and 342 controls, and a follow-up study using a replication sample set of 316 cases and 313 controls. Cases with high myopia were defined by spherical equivalent ≤ -8 dioptres and emmetropic controls by spherical equivalent within ±1.00 dioptre for both eyes. Manual candidate gene selection from the MYP6 locus was supported by objective in silico prioritization. DNA samples of discovery sample set were genotyped for 178 tagging single nucleotide polymorphisms (SNPs) from 26 genes. For replication, 25 SNPs (tagging or located at predicted transcription factor or microRNA binding sites) from 4 genes were subsequently examined using the replication sample set. Fisher P value was calculated for all SNPs and overall association results were summarized by meta-analysis. Based on initial and replication studies, rs2009066 located in the crystallin beta A4 (CRYBA4) gene was identified to be the most significantly associated with high myopia (initial study: P = 0.02; replication study: P = 1.88e-4; meta-analysis: P = 1.54e-5) among all the SNPs tested. The association result survived correction for multiple comparisons. Under the allelic genetic model for the combined sample set, the odds ratio of the minor allele G was 1.41 (95% confidence intervals, 1.21-1.64). Conclusions/Significance A novel susceptibility gene (CRYBA4) was discovered for high myopia. Our study also signified the potential importance of appropriate gene prioritization in candidate selection. PMID:22792142

Targeted and Untargeted Approaches Unravel Novel Candidate Genes and Diagnostic SNPs for Quantitative Resistance of the Potato (Solanum tuberosum L.) to Phytophthora infestans Causing the Late Blight Disease.

PubMed

Mosquera, Teresa; Alvarez, Maria Fernanda; Jiménez-Gómez, José M; Muktar, Meki Shehabu; Paulo, Maria João; Steinemann, Sebastian; Li, Jinquan; Draffehn, Astrid; Hofmann, Andrea; Lübeck, Jens; Strahwald, Josef; Tacke, Eckhard; Hofferbert, Hans-Reinhardt; Walkemeier, Birgit; Gebhardt, Christiane

2016-01-01

The oomycete Phytophthora infestans causes late blight of potato, which can completely destroy the crop. Therefore, for the past 160 years, late blight has been the most important potato disease worldwide. The identification of cultivars with high and durable field resistance to P. infestans is an objective of most potato breeding programs. This type of resistance is polygenic and therefore quantitative. Its evaluation requires multi-year and location trials. Furthermore, quantitative resistance to late blight correlates with late plant maturity, a negative agricultural trait. Knowledge of the molecular genetic basis of quantitative resistance to late blight not compromised by late maturity is very limited. It is however essential for developing diagnostic DNA markers that facilitate the efficient combination of superior resistance alleles in improved cultivars. We used association genetics in a population of 184 tetraploid potato cultivars in order to identify single nucleotide polymorphisms (SNPs) that are associated with maturity corrected resistance (MCR) to late blight. The population was genotyped for almost 9000 SNPs from three different sources. The first source was candidate genes specifically selected for their function in the jasmonate pathway. The second source was novel candidate genes selected based on comparative transcript profiling (RNA-Seq) of groups of genotypes with contrasting levels of quantitative resistance to P. infestans. The third source was the first generation 8.3k SolCAP SNP genotyping array available in potato for genome wide association studies (GWAS). Twenty seven SNPs from all three sources showed robust association with MCR. Some of those were located in genes that are strong candidates for directly controlling quantitative resistance, based on functional annotation. Most important were: a lipoxygenase (jasmonate pathway), a 3-hydroxy-3-methylglutaryl coenzyme A reductase (mevalonate pathway), a P450 protein (terpene biosynthesis), a transcription factor and a homolog of a major gene for resistance to P. infestans from the wild potato species Solanum venturii. The candidate gene approach and GWAS complemented each other as they identified different genes. The results of this study provide new insight in the molecular genetic basis of quantitative resistance in potato and a toolbox of diagnostic SNP markers for breeding applications.

Targeted and Untargeted Approaches Unravel Novel Candidate Genes and Diagnostic SNPs for Quantitative Resistance of the Potato (Solanum tuberosum L.) to Phytophthora infestans Causing the Late Blight Disease

PubMed Central

Jiménez-Gómez, José M.; Muktar, Meki Shehabu; Paulo, Maria João; Steinemann, Sebastian; Li, Jinquan; Draffehn, Astrid; Hofmann, Andrea; Lübeck, Jens; Strahwald, Josef; Tacke, Eckhard; Hofferbert, Hans-Reinhardt; Walkemeier, Birgit; Gebhardt, Christiane

2016-01-01

The oomycete Phytophthora infestans causes late blight of potato, which can completely destroy the crop. Therefore, for the past 160 years, late blight has been the most important potato disease worldwide. The identification of cultivars with high and durable field resistance to P. infestans is an objective of most potato breeding programs. This type of resistance is polygenic and therefore quantitative. Its evaluation requires multi-year and location trials. Furthermore, quantitative resistance to late blight correlates with late plant maturity, a negative agricultural trait. Knowledge of the molecular genetic basis of quantitative resistance to late blight not compromised by late maturity is very limited. It is however essential for developing diagnostic DNA markers that facilitate the efficient combination of superior resistance alleles in improved cultivars. We used association genetics in a population of 184 tetraploid potato cultivars in order to identify single nucleotide polymorphisms (SNPs) that are associated with maturity corrected resistance (MCR) to late blight. The population was genotyped for almost 9000 SNPs from three different sources. The first source was candidate genes specifically selected for their function in the jasmonate pathway. The second source was novel candidate genes selected based on comparative transcript profiling (RNA-Seq) of groups of genotypes with contrasting levels of quantitative resistance to P. infestans. The third source was the first generation 8.3k SolCAP SNP genotyping array available in potato for genome wide association studies (GWAS). Twenty seven SNPs from all three sources showed robust association with MCR. Some of those were located in genes that are strong candidates for directly controlling quantitative resistance, based on functional annotation. Most important were: a lipoxygenase (jasmonate pathway), a 3-hydroxy-3-methylglutaryl coenzyme A reductase (mevalonate pathway), a P450 protein (terpene biosynthesis), a transcription factor and a homolog of a major gene for resistance to P. infestans from the wild potato species Solanum venturii. The candidate gene approach and GWAS complemented each other as they identified different genes. The results of this study provide new insight in the molecular genetic basis of quantitative resistance in potato and a toolbox of diagnostic SNP markers for breeding applications. PMID:27281327

Opposite Effects of GSTM1 – and GSTT1 – Gene Deletion Variants on Bone Mineral Density

PubMed Central

Mlakar, Simona Jurkovic; Osredkar, Josko; Prezelj, Janez; Marc, Janja

2011-01-01

Oxidative stress is associated with osteoporosis. The glutathione S-transferases form the major detoxifying group of enzymes responsible for eliminating products of oxidative stress. We have therefore proposed GSTM1 and GSTT1 genes as candidates for studying the genetics of osteoporosis. The aim of the present study was to examine possible association of GSTM1 and GSTT1 gene deletion polymorphisms, alone or in combination, with bone mineral density at femoral neck (BMD_fn), lumbar spine (BMD_ls) and total hip (BMD_th) in Slovenian elderly women and men. GSTM1 and GSTT1 gene deletion polymorphisms in 712 elderly people were analyzed using the triplex PCR method for the presence of GSTM1 and GSTT1 gene segments. BMD_fn, BMD_ls and BMD_th were measured by the dual-energy X-ray absorptiometry (DEXA) method. Results were analyzed using univariate statistic model adjusted for sex, body mass index (BMI) and age. Our results showed the significant differences in BMD_th, BMD_ls and BMD_fn values (p = 0.031, 0.017 and 0.023, respectively) in subgroups of GSTT1 gene deletion polymorphism. For GSTM1 gene deletion polymorphism borderline significant association was found with BMD_ls (p = 0.100). Furthermore, subjects with homozygous deletion of GSTT1 gene showed higher BMD values on all measured skeletal sites and, in contrast, subjects with homozygous deletion of GSTM1 gene showed lower BMD values. Moreover, a gene-gene interaction study showed significant association of GSTM1-null and GSTT1-null polymorphisms with BMD_ls values (p = 0.044). Carriers with a combination of the presence of GSTT1 gene and the homozygous absence of GSTM1 gene fragment were associated with the lower BMD values at all skeletal sites. The significant association of combination of GSTT1 gene presence and homozygous absence of GSTM1 gene with BMD was demonstrated, suggesting that it could be used, if validated in other studies, as genetic marker for low BMD. PMID:22048269

Opposite effects of GSTM1--and GSTT1: gene deletion variants on bone mineral density.

PubMed

Mlakar, Simona Jurkovic; Osredkar, Josko; Prezelj, Janez; Marc, Janja

2011-01-01

Oxidative stress is associated with osteoporosis. The glutathione S-transferases form the major detoxifying group of enzymes responsible for eliminating products of oxidative stress. We have therefore proposed GSTM1 and GSTT1 genes as candidates for studying the genetics of osteoporosis. The aim of the present study was to examine possible association of GSTM1 and GSTT1 gene deletion polymorphisms, alone or in combination, with bone mineral density at femoral neck (BMD_fn), lumbar spine (BMD_ls) and total hip (BMD_th) in Slovenian elderly women and men.GSTM1 and GSTT1 gene deletion polymorphisms in 712 elderly people were analyzed using the triplex PCR method for the presence of GSTM1 and GSTT1 gene segments. BMD_fn, BMD_ls and BMD_th were measured by the dual-energy X-ray absorptiometry (DEXA) method. Results were analyzed using univariate statistic model adjusted for sex, body mass index (BMI) and age. Our results showed the significant differences in BMD_th, BMD_ls and BMD_fn values (p=0.031, 0.017 and 0.023, respectively) in subgroups of GSTT1 gene deletion polymorphism. For GSTM1 gene deletion polymorphism borderline significant association was found with BMD_ls (p=0.100). Furthermore, subjects with homozygous deletion of GSTT1 gene showed higher BMD values on all measured skeletal sites and, in contrast, subjects with homozygous deletion of GSTM1 gene showed lower BMD values. Moreover, a gene-gene interaction study showed significant association of GSTM1-null and GSTT1-null polymorphisms with BMD_ls values (p=0.044). Carriers with a combination of the presence of GSTT1 gene and the homozygous absence of GSTM1 gene fragment were associated with the lower BMD values at all skeletal sites. The significant association of combination of GSTT1 gene presence and homozygous absence of GSTM1 gene with BMD was demonstrated, suggesting that it could be used, if validated in other studies, as genetic marker for low BMD.

TPH-2 Polymorphisms Interact with Early Life Stress to Influence Response to Treatment with Antidepressant Drugs.

PubMed

Xu, Zhi; Reynolds, Gavin P; Yuan, Yonggui; Shi, Yanyan; Pu, Mengjia; Zhang, Zhijun

2016-11-01

Variation in genes implicated in monoamine neurotransmission may interact with environmental factors to influence antidepressant response. We aimed to determine how a range of single nucleotide polymorphisms in monoaminergic genes influence this response to treatment and how they interact with childhood trauma and recent life stress in a Chinese sample. An initial study of monoaminergic coding region single nucleotide polymorphisms identified significant associations of TPH2 and HTR1B single nucleotide polymorphisms with treatment response that showed interactions with childhood and recent life stress, respectively (Xu et al., 2012). A total of 47 further single nucleotide polymorphisms in 17 candidate monoaminergic genes were genotyped in 281 Chinese Han patients with major depressive disorder. Response to 6 weeks' antidepressant treatment was determined by change in the 17-item Hamilton Depression Rating Scale score, and previous stressful events were evaluated by the Life Events Scale and Childhood Trauma Questionnaire-Short Form. Three TPH2 single nucleotide polymorphisms (rs11178998, rs7963717, and rs2171363) were significantly associated with antidepressant response in this Chinese sample, as was a haplotype in TPH2 (rs2171363 and rs1487278). One of these, rs2171363, showed a significant interaction with childhood adversity in its association with antidepressant response. These findings provide further evidence that variation in TPH2 is associated with antidepressant response and may also interact with childhood trauma to influence outcome of antidepressant treatment. © The Author 2016. Published by Oxford University Press on behalf of CINP.

TPH-2 Polymorphisms Interact with Early Life Stress to Influence Response to Treatment with Antidepressant Drugs

PubMed Central

Reynolds, Gavin P.; Yuan, Yonggui; Shi, Yanyan; Pu, Mengjia; Zhang, Zhijun

2016-01-01

Background: Variation in genes implicated in monoamine neurotransmission may interact with environmental factors to influence antidepressant response. We aimed to determine how a range of single nucleotide polymorphisms in monoaminergic genes influence this response to treatment and how they interact with childhood trauma and recent life stress in a Chinese sample. An initial study of monoaminergic coding region single nucleotide polymorphisms identified significant associations of TPH2 and HTR1B single nucleotide polymorphisms with treatment response that showed interactions with childhood and recent life stress, respectively (Xu et al., 2012). Methods: A total of 47 further single nucleotide polymorphisms in 17 candidate monoaminergic genes were genotyped in 281 Chinese Han patients with major depressive disorder. Response to 6 weeks’ antidepressant treatment was determined by change in the 17-item Hamilton Depression Rating Scale score, and previous stressful events were evaluated by the Life Events Scale and Childhood Trauma Questionnaire-Short Form. Results: Three TPH2 single nucleotide polymorphisms (rs11178998, rs7963717, and rs2171363) were significantly associated with antidepressant response in this Chinese sample, as was a haplotype in TPH2 (rs2171363 and rs1487278). One of these, rs2171363, showed a significant interaction with childhood adversity in its association with antidepressant response. Conclusions: These findings provide further evidence that variation in TPH2 is associated with antidepressant response and may also interact with childhood trauma to influence outcome of antidepressant treatment. PMID:27521242

Whole-Genome Resequencing of Holstein Bulls for Indel Discovery and Identification of Genes Associated with Milk Composition Traits in Dairy Cattle.

PubMed

Jiang, Jianping; Gao, Yahui; Hou, Yali; Li, Wenhui; Zhang, Shengli; Zhang, Qin; Sun, Dongxiao

2016-01-01

The use of whole-genome resequencing to obtain more information on genetic variation could produce a range of benefits for the dairy cattle industry, especially with regard to increasing milk production and improving milk composition. In this study, we sequenced the genomes of eight Holstein bulls from four half- or full-sib families, with high and low estimated breeding values (EBVs) of milk protein percentage and fat percentage at an average effective depth of 10×, using Illumina sequencing. Over 0.9 million nonredundant short insertions and deletions (indels) [1-49 base pairs (bp)] were obtained. Among them, 3,625 indels that were polymorphic between the high and low groups of bulls were revealed and subjected to further analysis. The vast majority (76.67%) of these indels were novel. Follow-up validation assays confirmed that most (70%) of the randomly selected indels represented true variations. The indels that were polymorphic between the two groups were annotated based on the cattle genome sequence assembly (UMD3.1.69); as a result, nearly 1,137 of them were found to be located within 767 annotated genes, only 5 (0.138%) of which were located in exons. Then, by integrated analysis of the 767 genes with known quantitative trait loci (QTL); significant single-nucleotide polymorphisms (SNPs) previously identified by genome-wide association studies (GWASs) to be associated with bovine milk protein and fat traits; and the well-known pathways involved in protein, fat synthesis, and metabolism, we identified a total of 11 promising candidate genes potentially affecting milk composition traits. These were FCGR2B, CENPE, RETSAT, ACSBG2, NFKB2, TBC1D1, NLK, MAP3K1, SLC30A2, ANGPT1 and UGDH. Our findings provide a basis for further study and reveal key genes for milk composition traits in dairy cattle.

Genetic association analysis of CNR1 and CNR2 polymorphisms with schizophrenia in a Korean population.

PubMed

Bae, Joon Seol; Kim, Jason Yongha; Park, Byung-Lae; Kim, Jeong-Hyun; Kim, Bomi; Park, Chul Soo; Kim, Bong-Jo; Lee, Cheol-Soon; Lee, Migyung; Choi, Woo Hyuk; Shin, Tae-Min; Hwang, Jaeuk; Shin, Hyoung Doo; Woo, Sung-Il

2014-10-01

Located on 6q15 and 1p36.11, cannabinoid receptor 1 (CNR1) and cannabinoid receptor 2 (CNR2) genes are considered to be a positional and functional candidate gene for the development of mental disorders such as schizophrenia because CNR1 is known as a regulator of dopamine signaling in the hippocampus and the cerebral cortex. However, few genetic studies have been carried out to investigate an association of CNR1 and CNR2 polymorphisms and the risk of schizophrenia. In this study, although the result indicates that CNR1 and CNR2 variations are unlikely to influence schizophrenia susceptibility in a Korean population, the findings would provide meaningful information for further genetic studies.

Are "functionally related polymorphisms" of renin-angiotensin-aldosterone system gene polymorphisms associated with hypertension?

PubMed

Hahntow, Ines N; Mairuhu, Gideon; van Valkengoed, Irene Gm; Koopmans, Richard P; Michel, Martin C

2010-06-02

Genotype-phenotype association studies are typically based upon polymorphisms or haplotypes comprised of multiple polymorphisms within a single gene. It has been proposed that combinations of polymorphisms in distinct genes, which functionally impact the same phenotype, may have stronger phenotype associations than those within a single gene. We have tested this hypothesis using genes encoding components of the renin-angiotensin-aldosterone system and the high blood pressure phenotype. Our analysis is based on 1379 participants of the cross-sectional SUNSET study randomly selected from the population register of Amsterdam. Each subject was genotyped for the angiotensinogen M235T, the angiotensin-converting enzyme insertion/deletion and the angiotensin II type 1 receptor A1166C polymorphism. The phenotype high blood pressure was defined either as a categorical variable comparing hypertension versus normotension as in most previous studies or as a continuous variable using systolic, diastolic and mean blood pressure in a multiple regression analysis with gender, ethnicity, age, body-mass-index and antihypertensive medication as covariates. Genotype-phenotype relationships were explored for each polymorphism in isolation and for double and triple polymorphism combinations. At the single polymorphism level, only the A allele of the angiotensin II type 1 receptor was associated with a high blood pressure phenotype. Using combinations of polymorphisms of two or all three genes did not yield stronger/more consistent associations. We conclude that combinations of physiologically related polymorphisms of multiple genes, at least with regard to the renin-angiotensin-aldosterone system and the hypertensive phenotype, do not necessarily offer additional benefit in analyzing genotype/phenotype associations.

Polymorphisms in VDR gene in Tunisian postmenopausal women are associated with osteopenia phenotype.

PubMed

Sassi, R; Sahli, H; Souissi, C; Sellami, S; Ben Ammar El Gaaied, A

2015-01-01

Osteopenia is characterized by intermediate values of bone mineral density (BMD) as compared to normal and osteoporotic subjects. BMD, a surrogate phenotype for osteoporosis, is influenced in part by genetic factors. Among the genes associated with BMD, the vitamin D receptor (VDR) was the first gene studied as a potential candidate associated with BMD in adult and postmenopausal bone loss. However, results are controversial. To determine whether VDR polymorphisms ApaI and TaqI are associated with BMD, osteopenia, osteoporosis and low-impact fracture risk in North Africans, these genotypes were analyzed in 566 postmenopausal Tunisian women. In postmenopausal Tunisian women, the GT ApaI genotype seems to be protective against osteoporosis development (p = 0.02; odds ratio = 0.54). Moreover, the presence of the combined GT/TT genotype of ApaI and TaqI polymorphisms is more frequent in normal BMD women than in osteoporotic women (p = 0.00; odds ratio = 0.41). Interestingly, the GG ApaI genotype is associated with osteopenia development (p = 0.02; odds ratio = 1.86) and also the TT TaqI polymorphism (p = 0.02; odds ratio = 1.53). The GG ApaI genotype is associated with a three times risk of vertebral fracture. The ApaI polymorphism showed an association with osteopenia and low-impact vertebral fracture incidence but not with osteoporosis. The TaqI polymorphism is associated specifically with the osteopenia phenotype. The presence of the two polymorphisms increases the risk to develop osteopenia in postmenopausal Tunisian women. Osteopenia seems to be genetically determined. However, osteoporosis is the result of interaction between genetic and environmental factors.

USP38, FREM3, SDC1, DDC, and LOC727982 Gene Polymorphisms and Differential Susceptibility to Severe Malaria in Tanzania.

PubMed

Manjurano, Alphaxard; Sepúlveda, Nuno; Nadjm, Behzad; Mtove, George; Wangai, Hannah; Maxwell, Caroline; Olomi, Raimos; Reyburn, Hugh; Drakeley, Christopher J; Riley, Eleanor M; Clark, Taane G

2015-10-01

Populations exposed to Plasmodium falciparum infection develop genetic mechanisms of protection against severe malarial disease. Despite decades of genetic epidemiological research, the sickle cell trait (HbAS) sickle cell polymorphism, ABO blood group, and other hemoglobinopathies remain the few major determinants in severe malaria to be replicated across different African populations and study designs. Within a case-control study in a region of high transmission in Tanzania (n = 983), we investigated the role of 40 new loci identified in recent genome-wide studies. In 32 loci passing quality control procedures, we found polymorphisms in USP38, FREM3, SDC1, DDC, and LOC727982 genes to be putatively associated with differential susceptibility to severe malaria. Established candidates explained 7.4% of variation in severe malaria risk (HbAS polymorphism, 6.3%; α-thalassemia, 0.3%; ABO group, 0.3%; and glucose-6-phosphate dehydrogenase deficiency, 0.5%) and the new polymorphisms, another 4.3%. The regions encompassing the loci identified are promising targets for the design of future treatment and control interventions. © The Author 2015. Published by Oxford University Press on behalf of the Infectious Diseases Society of America.

A genome-wide association study of corneal astigmatism: The CREAM Consortium

PubMed Central

Shah, Rupal L.; Li, Qing; Zhao, Wanting; Tedja, Milly S.; Tideman, J. Willem L.; Khawaja, Anthony P.; Fan, Qiao; Yazar, Seyhan; Williams, Katie M.; Verhoeven, Virginie J.M.; Xie, Jing; Wang, Ya Xing; Hess, Moritz; Nickels, Stefan; Lackner, Karl J.; Pärssinen, Olavi; Wedenoja, Juho; Biino, Ginevra; Concas, Maria Pina; Uitterlinden, André; Rivadeneira, Fernando; Jaddoe, Vincent W.V.; Hysi, Pirro G.; Sim, Xueling; Tan, Nicholas; Tham, Yih-Chung; Sensaki, Sonoko; Hofman, Albert; Vingerling, Johannes R.; Jonas, Jost B.; Mitchell, Paul; Hammond, Christopher J.; Höhn, René; Baird, Paul N.; Wong, Tien-Yin; Cheng, Chinfsg-Yu; Teo, Yik Ying; Mackey, David A.; Williams, Cathy; Saw, Seang-Mei; Klaver, Caroline C.W.; Bailey-Wilson, Joan E.

2018-01-01

Purpose To identify genes and genetic markers associated with corneal astigmatism. Methods A meta-analysis of genome-wide association studies (GWASs) of corneal astigmatism undertaken for 14 European ancestry (n=22,250) and 8 Asian ancestry (n=9,120) cohorts was performed by the Consortium for Refractive Error and Myopia. Cases were defined as having >0.75 diopters of corneal astigmatism. Subsequent gene-based and gene-set analyses of the meta-analyzed results of European ancestry cohorts were performed using VEGAS2 and MAGMA software. Additionally, estimates of single nucleotide polymorphism (SNP)-based heritability for corneal and refractive astigmatism and the spherical equivalent were calculated for Europeans using LD score regression. Results The meta-analysis of all cohorts identified a genome-wide significant locus near the platelet-derived growth factor receptor alpha (PDGFRA) gene: top SNP: rs7673984, odds ratio=1.12 (95% CI:1.08–1.16), p=5.55×10−9. No other genome-wide significant loci were identified in the combined analysis or European/Asian ancestry-specific analyses. Gene-based analysis identified three novel candidate genes for corneal astigmatism in Europeans—claudin-7 (CLDN7), acid phosphatase 2, lysosomal (ACP2), and TNF alpha-induced protein 8 like 3 (TNFAIP8L3). Conclusions In addition to replicating a previously identified genome-wide significant locus for corneal astigmatism near the PDGFRA gene, gene-based analysis identified three novel candidate genes, CLDN7, ACP2, and TNFAIP8L3, that warrant further investigation to understand their role in the pathogenesis of corneal astigmatism. The much lower number of genetic variants and genes demonstrating an association with corneal astigmatism compared to published spherical equivalent GWAS analyses suggest a greater influence of rare genetic variants, non-additive genetic effects, or environmental factors in the development of astigmatism. PMID:29422769

Major Quantitative Trait Loci and Putative Candidate Genes for Powdery Mildew Resistance and Fruit-Related Traits Revealed by an Intraspecific Genetic Map for Watermelon (Citrullus lanatus var. lanatus).

PubMed

Kim, Kwang-Hwan; Hwang, Ji-Hyun; Han, Dong-Yeup; Park, Minkyu; Kim, Seungill; Choi, Doil; Kim, Yongjae; Lee, Gung Pyo; Kim, Sun-Tae; Park, Young-Hoon

2015-01-01

An intraspecific genetic map for watermelon was constructed using an F2 population derived from 'Arka Manik' × 'TS34' and transcript sequence variants and quantitative trait loci (QTL) for resistance to powdery mildew (PMR), seed size (SS), and fruit shape (FS) were analyzed. The map consists of 14 linkage groups (LGs) defined by 174 cleaved amplified polymorphic sequences (CAPS), 2 derived-cleaved amplified polymorphic sequence markers, 20 sequence-characterized amplified regions, and 8 expressed sequence tag-simple sequence repeat markers spanning 1,404.3 cM, with a mean marker interval of 6.9 cM and an average of 14.6 markers per LG. Genetic inheritance and QTL analyses indicated that each of the PMR, SS, and FS traits is controlled by an incompletely dominant effect of major QTLs designated as pmr2.1, ss2.1, and fsi3.1, respectively. The pmr2.1, detected on chromosome 2 (Chr02), explained 80.0% of the phenotypic variation (LOD = 30.76). This QTL was flanked by two CAPS markers, wsb2-24 (4.00 cM) and wsb2-39 (13.97 cM). The ss2.1, located close to pmr2.1 and CAPS marker wsb2-13 (1.00 cM) on Chr02, explained 92.3% of the phenotypic variation (LOD = 68.78). The fsi3.1, detected on Chr03, explained 79.7% of the phenotypic variation (LOD = 31.37) and was flanked by two CAPS, wsb3-24 (1.91 cM) and wsb3-9 (7.00 cM). Candidate gene-based CAPS markers were developed from the disease resistance and fruit shape gene homologs located on Chr.02 and Chr03 and were mapped on the intraspecific map. Colocalization of these markers with the major QTLs indicated that watermelon orthologs of a nucleotide-binding site-leucine-rich repeat class gene containing an RPW8 domain and a member of SUN containing the IQ67 domain are candidate genes for pmr2.1 and fsi3.1, respectively. The results presented herein provide useful information for marker-assisted breeding and gene cloning for PMR and fruit-related traits.

Major Quantitative Trait Loci and Putative Candidate Genes for Powdery Mildew Resistance and Fruit-Related Traits Revealed by an Intraspecific Genetic Map for Watermelon (Citrullus lanatus var. lanatus)

PubMed Central

Kim, Kwang-Hwan; Hwang, Ji-Hyun; Han, Dong-Yeup; Park, Minkyu; Kim, Seungill; Choi, Doil; Kim, Yongjae; Lee, Gung Pyo; Kim, Sun-Tae; Park, Young-Hoon

2015-01-01

An intraspecific genetic map for watermelon was constructed using an F2 population derived from ‘Arka Manik’ × ‘TS34’ and transcript sequence variants and quantitative trait loci (QTL) for resistance to powdery mildew (PMR), seed size (SS), and fruit shape (FS) were analyzed. The map consists of 14 linkage groups (LGs) defined by 174 cleaved amplified polymorphic sequences (CAPS), 2 derived-cleaved amplified polymorphic sequence markers, 20 sequence-characterized amplified regions, and 8 expressed sequence tag-simple sequence repeat markers spanning 1,404.3 cM, with a mean marker interval of 6.9 cM and an average of 14.6 markers per LG. Genetic inheritance and QTL analyses indicated that each of the PMR, SS, and FS traits is controlled by an incompletely dominant effect of major QTLs designated as pmr2.1, ss2.1, and fsi3.1, respectively. The pmr2.1, detected on chromosome 2 (Chr02), explained 80.0% of the phenotypic variation (LOD = 30.76). This QTL was flanked by two CAPS markers, wsb2-24 (4.00 cM) and wsb2-39 (13.97 cM). The ss2.1, located close to pmr2.1 and CAPS marker wsb2-13 (1.00 cM) on Chr02, explained 92.3% of the phenotypic variation (LOD = 68.78). The fsi3.1, detected on Chr03, explained 79.7% of the phenotypic variation (LOD = 31.37) and was flanked by two CAPS, wsb3-24 (1.91 cM) and wsb3-9 (7.00 cM). Candidate gene-based CAPS markers were developed from the disease resistance and fruit shape gene homologs located on Chr.02 and Chr03 and were mapped on the intraspecific map. Colocalization of these markers with the major QTLs indicated that watermelon orthologs of a nucleotide-binding site-leucine-rich repeat class gene containing an RPW8 domain and a member of SUN containing the IQ67 domain are candidate genes for pmr2.1 and fsi3.1, respectively. The results presented herein provide useful information for marker-assisted breeding and gene cloning for PMR and fruit-related traits. PMID:26700647

Analysis of 60 reported glioma risk SNPs replicates published GWAS findings but fails to replicate associations from published candidate-gene studies.

PubMed

Walsh, Kyle M; Anderson, Erik; Hansen, Helen M; Decker, Paul A; Kosel, Matt L; Kollmeyer, Thomas; Rice, Terri; Zheng, Shichun; Xiao, Yuanyuan; Chang, Jeffrey S; McCoy, Lucie S; Bracci, Paige M; Wiemels, Joe L; Pico, Alexander R; Smirnov, Ivan; Lachance, Daniel H; Sicotte, Hugues; Eckel-Passow, Jeanette E; Wiencke, John K; Jenkins, Robert B; Wrensch, Margaret R

2013-02-01

Genomewide association studies (GWAS) and candidate-gene studies have implicated single-nucleotide polymorphisms (SNPs) in at least 45 different genes as putative glioma risk factors. Attempts to validate these associations have yielded variable results and few genetic risk factors have been consistently replicated. We conducted a case-control study of Caucasian glioma cases and controls from the University of California San Francisco (810 cases, 512 controls) and the Mayo Clinic (852 cases, 789 controls) in an attempt to replicate previously reported genetic risk factors for glioma. Sixty SNPs selected from the literature (eight from GWAS and 52 from candidate-gene studies) were successfully genotyped on an Illumina custom genotyping panel. Eight SNPs in/near seven different genes (TERT, EGFR, CCDC26, CDKN2A, PHLDB1, RTEL1, TP53) were significantly associated with glioma risk in the combined dataset (P < 0.05), with all associations in the same direction as in previous reports. Several SNP associations showed considerable differences across histologic subtype. All eight successfully replicated associations were first identified by GWAS, although none of the putative risk SNPs from candidate-gene studies was associated in the full case-control sample (all P values > 0.05). Although several confirmed associations are located near genes long known to be involved in gliomagenesis (e.g., EGFR, CDKN2A, TP53), these associations were first discovered by the GWAS approach and are in noncoding regions. These results highlight that the deficiencies of the candidate-gene approach lay in selecting both appropriate genes and relevant SNPs within these genes. © 2012 WILEY PERIODICALS, INC.

The brain-derived neurotrophic factor Val66Met polymorphism is associated with reduced functional magnetic resonance imaging activity in the hippocampus and increased use of caudate nucleus-dependent strategies in a human virtual navigation task

PubMed Central

Banner, Harrison; Bhat, Venkataramana; Etchamendy, Nicole; Joober, Ridha; Bohbot, Véronique D

2011-01-01

Multiple memory systems are involved in parallel processing of spatial information during navigation. A series of studies have distinguished between hippocampus-dependent ‘spatial’ navigation, which relies on knowledge of the relationship between landmarks in one’s environment to build a cognitive map, and habit-based ‘response’ learning, which requires the memorization of a series of actions and is mediated by the caudate nucleus. Studies have demonstrated that people spontaneously use one of these two alternative navigational strategies with almost equal frequency to solve a given navigation task, and that strategy correlates with functional magnetic resonance imaging (fMRI) activity and grey matter density. Although there is evidence for experience modulating grey matter in the hippocampus, genetic contributions may also play an important role in the hippocampus and caudate nucleus. Recently, the Val66Met polymorphism of the brain-derived neurotrophic factor (BDNF) gene has emerged as a possible inhibitor of hippocampal function. We have investigated the role of the BDNF Val66Met polymorphism on virtual navigation behaviour and brain activation during an fMRI navigation task. Our results demonstrate a genetic contribution to spontaneous strategies, where ‘Met’ carriers use a response strategy more frequently than individuals homozygous for the ‘Val’ allele. Additionally, we found increased hippocampal activation in the Val group relative to the Met group during performance of a virtual navigation task. Our results support the idea that the BDNF gene with the Val66Met polymorphism is a novel candidate gene involved in determining spontaneous strategies during navigation behaviour. PMID:21255124

Influence of angiotensin converting enzyme (ACE) gene rs4362 polymorphism on the progression of kidney failure in patients with autosomal dominant polycystic kidney disease (ADPKD).

PubMed

Ramanathan, Gnanasambandan; Ghosh, Santu; Elumalai, Ramprasad; Periyasamy, Soundararajan; Lakkakula, Bhaskar V K S

2016-06-01

Autosomal dominant polycystic kidney disease (ADPKD) is an inherited systemic disorder, characterized by the fluid filled cysts in the kidneys leading to end stage renal failure in later years of life. Hypertension is one of the major factors independently contributing to the chronic kidney disease (CKD) progression. The renin-angiotensin aldosterone system (RAAS) genes have been extensively studied as hypertension candidate genes. The aim of the present study was to investigate the role of angiotensin converting enzyme tagging - single nucleotide polymorphisms (ACE tag-SNPs) in progression of CKD in patients with ADPKD. m0 ethods: In the present study six ACE tagSNPs (angiotensin converting enzyme tag single nucleotide polymorphisms) and insertion/deletion (I/D) in 102 ADPKD patients and 106 control subjects were investigated. The tagSNPs were genotyped using FRET-based KASPar method and ACE ID by polymerase chain reaction (PCR) and electrophoresis. Genotypes and haplotypes were compared between ADPKD patients and controls. Univariate and multivariate logistic regression analyses were performed to assess the effect of genotypes and hypertension on CKD advancement. Mantel-Haenszel (M-H) stratified analysis was performed to study the relationship between different CKD stages and hypertension and their interaction. All loci were polymorphic and except rs4293 SNP the remaining loci followed Hardy-Weinberg equilibrium. Distribution of ACE genotypes and haplotypes in controls and ADPKD patients was not significant. A significant linkage disequilibrium (LD) was observed between SNPs forming two LD blocks. The univariate analysis revealed that the age, hypertension, family history of diabetes and ACE rs4362 contributed to the advancement of CKD. The results suggest that the ACE genotypes are effect modifiers of the relationship between hypertension and CKD advancement among the ADPKD patients.

Parsing the genetic heterogeneity of chromosome 12q susceptibility genes for Alzheimer disease by family-based association analysis.

PubMed

Lin, Ping-I; Martin, Eden R; Browning-Large, Carrie A; Schmechel, Donald E; Welsh-Bohmer, Kathleen A; Doraiswamy, P Murali; Gilbert, John R; Haines, Jonathan L; Pericak-Vance, Margaret A

2006-07-01

Previous linkage studies have suggested that chromosome 12 may harbor susceptibility genes for late-onset Alzheimer disease (LOAD). No risk genes on chromosome 12 have been conclusively identified yet. We have reported that the linkage evidence for LOAD in a 12q region was significantly increased in autopsy-confirmed families particularly for those showing no linkage to alpha-T catenin gene, a LOAD candidate gene on chromosome 10 [LOD score increased from 0.1 in the autopsy-confirmed subset to 4.19 in the unlinked subset (optimal subset); p<0.0001 for the increase in LOD score], indicating a one-LOD support interval spanning 6 Mb. To further investigate this finding and to identify potential candidate LOAD risk genes for follow-up analysis, we analyzed 99 single nucleotide polymorphisms in this region, for the overall sample, the autopsy-confirmed subset, and the optimal subset, respectively, for comparison. We saw no significant association (p<0.01) in the overall sample. In the autopsy-confirmed subset, the best finding was obtained in the activation transcription factor 7 (ATF7) gene (single-locus association, p=0.002; haplotype association global, p=0.007). In the optimal subset, the best finding was obtained in the hypothetical protein FLJ20436 (FLJ20436) gene (single-locus association, p=0.0026). These results suggest that subset and covariate analyses may be one approach to help identify novel susceptibility genes on chromosome 12q for LOAD.

Integrated pathway-based approach identifies association between genomic regions at CTCF and CACNB2 and schizophrenia.

PubMed

Juraeva, Dilafruz; Haenisch, Britta; Zapatka, Marc; Frank, Josef; Witt, Stephanie H; Mühleisen, Thomas W; Treutlein, Jens; Strohmaier, Jana; Meier, Sandra; Degenhardt, Franziska; Giegling, Ina; Ripke, Stephan; Leber, Markus; Lange, Christoph; Schulze, Thomas G; Mössner, Rainald; Nenadic, Igor; Sauer, Heinrich; Rujescu, Dan; Maier, Wolfgang; Børglum, Anders; Ophoff, Roel; Cichon, Sven; Nöthen, Markus M; Rietschel, Marcella; Mattheisen, Manuel; Brors, Benedikt

2014-06-01

In the present study, an integrated hierarchical approach was applied to: (1) identify pathways associated with susceptibility to schizophrenia; (2) detect genes that may be potentially affected in these pathways since they contain an associated polymorphism; and (3) annotate the functional consequences of such single-nucleotide polymorphisms (SNPs) in the affected genes or their regulatory regions. The Global Test was applied to detect schizophrenia-associated pathways using discovery and replication datasets comprising 5,040 and 5,082 individuals of European ancestry, respectively. Information concerning functional gene-sets was retrieved from the Kyoto Encyclopedia of Genes and Genomes, Gene Ontology, and the Molecular Signatures Database. Fourteen of the gene-sets or pathways identified in the discovery dataset were confirmed in the replication dataset. These include functional processes involved in transcriptional regulation and gene expression, synapse organization, cell adhesion, and apoptosis. For two genes, i.e. CTCF and CACNB2, evidence for association with schizophrenia was available (at the gene-level) in both the discovery study and published data from the Psychiatric Genomics Consortium schizophrenia study. Furthermore, these genes mapped to four of the 14 presently identified pathways. Several of the SNPs assigned to CTCF and CACNB2 have potential functional consequences, and a gene in close proximity to CACNB2, i.e. ARL5B, was identified as a potential gene of interest. Application of the present hierarchical approach thus allowed: (1) identification of novel biological gene-sets or pathways with potential involvement in the etiology of schizophrenia, as well as replication of these findings in an independent cohort; (2) detection of genes of interest for future follow-up studies; and (3) the highlighting of novel genes in previously reported candidate regions for schizophrenia.

Missense mutation of the cholecystokinin B receptor gene: Lack of association with panic disorder

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kato, Tadafumi; Wang, Zhe Wu; Crowe, R.R.

1996-07-26

Cholecystokinin tetrapeptide (CCK{sub 4}) is known to induce panic attacks in patients with panic disorder at a lower dose than in normal controls. Therefore, the cholecystokinin B (CCK{sub B}) receptor gene is a candidate gene for panic disorder. We searched for mutations in the CCK{sub B} gene in 22 probands of panic disorder pedigrees, using single-strand conformation polymorphism (SSCP) analysis. Two polymorphisms were detected. A polymorphism in an intron (2491 C{yields}A) between exons 4 and 5 was observed in 10 of 22 probands. A missense mutation in the extracellular loop of exon 2 (1550 G{yields}A, Val{sup 125}{yields}Ile) was found inmore » only one proband. This mutation was also examined in additional 34 unrelated patients with panic disorder and 112 controls. The prevalence rate of this mutation was 8.8% in patients with panic disorder (3/34) and 4.4% in controls (5/112). The mutation did not segregate with panic disorder in two families where this could be tested. These results suggest no pathophysiological significance of this mutation in panic disorder. 21 refs., 4 figs., 1 tab.« less

Addictive genes and the relationship to obesity and inflammation.

PubMed

Heber, David; Carpenter, Catherine L

2011-10-01

There is increasing evidence that the same brain reward circuits involved in perpetuating drug abuse are involved in the hedonic urges and food cravings observed clinically in overweight and obese subjects. A polymorphism of the D2 dopamine receptor which renders it less sensitive to dopamine stimulation has been proposed to promote self-stimulatory behavior such as consuming alcohol, abusing drugs, or binging on foods. It is important to determine how this polymorphism may interact with other well-known candidate genes for obesity including polymorphisms of the leptin receptor gene and the opiomelanocortin gene. Leptin is a proinflammatory cytokine as well as a long-term signal maintaining body fat. Upper-body obesity stimulates systemic inflammation through the action of multiple cytokines including leptin throughout many organs including the brain. The association of numerous diseases including diabetes mellitus, heart disease, as well as depression with chronic low-grade inflammation due to abdominal obesity has raised the possibility that obesity-associated inflammation affecting the brain may promote addictive behaviors leading to a self-perpetuating cycle that may affect not only foods but addictions to drugs, alcohol, and gambling. This new area of interdisciplinary research holds the promise of developing new approaches to treating drug abuse and obesity.

Identification of a psoriasis susceptibility candidate gene by linkage disequilibrium mapping with a localized single nucleotide polymorphism map.

PubMed

Hewett, Duncan; Samuelsson, Lena; Polding, Joanne; Enlund, Fredrik; Smart, Devi; Cantone, Kathryn; See, Chee Gee; Chadha, Sapna; Inerot, Annica; Enerback, Charlotta; Montgomery, Doug; Christodolou, Chris; Robinson, Phil; Matthews, Paul; Plumpton, Mary; Wahlstrom, Jan; Swanbeck, Gunnar; Martinsson, Tommy; Roses, Allen; Riley, John; Purvis, Ian

2002-03-01

Psoriasis is a chronic inflammatory disease of the skin with both genetic and environmental risk factors. Here we describe the creation of a single-nucleotide polymorphism (SNP) map spanning 900-1200 kb of chromosome 3q21, which had been previously recognized as containing a psoriasis susceptibility locus, PSORS5. We genotyped 644 individuals, from 195 Swedish psoriatic families, for 19 polymorphisms. Linkage disequilibrium (LD) between marker and disease was assessed using the transmission/disequilibrium test (TDT). In the TDT analysis, alleles of three of these SNPs showed significant association with disease (P<0.05). A 160-kb interval encompassing these three SNPs was sequenced, and a coding sequence consisting of 13 exons was identified. The predicted protein shares 30-40% homology with the family of cation/chloride cotransporters. A five-marker haplotype spanning the 3' half of this gene is associated with psoriasis to a P value of 3.8<10(-5). We have called this gene SLC12A8, coding for a member of the solute carrier family 12 proteins. It belongs to a class of genes that were previously unrecognized as playing a role in psoriasis pathogenesis.

DNA methylation polymorphism in flue-cured tobacco and candidate markers for tobacco mosaic virus resistance*

PubMed Central

Zhao, Jie-hong; Zhang, Ji-shun; Wang, Yi; Wang, Ren-gang; Wu, Chun; Fan, Long-jiang; Ren, Xue-liang

2011-01-01

DNA methylation plays an important role in the epigenetic regulation of gene expression during plant growth, development, and polyploidization. However, there is still no distinct evidence in tobacco regarding the distribution of the methylation pattern and whether it contributes to qualitative characteristics. We studied the levels and patterns of methylation polymorphism at CCGG sites in 48 accessions of allotetraploid flue-cured tobacco, Nicotiana tabacum, using a methylation-sensitive amplified polymorphism (MSAP) technique. The results showed that methylation existed at a high level among tobacco accessions, among which 49.3% sites were methylated and 69.9% allelic sites were polymorphic. A cluster analysis revealed distinct patterns of geography-specific groups. In addition, three polymorphic sites significantly related to tobacco mosaic virus (TMV) resistance were explored. This suggests that tobacco breeders should pay more attention to epigenetic traits. PMID:22042659

Neutral mutation as the source of genetic variation in life history traits.

PubMed

Brcić-Kostić, Krunoslav

2005-08-01

The mechanism underlying the maintenance of adaptive genetic variation is a long-standing question in evolutionary genetics. There are two concepts (mutation-selection balance and balancing selection) which are based on the phenotypic differences between alleles. Mutation - selection balance and balancing selection cannot properly explain the process of gene substitution, i.e. the molecular evolution of quantitative trait loci affecting fitness. I assume that such loci have non-essential functions (small effects on fitness), and that they have the potential to evolve into new functions and acquire new adaptations. Here I show that a high amount of neutral polymorphism at these loci can exist in real populations. Consistent with this, I propose a hypothesis for the maintenance of genetic variation in life history traits which can be efficient for the fixation of alleles with very small selective advantage. The hypothesis is based on neutral polymorphism at quantitative trait loci and both neutral and adaptive gene substitutions. The model of neutral - adaptive conversion (NAC) assumes that neutral alleles are not neutral indefinitely, and that in specific and very rare situations phenotypic (relative fitness) differences between them can appear. In this paper I focus on NAC due to phenotypic plasticity of neutral alleles. The important evolutionary consequence of NAC could be the increased adaptive potential of a population. Loci responsible for adaptation should be fast evolving genes with minimally discernible phenotypic effects, and the recent discovery of genes with such characteristics implicates them as suitable candidates for loci involved in adaptation.

Dopa decarboxylase (Ddc) affects variation in Drosophila longevity.

PubMed

De Luca, Maria; Roshina, Nataliya V; Geiger-Thornsberry, Gretchen L; Lyman, Richard F; Pasyukova, Elena G; Mackay, Trudy F C

2003-08-01

Mutational analyses in model organisms have shown that genes affecting metabolism and stress resistance regulate life span, but the genes responsible for variation in longevity in natural populations are largely unidentified. Previously, we mapped quantitative trait loci (QTLs) affecting variation in longevity between two Drosophila melanogaster strains. Here, we show that the longevity QTL in the 36E;38B cytogenetic interval on chromosome 2 contains multiple closely linked QTLs, including the Dopa decarboxylase (Ddc) locus. Complementation tests to mutations show that Ddc is a positional candidate gene for life span in these strains. Linkage disequilibrium (LD) mapping in a sample of 173 alleles from a single population shows that three common molecular polymorphisms in Ddc account for 15.5% of the genetic contribution to variance in life span from chromosome 2. The polymorphisms are in strong LD, and the effects of the haplotypes on longevity suggest that the polymorphisms are maintained by balancing selection. DDC catalyzes the final step in the synthesis of the neurotransmitters, dopamine and serotonin. Thus, these data implicate variation in the synthesis of bioamines as a factor contributing to natural variation in individual life span.

Novel approach of molecular genetic understanding of iridology: relationship between iris constitution and angiotensin converting enzyme gene polymorphism.

PubMed

Um, Jae-Young; An, Nyeon-Hyoung; Yang, Gui-Bi; Lee, Geon-Mok; Cho, Ju-Jang; Cho, Jae-Woon; Hwang, Woo-Jun; Chae, Han-Jung; Kim, Hyung-Ryong; Hong, Seung-Heon; Kim, Hyung-Min

2005-01-01

Iridology is the study of the iris of the eye to detect the conditions of the body and its organs, genetic strengths and weaknesses, etc. Although iridology is not widely used as a scientific tool for healthcare professionals to get to the source of people's health conditions, it has been used as a supplementary source to help the diagnosis of medical conditions by noting irregularities of the pigmentation in the iris among some Korean Oriental medical doctors. Angiotensin converting enzyme (ACE) gene polymorphism is one of the most well studied genetic markers of vascular disease. We investigated the relationship between iridological constitution and ACE polymorphism in hypertensives. We classified 87 hypertensives and 79 controls according to iris constitution and determined the ACE genotype of each individual. DD genotype was more prevalent in patients with a neurogenic constitution than in controls. This finding supports the hypothesis that D allele is a candidate gene for hypertension and demonstrates the association among ACE genotype, Korean hypertensives and iris constitution.

Candidate gene study of genetic thrombophilic polymorphisms in pre-eclampsia and recurrent pregnancy loss in Sinhalese women.

PubMed

Dissanayake, Vajira H W; Sirisena, Nirmala D; Weerasekera, Lakshini Y; Gammulla, Chumithri G; Seneviratne, Harshalal R; Jayasekara, Rohan W

2012-09-01

Genetic thrombophilias are known to contribute to adverse pregnancy outcomes. Studies in Western populations show that 5, 10-methylenetetrahydrofolate reductase (MTHFR) 677C>T and Factor V (F5) 1691G>A (Leiden) polymorphisms are commonly associated with pre-eclampsia and recurrent spontaneous pregnancy loss. The objective of this study was to investigate the association of MTHFR 677C>T (rs1801133); 1298A>C (rs1801131) and F5 1691G>A (rs6025); 4070A>G (rs1800595) polymorphisms with pre-eclampsia and recurrent pregnancy loss among Sinhalese women in Sri Lanka. Genotype and allele frequencies at each polymorphic site in the MTHFR and F5 genes and the haplotypes defined by them were determined in 175 Sinhalese women with pre-eclampsia, 171 normotensive controls, 200 Sinhalese women with two or more recurrent pregnancy losses and 200 controls with two or more living children and no pregnancy losses. Genotyping was done by polymerase chain reaction/restriction fragment length polymorphism. Odds ratios and χ(2) -testing were performed to compare genotype/haplotype frequencies at each polymorphic site for both cases and controls. The genotype frequencies at each polymorphic site in the MTHFR 677C>T; 1298A>C; F5 1691G>A and 4070A>G genes and the haplotypes defined by them were not significantly associated with either pre-eclampsia or recurrent pregnancy loss. There was no significant association of genetic thrombophilia with either early or late pregnancy losses. The MTHFR and F5 polymorphisms and the haplotypes defined by them were not significantly associated with either pre-eclampsia or recurrent pregnancy loss in this group of Sinhalese women. © 2012 The Authors. Journal of Obstetrics and Gynaecology Research © 2012 Japan Society of Obstetrics and Gynecology.

Novel candidate genes may be possible predisposing factors revealed by whole exome sequencing in familial esophageal squamous cell carcinoma.

PubMed

Forouzanfar, Narjes; Baranova, Ancha; Milanizadeh, Saman; Heravi-Moussavi, Alireza; Jebelli, Amir; Abbaszadegan, Mohammad Reza

2017-05-01

Esophageal squamous cell carcinoma is one of the deadliest of all the cancers. Its metastatic properties portend poor prognosis and high rate of recurrence. A more advanced method to identify new molecular biomarkers predicting disease prognosis can be whole exome sequencing. Here, we report the most effective genetic variants of the Notch signaling pathway in esophageal squamous cell carcinoma susceptibility by whole exome sequencing. We analyzed nine probands in unrelated familial esophageal squamous cell carcinoma pedigrees to identify candidate genes. Genomic DNA was extracted and whole exome sequencing performed to generate information about genetic variants in the coding regions. Bioinformatics software applications were utilized to exploit statistical algorithms to demonstrate protein structure and variants conservation. Polymorphic regions were excluded by false-positive investigations. Gene-gene interactions were analyzed for Notch signaling pathway candidates. We identified novel and damaging variants of the Notch signaling pathway through extensive pathway-oriented filtering and functional predictions, which led to the study of 27 candidate novel mutations in all nine patients. Detection of the trinucleotide repeat containing 6B gene mutation (a slice site alteration) in five of the nine probands, but not in any of the healthy samples, suggested that it may be a susceptibility factor for familial esophageal squamous cell carcinoma. Noticeably, 8 of 27 novel candidate gene mutations (e.g. epidermal growth factor, signal transducer and activator of transcription 3, MET) act in a cascade leading to cell survival and proliferation. Our results suggest that the trinucleotide repeat containing 6B mutation may be a candidate predisposing gene in esophageal squamous cell carcinoma. In addition, some of the Notch signaling pathway genetic mutations may act as key contributors to esophageal squamous cell carcinoma.

Polymorphisms in HLA-DPB1 Are Associated With Differences in Rubella Virus–Specific Humoral Immunity After Vaccination

PubMed Central

Lambert, Nathaniel D.; Haralambieva, Iana H.; Kennedy, Richard B.; Ovsyannikova, Inna G.; Pankratz, Vernon Shane; Poland, Gregory A.

2015-01-01

Vaccination with live attenuated rubella virus induces a strong immune response in most individuals. However, small numbers of subjects never reach or maintain protective antibody levels, and there is a high degree of variability in immune response. We have previously described genetic polymorphisms in HLA and other candidate genes that are associated with interindividual differences in humoral immunity to rubella virus. To expand our previous work, we performed a genome-wide association study (GWAS) to discover single-nucleotide polymorphisms (SNPs) associated with rubella virus–specific neutralizing antibodies. We identified rs2064479 in the HLA-DPB1 genetic region as being significantly associated with humoral immune response variations after rubella vaccination (P = 8.62 × 10−8). All other significant SNPs in this GWAS were located near the HLA-DPB1 gene (P ≤ 1 × 10−7). These findings demonstrate that polymorphisms in HLA-DPB1 are strongly associated with interindividual differences in neutralizing antibody levels to rubella vaccination and represent a validation of our previous HLA work. PMID:25293367

Analysis of the porcine APOA2 gene expression in liver, polymorphism identification and association with fatty acid composition traits.

PubMed

Ballester, M; Revilla, M; Puig-Oliveras, A; Marchesi, J A P; Castelló, A; Corominas, J; Fernández, A I; Folch, J M

2016-10-01

APOA2 is a protein implicated in triglyceride, fatty acid and glucose metabolism. In pigs, the APOA2 gene is located on pig chromosome 4 (SSC4) in a QTL region affecting fatty acid composition, fatness and growth traits. In this study, we evaluated APOA2 as a candidate gene for meat quality traits in an Iberian × Landrace backcross population. The APOA2:c.131T>A polymorphism, located in exon 3 of APOA2 and determining a missense mutation, was associated with the percentage of hexadecenoic acid [C16:1(n-9)], linoleic acid [C18:2(n-6)], α-linolenic acid [C18:3(n-3)], dihomo-gamma-linolenic acid [C20:3(n-6)] and polyunsaturated fatty acids (PUFAs) in backfat. Furthermore, this SNP was associated with the global mRNA expression levels of APOA2 in liver and was used as a marker to determine allelic expression imbalance by pyrosequencing. We determined an overexpression of the T allele in heterozygous samples with a mean ratio of 2.8 (T/A), observing a high variability in the allelic expression among individuals. This result suggests that complex regulatory mechanisms, beyond a single polymorphism (e.g. epigenetic effects or multiple cis-acting polymorphisms), may be regulating APOA2 gene expression. © 2016 Stichting International Foundation for Animal Genetics.

Productive performance of the dairy cattle Girolando breed mediated by the fat-related genes DGAT1 and LEP and their polymorphisms.

PubMed

Cardoso, S R; Queiroz, L B; Goulart, V Alonso; Mourão, G B; Benedetti, E; Goulart, L R

2011-12-01

Candidate genes have been associated with milk production in bovines, such as the diacylglycerol O-acyltransferase 1 (DGAT1) and leptin (LEP); however, they have not been simultaneously investigated nor have been evaluated in the Brazilian Girolando breed (Gir×Holstein, backcrossed to Holstein). Our aim was to determine the influence of fat-related genes, DGAT1 and LEP, and their polymorphisms on performance traits of milk production in the Girolando breed. Results indicated that the K allele of the DGAT1 gene showed a significant association with total and average daily milk production with additive effect. The LEP gene showed that the A allele and its homozygote are highly prevalent and almost fixed in this population and may have been favorably selected during backcrossing for the origin of this breed. The important impact of the K allele of the DGAT1 gene on milk production corroborates the initiative of performing marker-assisted selections with this gene in breeding programs of the Girolando breed. Copyright © 2011 Elsevier Ltd. All rights reserved.

Antioxidant Defense Enzyme Genes and Asthma Susceptibility: Gender-Specific Effects and Heterogeneity in Gene-Gene Interactions between Pathogenetic Variants of the Disease

PubMed Central

Polonikov, Alexey V.; Ivanov, Vladimir P.; Bogomazov, Alexey D.; Freidin, Maxim B.; Illig, Thomas; Solodilova, Maria A.

2014-01-01

Oxidative stress resulting from an increased amount of reactive oxygen species and an imbalance between oxidants and antioxidants plays an important role in the pathogenesis of asthma. The present study tested the hypothesis that genetic susceptibility to allergic and nonallergic variants of asthma is determined by complex interactions between genes encoding antioxidant defense enzymes (ADE). We carried out a comprehensive analysis of the associations between adult asthma and 46 single nucleotide polymorphisms of 34 ADE genes and 12 other candidate genes of asthma in Russian population using set association analysis and multifactor dimensionality reduction approaches. We found for the first time epistatic interactions between ADE genes underlying asthma susceptibility and the genetic heterogeneity between allergic and nonallergic variants of the disease. We identified GSR (glutathione reductase) and PON2 (paraoxonase 2) as novel candidate genes for asthma susceptibility. We observed gender-specific effects of ADE genes on the risk of asthma. The results of the study demonstrate complexity and diversity of interactions between genes involved in oxidative stress underlying susceptibility to allergic and nonallergic asthma. PMID:24895604

Investigating the genetic basis of theory of mind (ToM): the role of catechol-O-methyltransferase (COMT) gene polymorphisms.

PubMed

Xia, Haiwei; Wu, Nan; Su, Yanjie

2012-01-01

The ability to deduce other persons' mental states and emotions which has been termed 'theory of mind (ToM)' is highly heritable. First molecular genetic studies focused on some dopamine-related genes, while the genetic basis underlying different components of ToM (affective ToM and cognitive ToM) remain unknown. The current study tested 7 candidate polymorphisms (rs4680, rs4633, rs2020917, rs2239393, rs737865, rs174699 and rs59938883) on the catechol-O-methyltransferase (COMT) gene. We investigated how these polymorphisms relate to different components of ToM. 101 adults participated in our study; all were genetically unrelated, non-clinical and healthy Chinese subjects. Different ToM tasks were applied to detect their theory of mind ability. The results showed that the COMT gene rs2020917 and rs737865 SNPs were associated with cognitive ToM performance, while the COMT gene rs5993883 SNP was related to affective ToM, in which a significant gender-genotype interaction was found (p = 0.039). Our results highlighted the contribution of DA-related COMT gene on ToM performance. Moreover, we found out that the different SNP at the same gene relates to the discriminative aspect of ToM. Our research provides some preliminary evidence to the genetic basis of theory of mind which still awaits further studies.

Genomic Analysis of Differentiation between Soil Types Reveals Candidate Genes for Local Adaptation in Arabidopsis lyrata

PubMed Central

Turner, Thomas L.; von Wettberg, Eric J.; Nuzhdin, Sergey V.

2008-01-01

Serpentine soil, which is naturally high in heavy metal content and has low calcium to magnesium ratios, comprises a difficult environment for most plants. An impressive number of species are endemic to serpentine, and a wide range of non-endemic plant taxa have been shown to be locally adapted to these soils. Locating genomic polymorphisms which are differentiated between serpentine and non-serpentine populations would provide candidate loci for serpentine adaptation. We have used the Arabidopsis thaliana tiling array, which has 2.85 million probes throughout the genome, to measure genetic differentiation between populations of Arabidopsis lyrata growing on granitic soils and those growing on serpentinic soils. The significant overrepresentation of genes involved in ion transport and other functions provides a starting point for investigating the molecular basis of adaptation to soil ion content, water retention, and other ecologically and economically important variables. One gene in particular, calcium-exchanger 7, appears to be an excellent candidate gene for adaptation to low Ca∶Mg ratio in A. lyrata. PMID:18784841

A comparative analysis of MC4R gene sequence, polymorphism, and chromosomal localization in Chinese raccoon dog and Arctic fox.

PubMed

Skorczyk, Anna; Flisikowski, Krzysztof; Switonski, Marek

2012-05-01

Numerous mutations of the human melanocortin receptor type 4 (MC4R) gene are responsible for monogenic obesity, and some of them appear to be associated with predisposition or resistance to polygenic obesity. Thus, this gene is considered a functional candidate for fat tissue accumulation and body weight in domestic mammals. The aim of the study was comparative analysis of chromosome localization, nucleotide sequence, and polymorphism of the MC4R gene in two farmed species of the Canidae family, namely the Chinese raccoon dog (Nycterutes procyonoides procyonoides) and the arctic fox (Alopex lagopus). The whole coding sequence, including fragments of 3'UTR and 5'UTR, shows 89% similarity between the arctic fox (1276 bp) and Chinese raccoon dog (1213 bp). Altogether, 30 farmed Chinese raccoon dogs and 30 farmed arctic foxes were searched for polymorphisms. In the Chinese raccoon dog, only one silent substitution in the coding sequence was identified; whereas in the arctic fox, four InDels and two single-nucleotide polymorphisms (SNPs) in the 5'UTR and six silent SNPs in the exon were found. The studied gene was mapped by FISH to the Chinese raccoon dog chromosome 9 (NPP9q1.2) and arctic fox chromosome 24 (ALA24q1.2-1.3). The obtained results are discussed in terms of genome evolution of species belonging to the family Canidae and their potential use in animal breeding.

Neuropsychiatric Genetics of Happiness, Friendships, and Politics: Hypothesizing Homophily (“Birds of a Feather Flock Together”) as a Function of Reward Gene Polymorphisms

PubMed Central

Blum, Kenneth; Oscar-Berman, Marlene; Bowirrat, Abdalla; Giordano, John; Madigan, Margaret; Braverman, Eric R.; Barh, Debmayla; Hauser, Mary; Borsten, Joan; Simpatico, Thomas

2013-01-01

Mindful of the new evolutionary ideas related to an emerging scientific focus known as omics, we propose that spiritual, social, and political behaviors may be tied in part to inheritable reward gene polymorphisms, as has been demonstrated for the addictions. If so, analyses of gene polymorphisms may assist in predicting liberalism or conservatism in partisan attachments. For example, both drinking (alcohol) and obesity seem to cluster in large social networks and are influenced by friends having the same genotype, in particular the DRD2 A1 allele. Likewise, voting, voting turnout and attachment to a particular political ideology is differentially related to various reward genes (e.g., 5HTT, MOA, DRD2, and DRD4), possibly predicting liberalism or conservatism. Moreover, voters’ genetic information may predict presidential outcomes more than the actual issues at hand or the presidential candidates themselves. Thus, political discussions on TV, radio, or other media may be morphed by one’s reward gene polymorphisms and as such, may explain the prevalence of generations of die-hard republicans and equally entrenched democratic legacies. Indeed, even in politics, birds of a feather (homophily) flock together. We caution that our proposal should be viewed mindfully awaiting additional research before definitive statements or conclusions can be derived from the studies to date, and we encourage large scale studies to confirm these earlier reports. PMID:23336089

Automatic approach-avoidance tendencies as a candidate intermediate phenotype for depression: Associations with childhood trauma and the 5-HTTLPR transporter polymorphism

PubMed Central

van Minnen, Agnes; Becker, Eni S.; van Oostrom, Iris; Speckens, Anne; Rinck, Mike; Vrijsen, Janna N.

2018-01-01

Depression risk genes in combination with childhood events have been associated with biased processing as an intermediate phenotype for depression. The aim of the present conceptual replication study was to investigate the role of biased automatic approach-avoidance tendencies as a candidate intermediate phenotype for depression, in the context of genes (5-HTTLPR polymorphism) and childhood trauma. A naturalistic remitted depressed patients sample (N = 209) performed an Approach-Avoidance Task (AAT) with facial expressions (angry, sad, happy and neutral). Childhood trauma was assessed with a questionnaire. Genotype groups were created based on allele frequency: LaLa versus S/Lg-carriers. The latter is associated with depression risk. We found that remitted S/Lg-carriers who experienced childhood trauma automatically avoided sad facial expressions relatively more than LaLa homozygotes with childhood trauma. Remitted LaLa-carriers who had not experienced childhood trauma, avoided sad faces relatively more than LaLa homozygotes with childhood trauma. We did not find a main effect of childhood trauma, nor differential avoidance of any of the other facial expressions. Although tentative, the results suggest that automatic approach-avoidance tendencies for disorder-congruent materials may be a fitting intermediate phenotype for depression. The specific pattern of tendencies, and the relation to depression, may depend on the genetic risk profile and childhood trauma, but replication is needed before firm conclusions can be drawn. PMID:29547643

[Linkage analysis of a family with familial hypertriglyceridemia].

PubMed

Tang, Xin; Lin, Ying; Liu, Bing; Ma, Shi; Yang, Yang; Yang, Zheng-lin

2009-10-01

To perform linkage analysis and mutation screening in a Chinese family with familial hpertriglyceridemia (FHTG). Thirty-two family members including 12 hypertriglyceridemia patients participated in the study. Genotyping and haplotype analysis for 22 subjects were performed using short tandem repeat (STR) microsatellite polymorphism markers on 16 candidate genes and/or loci related to lipid metabolism. Two of the sixteen known candidate genes, APOA2 and USF1 were screened for mutation by direct DNA sequencing. No linkage was found between the candidate genes/loci of APOA5, LIPI, RP1, APOC2, ABC1, LMF1, APOA1-APOC3-APOA4, LPL, APOB, CETP, LCAT, LDLR, APOE and the phenotype in this family. The two-point Lod scores (theta =0) were all less than-1.0 for all the markers tested. Linkage analysis suggested linkage to chromosome 1q23.3-24.2 between the disease phenotype and STR marker D1S194 with a two-point maximum Lod score of 2.44 at theta =0. Fine mapping indicated that the disease gene was localized to a 5.87 cM interval between D1S104 and D1S196. No disease-causing mutation was detected in the APOA2 and USF1 genes. The above mentioned candidate genes were excluded as the disease causing genes for this family. The results implied that there might be a novel gene/locus for FHTG on chromosome 1q23.3-1q24.2.

Allelism analysis of BrRfp locus in different restorer lines and map-based cloning of a fertility restorer gene, BrRfp1, for pol CMS in Chinese cabbage (Brassica rapa L.).

PubMed

Zhang, Huamin; Wu, Junqing; Dai, Zihui; Qin, Meiling; Hao, Lingyu; Ren, Yanjing; Li, Qingfei; Zhang, Lugang

2017-03-01

In Chinese cabbage, there are two Rf loci for pol CMS and one of them was mapped to a 12.6-kb region containing a potential candidate gene encoding PPR protein. In Chinese cabbage (Brassica rapa), polima cytoplasmic male sterility (pol CMS) is an important CMS type and is widely used for hybrid breeding. By extensive test crossing in Chinese cabbage, four restorer lines (92s105, 01s325, 00s109, and 88s148) for pol CMS were screened. By analyzing the allelism of the four restorer lines, it was found that 92s105, 01s325, and 00s109 had the same "restorers of fertility" (Rf) locus (designated as BrRfp1), but 88s148 had a different Rf locus (designated as BrRfp2). For fine mapping the BrRfp1 locus of 92s105, a BC 1 F 1 population with 487 individuals and a BC 1 F 2 population with 2485 individuals were successively constructed. Using simple sequence repeat (SSR) markers developed from Brassica rapa reference genome and InDel markers derived from whole-genome resequencing data of 94c9 and 92s105, BrRfp1 was mapped to a 12.6-kb region containing a potential candidate gene encoding pentatricopeptide repeat-containing protein. Based on the nucleotide polymorphisms of the candidate gene sequence between the restoring and nonrestoring alleles, a co-segregating marker SC718 was developed, which would be helpful for hybrid breeding by marker-assisted screening and for detecting new restorer lines.

Associations between single nucleotide polymorphisms in multiple candidate genes and body weight in rabbits

PubMed Central

El-Sabrout, Karim; Aggag, Sarah A.

2017-01-01

Aim: In this study, we examined parts of six growth genes (growth hormone [GH], melanocortin 4 receptor [MC4R], growth hormone receptor [GHR], phosphorglycerate mutase [PGAM], myostatin [MSTN], and fibroblast growth factor [FGF]) as specific primers for two rabbit lines (V-line, Alexandria) using nucleotide sequence analysis, to investigate association between detecting single nucleotide polymorphism (SNP) of these genes and body weight (BW) at market. Materials and Methods: Each line kits were grouped into high and low weight rabbits to identify DNA markers useful for association studies with high BW. DNA from blood samples of each group was extracted to amplify the six growth genes. SNP technique was used to study the associate polymorphism in the six growth genes and marketing BW (at 63 days) in the two rabbit lines. The purified polymerase chain reaction products were sequenced in those had the highest and lowest BW in each line. Results: Alignment of sequence data from each group revealed the following SNPs: At nucleotide 23 (A-C) and nucleotide 35 (T-G) in MC4R gene (sense mutation) of Alexandria and V-line high BW. Furthermore, we detected the following SNPs variation between the two lines: A SNP (T-C) at nucleotide 27 was identified by MC4R gene (sense mutation) and another one (A-C) at nucleotide 14 was identified by GHR gene (nonsense mutation) of Alexandria line. The results of individual BW at market (63 days) indicated that Alexandria rabbits had significantly higher BW compared with V-line rabbits. MC4R polymorphism showed significant association with high BW in rabbits. Conclusion: The results of polymorphism demonstrate the possibility to detect an association between BW in rabbits and the efficiency of the used primers to predict through the genetic specificity using the SNP of MC4R. PMID:28246458

Effects of BDNF polymorphisms on antidepressant action.

PubMed

Tsai, Shih-Jen; Hong, Chen-Jee; Liou, Ying-Jay

2010-12-01

Evidence suggests that the down-regulation of the signaling pathway involving brain-derived neurotrophic factor (BDNF), a molecular element known to regulate neuronal plasticity and survival, plays an important role in the pathogenesis of major depression. The restoration of BDNF activity induced by antidepressant treatment has been implicated in the antidepressant therapeutic mechanism. Because there is variability among patients with major depressive disorder in terms of response to antidepressant treatment and since genetic factors may contribute to this inter-individual variability in antidepressant response, pharmacogenetic studies have tested the associations between genetic polymorphisms in candidate genes related to antidepressant therapeutic action. In human BDNF gene, there is a common functional polymorphism (Val66Met) in the pro-region of BDNF, which affects the intracellular trafficking of proBDNF. Because of the potentially important role of BDNF in the antidepressant mechanism, many pharmacogenetic studies have tested the association between this polymorphism and the antidepressant therapeutic response, but they have produced inconsistent results. A recent meta-analysis of eight studies, which included data from 1,115 subjects, suggested that the Val/Met carriers have increased antidepressant response in comparison to Val/Val homozygotes, particularly in the Asian population. The positive molecular heterosis effect (subjects heterozygous for a specific genetic polymorphism show a significantly greater effect) is compatible with animal studies showing that, although BDNF exerts an antidepressant effect, too much BDNF may have a detrimental effect on mood. Several recommendations are proposed for future antidepressant pharmacogenetic studies of BDNF, including the consideration of multiple polymorphisms and a haplotype approach, gene-gene interaction, a single antidepressant regimen, controlling for age and gender interactions, and pharmacogenetic effects on specific depressive symptom-clusters.

Candidate Genes Involved in Beneficial or Adverse Responses to Commonly Eaten Brassica Vegetables in a New Zealand Crohn’s Disease Cohort

PubMed Central

Laing, Bobbi; Han, Dug Yeo; Ferguson, Lynnette R.

2013-01-01

Crohn’s disease (CD) is one of the two manifestations of inflammatory bowel disease. Particular foods are thought with CD to exacerbate their illness. Vegetables, especially Brassicaceae, are often shunned by people with CD because of the negative effects they are alleged to have on their symptoms. Brassicaceae supply key nutrients which are necessary to meet recommended daily intakes. We sought to identify the candidate genes involved in the beneficial or adverse effects of Brassicaceae most commonly eaten, as reported by the New Zealand adults from the “Genes and Diet in Inflammatory Bowel disease Study” based in Auckland. An analysis of associations between the single nucleotide polymorphisms (SNPs) and the beneficial or adverse effects of the ten most commonly eaten Brassicaceae was carried out. A total of 37 SNPs were significantly associated with beneficial effects (p = 0.00097 to 0.0497) and 64 SNPs were identified with adverse effects (p = 0.0000751 to 0.049). After correcting for multiple testing, rs7515322 (DIO1) and rs9469220 (HLA) remained significant. Our findings show that the tolerance of some varieties of Brassicaceae may be shown by analysis of a person’s genotype. PMID:24352087

Genetic Modifiers of Patent Ductus Arteriosus in Term Infants.

PubMed

Patel, Priti M; Momany, Allison M; Schaa, Kendra L; Romitti, Paul A; Druschel, Charlotte; Cooper, Margaret E; Marazita, Mary L; Murray, Jeffrey C; Dagle, John M

2016-09-01

To identify single-nucleotide polymorphisms (SNPs) in specific candidate genes associated with patent ductus arteriosus in term infants. We conducted an initial family-based, candidate gene study to analyze genotype data from DNA samples obtained from 171 term infants and their parents enrolled in the National Birth Defects Prevention Study (NBDPS). We performed transmission disequilibrium testing (TDT) using a panel of 55 SNPs in 17 genes. Replication of SNPs with P < .1 in the NBDPS trios was performed with a case-control strategy in an independent population. TDT analysis of the NBDPS trios resulted in 6 SNPs reaching the predetermined cutoff (P < .1) to be included in the replication study. These 6 SNPs were genotyped in the independent case-control population. A SNP in TGFBR2 was found to be associated with term patent ductus arteriosus in both populations after we corrected for multiple comparisons. (rs934328, TDT P = 2 × 10(-4), case-control P = 6.6 × 10(-5)). These findings confirm the importance of the transforming growth factor-beta pathway in the closure of the term ductus arteriosus and may suggest new therapeutic targets. Published by Elsevier Inc.

Meta-analysis of shared genetic architecture across ten pediatric autoimmune diseases

PubMed Central

Li, Yun R; Li, Jin; Zhao, Sihai D; Bradfield, Jonathan P; Mentch, Frank D; Maggadottir, S Melkorka; Hou, Cuiping; Abrams, Debra J; Chang, Diana; Gao, Feng; Guo, Yiran; Wei, Zhi; Connolly, John J; Cardinale, Christopher J; Bakay, Marina; Glessner, Joseph T; Li, Dong; Kao, Charlly; Thomas, Kelly A; Qiu, Haijun; Chiavacci, Rosetta M; Kim, Cecilia E; Wang, Fengxiang; Snyder, James; Richie, Marylyn D; Flatø, Berit; Førre, Øystein; Denson, Lee A; Thompson, Susan D; Becker, Mara L; Guthery, Stephen L; Latiano, Anna; Perez, Elena; Resnick, Elena; Russell, Richard K; Wilson, David C; Silverberg, Mark S; Annese, Vito; Lie, Benedicte A; Punaro, Marilynn; Dubinsky, Marla C; Monos, Dimitri S; Strisciuglio, Caterina; Staiano, Annamaria; Miele, Erasmo; Kugathasan, Subra; Ellis, Justine A; Munro, Jane E; Sullivan, Kathleen E; Wise, Carol A; Chapel, Helen; Cunningham-Rundles, Charlotte; Grant, Struan F A; Orange, Jordan S; Sleiman, Patrick M A; Behrens, Edward M; Griffiths, Anne M; Satsangi, Jack; Finkel, Terri H; Keinan, Alon; Prak, Eline T Luning; Polychronakos, Constantin; Baldassano, Robert N; Li, Hongzhe; Keating, Brendan J; Hakonarson, Hakon

2016-01-01

Genome-wide association studies (GWASs) have identified hundreds of susceptibility genes, including shared associations across clinically distinct autoimmune diseases. We performed an inverse χ2 meta-analysis across ten pediatric-age-of-onset autoimmune diseases (pAIDs) in a case-control study including more than 6,035 cases and 10,718 shared population-based controls. We identified 27 genome-wide significant loci associated with one or more pAIDs, mapping to in silico–replicated autoimmune-associated genes (including IL2RA) and new candidate loci with established immunoregulatory functions such as ADGRL2, TENM3, ANKRD30A, ADCY7 and CD40LG. The pAID-associated single-nucleotide polymorphisms (SNPs) were functionally enriched for deoxyribonuclease (DNase)-hypersensitivity sites, expression quantitative trait loci (eQTLs), microRNA (miRNA)-binding sites and coding variants. We also identified biologically correlated, pAID-associated candidate gene sets on the basis of immune cell expression profiling and found evidence of genetic sharing. Network and protein-interaction analyses demonstrated converging roles for the signaling pathways of type 1, 2 and 17 helper T cells (TH1, TH2 and TH17), JAK-STAT, interferon and interleukin in multiple autoimmune diseases. PMID:26301688

Investigating the genetics of Bti resistance using mRNA tag sequencing: application on laboratory strains and natural populations of the dengue vector Aedes aegypti

PubMed Central

Paris, Margot; Marcombe, Sebastien; Coissac, Eric; Corbel, Vincent; David, Jean-Philippe; Després, Laurence

2013-01-01

Mosquito control is often the main method used to reduce mosquito-transmitted diseases. In order to investigate the genetic basis of resistance to the bio-insecticide Bacillus thuringiensis subsp. israelensis (Bti), we used information on polymorphism obtained from cDNA tag sequences from pooled larvae of laboratory Bti-resistant and susceptible Aedes aegypti mosquito strains to identify and analyse 1520 single nucleotide polymorphisms (SNPs). Of the 372 SNPs tested, 99.2% were validated using DNA Illumina GoldenGate® array, with a strong correlation between the allelic frequencies inferred from the pooled and individual data (r = 0.85). A total of 11 genomic regions and five candidate genes were detected using a genome scan approach. One of these candidate genes showed significant departures from neutrality in the resistant strain at sequence level. Six natural populations from Martinique Island were sequenced for the 372 tested SNPs with a high transferability (87%), and association mapping analyses detected 14 loci associated with Bti resistance, including one located in a putative receptor for Cry11 toxins. Three of these loci were also significantly differentiated between the laboratory strains, suggesting that most of the genes associated with resistance might differ between the two environments. It also suggests that common selected regions might harbour key genes for Bti resistance. PMID:24187584

A few sequence polymorphisms among isolates of Maize bushy stunt phytoplasma associate with organ proliferation symptoms of infected maize plants

PubMed Central

Orlovskis, Zigmunds; Canale, Maria Cristina; Haryono, Mindia; Lopes, João Roberto Spotti

2017-01-01

Background and Aims Maize bushy stunt phytoplasma (MBSP) is a bacterial pathogen of maize (Zea mays L.) across Latin America. MBSP belongs to the 16SrI-B sub-group within the genus ‘Candidatus Phytoplasma’. MBSP and its insect vector Dalbulus maidis (Hemiptera: Cicadellidae) are restricted to maize; both are thought to have coevolved with maize during its domestication from a teosinte-like ancestor. MBSP-infected maize plants show a diversity of symptoms. and it is likely that MBSP is under strong selection for increased virulence and insect transmission on maize hybrids that are widely grown in Brazil. In this study it was investigated whether the differences in genome sequences of MBSP isolates from two maize-growing regions in South-east Brazil explain variations in symptom severity of the MBSP isolates on various maize genotypes. Methods MBSP isolates were collected from maize production fields in Guaíra and Piracicaba in South-east Brazil for infection assays. One representative isolate was chosen for de novo whole-genome assembly and for the alignment of sequence reads from the genomes of other phytoplasma isolates to detect polymorphisms. Statistical methods were applied to investigate the correlation between variations in disease symptoms of infected maize plants and MBSP sequence polymorphisms. Key Results MBSP isolates contributed consistently to organ proliferation symptoms and maize genotype to leaf necrosis, reddening and yellowing of infected maize plants. The symptom differences are associated with polymorphisms in a phase-variable lipoprotein, which is a candidate effector, and an ATP-dependent lipoprotein ABC export protein, whereas no polymorphisms were observed in other candidate effector genes. Lipoproteins and ABC export proteins activate host defence responses, regulate pathogen attachment to host cells and activate effector secretion systems in other pathogens. Conclusions Polymorphisms in two putative virulence genes among MBSP isolates from maize-growing regions in South-east Brazil are associated with variations in organ proliferation symptoms of MBSP-infected maize plants. PMID:28069632

Genetic Polymorphisms and Weight Loss in Obesity: A Randomised Trial of Hypo-Energetic High- versus Low-Fat Diets

PubMed Central

Sørensen, Thorkild I. A; Boutin, Philippe; Taylor, Moira A; Larsen, Lesli H; Verdich, Camilla; Petersen, Liselotte; Holst, Claus; Echwald, Søren M; Dina, Christian; Toubro, Søren; Petersen, Martin; Polak, Jan; Clément, Karine; Martínez, J. Alfredo; Langin, Dominique; Oppert, Jean-Michel; Stich, Vladimir; Macdonald, Ian; Arner, Peter; Saris, Wim H. M; Pedersen, Oluf; Astrup, Arne; Froguel, Philippe

2006-01-01

Objectives: To study if genes with common single nucleotide polymorphisms (SNPs) associated with obesity-related phenotypes influence weight loss (WL) in obese individuals treated by a hypo-energetic low-fat or high-fat diet. Design: Randomised, parallel, two-arm, open-label multi-centre trial. Setting: Eight clinical centres in seven European countries. Participants: 771 obese adult individuals. Interventions: 10-wk dietary intervention to hypo-energetic (−600 kcal/d) diets with a targeted fat energy of 20%–25% or 40%–45%, completed in 648 participants. Outcome Measures: WL during the 10 wk in relation to genotypes of 42 SNPs in 26 candidate genes, probably associated with hypothalamic regulation of appetite, efficiency of energy expenditure, regulation of adipocyte differentiation and function, lipid and glucose metabolism, or production of adipocytokines, determined in 642 participants. Results: Compared with the noncarriers of each of the SNPs, and after adjusting for gender, age, baseline weight and centre, heterozygotes showed WL differences that ranged from −0.6 to 0.8 kg, and homozygotes, from −0.7 to 3.1 kg. Genotype-dependent additional WL on low-fat diet ranged from 1.9 to −1.6 kg in heterozygotes, and from 3.8 kg to −2.1 kg in homozygotes relative to the noncarriers. Considering the multiple testing conducted, none of the associations was statistically significant. Conclusions: Polymorphisms in a panel of obesity-related candidate genes play a minor role, if any, in modulating weight changes induced by a moderate hypo-energetic low-fat or high-fat diet. PMID:16871334

Glutamate System Genes and Brain Volume Alterations in Pediatric Obsessive-Compulsive Disorder: A Preliminary Study

PubMed Central

Wu, Ke; Hanna, Gregory L.; Easter, Philip; Kennedy, James L.; Rosenberg, David R.; Arnold, Paul D

2012-01-01

Obsessive-compulsive disorder (OCD) has been associated with regional volumetric brain abnormalities, which provide promising intermediate phenotypes of the disorder. In this study, volumes of brain regions selected for a priori evidence of association with OCD (orbitofrontal cortex (OFC), anterior cingulate cortex (ACC), thalamus, caudate, putamen, globus pallidus and pituitary) were measured using structural magnetic resonance imaging (MRI) in 20 psychotropic-naïve pediatric OCD patients. We examined the association between these regional brain volumes and a total of 519 single nucleotide polymorphisms (SNPs) from nine glutamatergic candidate genes (DLGAP1, DLGAP2, DLGAP3, GRIN2B, SLC1A1, GRIK2, GRIK3, SLITRK1 and SLITRK5). These genes were selected based on either previous reported association with OCD in humans or evidence from animal models of OCD. After correcting for multiple comparisons by permutation testing, no SNP remained significantly associated with volumetric changes. The strongest trend toward association was identified between two SNPs in DLGAP2 (rs6558484 and rs7014992) and OFC white matter volume (P = 0.000565, Padjusted= 0.3071). Our other top ranked association findings were with ACC, OFC and thalamus. These preliminary results suggest that sequence variants in glutamate candidate genes may be associated with structural neuroimaging phenotypes of OCD. PMID:23154099

[Study of genetic variants in the BDNF, COMT, DAT1 and SERT genes in Colombian children with attention deficit disorder].

PubMed

Ortega-Rojas, Jenny; Arboleda-Bustos, Carlos E; Morales, Luis; Benítez, Bruno A; Beltrán, Diana; Izquierdo, Álvaro; Arboleda, Humberto; Vásquez, Rafael

Attention deficit and hyperactive disorder (ADHD) is highly prevalent among children in Bogota City. Both genetic and environmental factors play a very important role in the etiology of ADHD. However, to date few studies have addressed the association of genetic variants and ADHD in the Colombian population. To test the genetic association between polymorphisms in the DAT1, HTTLPR, COMT and BDNF genes and ADHD in a sample from Bogota City. We genotyped the most common polymorphisms in DAT1, SERT, COMT and BDNF genes associated with ADHD using conventional PCR followed by restriction fragment length polymorphism (RFLP) in 97 trios recruited in a medical center in Bogota. The transmission disequilibrium test (TDT) was used to determine the association between such genetic variants and ADHD. The TDT analysis showed that no individual allele of any variant studied has a preferential transmission. Our results suggest that the etiology of the ADHD may be complex and involves several genetic factors. Further studies in other candidate polymorphisms in a larger sample size will improve our knowledge of the ADHD in Colombian population. Copyright © 2016 Asociación Colombiana de Psiquiatría. Publicado por Elsevier España. All rights reserved.

Molecular basis of non-syndromic hypospadias: systematic mutation screening and genome-wide copy-number analysis of 62 patients.

PubMed

Kon, M; Suzuki, E; Dung, V C; Hasegawa, Y; Mitsui, T; Muroya, K; Ueoka, K; Igarashi, N; Nagasaki, K; Oto, Y; Hamajima, T; Yoshino, K; Igarashi, M; Kato-Fukui, Y; Nakabayashi, K; Hayashi, K; Hata, K; Matsubara, Y; Moriya, K; Ogata, T; Nonomura, K; Fukami, M

2015-03-01

What percentage of cases with non-syndromic hypospadias can be ascribed to mutations in known causative/candidate/susceptibility genes or submicroscopic copy-number variations (CNVs) in the genome? Monogenic and digenic mutations in known causative genes and cryptic CNVs account for >10% of cases with non-syndromic hypospadias. While known susceptibility polymorphisms appear to play a minor role in the development of this condition, further studies are required to validate this observation. Fifteen causative, three candidate, and 14 susceptible genes, and a few submicroscopic CNVs have been implicated in non-syndromic hypospadias. Systematic mutation screening and genome-wide copy-number analysis of 62 patients. The study group consisted of 57 Japanese and five Vietnamese patients with non-syndromic hypospadias. Systematic mutation screening was performed for 25 known causative/candidate/susceptibility genes using a next-generation sequencer. Functional consequences of nucleotide alterations were assessed by in silico assays. The frequencies of polymorphisms in the patient group were compared with those in the male general population. CNVs were analyzed by array-based comparative genomic hybridization and characterized by fluorescence in situ hybridization. Seven of 62 patients with anterior or posterior hypospadias carried putative pathogenic mutations, such as hemizygous mutations in AR, a heterozygous mutation in BNC2, and homozygous mutations in SRD5A2 and HSD3B2. Two of the seven patients had mutations in multiple genes. We did not find any rare polymorphisms that were abundant specifically in the patient group. One patient carried mosaic dicentric Y chromosome. The patient group consisted solely of Japanese and Vietnamese individuals and clinical and hormonal information of the patients remained rather fragmentary. In addition, mutation analysis focused on protein-altering substitutions. Our data provide evidence that pathogenic mutations can underlie both mild and severe hypospadias and that HSD3B2 mutations cause non-syndromic hypospadias as a sole clinical manifestation. Most importantly, this is the first report documenting possible oligogenicity of non-syndromic hypospadias. This study was funded by the Grant-in-Aid from the Ministry of Education, Culture, Sports, Science and Technology; by the Grant-in-Aid from the Japan Society for the Promotion of Science; by the Grants from the Ministry of Health, Labour and Welfare, from the National Center for Child Health and Development and from the Takeda Foundation. The authors have no competing interests to disclose. Not applicable. © The Author 2015. Published by Oxford University Press on behalf of the European Society of Human Reproduction and Embryology. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

Fine Mapping of a Clubroot Resistance Gene in Chinese Cabbage Using SNP Markers Identified from Bulked Segregant RNA Sequencing

PubMed Central

Huang, Zhen; Peng, Gary; Liu, Xunjia; Deora, Abhinandan; Falk, Kevin C.; Gossen, Bruce D.; McDonald, Mary R.; Yu, Fengqun

2017-01-01

Clubroot, caused by Plasmodiophora brassicae, is an important disease of canola (Brassica napus) in western Canada and worldwide. In this study, a clubroot resistance gene (Rcr2) was identified and fine mapped in Chinese cabbage cv. “Jazz” using single-nucleotide polymorphisms (SNP) markers identified from bulked segregant RNA sequencing (BSR-Seq) and molecular markers were developed for use in marker assisted selection. In total, 203.9 million raw reads were generated from one pooled resistant (R) and one pooled susceptible (S) sample, and >173,000 polymorphic SNP sites were identified between the R and S samples. One significant peak was observed between 22 and 26 Mb of chromosome A03, which had been predicted by BSR-Seq to contain the causal gene Rcr2. There were 490 polymorphic SNP sites identified in the region. A segregating population consisting of 675 plants was analyzed with 15 SNP sites in the region using the Kompetitive Allele Specific PCR method, and Rcr2 was fine mapped between two SNP markers, SNP_A03_32 and SNP_A03_67 with 0.1 and 0.3 cM from Rcr2, respectively. Five SNP markers co-segregated with Rcr2 in this region. Variants were identified in 14 of 36 genes annotated in the Rcr2 target region. The numbers of poly variants differed among the genes. Four genes encode TIR-NBS-LRR proteins and two of them Bra019410 and Bra019413, had high numbers of polymorphic variants and so are the most likely candidates of Rcr2. PMID:28894454

Polymorphism of BMP4 gene in Indian goat breeds differing in prolificacy.

PubMed

Sharma, Rekha; Ahlawat, Sonika; Maitra, A; Roy, Manoranjan; Mandakmale, S; Tantia, M S

2013-12-10

Bone morphogenetic proteins (BMPs) are members of the TGF-β (transforming growth factor-beta) superfamily, of which BMP4 is the most important due to its crucial role in follicular growth and differentiation, cumulus expansion and ovulation. Reproduction is a crucial trait in goat breeding and based on the important role of BMP4 gene in reproduction it was considered as a possible candidate gene for the prolificacy of goats. The objective of the present study was to detect polymorphism in intronic, exonic and 3' un-translated regions of BMP4 gene in Indian goats. Nine different goat breeds (Barbari, Beetal, Black Bengal, Malabari, Jakhrana (Twinning>40%), Osmanabadi, Sangamneri (Twinning 20-30%), Sirohi and Ganjam (Twinning<10%)) differing in prolificacy and geographic distribution were employed for polymorphism scanning. Cattle sequence (AC_000167.1) was used to design primers for the amplification of a targeted region followed by direct DNA sequencing to identify the genetic variations. Single nucleotide polymorphisms (SNPs) were not detected in exon 3, the intronic region and the 3' flanking region. A SNP (G1534A) was identified in exon 2. It was a non-synonymous mutation resulting in an arginine to lysine change in a corresponding protein sequence. G to A transition at the 1534 locus revealed two genotypes GG and GA in the nine investigated goat breeds. The GG genotype was predominant with a genotype frequency of 0.98. The GA genotype was present in the Black Bengal as well as Jakhrana breed with a genotype frequency of 0.02. A microsatellite was identified in the 3' flanking region, only 20 nucleotides downstream from the termination site of the coding region, as a short sequence with more than nineteen continuous and repeated CA dinucleotides. Since the gene is highly evolutionarily conserved, identification of a non-synonymous SNP (G1534A) in the coding region gains further importance. To our knowledge, this is the first report of a mutation in the coding region of the caprine BMP4 gene. But whether the reproduction trait of goat is associated with the BMP4 polymorphism, needs to be further defined by association studies in more populations so as to delineate an effect on it. © 2013 Elsevier B.V. All rights reserved.

Association study of serotonin transporter gene polymorphisms with obstructive sleep apnea syndrome in Chinese Han population.

PubMed

Yue, Weihua; Liu, Huiguo; Zhang, Jishui; Zhang, Xianghui; Wang, Xiaoping; Liu, Tieqiao; Liu, Pozi; Hao, Wei

2008-11-01

Since the serotonin (5-HT) is associated with circadian rhythm and breathing regulation, the serotonin transporter (5-HTT), which plays an important role in serotoninergic transmission, might be a strong candidate gene in the pathogenesis of obstructive sleep apnea syndrome (OSAS). To investigate the association of 5-HTT gene polymorphisms with OSAS and clinical characteristics. We genotyped the 5-HTT gene linked polymorphic region (5-HTTLPR) and a variable number of tandem repeats at intron 2 (STin2.VNTR) in 254 OSAS patients and 338 healthy controls in Chinese Han population. In total sample, the 10-repeat allele of STin2.VNTR was significantly associated with OSAS (P = 0.007, OR = 1.72, 95% CI = 1.15-2.58), but no association was found in 5-HTTLPR. In male subjects, both polymorphisms showed significant association with OSAS (Allele L: P = 0.005, OR = 1.44, 95% CI = 1.11 to 1.87; Allele 10: P = 0.002, OR= 1.94, 95% CI = 1.26 to 3.00). Two haplotypes, S-12 and L-10, constructed by the above polymorphisms also revealed significant associations with OSAS (global P-values were 0.020 for total sample and 0.0006 for male subjects, respectively). Male patients carrying the haplotype S-12 showed a significantly lower apnea / hypopnea index (AHI), depressive factor, plasma 5-HT level and 5-hydroxyindolacetic acid (5-HIAA) levels, but higher episodic memory, when compared with non-S-12 carriers (P < 0.05). However, no significant differences were found in excessive daytime sleepiness or other psychological function across haplotype carriers (P > 0.05). These findings support that 5-HTT gene may be involved in susceptibility to OSAS, especially with sex-dependent effect.

Development of Cymbidium ensifolium genic-SSR markers and their utility in genetic diversity and population structure analysis in cymbidiums.

PubMed

Li, Xiaobai; Jin, Feng; Jin, Liang; Jackson, Aaron; Huang, Cheng; Li, Kehu; Shu, Xiaoli

2014-12-05

Cymbidium is a genus of 68 species in the orchid family, with extremely high ornamental value. Marker-assisted selection has proven to be an effective strategy in accelerating plant breeding for many plant species. Analysis of cymbidiums genetic background by molecular markers can be of great value in assisting parental selection and breeding strategy design, however, in plants such as cymbidiums limited genomic resources exist. In order to obtain efficient markers, we deep sequenced the C. ensifolium transcriptome to identify simple sequence repeats derived from gene regions (genic-SSR). The 7,936 genic-SSR markers were identified. A total of 80 genic-SSRs were selected, and primers were designed according to their flanking sequences. Of the 80 genic-SSR primer sets, 62 were amplified in C. ensifolium successfully, and 55 showed polymorphism when cross-tested among 9 Cymbidium species comprising 59 accessions. Unigenes containing the 62 genic-SSRs were searched against Non-redundant (Nr), Gene Ontology database (GO), eukaryotic orthologous groups (KOGs) and Kyoto Encyclopedia of Genes and Genomes (KEGG) database. The search resulted in 53 matching Nr sequences, of which 39 had GO terms, 18 were assigned to KOGs, and 15 were annotated with KEGG. Genetic diversity and population structure were analyzed based on 55 polymorphic genic-SSR data among 59 accessions. The genetic distance averaged 0.3911, ranging from 0.016 to 0.618. The polymorphic index content (PIC) of 55 polymorphic markers averaged 0.407, ranging from 0.033 to 0.863. A model-based clustering analysis revealed that five genetic groups existed in the collection. Accessions from the same species were typically grouped together; however, C. goeringii accessions did not always form a separate cluster, suggesting that C. goeringii accessions were polyphyletic. The genic-SSR identified in this study constitute a set of markers that can be applied across multiple Cymbidium species and used for the evaluation of genetic relationships as well as qualitative and quantitative trait mapping studies. Genic-SSR's coupled with the functional annotations provided by the unigenes will aid in mapping candidate genes of specific function.

Building a multigenic model of breast cancer susceptibility: CYP17 and HSD17B1 are two important candidates.

PubMed

Feigelson, H S; McKean-Cowdin, R; Coetzee, G A; Stram, D O; Kolonel, L N; Henderson, B E

2001-01-15

We conducted a nested case-control study to evaluate whether polymorphisms in two genes involved in estrogen metabolism, CYP17 and HSD17B1, were useful in developing a breast cancer risk model that could help discriminate women who are at higher risk of breast cancer. If polymorphisms in these genes affect the level of circulating estrogens, they may directly influence breast cancer risk. The base population for this study is a multiethnic cohort study that includes African-American, Non-Latina White, Japanese, Latina, and Native Hawaiian women. For this analysis, 1508 randomly selected controls and 850 incident breast cancer cases of the first four ethnic groups who agreed to provide a blood specimen were included (76 and 80% response rates, respectively). The CYP17 A2 allele and the HSD17B1 A allele were considered "high-risk" alleles. Subjects were then classified according to number of high-risk alleles. After adjusting for age, weight, and ethnicity, we found that carrying one or more high-risk alleles increases the risk of advanced breast cancer in a dose-response fashion. The risk among women carrying four high-risk alleles was 2.21 [95% confidence interval (CI), 0.98-5.00; P for trend = 0.03] compared with those who carried none. This risk was largely limited to women who were not taking hormone replacement therapy (relative risk, 2.60; 95% CI, 0.95-7.14) and was most pronounced among those weighing 170 pounds or less (RR, 3.05; 95% CI, 1.29-7.25). These findings suggest that breast cancer risk has a strong genetic component and supports the theory that the underlying mechanism of "complex traits" can be understood using a multigenic model of candidate genes.

Identification of a QTL in Mus musculus for Alcohol Preference, Withdrawal, and Ap3m2 Expression Using Integrative Functional Genomics and Precision Genetics

PubMed Central

Bubier, Jason A.; Jay, Jeremy J.; Baker, Christopher L.; Bergeson, Susan E.; Ohno, Hiroshi; Metten, Pamela; Crabbe, John C.; Chesler, Elissa J.

2014-01-01

Extensive genetic and genomic studies of the relationship between alcohol drinking preference and withdrawal severity have been performed using animal models. Data from multiple such publications and public data resources have been incorporated in the GeneWeaver database with >60,000 gene sets including 285 alcohol withdrawal and preference-related gene sets. Among these are evidence for positional candidates regulating these behaviors in overlapping quantitative trait loci (QTL) mapped in distinct mouse populations. Combinatorial integration of functional genomics experimental results revealed a single QTL positional candidate gene in one of the loci common to both preference and withdrawal. Functional validation studies in Ap3m2 knockout mice confirmed these relationships. Genetic validation involves confirming the existence of segregating polymorphisms that could account for the phenotypic effect. By exploiting recent advances in mouse genotyping, sequence, epigenetics, and phylogeny resources, we confirmed that Ap3m2 resides in an appropriately segregating genomic region. We have demonstrated genetic and alcohol-induced regulation of Ap3m2 expression. Although sequence analysis revealed no polymorphisms in the Ap3m2-coding region that could account for all phenotypic differences, there are several upstream SNPs that could. We have identified one of these to be an H3K4me3 site that exhibits strain differences in methylation. Thus, by making cross-species functional genomics readily computable we identified a common QTL candidate for two related bio-behavioral processes via functional evidence and demonstrate sufficiency of the genetic locus as a source of variation underlying two traits. PMID:24923803

Identification of a QTL in Mus musculus for alcohol preference, withdrawal, and Ap3m2 expression using integrative functional genomics and precision genetics.

PubMed

Bubier, Jason A; Jay, Jeremy J; Baker, Christopher L; Bergeson, Susan E; Ohno, Hiroshi; Metten, Pamela; Crabbe, John C; Chesler, Elissa J

2014-08-01

Extensive genetic and genomic studies of the relationship between alcohol drinking preference and withdrawal severity have been performed using animal models. Data from multiple such publications and public data resources have been incorporated in the GeneWeaver database with >60,000 gene sets including 285 alcohol withdrawal and preference-related gene sets. Among these are evidence for positional candidates regulating these behaviors in overlapping quantitative trait loci (QTL) mapped in distinct mouse populations. Combinatorial integration of functional genomics experimental results revealed a single QTL positional candidate gene in one of the loci common to both preference and withdrawal. Functional validation studies in Ap3m2 knockout mice confirmed these relationships. Genetic validation involves confirming the existence of segregating polymorphisms that could account for the phenotypic effect. By exploiting recent advances in mouse genotyping, sequence, epigenetics, and phylogeny resources, we confirmed that Ap3m2 resides in an appropriately segregating genomic region. We have demonstrated genetic and alcohol-induced regulation of Ap3m2 expression. Although sequence analysis revealed no polymorphisms in the Ap3m2-coding region that could account for all phenotypic differences, there are several upstream SNPs that could. We have identified one of these to be an H3K4me3 site that exhibits strain differences in methylation. Thus, by making cross-species functional genomics readily computable we identified a common QTL candidate for two related bio-behavioral processes via functional evidence and demonstrate sufficiency of the genetic locus as a source of variation underlying two traits. Copyright © 2014 by the Genetics Society of America.

Association Genetics of Wood Physical Traits in the Conifer White Spruce and Relationships With Gene Expression

PubMed Central

Beaulieu, Jean; Doerksen, Trevor; Boyle, Brian; Clément, Sébastien; Deslauriers, Marie; Beauseigle, Stéphanie; Blais, Sylvie; Poulin, Pier-Luc; Lenz, Patrick; Caron, Sébastien; Rigault, Philippe; Bicho, Paul; Bousquet, Jean; MacKay, John

2011-01-01

Marker-assisted selection holds promise for highly influencing tree breeding, especially for wood traits, by considerably reducing breeding cycles and increasing selection accuracy. In this study, we used a candidate gene approach to test for associations between 944 single-nucleotide polymorphism markers from 549 candidate genes and 25 wood quality traits in white spruce. A mixed-linear model approach, including a weak but nonsignificant population structure, was implemented for each marker–trait combination. Relatedness among individuals was controlled using a kinship matrix estimated either from the known half-sib structure or from the markers. Both additive and dominance effect models were tested. Between 8 and 21 single-nucleotide polymorphisms (SNPs) were found to be significantly associated (P ≤ 0.01) with each of earlywood, latewood, or total wood traits. After controlling for multiple testing (Q ≤ 0.10), 13 SNPs were still significant across as many genes belonging to different families, each accounting for between 3 and 5% of the phenotypic variance in 10 wood characters. Transcript accumulation was determined for genes containing SNPs associated with these traits. Significantly different transcript levels (P ≤ 0.05) were found among the SNP genotypes of a 1-aminocyclopropane-1-carboxylate oxidase, a β-tonoplast intrinsic protein, and a long-chain acyl-CoA synthetase 9. These results should contribute toward the development of efficient marker-assisted selection in an economically important tree species. PMID:21385726

Association study of the tryptophan hydroxylase gene and bipolar affective disorder using family-based internal controls.

PubMed

Rietschel, M; Schorr, A; Albus, M; Franzek, E; Kreiner, R; Held, T; Knapp, M; Müller, D J; Schulze, T G; Propping, P; Maier, W; Nöthen, M M

2000-06-12

The tryptophan hydroxylase (TPH) gene encodes for the rate-limiting enzyme of the serotonin metabolism and, therefore, has to be considered a major candidate for association studies in affective disorders. Recently, an association between this gene and bipolar affective disorder has been reported in a French population. We sought to replicate this finding in a German sample. Allele frequencies of a biallelic polymorphism (A218C) of the TPH gene were determined in 95 bipolar I patients and their parents. Preferential transmission of alleles from heterozygous parents to bipolar offspring was tested with the "transmission disequilibrium test" (TDT), which eliminates the contribution of population stratification to an association finding. Our sample yielded a power >90% to detect the originally reported effect. Neither allele 218A nor allele 218C were preferentially transmitted from heterozygous parents to bipolar offspring. Our results, therefore, do not support the hypothesis that the TPH gene is involved in the etiology of bipolar disorder.

A Controlled Pharmacogenetic Trial of Sibutramine on Weight Loss and Body Composition in Obese or Overweight Adults

PubMed Central

Grudell, April B.M.; Sweetser, Seth; Camilleri, Michael; Eckert, Deborah J.; Vazquez-Roque, Maria I.; Carlson, Paula J.; Burton, Duane D.; Braddock, Autumn E.; Clark, Matthew M.; Graszer, Karen M.; Kalsy, Sarah A.; Zinsmeister, Alan R.

2008-01-01

Background/ Aim Weight loss in response to sibutramine is highly variable. We assessed the association of specific markers of polymorphisms of candidate a2A adrenoreceptor, 5-HT transporter and GNβ3 genes and weight loss with sibutramine. Methods We conducted a randomized, double-blind, pharmacogenetic study of behavioral therapy and sibutramine (10 or 15 mg daily) or placebo for 12 weeks in 181 overweight or obese participants. We measured body weight, BMI, body composition, gastric emptying and genetic variation (α2A C1291G, 5-HTTLPR, and GNβ3 C825T genotypes). ANCOVA was used to assess treatment effects on, and associations of the specific markers of candidate genes with weight loss and body composition. Results Sibutramine, 10 and 15 mg, caused significant weight loss (p = 0.009); there was a statistically significant gene by dose interaction for GNβ3 genotype. For each candidate gene, significant treatment effects at 12 weeks were observed (p<0.017) for all specific genotype variants (delta weight loss in the 2 sibutramine doses versus placebo): α2A CC genotype ( Δ ~5kg), GNβ3 TC/TT genotype (Δ ~6kg), and 5-HTTLPR LS/SS (Δ ~4.5kg). Gene pairs resulted in significantly greater sibutramine treatment effects on weight (both p<0.002): in participants with 5-HTTLPR LS/SS with GNβ3 TC/TT, Δ ~6kg and those with a2A CC with GNβ3 TC/TT, Δ ~8kg; however, effects were not synergistic. Treatment with sibutramine also resulted in significantly greater reduction of body fat for specific α2A CC and GNβ3 TC/TT genotype variants individually (both p<0.02). Conclusions Selection of patients with obesity based on candidate genes may enhance response to multidimensional sibutramine and behavioral therapy. PMID:18725220

Multilocus family-based association analysis of seven candidate polymorphisms with essential hypertension in an african-derived semi-isolated brazilian population.

PubMed

Kimura, L; Angeli, C B; Auricchio, M T B M; Fernandes, G R; Pereira, A C; Vicente, J P; Pereira, T V; Mingroni-Netto, R C

2012-01-01

Background. It has been widely suggested that analyses considering multilocus effects would be crucial to characterize the relationship between gene variability and essential hypertension (EH). Objective. To test for the presence of multilocus effects between/among seven polymorphisms (six genes) on blood pressure-related traits in African-derived semi-isolated Brazilian populations (quilombos). Methods. Analyses were carried out using a family-based design in a sample of 652 participants (97 families). Seven variants were investigated: ACE (rs1799752), AGT (rs669), ADD2 (rs3755351), NOS3 (rs1799983), GNB3 (rs5441 and rs5443), and GRK4 (rs1801058). Sensitivity analyses were further performed under a case-control design with unrelated participants only. Results. None of the investigated variants were associated individually with both systolic and diastolic BP levels (SBP and DBP, respectively) or EH (as a binary outcome). Multifactor dimensionality reduction-based techniques revealed a marginal association of the combined effect of both GNB3 variants on DBP levels in a family-based design (P = 0.040), whereas a putative NOS3-GRK4 interaction also in relation to DBP levels was observed in the case-control design only (P = 0.004). Conclusion. Our results provide limited support for the hypothesis of multilocus effects between/among the studied variants on blood pressure in quilombos. Further larger studies are needed to validate our findings.

Identification of KCNJ11 as a functional candidate gene for bovine meat tenderness.

PubMed

Tizioto, Polyana C; Gasparin, Gustavo; Souza, Marcela M; Mudadu, Mauricio A; Coutinho, Luiz L; Mourão, Gerson B; Tholon, Patricia; Meirelles, Sarah L C; Tullio, Rymer R; Rosa, Antônio N; Alencar, Maurício M; Medeiros, Sérgio R; Siqueira, Fabiane; Feijó, Gelson L D; Nassu, Renata T; Regitano, Luciana C A

2013-12-15

The potassium inwardly rectifying channel, subfamily J, member 11 (KCNJ11) gene was investigated as a candidate for meat tenderness based on the effects reported on muscle for KCNJ11 gene knockout in rat models and its position in a quantitative trait locus (QTL) for meat tenderness in the bovine genome. Sequence variations in the KCNJ11 gene were described by sequencing six amplified fragments, covering almost the entire gene. We identified single nucleotide polymorphisms (SNP) and validated them by different approaches, taking advantage of simultaneous projects that are being developed with the same Nelore population. By sequencing the KCNJ11 in Nelore steers representing extreme phenotypes for Warner-Bratzler shear force (WBSF), it was possible to identify 22 SNPs. We validated two of the identified markers by genotyping the whole population (n = 460). Analysis of association between genotypes and WBSF values revealed a significant additive effect of a SNP at different meat aging times (P ≤ 0.05). In addition, an association between the expression levels of KCNJ11 and WBSF was found, with lower expression levels of KCNJ11 associated with more tender meat (P ≤ 0.05). The results showed that the KCNJ11 gene is a candidate mapped to a QTL for meat tenderness previously identified on BTA15 and may be useful to identify animals with genetic potential to produce tender meat. The effect of KCNJ11 observed on muscle is potentially due to changes in activity of KATP channels, which in turn influence the flow of potassium in the intracellular space, allowing establishment of the membrane potential necessary for muscle contraction.

Fine mapping and candidate gene analysis of qFL-chr1, a fiber length QTL in cotton.

PubMed

Xu, Peng; Gao, Jin; Cao, Zhibin; Chee, Peng W; Guo, Qi; Xu, Zhenzhen; Paterson, Andrew H; Zhang, Xianggui; Shen, Xinlian

2017-06-01

A fiber length QTL, qFL-chr1, was fine mapped to a 0.9 cM interval of cotton chromosome 1. Two positional candidate genes showed positive correlation between gene expression level and fiber length. Prior analysis of a backcross-self mapping population derived from a cross between Gossypium hirsutum L. and G. barbadense L. revealed a QTL on chromosome 1 associated with increased fiber length (qFL-chr1), which was confirmed in three independent populations of near-isogenic introgression lines (NIILs). Here, a single NIIL, R01-40-08, was used to develop a large population segregating for the target region. Twenty-two PCR-based polymorphic markers used to genotype 1672 BC 4 F 2 plants identified 432 recombinants containing breakpoints in the target region. Substitution mapping using 141 informative recombinants narrowed the position of qFL-chr1 to a 1.0-cM interval between SSR markers MUSS084 and CIR018. To exclude possible effects of non-target introgressions on fiber length, different heterozygous BC 4 F 3 plants introgressed between SSR markers NAU3384 and CGR5144 were selected to develop sub-NILs. The qFL-chr1 was further mapped at 0.9-cM interval between MUSS422 and CIR018 by comparisons of sub-NIL phenotype, and increased fiber length by ~1 mm. The 2.38-Mb region between MUSS422 and CIR018 in G. barbadense contained 19 annotated genes. Expression levels of two of these genes, GOBAR07705 (encoding 1-aminocyclopropane-1-carboxylate synthase) and GOBAR25992 (encoding amino acid permease), were positively correlated with fiber length in a small F 2 population, supporting these genes as candidates for qFL-chr1.

Population Structure and Domestication Revealed by High-Depth Resequencing of Korean Cultivated and Wild Soybean Genomes†

PubMed Central

Chung, Won-Hyong; Jeong, Namhee; Kim, Jiwoong; Lee, Woo Kyu; Lee, Yun-Gyeong; Lee, Sang-Heon; Yoon, Woongchang; Kim, Jin-Hyun; Choi, Ik-Young; Choi, Hong-Kyu; Moon, Jung-Kyung; Kim, Namshin; Jeong, Soon-Chun

2014-01-01

Despite the importance of soybean as a major crop, genome-wide variation and evolution of cultivated soybeans are largely unknown. Here, we catalogued genome variation in an annual soybean population by high-depth resequencing of 10 cultivated and 6 wild accessions and obtained 3.87 million high-quality single-nucleotide polymorphisms (SNPs) after excluding the sites with missing data in any accession. Nuclear genome phylogeny supported a single origin for the cultivated soybeans. We identified 10-fold longer linkage disequilibrium (LD) in the wild soybean relative to wild maize and rice. Despite the small population size, the long LD and large SNP data allowed us to identify 206 candidate domestication regions with significantly lower diversity in the cultivated, but not in the wild, soybeans. Some of the genes in these candidate regions were associated with soybean homologues of canonical domestication genes. However, several examples, which are likely specific to soybean or eudicot crop plants, were also observed. Consequently, the variation data identified in this study should be valuable for breeding and for identifying agronomically important genes in soybeans. However, the long LD of wild soybeans may hinder pinpointing causal gene(s) in the candidate regions. PMID:24271940

Effects of DGAT1 gene on meat and carcass fatness quality in Chinese commercial cattle.

PubMed

Yuan, Zhengrong; Li, Junya; Li, Jiao; Gao, Xue; Gao, Huijiang; Xu, Shangzhong

2013-02-01

This study was designed to investigate the candidate single nucleotide polymorphisms (SNPs) in the exon's region of bovine diacylglycerol O-acyltransferase (DGAT1) gene using bioinformatics and experimental methods. A total of 17 SNPs were screened from public data resources and DNA sequencing. Three SNPs (c.572A>G, c.1241C>T and c.1416T>G) of these candidate SNPs were genotyped by created restriction site-polymerase chain reaction (CRS-PCR) methods. The gene-specific SNP markers and their effects on meat and carcass fatness quality traits were evaluated in Chinese commercial cattle. The c.572A>G and c.1416T>G significantly effected on backfat thickness, longissimus muscle area, marbling score, fat color and Warner-Bratzler shear force. No significant association was detected between the c.1241C>T and measured traits. Results from this study suggested that the SNP markers may be effective for the marker-assisted selection of meat and carcass fatness quality traits, and added new evidence that DGAT1 gene is an important candidate gene for the improvement of meat and carcass fatness quality in beef cattle industry.

Editor's Highlight: Genetic Targets of Acute Toluene Inhalation in Drosophila melanogaster.

PubMed

Bushnell, Philip J; Ward, William O; Morozova, Tatiana V; Oshiro, Wendy M; Lin, Mimi T; Judson, Richard S; Hester, Susan D; McKee, John M; Higuchi, Mark

2017-03-01

Interpretation and use of data from high-throughput assays for chemical toxicity require links between effects at molecular targets and adverse outcomes in whole animals. The well-characterized genome of Drosophila melanogaster provides a potential model system by which phenotypic responses to chemicals can be mapped to genes associated with those responses, which may in turn suggest adverse outcome pathways associated with those genes. To determine the utility of this approach, we used the Drosophila Genetics Reference Panel (DGRP), a collection of ∼200 homozygous lines of fruit flies whose genomes have been sequenced. We quantified toluene-induced suppression of motor activity in 123 lines of these flies during exposure to toluene, a volatile organic compound known to induce narcosis in mammals via its effects on neuronal ion channels. We then applied genome-wide association analyses on this effect of toluene using the DGRP web portal (http://dgrp2.gnets.ncsu.edu), which identified polymorphisms in candidate genes associated with the variation in response to toluene exposure. We tested ∼2 million variants and found 82 polymorphisms located in or near 66 candidate genes that were associated with phenotypic variation for sensitivity to toluene at P < 5 × 10-5, and human orthologs for 52 of these candidate Drosophila genes. None of these orthologs are known to be involved in canonical pathways for mammalian neuronal ion channels, including GABA, glutamate, dopamine, glycine, serotonin, and voltage sensitive calcium channels. Thus this analysis did not reveal a genetic signature consistent with processes previously shown to be involved in toluene-induced narcosis in mammals. The list of the human orthologs included Gene Ontology terms associated with signaling, nervous system development and embryonic morphogenesis; these orthologs may provide insight into potential new pathways that could mediate the narcotic effects of toluene. Published by Oxford University Press on behalf of the Society of Toxicology 2016. This work is written by US Government employees and is in the public domain in the US.

The Influence of DAT1, COMT, and BDNF Genetic Polymorphisms on Total and Subregional Hippocampal Volumes in Early Onset Heavy Cannabis Users

PubMed Central

Batalla, Albert; Lorenzetti, Valentina; Chye, Yann; Yücel, Murat; Soriano-Mas, Carles; Bhattacharyya, Sagnik; Torrens, Marta; Crippa, José A.S.; Martín-Santos, Rocío

2018-01-01

Abstract Introduction: Hippocampal neuroanatomy is affected by genetic variations in dopaminergic candidate genes and environmental insults, such as early onset of chronic cannabis exposure. Here, we examine how hippocampal total and subregional volumes are affected by cannabis use and functional polymorphisms of dopamine-relevant genes, including the catechol-O-methyltransferase (COMT), dopamine transporter (DAT1), and the brain-derived neurotrophic factor (BDNF) genes. Material and Methods: We manually traced total hippocampal volumes and automatically segmented hippocampal subregions using high-resolution MRI images, and performed COMT, DAT1, and BDNF genotyping in 59 male Caucasian young adults aged 18–30 years. These included 30 chronic cannabis users with early-onset (regular use at <16 years) and 29 age-, education-, and intelligence-matched controls. Results: Cannabis use and dopaminergic gene polymorphism had both distinct and interactive effects on the hippocampus. We found emerging alterations of hippocampal total and specific subregional volumes in cannabis users relative to controls (i.e., CA1, CA2/3, and CA4), and associations between cannabis use levels and total and specific subregional volumes. Furthermore, total hippocampal volume and the fissure subregion were affected by cannabis×DAT1 polymorphism (i.e., 9/9R and in 10/10R alleles), reflecting high and low levels of dopamine availability. Conclusion: These findings suggest that cannabis exposure alters the normal relationship between DAT1 polymorphism and the anatomy of total and subregional hippocampal volumes, and that specific hippocampal subregions may be particularly affected. PMID:29404409

The Influence of DAT1, COMT, and BDNF Genetic Polymorphisms on Total and Subregional Hippocampal Volumes in Early Onset Heavy Cannabis Users.

PubMed

Batalla, Albert; Lorenzetti, Valentina; Chye, Yann; Yücel, Murat; Soriano-Mas, Carles; Bhattacharyya, Sagnik; Torrens, Marta; Crippa, José A S; Martín-Santos, Rocío

2018-01-01

Introduction: Hippocampal neuroanatomy is affected by genetic variations in dopaminergic candidate genes and environmental insults, such as early onset of chronic cannabis exposure. Here, we examine how hippocampal total and subregional volumes are affected by cannabis use and functional polymorphisms of dopamine-relevant genes, including the catechol-O-methyltransferase (COMT), dopamine transporter (DAT1), and the brain-derived neurotrophic factor (BDNF) genes. Material and Methods: We manually traced total hippocampal volumes and automatically segmented hippocampal subregions using high-resolution MRI images, and performed COMT, DAT1, and BDNF genotyping in 59 male Caucasian young adults aged 18-30 years. These included 30 chronic cannabis users with early-onset (regular use at <16 years) and 29 age-, education-, and intelligence-matched controls. Results: Cannabis use and dopaminergic gene polymorphism had both distinct and interactive effects on the hippocampus. We found emerging alterations of hippocampal total and specific subregional volumes in cannabis users relative to controls (i.e., CA1, CA2/3, and CA4), and associations between cannabis use levels and total and specific subregional volumes. Furthermore, total hippocampal volume and the fissure subregion were affected by cannabis×DAT1 polymorphism (i.e., 9/9R and in 10/10R alleles), reflecting high and low levels of dopamine availability. Conclusion: These findings suggest that cannabis exposure alters the normal relationship between DAT1 polymorphism and the anatomy of total and subregional hippocampal volumes, and that specific hippocampal subregions may be particularly affected.

Polymorphisms in the bovine CIDEC gene are associated with body measurement traits and meat quality traits in Qinchuan cattle.

PubMed

Mei, C G; Gui, L S; Fu, C Z; Wang, H C; Wang, J L; Cheng, G; Zan, L S

2015-08-07

Previous studies have shown that the cell death-inducing DFF45-like effector-C (CIDEC) gene is involved in lipid storage and energy metabolism, suggesting that it is a potential candidate gene that affects body measurement traits (BMTs) and meat quality traits (MQTs). The aim of this study was to identify polymorphisms of the bovine CIDEC gene and analyze their possible associations with BMTs and MQTs in 531 randomly selected Qinchuan cattle aged between 18 and 24 months. DNA sequencing and polymerase chain reaction-restriction fragment length polymorphism were employed to detect CIDEC single nucleotide polymorphisms (SNPs). We found five SNPs: two in exon 5 (SNP1, g.9815G>A and SNP2, g.9924C>T) and three in the 3'-untranslated region (SNP3, g.13281C>T; SNP4, g.13297A>G; and SNP5, g.13307G>A). SNP1 was a missense mutation that resulted in an arginine to glutamine amino acid change, and exhibited two genotypes (GG and AG). SNP2 was a synonymous mutation that exhibited three genotypes (CC, CT, and TT). SNP3, 4, and 5 were completely linked, and only exhibited two genotypes (CC-AA-GG and CT-AG-GA). We found significant associations between these polymorphisms and BMTs and MQTs (P < 0.05); GG, CT, and CT-AG-GA appeared to be the most beneficial genotypes. Therefore, CIDEC may affect BMTs and MQTs in Qinchuan cattle, and could be used in marker-assisted selection.

Assignment of the gene locus for severe congenital neutropenia to chromosome 1q22 in the original Kostmann family from Northern Sweden.

PubMed

Melin, M; Entesarian, M; Carlsson, G; Garwicz, D; Klein, C; Fadeel, B; Nordenskjöld, M; Palmblad, J; Henter, J I; Dahl, N

2007-02-16

Autosomal recessive severe congenital neutropenia (SCN) or Kostmann syndrome is characterised by reduced neutrophil counts and subsequent recurrent bacterial infections. The disease was originally described in a large consanguineous pedigree from Northern Sweden. A genome-wide autozygosity scan was initiated on samples from four individuals in the original pedigree using high density single nucleotide polymorphism (SNP) genotyping arrays in order to map the disease locus. Thirty candidate regions were identified and the ascertainment of samples from two additional patients confirmed a single haplotype with significant association to the disorder (p<0.01) on chromosome 1q22. One affected individual from the original Kostmann pedigree was confirmed as a phenocopy. The minimal haplotype shared by affected individuals spans a candidate region of 1.2 Mb, containing several potential candidate genes.

APOC3 Promoter Polymorphisms C-482T and T-455C Are Associated with the Metabolic Syndrome1

PubMed Central

Miller, Michael; Rhyne, Jeffrey; Chen, Hegang; Beach, Valerie; Ericson, Richard; Luthra, Kalpana; Dwivedi, Manjari; Misra, Anoop

2007-01-01

Background Despite the growing epidemic of the metabolic syndrome (MetS), few studies have evaluated genetic polymorphisms associated with the MetS phenotype. One candidate, APOC3, modulates lipid and lipoprotein metabolism and the promoter polymorphisms C-482T/T-455C are associated with loss of insulin downregulation. Methods One hundred twenty two consecutive MetS cases were matched by age, sex and race in a 1:1 case-control design to evaluate the prevalence of common polymorphisms in the following candidate genes: APOC3, APOE, B3AR, FABP2, GNB3, LPL, and PPARα and PPARγ. Results Compared to controls, MetS subjects exhibited a greater prevalence of APOC3 promoter polymorphisms. Specifically, the frequency of the variant C-482T and T-455C alleles was 70.5 and 81.9% of cases compared to 43.4 and 54.1% in controls, respectively ( p <0.0001). Overall, APOC3 promoter variants were associated with a greater likelihood of MetS compared to wild type [C-482T (OR: 4.3; 95% CI: 2.2, 8.6 [p <0.0001]), T-455C (OR: 3.6; 95% CI: 2.0, 6.7 [p <0.0001])]. No material differences were identified between the other genetic variants tested and prevalence of MetS. Conclusions These data, therefore, suggest that the APOC3 promoter polymorphisms C-482T and T-455C are associated with the MetS. PMID:17416293

APOC3 promoter polymorphisms C-482T and T-455C are associated with the metabolic syndrome.

PubMed

Miller, Michael; Rhyne, Jeffrey; Chen, Hegang; Beach, Valerie; Ericson, Richard; Luthra, Kalpana; Dwivedi, Manjari; Misra, Anoop

2007-05-01

Despite the growing epidemic of the metabolic syndrome (MetS), few studies have evaluated genetic polymorphisms associated with the MetS phenotype. One candidate, APOC3, modulates lipid and lipoprotein metabolism and the promoter polymorphisms C-482T/T-455C are associated with loss of insulin downregulation. One hundred twenty two consecutive MetS cases were matched by age, sex and race in a 1:1 case-control design to evaluate the prevalence of common polymorphisms in the following candidate genes: APOC3, APOE, B3AR, FABP2, GNB3, LPL, and PPARalpha and PPARgamma. Compared to controls, MetS subjects exhibited a greater prevalence of APOC3 promoter polymorphisms. Specifically, the frequency of the variant C-482T and T-455C alleles was 70.5 and 81.9% of cases compared to 43.4 and 54.1% in controls, respectively (p <0.0001). Overall, APOC3 promoter variants were associated with a greater likelihood of MetS compared to wild type [C-482T (OR: 4.3; 95% CI: 2.2, 8.6 [p <0.0001]), T-455C (OR: 3.6; 95% CI: 2.0, 6.7 [p <0.0001])]. No material differences were identified between the other genetic variants tested and prevalence of MetS. These data, therefore, suggest that the APOC3 promoter polymorphisms C-482T and T-455C are associated with the MetS.

Two functional serotonin polymorphisms moderate the effect of food reinforcement on BMI.

PubMed

Carr, Katelyn A; Lin, Henry; Fletcher, Kelly D; Sucheston, Lara; Singh, Prashant K; Salis, Robbert J; Erbe, Richard W; Faith, Myles S; Allison, David B; Stice, Eric; Epstein, Leonard H

2013-06-01

Food reinforcement, or the motivation to eat, has been associated with increased energy intake, greater body weight, and prospective weight gain. Much of the previous research on the reinforcing value of food has focused on the role of dopamine, but it may be worthwhile to examine genetic polymorphisms in the serotonin and opioid systems as these neurotransmitters have been shown to be related to reinforcement processes and to influence energy intake. We examined the relationship among 44 candidate genetic polymorphisms in the dopamine, serotonin, and opioid systems, as well as food reinforcement and body mass index (BMI) in a sample of 245 individuals. Polymorphisms in the monoamine oxidase A (MAOA-LPR) and serotonin receptor 2A genes (rs6314) moderated the effect of food reinforcement on BMI, accounting for an additional 5-10% variance and revealed a potential role of the single nucleotide polymorphism, rs6314, in the serotonin 2A receptor as a differential susceptibility factor for obesity. Differential susceptibility describes a factor that can confer either risk or protection depending on a second variable, such that rs6314 is predictive of both high and low BMI based on the level of food reinforcement, while the diathesis stress or dual-gain model only influences one end of the outcome measure. The interaction with MAOA-LPR better fits the diathesis stress model, with the 3.5R/4R allele conferring protection for individuals low in food reinforcement. These results provide new insight into genes theoretically involved in obesity, and support the hypothesis that genetics moderate the association between food reinforcement and BMI. PsycINFO Database Record (c) 2013 APA, all rights reserved.

Molecular evolution of bovine Toll-like receptor 2 suggests substitutions of functional relevance.

PubMed

Jann, Oliver C; Werling, Dirk; Chang, Jung-Su; Haig, David; Glass, Elizabeth J

2008-10-20

There is accumulating evidence that polymorphism in Toll-like receptor (TLR) genes might be associated with disease resistance or susceptibility traits in livestock. Polymorphic sites affecting TLR function should exhibit signatures of positive selection, identified as a high ratio of non-synonymous to synonymous nucleotide substitutions (omega). Phylogeny based models of codon substitution based on estimates of omega for each amino acid position can therefore offer a valuable tool to predict sites of functional relevance. We have used this approach to identify such polymorphic sites within the bovine TLR2 genes from ten Bos indicus and Bos taurus cattle breeds. By analysing TLR2 gene phylogeny in a set of mammalian species and a subset of ruminant species we have estimated the selective pressure on individual sites and domains and identified polymorphisms at sites of putative functional importance. The omega were highest in the mammalian TLR2 domains thought to be responsible for ligand binding and lowest in regions responsible for heterodimerisation with other TLR-related molecules. Several positively-selected sites were detected in or around ligand-binding domains. However a comparison of the ruminant subset of TLR2 sequences with the whole mammalian set of sequences revealed that there has been less selective pressure among ruminants than in mammals as a whole. This suggests that there have been functional changes during ruminant evolution. Twenty newly-discovered non-synonymous polymorphic sites were identified in cattle. Three of them were localised at positions shaped by positive selection in the ruminant dataset (Leu227Phe, His305Pro, His326Gln) and in domains involved in the recognition of ligands. His326Gln is of particular interest as it consists of an exchange of differentially-charged amino acids at a position which has previously been shown to be crucial for ligand binding in human TLR2. Within bovine TLR2, polymorphisms at amino acid positions 227, 305 and 326 map to functionally important sites of TLR2 and should be considered as candidate SNPs for immune related traits in cattle. A final proof of their functional relevance requires further studies to determine their functional effect on the immune response after stimulation with relevant ligands and/or their association with immune related traits in animals.

Quantitative genetic bases of anthocyanin variation in grape (Vitis vinifera L. ssp. sativa) berry: a quantitative trait locus to quantitative trait nucleotide integrated study.

PubMed

Fournier-Level, Alexandre; Le Cunff, Loïc; Gomez, Camila; Doligez, Agnès; Ageorges, Agnès; Roux, Catherine; Bertrand, Yves; Souquet, Jean-Marc; Cheynier, Véronique; This, Patrice

2009-11-01

The combination of QTL mapping studies of synthetic lines and association mapping studies of natural diversity represents an opportunity to throw light on the genetically based variation of quantitative traits. With the positional information provided through quantitative trait locus (QTL) mapping, which often leads to wide intervals encompassing numerous genes, it is now feasible to directly target candidate genes that are likely to be responsible for the observed variation in completely sequenced genomes and to test their effects through association genetics. This approach was performed in grape, a newly sequenced genome, to decipher the genetic architecture of anthocyanin content. Grapes may be either white or colored, ranging from the lightest pink to the darkest purple tones according to the amount of anthocyanin accumulated in the berry skin, which is a crucial trait for both wine quality and human nutrition. Although the determinism of the white phenotype has been fully identified, the genetic bases of the quantitative variation of anthocyanin content in berry skin remain unclear. A single QTL responsible for up to 62% of the variation in the anthocyanin content was mapped on a Syrah x Grenache F(1) pseudo-testcross. Among the 68 unigenes identified in the grape genome within the QTL interval, a cluster of four Myb-type genes was selected on the basis of physiological evidence (VvMybA1, VvMybA2, VvMybA3, and VvMybA4). From a core collection of natural resources (141 individuals), 32 polymorphisms revealed significant association, and extended linkage disequilibrium was observed. Using a multivariate regression method, we demonstrated that five polymorphisms in VvMybA genes except VvMybA4 (one retrotransposon, three single nucleotide polymorphisms and one 2-bp insertion/deletion) accounted for 84% of the observed variation. All these polymorphisms led to either structural changes in the MYB proteins or differences in the VvMybAs promoters. We concluded that the continuous variation in anthocyanin content in grape was explained mainly by a single gene cluster of three VvMybA genes. The use of natural diversity helped to reduce one QTL to a set of five quantitative trait nucleotides and gave a clear picture of how isogenes combined their effects to shape grape color. Such analysis also illustrates how isogenes combine their effect to shape a complex quantitative trait and enables the definition of markers directly targeted for upcoming breeding programs.

Fine mapping and identification of candidate genes for the sy-2 locus in a temperature-sensitive chili pepper (Capsicum chinense).

PubMed

Liu, Li; Venkatesh, Jelli; Jo, Yeong Deuk; Koeda, Sota; Hosokawa, Munetaka; Kang, Jin-Ho; Goritschnig, Sandra; Kang, Byoung-Cheorl

2016-08-01

The sy - 2 temperature-sensitive gene from Capsicum chinense was fine mapped to a 138.8-kb region at the distal portion of pepper chromosome 1. Based on expression analyses, two putative F-box genes were identified as sy - 2 candidate genes. Seychelles-2 ('sy-2') is a temperature-sensitive natural mutant of Capsicum chinense, which exhibits an abnormal leaf phenotype when grown at temperatures below 24 °C. We previously showed that the sy-2 phenotype is controlled by a single recessive gene, sy-2, located on pepper chromosome 1. In this study, a high-resolution genetic and physical map for the sy-2 locus was constructed using two individual F2 mapping populations derived from a cross between C. chinense mutant 'sy-2' and wild-type 'No. 3341'. The sy-2 gene was fine mapped to a 138.8-kb region between markers SNP 5-5 and SNP 3-8 at the distal portion of chromosome 1, based on comparative genomic analysis and genomic information from pepper. The sy-2 target region was predicted to contain 27 genes. Expression analysis of these predicted genes showed a differential expression pattern for ORF10 and ORF20 between mutant and wild-type plants; with both having significantly lower expression in 'sy-2' than in wild-type plants. In addition, the coding sequences of both ORF10 and ORF20 contained single nucleotide polymorphisms (SNPs) causing amino acid changes, which may have important functional consequences. ORF10 and ORF20 are predicted to encode F-box proteins, which are components of the SCF complex. Based on the differential expression pattern and the presence of nonsynonymous SNPs, we suggest that these two putative F-box genes are most likely responsible for the temperature-sensitive phenotypes in pepper. Further investigation of these genes may enable a better understanding of the molecular mechanisms of low temperature sensitivity in plants.

Oxytocin Receptor Genetic Variation Promotes Human Trust Behavior

PubMed Central

Krueger, Frank; Parasuraman, Raja; Iyengar, Vijeth; Thornburg, Matthew; Weel, Jaap; Lin, Mingkuan; Clarke, Ellen; McCabe, Kevin; Lipsky, Robert H.

2012-01-01

Given that human trust behavior is heritable and intranasal administration of oxytocin enhances trust, the oxytocin receptor (OXTR) gene is an excellent candidate to investigate genetic contributions to individual variations in trust behavior. Although a single-nucleotide polymorphism involving an adenine (A)/guanine (G) transition (rs53576) has been associated with socio-emotional phenotypes, its link to trust behavior is unclear. We combined genotyping of healthy male students (n = 108) with the administration of a trust game experiment. Our results show that a common occurring genetic variation (rs53576) in the OXTR gene is reliably associated with trust behavior rather than a general increase in trustworthy or risk behaviors. Individuals homozygous for the G allele (GG) showed higher trust behavior than individuals with A allele carriers (AA/AG). Although the molecular functionality of this polymorphism is still unknown, future research should clarify how the OXTR gene interacts with other genes and the environment in promoting socio-emotional behaviors. PMID:22347177

Influence of haplotypes, gene expression and soluble levels of L-selectin on the risk of acute coronary syndrome.

PubMed

Sandoval-Pinto, Elena; Padilla-Gutiérrez, Jorge Ramón; Hernández-Bello, Jorge; Martínez-Fernández, Diana Emilia; Valdés-Alvarado, Emmanuel; Muñoz-Valle, José Francisco; Flores-Salinas, H E; Valle, Yeminia

2017-08-20

L-selectin gene (SELL) is a candidate gene for the development of acute coronary syndrome (ACS) that contributes to endothelial dysfunction. The -642C>T (rs2205849) and 725C>T (rs2229569) polymorphisms have been associated with changes in gene expression, ligand affinity and increased risk of cardiovascular disease. The aim of this study was to investigate the association between the haplotypes constructed with the -642C>T and 725C>T polymorphisms of the SELL gene, the expression levels of its mRNA and the serum levels of soluble L-selectin with ACS. We recruited 615 individuals of Mexican origin matched by age, including 342 patients with ACS and 273 individuals without personal history of ischemic cardiopathy as control group (CG). Genotyping was performed by PCR-RFLP. The qPCR technique was used to analyze the expression of mRNA using TaqMan® UPL probes. The levels of soluble L-selectin were measured with ELISA. The allele variants in both polymorphisms were over-represented in the CG compared to the ACS (OR range: 0.371-0.716, p<0.006). The CT and TT haplotypes had a protective effect against the development of ACS (OR=0.401, p<0.0001; OR=0.628, p<0.0001, respectively). SELL expression was 3.076 times higher in the ACS group compared to CG (p<0.001). The levels of soluble L-selectin were similar between ACS and CG. Both polymorphisms had no effect on mRNA expression and soluble protein levels. The polymorphisms -642C>T and 725C>T of the SELL gene are protective factors against the development of ACS. There is an increased gene expression of L-selectin in ACS compared to CG in the population of Western Mexico. Copyright © 2017 Elsevier B.V. All rights reserved.

Patterns of Nucleotide Diversity at the Regions Encompassing the Drosophila Insulin-Like Peptide (dilp) Genes: Demography vs. Positive Selection in Drosophila melanogaster

PubMed Central

Guirao-Rico, Sara; Aguadé, Montserrat

2013-01-01

In Drosophila, the insulin-signaling pathway controls some life history traits, such as fertility and lifespan, and it is considered to be the main metabolic pathway involved in establishing adult body size. Several observations concerning variation in body size in the Drosophila genus are suggestive of its adaptive character. Genes encoding proteins in this pathway are, therefore, good candidates to have experienced adaptive changes and to reveal the footprint of positive selection. The Drosophila insulin-like peptides (DILPs) are the ligands that trigger the insulin-signaling cascade. In Drosophila melanogaster, there are several peptides that are structurally similar to the single mammalian insulin peptide. The footprint of recent adaptive changes on nucleotide variation can be unveiled through the analysis of polymorphism and divergence. With this aim, we have surveyed nucleotide sequence variation at the dilp1-7 genes in a natural population of D. melanogaster. The comparison of polymorphism in D. melanogaster and divergence from D. simulans at different functional classes of the dilp genes provided no evidence of adaptive protein evolution after the split of the D. melanogaster and D. simulans lineages. However, our survey of polymorphism at the dilp gene regions of D. melanogaster has provided some evidence for the action of positive selection at or near these genes. The regions encompassing the dilp1-4 genes and the dilp6 gene stand out as likely affected by recent adaptive events. PMID:23308258

Dopaminergic and Serotonergic Genotypes and the Subjective Experiences of Hypnosis.

PubMed

Katonai, E R; Szekely, Anna; Vereczkei, A; Sasvari-Szekely, Maria; Bányai, Éva I; Varga, Katalin

2017-01-01

Hypnotizability is related to the Val 158 Met polymorphism of the COMT gene. The authors' aim was to find associations between candidate genes and subjective dimensions of hypnosis; 136 subjects participated in hypnosis and noninvasive DNA sampling. The phenomenological dimensions were tapped by the Archaic Involvement Measure (AIM), the Phenomenology of Consciousness Inventory (PCI), and the Dyadic Interactional Harmony Questionnaire (DIH). The main results were that the "Need of dependence" subscale of AIM was associated with the COMT genotypes. The GG subgroup showed higher scores, whereas AA had below average scores on the majority of the subjective measures. An association between the 5-HTTLPR polymorphism and the intimacy scores on the DIH was also evident. The effects are discussed in the social-psychobiological model of hypnosis.

The Conserved and Unique Genetic Architecture of Kernel Size and Weight in Maize and Rice1[OPEN

PubMed Central

Lan, Liu; Wang, Hongze; Xu, Yuancheng; Yang, Xiaohong; Li, Wenqiang; Tong, Hao; Xiao, Yingjie; Pan, Qingchun; Qiao, Feng; Raihan, Mohammad Sharif; Liu, Haijun; Yang, Ning; Wang, Xiaqing; Deng, Min; Jin, Minliang; Zhao, Lijun; Luo, Xin; Zhan, Wei; Liu, Nannan; Wang, Hong; Chen, Gengshen

2017-01-01

Maize (Zea mays) is a major staple crop. Maize kernel size and weight are important contributors to its yield. Here, we measured kernel length, kernel width, kernel thickness, hundred kernel weight, and kernel test weight in 10 recombinant inbred line populations and dissected their genetic architecture using three statistical models. In total, 729 quantitative trait loci (QTLs) were identified, many of which were identified in all three models, including 22 major QTLs that each can explain more than 10% of phenotypic variation. To provide candidate genes for these QTLs, we identified 30 maize genes that are orthologs of 18 rice (Oryza sativa) genes reported to affect rice seed size or weight. Interestingly, 24 of these 30 genes are located in the identified QTLs or within 1 Mb of the significant single-nucleotide polymorphisms. We further confirmed the effects of five genes on maize kernel size/weight in an independent association mapping panel with 540 lines by candidate gene association analysis. Lastly, the function of ZmINCW1, a homolog of rice GRAIN INCOMPLETE FILLING1 that affects seed size and weight, was characterized in detail. ZmINCW1 is close to QTL peaks for kernel size/weight (less than 1 Mb) and contains significant single-nucleotide polymorphisms affecting kernel size/weight in the association panel. Overexpression of this gene can rescue the reduced weight of the Arabidopsis (Arabidopsis thaliana) homozygous mutant line in the AtcwINV2 gene (Arabidopsis ortholog of ZmINCW1). These results indicate that the molecular mechanisms affecting seed development are conserved in maize, rice, and possibly Arabidopsis. PMID:28811335

The Conserved and Unique Genetic Architecture of Kernel Size and Weight in Maize and Rice.

PubMed

Liu, Jie; Huang, Juan; Guo, Huan; Lan, Liu; Wang, Hongze; Xu, Yuancheng; Yang, Xiaohong; Li, Wenqiang; Tong, Hao; Xiao, Yingjie; Pan, Qingchun; Qiao, Feng; Raihan, Mohammad Sharif; Liu, Haijun; Zhang, Xuehai; Yang, Ning; Wang, Xiaqing; Deng, Min; Jin, Minliang; Zhao, Lijun; Luo, Xin; Zhou, Yang; Li, Xiang; Zhan, Wei; Liu, Nannan; Wang, Hong; Chen, Gengshen; Li, Qing; Yan, Jianbing

2017-10-01

Maize ( Zea mays ) is a major staple crop. Maize kernel size and weight are important contributors to its yield. Here, we measured kernel length, kernel width, kernel thickness, hundred kernel weight, and kernel test weight in 10 recombinant inbred line populations and dissected their genetic architecture using three statistical models. In total, 729 quantitative trait loci (QTLs) were identified, many of which were identified in all three models, including 22 major QTLs that each can explain more than 10% of phenotypic variation. To provide candidate genes for these QTLs, we identified 30 maize genes that are orthologs of 18 rice ( Oryza sativa ) genes reported to affect rice seed size or weight. Interestingly, 24 of these 30 genes are located in the identified QTLs or within 1 Mb of the significant single-nucleotide polymorphisms. We further confirmed the effects of five genes on maize kernel size/weight in an independent association mapping panel with 540 lines by candidate gene association analysis. Lastly, the function of ZmINCW1 , a homolog of rice GRAIN INCOMPLETE FILLING1 that affects seed size and weight, was characterized in detail. ZmINCW1 is close to QTL peaks for kernel size/weight (less than 1 Mb) and contains significant single-nucleotide polymorphisms affecting kernel size/weight in the association panel. Overexpression of this gene can rescue the reduced weight of the Arabidopsis ( Arabidopsis thaliana ) homozygous mutant line in the AtcwINV2 gene (Arabidopsis ortholog of ZmINCW1 ). These results indicate that the molecular mechanisms affecting seed development are conserved in maize, rice, and possibly Arabidopsis. © 2017 American Society of Plant Biologists. All Rights Reserved.

Genetic association studies of glutamate, GABA and related genes in schizophrenia and bipolar disorder: a decade of advance.

PubMed

Cherlyn, Suat Ying Tan; Woon, Puay San; Liu, Jian Jun; Ong, Wei Yi; Tsai, Guo Chuan; Sim, Kang

2010-05-01

Schizophrenia (SZ) and bipolar disorder (BD) are debilitating neurobehavioural disorders likely influenced by genetic and non-genetic factors and which can be seen as complex disorders of synaptic neurotransmission. The glutamatergic and GABAergic neurotransmission systems have been implicated in both diseases and we have reviewed extensive literature over a decade for evidence to support the association of glutamate and GABA genes in SZ and BD. Candidate-gene based population and family association studies have implicated some ionotrophic glutamate receptor genes (GRIN1, GRIN2A, GRIN2B and GRIK3), metabotropic glutamate receptor genes (such as GRM3), the G72/G30 locus and GABAergic genes (e.g. GAD1 and GABRB2) in both illnesses to varying degrees, but further replication studies are needed to validate these results. There is at present no consensus on specific single nucleotide polymorphisms or haplotypes associated with the particular candidate gene loci in these illnesses. The genetic architecture of glutamate systems in bipolar disorder need to be better studied in view of recent data suggesting an overlap in the genetic aetiology of SZ and BD. There is a pressing need to integrate research platforms in genomics, epistatic models, proteomics, metabolomics, neuroimaging technology and translational studies in order to allow a more integrated understanding of glutamate and GABAergic signalling processes and aberrations in SZ and BD as well as their relationships with clinical presentations and treatment progress over time. (c) 2010 Elsevier Ltd. All rights reserved.

Refinement of the X-linked cataract locus (CXN) and gene analysis for CXN and Nance-Horan syndrome (NHS).

PubMed

Brooks, Simon; Ebenezer, Neil; Poopalasundaram, Subathra; Maher, Eamonn; Francis, Peter; Moore, Anthony; Hardcastle, Alison

2004-06-01

The X-linked congenital cataract (CXN) locus has been mapped to a 3-cM (approximately 3.5 Mb) interval on chromosome Xp22.13, which is syntenic to the mouse cataract disease locus Xcat and encompasses the recently refined Nance-Horan syndrome (NHS) locus. A positional cloning strategy has been adopted to identify the causative gene. In an attempt to refine the CXN locus, seven microsatellites were analysed within 21 individuals of a CXN family. Haplotypes were reconstructed confirming disease segregation with markers on Xp22.13. In addition, a proximal cross-over was observed between markers S3 and S4, thereby refining the CXN disease interval by approximately 400 Kb to 3.2 Mb, flanked by markers DXS9902 and S4. Two known genes (RAI2 and RBBP7) and a novel gene (TL1) were screened for mutations within an affected male from the CXN family and an NHS family by direct sequencing of coding exons and intron- exon splice sites. No mutations or polymorphisms were identified, therefore excluding them as disease-causative in CXN and NHS. In conclusion, the CXN locus has been successfully refined and excludes PPEF1 as a candidate gene. A further three candidates were excluded based on sequence analysis. Future positional cloning efforts will focus on the region of overlap between CXN, Xcat, and NHS.

Molecular Characterization of the Lipid Genome-Wide Association Study Signal on Chromosome 18q11.2 Implicates HNF4A-Mediated Regulation of the TMEM241 Gene.

PubMed

Rodríguez, Alejandra; Gonzalez, Luis; Ko, Arthur; Alvarez, Marcus; Miao, Zong; Bhagat, Yash; Nikkola, Elina; Cruz-Bautista, Ivette; Arellano-Campos, Olimpia; Muñoz-Hernández, Linda L; Ordóñez-Sánchez, Maria-Luisa; Rodriguez-Guillen, Rosario; Mohlke, Karen L; Laakso, Markku; Tusie-Luna, Teresa; Aguilar-Salinas, Carlos A; Pajukanta, Päivi

2016-07-01

We recently identified a locus on chromosome 18q11.2 for high serum triglycerides in Mexicans. We hypothesize that the lead genome-wide association study single-nucleotide polymorphism rs9949617, or its linkage disequilibrium proxies, regulates 1 of the 5 genes in the triglyceride-associated region. We performed a linkage disequilibrium analysis and found 9 additional variants in linkage disequilibrium (r(2)>0.7) with the lead single-nucleotide polymorphism. To select the variants for functional analyses, we annotated the 10 variants using DNase I hypersensitive sites, transcription factor and chromatin states and identified rs17259126 as the lead candidate variant for functional in vitro validation. Using luciferase transcriptional reporter assay in liver HepG2 cells, we found that the G allele exhibits a significantly lower effect on transcription (P<0.05). The electrophoretic mobility shift and ChIPqPCR (chromatin immunoprecipitation coupled with quantitative polymerase chain reaction) assays confirmed that the minor G allele of rs17259126 disrupts an hepatocyte nuclear factor 4 α-binding site. To find the regional candidate gene, we performed a local expression quantitative trait locus analysis and found that rs17259126 and its linkage disequilibrium proxies alter expression of the regional transmembrane protein 241 (TMEM241) gene in 795 adipose RNAs from the Metabolic Syndrome In Men (METSIM) cohort (P=6.11×10(-07)-5.80×10(-04)). These results were replicated in expression profiles of TMEM241 from the Multiple Tissue Human Expression Resource (MuTHER; n=856). The Mexican genome-wide association study signal for high serum triglycerides on chromosome 18q11.2 harbors a regulatory single-nucleotide polymorphism, rs17259126, which disrupts normal hepatocyte nuclear factor 4 α binding and decreases the expression of the regional TMEM241 gene. Our data suggest that decreased transcript levels of TMEM241 contribute to increased triglyceride levels in Mexicans. © 2016 American Heart Association, Inc.

Nitric oxide system and diabetic nephropathy

PubMed Central

2014-01-01

About 30% of patients with type 2 diabetes mellitus develop clinically overt nephropathy. Hyperglycemia is necessary, but not sufficient, to cause the renal damage that leads to kidney failure. Diabetic nephropathy (DN) is a multifactorial disorder that results from interaction between environmental and genetic factors. In the present article we will review the role of the nitric oxide synthase (NOS) in the pathogenesis of DN. Nitric oxide (NO) is a short-lived gaseous lipophilic molecule produced in almost all tissues, and it has three distinct genes that encode three NOS isoforms: neuronal (nNOS), inducible (iNOS) and endothelial (eNOS). The correct function of the endothelium depends on NO, participating in hemostasis control, vascular tone regulation, proliferation of vascular smooth muscle cells and blood pressure homeostasis, among other features. In the kidney, NO plays many different roles, including control of renal and glomerular hemodynamics. The net effect of NO in the kidney is to promote natriuresis and diuresis, along with renal adaptation to dietary salt intake. The eNOS gene has been considered a potential candidate gene for DN susceptibility. Three polymorphisms have been extensively researched: G894T missense mutation (rs1799983), a 27-bp repeat in intron 4, and the T786C single nucleotide polymorphism (SNP) in the promoter (rs2070744). However, the potential link between eNOS gene variants and the induction and progression of DN yielded contradictory results in the literature. In conclusion, NOS seems to be involve in the development and progression of DN. Despite the discrepant results of many studies, the eNOS gene is also a good candidate gene for DN. PMID:24520999

Identification of candidate genes associated with fibromyalgia susceptibility in southern Spanish women: the al-Ándalus project.

PubMed

Estévez-López, Fernando; Camiletti-Moirón, Daniel; Aparicio, Virginia A; Segura-Jiménez, Víctor; Álvarez-Gallardo, Inmaculada C; Soriano-Maldonado, Alberto; Borges-Cosic, Milkana; Acosta-Manzano, Pedro; Geenen, Rinie; Delgado-Fernández, Manuel; Martínez-González, Luis J; Ruiz, Jonatan R; Álvarez-Cubero, María J

2018-02-27

Candidate-gene studies on fibromyalgia susceptibility often include a small number of single nucleotide polymorphisms (SNPs), which is a limitation. Moreover, there is a paucity of evidence in Europe. Therefore, we compared genotype frequencies of candidate SNPs in a well-characterised sample of Spanish women with fibromyalgia and healthy non-fibromyalgia women. A total of 314 women with a diagnosis of fibromyalgia (cases) and 112 non-fibromyalgia healthy (controls) women participated in this candidate-gene study. Buccal swabs were collected for DNA extraction. Using TaqMan™ OpenArray™, we analysed 61 SNPs of 33 genes related to fibromyalgia susceptibility, symptoms, or potential mechanisms. We observed that the rs841 and rs1799971 GG genotype was more frequently observed in fibromyalgia than in controls (p = 0.04 and p = 0.02, respectively). The rs2097903 AT/TT genotypes were also more often present in the fibromyalgia participants than in their control peers (p = 0.04). There were no differences for the remaining SNPs. We identified, for the first time, associations of the rs841 (guanosine triphosphate cyclohydrolase 1 gene) and rs2097903 (catechol-O-methyltransferase gene) SNPs with higher risk of fibromyalgia susceptibility. We also confirmed that the rs1799971 SNP (opioid receptor μ1 gene) might confer genetic risk of fibromyalgia. We did not adjust for multiple comparisons, which would be too stringent and yield to non-significant differences in the genotype frequencies between cases and controls. Our findings may be biologically meaningful and informative, and should be further investigated in other populations. Of particular interest is to replicate the present study in a larger independent sample to confirm or refute our findings. On the other hand, by including 61 SNPs of 33 candidate-genes with a strong rationale (they were previously investigated in relation to fibromyalgia susceptibility, symptoms or potential mechanisms), the present research is the most comprehensive candidate-gene study on fibromyalgia susceptibility to date.

Genomic Signatures Reveal New Evidences for Selection of Important Traits in Domestic Cattle

PubMed Central

Xu, Lingyang; Bickhart, Derek M.; Cole, John B.; Schroeder, Steven G.; Song, Jiuzhou; Tassell, Curtis P. Van; Sonstegard, Tad S.; Liu, George E.

2015-01-01

We investigated diverse genomic selections using high-density single nucleotide polymorphism data of five distinct cattle breeds. Based on allele frequency differences, we detected hundreds of candidate regions under positive selection across Holstein, Angus, Charolais, Brahman, and N'Dama. In addition to well-known genes such as KIT, MC1R, ASIP, GHR, LCORL, NCAPG, WIF1, and ABCA12, we found evidence for a variety of novel and less-known genes under selection in cattle, such as LAP3, SAR1B, LRIG3, FGF5, and NUDCD3. Selective sweeps near LAP3 were then validated by next-generation sequencing. Genome-wide association analysis involving 26,362 Holsteins confirmed that LAP3 and SAR1B were related to milk production traits, suggesting that our candidate regions were likely functional. In addition, haplotype network analyses further revealed distinct selective pressures and evolution patterns across these five cattle breeds. Our results provided a glimpse into diverse genomic selection during cattle domestication, breed formation, and recent genetic improvement. These findings will facilitate genome-assisted breeding to improve animal production and health. PMID:25431480

Human 8-oxoguanine DNA glycosylase gene polymorphism (Ser326Cys) and cancer risk: updated meta-analysis

PubMed Central

Park, Hae Jeong; Chung, Joo-Ho; Ban, Ju Yeon

2017-01-01

Genetic polymorphism of human 8-oxoguanine glycosylase 1 (hOGG1) has been reported to have a relationship with the risk of the development of various cancers. Many studies have described the influence of Ser326Cys polymorphism of the hOGG1 gene on cancer susceptibility. However, the results have remained inconclusive and controversial. Therefore, we performed a meta-analysis to more precisely determine the relationship between the hOGG1 polymorphism and the development of cancer. Electronic databases including PubMed, Embase, Google Scholar, and the Korean Studies Information Service System (KISS) were searched. The odds ratio (OR), 95% confidence interval (CI), and p value were calculated to assess the strength of the association with the risk of cancer using Comprehensive Meta-analysis software (Corporation, NJ, USA). The 127 studies including 38,757 cancer patients and 50,177 control subjects were analyzed for the meta-analysis. Our meta-analysis revealed that G allele of Ser326Cys polymorphism of the hOGG1 gene statistically increased the susceptibility of cancer (all population, OR = 1.092, 95% CI = 1.051-1.134, p < 0.001; in Asian, OR = 1.095, 95% CI = 1.048-1.145, p < 0.001; in Caucasian, OR = 1.097, 95% CI = 1.033-1.179, p = 0.002). Also, other genotype models showed significant association with cancer (p < 0.05, respectively). The present meta-analysis concluded that the G allele was associated with an increased risk of cancer. It suggested that the hOGG1 polymorphism may be a candidate marker of cancer. PMID:28415770

Statistics on gene-based laser speckles with a small number of scatterers: implications for the detection of polymorphism in the Chlamydia trachomatis omp1 gene

NASA Astrophysics Data System (ADS)

Ulyanov, Sergey S.; Ulianova, Onega V.; Zaytsev, Sergey S.; Saltykov, Yury V.; Feodorova, Valentina A.

2018-04-01

The transformation mechanism for a nucleotide sequence of the Chlamydia trachomatis gene into a speckle pattern has been considered. The first and second-order statistics of gene-based speckles have been analyzed. It has been demonstrated that gene-based speckles do not obey Gaussian statistics and belong to the class of speckles with a small number of scatterers. It has been shown that gene polymorphism can be easily detected through analysis of the statistical characteristics of gene-based speckles.

Natural selection on marine carnivores elaborated a diverse family of classical MHC class I genes exhibiting haplotypic gene content variation and allelic polymorphism

PubMed Central

Norman, Paul J.; Parham, Peter

2012-01-01

Pinnipeds, marine carnivores, diverged from terrestrial carnivores ~45 million years ago, before their adaptation to marine environments. This lifestyle change exposed pinnipeds to different microbiota and pathogens, with probable impact on their MHC class I genes. Investigating this question, genomic sequences were determined for 71 MHC class I variants: 27 from harbor seal and 44 from gray seal. These variants form three MHC class I gene lineages, one comprising a pseudogene. The second, a candidate nonclassical MHC class I gene, comprises a nonpolymorphic transcribed gene related to dog DLA-79 and giant panda Aime-1906. The third is the diversity lineage, which includes 62 of the 71 seal MHC class I variants. All are transcribed, and they minimally represent six harbor and 12 gray seal MHC class I genes. Besides species-specific differences in gene number, seal MHC class I haplotypes exhibit gene content variation and allelic polymorphism. Patterns of sequence variation, and of positions for positively selected sites, indicate the diversity lineage genes are the seals’ classical MHC class I genes. Evidence that expansion of diversity lineage genes began before gray and harbor seals diverged is the presence in both species of two distinctive sublineages of diversity lineage genes. Pointing to further expansion following the divergence are the presence of species-specific genes and greater MHC class I diversity in gray seals than harbor seals. The elaboration of a complex variable family of classical MHC class I genes in pinnipeds contrasts with the single, highly polymorphic classical MHC class I gene of dog and giant panda, terrestrial carnivores. PMID:23001684

Genetic Correlates of Individual Differences in Sleep Behavior of Free-Living Great Tits (Parus major)

PubMed Central

Stuber, Erica F.; Baumgartner, Christine; Dingemanse, Niels J.; Kempenaers, Bart; Mueller, Jakob C.

2016-01-01

Within populations, free-living birds display considerable variation in observable sleep behaviors, reflecting dynamic interactions between individuals and their environment. Genes are expected to contribute to repeatable between-individual differences in sleep behaviors, which may be associated with individual fitness. We identified and genotyped polymorphisms in nine candidate genes for sleep, and measured five repeatable sleep behaviors in free-living great tits (Parus major), partly replicating a previous study in blue tits (Cyanistes caeruleus). Microsatellites in the CLOCK and NPAS2 clock genes exhibited an association with sleep duration relative to night length, and morning latency to exit the nest box, respectively. Furthermore, microsatellites in the NPSR1 and PCSK2 genes associated with relative sleep duration and proportion of time spent awake at night, respectively. Given the detection rate of associations in the same models run with random markers instead of candidate genes, we expected two associations to arise by chance. The detection of four associations between candidate genes and sleep, however, suggests that clock genes, a clock-related gene, or a gene involved in the melanocortin system, could play key roles in maintaining phenotypic variation in sleep behavior in avian populations. Knowledge of the genetic architecture underlying sleep behavior in the wild is important because it will enable ecologists to assess the evolution of sleep in response to selection. PMID:26739645

Evaluation of a DLA-79 allele associated with multiple immune-mediated diseases in dogs.

PubMed

Friedenberg, Steven G; Buhrman, Greg; Chdid, Lhoucine; Olby, Natasha J; Olivry, Thierry; Guillaumin, Julien; O'Toole, Theresa; Goggs, Robert; Kennedy, Lorna J; Rose, Robert B; Meurs, Kathryn M

2016-03-01

Immune-mediated diseases are common and life-threatening disorders in dogs. Many canine immune-mediated diseases have strong breed predispositions and are believed to be inherited. However, the genetic mutations that cause these diseases are mostly unknown. As many immune-mediated diseases in humans share polymorphisms among a common set of genes, we conducted a candidate gene study of 15 of these genes across four immune-mediated diseases (immune-mediated hemolytic anemia, immune-mediated thrombocytopenia, immune-mediated polyarthritis (IMPA), and atopic dermatitis) in 195 affected and 206 unaffected dogs to assess whether causative or predictive polymorphisms might exist in similar genes in dogs. We demonstrate a strong association (Fisher's exact p = 0.0004 for allelic association, p = 0.0035 for genotypic association) between two polymorphic positions (10 bp apart) in exon 2 of one allele in DLA-79, DLA-79*001:02, and multiple immune-mediated diseases. The frequency of this allele was significantly higher in dogs with immune-mediated disease than in control dogs (0.21 vs. 0.12) and ranged from 0.28 in dogs with IMPA to 0.15 in dogs with atopic dermatitis. This allele has two non-synonymous substitutions (compared with the reference allele, DLA-79*001:01), resulting in F33L and N37D amino acid changes. These mutations occur in the peptide-binding pocket of the protein, and based upon our computational modeling studies, are likely to affect critical interactions with the peptide N-terminus. Further studies are warranted to confirm these findings more broadly and to determine the specific mechanism by which the identified variants alter canine immune system function.

Interactions between MAOA and SYP polymorphisms were associated with symptoms of attention-deficit/hyperactivity disorder in Chinese Han subjects.

PubMed

Gao, Qian; Liu, Lu; Li, Hai-Mei; Tang, Yi-Lang; Wu, Zhao-Min; Chen, Yun; Wang, Yu-Feng; Qian, Qiu-Jin

2015-01-01

As candidate genes of attention--deficit/hyperactivity disorder (ADHD), monoamine oxidase A (MAOA), and synaptophysin (SYP) are both on the X chromosome, and have been suggested to be associated with the predominantly inattentive subtype (ADHD-I). The present study is to investigate the potential gene-gene interaction (G × G) between rs5905859 of MAOA and rs5906754 of SYP for ADHD in Chinese Han subjects. For family-based association study, 177 female trios were included. For case-control study, 1,462 probands and 807 normal controls were recruited. The ADHD Rating Scale-IV (ADHD-RS-IV) was used to evaluate ADHD symptoms. Pedigree-based generalized multifactor dimensionality reduction (PGMDR) for female ADHD trios indicated significant gene interaction effect of rs5905859 and rs5906754. Generalized multifactor dimensionality reduction (GMDR) indicated potential gene-gene interplay on ADHD RS-IV scores in female ADHD-I. No associations were observed in male subjects in case-control analysis. In conclusion, our findings suggested that the interaction of MAOA and SYP may be involved in the genetic mechanism of ADHD-I subtype and predict ADHD symptoms. © 2014 Wiley Periodicals, Inc.

Deploying QTL-seq for rapid delineation of a potential candidate gene underlying major trait-associated QTL in chickpea

PubMed Central

Das, Shouvik; Upadhyaya, Hari D.; Bajaj, Deepak; Kujur, Alice; Badoni, Saurabh; Laxmi; Kumar, Vinod; Tripathi, Shailesh; Gowda, C. L. Laxmipathi; Sharma, Shivali; Singh, Sube; Tyagi, Akhilesh K.; Parida, Swarup K.

2015-01-01

A rapid high-resolution genome-wide strategy for molecular mapping of major QTL(s)/gene(s) regulating important agronomic traits is vital for in-depth dissection of complex quantitative traits and genetic enhancement in chickpea. The present study for the first time employed a NGS-based whole-genome QTL-seq strategy to identify one major genomic region harbouring a robust 100-seed weight QTL using an intra-specific 221 chickpea mapping population (desi cv. ICC 7184 × desi cv. ICC 15061). The QTL-seq-derived major SW QTL (CaqSW1.1) was further validated by single-nucleotide polymorphism (SNP) and simple sequence repeat (SSR) marker-based traditional QTL mapping (47.6% R2 at higher LOD >19). This reflects the reliability and efficacy of QTL-seq as a strategy for rapid genome-wide scanning and fine mapping of major trait regulatory QTLs in chickpea. The use of QTL-seq and classical QTL mapping in combination narrowed down the 1.37 Mb (comprising 177 genes) major SW QTL (CaqSW1.1) region into a 35 kb genomic interval on desi chickpea chromosome 1 containing six genes. One coding SNP (G/A)-carrying constitutive photomorphogenic9 (COP9) signalosome complex subunit 8 (CSN8) gene of these exhibited seed-specific expression, including pronounced differential up-/down-regulation in low and high seed weight mapping parents and homozygous individuals during seed development. The coding SNP mined in this potential seed weight-governing candidate CSN8 gene was found to be present exclusively in all cultivated species/genotypes, but not in any wild species/genotypes of primary, secondary and tertiary gene pools. This indicates the effect of strong artificial and/or natural selection pressure on target SW locus during chickpea domestication. The proposed QTL-seq-driven integrated genome-wide strategy has potential to delineate major candidate gene(s) harbouring a robust trait regulatory QTL rapidly with optimal use of resources. This will further assist us to extrapolate the molecular mechanism underlying complex quantitative traits at a genome-wide scale leading to fast-paced marker-assisted genetic improvement in diverse crop plants, including chickpea. PMID:25922536

Plasma urotensin-2 level and Thr21Met but not Ser89Asn polymorphisms of the urotensin-2 gene are associated with migraines.

PubMed

Geyik, Sırma; Ergun, Sercan; Kuzudişli, Samiye; Şensoy, Figen; Temiz, Ebru; Altunışık, Erman; Korkmaz, Murat; Dağlı, Hasan; Kul, Seval; Akçalı, Aylin; Neyal, Ayşe Münife

2016-01-01

Urotensin-II (U-II) is a peptide recognized by its potent vasoconstrictor activity in many vascular events, however the role of urotensin-II in migraine has not been considered yet. The molecular mechanisms and genetics of migraine have not been fully clarified yet, but it is well-known that vascular changes considerably contribute in pathophysiology of migraine and also its complications. The aim of this study was to analyze the plasma U-II levels along with genotype distributions and allele frequencies for UTS2 Thr21Met and Ser89Asn polymorphisms among the patients with migraine without aura (MWoA). One hundred eighty-six patients with MWoA and 171 healthy individuals were included in this study. Plasma U-II levels were measured in attack free period. The genotype and allele frequencies for the Thr21Met (T21M) and Ser89Asn (S89N) polymorphisms in the UTS2 gene were analyzed. Plasma U-II levels were significantly higher in MWoA patients (p = 0.002). We detected a significant association between the T21M polymorphism in the UTS2 gene and migraine (53.8 % in patients, 40.4 % in controls, p = 0.035), but not with S89N polymorphism (p = 0.620). A significant relationship was found between U-II levels and MIDAS score (β = 0.508, p = 0.001). Our study suggests that U-II may play a role in migraine pathogenesis; also Thr21Met polymorphism was associated with the risk of migraine disease. Further studies are needed for considering the role of U-II in migraine pathophysiology and for deciding if UTS2 gene may be a novel candidate gene in migraine cases.

Genetic variation in genes for the xenobiotic-metabolizing enzymes CYP1A1, EPHX1, GSTM1, GSTT1 and GSTP1 and susceptibility to colorectal cancer in Lynch syndrome

PubMed Central

Pande, Mala; Amos, Christopher I.; Osterwisch, Daniel R.; Chen, Jinyun; Lynch, Patrick M.; Broaddus, Russell; Frazier, Marsha L.

2011-01-01

Individuals with Lynch syndrome are predisposed to cancer due to an inherited DNA mismatch repair gene mutation. However, there is significant variability observed in disease expression, likely due to the influence of other environmental, lifestyle, or genetic factors. Polymorphisms in genes encoding xenobiotic-metabolizing enzymes may modify cancer risk by influencing the metabolism and clearance of potential carcinogens from the body. In this retrospective analysis, we examined key candidate gene polymorphisms in CYP1A1, EPHX1, GSTT1, GSTM1, and GSTP1 as modifiers of age at onset of colorectal cancer among 257 individuals with Lynch syndrome. We found that subjects heterozygous for CYP1A1 I462V (c.1384A>G) developed colorectal cancer 4 years earlier than those with the homozygous wild-type genotype (median ages 39 and 43 years, respectively; log-rank test P = 0.018). Furthermore, being heterozygous for the CYP1A1 polymorphisms, I462V and Msp1 (g.6235T>C), was associated with an increased risk for developing colorectal cancer [adjusted hazard ratio for AG relative to AA = 1.78, 95% CI = 1.16–2.74, P = 0.008; and hazard ratio for TC relative to TT = 1.53, 95% CI = 1.06–2.22, P = 0.02]. Since homozygous variants for both CYP1A1 polymorphisms were rare, risk estimates were imprecise. None of the other gene polymorphisms examined were associated with an earlier onset age for colorectal cancer. Our results suggest that the I462V and Msp1 polymorphisms in CYP1A1 may be an additional susceptibility factor for disease expression in Lynch syndrome since they modify the age of colorectal cancer onset by up to 4 years. PMID:18768509

Analysis of the Association between Catechol-O-Methyltransferase Val158Met and Male Sexual Orientation.

PubMed

Yu, Wei; Tu, Dan; Hong, Fuchang; Wang, Jing; Liu, Xiaoli; Cai, Yumao; Xu, Ruiwei; Zhao, Guanglu; Wang, Feng; Pan, Hong; Wu, Shinan; Feng, Tiejian; Wang, Binbin

2015-09-01

Male sexual orientation is thought to have a genetic component. However, previous studies have failed to generate positive results from among candidate genes. Catechol-O-methyltransferase (COMT), located on chromosome 22, has six exons, spans 27 kb, and encodes a protein of 271 amino acids. COMT has an important role in regulating the embryonic levels of catecholamine neurotransmitters (such as dopamine, norepinephrine, and epinephrine) and estrogens. COMT is also thought to be related to sexual orientation. This study aimed to investigate the relationship between the COMT Val158Met variant and male sexual orientation. We performed association analysis of the COMT gene single nucleotide polymorphism, Val158Met, in 409 homosexual cases and 387 heterosexual control Chinese men. COMT polymorphism status was determined using a polymerase chain reaction-based assay. Polymerase chain reaction was performed to genotype the COMT Val158Met polymorphism. The frequency differences of the genotype and alleles distribution between the male homosexual and control groups. Significant differences, both in genotype and alleles, between male homosexual individuals and controls indicated a genetic component related to male homosexuality. The Val allele recessive model could be an interrelated genetic model of the cause of male homosexuality. The COMT Val158Met variant might be associated with male sexual orientation and a recessive model was suggested. © 2015 International Society for Sexual Medicine.

Single-nucleotide polymorphisms studied for associations with urinary toxicity from (125)I prostate brachytherapy implants.

PubMed

Usmani, Nawaid; Leong, Nelson; Martell, Kevin; Lan, Lanna; Ghosh, Sunita; Pervez, Nadeem; Pedersen, John; Yee, Don; Murtha, Albert; Amanie, John; Sloboda, Ron; Murray, David; Parliament, Matthew

2014-01-01

To identify clinical, dosimetric, and genetic factors that are associated with late urinary toxicity after a (125)I prostate brachytherapy implant. Genomic DNA from 296 men treated with (125)I prostate brachytherapy monotherapy was extracted from saliva samples for this study. A retrospective database was compiled including clinical, dosimetric, and toxicity data for this cohort of patients. Fourteen candidate single-nucleotide polymorphism (SNPs) from 13 genes (TP53, ERCC2, GSTP1, NOS, TGFβ1, MSH6, RAD51, ATM, LIG4, XRCC1, XRCC3, GSTA1, and SOD2) were tested in this cohort for correlations with toxicity. This study identified 217 men with at least 2 years of followup. Of these, 39 patients developed Grade ≥2 late urinary complications with a transurethral resection of prostate, urethral stricture, gross hematuria, or a sustained increase in their International Prostate Symptom Score. The only clinical or dosimetric factor that was associated with late urinary toxicity was age (p = 0.02). None of the 14 SNPs tested in this study were associated with late urinary toxicity in the univariate analysis. This study identified age as the only variable being associated with late urinary toxicity. However, the small sample size and the candidate gene approach used in this study mean that further investigations are essential. Genome-wide association studies are emerging as the preferred approach for future radiogenomic studies to overcome the limitations from a candidate gene approach. Crown Copyright © 2014. Published by Elsevier Inc. All rights reserved.

Candidate gene association analysis for milk yield, composition, urea nitrogen and somatic cell scores in Brown Swiss cows.

PubMed

Cecchinato, A; Ribeca, C; Chessa, S; Cipolat-Gotet, C; Maretto, F; Casellas, J; Bittante, G

2014-07-01

The aim of this study was to investigate 96 single-nucleotide polymorphisms (SNPs) from 54 candidate genes, and test the associations of the polymorphic SNPs with milk yield, composition, milk urea nitrogen (MUN) content and somatic cell score (SCS) in individual milk samples from Italian Brown Swiss cows. Milk and blood samples were collected from 1271 cows sampled once from 85 herds. Milk production, quality traits (i.e. protein, casein, fat and lactose percentages), MUN and SCS were measured for each milk sample. Genotyping was performed using a custom Illumina VeraCode GoldenGate approach. A Bayesian linear animal model that considered the effects of herd, days in milk, parity, SNP genotype and additive polygenic effect was used for the association analysis. Our results showed that 14 of the 51 polymorphic SNPs had relevant additive effects on at least one of the aforementioned traits. Polymorphisms in the glucocorticoid receptor DNA-binding factor 1 (GRLF1), prolactin receptor (PRLR) and chemokine ligand 2 (CCL2) were associated with milk yield; an SNP in the stearoyl-CoA desaturase (SCD-1) was related to fat content; SNPs in the caspase recruitment domain 15 protein (CARD15) and lipin 1 (LPIN1) affected the protein and casein contents; SNPs in growth hormone 1 (GH1), lactotransferrin (LTF) and SCD-1 were relevant for casein number; variants in beta casein (CSN2), GH1, GRLF1 and LTF affected lactose content; SNPs in beta-2 adrenergic receptor (ADRB2), serpin peptidase inhibitor (PI) and SCD-1 were associated with MUN; and SNPs in acetyl-CoA carboxylase alpha (ACACA) and signal transducer and activator of transcription 5A (STAT5A) were relevant in explaining the variation of SCS. Although further research is needed to validate these SNPs in other populations and breeds, the association between these markers and milk yield, composition, MUN and SCS could be exploited in gene-assisted selection programs for genetic improvement purposes.

Transcript level of the porcine ME1 gene is affected by SNP in its 3'UTR, which is also associated with subcutaneous fat thickness.

PubMed

Bartz, M; Kociucka, B; Mankowska, M; Switonski, M; Szydlowski, M

2014-08-01

Pork quality depends on multiple factors, including fatty acid composition in muscle and fat tissues. The ME1 gene is a strong candidate for fat accumulation, as it encodes the malic enzyme, which is required for fatty acid synthesis. We identified seven new polymorphisms in 3'UTR of the ME1 gene and moreover confirmed the presence of 4 polymorphisms detected previously. Interestingly, the studied Duroc pigs were monomorphic at all these polymorphic sites, while in 3 other breeds (Pietrain, Polish Landrace and Polish Large White), the polymorphisms were unevenly distributed. One of the novel SNPs (c.*488A>G) was found in the Polish Large White and the Polish Landrace only, and the association studies revealed that it was significantly associated with backfat thickness and average daily weight gain in the Polish Landrace (N = 207) and the Polish Large White (N = 157). This SNP was differently associated with ME1 transcript level in muscle and backfat. The in silico analysis of another novel SNP (c.*548C>T) indicated that it is located within a binding sequence conserved among vertebrates for the miR-30 family in 3'UTR of the ME1. It was shown that in the longissimus muscle, but not in adipose tissue, CT gilts compared with CC ones had significantly lower levels of the ME1 transcript. This polymorphism, however, was not associated with production traits. Additionally, we observed that transcript level of the ME1 was significantly higher in subcutaneous fat than in the longissimus muscle, as well as both investigated tissues of the Polish Landrace when compared to the other breeds. However, no association was found between this polymorphism and fatty acid profiles. We conclude that the ME1 gene polymorphism (c.*488A>G) is a potential marker for porcine backfat thickness. © 2013 Blackwell Verlag GmbH.

Association study of NDST3 gene for schizophrenia, bipolar disorder, major depressive disorder in the Han Chinese population.

PubMed

Wang, Lin; Chen, Jianhua; Li, Zhiqiang; Sun, Weiming; Chen, Boyu; Li, Sining; Li, Weidong; Lu, Dajiang; Wang, Yonggang; Shi, Yongyong

2018-01-01

The NDST3 gene at 4q26 was a functional candidate gene for mental disorders. Recently, a novel genome-wide significant risk locus at chromosome 4q26 was identified and the top single nucleotide polymorphism rs11098403 in the vicinity of NDST3 gene was reported to confer risk of schizophrenia in Caucasian. Nevertheless, association between NDST3 gene polymorphisms and schizophrenia, bipolar disorder, or major depressive disorders has not been well studied in the Han Chinese population. To further investigate whether NDST3 is a risk gene for these mental disorders, we genotyped and analyzed eight tag SNPs (rs11098403, rs10857057, rs2389521, rs4833564, rs6837896, rs7689157, rs3817274, rs609512) covering NDST3 gene in 1,248 schizophrenia cases, 1,056 major depression cases, 1,344 bipolar disorder cases, and 1,248 controls of Chinese origin. However, there was no significant difference in allelic or genotypic frequency observed between each case group and healthy controls. Accordingly, our study does not support that the NDST3 gene plays a major role in schizophrenia, bipolar disorder, and major depressive disorder in the Han Chinese population. © 2017 Wiley Periodicals, Inc.

No association between catechol-O-methyltransferase polymorphisms and neurotic disorders among mainland Chinese university students.

PubMed

Kou, Changgui; Meng, Xiangfei; Xie, Bing; Shi, Jieping; Yu, Qiong; Yu, Yaqin; D'Arcy, Carl

2012-07-30

This study investigates the genetic association between catechol-O-methyltransferase (COMT) gene polymorphisms and neurotic disorders. Data were derived from a case-control association study of 255 undergraduates affected by neurotic disorders and 269 matched healthy undergraduate controls. The polymorphisms of eight tag single nucleotide polymorphisms (SNPs) on the COMT gene were tested using polymerase chain reaction (PCR)-based Ligase Detection Reaction (PCR-LDR). The eight tag SNPs on the COMT gene assessed were not associated with neurotic disorders. Our finding suggests that the COMT gene may not be a susceptibility gene for neurotic disorders. Copyright © 2012 Elsevier Ltd. All rights reserved.

Family-Based Association Testing of OCD-Associated SNPs of SLC1A1 in an Autism Sample

PubMed Central

Brune, Camille W.; Kim, Soo-Jeong; Hanna, Gregory L.; Courchesne, Eric; Lord, Catherine; Leventhal, Bennett L.; Cook, Edwin H.

2009-01-01

Reports identified the neuronal glutamate transporter gene, SLC1A1 (OMIM 133550, chromosome 9p24), as a positional and functional candidate gene for obsessive–compulsive disorder (OCD). The presence of obsessions and compulsions similar to OCD in autism, the identification of this region in a genome-wide linkage analysis of individuals with autism spectrum disorders (ASDs), and the hypothesized role of glutamate in ASDs make SLC1A1 a candidate gene for ASD as well. To test for association between SLC1A1 and autism, we typed three single nucleotide polymorphisms (SNPs, rs301430, rs301979, rs301434) previously associated with OCD in 86 strictly defined trios with autism. Family-Based Association Tests (FBAT) with additive and recessive models were used to check for association. Additionally, an rs301430–rs301979 haplotype identified for OCD was investigated. FBAT revealed nominally significant association between autism and one SNP under a recessive model. The G allele of rs301979 was undertransmitted (equivalent to overtransmission of the C allele under a dominant model) to individuals with autism (Z = −2.47, P = 0.01). The G allele was also undertransmitted in the T–G haplotype under the recessive model (Z = −2.41, P = 0.02). Both findings were also observed in the male-only sample. However, they did not withstand correction for multiple comparisons. PMID:19360657

Polymorphism of the renalase gene in gestational diabetes mellitus.

PubMed

Fatima, Syeda Sadia; Jamil, Zehra; Alam, Faiza; Malik, Hajira Zafar; Madhani, Sarosh Irfan; Ahmad, Muhammad Saad; Shabbir, Tayyab; Rehmani, Muhammed Noman; Rabbani, Amna

2017-01-01

Renalase is considered as a novel candidate gene for type 2 diabetes. In this study, we aimed to investigate the relationship of serum renalase and two single nucleotide polymorphisms with gestational diabetes mellitus. One hundred and ninety-eight normotensive pregnant females (n = 99 gestational diabetes mellitus; n = 99 euglycemic pregnant controls) were classified according to the International Association of the Diabetes and Pregnancy Study criteria. Fasting and 2-h post glucose load blood levels and anthropometric assessment was performed. Serum renalase was measured using enzyme-linked immunosorbent assay, whereas DNA samples were genotyped for renalase single nucleotide polymorphisms rs2576178 and rs10887800 using Polymerase chain reaction-Restriction fragment length polymorphism method. In an age-matched case control study, no difference was observed in the serum levels of renalase (p > 0.05). The variant rs10887800 showed an association with gestational diabetes mellitus and remained significant after multiple adjustments (p < 0.05), whereas rs2576178 showed weak association (p = 0.030) that was lost after multiple adjustments (p = 0.09). We inferred a modest association of the rs10887800 polymorphism with gestational diabetes. Although gestational diabetes mellitus is self-reversible, yet presence of this minor G allele might predispose to metabolic syndrome phenotypes in near the future.

Intra- and inter-isolate variation of ribosomal and protein-coding genes in Pleurotus: implications for molecular identification and phylogeny on fungal groups.

PubMed

He, Xiao-Lan; Li, Qian; Peng, Wei-Hong; Zhou, Jie; Cao, Xue-Lian; Wang, Di; Huang, Zhong-Qian; Tan, Wei; Li, Yu; Gan, Bing-Cheng

2017-06-26

The internal transcribed spacer (ITS), RNA polymerase II second largest subunit (RPB2), and elongation factor 1-alpha (EF1α) are often used in fungal taxonomy and phylogenetic analysis. As we know, an ideal molecular marker used in molecular identification and phylogenetic studies is homogeneous within species, and interspecific variation exceeds intraspecific variation. However, during our process of performing ITS, RPB2, and EF1α sequencing on the Pleurotus spp., we found that intra-isolate sequence polymorphism might be present in these genes because direct sequencing of PCR products failed in some isolates. Therefore, we detected intra- and inter-isolate variation of the three genes in Pleurotus by polymerase chain reaction amplification and cloning in this study. Results showed that intra-isolate variation of ITS was not uncommon but the polymorphic level in each isolate was relatively low in Pleurotus; intra-isolate variations of EF1α and RPB2 sequences were present in an unexpectedly high amount. The polymorphism level differed significantly between ITS, RPB2, and EF1α in the same individual, and the intra-isolate heterogeneity level of each gene varied between isolates within the same species. Intra-isolate and intraspecific variation of ITS in the tested isolates was less than interspecific variation, and intra-isolate and intraspecific variation of RPB2 was probably equal with interspecific divergence. Meanwhile, intra-isolate and intraspecific variation of EF1α could exceed interspecific divergence. These findings suggested that RPB2 and EF1α are not desirable barcoding candidates for Pleurotus. We also discussed the reason why rDNA and protein-coding genes showed variants within a single isolate in Pleurotus, but must be addressed in further research. Our study demonstrated that intra-isolate variation of ribosomal and protein-coding genes are likely widespread in fungi. This has implications for studies on fungal evolution, taxonomy, phylogenetics, and population genetics. More extensive sampling of these genes and other candidates will be required to ensure reliability as phylogenetic markers and DNA barcodes.

DNA Sequence Polymorphism of the Lactate Dehydrogenase Genefrom Iranian Plasmodium vivax and Plasmodium falciparum Isolates.

PubMed

Getacher Feleke, Daniel; Nateghpour, Mehdi; Motevalli Haghi, Afsaneh; Hajjaran, Homa; Farivar, Leila; Mohebali, Mehdi; Raoofian, Reza

2015-01-01

Parasite lactate dehydrogenase (pLDH) is extensively employed as malaria rapid diagnostic tests (RDTs). Moreover, it is a well-known drug target candidate. However, the genetic diversity of this gene might influence performance of RDT kits and its drug target candidacy. This study aimed to determine polymorphism of pLDH gene from Iranian isolates of P. vivax and P. falciparum. Genomic DNA was extracted from whole blood of microscopically confirmed P. vivax and P. falciparum infected patients. pLDH gene of P. falciparum and P. vivax was amplified using conventional PCR from 43 symptomatic malaria patients from Sistan and Baluchistan Province, Southeast Iran from 2012 to 2013. Sequence analysis of 15 P. vivax LDH showed fourteen had 100% identity with P. vivax Sal-1 and Belem strains. Two nucleotide substitutions were detected with only one resulted in amino acid change. Analysis of P. falciparum LDH sequences showed six of the seven sequences had 100% homology with P. falciparum 3D7 and Mzr-1. Moreover, PfLDH displayed three nucleotide changes that resulted in changing only one amino acid. PvLDH and PfLDH showed 75%-76% nucleotide and 90.4%-90.76% amino acid homology. pLDH gene from Iranian P. falciparum and P. vivax isolates displayed 98.8-100% homology with 1-3 nucleotide substitutions. This indicated this gene was relatively conserved. Additional studies can be done weather this genetic variation can influence the performance of pLDH based RDTs or not.

Gender-related association of AGT gene variants (M235T and T174M) with essential hypertension--a case-control study.

PubMed

Mohana, Vamsi U; Swapna, N; Surender, Reddy S; Vishnupriya, S; Padma, Tirunilai

2012-01-01

The human angiotensinogen (AGT) is a promising candidate gene for evaluating susceptibility to essential hypertension (EH). We aimed to assess the association of the variants of AGT gene and the extent of risk involved in developing EH. A case-control study was designed to compare 279 hypertensive patients with 200 normotensive subjects. The frequency distribution of M235T and T174M polymorphisms of AGT gene was assessed by polymerase chain reaction (PCR)-restriction fragment length polymorphism (RFLP) method. A haplotype analysis was done to determine the risk conferred by the combination of alleles of the two polymorphisms for EH. The genotype distribution of the T174M variant differed significantly between hypertensives and normotensives, whereas genotypes of M235T variant did not show such difference. For M235T, MM genotype conferred an increase in risk for hypertension in women (odds ratios (OR) = 2.82; 95% confidence interval (CI) = 1.22-6.49). For the variant T174M, the TM genotype frequency was elevated in hypertensive females (36.5%) as compared to controls (18.8 %; P = .034). The 174M allele was more prevalent among female hypertensives than among female controls (0.20 vs. 0.12; P = .059). The haplotype analysis showed a significant association for the haplotypes of paired markers (M235 and 174M) with a χ(2) value of 8.037 (P = .045). Our findings suggest that the polymorphic variants of AGT gene-M235T and T174M-show association with hypertension.