Transcriptome and Complexity-Reduced, DNA-Based Identification of Intraspecies Single-Nucleotide Polymorphisms in the Polyploid Gossypium hirsutum L.

PubMed Central

Zhu, Qian-Hao; Spriggs, Andrew; Taylor, Jennifer M.; Llewellyn, Danny; Wilson, Iain

2014-01-01

Varietal single nucleotide polymorphisms (SNPs) are the differences within one of the two subgenomes between different tetraploid cotton varieties and have not been practically used in cotton genetics and breeding because they are difficult to identify due to low genetic diversity and very high sequence identity between homeologous genes in cotton. We have used transcriptome and restriction site−associated DNA sequencing to identify varietal SNPs among 18 G. hirsutum varieties based on the rationale that varietal SNPs can be more confidently called when flanked by subgenome-specific SNPs. Using transcriptome data, we successfully identified 37,413 varietal SNPs and, of these, 22,121 did not have an additional varietal SNP within their 20-bp flanking regions so can be used in most SNP genotyping assays. From restriction site−associated DNA sequencing data, we identified an additional 3090 varietal SNPs between two of the varieties. Of the 1583 successful SNP assays achieved using different genotyping platforms, 1363 were verified. Many of the SNPs behaved as dominant markers because of coamplification from homeologous loci, but the number of SNPs acting as codominant markers increased when one or more subgenome-specific SNP(s) were incorporated in their assay primers, giving them greater utility for breeding applications. A G. hirsutum genetic map with 1244 SNP markers was constructed covering 5557.42 centiMorgan and used to map qualitative and quantitative traits. This collection of G. hirsutum varietal SNPs complements existing intra-specific SNPs and provides the cotton community with a valuable marker resource applicable to genetic analyses and breeding programs. PMID:25106949

Evaluation and identification of damaged single nucleotide polymorphisms in COL1A1 gene involved in osteoporosis

PubMed Central

Alsaif, Mohammed A.; Al Shammari, Sulaiman A.; Alhamdan, Adel A.

2012-01-01

Introduction Single-nucleotide polymorphisms (SNPs) are biomarkers for exploring the genetic basis of many complex human diseases. The prediction of SNPs is promising in modern genetic analysis but it is still a great challenge to identify the functional SNPs in a disease-related gene. The computational approach has overcome this challenge and an increase in the successful rate of genetic association studies and reduced cost of genotyping have been achieved. The objective of this study is to identify deleterious non-synonymous SNPs (nsSNPs) associated with the COL1A1 gene. Material and methods The SNPs were retrieved from the Single Nucleotide Polymorphism Database (dbSNP). Using I-Mutant, protein stability change was calculated. The potentially functional nsSNPs and their effect on proteins were predicted by PolyPhen and SIFT respectively. FASTSNP was used for estimation of risk score. Results Our analysis revealed 247 SNPs as non-synonymous, out of which 5 nsSNPs were found to be least stable by I-Mutant 2.0 with a DDG value of > –1.0. Four nsSNPs, namely rs17853657, rs17857117, rs57377812 and rs1059454, showed a highly deleterious tolerance index score of 0.00 with a change in their physicochemical properties by the SIFT server. Seven nsSNPs, namely rs1059454, rs8179178, rs17853657, rs17857117, rs72656340, rs72656344 and rs72656351, were found to be probably damaging with a PSIC score difference between 2.0 and 3.5 by the PolyPhen server. Three nsSNPs, namely rs1059454, rs17853657 and rs17857117, were found to be highly polymorphic with a risk score of 3-4 with a possible effect of non-conservative change and splicing regulation by FASTSNP. Conclusions Three nsSNPs, namely rs1059454, rs17853657 and rs17857117, are potential functional polymorphisms that are likely to have a functional impact on the COL1A1 gene. PMID:24273577

CGDSNPdb: a database resource for error-checked and imputed mouse SNPs.

PubMed

Hutchins, Lucie N; Ding, Yueming; Szatkiewicz, Jin P; Von Smith, Randy; Yang, Hyuna; de Villena, Fernando Pardo-Manuel; Churchill, Gary A; Graber, Joel H

2010-07-06

The Center for Genome Dynamics Single Nucleotide Polymorphism Database (CGDSNPdb) is an open-source value-added database with more than nine million mouse single nucleotide polymorphisms (SNPs), drawn from multiple sources, with genotypes assigned to multiple inbred strains of laboratory mice. All SNPs are checked for accuracy and annotated for properties specific to the SNP as well as those implied by changes to overlapping protein-coding genes. CGDSNPdb serves as the primary interface to two unique data sets, the 'imputed genotype resource' in which a Hidden Markov Model was used to assess local haplotypes and the most probable base assignment at several million genomic loci in tens of strains of mice, and the Affymetrix Mouse Diversity Genotyping Array, a high density microarray with over 600,000 SNPs and over 900,000 invariant genomic probes. CGDSNPdb is accessible online through either a web-based query tool or a MySQL public login. Database URL: http://cgd.jax.org/cgdsnpdb/

Automated detection system of single nucleotide polymorphisms using two kinds of functional magnetic nanoparticles

NASA Astrophysics Data System (ADS)

Liu, Hongna; Li, Song; Wang, Zhifei; Li, Zhiyang; Deng, Yan; Wang, Hua; Shi, Zhiyang; He, Nongyue

2008-11-01

Single nucleotide polymorphisms (SNPs) comprise the most abundant source of genetic variation in the human genome wide codominant SNPs identification. Therefore, large-scale codominant SNPs identification, especially for those associated with complex diseases, has induced the need for completely high-throughput and automated SNP genotyping method. Herein, we present an automated detection system of SNPs based on two kinds of functional magnetic nanoparticles (MNPs) and dual-color hybridization. The amido-modified MNPs (NH 2-MNPs) modified with APTES were used for DNA extraction from whole blood directly by electrostatic reaction, and followed by PCR, was successfully performed. Furthermore, biotinylated PCR products were captured on the streptavidin-coated MNPs (SA-MNPs) and interrogated by hybridization with a pair of dual-color probes to determine SNP, then the genotype of each sample can be simultaneously identified by scanning the microarray printed with the denatured fluorescent probes. This system provided a rapid, sensitive and highly versatile automated procedure that will greatly facilitate the analysis of different known SNPs in human genome.

A New Single Nucleotide Polymorphism Database for Rainbow Trout Generated Through Whole Genome Resequencing.

PubMed

Gao, Guangtu; Nome, Torfinn; Pearse, Devon E; Moen, Thomas; Naish, Kerry A; Thorgaard, Gary H; Lien, Sigbjørn; Palti, Yniv

2018-01-01

Single-nucleotide polymorphisms (SNPs) are highly abundant markers, which are broadly distributed in animal genomes. For rainbow trout ( Oncorhynchus mykiss ), SNP discovery has been previously done through sequencing of restriction-site associated DNA (RAD) libraries, reduced representation libraries (RRL) and RNA sequencing. Recently we have performed high coverage whole genome resequencing with 61 unrelated samples, representing a wide range of rainbow trout and steelhead populations, with 49 new samples added to 12 aquaculture samples from AquaGen (Norway) that we previously used for SNP discovery. Of the 49 new samples, 11 were double-haploid lines from Washington State University (WSU) and 38 represented wild and hatchery populations from a wide range of geographic distribution and with divergent migratory phenotypes. We then mapped the sequences to the new rainbow trout reference genome assembly (GCA_002163495.1) which is based on the Swanson YY doubled haploid line. Variant calling was conducted with FreeBayes and SAMtools mpileup , followed by filtering of SNPs based on quality score, sequence complexity, read depth on the locus, and number of genotyped samples. Results from the two variant calling programs were compared and genotypes of the double haploid samples were used for detecting and filtering putative paralogous sequence variants (PSVs) and multi-sequence variants (MSVs). Overall, 30,302,087 SNPs were identified on the rainbow trout genome 29 chromosomes and 1,139,018 on unplaced scaffolds, with 4,042,723 SNPs having high minor allele frequency (MAF > 0.25). The average SNP density on the chromosomes was one SNP per 64 bp, or 15.6 SNPs per 1 kb. Results from the phylogenetic analysis that we conducted indicate that the SNP markers contain enough population-specific polymorphisms for recovering population relationships despite the small sample size used. Intra-Population polymorphism assessment revealed high level of polymorphism and heterozygosity within each population. We also provide functional annotation based on the genome position of each SNP and evaluate the use of clonal lines for filtering of PSVs and MSVs. These SNPs form a new database, which provides an important resource for a new high density SNP array design and for other SNP genotyping platforms used for genetic and genomics studies of this iconic salmonid fish species.

Association of calpain 10 gene polymorphisms with type 2 diabetes mellitus in Southern Indians.

PubMed

Bodhini, Dhanasekaran; Radha, Venkatesan; Ghosh, Saurabh; Sanapala, Krishna R; Majumder, Partha P; Rao, Manchanahalli Rangaswamy Satyanarayana; Mohan, Viswanathan

2011-05-01

The aim was to investigate the association between the CAPN10 gene single nucleotide polymorphisms (SNPs) -44 (rs2975760), -43 (rs3792267), -19 (rs3842570), and -63 (rs5030952) and type 2 diabetes mellitus in an Asian Indian population in Southern India. A total of 1443 subjects, 794 normal glucose tolerant (NGT) and 649 type 2 diabetes mellitus subjects, were randomly selected from the Chennai Urban Rural Epidemiology Study. These subjects were genotyped for the 4 CAPN10 SNPs using polymerase chain reaction-restriction fragment length polymorphism and validated by direct sequencing. None of the 4 SNPs showed any significant differences in the genotypic distribution among the NGT and type 2 diabetes mellitus subjects (P = .20, .86, .34, and .39 for SNPs -44, -43, -19, and -63, respectively). The NGT subjects with the 11 genotype of the SNP -63 had significantly higher 2-hour postload plasma glucose (mean ± SD, 5.66 ± 1.05 mmol/L) levels compared with the combined 12 and 22 genotype group (5.33 ± 1.11 mmol/L, P = .004). The P value remained significant even after adjusting for age, sex, body mass index, smoking, and alcohol consumption (nominal P = .008). No significant difference in the biochemical parameters was observed when the subjects were stratified according to the other SNPs. The 2111 haplotype corresponding to SNPs -44, -43, -19, and -63 showed a significant difference in the proportion among NGT (0.18) and type 2 diabetes mellitus subjects (0.22, nominal P = .014). Although the Bonferroni correction based on the asymptotic test does not preserve this significance, the test based on the empirical distribution remained significant. In conclusion, our study raises the possibility that the 2111 haplotype of SNPs -44, -43, -19, and -63 may be associated with type 2 diabetes mellitus, although none of these SNPs may be individually associated with diabetes. Copyright © 2011 Elsevier Inc. All rights reserved.

Prospects for inferring pairwise relationships with single nucleotide polymorphisms

Treesearch

Jeffery C. Glaubitz; O. Eugene, Jr. Rhodes; J. Andrew DeWoody

2003-01-01

An extraordinarily large number of single nucleotide polymorphisms (SNPs) are now available in humans as well as in other model organisms. Technological advancements may soon make it feasible to assay hundreds of SNPs in virtually any organism of interest. One potential application of SNPs is the determination of pairwise genetic relationships in populations without...

Impact of SNPs on Protein Phosphorylation Status in Rice (Oryza sativa L.).

PubMed

Lin, Shoukai; Chen, Lijuan; Tao, Huan; Huang, Jian; Xu, Chaoqun; Li, Lin; Ma, Shiwei; Tian, Tian; Liu, Wei; Xue, Lichun; Ai, Yufang; He, Huaqin

2016-11-11

Single nucleotide polymorphisms (SNPs) are widely used in functional genomics and genetics research work. The high-quality sequence of rice genome has provided a genome-wide SNP and proteome resource. However, the impact of SNPs on protein phosphorylation status in rice is not fully understood. In this paper, we firstly updated rice SNP resource based on the new rice genome Ver. 7.0, then systematically analyzed the potential impact of Non-synonymous SNPs (nsSNPs) on the protein phosphorylation status. There were 3,897,312 SNPs in Ver. 7.0 rice genome, among which 9.9% was nsSNPs. Whilst, a total 2,508,261 phosphorylated sites were predicted in rice proteome. Interestingly, we observed that 150,197 (39.1%) nsSNPs could influence protein phosphorylation status, among which 52.2% might induce changes of protein kinase (PK) types for adjacent phosphorylation sites. We constructed a database, SNP_rice, to deposit the updated rice SNP resource and phosSNPs information. It was freely available to academic researchers at http://bioinformatics.fafu.edu.cn. As a case study, we detected five nsSNPs that potentially influenced heterotrimeric G proteins phosphorylation status in rice, indicating that genetic polymorphisms showed impact on the signal transduction by influencing the phosphorylation status of heterotrimeric G proteins. The results in this work could be a useful resource for future experimental identification and provide interesting information for better rice breeding.

N-acetyltransferase single nucleotide polymorphisms: Emerging concepts serve as a paradigm for understanding complexities of personalized medicine

PubMed Central

Hein, David W.

2009-01-01

Arylamine N-acetyltransferase 1 (NAT1) and 2 (NAT2) exhibit single nucleotide polymorphisms (SNPs) in human populations that modify drug and carcinogen metabolism. This paper updates the identity, location, and functional effects of these SNPs and then follows with emerging concepts for understanding why pharmacogenetic findings may not be replicated consistently. Using this paradigm as an example, laboratory-based mechanistic analyses can reveal complexities such that genetic polymorphisms become biologically and medically relevant when confounding factors are more fully understood and considered. As medical care moves to a more personalized approach, the implications of these confounding factors will be important in understanding the complexities of personalized medicine. PMID:19379125

Vitamin D receptor polymorphisms in patients with cutaneous melanoma.

PubMed

Orlow, Irene; Roy, Pampa; Reiner, Anne S; Yoo, Sarah; Patel, Himali; Paine, Susan; Armstrong, Bruce K; Kricker, Anne; Marrett, Loraine D; Millikan, Robert C; Thomas, Nancy E; Gruber, Stephen B; Anton-Culver, Hoda; Rosso, Stefano; Gallagher, Richard P; Dwyer, Terence; Kanetsky, Peter A; Busam, Klaus; From, Lynn; Begg, Colin B; Berwick, Marianne

2012-01-15

The vitamin D receptor (VDR) gene has been associated with cancer risk, but only a few polymorphisms have been studied in relation to melanoma risk and the results have been inconsistent. We examined 38 VDR gene single nucleotide polymorphisms (SNPs) in a large international multicenter population-based case-control study of melanoma. Buccal DNAs were obtained from 1,207 people with incident multiple primary melanoma and 2,469 with incident single primary melanoma. SNPs with known or suspected impact on VDR activity, haplotype tagging SNPs with ≥ 10% minor allele frequency in Caucasians, and SNPs reported as significant in other association studies were examined. Logistic regression was used to calculate the relative risks conferred by the individual SNP. Eight of 38 SNPs in the promoter, coding, and 3' gene regions were individually significantly associated with multiple primary melanoma after adjusting for covariates. The estimated increase in risk for individuals who were homozygous for the minor allele ranged from 25 to 33% for six polymorphisms: rs10875712 (odds ratios [OR] 1.28; 95% confidence interval (CI), 1.01-1.62), rs4760674 (OR 1.33; 95% CI, 1.06-1.67), rs7139166 (OR 1.26; 95%CI, 1.02-1.56), rs4516035 (OR 1.25; 95%CI, 1.01-1.55), rs11168287 (OR 1.27; 95%CI, 1.03-1.57) and rs1544410 (OR 1.30; 95%CI, 1.04-1.63); for two polymorphisms, homozygous carriers had a decreased risk: rs7305032 (OR 0.81; 95%CI 0.65-1.02) and rs7965281 (OR, 0.78; 95%CI, 0.62-0.99). We recognize the potential false positive findings because of multiple comparisons; however, the eight significant SNPs in our study outnumbered the two significant tests expected to occur by chance. The VDR may play a role in melanomagenesis. Copyright © 2011 UICC.

A web-based genome browser for 'SNP-aware' assay design

USDA-ARS?s Scientific Manuscript database

Human and animal genomes contain an abundance of single nucleotide polymorphisms (SNPs) that are useful for genetic testing. However, the relatively large number of SNPs present in diverse populations can pose serious problems when designing assays. It is important to “mask” some SNP positions so ...

A genetic variation map for chicken with 2.8 million single nucleotide polymorphisms

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wong, G K; Hillier, L; Brandstrom, M

2005-02-20

We describe a genetic variation map for the chicken genome containing 2.8 million single nucleotide polymorphisms (SNPs), based on a comparison of the sequences of 3 domestic chickens (broiler, layer, Silkie) to their wild ancestor Red Jungle Fowl (RJF). Subsequent experiments indicate that at least 90% are true SNPs, and at least 70% are common SNPs that segregate in many domestic breeds. Mean nucleotide diversity is about 5 SNP/kb for almost every possible comparison between RJF and domestic lines, between two different domestic lines, and within domestic lines--contrary to the idea that domestic animals are highly inbred relative to theirmore » wild ancestors. In fact, most of the SNPs originated prior to domestication, and there is little to no evidence of selective sweeps for adaptive alleles on length scales of greater than 100 kb.« less

Single nucleotide polymorphisms from Theobroma cacao expressed sequence tags associated with witches' broom disease in cacao.

PubMed

Lima, L S; Gramacho, K P; Carels, N; Novais, R; Gaiotto, F A; Lopes, U V; Gesteira, A S; Zaidan, H A; Cascardo, J C M; Pires, J L; Micheli, F

2009-07-14

In order to increase the efficiency of cacao tree resistance to witches' broom disease, which is caused by Moniliophthora perniciosa (Tricholomataceae), we looked for molecular markers that could help in the selection of resistant cacao genotypes. Among the different markers useful for developing marker-assisted selection, single nucleotide polymorphisms (SNPs) constitute the most common type of sequence difference between alleles and can be easily detected by in silico analysis from expressed sequence tag libraries. We report the first detection and analysis of SNPs from cacao-M. perniciosa interaction expressed sequence tags, using bioinformatics. Selection based on analysis of these SNPs should be useful for developing cacao varieties resistant to this devastating disease.

The Associations between RNA Splicing Complex Gene SF3A1 Polymorphisms and Colorectal Cancer Risk in a Chinese Population.

PubMed

Chen, Xiaohua; Du, Hua; Liu, Binjian; Zou, Li; Chen, Wei; Yang, Yang; Zhu, Ying; Gong, Yajie; Tian, Jianbo; Li, Feng; Zhong, Shan

2015-01-01

Aberrant alternative splicing included alterations in components of the mRNA splicing machinery often occurred in colon cancer. However, the role of SF3A1, one key component of the mRNA splicing machinery, on colorectal cancer (CRC) risk was still not elucidated. We performed a hospital-based case-control study containing 801 CRC patients and 817 cancer-free controls to examine the association between SF3A1 polymorphisms and CRC risk in a Chinese population. Four candidate SNPs (rs10376, rs5753073, rs2839998 and rs2074733) were selected based on bioinformatics analysis and previous findings. The results showed no significant associations between these SNPs and CRC risk (P > 0.05). Besides, the stratified analysis based on the smoking and alcohol use status obtained no statistically significant results. Our study was the first one to investigate the association between SF3A1 polymorphisms and CRC risk. The results suggested these four SNPs in SF3A1 were not associated with CRC risk in a Chinese population, however, further more studies are needed to confirm our findings.

Genome-wide single-nucleotide polymorphism arrays demonstrate high fidelity of multiple displacement-based whole-genome amplification.

PubMed

Tzvetkov, Mladen V; Becker, Christian; Kulle, Bettina; Nürnberg, Peter; Brockmöller, Jürgen; Wojnowski, Leszek

2005-02-01

Whole-genome DNA amplification by multiple displacement (MD-WGA) is a promising tool to obtain sufficient DNA amounts from samples of limited quantity. Using Affymetrix' GeneChip Human Mapping 10K Arrays, we investigated the accuracy and allele amplification bias in DNA samples subjected to MD-WGA. We observed an excellent concordance (99.95%) between single-nucleotide polymorphisms (SNPs) called both in the nonamplified and the corresponding amplified DNA. This concordance was only 0.01% lower than the intra-assay reproducibility of the genotyping technique used. However, MD-WGA failed to amplify an estimated 7% of polymorphic loci. Due to the algorithm used to call genotypes, this was detected only for heterozygous loci. We achieved a 4.3-fold reduction of noncalled SNPs by combining the results from two independent MD-WGA reactions. This indicated that inter-reaction variations rather than specific chromosomal loci reduced the efficiency of MD-WGA. Consistently, we detected no regions of reduced amplification, with the exception of several SNPs located near chromosomal ends. Altogether, despite a substantial loss of polymorphic sites, MD-WGA appears to be the current method of choice to amplify genomic DNA for array-based SNP analyses. The number of nonamplified loci can be substantially reduced by amplifying each DNA sample in duplicate.

Contributions of IKZF1, DDC, CDKN2A, CEBPE, and LMO1 Gene Polymorphisms to Acute Lymphoblastic Leukemia in a Yemeni Population.

PubMed

Al-Absi, Boshra; Razif, Muhammad F M; Noor, Suzita M; Saif-Ali, Riyadh; Aqlan, Mohammed; Salem, Sameer D; Ahmed, Radwan H; Muniandy, Sekaran

2017-10-01

Genome-wide and candidate gene association studies have previously revealed links between a predisposition to acute lymphoblastic leukemia (ALL) and genetic polymorphisms in the following genes: IKZF1 (7p12.2; ID: 10320), DDC (7p12.2; ID: 1644), CDKN2A (9p21.3; ID: 1029), CEBPE (14q11.2; ID: 1053), and LMO1 (11p15; ID: 4004). In this study, we aimed to conduct an investigation into the possible association between polymorphisms in these genes and ALL within a sample of Yemeni children of Arab-Asian descent. Seven single-nucleotide polymorphisms (SNPs) in IKZF1, three SNPs in DDC, two SNPs in CDKN2A, two SNPs in CEBPE, and three SNPs in LMO1 were genotyped in 289 Yemeni children (136 cases and 153 controls), using the nanofluidic Dynamic Array (Fluidigm 192.24 Dynamic Array). Logistic regression analyses were used to estimate ALL risk, and the strength of association was expressed as odds ratios with 95% confidence intervals. We found that the IKZF1 SNP rs10235796 C allele (p = 0.002), the IKZF1 rs6964969 A>G polymorphism (p = 0.048, GG vs. AA), the CDKN2A rs3731246 G>C polymorphism (p = 0.047, GC+CC vs. GG), and the CDKN2A SNP rs3731246 C allele (p = 0.007) were significantly associated with ALL in Yemenis of Arab-Asian descent. In addition, a borderline association was found between IKZF1 rs4132601 T>G variant and ALL risk. No associations were found between the IKZF1 SNPs (rs11978267; rs7789635), DDC SNPs (rs3779084; rs880028; rs7809758), CDKN2A SNP (rs3731217), the CEBPE SNPs (rs2239633; rs12434881) and LMO1 SNPs (rs442264; rs3794012; rs4237770) with ALL in Yemeni children. The IKZF1 SNPs, rs10235796 and rs6964969, and the CDKN2A SNP rs3731246 (previously unreported) could serve as risk markers for ALL susceptibility in Yemeni children.

A Primary Assembly of a Bovine Haplotype Block Map Based on a 15,036-Single-Nucleotide Polymorphism Panel Genotyped in Holstein–Friesian Cattle

PubMed Central

Khatkar, Mehar S.; Zenger, Kyall R.; Hobbs, Matthew; Hawken, Rachel J.; Cavanagh, Julie A. L.; Barris, Wes; McClintock, Alexander E.; McClintock, Sara; Thomson, Peter C.; Tier, Bruce; Nicholas, Frank W.; Raadsma, Herman W.

2007-01-01

Analysis of data on 1000 Holstein–Friesian bulls genotyped for 15,036 single-nucleotide polymorphisms (SNPs) has enabled genomewide identification of haplotype blocks and tag SNPs. A final subset of 9195 SNPs in Hardy–Weinberg equilibrium and mapped on autosomes on the bovine sequence assembly (release Btau 3.1) was used in this study. The average intermarker spacing was 251.8 kb. The average minor allele frequency (MAF) was 0.29 (0.05–0.5). Following recent precedents in human HapMap studies, a haplotype block was defined where 95% of combinations of SNPs within a region are in very high linkage disequilibrium. A total of 727 haplotype blocks consisting of ≥3 SNPs were identified. The average block length was 69.7 ± 7.7 kb, which is ∼5–10 times larger than in humans. These blocks comprised a total of 2964 SNPs and covered 50,638 kb of the sequence map, which constitutes 2.18% of the length of all autosomes. A set of tag SNPs, which will be useful for further fine-mapping studies, has been identified. Overall, the results suggest that as many as 75,000–100,000 tag SNPs would be needed to track all important haplotype blocks in the bovine genome. This would require ∼250,000 SNPs in the discovery phase. PMID:17435229

Effect of P450 Oxidoreductase Polymorphisms on the Metabolic Activities of Ten Cytochrome P450s Varied by Polymorphic CYP Genotypes in Human Liver Microsomes.

PubMed

Fang, Yan; Gao, Na; Tian, Xin; Zhou, Jun; Zhang, Hai-Feng; Gao, Jie; He, Xiao-Pei; Wen, Qiang; Jia, Lin-Jing; Jin, Han; Qiao, Hai-Ling

2018-06-27

Background/ Aims: Little is known about the effect of P450 oxidoreductase (POR) gene polymorphisms on the activities of CYPs with multiple genotypes. We genotyped 102 human livers for 18 known POR single nucleotide polymorphisms (SNPs) with allelic frequencies greater than 1% as well as for 27 known SNPs in 10 CYPs. CYP enzyme activities in microsomes prepared from these livers were determined by measuring probe substrate metabolism by high performance liquid chromatograph. We found that the effects of the 18 POR SNPs on 10 CYP activities were CYP genotype-dependent. The POR mutations were significantly associated with decreased overall Km for CYP2B6 and 2E1, and specific genotypes within CYP1A2, 2A6, 2B6, 2C8, 2D6 and 2E1 were identified as being affected by these POR SNPs. Notably, the effect of a specific POR mutation on the activity of a CYP genotype could not be predicted from other CYP genotypes of even the same CYP. When combining one POR SNP with other POR SNPs, a hitherto unrecognized effect of multiple-site POR gene polymorphisms (MSGP) on CYP activity was uncovered, which was not necessarily consistent with the effect of either single POR SNP. The effects of POR SNPs on CYP activities were not only CYP-dependent, but more importantly, CYP genotype-dependent. Moreover, the effect of a POR SNP alone and in combination with other POR SNPs (MSGP) was not always consistent, nor predictable. Understanding the impact of POR gene polymorphisms on drug metabolism necessitates knowing the complete SNP complement of POR and the genotype of the relevant CYPs. © 2018 The Author(s). Published by S. Karger AG, Basel.

[Association analysis between SNPs of the growth hormone receptor gene and growth traits in arctic fox].

PubMed

DU, Zhi-Heng; Liu, Zong-Yue; Bai, Xiu-Juan

2010-06-01

Using single-strand conformation polymorphism (PCR-SSCP) and DNA sequencing, single nucleotide polymorphisms (SNPs) of growth hormone receptor (GHR) gene were detected in an arctic fox population. Correlation analysis between GHR polymorphisms and growth traits were carried out using the appropriate model. Four SNPs, G3A in the 5'UTR, C99T in the first exon, T59C and G65A in the fifth exon were identified on the arctic fox GHR gene. The G3A and C99T polymorphisms of GHR were associated with female fox body weight (Pamp;0.05) and the T59C and G65A polymorphisms of GHR were associated with male fox body weight (Pamp;0.05) and the skin length of the female fox (Pamp;0.01). Therefore, marker assistant selection on body weight and skin length of arctic foxes using these SNPs can be applied to get big and high quality arctic foxes.

Allele frequency and genotype distribution of polymorphisms within disease-related genes is influenced by ethnic population sub-structuring in Sudan.

PubMed

Bereir, R E H; Mohamed, H S; Seielstad, M; El Hassani, A M; Khalil, E A G; Peacock, C S; Blackwell, J M; Ibrahim, M E

2003-09-01

Four single nucleotide polymorphisms (SNPs) and a variable number of tandem repeats (VNTR) polymorphism located within disease associated/causing genes were typed in four populations of different tribal and ethnic affiliation from the Sudan. The genotype and allele frequencies were compared with those of other groups from published and unpublished data of world populations. The combined Sudanese sample conformed with Hardy-Weinberg equilibrium (HWE) expectation. However, population sub-structuring according to ethnic/linguistic group indicated at least two SNPs in departure from HWE. Differences in allele frequencies and genotype distribution between groups was also noted in three of the four SNPs. The other loci were distributed homogeneously within the populations studied with genotype frequencies in agreement with HWE expectation. These results highlight the importance of inter-population stratification for polymorphic markers, as well as the potential influence of evolutionary history and ethnic variation of loci, in the general distribution of SNPs and other polymorphisms.

Mapping a Mutation in "Caenorhabditis elegans" Using a Polymerase Chain Reaction-Based Approach

ERIC Educational Resources Information Center

Myers, Edith M.

2014-01-01

Many single nucleotide polymorphisms (SNPs) have been identified within the "Caenorhabditis elegans" genome. SNPs present in the genomes of two isogenic "C. elegans" strains have been routinely used as a tool in forward genetics to map a mutation to a particular chromosome. This article describes a laboratory exercise in which…

Analysis of single nucleotide polymorphisms in case-control studies.

PubMed

Li, Yonghong; Shiffman, Dov; Oberbauer, Rainer

2011-01-01

Single nucleotide polymorphisms (SNPs) are the most common type of genetic variants in the human genome. SNPs are known to modify susceptibility to complex diseases. We describe and discuss methods used to identify SNPs associated with disease in case-control studies. An outline on study population selection, sample collection and genotyping platforms is presented, complemented by SNP selection, data preprocessing and analysis.

Single nucleotide polymorphism analysis of Korean native chickens using next generation sequencing data.

PubMed

Seo, Dong-Won; Oh, Jae-Don; Jin, Shil; Song, Ki-Duk; Park, Hee-Bok; Heo, Kang-Nyeong; Shin, Younhee; Jung, Myunghee; Park, Junhyung; Jo, Cheorun; Lee, Hak-Kyo; Lee, Jun-Heon

2015-02-01

There are five native chicken lines in Korea, which are mainly classified by plumage colors (black, white, red, yellow, gray). These five lines are very important genetic resources in the Korean poultry industry. Based on a next generation sequencing technology, whole genome sequence and reference assemblies were performed using Gallus_gallus_4.0 (NCBI) with whole genome sequences from these lines to identify common and novel single nucleotide polymorphisms (SNPs). We obtained 36,660,731,136 ± 1,257,159,120 bp of raw sequence and average 26.6-fold of 25-29 billion reference assembly sequences representing 97.288 % coverage. Also, 4,006,068 ± 97,534 SNPs were observed from 29 autosomes and the Z chromosome and, of these, 752,309 SNPs are the common SNPs across lines. Among the identified SNPs, the number of novel- and known-location assigned SNPs was 1,047,951 ± 14,956 and 2,948,648 ± 81,414, respectively. The number of unassigned known SNPs was 1,181 ± 150 and unassigned novel SNPs was 8,238 ± 1,019. Synonymous SNPs, non-synonymous SNPs, and SNPs having character changes were 26,266 ± 1,456, 11,467 ± 604, 8,180 ± 458, respectively. Overall, 443,048 ± 26,389 SNPs in each bird were identified by comparing with dbSNP in NCBI. The presently obtained genome sequence and SNP information in Korean native chickens have wide applications for further genome studies such as genetic diversity studies to detect causative mutations for economic and disease related traits.

Quantifying the utility of single nucleotide polymorphisms to guide colorectal cancer screening

PubMed Central

Jenkins, Mark A; Makalic, Enes; Dowty, James G; Schmidt, Daniel F; Dite, Gillian S; MacInnis, Robert J; Ait Ouakrim, Driss; Clendenning, Mark; Flander, Louisa B; Stanesby, Oliver K; Hopper, John L; Win, Aung K; Buchanan, Daniel D

2016-01-01

Aim: To determine whether single nucleotide polymorphisms (SNPs) can be used to identify people who should be screened for colorectal cancer. Methods: We simulated one million people with and without colorectal cancer based on published SNP allele frequencies and strengths of colorectal cancer association. We estimated 5-year risks of colorectal cancer by number of risk alleles. Results: We identified 45 SNPs with an average 1.14-fold increase colorectal cancer risk per allele (range: 1.05–1.53). The colorectal cancer risk for people in the highest quintile of risk alleles was 1.81-times that for the average person. Conclusion: We have quantified the extent to which known susceptibility SNPs can stratify the population into clinically useful colorectal cancer risk categories. PMID:26846999

Cytochrome P450 2E1 gene polymorphisms/haplotypes and anti-tuberculosis drug-induced hepatitis in a Chinese cohort.

PubMed

Tang, Shaowen; Lv, Xiaozhen; Zhang, Yuan; Wu, Shanshan; Yang, Zhirong; Xia, Yinyin; Tu, Dehua; Deng, Peiyuan; Ma, Yu; Chen, Dafang; Zhan, Siyan

2013-01-01

The pathogenic mechanism of anti-tuberculosis (anti-TB) drug-induced hepatitis is associated with drug metabolizing enzymes. No tagging single-nucleotide polymorphisms (tSNPs) of cytochrome P450 2E1(CYP2E1) in the risk of anti-TB drug-induced hepatitis have been reported. The present study was aimed at exploring the role of tSNPs in CYP2E1 gene in a population-based anti-TB treatment cohort. A nested case-control study was designed. Each hepatitis case was 14 matched with controls by age, gender, treatment history, disease severity and drug dosage. The tSNPs were selected by using Haploview 4.2 based on the HapMap database of Han Chinese in Beijing, and detected by using TaqMan allelic discrimination technology. Eighty-nine anti-TB drug-induced hepatitis cases and 356 controls were included in this study. 6 tSNPs (rs2031920, rs2070672, rs915908, rs8192775, rs2515641, rs2515644) were genotyped and minor allele frequencies of these tSNPs were 21.9%, 23.0%, 19.1%, 23.6%, 20.8% and 44.4% in the cases and 20.9%, 22.7%, 18.9%, 23.2%, 18.2% and 43.2% in the controls, respectively. No significant difference was observed in genotypes or allele frequencies of the 6 tSNPs between case group and control group, and neither of haplotypes in block 1 nor in block 2 was significantly associated with the development of hepatitis. Based on the Chinese anti-TB treatment cohort, we did not find a statistically significant association between genetic polymorphisms of CYP2E1 and the risk of anti-TB drug-induced hepatitis. None of the haplotypes showed a significant association with the development of hepatitis in Chinese TB population.

Single Nucleotide Polymorphisms Predict Symptom Severity of Autism Spectrum Disorder

ERIC Educational Resources Information Center

Jiao, Yun; Chen, Rong; Ke, Xiaoyan; Cheng, Lu; Chu, Kangkang; Lu, Zuhong; Herskovits, Edward H.

2012-01-01

Autism is widely believed to be a heterogeneous disorder; diagnosis is currently based solely on clinical criteria, although genetic, as well as environmental, influences are thought to be prominent factors in the etiology of most forms of autism. Our goal is to determine whether a predictive model based on single-nucleotide polymorphisms (SNPs)…

Human leukocyte antigen class I region single-nucleotide polymorphisms are associated with leprosy susceptibility in Vietnam and India.

PubMed

Alter, Andrea; Huong, Nguyen Thu; Singh, Meenakshi; Orlova, Marianna; Van Thuc, Nguyen; Katoch, Kiran; Gao, Xiaojiang; Thai, Vu Hong; Ba, Nguyen Ngoc; Carrington, Mary; Abel, Laurent; Mehra, Narinder; Alcaïs, Alexandre; Schurr, Erwin

2011-05-01

Experimental evidence suggested the existence of unidentified leprosy susceptibility loci in the human leukocyte antigen (HLA) complex. To identify such genetic risk factors, a high-density association scan of a 1.9-mega-base (Mb) region in the HLA complex was performed. Among 682 single-nucleotide polymorphisms (SNPs), 59 were associated with leprosy (P <.01) in 198 Vietnamese single-case leprosy families. Genotyping of these SNPs in an independent sample of 292 Vietnamese single-case leprosy families replicated the association of 12 SNPs (P <.01). Multivariate analysis of these 12 SNPs showed that the association information could be captured by 2 intergenic HLA class I region SNPs (P = 9.4 × 10⁻⁹)-rs2394885 and rs2922997 (marginal multivariate P = 2.1 × 10⁻⁷ and P = .0016, respectively). SNP rs2394885 tagged the HLA-C*15:05 allele in the Vietnamese population. The identical associations were validated in a third sample of 364 patients with leprosy and 371 control subjects from North India. These results implicated class I alleles in leprosy pathogenesis.

Human Leukocyte Antigen Class I Region Single-Nucleotide Polymorphisms are Associated with Leprosy Susceptibility in Vietnam and India

PubMed Central

Alter, Andrea; Huong, Nguyen Thu; Singh, Meenakshi; Orlova, Marianna; Van Thuc, Nguyen; Katoch, Kiran; Gao, Xiaojiang; Thai, Vu Hong; Ba, Nguyen Ngoc; Carrington, Mary; Abel, Laurent; Mehra, Narinder; Alcaïs, Alexandre

2011-01-01

Experimental evidence suggested the existence of unidentified leprosy susceptibility loci in the human leukocyte antigen (HLA) complex. To identify such genetic risk factors, a high-density association scan of a 1.9-mega-base (Mb) region in the HLA complex was performed. Among 682 single-nucleotide polymorphisms (SNPs), 59 were associated with leprosy (P <.01) in 198 Vietnamese single-case leprosy families. Genotyping of these SNPs in an independent sample of 292 Vietnamese single-case leprosy families replicated the association of 12 SNPs (P <.01). Multivariate analysis of these 12 SNPs showed that the association information could be captured by 2 intergenic HLA class I region SNPs (P = 9.4 × 10−9)—rs2394885 and rs2922997 (marginal multivariate P = 2.1 × 10−7 and P = .0016, respectively). SNP rs2394885 tagged the HLA-C*15:05 allele in the Vietnamese population. The identical associations were validated in a third sample of 364 patients with leprosy and 371 control subjects from North India. These results implicated class I alleles in leprosy pathogenesis. PMID:21459816

Study of five novel non-synonymous polymorphisms in human brain-expressed genes in a Colombian sample.

PubMed

Ojeda, Diego A; Forero, Diego A

2014-10-01

Non-synonymous single nucleotide polymorphisms (nsSNPs) in brain-expressed genes represent interesting candidates for genetic research in neuropsychiatric disorders. To study novel nsSNPs in brain-expressed genes in a sample of Colombian subjects. We applied an approach based on in silico mining of available genomic data to identify and select novel nsSNPs in brain-expressed genes. We developed novel genotyping assays, based in allele-specific PCR methods, for these nsSNPs and genotyped them in 171 Colombian subjects. Five common nsSNPs (rs6855837; p.Leu395Ile, rs2305160; p.Thr394Ala, rs10503929; p.Met289Thr, rs2270641; p.Thr4Pro and rs3822659; p.Ser735Ala) were studied, located in the CLOCK, NPAS2, NRG1, SLC18A1 and WWC1 genes. We reported allele and genotype frequencies in a sample of South American healthy subjects. There is previous experimental evidence, arising from genome-wide expression and association studies, for the involvement of these genes in several neuropsychiatric disorders and endophenotypes, such as schizophrenia, mood disorders or memory performance. Frequencies for these nsSNPSs in the Colombian samples varied in comparison to different HapMap populations. Future study of these nsSNPs in brain-expressed genes, a synaptogenomics approach, will be important for a better understanding of neuropsychiatric diseases and endophenotypes in different populations.

[Natural nucleotide polymorphism of the Srlk gene that determines salt stress tolerance in alfalfa (Medicago sativa L)].

PubMed

Vishnevskaia, M S; Pavlov, A V; Dziubenko, E A; Dziubenko, N I; Potokina, E K

2014-04-01

Based on legume genome syntheny, the nucleotide sequence of Srlk gene, key role of which in response to salt stress was demonstrated for the model species Medicago truncatula, was identified in the major forage and siderate crop alfalfa (Medicago sativa). In twelve alfalfa samples originating from regions with contrasting growing conditions, 19 SNPs were revealed in the Srlk gene. For two nonsynonymous SNPs, molecular markers were designed that could be further used to analyze the association between Srlk gene nucleotide polymorphism and the variability in salt stress tolerance among alfalfa cultivars.

Sequence Analysis of APOA5 Among the Kuwaiti Population Identifies Association of rs2072560, rs2266788, and rs662799 With TG and VLDL Levels

PubMed Central

Jasim, Anfal A.; Al-Bustan, Suzanne A.; Al-Kandari, Wafa; Al-Serri, Ahmad; AlAskar, Huda

2018-01-01

Common variants of Apolipoprotein A5 (APOA5) have been associated with lipid levels yet very few studies have reported full sequence data from various ethnic groups. The purpose of this study was to analyse the full APOA5 gene sequence to identify variants in 100 healthy Kuwaitis of Arab ethnicities and assess their association with variation in lipid levels in a cohort of 733 samples. Sanger method was used in the direct sequencing of the full 3.7 Kb APOA5 and multiple sequence alignment was used to identify variants. The complete APOA5 sequence in Kuwaiti Arabs has been deposited in GenBank (KJ401315). A total of 20 reported single nucleotide polymorphisms (SNPs) were identified. Two novel SNPs were also identified: a synonymous 2197G>A polymorphism at genomic position 116661525 and a 3′ UTR 3222 C>T polymorphism at genomic position 116660500 based on human genome assembly GRCh37/hg:19. Five SNPs along with the two novel SNPs were selected for validation in the cohort. Association of those SNPs with lipid levels was tested and minor alleles of three SNPs (rs2072560, rs2266788, and rs662799) were found significantly associated with TG and VLDL levels. This is the first study to report the full APOA5 sequence and SNPs in an Arab ethnic group. Analysis of the variants identified and comparison to other populations suggests a distinctive genetic component in Arabs. The positive association observed for rs2072560 and rs2266788 with TG and VLDL levels confirms their role in lipid metabolism. PMID:29686695

Sequence Analysis of APOA5 Among the Kuwaiti Population Identifies Association of rs2072560, rs2266788, and rs662799 With TG and VLDL Levels.

PubMed

Jasim, Anfal A; Al-Bustan, Suzanne A; Al-Kandari, Wafa; Al-Serri, Ahmad; AlAskar, Huda

2018-01-01

Common variants of Apolipoprotein A5 ( APOA 5) have been associated with lipid levels yet very few studies have reported full sequence data from various ethnic groups. The purpose of this study was to analyse the full APOA5 gene sequence to identify variants in 100 healthy Kuwaitis of Arab ethnicities and assess their association with variation in lipid levels in a cohort of 733 samples. Sanger method was used in the direct sequencing of the full 3.7 Kb APOA5 and multiple sequence alignment was used to identify variants. The complete APOA5 sequence in Kuwaiti Arabs has been deposited in GenBank (KJ401315). A total of 20 reported single nucleotide polymorphisms (SNPs) were identified. Two novel SNPs were also identified: a synonymous 2197G>A polymorphism at genomic position 116661525 and a 3' UTR 3222 C>T polymorphism at genomic position 116660500 based on human genome assembly GRCh37/hg:19. Five SNPs along with the two novel SNPs were selected for validation in the cohort. Association of those SNPs with lipid levels was tested and minor alleles of three SNPs (rs2072560, rs2266788, and rs662799) were found significantly associated with TG and VLDL levels. This is the first study to report the full APOA5 sequence and SNPs in an Arab ethnic group. Analysis of the variants identified and comparison to other populations suggests a distinctive genetic component in Arabs. The positive association observed for rs2072560 and rs2266788 with TG and VLDL levels confirms their role in lipid metabolism.

Blood lead levels, iron metabolism gene polymorphisms and homocysteine: a gene-environment interaction study.

PubMed

Kim, Kyoung-Nam; Lee, Mee-Ri; Lim, Youn-Hee; Hong, Yun-Chul

2017-12-01

Homocysteine has been causally associated with various adverse health outcomes. Evidence supporting the relationship between lead and homocysteine levels has been accumulating, but most prior studies have not focused on the interaction with genetic polymorphisms. From a community-based prospective cohort, we analysed 386 participants (aged 41-71 years) with information regarding blood lead and plasma homocysteine levels. Blood lead levels were measured between 2001 and 2003, and plasma homocysteine levels were measured in 2007. Interactions of lead levels with 42 genotyped single-nucleotide polymorphisms (SNPs) in five genes ( TF , HFE , CBS , BHMT and MTR ) were assessed via a 2-degree of freedom (df) joint test and a 1-df interaction test. In secondary analyses using imputation, we further assessed 58 imputed SNPs in the TF and MTHFR genes. Blood lead concentrations were positively associated with plasma homocysteine levels (p=0.0276). Six SNPs in the TF and MTR genes were screened using the 2-df joint test, and among them, three SNPs in the TF gene showed interactions with lead with respect to homocysteine levels through the 1-df interaction test (p<0.0083). Seven SNPs in the MTHFR gene were associated with homocysteine levels at an α-level of 0.05, but the associations did not persist after Bonferroni correction. These SNPs did not show interactions with lead levels. Blood lead levels were positively associated with plasma homocysteine levels measured 4-6 years later, and three SNPs in the TF gene modified the association. © Article author(s) (or their employer(s) unless otherwise stated in the text of the article) 2017. All rights reserved. No commercial use is permitted unless otherwise expressly granted.

Mango (Mangifera indica L.) germplasm diversity based on single nucleotide polymorphisms derived from the transcriptome.

PubMed

Sherman, Amir; Rubinstein, Mor; Eshed, Ravit; Benita, Miri; Ish-Shalom, Mazal; Sharabi-Schwager, Michal; Rozen, Ada; Saada, David; Cohen, Yuval; Ophir, Ron

2015-11-14

Germplasm collections are an important source for plant breeding, especially in fruit trees which have a long duration of juvenile period. Thus, efforts have been made to study the diversity of fruit tree collections. Even though mango is an economically important crop, most of the studies on diversity in mango collections have been conducted with a small number of genetic markers. We describe a de novo transcriptome assembly from mango cultivar 'Keitt'. Variation discovery was performed using Illumina resequencing of 'Keitt' and 'Tommy Atkins' cultivars identified 332,016 single-nucleotide polymorphisms (SNPs) and 1903 simple-sequence repeats (SSRs). Most of the SSRs (70.1%) were of trinucleotide with the preponderance of motif (GGA/AAG)n and only 23.5% were di-nucleotide SSRs with the mostly of (AT/AT)n motif. Further investigation of the diversity in the Israeli mango collection was performed based on a subset of 293 SNPs. Those markers have divided the Israeli mango collection into two major groups: one group included mostly mango accessions from Southeast Asia (Malaysia, Thailand, Indonesia) and India and the other with mainly of Floridian and Israeli mango cultivars. The latter group was more polymorphic (FS=-0.1 on the average) and was more of an admixture than the former group. A slight population differentiation was detected (FST=0.03), suggesting that if the mango accessions of the western world apparently was originated from Southeast Asia, as has been previously suggested, the duration of cultivation was not long enough to develop a distinct genetic background. Whole-transcriptome reconstruction was used to significantly broaden the mango's genetic variation resources, i.e., SNPs and SSRs. The set of SNP markers described in this study is novel. A subset of SNPs was sampled to explore the Israeli mango collection and most of them were polymorphic in many mango accessions. Therefore, we believe that these SNPs will be valuable as they recapitulate and strengthen the history of mango diversity.

Differential Single Nucleotide Polymorphism-Based Analysis of an Outbreak Caused by Salmonella enterica Serovar Manhattan Reveals Epidemiological Details Missed by Standard Pulsed-Field Gel Electrophoresis

PubMed Central

Scaltriti, Erika; Sassera, Davide; Comandatore, Francesco; Morganti, Marina; Mandalari, Carmen; Gaiarsa, Stefano; Bandi, Claudio; Zehender, Gianguglielmo; Bolzoni, Luca; Casadei, Gabriele

2015-01-01

We retrospectively analyzed a rare Salmonella enterica serovar Manhattan outbreak that occurred in Italy in 2009 to evaluate the potential of new genomic tools based on differential single nucleotide polymorphism (SNP) analysis in comparison with the gold standard genotyping method, pulsed-field gel electrophoresis. A total of 39 isolates were analyzed from patients (n = 15) and food, feed, animal, and environmental sources (n = 24), resulting in five different pulsed-field gel electrophoresis (PFGE) profiles. Isolates epidemiologically related to the outbreak clustered within the same pulsotype, SXB_BS.0003, without any further differentiation. Thirty-three isolates were considered for genomic analysis based on different sets of SNPs, core, synonymous, nonsynonymous, as well as SNPs in different codon positions, by Bayesian and maximum likelihood algorithms. Trees generated from core and nonsynonymous SNPs, as well as SNPs at the second and first plus second codon positions detailed four distinct groups of isolates within the outbreak pulsotype, discriminating outbreak-related isolates of human and food origins. Conversely, the trees derived from synonymous and third-codon-position SNPs clustered food and human isolates together, indicating that all outbreak-related isolates constituted a single clone, which was in line with the epidemiological evidence. Further experiments are in place to extend this approach within our regional enteropathogen surveillance system. PMID:25653407

Differential single nucleotide polymorphism-based analysis of an outbreak caused by Salmonella enterica serovar Manhattan reveals epidemiological details missed by standard pulsed-field gel electrophoresis.

PubMed

Scaltriti, Erika; Sassera, Davide; Comandatore, Francesco; Morganti, Marina; Mandalari, Carmen; Gaiarsa, Stefano; Bandi, Claudio; Zehender, Gianguglielmo; Bolzoni, Luca; Casadei, Gabriele; Pongolini, Stefano

2015-04-01

We retrospectively analyzed a rare Salmonella enterica serovar Manhattan outbreak that occurred in Italy in 2009 to evaluate the potential of new genomic tools based on differential single nucleotide polymorphism (SNP) analysis in comparison with the gold standard genotyping method, pulsed-field gel electrophoresis. A total of 39 isolates were analyzed from patients (n=15) and food, feed, animal, and environmental sources (n=24), resulting in five different pulsed-field gel electrophoresis (PFGE) profiles. Isolates epidemiologically related to the outbreak clustered within the same pulsotype, SXB_BS.0003, without any further differentiation. Thirty-three isolates were considered for genomic analysis based on different sets of SNPs, core, synonymous, nonsynonymous, as well as SNPs in different codon positions, by Bayesian and maximum likelihood algorithms. Trees generated from core and nonsynonymous SNPs, as well as SNPs at the second and first plus second codon positions detailed four distinct groups of isolates within the outbreak pulsotype, discriminating outbreak-related isolates of human and food origins. Conversely, the trees derived from synonymous and third-codon-position SNPs clustered food and human isolates together, indicating that all outbreak-related isolates constituted a single clone, which was in line with the epidemiological evidence. Further experiments are in place to extend this approach within our regional enteropathogen surveillance system. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

Polymorphic amplified typing sequences (PATS) and pulsed-field gel electrophoresis (PFGE) yield comparable results in the strain typing of a diverse set of bovine Escherichia coli O157 isolates

USDA-ARS?s Scientific Manuscript database

The PCR-based Escherichia coli O157 (O157) strain typing system, Polymorphic Amplified Typing Sequences (PATS), targets insertions-deletions (Indels) and single nucleotide polymorphisms (SNPs) at the XbaI and AvrII(BlnI) restriction enzyme sites, respectively, besides amplifying four known virulenc...

Interleukin 18 receptor 1 gene polymorphisms are associated with asthma.

PubMed

Zhu, Guohua; Whyte, Moira K B; Vestbo, Jorgen; Carlsen, Karin; Carlsen, Kai-Håkon; Lenney, Warren; Silverman, Michael; Helms, Peter; Pillai, Sreekumar G

2008-09-01

The interleukin 18 receptor (IL18R1) gene is a strong candidate gene for asthma. It has been implicated in the pathophysiology of asthma and maps to an asthma susceptibility locus on chromosome 2q12. The possibility of association between polymorphisms in IL18R1 and asthma was examined by genotyping seven SNPs in 294, 342 and 100 families from Denmark, United Kingdom and Norway and conducting family-based association analyses for asthma, atopic asthma and bronchial hyper-reactivity (BHR) phenotypes. Three SNPs in IL18R1 were associated with asthma (0.01131 < or = P < or = 0.01377), five with atopic asthma (0.00066 < or = P < or = 0.00405) and two with BHR (0.01450 < or = P < or = 0.03203) in the Danish population; two SNPs were associated with atopic asthma (0.00397 < or = P < or = 0.01481) and four with BHR (0.00435 < or = P < or = 0.03544) in the UK population; four SNPs showed associations with asthma (0.00015 < or = P < or = 0.03062), two with atopic asthma (0.01269 < or = P < or = 0.04042) and three with BHR (0.00259 < or = P < or = 0.01401) in the Norwegian population; five SNPs showed associations with asthma (0.00005 < or = P < or = 0.03744), five with atopic asthma (0.00001 < or = P < or = 0.04491) and three with BHR (0.03568 < or = P < or = 0.04778) in the combined population. Three intronic SNPs (rs1420099, rs1362348 and rs1974675) showed replicated association for at least one asthma-related phenotype. These results demonstrate significant association between polymorphisms in IL18R1 and asthma.

Vitamin D receptor polymorphisms and survival in patients with cutaneous melanoma: a population-based study.

PubMed

Orlow, Irene; Reiner, Anne S; Thomas, Nancy E; Roy, Pampa; Kanetsky, Peter A; Luo, Li; Paine, Susan; Armstrong, Bruce K; Kricker, Anne; Marrett, Loraine D; Rosso, Stefano; Zanetti, Roberto; Gruber, Stephen B; Anton-Culver, Hoda; Gallagher, Richard P; Dwyer, Terence; Busam, Klaus; Begg, Colin B; Berwick, Marianne

2016-01-01

Factors known to affect melanoma survival include age at presentation, sex and tumor characteristics. Polymorphisms also appear to modulate survival following diagnosis. Result from other studies suggest that vitamin D receptor (VDR) polymorphisms (SNPs) impact survival in patients with glioma, renal cell carcinoma, lung, breast, prostate and other cancers; however, a comprehensive study of VDR polymorphisms and melanoma-specific survival is lacking. We aimed to investigate whether VDR genetic variation influences survival in patients with cutaneous melanoma. The analysis involved 3566 incident single and multiple primary melanoma cases enrolled in the international population-based Genes, Environment, and Melanoma Study. Melanoma-specific survival outcomes were calculated for each of 38 VDR SNPs using a competing risk analysis after adjustment for covariates. There were 254 (7.1%) deaths due to melanoma during the median 7.6 years follow-up period. VDR SNPs rs7299460, rs3782905, rs2239182, rs12370156, rs2238140, rs7305032, rs1544410 (BsmI) and rs731236 (TaqI) each had a statistically significant (trend P values < 0.05) association with melanoma-specific survival in multivariate analysis. One functional SNP (rs2239182) remained significant after adjustment for multiple testing using the Monte Carlo method. None of the SNPs associated with survival were significantly associated with Breslow thickness, ulceration or mitosis. These results suggest that the VDR gene may influence survival from melanoma, although the mechanism by which VDR exerts its effect does not seem driven by tumor aggressiveness. Further investigations are needed to confirm our results and to understand the relationship between VDR and survival in the combined context of tumor and host characteristics. © The Author 2015. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

Vitamin D receptor polymorphisms and survival in patients with cutaneous melanoma: a population-based study

PubMed Central

Orlow, Irene; Reiner, Anne S.; Thomas, Nancy E.; Roy, Pampa; Kanetsky, Peter A.; Luo, Li; Paine, Susan; Armstrong, Bruce K.; Kricker, Anne; Marrett, Loraine D.; Rosso, Stefano; Zanetti, Roberto; Gruber, Stephen B.; Anton-Culver, Hoda; Gallagher, Richard P.; Dwyer, Terence; Busam, Klaus; Begg, Colin B.; Berwick, Marianne

2016-01-01

Factors known to affect melanoma survival include age at presentation, sex and tumor characteristics. Polymorphisms also appear to modulate survival following diagnosis. Result from other studies suggest that vitamin D receptor (VDR) polymorphisms (SNPs) impact survival in patients with glioma, renal cell carcinoma, lung, breast, prostate and other cancers; however, a comprehensive study of VDR polymorphisms and melanoma-specific survival is lacking. We aimed to investigate whether VDR genetic variation influences survival in patients with cutaneous melanoma. The analysis involved 3566 incident single and multiple primary melanoma cases enrolled in the international population-based Genes, Environment, and Melanoma Study. Melanoma-specific survival outcomes were calculated for each of 38 VDR SNPs using a competing risk analysis after adjustment for covariates. There were 254 (7.1%) deaths due to melanoma during the median 7.6 years follow-up period. VDR SNPs rs7299460, rs3782905, rs2239182, rs12370156, rs2238140, rs7305032, rs1544410 (BsmI) and rs731236 (TaqI) each had a statistically significant (trend P values < 0.05) association with melanoma-specific survival in multivariate analysis. One functional SNP (rs2239182) remained significant after adjustment for multiple testing using the Monte Carlo method. None of the SNPs associated with survival were significantly associated with Breslow thickness, ulceration or mitosis. These results suggest that the VDR gene may influence survival from melanoma, although the mechanism by which VDR exerts its effect does not seem driven by tumor aggressiveness. Further investigations are needed to confirm our results and to understand the relationship between VDR and survival in the combined context of tumor and host characteristics. PMID:26521212

Development of a single nucleotide polymorphism barcode to genotype Plasmodium vivax infections.

PubMed

Baniecki, Mary Lynn; Faust, Aubrey L; Schaffner, Stephen F; Park, Daniel J; Galinsky, Kevin; Daniels, Rachel F; Hamilton, Elizabeth; Ferreira, Marcelo U; Karunaweera, Nadira D; Serre, David; Zimmerman, Peter A; Sá, Juliana M; Wellems, Thomas E; Musset, Lise; Legrand, Eric; Melnikov, Alexandre; Neafsey, Daniel E; Volkman, Sarah K; Wirth, Dyann F; Sabeti, Pardis C

2015-03-01

Plasmodium vivax, one of the five species of Plasmodium parasites that cause human malaria, is responsible for 25-40% of malaria cases worldwide. Malaria global elimination efforts will benefit from accurate and effective genotyping tools that will provide insight into the population genetics and diversity of this parasite. The recent sequencing of P. vivax isolates from South America, Africa, and Asia presents a new opportunity by uncovering thousands of novel single nucleotide polymorphisms (SNPs). Genotyping a selection of these SNPs provides a robust, low-cost method of identifying parasite infections through their unique genetic signature or barcode. Based on our experience in generating a SNP barcode for P. falciparum using High Resolution Melting (HRM), we have developed a similar tool for P. vivax. We selected globally polymorphic SNPs from available P. vivax genome sequence data that were located in putatively selectively neutral sites (i.e., intergenic, intronic, or 4-fold degenerate coding). From these candidate SNPs we defined a barcode consisting of 42 SNPs. We analyzed the performance of the 42-SNP barcode on 87 P. vivax clinical samples from parasite populations in South America (Brazil, French Guiana), Africa (Ethiopia) and Asia (Sri Lanka). We found that the P. vivax barcode is robust, as it requires only a small quantity of DNA (limit of detection 0.3 ng/μl) to yield reproducible genotype calls, and detects polymorphic genotypes with high sensitivity. The markers are informative across all clinical samples evaluated (average minor allele frequency > 0.1). Population genetic and statistical analyses show the barcode captures high degrees of population diversity and differentiates geographically distinct populations. Our 42-SNP barcode provides a robust, informative, and standardized genetic marker set that accurately identifies a genomic signature for P. vivax infections.

Development of a Single Nucleotide Polymorphism Barcode to Genotype Plasmodium vivax Infections

PubMed Central

Baniecki, Mary Lynn; Faust, Aubrey L.; Schaffner, Stephen F.; Park, Daniel J.; Galinsky, Kevin; Daniels, Rachel F.; Hamilton, Elizabeth; Ferreira, Marcelo U.; Karunaweera, Nadira D.; Serre, David; Zimmerman, Peter A.; Sá, Juliana M.; Wellems, Thomas E.; Musset, Lise; Legrand, Eric; Melnikov, Alexandre; Neafsey, Daniel E.; Volkman, Sarah K.; Wirth, Dyann F.; Sabeti, Pardis C.

2015-01-01

Plasmodium vivax, one of the five species of Plasmodium parasites that cause human malaria, is responsible for 25–40% of malaria cases worldwide. Malaria global elimination efforts will benefit from accurate and effective genotyping tools that will provide insight into the population genetics and diversity of this parasite. The recent sequencing of P. vivax isolates from South America, Africa, and Asia presents a new opportunity by uncovering thousands of novel single nucleotide polymorphisms (SNPs). Genotyping a selection of these SNPs provides a robust, low-cost method of identifying parasite infections through their unique genetic signature or barcode. Based on our experience in generating a SNP barcode for P. falciparum using High Resolution Melting (HRM), we have developed a similar tool for P. vivax. We selected globally polymorphic SNPs from available P. vivax genome sequence data that were located in putatively selectively neutral sites (i.e., intergenic, intronic, or 4-fold degenerate coding). From these candidate SNPs we defined a barcode consisting of 42 SNPs. We analyzed the performance of the 42-SNP barcode on 87 P. vivax clinical samples from parasite populations in South America (Brazil, French Guiana), Africa (Ethiopia) and Asia (Sri Lanka). We found that the P. vivax barcode is robust, as it requires only a small quantity of DNA (limit of detection 0.3 ng/μl) to yield reproducible genotype calls, and detects polymorphic genotypes with high sensitivity. The markers are informative across all clinical samples evaluated (average minor allele frequency > 0.1). Population genetic and statistical analyses show the barcode captures high degrees of population diversity and differentiates geographically distinct populations. Our 42-SNP barcode provides a robust, informative, and standardized genetic marker set that accurately identifies a genomic signature for P. vivax infections. PMID:25781890

Identification of single-nucleotide polymorphisms of the prion protein gene in sika deer (Cervus nippon laiouanus)

PubMed Central

Jeong, Hyun-Jeong; Lee, Joong-Bok; Park, Seung-Yong; Song, Chang-Seon; Kim, Bo-Sook; Rho, Jung-Rae; Yoo, Mi-Hyun; Jeong, Byung-Hoon; Kim, Yong-Sun

2007-01-01

Polymorphisms of the prion protein gene (PRNP) have been detected in several cervid species. In order to confirm the genetic variations, this study examined the DNA sequences of the PRNP obtained from 33 captive sika deer (Cervus nippon laiouanus) in Korea. A total of three single-nucleotide polymorphisms (SNPs) at codons 100, 136 and 226 in the PRNP of the sika deer were identified. The polymorphic site located at codon 100 has not been reported. The SNPs detected at codons 100 and 226 induced amino acid substitutions. The SNP at codon 136 was a silent mutation that does not induce any amino acid change. The genotype and allele frequencies were determined for each of the SNPs. PMID:17679779

Vitamin D receptor polymorphisms in patients with cutaneous melanoma

PubMed Central

Orlow, Irene; Roy, Pampa; Reiner, Anne S.; Yoo, Sarah; Patel, Himali; Paine, Susan; Armstrong, Bruce K.; Kricker, Anne; Marrett, Loraine D.; Millikan, Robert C.; Thomas, Nancy E.; Gruber, Stephen B.; Anton-Culver, Hoda; Rosso, Stefano; Gallagher, Richard P.; Dwyer, Terence; Kanetsky, Peter A.; Busam, Klaus; From, Lynn; Begg, Colin B.; Berwick, Marianne

2011-01-01

The vitamin D receptor (VDR) gene has been associated with cancer risk, but only a few polymorphisms have been studied in relation to melanoma risk and the results have been inconsistent. We examined 38 VDR gene SNPs in a large international multi-center population-based case-control study of melanoma. Buccal DNAs were obtained from 1207 people with incident multiple primary melanoma and 2469 with incident single primary melanoma. SNPs with known or suspected impact on VDR activity, htSNPs with ≥10% MAF in Caucasians, and SNPs reported as significant in other association studies were examined. Logistic regression was used to calculate the relative risks conferred by the individual SNP. Eight of 38 SNPs in the promoter, coding, and 3’ gene regions were individually significantly associated with multiple primary melanoma after adjusting for covariates. The estimated increase in risk for individuals who were homozygous for the minor allele ranged from 25% to 33% for 6 polymorphisms: rs10875712 (OR 1.28; 95%CI, 1.01–1.62), rs4760674 (OR 1.33; 95% CI, 1.06–1.67), rs7139166 (OR 1.26; 95%CI, 1.02–1.56), rs4516035 (OR 1.25; 95%CI, 1.01–1.55), rs11168287 (OR 1.27; 95%CI, 1.03–1.57), rs1544410 (OR 1.30; 95%CI, 1.04–1.63); for 2 polymorphisms, homozygous carriers had a decreased risk: rs7305032 (OR 0.81; 95%CI 0.65–1.02), rs7965281 (OR, 0.78; 95%CI, 0.62–0.99). We recognize the potential false positive findings due to multiple comparisons; however the 8 significant SNPs in this study outnumbered the 2 significant tests expected to occur by chance. The vitamin D receptor may play a role in melanomagenesis. PMID:21365644

Genotyping three SNPs affecting warfarin drug response by isothermal real-time HDA assays.

PubMed

Li, Ying; Jortani, Saeed A; Ramey-Hartung, Bronwyn; Hudson, Elizabeth; Lemieux, Bertrand; Kong, Huimin

2011-01-14

The response to the anticoagulant drug warfarin is greatly affected by genetic polymorphisms in the VKORC1 and CYP2C9 genes. Genotyping these polymorphisms has been shown to be important in reducing the time of the trial and error process for finding the maintenance dose of warfarin thus reducing the risk of adverse effects of the drug. We developed a real-time isothermal DNA amplification system for genotyping three single nucleotide polymorphisms (SNPs) that influence warfarin response. For each SNP, real-time isothermal Helicase Dependent Amplification (HDA) reactions were performed to amplify a DNA fragment containing the SNP. Amplicons were detected by fluorescently labeled allele specific probes during real-time HDA amplification. Fifty clinical samples were analyzed by the HDA-based method, generating a total of 150 results. Of these, 148 were consistent between the HDA-based assays and a reference method. The two samples with unresolved HDA-based test results were repeated and found to be consistent with the reference method. The HDA-based assays demonstrated a clinically acceptable performance for genotyping the VKORC1 -1639G>A SNP and two SNPs (430C>T and 1075A>C) for the CYP2C9 enzyme (CYP2C9*2 and CYP2C9*3), all of which are relevant in warfarin pharmacogenentics. Copyright © 2010 Elsevier B.V. All rights reserved.

SNPServer: a real-time SNP discovery tool.

PubMed

Savage, David; Batley, Jacqueline; Erwin, Tim; Logan, Erica; Love, Christopher G; Lim, Geraldine A C; Mongin, Emmanuel; Barker, Gary; Spangenberg, German C; Edwards, David

2005-07-01

SNPServer is a real-time flexible tool for the discovery of SNPs (single nucleotide polymorphisms) within DNA sequence data. The program uses BLAST, to identify related sequences, and CAP3, to cluster and align these sequences. The alignments are parsed to the SNP discovery software autoSNP, a program that detects SNPs and insertion/deletion polymorphisms (indels). Alternatively, lists of related sequences or pre-assembled sequences may be entered for SNP discovery. SNPServer and autoSNP use redundancy to differentiate between candidate SNPs and sequence errors. For each candidate SNP, two measures of confidence are calculated, the redundancy of the polymorphism at a SNP locus and the co-segregation of the candidate SNP with other SNPs in the alignment. SNPServer is available at http://hornbill.cspp.latrobe.edu.au/snpdiscovery.html.

Development of genetic markers in abalone through construction of a SNP database.

PubMed

Kang, J-H; Appleyard, S A; Elliott, N G; Jee, Y-J; Lee, J B; Kang, S W; Baek, M K; Han, Y S; Choi, T-J; Lee, Y S

2011-06-01

In the absence of a reference genome, single-nucleotide polymorphisms (SNP) discovery in a group of abalone species was undertaken by random sequence assembly. A web-based interface was constructed, and 11 932 DNA sequences from the genus Haliotis were assembled, with 1321 contigs built. Of these, 118 contigs that consisted of at least ten annotation groups were selected. The 1577 putative SNPs were identified from the 118 contigs, with SNPs in several HSP70 gene contigs confirmed by PCR amplification of an 809-bp DNA fragment. SNPs in the HSP70 gene were compared across eight abalone species. A total of 129 polymorphic sites, including heterozygote sites within and among species, were observed. Phylogenetic analysis of the partial HSP70 gene region showed separation of the tested abalone into two groups, one reflecting the southern hemisphere species and the other the northern hemisphere species. Interestingly, Haliotis iris from New Zealand showed a closer relationship to species distributed in the northern Pacific region. Although HSP genes are known to be highly conserved among taxa, the validation of polymorphic SNPs from HSP70 in this mollusc demonstrates the applicability of cross-species SNP markers in abalone and the first step towards universal nuclear markers in Haliotis. © 2010 NFRDI, Animal Genetics © 2010 Stichting International Foundation for Animal Genetics.

SNP identification in FBXO32 gene and their associations with growth traits in cattle.

PubMed

Wang, Ailan; Zhang, Ya; Li, Mijie; Lan, Xianyong; Wang, Juqiang; Chen, Hong

2013-02-15

The F-box protein 32 (FBXO32), also known as Atrogin-1, is one of the four subunits of the ubiquitin protein ligase complex. FBXO32 has been previously shown to be involved in regulation of initiation and development of muscle mass. In the present study, we investigated the polymorphism of FBXO32 gene in 1313 cattle from seven bovine breeds using DNA sequencing, polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) and PCR-based amplification-created restriction site (PCR-ACRS) methods. Four novel single nucleotide polymorphisms (SNPs) were identified within bovine FBXO32, and were deposited in the GenBank database. The association studies between these four SNPs and growth traits were performed in NanYang cattle. Notably, the SNPs ss411628932 and ss411628936 were shown to be significantly associated with body length of 24-month-old NanYang cattle. Based on the above four SNPs, 16 haplotypes were identified. The main haplotype was AATA, which occurred at a frequency of more than 40%. Additionally, phylogenetic analysis showed that geographical distance was essential to gene flow among seven cattle breeds. Indigenous bovine breeds displayed genetic difference in comparison to hybrid bovine breeds that have foreign origins. We herein describe for the first time a comprehensive study on the variability of bovine FBXO32 gene that is predictive of genetic potential for body length phenotype. Copyright © 2012 Elsevier B.V. All rights reserved.

Naked-eye fingerprinting of single nucleotide polymorphisms on psoriasis patients

NASA Astrophysics Data System (ADS)

Valentini, Paola; Marsella, Alessandra; Tarantino, Paolo; Mauro, Salvatore; Baglietto, Silvia; Congedo, Maurizio; Paolo Pompa, Pier

2016-05-01

We report a low-cost test, based on gold nanoparticles, for the colorimetric (naked-eye) fingerprinting of a panel of single nucleotide polymorphisms (SNPs), relevant for the personalized therapy of psoriasis. Such pharmacogenomic tests are not routinely performed on psoriasis patients, due to the high cost of standard technologies. We demonstrated high sensitivity and specificity of our colorimetric test by validating it on a cohort of 30 patients, through a double-blind comparison with two state-of-the-art instrumental techniques, namely reverse dot blotting and sequencing, finding 100% agreement. This test offers high parallelization capabilities and can be easily generalized to other SNPs of clinical relevance, finding broad utility in diagnostics and pharmacogenomics.We report a low-cost test, based on gold nanoparticles, for the colorimetric (naked-eye) fingerprinting of a panel of single nucleotide polymorphisms (SNPs), relevant for the personalized therapy of psoriasis. Such pharmacogenomic tests are not routinely performed on psoriasis patients, due to the high cost of standard technologies. We demonstrated high sensitivity and specificity of our colorimetric test by validating it on a cohort of 30 patients, through a double-blind comparison with two state-of-the-art instrumental techniques, namely reverse dot blotting and sequencing, finding 100% agreement. This test offers high parallelization capabilities and can be easily generalized to other SNPs of clinical relevance, finding broad utility in diagnostics and pharmacogenomics. Electronic supplementary information (ESI) available. See DOI: 10.1039/c6nr02200f

What can time-frequency and phase coherence measures tell us about the genetic basis of P3 amplitude?

PubMed Central

McGue, Matt; Iacono, William G.

2017-01-01

In a recent comprehensive investigation, we largely failed to identify significant genetic markers associated with P3 amplitude or to corroborate previous associations between P3 and specific single nucleotide polymorphisms (SNPs) or genes. In the present study we extended this line of investigation to examine time-frequency (TF) activity and intertrial phase coherence (ITPC) in the P3 time window, both of which are associated with P3 amplitude. Previous genome-wide research has reported associations between P3-related theta and delta activity and individual genetic variants. A large, population-based sample of 4211 subjects, comprising male and female adolescent twins and their parents, was genotyped for 527,828 single nucleotide polymorphisms (SNPs), from which over six million SNPs were accurately imputed. Heritability estimates were greater for TF energy than ITPC, whether based on biometric models or the combined influence of all measured SNPs (derived from genome-wide complex trait analysis). The magnitude of overlap in the specific SNPs associated with delta energy and ITPC and P3 amplitude was significant. A genome-wide analysis of all SNPs, accompanied by an analysis of approximately 17,600 genes, indicated a region of chromosome 2 around TEKT4 that was significantly associated with theta ITPC. Analysis of candidate SNPs and genes previously reported to be associated with P3 or related phenotypes yielded one association surviving correction for multiple tests: between theta energy and CRHR1. However, we did not obtain significant associations for SNPs implicated in previous genome-wide studies of TF measures. Identifying specific genetic variants associated with P3 amplitude remains a challenge. PMID:27871913

A genotyping system capable of simultaneously analyzing >1000 single nucleotide polymorphisms in a haploid genome.

PubMed

Wang, Hui-Yun; Luo, Minjie; Tereshchenko, Irina V; Frikker, Danielle M; Cui, Xiangfeng; Li, James Y; Hu, Guohong; Chu, Yi; Azaro, Marco A; Lin, Yong; Shen, Li; Yang, Qifeng; Kambouris, Manousos E; Gao, Richeng; Shih, Weichung; Li, Honghua

2005-02-01

A high-throughput genotyping system for scoring single nucleotide polymorphisms (SNPs) has been developed. With this system, >1000 SNPs can be analyzed in a single assay, with a sensitivity that allows the use of single haploid cells as starting material. In the multiplex polymorphic sequence amplification step, instead of attaching universal sequences to the amplicons, primers that are unlikely to have nonspecific and productive interactions are used. Genotypes of SNPs are then determined by using the widely accessible microarray technology and the simple single-base extension assay. Three SNP panels, each consisting of >1000 SNPs, were incorporated into this system. The system was used to analyze 24 human genomic DNA samples. With 5 ng of human genomic DNA, the average detection rate was 98.22% when single probes were used, and 96.71% could be detected by dual probes in different directions. When single sperm cells were used, 91.88% of the SNPs were detectable, which is comparable to the level that was reached when very few genetic markers were used. By using a dual-probe assay, the average genotyping accuracy was 99.96% for 5 ng of human genomic DNA and 99.95% for single sperm. This system may be used to significantly facilitate large-scale genetic analysis even if the amount of DNA template is very limited or even highly degraded as that obtained from paraffin-embedded cancer specimens, and to make many unpractical research projects highly realistic and affordable.

Validation of PDE9A Gene Identified in GWAS Showing Strong Association with Milk Production Traits in Chinese Holstein.

PubMed

Yang, Shao-Hua; Bi, Xiao-Jun; Xie, Yan; Li, Cong; Zhang, Sheng-Li; Zhang, Qin; Sun, Dong-Xiao

2015-11-05

Phosphodiesterase9A (PDE9A) is a cyclic guanosine monophosphate (cGMP)-specific enzyme widely expressed among the tissues, which is important in activating cGMP-dependent signaling pathways. In our previous genome-wide association study, a single nucleotide polymorphism (SNP) (BTA-55340-no-rs(b)) located in the intron 14 of PDE9A, was found to be significantly associated with protein yield. In addition, we found that PDE9A was highly expressed in mammary gland by analyzing its mRNA expression in different tissues. The objectives of this study were to identify genetic polymorphisms of PDE9A and to determine the effects of these variants on milk production traits in dairy cattle. DNA sequencing identified 11 single nucleotide polymorphisms (SNPs) and six SNPs in 5' regulatory region were genotyped to test for the subsequent association analyses. After Bonferroni correction for multiple testing, all these identified SNPs were statistically significant for one or more milk production traits (p < 0.0001~0.0077). Interestingly, haplotype-based association analysis revealed similar effects on milk production traits (p < 0.01). In follow-up RNA expression analyses, two SNPs (c.-1376 G>A, c.-724 A>G) were involved in the regulation of gene expression. Consequently, our findings provide confirmatory evidences for associations of PDE9A variants with milk production traits and these identified SNPs may serve as genetic markers to accelerate Chinese Holstein breeding program.

Association of ITPA polymorphisms rs6051702/rs1127354 instead of rs7270101/rs1127354 as predictor of ribavirin-associated anemia in chronic hepatitis C treated patients.

PubMed

D'Avolio, Antonio; De Nicolò, Amedeo; Cusato, Jessica; Ciancio, Alessia; Boglione, Lucio; Strona, Silvia; Cariti, Giuseppe; Troshina, Giulia; Caviglia, Gian Paolo; Smedile, Antonina; Rizzetto, Mario; Di Perri, Giovanni

2013-10-01

Functional variants rs7270101 and rs1127354 of inosine triphosphatase (ITPA) were recently found to protect against ribavirin (RBV)-induced hemolytic anemia. However, no definitive data are yet available on the role of no functional rs6051702 polymorphism. Since a simultaneous evaluation of the three ITPA SNPs for hemolytic anemia has not yet been investigated, we aimed to understand the contribution of each SNPs and its potential clinical use to predict anemia in HCV treated patients. A retrospective analysis included 379 HCV treated patients. The ITPA variants rs6051702, rs7270101 and rs1127354 were genotyped and tested for association with achieving anemia at week 4. We also investigated, using multivariate logistic regression, the impact of each single and paired associated polymorphism on anemia onset. All SNPs were associated with Hb decrease. The carrier of at least one variant allele in the functional ITPA SNPs was associated with a lower decrement of Hb, as compared to patients without a variant allele. In multivariate logistic regression analyses the carrier of a variant allele in the rs6051702/rs1127354 association (OR=0.11, p=1.75×10(-5)) and Hb at baseline (OR=1.51, p=1.21×10(-4)) were independently associated with protection against clinically significant anemia at week 4. All ITPA polymorphisms considered were shown to be significantly associated with anemia onset. A multivariate regression model based on ITPA genetic polymorphisms was developed for predicting the risk of anemia. Considering the characterization of pre-therapy anemia predictors, rs6051702 SNP in association to rs1127354 is more informative in order to avoid this relevant adverse event. Copyright © 2013 Elsevier B.V. All rights reserved.

Identification of single nucleotide polymorphism in ginger using expressed sequence tags

PubMed Central

Chandrasekar, Arumugam; Riju, Aikkal; Sithara, Kandiyl; Anoop, Sahadevan; Eapen, Santhosh J

2009-01-01

Ginger (Zingiber officinale Rosc) (Family: Zingiberaceae) is a herbaceous perennial, the rhizomes of which are used as a spice. Ginger is a plant which is well known for its medicinal applications. Recently EST-derived SNPs are a free by-product of the currently expanding EST (Expressed Sequence Tag) databases. The development of high-throughput methods for the detection of SNPs (Single Nucleotide Polymorphism) and small indels (insertion/deletion) has led to a revolution in their use as molecular markers. Available (38139) Ginger EST sequences were mined from dbEST of NCBI. CAP3 program was used to assemble EST sequences into contigs. Candidate SNPs and Indel polymorphisms were detected using the perl script AutoSNP version 1.0 which has used 31905 ESTs for detecting SNPs and Indel sites. We found 64026 SNP sites and 7034 indel polymorphisms with frequency of 0.84 SNPs / 100 bp. Among the three tissues from which the EST libraries had been generated, Rhizomes had high frequency of 1.08 SNPs/indels per 100 bp whereas the leaves had lowest frequency of 0.63 per 100 bp and root is showing relative frequency 0.82/100bp. Transitions and transversion ratio is 0.90. In overall detected SNP, transversion is high when compare to transition. These detected SNPs can be used as markers for genetic studies. Availability The results of the present study hosted in our webserver www.spices.res.in/spicesnip PMID:20198184

Screening and Evaluation of Deleterious SNPs in APOE Gene of Alzheimer's Disease.

PubMed

Masoodi, Tariq Ahmad; Al Shammari, Sulaiman A; Al-Muammar, May N; Alhamdan, Adel A

2012-01-01

Introduction. Apolipoprotein E (APOE) is an important risk factor for Alzheimer's disease (AD) and is present in 30-50% of patients who develop late-onset AD. Several single-nucleotide polymorphisms (SNPs) are present in APOE gene which act as the biomarkers for exploring the genetic basis of this disease. The objective of this study is to identify deleterious nsSNPs associated with APOE gene. Methods. The SNPs were retrieved from dbSNP. Using I-Mutant, protein stability change was calculated. The potentially functional nonsynonymous (ns) SNPs and their effect on protein was predicted by PolyPhen and SIFT, respectively. FASTSNP was used for functional analysis and estimation of risk score. The functional impact on the APOE protein was evaluated by using Swiss PDB viewer and NOMAD-Ref server. Results. Six nsSNPs were found to be least stable by I-Mutant 2.0 with DDG value of >-1.0. Four nsSNPs showed a highly deleterious tolerance index score of 0.00. Nine nsSNPs were found to be probably damaging with position-specific independent counts (PSICs) score of ≥2.0. Seven nsSNPs were found to be highly polymorphic with a risk score of 3-4. The total energies and root-mean-square deviation (RMSD) values were higher for three mutant-type structures compared to the native modeled structure. Conclusion. We concluded that three nsSNPs, namely, rs11542041, rs11542040, and rs11542034, to be potentially functional polymorphic.

Association of CASP9, CASP10 gene polymorphisms and tea drinking with colorectal cancer risk in the Han Chinese population.

PubMed

Liu, He; Jiang, Xia; Zhang, Ming-wu; Pan, Yi-feng; Yu, Yun-xian; Zhang, Shan-chun; Ma, Xin-yuan; Li, Qi-long; Chen, Kun

2013-01-01

The initiators caspase-9 (CASP9) and caspase-10 (CASP10) are two key controllers of apoptosis and play important roles in carcinogenesis. This study aims to explore the association between CASPs gene polymorphisms and colorectal cancer (CRC) susceptibility in a population-based study. A two-stage designed population-based case-control study was carried out, including a testing set with 300 cases and 296 controls and a validation set with 206 cases and 845 controls. A total of eight tag selected single nucleotide polymorphisms (SNPs) in CASP9 and CASP10 were chosen based on HapMap and the National Center of Biotechnology Information (NCBI) datasets and genotyped by restriction fragment length polymorphism (RFLP) assay. Multivariate logistic regression models were applied to evaluate the association of SNPs with CRC risk. In the first stage, from eight tag SNPs, three polymorphisms rs4646077 (odds ratio (OR)(AA+AG): 0.654, 95% confidence interval (CI): 0.406-1.055; P=0.082), rs4233532 (OR(CC): 1.667, 95% CI: 0.967-2.876; OR(CT): 1.435, 95% CI: 0.998-2.063; P=0.077), and rs2881930 (OR(CC): 0.263, 95% CI: 0.095-0.728, P=0.036) showed possible association with CRC risk. However, none of the three SNPs, rs4646077 (OR(AA+AG): 1.233, 95% CI: 0.903-1.683), rs4233532 (OR(CC): 0.892, 95% CI: 0.640-1.243; OR(CT): 1.134, 95% CI: 0.897-1.433), and rs2881930 (OR(CC): 1.096, 95% CI: 0.620-1.938; OR(CT): 1.009, 95% CI: 0.801-1.271), remained significant with CRC risk in the validation set, even after stratification for different tumor locations (colon or rectum). In addition, never tea drinking was associated with a significantly increased risk of CRC in testing set together with validation set (OR: 1.755, 95% CI: 1.319-2.334). Our results found that polymorphisms of CASP9 and CASP10 genes may not contribute to CRC risk in Chinese population and thereby the large-scale case-control studies might be in consideration. In addition, tea drinking was a protective factor for CRC.

Association of CASP9, CASP10 gene polymorphisms and tea drinking with colorectal cancer risk in the Han Chinese population*

PubMed Central

Liu, He; Jiang, Xia; Zhang, Ming-wu; Pan, Yi-feng; Yu, Yun-xian; Zhang, Shan-chun; Ma, Xin-yuan; Li, Qi-long; Chen, Kun

2013-01-01

The initiators caspase-9 (CASP9) and caspase-10 (CASP10) are two key controllers of apoptosis and play important roles in carcinogenesis. This study aims to explore the association between CASPs gene polymorphisms and colorectal cancer (CRC) susceptibility in a population-based study. A two-stage designed population-based case-control study was carried out, including a testing set with 300 cases and 296 controls and a validation set with 206 cases and 845 controls. A total of eight tag selected single nucleotide polymorphisms (SNPs) in CASP9 and CASP10 were chosen based on HapMap and the National Center of Biotechnology Information (NCBI) datasets and genotyped by restriction fragment length polymorphism (RFLP) assay. Multivariate logistic regression models were applied to evaluate the association of SNPs with CRC risk. In the first stage, from eight tag SNPs, three polymorphisms rs4646077 (odds ratio (OR)AA+AG: 0.654, 95% confidence interval (CI): 0.406–1.055; P=0.082), rs4233532 (ORCC: 1.667, 95% CI: 0.967–2.876; ORCT: 1.435, 95% CI: 0.998–2.063; P=0.077), and rs2881930 (ORCC: 0.263, 95% CI: 0.095–0.728, P=0.036) showed possible association with CRC risk. However, none of the three SNPs, rs4646077 (ORAA+AG: 1.233, 95% CI: 0.903–1.683), rs4233532 (ORCC: 0.892, 95% CI: 0.640–1.243; ORCT: 1.134, 95% CI: 0.897–1.433), and rs2881930 (ORCC: 1.096, 95% CI: 0.620–1.938; ORCT: 1.009, 95% CI: 0.801–1.271), remained significant with CRC risk in the validation set, even after stratification for different tumor locations (colon or rectum). In addition, never tea drinking was associated with a significantly increased risk of CRC in testing set together with validation set (OR: 1.755, 95% CI: 1.319–2.334). Our results found that polymorphisms of CASP9 and CASP10 genes may not contribute to CRC risk in Chinese population and thereby the large-scale case-control studies might be in consideration. In addition, tea drinking was a protective factor for CRC. PMID:23303631

Association study of 21 circadian genes with bipolar I disorder, schizoaffective disorder, and schizophrenia

PubMed Central

Mansour, Hader A; Talkowski, Michael E; Wood, Joel; Chowdari, Kodavali V; McClain, Lora; Prasad, Konasale; Montrose, Debra; Fagiolini, Andrea; Friedman, Edward S; Allen, Michael H; Bowden, Charles L; Calabrese, Joseph; El-Mallakh, Rif S; Escamilla, Michael; Faraone, Stephen V; Fossey, Mark D; Gyulai, Laszlo; Loftis, Jennifer M; Hauser, Peter; Ketter, Terence A; Marangell, Lauren B; Miklowitz, David J; Nierenberg, Andrew A; Patel, Jayendra; Sachs, Gary S; Sklar, Pamela; Smoller, Jordan W; Laird, Nan; Keshavan, Matcheri; Thase, Michael E; Axelson, David; Birmaher, Boris; Lewis, David; Monk, Tim; Frank, Ellen; Kupfer, David J; Devlin, Bernie; Nimgaonkar, Vishwajit L

2012-01-01

Objective Published studies suggest associations between circadian gene polymorphisms and bipolar I disorder (BPI), as well as schizoaffective disorder (SZA) and schizophrenia (SZ). The results are plausible, based on prior studies of circadian abnormalities. As replications have not been attempted uniformly, we evaluated representative, common polymorphisms in all three disorders. Methods We assayed 276 publicly available ‘tag’ single nucleotide polymorphisms (SNPs) at 21 circadian genes among 523 patients with BPI, 527 patients with SZ/SZA, and 477 screened adult controls. Detected associations were evaluated in relation to two published genome-wide association studies (GWAS). Results Using gene-based tests, suggestive associations were noted between EGR3 and BPI (p = 0.017), and between NPAS2 and SZ/SZA (p = 0.034). Three SNPs were associated with both sets of disorders (NPAS2: rs13025524 and rs11123857; RORB: rs10491929; p < 0.05). None of the associations remained significant following corrections for multiple comparisons. Approximately 15% of the analyzed SNPs overlapped with an independent study that conducted GWAS for BPI; suggestive overlap between the GWAS analyses and ours was noted at ARNTL. Conclusions Several suggestive, novel associations were detected with circadian genes and BPI and SZ/SZA, but the present analyses do not support associations with common polymorphisms that confer risk with odds ratios greater than 1.5. Additional analyses using adequately powered samples are warranted to further evaluate these results. PMID:19839995

Discovery, Validation and Characterization of 1039 Cattle Single Nucleotide Polymorphisms

USDA-ARS?s Scientific Manuscript database

We identified approximately 13000 putative single nucleotide polymorphisms (SNPs) by comparison of repeat-masked BAC-end sequences from the cattle RPCI-42 BAC library with whole-genome shotgun contigs of cattle genome assembly Btau 1.0. Genotyping of a subset of these SNPs was performed on a panel ...

Informativeness of single nucleotide polymorphisms and relationships among onion populations from important world production regions

USDA-ARS?s Scientific Manuscript database

Single nucleotide polymorphisms (SNPs) were genotyped using a high-density array and DNAs from individual plants from important onion populations from major production regions world-wide and the likely progenitor of onion, Allium vavilovii. Genotypes at 1226 SNPs were used to estimate genetic relati...

Microsatellite genotyping and genome-wide single nucleotide polymorphism-based indices of Plasmodium falciparum diversity within clinical infections.

PubMed

Murray, Lee; Mobegi, Victor A; Duffy, Craig W; Assefa, Samuel A; Kwiatkowski, Dominic P; Laman, Eugene; Loua, Kovana M; Conway, David J

2016-05-12

In regions where malaria is endemic, individuals are often infected with multiple distinct parasite genotypes, a situation that may impact on evolution of parasite virulence and drug resistance. Most approaches to studying genotypic diversity have involved analysis of a modest number of polymorphic loci, although whole genome sequencing enables a broader characterisation of samples. PCR-based microsatellite typing of a panel of ten loci was performed on Plasmodium falciparum in 95 clinical isolates from a highly endemic area in the Republic of Guinea, to characterize within-isolate genetic diversity. Separately, single nucleotide polymorphism (SNP) data from genome-wide short-read sequences of the same samples were used to derive within-isolate fixation indices (F ws), an inverse measure of diversity within each isolate compared to overall local genetic diversity. The latter indices were compared with the microsatellite results, and also with indices derived by randomly sampling modest numbers of SNPs. As expected, the number of microsatellite loci with more than one allele in each isolate was highly significantly inversely correlated with the genome-wide F ws fixation index (r = -0.88, P < 0.001). However, the microsatellite analysis revealed that most isolates contained mixed genotypes, even those that had no detectable genome sequence heterogeneity. Random sampling of different numbers of SNPs showed that an F ws index derived from ten or more SNPs with minor allele frequencies of >10 % had high correlation (r > 0.90) with the index derived using all SNPs. Different types of data give highly correlated indices of within-infection diversity, although PCR-based analysis detects low-level minority genotypes not apparent in bulk sequence analysis. When whole-genome data are not obtainable, quantitative assay of ten or more SNPs can yield a reasonably accurate estimate of the within-infection fixation index (F ws).

Mining of haplotype-based expressed sequence tag single nucleotide polymorphisms in citrus

PubMed Central

2013-01-01

Background Single nucleotide polymorphisms (SNPs), the most abundant variations in a genome, have been widely used in various studies. Detection and characterization of citrus haplotype-based expressed sequence tag (EST) SNPs will greatly facilitate further utilization of these gene-based resources. Results In this paper, haplotype-based SNPs were mined out of publicly available citrus expressed sequence tags (ESTs) from different citrus cultivars (genotypes) individually and collectively for comparison. There were a total of 567,297 ESTs belonging to 27 cultivars in varying numbers and consequentially yielding different numbers of haplotype-based quality SNPs. Sweet orange (SO) had the most (213,830) ESTs, generating 11,182 quality SNPs in 3,327 out of 4,228 usable contigs. Summed from all the individually mining results, a total of 25,417 quality SNPs were discovered – 15,010 (59.1%) were transitions (AG and CT), 9,114 (35.9%) were transversions (AC, GT, CG, and AT), and 1,293 (5.0%) were insertion/deletions (indels). A vast majority of SNP-containing contigs consisted of only 2 haplotypes, as expected, but the percentages of 2 haplotype contigs varied widely in these citrus cultivars. BLAST of the 25,417 25-mer SNP oligos to the Clementine reference genome scaffolds revealed 2,947 SNPs had “no hits found”, 19,943 had 1 unique hit / alignment, 1,571 had one hit and 2+ alignments per hit, and 956 had 2+ hits and 1+ alignment per hit. Of the total 24,293 scaffold hits, 23,955 (98.6%) were on the main scaffolds 1 to 9, and only 338 were on 87 minor scaffolds. Most alignments had 100% (25/25) or 96% (24/25) nucleotide identities, accounting for 93% of all the alignments. Considering almost all the nucleotide discrepancies in the 24/25 alignments were at the SNP sites, it served well as in silico validation of these SNPs, in addition to and consistent with the rate (81%) validated by sequencing and SNaPshot assay. Conclusions High-quality EST-SNPs from different citrus genotypes were detected, and compared to estimate the heterozygosity of each genome. All the SNP oligo sequences were aligned with the Clementine citrus genome to determine their distribution and uniqueness and for in silico validation, in addition to SNaPshot and sequencing validation of selected SNPs. PMID:24175923

A gold nanoparticles-based colorimetric test to detect single nucleotide polymorphisms for improvement of personalized therapy of psoriasis

NASA Astrophysics Data System (ADS)

Marsella, Alessandra; Valentini, Paola; Tarantino, Paolo; Congedo, Maurizio; Pompa, Pier Paolo

2016-04-01

We report a simple, rapid and low-cost test, based on gold nanoparticles, for the naked-eye colorimetric detection of a signature of single nucleotide polymorphisms (SNPs) relevant for the personalized medicine of psoriasis patients. We validated the colorimetric assay on real-world DNA samples from a cohort of 30 psoriasis patients and we compared the results, in double-blind, with those obtained with two state-of-the-art instrumental techniques, namely reverse dot blotting and direct sequencing, finding 100% agreement. We demonstrated high accuracy, sensitivity and specificity of the colorimetric test that can be easily adapted for the genotypization of different SNPs, important for the pharmacogenomics of various diseases, and in other fields, such as food traceability and population structure analysis.

Genetic polymorphisms associated with breast cancer in malaysian cohort.

PubMed

Chahil, Jagdish Kaur; Munretnam, Khamsigan; Samsudin, Nurulhafizah; Lye, Say Hean; Hashim, Nikman Adli Nor; Ramzi, Nurul Hanis; Velapasamy, Sharmila; Wee, Ler Lian; Alex, Livy

2015-04-01

Genome-wide association studies have discovered multiple single nucleotide polymorphisms (SNPs) associated with the risk of common diseases. The objective of this study was to demonstrate the replication of previously published SNPs that showed statistical significance for breast cancer in the Malaysian population. In this case-control study, 80 subjects for each group were recruited from various hospitals in Malaysia. A total of 768 SNPs were genotyped and analyzed to distinguish risk and protective alleles. A total of three SNPs were found to be associated with increased risk of breast cancer while six SNPs showed protective effect. All nine were statistically significant SNPs (p ≤ 0.01), five SNPs from previous studies were successfully replicated in our study. Significant modifiable (diet) and non-modifiable (family history of breast cancer in first degree relative) risk factors were also observed. We identified nine SNPs from this study to be either conferring susceptibility or protection to breast cancer which may serve as potential markers in risk prediction.

Cloning of polymorphisms (COP): enrichment of polymorphic sequences from complex genomes

PubMed Central

Li, Jingfeng; Wang, Fuli; Zabarovska, Veronika; Wahlestedt, Claes; Zabarovsky, Eugene R.

2000-01-01

Here we describe a new procedure (cloning of polymorphisms, COP) for enrichment of single nucleotide polymorphisms (SNPs) that represent restriction fragment length polymorphisms (RFLPs). COP would be applicable to the isolation of SNPs from particular regions of the genome, e.g. CpG islands, chromosomal bands, YACs or PAC contigs. A combination of digestion with restriction enzymes, treatment with uracil-DNA glycosylase and mung bean nuclease, PCR amplification and purification with streptavidin magnetic beads was used to isolate polymorphic sequences from the genomes of two human samples. After only two cycles of enrichment, 80% of the isolated clones were found to contain RFLPs. A simple method for the PCR detection of these polymorphisms was also developed. PMID:10606669

SNPs in stress-responsive rice genes: validation, genotyping, functional relevance and population structure

PubMed Central

2012-01-01

Background Single nucleotide polymorphism (SNP) validation and large-scale genotyping are required to maximize the use of DNA sequence variation and determine the functional relevance of candidate genes for complex stress tolerance traits through genetic association in rice. We used the bead array platform-based Illumina GoldenGate assay to validate and genotype SNPs in a select set of stress-responsive genes to understand their functional relevance and study the population structure in rice. Results Of the 384 putative SNPs assayed, we successfully validated and genotyped 362 (94.3%). Of these 325 (84.6%) showed polymorphism among the 91 rice genotypes examined. Physical distribution, degree of allele sharing, admixtures and introgression, and amino acid replacement of SNPs in 263 abiotic and 62 biotic stress-responsive genes provided clues for identification and targeted mapping of trait-associated genomic regions. We assessed the functional and adaptive significance of validated SNPs in a set of contrasting drought tolerant upland and sensitive lowland rice genotypes by correlating their allelic variation with amino acid sequence alterations in catalytic domains and three-dimensional secondary protein structure encoded by stress-responsive genes. We found a strong genetic association among SNPs in the nine stress-responsive genes with upland and lowland ecological adaptation. Higher nucleotide diversity was observed in indica accessions compared with other rice sub-populations based on different population genetic parameters. The inferred ancestry of 16% among rice genotypes was derived from admixed populations with the maximum between upland aus and wild Oryza species. Conclusions SNPs validated in biotic and abiotic stress-responsive rice genes can be used in association analyses to identify candidate genes and develop functional markers for stress tolerance in rice. PMID:22921105

Association of single-nucleotide polymorphisms of the tau gene with late-onset Parkinson disease.

PubMed

Martin, E R; Scott, W K; Nance, M A; Watts, R L; Hubble, J P; Koller, W C; Lyons, K; Pahwa, R; Stern, M B; Colcher, A; Hiner, B C; Jankovic, J; Ondo, W G; Allen, F H; Goetz, C G; Small, G W; Masterman, D; Mastaglia, F; Laing, N G; Stajich, J M; Ribble, R C; Booze, M W; Rogala, A; Hauser, M A; Zhang, F; Gibson, R A; Middleton, L T; Roses, A D; Haines, J L; Scott, B L; Pericak-Vance, M A; Vance, J M

2001-11-14

The human tau gene, which promotes assembly of neuronal microtubules, has been associated with several rare neurologic diseases that clinically include parkinsonian features. We recently observed linkage in idiopathic Parkinson disease (PD) to a region on chromosome 17q21 that contains the tau gene. These factors make tau a good candidate for investigation as a susceptibility gene for idiopathic PD, the most common form of the disease. To investigate whether the tau gene is involved in idiopathic PD. Among a sample of 1056 individuals from 235 families selected from 13 clinical centers in the United States and Australia and from a family ascertainment core center, we tested 5 single-nucleotide polymorphisms (SNPs) within the tau gene for association with PD, using family-based tests of association. Both affected (n = 426) and unaffected (n = 579) family members were included; 51 individuals had unclear PD status. Analyses were conducted to test individual SNPs and SNP haplotypes within the tau gene. Family-based tests of association, calculated using asymptotic distributions. Analysis of association between the SNPs and PD yielded significant evidence of association for 3 of the 5 SNPs tested: SNP 3, P =.03; SNP 9i, P =.04; and SNP 11, P =.04. The 2 other SNPs did not show evidence of significant association (SNP 9ii, P =.11, and SNP 9iii, P =.87). Strong evidence of association was found with haplotype analysis, with a positive association with one haplotype (P =.009) and a negative association with another haplotype (P =.007). Substantial linkage disequilibrium (P<.001) was detected between 4 of the 5 SNPs (SNPs 3, 9i, 9ii, and 11). This integrated approach of genetic linkage and positional association analyses implicates tau as a susceptibility gene for idiopathic PD.

Association of TRPV4 gene polymorphisms with chronic obstructive pulmonary disease.

PubMed

Zhu, Guohua; Gulsvik, Amund; Bakke, Per; Ghatta, Srinivas; Anderson, Wayne; Lomas, David A; Silverman, Edwin K; Pillai, Sreekumar G

2009-06-01

Chronic obstructive pulmonary disease (COPD) is characterized by airway epithelial damage, bronchoconstriction, parenchymal destruction and mucus hypersecretion. Upon activation by a broad range of stimuli, transient receptor potential vanilloid 4 (TRPV4) functions to control airway epithelial cell volume and epithelial and endothelial permeability; it also triggers bronchial smooth muscle contraction and participates in autoregulation of mucociliary transport. These functions of TRPV4 may be important for the regulation of COPD pathogenesis, so TRPV4 is a candidate gene for COPD. We genotyped 20 single nucleotide polymorphisms (SNPs) in TRPV4, and tested qualitative COPD and quantitative FEV(1) and FEV(1)/(F)VC phenotypes in two independent large populations. The family population had 606 pedigrees including 1891 individuals, and the case-control sample included 953 COPD cases and 956 controls. Family-based association tests were performed in the family data. Logistic regression and linear models were used in the case-control data to replicate the association results. In the family data, seven out of 20 SNPs tested were associated with COPD (2.5 x 10(-4) < or = P < or = 0.04) and six SNPs were associated with FEV(1)/VC (0.02 < or = P < or = 0.03) from family-based association tests (PBAT) analysis. Four out of the seven SNPs associated with COPD demonstrated replicated associations with the same effect directions in the case-control population (0.02 < or = P < or = 0.03). Significant haplotype associations supported the results of single SNP analyses. Thus, polymorphisms in the TRPV4 gene are associated with COPD.

CsSNP: A Web-Based Tool for the Detecting of Comparative Segments SNPs.

PubMed

Wang, Yi; Wang, Shuangshuang; Zhou, Dongjie; Yang, Shuai; Xu, Yongchao; Yang, Chao; Yang, Long

2016-07-01

SNP (single nucleotide polymorphism) is a popular tool for the study of genetic diversity, evolution, and other areas. Therefore, it is necessary to develop a convenient, utility, robust, rapid, and open source detecting-SNP tool for all researchers. Since the detection of SNPs needs special software and series steps including alignment, detection, analysis and present, the study of SNPs is limited for nonprofessional users. CsSNP (Comparative segments SNP, http://biodb.sdau.edu.cn/cssnp/ ) is a freely available web tool based on the Blat, Blast, and Perl programs to detect comparative segments SNPs and to show the detail information of SNPs. The results are filtered and presented in the statistics figure and a Gbrowse map. This platform contains the reference genomic sequences and coding sequences of 60 plant species, and also provides new opportunities for the users to detect SNPs easily. CsSNP is provided a convenient tool for nonprofessional users to find comparative segments SNPs in their own sequences, and give the users the information and the analysis of SNPs, and display these data in a dynamic map. It provides a new method to detect SNPs and may accelerate related studies.

SNiPlay: a web-based tool for detection, management and analysis of SNPs. Application to grapevine diversity projects.

PubMed

Dereeper, Alexis; Nicolas, Stéphane; Le Cunff, Loïc; Bacilieri, Roberto; Doligez, Agnès; Peros, Jean-Pierre; Ruiz, Manuel; This, Patrice

2011-05-05

High-throughput re-sequencing, new genotyping technologies and the availability of reference genomes allow the extensive characterization of Single Nucleotide Polymorphisms (SNPs) and insertion/deletion events (indels) in many plant species. The rapidly increasing amount of re-sequencing and genotyping data generated by large-scale genetic diversity projects requires the development of integrated bioinformatics tools able to efficiently manage, analyze, and combine these genetic data with genome structure and external data. In this context, we developed SNiPlay, a flexible, user-friendly and integrative web-based tool dedicated to polymorphism discovery and analysis. It integrates:1) a pipeline, freely accessible through the internet, combining existing softwares with new tools to detect SNPs and to compute different types of statistical indices and graphical layouts for SNP data. From standard sequence alignments, genotyping data or Sanger sequencing traces given as input, SNiPlay detects SNPs and indels events and outputs submission files for the design of Illumina's SNP chips. Subsequently, it sends sequences and genotyping data into a series of modules in charge of various processes: physical mapping to a reference genome, annotation (genomic position, intron/exon location, synonymous/non-synonymous substitutions), SNP frequency determination in user-defined groups, haplotype reconstruction and network, linkage disequilibrium evaluation, and diversity analysis (Pi, Watterson's Theta, Tajima's D).Furthermore, the pipeline allows the use of external data (such as phenotype, geographic origin, taxa, stratification) to define groups and compare statistical indices.2) a database storing polymorphisms, genotyping data and grapevine sequences released by public and private projects. It allows the user to retrieve SNPs using various filters (such as genomic position, missing data, polymorphism type, allele frequency), to compare SNP patterns between populations, and to export genotyping data or sequences in various formats. Our experiments on grapevine genetic projects showed that SNiPlay allows geneticists to rapidly obtain advanced results in several key research areas of plant genetic diversity. Both the management and treatment of large amounts of SNP data are rendered considerably easier for end-users through automation and integration. Current developments are taking into account new advances in high-throughput technologies.SNiPlay is available at: http://sniplay.cirad.fr/.

An SNP resource for rice genetics and breeding based on subspecies indica and japonica genome alignments.

PubMed

Feltus, F Alex; Wan, Jun; Schulze, Stefan R; Estill, James C; Jiang, Ning; Paterson, Andrew H

2004-09-01

Dense coverage of the rice genome with polymorphic DNA markers is an invaluable tool for DNA marker-assisted breeding, positional cloning, and a wide range of evolutionary studies. We have aligned drafts of two rice subspecies, indica and japonica, and analyzed levels and patterns of genetic diversity. After filtering multiple copy and low quality sequence, 408,898 candidate DNA polymorphisms (SNPs/INDELs) were discerned between the two subspecies. These filters have the consequence that our data set includes only a subset of the available SNPs (in particular excluding large numbers of SNPs that may occur between repetitive DNA alleles) but increase the likelihood that this subset is useful: Direct sequencing suggests that 79.8% +/- 7.5% of the in silico SNPs are real. The SNP sample in our database is not randomly distributed across the genome. In fact, 566 rice genomic regions had unusually high (328 contigs/48.6 Mb/13.6% of genome) or low (237 contigs/64.7 Mb/18.1% of genome) polymorphism rates. Many SNP-poor regions were substantially longer than most SNP-rich regions, covering up to 4 Mb, and possibly reflecting introgression between the respective gene pools that may have occurred hundreds of years ago. Although 46.2% +/- 8.3% of the SNPs differentiate other pairs of japonica and indica genotypes, SNP rates in rice were not predictive of evolutionary rates for corresponding genes in another grass species, sorghum. The data set is freely available at http://www.plantgenome.uga.edu/snp.

An SNP Resource for Rice Genetics and Breeding Based on Subspecies Indica and Japonica Genome Alignments

PubMed Central

Feltus, F. Alex; Wan, Jun; Schulze, Stefan R.; Estill, James C.; Jiang, Ning; Paterson, Andrew H.

2004-01-01

Dense coverage of the rice genome with polymorphic DNA markers is an invaluable tool for DNA marker-assisted breeding, positional cloning, and a wide range of evolutionary studies. We have aligned drafts of two rice subspecies, indica and japonica, and analyzed levels and patterns of genetic diversity. After filtering multiple copy and low quality sequence, 408,898 candidate DNA polymorphisms (SNPs/INDELs) were discerned between the two subspecies. These filters have the consequence that our data set includes only a subset of the available SNPs (in particular excluding large numbers of SNPs that may occur between repetitive DNA alleles) but increase the likelihood that this subset is useful: Direct sequencing suggests that 79.8% ± 7.5% of the in silico SNPs are real. The SNP sample in our database is not randomly distributed across the genome. In fact, 566 rice genomic regions had unusually high (328 contigs/48.6 Mb/13.6% of genome) or low (237 contigs/64.7 Mb/18.1% of genome) polymorphism rates. Many SNP-poor regions were substantially longer than most SNP-rich regions, covering up to 4 Mb, and possibly reflecting introgression between the respective gene pools that may have occurred hundreds of years ago. Although 46.2% ± 8.3% of the SNPs differentiate other pairs of japonica and indica genotypes, SNP rates in rice were not predictive of evolutionary rates for corresponding genes in another grass species, sorghum. The data set is freely available at http://www.plantgenome.uga.edu/snp. PMID:15342564

Genome-wide analysis of intraspecific DNA polymorphism in 'Micro-Tom', a model cultivar of tomato (Solanum lycopersicum).

PubMed

Kobayashi, Masaaki; Nagasaki, Hideki; Garcia, Virginie; Just, Daniel; Bres, Cécile; Mauxion, Jean-Philippe; Le Paslier, Marie-Christine; Brunel, Dominique; Suda, Kunihiro; Minakuchi, Yohei; Toyoda, Atsushi; Fujiyama, Asao; Toyoshima, Hiromi; Suzuki, Takayuki; Igarashi, Kaori; Rothan, Christophe; Kaminuma, Eli; Nakamura, Yasukazu; Yano, Kentaro; Aoki, Koh

2014-02-01

Tomato (Solanum lycopersicum) is regarded as a model plant of the Solanaceae family. The genome sequencing of the tomato cultivar 'Heinz 1706' was recently completed. To accelerate the progress of tomato genomics studies, systematic bioresources, such as mutagenized lines and full-length cDNA libraries, have been established for the cultivar 'Micro-Tom'. However, these resources cannot be utilized to their full potential without the completion of the genome sequencing of 'Micro-Tom'. We undertook the genome sequencing of 'Micro-Tom' and here report the identification of single nucleotide polymorphisms (SNPs) and insertion/deletions (indels) between 'Micro-Tom' and 'Heinz 1706'. The analysis demonstrated the presence of 1.23 million SNPs and 0.19 million indels between the two cultivars. The density of SNPs and indels was high in chromosomes 2, 5 and 11, but was low in chromosomes 6, 8 and 10. Three known mutations of 'Micro-Tom' were localized on chromosomal regions where the density of SNPs and indels was low, which was consistent with the fact that these mutations were relatively new and introgressed into 'Micro-Tom' during the breeding of this cultivar. We also report SNP analysis for two 'Micro-Tom' varieties that have been maintained independently in Japan and France, both of which have served as standard lines for 'Micro-Tom' mutant collections. Approximately 28,000 SNPs were identified between these two 'Micro-Tom' lines. These results provide high-resolution DNA polymorphic information on 'Micro-Tom' and represent a valuable contribution to the 'Micro-Tom'-based genomics resources.

IL28B polymorphisms of both recipient and donor cooperate to influence IFN treatment response in HCV recurrence after liver transplantation, but IL28B SNPs of the recipient play a major role in IFN-induced blocking of HCV replication.

PubMed

Barbera, Floriana; Russelli, Giovanna; Pipitone, Loredana; Pietrosi, Giada; Corsale, Sveva; Vizzini, Giovanni; Gridelli, Bruno; Conaldi, Pier Giulio

2015-04-01

Single nucleotide polymorphisms (SNPs) of the IL28B locus are associated with a positive response to pegylated interferon-alpha and ribavirin (pegIFN-alpha/RBV) treatment of HCV-infected patients. This study evaluated the association between SNPs rs12980275, rs12979860 and rs8099917 and treatment outcome of HCV recurrent infection in HCV-positive patients who underwent liver transplant. We aimed to assess to what extent recipient and/or graft donor IL28B polymorphisms contribute to HCV clearance after transplantation influencing the response to the antiviral treatment. We found that the allele frequencies in donors were in agreement with the pattern expected in the European population. The frequency of favourable genotypes was significantly lower in recipients than in donors, reasonably because the recipients represented a group of patients affected by chronic Hepatitis C. Our study demonstrated that the positive outcome of the pegIFN-alpha/RBV treatment of HCV recurrence is associated with the co-presence of favourable genotypes of both donors and recipients. However, IL28B SNPs of the recipient seem to play a major role in this clinical setting. In particular, homozygosis of rs12979860 favourable genotype in recipients was associated with sustained virological response independently from the donor's genotype. Thus, identification of these SNPs may be useful to predict the response to IFN-based therapy of HCV recurrent infection in liver-transplanted patients.

Polymorphisms of clip domain serine proteinase and serine proteinase homolog in the swimming crab Portunus trituberculatus and their association with Vibrio alginolyticus

NASA Astrophysics Data System (ADS)

Liu, Meng; Liu, Yuan; Hui, Min; Song, Chengwen; Cui, Zhaoxia

2017-03-01

Clip domain serine proteases (cSPs) and their homologs (SPHs) play an important role in various biological processes that are essential components of extracellular signaling cascades, especially in the innate immune responses of invertebrates. Here, polymorphisms of PtcSP and PtSPH from the swimming crab Portunus trituberculatus were investigated to explore their association with resistance/susceptibility to Vibrio alginolyticus. Polymorphic loci were identified using Clustal X, and characterized with SPSS 16.0 software, and then the significance of genotype and allele frequencies between resistant and susceptible stocks was determined by a χ 2 test. A total of 109 and 77 single nucleotide polymorphisms (SNPs) were identified in the genomic fragments of PtcSP and PtSPH, respectively. Notably, nearly half of PtSPH polymorphisms were found in the non-coding exon 1. Fourteen SNPs investigated were significantly associated with susceptibility/resistance to V. alginolyticus ( P <0.05). Among them, eight SNPs were observed in introns, and one synonymous, four non-synonymous SNPs and one ins-del were found in coding exons. In addition, five simple sequence repeats (SSRs) were detected in intron 3 of PtcSP. Although there was no statistically significant difference of allele frequencies, the SSRs showed different polymorphic alleles on the basis of the repeat number between resistant and susceptible stocks. After further validation, polymorphisms investigated here might be applied to select potential molecular markers of P. trituberculatus with resistance to V. alginolyticus.

Forensic genetic informativeness of an SNP panel consisting of 19 multi-allelic SNPs.

PubMed

Gao, Zehua; Chen, Xiaogang; Zhao, Yuancun; Zhao, Xiaohong; Zhang, Shu; Yang, Yiwen; Wang, Yufang; Zhang, Ji

2018-05-01

Current research focusing on forensic personal identification, phenotype inference and ancestry information on single-nucleotide polymorphisms (SNPs) has been widely reported. In the present study, we focused on tetra-allelic SNPs in the Chinese Han population. A total of 48 tetra-allelic SNPs were screened out from the Chinese Han population of the 1000 Genomes Database, including Chinese Han in Beijing (CHB) and Chinese Han South (CHS). Considering the forensic genetic requirement for the polymorphisms, only 11 tetra-allelic SNPs with a heterozygosity >0.06 were selected for further multiplex panel construction. In order to meet the demands of personal identification and parentage identification, an additional 8 tri-allelic SNPs were combined into the final multiplex panel. To ensure application in the degraded DNA analysis, all the PCR products were designed to be 87-188 bp. Employing multiple PCR reactions and SNaPshot minisequencing, 511 unrelated Chinese Han individuals from Sichuan were genotyped. The combined match probability (CMP), combined discrimination power (CDP), and cumulative probability of exclusion (CPE) of the panel were 6.07 × 10 -11 , 0.9999999999393 and 0.996764, respectively. Based on the population data retrieved from the 1000 Genomes Project, Fst values between Chinese Han in Sichuan (SCH) and all the populations included in the 1000 Genomes Project were calculated. The results indicated that two SNPs in this panel may contain ancestry information and may be used as markers of forensic biogeographical ancestry inference. Copyright © 2018 Elsevier B.V. All rights reserved.

Genetic polymorphisms for estimating risk of atrial fibrillation: a literature-based meta-analysis

PubMed Central

Smith, J. Gustav; Almgren, Peter; Engström, Gunnar; Hedblad, Bo; Platonov, Pyotr G.; Newton-Cheh, Christopher; Melander, Olle

2013-01-01

Objectives Genome-wide association studies have recently identified genetic polymorphisms associated with common, etiologically complex diseases, for which direct-to-consumer genetic testing with provision of absolute genetic risk estimates is marketed by commercial companies. Polymorphisms associated with atrial fibrillation (AF) have shown relatively large risk estimates but the robustness of such estimates across populations and study designs has not been studied. Design A systematic literature review with meta-analysis and assessment of between-study heterogeneity was performed for single nucleotide polymorphisms (SNPs) in the six genetic regions associated with AF in genome-wide or candidate gene studies. Results Data from 18 samples of European ancestry (n=12,100 cases; 115,702 controls) were identified for the SNP on chromosome 4q25 (rs220733), 16 samples (n=12,694 cases; 132,602 controls) for the SNP on 16q22 (rs2106261) and 4 samples (n=5,272 cases; 59,725 controls) for the SNP in KCNH2 (rs1805123). Only the discovery studies were identified for SNPs on 1q21 and in GJA5 and IL6R, why no meta-analyses were performed for those SNPs. In overall random-effects meta-analyses, association with AF was observed for both SNPs from genome-wide studies on 4q25 (OR 1.67, 95% CI=1.50–1.86, p=2×10−21) and 16q22 (OR 1.21, 95% CI=1.13–1.29, p=1×10−8), but not the SNP in KCNH2 from candidate gene studies (p=0.15). There was substantial effect heterogeneity across case-control and cross-sectional studies for both polymorphisms (I2=0.50–0.78, p<0.05), but not across prospective cohort studies (I2=0.39, p=0.15). Both polymorphisms were robustly associated with AF for each study design individually (p<0.05). Conclusions In meta-analyses including up to 150,000 individuals, polymorphisms in two genetic regions were robustly associated with AF across all study designs but with substantial context-dependency of risk estimates. PMID:22690879

A fast boosting-based screening method for large-scale association study in complex traits with genetic heterogeneity.

PubMed

Wang, Lu-Yong; Fasulo, D

2006-01-01

Genome-wide association study for complex diseases will generate massive amount of single nucleotide polymorphisms (SNPs) data. Univariate statistical test (i.e. Fisher exact test) was used to single out non-associated SNPs. However, the disease-susceptible SNPs may have little marginal effects in population and are unlikely to retain after the univariate tests. Also, model-based methods are impractical for large-scale dataset. Moreover, genetic heterogeneity makes the traditional methods harder to identify the genetic causes of diseases. A more recent random forest method provides a more robust method for screening the SNPs in thousands scale. However, for more large-scale data, i.e., Affymetrix Human Mapping 100K GeneChip data, a faster screening method is required to screening SNPs in whole-genome large scale association analysis with genetic heterogeneity. We propose a boosting-based method for rapid screening in large-scale analysis of complex traits in the presence of genetic heterogeneity. It provides a relatively fast and fairly good tool for screening and limiting the candidate SNPs for further more complex computational modeling task.

Design of a 9K illumina BeadChip for polar bears (Ursus maritimus) from RAD and transcriptome sequencing.

PubMed

Malenfant, René M; Coltman, David W; Davis, Corey S

2015-05-01

Single-nucleotide polymorphisms (SNPs) offer numerous advantages over anonymous markers such as microsatellites, including improved estimation of population parameters, finer-scale resolution of population structure and more precise genomic dissection of quantitative traits. However, many SNPs are needed to equal the resolution of a single microsatellite, and reliable large-scale genotyping of SNPs remains a challenge in nonmodel species. Here, we document the creation of a 9K Illumina Infinium BeadChip for polar bears (Ursus maritimus), which will be used to investigate: (i) the fine-scale population structure among Canadian polar bears and (ii) the genomic architecture of phenotypic traits in the Western Hudson Bay subpopulation. To this end, we used restriction-site associated DNA (RAD) sequencing from 38 bears across their circumpolar range, as well as blood/fat transcriptome sequencing of 10 individuals from Western Hudson Bay. Six-thousand RAD SNPs and 3000 transcriptomic SNPs were selected for the chip, based primarily on genomic spacing and gene function respectively. Of the 9000 SNPs ordered from Illumina, 8042 were successfully printed, and - after genotyping 1450 polar bears - 5441 of these SNPs were found to be well clustered and polymorphic. Using this array, we show rapid linkage disequilibrium decay among polar bears, we demonstrate that in a subsample of 78 individuals, our SNPs detect known genetic structure more clearly than 24 microsatellites genotyped for the same individuals and that these results are not driven by the SNP ascertainment scheme. Here, we present one of the first large-scale genotyping resources designed for a threatened species. © 2014 John Wiley & Sons Ltd.

Genomewide single nucleotide polymorphism discovery in Atlantic salmon (Salmo salar): validation in wild and farmed American and European populations.

PubMed

Yáñez, J M; Naswa, S; López, M E; Bassini, L; Correa, K; Gilbey, J; Bernatchez, L; Norris, A; Neira, R; Lhorente, J P; Schnable, P S; Newman, S; Mileham, A; Deeb, N; Di Genova, A; Maass, A

2016-07-01

A considerable number of single nucleotide polymorphisms (SNPs) are required to elucidate genotype-phenotype associations and determine the molecular basis of important traits. In this work, we carried out de novo SNP discovery accounting for both genome duplication and genetic variation from American and European salmon populations. A total of 9 736 473 nonredundant SNPs were identified across a set of 20 fish by whole-genome sequencing. After applying six bioinformatic filtering steps, 200 K SNPs were selected to develop an Affymetrix Axiom(®) myDesign Custom Array. This array was used to genotype 480 fish representing wild and farmed salmon from Europe, North America and Chile. A total of 159 099 (79.6%) SNPs were validated as high quality based on clustering properties. A total of 151 509 validated SNPs showed a unique position in the genome. When comparing these SNPs against 238 572 markers currently available in two other Atlantic salmon arrays, only 4.6% of the SNP overlapped with the panel developed in this study. This novel high-density SNP panel will be very useful for the dissection of economically and ecologically relevant traits, enhancing breeding programmes through genomic selection as well as supporting genetic studies in both wild and farmed populations of Atlantic salmon using high-resolution genomewide information. © 2016 John Wiley & Sons Ltd.

Pharmacogenetic screening for polymorphisms in drug-metabolizing enzymes and drug transporters in a Dutch population.

PubMed

Bosch, T M; Doodeman, V D; Smits, P H M; Meijerman, I; Schellens, J H M; Beijnen, J H

2006-01-01

A possible explanation for the wide interindividual variability in toxicity and efficacy of drug therapy is variation in genes encoding drug-metabolizing enzymes and drug transporters. The allelic frequency of these genetic variants, linkage disequilibrium (LD), and haplotype of these polymorphisms are important parameters in determining the genetic differences between patients. The aim of this study was to explore the frequencies of polymorphisms in drug-metabolizing enzymes (CYP1A1, CYP2C9, CYP2C19, CYP3A4, CYP2D6, CYP3A5, DPYD, UGT1A1, GSTM1, GSTP1, GSTT1) and drug transporters (ABCB1[MDR1] and ABCC2[MRP2]), and to investigate the LD and perform haplotype analysis of these polymorphisms in a Dutch population. Blood samples were obtained from 100 healthy volunteers and genomic DNA was isolated and amplified by PCR. The amplification products were sequenced and analyzed for the presence of polymorphisms by sequence alignment. In the study population, we identified 13 new single nucleotide polymorphisms (SNPs) in Caucasians and three new SNPs in non-Caucasians, in addition to previously recognized SNPs. Three of the new SNPs were found within exons, of which two resulted in amino acid changes (A428T in CYP2C9 resulting in the amino acid substitution D143V; and C4461T in ABCC2 in a non-Caucasian producing the amino acid change T1476M). Several LDs and haplotypes were found in the Caucasian individuals. In this Dutch population, the frequencies of 16 new SNPs and those of previously recognized SNPs were determined in genes coding for drug-metabolizing enzymes and drug transporters. Several LDs and haplotypes were also inferred. These data are important for further research to help explain the interindividual pharmacokinetic and pharmacodynamic variability in response to drug therapy.

A case-based evaluation of SRD5A1, SRD5A2, AR, and ADRA1A as candidate genes for severity of BPH.

PubMed

Klotsman, M; Weinberg, C R; Davis, K; Binnie, C G; Hartmann, K E

2004-01-01

In men with a clinical diagnosis of benign prostatic hyperplasia (BPH), polytomous logistic regression analysis was conducted to evaluate associations between two silent polymorphisms in SRD5A1 (codon positions 30 and 116), two polymorphisms in SRD5A2 (Val89Leu substitution and C to T transition in intron 1), a trinucleotide (CAG)n repeat in androgen receptor (AR), and an Arg492Cys substitution in ADRA1A and clinical parameters that characterize severity of BPH. Candidate gene selection was based on two mechanistic pathways targeted by pharmacotherapy for BPH: (1) androgen metabolic loci contributing to prostate growth (static obstruction); and (2) factors affecting smooth muscle tone (dynamic obstruction). Polymorphisms in SRD5A2 were not associated with severity of BPH; however, SRD5A1 polymorphisms were associated with severity of BPH. The process(es) in which these silent single-nucleotide polymorphisms (SNPs) influence BPH phenotypes is unknown and additional studies will be needed to assess whether these SNPs have direct functional consequences. The characterization of additional molecular factors that contribute to static and dynamic obstruction may help predict response to pharmacotherapy and serve to identify novel drug targets for the clinical management of BPH.

Characterization of six human disease-associated inversion polymorphisms.

PubMed

Antonacci, Francesca; Kidd, Jeffrey M; Marques-Bonet, Tomas; Ventura, Mario; Siswara, Priscillia; Jiang, Zhaoshi; Eichler, Evan E

2009-07-15

The human genome is a highly dynamic structure that shows a wide range of genetic polymorphic variation. Unlike other types of structural variation, little is known about inversion variants within normal individuals because such events are typically balanced and are difficult to detect and analyze by standard molecular approaches. Using sequence-based, cytogenetic and genotyping approaches, we characterized six large inversion polymorphisms that map to regions associated with genomic disorders with complex segmental duplications mapping at the breakpoints. We developed a metaphase FISH-based assay to genotype inversions and analyzed the chromosomes of 27 individuals from three HapMap populations. In this subset, we find that these inversions are less frequent or absent in Asians when compared with European and Yoruban populations. Analyzing multiple individuals from outgroup species of great apes, we show that most of these large inversion polymorphisms are specific to the human lineage with two exceptions, 17q21.31 and 8p23 inversions, which are found to be similarly polymorphic in other great ape species and where the inverted allele represents the ancestral state. Investigating linkage disequilibrium relationships with genotyped SNPs, we provide evidence that most of these inversions appear to have arisen on at least two different haplotype backgrounds. In these cases, discovery and genotyping methods based on SNPs may be confounded and molecular cytogenetics remains the only method to genotype these inversions.

Development of cleaved amplified polymorphic sequence markers and a CAPS-based genetic linkage map in watermelon (Citrullus lanatus [Thunb.] Matsum. and Nakai) constructed using whole-genome re-sequencing data

PubMed Central

Liu, Shi; Gao, Peng; Zhu, Qianglong; Luan, Feishi; Davis, Angela R.; Wang, Xiaolu

2016-01-01

Cleaved amplified polymorphic sequence (CAPS) markers are useful tools for detecting single nucleotide polymorphisms (SNPs). This study detected and converted SNP sites into CAPS markers based on high-throughput re-sequencing data in watermelon, for linkage map construction and quantitative trait locus (QTL) analysis. Two inbred lines, Cream of Saskatchewan (COS) and LSW-177 had been re-sequenced and analyzed by Perl self-compiled script for CAPS marker development. 88.7% and 78.5% of the assembled sequences of the two parental materials could map to the reference watermelon genome, respectively. Comparative assembled genome data analysis provided 225,693 and 19,268 SNPs and indels between the two materials. 532 pairs of CAPS markers were designed with 16 restriction enzymes, among which 271 pairs of primers gave distinct bands of the expected length and polymorphic bands, via PCR and enzyme digestion, with a polymorphic rate of 50.94%. Using the new CAPS markers, an initial CAPS-based genetic linkage map was constructed with the F2 population, spanning 1836.51 cM with 11 linkage groups and 301 markers. 12 QTLs were detected related to fruit flesh color, length, width, shape index, and brix content. These newly CAPS markers will be a valuable resource for breeding programs and genetic studies of watermelon. PMID:27162496

Genetic polymorphisms to predict gains in maximal O2 uptake and knee peak torque after a high intensity training program in humans.

PubMed

Yoo, Jinho; Kim, Bo-Hyung; Kim, Soo-Hwan; Kim, Yangseok; Yim, Sung-Vin

2016-05-01

The study aimed to identify single nucleotide polymorphisms (SNPs) that significantly influenced the level of improvement of two kinds of training responses, including maximal O2 uptake (V'O2max) and knee peak torque of healthy adults participating in the high intensity training (HIT) program. The study also aimed to use these SNPs to develop prediction models for individual training responses. 79 Healthy volunteers participated in the HIT program. A genome-wide association study, based on 2,391,739 SNPs, was performed to identify SNPs that were significantly associated with gains in V'O2max and knee peak torque, following 9 weeks of the HIT program. To predict two training responses, two independent SNPs sets were determined using linear regression and iterative binary logistic regression analysis. False discovery rate analysis and permutation tests were performed to avoid false-positive findings. To predict gains in V'O2max, 7 SNPs were identified. These SNPs accounted for 26.0 % of the variance in the increment of V'O2max, and discriminated the subjects into three subgroups, non-responders, medium responders, and high responders, with prediction accuracy of 86.1 %. For the knee peak torque, 6 SNPs were identified, and accounted for 27.5 % of the variance in the increment of knee peak torque. The prediction accuracy discriminating the subjects into the three subgroups was estimated as 77.2 %. Novel SNPs found in this study could explain, and predict inter-individual variability in gains of V'O2max, and knee peak torque. Furthermore, with these genetic markers, a methodology suggested in this study provides a sound approach for the personalized training program.

Development and evaluation of high-density Axiom® CicerSNP Array for high-resolution genetic mapping and breeding applications in chickpea.

PubMed

Roorkiwal, Manish; Jain, Ankit; Kale, Sandip M; Doddamani, Dadakhalandar; Chitikineni, Annapurna; Thudi, Mahendar; Varshney, Rajeev K

2018-04-01

To accelerate genomics research and molecular breeding applications in chickpea, a high-throughput SNP genotyping platform 'Axiom ® CicerSNP Array' has been designed, developed and validated. Screening of whole-genome resequencing data from 429 chickpea lines identified 4.9 million SNPs, from which a subset of 70 463 high-quality nonredundant SNPs was selected using different stringent filter criteria. This was further narrowed down to 61 174 SNPs based on p-convert score ≥0.3, of which 50 590 SNPs could be tiled on array. Among these tiled SNPs, a total of 11 245 SNPs (22.23%) were from the coding regions of 3673 different genes. The developed Axiom ® CicerSNP Array was used for genotyping two recombinant inbred line populations, namely ICCRIL03 (ICC 4958 × ICC 1882) and ICCRIL04 (ICC 283 × ICC 8261). Genotyping data reflected high success and polymorphic rate, with 15 140 (29.93%; ICCRIL03) and 20 018 (39.57%; ICCRIL04) polymorphic SNPs. High-density genetic maps comprising 13 679 SNPs spanning 1033.67 cM and 7769 SNPs spanning 1076.35 cM were developed for ICCRIL03 and ICCRIL04 populations, respectively. QTL analysis using multilocation, multiseason phenotyping data on these RILs identified 70 (ICCRIL03) and 120 (ICCRIL04) main-effect QTLs on genetic map. Higher precision and potential of this array is expected to advance chickpea genetics and breeding applications. © 2017 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.

Bioinformatic analyses to select phenotype affecting polymorphisms in HTR2C gene.

PubMed

Piva, Francesco; Giulietti, Matteo; Baldelli, Luisa; Nardi, Bernardo; Bellantuono, Cesario; Armeni, Tatiana; Saccucci, Franca; Principato, Giovanni

2011-08-01

Single nucleotide polymorphisms (SNPs) in serotonin related genes influence mental disorders, responses to pharmacological and psychotherapeutic treatments. In planning association studies, researchers that want to investigate new SNPs have to select some among a large number of candidates. Our aim is to guide researchers in the selection of the most likely phenotype affecting polymorphisms. Here, we studied serotonin receptor 2C (HTR2C) SNPs because, till now, only relatively few of about 2000 are investigated. We used the most updated and assessed bioinformatic tools to predict which variations can give rise to biological effects among 2450 HTR2C SNPs. We suggest 48 SNPs that are worth considering in future association studies in the field of psychiatry, psychology and pharmacogenomics. Moreover, our analyses point out the biological level probably affected, such as transcription, splicing, miRNA regulation and protein structure, thus allowing to suggest future molecular investigations. Although few association studies are available in literature, their results are in agreement with our predictions, showing that our selection methods can help to guide future association studies. Copyright © 2011 John Wiley & Sons, Ltd.

[Relationship of Ghrelin gene polymorphism with congenital anorectal malformation and Hirschsprung disease].

PubMed

Gao, Hong; Wang, Dajia; Zhao, Xiangxuan; Mi, Jie; Bai, Yuzuo; Wang, Weilin

2015-07-01

To explore the relationship of Ghrelin gene polymorphism with the occurrence of human anorectal malformations (ARMs) and Hirschsprung disease(HSCR). PCR and DNA sequencing were used to detect the single nucleotide polymorphism (SNPs) of 3 loci (rs139684563, rs149447194, rs186599567) genotype of Ghrelin gene in 100 children with ARMs, 100 children with HSCR, and 100 healthy children (normal group). Genovariation and gene mutation were analyzed with case-control method. Three loci SNPs were in accordance with Hardy-Weinberg genetic equilibrium. No significant differences were found in rs139684563 allele and genotype frequencies between the cases and the normal groups (P>0.05). The allele and genotype frequencies of rs149447194 and rs186599567 were significantly different between cases and normal group (P<0.05). DNA sequencing results showed that wild-type homozygous deletion (176th and 191th base A deletion, respectively) were found in rs149447194 and rs186599567of ARMs and HSCR children, and single base substitution was detected in rs149447194 of ARMs children (194th codon nucleotide CCT to CTC). The rs149447194 and the rs186599567 polymorphism changes may be associated with the pathogenesis of ARMs and HSCR.

Novel Single Nucleotide Polymorphism-Based Assay for Genotyping Mycobacterium avium subsp. paratuberculosis

PubMed Central

Goldstone, Robert J.; McLuckie, Joyce; Smith, David G. E.

2015-01-01

Typing of Mycobacterium avium subspecies paratuberculosis strains presents a challenge, since they are genetically monomorphic and traditional molecular techniques have limited discriminatory power. The recent advances and availability of whole-genome sequencing have extended possibilities for the characterization of Mycobacterium avium subspecies paratuberculosis, and whole-genome sequencing can provide a phylogenetic context to facilitate global epidemiology studies. In this study, we developed a single nucleotide polymorphism (SNP) assay based on PCR and restriction enzyme digestion or sequencing of the amplified product. The SNP analysis was performed using genome sequence data from 133 Mycobacterium avium subspecies paratuberculosis isolates with different genotypes from 8 different host species and 17 distinct geographic regions around the world. A total of 28,402 SNPs were identified among all of the isolates. The minimum number of SNPs required to distinguish between all of the 133 genomes was 93 and between only the type C isolates was 41. To reduce the number of SNPs and PCRs required, we adopted an approach based on sequential detection of SNPs and a decision tree. By the analysis of 14 SNPs Mycobacterium avium subspecies paratuberculosis isolates can be characterized within 14 phylogenetic groups with a higher discriminatory power than mycobacterial interspersed repetitive unit–variable number tandem repeat assay and other typing methods. Continuous updating of genome sequences is needed in order to better characterize new phylogenetic groups and SNP profiles. The novel SNP assay is a discriminative, simple, reproducible method and requires only basic laboratory equipment for the large-scale global typing of Mycobacterium avium subspecies paratuberculosis isolates. PMID:26677250

GSTO and AS3MT genetic polymorphisms and differences in urinary arsenic concentrations among residents in Bangladesh.

PubMed

Rodrigues, Ema G; Kile, Molly; Hoffman, Elaine; Quamruzzaman, Quazi; Rahman, Mahmuder; Mahiuddin, Golam; Hsueh, Yumei; Christiani, David C

2012-05-01

We determined whether single nucleotide polymorphisms (SNPs) in the glutathione S-transferase omega (GSTO) and arsenic(III)methyltransferase (AS3MT) genes were associated with concentrations of urinary arsenic metabolites among 900 individuals without skin lesions in Bangladesh. Four SNPs were assessed in these genes. A pathway analysis evaluated the association between urinary arsenic metabolites and SNPs. GSTO1 rs4925 homozygous wild type was significantly associated with higher monomethylarsonic acid (MMA) and dimethylarsinic acid urinary concentrations, whereas wild-type AS3MT rs11191439 had significantly lower levels of As(III) and MMA. Genetic polymorphisms GSTO and As3MT modify arsenic metabolism as evidenced by altered urinary arsenic excretion.

Genetic polymorphisms in TERT are associated with increased risk of esophageal cancer.

PubMed

Wu, Yifei; Yan, Mengdan; Li, Jing; Li, Jingjie; Chen, Zhengshuai; Chen, Peng; Li, Bin; Chen, Fulin; Jin, Tianbo; Chen, Chao

2017-02-07

Single nucleotide polymorphisms (SNPs) in TERT may be associated with susceptibility to esophageal cancer. In this study, we analyzed the association between TERT SNPs and risk of esophageal cancer in 386 esophageal cancer patients and 495 healthy subjects from the Xi'an area of China. Of the four SNPs examined, rs10069690 and rs2242652 were correlated with esophageal cancer risk. Additionally, after adjusting for age and gender, the "Trs10069690Ars2242652", "Trs10069690Grs2242652" haplotypes were associated with an increased risk of esophageal cancer, while the and "Crs10069690Grs2242652" haplotype was associated with a decreased risk of esophageal cancer. These findings suggest that TERT polymorphisms may contribute to the development of esophageal cancer.

Impact of single nucleotide polymorphisms of cytarabine metabolic genes on drug toxicity in childhood acute lymphoblastic leukemia.

PubMed

Gabor, Krisztina Mita; Schermann, Geza; Lautner-Csorba, Orsolya; Rarosi, Ferenc; Erdelyi, Daniel J; Endreffy, Emoke; Berek, Krisztina; Bartyik, Katalin; Bereczki, Csaba; Szalai, Csaba; Semsei, Agnes F

2015-04-01

Cytarabine (cytosine arabinoside, ara-C) is a chemotherapeutical agent used in the treatment of pediatric acute lymphoblastic leukemia (ALL). Adverse drug reactions, such as interpatient variability in sensitivity to ara-C, are considerable and may cause difficulties during chemotherapy. Single nucleotide polymorphisms (SNPs) can play a significant role in modifying nucleoside-drug pharmacokinetics and pharmacodynamics and thus the development of adverse effects. Our aim was to determine whether polymorphisms in genes encoding transporters and enzymes responsible for the metabolism of ara-C are associated with toxicity and clinical outcome in a patient population with childhood ALL. We studied 8 SNPs in the CDA, DCK, DCTD, SLC28A3, and SLC29A1 genes in 144 patients with childhood acute lymphoblastic leukemia treated according to ALLIC BFM 1990, 1995 and 2002 protocols. DCK rs12648166 and DCK rs4694362 SNPs were associated with hematologic toxicity (OR = 2.63, CI 95% = 1.37-5.04, P = 0.0036 and OR = 2.53, CI 95% = 1.34-4.80, P = 0.0044, respectively). Our results indicate that DCK polymorphisms might be important genetic risk factors for hematologic toxicity during ALL treatment with ara-C. Individualized chemotherapy based on genetic profiling may help to optimize ara-C dosing, leading to improvements in clinical outcome and reduced toxicity. © 2015 Wiley Periodicals, Inc.

ADAM33 polymorphisms are associated with asthma and a distinctive palm dermatoglyphic pattern

PubMed Central

XUE, WEILIN; HAN, WEI; ZHOU, ZHAO-SHAN

2013-01-01

A close correlation between asthma and palm dermatoglyphic patterns has been observed in previous studies, but the underlying genetic mechanisms have not been investigated. A disintegrin and metalloprotein-33 (ADAM33) polymorphisms are important in the development of asthma and other atopic diseases. To investigate the underlying mechanisms of the association between asthma and distinctive palm dermatoglyphic patterns, thirteen ADAM33 single-nucleotide polymorphisms (SNPs) were analyzed for the association between asthma and palm dermatoglyphic patterns in a population of 400 asthmatic patients and 200 healthy controls. Based on the results, five SNPs, rs44707 (codominant model, P=0.031; log-additive model, P=0.0084), rs2787094 (overdominant model, P=0.049), rs678881 (codominant model, P=0.028; overdominant model, P=0.0083), rs677044 (codominant model, P=0.013; log-additive model, P=0.0033) and rs512625 (dominant model, P=0.033), were associated with asthma in this population. Two SNPs, rs44707 (dominant model, P=0.042) and rs2787094 (codominant model, P=0.014; recessive model, P=0.0038), were observed in the asthma patients with the distinctive palm pattern. As rs44707 and rs2787094 are associated with asthma and a distinctive palm pattern, the data suggest that ADAM33 polymorphisms are correlated with asthma and may be the underlying genetic basis of the association between asthma and palm dermatoglyphic patterns. PMID:24141861

Development of a cost-efficient novel method for rapid, concurrent genotyping of five common single nucleotide polymorphisms of the brain derived neurotrophic factor (BDNF) gene by tetra-primer amplification refractory mutation system.

PubMed

Wang, Cathy K; Xu, Michael S; Ross, Colin J; Lo, Ryan; Procyshyn, Ric M; Vila-Rodriguez, Fidel; White, Randall F; Honer, William G; Barr, Alasdair M

2015-09-01

Brain derived neurotrophic factor (BDNF) is a molecular trophic factor that plays a key role in neuronal survival and plasticity. Single nucleotide polymorphisms (SNPs) of the BDNF gene have been associated with specific phenotypic traits in a large number of neuropsychiatric disorders and the response to psychotherapeutic medications in patient populations. Nevertheless, due to study differences and occasionally contrasting findings, substantial further research is required to understand in better detail the association between specific BDNF SNPs and these psychiatric disorders. While considerable progress has been made recently in developing advanced genotyping platforms of SNPs, many high-throughput probe- or array-based detection methods currently available are limited by high costs, slow processing times or access to advanced instrumentation. The polymerase chain reaction (PCR)-based, tetra-primer amplification refractory mutation system (T-ARMS) method is a potential alternative technique for detecting SNP genotypes efficiently, quickly, easily, and cheaply. As a tool in psychopathology research, T-ARMS was shown to be capable of detecting five common SNPs in the BDNF gene (rs6265, rs988748, rs11030104, 11757G/C and rs7103411), which are all SNPs with previously demonstrated clinical relevance to schizophrenia and depression. The present technique therefore represents a suitable protocol for many research laboratories to study the genetic correlates of BDNF in psychiatric disorders. Copyright Copyright © 2015 John Wiley & Sons, Ltd. Copyright © 2015 John Wiley & Sons, Ltd.

Inferring Alcoholism SNPs and Regulatory Chemical Compounds Based on Ensemble Bayesian Network.

PubMed

Chen, Huan; Sun, Jiatong; Jiang, Hong; Wang, Xianyue; Wu, Lingxiang; Wu, Wei; Wang, Qh

2017-01-01

The disturbance of consciousness is one of the most common symptoms of those have alcoholism and may cause disability and mortality. Previous studies indicated that several single nucleotide polymorphisms (SNP) increase the susceptibility of alcoholism. In this study, we utilized the Ensemble Bayesian Network (EBN) method to identify causal SNPs of alcoholism based on the verified GAW14 data. We built a Bayesian network combining random process and greedy search by using Genetic Analysis Workshop 14 (GAW14) dataset to establish EBN of SNPs. Then we predicted the association between SNPs and alcoholism by determining Bayes' prior probability. Thirteen out of eighteen SNPs directly connected with alcoholism were found concordance with potential risk regions of alcoholism in OMIM database. As many SNPs were found contributing to alteration on gene expression, known as expression quantitative trait loci (eQTLs), we further sought to identify chemical compounds acting as regulators of alcoholism genes captured by causal SNPs. Chloroprene and valproic acid were identified as the expression regulators for genes C11orf66 and SALL3 which were captured by alcoholism SNPs, respectively. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.

Family-based association testing strongly implicates DRD2 as a risk gene for schizophrenia in Han Chinese from Taiwan

PubMed Central

Glatt, SJ; Faraone, SV; Lasky-Su, JA; Kanazawa, T; Hwu, H-G; Tsuang, MT

2009-01-01

The gene that codes for dopamine receptor D2 (DRD2 on chromosome 11q23) has long been a prime functional and positional candidate risk gene for schizophrenia. Collectively, prior case–control studies found a reliable effect of the Ser311Cys DRD2 polymorphism (rs1801028) on risk for schizophrenia, but few other polymorphisms in the gene had ever been evaluated and no adequately powered family-based association study has been performed to date. Our objective was to test 21 haplotype-tagging and all three known nonsynonymous single-nucleotide polymorphisms (SNPs) in DRD2 for association with schizophrenia in a family-based study of 2408 Han Chinese, including 1214 affected individuals from 616 families. We did not find a significant effect of rs1801028, but we did find significant evidence for association of schizophrenia with two multi-marker haplotypes spanning blocks of strong linkage disequilibrium (LD) and nine individual SNPs (Ps < 0.05). Importantly, two SNPs (rs1079727 and rs2283265) and both multi-marker haplotypes spanning entire LD blocks (including one that contained rs1801028) remained significant after correcting for multiple testing. These results further add to the body of data implicating DRD2 as a schizophrenia risk gene; however, a causal variant(s) in DRD2 remains to be elucidated by further fine mapping of the gene, with particular attention given to the area surrounding the third through fifth exons. PMID:18332877

Screening for SNPs with Allele-Specific Methylation based on Next-Generation Sequencing Data.

PubMed

Hu, Bo; Ji, Yuan; Xu, Yaomin; Ting, Angela H

2013-05-01

Allele-specific methylation (ASM) has long been studied but mainly documented in the context of genomic imprinting and X chromosome inactivation. Taking advantage of the next-generation sequencing technology, we conduct a high-throughput sequencing experiment with four prostate cell lines to survey the whole genome and identify single nucleotide polymorphisms (SNPs) with ASM. A Bayesian approach is proposed to model the counts of short reads for each SNP conditional on its genotypes of multiple subjects, leading to a posterior probability of ASM. We flag SNPs with high posterior probabilities of ASM by accounting for multiple comparisons based on posterior false discovery rates. Applying the Bayesian approach to the in-house prostate cell line data, we identify 269 SNPs as candidates of ASM. A simulation study is carried out to demonstrate the quantitative performance of the proposed approach.

Influence of angiotensin converting enzyme (ACE) gene rs4362 polymorphism on the progression of kidney failure in patients with autosomal dominant polycystic kidney disease (ADPKD).

PubMed

Ramanathan, Gnanasambandan; Ghosh, Santu; Elumalai, Ramprasad; Periyasamy, Soundararajan; Lakkakula, Bhaskar V K S

2016-06-01

Autosomal dominant polycystic kidney disease (ADPKD) is an inherited systemic disorder, characterized by the fluid filled cysts in the kidneys leading to end stage renal failure in later years of life. Hypertension is one of the major factors independently contributing to the chronic kidney disease (CKD) progression. The renin-angiotensin aldosterone system (RAAS) genes have been extensively studied as hypertension candidate genes. The aim of the present study was to investigate the role of angiotensin converting enzyme tagging - single nucleotide polymorphisms (ACE tag-SNPs) in progression of CKD in patients with ADPKD. m0 ethods: In the present study six ACE tagSNPs (angiotensin converting enzyme tag single nucleotide polymorphisms) and insertion/deletion (I/D) in 102 ADPKD patients and 106 control subjects were investigated. The tagSNPs were genotyped using FRET-based KASPar method and ACE ID by polymerase chain reaction (PCR) and electrophoresis. Genotypes and haplotypes were compared between ADPKD patients and controls. Univariate and multivariate logistic regression analyses were performed to assess the effect of genotypes and hypertension on CKD advancement. Mantel-Haenszel (M-H) stratified analysis was performed to study the relationship between different CKD stages and hypertension and their interaction. All loci were polymorphic and except rs4293 SNP the remaining loci followed Hardy-Weinberg equilibrium. Distribution of ACE genotypes and haplotypes in controls and ADPKD patients was not significant. A significant linkage disequilibrium (LD) was observed between SNPs forming two LD blocks. The univariate analysis revealed that the age, hypertension, family history of diabetes and ACE rs4362 contributed to the advancement of CKD. The results suggest that the ACE genotypes are effect modifiers of the relationship between hypertension and CKD advancement among the ADPKD patients.

Association analysis of vitamin D receptor gene polymorphisms and bone mineral density in postmenopausal Mexican-Mestizo women.

PubMed

González-Mercado, A; Sánchez-López, J Y; Regla-Nava, J A; Gámez-Nava, J I; González-López, L; Duran-Gonzalez, J; Celis, A; Perea-Díaz, F J; Salazar-Páramo, M; Ibarra, B

2013-07-30

We investigated associations between vitamin D receptor (VDR) gene polymorphisms, FokI T>C (rs2228570), BsmI G>A (rs1544410), ApaI G>T (rs7975232), and TaqI T>C (rs731236), with bone mineral density (BMD) in postmenopausal Mexican-Mestizo women. Three hundred and twenty postmenopausal women participated, who were classified according to World Health Organization criteria as non-osteoporotic (Non-OP; N = 88), osteopenic (Opn; N = 144), and osteoporotic (OP; N = 88). BMD measurements at the lumbar (L1-L4) spine and at the left and right femoral neck were obtained by dual-energy X-ray absorptiometry. Single nucleotide polymorphisms (SNPs) were genotyped using real-time polymerase chain reaction and TaqMan probes. Genotype and allelic frequencies of the 4 VDR SNPs were similar among the 3 groups. Polymorphic allele frequencies were as follows: FokI (C) 0.53, 0.49, 0.56; BsmI (A) 0.26, 0.22, 0.23; ApaI (T) 0.43, 0.39, 0.44; TaqI (C) 0.27, 0.22, 0.23 for the Non-OP, Opn, and OP groups, respectively. Although no associations were found between the SNPs and BMD, based on the putative function of the FokI SNP, we constructed, for the first time, the haplotype with the 4 VDR SNPs, and found that the CGGT haplotype differed between the Non- OP and OP groups (21.8 vs 31.8%, P < 0.05). The risk analysis for this haplotype was nearly significant under the dominant model (OR = 1.783, 95%CI = 0.98-3.25, P = 0.058). This result suggests a possible susceptibility effect of the C allele of the FokI SNP for the development of osteoporosis in postmenopausal Mexican-Mestizo women.

ErbB polymorphisms: insights and implications for response to targeted cancer therapeutics.

PubMed

Alaoui-Jamali, Moulay A; Morand, Grégoire B; da Silva, Sabrina Daniela

2015-01-01

Advances in high-throughput genomic-scanning have expanded the repertory of genetic variations in DNA sequences encoding ErbB tyrosine kinase receptors in humans, including single nucleotide polymorphisms (SNPs), polymorphic repetitive elements, microsatellite variations, small-scale insertions and deletions. The ErbB family members: EGFR, ErbB2, ErbB3, and ErbB4 receptors are established as drivers of many aspects of tumor initiation and progression to metastasis. This knowledge has provided rationales for the development of an arsenal of anti-ErbB therapeutics, ranging from small molecule kinase inhibitors to monoclonal antibodies. Anti-ErbB agents are becoming the cornerstone therapeutics for the management of cancers that overexpress hyperactive variants of ErbB receptors, in particular ErbB2-positive breast cancer and non-small cell lung carcinomas. However, their clinical benefit has been limited to a subset of patients due to a wide heterogeneity in drug response despite the expression of the ErbB targets, attributed to intrinsic (primary) and to acquired (secondary) resistance. Somatic mutations in ErbB tyrosine kinase domains have been extensively investigated in preclinical and clinical setting as determinants for either high sensitivity or resistance to anti-ErbB therapeutics. In contrast, only scant information is available on the impact of SNPs, which are widespread in genes encoding ErbB receptors, on receptor structure and activity, and their predictive values for drug susceptibility. This review aims to briefly update polymorphic variations in genes encoding ErbB receptors based on recent advances in deep sequencing technologies, and to address challenging issues for a better understanding of the functional impact of single versus combined SNPs in ErbB genes to receptor topology, receptor-drug interaction, and drug susceptibility. The potential of exploiting SNPs in the era of stratified targeted therapeutics is discussed.

CCDC26, CDKN2BAS, RTEL1 and TERT Polymorphisms in pediatric brain tumor susceptibility.

PubMed

Adel Fahmideh, Maral; Lavebratt, Catharina; Schüz, Joachim; Röösli, Martin; Tynes, Tore; Grotzer, Michael A; Johansen, Christoffer; Kuehni, Claudia E; Lannering, Birgitta; Prochazka, Michaela; Schmidt, Lisbeth S; Feychting, Maria

2015-08-01

The role of genetic polymorphisms in pediatric brain tumor (PBT) etiology is poorly understood. We hypothesized that single nucleotide polymorphisms (SNPs) identified in genome-wide association studies (GWAS) on adult glioma would also be associated with PBT risk. The study is based on the Cefalo study, a population-based multicenter case-control study. Saliva DNA from 245 cases and 489 controls, aged 7-19 years at diagnosis/reference date, was extracted and genotyped for 29 SNPs reported by GWAS to be significantly associated with risk of adult glioma. Data were analyzed using unconditional logistic regression. Stratified analyses were performed for two histological subtypes: astrocytoma alone and the other tumor types combined. The results indicated that four SNPs, CDKN2BAS rs4977756 (p = 0.036), rs1412829 (p = 0.037), rs2157719 (p = 0.018) and rs1063192 (p = 0.021), were associated with an increased susceptibility to PBTs, whereas the TERT rs2736100 was associated with a decreased risk (p = 0.018). Moreover, the stratified analyses showed a decreased risk of astrocytoma associated with RTEL1 rs6089953, rs6010620 and rs2297440 (p trend = 0.022, p trend = 0.042, p trend = 0.029, respectively) as well as an increased risk of this subtype associated with RTEL1 rs4809324 (p trend = 0.033). In addition, SNPs rs10464870 and rs891835 in CCDC26 were associated with an increased risk of non-astrocytoma tumor subtypes (p trend = 0.009, p trend = 0.007, respectively). Our findings indicate that SNPs in CDKN2BAS, TERT, RTEL1 and CCDC26 may be associated with the risk of PBTs. Therefore, we suggest that pediatric and adult brain tumors might share common genetic risk factors and similar etiological pathways. © The Author 2015. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

Promoter Polymorphisms in the Nitric Oxide Synthase 3 Gene Are Associated With Ischemic Stroke Susceptibility in Young Black Women

PubMed Central

Howard, Timothy D.; Giles, Wayne H.; Xu, Jianfeng; Wozniak, Marcella A.; Malarcher, Ann M.; Lange, Leslie A.; Macko, Richard F.; Basehore, Monica J.; Meyers, Deborah A.; Cole, John W.; Kittner, Steven J.

2006-01-01

Background and Purpose Endothelial nitric oxide exerts a variety of protective effects on endothelial cells and blood vessels, and therefore the nitric oxide synthase 3 gene (NOS3) is a logical candidate gene for stroke susceptibility. Methods We used the population-based Stroke Prevention in Young Women case-control study to assess the association of five NOS3 polymorphisms in 110 cases (46% black) with ischemic stroke and 206 controls (38% black), 15 to 44 years of age. Polymorphisms included 3 single nucleotide polymorphisms (SNPs) in the promoter region (−1468 T>A, −922 G>A, −786 T>C), 1 SNP in exon 7 (G894T), and 1 insertion/deletion polymorphism within intron 4. Results Significant associations with both the −922 G>A and −786 T>C SNPs with ischemic stroke were observed in the black, but not the white, population. This association was attributable to an increased prevalence of the −922 A allele (OR=3.0, 95% CI=1.3 to 6.8; P=0.005) and the −786 T allele (OR=2.9, 95% CI=1.3 to 6.4; P=0.005) in cases versus controls. These 2 SNPs were in strong linkage disequilibrium (D′=1.0), making it impossible to determine, within the confines of this genetic study, whether 1 or both of these polymorphisms are functionally related to NOS3 expression. Two sets of haplotypes were also identified, 1 of which may confer an increased susceptibility to stroke in blacks, whereas the other appears to be protective. Conclusion Promoter variants in NOS3 may be associated with ischemic stroke susceptibility among young black women. PMID:16100023

Promoter polymorphisms in the nitric oxide synthase 3 gene are associated with ischemic stroke susceptibility in young black women.

PubMed

Howard, Timothy D; Giles, Wayne H; Xu, Jianfeng; Wozniak, Marcella A; Malarcher, Ann M; Lange, Leslie A; Macko, Richard F; Basehore, Monica J; Meyers, Deborah A; Cole, John W; Kittner, Steven J

2005-09-01

Endothelial nitric oxide exerts a variety of protective effects on endothelial cells and blood vessels, and therefore the nitric oxide synthase 3 gene (NOS3) is a logical candidate gene for stroke susceptibility. We used the population-based Stroke Prevention in Young Women case-control study to assess the association of five NOS3 polymorphisms in 110 cases (46% black) with ischemic stroke and 206 controls (38% black), 15 to 44 years of age. Polymorphisms included 3 single nucleotide polymorphisms (SNPs) in the promoter region (-1468 T>A, -922 G>A, -786 T>C), 1 SNP in exon 7 (G894T), and 1 insertion/deletion polymorphism within intron 4. Significant associations with both the -922 G>A and -786 T>C SNPs with ischemic stroke were observed in the black, but not the white, population. This association was attributable to an increased prevalence of the -922 A allele (OR=3.0, 95% CI=1.3 to 6.8; P=0.005) and the -786 T allele (OR=2.9, 95% CI=1.3 to 6.4; P=0.005) in cases versus controls. These 2 SNPs were in strong linkage disequilibrium (D'=1.0), making it impossible to determine, within the confines of this genetic study, whether 1 or both of these polymorphisms are functionally related to NOS3 expression. Two sets of haplotypes were also identified, 1 of which may confer an increased susceptibility to stroke in blacks, whereas the other appears to be protective. Promoter variants in NOS3 may be associated with ischemic stroke susceptibility among young black women.

Single-Nucleotide Polymorphisms of Genes Involved in Repair of Oxidative DNA Damage and the Risk of Recurrent Depressive Disorder.

PubMed

Czarny, Piotr; Kwiatkowski, Dominik; Toma, Monika; Gałecki, Piotr; Orzechowska, Agata; Bobińska, Kinga; Bielecka-Kowalska, Anna; Szemraj, Janusz; Berk, Michael; Anderson, George; Śliwiński, Tomasz

2016-11-20

BACKGROUND Depressive disorder, including recurrent type (rDD), is accompanied by increased oxidative stress and activation of inflammatory pathways, which may induce DNA damage. This thesis is supported by the presence of increased levels of DNA damage in depressed patients. Such DNA damage is repaired by the base excision repair (BER) pathway. BER efficiency may be influenced by polymorphisms in BER-related genes. Therefore, we genotyped nine single-nucleotide polymorphisms (SNPs) in six genes encoding BER proteins. MATERIAL AND METHODS Using TaqMan, we selected and genotyped the following SNPs: c.-441G>A (rs174538) of FEN1, c.2285T>C (rs1136410) of PARP1, c.580C>T (rs1799782) and c.1196A>G (rs25487) of XRCC1, c.*83A>C (rs4796030) and c.*50C>T (rs1052536) of LIG3, c.-7C>T (rs20579) of LIG1, and c.-468T>G (rs1760944) and c.444T>G (rs1130409) of APEX1 in 599 samples (288 rDD patients and 311 controls). RESULTS We found a strong correlation between rDD and both SNPs of LIG3, their haplotypes, as well as a weaker association with the c.-468T>G of APEXI which diminished after Nyholt correction. Polymorphisms of LIG3 were also associated with early onset versus late onset depression, whereas the c.-468T>G polymorphism showed the opposite association. CONCLUSIONS The SNPs of genes involved in the repair of oxidative DNA damage may modulate rDD risk. Since this is an exploratory study, the results should to be treated with caution and further work needs to be done to elucidate the exact involvement of DNA damage and repair mechanisms in the development of this disease.

Single-Nucleotide Polymorphisms of Genes Involved in Repair of Oxidative DNA Damage and the Risk of Recurrent Depressive Disorder

PubMed Central

Czarny, Piotr; Kwiatkowski, Dominik; Toma, Monika; Gałecki, Piotr; Orzechowska, Agata; Bobińska, Kinga; Bielecka-Kowalska, Anna; Szemraj, Janusz; Berk, Michael; Anderson, George; Śliwiński, Tomasz

2016-01-01

Background Depressive disorder, including recurrent type (rDD), is accompanied by increased oxidative stress and activation of inflammatory pathways, which may induce DNA damage. This thesis is supported by the presence of increased levels of DNA damage in depressed patients. Such DNA damage is repaired by the base excision repair (BER) pathway. BER efficiency may be influenced by polymorphisms in BER-related genes. Therefore, we genotyped nine single-nucleotide polymorphisms (SNPs) in six genes encoding BER proteins. Material/Methods Using TaqMan, we selected and genotyped the following SNPs: c.-441G>A (rs174538) of FEN1, c.2285T>C (rs1136410) of PARP1, c.580C>T (rs1799782) and c.1196A>G (rs25487) of XRCC1, c.*83A>C (rs4796030) and c.*50C>T (rs1052536) of LIG3, c.-7C>T (rs20579) of LIG1, and c.-468T>G (rs1760944) and c.444T>G (rs1130409) of APEX1 in 599 samples (288 rDD patients and 311 controls). Results We found a strong correlation between rDD and both SNPs of LIG3, their haplotypes, as well as a weaker association with the c.-468T>G of APEXI which diminished after Nyholt correction. Polymorphisms of LIG3 were also associated with early onset versus late onset depression, whereas the c.-468T>G polymorphism showed the opposite association. Conclusions The SNPs of genes involved in the repair of oxidative DNA damage may modulate rDD risk. Since this is an exploratory study, the results should to be treated with caution and further work needs to be done to elucidate the exact involvement of DNA damage and repair mechanisms in the development of this disease. PMID:27866211

HapMap-based study on the association between MPO and GSTP1 gene polymorphisms and lung cancer susceptibility in Chinese Han population

PubMed Central

Gu, Jun-dong; Hua, Feng; Mei, Chao-rong; Zheng, De-jie; Wang, Guo-fan; Zhou, Qing-hua

2014-01-01

Aim: Myeloperoxidase (MPO) and glutathione S-transferase pi 1 (GSTP1) are important carcinogen-metabolizing enzymes. The aim of this study was to investigate the association between the common polymorphisms of MPO and GSTP1 genes and lung cancer risk in Chinese Han population. Methods: A total of 266 subjects with lung cancer and 307 controls without personal history of the disease were recruited in this case control study. The tagSNPs approach was used to assess the common polymorphisms of MOP and GSTP1 genes and lung cancer risk according to the disequilibrium information from the HapMap project. The tagSNP rs7208693 was selected as the polymorphism site for MPO, while the haplotype-tagging SNPs rs1695, rs4891, rs762803 and rs749174 were selected as the polymorphism sites for GSTP1. The gene polymorphisms were confirmed using real-time PCR, cloning and sequencing. Results: The four GSTP1 haplotype-tagging SNPs rs1695, rs4891, rs762803 and rs749174, but not the MPO tagSNP rs7208693, exhibited an association with lung cancer susceptibility in smokers in the overall population and in the studied subgroups. When Phase 2 software was used to reconstruct the haplotype for GSTP1, the haplotype CACA (rs749174+rs1695 + rs762803+rs4891) exhibited an increased risk of lung cancer among smokers (adjust odds ratio 1.53; 95%CI 1.04–2.25, P=0.033). Furthermore, diplotype analyses demonstrated that the significant association between the risk haplotype and lung cancer. The risk haplotypes co-segregated with one or more biologically functional polymorphisms and corresponded to a recessive inheritance model. Conclusion: The common polymorphisms of the GSTP1 gene may be the candidates for SNP markers for lung cancer susceptibility in Chinese Han population. PMID:24786234

Development and Evaluation of a 9K SNP Array for Peach by Internationally Coordinated SNP Detection and Validation in Breeding Germplasm

PubMed Central

Scalabrin, Simone; Gilmore, Barbara; Lawley, Cynthia T.; Gasic, Ksenija; Micheletti, Diego; Rosyara, Umesh R.; Cattonaro, Federica; Vendramin, Elisa; Main, Dorrie; Aramini, Valeria; Blas, Andrea L.; Mockler, Todd C.; Bryant, Douglas W.; Wilhelm, Larry; Troggio, Michela; Sosinski, Bryon; Aranzana, Maria José; Arús, Pere; Iezzoni, Amy; Morgante, Michele; Peace, Cameron

2012-01-01

Although a large number of single nucleotide polymorphism (SNP) markers covering the entire genome are needed to enable molecular breeding efforts such as genome wide association studies, fine mapping, genomic selection and marker-assisted selection in peach [Prunus persica (L.) Batsch] and related Prunus species, only a limited number of genetic markers, including simple sequence repeats (SSRs), have been available to date. To address this need, an international consortium (The International Peach SNP Consortium; IPSC) has pursued a coordinated effort to perform genome-scale SNP discovery in peach using next generation sequencing platforms to develop and characterize a high-throughput Illumina Infinium® SNP genotyping array platform. We performed whole genome re-sequencing of 56 peach breeding accessions using the Illumina and Roche/454 sequencing technologies. Polymorphism detection algorithms identified a total of 1,022,354 SNPs. Validation with the Illumina GoldenGate® assay was performed on a subset of the predicted SNPs, verifying ∼75% of genic (exonic and intronic) SNPs, whereas only about a third of intergenic SNPs were verified. Conservative filtering was applied to arrive at a set of 8,144 SNPs that were included on the IPSC peach SNP array v1, distributed over all eight peach chromosomes with an average spacing of 26.7 kb between SNPs. Use of this platform to screen a total of 709 accessions of peach in two separate evaluation panels identified a total of 6,869 (84.3%) polymorphic SNPs. The almost 7,000 SNPs verified as polymorphic through extensive empirical evaluation represent an excellent source of markers for future studies in genetic relatedness, genetic mapping, and dissecting the genetic architecture of complex agricultural traits. The IPSC peach SNP array v1 is commercially available and we expect that it will be used worldwide for genetic studies in peach and related stone fruit and nut species. PMID:22536421

Candidate gene association analysis for milk yield, composition, urea nitrogen and somatic cell scores in Brown Swiss cows.

PubMed

Cecchinato, A; Ribeca, C; Chessa, S; Cipolat-Gotet, C; Maretto, F; Casellas, J; Bittante, G

2014-07-01

The aim of this study was to investigate 96 single-nucleotide polymorphisms (SNPs) from 54 candidate genes, and test the associations of the polymorphic SNPs with milk yield, composition, milk urea nitrogen (MUN) content and somatic cell score (SCS) in individual milk samples from Italian Brown Swiss cows. Milk and blood samples were collected from 1271 cows sampled once from 85 herds. Milk production, quality traits (i.e. protein, casein, fat and lactose percentages), MUN and SCS were measured for each milk sample. Genotyping was performed using a custom Illumina VeraCode GoldenGate approach. A Bayesian linear animal model that considered the effects of herd, days in milk, parity, SNP genotype and additive polygenic effect was used for the association analysis. Our results showed that 14 of the 51 polymorphic SNPs had relevant additive effects on at least one of the aforementioned traits. Polymorphisms in the glucocorticoid receptor DNA-binding factor 1 (GRLF1), prolactin receptor (PRLR) and chemokine ligand 2 (CCL2) were associated with milk yield; an SNP in the stearoyl-CoA desaturase (SCD-1) was related to fat content; SNPs in the caspase recruitment domain 15 protein (CARD15) and lipin 1 (LPIN1) affected the protein and casein contents; SNPs in growth hormone 1 (GH1), lactotransferrin (LTF) and SCD-1 were relevant for casein number; variants in beta casein (CSN2), GH1, GRLF1 and LTF affected lactose content; SNPs in beta-2 adrenergic receptor (ADRB2), serpin peptidase inhibitor (PI) and SCD-1 were associated with MUN; and SNPs in acetyl-CoA carboxylase alpha (ACACA) and signal transducer and activator of transcription 5A (STAT5A) were relevant in explaining the variation of SCS. Although further research is needed to validate these SNPs in other populations and breeds, the association between these markers and milk yield, composition, MUN and SCS could be exploited in gene-assisted selection programs for genetic improvement purposes.

Genetic Polymorphisms are Associated with Hair, Blood, and Urine Mercury Levels in the American Dental Association (ADA) Study Participants

PubMed Central

Parajuli, Rajendra Prasad; Goodrich, Jaclyn M.; Chou, Hwai-Nan; Gruninger, Stephen E.; Dolinoy, Dana C.; Franzblau, Alfred; Basu, Niladri

2015-01-01

Background/Aims Mercury (Hg) is a potent toxicant of concern to the general public. Recent studies suggest that several genes that mediate Hg metabolism are polymorphic. We hypothesize that single nucleotide polymorphisms (SNPs) in such genes may underline inter-individual differences in exposure biomarker concentrations. Methods Dental professionals were recruited during the American Dental Association (ADA) 2012 Annual Meeting. Samples of hair, blood, and urine were collected for quantifying Hg levels and genotyping (88 SNPs in classes relevant to Hg toxicokinetics including glutathione metabolism, selenoproteins, metallothioneins, and xenobiotic transporters). Questionnaires were administrated to obtain information on demographics and sources of Hg exposure (e.g., fish consumption and use of dental amalgam). Here, we report results for 380 participants with complete genotype and Hg biomarker datasets. ANOVA and linear regressions were used for statistical analysis. Results Mean (geometric) Hg levels in hair (hHg), blood (bHg), urine (uHg), and the average estimated Hg intake from fish were 0.62μg/g, 3.75μg/L, 1.32μg/L, and 0.12μg/kg body weight/day, respectively. Out of 88 SNPs successfully genotyped, Hg biomarker levels differed by genotype for 25 SNPs, one of which remained significant following Bonferroni correction in ANOVA. When the associations between sources of Hg exposure and SNPs were analyzed with respect to Hg biomarker concentrations, 38 SNPs had significant main effects and/or gene-Hg exposure source interactions. Twenty-five, 23, and four SNPs showed significant main effects and/or interactions for hHg, bHg, and uHg levels, respectively (p<0.05), and six SNPs (in GCLC, MT1M, MT4, ATP7B, and BDNF) remained significant following Bonferroni correction. Conclusion The findings suggest that polymorphisms in environmentally-responsive genes can influence Hg biomarker levels. Hence, consideration of such gene-environment factors may improve the ability to assess the health risks of Hg more precisely. PMID:26673400

Association of CHEK2 polymorphisms with the efficacy of platinum-based chemotherapy for advanced non-small-cell lung cancer in Chinese never-smoking women.

PubMed

Xu, Wen; Liu, Di; Yang, Yang; Ding, Xi; Sun, Yifeng; Zhang, Baohong; Xu, Jinfu; Su, Bo

2016-09-01

Cell cycle checkpoint kinase 2 (CHEK2) plays an essential role in the repair of DNA damage. Single nucleotide polymorphisms (SNPs) in DNA repair genes are thought to influence treatment effects and survival of cancer patients. This study aimed to investigate the relationship between polymorphisms in the CHEK2 gene and efficacy of platinum-based doublet chemotherapy in never-smoking Chinese female patients with advanced non-small-cell lung cancer (NSCLC). Using DNA from blood samples of 272 Chinese advanced NSCLC non-smoking female patients treated with first-line platinum-based chemotherapy, we have analyzed the relationships between four SNPs in the CHEK2 gene and clinical outcomes. We found that overall survival (OS) was significantly associated with CHEK2 rs4035540 (Log-Rank P=0.020), as well as the CHEK2 rs4035540 dominant model (Log-Rank P=0.026), especially in the lung adenocarcinoma group. After multivariate analysis, patients with rs4035540 A/G genotype had a significantly better OS than those with the G/G genotype (HR =0.67, 95% CI, 0.48-0.93; P=0.016). In the toxicity analysis, it was observed that patients with the CHEK2 rs4035540 A/A genotype had a higher risk of gastrointestinal toxicity than the G/G genotype group (P=0.009). However, there are no significant associations between chemotherapy treatments and genetic variations. Our findings indicate that SNPs in CHEK2 are related to Chinese advanced NSCLC never-smoking female patients receiving platinum-based doublet chemotherapy in China. Patients with rs4035540 A/G genotype have a better OS. And patients with rs4035540 A/A genotype have a higher risk of gastrointestinal toxicity. These results point to a direction for predicting the prognosis for Chinese never-smoking NSCLC female patients. However, there are no significant associations between chemotherapy treatments and SNPs in CHEK2 , which need more samples to the further study.

The effects of single nucleotide polymorphisms (SNPs) of calpastatin (CAST) gene on meat tenderness of yak.

USDA-ARS?s Scientific Manuscript database

The association of single nucleotide polymorphisms (SNPs) of calpastatin (CAST) gene with shear force of 2.54 cm steaks from M. longissimus dorsi from Gannan yaks (Bos grunniens, n=181) was studied. Yaks were harvested at 2, 3, and 4 yr of age (n=51, 59, and 71, respectively), and samples of each ya...

CLC-2 single nucleotide polymorphisms (SNPs) as potential modifiers of cystic fibrosis disease severity

PubMed Central

Blaisdell, Carol J; Howard, Timothy D; Stern, Augustus; Bamford, Penelope; Bleecker, Eugene R; Stine, O Colin

2004-01-01

Background Cystic fibrosis (CF) lung disease manifest by impaired chloride secretion leads to eventual respiratory failure. Candidate genes that may modify CF lung disease severity include alternative chloride channels. The objectives of this study are to identify single nucleotide polymorphisms (SNPs) in the airway epithelial chloride channel, CLC-2, and correlate these polymorphisms with CF lung disease. Methods The CLC-2 promoter, intron 1 and exon 20 were examined for SNPs in adult CF dF508/dF508 homozygotes with mild and severe lung disease (forced expiratory volume at one second (FEV1) > 70% and < 40%). Results PCR amplification of genomic CLC-2 and sequence analysis revealed 1 polymorphism in the hClC -2 promoter, 4 in intron 1, and none in exon 20. Fisher's analysis within this data set, did not demonstrate a significant relationship between the severity of lung disease and SNPs in the CLC-2 gene. Conclusions CLC-2 is not a key modifier gene of CF lung phenotype. Further studies evaluating other phenotypes associated with CF may be useful in the future to assess the ability of CLC-2 to modify CF disease severity. PMID:15507145

Accumulation of slightly deleterious mutations in the mitochondrial genome: a hallmark of animal domestication.

PubMed

Hughes, Austin L

2013-02-15

The hypothesis that domestication leads to a relaxation of purifying selection on mitochondrial (mt) genomes was tested by comparative analysis of mt genes from dog, pig, chicken, and silkworm. The three vertebrate species showed mt genome phylogenies in which domestic and wild isolates were intermingled, whereas the domestic silkworm (Bombyx mori) formed a distinct cluster nested within its closest wild relative (Bombyx mandarina). In spite of these differences in phylogenetic pattern, significantly greater proportions of nonsynonymous SNPs than of synonymous SNPs were unique to the domestic populations of all four species. Likewise, in all four species, significantly greater proportions of RNA-encoding SNPs than of synonymous SNPs were unique to the domestic populations. Thus, domestic populations were characterized by an excess of unique polymorphisms in two categories generally subject to purifying selection: nonsynonymous sites and RNA-encoding sites. Many of these unique polymorphisms thus seem likely to be slightly deleterious; the latter hypothesis was supported by the generally lower gene diversities of polymorphisms unique to domestic populations in comparison to those of polymorphisms shared by domestic and wild populations. Copyright © 2012 Elsevier B.V. All rights reserved.

Precise Estimation of Allele Frequencies of Single-Nucleotide Polymorphisms by a Quantitative SSCP Analysis of Pooled DNA

PubMed Central

Sasaki, Tomonari; Tahira, Tomoko; Suzuki, Akari; Higasa, Koichiro; Kukita, Yoji; Baba, Shingo; Hayashi, Kenshi

2001-01-01

We show that single-nucleotide polymorphisms (SNPs) of moderate to high heterozygosity (minor allele frequencies >10%) can be efficiently detected, and their allele frequencies accurately estimated, by pooling the DNA samples and applying a capillary-based SSCP analysis. In this method, alleles are separated into peaks, and their frequencies can be reliably and accurately quantified from their peak heights (SD <1.8%). We found that as many as 40% of publicly available SNPs that were analyzed by this method have widely differing allele frequency distributions among groups of different ethnicity (parents of Centre d'Etude Polymorphisme Humaine families vs. Japanese individuals). These results demonstrate the effectiveness of the present pooling method in the reevaluation of candidate SNPs that have been collected by examination of limited numbers of individuals. The method should also serve as a robust quantitative technique for studies in which a precise estimate of SNP allele frequencies is essential—for example, in linkage disequilibrium analysis. PMID:11083945

SNP Assay Development for Linkage Map Construction, Anchoring Whole-Genome Sequence, and Other Genetic and Genomic Applications in Common Bean

DOE Office of Scientific and Technical Information (OSTI.GOV)

Song, Qijian; Jia, Gaofeng; Hyten, David L.

A total of 992,682 single-nucleotide polymorphisms (SNPs) was identified as ideal for Illumina Infinium II BeadChip design after sequencing a diverse set of 17 common bean (Phaseolus vulgaris L) varieties with the aid of next-generation sequencing technology. From these, two BeadChips each with >5000 SNPs were designed. The BARCBean6K_1 BeadChip was selected for the purpose of optimizing polymorphism among market classes and, when possible, SNPs were targeted to sequence scaffolds in the Phaseolus vulgaris 14× genome assembly with sequence lengths >10 kb. The BARCBean6K_2 BeadChip was designed with the objective of anchoring additional scaffolds and to facilitate orientation of largemore » scaffolds. Analysis of 267 F2 plants from a cross of varieties Stampede × Red Hawk with the two BeadChips resulted in linkage maps with a total of 7040 markers including 7015 SNPs. With the linkage map, a total of 432.3 Mb of sequence from 2766 scaffolds was anchored to create the Phaseolus vulgaris v1.0 assembly, which accounted for approximately 89% of the 487 Mb of available sequence scaffolds of the Phaseolus vulgaris v0.9 assembly. A core set of 6000 SNPs (BARCBean6K_3 BeadChip) with high genotyping quality and polymorphism was selected based on the genotyping of 365 dry bean and 134 snap bean accessions with the BARCBean6K_1 and BARCBean6K_2 BeadChips. The BARCBean6K_3 BeadChip is a useful tool for genetics and genomics research and it is widely used by breeders and geneticists in the United States and abroad.« less

SNP Assay Development for Linkage Map Construction, Anchoring Whole-Genome Sequence, and Other Genetic and Genomic Applications in Common Bean

DOE PAGES

Song, Qijian; Jia, Gaofeng; Hyten, David L.; ...

2015-08-28

A total of 992,682 single-nucleotide polymorphisms (SNPs) was identified as ideal for Illumina Infinium II BeadChip design after sequencing a diverse set of 17 common bean (Phaseolus vulgaris L) varieties with the aid of next-generation sequencing technology. From these, two BeadChips each with >5000 SNPs were designed. The BARCBean6K_1 BeadChip was selected for the purpose of optimizing polymorphism among market classes and, when possible, SNPs were targeted to sequence scaffolds in the Phaseolus vulgaris 14× genome assembly with sequence lengths >10 kb. The BARCBean6K_2 BeadChip was designed with the objective of anchoring additional scaffolds and to facilitate orientation of largemore » scaffolds. Analysis of 267 F2 plants from a cross of varieties Stampede × Red Hawk with the two BeadChips resulted in linkage maps with a total of 7040 markers including 7015 SNPs. With the linkage map, a total of 432.3 Mb of sequence from 2766 scaffolds was anchored to create the Phaseolus vulgaris v1.0 assembly, which accounted for approximately 89% of the 487 Mb of available sequence scaffolds of the Phaseolus vulgaris v0.9 assembly. A core set of 6000 SNPs (BARCBean6K_3 BeadChip) with high genotyping quality and polymorphism was selected based on the genotyping of 365 dry bean and 134 snap bean accessions with the BARCBean6K_1 and BARCBean6K_2 BeadChips. The BARCBean6K_3 BeadChip is a useful tool for genetics and genomics research and it is widely used by breeders and geneticists in the United States and abroad.« less

SNP Assay Development for Linkage Map Construction, Anchoring Whole-Genome Sequence, and Other Genetic and Genomic Applications in Common Bean.

PubMed

Song, Qijian; Jia, Gaofeng; Hyten, David L; Jenkins, Jerry; Hwang, Eun-Young; Schroeder, Steven G; Osorno, Juan M; Schmutz, Jeremy; Jackson, Scott A; McClean, Phillip E; Cregan, Perry B

2015-08-28

A total of 992,682 single-nucleotide polymorphisms (SNPs) was identified as ideal for Illumina Infinium II BeadChip design after sequencing a diverse set of 17 common bean (Phaseolus vulgaris L) varieties with the aid of next-generation sequencing technology. From these, two BeadChips each with >5000 SNPs were designed. The BARCBean6K_1 BeadChip was selected for the purpose of optimizing polymorphism among market classes and, when possible, SNPs were targeted to sequence scaffolds in the Phaseolus vulgaris 14× genome assembly with sequence lengths >10 kb. The BARCBean6K_2 BeadChip was designed with the objective of anchoring additional scaffolds and to facilitate orientation of large scaffolds. Analysis of 267 F2 plants from a cross of varieties Stampede × Red Hawk with the two BeadChips resulted in linkage maps with a total of 7040 markers including 7015 SNPs. With the linkage map, a total of 432.3 Mb of sequence from 2766 scaffolds was anchored to create the Phaseolus vulgaris v1.0 assembly, which accounted for approximately 89% of the 487 Mb of available sequence scaffolds of the Phaseolus vulgaris v0.9 assembly. A core set of 6000 SNPs (BARCBean6K_3 BeadChip) with high genotyping quality and polymorphism was selected based on the genotyping of 365 dry bean and 134 snap bean accessions with the BARCBean6K_1 and BARCBean6K_2 BeadChips. The BARCBean6K_3 BeadChip is a useful tool for genetics and genomics research and it is widely used by breeders and geneticists in the United States and abroad. Copyright © 2015 Song et al.

Identification and validation of single nucleotide polymorphisms in growth- and maturation-related candidate genes in sole (Solea solea L.).

PubMed

Diopere, Eveline; Hellemans, Bart; Volckaert, Filip A M; Maes, Gregory E

2013-03-01

Genomic methodologies applied in evolutionary and fisheries research have been of great benefit to understand the marine ecosystem and the management of natural resources. Although single nucleotide polymorphisms (SNPs) are attractive for the study of local adaptation, spatial stock management and traceability, and investigating the effects of fisheries-induced selection, they have rarely been exploited in non-model organisms. This is partly due to difficulties in finding and validating SNPs in species with limited or no genomic resources. Complementary to random genome-scan approaches, a targeted candidate gene approach has the potential to unveil pre-selected functional diversity and provides more in depth information on the action of selection at specific genes. For example genes can be under selective pressure due to climate change and sustained periods of heavy fishing pressure. In this study, we applied a candidate gene approach in sole (Solea solea L.), an important member of the demersal ecosystem. As consumption flatfish it is heavy exploited and has experienced associated life-history changes over the last 60years. To discover novel genetic polymorphisms in or around genes linked to important life history traits in sole, we screened a total of 76 candidate genes related to growth and maturation using a targeted resequencing approach. We identified in total 86 putative SNPs in 22 genes and validated 29 SNPs using a multiplex single-base extension genotyping assay. We found 22 informative SNPs, of which two represent non-synonymous mutations, potentially of functional relevance. These novel markers should be rapidly and broadly applicable in analyses of natural sole populations, as a measure of the evolutionary signature of overfishing and for initiatives on marker assisted selection. Copyright © 2012 Elsevier B.V. All rights reserved.

Single-nucleotide polymorphisms g.151435C>T and g.173057T>C in PRLR gene regulated by bta-miR-302a are associated with litter size in goats.

PubMed

An, Xiaopeng; Hou, Jinxing; Gao, Teyang; Lei, Yingnan; Li, Guang; Song, Yuxuan; Wang, Jiangang; Cao, Binyun

2015-06-01

Single-nucleotide polymorphisms (SNPs) located at microRNA-binding sites (miR-SNPs) can affect the expression of genes. This study aimed to identify the miR-SNPs associated with litter size. Guanzhong (n = 321) and Boer (n = 191) goat breeds were used to detect SNPs in the caprine prolactin receptor (PRLR) gene by DNA sequencing, primer-introduced restriction analysis-polymerase chain reaction, and polymerase chain reaction-restriction fragment length polymorphism. Three novel SNPs (g.151435C>T, g.151454A>G, and g.173057T>C) were identified in the caprine PRLR gene. Statistical results indicated that the g.151435C>T and g.173057T>C SNPs were significantly associated with litter size in Guanzhong and Boer goat breeds. Further analysis revealed that combinative genotype C6 (TTAACC) was better than the others for litter size in both goat breeds. Furthermore, the PRLR g.173057T>C polymorphism was predicted to regulate the binding activity of bta-miR-302a. Luciferase reporter gene assay confirmed that 173057C to T substitution disrupted the binding site for bta-miR-302a, resulting in the reduced levels of luciferase. Taken together, these findings suggested that bta-miR-302a can influence the expression of PRLR protein by binding with 3'untranslated region, resulting in that the g.173057T>C SNP had significant effects on litter size. Copyright © 2015 Elsevier Inc. All rights reserved.

GESPA: classifying nsSNPs to predict disease association.

PubMed

Khurana, Jay K; Reeder, Jay E; Shrimpton, Antony E; Thakar, Juilee

2015-07-25

Non-synonymous single nucleotide polymorphisms (nsSNPs) are the most common DNA sequence variation associated with disease in humans. Thus determining the clinical significance of each nsSNP is of great importance. Potential detrimental nsSNPs may be identified by genetic association studies or by functional analysis in the laboratory, both of which are expensive and time consuming. Existing computational methods lack accuracy and features to facilitate nsSNP classification for clinical use. We developed the GESPA (GEnomic Single nucleotide Polymorphism Analyzer) program to predict the pathogenicity and disease phenotype of nsSNPs. GESPA is a user-friendly software package for classifying disease association of nsSNPs. It allows flexibility in acceptable input formats and predicts the pathogenicity of a given nsSNP by assessing the conservation of amino acids in orthologs and paralogs and supplementing this information with data from medical literature. The development and testing of GESPA was performed using the humsavar, ClinVar and humvar datasets. Additionally, GESPA also predicts the disease phenotype associated with a nsSNP with high accuracy, a feature unavailable in existing software. GESPA's overall accuracy exceeds existing computational methods for predicting nsSNP pathogenicity. The usability of GESPA is enhanced by fast SQL-based cloud storage and retrieval of data. GESPA is a novel bioinformatics tool to determine the pathogenicity and phenotypes of nsSNPs. We anticipate that GESPA will become a useful clinical framework for predicting the disease association of nsSNPs. The program, executable jar file, source code, GPL 3.0 license, user guide, and test data with instructions are available at http://sourceforge.net/projects/gespa.

Replication and validation of genetic polymorphisms associated with survival after allogeneic blood or marrow transplant

PubMed Central

Karaesmen, Ezgi; Rizvi, Abbas A.; Preus, Leah M.; McCarthy, Philip L.; Pasquini, Marcelo C.; Onel, Kenan; Zhu, Xiaochun; Spellman, Stephen; Haiman, Christopher A.; Stram, Daniel O.; Pooler, Loreall; Sheng, Xin; Zhu, Qianqian; Yan, Li; Liu, Qian; Hu, Qiang; Webb, Amy; Brock, Guy; Clay-Gilmour, Alyssa I.; Battaglia, Sebastiano; Tritchler, David; Liu, Song; Hahn, Theresa

2017-01-01

Multiple candidate gene-association studies of non-HLA single-nucleotide polymorphisms (SNPs) and outcomes after blood or marrow transplant (BMT) have been conducted. We identified 70 publications reporting 45 SNPs in 36 genes significantly associated with disease-related mortality, progression-free survival, transplant-related mortality, and/or overall survival after BMT. Replication and validation of these SNP associations were performed using DISCOVeRY-BMT (Determining the Influence of Susceptibility COnveying Variants Related to one-Year mortality after BMT), a well-powered genome-wide association study consisting of 2 cohorts, totaling 2888 BMT recipients with acute myeloid leukemia, acute lymphoblastic leukemia, or myelodysplastic syndrome, and their HLA-matched unrelated donors, reported to the Center for International Blood and Marrow Transplant Research. Gene-based tests were used to assess the aggregate effect of SNPs on outcome. None of the previously reported significant SNPs replicated at P < .05 in DISCOVeRY-BMT. Validation analyses showed association with one previously reported donor SNP at P < .05 and survival; more associations would be anticipated by chance alone. No gene-based tests were significant at P < .05. Functional annotation with publicly available data shows these candidate SNPs most likely do not have biochemical function; only 13% of candidate SNPs correlate with gene expression or are predicted to impact transcription factor binding. Of these, half do not impact the candidate gene of interest; the other half correlate with expression of multiple genes. These findings emphasize the peril of pursing candidate approaches and the importance of adequately powered tests of unbiased genome-wide associations with BMT clinical outcomes given the ultimate goal of improving patient outcomes. PMID:28811306

WASP: a Web-based Allele-Specific PCR assay designing tool for detecting SNPs and mutations

PubMed Central

Wangkumhang, Pongsakorn; Chaichoompu, Kridsadakorn; Ngamphiw, Chumpol; Ruangrit, Uttapong; Chanprasert, Juntima; Assawamakin, Anunchai; Tongsima, Sissades

2007-01-01

Background Allele-specific (AS) Polymerase Chain Reaction is a convenient and inexpensive method for genotyping Single Nucleotide Polymorphisms (SNPs) and mutations. It is applied in many recent studies including population genetics, molecular genetics and pharmacogenomics. Using known AS primer design tools to create primers leads to cumbersome process to inexperience users since information about SNP/mutation must be acquired from public databases prior to the design. Furthermore, most of these tools do not offer the mismatch enhancement to designed primers. The available web applications do not provide user-friendly graphical input interface and intuitive visualization of their primer results. Results This work presents a web-based AS primer design application called WASP. This tool can efficiently design AS primers for human SNPs as well as mutations. To assist scientists with collecting necessary information about target polymorphisms, this tool provides a local SNP database containing over 10 million SNPs of various populations from public domain databases, namely NCBI dbSNP, HapMap and JSNP respectively. This database is tightly integrated with the tool so that users can perform the design for existing SNPs without going off the site. To guarantee specificity of AS primers, the proposed system incorporates a primer specificity enhancement technique widely used in experiment protocol. In particular, WASP makes use of different destabilizing effects by introducing one deliberate 'mismatch' at the penultimate (second to last of the 3'-end) base of AS primers to improve the resulting AS primers. Furthermore, WASP offers graphical user interface through scalable vector graphic (SVG) draw that allow users to select SNPs and graphically visualize designed primers and their conditions. Conclusion WASP offers a tool for designing AS primers for both SNPs and mutations. By integrating the database for known SNPs (using gene ID or rs number), this tool facilitates the awkward process of getting flanking sequences and other related information from public SNP databases. It takes into account the underlying destabilizing effect to ensure the effectiveness of designed primers. With user-friendly SVG interface, WASP intuitively presents resulting designed primers, which assist users to export or to make further adjustment to the design. This software can be freely accessed at . PMID:17697334

Polymorphisms in the SIRT5 gene and their association with body measurement and ultrasound traits in Qinchuan cattle.

PubMed

Gui, L S; Wang, H C; Liu, G Y; Zan, L S

2015-04-22

Silent information regulator 5 (SIRT5), a member of the Sirtuin family class III nicotinamide adenine dinucleotide-dependent protein deacetylases, plays an important role in metabolic and aging processes in mammals. We identified 4 single-nucleotide polymorphisms (SNPs) (G22010A, G22052A, G22119T, and G22245C) in the 3' untranslated regions of the SIRT5 gene from 572 Qinchuan cattle by sequencing and investigating their association with growth and ultrasound traits. The frequencies of genotype GG and allele G were high at the 4 SNPs. Based on the X(2) test, the genotypic distributions of the 4 SNPs were not in Hardy-Weinberg equilibrium (P < 0.05 or P < 0.01). Association analysis of individual SNPs and haplotype combinations revealed that the 4 loci were significantly associated with some body measurement and ultrasound traits in Qinchuan cattle, and the H1H5 (AG-GA-GG-GG) diplotypes had better performance than other combinations in Qinchuan cattle. Our results demonstrate that SIRT5 may be a candidate for marker-assisted selection in future breeding programs for Qinchuan cattle.

LS-SNP: large-scale annotation of coding non-synonymous SNPs based on multiple information sources.

PubMed

Karchin, Rachel; Diekhans, Mark; Kelly, Libusha; Thomas, Daryl J; Pieper, Ursula; Eswar, Narayanan; Haussler, David; Sali, Andrej

2005-06-15

The NCBI dbSNP database lists over 9 million single nucleotide polymorphisms (SNPs) in the human genome, but currently contains limited annotation information. SNPs that result in amino acid residue changes (nsSNPs) are of critical importance in variation between individuals, including disease and drug sensitivity. We have developed LS-SNP, a genomic scale software pipeline to annotate nsSNPs. LS-SNP comprehensively maps nsSNPs onto protein sequences, functional pathways and comparative protein structure models, and predicts positions where nsSNPs destabilize proteins, interfere with the formation of domain-domain interfaces, have an effect on protein-ligand binding or severely impact human health. It currently annotates 28,043 validated SNPs that produce amino acid residue substitutions in human proteins from the SwissProt/TrEMBL database. Annotations can be viewed via a web interface either in the context of a genomic region or by selecting sets of SNPs, genes, proteins or pathways. These results are useful for identifying candidate functional SNPs within a gene, haplotype or pathway and in probing molecular mechanisms responsible for functional impacts of nsSNPs. http://www.salilab.org/LS-SNP CONTACT: rachelk@salilab.org http://salilab.org/LS-SNP/supp-info.pdf.

Development of 101 novel EST-derived single nucleotide polymorphism markers for Zhikong scallop ( Chlamys farreri)

NASA Astrophysics Data System (ADS)

Li, Jiqin; Bao, Zhenmin; Li, Ling; Wang, Xiaojian; Wang, Shi; Hu, Xiaoli

2013-09-01

Zhikong scallop ( Chlamys farreri) is an important maricultured species in China. Many researches on this species, such as population genetics and QTL fine-mapping, need a large number of molecular markers. In this study, based on the expressed sequence tags (EST), a total of 300 putative single nucleotide polymorphisms (SNPs) were selected and validated using high resolution melting (HRM) technology with unlabeled probe. Of them, 101 (33.7%) were found to be polymorphic in 48 individuals from 4 populations. Further evaluation with 48 individuals from Qingdao population showed that all the polymorphic loci had two alleles with the minor allele frequency ranged from 0.046 to 0.500. The observed and expected heterozygosities ranged from 0.000 to 0.925 and from 0.089 to 0.505, respectively. Fifteen loci deviated significantly from Hardy-Weinberg equilibrium and significant linkage disequilibrate was detected in one pair of markers. BLASTx gave significant hits for 72 of the 101 polymorphic SNP-containing ESTs. Thirty four polymorphic SNP loci were predicted to be non-synonymous substitutions as they caused either the change of codons (33 SNPs) or pretermination of translation (1 SNP). The markers developed can be used for the population studies and genetic improvement on Zhikong scallop.

Genetic effects of PDGFRB and MARCH1 identified in GWAS revealing strong associations with semen production traits in Chinese Holstein bulls.

PubMed

Liu, Shuli; Yin, Hongwei; Li, Cong; Qin, Chunhua; Cai, Wentao; Cao, Mingyue; Zhang, Shengli

2017-07-03

Using a genome-wide association study strategy, our previous study discovered 19 significant single-nucleotide polymorphisms (SNPs) related to semen production traits in Chinese Holstein bulls. Among them, three SNPs were within or close to the phosphodiesterase 3A (PDE3A), membrane associated ring-CH-type finger 1 (MARCH1) and platelet derived growth factor receptor beta (PDGFRB) genes. The present study was designed with the objectives of identifying genetic polymorphism of the PDE3A, PDGFRB and MARCH1 genes and their effects on semen production traits in a Holstein bull population. A total of 20 SNPs were detected and genotyped in 730 bulls. Association analyses using de-regressed estimated breeding values of each semen production trait revealed four statistically significant SNPs for one or more semen production traits (P < 0.05): one SNP was located downstream of PDGFRB and three SNPs were located in the promoter of MARCH1. Interestingly, for MARCH1, haplotype-based analysis revealed significant associations of haplotypes with semen volume per ejaculate. Furthermore, high expression of the MARCH1 gene was observed in sperm cells. One SNP (rs43445726) in the regulatory region of MARCH1 had a significant effect on gene expression. Our study demonstrated the significant associations of genetic variants of the PDGFRB and MARCH1 genes with semen production traits. The identified SNPs may serve as genetic markers to optimize breeding programs for semen production traits in Holstein bull populations.

Single Nucleotide Polymorphisms in IL8 and TLR4 Genes as Candidates for Digital Dermatitis Resistance/Susceptibility in Holstein Cattle.

PubMed

El-Shafaey, El-Sayed; Ateya, Ahmed; Ramadan, Hazem; Saleh, Rasha; Elseady, Yousef; Abo El Fadl, Eman; El-Khodery, Sabry

2017-04-03

Relatedness between single nucleotide polymorphisms in IL8 and TLR4 genes and digital dermatitis resistance/susceptibility was investigated in seventy Holstein dairy cows. Animals were assigned into two groups, affected group (n = 35) and resistant group (n = 35) based on clinical signs and previous history of farm clinical records. Blood samples were collected for DNA extraction to ampliy fragments of 267-bp and 382-bp for IL8 and TLR4 genes, respectively. PCR-DNA sequencing revealed three SNPs in each of IL8 and TLR4 genes. The identified SNPs associated with digital dermatitis resistance were C94T, A220G, and T262A for IL8 and C118T for TLR4. However, the G349C and C355A SNPs in TLR4 gene were associated with digital dermatitis susceptibility. Chi-square analysis for comparison the distribution of all identified SNPs in both IL8 and TLR4 genes between resistant and affected animals showed no significant variation among the identified SNPs in IL8 gene. Meanwhile, there was a significant variation in case of TLR4 gene. As a pilot study, the present results revealed that identified SNPs in IL8 and TLR4 genes can be used as a genetic marker and predisposing factor for resistance/susceptibility to digital dermatitis in dairy cows. However, TLR4 gene may be a potential candidate for such disease.

Cytochrome P2A13 and P1A1 gene polymorphisms are associated with the occurrence of uterine leiomyoma.

PubMed

Herr, D; Bettendorf, H; Denschlag, D; Keck, C; Pietrowski, D

2006-10-01

To investigate the association between the occurrence of uterine leiomyoma and two SNPs of the CYP 2A13 and CYP 1A1 genes. Prospective case control study with 132 women with clinically and surgically diagnosed uterine leiomyoma and 260 controls. Genotyping was performed by polymerase chain reaction (PCR) based amplification of CYP 2A13 and CYP 1A1 genes, and restriction fragment length polymorphism (RFLP) analysis. Comparing women with uterine leiomyoma and controls, we demonstrate statistical significant differences of allele frequency and genotype distribution for the CYP 1A1 polymorphism (P = 0.025 and P = 0.046, respectively). Furthermore, for the CYP 2A13 polymorphism we found a significant difference concerning allele frequency (P = 0.033). However, for the genotype distribution, only borderline significance was observed (P = 0.064). The CYP 2A13 and CYP 1A1 SNPs are associated with uterine leiomyoma in a Caucasian population and may contribute to the understanding of the pathogenic mechanisms of uterine leiomyoma.

Association study of interleukin-4 polymorphisms with paranoid schizophrenia in the Polish population: a critical approach.

PubMed

Fila-Danilow, Anna; Kucia, Krzysztof; Kowalczyk, Malgorzata; Owczarek, Aleksander; Paul-Samojedny, Monika; Borkowska, Paulina; Suchanek, Renata; Kowalski, Jan

2012-08-01

Changes in immunological system are one of dysfunctions reported in schizophrenia. Some changes based on an imbalance between Th1 and Th2 cytokines results from cytokine gene polymorphisms. Interleukin-4 gene (IL4) is considered as a potential candidate gene in schizophrenia association studies. The aim of the current case-control study was to examine whether the -590C/T (rs2243250) and -33C/T (rs2070874) IL4 gene polymorphisms are implicated in paranoid schizophrenia development in the Polish population. Genotyping of polymorphisms was performed by using PCR-RFLP technique. The genotypes and alleles distribution of both SNPs were analysed in patients (n = 182) and healthy individuals constituted the control group (n = 215). The connection between some clinical variables and studied polymorphisms has been examined as well. We did not revealed any association between the -590C/T and -33C/T polymorphisms and paranoid schizophrenia. In case of both SNPs the homozygous TT genotype was extremely rare. Both polymorphic sites of the IL4 gene were found to be in a very strong linkage disequilibrium. However we did not identify a haplotype predispose to paranoid schizophrenia. No associations were also observed between the clinical course and psychopathology of the disease and the genotypes of both analysed polymorphisms. Our results suggest that the polymorphisms -590C/T in IL4 gene promoter region and -33C/T in the 5'-UTR are not involved in the pathophysiology of paranoid schizophrenia in Polish residents.

Potential relationship between single nucleotide polymorphisms used in forensic genetics and diseases or other traits in European population.

PubMed

Pombar-Gomez, Maria; Lopez-Lopez, Elixabet; Martin-Guerrero, Idoia; Garcia-Orad Carles, Africa; de Pancorbo, Marian M

2015-05-01

Single nucleotide polymorphisms (SNPs) are an interesting option to facilitate the analysis of highly degraded DNA by allowing the reduction of the size of the DNA amplicons. The SNPforID 52-plex panel is a clear example of the use of non-coding SNPs in forensic genetics. However, nonstop advances in studies of genetic polymorphisms are leading to the discovery of new associations between SNPs and diseases. The aim of this study was to perform a comprehensive review of the state of association between the 52 SNPs in the 52-plex panel and diseases or other traits related to their treatment, such as drug response characters. In order to achieve this goal, we have conducted a bioinformatic search for each SNP included in the panel and the SNPs in linkage disequilibrium (LD) with them in the European population (r (2)  > 0.8). A total of 424 SNPs (52 in the panel and 372 in LD) were investigated in PubMed, Scopus, and dbSNP databases. Our results show that three SNPs in the SNPforID 52-plex panel (rs2107612, rs1979255, rs1463729) have been associated with diseases such as hypertension or macular degeneration, as well as drug response. Similarly, three out of the 372 SNPs in LD (rs2107614, r (2)  = 0.859; rs765250, r (2)  = 0.858; rs11064560, r (2)  = 0,887) are also associated with various pathologies. In view of these results, we propose the need for a periodic review of the SNPs used in forensic genetics in order to keep their associations with diseases or related phenotypes updated and to evaluate their continuity in forensic panels for avoiding legal and ethical conflicts.

Significant SNPs have limited prediction ability for thyroid cancer

PubMed Central

Guo, Shicheng; Wang, Yu-Long; Li, Yi; Jin, Li; Xiong, Momiao; Ji, Qing-Hai; Wang, Jiucun

2014-01-01

Recently, five thyroid cancer significantly associated genetic variants (rs965513, rs944289, rs116909374, rs966423, and rs2439302) have been discovered and validated in two independent GWAS and numerous case–control studies, which were conducted in different populations. We genotyped the above five single nucleotide polymorphisms (SNPs) in Han Chinese populations and performed thyroid cancer-risk predictions with nine machine learning methods. We found that four SNPs were significantly associated with thyroid cancer in Han Chinese population, while no polymorphism was observed for rs116909374. Small familial relative risks (1.02–1.05) and limited power to predict thyroid cancer (AUCs: 0.54–0.60) indicate limited clinical potential. Four significant SNPs have limited prediction ability for thyroid cancer. PMID:24591304

Physiological Study on Association between Nicotinamide N-Methyltransferase Gene Polymorphisms and Hyperlipidemia

PubMed Central

Zhu, Xiao-Juan; Lin, Ya-Jun; Chen, Wei; Wang, Ya-Hui; Qiu, Li-Qiang; Cai, Can-Xin; Xiong, Qun; Chen, Fei; Chen, Li-Hui; Zhou, Qiong

2016-01-01

Nicotinamide N-methyltransferase (NNMT) catalyzes the methylation of nicotinamide. Our previous works indicate that NNMT is involved in the body mass index and energy metabolism, and recently the association between a SNP (rs694539) of NNMT and a variety of cardiovascular diseases was reported. At present, more than 200 NNMT single nucleotide polymorphisms (SNPs) have been identified in the databases of the human genome projects; however, the association between rs694539 variation and hyperlipidemia has not been reported yet, and whether there are any SNPs in NNMT significantly associated with hyperlipidemia is still unclear. In this paper, we selected 19 SNPs in NNMT as the tagSNPs using Haploview software (Haploview 4.2) first and then performed a case-control study to observe the association between these tagSNPs and hyperlipidemia and finally applied physiological approaches to explore the possible mechanisms through which the NNMT polymorphism induces hyperlipidemia. The results show that a SNP (rs1941404) in NNMT is significantly associated with hyperlipidemia, and the influence of rs1941404 variation on the resting energy expenditure may be the possible mechanism for rs1941404 variation to induce hyperlipidemia. PMID:27999813

Significant association of APOA5 and APOC3 gene polymorphisms with meat quality traits in Kele pigs.

PubMed

Hui, Y T; Yang, Y Q; Liu, R Y; Zhang, Y Y; Xiang, C J; Liu, Z Z; Ding, Y H; Zhang, Y L; Wang, B R

2013-09-13

Apolipoprotein A5 (APOA5) and C3 (APOC3) genes are involved in the PPAR lipid metabolism pathway and thus associated with elevated triglyceride levels. However, whether APOA5 and APOC3 genetic polymorphisms affect intramuscular fat deposition and other meat quality traits remains unknown in pigs. One hundred and seventy-one Kele pigs were sampled to investigate genetic variants in the APOA5 and APOC3 genes and their association with seven pork quality traits. We identified 5 single nucleotide polymorphisms (SNPs) in the promoter region of the APOA5 gene and 17 SNPs in the APOC3 gene. Linkage disequilibrium analysis revealed 5 complete linkage disequilibria among these 22 SNPs. We found that 10 SNPs were significantly correlated with meat quality traits, including the mutation A5/-769 in the APOA5 gene, which was significantly associated with cooked weight percentage, and 9 SNPs in the APOC3 gene that were significantly associated with drip loss rate, meat color value of longissimus dorsi muscle and shear force. Therefore, these SNP markers will be useful for marker-assisted selection for improved pork quality.

Fast Screening Technology for Drug Emergency Management: Predicting Suspicious SNPs for ADR with Information Theory-based Models.

PubMed

Liang, Zhaohui; Liu, Jun; Huang, Jimmy X; Zeng, Xing

2018-01-01

The genetic polymorphism of Cytochrome P450 (CYP 450) is considered as one of the main causes for adverse drug reactions (ADRs). In order to explore the latent correlations between ADRs and potentially corresponding single-nucleotide polymorphism (SNPs) in CYP450, three algorithms based on information theory are used as the main method to predict the possible relation. The study uses a retrospective case-control study to explore the potential relation of ADRs to specific genomic locations and single-nucleotide polymorphism (SNP). The genomic data collected from 53 healthy volunteers are applied for the analysis, another group of genomic data collected from 30 healthy volunteers excluded from the study are used as the control group. The SNPs respective on five loci of CYP2D6*2,*10,*14 and CYP1A2*1C, *1F are detected by the Applied Biosystem 3130xl. The raw data is processed by ChromasPro to detect the specific alleles on the above loci from each sample. The secondary data are reorganized and processed by R combined with the reports of ADRs from clinical reports. Three information theory based algorithms are implemented for the screening task: JMI, CMIM, and mRMR. If a SNP is selected by more than two algorithms, we are confident to conclude that it is related to the corresponding ADR. The selection results are compared with the control decision tree + LASSO regression model. In the study group where ADRs occur, 10 SNPs are considered relevant to the occurrence of a specific ADR by the combined information theory model. In comparison, only 5 SNPs are considered relevant to a specific ADR by the decision tree + LASSO regression model. In addition, the new method detects more relevant pairs of SNP and ADR which are affected by both SNP and dosage. This implies that the new information theory based model is effective to discover correlations of ADRs and CYP 450 SNPs and is helpful in predicting the potential vulnerable genotype for some ADRs. The newly proposed information theory based model has superiority performance in detecting the relation between SNP and ADR compared to the decision tree + LASSO regression model. The new model is more sensitive to detect ADRs compared to the old method, while the old method is more reliable. Therefore, the selection criteria for selecting algorithms should depend on the pragmatic needs. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.

efficient association study design via power-optimized tag SNP selection

PubMed Central

HAN, BUHM; KANG, HYUN MIN; SEO, MYEONG SEONG; ZAITLEN, NOAH; ESKIN, ELEAZAR

2008-01-01

Discovering statistical correlation between causal genetic variation and clinical traits through association studies is an important method for identifying the genetic basis of human diseases. Since fully resequencing a cohort is prohibitively costly, genetic association studies take advantage of local correlation structure (or linkage disequilibrium) between single nucleotide polymorphisms (SNPs) by selecting a subset of SNPs to be genotyped (tag SNPs). While many current association studies are performed using commercially available high-throughput genotyping products that define a set of tag SNPs, choosing tag SNPs remains an important problem for both custom follow-up studies as well as designing the high-throughput genotyping products themselves. The most widely used tag SNP selection method optimizes over the correlation between SNPs (r2). However, tag SNPs chosen based on an r2 criterion do not necessarily maximize the statistical power of an association study. We propose a study design framework that chooses SNPs to maximize power and efficiently measures the power through empirical simulation. Empirical results based on the HapMap data show that our method gains considerable power over a widely used r2-based method, or equivalently reduces the number of tag SNPs required to attain the desired power of a study. Our power-optimized 100k whole genome tag set provides equivalent power to the Affymetrix 500k chip for the CEU population. For the design of custom follow-up studies, our method provides up to twice the power increase using the same number of tag SNPs as r2-based methods. Our method is publicly available via web server at http://design.cs.ucla.edu. PMID:18702637

Haplotag: Software for Haplotype-Based Genotyping-by-Sequencing Analysis

PubMed Central

Tinker, Nicholas A.; Bekele, Wubishet A.; Hattori, Jiro

2016-01-01

Genotyping-by-sequencing (GBS), and related methods, are based on high-throughput short-read sequencing of genomic complexity reductions followed by discovery of single nucleotide polymorphisms (SNPs) within sequence tags. This provides a powerful and economical approach to whole-genome genotyping, facilitating applications in genomics, diversity analysis, and molecular breeding. However, due to the complexity of analyzing large data sets, applications of GBS may require substantial time, expertise, and computational resources. Haplotag, the novel GBS software described here, is freely available, and operates with minimal user-investment on widely available computer platforms. Haplotag is unique in fulfilling the following set of criteria: (1) operates without a reference genome; (2) can be used in a polyploid species; (3) provides a discovery mode, and a production mode; (4) discovers polymorphisms based on a model of tag-level haplotypes within sequenced tags; (5) reports SNPs as well as haplotype-based genotypes; and (6) provides an intuitive visual “passport” for each inferred locus. Haplotag is optimized for use in a self-pollinating plant species. PMID:26818073

Detection of single-nucleotide polymorphisms using an ON-OFF switching of regenerated biosensor based on a locked nucleic acid-integrated and toehold-mediated strand displacement reaction.

PubMed

Gao, Zhong Feng; Ling, Yu; Lu, Lu; Chen, Ning Yu; Luo, Hong Qun; Li, Nian Bing

2014-03-04

Although various strategies have been reported for single-nucleotide polymorphisms (SNPs) detection, development of a time-saving, specific, and regenerated electrochemical sensing platform still remains a realistic goal. In this study, an ON-OFF switching of a regenerated biosensor based on a locked nucleic acid (LNA)-integrated and toehold-mediated strand displacement reaction technique is constructed for detection of SNPs. The LNA-integrated and methylene blue-labeled capture probe with an external toehold is designed to switch on the sensing system. The mutant-type DNA probe completes complementary with the capture probe to trigger the strand displacement reaction, which switches off the sensing system. However, when the single-base mismatched wild-type DNA probe is presented, the strand displacement reaction cannot be achieved; therefore, the sensing system still keeps the ON state. This DNA sensor is stable over five reuses. We further testify that the LNA-integrated sequence has better recognition ability for SNPs detection compared to the DNA-integrated sequence. Moreover, this DNA senor exhibits a remarkable discrimination capability of SNPs among abundant wild-type targets and 6000-fold (m/m) excess of genomic DNA. In addition, it is selective enough in complex and contaminant-ridden samples, such as human urine, soil, saliva, and beer. Overall, these results demonstrate that this reliable DNA sensor is easy to be fabricated, simple to operate, and stable enough to be readily regenerated.

FABP4 is a leading candidate gene associated with residual feed intake in growing Holstein calves.

PubMed

Cohen-Zinder, Miri; Asher, Aviv; Lipkin, Ehud; Feingersch, Roi; Agmon, Rotem; Karasik, David; Brosh, Arieh; Shabtay, Ariel

2016-05-01

Ecological and economic concerns drive the need to improve feed utilization by domestic animals. Residual feed intake (RFI) is one of the most acceptable measures for feed efficiency (FE). However, phenotyping RFI-related traits is complex and expensive and requires special equipment. Advances in marker technology allow the development of various DNA-based selection tools. To assimilate these technologies for the benefit of RFI-based selection, reliable phenotypic measures are prerequisite. In the current study, we identified single nucleotide polymorphisms (SNPs) associated with RFI phenotypic consistency across different ages and diets (named RFI 1-3), using DNA samples of high or low RFI ranked Holstein calves. Using targeted sequencing of chromosomal regions associated with FE- and RFI-related traits, we identified 48 top SNPs significantly associated with at least one of three defined RFIs. Eleven of these SNPs were harbored by the fatty acid binding protein 4 (FABP4). While 10 significant SNPs found in FABP4 were common for RFI 1 and RFI 3, one SNP (FABP4_5; A

A novel method for in silico identification of regulatory SNPs in human genome.

PubMed

Li, Rong; Zhong, Dexing; Liu, Ruiling; Lv, Hongqiang; Zhang, Xinman; Liu, Jun; Han, Jiuqiang

2017-02-21

Regulatory single nucleotide polymorphisms (rSNPs), kind of functional noncoding genetic variants, can affect gene expression in a regulatory way, and they are thought to be associated with increased susceptibilities to complex diseases. Here a novel computational approach to identify potential rSNPs is presented. Different from most other rSNPs finding methods which based on hypothesis that SNPs causing large allele-specific changes in transcription factor binding affinities are more likely to play regulatory functions, we use a set of documented experimentally verified rSNPs and nonfunctional background SNPs to train classifiers, so the discriminating features are found. To characterize variants, an extensive range of characteristics, such as sequence context, DNA structure and evolutionary conservation etc. are analyzed. Support vector machine is adopted to build the classifier model together with an ensemble method to deal with unbalanced data. 10-fold cross-validation result shows that our method can achieve accuracy with sensitivity of ~78% and specificity of ~82%. Furthermore, our method performances better than some other algorithms based on aforementioned hypothesis in handling false positives. The original data and the source matlab codes involved are available at https://sourceforge.net/projects/rsnppredict/. Copyright © 2016 Elsevier Ltd. All rights reserved.

Screening for polymorphisms in the PXR gene in a Dutch population.

PubMed

Bosch, Tessa M; Deenen, Maarten; Pruntel, Roelof; Smits, Paul H M; Schellens, Jan H M; Beijnen, Jos H; Meijerman, Irma

2006-05-01

Cytochrome P450 3A4 (CYP3A4) is involved in the metabolism of over 50% of all drugs currently in use. However, CYP3A4 expression shows a large inter-individual variation that cannot only be explained by genetic polymorphisms identified in this gene. The pregnane X receptor (PXR) has been identified as a transcriptional regulator of CYP3A4. Single nucleotide polymorphisms (SNPs) in the PXR gene could influence PXR activity and thereby CYP3A4 expression. This study was therefore aimed at determining the frequencies of known SNPs and detecting yet unknown SNPs in the PXR gene in a Dutch population. Genomic DNA was isolated from blood samples obtained from 100 healthy volunteers and subjected to PCR amplification, followed by DNA sequencing. The population, of which the ethnicity was 93% Caucasian, consisted of 79 female individuals and 21 males. A total of 24 SNPs were found in the PXR gene, eight of which are previously unknown. The allelic frequencies found in this population varied from 0.5 to 73%. Most of the previously detected SNPs were located in introns. One new SNP, T8555G in exon 8, causes an amino acid change of C379G and is located in the Ligand Binding Domain of PXR. Several SNPs were detected in the PXR gene, one of which is located in the ligand binding domain (LBD). These SNPs may influence PXR-mediated CYP3A4 induction.

Screening for SNPs with Allele-Specific Methylation based on Next-Generation Sequencing Data

PubMed Central

Hu, Bo; Xu, Yaomin

2013-01-01

Allele-specific methylation (ASM) has long been studied but mainly documented in the context of genomic imprinting and X chromosome inactivation. Taking advantage of the next-generation sequencing technology, we conduct a high-throughput sequencing experiment with four prostate cell lines to survey the whole genome and identify single nucleotide polymorphisms (SNPs) with ASM. A Bayesian approach is proposed to model the counts of short reads for each SNP conditional on its genotypes of multiple subjects, leading to a posterior probability of ASM. We flag SNPs with high posterior probabilities of ASM by accounting for multiple comparisons based on posterior false discovery rates. Applying the Bayesian approach to the in-house prostate cell line data, we identify 269 SNPs as candidates of ASM. A simulation study is carried out to demonstrate the quantitative performance of the proposed approach. PMID:23710259

Genetic variation in Pythium myriotylum based on SNP typing and development of a PCR-RFLP detection of isolates recovered from Pythium soft rot ginger.

PubMed

Le, D P; Smith, M K; Aitken, E A B

2017-10-01

Pythium myriotylum is responsible for severe losses in both capsicum and ginger crops in Australia under different regimes. Intraspecific genomic variation within the pathogen might explain the differences in aggressiveness and pathogenicity on diverse hosts. In this study, whole genome data of four P. myriotylum isolates recovered from three hosts and one Pythium zingiberis isolate were derived and analysed for sequence diversity based on single nucleotide polymorphisms (SNPs). A higher number of true and unique SNPs occurred in P. myriotylum isolates obtained from ginger with symptoms of Pythium soft rot (PSR) in Australia compared to other P. myriotylum isolates. Overall, SNPs were discovered more in the mitochondrial genome than those in the nuclear genome. Among the SNPs, a single substitution from the cytosine (C) to the thymine (T) in the partially sequenced CoxII gene of 14 representatives of PSR P. myriotylum isolates was within a restriction site of HinP1I enzyme which was used in the PCR-RFLP for detection and identification of the isolates without sequencing. The PCR-RFLP was also sensitive to detect PSR P. myriotylum strains from artificially infected ginger without the need for isolation for pure cultures. This is the first study of intraspecific variants of Pythium myriotylum isolates recovered from different hosts and origins based on single nucleotide polymorphism (SNP) genotyping of multiple genes. The SNPs discovered provide valuable makers for detection and identification of P. myriotylum strains initially isolated from Pythium soft rot (PSR) ginger by using PCR-RFLP of the CoxII locus. The PCR-RFLP was also sensitive to detect P. myriotylum directly from PSR ginger sampled from pot trials without the need of isolation for pure cultures. © 2017 The Society for Applied Microbiology.

Interleukin-2 and Interleukin-8 Gene Polymorphisms and Acquired Aplastic Anemia Risk in a Chinese Population.

PubMed

Zhang, Xuejie; Lin, Shengyun; Yang, Yan; Rong, Liucheng; He, Guangsheng; He, Hailong; Xue, Yao; Fang, Yongjun; Wang, Yaping

2017-01-01

Cytokines IL-2 and IL-8 both participate in immune regulation. However, the relationship between polymorphisms in these two cytokines and the risk of acquired aplastic anemia (acquired AA) has not been explored. We selected five SNPs including rs11575812, rs2069772 and rs2069762 of IL-2, rs2227306 and rs2227543 of IL-8. SNaPshot genotyping was used to test the genotypes of IL-2 and IL-8 polymorphisms in a population of 101 acquired AA patients and 165 healthy controls. The rs2069762 G allele appeared to be a protective mutation, but no significant differences were found in other four SNPs. We also found that rs2069762 had an impact on the transcriptional regulation. It could be assumed that the rs2069762 polymorphism might reduce the risk of acquired aplastic anemia, while the remaining four SNPs might not contribute to susceptibility to acquired AA in a Chinese population. © 2017 The Author(s)Published by S. Karger AG, Basel.

Catalog of MicroRNA Seed Polymorphisms in Vertebrates

PubMed Central

Calin, George Adrian; Horvat, Simon; Jiang, Zhihua; Dovc, Peter; Kunej, Tanja

2012-01-01

MicroRNAs (miRNAs) are a class of non-coding RNA that plays an important role in posttranscriptional regulation of mRNA. Evidence has shown that miRNA gene variability might interfere with its function resulting in phenotypic variation and disease susceptibility. A major role in miRNA target recognition is ascribed to complementarity with the miRNA seed region that can be affected by polymorphisms. In the present study, we developed an online tool for the detection of miRNA polymorphisms (miRNA SNiPer) in vertebrates (http://www.integratomics-time.com/miRNA-SNiPer) and generated a catalog of miRNA seed region polymorphisms (miR-seed-SNPs) consisting of 149 SNPs in six species. Although a majority of detected polymorphisms were due to point mutations, two consecutive nucleotide substitutions (double nucleotide polymorphisms, DNPs) were also identified in nine miRNAs. We determined that miR-SNPs are frequently located within the quantitative trait loci (QTL), chromosome fragile sites, and cancer susceptibility loci, indicating their potential role in the genetic control of various complex traits. To test this further, we performed an association analysis between the mmu-miR-717 seed SNP rs30372501, which is polymorphic in a large number of standard inbred strains, and all phenotypic traits in these strains deposited in the Mouse Phenome Database. Analysis showed a significant association between the mmu-miR-717 seed SNP and a diverse array of traits including behavior, blood-clinical chemistry, body weight size and growth, and immune system suggesting that seed SNPs can indeed have major pleiotropic effects. The bioinformatics analyses, data and tools developed in the present study can serve researchers as a starting point in testing more targeted hypotheses and designing experiments using optimal species or strains for further mechanistic studies. PMID:22303453

Polymorphisms in HSD17B1: Early Onset and Increased Risk of Alzheimer's Disease in Women with Down Syndrome.

PubMed

Lee, Joseph H; Gurney, Susan; Pang, Deborah; Temkin, Alexis; Park, Naeun; Janicki, Sarah C; Zigman, Warren B; Silverman, Wayne; Tycko, Benjamin; Schupf, Nicole

2012-01-01

Background/Aims. Genetic variants that affect estrogen activity may influence the risk of Alzheimer's disease (AD). In women with Down syndrome, we examined the relation of polymorphisms in hydroxysteroid-17beta-dehydrogenase (HSD17B1) to age at onset and risk of AD. HSD17B1 encodes the enzyme 17β-hydroxysteroid dehydrogenase (HSD1), which catalyzes the conversion of estrone to estradiol. Methods. Two hundred and thirty-eight women with DS, nondemented at baseline, 31-78 years of age, were followed at 14-18-month intervals for 4.5 years. Women were genotyped for 5 haplotype-tagging single-nucleotide polymorphisms (SNPs) in the HSD17B1 gene region, and their association with incident AD was examined. Results. Age at onset was earlier, and risk of AD was elevated from two- to threefold among women homozygous for the minor allele at 3 SNPs in intron 4 (rs676387), exon 6 (rs605059), and exon 4 in COASY (rs598126). Carriers of the haplotype TCC, based on the risk alleles for these three SNPs, had an almost twofold increased risk of developing AD (hazard ratio = 1.8, 95% CI, 1.1-3.1). Conclusion. These findings support experimental and clinical studies of the neuroprotective role of estrogen.

SNP-markers in Allium species to facilitate introgression breeding in onion.

PubMed

Scholten, Olga E; van Kaauwen, Martijn P W; Shahin, Arwa; Hendrickx, Patrick M; Keizer, L C Paul; Burger, Karin; van Heusden, Adriaan W; van der Linden, C Gerard; Vosman, Ben

2016-08-31

Within onion, Allium cepa L., the availability of disease resistance is limited. The identification of sources of resistance in related species, such as Allium roylei and Allium fistulosum, was a first step towards the improvement of onion cultivars by breeding. SNP markers linked to resistance and polymorphic between these related species and onion cultivars are a valuable tool to efficiently introgress disease resistance genes. In this paper we describe the identification and validation of SNP markers valuable for onion breeding. Transcriptome sequencing resulted in 192 million RNA seq reads from the interspecific F1 hybrid between A. roylei and A. fistulosum (RF) and nine onion cultivars. After assembly, reliable SNPs were discovered in about 36 % of the contigs. For genotyping of the interspecific three-way cross population, derived from a cross between an onion cultivar and the RF (CCxRF), 1100 SNPs that are polymorphic in RF and monomorphic in the onion cultivars (RF SNPs) were selected for the development of KASP assays. A molecular linkage map based on 667 RF-SNP markers was constructed for CCxRF. In addition, KASP assays were developed for 1600 onion-SNPs (SNPs polymorphic among onion cultivars). A second linkage map was constructed for an F2 of onion x A. roylei (F2(CxR)) that consisted of 182 onion-SNPs and 119 RF-SNPs, and 76 previously mapped markers. Markers co-segregating in both the F2(CxR) and the CCxRF population were used to assign the linkage groups of RF to onion chromosomes. To validate usefulness of these SNP markers, QTL mapping was applied in the CCxRF population that segregates for resistance to Botrytis squamosa and resulted in a QTL for resistance on chromosome 6 of A. roylei. Our research has more than doubled the publicly available marker sequences of expressed onion genes and two onion-related species. It resulted in a detailed genetic map for the interspecific CCxRF population. This is the first paper that reports the detection of a QTL for resistance to B. squamosa in A. roylei.

Rapid Genotyping of Single Nucleotide Polymorphisms Influencing Warfarin Drug Response by Surface-Enhanced Laser Desorption and Ionization Time-of-Flight (SELDI-TOF) Mass Spectrometry

PubMed Central

Yang, Shangbin; Xu, LiHui; Wu, Haifeng M.

2010-01-01

Warfarin exhibits significant interindividual variability in dosing requirements. Different drug responses are partly attributed to the single nucleotide polymorphisms (SNPs) that influence either drug action or drug metabolism. Rapid genotyping of these SNPs helps clinicians to choose appropriate initial doses to quickly achieve anticoagulation effects and to prevent complications. We report a novel application of surface-enhanced laser desorption and ionization time-of-flight mass spectrometry (SELDI-TOF MS) in the rapid genotyping of SNPs that impact warfarin efficacy. The SNPs were first amplified by PCR and then underwent single base extension to generate the specific SNP product. Next, genetic variants displaying different masses were bound to Q10 anionic proteinChips and then genotyped by using SELDI-TOF MS in a multiplex fashion. SELDI-TOF MS offered unique properties of on-chip sample enrichment and clean-ups, which streamlined the testing procedures and eliminated many tedious experimental steps required by the conventional MS-based method. The turn-around time for genotyping three known warfarin-related SNPs, CYP2C9*2, CYP2C9*3, and VKORC1 3673G>A by SELDI-TOF MS was less than 5 hours. The analytical accuracy of this method was confirmed both by bidirectional DNA sequencing and by comparing the genotype results (n = 189) obtained by SELDI-TOF MS to reports from a clinical reference laboratory. This new multiplex genotyping method provides an excellent clinical laboratory platform to promote personalized medicine in warfarin therapy. PMID:20075209

Rapid genotyping of single nucleotide polymorphisms influencing warfarin drug response by surface-enhanced laser desorption and ionization time-of-flight (SELDI-TOF) mass spectrometry.

PubMed

Yang, Shangbin; Xu, LiHui; Wu, Haifeng M

2010-03-01

Warfarin exhibits significant interindividual variability in dosing requirements. Different drug responses are partly attributed to the single nucleotide polymorphisms (SNPs) that influence either drug action or drug metabolism. Rapid genotyping of these SNPs helps clinicians to choose appropriate initial doses to quickly achieve anticoagulation effects and to prevent complications. We report a novel application of surface-enhanced laser desorption and ionization time-of-flight mass spectrometry (SELDI-TOF MS) in the rapid genotyping of SNPs that impact warfarin efficacy. The SNPs were first amplified by PCR and then underwent single base extension to generate the specific SNP product. Next, genetic variants displaying different masses were bound to Q10 anionic proteinChips and then genotyped by using SELDI-TOF MS in a multiplex fashion. SELDI-TOF MS offered unique properties of on-chip sample enrichment and clean-ups, which streamlined the testing procedures and eliminated many tedious experimental steps required by the conventional MS-based method. The turn-around time for genotyping three known warfarin-related SNPs, CYP2C9*2, CYP2C9*3, and VKORC1 3673G>A by SELDI-TOF MS was less than 5 hours. The analytical accuracy of this method was confirmed both by bidirectional DNA sequencing and by comparing the genotype results (n = 189) obtained by SELDI-TOF MS to reports from a clinical reference laboratory. This new multiplex genotyping method provides an excellent clinical laboratory platform to promote personalized medicine in warfarin therapy.

Association of Single-Nucleotide Polymorphisms of the Tau Gene With Late-Onset Parkinson Disease

PubMed Central

Martin, Eden R.; Scott, William K.; Nance, Martha A.; Watts, Ray L.; Hubble, Jean P.; Koller, William C.; Lyons, Kelly; Pahwa, Rajesh; Stern, Matthew B.; Colcher, Amy; Hiner, Bradley C.; Jankovic, Joseph; Ondo, William G.; Allen, Fred H.; Goetz, Christopher G.; Small, Gary W.; Masterman, Donna; Mastaglia, Frank; Laing, Nigel G.; Stajich, Jeffrey M.; Ribble, Robert C.; Booze, Michael W.; Rogala, Allison; Hauser, Michael A.; Zhang, Fengyu; Gibson, Rachel A.; Middleton, Lefkos T.; Roses, Allen D.; Haines, Jonathan L.; Scott, Burton L.; Pericak-Vance, Margaret A.; Vance, Jeffery M.

2013-01-01

Context The human tau gene, which promotes assembly of neuronal microtubules, has been associated with several rare neurologic diseases that clinically include parkinsonian features. We recently observed linkage in idiopathic Parkinson disease (PD) to a region on chromosome 17q21 that contains the tau gene. These factors make tau a good candidate for investigation as a susceptibility gene for idiopathic PD, the most common form of the disease. Objective To investigate whether the tau gene is involved in idiopathic PD. Design, Setting, and Participants Among a sample of 1056 individuals from 235 families selected from 13 clinical centers in the United States and Australia and from a family ascertainment core center, we tested 5 single-nucleotide polymorphisms (SNPs) within the tau gene for association with PD, using family-based tests of association. Both affected (n = 426) and unaffected (n = 579) family members were included; 51 individuals had unclear PD status. Analyses were conducted to test individual SNPs and SNP haplotypes within the tau gene. Main Outcome Measure Family-based tests of association, calculated using asymptotic distributions. Results Analysis of association between the SNPs and PD yielded significant evidence of association for 3 of the 5 SNPs tested: SNP 3, P = .03; SNP 9i, P = .04; and SNP 11, P = .04. The 2 other SNPs did not show evidence of significant association (SNP 9ii, P = .11, and SNP 9iii, P = .87). Strong evidence of association was found with haplotype analysis, with a positive association with one haplotype (P = .009) and a negative association with another haplotype (P = .007). Substantial linkage disequilibrium (P<.001) was detected between 4 of the 5 SNPs (SNPs 3,9i, 9ii, and 11). Conclusions This integrated approach of genetic linkage and positional association analyses implicates tau as a susceptibility gene for idiopathic PD. PMID:11710889

Reinvestigations of six unusual paternity cases by typing of autosomal single-nucleotide polymorphisms.

PubMed

Børsting, Claus; Morling, Niels

2012-02-01

In some relationship cases, the initial investigations of autosomal short tandem repeats (STRs) lead to an ambiguous conclusion and supplementary investigations become necessary. Six unusual paternity cases were previously investigated by other researchers and published as case work examples in forensic journals. Here, the cases were reinvestigated by typing the samples for 49 autosomal single-nucleotide polymorphisms (SNPs) using the SNPforID multiplex assay. Three cases were solved by the SNP investigation without the need for any additional testing. In two cases, the SNP results supported the conclusions based on STRs. In the last case, the SNP results spoke in favor of paternity, and the combined paternity index based on autosomal STRs and SNPs was 12.3 billion. Nevertheless, the alleged father was excluded by X-chromosome typing. The case work examples underline the importance of performing supplementary investigations, and they advocate for the implementation of several panels that may be used in the highly unusual cases. Panels with SNPs or other markers with low mutation probabilities are preferable as supplementary markers, because the risk of detecting (additional) mutations is very low. © 2012 American Association of Blood Banks.

Influence of genetic variants associated with body mass index on eating behavior in childhood

PubMed Central

Monnereau, Claire; Jansen, Pauline W; Tiemeier, Henning; Jaddoe, Vincent WV; Felix, Janine F

2017-01-01

Objective Childhood eating behaviors are associated with body mass index (BMI). Recent genome-wide association studies have identified many single nucleotide polymorphisms (SNPs) associated with adult and childhood BMI. We hypothesized that these SNPs also influence eating behavior. Methods In a population-based prospective cohort study among 3,179 children (mean age (standard deviation): 4.0 (0.1) years), we tested two weighted genetic risk scores, based on 15 childhood and 97 adult BMI SNPs, and ten individual appetite and/or satiety related SNPs for association with food fussiness, food responsiveness, enjoyment of food, satiety responsiveness, slowness in eating. Results The 15 SNP-based childhood BMI genetic risk score was not associated with the eating behavior subscales. The 97 SNP-based adult BMI genetic risk score was nominally associated with satiety responsiveness (β: -0.007 standard deviation, 95% confidence interval (CI) -0.013, 0.000). Of the ten individual SNPs, rs11030104 in BDNF and rs10733682 in LMX1B were nominally associated with satiety responsiveness (β: -0.057 standard deviation, 95% CI -0.112, -0.002). Conclusion Our findings do not strongly support the hypothesis that BMI associated SNPs also influence eating behavior at this age. A potential role for BMI SNPs in satiety responsiveness during childhood was observed, however, no associations with the other eating behavior subscales. PMID:28245097

Effect of polymorphisms in the CSN3 (κ-casein) gene on milk production traits in Chinese Holstein Cattle.

PubMed

Alim, M A; Dong, T; Xie, Y; Wu, X P; Zhang, Yi; Zhang, Shengli; Sun, D X

2014-11-01

This study was designed to evaluate significant associations between single nucleotide polymorphisms (SNPs) and milk composition and milk production traits in Chinese Holstein cows. Six SNPs were identified in the κ-casein gene using pooled DNA sequencing. The identified SNPs were genotyped by Matrix-assisted laser desorption/ionization time of flight mass spectrometry (MALDI-TOF MS) methods from 507 individuals. Out of six, we identified three non-synonymous SNPs (g.10888T>C, g.10924C>A and g.10944A>G) that changed in the protein product. SIFT (Sorting_Intolerant_From_Tolerant) prediction score (0.01) demonstrated that protein changed Isoleucine > Threonine (g.10888T>C) will affect the phenotypes. Significant associations between identified SNPs and three yield traits (milk, protein and fat) and two composition traits (fat and protein percentages) were found whereas it did not reach significance for fat percentage in haplotypes association. Importantly, the significant SNPs in our results showed a large proportion of the phenotypic variation of milk protein yield and concentration. Our results suggest that CSN3 is an important candidate gene that influences milk production traits, and identified polymorphisms and haplotypes could be used as a genetic marker in programs of marker-assisted selection for the genetic improvement of milk production traits in dairy cattle.

Association of Adenylate Cyclase 10 (ADCY10) Polymorphisms and Bone Mineral Density in Healthy Adults

PubMed Central

Ichikawa, Shoji; Koller, Daniel L.; Curry, Leah R.; Lai, Dongbing; Xuei, Xiaoling; Edenberg, Howard J.; Hui, Siu L.; Peacock, Munro; Foroud, Tatiana; Econs, Michael J.

2010-01-01

Phenotypic variation in bone mineral density (BMD) among healthy adults is influenced by both genetic and environmental factors. Genetic sequence variations in the adenylate cyclase 10 (ADCY10) gene, which is also called soluble adenylate cyclase, have previously been reported to be associated with low spinal BMD in hypercalciuric patients. Since ADCY10 is located in the region linked to spinal BMD in our previous linkage analysis, we tested whether polymorphisms in this gene are also associated with normal BMD variation in healthy adults. Sixteen single nucleotide polymorphisms (SNPs) distributed throughout ADCY10 were genotyped in two healthy groups of American whites: 1,692 premenopausal women and 715 men. Statistical analyses were performed in the two groups to test for association between these SNPs and femoral neck and lumbar spine areal BMD. We observed significant evidence of association (p<0.01) with one SNP each in men and women. Genotypes at these SNPs accounted for less than 1% of hip BMD variation in men, but 1.5% of spinal BMD in women. However, adjacent SNPs did not corroborate the association in either males or females. In conclusion, we found a modest association between an ADCY10 polymorphism and spinal areal BMD in premenopausal white women. PMID:19093065

Leu72Met and Other Intronic Polymorphisms in the GHRL and GHSR Genes Are Not Associated with Type 2 Diabetes Mellitus, Insulin Resistance, or Serum Ghrelin Levels in a Saudi Population

PubMed Central

Joatar, Faris Elbahi; Al Qarni, Ali Ahmed; Ali, Muhalab E.; Al Masaud, Abdulaziz; Shire, Abdirashid M.; Das, Nagalla; Gumaa, Khalid

2017-01-01

Background Ghrelin (GHRL), a gastric peptide encoded by the GHRL gene, is known to be involved in energy homeostasis via its G protein receptor, encoded by the growth hormone secretagogue receptor (GHSR) gene. Some studies have shown associations between plasma GHRL levels and GHRL single-nucleotide polymorphisms (SNPs), namely the Leu72Met polymorphism (rs696217 TG), with type 2 diabetes mellitus (T2DM) and insulin resistance (IR), while others have not. The controversies in these associations raise the issue of ‘which SNPs in which populations.’ The aim of this study was to investigate whether SNPs in GHRL and/or GHSR genes were associated with T2DM, IR, or plasma GHRL levels among Arab Saudis. Methods Blood was collected from 208 Saudi subjects with (n=107) and without (n=101) T2DM. DNA samples from these subjects were analyzed by real-time polymerase chain reaction to genotype five intronic SNPs in the GHRL (rs696217 TG, rs27647 CT, rs2075356 CT, and rs4684677 AT) and GHSR (rs509030 GC) genes. In addition, plasma GHRL levels were measured by a radioimmunoassay. Results None of the SNPs were associated with T2DM, IR, or plasma GHRL levels. The frequencies of the alleles, genotypes, and haplotypes of the five SNPs were comparable between the T2DM patients and the non-diabetic subjects. A large number of the GHRL haplotypes indicates the molecular heterogeneity of the preproghrelin gene in this region. Conclusion Neither the Leu72Met polymorphism nor the other intronic GHRL and GHSR SNPs were associated with T2DM, IR, or GHRL levels. Further investigations should be carried out to explain the molecular basis of the association of the GHRL peptide with T2DM and IR. PMID:28956366

Leu72Met and Other Intronic Polymorphisms in the GHRL and GHSR Genes Are Not Associated with Type 2 Diabetes Mellitus, Insulin Resistance, or Serum Ghrelin Levels in a Saudi Population.

PubMed

Joatar, Faris Elbahi; Al Qarni, Ali Ahmed; Ali, Muhalab E; Al Masaud, Abdulaziz; Shire, Abdirashid M; Das, Nagalla; Gumaa, Khalid; Giha, Hayder A

2017-09-01

Ghrelin (GHRL), a gastric peptide encoded by the GHRL gene, is known to be involved in energy homeostasis via its G protein receptor, encoded by the growth hormone secretagogue receptor (GHSR) gene. Some studies have shown associations between plasma GHRL levels and GHRL single-nucleotide polymorphisms (SNPs), namely the Leu72Met polymorphism (rs696217 TG), with type 2 diabetes mellitus (T2DM) and insulin resistance (IR), while others have not. The controversies in these associations raise the issue of 'which SNPs in which populations.' The aim of this study was to investigate whether SNPs in GHRL and/or GHSR genes were associated with T2DM, IR, or plasma GHRL levels among Arab Saudis. Blood was collected from 208 Saudi subjects with (n=107) and without (n=101) T2DM. DNA samples from these subjects were analyzed by real-time polymerase chain reaction to genotype five intronic SNPs in the GHRL (rs696217 TG, rs27647 CT, rs2075356 CT, and rs4684677 AT) and GHSR (rs509030 GC) genes. In addition, plasma GHRL levels were measured by a radioimmunoassay. None of the SNPs were associated with T2DM, IR, or plasma GHRL levels. The frequencies of the alleles, genotypes, and haplotypes of the five SNPs were comparable between the T2DM patients and the non-diabetic subjects. A large number of the GHRL haplotypes indicates the molecular heterogeneity of the preproghrelin gene in this region. Neither the Leu72Met polymorphism nor the other intronic GHRL and GHSR SNPs were associated with T2DM, IR, or GHRL levels. Further investigations should be carried out to explain the molecular basis of the association of the GHRL peptide with T2DM and IR. Copyright © 2017 Korean Endocrine Society

Selected single-nucleotide polymorphisms in FOXE1, SERPINA5, FTO, EVPL, TICAM1 and SCARB1 are associated with papillary and follicular thyroid cancer risk: replication study in a German population

PubMed Central

Sigurdson, Alice J.; Brenner, Alina V.; Roach, James A.; Goudeva, Lilia; Müller, Jörg A.; Nerlich, Kai; Reiners, Christoph; Schwab, Robert; Pfeiffer, Liliane; Waldenberger, Melanie; Braganza, Melissa; Xu, Li; Sturgis, Erich M.; Yeager, Meredith; Chanock, Stephen J.; Pfeiffer, Ruth M.; Abend, Michael; Port, Matthias

2016-01-01

Several single-nucleotide polymorphisms (SNPs) have been associated with papillary and follicular thyroid cancer (PTC and FTC, respectively) risk, but few have replicated. After analyzing 17525 tag SNPs in 1129 candidate genes, we found associations with PTC risk in SERPINA5, FTO, HEMGN (near FOXE1) and other genes. Here, we report results from a replication effort in a large independent PTC/FTC case–control study conducted in Germany. We evaluated the best tagging SNPs from our previous PTC study and additionally included SNPs in or near FOXE1 and NKX2-1 genes, known susceptibility loci for thyroid cancer. We genotyped 422 PTC and 130 FTC cases and 752 controls recruited from three German clinical centers. We used polytomous logistic regression to simultaneously estimate PTC and FTC associations for 79 SNPs based on log-additive models. We assessed effect modification by body mass index (BMI), gender and age for all SNPs, and selected SNP by SNP interactions. We confirmed associations with PTC and SNPs in FOXE1/HEMGN, SERPINA5 (rs2069974), FTO (rs8047395), EVPL (rs2071194), TICAM1 (rs8120) and SCARB1 (rs11057820) genes. We found associations with SNPs in FOXE1, SERPINA5, FTO, TICAM1 and HSPA6 and FTC. We found two significant interactions between FTO (rs8047395) and BMI (P = 0.0321) and between TICAM1 (rs8120) and FOXE1 (rs10984377) (P = 0.0006). Besides the known associations with FOXE1 SNPs, we confirmed additional PTC SNP associations reported previously. We also found several new associations with FTC risk and noteworthy interactions. We conclude that multiple variants and host factors might interact in complex ways to increase risk of PTC and FTC. PMID:27207655

Selected single-nucleotide polymorphisms in FOXE1, SERPINA5, FTO, EVPL, TICAM1 and SCARB1 are associated with papillary and follicular thyroid cancer risk: replication study in a German population.

PubMed

Sigurdson, Alice J; Brenner, Alina V; Roach, James A; Goudeva, Lilia; Müller, Jörg A; Nerlich, Kai; Reiners, Christoph; Schwab, Robert; Pfeiffer, Liliane; Waldenberger, Melanie; Braganza, Melissa; Xu, Li; Sturgis, Erich M; Yeager, Meredith; Chanock, Stephen J; Pfeiffer, Ruth M; Abend, Michael; Port, Matthias

2016-07-01

Several single-nucleotide polymorphisms (SNPs) have been associated with papillary and follicular thyroid cancer (PTC and FTC, respectively) risk, but few have replicated. After analyzing 17525 tag SNPs in 1129 candidate genes, we found associations with PTC risk in SERPINA5, FTO, HEMGN (near FOXE1) and other genes. Here, we report results from a replication effort in a large independent PTC/FTC case-control study conducted in Germany. We evaluated the best tagging SNPs from our previous PTC study and additionally included SNPs in or near FOXE1 and NKX2-1 genes, known susceptibility loci for thyroid cancer. We genotyped 422 PTC and 130 FTC cases and 752 controls recruited from three German clinical centers. We used polytomous logistic regression to simultaneously estimate PTC and FTC associations for 79 SNPs based on log-additive models. We assessed effect modification by body mass index (BMI), gender and age for all SNPs, and selected SNP by SNP interactions. We confirmed associations with PTC and SNPs in FOXE1/HEMGN, SERPINA5 (rs2069974), FTO (rs8047395), EVPL (rs2071194), TICAM1 (rs8120) and SCARB1 (rs11057820) genes. We found associations with SNPs in FOXE1, SERPINA5, FTO, TICAM1 and HSPA6 and FTC. We found two significant interactions between FTO (rs8047395) and BMI (P = 0.0321) and between TICAM1 (rs8120) and FOXE1 (rs10984377) (P = 0.0006). Besides the known associations with FOXE1 SNPs, we confirmed additional PTC SNP associations reported previously. We also found several new associations with FTC risk and noteworthy interactions. We conclude that multiple variants and host factors might interact in complex ways to increase risk of PTC and FTC. Published by Oxford University Press 2016.

Incorporating Single-nucleotide Polymorphisms Into the Lyman Model to Improve Prediction of Radiation Pneumonitis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Tucker, Susan L., E-mail: sltucker@mdanderson.org; Li Minghuan; Xu Ting

2013-01-01

Purpose: To determine whether single-nucleotide polymorphisms (SNPs) in genes associated with DNA repair, cell cycle, transforming growth factor-{beta}, tumor necrosis factor and receptor, folic acid metabolism, and angiogenesis can significantly improve the fit of the Lyman-Kutcher-Burman (LKB) normal-tissue complication probability (NTCP) model of radiation pneumonitis (RP) risk among patients with non-small cell lung cancer (NSCLC). Methods and Materials: Sixteen SNPs from 10 different genes (XRCC1, XRCC3, APEX1, MDM2, TGF{beta}, TNF{alpha}, TNFR, MTHFR, MTRR, and VEGF) were genotyped in 141 NSCLC patients treated with definitive radiation therapy, with or without chemotherapy. The LKB model was used to estimate the risk ofmore » severe (grade {>=}3) RP as a function of mean lung dose (MLD), with SNPs and patient smoking status incorporated into the model as dose-modifying factors. Multivariate analyses were performed by adding significant factors to the MLD model in a forward stepwise procedure, with significance assessed using the likelihood-ratio test. Bootstrap analyses were used to assess the reproducibility of results under variations in the data. Results: Five SNPs were selected for inclusion in the multivariate NTCP model based on MLD alone. SNPs associated with an increased risk of severe RP were in genes for TGF{beta}, VEGF, TNF{alpha}, XRCC1 and APEX1. With smoking status included in the multivariate model, the SNPs significantly associated with increased risk of RP were in genes for TGF{beta}, VEGF, and XRCC3. Bootstrap analyses selected a median of 4 SNPs per model fit, with the 6 genes listed above selected most often. Conclusions: This study provides evidence that SNPs can significantly improve the predictive ability of the Lyman MLD model. With a small number of SNPs, it was possible to distinguish cohorts with >50% risk vs <10% risk of RP when they were exposed to high MLDs.« less

Association of Notch3 single-nucleotide polymorphisms and lacunar infarctions in patients.

PubMed

Li, Ying; Liu, Nan; Chen, Hui; Huang, Yonghua; Zhang, Weiwei

2016-01-01

Cerebrovascular disease is a leading cause of morbidity and mortality worldwide, which is influenced by genetic and environmental factors. The aim of the present study was to examine the association between single-nucleotide polymorphisms (SNPs) in Notch3 exons 3-6 and lacunar infarction by comparing SNPs between control subjects and those with lacunar infarction. A single-center case-control study was conducted to investigate the association between Notch3 SNPs and risk of stroke. A total of 140 patients were included in the study, 30 of whom had no infarction (control) and 110 had lacunar infarction. Lacunar patients were divided into the 'pure lacunar' and 'lacunar + leukoarasis' groups based on brain imaging. All the patients were of Chinese Han ethnicity, and the male to female ratio was 84:56. Patient clinical histories included hypertension, diabetes mellitus (DM), hyperlipidemia, and heart disease were recorded. The Notch3 sequence was obtained from the National Centser for Biotechnology Information database. Notch3 was amplified by polymerase chain reaction from whole blood samples, and exons 3-6 were sequenced to identify SNPs. The result showed that there was no significant difference in the prevalence of hypertension, DM, hyperlipidemia, and heart disease between the control and lacunar infarction patients. Notabley, the age of the lacunar + leukoarasis patients was significantly higher than that of the control and pure lacunar patients (P<0.05). Eight SNPs were detected at low frequencies, and only rs3815388 and rs1043994 exhibited slightly higher frequencies. A χ 2 test indicated that Notch3 SNPs, particularly rs1043994, were associated with lacunar infarction (P<0.05). In conclusion, the result of the present study have shown that Notch3 SNPs, particularly rs1043994, are associated with lacunar infarction.

Maternal and offspring genetic variants of AKR1C3 and the risk of childhood leukemia

PubMed Central

Liu, Chen-yu; Hsu, Yi-Hsiang; Pan, Pi-Chen; Wu, Ming-Tsang; Ho, Chi-Kung; Su, Li; Xu, Xin; Li, Yi; Christiani, David C.

2008-01-01

The aldo-keto reductase 1C3 (AKR1C3) gene located on chromosome 10p15-p14, a regulator of myeloid cell proliferation and differentiation, represents an important candidate gene for studying human carcinogenesis. In a prospectively enrolled population-based case–control study of Han Chinese conducted in Kaohsiung in southern Taiwan, a total of 114 leukemia cases and 221 controls <20 years old were recruited between November 1997 and December 2005. The present study set out to evaluate the association between childhood leukemia and both maternal and offspring's genotypes. To do so, we conducted a systematic assessment of common single-nucleotide polymorphisms (SNPs) at the 5′ flanking 10 kb to 3′ UTR of AKR1C3 gene. Gln5His and three tagSNPs (rs2245191, rs10508293 and rs3209896) and one multimarker (rs2245191, rs10508293 and rs3209896) were selected with average 90% coverage of untagged SNPs by using the HapMap II data set. Odds ratios and 95% confidence intervals were adjusted for age and gender. After correcting for multiple comparisons, we observed that risk of developing childhood leukemia is significantly associated with rs10508293 polymorphism on intron 4 of the AKR1C3 gene in both offspring alone and in the combined maternal and offspring genotypes (nominal P < 0.0001, permutation P < 0.005). The maternal methylenetetrahydrofolate reductase A1298C polymorphism was found to be an effect modifier of the maternal intron 4 polymorphism of the AKR1C3 gene (rs10508293) and the childhood leukemia risk. In conclusion, this study suggests that AKR1C3 polymorphisms may be important predictive markers for childhood leukemia susceptibility. PMID:18339682

Uncoupling protein 2 gene polymorphisms are associated with obesity

PubMed Central

2012-01-01

Background Uncoupling protein 2 (UCP2) gene polymorphisms have been reported as genetic risk factors for obesity and type 2 diabetes mellitus (T2DM). We examined the association of commonly observed UCP2 G(−866)A (rs659366) and Ala55Val (C > T) (rs660339) single nucleotide polymorphisms (SNPs) with obesity, high fasting plasma glucose, and serum lipids in a Balinese population. Methods A total of 603 participants (278 urban and 325 rural subjects) were recruited from Bali Island, Indonesia. Fasting plasma glucose (FPG), triglyceride (TG), high density lipoprotein cholesterol (HDL-C), low density lipoprotein cholesterol (LDL-C) and total cholesterol (TC) were measured. Obesity was determined based on WHO classifications for adult Asians. Participants were genotyped for G(−866)A and Ala55Val polymorphisms of the UCP2 gene. Results Obesity prevalence was higher in urban subjects (51%) as compared to rural subjects (23%). The genotype, minor allele (MAF), and heterozygosity frequencies were similar between urban and rural subjects for both SNPs. All genotype frequencies were in Hardy-Weinberg equilibrium. A combined analysis of genotypes and environment revealed that the urban subjects carrying the A/A genotype of the G(−866)A SNP have higher BMI than the rural subjects with the same genotype. Since the two SNPs showed strong linkage disequilibrium (D’ = 0.946, r2 = 0.657), a haplotype analysis was performed. We found that the AT haplotype was associated with high BMI only when the urban environment was taken into account. Conclusions We have demonstrated the importance of environmental settings in studying the influence of the common UCP2 gene polymorphisms in the development of obesity in a Balinese population. PMID:22533685

Adaptive and neutral markers both show continent-wide population structure of mountain pine beetle (Dendroctonus ponderosae).

PubMed

Batista, Philip D; Janes, Jasmine K; Boone, Celia K; Murray, Brent W; Sperling, Felix A H

2016-09-01

Assessments of population genetic structure and demographic history have traditionally been based on neutral markers while explicitly excluding adaptive markers. In this study, we compared the utility of putatively adaptive and neutral single-nucleotide polymorphisms (SNPs) for inferring mountain pine beetle population structure across its geographic range. Both adaptive and neutral SNPs, and their combination, allowed range-wide structure to be distinguished and delimited a population that has recently undergone range expansion across northern British Columbia and Alberta. Using an equal number of both adaptive and neutral SNPs revealed that adaptive SNPs resulted in a stronger correlation between sampled populations and inferred clustering. Our results suggest that adaptive SNPs should not be excluded prior to analysis from neutral SNPs as a combination of both marker sets resulted in better resolution of genetic differentiation between populations than either marker set alone. These results demonstrate the utility of adaptive loci for resolving population genetic structure in a nonmodel organism.

LAMB1 polymorphism is associated with autism symptom severity in Korean autism spectrum disorder patients.

PubMed

Kim, Young Jong; Park, Jin Kyung; Kang, Won Sub; Kim, Su Kang; Park, Hae Jeong; Nam, Min; Kim, Jong Woo

2015-01-01

LAMB1 encodes laminin beta-1, which is expressed during early development of the human nervous system, and could be involved in the pathogenesis of neurodevelopmental disorders. In our study, we aimed to investigate whether single nucleotide polymorphisms (SNPs) in LAMB1 were associated with autism spectrum disorder (ASD) and with related clinical severities of ASD. Two coding SNPs (rs20556 and rs25659) and two intronic SNPs (rs2158836 and rs2237659) were compared between 180 patients with ASD and 147 healthy control subjects using direct sequencing. The Korean version of the Childhood Autism Rating Scale (K-CARS) was used to assess clinical severities. Multiple logistic regression models were employed to analyze genetic data, and associations with symptom severity were tested with the Kruskal-Wallis and the Mann-Whitney U tests. None of the four examined SNPs was associated with ASD risk. However, the GG genotype of rs2158836 was associated with more severe symptoms for the "object use" and "non-verbal communication" measures. The results of our study suggest the association between rs2158836 polymorphisms and symptom severity in ASD.

Genetic association between ghrelin polymorphisms and Alzheimer's disease in a Japanese population.

PubMed

Shibata, Nobuto; Ohnuma, Tohru; Kuerban, Bolati; Komatsu, Miwa; Arai, Heii

2011-01-01

Ghrelin has been reported to enter the hippocampus and to bind to the neurons of the hippocampal formation. This peptide also affects neuronal glucose uptake and decreases tau hyperphosphorylation. There is increasing evidence suggesting an association between ghrelin and Alzheimer's disease (AD) pathology. The aim of this study was to investigate whether single nucleotide polymorphisms (SNPs) of the ghrelin gene are associated with AD. The SNPs were genotyped using TaqMan technology and were analyzed using a case-control study design. Our case-control dataset consisted of 182 AD patients and 143 age-matched controls. Hardy-Weinberg equilibrium and linkage disequilibrium analyses suggest that the region in and around the gene is highly polymorphic. One SNP, rs4684677 (Leu90Gln), showed a marginal association with age of AD onset. We did not detect any association between the other SNPs of the ghrelin gene and AD. There have been few genetic studies on the relationship between circulating ghrelin and functional SNPs. Further multifactorial studies are needed to clarify the relationship between ghrelin and AD. Copyright © 2011 S. Karger AG, Basel.

A tool for selecting SNPs for association studies based on observed linkage disequilibrium patterns.

PubMed

De La Vega, Francisco M; Isaac, Hadar I; Scafe, Charles R

2006-01-01

The design of genetic association studies using single-nucleotide polymorphisms (SNPs) requires the selection of subsets of the variants providing high statistical power at a reasonable cost. SNPs must be selected to maximize the probability that a causative mutation is in linkage disequilibrium (LD) with at least one marker genotyped in the study. The HapMap project performed a genome-wide survey of genetic variation with about a million SNPs typed in four populations, providing a rich resource to inform the design of association studies. A number of strategies have been proposed for the selection of SNPs based on observed LD, including construction of metric LD maps and the selection of haplotype tagging SNPs. Power calculations are important at the study design stage to ensure successful results. Integrating these methods and annotations can be challenging: the algorithms required to implement these methods are complex to deploy, and all the necessary data and annotations are deposited in disparate databases. Here, we present the SNPbrowser Software, a freely available tool to assist in the LD-based selection of markers for association studies. This stand-alone application provides fast query capabilities and swift visualization of SNPs, gene annotations, power, haplotype blocks, and LD map coordinates. Wizards implement several common SNP selection workflows including the selection of optimal subsets of SNPs (e.g. tagging SNPs). Selected SNPs are screened for their conversion potential to either TaqMan SNP Genotyping Assays or the SNPlex Genotyping System, two commercially available genotyping platforms, expediting the set-up of genetic studies with an increased probability of success.

Correlation between facial morphology and gene polymorphisms in the Uygur youth population.

PubMed

He, Huiyu; Mi, Xue; Zhang, Jiayu; Zhang, Qin; Yao, Yuan; Zhang, Xu; Xiao, Feng; Zhao, Chunping; Zheng, Shutao

2017-04-25

Human facial morphology varies considerably among individuals and can be influenced by gene polymorphisms. We explored the effects of single nucleotide polymorphisms (SNPs) on facial features in the Uygur youth population of the Kashi area in Xinjiang, China. Saliva samples were collected from 578 volunteers, and 10 SNPs previously associated with variations in facial physiognomy were genotyped. In parallel, 3D images of the subjects' faces were obtained using grating facial scanning technology. After delimitation of 15 salient landmarks, the correlation between SNPs and the distances between facial landmark pairs was assessed. Analysis of variance revealed that ENPP1 rs7754561 polymorphism was significantly associated with RAla-RLipCn and RLipCn-Sbn linear distances (p = 0.044 and p = 0.012, respectively) as well as RLipCn-Stm curve distance (p = 0.042). The GHR rs6180 polymorphism correlated with RLipCn-Stm linear distance (p = 0.04), while the GHR rs6184 polymorphism correlated with RLipCn-ULipP curve distance (p = 0.047). The FGFR1 rs4647905 polymorphism was associated with LLipCn-Nsn linear distance (p = 0.042). These results reveal that ENPP1 and FGFR1 influence lower anterior face height, the distance from the upper lip to the nasal floor, and lip shape. FGFR1 also influences the lower anterior face height, while GHR is associated with the length and width of the lip.

Common Polymorphisms in the PKP3-SIGIRR-TMEM16J Gene Region Are Associated With Susceptibility to Tuberculosis

PubMed Central

Randhawa, April K.; Chau, Tran T. H.; Bang, Nguyen D.; Yen, Nguyen T. B.; Farrar, Jeremy J.; Dunstan, Sarah J.; Hawn, Thomas R.

2012-01-01

(See the editorial commentary by Wilkinson, on pages 525–7.) Background. Tuberculosis has been associated with genetic variation in host immunity. We hypothesized that single-nucleotide polymorphisms (SNPs) in SIGIRR, a negative regulator of Toll-like receptor/IL-1R signaling, are associated with susceptibility to tuberculosis. Methods. We used a case-population study design in Vietnam with cases that had either tuberculous meningitis or pulmonary tuberculosis. We genotyped 6 SNPs in the SIGIRR gene region (including the adjacent genes PKP3 and TMEM16J) in a discovery cohort of 352 patients with tuberculosis and 382 controls. Significant associations were genotyped in a validation cohort (339 patients with tuberculosis, 376 controls). Results. Three SNPs (rs10902158, rs7105848, rs7111432) were associated with tuberculosis in discovery and validation cohorts. The polymorphisms were associated with both tuberculous meningitis and pulmonary tuberculosis and were strongest with a recessive genetic model (odds ratios, 1.5–1.6; P = .0006–.001). Coinheritance of these polymorphisms with previously identified risk alleles in Toll-like receptor 2 and TIRAP was associated with an additive risk of tuberculosis susceptibility. Conclusions. These results demonstrate a strong association of SNPs in the PKP3-SIGIRR-TMEM16J gene region and tuberculosis in discovery and validation cohorts. To our knowledge, these are the first associations of polymorphisms in this region with any disease. PMID:22223854

Identification of IDUA and WNT16 Phosphorylation-Related Non-Synonymous Polymorphisms for Bone Mineral Density in Meta-Analyses of Genome-Wide Association Studies

PubMed Central

Niu, Tianhua; Liu, Ning; Yu, Xun; Zhao, Ming; Choi, Hyung Jin; Leo, Paul J.; Brown, Matthew A.; Zhang, Lei; Pei, Yu-Fang; Shen, Hui; He, Hao; Fu, Xiaoying; Lu, Shan; Chen, Xiang-Ding; Tan, Li-Jun; Yang, Tie-Lin; Guo, Yan; Cho, Nam H.; Shen, Jie; Guo, Yan-Fang; Nicholson, Geoffrey C.; Prince, Richard L.; Eisman, John A.; Jones, Graeme; Sambrook, Philip N.; Tian, Qing; Zhu, Xue-Zhen; Papasian, Christopher J.; Duncan, Emma L.; Uitterlinden, André G.; Shin, Chan Soo; Xiang, Shuanglin; Deng, Hong-Wen

2016-01-01

Protein phosphorylation regulates a wide variety of cellular processes. Thus, we hypothesize that single nucleotide polymorphisms (SNPs) that may modulate protein phosphorylation could affect osteoporosis risk. Based on a previous conventional genome-wide association (GWA) study, we conducted a three-stage meta-analysis targeting phosphorylation-related SNPs (phosSNPs) for femoral neck (FN)-, total hip (HIP)-, and Lumbar Spine (LS)-BMD phenotypes. In stage 1, 9,593 phosSNPs were meta-analyzed in 11,140 individuals of various ancestries. Genome-wide significance (GWS) and suggestive significance were defined by α = 5.21×10−6 (0.05/9,593) and 1.00×10−4, respectively. In stage 2, 9 stage 1-discovered phosSNPs (based on α = 1.00×10−4) were in silico meta-analyzed in Dutch, Korean, and Australian cohorts. In stage 3, four phosSNPs that replicated in stage 2 (based on α = 5.56×10−3, 0.05/9) were de novo genotyped in two independent cohorts. IDUA rs3755955 and rs6831280, and WNT16 rs2707466 were associated with BMD phenotypes in each respective stage, and in 3 stages combined, achieving GWS for both FN-BMD (P-value = 8.36×10−10, 5.26×10−10, and 3.01×10−10, respectively) and HIP-BMD (P-value = 3.26×10−6, 1.97×10−6, and 1.63×10−12, respectively). Although in vitro studies demonstrated no differences in expressions of wild-type and mutant forms of IDUA and WNT16B proteins, in silico analysis predicts that WNT16 rs2707466 directly abolishes a phosphorylation site, which could cause a deleterious effect on WNT16 protein, and that IDUA phosSNPs rs3755955 and rs6831280 could exert indirect effects on nearby phosphorylation sites. Further studies will be required to determine the detailed and specific molecular effects of these BMD-associated non-synonymous variants. PMID:26256109

Mitochondrial pathogenic mutations are population-specific.

PubMed

Breen, Michael S; Kondrashov, Fyodor A

2010-12-31

Surveying deleterious variation in human populations is crucial for our understanding, diagnosis and potential treatment of human genetic pathologies. A number of recent genome-wide analyses focused on the prevalence of segregating deleterious alleles in the nuclear genome. However, such studies have not been conducted for the mitochondrial genome. We present a systematic survey of polymorphisms in the human mitochondrial genome, including those predicted to be deleterious and those that correspond to known pathogenic mutations. Analyzing 4458 completely sequenced mitochondrial genomes we characterize the genetic diversity of different types of single nucleotide polymorphisms (SNPs) in African (L haplotypes) and non-African (M and N haplotypes) populations. We find that the overall level of polymorphism is higher in the mitochondrial compared to the nuclear genome, although the mitochondrial genome appears to be under stronger selection as indicated by proportionally fewer nonsynonymous than synonymous substitutions. The African mitochondrial genomes show higher heterozygosity, a greater number of polymorphic sites and higher frequencies of polymorphisms for synonymous, benign and damaging polymorphism than non-African genomes. However, African genomes carry significantly fewer SNPs that have been previously characterized as pathogenic compared to non-African genomes. Finding SNPs classified as pathogenic to be the only category of polymorphisms that are more abundant in non-African genomes is best explained by a systematic ascertainment bias that favours the discovery of pathogenic polymorphisms segregating in non-African populations. This further suggests that, contrary to the common disease-common variant hypothesis, pathogenic mutations are largely population-specific and different SNPs may be associated with the same disease in different populations. Therefore, to obtain a comprehensive picture of the deleterious variability in the human population, as well as to improve the diagnostics of individuals carrying African mitochondrial haplotypes, it is necessary to survey different populations independently. This article was reviewed by Dr Mikhail Gelfand, Dr Vasily Ramensky (nominated by Dr Eugene Koonin) and Dr David Rand (nominated by Dr Laurence Hurst).

WS-SNPs&GO: a web server for predicting the deleterious effect of human protein variants using functional annotation

PubMed Central

2013-01-01

Background SNPs&GO is a method for the prediction of deleterious Single Amino acid Polymorphisms (SAPs) using protein functional annotation. In this work, we present the web server implementation of SNPs&GO (WS-SNPs&GO). The server is based on Support Vector Machines (SVM) and for a given protein, its input comprises: the sequence and/or its three-dimensional structure (when available), a set of target variations and its functional Gene Ontology (GO) terms. The output of the server provides, for each protein variation, the probabilities to be associated to human diseases. Results The server consists of two main components, including updated versions of the sequence-based SNPs&GO (recently scored as one of the best algorithms for predicting deleterious SAPs) and of the structure-based SNPs&GO3d programs. Sequence and structure based algorithms are extensively tested on a large set of annotated variations extracted from the SwissVar database. Selecting a balanced dataset with more than 38,000 SAPs, the sequence-based approach achieves 81% overall accuracy, 0.61 correlation coefficient and an Area Under the Curve (AUC) of the Receiver Operating Characteristic (ROC) curve of 0.88. For the subset of ~6,600 variations mapped on protein structures available at the Protein Data Bank (PDB), the structure-based method scores with 84% overall accuracy, 0.68 correlation coefficient, and 0.91 AUC. When tested on a new blind set of variations, the results of the server are 79% and 83% overall accuracy for the sequence-based and structure-based inputs, respectively. Conclusions WS-SNPs&GO is a valuable tool that includes in a unique framework information derived from protein sequence, structure, evolutionary profile, and protein function. WS-SNPs&GO is freely available at http://snps.biofold.org/snps-and-go. PMID:23819482

Polymorphisms of the bovine DKK2 and their associations with body measurement traits and meat quality traits in Qinchuan cattle.

PubMed

Zhan, Xiaoli; Gao, Jianbin; Huangfu, Yifan; Fu, Changzhen; Zan, Linsen

2013-12-01

The objective of this research were to detect bovine Dickkopf 2 (DKK2) gene polymorphism and analyze their associations with body measurement traits (BMT) and meat quality traits (MQT) of animals. Blood samples were taken from a total of 541 Qinchuan cattle aged from 18 to 24 months. Polymerase chain reaction-single strand conformation polymorphism (PCR-SSCP) was employed to find out DKK2 single-polymorphism nucleotide (SNPs) and to explore their possible association with BMT and MQT. Sequence analysis of DKK2 gene revealed 2 SNPs (C29 T and A169C) in 5' untranslated region (5'UTR) of exon 1.C29T and A164T SNPs are both synonymous mutation, which showed 2 genotypes namely (CC, CT) and (AA and AC), respectively. Association analysis of polymorphism with body measurement and meat quality traits at the two locus showed that there were significant effects on CT, BL, RL, PBW, BFT, LMA, and IFC. These results suggest that the DKK2 gene might have potential effects on BMT and MQT in Qinchuan cattle population and could be used for marker-assisted selection.

Association study of ghrelin receptor gene polymorphisms in rheumatoid arthritis.

PubMed

Robledo, G; Rueda, B; Gonzalez-Gay, M A; Fernández, B; Lamas, J R; Balsa, A; Pascual-Salcedo, D; García, A; Raya, E; Martín, J

2010-01-01

Ghrelin is a newly characterised growth hormone (GH) releasing peptide widely distributed that may play an important role in the regulation of metabolic balance in inflammatory diseases such as rheumatoid arthritis (RA) by decreasing the pro-inflammatory Th1 responses. In this study we investigated the possible contribution of several polymorphisms in the functional Ghrelin receptor to RA susceptibility. A screening of 3 single nucleotide polymorphisms (SNPs) was performed in a total of 950 RA patients and 990 healthy controls of Spanish Caucasian origin. Genotyping of all 3 SNPs was performed by real-time polymerase chain reaction technology, using the TaqMan 5'-allele discrimination assay. We observed no statistically significant deviation between RA patients and controls for the GHSR SNPs analysed. In addition, we performed a haplotype analysis that did not reveal an association with RA susceptibility. The stratification analysis for the presence of shared epitope (SE), rheumatoid factor (RF) or antibodies anti cyclic citrullinated peptide (anti-CCP) did not detect significant association of the GHSR polymorphisms with RA. These findings suggest that the GHSR gene polymorphisms do not appear to play a major role in RA genetic predisposition in our population.

Genetic contributions to the association between adult height and testicular germ cell tumors.

PubMed

Cook, Michael B; Chia, Victoria M; Berndt, Sonja I; Graubard, Barry I; Chanock, Stephen J; Rubertone, Mark V; Erickson, Ralph L; Hayes, Richard B; McGlynn, Katherine A

2011-06-01

Previously, we have shown that increasing adult height is associated with increased risk of testicular germ-cell tumor (TGCT). Recently, a number of single nucleotide polymorphisms (SNPs) have been found to be related to height. We examined whether these SNPs were associated with TGCT and whether they explained the relationship between height and TGCT. We genotyped 15 height-related SNPs in the US Servicemen's Testicular Tumor Environmental and Endocrine Determinants (STEED) case-control study. DNA was extracted from buccal cell samples and Taqman assays were used to type the selected SNPs. We used logistic regression models to estimate odds ratios (ORs) and 95% confidence intervals (95%CIs). There were 561 cases and 676 controls for analysis. Two SNPs were found to be associated with risk of TGCT, rs6060373 (CC vs TT, OR = 1.51, 95% CI: 1.06-2.15) and rs143384 (CC vs TT, OR = 1.53, 95% CI: 1.09-2.15). rs6060373 is an intronic polymorphism of ubiquinol-cytochrome c reductase complex chaperone (UQCC), and rs143384 is a 5'UTR polymorphism of growth differentiation factor 5 (GDF5). No individual SNP attenuated the association between height and TGCT. Adjustment for all SNPs previously associated with adult height reduced the associations between adult height and TGCT by ~8.5%, although the P-value indicated only weak evidence that this difference was important (P = 0.26). This novel analysis provides tentative evidence that SNPs which are associated with adult height may also share an association with risk of TGCT.

Effects of GWAS-Associated Genetic Variants on lncRNAs within IBD and T1D Candidate Loci

PubMed Central

Brorsson, Caroline A.; Pociot, Flemming

2014-01-01

Long non-coding RNAs are a new class of non-coding RNAs that are at the crosshairs in many human diseases such as cancers, cardiovascular disorders, inflammatory and autoimmune disease like Inflammatory Bowel Disease (IBD) and Type 1 Diabetes (T1D). Nearly 90% of the phenotype-associated single-nucleotide polymorphisms (SNPs) identified by genome-wide association studies (GWAS) lie outside of the protein coding regions, and map to the non-coding intervals. However, the relationship between phenotype-associated loci and the non-coding regions including the long non-coding RNAs (lncRNAs) is poorly understood. Here, we systemically identified all annotated IBD and T1D loci-associated lncRNAs, and mapped nominally significant GWAS/ImmunoChip SNPs for IBD and T1D within these lncRNAs. Additionally, we identified tissue-specific cis-eQTLs, and strong linkage disequilibrium (LD) signals associated with these SNPs. We explored sequence and structure based attributes of these lncRNAs, and also predicted the structural effects of mapped SNPs within them. We also identified lncRNAs in IBD and T1D that are under recent positive selection. Our analysis identified putative lncRNA secondary structure-disruptive SNPs within and in close proximity (+/−5 kb flanking regions) of IBD and T1D loci-associated candidate genes, suggesting that these RNA conformation-altering polymorphisms might be associated with diseased-phenotype. Disruption of lncRNA secondary structure due to presence of GWAS SNPs provides valuable information that could be potentially useful for future structure-function studies on lncRNAs. PMID:25144376

A genetic variant in SLC28A3, rs56350726, is associated with progression to castration-resistant prostate cancer in a Korean population with metastatic prostate cancer.

PubMed

Jo, Jung Ku; Oh, Jong Jin; Kim, Yong Tae; Moon, Hong Sang; Choi, Hong Yong; Park, Seunghyun; Ho, Jin-Nyoung; Yoon, Sungroh; Park, Hae Young; Byun, Seok-Soo

2017-11-14

Genetic variation which related with progression to castration-resistant prostate cancer (CRPC) during androgen-deprivation therapy (ADT) has not been elucidated in patients with metastatic prostate cancer (mPCa). Therefore, we assessed the association between genetic variats in mPCa and progession to CRPC. Analysis of exome genotypes revealed that 42 SNPs were significantly associated with mPCa. The top five polymorphisms were statistically significantly associated with metastatic disease. In addition, one of these SNPs, rs56350726, was significantly associated with time to CRPC in Kaplan-Meier analysis (Log-rank test, p = 0.011). In multivariable Cox regression, rs56350726 was strongly associated with progression to CRPC (HR = 4.172 95% CI = 1.223-14.239, p = 0.023). We assessed genetic variation among 1000 patients with PCa with or without metastasis, using 242,221 single nucleotide polymorphisms (SNPs) on the custom HumanExome BeadChip v1.0 (Illuminam Inc.). We analyzed the time to CRPC in 110 of the 1000 patients who were treated with ADT. Genetic data were analyzed using unconditional logistic regression and odds ratios calculated as estimates of relative risk of metastasis. We identified SNPs associated with metastasis and analyzed the relationship between these SNPs and time to CRPC in mPCa. Based on a genetic variation, the five top SNPs were observed to associate with mPCa. And one (SLC28A3, rs56350726) of five SNP was found the association with the progression to CRPC in patients with mPCa.

Genome-wide DNA polymorphisms in Kavuni, a traditional rice cultivar with nutritional and therapeutic properties.

PubMed

Rathinasabapathi, Pasupathi; Purushothaman, Natarajan; Parani, Madasamy

2016-05-01

Although rice genome was sequenced in the year 2002, efforts in resequencing the large number of available accessions, landraces, traditional cultivars, and improved varieties of this important food crop are limited. We have initiated resequencing of the traditional cultivars from India. Kavuni is an important traditional rice cultivar from South India that attracts premium price for its nutritional and therapeutic properties. Whole-genome sequencing of Kavuni using Illumina platform and SNPs analysis using Nipponbare reference genome identified 1 150 711 SNPs of which 377 381 SNPs were located in the genic regions. Non-synonymous SNPs (62 708) were distributed in 19 251 genes, and their number varied between 1 and 115 per gene. Large-effect DNA polymorphisms (7769) were present in 3475 genes. Pathway mapping of these polymorphisms revealed the involvement of genes related to carbohydrate metabolism, translation, protein-folding, and cell death. Analysis of the starch biosynthesis related genes revealed that the granule-bound starch synthase I gene had T/G SNPs at the first intron/exon junction and a two-nucleotide combination, which were reported to favour high amylose content and low glycemic index. The present study provided a valuable genomics resource to study the rice varieties with nutritional and medicinal properties.

Possible association of VISA gene polymorphisms with susceptibility to systemic lupus erythematosus in Chinese population.

PubMed

Liu, Xiaowen; Jiao, Yulian; Wen, Xin; Wang, Laicheng; Ma, Chunyan; Gao, Xuejun; Chen, Zi-Jiang; Zhao, Yueran

2011-10-01

Virus-induced signaling adapter (VISA), an important adaptor protein linking both RIG-I and MDA-5 to downstream signaling events, may mediates the activation of NF kappaB and IRFs and the induction of type I IFN. As the evidence has showed that Toll-like receptors (TLRs), I-IFN and IFN-inducible genes contribute to the pathogenesis of systemic lupus erythematosus (SLE), the aim of the current study was to investigate the possible associations between the VISA gene and SLE. Four single nucleotide polymorphisms (SNPs), rs17857295, rs2326369, rs7262903, and rs7269320, in VISA gene were genotyped in 123 SLE patients and 95 healthy controls. Genotyping was performed using direct sequencing the purified PCR products. Associations were analyzed by using the chi-square test and Fisher's exact test. Haplotype analysis was performed using haploview and PHASE2.1. None of the four SNPs was found to be associated with SLE. The four-SNPs haplotype analysis showed different effect between cases and controls. While the SNPs, rs17857295 and rs2326369, were found to be associated with the renal nephritis and arthritis of SLE patient, respectively. The SNPs rs7269320 showed associations with different manifestations. Our data reveal that polymorphisms in the VISA gene may be related to disease susceptibility and manifestations of SLE.

Genetic Variation in FABP4 and Evaluation of Its Effects on Beef Cattle Fat Content.

PubMed

Goszczynski, Daniel E; Papaleo-Mazzucco, Juliana; Ripoli, María V; Villarreal, Edgardo L; Rogberg-Muñoz, Andrés; Mezzadra, Carlos A; Melucci, Lilia M; Giovambattista, Guillermo

2017-07-03

FABP4 is a protein primarily expressed in adipocytes and macrophages that plays a key role in fatty acid trafficking and lipid hydrolysis. FABP4 gene polymorphisms have been associated with meat quality traits in cattle, mostly in Asian breeds under feedlot conditions. The objectives of this work were to characterize FABP4 genetic variation in several worldwide cattle breeds and evaluate possible genotype effects on fat content in a pasture-fed crossbred (Angus-Hereford-Limousin) population. We re-sequenced 43 unrelated animals from nine cattle breeds (Angus, Brahman, Creole, Hereford, Holstein, Limousin, Nelore, Shorthorn, and Wagyu) and obtained 22 single nucleotide polymorphisms (SNPs) over 3,164 bp, including four novel polymorphisms. Haplotypes and linkage disequilibrium analyses showed a high variability. Five SNPs were selected to perform validation and association studies in our crossbred population. Four SNPs showed well-balanced allele frequencies (minor frequency > 0.159), and three showed no significant deviations from Hardy-Weinberg proportions. SNPs showed significant effects on backfat thickness and fatty acid composition (P < 0.05). The protein structure of one of the missense SNPs was analyzed to elucidate its possible effect on fat content in our studied population. Our results revealed a possible blockage of the fatty acid binding site by the missense mutation.

Polymorphisms in the Tlr4 and Tlr5 Gene Are Significantly Associated with Inflammatory Bowel Disease in German Shepherd Dogs

PubMed Central

Kathrani, Aarti; House, Arthur; Catchpole, Brian; Murphy, Angela; German, Alex; Werling, Dirk; Allenspach, Karin

2010-01-01

Inflammatory bowel disease (IBD) is considered to be the most common cause of vomiting and diarrhoea in dogs, and the German shepherd dog (GSD) is particularly susceptible. The exact aetiology of IBD is unknown, however associations have been identified between specific single-nucleotide polymorphisms (SNPs) in Toll-like receptors (TLRs) and human IBD. However, to date, no genetic studies have been undertaken in canine IBD. The aim of this study was to investigate whether polymorphisms in canine TLR 2, 4 and 5 genes are associated with IBD in GSDs. Mutational analysis of TLR2, TLR4 and TLR5 was performed in 10 unrelated GSDs with IBD. Four non-synonymous SNPs (T23C, G1039A, A1571T and G1807A) were identified in the TLR4 gene, and three non-synonymous SNPs (G22A, C100T and T1844C) were identified in the TLR5 gene. The non-synonymous SNPs identified in TLR4 and TLR5 were evaluated further in a case-control study using a SNaPSHOT multiplex reaction. Sequencing information from 55 unrelated GSDs with IBD were compared to a control group consisting of 61 unrelated GSDs. The G22A SNP in TLR5 was significantly associated with IBD in GSDs, whereas the remaining two SNPs were found to be significantly protective for IBD. Furthermore, the two SNPs in TLR4 (A1571T and G1807A) were in complete linkage disequilibrium, and were also significantly associated with IBD. The TLR5 risk haplotype (ACC) without the two associated TLR4 SNP alleles was significantly associated with IBD, however the presence of the two TLR4 SNP risk alleles without the TLR5 risk haplotype was not statistically associated with IBD. Our study suggests that the three TLR5 SNPs and two TLR4 SNPs; A1571T and G1807A could play a role in the pathogenesis of IBD in GSDs. Further studies are required to confirm the functional importance of these polymorphisms in the pathogenesis of this disease. PMID:21203467

Polymorphisms in the TLR4 and TLR5 gene are significantly associated with inflammatory bowel disease in German shepherd dogs.

PubMed

Kathrani, Aarti; House, Arthur; Catchpole, Brian; Murphy, Angela; German, Alex; Werling, Dirk; Allenspach, Karin

2010-12-23

Inflammatory bowel disease (IBD) is considered to be the most common cause of vomiting and diarrhoea in dogs, and the German shepherd dog (GSD) is particularly susceptible. The exact aetiology of IBD is unknown, however associations have been identified between specific single-nucleotide polymorphisms (SNPs) in Toll-like receptors (TLRs) and human IBD. However, to date, no genetic studies have been undertaken in canine IBD. The aim of this study was to investigate whether polymorphisms in canine TLR 2, 4 and 5 genes are associated with IBD in GSDs. Mutational analysis of TLR2, TLR4 and TLR5 was performed in 10 unrelated GSDs with IBD. Four non-synonymous SNPs (T23C, G1039A, A1571T and G1807A) were identified in the TLR4 gene, and three non-synonymous SNPs (G22A, C100T and T1844C) were identified in the TLR5 gene. The non-synonymous SNPs identified in TLR4 and TLR5 were evaluated further in a case-control study using a SNaPSHOT multiplex reaction. Sequencing information from 55 unrelated GSDs with IBD were compared to a control group consisting of 61 unrelated GSDs. The G22A SNP in TLR5 was significantly associated with IBD in GSDs, whereas the remaining two SNPs were found to be significantly protective for IBD. Furthermore, the two SNPs in TLR4 (A1571T and G1807A) were in complete linkage disequilibrium, and were also significantly associated with IBD. The TLR5 risk haplotype (ACC) without the two associated TLR4 SNP alleles was significantly associated with IBD, however the presence of the two TLR4 SNP risk alleles without the TLR5 risk haplotype was not statistically associated with IBD. Our study suggests that the three TLR5 SNPs and two TLR4 SNPs; A1571T and G1807A could play a role in the pathogenesis of IBD in GSDs. Further studies are required to confirm the functional importance of these polymorphisms in the pathogenesis of this disease.

Large Scale Single Nucleotide Polymorphism Study of PD Susceptibility

DTIC Science & Technology

2006-03-01

familial PD, the results of intensive investigations of polymorphisms in dozens of genes related to sporadic, late onset, typical PD have not shown...association between classical, sporadic PD and 2386 SNPs in 23 genes implicated in the pathogenesis of PD; (2) construct haplotypes based on the SNP...derived from this study may be applied in other complex disorders for the identification of susceptibility genes , as well as in genome-wide SNP

Data on polymorphisms in CYP2A6 associated to risk and predispose to smoking related variables.

PubMed

López-Flores, Luis A; Pérez-Rubio, Gloria; Ramírez-Venegas, Alejandra; Ambrocio-Ortiz, Enrique; Sansores, Raúl H; Falfán-Valencia, Ramcés

2017-12-01

This article contains data on the single nucleotide polymorphisms (SNPs) rs1137115, rs1801272 and rs28399433 rs4105144 in CYP2A6 associated to smoking related variables in Mexican Mestizo smokers (Pérez-Rubio et al., 2017) [1]. These SNPs were selected due to previous associations with other populations. Mexican Mestizo smokers were classified according their smoking pattern. A genetic association test was performed.

Association of Cytokine Candidate Genes with Severity of Pain and Co-Occurring Symptoms in Breast Cancer Patients Receiving Chemotherapy

DTIC Science & Technology

2013-10-01

identify common genetic variations (i.e., single nucleotide polymorphisms [ SNPs ] and haplotypes) in cytokine genes, as well demographic, clinical, and...Center. The purpose of the proposed project is to identify common genetic variations (i.e., single nucleotide polymorphisms [ SNPs ] and haplotypes) in...research team continues to meet monthly to discuss progress with regards to recruitment, enrollment, and data collection. Training in Genetics In year

Single nucleotide polymorphisms associated with coronary heart disease predict incident ischemic stroke in the atherosclerosis risk in communities study.

PubMed

Morrison, Alanna C; Bare, Lance A; Luke, May M; Pankow, James S; Mosley, Thomas H; Devlin, James J; Willerson, James T; Boerwinkle, Eric

2008-01-01

Ischemic stroke and coronary heart disease (CHD) may share genetic factors contributing to a common etiology. This study investigates whether 51 single nucleotide polymorphisms (SNPs) associated with CHD in multiple antecedent studies are associated with incident ischemic stroke in the Atherosclerosis Risk in Communities (ARIC) study. From the multiethnic ARIC cohort of 14,215 individuals, 495 validated ischemic strokes were identified. Cox proportional hazards models, adjusted for age and gender, identified three SNPs in Whites and two SNPs in Blacks associated with incident stroke (p

Linkage disequilibrium and signatures of positive selection around LINE-1 retrotransposons in the human genome.

PubMed

Kuhn, Alexandre; Ong, Yao Min; Cheng, Ching-Yu; Wong, Tien Yin; Quake, Stephen R; Burkholder, William F

2014-06-03

Insertions of the human-specific subfamily of LINE-1 (L1) retrotransposon are highly polymorphic across individuals and can critically influence the human transcriptome. We hypothesized that L1 insertions could represent genetic variants determining important human phenotypic traits, and performed an integrated analysis of L1 elements and single nucleotide polymorphisms (SNPs) in several human populations. We found that a large fraction of L1s were in high linkage disequilibrium with their surrounding genomic regions and that they were well tagged by SNPs. However, L1 variants were only partially captured by SNPs on standard SNP arrays, so that their potential phenotypic impact would be frequently missed by SNP array-based genome-wide association studies. We next identified potential phenotypic effects of L1s by looking for signatures of natural selection linked to L1 insertions; significant extended haplotype homozygosity was detected around several L1 insertions. This finding suggests that some of these L1 insertions may have been the target of recent positive selection.

Association study between single nucleotide polymorphisms in promoter region of AVPR1A and Korean autism spectrum disorders.

PubMed

Yang, So Young; Cho, Soo-Churl; Yoo, Hee Jeong; Cho, In Hee; Park, Mira; Kim, Boong-Nyun; Kim, Jae-Won; Shin, Min-Sup; Park, Tae-Won; Son, Jung-Woo; Chung, Un-Sun; Kim, Hyo-Won; Yang, Young-Hui; Kang, Je-Ouk; Kim, Soon Ae

2010-08-02

To determine the association between arginine vasopressin receptor 1A gene (AVPR1A) and autism spectrum disorders (ASDs), we examined 3 single nucleotide polymorphisms (SNPs), namely, rs7294536, rs3759292, and rs10877969, in the promoter region of AVPR1A by using a family-based association test (FBAT) in 151 Korean trios. Our results demonstrated a statistically significant association between autism and SNPs (additive model: rs7294536, chi(2)=9.328, df=2, P=0.002; rs10877969, chi(2)=11.529, df=2, P<0.001) as well as between autism and haplotype analysis (additive model: chi(2)=14.122, df=3, P=0.003). In addition, we found that ADI-R scores calculated by using a diagnostic algorithm for failure to develop peer relationships (A2) were higher in subjects having the AA genotype than in subjects having the AG and GG genotypes of rs7294536. Thus, our study provides evidence for a possible association between these SNPs and the phenotype of ASDs. Copyright 2010 Elsevier Ireland Ltd. All rights reserved.

The single-nucleotide polymorphisms in CHD5 affect the prognosis of patients with hepatocellular carcinoma

PubMed Central

Zhu, Xiao; Kong, Qingming; Xie, Liwei; Chen, Zhihong; Li, Hongmei; Zhu, Zhu; Huang, Yongmei; Lan, Feifei; Luo, Haiqing; Zhan, Jingting; Ding, Hongrong; Lei, Jinli; Xiao, Qin; Fu, Weiming; Fan, Wenguo; Zhang, Jinfang; Luo, Hui

2018-01-01

Previous studies showed that the low expressions of chromodomain-helicase-DNA-binding protein 5 (CHD5) were intensively associated with deteriorative biologic and clinical characteristics as well as outcomes in many tumors. The aim of this study is to determine whether CHD5 single nucleotide polymorphisms (SNPs) contribute to the prognosis of hepatocellular carcima (HCC). The SNPs were selected according to their linkage disequilibrium (LD) in the targeted next-generation sequencing (NGS) and then genotyped with TaqMan probers. We revealed a rare haplotype AG in CHD5 (SNPs: rs12564469-rs9434711) was markedly associated with HCC prognosis. The univariate and multivariate regression analyses revealed the patients with worse overall survival time were those with tumor metastasis and haplotype AG, as well as cirrhosis, poor differentiation and IV-TNM stage. Based on the available public databases, we discovered the significant association between haplotype AG and CHD5 mRNA expressions only existed in Chinese. These data proposed that the potentially genetic haplotype might functionally contribute to HCC prognosis and CHD5 mRNA expressions. PMID:29568352

An abbreviated SNP panel for ancestry assignment of honeybees (Apis mellifera)

USDA-ARS?s Scientific Manuscript database

This paper examines whether an abbreviated panel of 37 single nucleotide polymorphisms (SNPs) has the same power as a larger and more expensive panel of 95 SNPs to assign ancestry of honeybees (Apis mellifera) to three ancestral lineages. We selected 37 SNPs from the original 95 SNP panel using alle...

Genetic diversity of tyrosine hydroxylase (TH) and dopamine β-hydroxylase (DBH) genes in cattle breeds

PubMed Central

Lourenco-Jaramillo, Diana Lelidett; Sifuentes-Rincón, Ana María; Parra-Bracamonte, Gaspar Manuel; de la Rosa-Reyna, Xochitl Fabiola; Segura-Cabrera, Aldo; Arellano-Vera, Williams

2012-01-01

DNA from four cattle breeds was used to re-sequence all of the exons and 56% of the introns of the bovine tyrosine hydroxylase (TH) gene and 97% and 13% of the bovine dopamine β-hydroxylase (DBH) coding and non-coding sequences, respectively. Two novel single nucleotide polymorphisms (SNPs) and a microsatellite motif were found in the TH sequences. The DBH sequences contained 62 nucleotide changes, including eight non-synonymous SNPs (nsSNPs) that are of particular interest because they may alter protein function and therefore affect the phenotype. These DBH nsSNPs resulted in amino acid substitutions that were predicted to destabilize the protein structure. Six SNPs (one from TH and five from DBH non-synonymous SNPs) were genotyped in 140 animals; all of them were polymorphic and had a minor allele frequency of > 9%. There were significant differences in the intra- and inter-population haplotype distributions. The haplotype differences between Brahman cattle and the three B. t. taurus breeds (Charolais, Holstein and Lidia) were interesting from a behavioural point of view because of the differences in temperament between these breeds. PMID:22888292

Dextromethorphan and debrisoquine metabolism and polymorphism of the gene for cytochrome P450 isozyme 2D50 in Thoroughbreds.

PubMed

Corado, Carley R; McKemie, Daniel S; Knych, Heather K

2016-09-01

OBJECTIVE To characterize polymorphisms of the gene for cytochrome P450 isozyme 2D50 (CYP2D50) and the disposition of 2 CYP2D50 probe drugs, dextromethorphan and debrisoquine, in horses. ANIMALS 23 healthy horses (22 Thoroughbreds and 1 Standardbred). PROCEDURES Single-nucleotide polymorphisms (SNPs) in CYP2D50 were identified. Disposition of dextromethorphan (2 mg/kg) and debrisoquine (0.2 mg/kg) were determined after oral (dextromethorphan) or nasogastric (debrisoquine) administration to the horses. Metabolic ratios of plasma dextromethorphan and total dextrorphan (dextrorphan plus dextrorphan-O-β-glucuronide) and 4-hydroxydebrisoquine concentrations were calculated on the basis of the area under the plasma concentration-versus-time curve extrapolated to infinity for the parent drug divided by that for the corresponding metabolite. Pharmacokinetic data were used to categorize horses into the phenotypic drug-metabolism categories poor, extensive, and ultrarapid. Disposition patterns were compared among categories, and relationships between SNPs and metabolism categories were explored. RESULTS Gene sequencing identified 51 SNPs, including 27 nonsynonymous SNPs. Debrisoquine was minimally detected after oral administration. Disposition of dextromethorphan varied markedly among horses. Metabolic ratios for dextromethorphan ranged from 0.03 to 0.46 (mean, 0.12). On the basis of these data, 1 horse was characterized as a poor metabolizer, 18 were characterized as extensive metabolizers, and 3 were characterized as ultrarapid metabolizers. CONCLUSIONS AND CLINICAL RELEVANCE Findings suggested that CYP2D50 is polymorphic and that the disposition of the probe drug varies markedly in horses. The polymorphisms may be related to rates of drug metabolism. Additional research involving more horses of various breeds is needed to fully explore the functional implication of polymorphisms in CYP2D50.

No association of dynamin binding protein (DNMBP) gene SNPs and Alzheimer's disease.

PubMed

Minster, Ryan L; DeKosky, Steven T; Kamboh, M Ilyas

2008-10-01

A recent scan of single nucleotide polymorphisms (SNPs) on chromosome 10q found significant association of six correlated SNPs with late-onset Alzheimer's disease (AD) among Japanese. We examined the SNP with the highest statistical significance (rs3740058) in a large Caucasian American case-control cohort and the remaining five SNPs in a smaller subset of cases and controls. We observed no association of statistical significance in either the total sample or the APOE*4 non-carriers for any of the SNPs.

CLUSTAG: hierarchical clustering and graph methods for selecting tag SNPs.

PubMed

Ao, S I; Yip, Kevin; Ng, Michael; Cheung, David; Fong, Pui-Yee; Melhado, Ian; Sham, Pak C

2005-04-15

Cluster and set-cover algorithms are developed to obtain a set of tag single nucleotide polymorphisms (SNPs) that can represent all the known SNPs in a chromosomal region, subject to the constraint that all SNPs must have a squared correlation R2>C with at least one tag SNP, where C is specified by the user. http://hkumath.hku.hk/web/link/CLUSTAG/CLUSTAG.html mng@maths.hku.hk.

Developing a new nonbinary SNP fluorescent multiplex detection system for forensic application in China.

PubMed

Liu, Yanfang; Liao, Huidan; Liu, Ying; Guo, Juanjuan; Sun, Yi; Fu, Xiaoliang; Xiao, Ding; Cai, Jifeng; Lan, Lingmei; Xie, Pingli; Zha, Lagabaiyila

2017-04-01

Nonbinary single-nucleotide polymorphisms (SNPs) are potential forensic genetic markers because their discrimination power is greater than that of normal binary SNPs, and that they can detect highly degraded samples. We previously developed a nonbinary SNP multiplex typing assay. In this study, we selected additional 20 nonbinary SNPs from the NCBI SNP database and verified them through pyrosequencing. These 20 nonbinary SNPs were analyzed using the fluorescent-labeled SNaPshot multiplex SNP typing method. The allele frequencies and genetic parameters of these 20 nonbinary SNPs were determined among 314 unrelated individuals from Han populations from China. The total power of discrimination was 0.9999999999994, and the cumulative probability of exclusion was 0.9986. Moreover, the result of the combination of this 20 nonbinary SNP assay with the 20 nonbinary SNP assay we previously developed demonstrated that the cumulative probability of exclusion of the 40 nonbinary SNPs was 0.999991 and that no significant linkage disequilibrium was observed in all 40 nonbinary SNPs. Thus, we concluded that this new system consisting of new 20 nonbinary SNPs could provide highly informative polymorphic data which would be further used in forensic application and would serve as a potentially valuable supplement to forensic DNA analysis. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Top single nucleotide polymorphisms affecting carbohydrate metabolism in metabolic syndrome: from the LIPGENE study.

PubMed

Delgado-Lista, Javier; Perez-Martinez, Pablo; Solivera, Juan; Garcia-Rios, Antonio; Perez-Caballero, A I; Lovegrove, Julie A; Drevon, Christian A; Defoort, Catherine; Blaak, Ellen E; Dembinska-Kieć, Aldona; Risérus, Ulf; Herruzo-Gomez, Ezequiel; Camargo, Antonio; Ordovas, Jose M; Roche, Helen; Lopez-Miranda, José

2014-02-01

Metabolic syndrome (MetS) is a high-prevalence condition characterized by altered energy metabolism, insulin resistance, and elevated cardiovascular risk. Although many individual single nucleotide polymorphisms (SNPs) have been linked to certain MetS features, there are few studies analyzing the influence of SNPs on carbohydrate metabolism in MetS. A total of 904 SNPs (tag SNPs and functional SNPs) were tested for influence on 8 fasting and dynamic markers of carbohydrate metabolism, by performance of an intravenous glucose tolerance test in 450 participants in the LIPGENE study. From 382 initial gene-phenotype associations between SNPs and any phenotypic variables, 61 (16% of the preselected variables) remained significant after bootstrapping. Top SNPs affecting glucose metabolism variables were as follows: fasting glucose, rs26125 (PPARGC1B); fasting insulin, rs4759277 (LRP1); C-peptide, rs4759277 (LRP1); homeostasis assessment of insulin resistance, rs4759277 (LRP1); quantitative insulin sensitivity check index, rs184003 (AGER); sensitivity index, rs7301876 (ABCC9), acute insulin response to glucose, rs290481 (TCF7L2); and disposition index, rs12691 (CEBPA). We describe here the top SNPs linked to phenotypic features in carbohydrate metabolism among approximately 1000 candidate gene variations in fasting and postprandial samples of 450 patients with MetS from the LIPGENE study.

Association Study of Genes Controlling IL-12-dependent IFN-γ Immunity: STAT4 Alleles Increase Risk of Pulmonary Tuberculosis in Morocco

PubMed Central

Sabri, Ayoub; Grant, Audrey V.; Cosker, Kristel; El Azbaoui, Safa; Abid, Ahmed; Abderrahmani Rhorfi, Ismail; Souhi, Hicham; Janah, Hicham; Alaoui-Tahiri, Kebir; Gharbaoui, Yasser; Benkirane, Majid; Orlova, Marianna; Boland, Anne; Deswarte, Caroline; Migaud, Melanie; Bustamante, Jacinta; Schurr, Erwin; Boisson-Dupuis, Stephanie; Casanova, Jean-Laurent; Abel, Laurent; El Baghdadi, Jamila

2014-01-01

Background. Only a minority of individuals infected with Mycobacterium tuberculosis develop clinical tuberculosis. Genetic epidemiological evidence suggests that pulmonary tuberculosis has a strong human genetic component. Previous genetic findings in Mendelian predisposition to more severe mycobacterial infections, including by M. tuberculosis, underlined the importance of the interleukin 12 (IL-12)/interferon γ (IFN-γ) circuit in antimycobacterial immunity. Methods. We conducted an association study in Morocco between pulmonary tuberculosis and a panel of single-nucleotide polymorphisms (SNPs) covering 14 core IL-12/IFN-γ circuit genes. The analyses were performed in a discovery family-based sample followed by replication in a case-control population. Results. Out of 228 SNPs tested in the family-based sample, 6 STAT4 SNPs were associated with pulmonary tuberculosis (P = .0013–.01). We replicated the same direction of association for 1 cluster of 3 SNPs encompassing the promoter region of STAT4. In the combined sample, the association was stronger among younger subjects (pulmonary tuberculosis onset <25 years) with an odds ratio of developing pulmonary tuberculosis at rs897200 for GG vs AG/AA subjects of 1.47 (1.06–2.04). Previous functional experiments showed that the G allele of rs897200 was associated with lower STAT4 expression. Conclusions. Our present findings in a Moroccan population support an association of pulmonary tuberculosis with STAT4 promoter-region polymorphisms that may impact STAT4 expression. PMID:24610875

Single nucleotide polymorphism discovery in bovine liver using RNA-seq technology.

PubMed

Pareek, Chandra Shekhar; Błaszczyk, Paweł; Dziuba, Piotr; Czarnik, Urszula; Fraser, Leyland; Sobiech, Przemysław; Pierzchała, Mariusz; Feng, Yaping; Kadarmideen, Haja N; Kumar, Dibyendu

2017-01-01

RNA-seq is a useful next-generation sequencing (NGS) technology that has been widely used to understand mammalian transcriptome architecture and function. In this study, a breed-specific RNA-seq experiment was utilized to detect putative single nucleotide polymorphisms (SNPs) in liver tissue of young bulls of the Polish Red, Polish Holstein-Friesian (HF) and Hereford breeds, and to understand the genomic variation in the three cattle breeds that may reflect differences in production traits. The RNA-seq experiment on bovine liver produced 107,114,4072 raw paired-end reads, with an average of approximately 60 million paired-end reads per library. Breed-wise, a total of 345.06, 290.04 and 436.03 million paired-end reads were obtained from the Polish Red, Polish HF, and Hereford breeds, respectively. Burrows-Wheeler Aligner (BWA) read alignments showed that 81.35%, 82.81% and 84.21% of the mapped sequencing reads were properly paired to the Polish Red, Polish HF, and Hereford breeds, respectively. This study identified 5,641,401 SNPs and insertion and deletion (indel) positions expressed in the bovine liver with an average of 313,411 SNPs and indel per young bull. Following the removal of the indel mutations, a total of 195,3804, 152,7120 and 205,3184 raw SNPs expressed in bovine liver were identified for the Polish Red, Polish HF, and Hereford breeds, respectively. Breed-wise, three highly reliable breed-specific SNP-databases (SNP-dbs) with 31,562, 24,945 and 28,194 SNP records were constructed for the Polish Red, Polish HF, and Hereford breeds, respectively. Using a combination of stringent parameters of a minimum depth of ≥10 mapping reads that support the polymorphic nucleotide base and 100% SNP ratio, 4,368, 3,780 and 3,800 SNP records were detected in the Polish Red, Polish HF, and Hereford breeds, respectively. The SNP detections using RNA-seq data were successfully validated by kompetitive allele-specific PCR (KASPTM) SNP genotyping assay. The comprehensive QTL/CG analysis of 110 QTL/CG with RNA-seq data identified 20 monomorphic SNP hit loci (CARTPT, GAD1, GDF5, GHRH, GHRL, GRB10, IGFBPL1, IGFL1, LEP, LHX4, MC4R, MSTN, NKAIN1, PLAG1, POU1F1, SDR16C5, SH2B2, TOX, UCP3 and WNT10B) in all three cattle breeds. However, six SNP loci (CCSER1, GHR, KCNIP4, MTSS1, EGFR and NSMCE2) were identified as highly polymorphic among the cattle breeds. This study identified breed-specific SNPs with greater SNP ratio and excellent mapping coverage, as well as monomorphic and highly polymorphic putative SNP loci within QTL/CGs of bovine liver tissue. A breed-specific SNP-db constructed for bovine liver yielded nearly six million SNPs. In addition, a KASPTM SNP genotyping assay, as a reliable cost-effective method, successfully validated the breed-specific putative SNPs originating from the RNA-seq experiments.

Association Between Genes Involved in Craniofacial Development and Nonsyndromic Cleft Lip and/or Palate in the Brazilian Population.

PubMed

Machado, Renato Assis; Messetti, Ana Camila; de Aquino, Sibele Nascimento; Martelli-Júnior, Hercílio; Swerts, Mário Sérgio Oliveira; de Almeida Reis, Silvia Regina; Moreira, Helenara Salvati Bertolossi; Persuhn, Darlene Camati; Coletta, Ricardo D

2016-09-01

To determine the association of single-nucleotide polymorphisms (SNPs) in genes related to craniofacial development, which were previously identified as susceptibility signals for nonsyndromic oral clefts, in Brazilians with nonsyndromic cleft lip and/or palate (NSCL/P). The SNPs rs748044 (TNP1), rs1106514 (MSX1), rs28372960, rs15251 and rs2569062 (TCOF1), rs7829058 (FGFR1), rs1793949 (COL2A1), rs11653738 (WNT3), and rs242082 (TIMP3) were assessed in a family-based transmission disequilibrium test (TDT) and a structured case-control analysis based on the individual ancestry proportions. The SNPs were initially analyzed by TDT, and polymorphisms showing a trend toward excess transmission were subsequently studied in an independent case-control sample. The study sample consisted of 189 case-parent trios of nonsyndromic cleft lip with or without cleft palate (NSCL±P), 107 case-parent trios of nonsyndromic cleft palate (NSCP), 318 isolated samples of NSCL±P, 189 isolated samples of NSCP, and 599 healthy controls. Association of alleles with NSCL/P pathogenesis. Preferential transmission of SNPs rs28372960 and rs7829058 in NSCL±P trios and rs11653738 in NSCP trios (P = .04) were observed, although the structured case-control analysis did not confirm these associations. The haplotype T-C-C formed by TCOF1 SNPs rs28372960, rs15251, and rs2569062 was more frequently transmitted from healthy parents to NSCL±P offspring, but the P value (P = .01) did not withstand Bonferroni correction for multiple tests. With the modest associations, our results do not support the hypothesis that TNP1, MSX1, TCOF1, FGFR1, COL2A1, WNT3, and TIMP3 variants are risk factors for nonsyndromic oral clefts in the Brazilian population.

Identification and prioritization of NUAK1 and PPP1CC as positional candidate loci for skeletal muscle strength phenotypes

PubMed Central

Windelinckx, An; De Mars, Gunther; Huygens, Wim; Peeters, Maarten W.; Vincent, Barbara; Wijmenga, Cisca; Lambrechts, Diether; Aerssens, Jeroen; Vlietinck, Robert; Beunen, Gaston

2011-01-01

Muscle strength is an important determinant in elite sports performance as well as in the activities of daily living. Muscle metabolism also plays a role in the genesis, and therefore prevention, of common pathological conditions and chronic diseases. Even though heritability estimates between 31 and 78% suggest a significant genetic component in muscle strength, only a limited number of genes influencing muscle strength have been identified. This study aimed to identify and prioritize positional candidate genes within a skeletal muscle strength quantitative trait locus on chromosome 12q22-23 for follow-up. A two-staged gene-centered fine-mapping approach using 122 single nucleotide polymorphisms (SNPs) in stage 1 identified a familybased association (n = 500) between several tagSNPs located in the ATPase, Ca2+ transporting, cardiac muscle, slow twitch 2 (ATP2A2; rs3026468), the NUAK family, SNF1-like kinase, 1 (NUAK1; rs10861553 and rs3741886), and the protein phosphatase 1, catalytic subunit, gamma isoform (PPP1CC; rs1050587 and rs7901769) genes and knee torque production (P values up to 0.00092). In stage 2, family-based association tests on additional putatively functional SNPs (e.g., exonic SNPs, SNPs in transcription factor binding sites or in conserved regions) in an enlarged sample (n = 536; 464 individuals overlap with stage 1) did not identify additional associations with muscle strength characteristics. Further in-depth analyses will be necessary to elucidate the exact role of ATP2A2, PPP1CC, and NUAK1 in muscle strength and to find out which functional polymorphisms are at the base of the interindividual strength differences. PMID:21750233

Genetic variants of ADAM33 are associated with asthma susceptibility in the Punjabi population of Pakistan.

PubMed

Sabar, Muhammad Farooq; Ghani, Muhammad Usman; Shahid, Mariam; Sumrin, Aleena; Ali, Amjad; Akram, Muhammad; Tariq, Muhammad Akram; Bano, Iqbal

2016-01-01

A disintegrin and metalloproteinase 33 (ADAM33) gene has been considered as an asthma susceptibility gene due to its possible role in airway remodeling, abnormal cell proliferation, and differentiation. Association of this gene with asthma has been reported in several genetic studies on various populations. The current study aims to evaluate the association of ADAM33 gene polymorphisms with the risk of asthma in the Punjabi population of Pakistan. A total of 101 asthma patients and 102 age-matched healthy controls from Lahore, a city in Punjab, were recruited. ADAM33 single nucleotide polymorphisms (SNPs) T + 1[rs2280089], T2[rs2280090], T1[rs2280091], ST + 5[rs597980], ST + 4[rs44707], S2[rs528557], Q - 1[rs612709], and F + 1[rs511898] were genotyped in both patients and controls using single base extension and capillary electrophoresis-based genetic analyzer. The basic allelic and genotypic model was analyzed for association of the SNPs with asthma using SHEsis software. Haploview software was used to calculate pairwise linkage disequilibrium (LD) among six of the genotyped SNPs. Of the 8 SNPs genotyped, only S2[rs528557] showed significant association with asthma (Allele p = 0.0189, Genotype p = 0.021). SNPs T + 1[rs2280089], T2[rs2280090], T1[rs2280091], ST + 4[rs44707], S2[rs528557], and Q - 1[rs612709] were found to be in moderate to strong LD. The significantly higher frequency of haplotype "AAGTCG" in healthy controls suggests a protective effect against asthma risk in the studied population (p = 0.0059). These findings suggest that genetic variants of ADAM33 gene may play important roles in asthma susceptibility in the Punjabi population of Pakistan.

SNCA polymorphisms, smoking, and sporadic Parkinson's disease in Japanese.

PubMed

Miyake, Yoshihiro; Tanaka, Keiko; Fukushima, Wakaba; Kiyohara, Chikako; Sasaki, Satoshi; Tsuboi, Yoshio; Yamada, Tatsuo; Oeda, Tomoko; Shimada, Hiroyuki; Kawamura, Nobutoshi; Sakae, Nobutaka; Fukuyama, Hidenao; Hirota, Yoshio; Nagai, Masaki

2012-06-01

Several case-control studies and genome-wide association studies have examined the relationships between single nucleotide polymorphisms (SNPs) in the SNCA gene and Parkinson's disease (PD), and have provided inconsistent results. We investigated the relationships between SNPs rs356229, rs356219, rs356220, rs7684318, and rs2736990 and the risk of sporadic PD in Japan using data from a multicenter hospital-based case-control study. Included were 229 cases within 6 years of onset of PD as defined according to the UK PD Society Brain Bank clinical diagnostic criteria. Controls were 357 inpatients and outpatients without neurodegenerative disease. Adjustment was made for sex, age, region of residence, and smoking. Based on the recessive model, compared with subjects with the CC or CT genotype of SNP rs356220, those with the TT genotype had a significantly increased risk of sporadic PD: the adjusted OR was 1.42 (95% CI: 1.002-2.02). In the additive model, SNP rs2736990 was significantly related to the risk of sporadic PD: the adjusted OR was 1.30 (95% CI: 1.002-1.68). There were no significant relationships between SNP rs356229, rs356219, or rs7684318 and the risk of sporadic PD in any genetic model. The additive interactions between SNPs rs356219 and rs356220 and smoking with respect to sporadic PD were significant although the multiplicative interactions were not significant. This study suggests that SNCA SNPs rs356220 and rs2736990 are significantly associated with the risk of sporadic PD in Japanese. We also present new evidence for biological interactions between SNPs rs356219 and rs356220 and smoking that affect sporadic PD. Copyright © 2012 Elsevier Ltd. All rights reserved.

Associations of IL6 polymorphisms with lung function decline and COPD

PubMed Central

He, Jian-Qing; Foreman, Marilyn G.; Shumansky, Karey; Zhang, Xuekui; Akhabir, Loubna; Sin, Don D; Man, S F Paul; DeMeo, Dawn L.; Litonjua, Augusto A.; Silverman, Edwin K.; Connett, John E; Anthonisen, Nicholas R; Wise, Robert A; Paré, Peter D; Sandford, Andrew J

2010-01-01

Background Interleukin-6 (IL6) is a pleiotropic pro-inflammatory and immunomodulatory cytokine which likely plays an important role in the pathogenesis of COPD. There is a functional single nucleotide polymorphism (SNP), −174G/C, in the promoter region of IL6. We hypothesized that IL6 SNPs influence susceptibility for impaired lung function and COPD in smokers. Methods Seven and 5 SNPs in IL6 were genotyped in two nested case-control samples derived from the Lung Health Study (LHS) based on phenotypes of rate of decline of forced expiratory volume in one second (FEV1) over 5 years and baseline FEV1 at the beginning of the LHS. Serum IL6 concentrations were measured for all subjects. A partially overlapping panel of 9 IL6 SNPs was genotyped in 389 COPD cases from the National Emphysema Treatment Trial (NETT) and 420 controls from the Normative Aging Study (NAS). Results In the LHS, three IL6 SNPs were associated with FEV1 decline (0.023 ≤ P ≤ 0.041 in additive models). Among them the IL6_−174C allele was associated with rapid decline of lung function. The association was more significant in a genotype-based analysis (P = 0.006). In the NETT-NAS study, IL6_−174G/C and four other IL6 SNPs, all of which are in linkage disequilibrium with IL6_−174G/C, were associated with susceptibility to COPD (0.01 ≤ P ≤ 0.04 in additive genetic models). Conclusion Our results suggest that the IL6_−174G/C SNP is associated with rapid decline of FEV1 and susceptibility to COPD in smokers. PMID:19359268

Single-nucleotide polymorphisms (SNPs) of the IRF6 and TFAP2A in non-syndromic cleft lip with or without cleft palate (NSCLP) in a northern Chinese population

DOE Office of Scientific and Technical Information (OSTI.GOV)

Shi, Jinna, E-mail: kqkjk@yahoo.com.cn; Song, Tao; Jiao, Xiaohui

2011-07-15

Highlights: {yields} IRF6 rs642961 polymorphism is intensively associated with NSCLP. {yields} IRF6 rs2235371 polymorphism is not associated with NSCLP in the northern Chinese population. {yields} This investigation failed to yield any evidence for the involvement of TFAP2A polymorphisms in NSCLP in the northern Chinese population. -- Abstract: Non-syndromic cleft lip with or without cleft palate (NSCLP) is a common birth defect that is presumably caused by genetic factors alone or gene alterations in combination with environmental changes. A number of studies have shown an association between NSCLP and single-nucleotide polymorphisms (SNPs) in the interferon regulatory factor 6 (IRF6) gene inmore » several populations. The transcription factor AP-2a (TFAP2A), which is involved in regulating mid-face development and upper lip fusion, has also be considered a candidate gene contributing to the etiology of NSCLP. The potential importance of IRF6 and TFAP2A in the NSCLP is further highlighted by a study showing that the two molecules are in the same developmental pathway. To further assess the roles of the IRF6 and TFAP2A in NSCLP, we investigated two identified IRF6 SNPs (rs2235371, rs642961) and three TFAP2A tag SNPs (rs3798691, rs1675414, rs303050) selected from HapMap data in a northern Chinese population, a group with a high prevalence of NSCLP. These SNPs were examined for association with NSCLP in 175 patients and 160 healthy controls. We observed a significant correlation between IRF6 rs642961 and NSCLP, and a lack of association between IRF6 rs2235371 polymorphisms and NSCLP in this population. This investigation indicated that there is no association between the three SNPs in the TFAP2A and NSCLP, suggesting that TFAP2A may not be involved in the development of NSCLP in the northern Chinese population. Our study provides further evidence regarding the role of IRF6 variations in NSCLP development and finds no significant association between TFAP2A and NSCLP in this northern Chinese population.« less

PXR polymorphisms and their impact on pharmacokinetics/pharmacodynamics of repaglinide in healthy Chinese volunteers.

PubMed

Du, Qing-qing; Wang, Zhi-jun; He, Lin; Jiang, Xue-hua; Wang, Ling

2013-11-01

CYP3A4 is the main isoform of cytochrome P450 oxidases involved in the metabolism of approximately 60 % drugs, and its expression level is highly variable in human subjects. CYP3A4 is regulated by many transcription factors, among which the pregnane X receptor/steroid and xenobiotic receptor (PXR/SXR, NR1I2) have been identified as the most critical. Genetic polymorphisms (such as SNPs) in PXR may affect the expression level of CYP3A4. Although numerous SNPs have been identified in PXR and have appeared to affect PXR function, their impact on the expression of CYP3A4 in human subjects has not been well studied. Thus, a clinical study in healthy Chinese subjects was conducted to investigate the impact of PXR polymorphisms on repaglinide (an endogenous marker for CYP3A4 activity) pharmacokinetics used alone or in combination with a PXR inducer, flucloxacillin. Two SNPs, -298A>G and 11193T>C, were identified as the tag SNPs to represent the overall genetic polymorphic profile of PXR. To evaluate the potential functional change of these two SNPs, 24 healthy subjects were recruited in a pharmacokinetics/pharmacodynamics study of repaglinide with or without flucloxacillin. The pharmacokinetic parameters including AUC and T1/2 were significantly different among the PXR genotype groups. The SNPs of -298G/G and 11193C/C were found to be associated with a lower PXR activity resulting in reduction of CYP3A4 activity in vivo. After administration of flucloxacillin, a significant drug-drug interaction was observed. The clearance of repagnilide was significantly increased by concomitant flucloxacillin in a genotype dependent manner. The subjects with SNPs of -298G/G and 11193C/C appeared to be less sensitive to flucloxacillin. Our study results demonstrated for the first time the impact of genetic polymorphisms of PXR on the PK and PD of repaglinide, and showed that subjects with genotype of -298G/G and 11193C/C in PXR has a decreased elimination rate of 3A4/2C8. Furthermore, flucloxacillin was able to induce 3A4/2C8 expression mediated by PXR in a genotype dependent manner.

A novel approach for small sample size family-based association studies: sequential tests.

PubMed

Ilk, Ozlem; Rajabli, Farid; Dungul, Dilay Ciglidag; Ozdag, Hilal; Ilk, Hakki Gokhan

2011-08-01

In this paper, we propose a sequential probability ratio test (SPRT) to overcome the problem of limited samples in studies related to complex genetic diseases. The results of this novel approach are compared with the ones obtained from the traditional transmission disequilibrium test (TDT) on simulated data. Although TDT classifies single-nucleotide polymorphisms (SNPs) to only two groups (SNPs associated with the disease and the others), SPRT has the flexibility of assigning SNPs to a third group, that is, those for which we do not have enough evidence and should keep sampling. It is shown that SPRT results in smaller ratios of false positives and negatives, as well as better accuracy and sensitivity values for classifying SNPs when compared with TDT. By using SPRT, data with small sample size become usable for an accurate association analysis.

Association of CHEK2 polymorphisms with the efficacy of platinum-based chemotherapy for advanced non-small-cell lung cancer in Chinese never-smoking women

PubMed Central

Xu, Wen; Liu, Di; Yang, Yang; Ding, Xi; Sun, Yifeng; Zhang, Baohong

2016-01-01

Background Cell cycle checkpoint kinase 2 (CHEK2) plays an essential role in the repair of DNA damage. Single nucleotide polymorphisms (SNPs) in DNA repair genes are thought to influence treatment effects and survival of cancer patients. This study aimed to investigate the relationship between polymorphisms in the CHEK2 gene and efficacy of platinum-based doublet chemotherapy in never-smoking Chinese female patients with advanced non-small-cell lung cancer (NSCLC). Methods Using DNA from blood samples of 272 Chinese advanced NSCLC non-smoking female patients treated with first-line platinum-based chemotherapy, we have analyzed the relationships between four SNPs in the CHEK2 gene and clinical outcomes. Results We found that overall survival (OS) was significantly associated with CHEK2 rs4035540 (Log-Rank P=0.020), as well as the CHEK2 rs4035540 dominant model (Log-Rank P=0.026), especially in the lung adenocarcinoma group. After multivariate analysis, patients with rs4035540 A/G genotype had a significantly better OS than those with the G/G genotype (HR =0.67, 95% CI, 0.48–0.93; P=0.016). In the toxicity analysis, it was observed that patients with the CHEK2 rs4035540 A/A genotype had a higher risk of gastrointestinal toxicity than the G/G genotype group (P=0.009). However, there are no significant associations between chemotherapy treatments and genetic variations. Conclusions Our findings indicate that SNPs in CHEK2 are related to Chinese advanced NSCLC never-smoking female patients receiving platinum-based doublet chemotherapy in China. Patients with rs4035540 A/G genotype have a better OS. And patients with rs4035540 A/A genotype have a higher risk of gastrointestinal toxicity. These results point to a direction for predicting the prognosis for Chinese never-smoking NSCLC female patients. However, there are no significant associations between chemotherapy treatments and SNPs in CHEK2, which need more samples to the further study. PMID:27747004

Association of MAP4K4 gene single nucleotide polymorphism with mastitis and milk traits in Chinese Holstein cattle.

PubMed

Bhattarai, Dinesh; Chen, Xing; Ur Rehman, Zia; Hao, Xingjie; Ullah, Farman; Dad, Rahim; Talpur, Hira Sajjad; Kadariya, Ishwari; Cui, Lu; Fan, Mingxia; Zhang, Shujun

2017-02-01

The objective of the studies presented in this Research Communication was to investigate the association of single nucleotide polymorphisms present in the MAP4K4 gene with different milk traits in dairy cows. Based on previous QTL fine mapping results on bovine chromosome 11, the MAP4K4 gene was selected as a candidate gene to evaluate its effect on somatic cell count and milk traits in ChineseHolstein cows. Milk production traits including milk yield, fat percentage, and protein percentage of each cow were collected using 305 d lactation records. Association between MAP4K4 genotype and different traits and Somatic Cell Score (SCS) was performed using General Linear Regression Model of R. Two SNPs at exon 18 (c.2061T > G and c.2196T > C) with genotype TT in both SNPs were found significantly higher for somatic SCS. We found the significant effect of exon 18 (c.2061T > G) on protein percentage, milk yield and SCS. We identified SNPs at different location of MAP4K4 gene of the cattle and several of them were significantly associated with the somatic cell score and other different milk traits. Thus, MAP4K4 gene could be a useful candidate gene for selection of dairy cattle against mastitis and the identified polymorphisms might potentially be strong genetic markers.

SNP Discovery and Linkage Map Construction in Cultivated Tomato

PubMed Central

Shirasawa, Kenta; Isobe, Sachiko; Hirakawa, Hideki; Asamizu, Erika; Fukuoka, Hiroyuki; Just, Daniel; Rothan, Christophe; Sasamoto, Shigemi; Fujishiro, Tsunakazu; Kishida, Yoshie; Kohara, Mitsuyo; Tsuruoka, Hisano; Wada, Tsuyuko; Nakamura, Yasukazu; Sato, Shusei; Tabata, Satoshi

2010-01-01

Few intraspecific genetic linkage maps have been reported for cultivated tomato, mainly because genetic diversity within Solanum lycopersicum is much less than that between tomato species. Single nucleotide polymorphisms (SNPs), the most abundant source of genomic variation, are the most promising source of polymorphisms for the construction of linkage maps for closely related intraspecific lines. In this study, we developed SNP markers based on expressed sequence tags for the construction of intraspecific linkage maps in tomato. Out of the 5607 SNP positions detected through in silico analysis, 1536 were selected for high-throughput genotyping of two mapping populations derived from crosses between ‘Micro-Tom’ and either ‘Ailsa Craig’ or ‘M82’. A total of 1137 markers, including 793 out of the 1338 successfully genotyped SNPs, along with 344 simple sequence repeat and intronic polymorphism markers, were mapped onto two linkage maps, which covered 1467.8 and 1422.7 cM, respectively. The SNP markers developed were then screened against cultivated tomato lines in order to estimate the transferability of these SNPs to other breeding materials. The molecular markers and linkage maps represent a milestone in the genomics and genetics, and are the first step toward molecular breeding of cultivated tomato. Information on the DNA markers, linkage maps, and SNP genotypes for these tomato lines is available at http://www.kazusa.or.jp/tomato/. PMID:21044984

Impact of obesity-related genes in Spanish population

PubMed Central

2013-01-01

Background The objective was to investigate the association between BMI and single nucleotide polymorphisms previously identified of obesity-related genes in two Spanish populations. Forty SNPs in 23 obesity-related genes were evaluated in a rural population characterized by a high prevalence of obesity (869 subjects, mean age 46 yr, 62% women, 36% obese) and in an urban population (1425 subjects, mean age 54 yr, 50% women, 19% obese). Genotyping was assessed by using SNPlex and PLINK for the association analysis. Results Polymorphisms of the FTO were significantly associated with BMI, in the rural population (beta 0.87, p-value <0.001). None of the other SNPs showed significant association after Bonferroni correction in the two populations or in the pooled analysis. A weighted genetic risk score (wGRS) was constructed using the risk alleles of the Tag-SNPs with a positive Beta parameter in both populations. From the first to the fifth quintile of the score, the BMI increased 0.45 kg/m2 in Hortega and 2.0 kg/m2 in Pizarra. Overall, the obesity predictive value was low (less than 1%). Conclusion The risk associated with polymorphisms is low and the overall effect on BMI or obesity prediction is minimal. A weighted genetic risk score based on genes mainly acting through central nervous system mechanisms was associated with BMI but it yields minimal clinical prediction for the obesity risk in the general population. PMID:24267414

Impact of obesity-related genes in Spanish population.

PubMed

Martínez-García, Fernando; Mansego, María L; Rojo-Martínez, Gemma; De Marco-Solar, Griselda; Morcillo, Sonsoles; Soriguer, Federico; Redón, Josep; Pineda Alonso, Monica; Martín-Escudero, Juan C; Cooper, Richard S; Chaves, Felipe J

2013-11-23

The objective was to investigate the association between BMI and single nucleotide polymorphisms previously identified of obesity-related genes in two Spanish populations. Forty SNPs in 23 obesity-related genes were evaluated in a rural population characterized by a high prevalence of obesity (869 subjects, mean age 46 yr, 62% women, 36% obese) and in an urban population (1425 subjects, mean age 54 yr, 50% women, 19% obese). Genotyping was assessed by using SNPlex and PLINK for the association analysis. Polymorphisms of the FTO were significantly associated with BMI, in the rural population (beta 0.87, p-value <0.001). None of the other SNPs showed significant association after Bonferroni correction in the two populations or in the pooled analysis. A weighted genetic risk score (wGRS) was constructed using the risk alleles of the Tag-SNPs with a positive Beta parameter in both populations. From the first to the fifth quintile of the score, the BMI increased 0.45 kg/m2 in Hortega and 2.0 kg/m2 in Pizarra. Overall, the obesity predictive value was low (less than 1%). The risk associated with polymorphisms is low and the overall effect on BMI or obesity prediction is minimal. A weighted genetic risk score based on genes mainly acting through central nervous system mechanisms was associated with BMI but it yields minimal clinical prediction for the obesity risk in the general population.

An innovative SNP genotyping method adapting to multiple platforms and throughputs.

PubMed

Long, Y M; Chao, W S; Ma, G J; Xu, S S; Qi, L L

2017-03-01

An innovative genotyping method designated as semi-thermal asymmetric reverse PCR (STARP) was developed for genotyping individual SNPs with improved accuracy, flexible throughputs, low operational costs, and high platform compatibility. Multiplex chip-based technology for genome-scale genotyping of single nucleotide polymorphisms (SNPs) has made great progress in the past two decades. However, PCR-based genotyping of individual SNPs still remains problematic in accuracy, throughput, simplicity, and/or operational costs as well as the compatibility with multiple platforms. Here, we report a novel SNP genotyping method designated semi-thermal asymmetric reverse PCR (STARP). In this method, genotyping assay was performed under unique PCR conditions using two universal priming element-adjustable primers (PEA-primers) and one group of three locus-specific primers: two asymmetrically modified allele-specific primers (AMAS-primers) and their common reverse primer. The two AMAS-primers each were substituted one base in different positions at their 3' regions to significantly increase the amplification specificity of the two alleles and tailed at 5' ends to provide priming sites for PEA-primers. The two PEA-primers were developed for common use in all genotyping assays to stringently target the PCR fragments generated by the two AMAS-primers with similar PCR efficiencies and for flexible detection using either gel-free fluorescence signals or gel-based size separation. The state-of-the-art primer design and unique PCR conditions endowed STARP with all the major advantages of high accuracy, flexible throughputs, simple assay design, low operational costs, and platform compatibility. In addition to SNPs, STARP can also be employed in genotyping of indels (insertion-deletion polymorphisms). As vast variations in DNA sequences are being unearthed by many genome sequencing projects and genotyping by sequencing, STARP will have wide applications across all biological organisms in agriculture, medicine, and forensics.

A novel MALDI–TOF based methodology for genotyping single nucleotide polymorphisms

PubMed Central

Blondal, Thorarinn; Waage, Benedikt G.; Smarason, Sigurdur V.; Jonsson, Frosti; Fjalldal, Sigridur B.; Stefansson, Kari; Gulcher, Jeffery; Smith, Albert V.

2003-01-01

A new MALDI–TOF based detection assay was developed for analysis of single nucleotide polymorphisms (SNPs). It is a significant modification on the classic three-step minisequencing method, which includes a polymerase chain reaction (PCR), removal of excess nucleotides and primers, followed by primer extension in the presence of dideoxynucleotides using modified thermostable DNA polymerase. The key feature of this novel assay is reliance upon deoxynucleotide mixes, lacking one of the nucleotides at the polymorphic position. During primer extension in the presence of depleted nucleotide mixes, standard thermostable DNA polymerases dissociate from the template at positions requiring a depleted nucleotide; this principal was harnessed to create a genotyping assay. The assay design requires a primer- extension primer having its 3′-end one nucleotide upstream from the interrogated site. The assay further utilizes the same DNA polymerase in both PCR and the primer extension step. This not only simplifies the assay but also greatly reduces the cost per genotype compared to minisequencing methodology. We demonstrate accurate genotyping using this methodology for two SNPs run in both singleplex and duplex reactions. We term this assay nucleotide depletion genotyping (NUDGE). Nucleotide depletion genotyping could be extended to other genotyping assays based on primer extension such as detection by gel or capillary electrophoresis. PMID:14654708

Association of variants in innate immune genes with asthma and eczema

PubMed Central

Sharma, Sunita; Poon, Audrey; Himes, Blanca E.; Lasky-Su, Jessica; Sordillo, Joanne E.; Belanger, Kathleen; Milton, Donald K.; Bracken, Michael B.; Triche, Elizabeth W.; Leaderer, Brian P.; Gold, Diane R.; Litonjua, Augusto A.

2012-01-01

Background The innate immune pathway is important in the pathogenesis of asthma and eczema. However, only a few variants in these genes have been associated with either disease. We investigate the association between polymorphisms of genes in the innate immune pathway with childhood asthma and eczema. In addition, we compare individual associations with those discovered using a multivariate approach. Methods Using a novel method, case control based association testing (C2BAT), 569 single nucleotide polymorphisms (SNPs) in 44 innate immune genes were tested for association with asthma and eczema in children from the Boston Home Allergens and Asthma Study and the Connecticut Childhood Asthma Study. The screening algorithm was used to identify the top SNPs associated with asthma and eczema. We next investigated the interaction of innate immune variants with asthma and eczema risk using Bayesian networks. Results After correction for multiple comparisons, 7 SNPs in 6 genes (CARD25, TGFB1, LY96, ACAA1, DEFB1, and IFNG) were associated with asthma (adjusted p-value<0.02), while 5 SNPs in 3 different genes (CD80, STAT4, and IRAKI) were significantly associated with eczema (adjusted p-value < 0.02). None of these SNPs were associated with both asthma and eczema. Bayesian network analysis identified 4 SNPs that were predictive of asthma and 10 SNPs that predicted eczema. Of the genes identified using Bayesian networks, only CD80 was associated with eczema in the single-SNP study. Using novel methodology that allows for screening and replication in the same population, we have identified associations of innate immune genes with asthma and eczema. Bayesian network analysis suggests that additional SNPs influence disease susceptibility via SNP interactions. Conclusion Our findings suggest that innate immune genes contribute to the pathogenesis of asthma and eczema, and that these diseases likely have different genetic determinants. PMID:22192168

Effect of BCHE single nucleotide polymorphisms on lipid metabolism markers in women.

PubMed

Oliveira, Jéssica de; Tureck, Luciane Viater; Santos, Willian Dos; Saliba, Louise Farah; Schenknecht, Caroline Schovanz; Scaraboto, Débora; Souza, Ricardo Lehtonen R; Furtado-Alle, Lupe

2017-01-01

Butyrylcholinesterase (BChE) activity and polymorphisms in its encoding gene had previously been associated with metabolic traits of obesity. This study investigated the association of three single nucleotide polymorphisms (SNPs) in the BCHE gene: -116G > A (rs1126680), 1615GA (rs1803274), 1914A < G (rs3495), with obesity and lipid metabolism markers, body mass index (BMI), total cholesterol (TC), low density lipoprotein cholesterol (LDL-C), high density lipoprotein cholesterol (HDL-C), triglyceride (TG) levels, and BChE enzymatic activity in obese (BMI≥30/n = 226) and non-obese women (BMI < 25/n = 81). BCHE SNPs genotyping was obtained by TaqMan allelic discrimination assay and by RFLP-PCR. Plasmatic BChE activity was measured using propionylthiocholine as substrate. Similar allele frequencies were found in obese and non-obese women for the three studied SNPs (p > 0.05). The dominant and recessive models were tested, and different effects were found. The -116A allele showed a dominant effect in BChE activity reduction in both non-obese and obese women (p = 0.045 and p < 0.001, respectively). The 1914A > G and 1615GA SNPs influenced the TG levels only in obese women. The 1914G and the 1615A alleles were associated with decreased plasma levels of TG. Thus, our results suggest that the obesity condition, characterized by loss of energy homeostasis, is modulated by BCHE polymorphisms.

Evidence for association between Disrupted-in-schizophrenia 1 (DISC1) gene polymorphisms and autism in Chinese Han population: a family-based association study

PubMed Central

2011-01-01

Background Disrupted-in-Schizophrenia 1 (DISC1) gene is one of the most promising candidate genes for major mental disorders. In a previous study, a Finnish group demonstrated that DISC1 polymorphisms were associated with autism and Asperger syndrome. However, the results were not replicated in Korean population. To determine whether DISC1 is associated with autism in Chinese Han population, we performed a family-based association study between DISC1 polymorphisms and autism. Methods We genotyped seven tag single nucleotide polymorphisms (SNPs) in DISC1, spanning 338 kb, in 367 autism trios (singleton and their biological parents) including 1,101 individuals. Single SNP association and haplotype association analysis were performed using the family-based association test (FBAT) and Haploview software. Results We found three SNPs showed significant associations with autism (rs4366301: G > C, Z = 2.872, p = 0.004; rs11585959: T > C, Z = 2.199, p = 0.028; rs6668845: A > G, Z = 2.326, p = 0.02). After the Bonferroni correction, SNP rs4366301, which located in the first intron of DISC1, remained significant. When haplotype were constructed with two-markers, three haplotypes displayed significant association with autism. These results were still significant after using the permutation method to obtain empirical p values. Conclusions Our study provided evidence that the DISC1 may be the susceptibility gene of autism. It suggested DISC1 might play a role in the pathogenesis of autism. PMID:21569632

Investigating the CFH Gene Polymorphisms as a Risk Factor for Age-related Macular Degeneration in an Iranian Population.

PubMed

Babanejad, Mojgan; Moein, Hamidreza; Akbari, Mohammad R; Badiei, Azadeh; Yaseri, Mehdi; Soheilian, Masoud; Najmabadi, Hossein

2016-06-01

Age-related macular degeneration (AMD) is a complex disorder which results in irreversible vision loss and progressive impairment of central vision. Disease susceptibility is influenced by multiple genetic and environmental factors. Single nucleotide polymorphisms (SNP) in the complement factor H gene are the most important genetic risk factors. We conducted a case-control study to investigate the association four SNPs (dbSNP ID: rs800292, rs1061170, rs2274700 and rs3753395) of CFH gene with AMD in the Iranian population. We recruited 100 AMD patients and 100 age- and sex-matched normal controls. Direct sequencing for three SNPs (rs800292, rs2274700 and rs3753395) and restriction fragment length polymorphism utilized for rs1061170. Allele and genotype frequencies of SNPs were calculated and tested for departure from Hardy-Weinberg equilibrium using the Chi-square test. An allelic and genotypic association was compared by logistic regression analysis using the SNPassoc. According to our results, the frequencies of risk allele for all SNPs (G, G, A, and C alleles of rs800292, rs2274700, rs3753395 and rs1061170, respectively) were significantly higher in AMD patients (p value < 0.001). AMD individuals who had at least one copy of the C allele of rs1061170 had an increased risk of disease compared with cases with the T allele. Other studied polymorphisms showed the same association. Our results suggest the contribution of all four predicted CFH polymorphisms in AMD susceptibility among the Iranian population. This association with CFH may lead to early detection and new strategies for prevention and treatment of AMD.

Clinical Relevance of Multiple Single-Nucleotide Polymorphisms in Pneumocystis jirovecii Pneumonia: Development of a Multiplex PCR-Single-Base-Extension Methodology▿

PubMed Central

Esteves, F.; Gaspar, J.; De Sousa, B.; Antunes, F.; Mansinho, K.; Matos, O.

2011-01-01

Pneumocystis jirovecii pneumonia (PcP) is a major cause of respiratory illness in patients with AIDS. The identification of multiple single-nucleotide polymorphisms (SNPs) at three distinct P. jirovecii loci encoding dihydrofolate reductase (DHFR), mitochondrial large-subunit rRNA (mtLSU rRNA), and superoxide dismutase (SOD) was achieved using multiplex-PCR (MPCR) followed by direct sequencing and two single-base extension (SBE) techniques. Four SNPs (DHFR312, mt85, SOD215, and SOD110), correlated previously with parameters of disease, were amplified and genotyped simultaneously. The concordance of results between the standard sequencing technique (direct sequencing) and SBE analysis was 96.9% for the acrylamide gel electrophoresis and 98.4% for the capillary electrophoresis. The cross-genetic analysis established several statistical associations among the SNPs studied: mt85C-SOD110T, SOD110T-SOD215C, and SOD110C-SOD215T. These results were confirmed by cluster analysis. Data showed that among the isolates with low to moderate parasite burden, the highest percentages of DHFR312C, mt85C, SOD110T, and SOD215C were detected, whereas for high parasite burden cases the highest frequencies were observed among isolates with DHFR312T, mt85T, SOD110C, and SOD215T. The polymorphisms studied were shown to be suitable genetic targets potentially correlated with PcP clinical data that can be used as predictors of outcome in further studies to help clinical decision-making in the management of PcP. The MPCR/SBE protocol described for the first time in the present study was shown to be a rapid, highly accurate method for genotyping P. jirovecii SNPs encoded by different loci that could be used for epidemiological studies and as an additional procedure for the prognostic classification and diagnosis of PcP. PMID:21389160

Clinical relevance of multiple single-nucleotide polymorphisms in Pneumocystis jirovecii Pneumonia: development of a multiplex PCR-single-base-extension methodology.

PubMed

Esteves, F; Gaspar, J; De Sousa, B; Antunes, F; Mansinho, K; Matos, O

2011-05-01

Pneumocystis jirovecii pneumonia (PcP) is a major cause of respiratory illness in patients with AIDS. The identification of multiple single-nucleotide polymorphisms (SNPs) at three distinct P. jirovecii loci encoding dihydrofolate reductase (DHFR), mitochondrial large-subunit rRNA (mtLSU rRNA), and superoxide dismutase (SOD) was achieved using multiplex-PCR (MPCR) followed by direct sequencing and two single-base extension (SBE) techniques. Four SNPs (DHFR312, mt85, SOD215, and SOD110), correlated previously with parameters of disease, were amplified and genotyped simultaneously. The concordance of results between the standard sequencing technique (direct sequencing) and SBE analysis was 96.9% for the acrylamide gel electrophoresis and 98.4% for the capillary electrophoresis. The cross-genetic analysis established several statistical associations among the SNPs studied: mt85C-SOD110T, SOD110T-SOD215C, and SOD110C-SOD215T. These results were confirmed by cluster analysis. Data showed that among the isolates with low to moderate parasite burden, the highest percentages of DHFR312C, mt85C, SOD110T, and SOD215C were detected, whereas for high parasite burden cases the highest frequencies were observed among isolates with DHFR312T, mt85T, SOD110C, and SOD215T. The polymorphisms studied were shown to be suitable genetic targets potentially correlated with PcP clinical data that can be used as predictors of outcome in further studies to help clinical decision-making in the management of PcP. The MPCR/SBE protocol described for the first time in the present study was shown to be a rapid, highly accurate method for genotyping P. jirovecii SNPs encoded by different loci that could be used for epidemiological studies and as an additional procedure for the prognostic classification and diagnosis of PcP.

Lack of association between autonomously functioning thyroid nodules and germline polymorphisms of the thyrotropin receptor and Gαs genes in a mild to moderate iodine-deficient Caucasian population.

PubMed

Vicchio, Teresa Manuela; Giovinazzo, Salvatore; Certo, Rosaria; Cucinotta, Mariapaola; Micali, Carmelo; Baldari, Sergio; Benvenga, Salvatore; Trimarchi, Francesco; Campennì, Alfredo; Ruggeri, Rosaria Maddalena

2014-07-01

Mutations of the thyrotropin receptor (TSHR) and/or Gαs gene have been found in a number of, but not all, autonomously functioning thyroid nodules (AFTNs). Recently, in a 15-year-old girl with a hyperfunctioning papillary thyroid carcinoma, we found two somatic and germline single nucleotide polymorphisms (SNPs): a SNP of the TSHR gene (exon 7, codon 187) and a SNP of Gαs gene (exon 8, codon 185). The same silent SNP of the TSHR gene had been reported in patients with AFTN or familial non-autoimmune hyperthyroidism. No further data about the prevalence of the two SNPs in AFTNs as well as in the general population are available in the literature. To clarify the possible role of these SNPs in predisposing to AFTN. Germline DNA was extracted from blood leukocytes of 115 patients with AFTNs (43 males and 72 females, aged 31-85 years, mean ± SD = 64 ± 13) and 100 sex-matched healthy individuals from the same geographic area, which is marginally iodine deficient. The genotype distribution of the two SNPs was investigated by restriction fragment length polymorphism-polymerase chain reaction. The prevalence of the two SNPs in our study population was low and not different to that found in healthy individuals: 8 % of patients vs. 9 % of controls were heterozygous for the TSHR SNP and 4 % patients vs. 6 % controls were heterozygous for the Gαs SNP. One patient harbored both SNPs. These results suggest that these two SNPs do not confer susceptibility for the development of AFTN.

Analysis of single nucleotide polymorphisms in the 3' region of the estrogen receptor 1 gene in normal and cryptorchid Miniature Dachshunds and Chihuahuas.

PubMed

Pathirana, Indunil Nishantha; Tanaka, Kakeru; Kawate, Noritoshi; Tsuji, Makoto; Kida, Kayoko; Hatoya, Shingo; Inaba, Toshio; Tamada, Hiromichi

2010-08-01

This study was performed to examine the distribution of single nucleotide polymorphisms (SNPs) and estimated haplotypes in the canine estrogen receptor (ER) alpha gene (ESR1) and the association of them with different phenotypes of cryptorchidism (CO) in Miniature Dachshunds and Chihuahuas. Forty CO and 68 normal dogs were used, and CO was classified into unilateral (UCO; n=33) and bilateral CO (BCO; n=5) or into abdominal (ACO; n=16) and inguinal CO (ICO; n=22). Thirteen DNA fragments located in the 70-kb region at the 3' end of ESR1 were amplified by PCR and sequenced to examine 13 SNPs (#1-#13) reported in a canine SNP database. Ten SNPs (#1-#4, #7, #8, #10-#13) were not polymorphic, and 5 new SNPs (#14-#18) were discovered. A common haplotype block in normal, CO and CO phenotypes was identified for an approximately 20-kb region encompassing 4 SNPs (#14-#17). Allele, genotype and haplotype frequencies in CO without classification by phenotype and also in UCO, ACO and ICO phenotypes were not statistically different from the normal group. Significant differences in genotype frequencies and homozygosity for the estimated GTTG haplotype within the block were observed in BCO compared with the normal group, although the number of BCO animals was small. Our results demonstrate that the examined SNPs and haplotypes in the 3' end of canine ESR1 are not associated with unilateral, abdominal and inguinal CO phenotypes and CO per se in Miniature Dachshunds and Chihuahuas. Further studies are necessary to suggest a clear association between the ESR1 SNPs and bilateral CO in dogs.

Interleukin gene polymorphisms and breast cancer: a case control study and systematic literature review

PubMed Central

Balasubramanian, SP; Azmy, IAF; Higham, SE; Wilson, AG; Cross, SS; Cox, A; Brown, NJ; Reed, MW

2006-01-01

Background Interleukins and cytokines play an important role in the pathogenesis of many solid cancers. Several single nucleotide polymorphisms (SNPs) identified in cytokine genes are thought to influence the expression or function of these proteins and many have been evaluated for their role in inflammatory disease and cancer predisposition. The aim of this study was to evaluate any role of specific SNPs in the interleukin genes IL1A, IL1B, IL1RN, IL4R, IL6 and IL10 in predisposition to breast cancer susceptibility and severity. Methods Candidate single nucleotide polymorphisms (SNPs) in key cytokine genes were genotyped in breast cancer patients and in appropriate healthy volunteers who were similar in age, race and sex. Genotyping was performed using a high throughput allelic discrimination method. Data on clinico-pathological details and survival were collected. A systematic review of Medline English literature was done to retrieve previous studies of these polymorphisms in breast cancer. Results None of the polymorphisms studied showed any overall predisposition to breast cancer susceptibility, severity or to time to death or occurrence of distant metastases. The results of the systematic review are summarised. Conclusion Polymorphisms within key interleukin genes (IL1A, IL1B, IL1RN, IL4R, IL6 and IL10 do not appear to play a significant overall role in breast cancer susceptibility or severity. PMID:16842617

An investigation of causes of false positive single nucleotide polymorphisms using simulated reads from a small eukaryote genome.

PubMed

Ribeiro, Antonio; Golicz, Agnieszka; Hackett, Christine Anne; Milne, Iain; Stephen, Gordon; Marshall, David; Flavell, Andrew J; Bayer, Micha

2015-11-11

Single Nucleotide Polymorphisms (SNPs) are widely used molecular markers, and their use has increased massively since the inception of Next Generation Sequencing (NGS) technologies, which allow detection of large numbers of SNPs at low cost. However, both NGS data and their analysis are error-prone, which can lead to the generation of false positive (FP) SNPs. We explored the relationship between FP SNPs and seven factors involved in mapping-based variant calling - quality of the reference sequence, read length, choice of mapper and variant caller, mapping stringency and filtering of SNPs by read mapping quality and read depth. This resulted in 576 possible factor level combinations. We used error- and variant-free simulated reads to ensure that every SNP found was indeed a false positive. The variation in the number of FP SNPs generated ranged from 0 to 36,621 for the 120 million base pairs (Mbp) genome. All of the experimental factors tested had statistically significant effects on the number of FP SNPs generated and there was a considerable amount of interaction between the different factors. Using a fragmented reference sequence led to a dramatic increase in the number of FP SNPs generated, as did relaxed read mapping and a lack of SNP filtering. The choice of reference assembler, mapper and variant caller also significantly affected the outcome. The effect of read length was more complex and suggests a possible interaction between mapping specificity and the potential for contributing more false positives as read length increases. The choice of tools and parameters involved in variant calling can have a dramatic effect on the number of FP SNPs produced, with particularly poor combinations of software and/or parameter settings yielding tens of thousands in this experiment. Between-factor interactions make simple recommendations difficult for a SNP discovery pipeline but the quality of the reference sequence is clearly of paramount importance. Our findings are also a stark reminder that it can be unwise to use the relaxed mismatch settings provided as defaults by some read mappers when reads are being mapped to a relatively unfinished reference sequence from e.g. a non-model organism in its early stages of genomic exploration.

Genetic polymorphism and prostate cancer aggressiveness: a case-only study of 1,536 GWAS and candidate SNPs in African-Americans and European-Americans.

PubMed

Bensen, Jeannette T; Xu, Zongli; Smith, Gary J; Mohler, James L; Fontham, Elizabeth T H; Taylor, Jack A

2013-01-01

Genome-wide association studies have established a number of replicated single nucleotide polymorphisms (SNPs) for susceptibility to prostate cancer (CaP), but it is unclear whether these susceptibility SNPs are also associated with disease aggressiveness. This study evaluates whether such replication SNPs or other candidate SNPs are associated with CaP aggressiveness in African-American (AA) and European-American (EA) men. A 1,536 SNP panel which included 34 genome-wide association study (GWAS) replication SNPs, 38 flanking SNPs, a set of ancestry informative markers, and SNPs in candidate genes and other areas was genotyped in 1,060 AA and 1,087 EA men with incident CaP from the North Carolina-Louisiana Prostate Cancer Project (PCaP). Tests for association were conducted using ordinal logistic regression with a log-additive genotype model and a 3-category CaP aggressiveness variable. Four GWAS replication SNPs (rs2660753, rs13254738, rs10090154, rs2735839) and seven flanking SNPs were associated with CaP aggressiveness (P < 0.05) in three genomic regions: One at 3p12 (EA), seven at 8q24 (5 AA, 2 EA), and three at 19q13 at the kallilkrein-related peptidase 3 (KLK3) locus (two AA, one AA and EA). The KLK3 SNPs also were associated with serum prostate-specific antigen (PSA) levels in AA (P < 0.001) but not in EA. A number of the other SNPs showed some evidence of association but none met study-wide significance levels after adjusting for multiple comparisons. Some replicated GWAS susceptibility SNPs may play a role in CaP aggressiveness. However, like susceptibility, these associations are not consistent between racial groups. Copyright © 2012 Wiley Periodicals, Inc.

Genetic polymorphism and prostate cancer aggressiveness: A case-only study of 1536 GWAS and candidate SNPs in African Americans and European Americans

PubMed Central

Bensen, Jeannette T.; Xu, Zongli; Smith, Gary J.; Mohler, James L.; Fontham, Elizabeth T.H.; Taylor, Jack A.

2012-01-01

BACKGROUND Genome-wide association studies have established a number of replicated single nucleotide polymorphisms (SNPs) for susceptibility to prostate cancer (CaP), but it is unclear whether these susceptibility SNPs are also associated with disease aggressiveness. This study evaluates whether such replication SNPs or other candidate SNPs are associated with CaP aggressiveness in African-American (AA) and European-American (EA) men. METHODS A 1,536 SNP panel which included 34 genome-wide association study (GWAS) replication SNPs, 38 flanking SNPs, a set of ancestry informative markers, and SNPs in candidate genes and other areas was genotyped in 1,060 AA and 1,087 EA men with incident CaP from the North Carolina-Louisiana Prostate Cancer Project (PCaP). Tests for association were conducted using ordinal logistic regression with a log-additive genotype model and a 3-category CaP aggressiveness variable. RESULTS 4 GWAS replication SNPs (rs2660753, rs13254738, rs10090154, rs2735839) and 7 flanking SNPs were associated with CaP aggressiveness (P<0.05) in 3 genomic regions: one at 3p12 (EA), 7 at 8q24 (5 AA, 2 EA), and 3 at 19q13 at the kallilkrein-related peptidase 3 (KLK3) locus (2 AA, 1 AA and EA). The KLK3 SNPs also were associated with serum prostate-specific antigen (PSA) levels in AA (p < 0.001) but not in EA. A number of the other SNPs showed some evidence of association but none met study-wide significance levels after adjusting for multiple comparisons. CONCLUSIONS Some replicated GWAS susceptibility SNPs may play a role in CaP aggressiveness. However, like susceptibility, these associations are not consistent between racial groups. PMID:22549899

Genetic variations in the beta-tubulin gene and the internal transcribed spacer 2 region of Trichuris species from man and baboons.

PubMed

Hansen, Tina V A; Thamsborg, Stig M; Olsen, Annette; Prichard, Roger K; Nejsum, Peter

2013-08-12

The whipworm Trichuris trichiura has been estimated to infect 604 - 795 million people worldwide. The current control strategy against trichuriasis using the benzimidazoles (BZs) albendazole (400 mg) or mebendazole (500 mg) as single-dose treatment is not satisfactory. The occurrence of single nucleotide polymorphisms (SNPs) in codons 167, 198 or 200 of the beta-tubulin gene has been reported to convey BZ-resistance in intestinal nematodes of veterinary importance. It was hypothesised that the low susceptibility of T. trichiura to BZ could be due to a natural occurrence of such SNPs. The aim of this study was to investigate whether these SNPs were present in the beta-tubulin gene of Trichuris spp. from humans and baboons. As a secondary objective, the degree of identity between T. trichiura from humans and Trichuris spp. from baboons was evaluated based on the beta-tubulin gene and the internal transcribed spacer 2 region (ITS2). Nucleotide sequences of the beta-tubulin gene were generated by PCR using degenerate primers, specific primers and DNA from worms and eggs of T. trichiura and worms of Trichuris spp. from baboons. The ITS2 region was amplified using adult Trichuris spp. from baboons. PCR products were sequenced and analysed. The beta-tubulin fragments were studied for SNPs in codons 167, 198 or 200 and the ITS2 amplicons were compared with GenBank records of T. trichiura. No SNPs in codons 167, 198 or 200 were identified in any of the analysed Trichuris spp. from humans and baboons. Based on the ITS2 region, the similarity between Trichuris spp. from baboons and GenBank records of T. trichiura was found to be 98 - 99%. Single nucleotide polymorphisms in codon 167, 198 and 200, known to confer BZ-resistance in other nematodes, were absent in the studied material. This study does not provide data that could explain previous reports of poor BZ treatment efficacy in terms of polymorphism in these codons of beta-tubulin. Based on a fragment of the beta-tubulin gene and the ITS2 region sequenced, it was found that T. trichiura from humans and Trichuris spp. isolated from baboons are closely related and may be the same species.

Genetic variations in the beta-tubulin gene and the internal transcribed spacer 2 region of Trichuris species from man and baboons

PubMed Central

2013-01-01

Background The whipworm Trichuris trichiura has been estimated to infect 604 – 795 million people worldwide. The current control strategy against trichuriasis using the benzimidazoles (BZs) albendazole (400 mg) or mebendazole (500 mg) as single-dose treatment is not satisfactory. The occurrence of single nucleotide polymorphisms (SNPs) in codons 167, 198 or 200 of the beta-tubulin gene has been reported to convey BZ-resistance in intestinal nematodes of veterinary importance. It was hypothesised that the low susceptibility of T. trichiura to BZ could be due to a natural occurrence of such SNPs. The aim of this study was to investigate whether these SNPs were present in the beta-tubulin gene of Trichuris spp. from humans and baboons. As a secondary objective, the degree of identity between T. trichiura from humans and Trichuris spp. from baboons was evaluated based on the beta-tubulin gene and the internal transcribed spacer 2 region (ITS2). Methods Nucleotide sequences of the beta-tubulin gene were generated by PCR using degenerate primers, specific primers and DNA from worms and eggs of T. trichiura and worms of Trichuris spp. from baboons. The ITS2 region was amplified using adult Trichuris spp. from baboons. PCR products were sequenced and analysed. The beta-tubulin fragments were studied for SNPs in codons 167, 198 or 200 and the ITS2 amplicons were compared with GenBank records of T. trichiura. Results No SNPs in codons 167, 198 or 200 were identified in any of the analysed Trichuris spp. from humans and baboons. Based on the ITS2 region, the similarity between Trichuris spp. from baboons and GenBank records of T. trichiura was found to be 98 – 99%. Conclusions Single nucleotide polymorphisms in codon 167, 198 and 200, known to confer BZ-resistance in other nematodes, were absent in the studied material. This study does not provide data that could explain previous reports of poor BZ treatment efficacy in terms of polymorphism in these codons of beta-tubulin. Based on a fragment of the beta-tubulin gene and the ITS2 region sequenced, it was found that T. trichiura from humans and Trichuris spp. isolated from baboons are closely related and may be the same species. PMID:23938038

Japanese population structure, based on SNP genotypes from 7003 individuals compared to other ethnic groups: effects on population-based association studies.

PubMed

Yamaguchi-Kabata, Yumi; Nakazono, Kazuyuki; Takahashi, Atsushi; Saito, Susumu; Hosono, Naoya; Kubo, Michiaki; Nakamura, Yusuke; Kamatani, Naoyuki

2008-10-01

Because population stratification can cause spurious associations in case-control studies, understanding the population structure is important. Here, we examined Japanese population structure by "Eigenanalysis," using the genotypes for 140,387 SNPs in 7003 Japanese individuals, along with 60 European, 60 African, and 90 East-Asian individuals, in the HapMap project. Most Japanese individuals fell into two main clusters, Hondo and Ryukyu; the Hondo cluster includes most of the individuals from the main islands in Japan, and the Ryukyu cluster includes most of the individuals from Okinawa. The SNPs with the greatest frequency differences between the Hondo and Ryukyu clusters were found in the HLA region in chromosome 6. The nonsynonymous SNPs with the greatest frequency differences between the Hondo and Ryukyu clusters were the Val/Ala polymorphism (rs3827760) in the EDAR gene, associated with hair thickness, and the Gly/Ala polymorphism (rs17822931) in the ABCC11 gene, associated with ear-wax type. Genetic differentiation was observed, even among different regions in Honshu Island, the largest island of Japan. Simulation studies showed that the inclusion of different proportions of individuals from different regions of Japan in case and control groups can lead to an inflated rate of false-positive results when the sample sizes are large.

Polymorphisms in nitric oxide synthase and endothelin genes among children with obstructive sleep apnea.

PubMed

Chatsuriyawong, Siriporn; Gozal, David; Kheirandish-Gozal, Leila; Bhattacharjee, Rakesh; Khalyfa, Ahamed A; Wang, Yang; Sukhumsirichart, Wasana; Khalyfa, Abdelnaby

2013-09-06

Obstructive sleep apnea (OSA) is associated with adverse and interdependent cognitive and cardiovascular consequences. Increasing evidence suggests that nitric oxide synthase (NOS) and endothelin family (EDN) genes underlie mechanistic aspects of OSA-associated morbidities. We aimed to identify single nucleotide polymorphisms (SNPs) in the NOS family (3 isoforms), and EDN family (3 isoforms) to identify potential associations of these SNPs in children with OSA. A pediatric community cohort (ages 5-10 years) enriched for snoring underwent overnight polysomnographic (NPSG) and a fasting morning blood draw. The diagnostic criteria for OSA were an obstructive apnea-hypopnea Index (AHI) >2/h total sleep time (TST), snoring during the night, and a nadir oxyhemoglobin saturation <92%. Control children were defined as non-snoring children with AHI <2/h TST (NOSA). Endothelial function was assessed using a modified post-occlusive hyperemic test. The time to peak reperfusion (Tmax) was considered as the indicator for normal endothelial function (NEF; Tmax<45 sec), or ED (Tmax ≥ 45 sec). Genomic DNA from peripheral blood was extracted and allelic frequencies were assessed for, NOS1 (209 SNPs), NOS2 (122 SNPs), NOS3 (50 SNPs), EDN1 (43 SNPs), EDN2 (48 SNPs), EDN3 (14 SNPs), endothelin receptor A, EDNRA, (27 SNPs), and endothelin receptor B, EDNRB (23 SNPs) using a custom SNPs array. The relative frequencies of NOS-1,-2, and -3, and EDN-1,-2,-3,-EDNRA, and-EDNRB genotypes were evaluated in 608 subjects [128 with OSA, and 480 without OSA (NOSA)]. Furthermore, subjects with OSA were divided into 2 subgroups: OSA with normal endothelial function (OSA-NEF), and OSA with endothelial dysfunction (OSA-ED). Linkage disequilibrium was analyzed using Haploview version 4.2 software. For NOSA vs. OSA groups, 15 differentially distributed SNPs for NOS1 gene, and 1 SNP for NOS3 emerged, while 4 SNPs for EDN1 and 1 SNP for both EDN2 and EDN3 were identified. However, in the smaller sub-group for whom endothelial function was available, none of the significant SNPs was retained due to lack of statistical power. Differences in the distribution of polymorphisms among NOS and EDN gene families suggest that these SNPs could play a contributory role in the pathophysiology and risk of OSA-induced cardiovascular morbidity. Thus, analysis of genotype-phenotype interactions in children with OSA may assist in the formulation of categorical risk estimates.

Genome-wide DNA polymorphisms in two cultivars of mei (Prunus mume sieb. et zucc.).

PubMed

Sun, Lidan; Zhang, Qixiang; Xu, Zongda; Yang, Weiru; Guo, Yu; Lu, Jiuxing; Pan, Huitang; Cheng, Tangren; Cai, Ming

2013-10-06

Mei (Prunus mume Sieb. et Zucc.) is a famous ornamental plant and fruit crop grown in East Asian countries. Limited genetic resources, especially molecular markers, have hindered the progress of mei breeding projects. Here, we performed low-depth whole-genome sequencing of Prunus mume 'Fenban' and Prunus mume 'Kouzi Yudie' to identify high-quality polymorphic markers between the two cultivars on a large scale. A total of 1464.1 Mb and 1422.1 Mb of 'Fenban' and 'Kouzi Yudie' sequencing data were uniquely mapped to the mei reference genome with about 6-fold coverage, respectively. We detected a large number of putative polymorphic markers from the 196.9 Mb of sequencing data shared by the two cultivars, which together contained 200,627 SNPs, 4,900 InDels, and 7,063 SSRs. Among these markers, 38,773 SNPs, 174 InDels, and 418 SSRs were distributed in the 22.4 Mb CDS region, and 63.0% of these marker-containing CDS sequences were assigned to GO terms. Subsequently, 670 selected SNPs were validated using an Agilent's SureSelect solution phase hybridization assay. A subset of 599 SNPs was used to assess the genetic similarity of a panel of mei germplasm samples and a plum (P. salicina) cultivar, producing a set of informative diversity data. We also analyzed the frequency and distribution of detected InDels and SSRs in mei genome and validated their usefulness as DNA markers. These markers were successfully amplified in the cultivars and in their segregating progeny. A large set of high-quality polymorphic SNPs, InDels, and SSRs were identified in parallel between 'Fenban' and 'Kouzi Yudie' using low-depth whole-genome sequencing. The study presents extensive data on these polymorphic markers, which can be useful for constructing high-resolution genetic maps, performing genome-wide association studies, and designing genomic selection strategies in mei.

Mutation analysis of BRCA1/2 mutations with special reference to polymorphic SNPs in Indian breast cancer patients.

PubMed

Shah, Nidhi D; Shah, Parth S; Panchal, Yash Y; Katudia, Kalpesh H; Khatri, Nikunj B; Ray, Hari Shankar P; Bhatiya, Upti R; Shah, Sandip C; Shah, Bhavini S; Rao, Mandava V

2018-01-01

Germline mutations BRCA1 and BRCA2 contribute almost equally in the causation of breast cancer (BC). The type of mutations in the Indian population that cause this condition is largely unknown. In this cohort, 79 randomized BC patients were screened for various types of BRCA1 and BRCA2 mutations including frameshift, nonsense, missense, in-frame and splice site types. The purified extracted DNA of each referral patient was subjected to Sanger gene sequencing using Codon Code Analyzer and Mutation Surveyor and next-generation sequencing (NGS) methods with Ion torrent software, after appropriate care. The data revealed that 35 cases were positive for BRCA1 or BRCA2 (35/79: 44.3%). BRCA2 mutations were higher (52.4%) than BRCA1 mutations (47.6%). Five novel mutations detected in this study were p.pro163 frameshift, p.asn997 frameshift, p.ser148 frameshift and two splice site single-nucleotide polymorphisms (SNPs). Additionally, four nonsense and one in-frame deletion were identified, which all seemed to be pathogenic. Polymorphic SNPs contributed the highest percentage of mutations (72/82: 87.8%) and contributed to pathogenic, likely pathogenic, likely benign, benign and variant of unknown significance (VUS). Young age groups (20-60 years) had a high frequency of germline mutations (62/82;75.6%) in the Indian population. This study suggested that polymorphic SNPs contributed a high percentage of mutations along with five novel types. Younger age groups are prone to having BC with a higher mutational rate. Furthermore, the SNPs detected in exons 10, 11 and 16 of BRCA1 and BRCA2 were higher than those in other exons 2, 3 and 9 polymorphic sites in two germline genes. These may be contributory for BC although missense types are known to be susceptible for cancer depending on the type of amino acid replaced in the protein and associated with pathologic events. Accordingly, appropriate counseling and treatment may be suggested.

Polymorphisms in inflammation pathway genes and endometrial cancer risk

PubMed Central

Delahanty, Ryan J.; Xiang, Yong-Bing; Spurdle, Amanda; Beeghly-Fadiel, Alicia; Long, Jirong; Thompson, Deborah; Tomlinson, Ian; Yu, Herbert; Lambrechts, Diether; Dörk, Thilo; Goodman, Marc T.; Zheng, Ying; Salvesen, Helga B.; Bao, Ping-Ping; Amant, Frederic; Beckmann, Matthias W.; Coenegrachts, Lieve; Coosemans, An; Dubrowinskaja, Natalia; Dunning, Alison; Runnebaum, Ingo B.; Easton, Douglas; Ekici, Arif B.; Fasching, Peter A.; Halle, Mari K.; Hein, Alexander; Howarth, Kimberly; Gorman, Maggie; Kaydarova, Dylyara; Krakstad, Camilla; Lose, Felicity; Lu, Lingeng; Lurie, Galina; O’Mara, Tracy; Matsuno, Rayna K.; Pharoah, Paul; Risch, Harvey; Corssen, Madeleine; Trovik, Jone; Turmanov, Nurzhan; Wen, Wanqing; Lu, Wei; Cai, Qiuyin; Zheng, Wei; Shu, Xiao-Ou

2013-01-01

Background Experimental and epidemiological evidence have suggested that chronic inflammation may play a critical role in endometrial carcinogenesis. Methods To investigate this hypothesis, a two-stage study was carried out to evaluate single nucleotide polymorphisms (SNPs) in inflammatory pathway genes in association with endometrial cancer risk. In stage 1, 64 candidate pathway genes were identified and 4,542 directly genotyped or imputed SNPs were analyzed among 832 endometrial cancer cases and 2,049 controls, using data from the Shanghai Endometrial Cancer Genetics Study. Linkage disequilibrium of stage 1 SNPs significantly associated with endometrial cancer (P<0.05) indicated that the majority of associations could be linked to one of 24 distinct loci. One SNP from each of the 24 loci was then selected for follow-up genotyping. Of these, 21 SNPs were successfully designed and genotyped in stage 2, which consisted of ten additional studies including 6,604 endometrial cancer cases and 8,511 controls. Results Five of the 21 SNPs had significant allelic odds ratios and 95% confidence intervals as follows: FABP1, 0.92 (0.85-0.99); CXCL3, 1.16 (1.05-1.29); IL6, 1.08 (1.00-1.17); MSR1, 0.90 (0.82-0.98); and MMP9, 0.91 (0.87-0.97). Two of these polymorphisms were independently significant in the replication sample (rs352038 in CXCL3 and rs3918249 in MMP9). The association for the MMP9 polymorphism remained significant after Bonferroni correction and showed a significant association with endometrial cancer in both Asian- and European-ancestry samples. Conclusions These findings lend support to the hypothesis that genetic polymorphisms in genes involved in the inflammatory pathway may contribute to genetic susceptibility to endometrial cancer. Impact Statement This study adds to the growing evidence that inflammation plays an important role in endometrial carcinogenesis. PMID:23221126

Polymorphic trial in oxidative damage of arsenic exposed Vietnamese.

PubMed

Fujihara, Junko; Soejima, Mikiko; Yasuda, Toshihiro; Koda, Yoshiro; Kunito, Takashi; Iwata, Hisato; Tanabe, Shinsuke; Takeshita, Haruo

2011-10-15

Arsenic causes DNA damage and changes the cellular capacity for DNA repair. Genes in the base excision repair (BER) pathway influence the generation and repair of oxidative lesions. Single nucleotide polymorphisms (SNPs) in human 8-oxoguanine DNA glycosylase (hOGG1) Ser326Cys; apurinic/apyrimidinic endonuclease (APE1) Asp148Glu; X-ray and repair and cross-complementing group 1 (XRCC1) Arg280His and Arg399Gln in the BER genes were analyzed, and the relationship between these 4 SNPs and the urinary 8-hydroxy-2'-deoxyguanosine (8-OHdG) concentrations of 100 Vietnamese population exposed to arsenic was investigated. Individuals with hOGG1 326Cys/Cys showed significantly higher urinary 8-OHdG concentrations than did those with 326 Ser/Cys and Ser/Ser. As for APE1 Asp148Glu, heterozygous subjects showed significantly higher urinary 8-OHdG concentrations than did those homozygous for Asp/Asp. Moreover, global ethnic comparison of the allelic frequencies of the 4SNPs was performed in 10 population and previous reported data. The mutant allele frequencies of hOGG1 Ser326Cys in the Asian populations were higher than those in the African and Caucasian populations. As for APE1 Asp148Glu, Caucasians showed higher mutant frequencies than those shown by African and Asian populations. Among Asian populations, the Bangladeshi population showed relatively higher mutant allele frequencies of the APE1 Asp148Glu polymorphism. This study is the first to demonstrate the existence of genetic heterogeneity in a worldwide distribution of SNPs (hOGG1 Ser326Cys, APE1 Asp148Glu, XRCC1 Arg280His, and XRCC1 Arg399Gln) in the BER genes. Published by Elsevier Inc.

SNPs in DNA repair or oxidative stress genes and late subcutaneous fibrosis in patients following single shot partial breast irradiation

PubMed Central

2012-01-01

Background The aim of this study was to evaluate the potential association between single nucleotide polymorphisms related response to radiotherapy injury, such as genes related to DNA repair or enzymes involved in anti-oxidative activities. The paper aims to identify marker genes able to predict an increased risk of late toxicity studying our group of patients who underwent a Single Shot 3D-CRT PBI (SSPBI) after BCS (breast conserving surgery). Methods A total of 57 breast cancer patients who underwent SSPBI were genotyped for SNPs (single nucleotide polymorphisms) in XRCC1, XRCC3, GST and RAD51 by Pyrosequencing technology. Univariate analysis (ORs and 95% CI) was performed to correlate SNPs with the risk of developing ≥ G2 fibrosis or fat necrosis. Results A higher significant risk of developing ≥ G2 fibrosis or fat necrosis in patients with: polymorphic variant GSTP1 (Ile105Val) (OR = 2.9; 95%CI, 0.88-10.14, p = 0.047). Conclusions The presence of some SNPs involved in DNA repair or response to oxidative stress seem to be able to predict late toxicity. Trial Registration ClinicalTrials.gov: NCT01316328 PMID:22272830

Gene by Environment Investigation of Incident Lung Cancer Risk in African-Americans.

PubMed

David, Sean P; Wang, Ange; Kapphahn, Kristopher; Hedlin, Haley; Desai, Manisha; Henderson, Michael; Yang, Lingyao; Walsh, Kyle M; Schwartz, Ann G; Wiencke, John K; Spitz, Margaret R; Wenzlaff, Angela S; Wrensch, Margaret R; Eaton, Charles B; Furberg, Helena; Mark Brown, W; Goldstein, Benjamin A; Assimes, Themistocles; Tang, Hua; Kooperberg, Charles L; Quesenberry, Charles P; Tindle, Hilary; Patel, Manali I; Amos, Christopher I; Bergen, Andrew W; Swan, Gary E; Stefanick, Marcia L

2016-02-01

Genome-wide association studies have identified polymorphisms linked to both smoking exposure and risk of lung cancer. The degree to which lung cancer risk is driven by increased smoking, genetics, or gene-environment interactions is not well understood. We analyzed associations between 28 single nucleotide polymorphisms (SNPs) previously associated with smoking quantity and lung cancer in 7156 African-American females in the Women's Health Initiative (WHI), then analyzed main effects of top nominally significant SNPs and interactions between SNPs, cigarettes per day (CPD) and pack-years for lung cancer in an independent, multi-center case-control study of African-American females and males (1078 lung cancer cases and 822 controls). Nine nominally significant SNPs for CPD in WHI were associated with incident lung cancer (corrected p-values from 0.027 to 6.09 × 10(-5)). CPD was found to be a nominally significant effect modifier between SNP and lung cancer for six SNPs, including CHRNA5 rs2036527[A](betaSNP*CPD = - 0.017, p = 0.0061, corrected p = 0.054), which was associated with CPD in a previous genome-wide meta-analysis of African-Americans. These results suggest that chromosome 15q25.1 variants are robustly associated with CPD and lung cancer in African-Americans and that the allelic dose effect of these polymorphisms on lung cancer risk is most pronounced in lighter smokers.

Association between mitochondrial DNA variations and schizophrenia in the northern Chinese Han population.

PubMed

Xu, Feng-Ling; Ding, Mei; Yao, Jun; Shi, Zhang-Sen; Wu, Xue; Zhang, Jing-Jing; Pang, Hao; Xing, Jia-Xin; Xuan, Jin-Feng; Wang, Bao-Jie

2017-01-01

To determine whether mitochondrial DNA (mtDNA) variations are associated with schizophrenia, 313 patients with schizophrenia and 326 unaffected participants of the northern Chinese Han population were included in a prospective study. Single-nucleotide polymorphisms (SNPs) including C5178A, A10398G, G13708A, and C13928G were analyzed by polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP). Hypervariable regions I and II (HVSI and HVSII) were analyzed by sequencing. The results showed that the 4 SNPs and 11 haplotypes, composed of the 4 SNPs, did not differ significantly between patient and control groups. No significant association between haplogroups and the risk of schizophrenia was ascertained after Bonferroni correction. Drawing a conclusion, there was no evidence of an association between mtDNA (the 4 SNPs and the control region) and schizophrenia in the northern Chinese Han population.

Single nucleotide polymorphisms of the bovine VEGF-B gene and their associations with growth traits in the Nanyang cattle breed.

PubMed

Pang, Y H; Lei, C Z; Zhang, C L; Lan, X Y; Shao, S M; Gao, X M; Chen, H

2012-01-01

PCR-SSCP and DNA sequencing methods were applied to reveal single nucleotide polymorphisms (SNPs) in the bovine VEGF-B gene in 675 samples belonging to three native Chinese cattle breeds. We found 3 SNPs and a duplication NC_007330.5: g. [782 A>G p. (Gly112 =) (;) 1000-1001dup CT (;) 1079 C>T (;) 2129 G>A p. (Arg184Gln)]. We also observed a statistically significant association of the polymorphism (1000-1001dup CT) in intron 3 of the VEGF-B gene with the body weight of the Nanyang cattle (p < 0.05). This polymorphisms of VEGF-B gene need to be verified among a larger cattle population before it can be identified as a marker for bovine body weight.

Haplotype-Based Genotyping in Polyploids.

PubMed

Clevenger, Josh P; Korani, Walid; Ozias-Akins, Peggy; Jackson, Scott

2018-01-01

Accurate identification of polymorphisms from sequence data is crucial to unlocking the potential of high throughput sequencing for genomics. Single nucleotide polymorphisms (SNPs) are difficult to accurately identify in polyploid crops due to the duplicative nature of polyploid genomes leading to low confidence in the true alignment of short reads. Implementing a haplotype-based method in contrasting subgenome-specific sequences leads to higher accuracy of SNP identification in polyploids. To test this method, a large-scale 48K SNP array (Axiom Arachis2) was developed for Arachis hypogaea (peanut), an allotetraploid, in which 1,674 haplotype-based SNPs were included. Results of the array show that 74% of the haplotype-based SNP markers could be validated, which is considerably higher than previous methods used for peanut. The haplotype method has been implemented in a standalone program, HAPLOSWEEP, which takes as input bam files and a vcf file and identifies haplotype-based markers. Haplotype discovery can be made within single reads or span paired reads, and can leverage long read technology by targeting any length of haplotype. Haplotype-based genotyping is applicable in all allopolyploid genomes and provides confidence in marker identification and in silico-based genotyping for polyploid genomics.

Genetic Polymorphisms in Host Antiviral Genes: Associations with Humoral and Cellular Immunity to Measles Vaccine

PubMed Central

Haralambieva, Iana H.; Ovsyannikova, Inna G.; Umlauf, Benjamin J.; Vierkant, Robert A.; Pankratz, V. Shane; Jacobson, Robert M.; Poland, Gregory A.

2014-01-01

Host antiviral genes are important regulators of antiviral immunity and plausible genetic determinants of immune response heterogeneity after vaccination. We genotyped and analyzed 307 common candidate tagSNPs from 12 antiviral genes in a cohort of 745 schoolchildren immunized with two doses of measles-mumps-rubella vaccine. Associations between SNPs/haplotypes and measles virus-specific immune outcomes were assessed using linear regression methodologies in Caucasians and African-Americans. Genetic variants within the DDX58/RIG-I gene, including a coding polymorphism (rs3205166/Val800Val), were associated as single-SNPs (p≤0.017; although these SNPs did not remain significant after correction for false discovery rate/FDR) and in haplotype-level analysis, with measles-specific antibody variations in Caucasians (haplotype allele p-value=0.021; haplotype global p-value=0.076). Four DDX58 polymorphisms, in high LD, demonstrated also associations (after correction for FDR) with variations in both measles-specific IFN-γ and IL-2 secretion in Caucasians (p≤0.001, q=0.193). Two intronic OAS1 polymorphisms, including the functional OAS1 SNP rs10774671 (p=0.003), demonstrated evidence of association with a significant allele-dose-related increase in neutralizing antibody levels in African-Americans. Genotype and haplotype-level associations demonstrated the role of ADAR genetic variants, including a non-synonymous SNP (rs2229857/Arg384Lys; p=0.01), in regulating measles virus-specific IFN-γ Elispot responses in Caucasians (haplotype global p-value=0.017). After correction FDR, 15 single-SNP associations (11 SNPs in Caucasians and 4 SNPs in African-Americans) still remained significant at the q-value<0.20. In conclusion, our findings strongly point to genetic variants/genes, involved in antiviral sensing and antiviral control, as critical determinants, differentially modulating the adaptive immune responses to live attenuated measles vaccine in Caucasians and African-Americans. PMID:21939710

SNP discovery in common bean by restriction-associated DNA (RAD) sequencing for genetic diversity and population structure analysis.

PubMed

Valdisser, Paula Arielle M R; Pappas, Georgios J; de Menezes, Ivandilson P P; Müller, Bárbara S F; Pereira, Wendell J; Narciso, Marcelo G; Brondani, Claudio; Souza, Thiago L P O; Borba, Tereza C O; Vianello, Rosana P

2016-06-01

Researchers have made great advances into the development and application of genomic approaches for common beans, creating opportunities to driving more real and applicable strategies for sustainable management of the genetic resource towards plant breeding. This work provides useful polymorphic single-nucleotide polymorphisms (SNPs) for high-throughput common bean genotyping developed by RAD (restriction site-associated DNA) sequencing. The RAD tags were generated from DNA pooled from 12 common bean genotypes, including breeding lines of different gene pools and market classes. The aligned sequences identified 23,748 putative RAD-SNPs, of which 3357 were adequate for genotyping; 1032 RAD-SNPs with the highest ADT (assay design tool) score are presented in this article. The RAD-SNPs were structurally annotated in different coding (47.00 %) and non-coding (53.00 %) sequence components of genes. A subset of 384 RAD-SNPs with broad genome distribution was used to genotype a diverse panel of 95 common bean germplasms and revealed a successful amplification rate of 96.6 %, showing 73 % of polymorphic SNPs within the Andean group and 83 % in the Mesoamerican group. A slightly increased He (0.161, n = 21) value was estimated for the Andean gene pool, compared to the Mesoamerican group (0.156, n = 74). For the linkage disequilibrium (LD) analysis, from a group of 580 SNPs (289 RAD-SNPs and 291 BARC-SNPs) genotyped for the same set of genotypes, 70.2 % were in LD, decreasing to 0.10 %in the Andean group and 0.77 % in the Mesoamerican group. Haplotype patterns spanning 310 Mb of the genome (60 %) were characterized in samples from different origins. However, the haplotype frameworks were under-represented for the Andean (7.85 %) and Mesoamerican (5.55 %) gene pools separately. In conclusion, RAD sequencing allowed the discovery of hundreds of useful SNPs for broad genetic analysis of common bean germplasm. From now, this approach provides an excellent panel of molecular tools for whole genome analysis, allowing integrating and better exploring the common bean breeding practices.

Genome-wide association study in discordant sibships identifies multiple inherited susceptibility alleles linked to lung cancer.

PubMed

Galvan, Antonella; Falvella, Felicia S; Frullanti, Elisa; Spinola, Monica; Incarbone, Matteo; Nosotti, Mario; Santambrogio, Luigi; Conti, Barbara; Pastorino, Ugo; Gonzalez-Neira, Anna; Dragani, Tommaso A

2010-03-01

We analyzed a series of young (median age = 52 years) non-smoker lung cancer patients and their unaffected siblings as controls, using a genome-wide 620 901 single-nucleotide polymorphism (SNP) array analysis and a case-control DNA pooling approach. We identified 82 putatively associated SNPs that were retested by individual genotyping followed by use of the sib transmission disequilibrium test, pointing to 36 SNPs associated with lung cancer risk in the discordant sibs series. Analysis of these 36 SNPs in a polygenic model characterized by additive and interchangeable effects of rare alleles revealed a highly statistically significant dosage-dependent association between risk allele carrier status and proportion of cancer cases. Replication of the same 36 SNPs in a population-based series confirmed the association with lung cancer for three SNPs, suggesting that phenocopies and genetic heterogeneity can play a major role in the complex genetics of lung cancer risk in the general population.

Different effects of apolipoprotein A5 SNPs and haplotypes on triglyceride concentration in three ethnic origins.

PubMed

Ken-Dror, Gie; Goldbourt, Uri; Dankner, Rachel

2010-05-01

Several polymorphisms in the ApoA5 gene emerged as important candidate genes in triglyceride metabolism. The aim of this study was to determine the associations between ApoA5 polymorphisms, plasma triglyceride concentrations and the presence of cardiovascular disease (CVD) in three ethnic origins. Genotypes for 15 single nucleotide polymorphisms (SNPs) were determined in 659 older adults (mean age 71+/-7 years) who immigrated to Israel or whose ancestors originated from East Europe (Ashkenazi), North Africa, Asia (Sephardic) or Yemen (Yemenite). The minor alleles of the four common SNPs (rs662799, rs651821, rs2072560 and rs2266788) are associated with an increase of 27-38% in triglyceride concentration among Ashkenazi and Yemenite Jews compared with the major alleles, but not among those of Sephardic origin. Conversely, among the Sephardic group, the presence of the minor allele in SNP rs3135506 compared with the major allele was associated with an increase of 34% in triglyceride concentration. The four SNPs were in significant linkage disequilibrium (D'=0.96-0.99), resulting in three haplotypes H1, H2 and H3, representing 98-99% of the population. Haplotype H2 was significantly associated with triglyceride concentration among Ashkenazi and Yemenite but not among Sephardic Jews. Conversely, haplotype H3 was associated with triglyceride concentration in Sephardic but not in Ashkenazi and Yemenite Jews. Ashkenazi carriers of H2 haplotype had a CVD odds ratio of 2.19 (95% CI: 1.05-4.58) compared with H1 (the most frequent), after adjustment for all other risk factors. These results suggest that different SNPs in ApoA5 polymorphisms may be associated with triglyceride concentration and CVD in each of these ethnic origins.

Genetic polymorphisms within tumor necrosis factor gene promoter region: a role for susceptibility to ventilator-associated pneumonia.

PubMed

Kotsaki, Antigoni; Raftogiannis, Maria; Routsi, Christina; Baziaka, Fotini; Kotanidou, Anastasia; Antonopoulou, Anastasia; Orfanos, Stylianos E; Katsenos, Chrisostomos; Koutoukas, Pantelis; Plachouras, Diamantis; Mandragos, Konstantinos; Giamarellos-Bourboulis, Evangelos J

2012-08-01

Debatable findings exist among various studies regarding the impact of single nucleotide polymorphisms (SNPs) within the promoter region of the tumor necrosis factor (TNF) gene for susceptibility to infections. Their impact was investigated in a cohort of mechanically ventilated patients who developed ventilator-associated pneumonia (VAP). Two-hundred and thirteen mechanically ventilated patients who developed VAP were enrolled. Genomic DNA was extracted and SNPs at the -376, -308 and -238 position of the promoter region of the TNF gene were assessed by restriction fragment length polymorphisms. Monocytes were isolated from 47 patients when they developed sepsis and stimulated by bacterial endotoxin for the production of TNFα and of interleukin-6 (IL-6). Patients were divided into two groups; 166 patients bearing only wild-type alleles of all three studied polymorphisms; and 47 patients carrying at least one A allele of the three studied SNPs. Time between start of mechanical ventilation and advent of VAP was significantly shorter in the second group than in the first group (log-rank: 4.416, p: 0.041). When VAP supervened, disease severity did not differ between groups. Stimulation of TNFα and of IL-6 was much greater by monocytes for patients carrying A alleles. Carriage of at least one A allele of the three studied SNPs at the promoter region of the TNF-gene is associated with shorter time to development of VAP but it is not associated with disease severity. Findings may be related with a role of the studied SNPs in the production of pro-inflammatory cytokines. Copyright © 2012 Elsevier Ltd. All rights reserved.

Dopamine D2 receptor gene polymorphisms and externalizing behaviors in children and adolescents.

PubMed

Della Torre, Osmar Henrique; Paes, Lúcia Arisaka; Henriques, Taciane Barbosa; de Mello, Maricilda Palandi; Celeri, Eloisa Helena Rubello Valler; Dalgalarrondo, Paulo; Guerra-Júnior, Gil; Santos-Júnior, Amilton Dos

2018-05-02

Dopamine is involved in several cerebral physiological processes, and single nucleotide polymorphisms (SNP) in the dopamine D2 receptor gene (DRD2) have been associated with numerous neurological and mental disorders, including those involving alterations in cognitive and emotional processes. The aim of this study was to evaluate the association between the SNPs c.957C > T (rs6277) and c.-585A > G (rs1799978) in the DRD2 gene and behavioral characteristics of children and adolescents based on an inventory of the Child Behavior Checklist (CBCL). Children and adolescents between 8 and 20 years old who were clinically followed-up were genotyped for the SNPs c.957C > T and c.-585A > G, and related to data of the CBCL/6-18 scale assessment performed with the help of caregivers. The chi-squared test was used to assess the differences in the frequencies of the C and T alleles in the polymorphism c.957C > T and of the A and G alleles in the polymorphism c.-585A > G with respect to the grouped CBCL scores at a significance level of 5%. Multiple logistic regression models were performed, to control whether sex and/or ethnicity could influence the results. Eighty-five patients were assessed overall, and the presence of the T allele (C/T and T/T) of DRD2 c.957C > T polymorphism was found to be significantly associated with the occurrence of defiant and oppositional problems and with attention and hyperactivity problems. There were no associations detected with polymorphism DRD2 c.-585A > G polymorphism. Both SNPs were in Hardy-Weinberg-equilibrium. Although the findings of this study are preliminary, due to its small number of participants, the presence of T allele (C/T, T/T) in c.957C > T SNP was associated with difficulty in impulse control, self-control of emotions, and conduct adjustment, which can contribute to improving the identification of mental and behavioral phenotypes associated with gene expression.

Functional polymorphisms of circadian negative feedback regulation genes are associated with clinical outcome in hepatocellular carcinoma patients receiving radical resection.

PubMed

Zhang, Zhaohui; Ma, Fei; Zhou, Feng; Chen, Yibing; Wang, Xiaoyan; Zhang, Hongxin; Zhu, Yong; Bi, Jianwei; Zhang, Yiguan

2014-12-01

Previous studies have demonstrated that circadian negative feedback loop genes play an important role in the development and progression of many cancers. However, the associations between single-nucleotide polymorphisms (SNPs) in these genes and the clinical outcomes of hepatocellular carcinoma (HCC) after surgical resection have not been studied so far. Thirteen functional SNPs in circadian genes were genotyped using the Sequenom iPLEX genotyping system in a cohort of 489 Chinese HCC patients who received radical resection. Multivariate Cox proportional hazards model and Kaplan-Meier curve were used for the prognosis analysis. Cumulative effect analysis and survival tree analysis were used for the multiple SNPs analysis. Four individual SNPs, including rs3027178 in PER1, rs228669 and rs2640908 in PER3 and rs3809236 in CRY1, were significantly associated with overall survival (OS) of HCC patients, and three SNPs, including rs3027178 in PER1, rs228729 in PER3 and rs3809236 in CRY1, were significantly associated with recurrence-free survival (RFS). Moreover, we observed a cumulative effect of significant SNPs on OS and RFS (P for trend < 0.001 for both). Survival tree analysis indicated that wild genotype of rs228729 in PER3 was the primary risk factor contributing to HCC patients' RFS. Our study suggests that the polymorphisms in circadian negative feedback loop genes may serve as independent prognostic biomarkers in predicting clinical outcomes for HCC patients who received radical resection. Further studies with different ethnicities are needed to validate our findings and generalize its clinical utility.

FIFS: A data mining method for informative marker selection in high dimensional population genomic data.

PubMed

Kavakiotis, Ioannis; Samaras, Patroklos; Triantafyllidis, Alexandros; Vlahavas, Ioannis

2017-11-01

Single Nucleotide Polymorphism (SNPs) are, nowadays, becoming the marker of choice for biological analyses involving a wide range of applications with great medical, biological, economic and environmental interest. Classification tasks i.e. the assignment of individuals to groups of origin based on their (multi-locus) genotypes, are performed in many fields such as forensic investigations, discrimination between wild and/or farmed populations and others. Τhese tasks, should be performed with a small number of loci, for computational as well as biological reasons. Thus, feature selection should precede classification tasks, especially for Single Nucleotide Polymorphism (SNP) datasets, where the number of features can amount to hundreds of thousands or millions. In this paper, we present a novel data mining approach, called FIFS - Frequent Item Feature Selection, based on the use of frequent items for selection of the most informative markers from population genomic data. It is a modular method, consisting of two main components. The first one identifies the most frequent and unique genotypes for each sampled population. The second one selects the most appropriate among them, in order to create the informative SNP subsets to be returned. The proposed method (FIFS) was tested on a real dataset, which comprised of a comprehensive coverage of pig breed types present in Britain. This dataset consisted of 446 individuals divided in 14 sub-populations, genotyped at 59,436 SNPs. Our method outperforms the state-of-the-art and baseline methods in every case. More specifically, our method surpassed the assignment accuracy threshold of 95% needing only half the number of SNPs selected by other methods (FIFS: 28 SNPs, Delta: 70 SNPs Pairwise FST: 70 SNPs, In: 100 SNPs.) CONCLUSION: Our approach successfully deals with the problem of informative marker selection in high dimensional genomic datasets. It offers better results compared to existing approaches and can aid biologists in selecting the most informative markers with maximum discrimination power for optimization of cost-effective panels with applications related to e.g. species identification, wildlife management, and forensics. Copyright © 2017 Elsevier Ltd. All rights reserved.

Canonical single nucleotide polymorphisms (SNPs) for high-resolution subtyping of Shiga-toxin producing Escherichia coli (STEC) O157:H7

USDA-ARS?s Scientific Manuscript database

The objective of this study was to develop a canonical SNP panel for subtyping of Shiga-toxin producing Escherichia coli (STEC). To this purpose, 906 putative SNPs were identified using resequencing tiling arrays. A subset of 391 SNPs was further screened using high-throughput TaqMan PCR against a d...

A Multi-Trait, Meta-analysis for Detecting Pleiotropic Polymorphisms for Stature, Fatness and Reproduction in Beef Cattle

PubMed Central

Bolormaa, Sunduimijid; Pryce, Jennie E.; Reverter, Antonio; Zhang, Yuandan; Barendse, William; Kemper, Kathryn; Tier, Bruce; Savin, Keith; Hayes, Ben J.; Goddard, Michael E.

2014-01-01

Polymorphisms that affect complex traits or quantitative trait loci (QTL) often affect multiple traits. We describe two novel methods (1) for finding single nucleotide polymorphisms (SNPs) significantly associated with one or more traits using a multi-trait, meta-analysis, and (2) for distinguishing between a single pleiotropic QTL and multiple linked QTL. The meta-analysis uses the effect of each SNP on each of n traits, estimated in single trait genome wide association studies (GWAS). These effects are expressed as a vector of signed t-values (t) and the error covariance matrix of these t values is approximated by the correlation matrix of t-values among the traits calculated across the SNP (V). Consequently, t'V−1t is approximately distributed as a chi-squared with n degrees of freedom. An attractive feature of the meta-analysis is that it uses estimated effects of SNPs from single trait GWAS, so it can be applied to published data where individual records are not available. We demonstrate that the multi-trait method can be used to increase the power (numbers of SNPs validated in an independent population) of GWAS in a beef cattle data set including 10,191 animals genotyped for 729,068 SNPs with 32 traits recorded, including growth and reproduction traits. We can distinguish between a single pleiotropic QTL and multiple linked QTL because multiple SNPs tagging the same QTL show the same pattern of effects across traits. We confirm this finding by demonstrating that when one SNP is included in the statistical model the other SNPs have a non-significant effect. In the beef cattle data set, cluster analysis yielded four groups of QTL with similar patterns of effects across traits within a group. A linear index was used to validate SNPs having effects on multiple traits and to identify additional SNPs belonging to these four groups. PMID:24675618

Genotypic distribution of single nucleotide polymorphisms in oral cancer: global scene.

PubMed

Multani, Shaleen; Saranath, Dhananjaya

2016-11-01

Globocan 2012 reports the global oral cancer incidence of 300,373 new oral cancer cases annually, contributing to 2.1 % of the world cancer burden. The major well-established risk factors for oral cancer include tobacco, betel/areca nut, alcohol and high-risk oncogenic human papilloma virus (HPV) 16/18. However, only 5-10 % of individuals with high-risk lifestyle develop oral cancer. Thus, genomic variants in individuals represented as single nucleotide polymorphisms (SNPs) influence susceptibility to oral cancer. With a view to understanding the role of genomic variants in oral cancer, we reviewed SNPs in case-control studies with a minimum of 100 cases and 100 controls. PubMed and HuGE navigator search engines were used to obtain data published from 1990 to 2015, which identified 67 articles investigating the role of SNPs in oral cancer. Single publications reported 93 SNPs in 55 genes, with 34 SNPs associated with a risk of oral cancer. Meta-analysis of data in multiple studies defined nine SNPs associated with a risk of oral cancer. The genes were associated with critical functions deregulated in cancers, including cell proliferation, immune function, inflammation, transcription, DNA repair and xenobiotic metabolism.

Epicuticular waxes and thrips resistance in onion

USDA-ARS?s Scientific Manuscript database

Next-generation sequencing of normalized cDNAs from two inbred lines of onion revealed over 3000 well supported single nucleotide polymorphisms (SNPs), of which over 800 have been mapped. This SNP-based map was used to identify quantitative trait loci (QTL) controlling the amounts and types of epicu...

76 FR 4921 - Government-Owned Inventions; Availability for Licensing

Federal Register 2010, 2011, 2012, 2013, 2014

2011-01-27

... chemical imaging (IRCI) to detect nanostructure-based DNA microarrays, which can be utilized in the life science research arena to examine gene expression and single nucleotide polymorphisms (SNPs), as well as... can be applied to the areas of environmental sciences, agriculture research, bio-defense, diagnostics...

Genome-wide association study on growth traits in Colombian creole breeds and crossbreeds with Zebu cattle.

PubMed

Martínez, R; Gómez, Y; Rocha, J F M

2014-08-25

Whole genome selection represents an important tool for improving parameters related to the production of livestock. In order to build genomic selection indexes within a particular breed, it is important to identify polymorphisms that have the most significant association with a desired trait. A genome-wide marker association approach based on the Illumina BovineSNP50 BeadChip(TM) was used to identify genomic regions affecting birth weight (BW), weaning weight (WW), and daily weight gain (DWG) in purebred and crossbred creole cattle populations. We genotyped 654 individuals of Blanco Orejinegro (BON), Romosinuano (ROMO) and Cebú breeds and the crossbreeds BON x Cebú and ROMO x Cebú, and tested 5 genetic control models. In total, 85 single nucleotide polymorphisms (SNPs) were related (P < 0.05) to the 3 evaluated traits; BW was associated with the highest number of SNPs. For statistical false-positive correction, Bonferroni correction was used. From the results, we identified 7, 6, and 4 SNPs with strong associations with BW, WW, and DWG, respectively. Many of these SNPs were located on important coding regions of the bovine genome; their ontology and interactions are discussed herein. The results could contribute to the identification of genes involved in the physiology of beef cattle growth and the development of new strategies for breeding management via genomic selection to improve the productivity of creole cattle herds.

Population structure of pigs determined by single nucleotide polymorphisms observed in assembled expressed sequence tags.

PubMed

Matsumoto, Toshimi; Okumura, Naohiko; Uenishi, Hirohide; Hayashi, Takeshi; Hamasima, Noriyuki; Awata, Takashi

2012-01-01

We have collected more than 190000 porcine expressed sequence tags (ESTs) from full-length complementary DNA (cDNA) libraries and identified more than 2800 single nucleotide polymorphisms (SNPs). In this study, we tentatively chose 222 SNPs observed in assembled ESTs to study pigs of different breeds; 104 were selected by comparing the cDNA sequences of a Meishan pig and samples of three-way cross pigs (Landrace, Large White, and Duroc: LWD), and 118 were selected from LWD samples. To evaluate the genetic variation between the chosen SNPs from pig breeds, we determined the genotypes for 192 pig samples (11 pig groups) from our DNA reference panel with matrix-assisted laser desorption ionization time-of-flight mass spectrometry. Of the 222 reference SNPs, 186 were successfully genotyped. A neighbor-joining tree showed that the pig groups were classified into two large clusters, namely, Euro-American and East Asian pig populations. F-statistics and the analysis of molecular variance of Euro-American pig groups revealed that approximately 25% of the genetic variations occurred because of intergroup differences. As the F(IS) values were less than the F(ST) values(,) the clustering, based on the Bayesian inference, implied that there was strong genetic differentiation among pig groups and less divergence within the groups in our samples. © 2011 The Authors. Animal Science Journal © 2011 Japanese Society of Animal Science.

[Genetic diversity analysis of Andrographis paniculata in China based on SRAP and SNP].

PubMed

Chen, Rong; Wang, Xiao-Yun; Song, Yu-Ning; Zhu, Yun-feng; Wang, Peng-liang; Li, Min; Zhong, Guo-Yue

2014-12-01

In order to reveal genetic diversity of domestic Andrographis paniculata and its impact on quality, genetic backgrounds of 103 samples from 7 provinces in China were analyzed using SRAP marker and SNP marker. Genetic structures of the A. paniculata populations were estimated with Powermarker V 3.25 and Mega 6.0 software, and polymorphic SNPs were identified with CodonCode Aligner software. The results showed that the genetic distances of domestic A. paniculata germplasm ranged from 0. 01 to 0.09, and no polymorphic SNPs were discovered in coding sequence fragments of ent-copalyl diphosphate synthase. A. paniculata germplasm from various regions in China had poor genetic diversity. This phenomenon was closely related to strict self-fertilization and earlier introduction from the same origin. Therefore, genetic background had little impact on variable qualities of A. paniculata in domestic market. Mutation breeding, polyploid breeding and molecular breeding were proposed as promising strategies in germplasm innovation.

Automated SNP detection from a large collection of white spruce expressed sequences: contributing factors and approaches for the categorization of SNPs

PubMed Central

Pavy, Nathalie; Parsons, Lee S; Paule, Charles; MacKay, John; Bousquet, Jean

2006-01-01

Background High-throughput genotyping technologies represent a highly efficient way to accelerate genetic mapping and enable association studies. As a first step toward this goal, we aimed to develop a resource of candidate Single Nucleotide Polymorphisms (SNP) in white spruce (Picea glauca [Moench] Voss), a softwood tree of major economic importance. Results A white spruce SNP resource encompassing 12,264 SNPs was constructed from a set of 6,459 contigs derived from Expressed Sequence Tags (EST) and by using the bayesian-based statistical software PolyBayes. Several parameters influencing the SNP prediction were analysed including the a priori expected polymorphism, the probability score (PSNP), and the contig depth and length. SNP detection in 3' and 5' reads from the same clones revealed a level of inconsistency between overlapping sequences as low as 1%. A subset of 245 predicted SNPs were verified through the independent resequencing of genomic DNA of a genotype also used to prepare cDNA libraries. The validation rate reached a maximum of 85% for SNPs predicted with either PSNP ≥ 0.95 or ≥ 0.99. A total of 9,310 SNPs were detected by using PSNP ≥ 0.95 as a criterion. The SNPs were distributed among 3,590 contigs encompassing an array of broad functional categories, with an overall frequency of 1 SNP per 700 nucleotide sites. Experimental and statistical approaches were used to evaluate the proportion of paralogous SNPs, with estimates in the range of 8 to 12%. The 3,789 coding SNPs identified through coding region annotation and ORF prediction, were distributed into 39% nonsynonymous and 61% synonymous substitutions. Overall, there were 0.9 SNP per 1,000 nonsynonymous sites and 5.2 SNPs per 1,000 synonymous sites, for a genome-wide nonsynonymous to synonymous substitution rate ratio (Ka/Ks) of 0.17. Conclusion We integrated the SNP data in the ForestTreeDB database along with functional annotations to provide a tool facilitating the choice of candidate genes for mapping purposes or association studies. PMID:16824208

Functional Polymorphisms of Base Excision Repair Genes XRCC1 and APEX1 Predict Risk of Radiation Pneumonitis in Patients With Non-Small Cell Lung Cancer Treated With Definitive Radiation Therapy

DOE Office of Scientific and Technical Information (OSTI.GOV)

Yin Ming; Liao Zhongxing; Liu Zhensheng

2011-11-01

Purpose: To explore whether functional single nucleotide polymorphisms (SNPs) of base-excision repair genes are predictors of radiation treatment-related pneumonitis (RP), we investigated associations between functional SNPs of ADPRT, APEX1, and XRCC1 and RP development. Methods and Materials: We genotyped SNPs of ADPRT (rs1136410 [V762A]), XRCC1 (rs1799782 [R194W], rs25489 [R280H], and rs25487 [Q399R]), and APEX1 (rs1130409 [D148E]) in 165 patients with non-small cell lung cancer (NSCLC) who received definitive chemoradiation therapy. Results were assessed by both Logistic and Cox regression models for RP risk. Kaplan-Meier curves were generated for the cumulative RP probability by the genotypes. Results: We found that SNPsmore » of XRCC1 Q399R and APEX1 D148E each had a significant effect on the development of Grade {>=}2 RP (XRCC1: AA vs. GG, adjusted hazard ratio [HR] = 0.48, 95% confidence interval [CI], 0.24-0.97; APEX1: GG vs. TT, adjusted HR = 3.61, 95% CI, 1.64-7.93) in an allele-dose response manner (Trend tests: p = 0.040 and 0.001, respectively). The number of the combined protective XRCC1 A and APEX1 T alleles (from 0 to 4) also showed a significant trend of predicting RP risk (p = 0.001). Conclusions: SNPs of the base-excision repair genes may be biomarkers for susceptibility to RP. Larger prospective studies are needed to validate our findings.« less

Comparative Analysis of Disease-Linked Single Nucleotide Polymorphic Markers from Brassica rapa for Their Applicability to Brassica oleracea

PubMed Central

Cho, Young-Il; Ahn, Yul-Kyun; Tripathi, Swati; Kim, Jeong-Ho; Lee, Hye-Eun; Kim, Do-Sun

2015-01-01

Numerous studies using single nucleotide polymorphisms (SNPs) have been conducted in humans, and other animals, and in major crops, including rice, soybean, and Chinese cabbage. However, the number of SNP studies in cabbage is limited. In this present study, we evaluated whether 7,645 SNPs previously identified as molecular markers linked to disease resistance in the Brassica rapa genome could be applied to B. oleracea. In a BLAST analysis using the SNP sequences of B. rapa and B. oleracea genomic sequence data registered in the NCBI database, 256 genes for which SNPs had been identified in B. rapa were found in B. oleracea. These genes were classified into three functional groups: molecular function (64 genes), biological process (96 genes), and cellular component (96 genes). A total of 693 SNP markers, including 145 SNP markers [BRH—developed from the B. rapa genome for high-resolution melt (HRM) analysis], 425 SNP markers (BRP—based on the B. rapa genome that could be applied to B. oleracea), and 123 new SNP markers (BRS—derived from BRP and designed for HRM analysis), were investigated for their ability to amplify sequences from cabbage genomic DNA. In total, 425 of the SNP markers (BRP-based on B. rapa genome), selected from 7,645 SNPs, were successfully applied to B. oleracea. Using PCR, 108 of 145 BRH (74.5%), 415 of 425 BRP (97.6%), and 118 of 123 BRS (95.9%) showed amplification, suggesting that it is possible to apply SNP markers developed based on the B. rapa genome to B. oleracea. These results provide valuable information that can be utilized in cabbage genetics and breeding programs using molecular markers derived from other Brassica species. PMID:25790283

ILDgenDB: integrated genetic knowledge resource for interstitial lung diseases (ILDs).

PubMed

Mishra, Smriti; Shah, Mohammad I; Sarkar, Malay; Asati, Nimisha; Rout, Chittaranjan

2018-01-01

Interstitial lung diseases (ILDs) are a diverse group of ∼200 acute and chronic pulmonary disorders that are characterized by variable amounts of inflammation, fibrosis and architectural distortion with substantial morbidity and mortality. Inaccurate and delayed diagnoses increase the risk, especially in developing countries. Studies have indicated the significant roles of genetic elements in ILDs pathogenesis. Therefore, the first genetic knowledge resource, ILDgenDB, has been developed with an objective to provide ILDs genetic data and their integrated analyses for the better understanding of disease pathogenesis and identification of diagnostics-based biomarkers. This resource contains literature-curated disease candidate genes (DCGs) enriched with various regulatory elements that have been generated using an integrated bioinformatics workflow of databases searches, literature-mining and DCGs-microRNA (miRNAs)-single nucleotide polymorphisms (SNPs) association analyses. To provide statistical significance to disease-gene association, ILD-specificity index and hypergeomatric test scores were also incorporated. Association analyses of miRNAs, SNPs and pathways responsible for the pathogenesis of different sub-classes of ILDs were also incorporated. Manually verified 299 DCGs and their significant associations with 1932 SNPs, 2966 miRNAs and 9170 miR-polymorphisms were also provided. Furthermore, 216 literature-mined and proposed biomarkers were identified. The ILDgenDB resource provides user-friendly browsing and extensive query-based information retrieval systems. Additionally, this resource also facilitates graphical view of predicted DCGs-SNPs/miRNAs and literature associated DCGs-ILDs interactions for each ILD to facilitate efficient data interpretation. Outcomes of analyses suggested the significant involvement of immune system and defense mechanisms in ILDs pathogenesis. This resource may potentially facilitate genetic-based disease monitoring and diagnosis.Database URL: http://14.139.240.55/ildgendb/index.php.

Polymorphisms within the FANCA gene associate with premature ovarian failure in Korean women.

PubMed

Pyun, Jung-A; Kim, Sunshin; Cha, Dong Hyun; Kwack, KyuBum

2014-05-01

This study investigated whether polymorphisms within the Fanconi anemia complementation group A (FANCA) gene contribute to the increased risk of premature ovarian failure (POF) in Korean women. Ninety-eight women with POF and 218 controls participated in this study. Genomic DNA from peripheral blood was isolated, and GoldenGate genotyping assay was used to identify single nucleotide polymorphisms (SNPs) within the FANCA gene. Two significant SNPs (rs1006547 and rs2239359; P < 0.05) were identified by logistic regression analysis, but results were insignificant after Bonferroni correction. Six SNPs formed a linkage disequilibrium block, and three main haplotypes were found. Two of three haplotypes (AAAGAA and GGGAGG) distributed highly in the POF group, whereas the remaining haplotype (GGAAGG) distributed highly in the control group by logistic regression analysis (highest odds ratio, 2.515; 95% CI, 1.515-4.175; P = 0.00036). Our observations suggest that genetic variations in the FANCA gene may increase the risk for POF in Korean women.

Nonassociation of homocysteine gene polymorphisms with treatment outcome in South Indian Tamil Rheumatoid Arthritis patients.

PubMed

Muralidharan, Niveditha; Gulati, Reena; Misra, Durga Prasanna; Negi, Vir S

2018-02-01

The aim of the study was to look for any association of MTR 2756A>G and MTRR 66A>G gene polymorphisms with clinical phenotype, methotrexate (MTX) treatment response, and MTX-induced adverse events in South Indian Tamil patients with rheumatoid arthritis (RA). A total of 335 patients with RA were investigated. MTR 2756A>G gene polymorphism was analyzed by PCR-RFLP, and MTRR 66A>G SNP was analyzed by TaqMan 5' nuclease assay. The allele frequencies were compared with HapMap groups. MTR 2756G allele was found to be associated with risk of developing RA. The allele frequencies of MTR 2756A>G and MTRR 66A>G SNPs in controls differed significantly when compared with HapMap groups. Neither of the SNPs influenced the MTX treatment outcome and adverse effects. Neither of the SNPs seems to be associated with MTX treatment outcome and adverse events in South Indian Tamil patients with RA.

A false single nucleotide polymorphism generated by gene duplication compromises meat traceability.

PubMed

Sanz, Arianne; Ordovás, Laura; Zaragoza, Pilar; Sanz, Albina; de Blas, Ignacio; Rodellar, Clementina

2012-07-01

Controlling meat traceability using SNPs is an effective method of ensuring food safety. We have analyzed several SNPs to create a panel for bovine genetic identification and traceability studies. One of these was the transversion g.329C>T (Genbank accession no. AJ496781) on the cytochrome P450 17A1 gene, which has been included in previously published panels. Using minisequencing reactions, we have tested 701 samples belonging to eight Spanish cattle breeds. Surprisingly, an excess of heterozygotes was detected, implying an extreme departure from Hardy-Weinberg equilibrium (P<0.001). By alignment analysis and sequencing, we detected that the g.329C>T SNP is a false positive polymorphism, which allows us to explain the inflated heterozygotic value. We recommend that this ambiguous SNP, as well as other polymorphisms located in this region, should not be used in identification, traceability or disease association studies. Annotation of these false SNPs should improve association studies and avoid misinterpretations. Copyright © 2012 Elsevier Ltd. All rights reserved.

Polymorphism of prion protein gene in Arctic fox (Vulpes lagopus).

PubMed

Wan, Jiayu; Bai, Xue; Liu, Wensen; Xu, Jing; Xu, Ming; Gao, Hongwei

2009-07-01

Prion diseases are fatal neurodegenerative disorders of humans and certain other mammals. Prion protein gene (Prnp) is associated with susceptibility and species barrier to prion diseases. No natural and experimental prion diseases have been documented to date in Arctic fox. In the present study, coding region of Prnp from 135 Arctic foxes were cloned and screened for polymorphisms. Our results indicated that the Arctic fox Prnp open reading frame (ORF) contains 771 nucleotides encoding 257 amino acids. Four single nucleotide polymorphisms (SNPs) (G312C, A337G, C541T, and A723G) were identified. SNPs G312C and A723G produced silent mutations, but SNPs A337G and C541T resulted in a M-V change at codon 113 and R-C at codon 181, respectively. The Arctic fox Prnp amino acid sequence was similar to that of the dog (XM 542906). In short, this study provides preliminary information about genotypes of Prnp in Arctic fox.

Probing genomic diversity and evolution of Escherichia coli O157 by single nucleotide polymorphisms.

PubMed

Zhang, Wei; Qi, Weihong; Albert, Thomas J; Motiwala, Alifiya S; Alland, David; Hyytia-Trees, Eija K; Ribot, Efrain M; Fields, Patricia I; Whittam, Thomas S; Swaminathan, Bala

2006-06-01

Infections by Shiga toxin-producing Escherichia coli O157:H7 (STEC O157) are the predominant cause of bloody diarrhea and hemolytic uremic syndrome in the United States. In silico comparison of the two complete STEC O157 genomes (Sakai and EDL933) revealed a strikingly high level of sequence identity in orthologous protein-coding genes, limiting the use of nucleotide sequences to study the evolution and epidemiology of this bacterial pathogen. To systematically examine single nucleotide polymorphisms (SNPs) at a genome scale, we designed comparative genome sequencing microarrays and analyzed 1199 chromosomal genes (a total of 1,167,948 bp) and 92,721 bp of the large virulence plasmid (pO157) of eleven outbreak-associated STEC O157 strains. We discovered 906 SNPs in 523 chromosomal genes and observed a high level of DNA polymorphisms among the pO157 plasmids. Based on a uniform rate of synonymous substitution for Escherichia coli and Salmonella enterica (4.7x10(-9) per site per year), we estimate that the most recent common ancestor of the contemporary beta-glucuronidase-negative, non-sorbitolfermenting STEC O157 strains existed ca. 40 thousand years ago. The phylogeny of the STEC O157 strains based on the informative synonymous SNPs was compared to the maximum parsimony trees inferred from pulsed-field gel electrophoresis and multilocus variable numbers of tandem repeats analysis. The topological discrepancies indicate that, in contrast to the synonymous mutations, parts of STEC O157 genomes have evolved through different mechanisms with highly variable divergence rates. The SNP loci reported here will provide useful genetic markers for developing high-throughput methods for fine-resolution genotyping of STEC O157. Functional characterization of nucleotide polymorphisms should shed new insights on the evolution, epidemiology, and pathogenesis of STEC O157 and related pathogens.

Probing genomic diversity and evolution of Escherichia coli O157 by single nucleotide polymorphisms

PubMed Central

Zhang, Wei; Qi, Weihong; Albert, Thomas J.; Motiwala, Alifiya S.; Alland, David; Hyytia-Trees, Eija K.; Ribot, Efrain M.; Fields, Patricia I.; Whittam, Thomas S.; Swaminathan, Bala

2006-01-01

Infections by Shiga toxin-producing Escherichia coli O157:H7 (STEC O157) are the predominant cause of bloody diarrhea and hemolytic uremic syndrome in the United States. In silico comparison of the two complete STEC O157 genomes (Sakai and EDL933) revealed a strikingly high level of sequence identity in orthologous protein-coding genes, limiting the use of nucleotide sequences to study the evolution and epidemiology of this bacterial pathogen. To systematically examine single nucleotide polymorphisms (SNPs) at a genome scale, we designed comparative genome sequencing microarrays and analyzed 1199 chromosomal genes (a total of 1,167,948 bp) and 92,721 bp of the large virulence plasmid (pO157) of eleven outbreak-associated STEC O157 strains. We discovered 906 SNPs in 523 chromosomal genes and observed a high level of DNA polymorphisms among the pO157 plasmids. Based on a uniform rate of synonymous substitution for Escherichia coli and Salmonella enterica (4.7 × 10−9 per site per year), we estimate that the most recent common ancestor of the contemporary β-glucuronidase-negative, non-sorbitolfermenting STEC O157 strains existed ca. 40 thousand years ago. The phylogeny of the STEC O157 strains based on the informative synonymous SNPs was compared to the maximum parsimony trees inferred from pulsed-field gel electrophoresis and multilocus variable numbers of tandem repeats analysis. The topological discrepancies indicate that, in contrast to the synonymous mutations, parts of STEC O157 genomes have evolved through different mechanisms with highly variable divergence rates. The SNP loci reported here will provide useful genetic markers for developing high-throughput methods for fine-resolution genotyping of STEC O157. Functional characterization of nucleotide polymorphisms should shed new insights on the evolution, epidemiology, and pathogenesis of STEC O157 and related pathogens. PMID:16606700

Polymorphisms in the vitamin D receptor and their associations with risk of schizophrenia and selected anthropometric measures.

PubMed

Handoko, H Y; Nancarrow, D J; Mowry, B J; McGrath, J J

2006-01-01

The association between vitamin D levels and skeletal growth has long been recognized. However, exposure to low levels of vitamin D during early life is also known to alter brain development, and is a candidate risk factor for schizophrenia. This study examines the association between four polymorphisms in the vitamin D receptor (VDR) and 1) risk of schizophrenia, and 2) three anthropometric variables (height, head size, and head shape). Four single-nucleotide polymorphisms (SNPs; rs10735810/FokI, rs1544410/BsmI, rs7975232/ApaI, and rs731236/TaqI) in the VDR gene were genotyped in 179 individuals with schizophrenia and 189 healthy controls. No significant associations were detected between any of the four VDR SNPs and risk of schizophrenia. Patients were slightly but significantly shorter compared to controls. Of the four SNPs, only rs10735810/FokI was associated with any of the anthropometric measures: the M4 isoform of this SNP was significantly associated with larger head size (P = 0.002). In light of the evidence demonstrating a role for vitamin D during brain development, the association between polymorphisms in VDR and brain development warrants closer scrutiny.

Association study of genes controlling IL-12-dependent IFN-γ immunity: STAT4 alleles increase risk of pulmonary tuberculosis in Morocco.

PubMed

Sabri, Ayoub; Grant, Audrey V; Cosker, Kristel; El Azbaoui, Safa; Abid, Ahmed; Abderrahmani Rhorfi, Ismail; Souhi, Hicham; Janah, Hicham; Alaoui-Tahiri, Kebir; Gharbaoui, Yasser; Benkirane, Majid; Orlova, Marianna; Boland, Anne; Deswarte, Caroline; Migaud, Melanie; Bustamante, Jacinta; Schurr, Erwin; Boisson-Dupuis, Stephanie; Casanova, Jean-Laurent; Abel, Laurent; El Baghdadi, Jamila

2014-08-15

Only a minority of individuals infected with Mycobacterium tuberculosis develop clinical tuberculosis. Genetic epidemiological evidence suggests that pulmonary tuberculosis has a strong human genetic component. Previous genetic findings in Mendelian predisposition to more severe mycobacterial infections, including by M. tuberculosis, underlined the importance of the interleukin 12 (IL-12)/interferon γ (IFN-γ) circuit in antimycobacterial immunity. We conducted an association study in Morocco between pulmonary tuberculosis and a panel of single-nucleotide polymorphisms (SNPs) covering 14 core IL-12/IFN-γ circuit genes. The analyses were performed in a discovery family-based sample followed by replication in a case-control population. Out of 228 SNPs tested in the family-based sample, 6 STAT4 SNPs were associated with pulmonary tuberculosis (P = .0013-.01). We replicated the same direction of association for 1 cluster of 3 SNPs encompassing the promoter region of STAT4. In the combined sample, the association was stronger among younger subjects (pulmonary tuberculosis onset <25 years) with an odds ratio of developing pulmonary tuberculosis at rs897200 for GG vs AG/AA subjects of 1.47 (1.06-2.04). Previous functional experiments showed that the G allele of rs897200 was associated with lower STAT4 expression. Our present findings in a Moroccan population support an association of pulmonary tuberculosis with STAT4 promoter-region polymorphisms that may impact STAT4 expression. © The Author 2014. Published by Oxford University Press on behalf of the Infectious Diseases Society of America.

RAN/RANBP2 polymorphisms and neuroblastoma risk in Chinese children: a three-center case-control study.

PubMed

Wang, Juxiang; Zhuo, Zhenjian; Chen, Min; Zhu, Jinhong; Zhao, Jie; Zhang, Jiao; Chen, Shanshan; He, Jing; Zhou, Haixia

2018-04-28

The genetic etiology of sporadic neuroblastoma remains largely obscure. RAN and RANBP2 genes encode Ras-related nuclear protein and Ran-binding protein 2, respectively. These two proteins form Ran-RanBP2 complex that regulate various cellular activities including nuclear transport. Aberrant functions of the two proteins are implicated in carcinogenesis. Given the unknown role of RAN/RANBP2 single nucleotide polymorphisms (SNPs) in neuroblastoma risk, we performed a multi-center case-control study in Chinese children to assess the association of the RAN/RANBP2 SNPs with neuroblastoma risk. We analyzed three potentially functional SNPs in RAN gene (rs56109543 C>T, rs7132224 A>G, rs14035 C>T) and one in RANBP2 (rs2462788 C>T) in 429 cases and 884 controls. Odds ratios (ORs) and 95% confidence intervals (CIs) were used to access the association between these four polymorphisms and neuroblastoma risk. No single variant was found to statistically significantly associate with neuroblastoma risk. However, individuals with 3 protective genotypes were less likely to develop neuroblastoma, in comparison to non-carriers (adjusted OR=0.33; 95% CI=0.12-0.96; P =0.042), as well as those with 0-2 protective genotypes (adjusted OR=0.33; 95% CI=0.11-0.94; P =0.038). Stratified analysis revealed no significant association for any of the four polymorphisms. Further studies are warranted to validate the weak impact of RAN/RANBP2 SNPs on neuroblastoma risk.

Association of Interleukin-1 gene clusters polymorphisms with primary open-angle glaucoma: a meta-analysis.

PubMed

Li, Junhua; Feng, Yifan; Sung, Mi Sun; Lee, Tae Hee; Park, Sang Woo

2017-11-28

Previous studies have associated the Interleukin-1 (IL-1) gene clusters polymorphisms with the risk of primary open-angle glaucoma (POAG). However, the results were not consistent. Here, we performed a meta-analysis to evaluate the role of IL-1 gene clusters polymorphisms in POAG susceptibility. PubMed, EMBASE and Cochrane Library (up to July 15, 2017) were searched by two independent investigators. All case-control studies investigating the association between single-nucleotide polymorphisms (SNPs) of IL-1 gene clusters and POAG risk were included. Odds ratios (ORs) with 95% confidence intervals (CIs) were calculated for quantifying the strength of association that has been involved in at least two studies. Five studies on IL-1β rs16944 (c. -511C > T) (1053 cases and 986 controls), 4 studies on IL-1α rs1800587 (c. -889C > T) (822 cases and 714 controls), and 4 studies on IL-1β rs1143634 (c. +3953C > T) (798 cases and 730 controls) were included. The results suggest that all three SNPs were not associated with POAG risk. Stratification analyses indicated that the rs1143634 has a suggestive associated with high tension glaucoma (HTG) under dominant (P = 0.03), heterozygote (P = 0.04) and allelic models (P = 0.02), however, the weak association was nullified after Bonferroni adjustments for multiple tests. Based on current meta-analysis, we indicated that there is lack of association between the three SNPs of IL-1 and POAG. However, this conclusion should be interpreted with caution and further well designed studies with large sample-size are required to validate the conclusion as low statistical powers.

Disinfection by-products exposure and intra-uterine growth restriction: Do genetic polymorphisms of CYP2E1or deletion of GSTM1 or GSTT1 modify the association?

PubMed

Levallois, Patrick; Giguère, Yves; Nguile-Makao, Molière; Rodriguez, Manuel; Campagna, Céline; Tardif, Robert; Bureau, Alexandre

2016-01-01

Exposure to disinfection by-products (DBPs) during pregnancy was associated with reduced foetal growth. Genetic susceptibility might play a role, especially for genes encoding for the Cytochrome P450 (CYP2E1) and Glutathione S-Transferase (GST) enzymes, involved in metabolism and activation of DBPs. Few epidemiological studies evaluated these gene-environment interactions and their results were never replicated. This study aims to examine interactions between trihalomethanes (THM) or haloacetic acids (HAA) exposure and genetic polymorphisms on small for gestational age (SGA) neonates by investigating single nucleotide polymorphisms (SNPs) in CYP2E1 gene and GSTM1 and GSTT1 deletions in mothers-children pairs. A population-based case-control study of 1549 mothers and 1455 children was conducted on SGA and THM/HAA exposure. DNA was extracted from blood or saliva cells. Targeted SNPs and deletions were genotyped. Statistical interaction between SNPs/deletions and THMs or HAAs in utero exposure with regard to SGA occurrence was evaluated by unconditional logistic regression with control of potential confounders. Previously reported positive modification of the effect of THM uterine exposure by mothers or newborns CYP2E1 rs3813867 C allele or GSTM1 deletion was not replicated. However interactions with CYP2E1 rs117618383 and rs2515641 were observed but were not statistically significant after correction for multiple testing. Previous positive interactions between THMs exposure and CYP2E1 and GSTM1 were not replicated but interactions with other CYP2E1 polymorphisms are reported. Copyright © 2016 Elsevier Ltd. All rights reserved.

Disinfection by-products exposure and intra-uterine growth restriction: do genetic polymorphisms of CYP2E1or deletion of GSTM1 or GSTT1 modify the association?

PubMed Central

Levallois, Patrick; Giguère, Yves; Nguile-Makao, Molière; Rodriguez, Manuel; Campagna, Céline; Tardif, Robert; Bureau, Alexandre

2016-01-01

Background Exposure to disinfection by-products (DBPs) during pregnancy was associated with reduced fetal growth. Genetic susceptibility might play a role, especially for genes encoding for the Cytochrome P450 (CYP2E1) and Glutathione S-Transferase (GST) enzymes, involved in metabolism and activation of DBPs. Few epidemiological studies evaluated these gene-environment interactions and their results were never replicated. Objective This study aims to examine interactions between trihalomethanes (THM) or haloacetic acids (HAA) exposure and genetic polymorphisms on small for gestational age (SGA) neonates by investigating single nucleotide polymorphisms (SNPs) in CYP2E1 gene and GSTM1 and GSTT1 deletions in mothers-children pairs. Methods A population-based case-control study of 1549 mothers and 1455 children was conducted on SGA and THM/HAA exposure. DNA was extracted from blood or saliva cells. Targeted SNPs and deletions were genotyped. Statistical interaction between SNPs/deletions and THMs or HAAs in utero exposure with regard to SGA occurrence was evaluated by unconditional logistic regression with control of potential confounders. Results Previously reported positive modification of the effect of THM uterine exposure by mothers or newborns CYP2E1 rs3813867 C allele or GSTM1 deletion was not replicated. However interactions with CYP2E1 rs117618383 and rs2515641 were observed but were not statistically significant after correction for multiple testing. Conclusions Previous positive interactions between THMs exposure and CYP2E1 and GSTM1 were not replicated but interactions with other CYP2E1 polymorphisms are reported. PMID:27107227

A brain-derived neurotrophic factor polymorphism Val66Met identifies fibromyalgia syndrome subgroup with higher body mass index and C-reactive protein.

PubMed

Xiao, Yangming; Russell, I Jon; Liu, Ya-Guang

2012-08-01

A common single nucleotide polymorphism (SNP) in the gene of brain-derived neurotrophic factor (BDNF) results from a substitution at position 66 from valine (Val) to methionine (Met) and may predispose to human neuropsychiatric disorders. We proposed to determine whether these BDNF gene SNPs were associated with fibromyalgia syndrome (FMS) and/or any of its typical phenotypes. Patients with FMS (N = 95) and healthy normal controls (HNC, N = 58) were studied. Serum high-sensitivity C-reactive protein (hsCRP) levels were measured using an enzyme-linked immunosorbent assay (ELISA). The BDNF SNPs were determined using polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP).The BDNF SNP distribution was 65 (68%) Val/Val, 28 (30%) Val/Met, and 2 (2%) Met/Met for FMS and 40 (69%), 17(29%), and 1 (2%) for HNC, respectively. The serum high-sensitivity C-reactive protein (hsCRP)and body mass index (BMI) in FMS were higher than in HNC. The FMS with BDNF Val66Val had significantly higher mean BMI (P = 0.0001) and hsCRP (P = 0.02) than did FMS carrying the Val66Met genotype. This pattern was not found in HNC. Phenotypic measures of subjective pain, pain threshold, depression, or insomnia did not relate to either of the BDNF SNPs in FMS. The relative distribution BDNF SNPs did not differ between FMS and HNC. The BDNF Val66Met polymorphism is not selective for FMS. The BDNF Val66Val SNP identifies a subgroup of FMS with elevated hsCRP and higher BMI. This is the first study to associate a BDNF polymorphism with a FMS subgroup phenotype.

SNP2TFBS - a database of regulatory SNPs affecting predicted transcription factor binding site affinity.

PubMed

Kumar, Sunil; Ambrosini, Giovanna; Bucher, Philipp

2017-01-04

SNP2TFBS is a computational resource intended to support researchers investigating the molecular mechanisms underlying regulatory variation in the human genome. The database essentially consists of a collection of text files providing specific annotations for human single nucleotide polymorphisms (SNPs), namely whether they are predicted to abolish, create or change the affinity of one or several transcription factor (TF) binding sites. A SNP's effect on TF binding is estimated based on a position weight matrix (PWM) model for the binding specificity of the corresponding factor. These data files are regenerated at regular intervals by an automatic procedure that takes as input a reference genome, a comprehensive SNP catalogue and a collection of PWMs. SNP2TFBS is also accessible over a web interface, enabling users to view the information provided for an individual SNP, to extract SNPs based on various search criteria, to annotate uploaded sets of SNPs or to display statistics about the frequencies of binding sites affected by selected SNPs. Homepage: http://ccg.vital-it.ch/snp2tfbs/. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

Haplotype combination of the bovine INSIG1 gene sequence variants and association with growth traits in Nanyang cattle.

PubMed

Sun, Jiajie; Gao, Yuan; Liu, Dong; Ma, Wei; Xue, Jing; Zhang, Chunlei; Lan, Xianyong; Lei, Chuzhao; Chen, Hong

2012-06-01

The insulin-induced gene 1 (INSIG1) gene encodes a protein that blocks proteolytic activation of sterol regulatory element binding proteins, which are transcription factors that activate genes that regulate cholesterol, fatty acid, and glucose metabolism. However, similar research for the bovine INSIG1 gene is lacking. Therefore, in this study, polymorphisms of the bovine INSIG1 gene were detected in 643 individuals from four cattle breeds by DNA pooling, forced PCR-RFLP, PCR-SSCP, and DNA sequencing methods. Only 10 novel SNPs were identified, which included four mutations in the coding region and the others in the introns. In Nanyang individuals, seven common haplotypes were identified based on four coding region SNPs. The haplotype GACT, with a frequency of 75.4%, was the most prevalent haplotypes and SNPs formed two linkage disequilibrium blocks with strong multi-allelic D' (D' = 1). Additionally, association analysis between mutations of the bovine INSIG1 gene and growth traits in Nanyang cattle at 6, 12, 18, and 24 months old was performed, and the results indicated that the polymorphisms were not significantly associated with body mass.

A phased SNP-based classification of sickle cell anemia HBB haplotypes.

PubMed

Shaikho, Elmutaz M; Farrell, John J; Alsultan, Abdulrahman; Qutub, Hatem; Al-Ali, Amein K; Figueiredo, Maria Stella; Chui, David H K; Farrer, Lindsay A; Murphy, George J; Mostoslavsky, Gustavo; Sebastiani, Paola; Steinberg, Martin H

2017-08-11

Sickle cell anemia causes severe complications and premature death. Five common β-globin gene cluster haplotypes are each associated with characteristic fetal hemoglobin (HbF) levels. As HbF is the major modulator of disease severity, classifying patients according to haplotype is useful. The first method of haplotype classification used restriction fragment length polymorphisms (RFLPs) to detect single nucleotide polymorphisms (SNPs) in the β-globin gene cluster. This is labor intensive, and error prone. We used genome-wide SNP data imputed to the 1000 Genomes reference panel to obtain phased data distinguishing parental alleles. We successfully haplotyped 813 sickle cell anemia patients previously classified by RFLPs with a concordance >98%. Four SNPs (rs3834466, rs28440105, rs10128556, and rs968857) marking four different restriction enzyme sites unequivocally defined most haplotypes. We were able to assign a haplotype to 86% of samples that were either partially or misclassified using RFLPs. Phased data using only four SNPs allowed unequivocal assignment of a haplotype that was not always possible using a larger number of RFLPs. Given the availability of genome-wide SNP data, our method is rapid and does not require high computational resources.

Single nucleotide polymorphism discrimination with and without an ethidium bromide intercalator.

PubMed

Fenati, Renzo A; Connolly, Ashley R; Ellis, Amanda V

2017-02-15

Single nucleotide polymorphism (SNP) genotyping is an important aspect in understanding genetic variations. Here, we discriminate SNPs using toe-hold mediated displacement reactions. The biological target is an 80 nucleotide long double-stranded-DNA from the mtDNA HV1 region, associated with maternal ancestry. This target has been specially designed with a pendant toehold and a cationic fluorophore, ATTO 647N, as a reporter, produced in a polymerase chain reaction. Rates of reaction for the toehold-polymerase chain reaction products (TPPs) with their corresponding complementary displacing sequences, labelled with a Black Hole Quencher 1, followed the order TPP-Cytosine > TPP-Thymine > TPP-Adenine ≥ TPP-Guanine. Non-complementary rates were the slowest with mismatches involving cytosine. These reactions, operating in a static/or contact mode, gave averaged readouts between SNPs within 15 min (with 80-90% quenching), compared to 25-30 min in previous studies involving fluorescence resonance energy transfer. Addition of an intercalating agent, ethidium bromide, retarded the rate of reaction in which cytosine was involved, presumably through stabilization of the base pairing, which resulted in markedly improved discrimination of cytosine containing SNPs. Copyright © 2016 Elsevier B.V. All rights reserved.

Performance of commercial platforms for rapid genotyping of polymorphisms affecting warfarin dose.

PubMed

King, Cristi R; Porche-Sorbet, Rhonda M; Gage, Brian F; Ridker, Paul M; Renaud, Yannick; Phillips, Michael S; Eby, Charles

2008-06-01

Initiation of warfarin therapy is associated with bleeding owing to its narrow therapeutic window and unpredictable therapeutic dose. Pharmacogenetic-based dosing algorithms can improve accuracy of initial warfarin dosing but require rapid genotyping for cytochrome P-450 2C9 (CYP2C9) *2 and *3 single nucleotide polymorphisms (SNPs) and a vitamin K epoxide reductase (VKORC1) SNP. We evaluated 4 commercial systems: INFINITI analyzer (AutoGenomics, Carlsbad, CA), Invader assay (Third Wave Technologies, Madison, WI), Tag-It Mutation Detection assay (Luminex Molecular Diagnostics, formerly Tm Bioscience, Toronto, Canada), and Pyrosequencing (Biotage, Uppsala, Sweden). We genotyped 112 DNA samples and resolved any discrepancies with bidirectional sequencing. The INFINITI analyzer was 100% accurate for all SNPs and required 8 hours. Invader and Tag-It were 100% accurate for CYP2C9 SNPs, 99% accurate for VKORC1 -1639/3673 SNP, and required 3 hours and 8 hours, respectively. Pyrosequencing was 99% accurate for CYP2C9 *2, 100% accurate for CYP2C9 *3, and 100% accurate for VKORC1 and required 4 hours. Current commercial platforms provide accurate and rapid genotypes for pharmacogenetic dosing during initiation of warfarin therapy.

Single nucleotide polymorphism discovery in bovine liver using RNA-seq technology

PubMed Central

Pareek, Chandra Shekhar; Błaszczyk, Paweł; Dziuba, Piotr; Czarnik, Urszula; Fraser, Leyland; Sobiech, Przemysław; Pierzchała, Mariusz; Feng, Yaping; Kadarmideen, Haja N.; Kumar, Dibyendu

2017-01-01

Background RNA-seq is a useful next-generation sequencing (NGS) technology that has been widely used to understand mammalian transcriptome architecture and function. In this study, a breed-specific RNA-seq experiment was utilized to detect putative single nucleotide polymorphisms (SNPs) in liver tissue of young bulls of the Polish Red, Polish Holstein-Friesian (HF) and Hereford breeds, and to understand the genomic variation in the three cattle breeds that may reflect differences in production traits. Results The RNA-seq experiment on bovine liver produced 107,114,4072 raw paired-end reads, with an average of approximately 60 million paired-end reads per library. Breed-wise, a total of 345.06, 290.04 and 436.03 million paired-end reads were obtained from the Polish Red, Polish HF, and Hereford breeds, respectively. Burrows-Wheeler Aligner (BWA) read alignments showed that 81.35%, 82.81% and 84.21% of the mapped sequencing reads were properly paired to the Polish Red, Polish HF, and Hereford breeds, respectively. This study identified 5,641,401 SNPs and insertion and deletion (indel) positions expressed in the bovine liver with an average of 313,411 SNPs and indel per young bull. Following the removal of the indel mutations, a total of 195,3804, 152,7120 and 205,3184 raw SNPs expressed in bovine liver were identified for the Polish Red, Polish HF, and Hereford breeds, respectively. Breed-wise, three highly reliable breed-specific SNP-databases (SNP-dbs) with 31,562, 24,945 and 28,194 SNP records were constructed for the Polish Red, Polish HF, and Hereford breeds, respectively. Using a combination of stringent parameters of a minimum depth of ≥10 mapping reads that support the polymorphic nucleotide base and 100% SNP ratio, 4,368, 3,780 and 3,800 SNP records were detected in the Polish Red, Polish HF, and Hereford breeds, respectively. The SNP detections using RNA-seq data were successfully validated by kompetitive allele-specific PCR (KASPTM) SNP genotyping assay. The comprehensive QTL/CG analysis of 110 QTL/CG with RNA-seq data identified 20 monomorphic SNP hit loci (CARTPT, GAD1, GDF5, GHRH, GHRL, GRB10, IGFBPL1, IGFL1, LEP, LHX4, MC4R, MSTN, NKAIN1, PLAG1, POU1F1, SDR16C5, SH2B2, TOX, UCP3 and WNT10B) in all three cattle breeds. However, six SNP loci (CCSER1, GHR, KCNIP4, MTSS1, EGFR and NSMCE2) were identified as highly polymorphic among the cattle breeds. Conclusions This study identified breed-specific SNPs with greater SNP ratio and excellent mapping coverage, as well as monomorphic and highly polymorphic putative SNP loci within QTL/CGs of bovine liver tissue. A breed-specific SNP-db constructed for bovine liver yielded nearly six million SNPs. In addition, a KASPTM SNP genotyping assay, as a reliable cost-effective method, successfully validated the breed-specific putative SNPs originating from the RNA-seq experiments. PMID:28234981

Elastic-net regularization approaches for genome-wide association studies of rheumatoid arthritis.

PubMed

Cho, Seoae; Kim, Haseong; Oh, Sohee; Kim, Kyunga; Park, Taesung

2009-12-15

The current trend in genome-wide association studies is to identify regions where the true disease-causing genes may lie by evaluating thousands of single-nucleotide polymorphisms (SNPs) across the whole genome. However, many challenges exist in detecting disease-causing genes among the thousands of SNPs. Examples include multicollinearity and multiple testing issues, especially when a large number of correlated SNPs are simultaneously tested. Multicollinearity can often occur when predictor variables in a multiple regression model are highly correlated, and can cause imprecise estimation of association. In this study, we propose a simple stepwise procedure that identifies disease-causing SNPs simultaneously by employing elastic-net regularization, a variable selection method that allows one to address multicollinearity. At Step 1, the single-marker association analysis was conducted to screen SNPs. At Step 2, the multiple-marker association was scanned based on the elastic-net regularization. The proposed approach was applied to the rheumatoid arthritis (RA) case-control data set of Genetic Analysis Workshop 16. While the selected SNPs at the screening step are located mostly on chromosome 6, the elastic-net approach identified putative RA-related SNPs on other chromosomes in an increased proportion. For some of those putative RA-related SNPs, we identified the interactions with sex, a well known factor affecting RA susceptibility.

Comparison of three PCR-based assays for SNP genotyping in sugar beet

USDA-ARS?s Scientific Manuscript database

Background: PCR allelic discrimination technologies have broad applications in the detection of single nucleotide polymorphisms (SNPs) in genetics and genomics. The use of fluorescence-tagged probes is the leading method for targeted SNP detection, but assay costs and error rates could be improved t...

Lipoprotein lipase variants interact with polyunsaturated fatty acids to modulate obesity traits in Puerto Ricans

USDA-ARS?s Scientific Manuscript database

Lipoprotein lipase (LPL) is a candidate gene for obesity based on its role in triglyceride hydrolysis and the partitioning of fatty acids towards storage or oxidation. Whether dietary fatty acids modify LPL associated obesity risk is unknown. We examined five single nucleotide polymorphisms (SNPs) (...

Levels of taurine introgression in the current Brazilian Nelore and Gir indicine cattle populations

USDA-ARS?s Scientific Manuscript database

A high density panel of more than 777000 genome-wide single nucleotide polymorphisms (SNPs) were used to investigate the population structure of Nelore and Gir, compared to seven other populations worldwide. Principal Component Analysis and model-based ancestry estimation clearly separate the indici...

Genetic Variants in SDC3 Gene are Significantly Associated with Growth Traits in Two Chinese Beef Cattle Breeds.

PubMed

Huang, Yong-Zhen; Wang, Qin; Zhang, Chun-Lei; Fang, Xing-Tang; Song, En-Liang; Chen, Hong

2016-01-01

Identification of the genes and polymorphisms underlying quantitative traits, and understanding these genes and polymorphisms affect economic growth traits, are important for successful marker-assisted selection and more efficient management strategies in commercial cattle (Bos taurus) population. Syndecan-3 (SDC3), a member of the syndecan family of type I transmembrane heparan sulfate proteoglycans is a novel regulator of feeding behavior and body weight. The aim of this study is to examine the association of the SDC3 polymorphism with growth traits in Chinese Jiaxian and Qinchuan cattle breeds (). Four single nucleotide polymorphisms (SNPs: 1-4) were detected in 555 cows from three Chinese native cattle breeds by means of sequencing pooled DNA samples and polymerase chain reaction-single stranded conformational polymorphism (PCR-SSCP) methods. We found one SNP (g.28362A > G) in intron and three SNPs (g.30742T > G, g.30821C > T and 33418 A > G) in exons. The statistical analyses indicated that these SNPs of SDC3 gene were associated with bovine body height, body length, chest circumference, and circumference of cannon bone (P < 0.05). The mutant-type variant was superior for growth traits; the heterozygote was associated with higher growth traits compared to wild-type homozygote. Our result confirms the polymorphisms in the SDC3 gene are associated with growth traits that may be used for marker-assisted selection in beef cattle breeding programs.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gardner, Shea; Slezak, Tom

With the flood of whole genome finished and draft microbial sequences, we need faster, more scalable bioinformatics tools for sequence comparison. An algorithm is described to find single nucleotide polymorphisms (SNPs) in whole genome data. It scales to hundreds of bacterial or viral genomes, and can be used for finished and/or draft genomes available as unassembled contigs. The method is fast to compute, finding SNPs and building a SNP phylogeny in seconds to hours. We use it to identify thousands of putative SNPs from all publicly available Filoviridae, Poxviridae, foot-and-mouth disease virus, Bacillus, and Escherichia coli genomes and plasmids. Themore » SNP-based trees that result are consistent with known taxonomy and trees determined in other studies. The approach we describe can handle as input hundreds of gigabases of sequence in a single run. The algorithm is based on k-mer analysis using a suffix array, so we call it saSNP.« less

Genome-wide divergence and linkage disequilibrium analyses for Capsicum baccatum revealed by genome-anchored single nucleotide polymorphisms

USDA-ARS?s Scientific Manuscript database

Principal component analysis (PCA) with 36,621 polymorphic genome-anchored single nucleotide polymorphisms (SNPs) identified collectively for Capsicum annuum and Capsicum baccatum was used to show the distribution of these 2 important incompatible cultivated pepper species. Estimated mean nucleotide...

Interaction between LRP5 and periostin gene polymorphisms on serum periostin levels and cortical bone microstructure.

PubMed

Pepe, J; Bonnet, N; Herrmann, F R; Biver, E; Rizzoli, R; Chevalley, T; Ferrari, S L

2018-02-01

We investigated the interaction between periostin SNPs and the SNPs of the genes assumed to modulate serum periostin levels and bone microstructure in a cohort of postmenopausal women. We identified an interaction between LRP5 SNP rs648438 and periostin SNP rs9547970 on serum periostin levels and on radial cortical porosity. The purpose of this study is to investigate the interaction between periostin gene polymorphisms (SNPs) and other genes potentially responsible for modulating serum periostin levels and bone microstructure in a cohort of postmenopausal women. In 648 postmenopausal women from the Geneva Retirees Cohort, we analyzed 6 periostin SNPs and another 149 SNPs in 14 genes, namely BMP2, CTNNB1, ESR1, ESR2, LRP5, LRP6, PTH, SPTBN1, SOST, TGFb1, TNFRSF11A, TNFSF11, TNFRSF11B and WNT16. Volumetric BMD and bone microstructure were measured by high-resolution peripheral quantitative computed tomography at the distal radius and tibia. Serum periostin levels were associated with radial cortical porosity, including after adjustment for age, BMI, and years since menopause (p = 0.036). Sixteen SNPs in the ESR1, LRP5, TNFRSF11A, SOST, SPTBN1, TNFRSF11B and TNFSF11 genes were associated with serum periostin levels (p range 0.03-0.001) whereas 26 SNPs in 9 genes were associated with cortical porosity at the radius and/or at the tibia. WNT 16 was the gene with the highest number of SNPs associated with both trabecular and cortical microstructure. The periostin SNP rs9547970 was also associated with cortical porosity (p = 0.04). In particular, SNPs in LRP5, ESR1 and near the TNFRSF11A gene were associated with both cortical porosity and serum periostin levels. Eventually, we identified an interaction between LRP5 SNP rs648438 and periostin SNP rs9547970 on serum periostin levels (interaction p = 0.01) and on radial cortical porosity (interaction p = 0.005). These results suggest that periostin expression is genetically modulated, particularly by polymorphisms in the Wnt pathway, and is thereby implicated in the genetic variation of bone microstructure.

Development of a simple and practical method of discrimination between Vibrio furnissii and V. fluvialis based on single-nucleotide polymorphisms of 16S rRNA genes observed in V. furnissii but not in V. fluvialis.

PubMed

Takajo, Ichiro; Yamada, Akiteru; Umeki, Kazumi; Saeki, Yuji; Hashikura, Yuuki; Yamamoto, Ikuo; Umekita, Kunihiko; Urayama-Kawano, Midori; Yamasaki, Shogo; Taniguchi, Takako; Misawa, Naoaki; Okayama, Akihiko

2018-01-01

Vibrio furnissii and V. fluvialis are closely related, the discrimination of which by conventional biochemical assay remains a challenge. Investigation of the sequence of the 16S rRNA genes in a clinical isolate of V. furnissii by visual inspection of a sequencing electropherogram revealed two sites of single-nucleotide polymorphisms (SNPs; positions 460 A/G and 1261 A/G) in these genes. A test of 12 strains each of V. fluvialis and V. furnissii revealed these SNPs to be common in V. furnissii but not in V. fluvialis. Divergence of SNP frequency was observed among the strains of V. furnissii tested. Because the SNPs described in V. furnissii produce a difference in the target sequence of restriction enzymes, a combination of polymerase chain reaction (PCR) of the 16S rRNA genes using conventional primers and restriction fragment length polymorphism analysis using Eco RV and Eae I was shown to discriminate between V. fluvialis and V. furnissii. This method is simple and alleviates the need for expensive equipment or primer sets specific to these bacteria. Therefore, we believe that this method can be useful, alongside specific PCR and mass spectrometry, when there is a need to discriminate between V. fluvialis and V. furnissii. Copyright © 2017 Elsevier B.V. All rights reserved.

Genetic polymorphisms and skin aging: the identification of population genotypic groups holds potential for personalized treatments.

PubMed

Naval, Jordi; Alonso, Vicente; Herranz, Miquel Angel

2014-01-01

Skin changes are among the most visible signs of aging. Skin properties such as hydration, elasticity, and antioxidant capacity play a key role in the skin aging process. Skin aging is a complex process influenced by heritable and environmental factors. Recent studies on twins have revealed that up to 60% of the skin aging variation between individuals can be attributed to genetic factors, while the remaining 40% is due to non-genetic factors. Recent advances in genomics and bioinformatics approaches have led to the association of certain single nucleotide polymorphisms (SNPs) to skin properties. Our aim was to classify individuals based on an ensemble of multiple polymorphisms associated with certain properties of the skin for providing personalized skin care and anti-aging therapies. We identified the key proteins and SNPs associated with certain properties of the skin that contribute to skin aging. We selected a set of 13 SNPs in gene coding for these proteins which are potentially associated with skin aging. Finally, we classified a sample of 120 female volunteers into ten clusters exhibiting different skin properties according to their genotypic signature. This is the first study that describes the actual frequency of genetic polymorphisms and their distribution in clusters involved in skin aging in a Caucasian population. Individuals can be divided into genetic clusters defined by genotypic variables. These genotypic variables are linked with polymorphisms in one or more genes associated with certain properties of the skin that contribute to a person's perceived age. Therefore, by using this classification, it is possible to characterize human skin care and anti-aging needs on the basis of an individual's genetic signature, thus opening the door to personalized treatments addressed at specific populations. This is part of an ongoing effort towards personalized anti-aging therapies combining genetic signatures with environmental and life style evaluations.

Genetic polymorphisms and skin aging: the identification of population genotypic groups holds potential for personalized treatments

PubMed Central

Naval, Jordi; Alonso, Vicente; Herranz, Miquel Angel

2014-01-01

Introduction Skin changes are among the most visible signs of aging. Skin properties such as hydration, elasticity, and antioxidant capacity play a key role in the skin aging process. Skin aging is a complex process influenced by heritable and environmental factors. Recent studies on twins have revealed that up to 60% of the skin aging variation between individuals can be attributed to genetic factors, while the remaining 40% is due to non-genetic factors. Recent advances in genomics and bioinformatics approaches have led to the association of certain single nucleotide polymorphisms (SNPs) to skin properties. Our aim was to classify individuals based on an ensemble of multiple polymorphisms associated with certain properties of the skin for providing personalized skin care and anti-aging therapies. Methods and results We identified the key proteins and SNPs associated with certain properties of the skin that contribute to skin aging. We selected a set of 13 SNPs in gene coding for these proteins which are potentially associated with skin aging. Finally, we classified a sample of 120 female volunteers into ten clusters exhibiting different skin properties according to their genotypic signature. Conclusion This is the first study that describes the actual frequency of genetic polymorphisms and their distribution in clusters involved in skin aging in a Caucasian population. Individuals can be divided into genetic clusters defined by genotypic variables. These genotypic variables are linked with polymorphisms in one or more genes associated with certain properties of the skin that contribute to a person’s perceived age. Therefore, by using this classification, it is possible to characterize human skin care and anti-aging needs on the basis of an individual’s genetic signature, thus opening the door to personalized treatments addressed at specific populations. This is part of an ongoing effort towards personalized anti-aging therapies combining genetic signatures with environmental and life style evaluations. PMID:25061327

A nuclear phylogenetic analysis: SNPs, indels and SSRs deliver new insights into the relationships in the ‘true citrus fruit trees’ group (Citrinae, Rutaceae) and the origin of cultivated species

PubMed Central

Garcia-Lor, Andres; Curk, Franck; Snoussi-Trifa, Hager; Morillon, Raphael; Ancillo, Gema; Luro, François; Navarro, Luis; Ollitrault, Patrick

2013-01-01

Background and Aims Despite differences in morphology, the genera representing ‘true citrus fruit trees’ are sexually compatible, and their phylogenetic relationships remain unclear. Most of the important commercial ‘species’ of Citrus are believed to be of interspecific origin. By studying polymorphisms of 27 nuclear genes, the average molecular differentiation between species was estimated and some phylogenetic relationships between ‘true citrus fruit trees’ were clarified. Methods Sanger sequencing of PCR-amplified fragments from 18 genes involved in metabolite biosynthesis pathways and nine putative genes for salt tolerance was performed for 45 genotypes of Citrus and relatives of Citrus to mine single nucleotide polymorphisms (SNPs) and indel polymorphisms. Fifty nuclear simple sequence repeats (SSRs) were also analysed. Key Results A total of 16 238 kb of DNA was sequenced for each genotype, and 1097 single nucleotide polymorphisms (SNPs) and 50 indels were identified. These polymorphisms were more valuable than SSRs for inter-taxon differentiation. Nuclear phylogenetic analysis revealed that Citrus reticulata and Fortunella form a cluster that is differentiated from the clade that includes three other basic taxa of cultivated citrus (C. maxima, C. medica and C. micrantha). These results confirm the taxonomic subdivision between the subgenera Metacitrus and Archicitrus. A few genes displayed positive selection patterns within or between species, but most of them displayed neutral patterns. The phylogenetic inheritance patterns of the analysed genes were inferred for commercial Citrus spp. Conclusions Numerous molecular polymorphisms (SNPs and indels), which are potentially useful for the analysis of interspecific genetic structures, have been identified. The nuclear phylogenetic network for Citrus and its sexually compatible relatives was consistent with the geographical origins of these genera. The positive selection observed for a few genes will help further works to analyse the molecular basis of the variability of the associated traits. This study presents new insights into the origin of C. sinensis. PMID:23104641

A nuclear phylogenetic analysis: SNPs, indels and SSRs deliver new insights into the relationships in the 'true citrus fruit trees' group (Citrinae, Rutaceae) and the origin of cultivated species.

PubMed

Garcia-Lor, Andres; Curk, Franck; Snoussi-Trifa, Hager; Morillon, Raphael; Ancillo, Gema; Luro, François; Navarro, Luis; Ollitrault, Patrick

2013-01-01

Despite differences in morphology, the genera representing 'true citrus fruit trees' are sexually compatible, and their phylogenetic relationships remain unclear. Most of the important commercial 'species' of Citrus are believed to be of interspecific origin. By studying polymorphisms of 27 nuclear genes, the average molecular differentiation between species was estimated and some phylogenetic relationships between 'true citrus fruit trees' were clarified. Sanger sequencing of PCR-amplified fragments from 18 genes involved in metabolite biosynthesis pathways and nine putative genes for salt tolerance was performed for 45 genotypes of Citrus and relatives of Citrus to mine single nucleotide polymorphisms (SNPs) and indel polymorphisms. Fifty nuclear simple sequence repeats (SSRs) were also analysed. A total of 16 238 kb of DNA was sequenced for each genotype, and 1097 single nucleotide polymorphisms (SNPs) and 50 indels were identified. These polymorphisms were more valuable than SSRs for inter-taxon differentiation. Nuclear phylogenetic analysis revealed that Citrus reticulata and Fortunella form a cluster that is differentiated from the clade that includes three other basic taxa of cultivated citrus (C. maxima, C. medica and C. micrantha). These results confirm the taxonomic subdivision between the subgenera Metacitrus and Archicitrus. A few genes displayed positive selection patterns within or between species, but most of them displayed neutral patterns. The phylogenetic inheritance patterns of the analysed genes were inferred for commercial Citrus spp. Numerous molecular polymorphisms (SNPs and indels), which are potentially useful for the analysis of interspecific genetic structures, have been identified. The nuclear phylogenetic network for Citrus and its sexually compatible relatives was consistent with the geographical origins of these genera. The positive selection observed for a few genes will help further works to analyse the molecular basis of the variability of the associated traits. This study presents new insights into the origin of C. sinensis.

Pharmacogenetics of human 3'-phosphoadenosine 5'-phosphosulfate synthetase 1 (PAPSS1): gene resequencing, sequence variation, and functional genomics.

PubMed

Xu, Zhen-Hua; Thomae, Bianca A; Eckloff, Bruce W; Wieben, Eric D; Weinshilboum, Richard M

2003-06-01

3'-Phosphoadenosine 5'-phosphosulfate (PAPS) is the high-energy "sulfate donor" for reactions catalyzed by sulfotransferase (SULT) enzymes. The strict requirement of SULTs for PAPS suggests that PAPS synthesis might influence the rate of sulfate conjugation. In humans, PAPS is synthesized from ATP and SO(4)(2-) by two isoforms of PAPS synthetase (PAPSS): PAPSS1 and PAPSS2. As a step toward pharmacogenetic studies, we have resequenced the entire coding sequence of the human PAPSS1 gene, including exon-intron splice junctions, using DNA samples from 60 Caucasian-American and 58 African-American subjects. Twenty-one genetic polymorphisms were observed-1 insertion-deletion event and 20 single nucleotide polymorphisms (SNPs)-including two non-synonymous coding SNPs (cSNPs) that altered the following amino acids: Arg333Cys and Glu531Gln. Twelve pairs of these polymorphisms were tightly linked, and a total of twelve unequivocal haplotypes could be identified-two that were common to both ethnic groups and ten that were ethnic-specific. The Arg333Cys polymorphism, with an allele frequency of 2.5%, was observed only in DNA samples from Caucasian subjects. The Glu531Gln polymorphism was rare, with only a single copy of that allele in a DNA sample from an African-American subject. Transient expression in mammalian cells showed that neither of the non-synonymous cSNPs resulted in a change in the basal level of enzyme activity measured under optimal assay conditions. However, the Glu531Gln polymorphism altered the substrate kinetic properties of the enzyme. The Gln531 variant allozyme had a 5-fold higher K(m) value for SO(4)(2-) than did the wild-type allozyme and displayed monophasic kinetics for Na(2)SO(4). The wild-type allozyme (Glu531) showed biphasic kinetics for that substrate. These observations represent a step toward testing the hypothesis that genetic variation in PAPS synthesis catalyzed by PAPSS1 might alter in vivo sulfate conjugation.

Genotyping of 75 SNPs using arrays for individual identification in five population groups.

PubMed

Hwa, Hsiao-Lin; Wu, Lawrence Shih Hsin; Lin, Chun-Yen; Huang, Tsun-Ying; Yin, Hsiang-I; Tseng, Li-Hui; Lee, James Chun-I

2016-01-01

Single nucleotide polymorphism (SNP) typing offers promise to forensic genetics. Various strategies and panels for analyzing SNP markers for individual identification have been published. However, the best panels with fewer identity SNPs for all major population groups are still under discussion. This study aimed to find more autosomal SNPs with high heterozygosity for individual identification among Asian populations. Ninety-six autosomal SNPs of 502 DNA samples from unrelated individuals of five population groups (208 Taiwanese Han, 83 Filipinos, 62 Thais, 69 Indonesians, and 80 individuals with European, Near Eastern, or South Asian ancestry) were analyzed using arrays in an initial screening, and 75 SNPs (group A, 46 newly selected SNPs; groups B, 29 SNPs based on a previous SNP panel) were selected for further statistical analyses. Some SNPs with high heterozygosity from Asian populations were identified. The combined random match probability of the best 40 and 45 SNPs was between 3.16 × 10(-17) and 7.75 × 10(-17) and between 2.33 × 10(-19) and 7.00 × 10(-19), respectively, in all five populations. These loci offer comparable power to short tandem repeats (STRs) for routine forensic profiling. In this study, we demonstrated the population genetic characteristics and forensic parameters of 75 SNPs with high heterozygosity from five population groups. This SNPs panel can provide valuable genotypic information and can be helpful in forensic casework for individual identification among these populations.

Effect of epidermal growth factor receptor gene polymorphisms on prognosis in glioma patients

PubMed Central

Li, Jingjie; Yan, Mengdan; Xie, Zhilan; Zhu, Yuanyuan; Chen, Chao; Jin, Tianbo

2016-01-01

Previous studies suggested that single nucleotide polymorphisms (SNPs) in epidermal growth factor receptor (EGFR) are associated with risk of glioma. However, the associations between these SNPs and glioma patient prognosis have not yet been fully investigated. Therefore, the present study was aimed to evaluate the effects of EGFR polymorphisms on the glioma patient prognosis. We retrospectively evaluated 269 glioma patients and investigated associations between EGFR SNPs and patient prognosis using Cox proportional hazard models and Kaplan-Meier curves. Univariate analysis revealed that age, gross-total resection and chemotherapy were associated with the prognosis of glioma patients (p < 0.05). In addition, four EGFR SNPs (rs11506105, rs3752651, rs1468727 and rs845552) correlated with overall survival (OS) (Log-rank p = 0.011, 0.020, 0.008, and 0.009, respectively) and progression-free survival PFS (Log-rank p = 0.026, 0.024, 0.019 and 0.009, respectively). Multivariate analysis indicated that the rs11506105 G/G genotype, the rs3752651 and rs1468727 C/C genotype and the rs845552 A/A genotype correlated inversely with OS and PFS. In addition, OS among patients with the rs730437 C/C genotype (p = 0.030) was significantly lower OS than among patients with A/A genotype. These data suggest that five EGFR SNPs (rs11506105, rs3752651, rs1468727, rs845552 and rs730437) correlated with glioma patient prognosis, and should be furthered validated in studies of ethnically diverse patients. PMID:27437777

Analysis of TLR2, TLR4, and TLR9 single nucleotide polymorphisms in children with bacterial meningitis and their healthy family members.

PubMed

Gowin, Ewelina; Świątek-Kościelna, Bogna; Kałużna, Ewelina; Nowak, Jerzy; Michalak, Michał; Wysocki, Jacek; Januszkiewicz-Lewandowska, Danuta

2017-07-01

The aim was to analyse TLR2 rs5743708, TLR2 rs4696480, TLR4 rs4986790, TLR9 rs5743836, and TLR9 rs352140 single nucleotide polymorphisms (SNPs) in children with pneumococcal and meningococcal meningitis and their family members. The study group consisted of 39 children with bacterial meningitis (25 with meningococcal meningitis and 14 with pneumococcal meningitis) and 49 family members. Laboratory test results and the course of the diseases were analyzed. Genomic DNA was extracted from 1.2ml of peripheral blood in order to analyze the five SNPs. Patients with pneumococcal and meningococcal meningitis showed a similar male/female ratio, mean age, and duration of symptoms. There were no statistically significant differences in biochemical markers between the two groups. All patients possessed at least one polymorphic variant of the analyzed SNPs. The most common SNP was TLR9 rs352140, detected in 89.7% of patients. No significant differences in SNP frequency were found between patients, family members, and the general population. The allele frequencies in the population studied are in accordance with the literature data. The study did not find an association between the analyzed SNPs and susceptibility to bacterial meningitis. The role of SNPs in genes coding toll-like receptors and the interactions between them in controlling inflammation in the central nervous system needs further evaluation. Copyright © 2017 The Author(s). Published by Elsevier Ltd.. All rights reserved.

Rapid Identification and Differentiation of Trichophyton Species, Based on Sequence Polymorphisms of the Ribosomal Internal Transcribed Spacer Regions, by Rolling-Circle Amplification▿

PubMed Central

Kong, Fanrong; Tong, Zhongsheng; Chen, Xiaoyou; Sorrell, Tania; Wang, Bin; Wu, Qixuan; Ellis, David; Chen, Sharon

2008-01-01

DNA sequencing analyses have demonstrated relatively limited polymorphisms within the fungal internal transcribed spacer (ITS) regions among Trichophyton spp. We sequenced the ITS region (ITS1, 5.8S, and ITS2) for 42 dermatophytes belonging to seven species (Trichophyton rubrum, T. mentagrophytes, T. soudanense, T. tonsurans, Epidermophyton floccosum, Microsporum canis, and M. gypseum) and developed a novel padlock probe and rolling-circle amplification (RCA)-based method for identification of single nucleotide polymorphisms (SNPs) that could be exploited to differentiate between Trichophyton spp. Sequencing results demonstrated intraspecies genetic variation for T. tonsurans, T. mentagrophytes, and T. soudanense but not T. rubrum. Signature sets of SNPs between T. rubrum and T. soudanense (4-bp difference) and T. violaceum and T. soudanense (3-bp difference) were identified. The RCA assay correctly identified five Trichophyton species. Although the use of two “group-specific” probes targeting both the ITS1 and the ITS2 regions were required to identify T. soudanense, the other species were identified by single ITS1- or ITS2-targeted species-specific probes. There was good agreement between ITS sequencing and the RCA assay. Despite limited genetic variation between Trichophyton spp., the sensitive, specific RCA-based SNP detection assay showed potential as a simple, reproducible method for the rapid (2-h) identification of Trichophyton spp. PMID:18234865

Construction of an SNP-based high-density linkage map for flax (Linum usitatissimum L.) using specific length amplified fragment sequencing (SLAF-seq) technology.

PubMed

Yi, Liuxi; Gao, Fengyun; Siqin, Bateer; Zhou, Yu; Li, Qiang; Zhao, Xiaoqing; Jia, Xiaoyun; Zhang, Hui

2017-01-01

Flax is an important crop for oil and fiber, however, no high-density genetic maps have been reported for this species. Specific length amplified fragment sequencing (SLAF-seq) is a high-resolution strategy for large scale de novo discovery and genotyping of single nucleotide polymorphisms. In this study, SLAF-seq was employed to develop SNP markers in an F2 population to construct a high-density genetic map for flax. In total, 196.29 million paired-end reads were obtained. The average sequencing depth was 25.08 in male parent, 32.17 in the female parent, and 9.64 in each F2 progeny. In total, 389,288 polymorphic SLAFs were detected, from which 260,380 polymorphic SNPs were developed. After filtering, 4,638 SNPs were found suitable for genetic map construction. The final genetic map included 4,145 SNP markers on 15 linkage groups and was 2,632.94 cM in length, with an average distance of 0.64 cM between adjacent markers. To our knowledge, this map is the densest SNP-based genetic map for flax. The SNP markers and genetic map reported in here will serve as a foundation for the fine mapping of quantitative trait loci (QTLs), map-based gene cloning and marker assisted selection (MAS) for flax.

Oxytocin Receptor Gene Polymorphisms Are Associated with Human Directed Social Behavior in Dogs (Canis familiaris)

PubMed Central

Lakatos, Gabriella; Pergel, Enikő; Turcsán, Borbála; Pluijmakers, Jolanda; Vas, Judit; Elek, Zsuzsanna; Brúder, Ildikó; Földi, Levente; Sasvári-Székely, Mária; Miklósi, Ádám; Rónai, Zsolt; Kubinyi, Enikő

2014-01-01

The oxytocin system has a crucial role in human sociality; several results prove that polymorphisms of the oxytocin receptor gene are related to complex social behaviors in humans. Dogs' parallel evolution with humans and their adaptation to the human environment has made them a useful species to model human social interactions. Previous research indicates that dogs are eligible models for behavioral genetic research, as well. Based on these previous findings, our research investigated associations between human directed social behaviors and two newly described (−212AG, 19131AG) and one known (rs8679684) single nucleotide polymorphisms (SNPs) in the regulatory regions (5′ and 3′ UTR) of the oxytocin receptor gene in German Shepherd (N = 104) and Border Collie (N = 103) dogs. Dogs' behavior traits have been estimated in a newly developed test series consisting of five episodes: Greeting by a stranger, Separation from the owner, Problem solving, Threatening approach, Hiding of the owner. Buccal samples were collected and DNA was isolated using standard protocols. SNPs in the 3′ and 5′ UTR regions were analyzed by polymerase chain reaction based techniques followed by subsequent electrophoresis analysis. The gene–behavior association analysis suggests that oxytocin receptor gene polymorphisms have an impact in both breeds on (i) proximity seeking towards an unfamiliar person, as well as their owner, and on (ii) how friendly dogs behave towards strangers, although the mediating molecular regulatory mechanisms are yet unknown. Based on these results, we conclude that similarly to humans, the social behavior of dogs towards humans is influenced by the oxytocin system. PMID:24454713

Oxytocin receptor gene polymorphisms are associated with human directed social behavior in dogs (Canis familiaris).

PubMed

Kis, Anna; Bence, Melinda; Lakatos, Gabriella; Pergel, Enikő; Turcsán, Borbála; Pluijmakers, Jolanda; Vas, Judit; Elek, Zsuzsanna; Brúder, Ildikó; Földi, Levente; Sasvári-Székely, Mária; Miklósi, Adám; Rónai, Zsolt; Kubinyi, Enikő

2014-01-01

The oxytocin system has a crucial role in human sociality; several results prove that polymorphisms of the oxytocin receptor gene are related to complex social behaviors in humans. Dogs' parallel evolution with humans and their adaptation to the human environment has made them a useful species to model human social interactions. Previous research indicates that dogs are eligible models for behavioral genetic research, as well. Based on these previous findings, our research investigated associations between human directed social behaviors and two newly described (-212AG, 19131AG) and one known (rs8679684) single nucleotide polymorphisms (SNPs) in the regulatory regions (5' and 3' UTR) of the oxytocin receptor gene in German Shepherd (N = 104) and Border Collie (N = 103) dogs. Dogs' behavior traits have been estimated in a newly developed test series consisting of five episodes: Greeting by a stranger, Separation from the owner, Problem solving, Threatening approach, Hiding of the owner. Buccal samples were collected and DNA was isolated using standard protocols. SNPs in the 3' and 5' UTR regions were analyzed by polymerase chain reaction based techniques followed by subsequent electrophoresis analysis. The gene-behavior association analysis suggests that oxytocin receptor gene polymorphisms have an impact in both breeds on (i) proximity seeking towards an unfamiliar person, as well as their owner, and on (ii) how friendly dogs behave towards strangers, although the mediating molecular regulatory mechanisms are yet unknown. Based on these results, we conclude that similarly to humans, the social behavior of dogs towards humans is influenced by the oxytocin system.

Capturing haplotypes in germplasm core collections

USDA-ARS?s Scientific Manuscript database

Genomewide data sets of single nucleotide polymorphisms (SNPs) offer great potential to improve ex situ conservation. Two factors impede their use for producing core collections. First, due to the large number of SNPs, the assembly of collections that maximize diversity may be intractable using ex...

Marker-assisted backcross approach for important agronomic traits of sorghum

USDA-ARS?s Scientific Manuscript database

Sequencing technologies are useful for identification of thousands of single nucleotide polymorphisms (SNPs) in a cost effective manner. QTL mapping, association mapping and Mutmap approaches provide opportunities for use of such SNPs to associate and identify genes that control important agronomic ...

eQTL networks unveil enriched mRNA master integrators downstream of complex disease-associated SNPs.

PubMed

Li, Haiquan; Pouladi, Nima; Achour, Ikbel; Gardeux, Vincent; Li, Jianrong; Li, Qike; Zhang, Hao Helen; Martinez, Fernando D; 'Skip' Garcia, Joe G N; Lussier, Yves A

2015-12-01

The causal and interplay mechanisms of Single Nucleotide Polymorphisms (SNPs) associated with complex diseases (complex disease SNPs) investigated in genome-wide association studies (GWAS) at the transcriptional level (mRNA) are poorly understood despite recent advancements such as discoveries reported in the Encyclopedia of DNA Elements (ENCODE) and Genotype-Tissue Expression (GTex). Protein interaction network analyses have successfully improved our understanding of both single gene diseases (Mendelian diseases) and complex diseases. Whether the mRNAs downstream of complex disease genes are central or peripheral in the genetic information flow relating DNA to mRNA remains unclear and may be disease-specific. Using expression Quantitative Trait Loci (eQTL) that provide DNA to mRNA associations and network centrality metrics, we hypothesize that we can unveil the systems properties of information flow between SNPs and the transcriptomes of complex diseases. We compare different conditions such as naïve SNP assignments and stringent linkage disequilibrium (LD) free assignments for transcripts to remove confounders from LD. Additionally, we compare the results from eQTL networks between lymphoblastoid cell lines and liver tissue. Empirical permutation resampling (p<0.001) and theoretic Mann-Whitney U test (p<10(-30)) statistics indicate that mRNAs corresponding to complex disease SNPs via eQTL associations are likely to be regulated by a larger number of SNPs than expected. We name this novel property mRNA hubness in eQTL networks, and further term mRNAs with high hubness as master integrators. mRNA master integrators receive and coordinate the perturbation signals from large numbers of polymorphisms and respond to the personal genetic architecture integratively. This genetic signal integration contrasts with the mechanism underlying some Mendelian diseases, where a genetic polymorphism affecting a single protein hub produces a divergent signal that affects a large number of downstream proteins. Indeed, we verify that this property is independent of the hubness in protein networks for which these mRNAs are transcribed. Our findings provide novel insights into the pleiotropy of mRNAs targeted by complex disease polymorphisms and the architecture of the information flow between the genetic polymorphisms and transcriptomes of complex diseases. Copyright © 2015 The Authors. Published by Elsevier Inc. All rights reserved.

Using microarray analysis to evaluate genetic polymorphisms involved in the metabolism of environmental chemicals.

PubMed

Ban, Susumu; Kondo, Tomoko; Ishizuka, Mayumi; Sasaki, Seiko; Konishi, Kanae; Washino, Noriaki; Fujita, Syoichi; Kishi, Reiko

2007-05-01

The field of molecular biology currently faces the need for a comprehensive method of evaluating individual differences derived from genetic variation in the form of single nucleotide polymorphisms (SNPs). SNPs in human genes are generally considered to be very useful in determining inherited genetic disorders, susceptibility to certain diseases, and cancer predisposition. Quick and accurate discrimination of SNPs is the key characteristic of technology used in DNA diagnostics. For this study, we first developed a DNA microarray and then evaluated its efficacy by determining the detection ability and validity of this method. Using DNA obtained from 380 pregnant Japanese women, we examined 13 polymorphisms of 9 genes, which are associated with the metabolism of environmental chemical compounds found in high frequency among Japanese populations. The ability to detect CYP1A1 I462V, CYP1B1 L432V, GSTP1 I105V and AhR R554K gene polymorphisms was above 98%, and agreement rates when compared with real time PCR analysis methods (kappa values) showed high validity: 0.98 (0.96), 0.97 (0.93), 0.90 (0.81), 0.90 (0.91), respectively. While this DNA microarray analysis should prove important as a method for initial screening, it is still necessary that we find better methods for improving the detection of other gene polymorphisms not part of this study.

Genetic Diversity in the Prion Protein Gene (PRNP) of Domestic Cattle and Water Buffaloes in Vietnam, Indonesia and Thailand

PubMed Central

UCHIDA, Leo; HERIYANTO, Agus; THONGCHAI, Chalermchaikit; HANH, Tran Thi; HORIUCHI, Motohiro; ISHIHARA, Kanako; TAMURA, Yutaka; MURAMATSU, Yasukazu

2014-01-01

ABSTRACT There has been an accumulation of information on frequencies of insertion/deletion (indel) polymorphisms within the bovine prion protein gene (PRNP) and on the number of octapeptide repeats and single nucleotide polymorphisms (SNPs) in the coding region of bovine PRNP related to bovine spongiform encephalopathy (BSE) susceptibility. We investigated the frequencies of 23-bp indel polymorphism in the promoter region (23indel) and 12-bp indel polymorphism in intron 1 region (12indel), octapeptide repeat polymorphisms and SNPs in the bovine PRNP of cattle and water buffaloes in Vietnam, Indonesia and Thailand. The frequency of the deletion allele in the 23indel site was significantly low in cattle of Indonesia and Thailand and water buffaloes. The deletion allele frequency in the 12indel site was significantly low in all of the cattle and buffaloes categorized in each subgroup. In both indel sites, the deletion allele has been reported to be associated with susceptibility to classical BSE. In some Indonesian local cattle breeds, the frequency of the allele with 5 octapeptide repeats was significantly high despite the fact that the allele with 6 octapeptide repeats has been reported to be most frequent in many breeds of cattle. Four SNPs observed in Indonesian local cattle have not been reported for domestic cattle. This study provided information on PRNP of livestock in these Southeast Asian countries. PMID:24705506

Polymorphisms of the resistin gene and their association with obesity and resistin levels in Malaysian Malays.

PubMed

Apalasamy, Yamunah Devi; Rampal, Sanjay; Salim, Agus; Moy, Foong Ming; Su, Tin Tin; Majid, Hazreen Abdul; Bulgiba, Awang; Mohamed, Zahurin

2015-06-01

Single nucleotide polymorphisms (SNP) in the resistin gene (RETN) are linked to obesity and resistin levels in various populations. However, results have been inconsistent. This study aimed to investigate association between polymorphisms in the resistin gene with obesity in a homogenous Malaysian Malay population. This study is also aimed to determine association between resistin levels with certain SNPs and haplotypes of RETN. A total of 631 Malaysian Malay subjects were included in this study and genotyping was carried out using Sequenom MassARRAY. There was no significant difference found in both allelic and genotype frequencies of each of the RETN SNPs between the obese and non-obese groups after Bonferroni correction. RETN rs34861192 and rs3219175 SNPs were significantly associated with log-resistin levels. The GG genotype carriers are found to have higher levels of log-resistin compared to A allele carriers. The RETN haplotypes (CAG, CGA and GA) were significantly associated with resistin levels. However, the haplotypes of the RETN gene were not associated with obesity. Resistin levels were not correlated to metabolic parameters such as body weight, waist circumference, body mass index, and lipid parameters. RETN SNPs and haplotypes are of apparent functional importance in the regulation of resistin levels but are not correlated with obesity and related markers.

EPH Receptor B4 (EPHB4) Gene Polymorphisms and Risk of Intracranial Hemorrhage in Patients with Brain Arteriovenous Malformations

PubMed Central

Weinsheimer, Shantel; Kim, Helen; Pawlikowska, Ludmila; Chen, Yongmei; Lawton, Michael T.; Sidney, Stephen; Kwok, Pui-Yan; McCulloch, Charles E.; Young, William L.

2009-01-01

Background Brain arteriovenous malformations (BAVM) are a tangle of abnormal vessels directly shunting blood from the arterial to venous circulation and an important cause of intracranial hemorrhage (ICH). EphB4 is involved in arterial-venous determination during embryogenesis; altered signaling could lead to vascular instability resulting in ICH. We investigated the association of single-nucleotide polymorphisms (SNPs) and haplotypes in EPHB4 with risk of ICH at clinical presentation in BAVM patients. Methods and Results Eight haplotype-tagging SNPs spanning ∼29 kb were tested for association with ICH presentation in 146 Caucasian BAVM patients (phase I: 56 ICH, 90 non-ICH) using allelic, haplotypic, and principal components analysis. Associated SNPs were then genotyped in 102 additional cases (phase II: 37 ICH, 65 non-ICH) and data combined for multivariable logistic regression. Minor alleles of 2 SNPs were associated with reduced risk of ICH presentation (rs314313 C, P=0.005; rs314308 T, P=0.0004). Overall, haplotypes were also significantly associated with ICH presentation (χ2=17.24, 6 df, P=0.008); 2 haplotypes containing the rs314308 T allele (GCCTGGGT, P=0.003; GTCTGGGC, P=0.036) were associated with reduced risk. In principal components analysis, 2 components explained 91% of the variance, and complemented haplotype results by implicating 4 SNPs at the 5′ end, including rs314308 and rs314313. These 2 SNPs were replicated in the phase II cohort, and combined data resulted in greater significance (rs314313, P=0.0007; rs314308, P=0.00008). SNP association with ICH presentation persisted after adjusting for age, sex, BAVM size, and deep venous drainage. Conclusions EPHB4 polymorphisms are associated with risk of ICH presentation in BAVM patients, warranting further study. PMID:20031623

Inverse correlation between HPSE gene single nucleotide polymorphisms and heparanase expression: possibility of multiple levels of heparanase regulation

PubMed Central

Ostrovsky, Olga; Korostishevsky, Michael; Shafat, Itay; Mayorov, Margarita; Ilan, Neta; Vlodavsky, Israel; Nagler, Arnon

2009-01-01

Heparanase is an endo-β-glucuronidase that specifically cleaves the saccharide chains of heparan sulfate proteoglycans. Heparanase plays important roles in processes such as angiogenesis, tumor metastasis, tissue repair and remodeling, inflammation and autoimmunity. Genetic variations of the heparanase gene (HPSE) have been associated with heparanase transcription level. The present study was undertaken to identify haplotype or single nucleotide polymorphisms (SNPs) genotype combinations that correlate with heparanase expression both at the mRNA and protein levels. For this purpose, 11 HPSE gene SNPs were genotyped among 108 healthy individuals. Five out of the eleven polymorphisms revealed an association between the SNPs and heparanase expression. SNP rs4693608 exhibited a strong evidence of association. Analysis of haplotypes distribution revealed that the combination of two SNPs (rs4693608 and rs4364254) disclosed the most significant result. This approach allowed segregation of possible genotype combinations to three groups that correlate with low (LR: GG-CC, GG-CT, GG-TT, GA-CC), intermediate (MR: GA-CT, GA-TT) and high (HR: AA-TT, AA-CT) heparanase expression. Unexpectedly, LR genotype combinations were associated with low mRNA expressions level and high heparanase concentration in plasma, while HR genotype combinations were associated with high expression of mRNA and low plasma protein level. Because the main site of activity of secreted active heparanase is the extracellular matrix and cell surface, the origin and functional significance of plasma heparanase remain to be investigated. The current study indicates that rs4693608 and rs4364254 SNPs are involved in the regulation of heparanase expression and provides the basis for further studies on the association between HPSE gene SNPs and disease outcome. PMID:19406828

Polymorphisms in genes related to inflammation and obesity and colorectal adenoma risk.

PubMed

Huang, Brian Z; Tsilidis, Konstantinos K; Smith, Michael W; Hoffman-Bolton, Judith; Visvanathan, Kala; Platz, Elizabeth A; Joshu, Corinne E

2018-05-26

We previously investigated the association between single nucleotide polymorphisms (SNPs) in genes related to obesity and inflammation and colorectal cancer in the CLUE II cohort. However, the relationships between these SNPs and colorectal adenomas have not been well evaluated. In a nested case-control study of 135 incident adenoma cases and 269 matched controls in the CLUE II cohort (1989-2000), we genotyped 17 candidate SNPs in 12 genes (PPARG, TCF7L2, ADIPOQ, LEP, IL10, CRP, TLR4, IL6, IL1B, IL8, TNF, RNASEL) and 19 tagSNPs in three genes (IL10, CRP, and TLR4). Conditional logistic regression was used to calculate odds ratios (OR) for adenomas (overall and by size, histology, location, number). Polymorphisms in the inflammatory-related genes CRP, ADIPOQ, IL6, and TLR4 were observed to be associated with adenoma risk. At rs1205 in CRP, T (minor allele) carriers had a higher risk (OR 1.67, 95%CI 1.07-2.60; reference: CC) of adenomas overall and adenomas with aggressive characteristics. At rs1201299 in ADIPOQ, the AC genotype had a higher risk (OR 1.58, 95%CI 1.00-2.49) of adenomas, while the minor AA genotype had a borderline inverse association (OR 0.44, 95%CI 0.18-1.08; reference: CC). At rs1800797 in IL6, the AA genotype had a borderline inverse association (OR 0.53, 95%CI 0.27-1.05; reference: GG). Three TLR4 tagSNPs (rs10116253, rs1927911, rs7873784) were associated with adenomas among obese participants. None of these SNPs were associated with colorectal cancer in our prior study in CLUE II, possibly suggesting a different genetic etiology for early colorectal neoplasia. © 2018 Wiley Periodicals, Inc.

Genome-Wide Divergence and Linkage Disequilibrium Analyses for Capsicum baccatum Revealed by Genome-Anchored Single Nucleotide Polymorphisms

PubMed Central

Nimmakayala, Padma; Abburi, Venkata L.; Saminathan, Thangasamy; Almeida, Aldo; Davenport, Brittany; Davidson, Joshua; Reddy, C. V. Chandra Mohan; Hankins, Gerald; Ebert, Andreas; Choi, Doil; Stommel, John; Reddy, Umesh K.

2016-01-01

Principal component analysis (PCA) with 36,621 polymorphic genome-anchored single nucleotide polymorphisms (SNPs) identified collectively for Capsicum annuum and Capsicum baccatum was used to characterize population structure and species domestication of these two important incompatible cultivated pepper species. Estimated mean nucleotide diversity (π) and Tajima's D across various chromosomes revealed biased distribution toward negative values on all chromosomes (except for chromosome 4) in cultivated C. baccatum, indicating a population bottleneck during domestication of C. baccatum. In contrast, C. annuum chromosomes showed positive π and Tajima's D on all chromosomes except chromosome 8, which may be because of domestication at multiple sites contributing to wider genetic diversity. For C. baccatum, 13,129 SNPs were available, with minor allele frequency (MAF) ≥0.05; PCA of the SNPs revealed 283 C. baccatum accessions grouped into 3 distinct clusters, for strong population structure. The fixation index (FST) between domesticated C. annuum and C. baccatum was 0.78, which indicates genome-wide divergence. We conducted extensive linkage disequilibrium (LD) analysis of C. baccatum var. pendulum cultivars on all adjacent SNP pairs within a chromosome to identify regions of high and low LD interspersed with a genome-wide average LD block size of 99.1 kb. We characterized 1742 haplotypes containing 4420 SNPs (range 9–2 SNPs per haplotype). Genome-wide association study (GWAS) of peduncle length, a trait that differentiates wild and domesticated C. baccatum types, revealed 36 significantly associated genome-wide SNPs. Population structure, identity by state (IBS) and LD patterns across the genome will be of potential use for future GWAS of economically important traits in C. baccatum peppers. PMID:27857720

Genome-Wide Divergence and Linkage Disequilibrium Analyses for Capsicum baccatum Revealed by Genome-Anchored Single Nucleotide Polymorphisms.

PubMed

Nimmakayala, Padma; Abburi, Venkata L; Saminathan, Thangasamy; Almeida, Aldo; Davenport, Brittany; Davidson, Joshua; Reddy, C V Chandra Mohan; Hankins, Gerald; Ebert, Andreas; Choi, Doil; Stommel, John; Reddy, Umesh K

2016-01-01

Principal component analysis (PCA) with 36,621 polymorphic genome-anchored single nucleotide polymorphisms (SNPs) identified collectively for Capsicum annuum and Capsicum baccatum was used to characterize population structure and species domestication of these two important incompatible cultivated pepper species. Estimated mean nucleotide diversity (π) and Tajima's D across various chromosomes revealed biased distribution toward negative values on all chromosomes (except for chromosome 4) in cultivated C. baccatum , indicating a population bottleneck during domestication of C. baccatum . In contrast, C. annuum chromosomes showed positive π and Tajima's D on all chromosomes except chromosome 8, which may be because of domestication at multiple sites contributing to wider genetic diversity. For C. baccatum , 13,129 SNPs were available, with minor allele frequency (MAF) ≥0.05; PCA of the SNPs revealed 283 C. baccatum accessions grouped into 3 distinct clusters, for strong population structure. The fixation index ( F ST ) between domesticated C. annuum and C. baccatum was 0.78, which indicates genome-wide divergence. We conducted extensive linkage disequilibrium (LD) analysis of C. baccatum var. pendulum cultivars on all adjacent SNP pairs within a chromosome to identify regions of high and low LD interspersed with a genome-wide average LD block size of 99.1 kb. We characterized 1742 haplotypes containing 4420 SNPs (range 9-2 SNPs per haplotype). Genome-wide association study (GWAS) of peduncle length, a trait that differentiates wild and domesticated C. baccatum types, revealed 36 significantly associated genome-wide SNPs. Population structure, identity by state (IBS) and LD patterns across the genome will be of potential use for future GWAS of economically important traits in C. baccatum peppers.

Prospecting for pig single nucleotide polymorphisms in the human genome: have we struck gold?

PubMed

Grapes, L; Rudd, S; Fernando, R L; Megy, K; Rocha, D; Rothschild, M F

2006-06-01

Gene-to-gene variation in the frequency of single nucleotide polymorphisms (SNPs) has been observed in humans, mice, rats, primates and pigs, but a relationship across species in this variation has not been described. Here, the frequency of porcine coding SNPs (cSNPs) identified by in silico methods, and the frequency of murine cSNPs, were compared with the frequency of human cSNPs across homologous genes. From 150,000 porcine expressed sequence tag (EST) sequences, a total of 452 SNP-containing sequence clusters were found, totalling 1394 putative SNPs. All the clustered porcine EST annotations and SNP data have been made publicly available at http://sputnik.btk.fi/project?name=swine. Human and murine cSNPs were identified from dbSNP and were characterized as either validated or total number of cSNPs (validated plus non-validated) for comparison purposes. The correlation between in silico pig cSNP and validated human cSNP densities was found to be 0.77 (p < 0.00001) for a set of 25 homologous genes, while a correlation of 0.48 (p < 0.0005) was found for a primarily random sample of 50 homologous human and mouse genes. This is the first evidence of conserved gene-to-gene variability in cSNP frequency across species and indicates that site-directed screening of porcine genes that are homologous to cSNP-rich human genes may rapidly advance cSNP discovery in pigs.

Transcriptome-wide single nucleotide polymorphisms (SNPs) for abalone (Haliotis midae): validation and application using GoldenGate medium-throughput genotyping assays.

PubMed

Bester-Van Der Merwe, Aletta; Blaauw, Sonja; Du Plessis, Jana; Roodt-Wilding, Rouvay

2013-09-23

Haliotis midae is one of the most valuable commercial abalone species in the world, but is highly vulnerable, due to exploitation, habitat destruction and predation. In order to preserve wild and cultured stocks, genetic management and improvement of the species has become crucial. Fundamental to this is the availability and employment of molecular markers, such as microsatellites and single nucleotide (SNPs). Transcriptome sequences generated through sequencing-by-synthesis technology were utilized for the in vitro and in silico identification of 505 putative SNPs from a total of 316 selected contigs. A subset of 234 SNPs were further validated and characterized in wild and cultured abalone using two Illumina GoldenGate genotyping assays. Combined with VeraCode technology, this genotyping platform yielded a 65%-69% conversion rate (percentage polymorphic markers) with a global genotyping success rate of 76%-85% and provided a viable means for validating SNP markers in a non-model species. The utility of 31 of the validated SNPs in population structure analysis was confirmed, while a large number of SNPs (174) were shown to be informative and are, thus, good candidates for linkage map construction. The non-synonymous SNPs (50) located in coding regions of genes that showed similarities with known proteins will also be useful for genetic applications, such as the marker-assisted selection of genes of relevance to abalone aquaculture.

Functional and Structural Consequence of Rare Exonic Single Nucleotide Polymorphisms: One Story, Two Tales

PubMed Central

Gu, Wanjun; Gurguis, Christopher I.; Zhou, Jin J.; Zhu, Yihua; Ko, Eun-A.; Ko, Jae-Hong; Wang, Ting; Zhou, Tong

2015-01-01

Genetic variation arising from single nucleotide polymorphisms (SNPs) is ubiquitously found among human populations. While disease-causing variants are known in some cases, identifying functional or causative variants for most human diseases remains a challenging task. Rare SNPs, rather than common ones, are thought to be more important in the pathology of most human diseases. We propose that rare SNPs should be divided into two categories dependent on whether the minor alleles are derived or ancestral. Derived alleles are less likely to have been purified by evolutionary processes and may be more likely to induce deleterious effects. We therefore hypothesized that the rare SNPs with derived minor alleles would be more important for human diseases and predicted that these variants would have larger functional or structural consequences relative to the rare variants for which the minor alleles are ancestral. We systematically investigated the consequences of the exonic SNPs on protein function, mRNA structure, and translation. We found that the functional and structural consequences are more significant for the rare exonic variants for which the minor alleles are derived. However, this pattern is reversed when the minor alleles are ancestral. Thus, the rare exonic SNPs with derived minor alleles are more likely to be deleterious. Age estimation of rare SNPs confirms that these potentially deleterious SNPs are recently evolved in the human population. These results have important implications for understanding the function of genetic variations in human exonic regions and for prioritizing functional SNPs in genome-wide association studies of human diseases. PMID:26454016

Protected DNA strand displacement for enhanced single nucleotide discrimination in double-stranded DNA.

PubMed

Khodakov, Dmitriy A; Khodakova, Anastasia S; Huang, David M; Linacre, Adrian; Ellis, Amanda V

2015-03-04

Single nucleotide polymorphisms (SNPs) are a prime source of genetic diversity. Discriminating between different SNPs provides an enormous leap towards the better understanding of the uniqueness of biological systems. Here we report on a new approach for SNP discrimination using toehold-mediated DNA strand displacement. The distinctiveness of the approach is based on the combination of both 3- and 4-way branch migration mechanisms, which allows for reliable discrimination of SNPs within double-stranded DNA generated from real-life human mitochondrial DNA samples. Aside from the potential diagnostic value, the current study represents an additional way to control the strand displacement reaction rate without altering other reaction parameters and provides new insights into the influence of single nucleotide substitutions on 3- and 4-way branch migration efficiency and kinetics.

Homogeneous real-time detection of single-nucleotide polymorphisms by strand displacement amplification on the BD ProbeTec ET system.

PubMed

Wang, Sha-Sha; Thornton, Keith; Kuhn, Andrew M; Nadeau, James G; Hellyer, Tobin J

2003-10-01

The BD ProbeTec ET System is based on isothermal strand displacement amplification (SDA) of target nucleic acid coupled with homogeneous real-time detection using fluorescent probes. We have developed a novel, rapid method using this platform that incorporates a universal detection format for identification of single-nucleotide polymorphisms (SNPs) and other genotypic variations. The system uses a common pair of fluorescent Detector Probes in conjunction with unlabeled allele-specific Adapter Primers and a universal buffer chemistry to permit analysis of multiple SNP loci under generic assay conditions. We used Detector Probes labeled with different dyes to facilitate differentiation of two alternative alleles in a single reaction with no postamplification manipulation. We analyzed six SNPs within the human beta(2)-adrenergic receptor (beta(2)AR) gene, using whole blood, buccal swabs, and urine samples, and compared results with those obtained by DNA sequencing. Unprocessed whole blood was successfully genotyped with as little as 0.1-1 micro L of sample per reaction. All six beta(2)AR assays were able to accommodate >/==" BORDER="0">20 micro L of unprocessed whole blood. For the 14 individuals tested, genotypes determined with the six beta(2)AR assays agreed with DNA sequencing results. SDA-based allelic differentiation on the BD ProbeTec ET System can detect SNPs rapidly, using whole blood, buccal swabs, or urine.

Decision Tree Algorithm-Generated Single-Nucleotide Polymorphism Barcodes of rbcL Genes for 38 Brassicaceae Species Tagging.

PubMed

Yang, Cheng-Hong; Wu, Kuo-Chuan; Chuang, Li-Yeh; Chang, Hsueh-Wei

2018-01-01

DNA barcode sequences are accumulating in large data sets. A barcode is generally a sequence larger than 1000 base pairs and generates a computational burden. Although the DNA barcode was originally envisioned as straightforward species tags, the identification usage of barcode sequences is rarely emphasized currently. Single-nucleotide polymorphism (SNP) association studies provide us an idea that the SNPs may be the ideal target of feature selection to discriminate between different species. We hypothesize that SNP-based barcodes may be more effective than the full length of DNA barcode sequences for species discrimination. To address this issue, we tested a r ibulose diphosphate carboxylase ( rbcL ) S NP b arcoding (RSB) strategy using a decision tree algorithm. After alignment and trimming, 31 SNPs were discovered in the rbcL sequences from 38 Brassicaceae plant species. In the decision tree construction, these SNPs were computed to set up the decision rule to assign the sequences into 2 groups level by level. After algorithm processing, 37 nodes and 31 loci were required for discriminating 38 species. Finally, the sequence tags consisting of 31 rbcL SNP barcodes were identified for discriminating 38 Brassicaceae species based on the decision tree-selected SNP pattern using RSB method. Taken together, this study provides the rational that the SNP aspect of DNA barcode for rbcL gene is a useful and effective sequence for tagging 38 Brassicaceae species.

Interleukin 1B rs16944 G>A polymorphism was associated with a decreased risk of esophageal cancer in a Chinese population.

PubMed

Zheng, Liang; Yin, Jun; Wang, Liming; Wang, Xu; Shi, Yijun; Shao, Aizhong; Tang, Weifeng; Ding, Guowen; Liu, Chao; Chen, Suocheng; Gu, Haiyong

2013-10-01

Esophageal cancer is the sixth leading cause of cancer-associated deaths worldwide and represents a particularly aggressive type of cancer. Genetic polymorphisms may partly explain individual differences in esophageal cancer susceptibility. We conducted a hospital-based case-control study to evaluate the genetic effects of functional single nucleotide polymorphisms (SNPs) in the interleukin 1 (IL1A and IL1B), IL1f7, IL3 and IL7Ra genes on the development of esophageal cancer. A total of 380 esophageal squamous cell carcinoma (ESCC) cases and 380 controls were recruited for this study. The genotypes were determined using a custom-by-design 48-Plex SNPscan™ Kit. When the IL1B rs16944 GG homozygote genotype was used as the reference group, the GA genotype was associated with a significantly decreased risk of ESCC (GA vs. GG: adjusted OR=0.69, 95% CI=0.49-0.99, p=0.041). However, there were no significant associations between the other five SNPs and ESCC risk. Stratified analyses indicated no significantly different risks of ESCC associated with the IL1B rs16944 G>A polymorphism according to sex, age, smoking status or alcohol consumption. IL3 rs2073506 G>A polymorphism was associated with an increased risk for ESCC higher tumor, nodal, and metastatic (TNM) stages. These findings indicated that the functional IL1B rs16944 G>A polymorphism might contribute to ESCC susceptibility. IL3 rs2073506 G>A polymorphism was associated with an increased risk for ESCC higher TNM stages. However, the results were based on a limited sample size and larger well-designed studies are warranted to confirm these initial findings. Copyright © 2013 The Canadian Society of Clinical Chemists. Published by Elsevier Inc. All rights reserved.

Variants for HDL-C, LDL-C, and triglycerides identified from admixture mapping and fine-mapping analysis in African American families.

PubMed

Shetty, Priya B; Tang, Hua; Feng, Tao; Tayo, Bamidele; Morrison, Alanna C; Kardia, Sharon L R; Hanis, Craig L; Arnett, Donna K; Hunt, Steven C; Boerwinkle, Eric; Rao, Dabeeru C; Cooper, Richard S; Risch, Neil; Zhu, Xiaofeng

2015-02-01

Admixture mapping of lipids was followed-up by family-based association analysis to identify variants for cardiovascular disease in African Americans. The present study conducted admixture mapping analysis for total cholesterol, high-density lipoprotein cholesterol, low-density lipoprotein cholesterol, and triglycerides. The analysis was performed in 1905 unrelated African American subjects from the National Heart, Lung and Blood Institute's Family Blood Pressure Program (FBPP). Regions showing admixture evidence were followed-up with family-based association analysis in 3556 African American subjects from the FBPP. The admixture mapping and family-based association analyses were adjusted for age, age(2), sex, body mass index, and genome-wide mean ancestry to minimize the confounding caused by population stratification. Regions that were suggestive of local ancestry association evidence were found on chromosomes 7 (low-density lipoprotein cholesterol), 8 (high-density lipoprotein cholesterol), 14 (triglycerides), and 19 (total cholesterol and triglycerides). In the fine-mapping analysis, 52 939 single-nucleotide polymorphisms (SNPs) were tested and 11 SNPs (8 independent SNPs) showed nominal significant association with high-density lipoprotein cholesterol (2 SNPs), low-density lipoprotein cholesterol (4 SNPs), and triglycerides (5 SNPs). The family data were used in the fine-mapping to identify SNPs that showed novel associations with lipids and regions, including genes with known associations for cardiovascular disease. This study identified regions on chromosomes 7, 8, 14, and 19 and 11 SNPs from the fine-mapping analysis that were associated with high-density lipoprotein cholesterol, low-density lipoprotein cholesterol, and triglycerides for further studies of cardiovascular disease in African Americans. © 2014 American Heart Association, Inc.

Ovine Reference Materials and Assays for Prion Genetic Testing

USDA-ARS?s Scientific Manuscript database

Codon variants implicated in scrapie susceptibility or disease progression include those at amino acid positions 112, 136, 141, 154, and 171. Nine single nucleotide polymorphisms (SNPs) determine which residues are encoded by the five implicated codons and accurately scoring these SNPs is essential...

Large-scale enrichment and discovery of gene-associated SNPs

USDA-ARS?s Scientific Manuscript database

With the recent advent of massively parallel pyrosequencing by 454 Life Sciences it has become feasible to cost-effectively identify numerous single nucleotide polymorphisms (SNPs) within the recombinogenic regions of the maize (Zea mays L.) genome. We developed a modified version of hypomethylated...

Single-nucleotide polymorphisms at the 9p21.3 genomic region not associated with the risk of cardiovascular disease in patients with rheumatoid arthritis.

PubMed

García-Bermúdez, M; López-Mejías, R; Genre, F; Castañeda, S; González-Juanatey, C; Llorca, J; Corrales, A; Miranda-Filloy, J A; Pina, T; Gómez-Vaquero, C; Rodríguez-Rodríguez, L; Fernández-Gutiérrez, B; Pascual-Salcedo, D; Balsa, A; López-Longo, F J; Carreira, P; Blanco, R; González-Álvaro, I; Martín, J; González-Gay, M A

2013-12-01

Rheumatoid arthritis (RA) is a chronic polygenic inflammatory disease associated with accelerated atherosclerosis and high risk of cardiovascular disease (CVD). In this study, we evaluated the potential association of 9p21.3 single-nucleotide polymorphisms (SNPs) - previously linked to coronary artery disease - and CVD risk in 2001 Spanish RA patients genotyped for 9p21.3 SNPs using TaqMan™ assays. Carotid intima media thickness (cIMT) and presence of carotid plaques were also analyzed. Cox regression model did not disclose significant differences between patients who experienced CVD and those who did not. Neither association was found between cIMT or carotid plaques and SNPs allele distribution. In conclusion, results do not support a role of rs10116277 or rs1537375 SNPs in CVD risk in Spanish RA patients. © 2013 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

Genetics of osteoporosis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Urano, Tomohiko; Inoue, Satoshi, E-mail: INOUE-GER@h.u-tokyo.ac.jp; Department of Anti-Aging Medicine, Graduate School of Medicine, The University of Tokyo, Tokyo 113-8655

Highlights: • Single-nucleotide polymorphisms (SNPs) associated with osteoporosis were identified. • SNPs mapped close to or within VDR and ESR1 are associated with bone mineral density. • WNT signaling pathway plays a pivotal role in regulating bone mineral density. • Genetic studies will be useful for identification of new therapeutic targets. - Abstract: Osteoporosis is a skeletal disease characterized by low bone mineral density (BMD) and microarchitectural deterioration of bone tissue, which increases susceptibility to fractures. BMD is a complex quantitative trait with normal distribution and seems to be genetically controlled (in 50–90% of the cases), according to studies onmore » twins and families. Over the last 20 years, candidate gene approach and genome-wide association studies (GWAS) have identified single-nucleotide polymorphisms (SNPs) that are associated with low BMD, osteoporosis, and osteoporotic fractures. These SNPs have been mapped close to or within genes including those encoding nuclear receptors and WNT-β-catenin signaling proteins. Understanding the genetics of osteoporosis will help identify novel candidates for diagnostic and therapeutic targets.« less

Association of DPP4 Gene Polymorphisms with Type 2 Diabetes Mellitus in Malaysian Subjects

PubMed Central

Ahmed, Radwan H.; Huri, Hasniza Zaman; Al-Hamodi, Zaid; Salem, Sameer D.; Al-absi, Boshra; Muniandy, Sekaran

2016-01-01

Background Genetic polymorphisms of the Dipeptidyl Peptidase 4 (DPP4) gene may play a role in the etiology of type 2 diabetes mellitus (T2DM). This study aimed to investigate the possible association of single nucleotide polymorphisms (SNPs) of the DPP4 gene in Malaysian subjects with T2DM and evaluated whether they had an effect on the serum levels of soluble dipeptidyl peptidase 4 (sDPP-IV). Method Ten DPP4 SNPs were genotyped by TaqMan genotyping assays in 314 subjects with T2DM and 235 controls. Of these, 71 metabolic syndrome (MetS) subjects were excluded from subsequent analysis. The odds ratios (ORs) and their 95% confidence interval (CIs) were calculated using multiple logistic regression for the association between the SNPs of DPP4 and T2DM. In addition, the serum levels of sDPP-IV were investigated to evaluate the association of the SNPs of DPP4 with the sDPP-IV levels. Results Dominant, recessive, and additive genetic models were employed to test the association of DPP4 polymorphisms with T2DM, after adjusting for age, race, gender and BMI. The rs12617656 was associated with T2DM in Malaysian subjects in the recessive genetic model (OR = 1.98, p = 0.006), dominant model (OR = 1.95, p = 0.008), and additive model (OR = 1.63, p = 0.001). This association was more pronounced among Malaysian Indians, recessive (OR = 3.21, p = 0.019), dominant OR = 3.72, p = 0.003) and additive model (OR = 2.29, p = 0.0009). The additive genetic model showed that DPP4 rs4664443 and rs7633162 polymorphisms were associated with T2DM (OR = 1.53, p = 0.039), and (OR = 1.42, p = 0.020), respectively. In addition, the rs4664443 G>A polymorphism was associated with increased sDPP-IV levels (p = 0.042) in T2DM subjects. Conclusions DPP4 polymorphisms were associated with T2DM in Malaysian subjects, and linked to variations in sDPP-IV levels. In addition, these associations were more pronounced among Malaysian Indian subjects. PMID:27111895

Association of DPP4 Gene Polymorphisms with Type 2 Diabetes Mellitus in Malaysian Subjects.

PubMed

Ahmed, Radwan H; Huri, Hasniza Zaman; Al-Hamodi, Zaid; Salem, Sameer D; Al-Absi, Boshra; Muniandy, Sekaran

2016-01-01

Genetic polymorphisms of the Dipeptidyl Peptidase 4 (DPP4) gene may play a role in the etiology of type 2 diabetes mellitus (T2DM). This study aimed to investigate the possible association of single nucleotide polymorphisms (SNPs) of the DPP4 gene in Malaysian subjects with T2DM and evaluated whether they had an effect on the serum levels of soluble dipeptidyl peptidase 4 (sDPP-IV). Ten DPP4 SNPs were genotyped by TaqMan genotyping assays in 314 subjects with T2DM and 235 controls. Of these, 71 metabolic syndrome (MetS) subjects were excluded from subsequent analysis. The odds ratios (ORs) and their 95% confidence interval (CIs) were calculated using multiple logistic regression for the association between the SNPs of DPP4 and T2DM. In addition, the serum levels of sDPP-IV were investigated to evaluate the association of the SNPs of DPP4 with the sDPP-IV levels. Dominant, recessive, and additive genetic models were employed to test the association of DPP4 polymorphisms with T2DM, after adjusting for age, race, gender and BMI. The rs12617656 was associated with T2DM in Malaysian subjects in the recessive genetic model (OR = 1.98, p = 0.006), dominant model (OR = 1.95, p = 0.008), and additive model (OR = 1.63, p = 0.001). This association was more pronounced among Malaysian Indians, recessive (OR = 3.21, p = 0.019), dominant OR = 3.72, p = 0.003) and additive model (OR = 2.29, p = 0.0009). The additive genetic model showed that DPP4 rs4664443 and rs7633162 polymorphisms were associated with T2DM (OR = 1.53, p = 0.039), and (OR = 1.42, p = 0.020), respectively. In addition, the rs4664443 G>A polymorphism was associated with increased sDPP-IV levels (p = 0.042) in T2DM subjects. DPP4 polymorphisms were associated with T2DM in Malaysian subjects, and linked to variations in sDPP-IV levels. In addition, these associations were more pronounced among Malaysian Indian subjects.

A systematic review and meta-analysis of MTHFR polymorphisms in methotrexate toxicity prediction in pediatric acute lymphoblastic leukemia.

PubMed

Lopez-Lopez, E; Martin-Guerrero, I; Ballesteros, J; Garcia-Orad, A

2013-12-01

Methotrexate (MTX) is an important component of therapy used to treat childhood acute lymphoblastic leukemia (ALL). Two single-nucleotide polymorphisms (SNPs) in the methylenetetrahydrofolate reductase (MTHFR) gene, C677T and A1298C, affect MTHFR activity. A large body of studies has investigated the potential role of MTHFR SNPs in MTX toxicity in pediatric ALL. However, the results are controversial. In this review and meta-analysis, we critically evaluate the relationship between the C677T and A1298C polymorphisms of MTHFR and MTX toxicity in pediatric ALL. The majority of published reports do not find associations between MTHFR polymorphisms and toxicity in pediatric ALL. When associations are reported, often the results are contradictory to each other. The meta-analysis confirms a lack of association. In conclusion, MTHFR, C677T and A1298C polymorphisms do not seem to be good markers of MTX-related toxicity in pediatric ALL.

In silico identification of genetic variants in glucocerebrosidase (GBA) gene involved in Gaucher's disease using multiple software tools.

PubMed

Manickam, Madhumathi; Ravanan, Palaniyandi; Singh, Pratibha; Talwar, Priti

2014-01-01

Gaucher's disease (GD) is an autosomal recessive disorder caused by the deficiency of glucocerebrosidase, a lysosomal enzyme that catalyses the hydrolysis of the glycolipid glucocerebroside to ceramide and glucose. Polymorphisms in GBA gene have been associated with the development of Gaucher disease. We hypothesize that prediction of SNPs using multiple state of the art software tools will help in increasing the confidence in identification of SNPs involved in GD. Enzyme replacement therapy is the only option for GD. Our goal is to use several state of art SNP algorithms to predict/address harmful SNPs using comparative studies. In this study seven different algorithms (SIFT, MutPred, nsSNP Analyzer, PANTHER, PMUT, PROVEAN, and SNPs&GO) were used to predict the harmful polymorphisms. Among the seven programs, SIFT found 47 nsSNPs as deleterious, MutPred found 46 nsSNPs as harmful. nsSNP Analyzer program found 43 out of 47 nsSNPs are disease causing SNPs whereas PANTHER found 32 out of 47 as highly deleterious, 22 out of 47 are classified as pathological mutations by PMUT, 44 out of 47 were predicted to be deleterious by PROVEAN server, all 47 shows the disease related mutations by SNPs&GO. Twenty two nsSNPs were commonly predicted by all the seven different algorithms. The common 22 targeted mutations are F251L, C342G, W312C, P415R, R463C, D127V, A309V, G46E, G202E, P391L, Y363C, Y205C, W378C, I402T, S366R, F397S, Y418C, P401L, G195E, W184R, R48W, and T43R.

Associations between incident ischemic stroke events and stroke and cardiovascular disease-related genome-wide association studies single nucleotide polymorphisms in the Population Architecture Using Genomics and Epidemiology study.

PubMed

Carty, Cara L; Buzková, Petra; Fornage, Myriam; Franceschini, Nora; Cole, Shelley; Heiss, Gerardo; Hindorff, Lucia A; Howard, Barbara V; Mann, Sue; Martin, Lisa W; Zhang, Ying; Matise, Tara C; Prentice, Ross; Reiner, Alexander P; Kooperberg, Charles

2012-04-01

Genome-wide association studies (GWAS) have identified loci associated with ischemic stroke (IS) and cardiovascular disease (CVD) in European-descent individuals, but their replication in different populations has been largely unexplored. Nine single nucleotide polymorphisms (SNPs) selected from GWAS and meta-analyses of stroke, and 86 SNPs previously associated with myocardial infarction and CVD risk factors, including blood lipids (high density lipoprotein [HDL], low density lipoprotein [LDL], and triglycerides), type 2 diabetes, and body mass index (BMI), were investigated for associations with incident IS in European Americans (EA) N=26 276, African-Americans (AA) N=8970, and American Indians (AI) N=3570 from the Population Architecture using Genomics and Epidemiology Study. Ancestry-specific fixed effects meta-analysis with inverse variance weighting was used to combine study-specific log hazard ratios from Cox proportional hazards models. Two of 9 stroke SNPs (rs783396 and rs1804689) were significantly associated with [corrected] IS hazard in AA; none were significant in this large EA cohort. Of 73 CVD risk factor SNPs tested in EA, 2 (HDL and triglycerides SNPs) were associated with IS. In AA, SNPs associated with LDL, HDL, and BMI were significantly associated with IS (3 of 86 SNPs tested). Out of 58 SNPs tested in AI, 1 LDL SNP was significantly associated with IS. Our analyses showing lack of replication in spite of reasonable power for many stroke SNPs and differing results by ancestry highlight the need to follow up on GWAS findings and conduct genetic association studies in diverse populations. We found modest IS associations with BMI and lipids SNPs, though these findings require confirmation.

Altools: a user friendly NGS data analyser.

PubMed

Camiolo, Salvatore; Sablok, Gaurav; Porceddu, Andrea

2016-02-17

Genotyping by re-sequencing has become a standard approach to estimate single nucleotide polymorphism (SNP) diversity, haplotype structure and the biodiversity and has been defined as an efficient approach to address geographical population genomics of several model species. To access core SNPs and insertion/deletion polymorphisms (indels), and to infer the phyletic patterns of speciation, most such approaches map short reads to the reference genome. Variant calling is important to establish patterns of genome-wide association studies (GWAS) for quantitative trait loci (QTLs), and to determine the population and haplotype structure based on SNPs, thus allowing content-dependent trait and evolutionary analysis. Several tools have been developed to investigate such polymorphisms as well as more complex genomic rearrangements such as copy number variations, presence/absence variations and large deletions. The programs available for this purpose have different strengths (e.g. accuracy, sensitivity and specificity) and weaknesses (e.g. low computation speed, complex installation procedure and absence of a user-friendly interface). Here we introduce Altools, a software package that is easy to install and use, which allows the precise detection of polymorphisms and structural variations. Altools uses the BWA/SAMtools/VarScan pipeline to call SNPs and indels, and the dnaCopy algorithm to achieve genome segmentation according to local coverage differences in order to identify copy number variations. It also uses insert size information from the alignment of paired-end reads and detects potential large deletions. A double mapping approach (BWA/BLASTn) identifies precise breakpoints while ensuring rapid elaboration. Finally, Altools implements several processes that yield deeper insight into the genes affected by the detected polymorphisms. Altools was used to analyse both simulated and real next-generation sequencing (NGS) data and performed satisfactorily in terms of positive predictive values, sensitivity, the identification of large deletion breakpoints and copy number detection. Altools is fast, reliable and easy to use for the mining of NGS data. The software package also attempts to link identified polymorphisms and structural variants to their biological functions thus providing more valuable information than similar tools.

Target capture enrichment of nuclear SNP markers for massively parallel sequencing of degraded and mixed samples.

PubMed

Bose, Nikhil; Carlberg, Katie; Sensabaugh, George; Erlich, Henry; Calloway, Cassandra

2018-05-01

DNA from biological forensic samples can be highly fragmented and present in limited quantity. When DNA is highly fragmented, conventional PCR based Short Tandem Repeat (STR) analysis may fail as primer binding sites may not be present on a single template molecule. Single Nucleotide Polymorphisms (SNPs) can serve as an alternative type of genetic marker for analysis of degraded samples because the targeted variation is a single base. However, conventional PCR based SNP analysis methods still require intact primer binding sites for target amplification. Recently, probe capture methods for targeted enrichment have shown success in recovering degraded DNA as well as DNA from ancient bone samples using next-generation sequencing (NGS) technologies. The goal of this study was to design and test a probe capture assay targeting forensically relevant nuclear SNP markers for clonal and massively parallel sequencing (MPS) of degraded and limited DNA samples as well as mixtures. A set of 411 polymorphic markers totaling 451 nuclear SNPs (375 SNPs and 36 microhaplotype markers) was selected for the custom probe capture panel. The SNP markers were selected for a broad range of forensic applications including human individual identification, kinship, and lineage analysis as well as for mixture analysis. Performance of the custom SNP probe capture NGS assay was characterized by analyzing read depth and heterozygote allele balance across 15 samples at 25 ng input DNA. Performance thresholds were established based on read depth ≥500X and heterozygote allele balance within ±10% deviation from 50:50, which was observed for 426 out of 451 SNPs. These 426 SNPs were analyzed in size selected samples (at ≤75 bp, ≤100 bp, ≤150 bp, ≤200 bp, and ≤250 bp) as well as mock degraded samples fragmented to an average of 150 bp. Samples selected for ≤75 bp exhibited 99-100% reportable SNPs across varied DNA amounts and as low as 0.5 ng. Mock degraded samples at 1 ng and 10 ng exhibited >90% reportable SNPs. Finally, two-person male-male mixtures were tested at 10 ng in contributor varying ratios. Overall, 85-100% of alleles unique to the minor contributor were observed at all mixture ratios. Results from these studies using the SNP probe capture NGS system demonstrates proof of concept for application to forensically relevant degraded and mixed DNA samples. Copyright © 2018 Elsevier B.V. All rights reserved.

Single Nucleotide Polymorphisms of Stemness Genes Predicted to Regulate RNA Splicing, microRNA and Oncogenic Signaling are Associated with Prostate Cancer Survival.

PubMed

Freedman, Jennifer A; Wang, Yanru; Li, Xuechan; Liu, Hongliang; Moorman, Patricia G; George, Daniel J; Lee, Norman H; Hyslop, Terry; Wei, Qingyi; Patierno, Steven R

2018-05-03

Prostate cancer is a clinically and molecularly heterogeneous disease, with variation in outcomes only partially predicted by grade and stage. Additional tools to distinguish indolent from aggressive disease are needed. Phenotypic characteristics of stemness correlate with poor cancer prognosis. Given this correlation, we identified single nucleotide polymorphisms (SNPs) of stemness-related genes and examined their associations with prostate cancer survival. SNPs within stemness-related genes were analyzed for association with overall survival of prostate cancer in the Prostate, Lung, Colorectal and Ovarian Cancer Screening Trial. Significant SNPs predicted to be functional were selected for linkage disequilibrium analysis and combined and stratified analyses. Identified SNPs were evaluated for association with gene expression. SNPs of CD44 (rs9666607), ABCC1 (rs35605 and rs212091) and GDF15 (rs1058587) were associated with prostate cancer survival and predicted to be functional. A role for rs9666607 of CD44 and rs35605 of ABCC1 in RNA splicing regulation, rs212091 of ABCC1 in miRNA binding site activity and rs1058587 of GDF15 in causing an amino acid change was predicted. These SNPs represent potential novel prognostic markers for overall survival of prostate cancer and support a contribution of the stemness pathway to prostate cancer patient outcome.

Polymorphisms in Genes Involved in the NF-κB Signalling Pathway Are Associated with Bone Mineral Density, Geometry and Turnover in Men

PubMed Central

Roshandel, Delnaz; Thomson, Wendy; Pye, Stephen R.; Boonen, Steven; Borghs, Herman; Vanderschueren, Dirk; Huhtaniemi, Ilpo T.; Adams, Judith E.; Ward, Kate A.; Bartfai, Gyorgy; Casanueva, Felipe F.; Finn, Joseph D.; Forti, Gianni; Giwercman, Aleksander; Han, Thang S.; Kula, Krzysztof; Lean, Michael E.; Pendleton, Neil; Punab, Margus; Wu, Frederick C.

2011-01-01

Introduction In this study, we aimed to investigate the association between single nucleotide polymorphisms (SNPs) within two genes involved in the NF-κB cascade (GPR177 and MAP3K14) and bone mineral density (BMD) assessed at different skeletal sites, radial geometric parameters and bone turnover. Methods Ten GPR177 SNPs previously associated with BMD with genome-wide significance and twelve tag SNPs (r2≥0.8) within MAP3K14 (±10 kb) were genotyped in 2359 men aged 40–79 years recruited from 8 centres for participation in the European Male Aging Study (EMAS). Measurement of bone turnover markers (PINP and CTX-I) in the serum and quantitative ultrasound (QUS) at the calcaneus were performed in all centres. Dual energy X-ray absorptiometry (DXA), at the lumbar spine and hip, and peripheral quantitative computed tomography (pQCT), at the distal and midshaft radius, were performed in a subsample (2 centres). Linear regression was used to test for association between the SNPs and bone measures under an additive genetic model adjusting for study centre. Results We validated the associations between SNPs in GPR177 and BMDa previously reported and also observed evidence of pleiotrophic effects on density and geometry. Rs2772300 in GPR177 was associated with increased total hip and LS BMDa, increased total and cortical vBMD at the radius and increased cortical area, thickness and stress strain index. We also found evidence of association with BMDa, vBMD, geometric parameters and CTX-I for SNPs in MAP3K14. None of the GPR177 and MAP3K14 SNPs were associated with calcaneal estimated BMD measured by QUS. Conclusion Our findings suggest that SNPs in GPR177 and MAP3K14 involved in the NF-κB signalling pathway influence bone mineral density, geometry and turnover in a population-based cohort of middle aged and elderly men. This adds to the understanding of the role of genetic variation in this pathway in determining bone health. PMID:22132199

Genetic basis of interindividual susceptibility to cancer cachexia: selection of potential candidate gene polymorphisms for association studies.

PubMed

Johns, N; Tan, B H; MacMillan, M; Solheim, T S; Ross, J A; Baracos, V E; Damaraju, S; Fearon, K C H

2014-12-01

Cancer cachexia is a complex and multifactorial disease. Evolving definitions highlight the fact that a diverse range of biological processes contribute to cancer cachexia. Part of the variation in who will and who will not develop cancer cachexia may be genetically determined. As new definitions, classifications and biological targets continue to evolve, there is a need for reappraisal of the literature for future candidate association studies. This review summarizes genes identified or implicated as well as putative candidate genes contributing to cachexia, identified through diverse technology platforms and model systems to further guide association studies. A systematic search covering 1986-2012 was performed for potential candidate genes / genetic polymorphisms relating to cancer cachexia. All candidate genes were reviewed for functional polymorphisms or clinically significant polymorphisms associated with cachexia using the OMIM and GeneRIF databases. Pathway analysis software was used to reveal possible network associations between genes. Functionality of SNPs/genes was explored based on published literature, algorithms for detecting putative deleterious SNPs and interrogating the database for expression of quantitative trait loci (eQTLs). A total of 154 genes associated with cancer cachexia were identified and explored for functional polymorphisms. Of these 154 genes, 119 had a combined total of 281 polymorphisms with functional and/or clinical significance in terms of cachexia associated with them. Of these, 80 polymorphisms (in 51 genes) were replicated in more than one study with 24 polymorphisms found to influence two or more hallmarks of cachexia (i.e., inflammation, loss of fat mass and/or lean mass and reduced survival). Selection of candidate genes and polymorphisms is a key element of multigene study design. The present study provides a contemporary basis to select genes and/or polymorphisms for further association studies in cancer cachexia, and to develop their potential as susceptibility biomarkers of cachexia.

Single nucleotide polymorphisms in long noncoding RNA, ANRIL, are not associated with severe periodontitis but with adverse cardiovascular events among patients with cardiovascular disease.

PubMed

Schulz, S; Seitter, L; Werdan, K; Hofmann, B; Schaller, H-G; Schlitt, A; Reichert, S

2018-05-06

Biological plausibility of an association between severe periodontitis and cardiovascular disease (CVD) has been proven. Genetic characteristics play an important role in both complex inflammatory diseases. Polymorphisms (single nucleotide polymorphisms [SNPs]) in the long noncoding RNA, antisense noncoding RNA in the INK4 locus (ANRIL), were shown to play a leading role in both diseases. The primary objectives of the study were to assess, among cardiovascular (CV angiographically proven ≥50% stenosis of a main coronary artery) patients, the impact of ANRIL SNPs rs133049 and rs3217992 on the severity of periodontitis and the previous history of coronary events, as well as on the occurrence of further adverse CV events. The prevalence of severe periodontitis was analyzed in 1002 CV patients. ANRIL SNPs rs133049 and rs3217992 were genotyped. The prognostic value of both ANRIL SNPs for combined CV endpoint (stroke/transient ischemic attack [TIA], myocardial infarction, death from a CV-related event, death from stroke) was evaluated after a 3-year follow-up period. Hazard ratios (HRs) were adjusted for established CV risk factors applying Cox regression. ANRIL SNPs rs133049 and rs3217992 were not associated with severe periodontitis or history of CVD in CV patients. In the Kaplan-Meier survival curve including the log rank-test (P = .036) and Cox regression (hazard ratio = 1.684, P = .009) the AA genotype of rs3217992 was shown to be an independent predictor for adverse CV events after 3 years of follow-up. SNPs in ANRIL are not risk modulators for severe periodontitis and history of CVD in CV patients. The AA genotype of ANRIL SNPs rs3217992 possesses prognostic power for further CV events within 3 years of follow-up. © 2018 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

Development and evaluation of the first high-throughput SNP array for common carp (Cyprinus carpio)

PubMed Central

2014-01-01

Background A large number of single nucleotide polymorphisms (SNPs) have been identified in common carp (Cyprinus carpio) but, as yet, no high-throughput genotyping platform is available for this species. C. carpio is an important aquaculture species that accounts for nearly 14% of freshwater aquaculture production worldwide. We have developed an array for C. carpio with 250,000 SNPs and evaluated its performance using samples from various strains of C. carpio. Results The SNPs used on the array were selected from two resources: the transcribed sequences from RNA-seq data of four strains of C. carpio, and the genome re-sequencing data of five strains of C. carpio. The 250,000 SNPs on the resulting array are distributed evenly across the reference C.carpio genome with an average spacing of 6.6 kb. To evaluate the SNP array, 1,072 C. carpio samples were collected and tested. Of the 250,000 SNPs on the array, 185,150 (74.06%) were found to be polymorphic sites. Genotyping accuracy was checked using genotyping data from a group of full-siblings and their parents, and over 99.8% of the qualified SNPs were found to be reliable. Analysis of the linkage disequilibrium on all samples and on three domestic C.carpio strains revealed that the latter had the longer haplotype blocks. We also evaluated our SNP array on 80 samples from eight species related to C. carpio, with from 53,526 to 71,984 polymorphic SNPs. An identity by state analysis divided all the samples into three clusters; most of the C. carpio strains formed the largest cluster. Conclusions The Carp SNP array described here is the first high-throughput genotyping platform for C. carpio. Our evaluation of this array indicates that it will be valuable for farmed carp and for genetic and population biology studies in C. carpio and related species. PMID:24762296

Development and evaluation of the first high-throughput SNP array for common carp (Cyprinus carpio).

PubMed

Xu, Jian; Zhao, Zixia; Zhang, Xiaofeng; Zheng, Xianhu; Li, Jiongtang; Jiang, Yanliang; Kuang, Youyi; Zhang, Yan; Feng, Jianxin; Li, Chuangju; Yu, Juhua; Li, Qiang; Zhu, Yuanyuan; Liu, Yuanyuan; Xu, Peng; Sun, Xiaowen

2014-04-24

A large number of single nucleotide polymorphisms (SNPs) have been identified in common carp (Cyprinus carpio) but, as yet, no high-throughput genotyping platform is available for this species. C. carpio is an important aquaculture species that accounts for nearly 14% of freshwater aquaculture production worldwide. We have developed an array for C. carpio with 250,000 SNPs and evaluated its performance using samples from various strains of C. carpio. The SNPs used on the array were selected from two resources: the transcribed sequences from RNA-seq data of four strains of C. carpio, and the genome re-sequencing data of five strains of C. carpio. The 250,000 SNPs on the resulting array are distributed evenly across the reference C.carpio genome with an average spacing of 6.6 kb. To evaluate the SNP array, 1,072 C. carpio samples were collected and tested. Of the 250,000 SNPs on the array, 185,150 (74.06%) were found to be polymorphic sites. Genotyping accuracy was checked using genotyping data from a group of full-siblings and their parents, and over 99.8% of the qualified SNPs were found to be reliable. Analysis of the linkage disequilibrium on all samples and on three domestic C.carpio strains revealed that the latter had the longer haplotype blocks. We also evaluated our SNP array on 80 samples from eight species related to C. carpio, with from 53,526 to 71,984 polymorphic SNPs. An identity by state analysis divided all the samples into three clusters; most of the C. carpio strains formed the largest cluster. The Carp SNP array described here is the first high-throughput genotyping platform for C. carpio. Our evaluation of this array indicates that it will be valuable for farmed carp and for genetic and population biology studies in C. carpio and related species.

Lack of association between ESR1 gene polymorphisms and premature ovarian failure in Serbian women.

PubMed

Li, J; Vujovic, S; Dalgleish, R; Thompson, J; Dragojevic-Dikic, S; Al-Azzawi, F

2014-06-01

It has previously been reported that estrogen receptor-alpha (ERα) gene (ESR1: estrogen receptor 1) polymorphisms are associated with premature ovarian failure (POF). The aim of this study was to investigate whether these genetic polymorphisms of ESR1 are associated with POF in Serbian women. A series of 197 POF cases matched with 547 fertile controls was recruited by the Institute for Endocrinology, Diabetes and Metabolic Disorders of Serbia between 2007 and 2010. Genomic DNA was extracted from saliva using Oragene® DNA sample collection kits. Two single-nucleotide polymorphisms (SNPs), PvuII and XbaI, in ESR1 were genotyped by dynamic allele-specific hybridization. Haplotype analyses were performed with the restriction fragment length polymorphism method. SNP and haplotype effects were analyzed by logistic regression models. No significant difference was found in the distribution of ESR1 PvuII and XbaI polymorphisms or haplotypes between the POF and control groups. The two ESR1 SNPs, PvuII and XbaI, are not commonly associated with POF in Serbian women and may not contribute to the genetic basis of the condition.

Pathway-Based Genome-Wide Association Studies for Two Meat Production Traits in Simmental Cattle.

PubMed

Fan, Huizhong; Wu, Yang; Zhou, Xiaojing; Xia, Jiangwei; Zhang, Wengang; Song, Yuxin; Liu, Fei; Chen, Yan; Zhang, Lupei; Gao, Xue; Gao, Huijiang; Li, Junya

2015-12-17

Most single nucleotide polymorphisms (SNPs) detected by genome-wide association studies (GWAS), explain only a small fraction of phenotypic variation. Pathway-based GWAS were proposed to improve the proportion of genes for some human complex traits that could be explained by enriching a mass of SNPs within genetic groups. However, few attempts have been made to describe the quantitative traits in domestic animals. In this study, we used a dataset with approximately 7,700,000 SNPs from 807 Simmental cattle and analyzed live weight and longissimus muscle area using a modified pathway-based GWAS method to orthogonalise the highly linked SNPs within each gene using principal component analysis (PCA). As a result, of the 262 biological pathways of cattle collected from the KEGG database, the gamma aminobutyric acid (GABA)ergic synapse pathway and the non-alcoholic fatty liver disease (NAFLD) pathway were significantly associated with the two traits analyzed. The GABAergic synapse pathway was biologically applicable to the traits analyzed because of its roles in feed intake and weight gain. The proposed method had high statistical power and a low false discovery rate, compared to those of the smallest P-value and SNP set enrichment analysis methods.

Toll-like receptor 2 gene polymorphisms in Chinese Holstein cattle and their associations with bovine tuberculosis.

PubMed

Zhao, Zhanqin; Xue, Yun; Hu, Zhigang; Zhou, Feng; Ma, Beibei; Long, Ta; Xue, Qiao; Liu, Huisheng

2017-04-01

This study evaluated whether there was an association between polymorphisms within the Toll-like receptor 2 gene (TLR2) of Chinese Holstein cattle and susceptibility to bovine tuberculosis (BTB). In a case-control study including 210 BTB cases and 237 control cattle, we found only two common single-nucleotide polymorphisms (SNPs) within the entire coding region of the TLR2 gene, A631G (rs95214857) and T1707C (rs1388116488). Additionally, the allele and genotype distributions of A631G and T1707C were not different between case and control groups, indicated that these SNPs were not associated with susceptibility to BTB. These results suggested that polymorphisms in the TLR2 gene might not play a significant role in the BTB risk in Chinese Holstein cattle. Copyright © 2017 Elsevier B.V. All rights reserved.

HERC1 polymorphisms: population-specific variations in haplotype composition.

PubMed

Yuasa, Isao; Umetsu, Kazuo; Nishimukai, Hiroaki; Fukumori, Yasuo; Harihara, Shinji; Saitou, Naruya; Jin, Feng; Chattopadhyay, Prasanta K; Henke, Lotte; Henke, Jürgen

2009-08-01

Human HERC1 is one of six HERC proteins and may play an important role in intracellular membrane trafficking. The human HERC1 gene is suggested to have been affected by local positive selection. To assess the global frequency distributions of coding and non-coding single nucleotide polymorphisms (SNPs) in the HERC1 gene, we developed a new simultaneous genotyping method for four SNPs, and applied this method to investigate 1213 individuals from 12 global populations. The results confirmed remarked differences in the allele and haplotype frequencies between East Asian and non-East Asian populations. One of the three common haplotypes observed was found to be characteristic of East Asians, who showed a relatively uniform distribution of haplotypes. Information on haplotypes would be useful for testing the function of polymorphisms in the HERC1 gene. This is the first study to investigate the distribution of HERC1 polymorphisms in various populations. (c) 2009 John Wiley & Sons, Ltd.

Genetic variations in MTHFR and esophageal squamous cell carcinoma susceptibility in Chinese Han population.

PubMed

Tang, Weifeng; Zhang, Sheng; Qiu, Hao; Wang, Lixin; Sun, Bin; Yin, Jun; Gu, Haiyong

2014-05-01

Esophageal cancer is the sixth most common cancer worldwide. Esophageal squamous cell carcinoma (ESCC) is a fatal malignancy associated with low 5-year survival rate. The aim of this study was to assess the association between methylenetetrahydrofolate reductase (MTHFR) tagging single nucleotide polymorphisms (SNPs) rs1801133 C>T, rs3753584 A>G, rs4845882 G>A, rs4846048 A>G and rs9651118 T>C genotypes and ESCC susceptibility in a hospital-based case-control study. We conducted genotyping analyses for these five SNPs with 629 ESCC cases and 686 controls in a Chinese Han population. Ligation detection reaction method was used to identify genotypes of these MTHFR SNPs. Our results demonstrated that MTHFR rs1801133 C>T was associated with the risk of ESCC; however, MTHFR rs4845882 G>A and rs4846048 A>G SNPs were associated with the decreased risk of ESCC, and MTHFR rs3753584 A>G and rs9651118 T>C SNPs were not associated with ESCC risk. Our findings suggests that MTHFR rs1801133 C>T, rs4845882 G>A and rs4846048 A>G SNPs may be genetic modifiers for developing ESCC in Chinese Han population.

Genome-wide association study of the four-constitution medicine.

PubMed

Yin, Chang Shik; Park, Hi Joon; Chung, Joo-Ho; Lee, Hye-Jung; Lee, Byung-Cheol

2009-12-01

Four-constitution medicine (FCM), also known as Sasang constitutional medicine, and the heritage of the long history of individualized acupuncture medicine tradition, is one of the holistic and traditional systems of constitution to appraise and categorize individual differences into four major types. This study first reports a genome-wide association study on FCM, to explore the genetic basis of FCM and facilitate the integration of FCM with conventional individual differences research. Healthy individuals of the Korean population were classified into the four constitutional types (FCTs). A total of 353,202 single nucleotide polymorphisms (SNPs) were typed using whole genome amplified samples, and six-way comparison of FCM types provided lists of significantly differential SNPs. In one-to-one FCT comparisons, 15,944 SNPs were significantly differential, and 5 SNPs were commonly significant in all of the three comparisons. In one-to-two FCT comparisons, 22,616 SNPs were significantly differential, and 20 SNPs were commonly significant in all of the three comparison groups. This study presents the association between genome-wide SNP profiles and the categorization of the FCM, and it could further provide a starting point of genome-based identification and research of the constitutions of FCM.

A study of possible associations between single nucleotide polymorphisms in the estrogen receptor 2 gene and female sexual desire.

PubMed

Gunst, Annika; Jern, Patrick; Westberg, Lars; Johansson, Ada; Salo, Benny; Burri, Andrea; Spector, Tim; Eriksson, Elias; Sandnabba, N Kenneth; Santtila, Pekka

2015-03-01

Female sexual desire and arousal problems have been shown to have a heritable component of moderate size. Previous molecular genetic studies on sexual desire have mainly focused on genes associated with neurotransmitters such as dopamine and serotonin. Nevertheless, there is reason to believe that hormones with more specific functions concerning sexuality could have an impact on sexual desire and arousal. The aim of the present study was to investigate the possible effects of 17 single nucleotide polymorphisms (SNPs) located in estrogen receptor genes on female sexual desire and subjective and genital arousal (lubrication). Based on previous research, we hypothesized that ESR1 and ESR2 are relevant genes that contribute to female sexual desire and arousal. The desire, arousal, and lubrication subdomains of the Female Sexual Function Index self-report questionnaire were used. The present study involved 2,448 female twins and their sisters aged 18-49 who had submitted saliva samples for genotyping. The participants were a subset from a large-scale, population-based sample. We found nominally significant main effects on sexual desire for three ESR2 -linked SNPs when controlled for anxiety, suggesting that individuals homozygous for the G allele of the rs1271572 SNP, and the A allele of the rs4986938 and rs928554 SNPs had lower levels of sexual desire. The rs4986938 SNP also had a nominally significant effect on lubrication. No effects for any of the SNPs on subjective arousal could be detected. The number of nominally significant results for SNPs in the ESR2 gene before correcting for multiple testing suggests that further studies on the possible influence of this gene on interindividual variation in female sexual functioning are warranted. In contrast, no support for an involvement of ESR1 was obtained. Our results should be interpreted with caution until replicated in independent, large samples. © 2014 International Society for Sexual Medicine.

Associations Between Polymorphisms in the Glucocorticoid-Receptor Gene and Cardiovascular Risk Factors in a Chinese Population

PubMed Central

Yan, Yu-Xiang; Dong, Jing; Wu, Li-Juan; Shao, Shuang; Zhang, Jie; Zhang, Ling; Wang, Wei; He, Yan; Liu, You-Qin

2013-01-01

Background Glucocorticoid is an important regulator of energy homeostasis. Glucocorticoid receptor (GR) gene polymorphisms that contribute to variability in glucocorticoid sensitivity have been identified. We explored the associations of single-nucleotide polymorphisms (SNPs) of the GR gene with traditional cardiovascular risk factors in the Chinese Han population. Methods We recruited 762 consecutive adults who underwent a regular physical examination at Beijing Xuanwu Hospital. Blood pressure, glucose, lipid levels (total cholesterol, high-density lipoprotein cholesterol, low-density lipoprotein [LDL] cholesterol and triglycerides), body mass index (BMI), and waist-to-hip ratio were measured. Fourteen tag SNPs and 5 functional SNPs were selected and genotyped using the high-throughput Sequenom genotyping platform. Differences between genotypes/alleles for each SNP were adjusted for sex and age and tested using a general linear model procedure. Various models of inheritance, including additive, dominant, and recessive, were tested. Results Among the 19 SNPs examined, 5 markers were associated with cardiovascular risk factors. The rs41423247 GG genotype and the rs7701443 AA genotype were associated with higher BMI and systolic blood pressure (P < 0.0004), and the rs17209251 GG genotype was associated with higher systolic blood pressure (P < 0.0004). Lower systolic blood pressure, total cholesterol, and LDL cholesterol were observed among rs10052957 A allele carriers (P < 0.0004), and lower plasma glucose and LDL-cholesterol concentrations were observed among rs2963156 TT carriers (P < 0.0004). Conclusions Polymorphism of the GR gene was associated with cardiovascular risk factors and may contribute to susceptibility to cardiovascular disease. PMID:23892712

Lack of association of two chromosome 10q24 SNPs with Alzheimer’s disease

PubMed Central

Minster, Ryan L.; DeKosky, Steven T.; Kamboh, M. Ilyas

2006-01-01

Several groups have reported evidence of linkage on chromosome 10 to late-onset Alzheimer’s disease (LOAD). In a recent scan of single nucleotide polymorphisms (SNPs) on chromosome 10, significant associations between the rs498055 and rs4417206 SNPs and risk of LOAD were observed. We examined the association of these two SNPs with LOAD risk in a large Caucasian American cohort comprising about 2,000 cases and controls. Neither SNP revealed significant association with LOAD risk or age-at-onset. PMID:17000046

Methods for discovering and validating relationships among genotyped animals

USDA-ARS?s Scientific Manuscript database

Genomic selection based on single-nucleotide polymorphisms (SNPs) has led to the collection of genotypes for over 2.2 million animals by the Council on Dairy Cattle Breeding in the United States. To assure that a genotype is assigned to the correct animal and that the animal’s pedigree is correct, t...

Rapid molecular pathotyping of major salmonella enterica serotypes based on single-nucleotide polymorphisms (SNPs) in the adenylate cyclase (cyaA) gene

USDA-ARS?s Scientific Manuscript database

Introduction: Salmonella enterica subsp. enterica serotype Enteriditis (S. Enteriditis) is the leading cause of salmonellosis worldwide, including the USA. Many S. enterica serotypes known to cause foodborne disease are associated with broiler meat contamination. While some serotypes are specific...

Association between IL-1β polymorphisms and gastritis risk: A meta-analysis.

PubMed

Sun, Xiaoming; Cai, Hongxing; Li, Zhouru; Li, Shanshan; Yin, Wenjiang; Dong, Guokai; Kuai, Jinxia; He, Yihui; Jia, Jing

2017-02-01

Helicobacter pylori (H. pylori) infection of the human stomach regularly leads to chronic gastric inflammation. The cytokine gene interleukin (IL)-1β has been implicated in influencing the pathology of inflammation induced by H. pylori infection. Currently, several studies have been carried out to investigate the association of IL-1β-511 (rs16944) and IL-1β-31 (rs1143627) polymorphisms with gastritis risk; however, the results are inconsistent and inconclusive. To assess the effect of IL-1β polymorphisms on gastritis susceptibility, we conducted a meta-analysis. Up to March 15, 2016, 2205 cases and 2289 controls were collected from 12 published case-control studies. Summarized odds ratios and corresponding 95% confidence intervals (CIs) for IL-1β-511 and IL-1β-31 polymorphisms and gastritis risk were estimated using fixed- or random-effects models when appropriate. Heterogeneity was assessed by chi-squared-based Q-statistic test, and the sources of heterogeneity were explored by subgroup analyses and logistic meta-regression analyses. Publication bias was evaluated by Begg funnel plot and Egger test. Sensitivity analyses were also performed. The results provided evidences that the single nucleotide polymorphisms (SNPs) in IL-1β-31 might be associated with the gastritis risk, especially in the Caucasian population, while SNPs in the IL-1β-511 might not be. Our studies may be helpful in supplementing the disease monitoring of gastritis in the future, and additional studies to determine the exact molecular mechanisms might inspire interventions to protect the susceptible subgroups.

Single nucleotide polymorphism-specific regulation of matrix metalloproteinase-9 by multiple miRNAs targeting the coding exon

PubMed Central

Duellman, Tyler; Warren, Christopher; Yang, Jay

2014-01-01

Microribonucleic acids (miRNAs) work with exquisite specificity and are able to distinguish a target from a non-target based on a single nucleotide mismatch in the core nucleotide domain. We questioned whether miRNA regulation of gene expression could occur in a single nucleotide polymorphism (SNP)-specific manner, manifesting as a post-transcriptional control of expression of genetic polymorphisms. In our recent study of the functional consequences of matrix metalloproteinase (MMP)-9 SNPs, we discovered that expression of a coding exon SNP in the pro-domain of the protein resulted in a profound decrease in the secreted protein. This missense SNP results in the N38S amino acid change and a loss of an N-glycosylation site. A systematic study demonstrated that the loss of secreted protein was due not to the loss of an N-glycosylation site, but rather an SNP-specific targeting by miR-671-3p and miR-657. Bioinformatics analysis identified 41 SNP-specific miRNA targeting MMP-9 SNPs, mostly in the coding exon and an extension of the analysis to chromosome 20, where the MMP-9 gene is located, suggesting that SNP-specific miRNAs targeting the coding exon are prevalent. This selective post-transcriptional regulation of a target messenger RNA harboring genetic polymorphisms by miRNAs offers an SNP-dependent post-transcriptional regulatory mechanism, allowing for polymorphic-specific differential gene regulation. PMID:24627221

Association of μ-Calpain and Calpastatin Polymorphisms with Meat Tenderness in a Brahman–Angus Population

PubMed Central

Leal-Gutiérrez, Joel D.; Elzo, Mauricio A.; Johnson, Dwain D.; Scheffler, Tracy L.; Scheffler, Jason M.; Mateescu, Raluca G.

2018-01-01

Autogenous proteolytic enzymes of the calpain family are implicated in myofibrillar protein degradation. As a result, the μ-calpain gene and its specific inhibitor, calpastatin, have been repeatedly investigated for their association with meat quality traits in cattle; however, no functional mutation has been identified for these two genes. The objectives of this study were: (1) to assess breed composition effect on tenderness; (2) to perform a linkage disequilibrium (LD) analysis in μ-calpain and calpastatin genes as well as an association analyses with tenderness; and (3) to analyze putative functional SNPs inside the significant LD block for an effect on tenderness. Tenderness measurements and genotypes for 16 SNPs in μ-calpain gene and 28 SNPs in calpastatin gene from 673 steers were analyzed. A bioinformatic analysis identified “putative functional SNPs” inside the associated LD block – polymorphisms able to produce a physical and/or chemical change in the DNA, mRNA, or translated protein in silico. Breed composition had a significant (P < 0.0001) effect on tenderness where animals with more than 80% Angus composition had the most tender meat. One 11-kb LD-block and three LD-blocks of 37, 17, and 14 kb in length were identified in the μ-calpain and calpastatin genes, respectively. Out of these, the LD-block 3 in calpastatin, tagged by SNPs located at 7-98566391 and 7-98581038, had a significant effect on tenderness with the TG-CG diplotype being approximately 1 kg more tender than the toughest diplotype, TG-CG. A total of 768 SNPs in the LD-block 3 of calpastatin were included in the bioinformatic analysis, and 28 markers were selected as putative functional SNPs inside the LD-block 3 of calpastatin; however, none of them were polymorphic in this population. Out of 15 initial polymorphisms segregating inside the LD-block 3 of calpastatin in this population, markers ARSUSMARC116, Cast5, rs730723459, and rs210861835 were found to be significantly associated with tenderness. PMID:29520298

Employing genome-wide SNP discovery and genotyping strategy to extrapolate the natural allelic diversity and domestication patterns in chickpea

PubMed Central

Kujur, Alice; Bajaj, Deepak; Upadhyaya, Hari D.; Das, Shouvik; Ranjan, Rajeev; Shree, Tanima; Saxena, Maneesha S.; Badoni, Saurabh; Kumar, Vinod; Tripathi, Shailesh; Gowda, C. L. L.; Sharma, Shivali; Singh, Sube; Tyagi, Akhilesh K.; Parida, Swarup K.

2015-01-01

The genome-wide discovery and high-throughput genotyping of SNPs in chickpea natural germplasm lines is indispensable to extrapolate their natural allelic diversity, domestication, and linkage disequilibrium (LD) patterns leading to the genetic enhancement of this vital legume crop. We discovered 44,844 high-quality SNPs by sequencing of 93 diverse cultivated desi, kabuli, and wild chickpea accessions using reference genome- and de novo-based GBS (genotyping-by-sequencing) assays that were physically mapped across eight chromosomes of desi and kabuli. Of these, 22,542 SNPs were structurally annotated in different coding and non-coding sequence components of genes. Genes with 3296 non-synonymous and 269 regulatory SNPs could functionally differentiate accessions based on their contrasting agronomic traits. A high experimental validation success rate (92%) and reproducibility (100%) along with strong sensitivity (93–96%) and specificity (99%) of GBS-based SNPs was observed. This infers the robustness of GBS as a high-throughput assay for rapid large-scale mining and genotyping of genome-wide SNPs in chickpea with sub-optimal use of resources. With 23,798 genome-wide SNPs, a relatively high intra-specific polymorphic potential (49.5%) and broader molecular diversity (13–89%)/functional allelic diversity (18–77%) was apparent among 93 chickpea accessions, suggesting their tremendous applicability in rapid selection of desirable diverse accessions/inter-specific hybrids in chickpea crossbred varietal improvement program. The genome-wide SNPs revealed complex admixed domestication pattern, extensive LD estimates (0.54–0.68) and extended LD decay (400–500 kb) in a structured population inclusive of 93 accessions. These findings reflect the utility of our identified SNPs for subsequent genome-wide association study (GWAS) and selective sweep-based domestication trait dissection analysis to identify potential genomic loci (gene-associated targets) specifically regulating important complex quantitative agronomic traits in chickpea. The numerous informative genome-wide SNPs, natural allelic diversity-led domestication pattern, and LD-based information generated in our study have got multidimensional applicability with respect to chickpea genomics-assisted breeding. PMID:25873920

A Family-Based Association Analysis and Meta-Analysis of the Reading Disabilities Candidate Gene DYX1C1

PubMed Central

Tran, C.; Gagnon, F.; Wigg, K.G.; Feng, Y.; Gomez, L.; Cate-Carter, T.D.; Kerr, E.N.; Field, L.L.; Kaplan, B.J.; Lovett, M.W.; Barr, C.L.

2017-01-01

Reading disabilities (RD) have a significant genetic basis and have shown linkage to multiple regions including chromosome 15q. Dyslexia susceptibility 1 candidate gene 1 (DYX1C1) on chromosome 15q21 was originally proposed as a candidate gene with two potentially functional polymorphisms at the −3G/A and 1249G/T positions showing association with RD. However, subsequent studies have yielded mixed results. We performed a literature review and meta-analysis of the −3G/A and 1249G/T polymorphisms, including new unpublished data from two family-based samples. Ten markers in DYX1C1 were genotyped in the two independently ascertained samples. Single marker and −3G/A:1249G/T haplotype analyses were performed for RD in both samples, and quantitative trait analyses using standardized reading-related measures was performed in one of the samples. For the meta-analysis, we used a random-effects model to summarize studies that tested for association between −3G/A or 1249G/T and RD. No significant association was found between the DYX1C1 SNPs and RD or any of the reading-related measures tested after correction for the number of tests performed. The previously reported risk haplotype (−3A:1249T) was not biased in transmission. A total of 9 and 10 study samples were included in the meta-analysis of the −3G/A and 1249G/T polymorphisms, respectively. Neither polymorphism reached statistical significance, but the heterogeneity for the 1249G/T polymorphism was high. The results of this study do not provide evidence for association between the putatively functional SNPs −3G/A and 1249G/T and RD. PMID:23341075

Genetic association of angiogenesis- and hypoxia-related gene polymorphisms with osteonecrosis of the femoral head

PubMed Central

Hong, Jung Min; Kim, Tae-Ho; Kim, Hyun-Ju; Park, Eui-Kyun

2010-01-01

Multiple factors have been implicated in the development of osteonecrosis of the femoral head (ONFH). In particular, non-traumatic ONFH is directly or indirectly related to injury of the vascular supply to the femoral head. Thus, hypoxia in the femoral head caused by impaired blood flow may be an important risk factor for ONFH. In this study, we investigated whether genetic variations of angiogenesis- and hypoxia-related genes contribute to an increased risk for the development of ONFH. Candidate genes were selected based on known hypoxia and angiogenesis pathways. An association study was performed using an Affymetrix Targeted Genotyping 3K Chip array with 460 ONFH patients and 300 control subjects. We showed that single nucleotide polymorphisms (SNPs) in the genes TF, VEGFC, IGFBP3, and ACE were associated with an increased risk of ONFH. On the other hand, SNPs in the KDR and NRP1 genes were associated with protection against ONFH. The most important finding was that one SNP (rs2453839) in the IGFBP3 gene was significantly associated with a higher risk of ONFH (P = 0.0061, OR 7.74). In subgroup analysis, most candidate gene variations that were associated with ONFH occurred in the idiopathic subgroup. Among other SNPs, ACE SNPs were associated with steroid-induced ONFH (P = 0.0018-0.0037, OR > 3). Collectively, our findings suggest that genetic variations in angiogenesis- and hypoxia-related genes may help to identify susceptibility factors for the development of ONFH in the Korean population. PMID:20215856

Nano-enabled bioanalytical approaches to ultrasensitive detection of low abundance single nucleotide polymorphisms

PubMed Central

Lapitan Jr., Lorico D. S.; Guo, Yuan

2015-01-01

Single nucleotide polymorphisms (SNPs) constitute the most common types of genetic variations in the human genome. A number of SNPs have been linked to the development of life threatening diseases including cancer, cardiovascular diseases and neurodegenerative diseases. The ability for ultrasensitive and accurate detection of low abundant disease-related SNPs in bodily fluids (e.g. blood, serum, etc.) holds a significant value in the development of non-invasive future biodiagnostic tools. Over the past two decades, nanomaterials have been utilized in a myriad of biosensing applications due to their ability of detecting extremely low quantities of biologically important biomarkers with high sensitivity and accuracy. Of particular interest is the application of such technologies in the detection of SNPs. The use of various nanomaterials, coupled with different powerful signal amplification strategies, has paved the way for a new generation of ultrasensitive SNP biodiagnostic assays. Over the past few years, several ultrasensitive SNP biosensors capable of detecting specific targets down to the ultra-low regimes (ca. aM and below) and therefore holding great promises for early clinical diagnosis of diseases have been developed. This mini review will highlight some of the most recent, significant advances in nanomaterial-based ultrasensitive SNP sensing technologies capable of detecting specific targets on the attomolar (10–18 M) regime or below. In particular, the design of novel, powerful signal amplification strategies that hold the key to the ultrasensitivity is highlighted. PMID:25785914

Genetic Association Study of KCNQ5 Polymorphisms with High Myopia.

PubMed

Liao, Xuan; Yap, Maurice K H; Leung, Kim Hung; Kao, Patrick Y P; Liu, Long Qian; Yip, Shea Ping

2017-01-01

Identification of genetic variations related to high myopia may advance our knowledge of the etiopathogenesis of refractive error. This study investigated the role of potassium channel gene (KCNQ5) polymorphisms in high myopia. We performed a case-control study of 1563 unrelated Han Chinese subjects (809 cases of high myopia and 754 emmetropic controls). Five tag single-nucleotide polymorphisms (SNPs) of KCNQ5 were genotyped, and association testing with high myopia was conducted using logistic regression analysis adjusted for sex and age to give P asym values, and multiple comparisons were corrected by permutation test to give P emp values. All five noncoding SNPs were associated with high myopia. The SNP rs7744813, previously shown to be associated with refractive error and myopia in two GWAS, showed an odds ratio of 0.75 (95% CI 0.63-0.90; P emp = 0.0058) for the minor allele. The top SNP rs9342979 showed an odds ratio of 0.75 (95% CI 0.64-0.89; P emp = 0.0045) for the minor allele. Both SNPs are located within enhancer histone marks and DNase-hypersensitive sites. Our data support the involvement of KCNQ5 gene polymorphisms in the genetic susceptibility to high myopia and further exploration of KCNQ5 as a risk factor for high myopia.

KIAA0319 gene polymorphisms are associated with developmental dyslexia in Chinese Uyghur children

PubMed Central

Zhao, Hua; Chen, Yun; Zhang, Bao-ping; Zuo, Peng-xiang

2016-01-01

The gene KIAA0319 has been reported to be associated with developmental dyslexia (DD) in previous studies, although the results have not always been consistent. However, few studies have been conducted in Uyghur populations. In the present study, we aimed to investigate the association of KIAA0319 polymorphisms and DD in individuals of Uyghurian descent. We used a custom-by-design 48-Plex SNPscan Kit to genotype 18 single-nucleotide polymorphisms (SNPs) of KIAA0319 in a group of 196 children with dyslexia and 196 controls of Uyghur descent aged 8–12 years. As a result, 7 SNPs (Pmin=0.001) of KIAA0319 had nominal significant differences between the cases and controls under specific genotypic models. The two SNPs rs6935076 (P=0.020 under dominant model; P=0.028 under additive model) and rs3756821 (P=0.021 under additive model) remained significantly associated with dyslexia after Bonferroni correction. Linkage disequilibrium analysis showed three blocks within KIAA0319, and only a 10-SNP haplotype in block 3 was present at significantly different frequencies in the dyslexic children and controls. This study indicated that genetic polymorphisms of KIAA0319 are associated with an increased risk of DD in the Uyghur population. PMID:27098879

Effect of the g.-723G-->T polymorphism in the bovine myogenic factor 5 (Myf5) gene promoter region on gene transcript level in the longissimus dorsi muscle and on meat traits of Polish Holstein-Friesian cattle.

PubMed

Robakowska-Hyzorek, Dagmara; Oprzadek, Jolanta; Zelazowska, Beata; Olbromski, Rafał; Zwierzchowski, Lech

2010-06-01

Myogenic factor 5 (Myf5), a product of the Myf5 gene, belongs to the MRF family of basic helix-loop-helix transcription factors that regulate myogenesis. Their roles in muscle growth and development make their genes candidates for molecular markers of meat production in livestock, but nucleotide sequence polymorphism has not been thoroughly studied in MRF genes. We detected four single nucleotide polymorphisms (SNPs) within exon 1 of the Myf5 gene, encoding the NH-terminal transactivation domain of the Myf5 protein. Three of these mutations change the amino acid sequence. The distribution of these SNPs was highly skewed in cattle populations; most of the mutations were found in only a few or even single individuals. Of the nine SNPs found in the promoter region of Myf5, one (transversion g.-723G-->T) was represented by all three genotypes distributed in the cattle populations studied. This polymorphism showed an influence on Myf5 gene expression in the longissimus dorsi muscle and was associated with sirloin weight and fat weight in sirloin in carcasses of Holstein-Friesian cattle.

Severity of eating disorder symptoms related to oxytocin receptor polymorphisms in anorexia nervosa.

PubMed

Acevedo, Summer F; Valencia, Celeste; Lutter, Michael; McAdams, Carrie J

2015-08-30

Oxytocin is a peptide hormone important for social behavior and differences in psychological traits have been associated with variants of the oxytocin receptor gene in healthy people. We examined whether single nucleotide polymorphisms (SNPs) of the oxytocin receptor gene (OXTR) correlated with clinical symptoms in women with anorexia nervosa, bulimia nervosa, and healthy comparison (HC) women. Subjects completed clinical assessments and provided DNA for analysis. Subjects were divided into four groups: HC, subjects currently with anorexia nervosa (AN-C), subjects with a history of anorexia nervosa but in long-term weight recovery (AN-WR), and subjects with bulimia nervosa (BN). Five SNPs of the oxytocin receptor were examined. Minor allele carriers showed greater severity in most of the psychiatric symptoms. Importantly, the combination of having had anorexia and carrying either of the A alleles for two SNPS in the OXTR gene (rs53576, rs2254298) was associated with increased severity specifically for ED symptoms including cognitions and behaviors associated both with eating and appearance. A review of psychosocial data related to the OXTR polymorphisms examined is included in the discussion. OXTR polymorphisms may be a useful intermediate endophenotype to consider in the treatment of patients with anorexia nervosa. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

Polymorphisms in the Wilms Tumor Gene Are Associated With Interindividual Variations in Rubella Virus-Specific Cellular Immunity After Measles-Mumps-Rubella II Vaccination.

PubMed

Voigt, Emily A; Haralambieva, Iana H; Larrabee, Beth L; Kennedy, Richard B; Ovsyannikova, Inna G; Schaid, Daniel J; Poland, Gregory A

2018-01-30

Rubella vaccination induces widely variable immune responses in vaccine recipients. While rubella vaccination is effective at inducing immunity to rubella infection in most subjects, up to 5% of individuals do not achieve or maintain long-term protective immunity. To expand upon our previous work identifying genetic polymorphisms that are associated with these interindividual differences in humoral immunity to rubella virus, we performed a genome-wide association study in a large cohort of 1843 subjects to discover single-nucleotide polymorphisms (SNPs) associated with rubella virus-specific cellular immune responses. We identified SNPs in the Wilms tumor protein gene (WT1) that were significantly associated (P < 5 × 10-8) with interindividual variations in rubella-specific interleukin 6 secretion from subjects' peripheral blood mononuclear cells postvaccination. No SNPs were found to be significantly associated with variations in rubella-specific interferon-γ secretion. Our findings demonstrate that genetic polymorphisms in the WT1 gene in subjects of European ancestry are associated with interindividual differences in rubella virus-specific cellular immunity after measles-mumps-rubella II vaccination. © The Author(s) 2017. Published by Oxford University Press for the Infectious Diseases Society of America. All rights reserved. For permissions, e-mail: journals.permissions@oup.com.

Paclitaxel sensitivity in relation to ABCB1 expression, efflux and single nucleotide polymorphisms in ovarian cancer.

PubMed

Gao, Bo; Russell, Amanda; Beesley, Jonathan; Chen, Xiao Qing; Healey, Sue; Henderson, Michelle; Wong, Mark; Emmanuel, Catherine; Galletta, Laura; Johnatty, Sharon E; Bowtell, David; Haber, Michelle; Norris, Murray; Harnett, Paul; Chenevix-Trench, Georgia; Balleine, Rosemary L; deFazio, Anna

2014-05-09

ABCB1 (adenosine triphosphate-binding cassette transporter B1) mediates cellular elimination of many chemotherapeutic agents including paclitaxel, which is commonly used to treat ovarian cancer. A significant association between common single nucleotide polymorphisms (SNPs) in ABCB1 and progression-free survival has been reported in patients with ovarian cancer. Variable paclitaxel clearance due to genotype specific differences in ABCB1 activity in cancer cells and/or normal tissues may underlie the association. Using cell-based models, we evaluated the correlations between ABCB1 expression, polymorphisms, transporter activity and paclitaxel sensitivity in ovarian cancer (n = 10) and lymphoblastoid (n = 19) cell lines. Close associations between ABCB1 expression, transporter function and paclitaxel sensitivity were found in lymphoblastoid cell lines, although we could not demonstrate an association with common SNPs. In ovarian cancer cell lines, ABCB1 expression was low and the association between expression and function was lost. These results suggest that ABCB1 related survival difference in ovarian cancer patients is more likely to be due to differential whole body paclitaxel clearance mediated by normal cells rather than a direct effect on cancer cells.

Associations of Polymorphisms in the Apolipoprotein APOA1-C3-A5 Gene Cluster with Acute Coronary Syndrome

PubMed Central

Ding, Yan; Zhu, Ming An; Wang, Zhi Xiao; Zhu, Jing; Feng, Jing Bo; Li, Dong Sheng

2012-01-01

Background. Acute coronary syndromes (ACSs) are clinically cardiovascular events associated with dyslipidemia in common. Single nucleotide polymorphisms (SNPs) and haplotypes in the APOA1/C3/A5 gene cluster are associated with diabetes and familial combined hyperlipidaemia (FCH). Little is known about whether the polymorphisms in these genes affect lipid homeostasis in patients with ACSs. The present paper aimed to examine these associations with 4 SNPs in the APOA1 −75G > A, the APOC3 −455T > C, and APOA5 −1131T > C, c.553G > T variant to ACSs in Chinese Han. Methods. Chinese Han of 229 patients with ACSs and 254 unrelated controls were analyzed. Four SNPs in APOA1/C3/A5 cluster were genotyped and lipid was determined. Results. Our data show that minor allelic frequencies of APOC3 −455T > C, APOA5 −1131T > C, and c.553G > T polymorphisms in patients with ACSs were significantly higher than control group (P < 0.05). Furthermore, the 3 polymorphic sites were strongly of linkage disequilibrium, and minor alleles of 3 SNP sites had higher TG level than wild alleles (P < 0.05), APOC3 −455C and APOA5 c.553T allele carriers also had lower level of HDL-C. Conclusions. The minor alleles of APOC3 −455T > C, APOA5 −1131T > C, and c.553G > T polymorphisms are closely associated with ACSs. PMID:22675253

Polygenic influences on dyslipidemias.

PubMed

Dron, Jacqueline S; Hegele, Robert A

2018-04-01

Rare large-effect genetic variants underlie monogenic dyslipidemias, whereas common small-effect genetic variants - single nucleotide polymorphisms (SNPs) - have modest influences on lipid traits. Over the past decade, these small-effect SNPs have been shown to cumulatively exert consistent effects on lipid phenotypes under a polygenic framework, which is the focus of this review. Several groups have reported polygenic risk scores assembled from lipid-associated SNPs, and have applied them to their respective phenotypes. For lipid traits in the normal population distribution, polygenic effects quantified by a score that integrates several common polymorphisms account for about 20-30% of genetic variation. Among individuals at the extremes of the distribution, that is, those with clinical dyslipidemia, the polygenic component includes both rare variants with large effects and common polymorphisms: depending on the trait, 20-50% of susceptibility can be accounted for by this assortment of genetic variants. Accounting for polygenic effects increases the numbers of dyslipidemic individuals who can be explained genetically, but a substantial proportion of susceptibility remains unexplained. Whether documenting the polygenic basis of dyslipidemia will affect outcomes in clinical trials or prospective observational studies remains to be determined.

Use of a draft genome of coffee (Coffea arabica) to identify SNPs associated with caffeine content.

PubMed

Tran, Hue T M; Ramaraj, Thiruvarangan; Furtado, Agnelo; Lee, Leonard Slade; Henry, Robert J

2018-03-07

Arabica coffee (Coffea arabica) has a small gene pool limiting genetic improvement. Selection for caffeine content within this gene pool would be assisted by identification of the genes controlling this important trait. Sequencing of DNA bulks from 18 genotypes with extreme high- or low-caffeine content from a population of 232 genotypes was used to identify linked polymorphisms. To obtain a reference genome, a whole genome assembly of arabica coffee (variety K7) was achieved by sequencing using short read (Illumina) and long-read (PacBio) technology. Assembly was performed using a range of assembly tools resulting in 76 409 scaffolds with a scaffold N50 of 54 544 bp and a total scaffold length of 1448 Mb. Validation of the genome assembly using different tools showed high completeness of the genome. More than 99% of transcriptome sequences mapped to the C. arabica draft genome, and 89% of BUSCOs were present. The assembled genome annotated using AUGUSTUS yielded 99 829 gene models. Using the draft arabica genome as reference in mapping and variant calling allowed the detection of 1444 nonsynonymous single nucleotide polymorphisms (SNPs) associated with caffeine content. Based on Kyoto Encyclopaedia of Genes and Genomes pathway-based analysis, 65 caffeine-associated SNPs were discovered, among which 11 SNPs were associated with genes encoding enzymes involved in the conversion of substrates, which participate in the caffeine biosynthesis pathways. This analysis demonstrated the complex genetic control of this key trait in coffee. © 2018 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.

XRCC1 Polymorphism Associated With Late Toxicity After Radiation Therapy in Breast Cancer Patients

DOE Office of Scientific and Technical Information (OSTI.GOV)

Seibold, Petra; Behrens, Sabine; Schmezer, Peter

Purpose: To identify single-nucleotide polymorphisms (SNPs) in oxidative stress–related genes associated with risk of late toxicities in breast cancer patients receiving radiation therapy. Methods and Materials: Using a 2-stage design, 305 SNPs in 59 candidate genes were investigated in the discovery phase in 753 breast cancer patients from 2 prospective cohorts from Germany. The 10 most promising SNPs in 4 genes were evaluated in the replication phase in up to 1883 breast cancer patients from 6 cohorts identified through the Radiogenomics Consortium. Outcomes of interest were late skin toxicity and fibrosis of the breast, as well as an overall toxicity score (Standardized Totalmore » Average Toxicity). Multivariable logistic and linear regression models were used to assess associations between SNPs and late toxicity. A meta-analysis approach was used to summarize evidence. Results: The association of a genetic variant in the base excision repair gene XRCC1, rs2682585, with normal tissue late radiation toxicity was replicated in all tested studies. In the combined analysis of discovery and replication cohorts, carrying the rare allele was associated with a significantly lower risk of skin toxicities (multivariate odds ratio 0.77, 95% confidence interval 0.61-0.96, P=.02) and a decrease in Standardized Total Average Toxicity scores (−0.08, 95% confidence interval −0.15 to −0.02, P=.016). Conclusions: Using a stage design with replication, we identified a variant allele in the base excision repair gene XRCC1 that could be used in combination with additional variants for developing a test to predict late toxicities after radiation therapy in breast cancer patients.« less

Prospective assessment of XRCC3, XPD and Aurora kinase A single-nucleotide polymorphisms in advanced lung cancer.

PubMed

Provencio, M; Camps, C; Cobo, M; De las Peñas, R; Massuti, B; Blanco, R; Alberola, V; Jimenez, U; Delgado, J R; Cardenal, F; Tarón, M; Ramírez, J L; Sanchez, A; Rosell, R

2012-12-01

New therapeutic approaches are being developed based on findings that several genetic abnormalities underlying non-small-cell lung cancer (NSCLC) can influence chemosensitivity. The identification of molecular markers, useful for therapeutic decisions in lung cancer, is thus crucial for disease management. The present study evaluated single-nucleotide polymorphisms (SNPs) in XRCC3, XPD and Aurora kinase A in NSCLC patients in order to assess whether these biomarkers were able to predict the outcomes of the patients. The Spanish Lung Cancer Group prospectively assessed this clinical study. Eligible patients had histologically confirmed stage IV or IIIB (with malignant pleural effusion) NSCLC, which had not previously been treated with chemotherapy, and a World Health Organization performance status (PS) of 0-1. Patients received intravenous doses of vinorelbine 25 mg/m(2) on days 1 and 8, and cisplatin 75 mg/m(2) on day 1, every 21 days for a maximum of 6 cycles. Venous blood was collected from each, and genomic DNA was isolated. SNPs in XRCC3 T241M, XPD K751Q, XPD D312N, AURORA 91, AURORA 169 were assessed. The study included 180 patients. Median age was 62 years; 87 % were male; 34 % had PS 0; and 83 % had stage IV disease. The median number of cycles was 4. Time to progression was 5.1 months (95 % CI, 4.2-5.9). Overall median survival was 8.6 months (95 % CI, 7.1-10.1). There was no significant association between SNPs in XRCC3 T241M, XPD K751Q, XPD D312N, AURORA 91, AURORA 169 in outcome or toxicity. Our findings indicate that SNPs in XRCC3, XPD or Aurora kinase A cannot predict outcomes in advanced NSCLC patients treated with platinum-based chemotherapy.

FTO Polymorphisms Moderate the Association of Food Reinforcement with Energy Intake

PubMed Central

Scheid, Jennifer L.; Carr, Katelyn A.; Lin, Henry; Fletcher, Kelly D.; Sucheston, Lara; Singh, Prashant K.; Salis, Robbert; Erbe, Richard; Faith, Myles S.; Allison, David B.; Epstein, Leonard H.

2015-01-01

Food reinforcement (RRVfood) is related to increased energy intake, cross-sectionally related to obesity, and prospectively related to weight gain. The fat mass and obesity-associated (FTO) gene is related to elevated body mass index and increased energy intake. The primary purpose of the current study was to determine whether any of 68 FTO single nucleotide polymorphisms (SNPs) or a FTO risk score moderate the association between food reinforcement and energy or macronutrient intake. Energy and macronutrient intake was measured using a laboratory ad libitum snack food consumption task in 237 adults of varying BMI. Controlling for BMI, the relative reinforcing value of reading (RRVreading) and proportion of African ancestry, RRVfood predicted 14.2% of the variance in energy intake, as well as predicted carbohydrate, fat, protein and sugar intake. In individual analyses, six FTO SNPs (rs12921970, rs9936768, rs12446047, rs7199716, rs8049933 and rs11076022, spanning approximately 251K bp) moderated the relationship between RRVfood and energy intake to predict an additional 4.9 - 7.4% of variance in energy intake. We created an FTO risk score based on 5 FTO SNPs (rs9939609, rs8050136, rs3751812, rs1421085, and rs1121980) that are related to BMI in multiple studies. The FTO risk score did not increase variance accounted for beyond individual FTO SNPs. Rs12921970 and rs12446047 served as moderators of the relationship between RRVfood and carbohydrate, fat, protein, and sugar intake. This study shows for the first time that the relationship between RRVfood and energy intake is moderated by FTO SNPs. Research is needed to understand how these processes interact to predict energy and macronutrient intake. PMID:24768648

Nucleotide polymorphisms in a pine ortholog of the Arabidopsis degrading enzyme cellulase KORRIGAN are associated with early growth performance in Pinus pinaster.

PubMed

Cabezas, José Antonio; González-Martínez, Santiago C; Collada, Carmen; Guevara, María Angeles; Boury, Christophe; de María, Nuria; Eveno, Emmanuelle; Aranda, Ismael; Garnier-Géré, Pauline H; Brach, Jean; Alía, Ricardo; Plomion, Christophe; Cervera, María Teresa

2015-09-01

We have carried out a candidate-gene-based association genetic study in Pinus pinaster Aiton and evaluated the predictive performance for genetic merit gain of the most significantly associated genes and single nucleotide polymorphisms (SNPs). We used a second generation 384-SNP array enriched with candidate genes for growth and wood properties to genotype mother trees collected in 20 natural populations covering most of the European distribution of the species. Phenotypic data for total height, polycyclism, root-collar diameter and biomass were obtained from a replicated provenance-progeny trial located in two sites with contrasting environments (Atlantic vs Mediterranean climate). General linear models identified strong associations between growth traits (total height and polycyclism) and four SNPs from the korrigan candidate gene, after multiple testing corrections using false discovery rate. The combined genomic breeding value predictions assessed for the four associated korrigan SNPs by ridge regression-best linear unbiased prediction (RR-BLUP) and cross-validation accounted for up to 8 and 15% of the phenotypic variance for height and polycyclic growth, respectively, and did not improve adding SNPs from other growth-related candidate genes. For root-collar diameter and total biomass, they accounted for 1.6 and 1.1% of the phenotypic variance, respectively, but increased to 15 and 4.1% when other SNPs from lp3.1, lp3.3 and cad were included in RR-BLUP models. These results point towards a desirable integration of candidate-gene studies as a means to pre-select relevant markers, and aid genomic selection in maritime pine breeding programs. © The Author 2015. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

Use of single-nucleotide polymorphisms (SNPs) to distinguish gene expression subtypes of chronic fatigue syndrome/myalgic encephalomyelitis (CFS/ME).

PubMed

Shimosako, Nana; Kerr, Jonathan R

2014-12-01

We have reported gene expression changes in patients with chronic fatigue syndrome/myalgic encephalomyelitis (CFS/ME) and the fact that such gene expression data can be used to identify subtypes of CFS/ME with distinct clinical phenotypes. Due to the difficulties in using a comparative gene expression method as an aid to CFS/ME disease and subtype-specific diagnosis, we have attempted to develop such a method based on single-nucleotide polymorphism (SNP) analysis. To identify SNP allele associations with CFS/ME and CFS/ME subtypes, we tested genomic DNA of patients with CFS/ME (n=108), patients with endogenous depression (n=17) and normal blood donors (n=68) for 504 human SNP alleles located within 88 CFS-associated human genes using the SNP Genotyping GoldenGate Assay (Illumina, San Diego, California, USA). 360 ancestry informative markers (AIM) were also examined. 21 SNPs were significantly associated with CFS/ME compared with depression and normal groups. 148 SNP alleles had a significant association with one or more CFS/ME subtypes. For each subtype, associated SNPs tended to be grouped together within particular genes. AIM SNPs indicated that 4 subjects were of Asian origin while the remainder were Caucasian. Hierarchical clustering of AIM data revealed the relatedness between 2 couples of patients with CFS only and confirmed the overall heterogeneity of all subjects. This study provides evidence that human SNPs located within CFS/ME associated genes are associated with particular genomic subtypes of CFS/ME. Further work is required to develop this into a clinically useful subtype-specific diagnostic test. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://group.bmj.com/group/rights-licensing/permissions.

Prediction of functionally significant single nucleotide polymorphisms in PTEN tumor suppressor gene: An in silico approach.

PubMed

Khan, Imran; Ansari, Irfan A; Singh, Pratichi; Dass J, Febin Prabhu

2017-09-01

The phosphatase and tensin homolog (PTEN) gene plays a crucial role in signal transduction by negatively regulating the PI3K signaling pathway. It is the most frequent mutated gene in many human-related cancers. Considering its critical role, a functional analysis of missense mutations of PTEN gene was undertaken in this study. Thirty five nonsynonymous single nucleotide polymorphisms (nsSNPs) within the coding region of the PTEN gene were selected for our in silico investigation, and five nsSNPs (G129E, C124R, D252G, H61D, and R130G) were found to be deleterious based on combinatorial predictions of different computational tools. Moreover, molecular dynamics (MD) simulation was performed to investigate the conformational variation between native and all the five mutant PTEN proteins having predicted deleterious nsSNPs. The results of MD simulation of all mutant models illustrated variation in structural attributes such as root-mean-square deviation, root-mean-square fluctuation, radius of gyration, and total energy; which depicts the structural stability of PTEN protein. Furthermore, mutant PTEN protein structures also showed a significant variation in the solvent accessible surface area and hydrogen bond frequencies from the native PTEN structure. In conclusion, results of this study have established the deleterious effect of the all the five predicted nsSNPs on the PTEN protein structure. Thus, results of the current study can pave a new platform to sort out nsSNPs that can be undertaken for the confirmation of their phenotype and their correlation with diseased status in case of control studies. © 2016 International Union of Biochemistry and Molecular Biology, Inc.

FTO polymorphisms moderate the association of food reinforcement with energy intake.

PubMed

Scheid, Jennifer L; Carr, Katelyn A; Lin, Henry; Fletcher, Kelly D; Sucheston, Lara; Singh, Prashant K; Salis, Robbert; Erbe, Richard W; Faith, Myles S; Allison, David B; Epstein, Leonard H

2014-06-10

Food reinforcement (RRVfood) is related to increased energy intake, cross-sectionally related to obesity, and prospectively related to weight gain. The fat mass and obesity-associated (FTO) gene is related to elevated body mass index and increased energy intake. The primary purpose of the current study was to determine whether any of 68 FTO single nucleotide polymorphisms (SNPs) or a FTO risk score moderate the association between food reinforcement and energy or macronutrient intake. Energy and macronutrient intake was measured using a laboratory ad libitum snack food consumption task in 237 adults of varying BMI. Controlling for BMI, the relative reinforcing value of reading (RRVreading) and proportion of African ancestry, RRVfood predicted 14.2% of the variance in energy intake, as well as predicted carbohydrate, fat, protein and sugar intake. In individual analyses, six FTO SNPs (rs12921970, rs9936768, rs12446047, rs7199716, rs8049933 and rs11076022, spanning approximately 251kbp) moderated the relationship between RRVfood and energy intake to predict an additional 4.9-7.4% of variance in energy intake. We created an FTO risk score based on 5 FTO SNPs (rs9939609, rs8050136, rs3751812, rs1421085, and rs1121980) that are related to BMI in multiple studies. The FTO risk score did not increase variance accounted for beyond individual FTO SNPs. rs12921970 and rs12446047 served as moderators of the relationship between RRVfood and carbohydrate, fat, protein, and sugar intake. This study shows for the first time that the relationship between RRVfood and energy intake is moderated by FTO SNPs. Research is needed to understand how these processes interact to predict energy and macronutrient intake. Copyright © 2014 Elsevier Inc. All rights reserved.

Association analysis of genes involved in maize (Zea mays L.) root development with seedling and agronomic traits under contrasting nitrogen levels.

PubMed

Abdel-Ghani, Adel H; Kumar, Bharath; Pace, Jordon; Jansen, Constantin; Gonzalez-Portilla, Pedro J; Reyes-Matamoros, Jenaro; San Martin, Juan Pablo; Lee, Michael; Lübberstedt, Thomas

2015-05-01

A better understanding of the genetic control of root development might allow one to develop lines with root systems with the potential to adapt to soils with limited nutrient availability. For this purpose, an association study (AS) panel consisting of 74 diverse set of inbred maize lines were screened for seedling root traits and adult plant root traits under two contrasting nitrogen (N) levels (low and high N). Allele re-sequencing of RTCL, RTH3, RUM1, and RUL1 genes related to root development was carried out for AS panel lines. Association analysis was carried out between individual polymorphisms, and both seedling and adult plant traits, while controlling for spurious associations due to population structure and kinship relations. Based on the SNPs identified in RTCL, RTH3, RUM1, and RUL1, lines within the AS panel were grouped into 16, 9, 22, and 7 haplotypes, respectively. Association analysis revealed several polymorphisms within root genes putatively associated with the variability in seedling root and adult plant traits development under contrasting N levels. The highest number of significantly associated SNPs with seedling root traits were found in RTCL (19 SNPs) followed by RUM1 (4 SNPs) and in case of RTH3 and RUL1, two and three SNPs, respectively, were significantly associated with root traits. RTCL and RTH3 were also found to be associated with grain yield. Thus considerable allelic diversity is present within the candidate genes studied and can be utilized to develop functional markers that allow identification of maize lines with improved root architecture and yield under N stress conditions.

Discovery of single nucleotide polymorphisms in candidate genes associated with fertility and production traits in Holstein cattle

PubMed Central

2013-01-01

Background Identification of single nucleotide polymorphisms (SNPs) for specific genes involved in reproduction might improve reliability of genomic estimates for these low-heritability traits. Semen from 550 Holstein bulls of high (≥ 1.7; n = 288) or low (≤ −2; n = 262) daughter pregnancy rate (DPR) was genotyped for 434 candidate SNPs using the Sequenom MassARRAY® system. Three types of SNPs were evaluated: SNPs previously reported to be associated with reproductive traits or physically close to genetic markers for reproduction, SNPs in genes that are well known to be involved in reproductive processes, and SNPs in genes that are differentially expressed between physiological conditions in a variety of tissues associated in reproductive function. Eleven reproduction and production traits were analyzed. Results A total of 40 SNPs were associated (P < 0.05) with DPR. Among these were genes involved in the endocrine system, cell signaling, immune function and inhibition of apoptosis. A total of 10 genes were regulated by estradiol. In addition, 22 SNPs were associated with heifer conception rate, 33 with cow conception rate, 36 with productive life, 34 with net merit, 23 with milk yield, 19 with fat yield, 13 with fat percent, 19 with protein yield, 22 with protein percent, and 13 with somatic cell score. The allele substitution effect for SNPs associated with heifer conception rate, cow conception rate, productive life and net merit were in the same direction as for DPR. Allele substitution effects for several SNPs associated with production traits were in the opposite direction as DPR. Nonetheless, there were 29 SNPs associated with DPR that were not negatively associated with production traits. Conclusion SNPs in a total of 40 genes associated with DPR were identified as well as SNPs for other traits. It might be feasible to include these SNPs into genomic tests of reproduction and other traits. The genes associated with DPR are likely to be important for understanding the physiology of reproduction. Given the large number of SNPs associated with DPR that were not negatively associated with production traits, it should be possible to select for DPR without compromising production. PMID:23759029

Effect of Single Nucleotide Polymorphisms in Cytochrome P450 Isoenzyme and N-Acetyltransferase 2 Genes on the Metabolism of Artemisinin-Based Combination Therapies in Malaria Patients from Cambodia and Tanzania

PubMed Central

Staehli Hodel, Eva Maria; Csajka, Chantal; Ariey, Frédéric; Guidi, Monia; Kabanywanyi, Abdunoor Mulokozi; Duong, Socheat; Decosterd, Laurent Arthur; Olliaro, Piero; Genton, Blaise

2013-01-01

The pharmacogenetics of antimalarial agents are poorly known, although the application of pharmacogenetics might be critical in optimizing treatment. This population pharmacokinetic-pharmacogenetic study aimed at assessing the effects of single nucleotide polymorphisms (SNPs) in cytochrome P450 isoenzyme genes (CYP, namely, CYP2A6, CYP2B6, CYP2C8, CYP2C9, CYP2C19, CYP2D6, CYP3A4, and CYP3A5) and the N-acetyltransferase 2 gene (NAT2) on the pharmacokinetics of artemisinin-based combination therapies in 150 Tanzanian patients treated with artemether-lumefantrine, 64 Cambodian patients treated with artesunate-mefloquine, and 61 Cambodian patients treated with dihydroartemisinin-piperaquine. The frequency of SNPs varied with the enzyme and the population. Higher frequencies of mutant alleles were found in Cambodians than Tanzanians for CYP2C9*3, CYP2D6*10 (100C→T), CYP3A5*3, NAT2*6, and NAT2*7. In contrast, higher frequencies of mutant alleles were found in Tanzanians for CYP2D6*17 (1023C→T and 2850C→T), CYP3A4*1B, NAT2*5, and NAT2*14. For 8 SNPs, no significant differences in frequencies were observed. In the genetic-based population pharmacokinetic analyses, none of the SNPs improved model fit. This suggests that pharmacogenetic data need not be included in appropriate first-line treatments with the current artemisinin derivatives and quinolines for uncomplicated malaria in specific populations. However, it cannot be ruled out that our results represent isolated findings, and therefore more studies in different populations, ideally with the same artemisinin-based combination therapies, are needed to evaluate the influence of pharmacogenetic factors on the clearance of antimalarials. PMID:23229480

Analysis of Over 10,000 Cases Finds No Association between Previously-Reported Candidate Polymorphisms and Ovarian Cancer Outcome

PubMed Central

White, Kristin L.; Vierkant, Robert A.; Fogarty, Zachary C.; Charbonneau, Bridget; Block, Matthew S.; Pharoah, Paul D.P.; Chenevix-Trench, Georgia; Rossing, Mary Anne; Cramer, Daniel W.; Pearce, C. Leigh; Schildkraut, Joellen M.; Menon, Usha; Kjaer, Susanne Kruger; Levine, Douglas A.; Gronwald, Jacek; Culver, Hoda Anton; Whittemore, Alice S.; Karlan, Beth Y.; Lambrechts, Diether; Wentzensen, Nicolas; Kupryjanczyk, Jolanta; Chang-Claude, Jenny; Bandera, Elisa V.; Hogdall, Estrid; Heitz, Florian; Kaye, Stanley B.; Fasching, Peter A.; Campbell, Ian; Goodman, Marc T.; Pejovic, Tanja; Bean, Yukie; Lurie, Galina; Eccles, Diana; Hein, Alexander; Beckmann, Matthias W.; Ekici, Arif B.; Paul, James; Brown, Robert; Flanagan, James; Harter, Philipp; du Bois, Andreas; Schwaab, Ira; Hogdall, Claus K.; Lundvall, Lene; Olson, Sara H.; Orlow, Irene; Paddock, Lisa E.; Rudolph, Anja; Eilber, Ursula; Dansonka-Mieszkowska, Agnieszka; Rzepecka, Iwona K.; Ziolkowska-Seta, Izabela; Brinton, Louise; Yang, Hannah; Garcia-Closas, Montserrat; Despierre, Evelyn; Lambrechts, Sandrina; Vergote, Ignace; Walsh, Christine; Lester, Jenny; Sieh, Weiva; McGuire, Valerie; Rothstein, Joseph H.; Ziogas, Argyrios; Lubiński, Jan; Cybulski, Cezary; Menkiszak, Janusz; Jensen, Allan; Gayther, Simon A.; Ramus, Susan J.; Gentry-Maharaj, Aleksandra; Berchuck, Andrew; Wu, Anna H.; Pike, Malcolm C.; Van Den Berg, David; Terry, Kathryn L.; Vitonis, Allison F.; Doherty, Jennifer A.; Johnatty, Sharon; deFazio, Anna; Song, Honglin; Tyrer, Jonathan; Sellers, Thomas A.; Phelan, Catherine M.; Kalli, Kimberly R.; Cunningham, Julie M.; Fridley, Brooke L.; Goode, Ellen L.

2013-01-01

Background Ovarian cancer is a leading cause of cancer-related death among women. In an effort to understand contributors to disease outcome, we evaluated single-nucleotide polymorphisms (SNPs) previously associated with ovarian cancer recurrence or survival, specifically in angiogenesis, inflammation, mitosis, and drug disposition genes. Methods Twenty-seven SNPs in VHL, HGF, IL18, PRKACB, ABCB1, CYP2C8, ERCC2, and ERCC1 previously associated with ovarian cancer outcome were genotyped in 10,084 invasive cases from 28 studies from the Ovarian Cancer Association Consortium with over 37,000 observed person-years and 4,478 deaths. Cox proportional hazards models were used to examine the association between candidate SNPs and ovarian cancer recurrence or survival with and without adjustment for key covariates. Results We observed no association between genotype and ovarian cancer recurrence or survival for any of the SNPs examined. Conclusions These results refute prior associations between these SNPs and ovarian cancer outcome and underscore the importance of maximally powered genetic association studies. Impact These variants should not be used in prognostic models. Alternate approaches to uncovering inherited prognostic factors, if they exist, are needed. PMID:23513043

Modulation of C-reactive protein and plasma omega-6 fatty acid levels by phospholipase A2 gene polymorphisms following a 6-week supplementation with fish oil.

PubMed

Tremblay, B L; Rudkowska, I; Couture, P; Lemieux, S; Julien, P; Vohl, M C

2015-12-01

This clinical trial investigated the impact of a six-week supplementation with fish oil and single nucleotide polymorphisms (SNPs) in PLA2G4A and PLA2G6 genes on total omega-6 fatty acid (n-6 FA) levels in plasma phospholipids (PL) and plasma C-reactive protein (CRP) levels in 191 subjects. Interaction effects between SNPs and supplementation modulated total n-6 FAs and CRP levels in both men and women. Associations between SNPs and total n-6 FA levels and between SNPs and CRP levels were identified in men, independently of supplementation. Supplementation decreased total n-6 FAs without affecting plasma CRP levels. Changes in CRP levels correlated positively with changes in total n-6 FAs in men (r=0.25 p=0.01), but not in women. In conclusion, total n-6 FA levels in plasma PL and plasma CRP levels are modulated by SNPs within PLA2G4A and PLA2G6 genes alone or in combination with fish oil supplementation. Copyright © 2015 Elsevier Ltd. All rights reserved.

Regionally clustered ABCC8 polymorphisms in a prospective cohort predict cerebral oedema and outcome in severe traumatic brain injury.

PubMed

Jha, Ruchira Menka; Koleck, Theresa A; Puccio, Ava M; Okonkwo, David O; Park, Seo-Young; Zusman, Benjamin E; Clark, Robert S B; Shutter, Lori A; Wallisch, Jessica S; Empey, Philip E; Kochanek, Patrick M; Conley, Yvette P

2018-04-19

ABCC8 encodes sulfonylurea receptor 1, a key regulatory protein of cerebral oedema in many neurological disorders including traumatic brain injury (TBI). Sulfonylurea-receptor-1 inhibition has been promising in ameliorating cerebral oedema in clinical trials. We evaluated whether ABCC8 tag single-nucleotide polymorphisms predicted oedema and outcome in TBI. DNA was extracted from 485 prospectively enrolled patients with severe TBI. 410 were analysed after quality control. ABCC8 tag single-nucleotide polymorphisms (SNPs) were identified (Hapmap, r 2 >0.8, minor-allele frequency >0.20) and sequenced (iPlex-Gold, MassArray). Outcomes included radiographic oedema, intracranial pressure (ICP) and 3-month Glasgow Outcome Scale (GOS) score. Proxy SNPs, spatial modelling, amino acid topology and functional predictions were determined using established software programs. Wild-type rs7105832 and rs2237982 alleles and genotypes were associated with lower average ICP (β=-2.91, p=0.001; β=-2.28, p=0.003) and decreased radiographic oedema (OR 0.42, p=0.012; OR 0.52, p=0.017). Wild-type rs2237982 also increased favourable 3-month GOS (OR 2.45, p=0.006); this was partially mediated by oedema (p=0.03). Different polymorphisms predicted 3-month outcome: variant rs11024286 increased (OR 1.84, p=0.006) and wild-type rs4148622 decreased (OR 0.40, p=0.01) the odds of favourable outcome. Significant tag and concordant proxy SNPs regionally span introns/exons 2-15 of the 39-exon gene. This study identifies four ABCC8 tag SNPs associated with cerebral oedema and/or outcome in TBI, tagging a region including 33 polymorphisms. In polymorphisms predictive of oedema, variant alleles/genotypes confer increased risk. Different variant polymorphisms were associated with favourable outcome, potentially suggesting distinct mechanisms. Significant polymorphisms spatially clustered flanking exons encoding the sulfonylurea receptor site and transmembrane domain 0/loop 0 (juxtaposing the channel pore/binding site). This, if validated, may help build a foundation for developing future strategies that may guide individualised care, treatment response, prognosis and patient selection for clinical trials. © Article author(s) (or their employer(s) unless otherwise stated in the text of the article) 2018. All rights reserved. No commercial use is permitted unless otherwise expressly granted.

ESR1 and ESR2 polymorphisms in the BIG 1-98 trial comparing adjuvant letrozole versus tamoxifen or their sequence for early breast cancer.

PubMed

Leyland-Jones, Brian; Gray, Kathryn P; Abramovitz, Mark; Bouzyk, Mark; Young, Brandon; Long, Bradley; Kammler, Roswitha; Dell'Orto, Patrizia; Biasi, Maria Olivia; Thürlimann, Beat; Harvey, Vernon; Neven, Patrick; Arnould, Laurent; Maibach, Rudolf; Price, Karen N; Coates, Alan S; Goldhirsch, Aron; Gelber, Richard D; Pagani, Olivia; Viale, Giuseppe; Rae, James M; Regan, Meredith M

2015-12-01

Estrogen receptor 1 (ESR1) and ESR2 gene polymorphisms have been associated with endocrine-mediated physiological mechanisms, and inconsistently with breast cancer risk and outcomes, bone mineral density changes, and hot flushes/night sweats. DNA was isolated and genotyped for six ESR1 and two ESR2 single-nucleotide polymorphisms (SNPs) from tumor specimens from 3691 postmenopausal women with hormone receptor-positive breast cancer enrolled in the BIG 1-98 trial to receive tamoxifen and/or letrozole for 5 years. Associations with recurrence and adverse events (AEs) were assessed using Cox proportional hazards models. 3401 samples were successfully genotyped for five SNPs. ESR1 rs9340799(XbaI) (T>C) variants CC or TC were associated with reduced breast cancer risk (HR = 0.82,95% CI = 0.67-1.0), and ESR1 rs2077647 (T>C) variants CC or TC was associated with reduced distant recurrence risk (HR = 0.69, 95% CI = 0.53-0.90), both regardless of the treatments. No differential treatment effects (letrozole vs. tamoxifen) were observed for the association of outcome with any of the SNPs. Letrozole-treated patients with rs2077647 (T>C) variants CC and TC had a reduced risk of bone AE (HR = 0.75, 95% CI = 0.58-0.98, P interaction = 0.08), whereas patients with rs4986938 (G>A) genotype variants AA and AG had an increased risk of bone AE (HR = 1.37, 95% CI = 1.01-1.84, P interaction = 0.07). We observed that (1) rare ESR1 homozygous polymorphisms were associated with lower recurrence, and (2) ESR1 and ESR2 SNPs were associated with bone AEs in letrozole-treated patients. Genes that are involved in estrogen signaling and synthesis have the potential to affect both breast cancer recurrence and side effects, suggesting that individual treatment strategies can incorporate not only oncogenic drivers but also SNPs related to estrogen activity.

Association of Androgen Metabolism Gene Polymorphisms with Prostate Cancer Risk and Androgen Concentrations: Results from the Prostate Cancer Prevention Trial

PubMed Central

Price, Douglas K.; Chau, Cindy H.; Till, Cathee; Goodman, Phyllis J.; Leach, Robin J.; Johnson-Pais, Teresa L.; Hsing, Ann W.; Hoque, Ashraful; Parnes, Howard L.; Schenk, Jeannette M.; Tangen, Catherine M.; Thompson, Ian M.; Reichardt, Juergen K.V.; Figg, William D.

2016-01-01

Background Prostate cancer is highly influenced by androgens and genes. We investigated whether genetic polymorphisms along the androgen biosynthesis and metabolism pathways are associated with androgen concentrations or risk of prostate cancer or high-grade disease from finasteride treatment. Methods A nested case-control study from the Prostate Cancer Prevention Trial using cases drawn from men with biopsy-proven prostate cancer and biopsy-negative, frequency-matched controls was conducted to investigate the association of 51 single nucleotide polymorphisms (SNPs) in 12 genes of the androgen pathway with total, low-grade, and high-grade prostate cancer incidence and serum hormone concentrations. Results There were significant associations of genetic polymorphisms in SRD5A1 (rs3736316, rs3822430, rs1560149, rs248797, and rs472402) and SRD5A2 (rs2300700) with risk of high-grade prostate cancer in the placebo arm of the PCPT; two SNPs were significantly associated with increased risk (SRD5A1 rs472402 [OR, 1.70; 95% CI, 1.05-2.75, Ptrend=0.03]; SRD5A2 rs2300700 [OR, 1.94; 95% CI, 1.19-3.18, Ptrend=0.01]). Eleven SNPs in SRD5A1, SRD5A2, CYP1B1, and CYP3A4 were found to be associated with modifying mean serum androgen and sex hormone-binding globulin concentrations; two SNPs (SRD5A1 rs824811 and CYP1B1 rs10012, Ptrend<0.05) consistently and significantly altered all androgen concentrations. Several SNPs (rs3822430, rs2300700; CYP3A43 rs800672; CYP19 rs700519; Ptrend<0.05) were significantly associated with both circulating hormone levels and prostate cancer risk. Conclusion Germline genetic variations of androgen-related pathway genes are associated with serum androgen concentrations and risk of prostate cancer. Further studies to examine the functional consequence of novel causal variants are warranted. PMID:27164191

Exploiting Genome Structure in Association Analysis

PubMed Central

Kim, Seyoung

2014-01-01

Abstract A genome-wide association study involves examining a large number of single-nucleotide polymorphisms (SNPs) to identify SNPs that are significantly associated with the given phenotype, while trying to reduce the false positive rate. Although haplotype-based association methods have been proposed to accommodate correlation information across nearby SNPs that are in linkage disequilibrium, none of these methods directly incorporated the structural information such as recombination events along chromosome. In this paper, we propose a new approach called stochastic block lasso for association mapping that exploits prior knowledge on linkage disequilibrium structure in the genome such as recombination rates and distances between adjacent SNPs in order to increase the power of detecting true associations while reducing false positives. Following a typical linear regression framework with the genotypes as inputs and the phenotype as output, our proposed method employs a sparsity-enforcing Laplacian prior for the regression coefficients, augmented by a first-order Markov process along the sequence of SNPs that incorporates the prior information on the linkage disequilibrium structure. The Markov-chain prior models the structural dependencies between a pair of adjacent SNPs, and allows us to look for association SNPs in a coupled manner, combining strength from multiple nearby SNPs. Our results on HapMap-simulated datasets and mouse datasets show that there is a significant advantage in incorporating the prior knowledge on linkage disequilibrium structure for marker identification under whole-genome association. PMID:21548809

Polymorphism of antimalaria drug metabolizing, nuclear receptor, and drug transport genes among malaria patients in Zanzibar, East Africa.

PubMed

Ferreira, Pedro Eduardo; Veiga, Maria Isabel; Cavaco, Isa; Martins, J Paulo; Andersson, Björn; Mushin, Shaliya; Ali, Abullah S; Bhattarai, Achuyt; Ribeiro, Vera; Björkman, Anders; Gil, José Pedro

2008-02-01

Artemisinin-based combination therapy is a main strategy for malaria control in Africa. Zanzibar introduced this new treatment policy in 2003. The authors have studied the prevalence of a number of functional single nucleotide polymorphisms (SNPs) in genes associated with the elimination of the artemisinin-based combination therapy compounds in use in Zanzibar to investigate the frequencies of subgroups potentially at higher drug exposure and therefore possible higher risk of toxicity. One hundred three unrelated children with uncomplicated malaria from the Unguja and Pemba islands of Zanzibar were enrolled. With use of polymerase chain reaction (PCR)-restriction fragment length polymorphism and real-time PCR-based allele discrimination methods, the CYP2B6 (G15631T), CYP3A4 (A-392G), CYP3A5 (A6986G, G14690A, 27131-132 insT, C3699T) SNPs and MDR1 SNPs C3435T, G2677T/A, and T-129C were analyzed. PCR product sequencing was applied to regulatory regions of MDR1, the CYP3A4 proximal promoter, and to exons 2 and 5 of PXR, a gene coding for a nuclear factor activated by artemisinin antimalarials and associated with the transcription induction of most of the studied genes. Homozygous subjects for alleles coding for low activity proteins were found at the following frequencies: 1) MDR1: 2.9%; 2) CYP2B6: 9.7%; 3) CYP3A5: 14.1%; and 4) CYP3A4: 49.5%. No functionally relevant allele was found in the analyzed regions of PXR. A new MDR1 SNP was found (T-158C), located in a putative antigen recognition element. Ten (10.1%) subjects were predicted to be low metabolizers simultaneously for CYP3A4 and CYP3A5. This fraction of the population is suggested to be under higher exposure to certain antimalarials, including lumefantrine and quinine.

The genetic association study between polymorphisms in uncoupling protein 2 and uncoupling protein 3 and metabolic data in dogs.

PubMed

Udagawa, Chihiro; Tada, Naomi; Asano, Junzo; Ishioka, Katsumi; Ochiai, Kazuhiko; Bonkobara, Makoto; Tsuchida, Shuichi; Omi, Toshinori

2014-12-11

The uncoupling proteins (UCPs) in the mitochondrial inner membrane are members of the mitochondrial anion carrier protein family that play an important role in energy homeostasis. Genetic association studies have shown that human UCP2 and UCP3 variants (SNPs and indels) are associated with obesity, insulin resistance, type 2 diabetes mellitus, and metabolic syndrome. The aim of this study was to examine the genetic association between polymorphisms in UCP2 and UCP3 and metabolic data in dogs. We identified 10 SNPs (9 intronic and 1 exonic) and 4 indels (intronic) in UCP2, and 13 SNPs (11 intronic and 2 exonic) and one indel (exonic) in UCP3, by DNA sequence analysis of 11 different dog breeds (n=119). An association study between these UCP2 and UCP3 variants and the biochemical parameters of glucose, total cholesterol, lactate dehydrogenase and triglyceride in Labrador Retrievers (n=50) showed that none of the UCP2 polymorphisms were significantly associated with the levels of these parameters. However, four UCP3 SNPs (intron 1) were significantly associated with total cholesterol levels. In addition, the allele frequencies of two of the four SNPs associated with higher total cholesterol levels in a breed that is susceptible to hypercholesterolemia (Shetland Sheepdogs, n=30), compared with the control breed (Shiba, n=30). The results obtained from a limited number of individuals suggest that the UCP3 gene in dogs may be associated with total cholesterol levels. The examination of larger sample sizes and further analysis will lead to increased precision of these results.

Association between ADAM metallopeptidase domain 33 gene polymorphism and risk of childhood asthma: a meta-analysis.

PubMed

Sun, F J; Zou, L Y; Tong, D M; Lu, X Y; Li, J; Deng, C B

2017-08-31

This study aimed to investigate the association between ADAM metallopeptidase domain 33 (ADAM33) gene polymorphisms and the risk of childhood asthma. The relevant studies about the relationship between ADAM33 gene polymorphisms and childhood asthma were searched from electronic databases and the deadline of retrieval was May 2016. The single nucleotide polymorphisms (SNPs) of ADAM33 (rs511898, rs2280092, rs3918396, rs528557, rs2853209, rs44707, rs2280091 and rs2280089) were analyzed based on several models including the allele, codominant, recessive and dominant models. The results showed that the ADAM33 rs2280091 polymorphism in all four genetic models was associated with an increased risk of childhood asthma. Positive associations were also found between the polymorphisms rs2280090, rs2787094, rs44707 and rs528557 and childhood asthma in some genetic models. This meta-analysis suggested that ADAM33 polymorphisms rs2280091, rs2280090, rs2787094, rs44707 and rs528557 were significantly associated with a high risk of childhood asthma.

Population-Specific Patterns of Linkage Disequilibrium and SNP Variation in Spring and Winter Polyploid Wheat

USDA-ARS?s Scientific Manuscript database

Single nucleotide polymorphisms (SNPs) are ideally suited for the construction of high-resolution genetic maps, studying population evolutionary history and performing genome-wide association mapping experiments. Here we used a genome-wide set of 1536 SNPs to study linkage disequilibrium (LD) and po...

A multi-SNP association test for complex diseases incorporating an optimal P-value threshold algorithm in nuclear families.

PubMed

Wang, Yi-Ting; Sung, Pei-Yuan; Lin, Peng-Lin; Yu, Ya-Wen; Chung, Ren-Hua

2015-05-15

Genome-wide association studies (GWAS) have become a common approach to identifying single nucleotide polymorphisms (SNPs) associated with complex diseases. As complex diseases are caused by the joint effects of multiple genes, while the effect of individual gene or SNP is modest, a method considering the joint effects of multiple SNPs can be more powerful than testing individual SNPs. The multi-SNP analysis aims to test association based on a SNP set, usually defined based on biological knowledge such as gene or pathway, which may contain only a portion of SNPs with effects on the disease. Therefore, a challenge for the multi-SNP analysis is how to effectively select a subset of SNPs with promising association signals from the SNP set. We developed the Optimal P-value Threshold Pedigree Disequilibrium Test (OPTPDT). The OPTPDT uses general nuclear families. A variable p-value threshold algorithm is used to determine an optimal p-value threshold for selecting a subset of SNPs. A permutation procedure is used to assess the significance of the test. We used simulations to verify that the OPTPDT has correct type I error rates. Our power studies showed that the OPTPDT can be more powerful than the set-based test in PLINK, the multi-SNP FBAT test, and the p-value based test GATES. We applied the OPTPDT to a family-based autism GWAS dataset for gene-based association analysis and identified MACROD2-AS1 with genome-wide significance (p-value=2.5×10(-6)). Our simulation results suggested that the OPTPDT is a valid and powerful test. The OPTPDT will be helpful for gene-based or pathway association analysis. The method is ideal for the secondary analysis of existing GWAS datasets, which may identify a set of SNPs with joint effects on the disease.

Assessing polar bear (Ursus maritimus) population structure in the Hudson Bay region using SNPs.

PubMed

Viengkone, Michelle; Derocher, Andrew Edward; Richardson, Evan Shaun; Malenfant, René Michael; Miller, Joshua Moses; Obbard, Martyn E; Dyck, Markus G; Lunn, Nick J; Sahanatien, Vicki; Davis, Corey S

2016-12-01

Defining subpopulations using genetics has traditionally used data from microsatellite markers to investigate population structure; however, single-nucleotide polymorphisms (SNPs) have emerged as a tool for detection of fine-scale structure. In Hudson Bay, Canada, three polar bear ( Ursus maritimus ) subpopulations (Foxe Basin (FB), Southern Hudson Bay (SH), and Western Hudson Bay (WH)) have been delineated based on mark-recapture studies, radiotelemetry and satellite telemetry, return of marked animals in the subsistence harvest, and population genetics using microsatellites. We used SNPs to detect fine-scale population structure in polar bears from the Hudson Bay region and compared our results to the current designations using 414 individuals genotyped at 2,603 SNPs. Analyses based on discriminant analysis of principal components (DAPC) and STRUCTURE support the presence of four genetic clusters: (i) Western-including individuals sampled in WH, SH (excluding Akimiski Island in James Bay), and southern FB (south of Southampton Island); (ii) Northern-individuals sampled in northern FB (Baffin Island) and Davis Strait (DS) (Labrador coast); (iii) Southeast-individuals from SH (Akimiski Island in James Bay); and (iv) Northeast-individuals from DS (Baffin Island). Population structure differed from microsatellite studies and current management designations demonstrating the value of using SNPs for fine-scale population delineation in polar bears.

Genome-wide screening for highly discriminative SNPs for personal identification and their assessment in world populations.

PubMed

Li, Liming; Wang, Yi; Yang, Shuping; Xia, Mingying; Yang, Yajun; Wang, Jiucun; Lu, Daru; Pan, Xingwei; Ma, Teng; Jiang, Pei; Yu, Ge; Zhao, Ziqin; Ping, Yuan; Zhou, Huaigu; Zhao, Xueying; Sun, Hui; Liu, Bing; Jia, Dongtao; Li, Chengtao; Hu, Rile; Lu, Hongzhou; Liu, Xiaoyang; Chen, Wenqing; Mi, Qin; Xue, Fuzhong; Su, Yongdong; Jin, Li; Li, Shilin

2017-05-01

The applications of DNA profiling aim to identify perpetrators, missing family members and disaster victims in forensic investigations. Single nucleotide polymorphisms (SNPs) based forensic applications are emerging rapidly with a potential to replace short tandem repeats (STRs) based panels which are now being used widely, and there is a need for a well-designed SNP panel to meet such challenge for this transition. Here we present a panel of 175 SNP markers (referred to as Fudan ID Panel or FID), selected from ∼3.6 million SNPs, for the application of personal identification. We optimized and validated FID panel using 729 Chinese individuals using a next generation sequencing (NGS) technology. We showed that the SNPs in the panel possess very high heterozygosity as well as low within- and among-continent differentiations, enabling FID panel exhibit discrimination power in both regional and worldwide populations, with the average match probabilities ranging from 4.77×10 -71 to 1.06×10 -64 across 54 world populations. With the advent of biomedical research, the SNPs connecting physical anthropological, physiological, behavioral and phenotypic traits will be eventually added to the forensic panels that will revolutionize criminal investigation. Copyright © 2017 Elsevier B.V. All rights reserved.

Trichomonas vaginalis Metronidazole Resistance Is Associated with Single Nucleotide Polymorphisms in the Nitroreductase Genes ntr4Tv and ntr6Tv

PubMed Central

Paulish-Miller, Teresa E.; Augostini, Peter; Schuyler, Jessica A.; Smith, William L.; Mordechai, Eli; Adelson, Martin E.; Gygax, Scott E.; Secor, William E.

2014-01-01

Metronidazole resistance in the sexually transmitted parasite Trichomonas vaginalis is a problematic public health issue. We have identified single nucleotide polymorphisms (SNPs) in two nitroreductase genes (ntr4Tv and ntr6Tv) associated with resistance. These SNPs were associated with one of two distinct T. vaginalis populations identified by multilocus sequence typing, yet one SNP (ntr6Tv A238T), which results in a premature stop codon, was associated with resistance independent of population structure and may be of diagnostic value. PMID:24550324

Single nucleotide polymorphisms in common bean: their discovery and genotyping using a multiplex detection system

USDA-ARS?s Scientific Manuscript database

Single-nucleotide Polymorphism (SNP) markers are by far the most common form of DNA polymorphism in a genome. The objectives of this study were to discover SNPs in common bean comparing sequences from coding and non-coding regions obtained from Genbank and genomic DNA and to compare sequencing resu...

Design of a High Density SNP Genotyping Assay in the Pig Using SNPs Identified and Characterized by Next Generation Sequencing Technology

PubMed Central

Ramos, Antonio M.; Crooijmans, Richard P. M. A.; Affara, Nabeel A.; Amaral, Andreia J.; Archibald, Alan L.; Beever, Jonathan E.; Bendixen, Christian; Churcher, Carol; Clark, Richard; Dehais, Patrick; Hansen, Mark S.; Hedegaard, Jakob; Hu, Zhi-Liang; Kerstens, Hindrik H.; Law, Andy S.; Megens, Hendrik-Jan; Milan, Denis; Nonneman, Danny J.; Rohrer, Gary A.; Rothschild, Max F.; Smith, Tim P. L.; Schnabel, Robert D.; Van Tassell, Curt P.; Taylor, Jeremy F.; Wiedmann, Ralph T.; Schook, Lawrence B.; Groenen, Martien A. M.

2009-01-01

Background The dissection of complex traits of economic importance to the pig industry requires the availability of a significant number of genetic markers, such as single nucleotide polymorphisms (SNPs). This study was conducted to discover several hundreds of thousands of porcine SNPs using next generation sequencing technologies and use these SNPs, as well as others from different public sources, to design a high-density SNP genotyping assay. Methodology/Principal Findings A total of 19 reduced representation libraries derived from four swine breeds (Duroc, Landrace, Large White, Pietrain) and a Wild Boar population and three restriction enzymes (AluI, HaeIII and MspI) were sequenced using Illumina's Genome Analyzer (GA). The SNP discovery effort resulted in the de novo identification of over 372K SNPs. More than 549K SNPs were used to design the Illumina Porcine 60K+SNP iSelect Beadchip, now commercially available as the PorcineSNP60. A total of 64,232 SNPs were included on the Beadchip. Results from genotyping the 158 individuals used for sequencing showed a high overall SNP call rate (97.5%). Of the 62,621 loci that could be reliably scored, 58,994 were polymorphic yielding a SNP conversion success rate of 94%. The average minor allele frequency (MAF) for all scorable SNPs was 0.274. Conclusions/Significance Overall, the results of this study indicate the utility of using next generation sequencing technologies to identify large numbers of reliable SNPs. In addition, the validation of the PorcineSNP60 Beadchip demonstrated that the assay is an excellent tool that will likely be used in a variety of future studies in pigs. PMID:19654876

AccuTyping: new algorithms for automated analysis of data from high-throughput genotyping with oligonucleotide microarrays

PubMed Central

Hu, Guohong; Wang, Hui-Yun; Greenawalt, Danielle M.; Azaro, Marco A.; Luo, Minjie; Tereshchenko, Irina V.; Cui, Xiangfeng; Yang, Qifeng; Gao, Richeng; Shen, Li; Li, Honghua

2006-01-01

Microarray-based analysis of single nucleotide polymorphisms (SNPs) has many applications in large-scale genetic studies. To minimize the influence of experimental variation, microarray data usually need to be processed in different aspects including background subtraction, normalization and low-signal filtering before genotype determination. Although many algorithms are sophisticated for these purposes, biases are still present. In the present paper, new algorithms for SNP microarray data analysis and the software, AccuTyping, developed based on these algorithms are described. The algorithms take advantage of a large number of SNPs included in each assay, and the fact that the top and bottom 20% of SNPs can be safely treated as homozygous after sorting based on their ratios between the signal intensities. These SNPs are then used as controls for color channel normalization and background subtraction. Genotype calls are made based on the logarithms of signal intensity ratios using two cutoff values, which were determined after training the program with a dataset of ∼160 000 genotypes and validated by non-microarray methods. AccuTyping was used to determine >300 000 genotypes of DNA and sperm samples. The accuracy was shown to be >99%. AccuTyping can be downloaded from . PMID:16982644

Cyclooxygenase 2 gene polymorphisms and chronic periodontitis in a North Indian population: a pilot study

PubMed Central

Daing, Anika; Singh, Sarvendra Vikram; Saimbi, Charanjeet Singh; Khan, Mohammad Akhlaq

2012-01-01

Purpose Cyclooxygenase (COX) enzyme catalyzes the production of prostaglandins, which are important mediators of tissue destruction in periodontitis. Single nucleotide polymorphisms of COX2 enzyme have been associated with increasing susceptibility to inflammatory diseases. The present study evaluates the association of two single nucleotide polymorphisms in COX2 gene (-1195G>A and 8473C>T) with chronic periodontitis in North Indians. Methods Both SNPs and their haplotypes were used to explore the associations between COX2 polymorphisms and chronic periodontitis in 56 patients and 60 controls. Genotyping was done by polymerase chain reaction followed by restriction fragment length polymorphism. Chi-square test and logistic regression analysis were performed for association analysis. Results By the individual genotype analysis, mutant genotypes (GA and AA) of COX2 -1195 showed more than a two fold risk (odds ratio [OR]>2) and COX2 8473 (TC and CC) showed a reduced risk for the disease, but the findings were not statistically significant. Haplotype analysis showed that the frequency of the haplotype AT was higher in the case group and a significant association was found for haplotype AT (OR, 1.79; 95% confidence interval, 1.03 to 3.11; P=0.0370) indicating an association between the AT haplotype of COX2 gene SNPs and chronic periodontitis. Conclusions Individual genotypes of both the SNPs were not associated while haplotype AT was found to be associated with chronic periodontitis in North Indians. PMID:23185695

Bovine GDF10 gene polymorphism analysis and its association with body measurement traits in Chinese indigenous cattle.

PubMed

Adoligbe, C; Zan, Linsen; Farougou, S; Wang, Hongbao; Ujjan, J A

2012-04-01

The objective of this research was to detect bovine GDF10 gene polymorphism and analyze its association with body measurement traits (BMT) of animals sampled from 6 different Chinese indigenous cattle populations. The populations included Xuelong (Xl), Luxi (Lx), Qinchuan (Qc), Jiaxian red (Jx), Xianang (Xn) and Nanyang (Ny). Blood samples were taken from a total of 417 female animals stratified into age categories of 12-36 months. Polymerase chain reaction-single strand conformation polymorphism (PCR-SSCP) was employed to find out GDF10 single polymorphism nucleotide (SNPs) and explore their possible association with BMT. Sequence analysis of GDF10 gene revealed 3 SNPs in total: 1 in exon1 (G142A) and 2 in exon3 (A11471G, and T12495C). G142A and T12495C SNPs are both synonymous mutation. They showed 2 genotypes namely respectively (GG, GA) and (PP and PB). A11471G SNP is a missense mutation leading to the change of Alanine to Threonine amino acid. It showed three genotypes namely AA, BB and AB. Analysis of association of polymorphism with body measurement traits at the three locus showed that there were significant effects on BMT in Qc, Jx and Ny cattle population. These results suggest that the GDF10 gene might have potential effects on body measurement traits in the above mentioned cattle populations and could be used for marker-assisted selection.

Polymorphisms in genes of the renin-angiotensin-aldosterone system and renal cell cancer risk: interplay with hypertension and intakes of sodium, potassium and fluid.

PubMed

Deckers, Ivette A; van den Brandt, Piet A; van Engeland, Manon; van Schooten, Frederik-Jan; Godschalk, Roger W; Keszei, András P; Schouten, Leo J

2015-03-01

Hypertension is an established risk factor for renal cell cancer (RCC). The renin-angiotensin-aldosterone system (RAAS) regulates blood pressure and is closely linked to hypertension. RAAS additionally influences homeostasis of electrolytes (e.g. sodium and potassium) and fluid. We investigated single nucleotide polymorphisms (SNPs) in RAAS and their interactions with hypertension and intakes of sodium, potassium and fluid regarding RCC risk in the Netherlands Cohort Study (NLCS), which was initiated in 1986 and included 120,852 participants aged 55 to 69 years. Diet and lifestyle were assessed by questionnaires and toenail clippings were collected. Genotyping of toenail DNA was performed using the SEQUENOM® MassARRAY® platform for a literature-based selection of 13 candidate SNPs in seven key RAAS genes. After 20.3 years of follow-up, Cox regression analyses were conducted using a case-cohort approach including 3,583 subcohort members and 503 RCC cases. Two SNPs in AGTR1 were associated with RCC risk. AGTR1_rs1492078 (AA vs. GG) decreased RCC risk [hazard ratio (HR) (95% confidence interval (CI)): 0.70(0.49-1.00)], whereas AGTR1_rs5186 (CC vs. AA) increased RCC risk [HR(95%CI): 1.49(1.08-2.05)]. Associations were stronger in participants with hypertension. The RCC risk for AGT_rs3889728 (AG + AA vs. GG) was modified by hypertension (p interaction = 0.039). SNP-diet interactions were not significant, although HRs suggested interaction between SNPs in ACE and sodium intake. SNPs in AGTR1 and AGT influenced RCC susceptibility, and their effects were modified by hypertension. Sodium intake was differentially associated with RCC risk across genotypes of several SNPs, yet some analyses had probably inadequate power to show significant interaction. Results suggest that RAAS may be a candidate pathway in RCC etiology. © 2014 UICC.

Direct sequencing and comprehensive screening of genetic polymorphisms on CYP2 family genes (CYP2A6, CYP2B6, CYP2C8, and CYP2E1) in five ethnic populations.

PubMed

Kim, Jeong-Hyun; Cheong, Hyun Sub; Park, Byung Lae; Kim, Lyoung Hyo; Shin, Hee Jung; Na, Han Sung; Chung, Myeon Woo; Shin, Hyoung Doo

2015-01-01

Recently, CYP2A6, CYP2B6, CYP2C8, and CYP2E1 have been reported to play a role in the metabolic effect of pharmacological and carcinogenic compounds. Moreover, genetic variations of drug metabolism genes have been implicated in the interindividual variation in drug disposition and pharmacological response. To define the distribution of single nucleotide polymorphisms (SNPs) in these four CYP2 family genes and to discover novel SNPs across ethnic groups, 288 DNAs composed of 48 African-Americans, 48 European-Americans, 48 Japanese, 48 Han Chinese, and 96 Koreans were resequenced. A total of 143 SNPs, 26 in CYP2A6, 45 in CYP2B6, 29 in CYP2C8, and 43 in CYP2E1, were identified, including 13 novel variants. Notably, two SNPs in the regulatory regions, a promoter SNP rs2054675 and a nonsynonymous rs3745274 (p.172Q>H) in CYP2B6, showed significantly different minor allele frequencies (MAFs) among ethnic groups (minimum P = 4.30 × 10(-12)). In addition, rs2031920 in the promoter region of CYP2E1 showed a wide range of MAF between different ethnic groups, and even among other various ethnic groups based on public reports. Among 13 newly discovered SNPs in this study, 5 SNPs were estimated to have potential functions in further in silico analyses. Some differences in genetic variations and haplotypes of CYP2A6, CYP2B6, CYP2C8, and CYP2E1 were observed among populations. Our findings could be useful in further researches, such as genetic associations with drug responses.

A 34K SNP genotyping array for Populus trichocarpa: design, application to the study of natural populations and transferability to other Populus species.

PubMed

Geraldes, A; Difazio, S P; Slavov, G T; Ranjan, P; Muchero, W; Hannemann, J; Gunter, L E; Wymore, A M; Grassa, C J; Farzaneh, N; Porth, I; McKown, A D; Skyba, O; Li, E; Fujita, M; Klápště, J; Martin, J; Schackwitz, W; Pennacchio, C; Rokhsar, D; Friedmann, M C; Wasteneys, G O; Guy, R D; El-Kassaby, Y A; Mansfield, S D; Cronk, Q C B; Ehlting, J; Douglas, C J; Tuskan, G A

2013-03-01

Genetic mapping of quantitative traits requires genotypic data for large numbers of markers in many individuals. For such studies, the use of large single nucleotide polymorphism (SNP) genotyping arrays still offers the most cost-effective solution. Herein we report on the design and performance of a SNP genotyping array for Populus trichocarpa (black cottonwood). This genotyping array was designed with SNPs pre-ascertained in 34 wild accessions covering most of the species latitudinal range. We adopted a candidate gene approach to the array design that resulted in the selection of 34 131 SNPs, the majority of which are located in, or within 2 kb of, 3543 candidate genes. A subset of the SNPs on the array (539) was selected based on patterns of variation among the SNP discovery accessions. We show that more than 95% of the loci produce high quality genotypes and that the genotyping error rate for these is likely below 2%. We demonstrate that even among small numbers of samples (n = 10) from local populations over 84% of loci are polymorphic. We also tested the applicability of the array to other species in the genus and found that the number of polymorphic loci decreases rapidly with genetic distance, with the largest numbers detected in other species in section Tacamahaca. Finally, we provide evidence for the utility of the array to address evolutionary questions such as intraspecific studies of genetic differentiation, species assignment and the detection of natural hybrids. © 2013 Blackwell Publishing Ltd.

Multianalyte, dipstick-type, nanoparticle-based DNA biosensor for visual genotyping of single-nucleotide polymorphisms.

PubMed

Litos, Ioannis K; Ioannou, Penelope C; Christopoulos, Theodore K; Traeger-Synodinos, Jan; Kanavakis, Emmanuel

2009-06-15

DNA biosensors involve molecular recognition of the target sequence by hybridization with specific probes and detection by electrochemical, optical or gravimetric transduction. Disposable, dipstick-type biosensors have been developed recently, which enable visual detection of DNA without using instruments. In this context, we report a multianalyte DNA biosensor for visual genotyping of two single-nucleotide polymorphisms (SNPs). As a model, the biosensor was applied to the simultaneous genotyping of two SNPs, entailing the detection of four alleles. A PCR product that flanks both polymorphic sites is subjected to a single primer extension (PEXT) reaction employing four allele-specific primers, each containing a region complementary to an allele and a characteristic segment that enables subsequent capture on a test zone of the biosensor. The primers are extended with dNTPs and biotin-dUTP only if there is perfect complementarity with the interrogated sequence. The PEXT mixture is applied to the biosensor. As the developing buffer migrates along the strip, all the allele-specific primers are captured by immobilized oligonucleotides at the four test zones of the biosensor and detected by antibiotin-functionalized gold nanoparticles. As a result, the test zones are colored red if extension has occurred denoting the presence of the corresponding allele in the original sample. The excess nanoparticles are captured by immobilized biotinylated albumin at the control zone of the sensor forming another red zone that indicates the proper performance of the system. The assay was applied successfully to the genotyping of twenty clinical samples for two common SNPs of MBL2 gene.

Identification of single nucleotide polymorphism in protein phosphatase 1 regulatory subunit 11 gene in Murrah bulls

PubMed Central

Jain, Varsha; Patel, Brijesh; Umar, Farhat Paul; Ajithakumar, H. M.; Gurjar, Suraj K.; Gupta, I. D.; Verma, Archana

2017-01-01

Aim: This study was conducted with the objective to identify single nucleotide polymorphism (SNP) in protein phosphatase 1 regulatory subunit 11 (PPP1R11) gene in Murrah bulls. Materials and Methods: Genomic DNA was isolated by phenol–chloroform extraction method from the frozen semen samples of 65 Murrah bulls maintained at Artificial Breeding Research Centre, ICAR-National Dairy Research Institute, Karnal. The quality and concentration of DNA was checked by spectrophotometer reading and agarose gel electrophoresis. The target region of PPP1R11 gene was amplified using four sets of primer designed based on Bos taurus reference sequence. The amplified products were sequenced and aligned using Clustal Omega for identification of SNPs. Animals were genotyped by polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) using EcoNI restriction enzyme. Results: The sequences in the NCBI accession number NW_005785016.1 for Bubalus bubalis were compared and aligned with the edited sequences of Murrah bulls with Clustal Omega software. A total of 10 SNPs were found, out of which 1 at 5’UTR, 3 at intron 1, and 6 at intron 2 region. PCR-RFLP using restriction enzyme EcoNI revealed only AA genotype indicating monomorphism in PPP1R11 gene of all Murrah animals included in the study. Conclusion: A total of 10 SNPs were found. PCR-RFLP revealed only AA genotype indicating monomorphism in PPP1R11 gene of all Murrah animals included in the study, due to which association analysis with conception rate was not feasible. PMID:28344410

Differential allelic expression of IL13 and CSF2 genes associated with asthma.

PubMed

Burkhardt, Jana; Kirsten, Holger; Wolfram, Grit; Quente, Elfi; Ahnert, Peter

2012-07-01

An important area of genetic research is the identification of functional mechanisms in polymorphisms associated with diseases. A highly relevant functional mechanism is the influence of polymorphisms on gene expression levels (differential allelic expression, DAE). The coding single nucleotide polymorphisms (SNPs) CSF2(rs25882) and IL13(rs20541) have been associated with asthma. In this work, we investigated whether the mRNA expression levels of CSF2 or IL13 were correlated with these SNPs. Samples were analyzed by mass spectrometry-based quantification of gene expression. Both SNPs influenced gene expression levels (CSF2(rs25882): p(overall) = 0.008 and p(DAE samples) = 0.00006; IL13(rs20541): p(overall) = 0.059 and p(DAE samples) = 0.036). For CSF2, the expression level was increased by 27.4% (95% CI: 18.5%-35.4%) in samples with significant DAE in the presence of one copy of risk variant CSF2(rs25882-T). The average expression level of IL13 was increased by 29.8% (95% CI: 3.1%-63.4%) in samples with significant DAE in the presence of one copy of risk variant IL13(rs20541-A). Enhanced expression of CSF2 could stimulate macrophages and neutrophils during inflammation and may be related to the etiology of asthma. For IL-13, higher expression could enhance the functional activity of the asthma-associated isoform. Overall, the analysis of DAE provides an efficient approach for identifying possible functional mechanisms that link disease-associated variants with altered gene expression levels.

Genome-wide polymorphisms and development of a microarray platform to detect genetic variations in Plasmodium yoelii.

PubMed

Nair, Sethu C; Pattaradilokrat, Sittiporn; Zilversmit, Martine M; Dommer, Jennifer; Nagarajan, Vijayaraj; Stephens, Melissa T; Xiao, Wenming; Tan, John C; Su, Xin-Zhuan

2014-01-01

The rodent malaria parasite Plasmodium yoelii is an important model for studying malaria immunity and pathogenesis. One approach for studying malaria disease phenotypes is genetic mapping, which requires typing a large number of genetic markers from multiple parasite strains and/or progeny from genetic crosses. Hundreds of microsatellite (MS) markers have been developed to genotype the P. yoelii genome; however, typing a large number of MS markers can be labor intensive, time consuming, and expensive. Thus, development of high-throughput genotyping tools such as DNA microarrays that enable rapid and accurate large-scale genotyping of the malaria parasite will be highly desirable. In this study, we sequenced the genomes of two P. yoelii strains (33X and N67) and obtained a large number of single nucleotide polymorphisms (SNPs). Based on the SNPs obtained, we designed sets of oligonucleotide probes to develop a microarray that could interrogate ∼11,000 SNPs across the 14 chromosomes of the parasite in a single hybridization. Results from hybridizations of DNA samples of five P. yoelii strains or cloned lines (17XNL, YM, 33X, N67 and N67C) and two progeny from a genetic cross (N67×17XNL) to the microarray showed that the array had a high call rate (∼97%) and accuracy (99.9%) in calling SNPs, providing a simple and reliable tool for typing the P. yoelii genome. Our data show that the P. yoelii genome is highly polymorphic, although isogenic pairs of parasites were also detected. Additionally, our results indicate that the 33X parasite is a progeny of 17XNL (or YM) and an unknown parasite. The highly accurate and reliable microarray developed in this study will greatly facilitate our ability to study the genetic basis of important traits and the disease it causes. Published by Elsevier B.V.

Genomic variation at the tips of the adaptive radiation of Darwin's finches.

PubMed

Chaves, Jaime A; Cooper, Elizabeth A; Hendry, Andrew P; Podos, Jeffrey; De León, Luis F; Raeymaekers, Joost A M; MacMillan, W Owen; Uy, J Albert C

2016-11-01

Adaptive radiation unfolds as selection acts on the genetic variation underlying functional traits. The nature of this variation can be revealed by studying the tips of an ongoing adaptive radiation. We studied genomic variation at the tips of the Darwin's finch radiation; specifically focusing on polymorphism within, and variation among, three sympatric species of the genus Geospiza. Using restriction site-associated DNA (RAD-seq), we characterized 32 569 single-nucleotide polymorphisms (SNPs), from which 11 outlier SNPs for beak and body size were uncovered by a genomewide association study (GWAS). Principal component analysis revealed that these 11 SNPs formed four statistically linked groups. Stepwise regression then revealed that the first PC score, which included 6 of the 11 top SNPs, explained over 80% of the variation in beak size, suggesting that selection on these traits influences multiple correlated loci. The two SNPs most strongly associated with beak size were near genes associated with beak morphology across deeper branches of the radiation: delta-like 1 homologue (DLK1) and high-mobility group AT-hook 2 (HMGA2). Our results suggest that (i) key adaptive traits are associated with a small fraction of the genome (11 of 32 569 SNPs), (ii) SNPs linked to the candidate genes are dispersed throughout the genome (on several chromosomes), and (iii) micro- and macro-evolutionary variation (roots and tips of the radiation) involve some shared and some unique genomic regions. © 2016 John Wiley & Sons Ltd.

HTRA1 promoter polymorphism predisposes Japanese to age-related macular degeneration.

PubMed

Yoshida, Tsunehiko; DeWan, Andrew; Zhang, Hong; Sakamoto, Ryosuke; Okamoto, Haru; Minami, Masayoshi; Obazawa, Minoru; Mizota, Atsushi; Tanaka, Minoru; Saito, Yoshihiro; Takagi, Ikue; Hoh, Josephine; Iwata, Takeshi

2007-04-04

To study the effect of candidate single nucleotide polymorphisms (SNPs) on chromosome 10q26, recently shown to be associated with wet age-related macular degeneration (AMD) in Chinese and Caucasian cohorts, in a Japanese cohort. Using genomic DNA isolated from peripheral blood of wet AMD cases and age-matched controls, we genotyped two SNPs, rs10490924, and rs11200638, on chromosome 10q26, 6.6 kb and 512 bp upstream of the HTRA1 gene, respectively, using temperature gradient capillary electrophoresis (TGCE) and direct sequencing. Association tests were performed for individual SNPs and jointly with SNP complement factor H (CFH) Y402H. The two SNPs, rs10490924 and rs11200638, are in complete linkage disequilibrium (D'=1). Previous sequence comparisons among seventeen species revealed that the genomic region containing rs11200638 was highly conserved while the region surrounding rs10490924 was not. The allelic association test for rs11200638 yielded a p-value <10(-11). SNP rs11200638 conferred disease risk in an autosomal recessive fashion: Odds ratio was 10.1 (95% CI 4.36, 23.06), adjusted for SNP CFH 402, for those carrying two copies of the risk allele, whereas indistinguishable from unity if carrying only one risk allele. The HTRA1 promoter polymorphism, rs11200638, is a strong candidate with a functional consequence that predisposes Japanese to develop neovascular AMD.

Fatal Methadone Toxicity: Potential Role of CYP3A4 Genetic Polymorphism

PubMed Central

Richards-Waugh, Lauren L.; Primerano, Donald A.; Dementieva, Yulia; Kraner, James C.; Rankin, Gary O.

2014-01-01

Methadone is difficult to administer as a therapeutic agent because of a wide range of interindividual pharmacokinetics, likely due to genetic variability of the CYP450 enzymes responsible for metabolism to its principal metabolite 2-ethylidene-1,5-dimethyl-3,3-diphenylpyrrolidine (EDDP). CYP3A4 is one of the primary CYP450 isoforms responsible for the metabolism of methadone to EDDP in humans. The purpose of this study was to evaluate the role of CYP3A4 genetic polymorphisms in accidental methadone fatalities. A study cohort consisting of 136 methadone-only and 92 combined methadone/benzodiazepine fatalities was selected from cases investigated at the West Virginia and Kentucky Offices of the Chief Medical Examiner. Seven single nucleotide polymorphisms (SNPs) were genotyped within the CYP3A4 gene. Observed allelic and genotypic frequencies were compared with expected frequencies obtained from The National Center for Biotechnology Information dbSNP database. SNPs rs2242480 and rs2740574 demonstrated an apparent enrichment within the methadone-only overdose fatalities compared with the control group and the general population. This enrichment was not apparent in the methadone/benzodiazepine cases for these two SNPs. Our findings indicate that there may be two or more SNPs on the CYP3A4 gene that cause or contribute to the methadone poor metabolizer phenotype. PMID:25217544

Exploration of structural stability in deleterious nsSNPs of the XPA gene: A molecular dynamics approach.

PubMed

Nagasundaram, N; Priya Doss, C George

2011-01-01

Distinguishing the deleterious from the massive number of non-functional nsSNPs that occur within a single genome is a considerable challenge in mutation research. In this approach, we have used the existing in silico methods to explore the mutation-structure-function relationship in the XPAgene. We used the Sorting Intolerant From Tolerant (SIFT), Polymorphism Phenotyping (PolyPhen), I-Mutant 2.0, and the Protein Analysis THrough Evolutionary Relationships methods to predict the effects of deleterious nsSNPs on protein function and evaluated the impact of mutation on protein stability by Molecular Dynamics simulations. By comparing the scores of all the four in silico methods, nsSNP with an ID rs104894131 at position C108F was predicted to be highly deleterious. We extended our Molecular dynamics approach to gain insight into the impact of this non-synonymous polymorphism on structural changes that may affect the activity of the XPAgene. Based on the in silico methods score, potential energy, root-mean-square deviation, and root-mean-square fluctuation, we predict that deleterious nsSNP at position C108F would play a significant role in causing disease by the XPA gene. Our approach would present the application of in silicotools in understanding the functional variation from the perspective of structure, evolution, and phenotype.

Polymorphisms in nucleotide excision repair genes and risk of primary prostate cancer in Chinese Han populations.

PubMed

Wang, Mengyun; Li, Qiaoxin; Gu, Chengyuan; Zhu, Yao; Yang, Yajun; Wang, Jiucun; Jin, Li; He, Jing; Ye, Dingwei; Wei, Qingyi

2017-04-11

Genetic variants of nucleotide excision repair (NER) genes have been extensively investigated for their roles in the development of prostate cancer (PCa); however, the published results have been inconsistent. In a hospital-based case-control study of 1,004 PCa cases and 1,055 cancer-free controls, we genotyped eight potentially functional single nucleotide polymorphisms (SNPs) of NER genes (i.e., XPC, rs2228001 T>G and rs1870134 G>C; XPD, rs13181 T>G and rs238406 G>T; XPG, rs1047768 T>C, rs751402 C>T, and rs17655 G>C; and XPF, rs2276464 G>C) and assessed their associations with risk of PCa by using logistic regression analysis. Among these eight SNPs investigated, only XPC rs1870134 CG/CC variant genotypes were associated with a decreased risk of prostate cancer under a dominant genetic model (adjusted odds ratio [OR] = 0.77, 95% confidence interval [CI] = 0.64-1.91, P = 0.003). Phenotype-genotype analysis also suggested that the XPC rs1870134 CG/CC variant genotypes were associated with significantly decreased expression levels of XPC mRNA in a mix population of different ethnicities. These findings suggested that XPC SNPs may contribute to risk of PCa in Eastern Chinese men.

TP53 and MDM2 single nucleotide polymorphisms influence survival in non-del(5q) myelodysplastic syndromes

PubMed Central

Sallman, David A.; Basiorka, Ashley A.; Irvine, Brittany A.; Zhang, Ling; Epling-Burnette, P.K.; Rollison, Dana E.; Mallo, Mar; Sokol, Lubomir; Solé, Francesc; Maciejewski, Jaroslaw; List, Alan F.

2015-01-01

P53 is a key regulator of many cellular processes and is negatively regulated by the human homolog of murine double minute-2 (MDM2) E3 ubiquitin ligase. Single nucleotide polymorphisms (SNPs) of either gene alone, and in combination, are linked to cancer susceptibility, disease progression, and therapy response. We analyzed the interaction of TP53 R72P and MDM2 SNP309 SNPs in relationship to outcome in patients with myelodysplastic syndromes (MDS). Sanger sequencing was performed on DNA isolated from 208 MDS cases. Utilizing a novel functional SNP scoring system ranging from +2 to −2 based on predicted p53 activity, we found statistically significant differences in overall survival (OS) (p = 0.02) and progression-free survival (PFS) (p = 0.02) in non-del(5q) MDS patients with low functional scores. In univariate analysis, only IPSS and the functional SNP score predicted OS and PFS in non-del(5q) patients. In multivariate analysis, the functional SNP score was independent of IPSS for OS and PFS. These data underscore the importance of TP53 R72P and MDM2 SNP309 SNPs in MDS, and provide a novel scoring system independent of IPSS that is predictive for disease outcome. PMID:26416416

Relationship Between Some Single-nucleotide Polymorphism and Response to Hydroxyurea Therapy in Iranian Patients With β-Thalassemia Intermedia.

PubMed

Karimi, Mehran; Zarei, Tahereh; Haghpanah, Sezaneh; Moghadam, Mohamad; Ebrahimi, Ahmad; Rezaei, Narges; Heidari, Ghazaleh; Vazin, Afsaneh; Khavari, Maryam; Miri, Hamid R

2017-05-01

To evaluate the possible relationship between hydroxyurea (HU) response and some single-nucleotide polymorphism (SNP) in patients affected by β-thalassemia intermedia. In this cross-sectional study, 100 β-thalassemia intermedia patients who were taking HU with a dose of 8 to 15 mg/kg body weight per day for a period of at least 6 months were randomly selected between February 2013 and October 2014 in southern Iran. HU response was defined based on decrease or cessation of the blood transfusion need and evaluation of Hb level. In univariate analysis, from all evaluated SNPs, only rs10837814 SNP of olfactory receptors (ORs) OR51B2 showed a significant association with HU response (P=0.038) and from laboratory characteristics, only nucleated red blood cells showed significant associations (116%±183%) in good responders versus (264%±286%) in poor responders (P=0.045). In multiple logistic regression, neither laboratory variables nor different SNPs, showed significant association with HU response. Three novel nucleotide variations (-665 [A→C], -1301 [T→G],-1199 delA) in OR51B2 gene were found in good responders. None of the evaluated SNPs in our study showed significant association with HU response. Further larger studies and evaluation of other genes are suggested.

Pool-based genome-wide association study identified novel candidate regions on BTA9 and 14 for oleic acid percentage in Japanese Black cattle.

PubMed

Kawaguchi, Fuki; Kigoshi, Hiroto; Nakajima, Ayaka; Matsumoto, Yuta; Uemoto, Yoshinobu; Fukushima, Moriyuki; Yoshida, Emi; Iwamoto, Eiji; Akiyama, Takayuki; Kohama, Namiko; Kobayashi, Eiji; Honda, Takeshi; Oyama, Kenji; Mannen, Hideyuki; Sasazaki, Shinji

2018-05-17

Fatty acid composition is an important indicator of beef quality. The objective of this study was to search the potential candidate region for fatty acid composition. We performed pool-based genome-wide association studies (GWAS) for oleic acid percentage (C18:1) in a Japanese Black cattle population from the Hyogo prefecture. GWAS analysis revealed two novel candidate regions on BTA9 and BTA14. The most significant single nucleotide polymorphisms (SNPs) in each region were genotyped in a population (n = 899) to verify their effect on C18:1. Statistical analysis revealed that both SNPs were significantly associated with C18:1 (p = .0080 and .0003), validating the quantitative trait loci (QTLs) detected in GWAS. We subsequently selected VNN1 and LYPLA1 genes as candidate genes from each region on BTA9 and BTA14, respectively. We sequenced full-length coding sequence (CDS) of these genes in eight individuals and identified a nonsynonymous SNP T66M on VNN1 gene as a putative candidate polymorphism. The polymorphism was also significantly associated with C18:1, but the p value (p = .0162) was higher than the most significant SNP on BTA9, suggesting that it would not be responsible for the QTL. Although further investigation will be needed to determine the responsible gene and polymorphism, our findings would contribute to development of selective markers for fatty acid composition in the Japanese Black cattle of Hyogo. © 2018 Japanese Society of Animal Science.

Lack of genetic diversity across diverse immune genes in an endangered mammal, the Tasmanian devil (Sarcophilus harrisii).

PubMed

Morris, Katrina M; Wright, Belinda; Grueber, Catherine E; Hogg, Carolyn; Belov, Katherine

2015-08-01

The Tasmanian devil (Sarcophilus harrisii) is threatened with extinction due to the spread of devil facial tumour disease. Polymorphisms in immune genes can provide adaptive potential to resist diseases. Previous studies in diversity at immune loci in wild species have almost exclusively focused on genes of the major histocompatibility complex (MHC); however, these genes only account for a fraction of immune gene diversity. Devils lack diversity at functionally important immunity loci, including MHC and Toll-like receptor genes. Whether there are polymorphisms at devil immune genes outside these two families is unknown. Here, we identify polymorphisms in a wide range of key immune genes, and develop assays to type single nucleotide polymorphisms (SNPs) within a subset of these genes. A total of 167 immune genes were examined, including cytokines, chemokines and natural killer cell receptors. Using genome-level data from ten devils, SNPs within coding regions, introns and 10 kb flanking genes of interest were identified. We found low polymorphism across 167 immune genes examined bioinformatically using whole-genome data. From this data, we developed long amplicon assays to target nine genes. These amplicons were sequenced in 29-220 devils and found to contain 78 SNPs, including eight SNPS within exons. Despite the extreme paucity of genetic diversity within these genes, signatures of balancing selection were exhibited by one chemokine gene, suggesting that remaining diversity may hold adaptive potential. The low functional diversity may leave devils highly vulnerable to infectious disease, and therefore, monitoring and preserving remaining diversity will be critical for the long-term management of this species. Examining genetic variation in diverse immune genes should be a priority for threatened wildlife species. This study can act as a model for broad-scale immunogenetic diversity analysis in threatened species. © 2015 The Authors. Molecular Ecology Published by John Wiley & Sons Ltd.

Genomic and transcriptomic predictors of triglyceride response to regular exercise

PubMed Central

Sarzynski, Mark A; Davidsen, Peter K; Sung, Yun Ju; Hesselink, Matthijs K C; Schrauwen, Patrick; Rice, Treva K; Rao, D C; Falciani, Francesco; Bouchard, Claude

2015-01-01

Aim We performed genome-wide and transcriptome-wide profiling to identify genes and single nucleotide polymorphisms (SNPs) associated with the response of triglycerides (TG) to exercise training. Methods Plasma TG levels were measured before and after a 20-week endurance training programme in 478 white participants from the HERITAGE Family Study. Illumina HumanCNV370-Quad v3.0 BeadChips were genotyped using the Illumina BeadStation 500GX platform. Affymetrix HG-U133+2 arrays were used to quantitate gene expression levels from baseline muscle biopsies of a subset of participants (N=52). Genome-wide association study (GWAS) analysis was performed using MERLIN, while transcriptomic predictor models were developed using the R-package GALGO. Results The GWAS results showed that eight SNPs were associated with TG training-response (ΔTG) at p<9.9×10−6, while another 31 SNPs showed p values <1×10−4. In multivariate regression models, the top 10 SNPs explained 32.0% of the variance in ΔTG, while conditional heritability analysis showed that four SNPs statistically accounted for all of the heritability of ΔTG. A molecular signature based on the baseline expression of 11 genes predicted 27% of ΔTG in HERITAGE, which was validated in an independent study. A composite SNP score based on the top four SNPs, each from the genomic and transcriptomic analyses, was the strongest predictor of ΔTG (R2=0.14, p=3.0×10−68). Conclusions Our results indicate that skeletal muscle transcript abundance at 11 genes and SNPs at a number of loci contribute to TG response to exercise training. Combining data from genomics and transcriptomics analyses identified a SNP-based gene signature that should be further tested in independent samples. PMID:26491034

TLR9 Gene Region Polymorphisms and Susceptibility to Tuberculosis in Vietnam

PubMed Central

Graustein, AD; Horne, DJ; Arentz, M; Bang, ND; Chau, TTH; Thwaites, GE; Caws, M; Thuong, NTT; Dunstan, SJ; Hawn, TR

2015-01-01

Summary Humans exposed to Mycobacterium tuberculosis (Mtb) show variation in susceptibility to infection and differences in tuberculosis (TB) disease outcome. Toll-like receptor 9 (TLR9) is a pattern recognition receptor that mediates recognition of Mtb and modulates Mtb-specific T-cell responses. Using a case-population design, we evaluated whether single nucleotide polymorphisms (SNPs) in the TLR9 gene region are associated with susceptibility to pulmonary or meningeal TB as well as neurologic presentation and mortality in the meningeal TB group. In a discovery cohort (n = 352 cases, 382 controls), three SNPs were associated with TB (all forms, p<0.05) while three additional SNPs neared significance (0.05

Interactions between C-reactive protein genotypes with markers of nutritional status in relation to inflammation.

PubMed

Nienaber-Rousseau, Cornelie; Swanepoel, Bianca; Dolman, Robin C; Pieters, Marlien; Conradie, Karin R; Towers, G Wayne

2014-11-11

Inflammation, as indicated by C-reactive protein concentrations (CRP), is a risk factor for chronic diseases. Both genetic and environmental factors affect susceptibility to inflammation. As dietary interventions can influence inflammatory status, we hypothesized that dietary effects could be influenced by interactions with single nucleotide polymorphisms (SNPs) in the CRP gene. We determined 12 CRP SNPs, as well as various nutrition status markers in 2010 black South Africans and analyzed their effect on CRP. Interactions were observed for several genotypes with obesity in determining CRP. Lipid intake modulated the pro-inflammatory effects of some SNPs, i.e., an increase in both saturated fatty acid and monounsaturated fatty acid intake in those homozygous for the polymorphic allele at rs2808630 was associated with a larger increase in CRP. Those harboring the minor alleles at rs3093058 and rs3093062 presented with significantly higher CRP in the presence of increased triglyceride or cholesterol intake. When harboring the minor allele of these SNPs, a high omega-6 to -3 ratio was, however, found to be anti-inflammatory. Carbohydrate intake also modulated CRP SNPs, as HbA1C and fasting glucose levels interacted with some SNPs to influence the CRP. This investigation highlights the impact that nutritional status can have on reducing the inherent genetic susceptibility to a heightened systemic inflammatory state.

Identification of a single nucleotide polymorphism indicative of high risk in acute myocardial infarction

PubMed Central

Shalia, Kavita; Saranath, Dhananjaya; Rayar, Jaipreet; Shah, Vinod K.; Mashru, Manoj R.; Soneji, Surendra L.

2017-01-01

Background & objectives: Acute myocardial infarction (AMI) is a major health concern in India. The aim of the study was to identify single nucleotide polymorphisms (SNPs) associated with AMI in patients using dedicated chip and validating the identified SNPs on custom-designed chips using high-throughput microarray analysis. Methods: In pilot phase, 48 AMI patients and 48 healthy controls were screened for SNPs using human CVD55K BeadChip with 48,472 SNP probes on Illumina high-throughput microarray platform. The identified SNPs were validated by genotyping additional 160 patients and 179 controls using custom-made Illumina VeraCode GoldenGate Genotyping Assay. Analysis was carried out using PLINK software. Results: From the pilot phase, 98 SNPs present on 94 genes were identified with increased risk of AMI (odds ratio of 1.84-8.85, P=0.04861-0.003337). Five of these SNPs demonstrated association with AMI in the validation phase (P<0.05). Among these, one SNP rs9978223 on interferon gamma receptor 2 [IFNGR2, interferon (IFN)-gamma transducer 1] gene showed a significant association (P=0.00021) with AMI below Bonferroni corrected P value (P=0.00061). IFNGR2 is the second subunit of the receptor for IFN-gamma, an important cytokine in inflammatory reactions. Interpretation & conclusions: The study identified an SNP rs9978223 on IFNGR2 gene, associated with increased risk in AMI patient from India. PMID:29434065

Worldwide Distribution of Four SNPs in X‐Ray and Repair and Cross‐Complementing Group 1 (XRCC1)

PubMed Central

Takeshita, Haruo; Yasuda, Toshihiro; Kimura‐Kataoka, Kaori

2014-01-01

Abstract Purpose X‐ray repair cross‐complementing group 1 (XRCC1) repairs single‐strand breaks in DNA. Several reports have shown the association of single nucleotide polymorphisms (SNPs) (Arg194Trp, Pro206Pro, Arg280His, Arg399Gln) in XRCC1 to diseases. Limited population data are available regarding SNPs in XRCC1, especially in African populations. In this study, genotype distributions of four SNPs in worldwide populations were examined and compared with those reported previously. Materials and Methods Four SNPs (Arg194Trp, Pro206Pro, Arg280His, Arg399Gln) in XRCC1 from genomic DNA samples of 10 populations were evaluated by using polymerase chain reaction followed by restriction fragment length polymorphism analysis. Results The frequency of the minor allele corresponding to the Trp allele of XRCC1Arg194Trp was higher in Asian populations than in African and Caucasian populations. As for XRCC1Pro206Pro, Africans showed higher minor allele frequencies than did Asian populations, except for Tamils and Sinhalese. XRCC1 Arg280His frequencies were similar among Africans and Caucasians but differed among Asian populations. Similarly, lower mutant XRCC1 Arg399Gln frequencies were observed in Africans. Conclusions This study is the first to show the existence of a certain genetic heterogeneity in the worldwide distribution of four SNPs in XRCC1. PMID:25387884

Single nucleotide polymorphisms and haplotype frequencies of CYP3A5 in a Japanese population.

PubMed

Saeki, Mayumi; Saito, Yoshiro; Nakamura, Takahiro; Murayama, Norie; Kim, Su-Ryang; Ozawa, Shogo; Komamura, Kazuo; Ueno, Kazuyuki; Kamakura, Shiro; Nakajima, Toshiharu; Saito, Hirohisa; Kitamura, Yutaka; Kamatani, Naoyuki; Sawada, Jun-ichi

2003-06-01

In order to identify single nucleotide polymorphisms (SNPs) and haplotype frequencies of CYP3A5 in a Japanese population, we sequenced the proximal promoter region, all exons, and the surrounding intronic regions using genomic DNA from 187 Japanese subjects. Thirteen SNPs, including seven novel ones: 13108T>C, 16025A>G, 16903A>G, 16993C>G, 27448C>A, 29782A>G, and 31551T>C (A of the translational start codon of GenBank Accession # NG_000004.2 is numbered 1 according to the CYP Allele Nomenclature), were identified. The most common SNP was 6986A>G (key SNP for CYP3A5*3), with a 0.759 frequency. Two novel SNPs, 29782A>G (I456V) and 31551T>C (I488T), as well as 12952T>C (*5 marker) were found, but these alterations were always associated with the *3A marker SNPs, 6986A>G and 31611C>T. Using these 13 SNPs, haplotype analysis was performed and five novel *1 haplotypes (subtypes) (*1e to *1i) and six novel *3 haplotypes (subtypes) (*3d to *3i) were identified. Our findings suggest that CYP3A5*3 is the major defective allele and that other functional exonic SNPs are rare in the Japanese. Copyright 2003 Wiley-Liss, Inc.

Genetic predisposition to coronary heart disease and stroke using an additive genetic risk score: a population-based study in Greece

USDA-ARS?s Scientific Manuscript database

Objective: To determine the extent to which the risk for incident coronary heart disease (CHD) increases in relation to a genetic risk score (GRS) that additively integrates the influence of high-risk alleles in nine documented single nucleotide polymorphisms (SNPs) for CHD, and to examine whether t...

SNP Discovery in the Transcriptome of White Pacific Shrimp Litopenaeus vannamei by Next Generation Sequencing

PubMed Central

Yu, Yang; Wei, Jiankai; Zhang, Xiaojun; Liu, Jingwen; Liu, Chengzhang; Li, Fuhua; Xiang, Jianhai

2014-01-01

The application of next generation sequencing technology has greatly facilitated high throughput single nucleotide polymorphism (SNP) discovery and genotyping in genetic research. In the present study, SNPs were discovered based on two transcriptomes of Litopenaeus vannamei (L. vannamei) generated from Illumina sequencing platform HiSeq 2000. One transcriptome of L. vannamei was obtained through sequencing on the RNA from larvae at mysis stage and its reference sequence was de novo assembled. The data from another transcriptome were downloaded from NCBI and the reads of the two transcriptomes were mapped separately to the assembled reference by BWA. SNP calling was performed using SAMtools. A total of 58,717 and 36,277 SNPs with high quality were predicted from the two transcriptomes, respectively. SNP calling was also performed using the reads of two transcriptomes together, and a total of 96,040 SNPs with high quality were predicted. Among these 96,040 SNPs, 5,242 and 29,129 were predicted as non-synonymous and synonymous SNPs respectively. Characterization analysis of the predicted SNPs in L. vannamei showed that the estimated SNP frequency was 0.21% (one SNP per 476 bp) and the estimated ratio for transition to transversion was 2.0. Fifty SNPs were randomly selected for validation by Sanger sequencing after PCR amplification and 76% of SNPs were confirmed, which indicated that the SNPs predicted in this study were reliable. These SNPs will be very useful for genetic study in L. vannamei, especially for the high density linkage map construction and genome-wide association studies. PMID:24498047

Evolutionary selective pressure on three mitochondrial SNPs is consistent with their influence on metabolic efficiency in Pima Indians.

PubMed

Chamala, Srikar; Beckstead, Wesley A; Rowe, Mark J; McClellan, David A

2007-01-01

We investigated whether the effect of evolutionary selection on three recent Single Nucleotide Polymorphisms (SNPs) in the mitochondrial sub-haplogroups of Pima Indians is consistent with their effects on metabolic efficiency. The mitochondrial SNPs impact metabolic rate and respiratory quotient, and may be adaptations to caloric restriction in a desert habitat. Using TreeSAAP software, we examined evolutionary selection in 107 mammalian species at these SNPs, characterising the biochemical shifts produced by the amino acid substitutions. Our results suggest that two SNPs were affected by selection during mammalian evolution in a manner consistent with their effects on metabolic efficiency in Pima Indians.

The linkage disequilibrium pattern of the angiotensin converting enzyme gene in Arabic and Asian population groups.

PubMed

Kharrat, Najla; Abdelmouleh, Wafa; Abdelhedi, Rania; Alfadhli, Suad; Rebai, Ahmed

2012-01-01

DNA variations within the Angiotensin-Converting Enzyme (ACE) gene have been shown to be involved in the aetiology of several common diseases and the therapeutic response. This study reports a comparison of haplotype analysis of five SNPs in the ACE gene region using a sample of 100 healthy subjects derived from five different populations (Tunisian, Iranian, Kuwaiti, Bahraini and Indian). Strong linkage disequilibrium was found among all SNPs studied for all populations. Two SNPs (rs1800764 and rs4340) were identified as key SNPs for all populations. These SNPs will be valuable for future effective association studies of the ACE gene polymorphisms in Arab and Asian populations.

Association between UGT2B7 gene polymorphisms and fentanyl sensitivity in patients undergoing painful orthognathic surgery

PubMed Central

Muraoka, Wataru; Nishizawa, Daisuke; Fukuda, Kenichi; Kasai, Shinya; Hasegawa, Junko; Wajima, Koichi; Nakagawa, Taneaki

2016-01-01

Background Fentanyl is often used instead of morphine for the treatment of pain because it has fewer side effects. The metabolism of morphine by glucuronidation is known to be influenced by polymorphisms of the UGT2B7 gene. Some metabolic products of fentanyl are reportedly metabolized by glucuronate conjugation. The genes that are involved in the metabolic pathway of fentanyl may also influence fentanyl sensitivity. We analyzed associations between fentanyl sensitivity and polymorphisms of the UGT2B7 gene to clarify the hereditary determinants of individual differences in fentanyl sensitivity. Results This study examined whether single-nucleotide polymorphisms (SNPs) of the UGT2B7 gene affect cold pain sensitivity and the analgesic effects of fentanyl, evaluated by a standardized pain test and fentanyl requirements in healthy Japanese subjects who underwent uniform surgical procedures. The rs7439366 SNP of UGT2B7 is reportedly associated with the metabolism and analgesic effects of morphine. We found that this SNP is also associated with the analgesic effects of fentanyl in the cold pressor-induced pain test. It suggested that the C allele of the rs7439366 SNP may enhance analgesic efficacy. Two SNPs of UGT2B7, rs4587017 and rs1002849, were also found to be novel SNPs that may influence the analgesic effects of fentanyl in the cold pressor-induced pain test. Conclusions Fentanyl sensitivity for cold pressor-induced pain was associated with the rs7439366, rs4587017, and rs1002849 SNPs of the UGT2B7 gene. Our findings may provide valuable information for achieving satisfactory pain control and open to new avenues for personalized pain treatment. PMID:28256933

The evaluation of endothelin 1 (EDN1) and endothelin receptor type A (EDNRA) gene polymorphisms in Hashimoto's thyroiditis.

PubMed

Aydin, A Fatih; Vural, Pervin; Oruç, Çoşkun Umut; Doğru-Abbasoğlu, Semra; Özderya, Ayşenur; Karadağ, Berrin; Uysal, Müjdat

2014-07-01

Endothelin1 (EDN1) is well established marker of inflammation. The functions of EDN1 are mediated mainly by endothelin receptors type A (EDNRA). The etiopathogenesis of Hashimoto's thyroiditis (HT) remains still elusive although the role of chronic inflammation and subsequent endothelial dysfunction has been established. This study examined firstly the possible association of EDN1 (G5665Tand T-1370G) and EDNRA (C+70G and G-231A) single nucleotide polymorphisms (SNPs) with the occurrence of HT, and evaluates the relationship between genotypes and clinical/laboratory manifestation of HT. We analyzed genotype and allele distributions of above mentioned polymorphisms in 163 patients with HT and 181 healthy controls by real-time PCR combined with melting curve analysis. No significant associations between HT and variant alleles of EDN1 5665 and -1370, as well as EDNRA +70 and -231 SNPs were found. Haplotype analysis demonstrated that there was a strong (D'=0.76, r(2)=0.487) and weak (D'=0.403, r(2)=0.086) linkage disequilibrium (LD) between EDN1 -1370 and 5665, and between EDNRA -231 and +70 SNPs, respectively. However, haplotype frequencies in patients were similar to those in controls. In addition, it was observed that the EDNRA +70 G allele had protective effect against early (at age before 40 years) disease onset of HT (OR: 0.51, 95% CI=0.32-0.79, p=0.003). Although no significant associations between susceptibility to HT with EDN1 5665 and -1370, as well as with EDNRA+70 and -231 SNPs were found, EDNRA +70 polymorphism was related with decreased risk for early onset HT. Copyright © 2014 Elsevier B.V. All rights reserved.

A cis-phase interaction study of genetic variants within the MAOA gene in major depressive disorder.

PubMed

Zhang, JieXu; Chen, YanBo; Zhang, KeRang; Yang, Hong; Sun, Yan; Fang, Yue; Shen, Yan; Xu, Qi

2010-11-01

The genetic basis of major depressive disorder (MDD) has been explored extensively, but the mode of transmission of the disease has yet to be established. To better understand the mechanism by which the monoamine oxidase A (MAOA) gene may play a role in developing MDD, the present work examined the cis-phase interaction between genetic variants within the MAOA gene for the pathogenesis of MDD. A variable number tandem repeat (VNTR) and 19 single nucleotide polymorphisms (SNPs) within the gene were genotyped in 512 unrelated patients with MDD and 567 unrelated control subjects among a Chinese population. Quantitative real-time polymerase chain reaction analysis was applied to test the effect of genetic variants on expression of the MAOA gene in MDD. Neither the VNTR polymorphism nor seven informative SNPs showed allelic association with MDD, but the cis-acting interactions between the VNTR polymorphism and four individual SNPs were strongly associated with MDD risk, of which the VNTR-rs1465107 combination showed the strongest association (p = .000011). Quantitative real-time polymerase chain reaction analysis showed that overall relative quantity of MAOA messenger RNA was significantly higher in patients with MDD than in control subjects (fold change = 5.28, p = 1.7 × 10⁻⁷) and that in the male subjects carrying the VNTR-L, rs1465107-A, rs6323-G, rs2072743-A, or rs1137070-T alleles, expression of MAOA messenger RNA was significantly higher in the patient group than in the control group. The cis-phase interaction between the VNTR polymorphism and functional SNPs may contribute to the etiology of MDD. Copyright © 2010 Society of Biological Psychiatry. Published by Elsevier Inc. All rights reserved.

Association between tumour necrosis-α gene polymorphisms and acne vulgaris in a Pakistani population.

PubMed

Aisha, N M; Haroon, J; Hussain, S; Tahir, C M; Ikramullah, M; Rahim, H; Kishwar, N; Younis, S; Hassan, M J; Javed, Q

2016-04-01

The cytokine tumour necrosis factor (TNF)-α is a well-studied potent candidate mediator that is systemically involved in a variety of inflammatory diseases. Several single nucleotide polymorphisms (SNPs) of the TNF-α gene have been studied with regard the pathogenesis of acne vulgaris, but the results have been inconclusive. This case-control study investigated the association of the TNF -308 G>A and -238 G>A SNPs with acne vulgaris in a high-risk Pakistani population. In total, 160 healthy controls and 140 patients with acne were enrolled in this study. Polymorphisms were determined by PCR and restriction fragment length polymorphism analysis. Our data showed that the TNF -308 G>A and TNF -238 G>A SNPs were present at a significantly higher rate in cases than in controls (P < 0.01 and P < 0.02; respectively). There was a significant difference between the G and A alleles from patients with acne and controls for -308 G>A (OR = 1.5, 95% CI = 1.07-2.19, P < 0.02) and -238 G>A (OR=1.6, 95% CI = 1.06-2.44, P = 0.02) genotype. Moreover, the severity of acne was significantly associated with TNF genotype (TNF -308 G>A: χ² = 34.6, P < 0.001; TNF -238 G>AL χ² = 12.9, P < 0.01). Our data suggest that the TNF -308 G>A and TNF -238 G>A SNPs may contribute to the pathogenesis of acne in the study population. Furthermore, patients with severe acne showed an increased frequency of mutant TNF genotypes at -308 and -238 compared with patients with less severe acne. © 2015 British Association of Dermatologists.

Association between polymorphisms in cancer-related genes and early onset of esophageal adenocarcinoma.

PubMed

Wu, I-Chen; Zhao, Yang; Zhai, Rihong; Liu, Geoffrey; Ter-Minassian, Monica; Asomaning, Kofi; Su, Li; Liu, Chen-Yu; Chen, Feng; Kulke, Matthew H; Heist, Rebecca S; Christiani, David C

2011-04-01

There is an increasing incidence of esophageal adenocarcinoma (EA) among younger people in the western populations. However, the association between genetic polymorphisms and the age of EA onset is unclear. In this study, 1330 functional/tagging single-nucleotide polymorphisms (SNPs) from 354 cancer-related genes were genotyped in 335 white EA patients. Twenty important SNPs that have the highest importance scores and lowest classification error rate were identified by the random forest algorithm to be associated with early onset of EA (age ≤ 55 years). Subsequent logistic regression analysis indicated that 10 SNPs (rs2070744 of NOS3, rs720321 of BCL2, rs17757541 of BCL2, rs11775256 of TNFRSF10A, rs1035142 of CASP8, rs2236302 of MMP14, rs4740363 of ABL1, rs696217 of GHRL, rs2445762 of CYP19A1, and rs11941492 of VEGFR2/KDR) were significantly associated with early onset of EA (≤55 vs >55 years, all P < .05 after adjusting for co-variates and false discovery rate). Among them, five SNPs in the NOS3, BCL2, TNFRSF10A, and CASP8 genes were known to be involved in apoptosis processes. In Kaplan-Meier analyses, rs2070744 of NOS3, rs720321 of BCL2, and rs1035142 of CASP8 were also significantly associated with early onset of EA. Moreover, there was a higher risk of developing EA at a younger age when one had more risk genotypes. In conclusion, polymorphisms in cancer-related genes, especially those in the apoptotic pathway, play an important role in the development of younger-aged EA in a dose-response manner.

A qualitative study on Singaporean women's views towards breast cancer screening and Single Nucleotide Polymorphisms (SNPs) gene testing to guide personalised screening strategies.

PubMed

Wong, Xin Yi; Chong, Kok Joon; van Til, Janine A; Wee, Hwee Lin

2017-11-21

Breast cancer is the top cancer by incidence and mortality in Singaporean women. Mammography is by far its best screening tool, but current recommended age and interval may not yield the most benefit. Recent studies have demonstrated the potential of single nucleotide polymorphisms (SNPs) to improve discriminatory accuracy of breast cancer risk assessment models. This study was conducted to understand Singaporean women's views towards breast cancer screening and SNPs gene testing to guide personalised screening strategies. Focus group discussions were conducted among English-speaking women (n = 27) between 40 to 65 years old, both current and lapsed mammogram users. Women were divided into four groups based on age and mammogram usage. Discussions about breast cancer and screening experience, as well as perception and attitude towards SNPs gene testing were conducted by an experienced moderator. Women were also asked for factors that will influence their uptake of the test. Transcripts were analysed using thematic analysis to captured similarities and differences in views expressed. Barriers to repeat mammogram attendance include laziness to make appointment and painful and uncomfortable screening process. However, the underlying reason may be low perceived susceptibility to breast cancer. Facilitators to repeat mammogram attendance include ease of making appointment and timely reminders. Women were generally receptive towards SNPs gene testing, but required information on accuracy, cost, invasiveness, and side effects before they decide whether to go for it. Other factors include waiting time for results and frequency interval. On average, women gave a rating of 7.5 (range 5 to 10) when asked how likely they will go for the test. Addressing concerns such as pain and discomfort during mammogram, providing timely reminders and debunking breast cancer myths can help to improve screening uptake. Women demonstrated a spectrum of responses towards a novel test like SNPs gene testing, but need more information to make an informed decision. Future public health education on predictive genetic testing should adequately address both benefits and risks. Findings from this study is used to inform a discrete choice experiment to empirically quantify women preferences and willingness-to-pay for SNPs gene testing.

Association analyses of vitamin D-binding protein gene with compression strength index variation in Caucasian nuclear families.

PubMed

Xu, X-H; Xiong, D-H; Liu, X-G; Guo, Y; Chen, Y; Zhao, J; Recker, R R; Deng, H-W

2010-01-01

This study was conducted to test whether there exists an association between vitamin D-binding protein (DBP) gene and compression strength index (CSI) phenotype. Candidate gene association analyses were conducted in total sample, male subgroup, and female subgroup, respectively. Two single-nucleotide polymorphisms (SNPs) with significant association results were found in males, suggesting the importance of DBP gene polymorphisms on the variation in CSI especially in Caucasian males. CSI of the femoral neck (FN) is a newly developed phenotype integrating information about bone size, body size, and bone mineral density. It is considered to have the potential to improve the performance of risk assessment for hip fractures because it is based on a combination of phenotypic traits influencing hip fractures rather than a single trait. CSI is under moderate genetic determination (with a heritability of approximately 44% found in this study), but the relevant genetic study is still rather scarce. Based on the known physiological role of DBP in bone biology and the relatively high heritability of CSI, we tested 12 SNPs of the DBP gene for association with CSI variation in 405 Caucasian nuclear families comprising 1,873 subjects from the Midwestern US. Association analyses were performed in the total sample, male and female subgroups, respectively. Significant associations with CSI were found with two SNPs (rs222029, P = 0.0019; rs222020, P = 0.0042) for the male subgroup. Haplotype-based association tests corroborated the single-SNP results. Our findings suggest that the DBP gene might be one of the genetic factors influencing CSI phenotype in Caucasians, especially in males.

Association of ALOX15 gene polymorphisms with obesity-related phenotypes in Chinese nuclear families with male offspring.

PubMed

Ke, Yao-hua; Xiao, Wen-jin; He, Jin-wei; Zhang, Hao; Yu, Jin-bo; Hu, Wei-wei; Gu, Jie-mei; Gao, Gao; Yue, Hua; Wang, Chun; Hu, Yun-qiu; Li, Miao; Liu, Yu-juan; Fu, Wen-zhen; Zhang, Zhen-lin

2012-02-01

Genetic variation in ALOX12, which encoded human 12-lipoxygenase, was found to be associated with fat mass in young Chinese men. The objective of this study was to investigate the relationship between single nucleotide polymorphisms (SNPs) and haplotypes in the ALOX15 gene and obesity-related phenotypes in Chinese nuclear families with male offspring. We recruited 1,296 subjects from 427 nuclear families with male offspring and genotyped five SNPs (rs9894225, rs748694, rs2619112, rs2619118, and rs916055) in the ALOX15 gene locus. The total fat mass (TFM), trunk fat mass (tFM), leg fat mass (LFM) and arm fat mass (AFM) were measured using dual-energy X-ray absorptiometry (DXA). The percentage of fat mass (PFM) was the ratio of TFM and body weight. The association between SNPs and haplotypes of ALOX15 and obesity-related phenotypic variation was measured using quantitative transmission disequilibrium test (QTDT). Using QTDT to measure family-based genetic association, we found that rs916055 had a statistically significant association with PFM (P=0.038), whereas rs916055 had a marginal but statistically insignificant association with tFM (P=0.093). The multiple-parameter 1000 permutations test agreed with the family-based association results: both showed that rs916055 had a statistically significant association with PFM (P=0.033). rs916055 in ALOX15 gene was significantly associated with the percentage of fat mass in Chinese nuclear families with male offspring in the family-based association study using QTDT approach.

Genomic profiling of thousands of candidate polymorphisms predicts risk of relapse in 778 Danish and German childhood acute lymphoblastic leukemia patients.

PubMed

Wesołowska-Andersen, A; Borst, L; Dalgaard, M D; Yadav, R; Rasmussen, K K; Wehner, P S; Rasmussen, M; Ørntoft, T F; Nordentoft, I; Koehler, R; Bartram, C R; Schrappe, M; Sicheritz-Ponten, T; Gautier, L; Marquart, H; Madsen, H O; Brunak, S; Stanulla, M; Gupta, R; Schmiegelow, K

2015-02-01

Childhood acute lymphoblastic leukemia survival approaches 90%. New strategies are needed to identify the 10-15% who evade cure. We applied targeted, sequencing-based genotyping of 25 000 to 34 000 preselected potentially clinically relevant single-nucleotide polymorphisms (SNPs) to identify host genome profiles associated with relapse risk in 352 patients from the Nordic ALL92/2000 protocols and 426 patients from the German Berlin-Frankfurt-Munster (BFM) ALL2000 protocol. Patients were enrolled between 1992 and 2008 (median follow-up: 7.6 years). Eleven cross-validated SNPs were significantly associated with risk of relapse across protocols. SNP and biologic pathway level analyses associated relapse risk with leukemia aggressiveness, glucocorticosteroid pharmacology/response and drug transport/metabolism pathways. Classification and regression tree analysis identified three distinct risk groups defined by end of induction residual leukemia, white blood cell count and variants in myeloperoxidase (MPO), estrogen receptor 1 (ESR1), lamin B1 (LMNB1) and matrix metalloproteinase-7 (MMP7) genes, ATP-binding cassette transporters and glucocorticosteroid transcription regulation pathways. Relapse rates ranged from 4% (95% confidence interval (CI): 1.6-6.3%) for the best group (72% of patients) to 76% (95% CI: 41-90%) for the worst group (5% of patients, P<0.001). Validation of these findings and similar approaches to identify SNPs associated with toxicities may allow future individualized relapse and toxicity risk-based treatments adaptation.

The Drosha rs10719 T>C polymorphism is associated with preeclampsia susceptibility.

PubMed

Rezaei, Mahnaz; Eskandari, Fatemeh; Mohammadpour-Gharehbagh, Abbas; Teimoori, Batool; Yaghmaei, Minoo; Mokhtari, Mojgan; Salimi, Saeedeh

2018-01-01

Drosha is a member of the micro RNA (miRNA) processing machinery that affects miRNA processing. Single-nucleotide polymorphisms (SNPs) in the Drosha gene might affect microRNA processing and the expression of various genes. The aim of this study is to investigate the association between SNPs in the Drosha gene and preeclampsia (PE) in the southeast of Iran. Genotyping of Drosha rs10719 and rs6877842 was performed using blood samples from 219 PE women and 205 healthy control subjects by a polymerase chain reaction-restriction fragment length polymorphism method. The Drosha rs10719TC genotype was significantly associated with 1.6-fold higher risk of PE (odds ratio (OR, 1.6 [95% CI, 1.1-2.4], P = 0.026). In addition, the frequency of the Drosha rs10719CC genotype was significantly higher in PE women and was associated with threefold higher risk of PE (OR 3 [95% CI 1.4-6.3], P = 0.004). There was no association between the Drosha rs6877842 polymorphism and PE susceptibility. The CC-GG combined genotype was associated with 3.4-fold higher risk of PE (OR 3.4 [95% CI 1.4-8.1], P = 0.007). The haplotype-based association analysis showed higher frequency of C-G haplotype of Drosha rs10719 and rs6877842 polymorphisms with the increased risk of PE 1.5-fold (OR 1.5 [95% CI 1.1 - 2], P = 0.01). The Drosha rs10719TC and CC genotypes were associated with PE risk. The CC-GG combined genotype and C-G haplotype of Drosha rs10719 and rs6877842 polymorphisms may increase PE susceptibility.

Association between IL-10a SNPs and resistance to cyprinid herpesvirus-3 infection in common carp (Cyprinus carpio)

USDA-ARS?s Scientific Manuscript database

Analysis of gene polymorphisms and disease association is essential for assessing putative candidate genes affecting susceptibility or resistance to disease. In this paper, we report the results of an association analysis between SNPs in common carp innate immune response genes and resistance to Cy...

Single nucleotide polymorphisms in candidate genes related to daughter pregnancy rate in Holstein cows

USDA-ARS?s Scientific Manuscript database

ABSTRACT: Previously, a candidate gene approach identified 40 SNPs associated with daughter pregnancy rate (DPR) in dairy bulls. We evaluated 39 of these SNPs for relationship to DPR in a separate population of Holstein cows grouped on their predicted transmitting ability for DPR: <= -1 (n=1266) a...

SEAN: SNP prediction and display program utilizing EST sequence clusters.

PubMed

Huntley, Derek; Baldo, Angela; Johri, Saurabh; Sergot, Marek

2006-02-15

SEAN is an application that predicts single nucleotide polymorphisms (SNPs) using multiple sequence alignments produced from expressed sequence tag (EST) clusters. The algorithm uses rules of sequence identity and SNP abundance to determine the quality of the prediction. A Java viewer is provided to display the EST alignments and predicted SNPs.

Polymorphisms in the FGF2 gene and risk of serous ovarian cancer: results from the Ovarian Cancer Association Consortium

PubMed Central

Johnatty, Sharon E.; Beesley, Jonathan; Chen, Xiaoqing; Spurdle, Amanda B.; deFazio, Anna; Webb, Penelope M; Goode, Ellen L.; Rider, David N.; Vierkant, Robert A.; Anderson, Stephanie; Wu, Anna H.; Pike, Malcolm; Van Den Berg, David; Moysich, Kirsten; Ness, Roberta; Doherty, Jennifer; Rossing, Mary-Anne; Pearce, Celeste Leigh; Chenevix-Trench, Georgia

2009-01-01

Fibroblast growth factor (FGF)-2 (basic) is a potent angiogenic molecule involved in tumour progression, and is one of several growth factors with a central role in ovarian carcinogenesis. We hypothesised that common single nucleotide polymorphisms (SNPs) in the FGF2 gene may alter angiogenic potential and thereby susceptibility to ovarian cancer. We analysed 25 FGF2 tgSNPs using five independent study populations from the United States and Australia. Analysis was restricted to non-Hispanic White women with serous ovarian carcinoma (1269 cases and 2829 controls). There were no statistically significant associations between any FGF2 SNPs and ovarian cancer risk. There were two nominally statistically significant associations between heterozygosity for two FGF2 SNPs (rs308379 and rs308447; p<0.05) and serous ovarian cancer risk in the combined dataset, but rare homozygous estimates did not achieve statistical significance, nor were they consistent with the log additive model of inheritance. Overall genetic variation in FGF2 does not appear to play a role in susceptibility to ovarian cancer. PMID:19456219

Association of CAT polymorphisms with catalase activity and exposure to environmental oxidative stimuli

PubMed Central

Nadif, Rachel; Mintz, Margaret; Jedlicka, Anne; Bertrand, Jean-Pierre; Kleeberger, Steven R.; Kauffmann, Francine

2005-01-01

We tested the hypotheses that catalase activity is modified by CAT single nucleotide polymorphisms (SNPs) (–262;–844), and by their interactions with oxidant exposures (coal dusts, smoking), lymphotoxin alpha (LTA, NcoI) and tumor necrosis factor (TNF, -308) in 196 miners. Erythrocyte catalase, superoxide dismutase, and glutathione peroxidase activities were measured. The CAT –262 SNP was related to lower catalase activity (104, 87 and 72 k/g hemoglobin for CC, CT and TT respectively, p<0.0001). Regardless of CAT SNPs, the LTA NcoI but not the TNF –308 SNP was associated with catalase activity (p=0.04 and p=0.8). CAT –262 T carriers were less frequent in highly exposed miners (OR=0.39 [0.20 – 0.78], p=0.007). In CAT –262 T carriers only, catalase activity decreased with high dust exposure (p=0.01). Haplotype analyses (combined CAT SNPs) confirm these results. Results show that CAT –262 and LTA NcoI SNPs, and interaction with coal dust exposure, influenced catalase activity. PMID:16298864

Integrating common and rare genetic variation in diverse human populations.

PubMed

Altshuler, David M; Gibbs, Richard A; Peltonen, Leena; Altshuler, David M; Gibbs, Richard A; Peltonen, Leena; Dermitzakis, Emmanouil; Schaffner, Stephen F; Yu, Fuli; Peltonen, Leena; Dermitzakis, Emmanouil; Bonnen, Penelope E; Altshuler, David M; Gibbs, Richard A; de Bakker, Paul I W; Deloukas, Panos; Gabriel, Stacey B; Gwilliam, Rhian; Hunt, Sarah; Inouye, Michael; Jia, Xiaoming; Palotie, Aarno; Parkin, Melissa; Whittaker, Pamela; Yu, Fuli; Chang, Kyle; Hawes, Alicia; Lewis, Lora R; Ren, Yanru; Wheeler, David; Gibbs, Richard A; Muzny, Donna Marie; Barnes, Chris; Darvishi, Katayoon; Hurles, Matthew; Korn, Joshua M; Kristiansson, Kati; Lee, Charles; McCarrol, Steven A; Nemesh, James; Dermitzakis, Emmanouil; Keinan, Alon; Montgomery, Stephen B; Pollack, Samuela; Price, Alkes L; Soranzo, Nicole; Bonnen, Penelope E; Gibbs, Richard A; Gonzaga-Jauregui, Claudia; Keinan, Alon; Price, Alkes L; Yu, Fuli; Anttila, Verneri; Brodeur, Wendy; Daly, Mark J; Leslie, Stephen; McVean, Gil; Moutsianas, Loukas; Nguyen, Huy; Schaffner, Stephen F; Zhang, Qingrun; Ghori, Mohammed J R; McGinnis, Ralph; McLaren, William; Pollack, Samuela; Price, Alkes L; Schaffner, Stephen F; Takeuchi, Fumihiko; Grossman, Sharon R; Shlyakhter, Ilya; Hostetter, Elizabeth B; Sabeti, Pardis C; Adebamowo, Clement A; Foster, Morris W; Gordon, Deborah R; Licinio, Julio; Manca, Maria Cristina; Marshall, Patricia A; Matsuda, Ichiro; Ngare, Duncan; Wang, Vivian Ota; Reddy, Deepa; Rotimi, Charles N; Royal, Charmaine D; Sharp, Richard R; Zeng, Changqing; Brooks, Lisa D; McEwen, Jean E

2010-09-02

Despite great progress in identifying genetic variants that influence human disease, most inherited risk remains unexplained. A more complete understanding requires genome-wide studies that fully examine less common alleles in populations with a wide range of ancestry. To inform the design and interpretation of such studies, we genotyped 1.6 million common single nucleotide polymorphisms (SNPs) in 1,184 reference individuals from 11 global populations, and sequenced ten 100-kilobase regions in 692 of these individuals. This integrated data set of common and rare alleles, called 'HapMap 3', includes both SNPs and copy number polymorphisms (CNPs). We characterized population-specific differences among low-frequency variants, measured the improvement in imputation accuracy afforded by the larger reference panel, especially in imputing SNPs with a minor allele frequency of

Genetic alterations within TLR genes in development of Toxoplasma gondii infection among Polish pregnant women.

PubMed

Wujcicka, Wioletta; Wilczyński, Jan; Nowakowska, Dorota

2017-09-01

The research was conducted to evaluate the role of genotypes, haplotypes and multiple-SNP variants in the range of TLR2, TLR4 and TLR9 single nucleotide polymorphisms (SNPs) in the development of Toxoplasma gondii infection among Polish pregnant women. The study was performed for 116 Polish pregnant women, including 51 patients infected with T. gondii, and 65 age-matched control pregnant individuals. Genotypes in TLR2 2258 G>A, TLR4 896 A>G, TLR4 1196 C>T and TLR9 2848 G>A SNPs were estimated by self-designed, nested PCR-RFLP assays. Randomly selected PCR products, representative for distinct genotypes in the studied polymorphisms, were confirmed by sequencing. All the genotypes were calculated for Hardy-Weinberg (H-W) equilibrium and TLR4 variants were tested for linkage disequilibrium. Relationships were assessed between alleles, genotypes, haplotypes or multiple-SNP variants in TLR polymorphisms and the occurrence of T. gondii infection in pregnant women, using a logistic regression model. All the analyzed genotypes preserved the H-W equilibrium among the studied groups of patients (P>0.050). Similar distribution of distinct alleles and individual genotypes in TLR SNPs, as well as of haplotypes in TLR4 polymorphisms, were observed in T. gondii infected and control uninfected pregnant women. However, the GACG multiple-SNP variant, within the range of all the four studied polymorphisms, was correlated with a decreased risk of the parasitic infection (OR 0.52, 95% CI 0.28-0.97; P≤0.050). The polymorphisms, located within TLR2, TLR4 and TLR9 genes, may be involved together in occurrence of T. gondii infection among Polish pregnant women. Copyright © 2017 Medical University of Bialystok. Published by Elsevier B.V. All rights reserved.

CCR5 gene polymorphism is a genetic risk factor for radiographic severity of rheumatoid arthritis.

PubMed

Han, S W; Sa, K H; Kim, S I; Lee, S I; Park, Y W; Lee, S S; Yoo, W H; Soe, J S; Nam, E J; Lee, J; Park, J Y; Kang, Y M

2012-11-01

The chemokine receptor [C-C chemokine receptor 5 (CCR5)] is expressed on diverse immune effecter cells and has been implicated in the pathogenesis of rheumatoid arthritis (RA). This study sought to determine whether single-nucleotide polymorphisms (SNPs) in the CCR5 gene and their haplotypes were associated with susceptibility to and severity of RA. Three hundred fifty-seven patients with RA and 383 healthy unrelated controls were recruited. Using a pyrosequencing assay, we examined four polymorphisms -1118 CTAT(ins) (/del) (rs10577983), 303 A>G (rs1799987), 927 C>T (rs1800024), and 4838 G>T (rs1800874) of the CCR5 gene, which were distributed over the promoter region as well as the 5' and 3' untranslated regions. No significant difference in the genotype, allele, and haplotype frequencies of the four selected SNPs was observed between RA patients and controls. CCR5 polymorphisms of -1118 CTAT(del) (P = 0.012; corrected P = 0.048) and 303 A>G (P = 0.012; corrected P = 0.048) showed a significant association with radiographic severity in a recessive model, and, as a result of multivariate logistic regression analysis, were found to be an independent predictor of radiographic severity. When we separated the erosion score from the total Sharp score, the statistical significance of CCR5 polymorphisms showed an increase; -1118 CTAT(ins) (/del) (P = 0.007; corrected P = 0.028) and 303 A>G (P = 0.007; corrected P = 0.028). Neither SNPs nor haplotypes of the CCR5 gene showed a significant association with joint space narrowing score. These results indicate that genetic polymorphisms of CCR5 are an independent risk factor for radiographic severity denoted by modified Sharp score, particularly joint erosion in RA. © 2012 John Wiley & Sons A/S.

Frequency distribution of polymorphisms of CYP2C19, CYP2C9, VKORC1 and SLCO1B1 genes in the Yakut population.

PubMed

Vasilyev, Filipp Filippovich; Danilova, Diana Aleksandrovna; Kaimonov, Vladimir Sergeevich; Chertovskih, Yana Valerievna; Maksimova, Nadezda Romanovna

2016-01-01

Allele frequencies of single nucleotide polymorphisms (SNPs) are variable among different populations; therefore the study of SNPs in ethnic groups is important for establishing the clinical significance of the screening of these polymorphisms. The main goal of the research is to study the polymorphisms of CYP2C9, CYP2C19, VKORC1, and SLCO1B1 in Yakuts. Genomic DNA from 229 Yakut subjects were analyzed by real-time polymerase chain reaction (PCR) (SLCO1B1 +521T > C, VKORC1 -1639G>A, CYP2C19 +681G>A, +636G>A, CYP2C9 +430С>T, +1075A>C). Genotype frequencies of polymorphisms in the population of the Yakuts were more characteristic of the Asian population. The results have been included in the software application "Lekgen" that we developed for the interpretation of pharmacogenetic testing. The data of our study obtained on frequency carriers of polymorphisms of genes SLCO1B1, CYP2C19, CYP2C9, VKORC1 among the Yakuts may be useful in developing recommendations for a personalized therapy.

Frequency distribution of polymorphisms of CYP2C19, CYP2C9, VKORC1 and SLCO1B1 genes in the Yakut population

PubMed Central

Vasilyev, Filipp Filippovich; Danilova, Diana Aleksandrovna; Kaimonov, Vladimir Sergeevich; Chertovskih, Yana Valerievna; Maksimova, Nadezda Romanovna

2016-01-01

Allele frequencies of single nucleotide polymorphisms (SNPs) are variable among different populations; therefore the study of SNPs in ethnic groups is important for establishing the clinical significance of the screening of these polymorphisms. The main goal of the research is to study the polymorphisms of CYP2C9, CYP2C19, VKORC1, and SLCO1B1 in Yakuts. Genomic DNA from 229 Yakut subjects were analyzed by real-time polymerase chain reaction (PCR) (SLCO1B1 +521T > C, VKORC1 -1639G>A, CYP2C19 +681G>A, +636G>A, CYP2C9 +430С>T, +1075A>C). Genotype frequencies of polymorphisms in the population of the Yakuts were more characteristic of the Asian population. The results have been included in the software application “Lekgen” that we developed for the interpretation of pharmacogenetic testing. The data of our study obtained on frequency carriers of polymorphisms of genes SLCO1B1, CYP2C19, CYP2C9, VKORC1 among the Yakuts may be useful in developing recommendations for a personalized therapy. PMID:27499796

Genome-Wide SNP Discovery, Genotyping and Their Preliminary Applications for Population Genetic Inference in Spotted Sea Bass (Lateolabrax maculatus)

PubMed Central

Wang, Juan; Xue, Dong-Xiu; Zhang, Bai-Dong; Li, Yu-Long; Liu, Bing-Jian; Liu, Jin-Xian

2016-01-01

Next-generation sequencing and the collection of genome-wide single-nucleotide polymorphisms (SNPs) allow identifying fine-scale population genetic structure and genomic regions under selection. The spotted sea bass (Lateolabrax maculatus) is a non-model species of ecological and commercial importance and widely distributed in northwestern Pacific. A total of 22 648 SNPs was discovered across the genome of L. maculatus by paired-end sequencing of restriction-site associated DNA (RAD-PE) for 30 individuals from two populations. The nucleotide diversity (π) for each population was 0.0028±0.0001 in Dandong and 0.0018±0.0001 in Beihai, respectively. Shallow but significant genetic differentiation was detected between the two populations analyzed by using both the whole data set (FST = 0.0550, P < 0.001) and the putatively neutral SNPs (FST = 0.0347, P < 0.001). However, the two populations were highly differentiated based on the putatively adaptive SNPs (FST = 0.6929, P < 0.001). Moreover, a total of 356 SNPs representing 298 unique loci were detected as outliers putatively under divergent selection by FST-based outlier tests as implemented in BAYESCAN and LOSITAN. Functional annotation of the contigs containing putatively adaptive SNPs yielded hits for 22 of 55 (40%) significant BLASTX matches. Candidate genes for local selection constituted a wide array of functions, including binding, catalytic and metabolic activities, etc. The analyses with the SNPs developed in the present study highlighted the importance of genome-wide genetic variation for inference of population structure and local adaptation in L. maculatus. PMID:27336696

Genome-Wide SNP Discovery, Genotyping and Their Preliminary Applications for Population Genetic Inference in Spotted Sea Bass (Lateolabrax maculatus).

PubMed

Wang, Juan; Xue, Dong-Xiu; Zhang, Bai-Dong; Li, Yu-Long; Liu, Bing-Jian; Liu, Jin-Xian

2016-01-01

Next-generation sequencing and the collection of genome-wide single-nucleotide polymorphisms (SNPs) allow identifying fine-scale population genetic structure and genomic regions under selection. The spotted sea bass (Lateolabrax maculatus) is a non-model species of ecological and commercial importance and widely distributed in northwestern Pacific. A total of 22 648 SNPs was discovered across the genome of L. maculatus by paired-end sequencing of restriction-site associated DNA (RAD-PE) for 30 individuals from two populations. The nucleotide diversity (π) for each population was 0.0028±0.0001 in Dandong and 0.0018±0.0001 in Beihai, respectively. Shallow but significant genetic differentiation was detected between the two populations analyzed by using both the whole data set (FST = 0.0550, P < 0.001) and the putatively neutral SNPs (FST = 0.0347, P < 0.001). However, the two populations were highly differentiated based on the putatively adaptive SNPs (FST = 0.6929, P < 0.001). Moreover, a total of 356 SNPs representing 298 unique loci were detected as outliers putatively under divergent selection by FST-based outlier tests as implemented in BAYESCAN and LOSITAN. Functional annotation of the contigs containing putatively adaptive SNPs yielded hits for 22 of 55 (40%) significant BLASTX matches. Candidate genes for local selection constituted a wide array of functions, including binding, catalytic and metabolic activities, etc. The analyses with the SNPs developed in the present study highlighted the importance of genome-wide genetic variation for inference of population structure and local adaptation in L. maculatus.

DNA-based differentiation of the Ecuadorian cocoa types CCN-51 and Arriba based on sequence differences in the chloroplast genome.

PubMed

Herrmann, Luise; Haase, Ilka; Blauhut, Maike; Barz, Nadine; Fischer, Markus

2014-12-17

Two cocoa types, Arriba and CCN-51, are being cultivated in Ecuador. With regard to the unique aroma, Arriba is considered a fine cocoa type, while CCN-51 is a bulk cocoa because of its weaker aroma. Because it is being assumed that Arriba is mixed with CCN-51, there is an interest in the analytical differentiation of the two types. Two methods to identify CCN-51 adulterations in Arriba cocoa were developed on the basis of differences in the chloroplast DNA. On the one hand, a different repeat of the sequence TAAAG in the inverted repeat region results in a different length of amplicons for the two cocoa types, which can be detected by agarose gel electrophoresis, capillary gel electrophoresis, and denaturing high-performance liquid chromatography. On the other hand, single nucleotide polymorphisms (SNPs) between the CCN-51 and Arriba sequences represent restriction sites, which can be used for restriction fragment length polymorphism analysis. A semi-quantitative analysis based on these SNPs is feasible. A method for an exact quantitation based on these results is not realizable. These sequence variations were confirmed for a comprehensive cultivar collection of Arriba and CCN-51, for both bean and leaf samples.

Screening large-scale association study data: exploiting interactions using random forests.

PubMed

Lunetta, Kathryn L; Hayward, L Brooke; Segal, Jonathan; Van Eerdewegh, Paul

2004-12-10

Genome-wide association studies for complex diseases will produce genotypes on hundreds of thousands of single nucleotide polymorphisms (SNPs). A logical first approach to dealing with massive numbers of SNPs is to use some test to screen the SNPs, retaining only those that meet some criterion for further study. For example, SNPs can be ranked by p-value, and those with the lowest p-values retained. When SNPs have large interaction effects but small marginal effects in a population, they are unlikely to be retained when univariate tests are used for screening. However, model-based screens that pre-specify interactions are impractical for data sets with thousands of SNPs. Random forest analysis is an alternative method that produces a single measure of importance for each predictor variable that takes into account interactions among variables without requiring model specification. Interactions increase the importance for the individual interacting variables, making them more likely to be given high importance relative to other variables. We test the performance of random forests as a screening procedure to identify small numbers of risk-associated SNPs from among large numbers of unassociated SNPs using complex disease models with up to 32 loci, incorporating both genetic heterogeneity and multi-locus interaction. Keeping other factors constant, if risk SNPs interact, the random forest importance measure significantly outperforms the Fisher Exact test as a screening tool. As the number of interacting SNPs increases, the improvement in performance of random forest analysis relative to Fisher Exact test for screening also increases. Random forests perform similarly to the univariate Fisher Exact test as a screening tool when SNPs in the analysis do not interact. In the context of large-scale genetic association studies where unknown interactions exist among true risk-associated SNPs or SNPs and environmental covariates, screening SNPs using random forest analyses can significantly reduce the number of SNPs that need to be retained for further study compared to standard univariate screening methods.

Association between IL-1β polymorphisms and gastritis risk

PubMed Central

Sun, Xiaoming; Cai, Hongxing; Li, Zhouru; Li, Shanshan; Yin, Wenjiang; Dong, Guokai; Kuai, Jinxia; He, Yihui; Jia, Jing

2017-01-01

Abstract Background: Helicobacter pylori (H. pylori) infection of the human stomach regularly leads to chronic gastric inflammation. The cytokine gene interleukin (IL)-1β has been implicated in influencing the pathology of inflammation induced by H. pylori infection. Currently, several studies have been carried out to investigate the association of IL-1β-511 (rs16944) and IL-1β-31 (rs1143627) polymorphisms with gastritis risk; however, the results are inconsistent and inconclusive. To assess the effect of IL-1β polymorphisms on gastritis susceptibility, we conducted a meta-analysis. Methods: Up to March 15, 2016, 2205 cases and 2289 controls were collected from 12 published case–control studies. Summarized odds ratios and corresponding 95% confidence intervals (CIs) for IL-1β-511 and IL-1β-31 polymorphisms and gastritis risk were estimated using fixed- or random-effects models when appropriate. Heterogeneity was assessed by chi-squared-based Q-statistic test, and the sources of heterogeneity were explored by subgroup analyses and logistic meta-regression analyses. Publication bias was evaluated by Begg funnel plot and Egger test. Sensitivity analyses were also performed. Results: The results provided evidences that the single nucleotide polymorphisms (SNPs) in IL-1β-31 might be associated with the gastritis risk, especially in the Caucasian population, while SNPs in the IL-1β-511 might not be. Conclusion: Our studies may be helpful in supplementing the disease monitoring of gastritis in the future, and additional studies to determine the exact molecular mechanisms might inspire interventions to protect the susceptible subgroups. PMID:28151895

The Discovery of Single-Nucleotide Polymorphisms—and Inferences about Human Demographic History

PubMed Central

Wakeley, John; Nielsen, Rasmus; Liu-Cordero, Shau Neen; Ardlie, Kristin

2001-01-01

A method of historical inference that accounts for ascertainment bias is developed and applied to single-nucleotide polymorphism (SNP) data in humans. The data consist of 84 short fragments of the genome that were selected, from three recent SNP surveys, to contain at least two polymorphisms in their respective ascertainment samples and that were then fully resequenced in 47 globally distributed individuals. Ascertainment bias is the deviation, from what would be observed in a random sample, caused either by discovery of polymorphisms in small samples or by locus selection based on levels or patterns of polymorphism. The three SNP surveys from which the present data were derived differ both in their protocols for ascertainment and in the size of the samples used for discovery. We implemented a Monte Carlo maximum-likelihood method to fit a subdivided-population model that includes a possible change in effective size at some time in the past. Incorrectly assuming that ascertainment bias does not exist causes errors in inference, affecting both estimates of migration rates and historical changes in size. Migration rates are overestimated when ascertainment bias is ignored. However, the direction of error in inferences about changes in effective population size (whether the population is inferred to be shrinking or growing) depends on whether either the numbers of SNPs per fragment or the SNP-allele frequencies are analyzed. We use the abbreviation “SDL,” for “SNP-discovered locus,” in recognition of the genomic-discovery context of SNPs. When ascertainment bias is modeled fully, both the number of SNPs per SDL and their allele frequencies support a scenario of growth in effective size in the context of a subdivided population. If subdivision is ignored, however, the hypothesis of constant effective population size cannot be rejected. An important conclusion of this work is that, in demographic or other studies, SNP data are useful only to the extent that their ascertainment can be modeled. PMID:11704929

A Mismatch EndoNuclease Array-Based Methodology (MENA) for Identifying Known SNPs or Novel Point Mutations.

PubMed

Comeron, Josep M; Reed, Jordan; Christie, Matthew; Jacobs, Julia S; Dierdorff, Jason; Eberl, Daniel F; Manak, J Robert

2016-04-05

Accurate and rapid identification or confirmation of single nucleotide polymorphisms (SNPs), point mutations and other human genomic variation facilitates understanding the genetic basis of disease. We have developed a new methodology (called MENA (Mismatch EndoNuclease Array)) pairing DNA mismatch endonuclease enzymology with tiling microarray hybridization in order to genotype both known point mutations (such as SNPs) as well as identify previously undiscovered point mutations and small indels. We show that our assay can rapidly genotype known SNPs in a human genomic DNA sample with 99% accuracy, in addition to identifying novel point mutations and small indels with a false discovery rate as low as 10%. Our technology provides a platform for a variety of applications, including: (1) genotyping known SNPs as well as confirming newly discovered SNPs from whole genome sequencing analyses; (2) identifying novel point mutations and indels in any genomic region from any organism for which genome sequence information is available; and (3) screening panels of genes associated with particular diseases and disorders in patient samples to identify causative mutations. As a proof of principle for using MENA to discover novel mutations, we report identification of a novel allele of the beethoven (btv) gene in Drosophila, which encodes a ciliary cytoplasmic dynein motor protein important for auditory mechanosensation.

Association of twelve polymorphisms in three onco-lncRNA genes with hepatocellular cancer risk and prognosis: A case-control study

PubMed Central

Wang, Ben-Gang; Xu, Qian; Lv, Zhi; Fang, Xin-Xin; Ding, Han-Xi; Wen, Jing; Yuan, Yuan

2018-01-01

AIM To evaluate the association of 12 tag single nucleotide polymorphisms (tagSNPs) in three onco-long non-coding RNA (lncRNA) genes (HOTTIP, CCAT2, MALAT1) with the risk and prognosis of hepatocellular cancer (HCC). METHODS Twelve tagSNPs covering the three onco-lncRNAs were genotyped by the KASP method in a total of 1338 samples, including 521 HCC patients and frequency-matched 817 controls. The samples were obtained from an unrelated Chinese population at the First Hospital of China Medical University from 2012-2015. The expression quantitative trait loci (eQTL) analyses were conducted to explore further the potential function of the promising SNPs. RESULTS Three SNPs in HOTTIP, one promoter SNP in MALAT1, and one haplotype of HOTTIP were associated with HCC risk. The HOTTIP rs17501292, rs2067087, and rs17427960 SNPs were increased to 1.55-, 1.20-, and 1.18-fold HCC risk under allelic models (P = 0.012, 0.017 and 0.049, respectively). MALAT1 rs4102217 SNP was increased to a 1.32-fold HCC risk under dominant models (P = 0.028). In addition, the two-way interaction of HOTTIP rs17501292-MALAT1 rs619586 polymorphisms showed a decreased effect on HCC risk (Pinteraction = 0.028, OR = 0.30) and epistasis with each other. HOTTIP rs3807598 variant genotype showed significantly longer survival time in HBV negative subgroup (P = 0.049, HR = 0.12), and MALAT1 rs591291 showed significantly better prognosis in female and HBV negative subgroups (P = 0.022, HR = 0.37; P = 0.042, HR = 0.25, respectively). In the study, no significant effect was observed in eQTL analysis. CONCLUSION Specific lncRNA (HOTTIP and MALAT1) SNPs have potential to be biomarkers for HCC risk and prognosis. PMID:29930469

BAC-End Sequence-Based SNP Mining in Allotetraploid Cotton (Gossypium) Utilizing Resequencing Data, Phylogenetic Inferences, and Perspectives for Genetic Mapping

PubMed Central

Hulse-Kemp, Amanda M.; Ashrafi, Hamid; Stoffel, Kevin; Zheng, Xiuting; Saski, Christopher A.; Scheffler, Brian E.; Fang, David D.; Chen, Z. Jeffrey; Van Deynze, Allen; Stelly, David M.

2015-01-01

A bacterial artificial chromosome library and BAC-end sequences for cultivated cotton (Gossypium hirsutum L.) have recently been developed. This report presents genome-wide single nucleotide polymorphism (SNP) mining utilizing resequencing data with BAC-end sequences as a reference by alignment of 12 G. hirsutum L. lines, one G. barbadense L. line, and one G. longicalyx Hutch and Lee line. A total of 132,262 intraspecific SNPs have been developed for G. hirsutum, whereas 223,138 and 470,631 interspecific SNPs have been developed for G. barbadense and G. longicalyx, respectively. Using a set of interspecific SNPs, 11 randomly selected and 77 SNPs that are putatively associated with the homeologous chromosome pair 12 and 26, we mapped 77 SNPs into two linkage groups representing these chromosomes, spanning a total of 236.2 cM in an interspecific F2 population (G. barbadense 3-79 × G. hirsutum TM-1). The mapping results validated the approach for reliably producing large numbers of both intraspecific and interspecific SNPs aligned to BAC-ends. This will allow for future construction of high-density integrated physical and genetic maps for cotton and other complex polyploid genomes. The methods developed will allow for future Gossypium resequencing data to be automatically genotyped for identified SNPs along the BAC-end sequence reference for anchoring sequence assemblies and comparative studies. PMID:25858960

Different evolutionary patterns of SNPs between domains and unassigned regions in human protein-coding sequences.

PubMed

Pang, Erli; Wu, Xiaomei; Lin, Kui

2016-06-01

Protein evolution plays an important role in the evolution of each genome. Because of their functional nature, in general, most of their parts or sites are differently constrained selectively, particularly by purifying selection. Most previous studies on protein evolution considered individual proteins in their entirety or compared protein-coding sequences with non-coding sequences. Less attention has been paid to the evolution of different parts within each protein of a given genome. To this end, based on PfamA annotation of all human proteins, each protein sequence can be split into two parts: domains or unassigned regions. Using this rationale, single nucleotide polymorphisms (SNPs) in protein-coding sequences from the 1000 Genomes Project were mapped according to two classifications: SNPs occurring within protein domains and those within unassigned regions. With these classifications, we found: the density of synonymous SNPs within domains is significantly greater than that of synonymous SNPs within unassigned regions; however, the density of non-synonymous SNPs shows the opposite pattern. We also found there are signatures of purifying selection on both the domain and unassigned regions. Furthermore, the selective strength on domains is significantly greater than that on unassigned regions. In addition, among all of the human protein sequences, there are 117 PfamA domains in which no SNPs are found. Our results highlight an important aspect of protein domains and may contribute to our understanding of protein evolution.

A genome-wide association study in American Indians implicates DNER as a susceptibility locus for type 2 diabetes.

PubMed

Hanson, Robert L; Muller, Yunhua L; Kobes, Sayuko; Guo, Tingwei; Bian, Li; Ossowski, Victoria; Wiedrich, Kim; Sutherland, Jeffrey; Wiedrich, Christopher; Mahkee, Darin; Huang, Ke; Abdussamad, Maryam; Traurig, Michael; Weil, E Jennifer; Nelson, Robert G; Bennett, Peter H; Knowler, William C; Bogardus, Clifton; Baier, Leslie J

2014-01-01

Most genetic variants associated with type 2 diabetes mellitus (T2DM) have been identified through genome-wide association studies (GWASs) in Europeans. The current study reports a GWAS for young-onset T2DM in American Indians. Participants were selected from a longitudinal study conducted in Pima Indians and included 278 cases with diabetes with onset before 25 years of age, 295 nondiabetic controls ≥45 years of age, and 267 siblings of cases or controls. Individuals were genotyped on a ∼1M single nucleotide polymorphism (SNP) array, resulting in 453,654 SNPs with minor allele frequency >0.05. SNPs were analyzed for association in cases and controls, and a family-based association test was conducted. Tag SNPs (n = 311) were selected for 499 SNPs associated with diabetes (P < 0.0005 in case-control analyses or P < 0.0003 in family-based analyses), and these SNPs were genotyped in up to 6,834 additional Pima Indians to assess replication. Rs1861612 in DNER was associated with T2DM (odds ratio = 1.29 per copy of the T allele; P = 6.6 × 10(-8), which represents genome-wide significance accounting for the number of effectively independent SNPs analyzed). Transfection studies in murine pancreatic β-cells suggested that DNER regulates expression of notch signaling pathway genes. These studies implicate DNER as a susceptibility gene for T2DM in American Indians.

Type 2 diabetes (T2D) associated polymorphisms regulate expression of adjacent transcripts in transformed lymphocytes, adipose, and muscle from Caucasian and African-American subjects.

PubMed

Sharma, Neeraj K; Langberg, Kurt A; Mondal, Ashis K; Elbein, Steven C; Das, Swapan K

2011-02-01

Genome-wide association scans (GWAS) have identified novel single nucleotide polymorphisms (SNPs) that increase T2D susceptibility and indicated the role of nearby genes in T2D pathogenesis. We hypothesized that T2D-associated SNPs act as cis-regulators of nearby genes in human tissues and that expression of these transcripts may correlate with metabolic traits, including insulin sensitivity (S(I)). Association of SNPs with the expression of their nearest transcripts was tested in adipose and muscle from 168 healthy individuals who spanned a broad range of S(I) and body mass index (BMI) and in transformed lymphocytes (TLs). We tested correlations between the expression of these transcripts in adipose and muscle with metabolic traits. Utilizing allelic expression imbalance (AEI) analysis we examined the presence of other cis-regulators for those transcripts in TLs. SNP rs9472138 was significantly (P = 0.037) associated with the expression of VEGFA in TLs while rs6698181 was detected as a cis-regulator for the PKN2 in muscle (P = 0.00027) and adipose (P = 0.018). Significant association was also observed for rs17036101 (P = 0.001) with expression of SYN2 in adipose of Caucasians. Among 19 GWAS-implicated transcripts, expression of VEGFA in adipose was correlated with BMI (r = -0.305) and S(I) (r = 0.230). Although only a minority of the T2D-associated SNPs were validated as cis-eQTLs for nearby transcripts, AEI analysis indicated presence of other cis-regulatory polymorphisms in 54% of these transcripts. Our study suggests that a small subset of GWAS-identified SNPs may increase T2D susceptibility by modulating expression of nearby transcripts in adipose or muscle.

Performance of Single Nucleotide Polymorphisms versus Haplotypes for Genome-Wide Association Analysis in Barley

PubMed Central

Jannink, Jean-Luc

2010-01-01

Genome-wide association studies (GWAS) may benefit from utilizing haplotype information for making marker-phenotype associations. Several rationales for grouping single nucleotide polymorphisms (SNPs) into haplotype blocks exist, but any advantage may depend on such factors as genetic architecture of traits, patterns of linkage disequilibrium in the study population, and marker density. The objective of this study was to explore the utility of haplotypes for GWAS in barley (Hordeum vulgare) to offer a first detailed look at this approach for identifying agronomically important genes in crops. To accomplish this, we used genotype and phenotype data from the Barley Coordinated Agricultural Project and constructed haplotypes using three different methods. Marker-trait associations were tested by the efficient mixed-model association algorithm (EMMA). When QTL were simulated using single SNPs dropped from the marker dataset, a simple sliding window performed as well or better than single SNPs or the more sophisticated methods of blocking SNPs into haplotypes. Moreover, the haplotype analyses performed better 1) when QTL were simulated as polymorphisms that arose subsequent to marker variants, and 2) in analysis of empirical heading date data. These results demonstrate that the information content of haplotypes is dependent on the particular mutational and recombinational history of the QTL and nearby markers. Analysis of the empirical data also confirmed our intuition that the distribution of QTL alleles in nature is often unlike the distribution of marker variants, and hence utilizing haplotype information could capture associations that would elude single SNPs. We recommend routine use of both single SNP and haplotype markers for GWAS to take advantage of the full information content of the genotype data. PMID:21124933

Toll-like receptors genes polymorphisms and the occurrence of HCMV infection among pregnant women.

PubMed

Wujcicka, Wioletta; Paradowska, Edyta; Studzińska, Mirosława; Wilczyński, Jan; Nowakowska, Dorota

2017-03-24

Human cytomegalovirus (HCMV) is the most common cause of intrauterine infections worldwide. The toll-like receptors (TLRs) have been reported as important factors in immune response against HCMV. Particularly, TLR2, TLR4 and TLR9 have been shown to be involved in antiviral immunity. Evaluation of the role of single nucleotide polymorphisms (SNPs), located within TLR2, TLR4 and TLR9 genes, in the development of human cytomegalovirus (HCMV) infection in pregnant women and their fetuses and neonates, was performed. The study was performed for 131 pregnant women, including 66 patients infected with HCMV during pregnancy, and 65 age-matched control pregnant individuals. The patients were selected to the study, based on serological status of anti-HCMV IgG and IgM antibodies and on the presence of viral DNA in their body fluids. Genotypes in TLR2 2258 A > G, TLR4 896 G > A and 1196 C > T and TLR9 2848 G > A SNPs were determined by self-designed nested PCR-RFLP assays. Randomly selected PCR products, representative for distinct genotypes in TLR SNPs, were confirmed by sequencing. A relationship between the genotypes, alleles, haplotypes and multiple variants in the studied polymorphisms, and the occurrence of HCMV infection in pregnant women and their offsprings, was determined, using a logistic regression model. Genotypes in all the analyzed polymorphisms preserved the Hardy-Weinberg equilibrium in pregnant women, both infected and uninfected with HCMV (P > 0.050). GG homozygotic and GA heterozygotic status in TLR9 2848 G > A SNP decreased significantly the occurrence of HCMV infection (OR 0.44 95% CI 0.21-0.94 in the dominant model, P ≤ 0.050). The G allele in TLR9 SNP was significantly more frequent among the uninfected pregnant women than among the infected ones (χ 2  = 4.14, P ≤ 0.050). Considering other polymorphisms, similar frequencies of distinct genotypes, haplotypes and multiple-SNP variants were observed between the studied groups of patients. TLR9 2848 G > A SNP may be associated with HCMV infection in pregnant women.

Polymorphisms in endothelin system genes, arsenic levels and obesity risk.

PubMed

Martínez-Barquero, Vanesa; de Marco, Griselda; Martínez-Hervas, Sergio; Rentero, Pilar; Galan-Chilet, Inmaculada; Blesa, Sebastian; Morchon, David; Morcillo, Sonsoles; Rojo, Gemma; Ascaso, Juan Francisco; Real, José Tomás; Martín-Escudero, Juan Carlos; Chaves, Felipe Javier

2015-01-01

Obesity has been linked to morbidity and mortality through increased risk for many chronic diseases. Endothelin (EDN) system has been related to endothelial function but it can be involved in lipid metabolism regulation: Receptor type A (EDNRA) activates lipolysis in adipocytes, the two endothelin receptors mediate arsenic-stimulated adipocyte dysfunction, and endothelin system can regulate adiposity by modulating adiponectin activity in different situations and, therefore, influence obesity development. The aim of the present study was to analyze if single nucleotide polymorphisms (SNPs) in the EDN system could be associated with human obesity. We analyzed two samples of general-population-based studies from two different regions of Spain: the VALCAR Study, 468 subjects from the area of Valencia, and the Hortega Study, 1502 subjects from the area of Valladolid. Eighteen SNPs throughout five genes were analyzed using SNPlex. We found associations for two polymorphisms of the EDNRB gene which codifies for EDN receptor type B. Genotypes AG and AA of the rs5351 were associated with a lower risk for obesity in the VALCAR sample (p=0.048, OR=0.63) and in the Hortega sample (p=0.001, OR=0.62). Moreover, in the rs3759475 polymorphism, genotypes CT and TT were also associated with lower risk for obesity in the Hortega sample (p=0.0037, OR=0.66) and in the VALCAR sample we found the same tendency (p=0.12, OR=0.70). Furthermore, upon studying the pooled population, we found a stronger association with obesity (p=0.0001, OR=0.61 and p=0.0008, OR=0.66 for rs5351 and rs3759475, respectively). Regarding plasma arsenic levels, we have found a positive association for the two SNPs studied with obesity risk in individuals with higher arsenic levels in plasma: rs5351 (p=0.0054, OR=0.51) and rs3759475 (p=0.009, OR=0.53). Our results support the hypothesis that polymorphisms of the EDNRB gene may influence the susceptibility to obesity and can interact with plasma arsenic levels.

A whole genome association study to detect additive and dominant single nucleotide polymorphisms for growth and carcass traits in Korean native cattle, Hanwoo.

PubMed

Li, Yi; Gao, Yuxuan; Kim, You-Sam; Iqbal, Asif; Kim, Jong-Joo

2017-01-01

A whole genome association study was conducted to identify single nucleotide polymorphisms (SNPs) with additive and dominant effects for growth and carcass traits in Korean native cattle, Hanwoo. The data set comprised 61 sires and their 486 Hanwoo steers that were born between spring of 2005 and fall of 2007. The steers were genotyped with the 35,968 SNPs that were embedded in the Illumina bovine SNP 50K beadchip and six growth and carcass quality traits were measured for the steers. A series of lack-of-fit tests between the models was applied to classify gene expression pattern as additive or dominant. A total of 18 (0), 15 (3), 12 (8), 15 (18), 11 (7), and 21 (1) SNPs were detected at the 5% chromosome (genome) - wise level for weaning weight (WWT), yearling weight (YWT), carcass weight (CWT), backfat thickness (BFT), longissimus dorsi muscle area (LMA) and marbling score, respectively. Among the significant 129 SNPs, 56 SNPs had additive effects, 20 SNPs dominance effects, and 53 SNPs both additive and dominance effects, suggesting that dominance inheritance mode be considered in genetic improvement for growth and carcass quality in Hanwoo. The significant SNPs were located at 33 quantitative trait locus (QTL) regions on 18 Bos Taurus chromosomes (i.e. BTA 3, 4, 5, 6, 7, 9, 11, 12, 13, 14, 16, 17, 18, 20, 23, 26, 28, and 29) were detected. There is strong evidence that BTA14 is the key chromosome affecting CWT. Also, BTA20 is the key chromosome for almost all traits measured (WWT, YWT, LMA). The application of various additive and dominance SNP models enabled better characterization of SNP inheritance mode for growth and carcass quality traits in Hanwoo, and many of the detected SNPs or QTL had dominance effects, suggesting that dominance be considered for the whole-genome SNPs data and implementation of successive molecular breeding schemes in Hanwoo.

Genetic Determinants of Enterovirus Infections: Polymorphisms in Type 1 Diabetes and Innate Immune Genes in the MIDIA Study.

PubMed

Witsø, Elisabet; Cinek, Ondrej; Tapia, German; Brorsson, Caroline A; Stene, Lars C; Gjessing, Håkon K; Rasmussen, Trond; Bergholdt, Regine; Pociot, Flemming M; Rønningen, Kjersti S

2015-12-01

Enteroviruses have been suggested as triggers of type 1 diabetes (T1D). We aimed to assess whether established T1D susceptibility single nucleotide polymorphisms (SNPs) and candidate SNPs in innate immune genes were associated with the frequency of enterovirus infection in otherwise healthy children. Fifty-six established T1D SNPs and 97 other candidate immunity SNPs were typed in 419 children carrying the T1D high-risk genotype, HLA-DR4-DQ8/DR3-DQ2 genotype, and 373 children without this genotype. Enteroviral RNA was detected using real-time polymerase chain reaction, with primers detecting essentially all enterovirus serotypes, in 7,393 longitudinal stool samples collected monthly (age range 3-36 months). The most significant association was with two T1D SNPs, rs12150079 (ZPBP2/ORMDL3/GSDMB region) (enterovirus frequency: AA 7.3%, AG 8.7%, GG 9.7%, RR = 0.86, overall p = 1.87E-02) and rs229541 (C1QTNF6/SSTR3/RAC2) (enterovirus frequency: CC 7.8%, CT 9.7%, TT 9.4%, RR = 1.13, overall p = 3.6E-02), followed by TLR8 (rs2407992) (p = 3.8E-02), TLR3 (1914926) (p = 4.9E-02), and two other T1D SNPs (IFIH1 rs3747517, p = 4.9E-02 and PTPN22, rs2476601, p = 5.3E-02). However, the quantile-quantile plot of p-values with confidence intervals for all 153 SNPs did not reveal clear evidence for rejection of the complete null hypothesis. Among a number of SNPs in candidate genes, we found no evidence for strong associations with enterovirus presence in stool samples from Norwegian children.

A catalogue of polymorphisms related to xenobiotic metabolism and cancer susceptibility.

PubMed

Gemignani, Federica; Landi, Stefano; Vivant, Franck; Zienolddiny, Shanbeh; Brennan, Paul; Canzian, Federico

2002-08-01

High-throughput genotyping technology of multiple genes based on large samples of cases and controls are likely to be important in identifying common genes which have a moderate effect on the development of specific diseases. We present here a comprehensive list of 313 known experimentally confirmed polymorphisms in 54 genes which are particularly relevant for metabolism of drugs, alcohol, tobacco, and other potential carcinogens. We have compiled a catalog with a standardized format that summarizes the genetic and biochemical properties of the selected polymorphisms. We have also confirmed or redesigned experimental conditions for simplex or multiplex PCR amplification of a subset of 168 SNPs of particular interest, which will provide the basis for the design of assays compatible with high-throughput genotyping.

Genotyping of Single Nucleotide Polymorphisms in DNA Isolated from Serum Using Sequenom MassARRAY Technology.

PubMed

Clendenen, Tess V; Rendleman, Justin; Ge, Wenzhen; Koenig, Karen L; Wirgin, Isaac; Currie, Diane; Shore, Roy E; Kirchhoff, Tomas; Zeleniuch-Jacquotte, Anne

2015-01-01

Large epidemiologic studies have the potential to make valuable contributions to the assessment of gene-environment interactions because they prospectively collected detailed exposure data. Some of these studies, however, have only serum or plasma samples as a low quantity source of DNA. We examined whether DNA isolated from serum can be used to reliably and accurately genotype single nucleotide polymorphisms (SNPs) using Sequenom multiplex SNP genotyping technology. We genotyped 81 SNPs using samples from 158 participants in the NYU Women's Health Study. Each participant had DNA from serum and at least one paired DNA sample isolated from a high quality source of DNA, i.e. clots and/or cell precipitates, for comparison. We observed that 60 of the 81 SNPs (74%) had high call frequencies (≥95%) using DNA from serum, only slightly lower than the 85% of SNPs with high call frequencies in DNA from clots or cell precipitates. Of the 57 SNPs with high call frequencies for serum, clot, and cell precipitate DNA, 54 (95%) had highly concordant (>98%) genotype calls across all three sample types. High purity was not a critical factor to successful genotyping. Our results suggest that this multiplex SNP genotyping method can be used reliably on DNA from serum in large-scale epidemiologic studies.

Mining the transcriptomes of four commercially important shellfish species for single nucleotide polymorphisms within biomineralization genes.

PubMed

Vendrami, David L J; Shah, Abhijeet; Telesca, Luca; Hoffman, Joseph I

2016-06-01

Transcriptional profiling not only provides insights into patterns of gene expression, but also generates sequences that can be mined for molecular markers, which in turn can be used for population genetic studies. As part of a large-scale effort to better understand how commercially important European shellfish species may respond to ocean acidification, we therefore mined the transcriptomes of four species (the Pacific oyster Crassostrea gigas, the blue mussel Mytilus edulis, the great scallop Pecten maximus and the blunt gaper Mya truncata) for single nucleotide polymorphisms (SNPs). Illumina data for C. gigas, M. edulis and P. maximus and 454 data for M. truncata were interrogated using GATK and SWAP454 respectively to identify between 8267 and 47,159 high quality SNPs per species (total=121,053 SNPs residing within 34,716 different contigs). We then annotated the transcripts containing SNPs to reveal homology to diverse genes. Finally, as oceanic pH affects the ability of organisms to incorporate calcium carbonate, we honed in on genes implicated in the biomineralization process to identify a total of 1899 SNPs in 157 genes. These provide good candidates for biomarkers with which to study patterns of selection in natural or experimental populations. Copyright © 2016 Elsevier B.V. All rights reserved.

Polymorphisms, de novo lipogenesis, and plasma triglyceride response following fish oil supplementation

PubMed Central

Bouchard-Mercier, Annie; Rudkowska, Iwona; Lemieux, Simone; Couture, Patrick; Vohl, Marie-Claude

2013-01-01

Interindividual variability in the response of plasma triglyceride concentrations (TG) following fish oil consumption has been observed. Our objective was to examine the associations between single-nucleotide polymorphisms (SNPs) within genes encoding proteins involved in de novo lipogenesis and the relative change in plasma TG levels following a fish oil supplementation. Two hundred and eight participants were recruited in the greater Quebec City area. The participants completed a six-week fish oil supplementation (5 g fish oil/day: 1.9–2.2 g eicosapentaenoic acid and 1.1 g docosahexaenoic acid. SNPs within SREBF1, ACLY, and ACACA genes were genotyped using TAQMAN methodology. After correction for multiple comparison, only two SNPs, rs8071753 (ACLY) and rs1714987 (ACACA), were associated with the relative change in plasma TG concentrations (P = 0.004 and P = 0.005, respectively). These two SNPs explained 7.73% of the variance in plasma TG relative change following fish oil consumption. Genotype frequencies of rs8071753 according to the TG response groups (responders versus nonresponders) were different (P = 0.02). We conclude that the presence of certain SNPs within genes, such as ACLY and ACACA, encoding proteins involved in de novo lipogenesis seem to influence the plasma TG response following fish oil consumption. PMID:23886516

Polymorphisms, de novo lipogenesis, and plasma triglyceride response following fish oil supplementation.

PubMed

Bouchard-Mercier, Annie; Rudkowska, Iwona; Lemieux, Simone; Couture, Patrick; Vohl, Marie-Claude

2013-10-01

Interindividual variability in the response of plasma triglyceride concentrations (TG) following fish oil consumption has been observed. Our objective was to examine the associations between single-nucleotide polymorphisms (SNPs) within genes encoding proteins involved in de novo lipogenesis and the relative change in plasma TG levels following a fish oil supplementation. Two hundred and eight participants were recruited in the greater Quebec City area. The participants completed a six-week fish oil supplementation (5 g fish oil/day: 1.9-2.2 g eicosapentaenoic acid and 1.1 g docosahexaenoic acid. SNPs within SREBF1, ACLY, and ACACA genes were genotyped using TAQMAN methodology. After correction for multiple comparison, only two SNPs, rs8071753 (ACLY) and rs1714987 (ACACA), were associated with the relative change in plasma TG concentrations (P = 0.004 and P = 0.005, respectively). These two SNPs explained 7.73% of the variance in plasma TG relative change following fish oil consumption. Genotype frequencies of rs8071753 according to the TG response groups (responders versus nonresponders) were different (P = 0.02). We conclude that the presence of certain SNPs within genes, such as ACLY and ACACA, encoding proteins involved in de novo lipogenesis seem to influence the plasma TG response following fish oil consumption.

Single nucleotide polymorphisms in the bovine Histophilus somni genome; a comparison of new and old isolates.

PubMed

Madampage, Claudia Avis; Rawlyk, Neil; Crockford, Gordon; Van Donkersgoed, Joyce; Dorin, Craig; Potter, Andrew

2015-07-01

Histophilus somni, a causative agent of the bovine respiratory disease complex, can also cause a variety of systemic disorders, including bronchopneumonia, myocarditis, pericarditis, arthritis, pleuritis, and infectious thrombotic meningoencephalitis. The purpose of this study was to determine if currently circulating strains differ from those of the 1980s by identifying genomic changes. Single nucleotide polymorphisms (SNPs) and insertion and deletion (INDEL) sites were examined by whole-genome sequencing in 12 samples, 6 old and 6 new. The 31 028 SNP/INDELs recorded were compared against the reference genome sequence of the pathogenic H. somni strain 2336. The distribution of about 75% of these SNPs within a specified gene differed between old and new isolates and did not follow any particular pattern. The other 25% clustered into 2 groups containing the same SNPs in various genes: group I included 5 old isolates and 1 new isolate; group II included 5 new isolates and 1 old isolate. For putative virulence genes there were more SNPs in group I compared with strain 2336, itself an older isolate, than in group II. Although only 25% of all the SNPs formed 2 clusters, the results suggest some genetic difference in various genes between old and new strains.

Single nucleotide polymorphisms in the bovine Histophilus somni genome; a comparison of new and old isolates

PubMed Central

Madampage, Claudia Avis; Rawlyk, Neil; Crockford, Gordon; Van Donkersgoed, Joyce; Dorin, Craig; Potter, Andrew

2015-01-01

Histophilus somni, a causative agent of the bovine respiratory disease complex, can also cause a variety of systemic disorders, including bronchopneumonia, myocarditis, pericarditis, arthritis, pleuritis, and infectious thrombotic meningoencephalitis. The purpose of this study was to determine if currently circulating strains differ from those of the 1980s by identifying genomic changes. Single nucleotide polymorphisms (SNPs) and insertion and deletion (INDEL) sites were examined by whole-genome sequencing in 12 samples, 6 old and 6 new. The 31 028 SNP/INDELs recorded were compared against the reference genome sequence of the pathogenic H. somni strain 2336. The distribution of about 75% of these SNPs within a specified gene differed between old and new isolates and did not follow any particular pattern. The other 25% clustered into 2 groups containing the same SNPs in various genes: group I included 5 old isolates and 1 new isolate; group II included 5 new isolates and 1 old isolate. For putative virulence genes there were more SNPs in group I compared with strain 2336, itself an older isolate, than in group II. Although only 25% of all the SNPs formed 2 clusters, the results suggest some genetic difference in various genes between old and new strains. PMID:26130851

Association Analyses of RANKL/RANK/OPG Gene Polymorphisms with Femoral Neck Compression Strength Index Variation in Caucasians

PubMed Central

Dong, Shan-Shan; Liu, Xiao-Gang; Chen, Yuan; Guo, Yan; Wang, Liang; Zhao, Jian; Xiong, Dong-Hai; Xu, Xiang-Hong; Recker, Robert R.

2010-01-01

Femoral neck compression strength index (fCSI), a novel phenotypic parameter that integrates bone density, bone size, and body size, has significant potential to improve hip fracture risk assessment. The genetic factors underlying variations in fCSI, however, remain largely unknown. Given the important roles of the receptor activator of the nuclear factor-κB ligand/receptor activator of the nuclear factor-κB/osteoprotegerin (RANKL/RANK/OPG) pathway in the regulation of bone remodeling, we tested the associations between RANKL/RANK/OPG polymorphisms and variations in fCSI as well as its components (femoral neck bone mineral density [fBMD], femoral neck width [FNW], and weight). This was accomplished with a sample comprising 1873 subjects from 405 Caucasian nuclear families. Of the 37 total SNPs studied in these three genes, 3 SNPs, namely, rs12585014, rs7988338, and rs2148073, of RANKL were significantly associated with fCSI (P = 0.0007, 0.0007, and 0.0005, respectively) after conservative Bonferroni correction. Moreover, the three SNPs were approximately in complete linkage disequilibrium. Haplotype-based association tests corroborated the single-SNP results since haplotype 1 of block 1 of the RANKL gene achieved an even more significant association with fCSI (P = 0.0003) than any of the individual SNPs. However, we did not detect any significant associations of these genes with fBMD, FNW, or weight. In summary, our findings suggest that the RANKL gene may play an important role in variation in fCSI, independent of fBMD and non-fBMD components. PMID:19458885

Association analyses of RANKL/RANK/OPG gene polymorphisms with femoral neck compression strength index variation in Caucasians.

PubMed

Dong, Shan-Shan; Liu, Xiao-Gang; Chen, Yuan; Guo, Yan; Wang, Liang; Zhao, Jian; Xiong, Dong-Hai; Xu, Xiang-Hong; Recker, Robert R; Deng, Hong-Wen

2009-08-01

Femoral neck compression strength index (fCSI), a novel phenotypic parameter that integrates bone density, bone size, and body size, has significant potential to improve hip fracture risk assessment. The genetic factors underlying variations in fCSI, however, remain largely unknown. Given the important roles of the receptor activator of the nuclear factor-kappaB ligand/receptor activator of the nuclear factor-kappaB/osteoprotegerin (RANKL/RANK/OPG) pathway in the regulation of bone remodeling, we tested the associations between RANKL/RANK/OPG polymorphisms and variations in fCSI as well as its components (femoral neck bone mineral density [fBMD], femoral neck width [FNW], and weight). This was accomplished with a sample comprising 1873 subjects from 405 Caucasian nuclear families. Of the 37 total SNPs studied in these three genes, 3 SNPs, namely, rs12585014, rs7988338, and rs2148073, of RANKL were significantly associated with fCSI (P = 0.0007, 0.0007, and 0.0005, respectively) after conservative Bonferroni correction. Moreover, the three SNPs were approximately in complete linkage disequilibrium. Haplotype-based association tests corroborated the single-SNP results since haplotype 1 of block 1 of the RANKL gene achieved an even more significant association with fCSI (P = 0.0003) than any of the individual SNPs. However, we did not detect any significant associations of these genes with fBMD, FNW, or weight. In summary, our findings suggest that the RANKL gene may play an important role in variation in fCSI, independent of fBMD and non-fBMD components.

Using surface-enhanced Raman spectroscopy and electrochemically driven melting to discriminate Yersinia pestis from Y. pseudotuberculosis based on single nucleotide polymorphisms within unpurified polymerase chain reaction amplicons.

PubMed

Papadopoulou, Evanthia; Goodchild, Sarah A; Cleary, David W; Weller, Simon A; Gale, Nittaya; Stubberfield, Michael R; Brown, Tom; Bartlett, Philip N

2015-02-03

The development of sensors for the detection of pathogen-specific DNA, including relevant species/strain level discrimination, is critical in molecular diagnostics with major impacts in areas such as bioterrorism and food safety. Herein, we use electrochemically driven denaturation assays monitored by surface-enhanced Raman spectroscopy (SERS) to target single nucleotide polymorphisms (SNPs) that distinguish DNA amplicons generated from Yersinia pestis, the causative agent of plague, from the closely related species Y. pseudotuberculosis. Two assays targeting SNPs within the groEL and metH genes of these two species have been successfully designed. Polymerase chain reaction (PCR) was used to produce Texas Red labeled single-stranded DNA (ssDNA) amplicons of 262 and 251 bases for the groEL and metH targets, respectively. These amplicons were used in an unpurified form to hybridize to immobilized probes then subjected to electrochemically driven melting. In all cases electrochemically driven melting was able to discriminate between fully homologous DNA and that containing SNPs. The metH assay was particularly challenging due to the presence of only a single base mismatch in the middle of the 251 base long PCR amplicon. However, manipulation of assay conditions (conducting the electrochemical experiments at 10 °C) resulted in greater discrimination between the complementary and mismatched DNA. Replicate data were collected and analyzed for each duplex on different days, using different batches of PCR product and different sphere segment void (SSV) substrates. Despite the variability introduced by these differences, the assays are shown to be reliable and robust providing a new platform for strain discrimination using unpurified PCR samples.

[The joint applications of DNA chips and single nucleotide polymorphisms in forensic science].

PubMed

Bai, Peng; Tian, Li; Zhou, Xue-ping

2005-05-01

DNA chip technology, being a new high-technology, shows its vigorous life and rapid growth. Single Nucleotide Polymorphisms (SNPs) is the most common diversity in the human genome. It provides suitable genetic markers which play a key role in disease linkage study, pharmacogenomics, forensic medicine, population evolution and immigration study. Their advantage such as being analyzed with DNA chips technology, is predicted to play an important role in the field of forensic medicine, especially in paternity test and individual identification. This report mainly reviews the characteristics of DNA chip and SNPs, and their joint applications in the practice of forensic medicine.

Single nucleotide polymorphisms in the bovine MHC region of Japanese Black cattle are associated with bovine leukemia virus proviral load.

PubMed

Takeshima, Shin-Nosuke; Sasaki, Shinji; Meripet, Polat; Sugimoto, Yoshikazu; Aida, Yoko

2017-04-04

Bovine leukemia virus (BLV) is the causative agent of enzootic bovine leukosis, a malignant B cell lymphoma that has spread worldwide and causes serious problems for the cattle industry. The BLV proviral load, which represents the BLV genome integrated into host genome, is a useful index for estimating disease progression and transmission risk. Here, we conducted a genome-wide association study to identify single nucleotide polymorphisms (SNPs) associated with BLV proviral load in Japanese Black cattle. The study examined 93 cattle with a high proviral load and 266 with a low proviral load. Three SNPs showed a significant association with proviral load. One SNP was detected in the CNTN3 gene on chromosome 22, and two (which were not in linkage disequilibrium) were detected in the bovine major histocompatibility complex region on chromosome 23. These results suggest that polymorphisms in the major histocompatibility complex region affect proviral load. This is the first report to detect SNPs associated with BLV proviral load in Japanese Black cattle using whole genome association study, and understanding host factors may provide important clues for controlling the spread of BLV in Japanese Black cattle.

Association of ARID5B gene variants with acute lymphoblastic leukemia in Yemeni children.

PubMed

Al-Absi, Boshra; Noor, Suzita M; Saif-Ali, Riyadh; Salem, Sameer D; Ahmed, Radwan H; Razif, Muhammad Fm; Muniandy, Sekaran

2017-04-01

Studies have shown an association between ARID5B gene polymorphisms and childhood acute lymphoblastic leukemia. However, the association between ARID5B variants and acute lymphoblastic leukemia among the Arab population still needs to be studied. The aim of this study was to investigate the association between ARID5B variants with acute lymphoblastic leukemia in Yemeni children. A total of 14 ARID5B gene single nucleotide polymorphisms (SNPs) were genotyped in 289 Yemeni children, of whom 136 had acute lymphoblastic leukemia and 153 were controls, using the nanofluidic Dynamic Array (Fluidigm 192.24 Dynamic Array). Using logistic regression adjusted for age and gender, the risks of acute lymphoblastic leukemia were presented as odds ratios and 95% confidence intervals. We found that nine SNPs were associated with acute lymphoblastic leukemia under additive genetic models: rs7073837, rs10740055, rs7089424, rs10821936, rs4506592, rs10994982, rs7896246, rs10821938, and rs7923074. Furthermore, the recessive models revealed that six SNPs were risk factors for acute lymphoblastic leukemia: rs10740055, rs7089424, rs10994982, rs7896246, rs10821938, and rs7923074. The gender-specific impact of these SNPs under the recessive genetic model revealed that SNPs rs10740055, rs10994982, and rs6479779 in females, and rs10821938 and rs7923074 in males were significantly associated with acute lymphoblastic leukemia risk. Under the dominant model, SNPs rs7073837, rs10821936, rs7896246, and rs6479778 in males only showed striking association with acute lymphoblastic leukemia. The additive model revealed that SNPs with significant association with acute lymphoblastic leukemia were rs10821936 (both males and females); rs7073837, rs10740055, rs10994982, and rs4948487 (females only); and rs7089424, rs7896246, rs10821938, and rs7923074 (males only). In addition, the ARID5B haplotype block (CGAACACAA) showed a higher risk for acute lymphoblastic leukemia. The haplotype (CCCGACTGC) was associated with protection against acute lymphoblastic leukemia. In conclusion, our study has shown that ARID5B variants are associated with acute lymphoblastic leukemia in Yemeni children with several gender biases of ARID5B single nucleotide polymorphisms reported.

Single nucleotide polymorphism discovery in rainbow trout by deep sequencing of a reduced representation library.

PubMed

Sánchez, Cecilia Castaño; Smith, Timothy P L; Wiedmann, Ralph T; Vallejo, Roger L; Salem, Mohamed; Yao, Jianbo; Rexroad, Caird E

2009-11-25

To enhance capabilities for genomic analyses in rainbow trout, such as genomic selection, a large suite of polymorphic markers that are amenable to high-throughput genotyping protocols must be identified. Expressed Sequence Tags (ESTs) have been used for single nucleotide polymorphism (SNP) discovery in salmonids. In those strategies, the salmonid semi-tetraploid genomes often led to assemblies of paralogous sequences and therefore resulted in a high rate of false positive SNP identification. Sequencing genomic DNA using primers identified from ESTs proved to be an effective but time consuming methodology of SNP identification in rainbow trout, therefore not suitable for high throughput SNP discovery. In this study, we employed a high-throughput strategy that used pyrosequencing technology to generate data from a reduced representation library constructed with genomic DNA pooled from 96 unrelated rainbow trout that represent the National Center for Cool and Cold Water Aquaculture (NCCCWA) broodstock population. The reduced representation library consisted of 440 bp fragments resulting from complete digestion with the restriction enzyme HaeIII; sequencing produced 2,000,000 reads providing an average 6 fold coverage of the estimated 150,000 unique genomic restriction fragments (300,000 fragment ends). Three independent data analyses identified 22,022 to 47,128 putative SNPs on 13,140 to 24,627 independent contigs. A set of 384 putative SNPs, randomly selected from the sets produced by the three analyses were genotyped on individual fish to determine the validation rate of putative SNPs among analyses, distinguish apparent SNPs that actually represent paralogous loci in the tetraploid genome, examine Mendelian segregation, and place the validated SNPs on the rainbow trout linkage map. Approximately 48% (183) of the putative SNPs were validated; 167 markers were successfully incorporated into the rainbow trout linkage map. In addition, 2% of the sequences from the validated markers were associated with rainbow trout transcripts. The use of reduced representation libraries and pyrosequencing technology proved to be an effective strategy for the discovery of a high number of putative SNPs in rainbow trout; however, modifications to the technique to decrease the false discovery rate resulting from the evolutionary recent genome duplication would be desirable.

Novel approach identifies SNPs in SLC2A10 and KCNK9 with evidence for parent-of-origin effect on body mass index.

PubMed

Hoggart, Clive J; Venturini, Giulia; Mangino, Massimo; Gomez, Felicia; Ascari, Giulia; Zhao, Jing Hua; Teumer, Alexander; Winkler, Thomas W; Tšernikova, Natalia; Luan, Jian'an; Mihailov, Evelin; Ehret, Georg B; Zhang, Weihua; Lamparter, David; Esko, Tõnu; Macé, Aurelien; Rüeger, Sina; Bochud, Pierre-Yves; Barcella, Matteo; Dauvilliers, Yves; Benyamin, Beben; Evans, David M; Hayward, Caroline; Lopez, Mary F; Franke, Lude; Russo, Alessia; Heid, Iris M; Salvi, Erika; Vendantam, Sailaja; Arking, Dan E; Boerwinkle, Eric; Chambers, John C; Fiorito, Giovanni; Grallert, Harald; Guarrera, Simonetta; Homuth, Georg; Huffman, Jennifer E; Porteous, David; Moradpour, Darius; Iranzo, Alex; Hebebrand, Johannes; Kemp, John P; Lammers, Gert J; Aubert, Vincent; Heim, Markus H; Martin, Nicholas G; Montgomery, Grant W; Peraita-Adrados, Rosa; Santamaria, Joan; Negro, Francesco; Schmidt, Carsten O; Scott, Robert A; Spector, Tim D; Strauch, Konstantin; Völzke, Henry; Wareham, Nicholas J; Yuan, Wei; Bell, Jordana T; Chakravarti, Aravinda; Kooner, Jaspal S; Peters, Annette; Matullo, Giuseppe; Wallaschofski, Henri; Whitfield, John B; Paccaud, Fred; Vollenweider, Peter; Bergmann, Sven; Beckmann, Jacques S; Tafti, Mehdi; Hastie, Nicholas D; Cusi, Daniele; Bochud, Murielle; Frayling, Timothy M; Metspalu, Andres; Jarvelin, Marjo-Riitta; Scherag, André; Smith, George Davey; Borecki, Ingrid B; Rousson, Valentin; Hirschhorn, Joel N; Rivolta, Carlo; Loos, Ruth J F; Kutalik, Zoltán

2014-07-01

The phenotypic effect of some single nucleotide polymorphisms (SNPs) depends on their parental origin. We present a novel approach to detect parent-of-origin effects (POEs) in genome-wide genotype data of unrelated individuals. The method exploits increased phenotypic variance in the heterozygous genotype group relative to the homozygous groups. We applied the method to >56,000 unrelated individuals to search for POEs influencing body mass index (BMI). Six lead SNPs were carried forward for replication in five family-based studies (of ∼4,000 trios). Two SNPs replicated: the paternal rs2471083-C allele (located near the imprinted KCNK9 gene) and the paternal rs3091869-T allele (located near the SLC2A10 gene) increased BMI equally (beta = 0.11 (SD), P<0.0027) compared to the respective maternal alleles. Real-time PCR experiments of lymphoblastoid cell lines from the CEPH families showed that expression of both genes was dependent on parental origin of the SNPs alleles (P<0.01). Our scheme opens new opportunities to exploit GWAS data of unrelated individuals to identify POEs and demonstrates that they play an important role in adult obesity.

Novel Approach Identifies SNPs in SLC2A10 and KCNK9 with Evidence for Parent-of-Origin Effect on Body Mass Index

PubMed Central

Hoggart, Clive J.; Venturini, Giulia; Mangino, Massimo; Gomez, Felicia; Ascari, Giulia; Zhao, Jing Hua; Teumer, Alexander; Winkler, Thomas W.; Tšernikova, Natalia; Luan, Jian'an; Mihailov, Evelin; Ehret, Georg B.; Zhang, Weihua; Lamparter, David; Esko, Tõnu; Macé, Aurelien; Rüeger, Sina; Bochud, Pierre-Yves; Barcella, Matteo; Dauvilliers, Yves; Benyamin, Beben; Evans, David M.; Hayward, Caroline; Lopez, Mary F.; Franke, Lude; Russo, Alessia; Heid, Iris M.; Salvi, Erika; Vendantam, Sailaja; Arking, Dan E.; Boerwinkle, Eric; Chambers, John C.; Fiorito, Giovanni; Grallert, Harald; Guarrera, Simonetta; Homuth, Georg; Huffman, Jennifer E.; Porteous, David; Moradpour, Darius; Iranzo, Alex; Hebebrand, Johannes; Kemp, John P.; Lammers, Gert J.; Aubert, Vincent; Heim, Markus H.; Martin, Nicholas G.; Montgomery, Grant W.; Peraita-Adrados, Rosa; Santamaria, Joan; Negro, Francesco; Schmidt, Carsten O.; Scott, Robert A.; Spector, Tim D.; Strauch, Konstantin; Völzke, Henry; Wareham, Nicholas J.; Yuan, Wei; Bell, Jordana T.; Chakravarti, Aravinda; Kooner, Jaspal S.; Peters, Annette; Matullo, Giuseppe; Wallaschofski, Henri; Whitfield, John B.; Paccaud, Fred; Vollenweider, Peter; Bergmann, Sven; Beckmann, Jacques S.; Tafti, Mehdi; Hastie, Nicholas D.; Cusi, Daniele; Bochud, Murielle; Frayling, Timothy M.; Metspalu, Andres; Jarvelin, Marjo-Riitta; Scherag, André; Smith, George Davey; Borecki, Ingrid B.; Rousson, Valentin; Hirschhorn, Joel N.; Rivolta, Carlo; Loos, Ruth J. F.; Kutalik, Zoltán

2014-01-01

The phenotypic effect of some single nucleotide polymorphisms (SNPs) depends on their parental origin. We present a novel approach to detect parent-of-origin effects (POEs) in genome-wide genotype data of unrelated individuals. The method exploits increased phenotypic variance in the heterozygous genotype group relative to the homozygous groups. We applied the method to >56,000 unrelated individuals to search for POEs influencing body mass index (BMI). Six lead SNPs were carried forward for replication in five family-based studies (of ∼4,000 trios). Two SNPs replicated: the paternal rs2471083-C allele (located near the imprinted KCNK9 gene) and the paternal rs3091869-T allele (located near the SLC2A10 gene) increased BMI equally (beta = 0.11 (SD), P<0.0027) compared to the respective maternal alleles. Real-time PCR experiments of lymphoblastoid cell lines from the CEPH families showed that expression of both genes was dependent on parental origin of the SNPs alleles (P<0.01). Our scheme opens new opportunities to exploit GWAS data of unrelated individuals to identify POEs and demonstrates that they play an important role in adult obesity. PMID:25078964

No association between oxytocin or prolactin gene variants and childhood-onset mood disorders

PubMed Central

Strauss, John S.; Freeman, Natalie L.; Shaikh, Sajid A.; Vetró, Ágnes; Kiss, Enikő; Kapornai, Krisztina; Daróczi, Gabriella; Rimay, Timea; Kothencné, Viola Osváth; Dombovári, Edit; Kaczvinszk, Emília; Tamás, Zsuzsa; Baji, Ildikó; Besny, Márta; Gádoros, Julia; DeLuca, Vincenzo; George, Charles J.; Dempster, Emma; Barr, Cathy L.; Kovacs, Maria; Kennedy, James L.

2010-01-01

Background Oxytocin (OXT) and prolactin (PRL) are neuropeptide hormones that interact with the serotonin system and are involved in the stress response and social affiliation. In human studies, serum OXT and PRL levels have been associated with depression and related phenotypes. Our purpose was to determine if single nucleotide polymorphisms (SNPs) at the loci for OXT, PRL and their receptors, OXTR and PRLR, were associated with childhood-onset mood disorders (COMD). Methods Using 678 families in a family-based association design, we genotyped sixteen SNPs at OXT, PRL, OXTR and PRLR to test for association with COMD. Results No significant associations were found for SNPs in the OXTR, PRL, or PRLR genes. Two of three SNPs 3' of the OXT gene were associated with COMD (p ≤ 0.02), significant after spectral decomposition, but were not significant after additionally correcting for the number of genes tested. Supplementary analyses of parent-of-origin and proband sex effects for OXT SNPs by Fisher’s Exact test were not significant after Bonferroni correction. Conclusions We have examined sixteen OXT and PRL system gene variants, with no evidence of statistically significant association after correction for multiple tests. PMID:20547007

Genetic Modifiers of Patent Ductus Arteriosus in Term Infants.

PubMed

Patel, Priti M; Momany, Allison M; Schaa, Kendra L; Romitti, Paul A; Druschel, Charlotte; Cooper, Margaret E; Marazita, Mary L; Murray, Jeffrey C; Dagle, John M

2016-09-01

To identify single-nucleotide polymorphisms (SNPs) in specific candidate genes associated with patent ductus arteriosus in term infants. We conducted an initial family-based, candidate gene study to analyze genotype data from DNA samples obtained from 171 term infants and their parents enrolled in the National Birth Defects Prevention Study (NBDPS). We performed transmission disequilibrium testing (TDT) using a panel of 55 SNPs in 17 genes. Replication of SNPs with P < .1 in the NBDPS trios was performed with a case-control strategy in an independent population. TDT analysis of the NBDPS trios resulted in 6 SNPs reaching the predetermined cutoff (P < .1) to be included in the replication study. These 6 SNPs were genotyped in the independent case-control population. A SNP in TGFBR2 was found to be associated with term patent ductus arteriosus in both populations after we corrected for multiple comparisons. (rs934328, TDT P = 2 × 10(-4), case-control P = 6.6 × 10(-5)). These findings confirm the importance of the transforming growth factor-beta pathway in the closure of the term ductus arteriosus and may suggest new therapeutic targets. Published by Elsevier Inc.

A genome-wide association scan implicates DCHS2, RUNX2, GLI3, PAX1 and EDAR in human facial variation

PubMed Central

Adhikari, Kaustubh; Fuentes-Guajardo, Macarena; Quinto-Sánchez, Mirsha; Mendoza-Revilla, Javier; Camilo Chacón-Duque, Juan; Acuña-Alonzo, Victor; Jaramillo, Claudia; Arias, William; Lozano, Rodrigo Barquera; Pérez, Gastón Macín; Gómez-Valdés, Jorge; Villamil-Ramírez, Hugo; Hunemeier, Tábita; Ramallo, Virginia; Silva de Cerqueira, Caio C.; Hurtado, Malena; Villegas, Valeria; Granja, Vanessa; Gallo, Carla; Poletti, Giovanni; Schuler-Faccini, Lavinia; Salzano, Francisco M.; Bortolini, Maria- Cátira; Canizales-Quinteros, Samuel; Cheeseman, Michael; Rosique, Javier; Bedoya, Gabriel; Rothhammer, Francisco; Headon, Denis; González-José, Rolando; Balding, David; Ruiz-Linares, Andrés

2016-01-01

We report a genome-wide association scan for facial features in ∼6,000 Latin Americans. We evaluated 14 traits on an ordinal scale and found significant association (P values<5 × 10−8) at single-nucleotide polymorphisms (SNPs) in four genomic regions for three nose-related traits: columella inclination (4q31), nose bridge breadth (6p21) and nose wing breadth (7p13 and 20p11). In a subsample of ∼3,000 individuals we obtained quantitative traits related to 9 of the ordinal phenotypes and, also, a measure of nasion position. Quantitative analyses confirmed the ordinal-based associations, identified SNPs in 2q12 associated to chin protrusion, and replicated the reported association of nasion position with SNPs in PAX3. Strongest association in 2q12, 4q31, 6p21 and 7p13 was observed for SNPs in the EDAR, DCHS2, RUNX2 and GLI3 genes, respectively. Associated SNPs in 20p11 extend to PAX1. Consistent with the effect of EDAR on chin protrusion, we documented alterations of mandible length in mice with modified Edar funtion. PMID:27193062

A genome-wide association scan implicates DCHS2, RUNX2, GLI3, PAX1 and EDAR in human facial variation.

PubMed

Adhikari, Kaustubh; Fuentes-Guajardo, Macarena; Quinto-Sánchez, Mirsha; Mendoza-Revilla, Javier; Camilo Chacón-Duque, Juan; Acuña-Alonzo, Victor; Jaramillo, Claudia; Arias, William; Lozano, Rodrigo Barquera; Pérez, Gastón Macín; Gómez-Valdés, Jorge; Villamil-Ramírez, Hugo; Hunemeier, Tábita; Ramallo, Virginia; Silva de Cerqueira, Caio C; Hurtado, Malena; Villegas, Valeria; Granja, Vanessa; Gallo, Carla; Poletti, Giovanni; Schuler-Faccini, Lavinia; Salzano, Francisco M; Bortolini, Maria-Cátira; Canizales-Quinteros, Samuel; Cheeseman, Michael; Rosique, Javier; Bedoya, Gabriel; Rothhammer, Francisco; Headon, Denis; González-José, Rolando; Balding, David; Ruiz-Linares, Andrés

2016-05-19

We report a genome-wide association scan for facial features in ∼6,000 Latin Americans. We evaluated 14 traits on an ordinal scale and found significant association (P values<5 × 10(-8)) at single-nucleotide polymorphisms (SNPs) in four genomic regions for three nose-related traits: columella inclination (4q31), nose bridge breadth (6p21) and nose wing breadth (7p13 and 20p11). In a subsample of ∼3,000 individuals we obtained quantitative traits related to 9 of the ordinal phenotypes and, also, a measure of nasion position. Quantitative analyses confirmed the ordinal-based associations, identified SNPs in 2q12 associated to chin protrusion, and replicated the reported association of nasion position with SNPs in PAX3. Strongest association in 2q12, 4q31, 6p21 and 7p13 was observed for SNPs in the EDAR, DCHS2, RUNX2 and GLI3 genes, respectively. Associated SNPs in 20p11 extend to PAX1. Consistent with the effect of EDAR on chin protrusion, we documented alterations of mandible length in mice with modified Edar funtion.

Identification of leptin gene polymorphisms associated with carcass traits and fatty acid composition in Japanese Black cattle.

PubMed

Kawaguchi, Fuki; Okura, Kazuki; Oyama, Kenji; Mannen, Hideyuki; Sasazaki, Shinji

2017-03-01

Previous studies have indicated that some leptin gene polymorphisms were associated with economically important traits in cattle breeds. However, polymorphisms in the leptin gene have not been reported thus far in Japanese Black cattle. Here, we aimed to identify the leptin gene polymorphisms which are associated with carcass traits and fatty acid composition in Japanese Black cattle. We sequenced the full-length coding sequence of leptin gene for eight Japanese Black cattle. Sequence comparison revealed eight single nucleotide polymorphisms (SNPs). Three of these were predicted to cause amino acid substitutions: Y7F, R25C and A80V. Then, we genotyped these SNPs in two populations (JB1 with 560 animals and JB2 with 450 animals) and investigated the effects on the traits. Y7F in JB1 and A80V in JB2 were excluded from statistical analysis because the minor allele frequencies were low (< 0.1). Association analysis revealed that Y7F had a significant effect on the dressed carcass weight in JB2; R25C had a significant effect on C18:0 and C14:1 in JB1 and JB2, respectively; and A80V had a significant effect on C16:0, C16:1, C18:1, monounsaturated fatty acid and saturated fatty acid in JB1. The results suggested that these SNPs could be used as an effective marker for the improvement of Japanese Black cattle. © 2016 Japanese Society of Animal Science.

Polymorphisms in the estrogen receptor alpha gene (ESR1), daily cycling estrogen and mammographic density phenotypes.

PubMed

Fjeldheim, F N; Frydenberg, H; Flote, V G; McTiernan, A; Furberg, A-S; Ellison, P T; Barrett, E S; Wilsgaard, T; Jasienska, G; Ursin, G; Wist, E A; Thune, I

2016-10-07

Single nucleotide polymorphisms (SNPs) involved in the estrogen pathway and SNPs in the estrogen receptor alpha gene (ESR1 6q25) have been linked to breast cancer development, and mammographic density is an established breast cancer risk factor. Whether there is an association between daily estradiol levels, SNPs in ESR1 and premenopausal mammographic density phenotypes is unknown. We assessed estradiol in daily saliva samples throughout an entire menstrual cycle in 202 healthy premenopausal women in the Norwegian Energy Balance and Breast Cancer Aspects I study. DNA was genotyped using the Illumina Golden Gate platform. Mammograms were taken between days 7 and 12 of the menstrual cycle, and digitized mammographic density was assessed using a computer-assisted method (Madena). Multivariable regression models were used to study the association between SNPs in ESR1, premenopausal mammographic density phenotypes and daily cycling estradiol. We observed inverse linear associations between the minor alleles of eight measured SNPs (rs3020364, rs2474148, rs12154178, rs2347867, rs6927072, rs2982712, rs3020407, rs9322335) and percent mammographic density (p-values: 0.002-0.026), these associations were strongest in lean women (BMI, ≤23.6 kg/m 2. ). The odds of above-median percent mammographic density (>28.5 %) among women with major homozygous genotypes were 3-6 times higher than those of women with minor homozygous genotypes in seven SNPs. Women with rs3020364 major homozygous genotype had an OR of 6.46 for above-median percent mammographic density (OR: 6.46; 95 % Confidence Interval 1.61, 25.94) when compared to women with the minor homozygous genotype. These associations were not observed in relation to absolute mammographic density. No associations between SNPs and daily cycling estradiol were observed. However, we suggest, based on results of borderline significance (p values: 0.025-0.079) that the level of 17β-estradiol for women with the minor genotype for rs3020364, rs24744148 and rs2982712 were lower throughout the cycle in women with low (<28.5 %) percent mammographic density and higher in women with high (>28.5 %) percent mammographic density, when compared to women with the major genotype. Our results support an association between eight selected SNPs in the ESR1 gene and percent mammographic density. The results need to be confirmed in larger studies.

Efficient SNP Discovery by Combining Microarray and Lab-on-a-Chip Data for Animal Breeding and Selection

PubMed Central

Huang, Chao-Wei; Lin, Yu-Tsung; Ding, Shih-Torng; Lo, Ling-Ling; Wang, Pei-Hwa; Lin, En-Chung; Liu, Fang-Wei; Lu, Yen-Wen

2015-01-01

The genetic markers associated with economic traits have been widely explored for animal breeding. Among these markers, single-nucleotide polymorphism (SNPs) are gradually becoming a prevalent and effective evaluation tool. Since SNPs only focus on the genetic sequences of interest, it thereby reduces the evaluation time and cost. Compared to traditional approaches, SNP genotyping techniques incorporate informative genetic background, improve the breeding prediction accuracy and acquiesce breeding quality on the farm. This article therefore reviews the typical procedures of animal breeding using SNPs and the current status of related techniques. The associated SNP information and genotyping techniques, including microarray and Lab-on-a-Chip based platforms, along with their potential are highlighted. Examples in pig and poultry with different SNP loci linked to high economic trait values are given. The recommendations for utilizing SNP genotyping in nimal breeding are summarized. PMID:27600241

Genomic Selection in Dairy Cattle: The USDA Experience.

PubMed

Wiggans, George R; Cole, John B; Hubbard, Suzanne M; Sonstegard, Tad S

2017-02-08

Genomic selection has revolutionized dairy cattle breeding. Since 2000, assays have been developed to genotype large numbers of single-nucleotide polymorphisms (SNPs) at relatively low cost. The first commercial SNP genotyping chip was released with a set of 54,001 SNPs in December 2007. Over 15,000 genotypes were used to determine which SNPs should be used in genomic evaluation of US dairy cattle. Official USDA genomic evaluations were first released in January 2009 for Holsteins and Jerseys, in August 2009 for Brown Swiss, in April 2013 for Ayrshires, and in April 2016 for Guernseys. Producers have accepted genomic evaluations as accurate indications of a bull's eventual daughter-based evaluation. The integration of DNA marker technology and genomics into the traditional evaluation system has doubled the rate of genetic progress for traits of economic importance, decreased generation interval, increased selection accuracy, reduced previous costs of progeny testing, and allowed identification of recessive lethals.

Association of androgen metabolism gene polymorphisms with prostate cancer risk and androgen concentrations: Results from the Prostate Cancer Prevention Trial.

PubMed

Price, Douglas K; Chau, Cindy H; Till, Cathee; Goodman, Phyllis J; Leach, Robin J; Johnson-Pais, Teresa L; Hsing, Ann W; Hoque, Ashraful; Parnes, Howard L; Schenk, Jeannette M; Tangen, Catherine M; Thompson, Ian M; Reichardt, Juergen K V; Figg, William D

2016-08-01

Prostate cancer is highly influenced by androgens and genes. The authors investigated whether genetic polymorphisms along the androgen biosynthesis and metabolism pathways are associated with androgen concentrations or with the risk of prostate cancer or high-grade disease from finasteride treatment. A nested case-control study from the Prostate Cancer Prevention Trial using data from men who had biopsy-proven prostate cancer (cases) and a group of biopsy-negative, frequency-matched controls was conducted to investigate the association of 51 single nucleotide polymorphisms (SNPs) in 12 genes of the androgen pathway with overall (total), low-grade, and high-grade prostate cancer incidence and serum hormone concentrations. There were significant associations of genetic polymorphisms in steroid 5α-reductase 1 (SRD5A1) (reference SNPs: rs3736316, rs3822430, rs1560149, rs248797, and rs472402) and SRD5A2 (rs2300700) with the risk of high-grade prostate cancer in the placebo arm of the Prostate Cancer Prevention Trial; 2 SNPs were significantly associated with an increased risk (SRD5A1 rs472402 [odds ratio, 1.70; 95% confidence interval, 1.05-2.75; Ptrend = .03] and SRD5A2 rs2300700 [odds ratio, 1.94; 95% confidence interval, 1.19-3.18; Ptrend = .01]). Eleven SNPs in SRD5A1, SRD5A2, cytochrome P450 family 1, subfamily B, polypeptide 1 (CYP1B1), and CYP3A4 were associated with modifying the mean concentrations of serum androgen and sex hormone-binding globulin; and 2 SNPs (SRD5A1 rs824811 and CYP1B1 rs10012; Ptrend < .05) consistently and significantly altered all androgen concentrations. Several SNPs (SRD5A1 rs3822430, SRD5A2 rs2300700, CYP3A43 rs800672, and CYP19 rs700519; Ptrend < .05) were significantly associated with both circulating hormone levels and prostate cancer risk. Germline genetic variations of androgen-related pathway genes are associated with serum androgen concentrations and the risk of prostate cancer. Further studies to examine the functional consequence of novel causal variants are warranted. Cancer 2016;122:2332-2340. © 2016 American Cancer Society. © 2016 American Cancer Society.

A new single-nucleotide polymorphism database for rainbow trout generated through whole genome re-sequencing

USDA-ARS?s Scientific Manuscript database

Single-nucleotide polymorphisms (SNPs) are highly abundant markers, which are broadly distributed in animal genomes. For rainbow trout, SNP discovery has been done through sequencing of restriction-site associated DNA (RAD) libraries, reduced representation libraries (RRL), RNA sequencing, and whole...

Genome-wide high-throughput SNP discovery and genotyping for understanding natural (functional) allelic diversity and domestication patterns in wild chickpea

PubMed Central

Bajaj, Deepak; Das, Shouvik; Badoni, Saurabh; Kumar, Vinod; Singh, Mohar; Bansal, Kailash C.; Tyagi, Akhilesh K.; Parida, Swarup K.

2015-01-01

We identified 82489 high-quality genome-wide SNPs from 93 wild and cultivated Cicer accessions through integrated reference genome- and de novo-based GBS assays. High intra- and inter-specific polymorphic potential (66–85%) and broader natural allelic diversity (6–64%) detected by genome-wide SNPs among accessions signify their efficacy for monitoring introgression and transferring target trait-regulating genomic (gene) regions/allelic variants from wild to cultivated Cicer gene pools for genetic improvement. The population-specific assignment of wild Cicer accessions pertaining to the primary gene pool are more influenced by geographical origin/phenotypic characteristics than species/gene-pools of origination. The functional significance of allelic variants (non-synonymous and regulatory SNPs) scanned from transcription factors and stress-responsive genes in differentiating wild accessions (with potential known sources of yield-contributing and stress tolerance traits) from cultivated desi and kabuli accessions, fine-mapping/map-based cloning of QTLs and determination of LD patterns across wild and cultivated gene-pools are suitably elucidated. The correlation between phenotypic (agromorphological traits) and molecular diversity-based admixed domestication patterns within six structured populations of wild and cultivated accessions via genome-wide SNPs was apparent. This suggests utility of whole genome SNPs as a potential resource for identifying naturally selected trait-regulating genomic targets/functional allelic variants adaptive to diverse agroclimatic regions for genetic enhancement of cultivated gene-pools. PMID:26208313

Comprehensive Survey of Genetic Diversity in Chloroplast Genomes and 45S nrDNAs within Panax ginseng Species

PubMed Central

Kim, Kyunghee; Lee, Sang-Choon; Lee, Junki; Lee, Hyun Oh; Joh, Ho Jun; Kim, Nam-Hoon; Park, Hyun-Seung; Yang, Tae-Jin

2015-01-01

We report complete sequences of chloroplast (cp) genome and 45S nuclear ribosomal DNA (45S nrDNA) for 11 Panax ginseng cultivars. We have obtained complete sequences of cp and 45S nrDNA, the representative barcoding target sequences for cytoplasm and nuclear genome, respectively, based on low coverage NGS sequence of each cultivar. The cp genomes sizes ranged from 156,241 to 156,425 bp and the major size variation was derived from differences in copy number of tandem repeats in the ycf1 gene and in the intergenic regions of rps16-trnUUG and rpl32-trnUAG. The complete 45S nrDNA unit sequences were 11,091 bp, representing a consensus single transcriptional unit with an intergenic spacer region. Comparative analysis of these sequences as well as those previously reported for three Chinese accessions identified very rare but unique polymorphism in the cp genome within P. ginseng cultivars. There were 12 intra-species polymorphisms (six SNPs and six InDels) among 14 cultivars. We also identified five SNPs from 45S nrDNA of 11 Korean ginseng cultivars. From the 17 unique informative polymorphic sites, we developed six reliable markers for analysis of ginseng diversity and cultivar authentication. PMID:26061692

Single nucleotide polymorphisms/haplotypes associated with multiple rubella-specific immune response outcomes post-MMR immunization in healthy children.

PubMed

Ovsyannikova, Inna G; Salk, Hannah M; Larrabee, Beth R; Pankratz, V Shane; Poland, Gregory A

2015-10-01

The observed heterogeneity in rubella-specific immune response phenotypes post-MMR vaccination is thought to be explained, in part, by inter-individual genetic variation. In this study, single nucleotide polymorphisms (SNPs) and multiple haplotypes in several candidate genes were analyzed for associations with more than one rubella-specific immune response outcome, including secreted IFN-γ, secreted IL-6, and neutralizing antibody titers. Overall, we identified 23 SNPs in 10 different genes that were significantly associated with at least two rubella-specific immune responses. Of these SNPs, we detected eight in the PVRL3 gene, five in the PVRL1 gene, one in the TRIM22 gene, two in the IL10RB gene, two in the TLR4 gene, and five in other genes (PVR, ADAR, ZFP57, MX1, and BTN2A1/BTN3A3). The PVRL3 gene haplotype GACGGGGGCAGCAAAAAGAAGAGGAAAGAACAA was significantly associated with both higher IFN-γ secretion (t-statistic 4.43, p < 0.0001) and higher neutralizing antibody titers (t-statistic 3.14, p = 0.002). Our results suggest that there is evidence of multigenic associations among identified gene SNPs and that polymorphisms in these candidate genes contribute to the overall observed differences between individuals in response to live rubella virus vaccine. These results will aid our understanding of mechanisms behind rubella-specific immune response to MMR vaccine and influence the development of vaccines in the future.