Identification of new genetic polymorphisms that alter the dietary requirement for choline and vary in their distribution across ethnic and racial groups

PubMed Central

da Costa, Kerry-Ann; Corbin, Karen D.; Niculescu, Mihai D.; Galanko, Joseph A.; Zeisel, Steven H.

2014-01-01

Effect alleles (alleles with a polymorphism that is associated with the effect being measured) in a small number of single-nucleotide polymorphisms (SNPs) are known to influence the dietary requirement for choline. In this study, we examined a much larger number of SNPs (n=200) in 10 genes related to choline metabolism for associations with development of organ dysfunction (liver or muscle) when 79 humans were fed a low-choline diet. We confirmed that effect alleles in SNPs such as the C allele of PEMT rs12325817 increase the risk of developing organ dysfunction in women when they consume a diet low in choline, and we identified novel effect alleles, such as the C allele of CHKA SNP rs7928739, that alter dietary choline requirements. When fed a low-choline diet, some people presented with muscle damage rather than liver damage; several effect alleles in SLC44A1 (rs7873937, G allele; rs2771040, G; rs6479313, G; rs16924529, A; and rs3199966, C) and one in CHKB (rs1557502, A) were more common in these individuals. This suggests that pathways related to choline metabolism are more important for normal muscle function than previously thought. In European, Mexican, and Asian Americans, and in individuals of African descent, we examined the prevalence of the effect alleles in SNPs that alter choline requirement and found that they are differentially distributed among people of different ethnic and racial backgrounds. Overall, our study has identified novel genetic variants that modulate choline requirements and suggests that the dietary requirement for choline may be different across racial and ethnic groups.—Da Costa, K.-A., Corbin, K. D., Niculescu, M. D., Galanko, J. A., Zeisel, S. H. Identification of new genetic polymorphisms that alter the dietary requirement for choline and vary in their distribution across ethnic and racial groups. PMID:24671709

Toll-like receptor 2 gene polymorphisms in Chinese Holstein cattle and their associations with bovine tuberculosis.

PubMed

Zhao, Zhanqin; Xue, Yun; Hu, Zhigang; Zhou, Feng; Ma, Beibei; Long, Ta; Xue, Qiao; Liu, Huisheng

2017-04-01

This study evaluated whether there was an association between polymorphisms within the Toll-like receptor 2 gene (TLR2) of Chinese Holstein cattle and susceptibility to bovine tuberculosis (BTB). In a case-control study including 210 BTB cases and 237 control cattle, we found only two common single-nucleotide polymorphisms (SNPs) within the entire coding region of the TLR2 gene, A631G (rs95214857) and T1707C (rs1388116488). Additionally, the allele and genotype distributions of A631G and T1707C were not different between case and control groups, indicated that these SNPs were not associated with susceptibility to BTB. These results suggested that polymorphisms in the TLR2 gene might not play a significant role in the BTB risk in Chinese Holstein cattle. Copyright © 2017 Elsevier B.V. All rights reserved.

No association between polymorphisms and haplotypes of COL1A1 and COL1A2 genes and osteoporotic fracture in postmenopausal Chinese women

PubMed Central

Hu, Wei-wei; He, Jin-wei; Zhang, Hao; Wang, Chun; Gu, Jie-mei; Yue, Hua; Ke, Yao-hua; Hu, Yun-qiu; Fu, Wen-zhen; Li, Miao; Liu, Yu-juan; Zhang, Zhen-lin

2011-01-01

Aim: To study whether genetic polymorphisms of COL1A1 and COL1A2 genes affected the onset of fracture in postmenopausal Chinese women. Methods: SNPs in COL1A1 and COL1A2 genes were identified via direct sequencing in 32 unrelated postmenopausal Chinese women. Ten SNPs were genotyped in 1252 postmenopausal Chinese women. The associations were examined using both single-SNP and haplotype tests using logistic regression. Results: Twenty four (4 novel) and 28 (7 novel) SNPs were identified in COL1A1 and COL1A2 gene, respectively. The distribution frequencies of 2 SNPs in COL1A1 (rs2075554 and rs2586494) and 3 SNPs in COL1A2 (rs42517, rs1801182, and rs42524) were significantly different from those documented for the European Caucasian population. No significant difference was observed between fracture and control groups with respect to allele frequency or genotype distribution in 9 selected SNPs and haplotype. No significant association was found between fragility fracture and each SNP or haplotype. The results remained the same after additional corrections for other risk factors such as weight, height, and bone mineral density. Conclusion: Our results show no association between common genetic variations of COL1A1 and COL1A2 genes and fracture, suggesting the complex genetic background of osteoporotic fractures. PMID:21602843

Analysis of genetic polymorphisms in skeletal Class I crowding.

PubMed

Ting, Tung Yuen; Wong, Ricky Wing Kit; Rabie, A Bakr M

2011-07-01

Dental crowding is a problem for both adolescents and adults in modern society. The purpose of this research was to identify single nucleotide polymorphisms (SNPs) responsible for crowding in subjects with skeletal Class I relationships. The case subjects consisted of healthy Chinese people living in Hong Kong with skeletal Class I relationships and at least 5 mm of crowding in either arch. The control subjects met the same requirements but lacked crowding or spacing. SNP genotyping was performed on the MassARRAY platform. The chi-square test was used to compare genotype and allele type distributions between the case and the control groups. Logistic regression was used to calculate odds ratios with 95% confidence intervals, and the effects of age and sex for each SNP. Analyses of linkage disequilibrium and haplotype associations between SNPs were performed with software. Five SNPs were found to be significantly different in genotype or allele type distributions. SNP rs372024 was significantly associated with crowding (P = 0.004). Two SNPs, rs3764746 and rs3795170, on the EDA gene were found to be associated marginally. SNPs rs1005464 and rs15705 also exhibited marginal association with crowding. The effects of associated SNPs remained significant after adjustments for age and sex factors. This study suggests an association for the genes EDA and XEDAR in dental crowding in the Hong Kong Chinese population. Copyright © 2011 American Association of Orthodontists. Published by Mosby, Inc. All rights reserved.

Genotypic distribution of single nucleotide polymorphisms in oral cancer: global scene.

PubMed

Multani, Shaleen; Saranath, Dhananjaya

2016-11-01

Globocan 2012 reports the global oral cancer incidence of 300,373 new oral cancer cases annually, contributing to 2.1 % of the world cancer burden. The major well-established risk factors for oral cancer include tobacco, betel/areca nut, alcohol and high-risk oncogenic human papilloma virus (HPV) 16/18. However, only 5-10 % of individuals with high-risk lifestyle develop oral cancer. Thus, genomic variants in individuals represented as single nucleotide polymorphisms (SNPs) influence susceptibility to oral cancer. With a view to understanding the role of genomic variants in oral cancer, we reviewed SNPs in case-control studies with a minimum of 100 cases and 100 controls. PubMed and HuGE navigator search engines were used to obtain data published from 1990 to 2015, which identified 67 articles investigating the role of SNPs in oral cancer. Single publications reported 93 SNPs in 55 genes, with 34 SNPs associated with a risk of oral cancer. Meta-analysis of data in multiple studies defined nine SNPs associated with a risk of oral cancer. The genes were associated with critical functions deregulated in cancers, including cell proliferation, immune function, inflammation, transcription, DNA repair and xenobiotic metabolism.

Performance of Single Nucleotide Polymorphisms versus Haplotypes for Genome-Wide Association Analysis in Barley

PubMed Central

Jannink, Jean-Luc

2010-01-01

Genome-wide association studies (GWAS) may benefit from utilizing haplotype information for making marker-phenotype associations. Several rationales for grouping single nucleotide polymorphisms (SNPs) into haplotype blocks exist, but any advantage may depend on such factors as genetic architecture of traits, patterns of linkage disequilibrium in the study population, and marker density. The objective of this study was to explore the utility of haplotypes for GWAS in barley (Hordeum vulgare) to offer a first detailed look at this approach for identifying agronomically important genes in crops. To accomplish this, we used genotype and phenotype data from the Barley Coordinated Agricultural Project and constructed haplotypes using three different methods. Marker-trait associations were tested by the efficient mixed-model association algorithm (EMMA). When QTL were simulated using single SNPs dropped from the marker dataset, a simple sliding window performed as well or better than single SNPs or the more sophisticated methods of blocking SNPs into haplotypes. Moreover, the haplotype analyses performed better 1) when QTL were simulated as polymorphisms that arose subsequent to marker variants, and 2) in analysis of empirical heading date data. These results demonstrate that the information content of haplotypes is dependent on the particular mutational and recombinational history of the QTL and nearby markers. Analysis of the empirical data also confirmed our intuition that the distribution of QTL alleles in nature is often unlike the distribution of marker variants, and hence utilizing haplotype information could capture associations that would elude single SNPs. We recommend routine use of both single SNP and haplotype markers for GWAS to take advantage of the full information content of the genotype data. PMID:21124933

Single-nucleotide polymorphisms at the 9p21.3 genomic region not associated with the risk of cardiovascular disease in patients with rheumatoid arthritis.

PubMed

García-Bermúdez, M; López-Mejías, R; Genre, F; Castañeda, S; González-Juanatey, C; Llorca, J; Corrales, A; Miranda-Filloy, J A; Pina, T; Gómez-Vaquero, C; Rodríguez-Rodríguez, L; Fernández-Gutiérrez, B; Pascual-Salcedo, D; Balsa, A; López-Longo, F J; Carreira, P; Blanco, R; González-Álvaro, I; Martín, J; González-Gay, M A

2013-12-01

Rheumatoid arthritis (RA) is a chronic polygenic inflammatory disease associated with accelerated atherosclerosis and high risk of cardiovascular disease (CVD). In this study, we evaluated the potential association of 9p21.3 single-nucleotide polymorphisms (SNPs) - previously linked to coronary artery disease - and CVD risk in 2001 Spanish RA patients genotyped for 9p21.3 SNPs using TaqMan™ assays. Carotid intima media thickness (cIMT) and presence of carotid plaques were also analyzed. Cox regression model did not disclose significant differences between patients who experienced CVD and those who did not. Neither association was found between cIMT or carotid plaques and SNPs allele distribution. In conclusion, results do not support a role of rs10116277 or rs1537375 SNPs in CVD risk in Spanish RA patients. © 2013 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

Genetics of osteoporosis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Urano, Tomohiko; Inoue, Satoshi, E-mail: INOUE-GER@h.u-tokyo.ac.jp; Department of Anti-Aging Medicine, Graduate School of Medicine, The University of Tokyo, Tokyo 113-8655

Highlights: • Single-nucleotide polymorphisms (SNPs) associated with osteoporosis were identified. • SNPs mapped close to or within VDR and ESR1 are associated with bone mineral density. • WNT signaling pathway plays a pivotal role in regulating bone mineral density. • Genetic studies will be useful for identification of new therapeutic targets. - Abstract: Osteoporosis is a skeletal disease characterized by low bone mineral density (BMD) and microarchitectural deterioration of bone tissue, which increases susceptibility to fractures. BMD is a complex quantitative trait with normal distribution and seems to be genetically controlled (in 50–90% of the cases), according to studies onmore » twins and families. Over the last 20 years, candidate gene approach and genome-wide association studies (GWAS) have identified single-nucleotide polymorphisms (SNPs) that are associated with low BMD, osteoporosis, and osteoporotic fractures. These SNPs have been mapped close to or within genes including those encoding nuclear receptors and WNT-β-catenin signaling proteins. Understanding the genetics of osteoporosis will help identify novel candidates for diagnostic and therapeutic targets.« less

Homozygosity of single nucleotide polymorphisms in the 3' region of the canine estrogen receptor 1 gene is greater in Toy Poodles than in Miniature Dachshunds and Chihuahuas.

PubMed

Pathirana, Indunil N; Tanaka, Kakeru; Kawate, Noritoshi; Tsuji, Makoto; Hatoya, Shingo; Inaba, Toshio; Tamada, Hiromichi

2011-06-01

Differences in the distribution of single nucleotide polymorphisms (SNPs) and haplotypes in the estrogen receptor α gene (ESR1) were examined in Miniature Dachshunds (n = 48), Chihuahuas (n = 20) and Toy Poodles (n = 18). Five DNA fragments located in the 40-kb region at the 3' end of ESR1 were amplified by polymerase chain reaction and were directly sequenced. We compared allele, genotype and estimated haplotype frequencies at each SNP in the 3' end of ESR1 for these three breeds of small dog. The frequency of the major allele and the genotype frequency of the major allele homozygotes, were significantly higher in Toy Poodles for five SNPs (SNP #5, #14-17) than in Miniature Dachshunds, and significantly higher in Toy Poodles than Chihuahuas for three SNPs (SNP #15-17). A common haplotype block was identified in an approximately 20-kb region encompassing four SNPs (SNPs # 14-17). The frequencies of the most abundant estimated haplotype (GTTG) and GTTG homozygotes were significantly higher in Toy Poodles than in the other two breeds. These results imply that homozygosity for the allele, genotype and haplotype distribution within the block at the 3' end of ESR1 is greater in Toy Poodles than in Miniature Dachshunds and Chihuahuas. © 2011 The Authors; Animal Science Journal © 2011 Japanese Society of Animal Science.

Identification and Evaluation of Single-Nucleotide Polymorphisms in Allotetraploid Peanut (Arachis hypogaea L.) Based on Amplicon Sequencing Combined with High Resolution Melting (HRM) Analysis.

PubMed

Hong, Yanbin; Pandey, Manish K; Liu, Ying; Chen, Xiaoping; Liu, Hong; Varshney, Rajeev K; Liang, Xuanqiang; Huang, Shangzhi

2015-01-01

The cultivated peanut (Arachis hypogaea L.) is an allotetraploid (AABB) species derived from the A-genome (Arachis duranensis) and B-genome (Arachis ipaensis) progenitors. Presence of two versions of a DNA sequence based on the two progenitor genomes poses a serious technical and analytical problem during single nucleotide polymorphism (SNP) marker identification and analysis. In this context, we have analyzed 200 amplicons derived from expressed sequence tags (ESTs) and genome survey sequences (GSS) to identify SNPs in a panel of genotypes consisting of 12 cultivated peanut varieties and two diploid progenitors representing the ancestral genomes. A total of 18 EST-SNPs and 44 genomic-SNPs were identified in 12 peanut varieties by aligning the sequence of A. hypogaea with diploid progenitors. The average frequency of sequence polymorphism was higher for genomic-SNPs than the EST-SNPs with one genomic-SNP every 1011 bp as compared to one EST-SNP every 2557 bp. In order to estimate the potential and further applicability of these identified SNPs, 96 peanut varieties were genotyped using high resolution melting (HRM) method. Polymorphism information content (PIC) values for EST-SNPs ranged between 0.021 and 0.413 with a mean of 0.172 in the set of peanut varieties, while genomic-SNPs ranged between 0.080 and 0.478 with a mean of 0.249. Total 33 SNPs were used for polymorphism detection among the parents and 10 selected lines from mapping population Y13Zh (Zhenzhuhei × Yueyou13). Of the total 33 SNPs, nine SNPs showed polymorphism in the mapping population Y13Zh, and seven SNPs were successfully mapped into five linkage groups. Our results showed that SNPs can be identified in allotetraploid peanut with high accuracy through amplicon sequencing and HRM assay. The identified SNPs were very informative and can be used for different genetic and breeding applications in peanut.

Genetic analysis of interleukin 18 gene polymorphisms in alopecia areata.

PubMed

Celik, Sumeyya Deniz; Ates, Omer

2018-06-01

Alopecia areata (AA), which appears as nonscarring hair shedding on any hair-bearing area, is a common organ-specific autoimmune condition. Cytokines have important roles in the development of AA. Interleukin (IL) 18 is a significant proinflammatory cytokine that was found higher in the patients with AA. We aimed to investigate whether the IL-18 (rs187238 and rs1946518) single nucleotide polymorphisms (SNPs) may be associated with AA and/or clinical outcome of patients with AA in Turkish population. Genotyping of rs187238 and rs1946518 SNPs were detected using sequence-specific primer-polymerase chain reaction (SSP-PCR) method in 200 patients with AA and 200 control subjects. The genotype distribution of rs1946518 (-607C>A) SNP was found to be statistically significantly different among patients with AA and controls (P = .0008). Distribution of CC+CA genotypes and frequency of -607/allele C of rs1946518 SNP were higher in patients with AA (P = .001, P = .001, respectively). The genotype distribution of rs187238 (-137G>C) SNP was found to be statistically significantly different among patients with AA and control subjects (P = .0014). Distribution of GG genotype and frequency of -137/allele G of rs187238 SNP were higher in patients with AA (P = .0003, P = .001, respectively). The rs1946518 (-607C>A) and rs187238 (-137G>C) polymorphisms were found associated with alopecia areata disease. The study suggests that IL-18 rs187238 and rs1946518 SNPs may be the cause of the AA susceptibility. © 2018 Wiley Periodicals, Inc.

Lack of association between ESR1 gene polymorphisms and premature ovarian failure in Serbian women.

PubMed

Li, J; Vujovic, S; Dalgleish, R; Thompson, J; Dragojevic-Dikic, S; Al-Azzawi, F

2014-06-01

It has previously been reported that estrogen receptor-alpha (ERα) gene (ESR1: estrogen receptor 1) polymorphisms are associated with premature ovarian failure (POF). The aim of this study was to investigate whether these genetic polymorphisms of ESR1 are associated with POF in Serbian women. A series of 197 POF cases matched with 547 fertile controls was recruited by the Institute for Endocrinology, Diabetes and Metabolic Disorders of Serbia between 2007 and 2010. Genomic DNA was extracted from saliva using Oragene® DNA sample collection kits. Two single-nucleotide polymorphisms (SNPs), PvuII and XbaI, in ESR1 were genotyped by dynamic allele-specific hybridization. Haplotype analyses were performed with the restriction fragment length polymorphism method. SNP and haplotype effects were analyzed by logistic regression models. No significant difference was found in the distribution of ESR1 PvuII and XbaI polymorphisms or haplotypes between the POF and control groups. The two ESR1 SNPs, PvuII and XbaI, are not commonly associated with POF in Serbian women and may not contribute to the genetic basis of the condition.

Association Study of Klotho Gene Polymorphism With Calcium Oxalate Stones in The Uyghur Population of Xinjiang, China.

PubMed

Ali, Abdusamat; Tursun, Halmurat; Talat, Alim; Abla, Akpar; Muhtar, Erpan; Zhang, Tao; Mahmut, Murat

2017-01-18

The aim of the present study was to investigate the correlation between Klotho gene polymorphisms andcalcium oxalate stones in Xinjiang Uyghur people. We compared 128 patients with calcium oxalate stones (case group) and 94 healthypeople (control group), detected the genotype and allele distributions of single-nucleotide polymorphisms (SNPs)of the Klotho gene (rs3752472, rs650439, and rs1207568) by reverse transcription polymerase chain reaction. The distributions of the genotype and allele frequencies of the SNPs were consistent with the Hardy-Weinberg equilibrium in the two groups. There were statistically significant differences between the genotype andallele distributions of rs3752472 between the case and control groups; the allele frequencies in the case/controlgroups were C = 240 (93.7%)/151 (80.3%) and T = 16 (6.3%)/37 (19.7%). There was no statistically significantdifference in the genotype distribution of rs650439 between the case and control groups, but there was a differencein the allele distribution; the allele frequencies in the case/control groups were A = 202 (78.9%)/143 (57.2%) andT = 54 (21.1%)/107 (42.8%). There were no statistically significant differences in genotype and allele distributionsbetween the case and control groups of rs1207568; the allele frequencies in the case/control groups were C = 194(71.3%)/145 (77.1%) and T = 78 (28.7%)/43 (22.9%). In rs3752472, the risk for patients with the C and A allelesincreased by 3.675 and 2.799 times, respectively. The rs3752472 and rs650439 SNPs are related to the risk of calcium oxalate stones in Xinjiang Uyghurpeople, and might be one of the risk factors.

Lack of association between autonomously functioning thyroid nodules and germline polymorphisms of the thyrotropin receptor and Gαs genes in a mild to moderate iodine-deficient Caucasian population.

PubMed

Vicchio, Teresa Manuela; Giovinazzo, Salvatore; Certo, Rosaria; Cucinotta, Mariapaola; Micali, Carmelo; Baldari, Sergio; Benvenga, Salvatore; Trimarchi, Francesco; Campennì, Alfredo; Ruggeri, Rosaria Maddalena

2014-07-01

Mutations of the thyrotropin receptor (TSHR) and/or Gαs gene have been found in a number of, but not all, autonomously functioning thyroid nodules (AFTNs). Recently, in a 15-year-old girl with a hyperfunctioning papillary thyroid carcinoma, we found two somatic and germline single nucleotide polymorphisms (SNPs): a SNP of the TSHR gene (exon 7, codon 187) and a SNP of Gαs gene (exon 8, codon 185). The same silent SNP of the TSHR gene had been reported in patients with AFTN or familial non-autoimmune hyperthyroidism. No further data about the prevalence of the two SNPs in AFTNs as well as in the general population are available in the literature. To clarify the possible role of these SNPs in predisposing to AFTN. Germline DNA was extracted from blood leukocytes of 115 patients with AFTNs (43 males and 72 females, aged 31-85 years, mean ± SD = 64 ± 13) and 100 sex-matched healthy individuals from the same geographic area, which is marginally iodine deficient. The genotype distribution of the two SNPs was investigated by restriction fragment length polymorphism-polymerase chain reaction. The prevalence of the two SNPs in our study population was low and not different to that found in healthy individuals: 8 % of patients vs. 9 % of controls were heterozygous for the TSHR SNP and 4 % patients vs. 6 % controls were heterozygous for the Gαs SNP. One patient harbored both SNPs. These results suggest that these two SNPs do not confer susceptibility for the development of AFTN.

Analysis of single nucleotide polymorphisms in the 3' region of the estrogen receptor 1 gene in normal and cryptorchid Miniature Dachshunds and Chihuahuas.

PubMed

Pathirana, Indunil Nishantha; Tanaka, Kakeru; Kawate, Noritoshi; Tsuji, Makoto; Kida, Kayoko; Hatoya, Shingo; Inaba, Toshio; Tamada, Hiromichi

2010-08-01

This study was performed to examine the distribution of single nucleotide polymorphisms (SNPs) and estimated haplotypes in the canine estrogen receptor (ER) alpha gene (ESR1) and the association of them with different phenotypes of cryptorchidism (CO) in Miniature Dachshunds and Chihuahuas. Forty CO and 68 normal dogs were used, and CO was classified into unilateral (UCO; n=33) and bilateral CO (BCO; n=5) or into abdominal (ACO; n=16) and inguinal CO (ICO; n=22). Thirteen DNA fragments located in the 70-kb region at the 3' end of ESR1 were amplified by PCR and sequenced to examine 13 SNPs (#1-#13) reported in a canine SNP database. Ten SNPs (#1-#4, #7, #8, #10-#13) were not polymorphic, and 5 new SNPs (#14-#18) were discovered. A common haplotype block in normal, CO and CO phenotypes was identified for an approximately 20-kb region encompassing 4 SNPs (#14-#17). Allele, genotype and haplotype frequencies in CO without classification by phenotype and also in UCO, ACO and ICO phenotypes were not statistically different from the normal group. Significant differences in genotype frequencies and homozygosity for the estimated GTTG haplotype within the block were observed in BCO compared with the normal group, although the number of BCO animals was small. Our results demonstrate that the examined SNPs and haplotypes in the 3' end of canine ESR1 are not associated with unilateral, abdominal and inguinal CO phenotypes and CO per se in Miniature Dachshunds and Chihuahuas. Further studies are necessary to suggest a clear association between the ESR1 SNPs and bilateral CO in dogs.

Development of genetic markers in abalone through construction of a SNP database.

PubMed

Kang, J-H; Appleyard, S A; Elliott, N G; Jee, Y-J; Lee, J B; Kang, S W; Baek, M K; Han, Y S; Choi, T-J; Lee, Y S

2011-06-01

In the absence of a reference genome, single-nucleotide polymorphisms (SNP) discovery in a group of abalone species was undertaken by random sequence assembly. A web-based interface was constructed, and 11 932 DNA sequences from the genus Haliotis were assembled, with 1321 contigs built. Of these, 118 contigs that consisted of at least ten annotation groups were selected. The 1577 putative SNPs were identified from the 118 contigs, with SNPs in several HSP70 gene contigs confirmed by PCR amplification of an 809-bp DNA fragment. SNPs in the HSP70 gene were compared across eight abalone species. A total of 129 polymorphic sites, including heterozygote sites within and among species, were observed. Phylogenetic analysis of the partial HSP70 gene region showed separation of the tested abalone into two groups, one reflecting the southern hemisphere species and the other the northern hemisphere species. Interestingly, Haliotis iris from New Zealand showed a closer relationship to species distributed in the northern Pacific region. Although HSP genes are known to be highly conserved among taxa, the validation of polymorphic SNPs from HSP70 in this mollusc demonstrates the applicability of cross-species SNP markers in abalone and the first step towards universal nuclear markers in Haliotis. © 2010 NFRDI, Animal Genetics © 2010 Stichting International Foundation for Animal Genetics.

A Multi-Trait, Meta-analysis for Detecting Pleiotropic Polymorphisms for Stature, Fatness and Reproduction in Beef Cattle

PubMed Central

Bolormaa, Sunduimijid; Pryce, Jennie E.; Reverter, Antonio; Zhang, Yuandan; Barendse, William; Kemper, Kathryn; Tier, Bruce; Savin, Keith; Hayes, Ben J.; Goddard, Michael E.

2014-01-01

Polymorphisms that affect complex traits or quantitative trait loci (QTL) often affect multiple traits. We describe two novel methods (1) for finding single nucleotide polymorphisms (SNPs) significantly associated with one or more traits using a multi-trait, meta-analysis, and (2) for distinguishing between a single pleiotropic QTL and multiple linked QTL. The meta-analysis uses the effect of each SNP on each of n traits, estimated in single trait genome wide association studies (GWAS). These effects are expressed as a vector of signed t-values (t) and the error covariance matrix of these t values is approximated by the correlation matrix of t-values among the traits calculated across the SNP (V). Consequently, t'V−1t is approximately distributed as a chi-squared with n degrees of freedom. An attractive feature of the meta-analysis is that it uses estimated effects of SNPs from single trait GWAS, so it can be applied to published data where individual records are not available. We demonstrate that the multi-trait method can be used to increase the power (numbers of SNPs validated in an independent population) of GWAS in a beef cattle data set including 10,191 animals genotyped for 729,068 SNPs with 32 traits recorded, including growth and reproduction traits. We can distinguish between a single pleiotropic QTL and multiple linked QTL because multiple SNPs tagging the same QTL show the same pattern of effects across traits. We confirm this finding by demonstrating that when one SNP is included in the statistical model the other SNPs have a non-significant effect. In the beef cattle data set, cluster analysis yielded four groups of QTL with similar patterns of effects across traits within a group. A linear index was used to validate SNPs having effects on multiple traits and to identify additional SNPs belonging to these four groups. PMID:24675618

Association between Ghrelin gene (GHRL) polymorphisms and clinical response to atypical antipsychotic drugs in Han Chinese schizophrenia patients

PubMed Central

2012-01-01

Background Ghrelin (GHRL) is a pivotal peptide regulator of food intake, energy balance, and body mass. Weight gain (WG) is a common side effect of the atypical antipsychotics (AAPs) used to treat schizophrenia (SZ). Ghrelin polymorphisms have been associated with pathogenic variations in plasma lipid concentrations, blood pressure, plasma glucose, and body mass index (BMI). However, it is unclear whether GHRL polymorphisms are associated with WG due to AAPs. Furthermore, there is no evidence of an association between GHRL polymorphisms and SZ or the therapeutic response to AAPs. We explored these potential associations by genotyping GHRL alleles in SZ patients and controls. We also examined the relation between these SNPs and changes in metabolic indices during AAP treatment in SZ subgroups distinguished by high or low therapeutic response. Methods Four SNPs (Leu72Met, -501A/C, -604 G/A, and -1062 G > C) were genotyped in 634 schizophrenia patients and 606 control subjects. Results There were no significant differences in allele frequencies, genotype distributions, or the distributions of two SNP haplotypes between SZ patients and healthy controls (P > 0.05). There was also no significant difference in symptom reduction between genotypes after 8 weeks of AAP treatment as measured by positive and negative symptom scale scores (PANSS). However, the -604 G/A polymorphism was associated with a greater BMI increase in response to AAP administration in both APP responders and non-responders as distinguished by PANSS score reduction (P < 0.001). There were also significant differences in WG when the responder group was further subdivided according to the specific AAP prescribed (P < 0.05). Conclusions These four GHRL gene SNPs were not associated with SZ in this Chinese Han population. The -604 G/A polymorphism was associated with significant BW and BMI increases during AAP treatment. Patients exhibiting higher WG showed greater improvements in positive and negative symptoms than patients exhibiting lower weight gain or weight loss. PMID:22369141

Association between ghrelin gene (GHRL) polymorphisms and clinical response to atypical antipsychotic drugs in Han Chinese schizophrenia patients.

PubMed

Yang, Yongfeng; Li, Wenqiang; Zhao, Jingyuan; Zhang, Hongxing; Song, Xueqin; Xiao, Bo; Yang, Ge; Jiang, Chengdi; Zhang, Dai; Yue, Weihua; Lv, Luxian

2012-02-28

Ghrelin (GHRL) is a pivotal peptide regulator of food intake, energy balance, and body mass. Weight gain (WG) is a common side effect of the atypical antipsychotics (AAPs) used to treat schizophrenia (SZ). Ghrelin polymorphisms have been associated with pathogenic variations in plasma lipid concentrations, blood pressure, plasma glucose, and body mass index (BMI). However, it is unclear whether GHRL polymorphisms are associated with WG due to AAPs. Furthermore, there is no evidence of an association between GHRL polymorphisms and SZ or the therapeutic response to AAPs. We explored these potential associations by genotyping GHRL alleles in SZ patients and controls. We also examined the relation between these SNPs and changes in metabolic indices during AAP treatment in SZ subgroups distinguished by high or low therapeutic response. Four SNPs (Leu72Met, -501A/C, -604 G/A, and -1062 G > C) were genotyped in 634 schizophrenia patients and 606 control subjects. There were no significant differences in allele frequencies, genotype distributions, or the distributions of two SNP haplotypes between SZ patients and healthy controls (P > 0.05). There was also no significant difference in symptom reduction between genotypes after 8 weeks of AAP treatment as measured by positive and negative symptom scale scores (PANSS). However, the -604 G/A polymorphism was associated with a greater BMI increase in response to AAP administration in both APP responders and non-responders as distinguished by PANSS score reduction (P < 0.001). There were also significant differences in WG when the responder group was further subdivided according to the specific AAP prescribed (P < 0.05). These four GHRL gene SNPs were not associated with SZ in this Chinese Han population. The -604 G/A polymorphism was associated with significant BW and BMI increases during AAP treatment. Patients exhibiting higher WG showed greater improvements in positive and negative symptoms than patients exhibiting lower weight gain or weight loss.

SNP discovery in common bean by restriction-associated DNA (RAD) sequencing for genetic diversity and population structure analysis.

PubMed

Valdisser, Paula Arielle M R; Pappas, Georgios J; de Menezes, Ivandilson P P; Müller, Bárbara S F; Pereira, Wendell J; Narciso, Marcelo G; Brondani, Claudio; Souza, Thiago L P O; Borba, Tereza C O; Vianello, Rosana P

2016-06-01

Researchers have made great advances into the development and application of genomic approaches for common beans, creating opportunities to driving more real and applicable strategies for sustainable management of the genetic resource towards plant breeding. This work provides useful polymorphic single-nucleotide polymorphisms (SNPs) for high-throughput common bean genotyping developed by RAD (restriction site-associated DNA) sequencing. The RAD tags were generated from DNA pooled from 12 common bean genotypes, including breeding lines of different gene pools and market classes. The aligned sequences identified 23,748 putative RAD-SNPs, of which 3357 were adequate for genotyping; 1032 RAD-SNPs with the highest ADT (assay design tool) score are presented in this article. The RAD-SNPs were structurally annotated in different coding (47.00 %) and non-coding (53.00 %) sequence components of genes. A subset of 384 RAD-SNPs with broad genome distribution was used to genotype a diverse panel of 95 common bean germplasms and revealed a successful amplification rate of 96.6 %, showing 73 % of polymorphic SNPs within the Andean group and 83 % in the Mesoamerican group. A slightly increased He (0.161, n = 21) value was estimated for the Andean gene pool, compared to the Mesoamerican group (0.156, n = 74). For the linkage disequilibrium (LD) analysis, from a group of 580 SNPs (289 RAD-SNPs and 291 BARC-SNPs) genotyped for the same set of genotypes, 70.2 % were in LD, decreasing to 0.10 %in the Andean group and 0.77 % in the Mesoamerican group. Haplotype patterns spanning 310 Mb of the genome (60 %) were characterized in samples from different origins. However, the haplotype frameworks were under-represented for the Andean (7.85 %) and Mesoamerican (5.55 %) gene pools separately. In conclusion, RAD sequencing allowed the discovery of hundreds of useful SNPs for broad genetic analysis of common bean germplasm. From now, this approach provides an excellent panel of molecular tools for whole genome analysis, allowing integrating and better exploring the common bean breeding practices.

Frequency and Distribution of Single-Nucleotide Polymorphisms within mprF in Methicillin-Resistant Staphylococcus aureus Clinical Isolates and Their Role in Cross-Resistance to Daptomycin and Host Defense Antimicrobial Peptides.

PubMed

Bayer, Arnold S; Mishra, Nagendra N; Chen, Liang; Kreiswirth, Barry N; Rubio, Aileen; Yang, Soo-Jin

2015-08-01

MprF is responsible for the lysinylation of phosphatidylglycerol (PG) to synthesize the positively charged phospholipid (PL) species, lysyl-PG (L-PG). It has been proposed that the single-nucleotide polymorphisms (SNPs) within the mprF open reading frame (ORF) are associated with a gain-in-function phenotype in terms of daptomycin resistance in Staphylococcus aureus. (Note that although the official term is daptomycin nonsusceptibility, we use the term daptomycin resistance in this paper for ease of presentation.) Using 22 daptomycin-susceptible (DAP(s))/daptomycin-resistant (DAP(r)) clinical methicillin-resistant S. aureus (MRSA) strain pairs, we assessed (i) the frequencies and distribution of putative mprF gain-in-function SNPs, (ii) the relationships of the SNPs to both daptomycin resistance and cross-resistance to the prototypical endovascular host defense peptide (HDP) thrombin-induced platelet microbicidal protein (tPMP), and (iii) the impact of mprF SNPs on positive surface charge phenotype and modifications of membrane PL profiles. Most of the mprF SNPs identified in our DAP(r) strains were clustered within the two MprF loci, (i) the central bifunctional domain and (ii) the C-terminal synthase domain. Moreover, we were able to correlate the presence and location of mprF SNPs in DAP(r) strains with HDP cross-resistance, positive surface charge, and L-PG profiles. Although DAP(r) strains with mprF SNPs in the bifunctional domain showed higher resistance to tPMPs than DAP(r) strains with SNPs in the synthase domain, this relationship was not observed in positive surface charge assays. These results demonstrated that both charge-mediated and -unrelated mechanisms are involved in DAP resistance and HDP cross-resistance in S. aureus. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

Frequency distribution of polymorphisms of CYP2C19, CYP2C9, VKORC1 and SLCO1B1 genes in the Yakut population.

PubMed

Vasilyev, Filipp Filippovich; Danilova, Diana Aleksandrovna; Kaimonov, Vladimir Sergeevich; Chertovskih, Yana Valerievna; Maksimova, Nadezda Romanovna

2016-01-01

Allele frequencies of single nucleotide polymorphisms (SNPs) are variable among different populations; therefore the study of SNPs in ethnic groups is important for establishing the clinical significance of the screening of these polymorphisms. The main goal of the research is to study the polymorphisms of CYP2C9, CYP2C19, VKORC1, and SLCO1B1 in Yakuts. Genomic DNA from 229 Yakut subjects were analyzed by real-time polymerase chain reaction (PCR) (SLCO1B1 +521T > C, VKORC1 -1639G>A, CYP2C19 +681G>A, +636G>A, CYP2C9 +430С>T, +1075A>C). Genotype frequencies of polymorphisms in the population of the Yakuts were more characteristic of the Asian population. The results have been included in the software application "Lekgen" that we developed for the interpretation of pharmacogenetic testing. The data of our study obtained on frequency carriers of polymorphisms of genes SLCO1B1, CYP2C19, CYP2C9, VKORC1 among the Yakuts may be useful in developing recommendations for a personalized therapy.

Frequency distribution of polymorphisms of CYP2C19, CYP2C9, VKORC1 and SLCO1B1 genes in the Yakut population

PubMed Central

Vasilyev, Filipp Filippovich; Danilova, Diana Aleksandrovna; Kaimonov, Vladimir Sergeevich; Chertovskih, Yana Valerievna; Maksimova, Nadezda Romanovna

2016-01-01

Allele frequencies of single nucleotide polymorphisms (SNPs) are variable among different populations; therefore the study of SNPs in ethnic groups is important for establishing the clinical significance of the screening of these polymorphisms. The main goal of the research is to study the polymorphisms of CYP2C9, CYP2C19, VKORC1, and SLCO1B1 in Yakuts. Genomic DNA from 229 Yakut subjects were analyzed by real-time polymerase chain reaction (PCR) (SLCO1B1 +521T > C, VKORC1 -1639G>A, CYP2C19 +681G>A, +636G>A, CYP2C9 +430С>T, +1075A>C). Genotype frequencies of polymorphisms in the population of the Yakuts were more characteristic of the Asian population. The results have been included in the software application “Lekgen” that we developed for the interpretation of pharmacogenetic testing. The data of our study obtained on frequency carriers of polymorphisms of genes SLCO1B1, CYP2C19, CYP2C9, VKORC1 among the Yakuts may be useful in developing recommendations for a personalized therapy. PMID:27499796

Inverse correlation between HPSE gene single nucleotide polymorphisms and heparanase expression: possibility of multiple levels of heparanase regulation

PubMed Central

Ostrovsky, Olga; Korostishevsky, Michael; Shafat, Itay; Mayorov, Margarita; Ilan, Neta; Vlodavsky, Israel; Nagler, Arnon

2009-01-01

Heparanase is an endo-β-glucuronidase that specifically cleaves the saccharide chains of heparan sulfate proteoglycans. Heparanase plays important roles in processes such as angiogenesis, tumor metastasis, tissue repair and remodeling, inflammation and autoimmunity. Genetic variations of the heparanase gene (HPSE) have been associated with heparanase transcription level. The present study was undertaken to identify haplotype or single nucleotide polymorphisms (SNPs) genotype combinations that correlate with heparanase expression both at the mRNA and protein levels. For this purpose, 11 HPSE gene SNPs were genotyped among 108 healthy individuals. Five out of the eleven polymorphisms revealed an association between the SNPs and heparanase expression. SNP rs4693608 exhibited a strong evidence of association. Analysis of haplotypes distribution revealed that the combination of two SNPs (rs4693608 and rs4364254) disclosed the most significant result. This approach allowed segregation of possible genotype combinations to three groups that correlate with low (LR: GG-CC, GG-CT, GG-TT, GA-CC), intermediate (MR: GA-CT, GA-TT) and high (HR: AA-TT, AA-CT) heparanase expression. Unexpectedly, LR genotype combinations were associated with low mRNA expressions level and high heparanase concentration in plasma, while HR genotype combinations were associated with high expression of mRNA and low plasma protein level. Because the main site of activity of secreted active heparanase is the extracellular matrix and cell surface, the origin and functional significance of plasma heparanase remain to be investigated. The current study indicates that rs4693608 and rs4364254 SNPs are involved in the regulation of heparanase expression and provides the basis for further studies on the association between HPSE gene SNPs and disease outcome. PMID:19406828

Genome-Wide Divergence and Linkage Disequilibrium Analyses for Capsicum baccatum Revealed by Genome-Anchored Single Nucleotide Polymorphisms

PubMed Central

Nimmakayala, Padma; Abburi, Venkata L.; Saminathan, Thangasamy; Almeida, Aldo; Davenport, Brittany; Davidson, Joshua; Reddy, C. V. Chandra Mohan; Hankins, Gerald; Ebert, Andreas; Choi, Doil; Stommel, John; Reddy, Umesh K.

2016-01-01

Principal component analysis (PCA) with 36,621 polymorphic genome-anchored single nucleotide polymorphisms (SNPs) identified collectively for Capsicum annuum and Capsicum baccatum was used to characterize population structure and species domestication of these two important incompatible cultivated pepper species. Estimated mean nucleotide diversity (π) and Tajima's D across various chromosomes revealed biased distribution toward negative values on all chromosomes (except for chromosome 4) in cultivated C. baccatum, indicating a population bottleneck during domestication of C. baccatum. In contrast, C. annuum chromosomes showed positive π and Tajima's D on all chromosomes except chromosome 8, which may be because of domestication at multiple sites contributing to wider genetic diversity. For C. baccatum, 13,129 SNPs were available, with minor allele frequency (MAF) ≥0.05; PCA of the SNPs revealed 283 C. baccatum accessions grouped into 3 distinct clusters, for strong population structure. The fixation index (FST) between domesticated C. annuum and C. baccatum was 0.78, which indicates genome-wide divergence. We conducted extensive linkage disequilibrium (LD) analysis of C. baccatum var. pendulum cultivars on all adjacent SNP pairs within a chromosome to identify regions of high and low LD interspersed with a genome-wide average LD block size of 99.1 kb. We characterized 1742 haplotypes containing 4420 SNPs (range 9–2 SNPs per haplotype). Genome-wide association study (GWAS) of peduncle length, a trait that differentiates wild and domesticated C. baccatum types, revealed 36 significantly associated genome-wide SNPs. Population structure, identity by state (IBS) and LD patterns across the genome will be of potential use for future GWAS of economically important traits in C. baccatum peppers. PMID:27857720

Genome-Wide Divergence and Linkage Disequilibrium Analyses for Capsicum baccatum Revealed by Genome-Anchored Single Nucleotide Polymorphisms.

PubMed

Nimmakayala, Padma; Abburi, Venkata L; Saminathan, Thangasamy; Almeida, Aldo; Davenport, Brittany; Davidson, Joshua; Reddy, C V Chandra Mohan; Hankins, Gerald; Ebert, Andreas; Choi, Doil; Stommel, John; Reddy, Umesh K

2016-01-01

Principal component analysis (PCA) with 36,621 polymorphic genome-anchored single nucleotide polymorphisms (SNPs) identified collectively for Capsicum annuum and Capsicum baccatum was used to characterize population structure and species domestication of these two important incompatible cultivated pepper species. Estimated mean nucleotide diversity (π) and Tajima's D across various chromosomes revealed biased distribution toward negative values on all chromosomes (except for chromosome 4) in cultivated C. baccatum , indicating a population bottleneck during domestication of C. baccatum . In contrast, C. annuum chromosomes showed positive π and Tajima's D on all chromosomes except chromosome 8, which may be because of domestication at multiple sites contributing to wider genetic diversity. For C. baccatum , 13,129 SNPs were available, with minor allele frequency (MAF) ≥0.05; PCA of the SNPs revealed 283 C. baccatum accessions grouped into 3 distinct clusters, for strong population structure. The fixation index ( F ST ) between domesticated C. annuum and C. baccatum was 0.78, which indicates genome-wide divergence. We conducted extensive linkage disequilibrium (LD) analysis of C. baccatum var. pendulum cultivars on all adjacent SNP pairs within a chromosome to identify regions of high and low LD interspersed with a genome-wide average LD block size of 99.1 kb. We characterized 1742 haplotypes containing 4420 SNPs (range 9-2 SNPs per haplotype). Genome-wide association study (GWAS) of peduncle length, a trait that differentiates wild and domesticated C. baccatum types, revealed 36 significantly associated genome-wide SNPs. Population structure, identity by state (IBS) and LD patterns across the genome will be of potential use for future GWAS of economically important traits in C. baccatum peppers.

Evaluation and identification of damaged single nucleotide polymorphisms in COL1A1 gene involved in osteoporosis

PubMed Central

Alsaif, Mohammed A.; Al Shammari, Sulaiman A.; Alhamdan, Adel A.

2012-01-01

Introduction Single-nucleotide polymorphisms (SNPs) are biomarkers for exploring the genetic basis of many complex human diseases. The prediction of SNPs is promising in modern genetic analysis but it is still a great challenge to identify the functional SNPs in a disease-related gene. The computational approach has overcome this challenge and an increase in the successful rate of genetic association studies and reduced cost of genotyping have been achieved. The objective of this study is to identify deleterious non-synonymous SNPs (nsSNPs) associated with the COL1A1 gene. Material and methods The SNPs were retrieved from the Single Nucleotide Polymorphism Database (dbSNP). Using I-Mutant, protein stability change was calculated. The potentially functional nsSNPs and their effect on proteins were predicted by PolyPhen and SIFT respectively. FASTSNP was used for estimation of risk score. Results Our analysis revealed 247 SNPs as non-synonymous, out of which 5 nsSNPs were found to be least stable by I-Mutant 2.0 with a DDG value of > –1.0. Four nsSNPs, namely rs17853657, rs17857117, rs57377812 and rs1059454, showed a highly deleterious tolerance index score of 0.00 with a change in their physicochemical properties by the SIFT server. Seven nsSNPs, namely rs1059454, rs8179178, rs17853657, rs17857117, rs72656340, rs72656344 and rs72656351, were found to be probably damaging with a PSIC score difference between 2.0 and 3.5 by the PolyPhen server. Three nsSNPs, namely rs1059454, rs17853657 and rs17857117, were found to be highly polymorphic with a risk score of 3-4 with a possible effect of non-conservative change and splicing regulation by FASTSNP. Conclusions Three nsSNPs, namely rs1059454, rs17853657 and rs17857117, are potential functional polymorphisms that are likely to have a functional impact on the COL1A1 gene. PMID:24273577

Single-nucleotide polymorphisms and mRNA expression for melatonin synthesis rate-limiting enzyme in recurrent depressive disorder.

PubMed

Gałecki, Piotr; Szemraj, Janusz; Bartosz, Grzegorz; Bieńkiewicz, Małgorzata; Gałecka, Elzbieta; Florkowski, Antoni; Lewiński, Andrzej; Karbownik-Lewińska, Małgorzata

2010-05-01

Depressive disorder (DD) is characterised by disturbances in blood melatonin concentration. It is well known that melatonin is involved in the control of circadian rhythms, sleep included. The use of melatonin and its analogues has been found to be effective in depression therapy. Melatonin synthesis is a multistage process, where the last stage is catalysed by acetylserotonin methyltransferase (ASMT), the reported rate-limiting melatonin synthesis enzyme. Taking into account the significance of genetic factors in depression development, the gene for ASMT may become an interesting focus for studies in patients with recurrent DD. The goal of the study was to evaluate two single-nucleotide polymorphisms (SNPs) (rs4446909; rs5989681) of the ASMT gene, as well as mRNA expression for ASMT in recurrent DD-affected patients. We genotyped two polymorphisms in a group of 181 recurrent DD patients and in 149 control subjects. The study was performed using the polymerase chain reaction/restriction fragment length polymorphism method. The distribution of genotypes in both studied SNPs in the ASMT gene differed significantly between DD and healthy subjects. The presence of AA genotype of rs4446909 polymorphism and of GG genotype of rs5989681 polymorphism was associated with lower risk for having recurrent DD. In turn, patients with depression were characterised by reduced mRNA expression for ASMT. In addition, ASMT transcript level in both recurrent DD patients and in healthy subjects depended significantly on genotype distributions in both polymorphisms. In conclusion, our results suggest the ASMT gene as a susceptibility gene for recurrent DD.

An SNP resource for rice genetics and breeding based on subspecies indica and japonica genome alignments.

PubMed

Feltus, F Alex; Wan, Jun; Schulze, Stefan R; Estill, James C; Jiang, Ning; Paterson, Andrew H

2004-09-01

Dense coverage of the rice genome with polymorphic DNA markers is an invaluable tool for DNA marker-assisted breeding, positional cloning, and a wide range of evolutionary studies. We have aligned drafts of two rice subspecies, indica and japonica, and analyzed levels and patterns of genetic diversity. After filtering multiple copy and low quality sequence, 408,898 candidate DNA polymorphisms (SNPs/INDELs) were discerned between the two subspecies. These filters have the consequence that our data set includes only a subset of the available SNPs (in particular excluding large numbers of SNPs that may occur between repetitive DNA alleles) but increase the likelihood that this subset is useful: Direct sequencing suggests that 79.8% +/- 7.5% of the in silico SNPs are real. The SNP sample in our database is not randomly distributed across the genome. In fact, 566 rice genomic regions had unusually high (328 contigs/48.6 Mb/13.6% of genome) or low (237 contigs/64.7 Mb/18.1% of genome) polymorphism rates. Many SNP-poor regions were substantially longer than most SNP-rich regions, covering up to 4 Mb, and possibly reflecting introgression between the respective gene pools that may have occurred hundreds of years ago. Although 46.2% +/- 8.3% of the SNPs differentiate other pairs of japonica and indica genotypes, SNP rates in rice were not predictive of evolutionary rates for corresponding genes in another grass species, sorghum. The data set is freely available at http://www.plantgenome.uga.edu/snp.

An SNP Resource for Rice Genetics and Breeding Based on Subspecies Indica and Japonica Genome Alignments

PubMed Central

Feltus, F. Alex; Wan, Jun; Schulze, Stefan R.; Estill, James C.; Jiang, Ning; Paterson, Andrew H.

2004-01-01

Dense coverage of the rice genome with polymorphic DNA markers is an invaluable tool for DNA marker-assisted breeding, positional cloning, and a wide range of evolutionary studies. We have aligned drafts of two rice subspecies, indica and japonica, and analyzed levels and patterns of genetic diversity. After filtering multiple copy and low quality sequence, 408,898 candidate DNA polymorphisms (SNPs/INDELs) were discerned between the two subspecies. These filters have the consequence that our data set includes only a subset of the available SNPs (in particular excluding large numbers of SNPs that may occur between repetitive DNA alleles) but increase the likelihood that this subset is useful: Direct sequencing suggests that 79.8% ± 7.5% of the in silico SNPs are real. The SNP sample in our database is not randomly distributed across the genome. In fact, 566 rice genomic regions had unusually high (328 contigs/48.6 Mb/13.6% of genome) or low (237 contigs/64.7 Mb/18.1% of genome) polymorphism rates. Many SNP-poor regions were substantially longer than most SNP-rich regions, covering up to 4 Mb, and possibly reflecting introgression between the respective gene pools that may have occurred hundreds of years ago. Although 46.2% ± 8.3% of the SNPs differentiate other pairs of japonica and indica genotypes, SNP rates in rice were not predictive of evolutionary rates for corresponding genes in another grass species, sorghum. The data set is freely available at http://www.plantgenome.uga.edu/snp. PMID:15342564

Single nucleotide polymorphisms in the bovine Histophilus somni genome; a comparison of new and old isolates.

PubMed

Madampage, Claudia Avis; Rawlyk, Neil; Crockford, Gordon; Van Donkersgoed, Joyce; Dorin, Craig; Potter, Andrew

2015-07-01

Histophilus somni, a causative agent of the bovine respiratory disease complex, can also cause a variety of systemic disorders, including bronchopneumonia, myocarditis, pericarditis, arthritis, pleuritis, and infectious thrombotic meningoencephalitis. The purpose of this study was to determine if currently circulating strains differ from those of the 1980s by identifying genomic changes. Single nucleotide polymorphisms (SNPs) and insertion and deletion (INDEL) sites were examined by whole-genome sequencing in 12 samples, 6 old and 6 new. The 31 028 SNP/INDELs recorded were compared against the reference genome sequence of the pathogenic H. somni strain 2336. The distribution of about 75% of these SNPs within a specified gene differed between old and new isolates and did not follow any particular pattern. The other 25% clustered into 2 groups containing the same SNPs in various genes: group I included 5 old isolates and 1 new isolate; group II included 5 new isolates and 1 old isolate. For putative virulence genes there were more SNPs in group I compared with strain 2336, itself an older isolate, than in group II. Although only 25% of all the SNPs formed 2 clusters, the results suggest some genetic difference in various genes between old and new strains.

Single nucleotide polymorphisms in the bovine Histophilus somni genome; a comparison of new and old isolates

PubMed Central

Madampage, Claudia Avis; Rawlyk, Neil; Crockford, Gordon; Van Donkersgoed, Joyce; Dorin, Craig; Potter, Andrew

2015-01-01

Histophilus somni, a causative agent of the bovine respiratory disease complex, can also cause a variety of systemic disorders, including bronchopneumonia, myocarditis, pericarditis, arthritis, pleuritis, and infectious thrombotic meningoencephalitis. The purpose of this study was to determine if currently circulating strains differ from those of the 1980s by identifying genomic changes. Single nucleotide polymorphisms (SNPs) and insertion and deletion (INDEL) sites were examined by whole-genome sequencing in 12 samples, 6 old and 6 new. The 31 028 SNP/INDELs recorded were compared against the reference genome sequence of the pathogenic H. somni strain 2336. The distribution of about 75% of these SNPs within a specified gene differed between old and new isolates and did not follow any particular pattern. The other 25% clustered into 2 groups containing the same SNPs in various genes: group I included 5 old isolates and 1 new isolate; group II included 5 new isolates and 1 old isolate. For putative virulence genes there were more SNPs in group I compared with strain 2336, itself an older isolate, than in group II. Although only 25% of all the SNPs formed 2 clusters, the results suggest some genetic difference in various genes between old and new strains. PMID:26130851

Association of vitamin D receptor gene polymorphisms with diabetic dyslipidemia in the elderly male population in North China.

PubMed

Xia, Zheng; Hu, Yazhuo; Han, Zhitao; Gao, Ya; Bai, Jie; He, Yao; Zhao, Hua; Zhang, Honghong

2017-01-01

The prevalence of dyslipidemia is rising alarmingly in elderly Han Chinese male patients with type 2 diabetes mellitus (T2DM). The genetic factors that contribute to the development of diabetic dyslipidemia remain incompletely identified. This study was conducted to assess the association between vitamin D receptor (VDR) polymorphisms and development of dyslipidemia in the Han elderly male population with T2DM in North China. A total of 242 T2DM patients with dyslipidemia (DH group, n=108) or without dyslipidemia (DO group, n=134) and 100 controls were genotyped for ApaI, TaqI and FokI single nucleotide polymorphisms (SNPs) of the VDR gene using polymerase chain reaction-restriction fragment length polymorphism and sequencing. The frequency and distribution of the SNPs were compared between cases and controls. The distribution of genotypes of VDR-FokI was significantly different between the control and DM group ( P =0.033), as well as between the control and DH subgroup ( P =0.011) but not DO subgroup ( P =0.111). The frequency of C allele and CC genotype of FokI was significantly higher in the DH patients than in the controls ( P =0.015 and P =0.003, respectively). Logistic regression analysis in a dominant model homozygous for the C allele of the FokI SNP showed that CC genotype was associated with DH patients (OR =1.797, 95% CI: 1.077-2.999, P =0.025). Significant associations of the ApaI and TaqI SNPs with either DO or DH subjects were not observed. These findings suggest that CC genotype of VDR-FokI is a risk factor for T2DM patients with dyslipidemia in elderly males in North China.

Precise Estimation of Allele Frequencies of Single-Nucleotide Polymorphisms by a Quantitative SSCP Analysis of Pooled DNA

PubMed Central

Sasaki, Tomonari; Tahira, Tomoko; Suzuki, Akari; Higasa, Koichiro; Kukita, Yoji; Baba, Shingo; Hayashi, Kenshi

2001-01-01

We show that single-nucleotide polymorphisms (SNPs) of moderate to high heterozygosity (minor allele frequencies >10%) can be efficiently detected, and their allele frequencies accurately estimated, by pooling the DNA samples and applying a capillary-based SSCP analysis. In this method, alleles are separated into peaks, and their frequencies can be reliably and accurately quantified from their peak heights (SD <1.8%). We found that as many as 40% of publicly available SNPs that were analyzed by this method have widely differing allele frequency distributions among groups of different ethnicity (parents of Centre d'Etude Polymorphisme Humaine families vs. Japanese individuals). These results demonstrate the effectiveness of the present pooling method in the reevaluation of candidate SNPs that have been collected by examination of limited numbers of individuals. The method should also serve as a robust quantitative technique for studies in which a precise estimate of SNP allele frequencies is essential—for example, in linkage disequilibrium analysis. PMID:11083945

Development and evaluation of the first high-throughput SNP array for common carp (Cyprinus carpio)

PubMed Central

2014-01-01

Background A large number of single nucleotide polymorphisms (SNPs) have been identified in common carp (Cyprinus carpio) but, as yet, no high-throughput genotyping platform is available for this species. C. carpio is an important aquaculture species that accounts for nearly 14% of freshwater aquaculture production worldwide. We have developed an array for C. carpio with 250,000 SNPs and evaluated its performance using samples from various strains of C. carpio. Results The SNPs used on the array were selected from two resources: the transcribed sequences from RNA-seq data of four strains of C. carpio, and the genome re-sequencing data of five strains of C. carpio. The 250,000 SNPs on the resulting array are distributed evenly across the reference C.carpio genome with an average spacing of 6.6 kb. To evaluate the SNP array, 1,072 C. carpio samples were collected and tested. Of the 250,000 SNPs on the array, 185,150 (74.06%) were found to be polymorphic sites. Genotyping accuracy was checked using genotyping data from a group of full-siblings and their parents, and over 99.8% of the qualified SNPs were found to be reliable. Analysis of the linkage disequilibrium on all samples and on three domestic C.carpio strains revealed that the latter had the longer haplotype blocks. We also evaluated our SNP array on 80 samples from eight species related to C. carpio, with from 53,526 to 71,984 polymorphic SNPs. An identity by state analysis divided all the samples into three clusters; most of the C. carpio strains formed the largest cluster. Conclusions The Carp SNP array described here is the first high-throughput genotyping platform for C. carpio. Our evaluation of this array indicates that it will be valuable for farmed carp and for genetic and population biology studies in C. carpio and related species. PMID:24762296

Development and evaluation of the first high-throughput SNP array for common carp (Cyprinus carpio).

PubMed

Xu, Jian; Zhao, Zixia; Zhang, Xiaofeng; Zheng, Xianhu; Li, Jiongtang; Jiang, Yanliang; Kuang, Youyi; Zhang, Yan; Feng, Jianxin; Li, Chuangju; Yu, Juhua; Li, Qiang; Zhu, Yuanyuan; Liu, Yuanyuan; Xu, Peng; Sun, Xiaowen

2014-04-24

A large number of single nucleotide polymorphisms (SNPs) have been identified in common carp (Cyprinus carpio) but, as yet, no high-throughput genotyping platform is available for this species. C. carpio is an important aquaculture species that accounts for nearly 14% of freshwater aquaculture production worldwide. We have developed an array for C. carpio with 250,000 SNPs and evaluated its performance using samples from various strains of C. carpio. The SNPs used on the array were selected from two resources: the transcribed sequences from RNA-seq data of four strains of C. carpio, and the genome re-sequencing data of five strains of C. carpio. The 250,000 SNPs on the resulting array are distributed evenly across the reference C.carpio genome with an average spacing of 6.6 kb. To evaluate the SNP array, 1,072 C. carpio samples were collected and tested. Of the 250,000 SNPs on the array, 185,150 (74.06%) were found to be polymorphic sites. Genotyping accuracy was checked using genotyping data from a group of full-siblings and their parents, and over 99.8% of the qualified SNPs were found to be reliable. Analysis of the linkage disequilibrium on all samples and on three domestic C.carpio strains revealed that the latter had the longer haplotype blocks. We also evaluated our SNP array on 80 samples from eight species related to C. carpio, with from 53,526 to 71,984 polymorphic SNPs. An identity by state analysis divided all the samples into three clusters; most of the C. carpio strains formed the largest cluster. The Carp SNP array described here is the first high-throughput genotyping platform for C. carpio. Our evaluation of this array indicates that it will be valuable for farmed carp and for genetic and population biology studies in C. carpio and related species.

Prospects for inferring pairwise relationships with single nucleotide polymorphisms

Treesearch

Jeffery C. Glaubitz; O. Eugene, Jr. Rhodes; J. Andrew DeWoody

2003-01-01

An extraordinarily large number of single nucleotide polymorphisms (SNPs) are now available in humans as well as in other model organisms. Technological advancements may soon make it feasible to assay hundreds of SNPs in virtually any organism of interest. One potential application of SNPs is the determination of pairwise genetic relationships in populations without...

Automated SNP detection from a large collection of white spruce expressed sequences: contributing factors and approaches for the categorization of SNPs

PubMed Central

Pavy, Nathalie; Parsons, Lee S; Paule, Charles; MacKay, John; Bousquet, Jean

2006-01-01

Background High-throughput genotyping technologies represent a highly efficient way to accelerate genetic mapping and enable association studies. As a first step toward this goal, we aimed to develop a resource of candidate Single Nucleotide Polymorphisms (SNP) in white spruce (Picea glauca [Moench] Voss), a softwood tree of major economic importance. Results A white spruce SNP resource encompassing 12,264 SNPs was constructed from a set of 6,459 contigs derived from Expressed Sequence Tags (EST) and by using the bayesian-based statistical software PolyBayes. Several parameters influencing the SNP prediction were analysed including the a priori expected polymorphism, the probability score (PSNP), and the contig depth and length. SNP detection in 3' and 5' reads from the same clones revealed a level of inconsistency between overlapping sequences as low as 1%. A subset of 245 predicted SNPs were verified through the independent resequencing of genomic DNA of a genotype also used to prepare cDNA libraries. The validation rate reached a maximum of 85% for SNPs predicted with either PSNP ≥ 0.95 or ≥ 0.99. A total of 9,310 SNPs were detected by using PSNP ≥ 0.95 as a criterion. The SNPs were distributed among 3,590 contigs encompassing an array of broad functional categories, with an overall frequency of 1 SNP per 700 nucleotide sites. Experimental and statistical approaches were used to evaluate the proportion of paralogous SNPs, with estimates in the range of 8 to 12%. The 3,789 coding SNPs identified through coding region annotation and ORF prediction, were distributed into 39% nonsynonymous and 61% synonymous substitutions. Overall, there were 0.9 SNP per 1,000 nonsynonymous sites and 5.2 SNPs per 1,000 synonymous sites, for a genome-wide nonsynonymous to synonymous substitution rate ratio (Ka/Ks) of 0.17. Conclusion We integrated the SNP data in the ForestTreeDB database along with functional annotations to provide a tool facilitating the choice of candidate genes for mapping purposes or association studies. PMID:16824208

Distribution of three SNPs related to low bone mineral density in Amerindian groups and Mestizos from Mexico.

PubMed

Nuño-Arana, Ismael; Sahagún-Núñez, Valeria Del Rocío; Muñoz-Valle, José Francisco; Sandoval, Lucila; Pinto-Escalante, Doris; Páez-Riberos, Luis Antonio; Lazalde, Brissia; Maldonado-González, Montserrat; Rangel-Villalobos, Héctor

2012-01-01

Some Single nucleotide polymorphisms (SNPs) of several candidate genes have been associated with low bone mineral density (BMD) and fracture risk. As the genetic variability of such SNPs in Hispanic and Native American populations is scarce, we analyzed the three SNPs that have been related with bone mass disorders (Sp1, A163G, and BsmI) located in the genes of Type I Collagen (COL1A1), Osteoprotegerin (OPG), and Vitamin D receptor (VDR) in Mexican Mestizos (people resulting from post-Columbian admixture) and five Amerindian populations. We genotyped these three SNPs by Polymerase chain reaction (PCR) and Restriction fragment length polymorphisms (RFLPs) in 523 individuals from five Mexican Amerindian groups (Nahua, Maya, Purépecha, Tarahumara, and Huichol) and 227 western Mestizos (Jalisco state). The modal allele was the same in all the six populations for Sp1-COL1A1 (S > 77%), A163G-OPG (A > 80%), and BsmI-VDR (b > 62%). Genotype distribution was in Hardy-Weinberg equilibrium in all SNPs/populations, excepting Sp1-COL1A1 in the Purépecha group and BsmI-VDR in Mestizo. In terms of the presumably Sp1-COL1A1 risk allele to low BMD (allele "s"), the Purépecha group showed the highest allele (23%) and homozygous (14.5%) frequencies. If the role of this allele as a genetic predisposing factor to low BMD were confirmed, this would mean increased susceptibility of Purépechas with regard to Europeans (14.5 vs. 6.8%). This finding presumably could influence the genetic susceptibility to low BMD in Purépechas. For the SNPs, BsmI-VDR and A163G-OPG, relative homogeneity was observed among the Mexican populations analyzed here. Copyright © 2012 Wiley Periodicals, Inc.

Association of vascular endothelial growth factor (VEGF) gene polymorphism and increased serum VEGF concentration with pancreatic adenocarcinoma.

PubMed

Sivaprasad, Siddapuram; Govardhan, Bale; Harithakrishna, Ramanujam; Venkat Rao, Guduru; Pradeep, Rebala; Kunal, Bharadhwaj; Ramakrishna, Nalla; Anuradha, Shekaran; Reddy, Duvvuru Nageshwar

2013-01-01

BACKGROUND &AIM: Pancreatic cancer is related to high mortality rate. The vascular endothelial growth factor (VEGF) has a strong influence in tumor-related angiogenesis having association with the grade of angiogenesis and the prognosis of different solid tumors including pancreatic cancer. The present study was aimed to analyze the genotype and haplotype distribution of VEGF gene single nucleotide polymorphisms (SNPs), -460T/C, +405G/C, +936C/T, in patients with pancreatic adenocarcinoma from South India, and the effect of these SNPs on serum VEGF level. Total 80 patients with pancreatic adenocarcinoma and 87 controls were recruited. The genotype of VEGF gene polymorphisms was determined in both patients and controls using polymerase chain reaction-restriction fragment length polymorphism method. The serum VEGF protein was estimated by standard enzyme-linked immunosorbent assay. The genotype, +405G/G of VEGF gene showed a significant association with the patients with pancreatic adenocarcinoma (P = 0.012, Odds ratio: 2.133), whereas no significant difference was found in the genotype distribution of SNPs, -460C/T and +936C/T between patient and control groups (P > 0.05). Serum VEGF level was found to be significantly high in patients (1315.10 pg/Ml, SD ± 230.79) when compared to controls (591.35 pg/mL, SD ± 92.48) (P < 0.0001), which showed a strong genotype-phenotype correlation between genotype +405G/G and serum VEGF level. Further, the haplotype C-G-T showed a strong association with the disease, and no specific haplotype was associated with increased serum VEGF level. The polymorphism, +405G/C but not -460T/C and +936C/T, of VEGF gene is strongly associated with pancreatic adenocarcinoma, and this SNP has significant influence on serum VEGF level. Copyright © 2013 IAP and EPC. Published by Elsevier B.V. All rights reserved.

Polymorphisms in the SIRT5 gene and their association with body measurement and ultrasound traits in Qinchuan cattle.

PubMed

Gui, L S; Wang, H C; Liu, G Y; Zan, L S

2015-04-22

Silent information regulator 5 (SIRT5), a member of the Sirtuin family class III nicotinamide adenine dinucleotide-dependent protein deacetylases, plays an important role in metabolic and aging processes in mammals. We identified 4 single-nucleotide polymorphisms (SNPs) (G22010A, G22052A, G22119T, and G22245C) in the 3' untranslated regions of the SIRT5 gene from 572 Qinchuan cattle by sequencing and investigating their association with growth and ultrasound traits. The frequencies of genotype GG and allele G were high at the 4 SNPs. Based on the X(2) test, the genotypic distributions of the 4 SNPs were not in Hardy-Weinberg equilibrium (P < 0.05 or P < 0.01). Association analysis of individual SNPs and haplotype combinations revealed that the 4 loci were significantly associated with some body measurement and ultrasound traits in Qinchuan cattle, and the H1H5 (AG-GA-GG-GG) diplotypes had better performance than other combinations in Qinchuan cattle. Our results demonstrate that SIRT5 may be a candidate for marker-assisted selection in future breeding programs for Qinchuan cattle.

The evaluation of endothelin 1 (EDN1) and endothelin receptor type A (EDNRA) gene polymorphisms in Hashimoto's thyroiditis.

PubMed

Aydin, A Fatih; Vural, Pervin; Oruç, Çoşkun Umut; Doğru-Abbasoğlu, Semra; Özderya, Ayşenur; Karadağ, Berrin; Uysal, Müjdat

2014-07-01

Endothelin1 (EDN1) is well established marker of inflammation. The functions of EDN1 are mediated mainly by endothelin receptors type A (EDNRA). The etiopathogenesis of Hashimoto's thyroiditis (HT) remains still elusive although the role of chronic inflammation and subsequent endothelial dysfunction has been established. This study examined firstly the possible association of EDN1 (G5665Tand T-1370G) and EDNRA (C+70G and G-231A) single nucleotide polymorphisms (SNPs) with the occurrence of HT, and evaluates the relationship between genotypes and clinical/laboratory manifestation of HT. We analyzed genotype and allele distributions of above mentioned polymorphisms in 163 patients with HT and 181 healthy controls by real-time PCR combined with melting curve analysis. No significant associations between HT and variant alleles of EDN1 5665 and -1370, as well as EDNRA +70 and -231 SNPs were found. Haplotype analysis demonstrated that there was a strong (D'=0.76, r(2)=0.487) and weak (D'=0.403, r(2)=0.086) linkage disequilibrium (LD) between EDN1 -1370 and 5665, and between EDNRA -231 and +70 SNPs, respectively. However, haplotype frequencies in patients were similar to those in controls. In addition, it was observed that the EDNRA +70 G allele had protective effect against early (at age before 40 years) disease onset of HT (OR: 0.51, 95% CI=0.32-0.79, p=0.003). Although no significant associations between susceptibility to HT with EDN1 5665 and -1370, as well as with EDNRA+70 and -231 SNPs were found, EDNRA +70 polymorphism was related with decreased risk for early onset HT. Copyright © 2014 Elsevier B.V. All rights reserved.

Influence of angiotensin converting enzyme (ACE) gene rs4362 polymorphism on the progression of kidney failure in patients with autosomal dominant polycystic kidney disease (ADPKD).

PubMed

Ramanathan, Gnanasambandan; Ghosh, Santu; Elumalai, Ramprasad; Periyasamy, Soundararajan; Lakkakula, Bhaskar V K S

2016-06-01

Autosomal dominant polycystic kidney disease (ADPKD) is an inherited systemic disorder, characterized by the fluid filled cysts in the kidneys leading to end stage renal failure in later years of life. Hypertension is one of the major factors independently contributing to the chronic kidney disease (CKD) progression. The renin-angiotensin aldosterone system (RAAS) genes have been extensively studied as hypertension candidate genes. The aim of the present study was to investigate the role of angiotensin converting enzyme tagging - single nucleotide polymorphisms (ACE tag-SNPs) in progression of CKD in patients with ADPKD. m0 ethods: In the present study six ACE tagSNPs (angiotensin converting enzyme tag single nucleotide polymorphisms) and insertion/deletion (I/D) in 102 ADPKD patients and 106 control subjects were investigated. The tagSNPs were genotyped using FRET-based KASPar method and ACE ID by polymerase chain reaction (PCR) and electrophoresis. Genotypes and haplotypes were compared between ADPKD patients and controls. Univariate and multivariate logistic regression analyses were performed to assess the effect of genotypes and hypertension on CKD advancement. Mantel-Haenszel (M-H) stratified analysis was performed to study the relationship between different CKD stages and hypertension and their interaction. All loci were polymorphic and except rs4293 SNP the remaining loci followed Hardy-Weinberg equilibrium. Distribution of ACE genotypes and haplotypes in controls and ADPKD patients was not significant. A significant linkage disequilibrium (LD) was observed between SNPs forming two LD blocks. The univariate analysis revealed that the age, hypertension, family history of diabetes and ACE rs4362 contributed to the advancement of CKD. The results suggest that the ACE genotypes are effect modifiers of the relationship between hypertension and CKD advancement among the ADPKD patients.

Cacao single-nucleotide polymorphism (SNP) markers: A discovery strategy to identify SNPs for genotyping, genetic mapping and genome wide association studies (GWAS)

USDA-ARS?s Scientific Manuscript database

Single-nucleotide polymorphisms (SNPs) are the most common genetic markers in Theobroma cacao, occurring approximately once in every 200 nucleotides. SNPs, like microsatellites, are co-dominant and PCR-based, but they have several advantages over microsatellites. They are unambiguous, so that a SN...

Genetic alterations within TLR genes in development of Toxoplasma gondii infection among Polish pregnant women.

PubMed

Wujcicka, Wioletta; Wilczyński, Jan; Nowakowska, Dorota

2017-09-01

The research was conducted to evaluate the role of genotypes, haplotypes and multiple-SNP variants in the range of TLR2, TLR4 and TLR9 single nucleotide polymorphisms (SNPs) in the development of Toxoplasma gondii infection among Polish pregnant women. The study was performed for 116 Polish pregnant women, including 51 patients infected with T. gondii, and 65 age-matched control pregnant individuals. Genotypes in TLR2 2258 G>A, TLR4 896 A>G, TLR4 1196 C>T and TLR9 2848 G>A SNPs were estimated by self-designed, nested PCR-RFLP assays. Randomly selected PCR products, representative for distinct genotypes in the studied polymorphisms, were confirmed by sequencing. All the genotypes were calculated for Hardy-Weinberg (H-W) equilibrium and TLR4 variants were tested for linkage disequilibrium. Relationships were assessed between alleles, genotypes, haplotypes or multiple-SNP variants in TLR polymorphisms and the occurrence of T. gondii infection in pregnant women, using a logistic regression model. All the analyzed genotypes preserved the H-W equilibrium among the studied groups of patients (P>0.050). Similar distribution of distinct alleles and individual genotypes in TLR SNPs, as well as of haplotypes in TLR4 polymorphisms, were observed in T. gondii infected and control uninfected pregnant women. However, the GACG multiple-SNP variant, within the range of all the four studied polymorphisms, was correlated with a decreased risk of the parasitic infection (OR 0.52, 95% CI 0.28-0.97; P≤0.050). The polymorphisms, located within TLR2, TLR4 and TLR9 genes, may be involved together in occurrence of T. gondii infection among Polish pregnant women. Copyright © 2017 Medical University of Bialystok. Published by Elsevier B.V. All rights reserved.

CCR5 gene polymorphism is a genetic risk factor for radiographic severity of rheumatoid arthritis.

PubMed

Han, S W; Sa, K H; Kim, S I; Lee, S I; Park, Y W; Lee, S S; Yoo, W H; Soe, J S; Nam, E J; Lee, J; Park, J Y; Kang, Y M

2012-11-01

The chemokine receptor [C-C chemokine receptor 5 (CCR5)] is expressed on diverse immune effecter cells and has been implicated in the pathogenesis of rheumatoid arthritis (RA). This study sought to determine whether single-nucleotide polymorphisms (SNPs) in the CCR5 gene and their haplotypes were associated with susceptibility to and severity of RA. Three hundred fifty-seven patients with RA and 383 healthy unrelated controls were recruited. Using a pyrosequencing assay, we examined four polymorphisms -1118 CTAT(ins) (/del) (rs10577983), 303 A>G (rs1799987), 927 C>T (rs1800024), and 4838 G>T (rs1800874) of the CCR5 gene, which were distributed over the promoter region as well as the 5' and 3' untranslated regions. No significant difference in the genotype, allele, and haplotype frequencies of the four selected SNPs was observed between RA patients and controls. CCR5 polymorphisms of -1118 CTAT(del) (P = 0.012; corrected P = 0.048) and 303 A>G (P = 0.012; corrected P = 0.048) showed a significant association with radiographic severity in a recessive model, and, as a result of multivariate logistic regression analysis, were found to be an independent predictor of radiographic severity. When we separated the erosion score from the total Sharp score, the statistical significance of CCR5 polymorphisms showed an increase; -1118 CTAT(ins) (/del) (P = 0.007; corrected P = 0.028) and 303 A>G (P = 0.007; corrected P = 0.028). Neither SNPs nor haplotypes of the CCR5 gene showed a significant association with joint space narrowing score. These results indicate that genetic polymorphisms of CCR5 are an independent risk factor for radiographic severity denoted by modified Sharp score, particularly joint erosion in RA. © 2012 John Wiley & Sons A/S.

Ghrelin gene polymorphisms in rheumatoid arthritis.

PubMed

Ozgen, Metin; Koca, Suleyman Serdar; Etem, Ebru Onalan; Yuce, Huseyin; Aydin, Suleyman; Isik, Ahmet

2011-07-01

Ghrelin, an endogenous orexigenic peptide, has anti-inflammatory effects, down-regulates pro-inflammatory cytokines, and its altered levels are reported in various inflammatory diseases. The human preproghrelin (ghrelin/obestatin) gene shows several single nucleotide polymorphisms (SNPs) including Arg51Gln, Leu72Met, Gln90Leu, and A-501C. The aim of this study was to investigate the frequency, and clinical significance, of these four SNPs in a small cohort of Turkish patients with rheumatoid arthritis (RA). The study included 103 patients with RA and 103 healthy controls. In the RA group, disease activity and disease-related damage were assessed using the Disease Activity Score-28 (DAS-28), and the modified Larsen scoring (MLS) methods. In all the participants, genomic DNA was isolated and genotyped by polymerase chain reaction and restriction fragment length polymorphism analysis. The frequencies of ghrelin gene SNPs were 82.5 and 79.6% in the RA and control groups, respectively, and there were no significant differences in terms of genotype distributions and allele frequencies for these four SNPs between the groups. However, the A-501C SNP was found to be associated with early disease onset, and Gln90Leu SNP with less frequent rheumatoid factor positivity, in the RA group. A-501C SNP is associated with earlier onset of RA suggesting that genetic variations in the ghrelin gene may have an impact on RA. Copyright © 2010 Société française de rhumatologie. Published by Elsevier SAS. All rights reserved.

Genotype distribution of estrogen receptor-alpha, catechol-O-methyltransferase, and cytochrome P450 17 gene polymorphisms in Caucasian women with uterine leiomyomas.

PubMed

Denschlag, Dominik; Bentz, Eva-Katrin; Hefler, Lukas; Pietrowski, Detlef; Zeillinger, Robert; Tempfer, Clemens; Tong, Dan

2006-02-01

To evaluate the association between the presence of uterine leiomyomas and three functional single nucleotide polymorphisms (SNPs) of the estrogen receptor alpha (ESR1), catechol-O-methyltransferase (COMT), and cytochrom P450 17 (CYP17A) genes, which have been described to modify the estrogen metabolism. Prospective case control study. Academic research institution. One hundred thirty women with clinically and surgically diagnosed uterine leiomyomas and 139 population controls. Peripheral venous puncture. Polymerase chain reaction and pyrosequencing were performed to genotype women with respect to the ESR1 IVS1-397 T/C (PvuII), COMT G158A, and the CYP17A 34T-->C SNPs. Comparing women with uterine leiomyomas and controls, no statistically significant differences with respect to allele frequency and genotype distribution were ascertained for ESR1 IVS 1-397 T/C (PvuII) (P=0.9 and P=0.6, respectively), COMT G158A (P=0.3 and P=0.6, respectively), and CYP17A 34T-->C (P=0.1 and P=0.5, respectively). When all two-way interactions of investigated SNPs were ascertained, no significant interactions were observed. In a multivariate model, no SNP was significantly associated with leiomyomas. Carriage of the ESR1 IVS1-397 T/C (PvuII), COMT G158A, and the CYP17A 34T-->C SNPs is not associated with the susceptibility to uterine leiomyoma in a Caucasian population.

Contributions of IKZF1, DDC, CDKN2A, CEBPE, and LMO1 Gene Polymorphisms to Acute Lymphoblastic Leukemia in a Yemeni Population.

PubMed

Al-Absi, Boshra; Razif, Muhammad F M; Noor, Suzita M; Saif-Ali, Riyadh; Aqlan, Mohammed; Salem, Sameer D; Ahmed, Radwan H; Muniandy, Sekaran

2017-10-01

Genome-wide and candidate gene association studies have previously revealed links between a predisposition to acute lymphoblastic leukemia (ALL) and genetic polymorphisms in the following genes: IKZF1 (7p12.2; ID: 10320), DDC (7p12.2; ID: 1644), CDKN2A (9p21.3; ID: 1029), CEBPE (14q11.2; ID: 1053), and LMO1 (11p15; ID: 4004). In this study, we aimed to conduct an investigation into the possible association between polymorphisms in these genes and ALL within a sample of Yemeni children of Arab-Asian descent. Seven single-nucleotide polymorphisms (SNPs) in IKZF1, three SNPs in DDC, two SNPs in CDKN2A, two SNPs in CEBPE, and three SNPs in LMO1 were genotyped in 289 Yemeni children (136 cases and 153 controls), using the nanofluidic Dynamic Array (Fluidigm 192.24 Dynamic Array). Logistic regression analyses were used to estimate ALL risk, and the strength of association was expressed as odds ratios with 95% confidence intervals. We found that the IKZF1 SNP rs10235796 C allele (p = 0.002), the IKZF1 rs6964969 A>G polymorphism (p = 0.048, GG vs. AA), the CDKN2A rs3731246 G>C polymorphism (p = 0.047, GC+CC vs. GG), and the CDKN2A SNP rs3731246 C allele (p = 0.007) were significantly associated with ALL in Yemenis of Arab-Asian descent. In addition, a borderline association was found between IKZF1 rs4132601 T>G variant and ALL risk. No associations were found between the IKZF1 SNPs (rs11978267; rs7789635), DDC SNPs (rs3779084; rs880028; rs7809758), CDKN2A SNP (rs3731217), the CEBPE SNPs (rs2239633; rs12434881) and LMO1 SNPs (rs442264; rs3794012; rs4237770) with ALL in Yemeni children. The IKZF1 SNPs, rs10235796 and rs6964969, and the CDKN2A SNP rs3731246 (previously unreported) could serve as risk markers for ALL susceptibility in Yemeni children.

A survey of genome-wide single nucleotide polymorphisms through genome resequencing in the Périgord black truffle (Tuber melanosporum Vittad.).

PubMed

Payen, Thibaut; Murat, Claude; Gigant, Anaïs; Morin, Emmanuelle; De Mita, Stéphane; Martin, Francis

2015-09-01

The Périgord black truffle (Tuber melanosporum Vittad.), considered a gastronomic delicacy worldwide, is an ectomycorrhizal filamentous fungus that is ecologically important in Mediterranean French, Italian and Spanish woodlands. In this study, we developed a novel resource of single nucleotide polymorphisms (SNPs) for T. melanosporum using Illumina high-throughput resequencing. The genome from six T. melanosporum geographical accessions was sequenced to a depth of approximately 20×. These geographical accessions were selected from different populations within the northern and southern regions of the geographical species distribution. Approximately 80% of the reads for each of the six resequenced geographical accessions mapped against the reference T. melanosporum genome assembly, estimating the core genome size of this organism to be approximately 110 Mbp. A total of 442 326 SNPs corresponding to 3540 SNPs/Mbps were identified as being included in all seven genomes. The SNPs occurred more frequently in repeated sequences (85%), although 4501 SNPs were also identified in the coding regions of 2587 genes. Using the ratio of nonsynonymous mutations per nonsynonymous site (pN) to synonymous mutations per synonymous site (pS) and Tajima's D index scanning the whole genome, we were able to identify genomic regions and genes potentially subjected to positive or purifying selection. The SNPs identified represent a valuable resource for future population genetics and genomics studies. © 2015 John Wiley & Sons Ltd.

Single Nucleotide Polymorphisms in IL8 and TLR4 Genes as Candidates for Digital Dermatitis Resistance/Susceptibility in Holstein Cattle.

PubMed

El-Shafaey, El-Sayed; Ateya, Ahmed; Ramadan, Hazem; Saleh, Rasha; Elseady, Yousef; Abo El Fadl, Eman; El-Khodery, Sabry

2017-04-03

Relatedness between single nucleotide polymorphisms in IL8 and TLR4 genes and digital dermatitis resistance/susceptibility was investigated in seventy Holstein dairy cows. Animals were assigned into two groups, affected group (n = 35) and resistant group (n = 35) based on clinical signs and previous history of farm clinical records. Blood samples were collected for DNA extraction to ampliy fragments of 267-bp and 382-bp for IL8 and TLR4 genes, respectively. PCR-DNA sequencing revealed three SNPs in each of IL8 and TLR4 genes. The identified SNPs associated with digital dermatitis resistance were C94T, A220G, and T262A for IL8 and C118T for TLR4. However, the G349C and C355A SNPs in TLR4 gene were associated with digital dermatitis susceptibility. Chi-square analysis for comparison the distribution of all identified SNPs in both IL8 and TLR4 genes between resistant and affected animals showed no significant variation among the identified SNPs in IL8 gene. Meanwhile, there was a significant variation in case of TLR4 gene. As a pilot study, the present results revealed that identified SNPs in IL8 and TLR4 genes can be used as a genetic marker and predisposing factor for resistance/susceptibility to digital dermatitis in dairy cows. However, TLR4 gene may be a potential candidate for such disease.

Effect of P450 Oxidoreductase Polymorphisms on the Metabolic Activities of Ten Cytochrome P450s Varied by Polymorphic CYP Genotypes in Human Liver Microsomes.

PubMed

Fang, Yan; Gao, Na; Tian, Xin; Zhou, Jun; Zhang, Hai-Feng; Gao, Jie; He, Xiao-Pei; Wen, Qiang; Jia, Lin-Jing; Jin, Han; Qiao, Hai-Ling

2018-06-27

Background/ Aims: Little is known about the effect of P450 oxidoreductase (POR) gene polymorphisms on the activities of CYPs with multiple genotypes. We genotyped 102 human livers for 18 known POR single nucleotide polymorphisms (SNPs) with allelic frequencies greater than 1% as well as for 27 known SNPs in 10 CYPs. CYP enzyme activities in microsomes prepared from these livers were determined by measuring probe substrate metabolism by high performance liquid chromatograph. We found that the effects of the 18 POR SNPs on 10 CYP activities were CYP genotype-dependent. The POR mutations were significantly associated with decreased overall Km for CYP2B6 and 2E1, and specific genotypes within CYP1A2, 2A6, 2B6, 2C8, 2D6 and 2E1 were identified as being affected by these POR SNPs. Notably, the effect of a specific POR mutation on the activity of a CYP genotype could not be predicted from other CYP genotypes of even the same CYP. When combining one POR SNP with other POR SNPs, a hitherto unrecognized effect of multiple-site POR gene polymorphisms (MSGP) on CYP activity was uncovered, which was not necessarily consistent with the effect of either single POR SNP. The effects of POR SNPs on CYP activities were not only CYP-dependent, but more importantly, CYP genotype-dependent. Moreover, the effect of a POR SNP alone and in combination with other POR SNPs (MSGP) was not always consistent, nor predictable. Understanding the impact of POR gene polymorphisms on drug metabolism necessitates knowing the complete SNP complement of POR and the genotype of the relevant CYPs. © 2018 The Author(s). Published by S. Karger AG, Basel.

[Association analysis between SNPs of the growth hormone receptor gene and growth traits in arctic fox].

PubMed

DU, Zhi-Heng; Liu, Zong-Yue; Bai, Xiu-Juan

2010-06-01

Using single-strand conformation polymorphism (PCR-SSCP) and DNA sequencing, single nucleotide polymorphisms (SNPs) of growth hormone receptor (GHR) gene were detected in an arctic fox population. Correlation analysis between GHR polymorphisms and growth traits were carried out using the appropriate model. Four SNPs, G3A in the 5'UTR, C99T in the first exon, T59C and G65A in the fifth exon were identified on the arctic fox GHR gene. The G3A and C99T polymorphisms of GHR were associated with female fox body weight (Pamp;0.05) and the T59C and G65A polymorphisms of GHR were associated with male fox body weight (Pamp;0.05) and the skin length of the female fox (Pamp;0.01). Therefore, marker assistant selection on body weight and skin length of arctic foxes using these SNPs can be applied to get big and high quality arctic foxes.

Association study of interleukin-4 polymorphisms with paranoid schizophrenia in the Polish population: a critical approach.

PubMed

Fila-Danilow, Anna; Kucia, Krzysztof; Kowalczyk, Malgorzata; Owczarek, Aleksander; Paul-Samojedny, Monika; Borkowska, Paulina; Suchanek, Renata; Kowalski, Jan

2012-08-01

Changes in immunological system are one of dysfunctions reported in schizophrenia. Some changes based on an imbalance between Th1 and Th2 cytokines results from cytokine gene polymorphisms. Interleukin-4 gene (IL4) is considered as a potential candidate gene in schizophrenia association studies. The aim of the current case-control study was to examine whether the -590C/T (rs2243250) and -33C/T (rs2070874) IL4 gene polymorphisms are implicated in paranoid schizophrenia development in the Polish population. Genotyping of polymorphisms was performed by using PCR-RFLP technique. The genotypes and alleles distribution of both SNPs were analysed in patients (n = 182) and healthy individuals constituted the control group (n = 215). The connection between some clinical variables and studied polymorphisms has been examined as well. We did not revealed any association between the -590C/T and -33C/T polymorphisms and paranoid schizophrenia. In case of both SNPs the homozygous TT genotype was extremely rare. Both polymorphic sites of the IL4 gene were found to be in a very strong linkage disequilibrium. However we did not identify a haplotype predispose to paranoid schizophrenia. No associations were also observed between the clinical course and psychopathology of the disease and the genotypes of both analysed polymorphisms. Our results suggest that the polymorphisms -590C/T in IL4 gene promoter region and -33C/T in the 5'-UTR are not involved in the pathophysiology of paranoid schizophrenia in Polish residents.

An innovative SNP genotyping method adapting to multiple platforms and throughputs

USDA-ARS?s Scientific Manuscript database

Single nucleotide polymorphisms (SNPs) are highly abundant, distributed throughout the genome in various species, and therefore they are widely used as genetic markers. However, the usefulness of this genetic tool relies heavily on the availability of user-friendly SNP genotyping methods. We have d...

Four SNPs and Systemic Level of FOXP3 in Smokers and Patients with Chronic Obstructive Pulmonary Disease.

PubMed

Chu, Shuyuan; Zhong, Xiaoning; Zhang, Jianquan; Lai, Xiaoying; Xie, Jiajun; Li, Yu

2016-12-01

Forkhead box P3 (FOXP3) is the essential transcription factor for the function of regulatory T-cell (Treg). However, the gene mutation of FOXP3 in patients with chronic obstructive pulmonary disease (COPD) at different stages has not been reported. We aim to investigate four single nucleotide polymorphisms (SNPs) and the mRNA expression of FOXP3 in smokers with normal lung function and smokers with COPD at different stages. FOXP3 mRNA expression and SNPs in FOXP3 were assessed in nonsmokers with normal lung function (N), smokers with normal lung function (S), smokers with COPD in the Global Initiative for Chronic Obstructive Lung Disease (GOLD) 1 or 2 grade (COPD 1-2), and smokers with COPD in GOLD 3 or 4 grade (COPD 3-4). In peripheral blood sample, FOXP3 mRNA was assessed using real-time quantitative PCR and SNPs were analyzed by TaqMan PCR. FOXP3 mRNA level in peripheral blood sample was decreased when COPD was aggravated. The frequency of FOXP3 rs5902434 genotype del/del and allele del are lower in COPD 1-2 and COPD 3-4 than that in N or S. The rs5902434 genotype del/del and allele del were, respectively, associated with decreased risk of COPD and lung function decline. The rs5902434 genotypic distribution was correlated with FOXP3 mRNA level. In conclusion, both FOXP3 rs5902434 genotypes and alleles were differently distributed in COPD patients and smokers with normal lung function. The distribution of del/del genotype was associated with systemic expression of FOXP3 mRNA. More research is needed to explore the role of FOXP3 gene polymorphism in immunoinflammation of COPD.

Analysis of single nucleotide polymorphisms in case-control studies.

PubMed

Li, Yonghong; Shiffman, Dov; Oberbauer, Rainer

2011-01-01

Single nucleotide polymorphisms (SNPs) are the most common type of genetic variants in the human genome. SNPs are known to modify susceptibility to complex diseases. We describe and discuss methods used to identify SNPs associated with disease in case-control studies. An outline on study population selection, sample collection and genotyping platforms is presented, complemented by SNP selection, data preprocessing and analysis.

Single nucleotide polymorphisms in bone turnover-related genes in Koreans: ethnic differences in linkage disequilibrium and haplotype

PubMed Central

Kim, Kyung-Seon; Kim, Ghi-Su; Hwang, Joo-Yeon; Lee, Hye-Ja; Park, Mi-Hyun; Kim, Kwang-joong; Jung, Jongsun; Cha, Hyo-Soung; Shin, Hyoung Doo; Kang, Jong-Ho; Park, Eui Kyun; Kim, Tae-Ho; Hong, Jung-Min; Koh, Jung-Min; Oh, Bermseok; Kimm, Kuchan; Kim, Shin-Yoon; Lee, Jong-Young

2007-01-01

Background Osteoporosis is defined as the loss of bone mineral density that leads to bone fragility with aging. Population-based case-control studies have identified polymorphisms in many candidate genes that have been associated with bone mass maintenance or osteoporotic fracture. To investigate single nucleotide polymorphisms (SNPs) that are associated with osteoporosis, we examined the genetic variation among Koreans by analyzing 81 genes according to their function in bone formation and resorption during bone remodeling. Methods We resequenced all the exons, splice junctions and promoter regions of candidate osteoporosis genes using 24 unrelated Korean individuals. Using the common SNPs from our study and the HapMap database, a statistical analysis of deviation in heterozygosity depicted. Results We identified 942 variants, including 888 SNPs, 43 insertion/deletion polymorphisms, and 11 microsatellite markers. Of the SNPs, 557 (63%) had been previously identified and 331 (37%) were newly discovered in the Korean population. When compared SNPs in the Korean population with those in HapMap database, 1% (or less) of SNPs in the Japanese and Chinese subpopulations and 20% of those in Caucasian and African subpopulations were significantly differentiated from the Hardy-Weinberg expectations. In addition, an analysis of the genetic diversity showed that there were no significant differences among Korean, Han Chinese and Japanese populations, but African and Caucasian populations were significantly differentiated in selected genes. Nevertheless, in the detailed analysis of genetic properties, the LD and Haplotype block patterns among the five sub-populations were substantially different from one another. Conclusion Through the resequencing of 81 osteoporosis candidate genes, 118 unknown SNPs with a minor allele frequency (MAF) > 0.05 were discovered in the Korean population. In addition, using the common SNPs between our study and HapMap, an analysis of genetic diversity and deviation in heterozygosity was performed and the polymorphisms of the above genes among the five populations were substantially differentiated from one another. Further studies of osteoporosis could utilize the polymorphisms identified in our data since they may have important implications for the selection of highly informative SNPs for future association studies. PMID:18036257

Gut metagenomes of type 2 diabetic patients have characteristic single-nucleotide polymorphism distribution in Bacteroides coprocola.

PubMed

Chen, Yaowen; Li, Zongcheng; Hu, Shuofeng; Zhang, Jian; Wu, Jiaqi; Shao, Ningsheng; Bo, Xiaochen; Ni, Ming; Ying, Xiaomin

2017-02-01

Gut microbes play a critical role in human health and disease, and researchers have begun to characterize their genomes, the so-called gut metagenome. Thus far, metagenomics studies have focused on genus- or species-level composition and microbial gene sets, while strain-level composition and single-nucleotide polymorphism (SNP) have been overlooked. The gut metagenomes of type 2 diabetes (T2D) patients have been found to be enriched with butyrate-producing bacteria and sulfate reduction functions. However, it is not known whether the gut metagenomes of T2D patients have characteristic strain patterns or SNP distributions. We downloaded public gut metagenome datasets from 170 T2D patients and 174 healthy controls and performed a systematic comparative analysis of their metagenome SNPs. We found that Bacteroides coprocola, whose relative abundance did not differ between the groups, had a characteristic distribution of SNPs in the T2D patient group. We identified 65 genes, all in B. coprocola, that had remarkably different enrichment of SNPs. The first and sixth ranked genes encode glycosyl hydrolases (GenBank accession EDU99824.1 and EDV02301.1). Interestingly, alpha-glucosidase, which is also a glycosyl hydrolase located in the intestine, is an important drug target of T2D. These results suggest that different strains of B. coprocola may have different roles in human gut and a specific set of B. coprocola strains are correlated with T2D.

Sequence analysis of three canine adipokine genes revealed an association between TNF polymorphisms and obesity in Labrador dogs.

PubMed

Mankowska, M; Stachowiak, M; Graczyk, A; Ciazynska, P; Gogulski, M; Nizanski, W; Switonski, M

2016-04-01

Obesity is an emerging health problem in purebred dogs. Due to their crucial role in energy homeostasis control, genes encoding adipokines are considered candidate genes, and their variants may be associated with predisposition to obesity. Searching for polymorphism was carried out in three adipokine genes (TNF, RETN and IL6). The study was performed on 260 dogs, including lean (n = 109), overweight (n = 88) and obese (n = 63) dogs. The largest cohort was represented by Labrador Retrievers (n = 136). Altogether, 24 novel polymorphisms were identified: 12 in TNF (including one missense SNP), eight in RETN (including one missense SNP) and four in IL6. Distributions of five common SNPs (two in TNF, two in RETN and one in IL6) were further analyzed with regard to body condition score. Two SNPs in the non-coding parts of TNF (c.-40A>C and c.233+14G>A) were associated with obesity in Labrador dogs. The obtained results showed that the studied adipokine genes are highly polymorphic and two polymorphisms in the TNF gene may be considered as markers predisposing Labrador dogs to obesity. © 2015 Stichting International Foundation for Animal Genetics.

Genetic polymorphisms associated with increased risk of developing chronic myelogenous leukemia

PubMed Central

Bruzzoni-Giovanelli, Heriberto; González, Juan R.; Sigaux, François; Villoutreix, Bruno O.; Cayuela, Jean Michel; Guilhot, Joëlle; Preudhomme, Claude; Guilhot, François; Poyet, Jean-Luc; Rousselot, Philippe

2015-01-01

Little is known about inherited factors associated with the risk of developing chronic myelogenous leukemia (CML). We used a dedicated DNA chip containing 16 561 single nucleotide polymorphisms (SNPs) covering 1 916 candidate genes to analyze 437 CML patients and 1 144 healthy control individuals. Single SNP association analysis identified 139 SNPs that passed multiple comparisons (1% false discovery rate). The HDAC9, AVEN, SEMA3C, IKBKB, GSTA3, RIPK1 and FGF2 genes were each represented by three SNPs, the PSM family by four SNPs and the SLC15A1 gene by six. Haplotype analysis showed that certain combinations of rare alleles of these genes increased the risk of developing CML by more than two or three-fold. A classification tree model identified five SNPs belonging to the genes PSMB10, TNFRSF10D, PSMB2, PPARD and CYP26B1, which were associated with CML predisposition. A CML-risk-allele score was created using these five SNPs. This score was accurate for discriminating CML status (AUC: 0.61, 95%CI: 0.58–0.64). Interestingly, the score was associated with age at diagnosis and the average number of risk alleles was significantly higher in younger patients. The risk-allele score showed the same distribution in the general population (HapMap CEU samples) as in our control individuals and was associated with differential gene expression patterns of two genes (VAPA and TDRKH). In conclusion, we describe haplotypes and a genetic score that are significantly associated with a predisposition to develop CML. The SNPs identified will also serve to drive fundamental research on the putative role of these genes in CML development. PMID:26474455

SNPs in stress-responsive rice genes: validation, genotyping, functional relevance and population structure

PubMed Central

2012-01-01

Background Single nucleotide polymorphism (SNP) validation and large-scale genotyping are required to maximize the use of DNA sequence variation and determine the functional relevance of candidate genes for complex stress tolerance traits through genetic association in rice. We used the bead array platform-based Illumina GoldenGate assay to validate and genotype SNPs in a select set of stress-responsive genes to understand their functional relevance and study the population structure in rice. Results Of the 384 putative SNPs assayed, we successfully validated and genotyped 362 (94.3%). Of these 325 (84.6%) showed polymorphism among the 91 rice genotypes examined. Physical distribution, degree of allele sharing, admixtures and introgression, and amino acid replacement of SNPs in 263 abiotic and 62 biotic stress-responsive genes provided clues for identification and targeted mapping of trait-associated genomic regions. We assessed the functional and adaptive significance of validated SNPs in a set of contrasting drought tolerant upland and sensitive lowland rice genotypes by correlating their allelic variation with amino acid sequence alterations in catalytic domains and three-dimensional secondary protein structure encoded by stress-responsive genes. We found a strong genetic association among SNPs in the nine stress-responsive genes with upland and lowland ecological adaptation. Higher nucleotide diversity was observed in indica accessions compared with other rice sub-populations based on different population genetic parameters. The inferred ancestry of 16% among rice genotypes was derived from admixed populations with the maximum between upland aus and wild Oryza species. Conclusions SNPs validated in biotic and abiotic stress-responsive rice genes can be used in association analyses to identify candidate genes and develop functional markers for stress tolerance in rice. PMID:22921105

Single-Nucleotide Polymorphisms of FAS and FASL Genes and Risk of Idiopathic Aplastic Anemia.

PubMed

Rehman, Sadia; Saba, Nusrat; Naz, Madiha; Ahmed, Parvez; Munir, Saeeda; Sajjad, Sumaira; Tabassum, Sobia; Naseem, Lubna

2018-04-03

FAS/FASL signaling system plays a vital role in the regulation of apoptosis, envisaged as a death process required for immune surveillance to prevent autoimmunity and tumorigenesis along with several other biological activities. Several single-nucleotide polymorphisms (SNPs) of FAS/FASL system can result in aberrant apoptosis, which can cause different cancers and autoimmune diseases. Aplastic anemia (AA) is an autoimmune dysfunction characterized by peripheral blood pancytopenia associated with hypoplasia of bone marrow. The aim of this study was to screen Pakistani AA patients and controls for two Fas SNPs rs2234767 and rs1800682 and two FASLG SNPs rs763110 and rs5030772. Genotyping of 392 DNA samples was done by Tetra-ARMS polymerase chain reaction. Genotypic frequencies of Fas rs1800682 and FASLG rs5030772 showed significance difference in their distribution in both controls and patients, while Fas rs2234767 and FASLG rs763110 SNPs had no such difference. Carriers of rs1800682 AG+GG had a very odd ratio of 4.63, with 95% confidence interval (CI) of 3.01-7.11, while individuals with FASLG rs5030772 AG+GG were more common in controls than patients with OR 0.53 and 95% CI of 0.34-0.83. Cumulative effects of these SNPs were analyzed, and they showed almost similar trends; however, Fas rs2234767 and FASLG rs763110 genotypes in combination with Fas rs1800682 and FASLG rs5030772 demonstrated significant association. This study provided information that endorsed the involvement of FAS/FASL system SNPs in the pathogenesis of AA; further studies should be designed to understand the exact role of SNPs that can help in early diagnosis and treatment.

Association of single-nucleotide polymorphisms of the tau gene with late-onset Parkinson disease.

PubMed

Martin, E R; Scott, W K; Nance, M A; Watts, R L; Hubble, J P; Koller, W C; Lyons, K; Pahwa, R; Stern, M B; Colcher, A; Hiner, B C; Jankovic, J; Ondo, W G; Allen, F H; Goetz, C G; Small, G W; Masterman, D; Mastaglia, F; Laing, N G; Stajich, J M; Ribble, R C; Booze, M W; Rogala, A; Hauser, M A; Zhang, F; Gibson, R A; Middleton, L T; Roses, A D; Haines, J L; Scott, B L; Pericak-Vance, M A; Vance, J M

2001-11-14

The human tau gene, which promotes assembly of neuronal microtubules, has been associated with several rare neurologic diseases that clinically include parkinsonian features. We recently observed linkage in idiopathic Parkinson disease (PD) to a region on chromosome 17q21 that contains the tau gene. These factors make tau a good candidate for investigation as a susceptibility gene for idiopathic PD, the most common form of the disease. To investigate whether the tau gene is involved in idiopathic PD. Among a sample of 1056 individuals from 235 families selected from 13 clinical centers in the United States and Australia and from a family ascertainment core center, we tested 5 single-nucleotide polymorphisms (SNPs) within the tau gene for association with PD, using family-based tests of association. Both affected (n = 426) and unaffected (n = 579) family members were included; 51 individuals had unclear PD status. Analyses were conducted to test individual SNPs and SNP haplotypes within the tau gene. Family-based tests of association, calculated using asymptotic distributions. Analysis of association between the SNPs and PD yielded significant evidence of association for 3 of the 5 SNPs tested: SNP 3, P =.03; SNP 9i, P =.04; and SNP 11, P =.04. The 2 other SNPs did not show evidence of significant association (SNP 9ii, P =.11, and SNP 9iii, P =.87). Strong evidence of association was found with haplotype analysis, with a positive association with one haplotype (P =.009) and a negative association with another haplotype (P =.007). Substantial linkage disequilibrium (P<.001) was detected between 4 of the 5 SNPs (SNPs 3, 9i, 9ii, and 11). This integrated approach of genetic linkage and positional association analyses implicates tau as a susceptibility gene for idiopathic PD.

IL28B gene polymorphism rs12979860, but not rs8099917, contributes to the occurrence of chronic HCV infection in Uruguayan patients.

PubMed

Echeverría, Natalia; Chiodi, Daniela; López, Pablo; Sanchez Ciceron, Adriana; Angulo, Jenniffer; López-Lastra, Marcelo; Silvera, Paola; Canavesi, Adrian; Bianchi, Carla; Colistro, Valentina; Cristina, Juan; Hernandez, Nelia; Moreno, Pilar

2018-03-02

Host single-nucleotide polymorphisms (SNPs) near the interleukin 28B (IL28B) locus are associated with sustained virological response to antiviral therapy and with spontaneous Hepatitis C Virus (HCV) clearance. Prevalence of these SNPs varies depending on ethnicity. The impact of IL28B SNPs in HCV-infected patients is currently unknown in Uruguay. Therefore, the aim of this study was to evaluate and compare the distribution of polymorphisms in the IL28B gene (rs12979860 and rs8099917) among HCV-infected patients and healthy individuals in Uruguay and thus assess their possible association with the establishment of HCV infection. DNA was recovered from 92 non-infected individuals and 78 HCV-infected patients and SNPs were determined by RFLP and allelic discrimination by real-time PCR. The distribution of rs12979860 genotypes for the infected population was 29.5%-CC, 47.4%-CT and 23.1%-TT and for the control group 45.7%, 42.4% and 11.9%, respectively. Prevalence in both infected and uninfected individuals is similar to that reported in other countries with admixed populations. The distribution of rs8099917 genotypes for the infected population was 57.7%-TT, 27.2%-TG and 14.1%-GG and for the control group 60.9%, 33.7% and 5.4%, respectively. The comparison of rs12979860 genotype distribution between the two populations evidenced a higher prevalence of the favourable genotype (CC) in the uninfected control group (p < 0.05). Additionally, results generated using logistic regression analysis show that individuals carrying rs12979860-TT or CT genotypes have a higher likelihood of developing chronic hepatitis upon infection with HCV, when compared to CC carriers, considering rs8099917 genotype as constant. Patients with HCV infection have a statistically significant lower prevalence of the favourable rs12979860 genotype when compared to uninfected individuals; therefore we can establish that only IL28B rs12979860-CT and TT genotypes seem to contribute to the occurrence of chronic HCV infection in the cohort of Uruguayan population studied. Considering that a trend towards a higher frequency of "good" response genotypes was observed in responder patients, we believe that IL28B rs12979860 genotyping could be a useful tool for predicting different therapies outcome, including in the DAA era.

[Distribution of variant alleles association with warfarin pharmacokinetics and pharmacodynamics in the Han population in China].

PubMed

Liu, Yuan; Zhong, Shi-long; Yang, Min; Tan, Hong-hong; Fei, Hong-wen; Chen, Ji-yan; Yu, Xi-yong; Lin, Shu-guang

2011-12-18

To investigate distribution of CYP2C9, CYP3A4, VKORC1 and GGCX gene polymorphisms in the Han population of Guangdong. The subjects included were 970 Chinese Han patients who received long-term warfarin anticoagulant therapy orally after valve replacement in Guangdong General Hospital between 2000 and 2008. By selecting and analyzing the 12 single nucleotide polymorphisms (SNPs) loci, rs12572351 G>A, rs9332146 G>A, rs4917639 G>T, rs1057910 A>C (CYP2C9*3), rs1934967 G>T, rs1934968 G>A, rs2242480 T>C, rs2246709 G>A, rs9923231 C>T (VKORC1-1639 G>A), rs2359612 G>A (VKORC1*2), rs10871454 C>T, and rs699664 T>C, in 4 genes including CYP2C9, CYP3A4, VKORC1 and GGCX that were possibly correlated with warfarin pharmacodynamics and pharmacokinetics through literature retrieval, the distribution of mutation frequencies of the 12 SNPs loci in Chinese Han population were obtained systematically. SNaPshot technique was used to detect gene SNPs, Hardy-Weinberg genetic equilibrium test was used to test population representativeness. The allelic mutation frequency at CYP2C9 gene rs12572351 G>A, rs9332146 G>A, rs4917639 C>A, rs1057910 A>C (*3), rs1934967 G>T and rs1934968 G>A loci was 32.53%, 2.16%, 8.25%, 3.61%, 19.18% and 37.37%, respectively; the allelic mutation frequency at CYP3A4 gene rs2242480 T>C and rs2246709 G>A loci was 29.07% and 40.41%, respectively; the allelic mutation frequency at VKORC1 gene rs9923231 C>T, rs2359612 G>A and rs10871454 C>T SNPs loci was 87.99%, 87.94% and 91.34%, respectively; the allelic mutation frequency at GGCX gene rs699664 T>C locus was 31.86%. It is of important clinical significance in individualized warfarin therapy to systematically study distribution of mutation frequencies at 12 polymorphisms loci in 4 genes including CYP2C9, CYP3A4 , VKORC1 and GGCX related to warfarin pharmacodynamics and pharmacokinetics in the Chinese Han population receiving valve replacement.

Identification of single-nucleotide polymorphisms of the prion protein gene in sika deer (Cervus nippon laiouanus)

PubMed Central

Jeong, Hyun-Jeong; Lee, Joong-Bok; Park, Seung-Yong; Song, Chang-Seon; Kim, Bo-Sook; Rho, Jung-Rae; Yoo, Mi-Hyun; Jeong, Byung-Hoon; Kim, Yong-Sun

2007-01-01

Polymorphisms of the prion protein gene (PRNP) have been detected in several cervid species. In order to confirm the genetic variations, this study examined the DNA sequences of the PRNP obtained from 33 captive sika deer (Cervus nippon laiouanus) in Korea. A total of three single-nucleotide polymorphisms (SNPs) at codons 100, 136 and 226 in the PRNP of the sika deer were identified. The polymorphic site located at codon 100 has not been reported. The SNPs detected at codons 100 and 226 induced amino acid substitutions. The SNP at codon 136 was a silent mutation that does not induce any amino acid change. The genotype and allele frequencies were determined for each of the SNPs. PMID:17679779

Influence of ghrelin gene polymorphisms on hypertension and atherosclerotic disease.

PubMed

Berthold, Heiner K; Giannakidou, Eleni; Krone, Wilhelm; Trégouët, David-Alexandre; Gouni-Berthold, Ioanna

2010-02-01

Ghrelin is involved in several metabolic and cardiovascular processes. Recent evidence suggests its involvement in blood pressure regulation and hypertension. The aim of the study was to determine associations of single-nucleotide polymorphisms (SNPs) and haplotypes of the ghrelin gene (GHRL) with hypertension and atherosclerotic disease. Six GHRL SNPs (rs27647, rs26802, rs34911341, rs696217, rs4684677 and a -473G/A (with no assigned rsID)) were investigated in a sample of 1143 hypertensive subjects and 1489 controls of Caucasian origin. Both single-locus and haplotype association analyses were performed. In single-locus analyses, only the non-synonymous rs34911341 was associated with hypertension (odds ratio (OR)=1.95 (95% confidence interval (CI): 1.26-3.02), P=0.003). Six common haplotypes with frequency >1% were inferred from the studied GHRL SNPs, and their frequency distribution was significantly different between hypertensive subjects and controls (chi(2)=12.96 with 5 d.f. (degree of freedom), P=0.024). The effect of rs26802 was found to be significantly (P=0.017) modulated by other GHRL SNPs, as its C allele conferred either an increased risk (OR=1.30 (1.08-1.57), P=0.005) or a decreased risk (OR=0.50 (0.23-1.06), P=0.07) of hypertension according to the two different haplotypes on which it can be found. No association of GHRL SNPs or haplotypes with atherosclerotic disease was observed. In conclusion, we observed statistical evidence for association between GHRL SNPs and risk of hypertension.

SNPServer: a real-time SNP discovery tool.

PubMed

Savage, David; Batley, Jacqueline; Erwin, Tim; Logan, Erica; Love, Christopher G; Lim, Geraldine A C; Mongin, Emmanuel; Barker, Gary; Spangenberg, German C; Edwards, David

2005-07-01

SNPServer is a real-time flexible tool for the discovery of SNPs (single nucleotide polymorphisms) within DNA sequence data. The program uses BLAST, to identify related sequences, and CAP3, to cluster and align these sequences. The alignments are parsed to the SNP discovery software autoSNP, a program that detects SNPs and insertion/deletion polymorphisms (indels). Alternatively, lists of related sequences or pre-assembled sequences may be entered for SNP discovery. SNPServer and autoSNP use redundancy to differentiate between candidate SNPs and sequence errors. For each candidate SNP, two measures of confidence are calculated, the redundancy of the polymorphism at a SNP locus and the co-segregation of the candidate SNP with other SNPs in the alignment. SNPServer is available at http://hornbill.cspp.latrobe.edu.au/snpdiscovery.html.

Evidence for Hitchhiking of Deleterious Mutations within the Human Genome

PubMed Central

Chun, Sung; Fay, Justin C.

2011-01-01

Deleterious mutations present a significant obstacle to adaptive evolution. Deleterious mutations can inhibit the spread of linked adaptive mutations through a population; conversely, adaptive substitutions can increase the frequency of linked deleterious mutations and even result in their fixation. To assess the impact of adaptive mutations on linked deleterious mutations, we examined the distribution of deleterious and neutral amino acid polymorphism in the human genome. Within genomic regions that show evidence of recent hitchhiking, we find fewer neutral but a similar number of deleterious SNPs compared to other genomic regions. The higher ratio of deleterious to neutral SNPs is consistent with simulated hitchhiking events and implies that positive selection eliminates some deleterious alleles and increases the frequency of others. The distribution of disease-associated alleles is also altered in hitchhiking regions. Disease alleles within hitchhiking regions have been associated with auto-immune disorders, metabolic diseases, cancers, and mental disorders. Our results suggest that positive selection has had a significant impact on deleterious polymorphism and may be partly responsible for the high frequency of certain human disease alleles. PMID:21901107

Genome supranucleosomal organization and genetic susceptibility to diseases

NASA Astrophysics Data System (ADS)

Jablonski, K. P.; Fretter, C.; Carron, L.; Forné, T.; Hütt, M.-T.; Lesne, A.

2017-09-01

The notion of disease-associated single-nucleotide polymorphisms (da-SNP), as determined in genome-wide association studies (GWAS), is relevant for many complex pathologies, including cancers. It appeared that da-SNPs are not only markers of causal genetic variation but may contribute to the disease development through an influence on gene expression levels. We argue that understanding this possible functional role of da-SNPs requires to consider their embedding in the tridimensional (3D) multi-scale organization of the human genome. We then focus on the potential impact of da-SNPs on chromatin loops and recently observed topologically associating domains (TADs). We show that for some diseases and cancer types, da-SNPs are over-represented in the borders of these topological domains, in a way that cannot be explained by an increased exon density. This analysis of the distribution of da-SNPs within the 3D genome organization suggests candidate loci for further experimental investigation of the mechanisms underlying genetic susceptibility to diseases, in particular cancer.

Characterization of polyploid wheat genomic diversity using a high-density 90 000 single nucleotide polymorphism array

PubMed Central

Wang, Shichen; Wong, Debbie; Forrest, Kerrie; Allen, Alexandra; Chao, Shiaoman; Huang, Bevan E; Maccaferri, Marco; Salvi, Silvio; Milner, Sara G; Cattivelli, Luigi; Mastrangelo, Anna M; Whan, Alex; Stephen, Stuart; Barker, Gary; Wieseke, Ralf; Plieske, Joerg; International Wheat Genome Sequencing Consortium; Lillemo, Morten; Mather, Diane; Appels, Rudi; Dolferus, Rudy; Brown-Guedira, Gina; Korol, Abraham; Akhunova, Alina R; Feuillet, Catherine; Salse, Jerome; Morgante, Michele; Pozniak, Curtis; Luo, Ming-Cheng; Dvorak, Jan; Morell, Matthew; Dubcovsky, Jorge; Ganal, Martin; Tuberosa, Roberto; Lawley, Cindy; Mikoulitch, Ivan; Cavanagh, Colin; Edwards, Keith J; Hayden, Matthew; Akhunov, Eduard

2014-01-01

High-density single nucleotide polymorphism (SNP) genotyping arrays are a powerful tool for studying genomic patterns of diversity, inferring ancestral relationships between individuals in populations and studying marker–trait associations in mapping experiments. We developed a genotyping array including about 90 000 gene-associated SNPs and used it to characterize genetic variation in allohexaploid and allotetraploid wheat populations. The array includes a significant fraction of common genome-wide distributed SNPs that are represented in populations of diverse geographical origin. We used density-based spatial clustering algorithms to enable high-throughput genotype calling in complex data sets obtained for polyploid wheat. We show that these model-free clustering algorithms provide accurate genotype calling in the presence of multiple clusters including clusters with low signal intensity resulting from significant sequence divergence at the target SNP site or gene deletions. Assays that detect low-intensity clusters can provide insight into the distribution of presence–absence variation (PAV) in wheat populations. A total of 46 977 SNPs from the wheat 90K array were genetically mapped using a combination of eight mapping populations. The developed array and cluster identification algorithms provide an opportunity to infer detailed haplotype structure in polyploid wheat and will serve as an invaluable resource for diversity studies and investigating the genetic basis of trait variation in wheat. PMID:24646323

Identification of single nucleotide polymorphism in ginger using expressed sequence tags

PubMed Central

Chandrasekar, Arumugam; Riju, Aikkal; Sithara, Kandiyl; Anoop, Sahadevan; Eapen, Santhosh J

2009-01-01

Ginger (Zingiber officinale Rosc) (Family: Zingiberaceae) is a herbaceous perennial, the rhizomes of which are used as a spice. Ginger is a plant which is well known for its medicinal applications. Recently EST-derived SNPs are a free by-product of the currently expanding EST (Expressed Sequence Tag) databases. The development of high-throughput methods for the detection of SNPs (Single Nucleotide Polymorphism) and small indels (insertion/deletion) has led to a revolution in their use as molecular markers. Available (38139) Ginger EST sequences were mined from dbEST of NCBI. CAP3 program was used to assemble EST sequences into contigs. Candidate SNPs and Indel polymorphisms were detected using the perl script AutoSNP version 1.0 which has used 31905 ESTs for detecting SNPs and Indel sites. We found 64026 SNP sites and 7034 indel polymorphisms with frequency of 0.84 SNPs / 100 bp. Among the three tissues from which the EST libraries had been generated, Rhizomes had high frequency of 1.08 SNPs/indels per 100 bp whereas the leaves had lowest frequency of 0.63 per 100 bp and root is showing relative frequency 0.82/100bp. Transitions and transversion ratio is 0.90. In overall detected SNP, transversion is high when compare to transition. These detected SNPs can be used as markers for genetic studies. Availability The results of the present study hosted in our webserver www.spices.res.in/spicesnip PMID:20198184

An Intronic Polymorphism in couch potato Is Not Distributed Clinally in European Drosophila melanogaster Populations nor Does It Affect Diapause Inducibility.

PubMed

Zonato, Valeria; Fedele, Giorgio; Kyriacou, Charalambos P

2016-01-01

couch potato (cpo) encodes an RNA binding protein that has been reported to be expressed in the peripheral and central nervous system of embryos, larvae and adults, including the major endocrine organ, the ring gland. A polymorphism in the D. melanogaster cpo gene coding region displays a latitudinal cline in frequency in North American populations, but as cpo lies within the inversion In(3R)Payne, which is at high frequencies and itself shows a strong cline on this continent, interpretation of the cpo cline is not straightforward. A second downstream SNP in strong linkage disequilibrium with the first has been claimed to be primarily responsible for the latitudinal cline in diapause incidence in USA populations.Here, we investigate the frequencies of these two cpo SNPs in populations of Drosophila throughout continental Europe. The advantage of studying cpo variation in Europe is the very low frequency of In(3R)Payne, which we reveal here, does not appear to be clinally distributed. We observe a very different geographical scenario for cpo variation from the one in North America, suggesting that the downstream SNP does not play a role in diapause. In an attempt to verify whether the SNPs influence diapause we subsequently generated lines with different combinations of the two cpo SNPs on known timeless (tim) genetic backgrounds, because polymorphism in the clock gene tim plays a significant role in diapause inducibility. Our results reveal that the downstream cpo SNP does not seem to play any role in diapause induction in European populations in contrast to the upstream coding cpo SNP. Consequently, all future diapause studies on strains of D. melanogaster should initially determine their tim and cpo status.

Population-based case-control study of DRD2 gene polymorphisms and alcoholism.

PubMed

Bhaskar, L V K S; Thangaraj, K; Non, A L; Singh, Lalji; Rao, V R

2010-10-01

Several independent lines of evidence for genetic contributions to vulnerability to alcoholism exist. Dopamine is thought to play a major role in the mechanism of reward and reinforcement in response to alcohol. D2 dopamine receptor (DRD2) gene has been among the stronger candidate genes implicated in alcoholism. In this study, alcohol use was assessed in 196 randomly selected Kota individuals of Nilgiri Hills, South India. Six DRD2 SNPs were assessed in 81 individuals with alcoholism and 151 controls to evaluate the association between single nucleotide polymorphisms (SNPs) and alcoholism. Of the three models (dominant, recessive, and additive) tested for association between alcoholism and DRD2 SNPs, only the additive model shows association for three loci (rs1116313, TaqID, and rs2734835). Of six studied polymorphisms, five are in strong linkage disequilibrium forming onesingle haplotype block. Though the global haplotype analysis with these five SNPs was not significant, haplotype analysis using all six SNPs yielded a global P value of .033, even after adjusting for age. These findings support the importance of dopamine receptor gene polymorphisms in alcoholism. Further studies to replicate these findings in different populations are needed to confirm these results.

The effects of non-synonymous single nucleotide polymorphisms (nsSNPs) on protein-protein interactions.

PubMed

Yates, Christopher M; Sternberg, Michael J E

2013-11-01

Non-synonymous single nucleotide polymorphisms (nsSNPs) are single base changes leading to a change to the amino acid sequence of the encoded protein. Many of these variants are associated with disease, so nsSNPs have been well studied, with studies looking at the effects of nsSNPs on individual proteins, for example, on stability and enzyme active sites. In recent years, the impact of nsSNPs upon protein-protein interactions has also been investigated, giving a greater insight into the mechanisms by which nsSNPs can lead to disease. In this review, we summarize these studies, looking at the various mechanisms by which nsSNPs can affect protein-protein interactions. We focus on structural changes that can impair interaction, changes to disorder, gain of interaction, and post-translational modifications before looking at some examples of nsSNPs at human-pathogen protein-protein interfaces and the analysis of nsSNPs from a network perspective. © 2013.

Screening and Evaluation of Deleterious SNPs in APOE Gene of Alzheimer's Disease.

PubMed

Masoodi, Tariq Ahmad; Al Shammari, Sulaiman A; Al-Muammar, May N; Alhamdan, Adel A

2012-01-01

Introduction. Apolipoprotein E (APOE) is an important risk factor for Alzheimer's disease (AD) and is present in 30-50% of patients who develop late-onset AD. Several single-nucleotide polymorphisms (SNPs) are present in APOE gene which act as the biomarkers for exploring the genetic basis of this disease. The objective of this study is to identify deleterious nsSNPs associated with APOE gene. Methods. The SNPs were retrieved from dbSNP. Using I-Mutant, protein stability change was calculated. The potentially functional nonsynonymous (ns) SNPs and their effect on protein was predicted by PolyPhen and SIFT, respectively. FASTSNP was used for functional analysis and estimation of risk score. The functional impact on the APOE protein was evaluated by using Swiss PDB viewer and NOMAD-Ref server. Results. Six nsSNPs were found to be least stable by I-Mutant 2.0 with DDG value of >-1.0. Four nsSNPs showed a highly deleterious tolerance index score of 0.00. Nine nsSNPs were found to be probably damaging with position-specific independent counts (PSICs) score of ≥2.0. Seven nsSNPs were found to be highly polymorphic with a risk score of 3-4. The total energies and root-mean-square deviation (RMSD) values were higher for three mutant-type structures compared to the native modeled structure. Conclusion. We concluded that three nsSNPs, namely, rs11542041, rs11542040, and rs11542034, to be potentially functional polymorphic.

Sudden infant death syndrome (SIDS) and polymorphisms in Monoamine oxidase A gene (MAOA): a revisit.

PubMed

Groß, Maximilian; Bajanowski, Thomas; Vennemann, Mechtild; Poetsch, Micaela

2014-01-01

Literature describes multiple possible links between genetic variations in the neuroadrenergic system and the occurrence of sudden infant death syndrome. The X-chromosomal Monoamine oxidase A (MAOA) is one of the genes with regulatory activity in the noradrenergic and serotonergic neuronal systems and a polymorphism of the promoter which affects the activity of this gene has been proclaimed to contribute significantly to the prevalence of sudden infant death syndrome (SIDS) in three studies from 2009, 2012 and 2013. However, these studies described different significant correlations regarding gender or age of children. Since several studies, suggesting associations between genetic variations and SIDS, were disproved by follow-up analysis, this study was conducted to take a closer look at the MAOA gene and its polymorphisms. The functional MAOA promoter length polymorphism was investigated in 261 SIDS cases and 93 control subjects. Moreover, the allele distribution of 12 coding and non-coding single nucleotide polymorphisms (SNPs) of the MAOA gene was examined in 285 SIDS cases and 93 controls by a minisequencing technique. In contrast to prior studies with fewer individuals, no significant correlations between the occurrence of SIDS and the frequency of allele variants of the promoter polymorphism could be demonstrated, even including the results from the abovementioned previous studies. Regarding the SNPs, three statistically significant associations were observed which had not been described before. This study clearly disproves interactions between MAOA promoter polymorphisms and SIDS, even if variations in single nucleotide polymorphisms of MAOA should be subjected to further analysis to clarify their impact on SIDS.

The first report of prion-related protein gene (PRNT) polymorphisms in goat.

PubMed

Kim, Yong-Chan; Jeong, Byung-Hoon

2017-06-01

Prion protein is encoded by the prion protein gene (PRNP). Polymorphisms of several members of the prion gene family have shown association with prion diseases in several species. Recent studies on a novel member of the prion gene family in rams have shown that prion-related protein gene (PRNT) has a linkage with codon 26 of prion-like protein (PRND). In a previous study, codon 26 polymorphism of PRND has shown connection with PRNP haplotype which is strongly associated with scrapie vulnerability. In addition, the genotype of a single nucleotide polymorphism (SNP) at codon 26 of PRND is related to fertilisation capacity. These findings necessitate studies on the SNP of PRNT gene which is connected with PRND. In goat, several polymorphism studies have been performed for PRNP, PRND, and shadow of prion protein gene (SPRN). However, polymorphism on PRNT has not been reported. Hence, the objective of this study was to determine the genotype and allelic distribution of SNPs of PRNT in 238 Korean native goats and compare PRNT DNA sequences between Korean native goats and several ruminant species. A total of five SNPs, including PRNT c.-114G > T, PRNT c.-58A > G in the upstream of PRNT gene, PRNT c.71C > T (p.Ala24Val) and PRNT c.102G > A in the open reading frame (ORF) and c.321C > T in the downstream of PRNT gene, were found in this study. All five SNPs of caprine PRNT gene in Korean native goat are in complete linkage disequilibrium (LD) with a D' value of 1.0. Interestingly, comparative sequence analysis of the PRNT gene revealed five mismatches between DNA sequences of Korean native goats and those of goats deposited in the GenBank. Korean native black goats also showed 5 mismatches in PRNT ORF with cattle. To the best of our knowledge, this is the first genetic research of the PRNT gene in goat.

Discovery, Validation and Characterization of 1039 Cattle Single Nucleotide Polymorphisms

USDA-ARS?s Scientific Manuscript database

We identified approximately 13000 putative single nucleotide polymorphisms (SNPs) by comparison of repeat-masked BAC-end sequences from the cattle RPCI-42 BAC library with whole-genome shotgun contigs of cattle genome assembly Btau 1.0. Genotyping of a subset of these SNPs was performed on a panel ...

Informativeness of single nucleotide polymorphisms and relationships among onion populations from important world production regions

USDA-ARS?s Scientific Manuscript database

Single nucleotide polymorphisms (SNPs) were genotyped using a high-density array and DNAs from individual plants from important onion populations from major production regions world-wide and the likely progenitor of onion, Allium vavilovii. Genotypes at 1226 SNPs were used to estimate genetic relati...

Digging more in the genetic risk prediction of hepatitis C virus epidemic in Egypt: Apoptosis genes polymorphisms in the susceptibility of hepatitis C virus and association with viral load.

PubMed

Khalifa, Rania H; Shahin, Rasha Mohamad Hosny; Aboukhalil, Reham Emad Eldin; Marie, Mohamed A; El-Deeb, Amr M; Riad, Nermine Magdi

2017-06-15

Egypt is confronted with the highest hepatitis C virus (HCV) epidemic. Apoptosis and cellular immune responses are crucial to the clearance or persistence of viral infections. This case-control study was carried out to detect whether apoptosis genes single nucleotide polymorphisms (SNPs) confer risk to HCV in a cohort of Egyptian patients and to explore their association with viral load. One hundred and ninety six blood samples were withdrawn from 96 HCV patients and 100 controls. The Tumor necrosis factor-related apoptosis inducing ligand (TRAIL) -1525G>A and FasL-844T>C SNPs were genotyped using the polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP). Hepatitis C viral load was measured using Real time PCR. Results Genotypes distributions of TRAIL -1525G>A and FasL-844 T>C polymorphisms in controls were in accordance with Hardy-Weinberg equilibrium (p>0.05). The study showed a statistically significant difference in the distribution of the TRAIL -1525G>A polymorphism genotypes and the FasL-844 T>C polymorphism genotypes between the HCV patients and the controls (p=0.001 and 0.02 respectively), with association of the -1525GA genotype and -844 TT genotype with increased risk of HCV infection (OR=2.68, 1.942 respectively, 95% CI=1.482-4.846, 1.1-3.43, respectively). No significant association was detected between TRAIL, FasL and the viral load. Our results suggest that the FasL -844T>C SNP is implicated in the susceptibility to HCV in Egyptian patients and firstly report the involvement of TRAIL gene polymorphism in the risk of the disease. Therefore we recommend national programs to delineate genetic factors that may put individuals at risk for contracting HCV. Copyright © 2017 Elsevier B.V. All rights reserved.

Interleukin-10 family cytokines pathway: genetic variants and psoriasis.

PubMed

Galimova, E; Rätsep, R; Traks, T; Kingo, K; Escott-Price, V; Kõks, S

2017-06-01

Interleukin (IL)-10 family cytokines IL-10, IL-19, IL-20 and IL-24 have been implicated in autoimmune diseases and we have previously reported that genetic variants in the IL10 gene cluster were associated with psoriasis. To analyse the relationship between genetic polymorphisms in the IL10 gene cluster and psoriasis. This study also explores whether there are gene-gene interactions among these genetic polymorphisms. A total of 377 patients with psoriasis and 403 matched healthy controls were enrolled to carry out a case-control study for 48 single-nucleotide polymorphisms (SNPs) of the IL10 gene cluster. Genotyping for the SNPs was conducted on the Applied Biosystems 3730 DNA Analyzer using SNPlex ® technology. Generalized multifactor dimensionality reduction (GMDR) analysis was applied to discover a likely gene-gene interaction model among the SNPs. The results showed that the allele distributions of IL10 gene cluster SNPs are significantly different between the case and control groups. Carriers of the IL10 T allele (rs1554286) and the IL20 T allele (rs1400986) conferred protection from psoriasis [odds ratio (OR) = 0·63, corrected P-value (Pc) = 0·007; OR = 0·62, Pc = 0·038, respectively]. GMDR analysis displayed a significant gene-gene interaction between IL10 (rs1554286) and IL20 (rs1518108) variants. The strongest protective effect was found with the block 1 haplotype ACATA in the IL10 gene (Pc = 0·004). This study presents a novel finding that the combination of the two SNPs, IL10 (rs1554286) and IL20 (rs1518108), is associated with a reduced risk of psoriasis. Our results indicate that genetic variants of the immunomodulatory IL10 and IL20 genes may offer a protective effect in Europeans from Russia. Independent studies are required to verify the results and find a possible functional explanation. © 2017 British Association of Dermatologists.

Development and validation of a high density SNP genotyping array for Atlantic salmon (Salmo salar).

PubMed

Houston, Ross D; Taggart, John B; Cézard, Timothé; Bekaert, Michaël; Lowe, Natalie R; Downing, Alison; Talbot, Richard; Bishop, Stephen C; Archibald, Alan L; Bron, James E; Penman, David J; Davassi, Alessandro; Brew, Fiona; Tinch, Alan E; Gharbi, Karim; Hamilton, Alastair

2014-02-06

Dense single nucleotide polymorphism (SNP) genotyping arrays provide extensive information on polymorphic variation across the genome of species of interest. Such information can be used in studies of the genetic architecture of quantitative traits and to improve the accuracy of selection in breeding programs. In Atlantic salmon (Salmo salar), these goals are currently hampered by the lack of a high-density SNP genotyping platform. Therefore, the aim of the study was to develop and test a dense Atlantic salmon SNP array. SNP discovery was performed using extensive deep sequencing of Reduced Representation (RR-Seq), Restriction site-Associated DNA (RAD-Seq) and mRNA (RNA-Seq) libraries derived from farmed and wild Atlantic salmon samples (n = 283) resulting in the discovery of > 400 K putative SNPs. An Affymetrix Axiom® myDesign Custom Array was created and tested on samples of animals of wild and farmed origin (n = 96) revealing a total of 132,033 polymorphic SNPs with high call rate, good cluster separation on the array and stable Mendelian inheritance in our sample. At least 38% of these SNPs are from transcribed genomic regions and therefore more likely to include functional variants. Linkage analysis utilising the lack of male recombination in salmonids allowed the mapping of 40,214 SNPs distributed across all 29 pairs of chromosomes, highlighting the extensive genome-wide coverage of the SNPs. An identity-by-state clustering analysis revealed that the array can clearly distinguish between fish of different origins, within and between farmed and wild populations. Finally, Y-chromosome-specific probes included on the array provide an accurate molecular genetic test for sex. This manuscript describes the first high-density SNP genotyping array for Atlantic salmon. This array will be publicly available and is likely to be used as a platform for high-resolution genetics research into traits of evolutionary and economic importance in salmonids and in aquaculture breeding programs via genomic selection.

Development and validation of a high density SNP genotyping array for Atlantic salmon (Salmo salar)

PubMed Central

2014-01-01

Background Dense single nucleotide polymorphism (SNP) genotyping arrays provide extensive information on polymorphic variation across the genome of species of interest. Such information can be used in studies of the genetic architecture of quantitative traits and to improve the accuracy of selection in breeding programs. In Atlantic salmon (Salmo salar), these goals are currently hampered by the lack of a high-density SNP genotyping platform. Therefore, the aim of the study was to develop and test a dense Atlantic salmon SNP array. Results SNP discovery was performed using extensive deep sequencing of Reduced Representation (RR-Seq), Restriction site-Associated DNA (RAD-Seq) and mRNA (RNA-Seq) libraries derived from farmed and wild Atlantic salmon samples (n = 283) resulting in the discovery of > 400 K putative SNPs. An Affymetrix Axiom® myDesign Custom Array was created and tested on samples of animals of wild and farmed origin (n = 96) revealing a total of 132,033 polymorphic SNPs with high call rate, good cluster separation on the array and stable Mendelian inheritance in our sample. At least 38% of these SNPs are from transcribed genomic regions and therefore more likely to include functional variants. Linkage analysis utilising the lack of male recombination in salmonids allowed the mapping of 40,214 SNPs distributed across all 29 pairs of chromosomes, highlighting the extensive genome-wide coverage of the SNPs. An identity-by-state clustering analysis revealed that the array can clearly distinguish between fish of different origins, within and between farmed and wild populations. Finally, Y-chromosome-specific probes included on the array provide an accurate molecular genetic test for sex. Conclusions This manuscript describes the first high-density SNP genotyping array for Atlantic salmon. This array will be publicly available and is likely to be used as a platform for high-resolution genetics research into traits of evolutionary and economic importance in salmonids and in aquaculture breeding programs via genomic selection. PMID:24524230

Polymorphic trial in oxidative damage of arsenic exposed Vietnamese.

PubMed

Fujihara, Junko; Soejima, Mikiko; Yasuda, Toshihiro; Koda, Yoshiro; Kunito, Takashi; Iwata, Hisato; Tanabe, Shinsuke; Takeshita, Haruo

2011-10-15

Arsenic causes DNA damage and changes the cellular capacity for DNA repair. Genes in the base excision repair (BER) pathway influence the generation and repair of oxidative lesions. Single nucleotide polymorphisms (SNPs) in human 8-oxoguanine DNA glycosylase (hOGG1) Ser326Cys; apurinic/apyrimidinic endonuclease (APE1) Asp148Glu; X-ray and repair and cross-complementing group 1 (XRCC1) Arg280His and Arg399Gln in the BER genes were analyzed, and the relationship between these 4 SNPs and the urinary 8-hydroxy-2'-deoxyguanosine (8-OHdG) concentrations of 100 Vietnamese population exposed to arsenic was investigated. Individuals with hOGG1 326Cys/Cys showed significantly higher urinary 8-OHdG concentrations than did those with 326 Ser/Cys and Ser/Ser. As for APE1 Asp148Glu, heterozygous subjects showed significantly higher urinary 8-OHdG concentrations than did those homozygous for Asp/Asp. Moreover, global ethnic comparison of the allelic frequencies of the 4SNPs was performed in 10 population and previous reported data. The mutant allele frequencies of hOGG1 Ser326Cys in the Asian populations were higher than those in the African and Caucasian populations. As for APE1 Asp148Glu, Caucasians showed higher mutant frequencies than those shown by African and Asian populations. Among Asian populations, the Bangladeshi population showed relatively higher mutant allele frequencies of the APE1 Asp148Glu polymorphism. This study is the first to demonstrate the existence of genetic heterogeneity in a worldwide distribution of SNPs (hOGG1 Ser326Cys, APE1 Asp148Glu, XRCC1 Arg280His, and XRCC1 Arg399Gln) in the BER genes. Published by Elsevier Inc.

Association of TCF7L2 Genetic Polymorphisms with Type 2 Diabetes Mellitus in the Uygur Population of China.

PubMed

Yao, Hua; Wang, Zhiqiang; Wang, Tingting; Ma, Yan; Su, Yinxia; Ma, Qi; Wang, Li; Zhu, Jun

2015-09-18

Genetic polymorphisms of the transcription factor 7-like 2 (TCF7L2) gene have been reported to be strongly associated with type 2 diabetes mellitus (T2DM) in Icelandic, Danish and American populations and further replicated in other European populations, African Americans, Mexican Americans, and Asian populations. The aim of the present study was to investigate the association of TCF7L2 gene polymorphisms with T2DM in a Uygur population of China. 877 T2DM patients and 871 controls were selected for the present study. Two single nucleotide polymorphisms (SNPs) (rs12255372 and rs7901695) were genotyped by using matrix-assisted laser desorption/ionization time-of-flight (MALDI-TOF) mass spectrometry. The associations of SNPs and haplotypes with T2DM and linkage disequilibrium (LD) structure of the TCF7L2 gene were analyzed. For total participants and male, the distribution of rs12255372 alleles and the dominant model (Guanine Guanine (GG) genotype vs. Guanine Thymine (GT) genotype + Thymine Thymine (TT) genotype) showed significant difference between T2DM and control subjects (for allele: p = 0.013 and p = 0.002, respectively; for dominant model: p = 0.028 and p = 0.008, respectively). The distribution of rs7901695 alleles and the dominant model (TT genotype vs. Thymine Cytosine (TC) genotype + Cytosine Cytosine (CC) genotype) for total participants and male showed significant difference between T2DM and control subjects (for allele: both p = 0.001; for dominant model: p = 0.006 and p = 0.008, respectively). Our data suggested that the genetic polymorphisms of the TCF7L2 gene were associated with T2DM in the Uygur population of China.

Genetic polymorphisms associated with breast cancer in malaysian cohort.

PubMed

Chahil, Jagdish Kaur; Munretnam, Khamsigan; Samsudin, Nurulhafizah; Lye, Say Hean; Hashim, Nikman Adli Nor; Ramzi, Nurul Hanis; Velapasamy, Sharmila; Wee, Ler Lian; Alex, Livy

2015-04-01

Genome-wide association studies have discovered multiple single nucleotide polymorphisms (SNPs) associated with the risk of common diseases. The objective of this study was to demonstrate the replication of previously published SNPs that showed statistical significance for breast cancer in the Malaysian population. In this case-control study, 80 subjects for each group were recruited from various hospitals in Malaysia. A total of 768 SNPs were genotyped and analyzed to distinguish risk and protective alleles. A total of three SNPs were found to be associated with increased risk of breast cancer while six SNPs showed protective effect. All nine were statistically significant SNPs (p ≤ 0.01), five SNPs from previous studies were successfully replicated in our study. Significant modifiable (diet) and non-modifiable (family history of breast cancer in first degree relative) risk factors were also observed. We identified nine SNPs from this study to be either conferring susceptibility or protection to breast cancer which may serve as potential markers in risk prediction.

Development of a 690K SNP array in catfish and its application for genetic mapping and validation of the reference genome sequence

USDA-ARS?s Scientific Manuscript database

Single nucleotide polymorphisms (SNPs) are capable of providing the highest level of genome coverage for genomic and genetic analysis because of their abundance and relatively even distribution in the genome. Such a capacity, however, cannot be achieved without an efficient genotyping platform such ...

Cloning of polymorphisms (COP): enrichment of polymorphic sequences from complex genomes

PubMed Central

Li, Jingfeng; Wang, Fuli; Zabarovska, Veronika; Wahlestedt, Claes; Zabarovsky, Eugene R.

2000-01-01

Here we describe a new procedure (cloning of polymorphisms, COP) for enrichment of single nucleotide polymorphisms (SNPs) that represent restriction fragment length polymorphisms (RFLPs). COP would be applicable to the isolation of SNPs from particular regions of the genome, e.g. CpG islands, chromosomal bands, YACs or PAC contigs. A combination of digestion with restriction enzymes, treatment with uracil-DNA glycosylase and mung bean nuclease, PCR amplification and purification with streptavidin magnetic beads was used to isolate polymorphic sequences from the genomes of two human samples. After only two cycles of enrichment, 80% of the isolated clones were found to contain RFLPs. A simple method for the PCR detection of these polymorphisms was also developed. PMID:10606669

Association of GNLY genetic polymorphisms with chronic liver disease in a Korean population.

PubMed

Park, Geun-Hee; Kim, Kyoung-Yeon; Cheong, Jae Youn; Cho, Sung Won; Kwack, KyuBum

2012-09-01

Granulysin (GNLY) is found in cytotoxic granules of cytolytic T lymphocytes and natural killer (NK) cells, which are critical for hepatitis B virus (HBV) clearance. GNLY cytotoxicity plays an important role in the defense against viruses or intracellular bacteria. We hypothesized that genetic variation in the GNLY gene could affect the resistance of hosts against HBV infection. We compared the distribution frequencies of GNLY polymorphisms between an HBV-induced chronic liver disease (CLD) group and a spontaneous recovery (SR) control group to determine whether GNLY polymorphisms play a role in HBV clearance. A total of 117 patients in the SR group and 230 patients in the CLD group were enrolled. Samples derived from complex infections, including hepatitis C and human immunodeficiency virus, and those associated with insufficient clinical information (10 samples in SR and 24 samples in CLD) were excluded from the study. The final analysis included 107 SR and 206 CLD samples. DNA was extracted from peripheral blood, and GNLY genotypes were determined by the GoldenGate(®) method. The genotype distribution of the single-nucleotide polymorphisms (SNPs) rs2886767 (C>T), rs1561285 (G>C), and rs11127 (T>C) were significantly different between the SR and CLD groups in a recessive model (p<0.015). These three SNPs were in a complete linkage disequilibrium (LD) block. Diplotype distributions of haplotype (HT) 1 (C-G-T) and HT2 (T-C-C) were significantly different between the SR and CLD groups in a recessive model (p=0.025) and a dominant model (p=0.008). All p-values remained significant after multiple comparisons. GNLY polymorphism genotypes and diplotypes were associated with the chronicity of HBV. These data suggested that genetic variation of GNLY may be an important factor in HBV clearance through the CD8+ T or NK cell-mediated removal of HBV-infected cells from the host.

Predicting adaptive phenotypes from multilocus genotypes in Sitka spruce (Picea sitchensis) using random forest.

PubMed

Holliday, Jason A; Wang, Tongli; Aitken, Sally

2012-09-01

Climate is the primary driver of the distribution of tree species worldwide, and the potential for adaptive evolution will be an important factor determining the response of forests to anthropogenic climate change. Although association mapping has the potential to improve our understanding of the genomic underpinnings of climatically relevant traits, the utility of adaptive polymorphisms uncovered by such studies would be greatly enhanced by the development of integrated models that account for the phenotypic effects of multiple single-nucleotide polymorphisms (SNPs) and their interactions simultaneously. We previously reported the results of association mapping in the widespread conifer Sitka spruce (Picea sitchensis). In the current study we used the recursive partitioning algorithm 'Random Forest' to identify optimized combinations of SNPs to predict adaptive phenotypes. After adjusting for population structure, we were able to explain 37% and 30% of the phenotypic variation, respectively, in two locally adaptive traits--autumn budset timing and cold hardiness. For each trait, the leading five SNPs captured much of the phenotypic variation. To determine the role of epistasis in shaping these phenotypes, we also used a novel approach to quantify the strength and direction of pairwise interactions between SNPs and found such interactions to be common. Our results demonstrate the power of Random Forest to identify subsets of markers that are most important to climatic adaptation, and suggest that interactions among these loci may be widespread.

No association of the Arg51Gln and Leu72Met polymorphisms of the ghrelin gene and polycystic ovary syndrome.

PubMed

Wang, Kehua; Wang, Leiguang; Zhao, Yueran; Shi, Yuhua; Wang, Laicheng; Chen, Zi-Jiang

2009-02-01

Ghrelin plays a role in regulating glucose metabolism and energy balance. Polymorphisms in preproghrelin and ghrelin gene could be responsible for obesity, insulin resistance and low ghrelin levels observed in some individuals. The objective of this study was to evaluate the influence of two single-nucleotide polymorphisms (SNPs) of ghrelin gene on the clinical, the hormonal and metabolic features in women with polycystic ovary syndrome (PCOS) in a Chinese population. A large sample of Chinese PCOS (n = 271) women and a control group (n = 296) of healthy women matched for age were studied. Hormone and metabolic profiles were measured and blood samples were collected for genotype and allelic frequency analysis. Non-synonymous SNPs in the coding region (exon 2) of the preproghrelin gene (Arg51Gln (346 G>A) and Leu72Met (408 C>A) were studied using PCR and restriction fragment length polymorphism analysis. The polymorphism Arg51Gln was not found in the cohorts studied. The distribution of Leu72Met was similar in PCOS group and in healthy controls. There was no significant difference in age, BMI, waist-hip-ratio and levels of FSH, LH, estradiol, testosterone and prolactin between PCOS patients with different genotypes, and the level of plasma glucose and insulin was also similar. No association was found between Leu72Met and Arg51Gln polymorphisms in the ghrelin gene and PCOS in Chinese population.

Association of TNF-α rs1799964 and IL-1β rs16944 polymorphisms with multiple system atrophy in Chinese Han population.

PubMed

Zhou, Xin; Wang, Chunrong; Chen, Zhao; Peng, Yun; Peng, Huirong; Hou, Xuan; Ye, Wei; Qiu, Rong; Xia, Kun; Tang, Beisha; Jiang, Hong

2018-01-07

Recent evidence suggested that several single nucleotide polymorphisms (SNPs) of inflammation-related genes (TNF-α rs1799964, IL-1α rs1800587, IL-1β rs16944, IL-8 rs4073, ICAM-1 rs5498) were associated with multiple system atrophy (MSA). Herein, we conducted this case-control study to evaluate the possible correlation between the five SNPs related to inflammation and MSA in Chinese Han population. We recruited 154 sporadic patients with MSA and 223 health controls in this study. All subjects were genotyped for the five SNPs using polymerase chain reaction amplification and Sanger sequencing. TNF-α rs1799964, genotype distribution and minor allele frequency (MAF) showed significant differences between patients and controls, which might illustrate the minor allele C may increase the risk for MSA (genotype, P = 0.006, OR = 1.245, 95% CI = [1.066-1.455]; allele, P = 0.001, OR = 1.887, 95% CI = [1.303-2.733]). For rs16944, patients carrying AA genotype showed a nearly 5-year early age at onset (AAO) than GG genotype (50.52 ± 7.45 years vs. 54.90 ± 7.21 years, P = 0.037). No differences were found in genotype distribution and MAF of the five SNPs between patients with MSA with predominant cerebellar ataxia (MSA-C) and with predominant Parkinsonism (MSA-P). Our study suggests that rs1799964 of TNF-α may act as a risk factor for MSA and the IL-1β rs16944 might be a genetic factor that modifies the AAO in MSA. Moreover, the exact mechanism of neuroinflammatory response in MSA deserves further exploration.

ABCB1 polymorphisms are associated with clozapine plasma levels in psychotic patients.

PubMed

Consoli, Giorgio; Lastella, Marianna; Ciapparelli, Antonio; Catena Dell'Osso, Mario; Ciofi, Laura; Guidotti, Emanuele; Danesi, Romano; Dell'Osso, Liliana; Del Tacca, Mario; Di Paolo, Antonello

2009-08-01

ABCB1 is a transmembrane transporter that is expressed in excretory organs (kidneys and liver), in intestine mucosa and on the blood-brain barrier. Because of the particular distribution of the protein, the activity of ABCB1 may significantly affect drug pharmacokinetics during absorption and distribution. Of note, several SNPs of ABCB1 are known and many of them affect transporter activity and/or expression. In this view, changes in the pharmacokinetics of drugs that are ABCB1 substrates could be clinically relevant and the evaluation of ABCB1 SNPs should deserve particular attention. Therefore, the aim of the present study was to investigate the possible association between ABCB1 polymorphisms and clozapine plasma levels in psychotic patients. c.1236C>T (exon 12), c.2677G>T (exon 21) and c.3435C>T (exon 26) SNPs of ABCB1 were evaluated by PCR techniques, while plasma levels of clozapine and norclozapine were measured by HPLC in 40 men (aged, 47.6 +/- 16.6 years, median: 42 years) and 20 women (aged 40.7 +/- 11.4 years, median: 38 years) 1 month after the start of clozapine administration. A total of three SNPs were in Hardy-Weinberg equilibrium, with a calculated frequency of the wild-type alleles of 0.54, 0.55 and 0.45 for SNPs on exons 12, 21 and 26, respectively. Patients with c.3435CC or c.2677GG genotypes had significantly lower dose-normalized clozapine levels than those who were heterozygous or TT carriers. More interestingly, c.3435CC patients (15 subjects) needed significantly higher daily doses of clozapine (246 +/- 142 mg/day) compared with the remaining 24 CT and 21 TT patients (140 +/- 90 mg/day) in order to achieve the same clinical benefit. c.3435CC patients require higher clozapine doses to achieve the same plasma concentrations as CT or TT patients, and ABCB1 genotyping should be considered as a novel strategy that should improve drug use.

Leptin and leptin receptor gene polymorphisms and their association with plasma leptin levels and obesity in a multi-ethnic Malaysian suburban population.

PubMed

Fan, Sook-Ha; Say, Yee-How

2014-06-20

This study was to investigate the prevalence of single nucleotide polymorphisms (SNPs) in leptin gene LEP (A19G and G2548A) and leptin receptor gene LEPR (K109R and Q223R) and their association with fasting plasma leptin level (PLL) and obesity in a Malaysian suburban population in Kampar, Perak. Convenience sampling was performed with informed consents, and the study sample was drawn from patients who were patrons of the Kampar Health Clinic. A total of 408 subjects (mean age, 52.4 ± 13.7 years; 169 men, 239 women; 190 obese, 218 non-obese; 148 Malays, 177 ethnic Chinese, 83 ethnic Indians) participated. Socio-demographic data and anthropometric measurements were taken, and genotyping was performed using polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP). The LEP A19G, G2548A and LEPR K109R, Q223R variant allele frequencies were 0.74, 0.67 and 0.61, 0.79, respectively. The genotype and allele distributions of these gene variants were significantly different among ethnic groups, but not among body mass index (BMI) classes. Subjects with LEPR K109 and Q223 allele had significantly higher systolic blood pressure and adiposity indices after adjustment for ethnicity (higher BMI, total body and subcutaneous fat; lower skeletal muscle percentage). Subjects with LEPR 109R allele had lower PLL than their wild-type allele counterparts. The influence of LEP A19G and G2548A SNPs on blood pressures, anthropometrics, and PLL was not evident. Interestingly, synergistic effect of the LEP and LEPR SNPs was observed as subjects homozygous for all four SNPs studied exhibited significantly higher subcutaneous fat and PLL than those with other genotype combinations. The LEP and LEPR SNPs in this study may not be an obesity marker among Malaysians in this population, but were associated with ethnicity. Our findings suggest that each of these SNPs contributes to minor but significant variation in obesity-related traits and in combination they display synergistic effects on subcutaneous fat and PLL.

Leptin and leptin receptor gene polymorphisms and their association with plasma leptin levels and obesity in a multi-ethnic Malaysian suburban population

PubMed Central

2014-01-01

Background This study was to investigate the prevalence of single nucleotide polymorphisms (SNPs) in leptin gene LEP (A19G and G2548A) and leptin receptor gene LEPR (K109R and Q223R) and their association with fasting plasma leptin level (PLL) and obesity in a Malaysian suburban population in Kampar, Perak. Methods Convenience sampling was performed with informed consents, and the study sample was drawn from patients who were patrons of the Kampar Health Clinic. A total of 408 subjects (mean age, 52.4 ± 13.7 years; 169 men, 239 women; 190 obese, 218 non-obese; 148 Malays, 177 ethnic Chinese, 83 ethnic Indians) participated. Socio-demographic data and anthropometric measurements were taken, and genotyping was performed using polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP). Results The LEP A19G, G2548A and LEPR K109R, Q223R variant allele frequencies were 0.74, 0.67 and 0.61, 0.79, respectively. The genotype and allele distributions of these gene variants were significantly different among ethnic groups, but not among body mass index (BMI) classes. Subjects with LEPR K109 and Q223 allele had significantly higher systolic blood pressure and adiposity indices after adjustment for ethnicity (higher BMI, total body and subcutaneous fat; lower skeletal muscle percentage). Subjects with LEPR 109R allele had lower PLL than their wild-type allele counterparts. The influence of LEP A19G and G2548A SNPs on blood pressures, anthropometrics, and PLL was not evident. Interestingly, synergistic effect of the LEP and LEPR SNPs was observed as subjects homozygous for all four SNPs studied exhibited significantly higher subcutaneous fat and PLL than those with other genotype combinations. Conclusions The LEP and LEPR SNPs in this study may not be an obesity marker among Malaysians in this population, but were associated with ethnicity. Our findings suggest that each of these SNPs contributes to minor but significant variation in obesity-related traits and in combination they display synergistic effects on subcutaneous fat and PLL. PMID:24947733

Statistical Genomic Approach Identifies Association between FSHR Polymorphisms and Polycystic Ovary Morphology in Women with Polycystic Ovary Syndrome

PubMed Central

Du, Tao; Duan, Yu; Li, Kaiwen; Zhao, Xiaomiao; Ni, Renmin; Li, Yu; Yang, Dongzi

2015-01-01

Background. Single-nucleotide polymorphisms (SNPs) in the follicle stimulating hormone receptor (FSHR) gene are associated with PCOS. However, their relationship to the polycystic ovary (PCO) morphology remains unknown. This study aimed to investigate whether PCOS related SNPs in the FSHR gene are associated with PCO in women with PCOS. Methods. Patients were grouped into PCO (n = 384) and non-PCO (n = 63) groups. Genomic genotypes were profiled using Affymetrix human genome SNP chip 6. Two polymorphisms (rs2268361 and rs2349415) of FSHR were analyzed using a statistical approach. Results. Significant differences were found in the allele distributions of the GG genotype of rs2268361 between the PCO and non-PCO groups (27.6% GG, 53.4% GA, and 19.0% AA versus 33.3% GG, 36.5% GA, and 30.2% AA), while no significant differences were found in the allele distributions of the GG genotype of rs2349415. When rs2268361 was considered, there were statistically significant differences of serum follicle stimulating hormone, estradiol, and sex hormone binding globulin between genotypes in the PCO group. In case of the rs2349415 SNP, only serum sex hormone binding globulin was statistically different between genotypes in the PCO group. Conclusions. Functional variants in FSHR gene may contribute to PCO susceptibility in women with PCOS. PMID:26273622

Geographically Distinct and Domain-Specific Sequence Variations in the Alleles of Rice Blast Resistance Gene Pib

PubMed Central

Vasudevan, Kumar; Vera Cruz, Casiana M.; Gruissem, Wilhelm; Bhullar, Navreet K.

2016-01-01

Rice blast is caused by Magnaporthe oryzae, which is the most destructive fungal pathogen affecting rice growing regions worldwide. The rice blast resistance gene Pib confers broad-spectrum resistance against Southeast Asian M. oryzae races. We investigated the allelic diversity of Pib in rice germplasm originating from 12 major rice growing countries. Twenty-five new Pib alleles were identified that have unique single nucleotide polymorphisms (SNPs), insertions and/or deletions, in addition to the polymorphic nucleotides that are shared between the different alleles. These partially or completely shared polymorphic nucleotides indicate frequent sequence exchange events between the Pib alleles. In some of the new Pib alleles, nucleotide diversity is high in the LRR domain, whereas, in others it is distributed among the NB-ARC and LRR domains. Most of the polymorphic amino acids in LRR and NB-ARC2 domains are predicted as solvent-exposed. Several of the alleles and the unique SNPs are country specific, suggesting a diversifying selection of alleles in various geographical locations in response to the locally prevalent M. oryzae population. Together, the new Pib alleles are an important genetic resource for rice blast resistance breeding programs and provide new information on rice-M. oryzae interactions at the molecular level. PMID:27446145

Two novel polymorphisms of bovine SIRT2 gene are associated with higher body weight in Nanyang cattle.

PubMed

Sun, Xiaomei; Li, Mingxun; Hao, Dan; Hua, Liushuai; Lan, Xianyong; Lei, Chuzhao; Hu, Shenrong; Qi, Xinglei; Chen, Hong

2015-03-01

Identification of polymorphisms associated with economic traits is important for successful marker-assisted selection in cattle breeding. The family of mammalian sirtuin regulates many biological functions, such as life span extension and energy metabolism. SIRT2, a most abundant sirtuin in adipocytes, acts as a crucial regulator of adipogenic differentiation and plays a key role in controlling adipose tissue function and mass. Here we investigated single nucleotide polymorphisms (SNPs) of bovine SIRT2 in 1226 cattle from five breeds and further evaluated the effects of identified SNPs on economically important traits of Nanyang cattle. Our results revealed four novel SNPs in bovine SIRT2, one was located in intronic region and the other three were synonymous mutations. Linkage disequilibrium and haplotype analyses based on the identified SNPs showed obvious difference between crossbred breed and the other four beef breeds. Association analyses demonstrated that SNPs g.17333C > T and g.17578A > G have a significantly effect on 18-months-old body weight of Nanyang population. Animals with combined genotype TTGG at the above two loci exhibited especially higher body weight. Our data for the first time demonstrated that polymorphisms in bovine SIRT2 are associated with economic traits of Nanyang cattle, which will be helpful for future cattle selection practices.

Polymorphisms of clip domain serine proteinase and serine proteinase homolog in the swimming crab Portunus trituberculatus and their association with Vibrio alginolyticus

NASA Astrophysics Data System (ADS)

Liu, Meng; Liu, Yuan; Hui, Min; Song, Chengwen; Cui, Zhaoxia

2017-03-01

Clip domain serine proteases (cSPs) and their homologs (SPHs) play an important role in various biological processes that are essential components of extracellular signaling cascades, especially in the innate immune responses of invertebrates. Here, polymorphisms of PtcSP and PtSPH from the swimming crab Portunus trituberculatus were investigated to explore their association with resistance/susceptibility to Vibrio alginolyticus. Polymorphic loci were identified using Clustal X, and characterized with SPSS 16.0 software, and then the significance of genotype and allele frequencies between resistant and susceptible stocks was determined by a χ 2 test. A total of 109 and 77 single nucleotide polymorphisms (SNPs) were identified in the genomic fragments of PtcSP and PtSPH, respectively. Notably, nearly half of PtSPH polymorphisms were found in the non-coding exon 1. Fourteen SNPs investigated were significantly associated with susceptibility/resistance to V. alginolyticus ( P <0.05). Among them, eight SNPs were observed in introns, and one synonymous, four non-synonymous SNPs and one ins-del were found in coding exons. In addition, five simple sequence repeats (SSRs) were detected in intron 3 of PtcSP. Although there was no statistically significant difference of allele frequencies, the SSRs showed different polymorphic alleles on the basis of the repeat number between resistant and susceptible stocks. After further validation, polymorphisms investigated here might be applied to select potential molecular markers of P. trituberculatus with resistance to V. alginolyticus.

SNPing Away at Complex Diseases: Analysis of Single-Nucleotide Polymorphisms around APOE in Alzheimer Disease

PubMed Central

Martin, Eden R.; Lai, Eric H.; Gilbert, John R.; Rogala, Allison R.; Afshari, A. J.; Riley, John; Finch, K. L.; Stevens, J. F.; Livak, K. J.; Slotterbeck, Brandon D.; Slifer, Susan H.; Warren, Liling L.; Conneally, P. Michael; Schmechel, Donald E.; Purvis, Ian; Pericak-Vance, Margaret A.; Roses, Allen D.; Vance, Jeffery M.

2000-01-01

There has been great interest in the prospects of using single-nucleotide polymorphisms (SNPs) in the search for complex disease genes, and several initiatives devoted to the identification and mapping of SNPs throughout the human genome are currently underway. However, actual data investigating the use of SNPs for identification of complex disease genes are scarce. To begin to look at issues surrounding the use of SNPs in complex disease studies, we have initiated a collaborative SNP mapping study around APOE, the well-established susceptibility gene for late-onset Alzheimer disease (AD). Sixty SNPs in a 1.5-Mb region surrounding APOE were genotyped in samples of unrelated cases of AD, in controls, and in families with AD. Standard tests were conducted to look for association of SNP alleles with AD, in cases and controls. We also used family-based association analyses, including recently developed methods to look for haplotype association. Evidence of association (P⩽.05) was identified for 7 of 13 SNPs, including the APOE-4 polymorphism, spanning 40 kb on either side of APOE. As expected, very strong evidence for association with AD was seen for the APOE-4 polymorphism, as well as for two other SNPs that lie <16 kb from APOE. Haplotype analysis using family data increased significance over that seen in single-locus tests for some of the markers, and, for these data, improved localization of the gene. Our results demonstrate that associations can be detected at SNPs near a complex disease gene. We found that a high density of markers will be necessary in order to have a good chance of including SNPs with detectable levels of allelic association with the disease mutation, and statistical analysis based on haplotypes can provide additional information with respect to tests of significance and fine localization of complex disease genes. PMID:10869235

SNPing away at complex diseases: analysis of single-nucleotide polymorphisms around APOE in Alzheimer disease.

PubMed

Martin, E R; Lai, E H; Gilbert, J R; Rogala, A R; Afshari, A J; Riley, J; Finch, K L; Stevens, J F; Livak, K J; Slotterbeck, B D; Slifer, S H; Warren, L L; Conneally, P M; Schmechel, D E; Purvis, I; Pericak-Vance, M A; Roses, A D; Vance, J M

2000-08-01

There has been great interest in the prospects of using single-nucleotide polymorphisms (SNPs) in the search for complex disease genes, and several initiatives devoted to the identification and mapping of SNPs throughout the human genome are currently underway. However, actual data investigating the use of SNPs for identification of complex disease genes are scarce. To begin to look at issues surrounding the use of SNPs in complex disease studies, we have initiated a collaborative SNP mapping study around APOE, the well-established susceptibility gene for late-onset Alzheimer disease (AD). Sixty SNPs in a 1.5-Mb region surrounding APOE were genotyped in samples of unrelated cases of AD, in controls, and in families with AD. Standard tests were conducted to look for association of SNP alleles with AD, in cases and controls. We also used family-based association analyses, including recently developed methods to look for haplotype association. Evidence of association (P

Pharmacogenetic screening for polymorphisms in drug-metabolizing enzymes and drug transporters in a Dutch population.

PubMed

Bosch, T M; Doodeman, V D; Smits, P H M; Meijerman, I; Schellens, J H M; Beijnen, J H

2006-01-01

A possible explanation for the wide interindividual variability in toxicity and efficacy of drug therapy is variation in genes encoding drug-metabolizing enzymes and drug transporters. The allelic frequency of these genetic variants, linkage disequilibrium (LD), and haplotype of these polymorphisms are important parameters in determining the genetic differences between patients. The aim of this study was to explore the frequencies of polymorphisms in drug-metabolizing enzymes (CYP1A1, CYP2C9, CYP2C19, CYP3A4, CYP2D6, CYP3A5, DPYD, UGT1A1, GSTM1, GSTP1, GSTT1) and drug transporters (ABCB1[MDR1] and ABCC2[MRP2]), and to investigate the LD and perform haplotype analysis of these polymorphisms in a Dutch population. Blood samples were obtained from 100 healthy volunteers and genomic DNA was isolated and amplified by PCR. The amplification products were sequenced and analyzed for the presence of polymorphisms by sequence alignment. In the study population, we identified 13 new single nucleotide polymorphisms (SNPs) in Caucasians and three new SNPs in non-Caucasians, in addition to previously recognized SNPs. Three of the new SNPs were found within exons, of which two resulted in amino acid changes (A428T in CYP2C9 resulting in the amino acid substitution D143V; and C4461T in ABCC2 in a non-Caucasian producing the amino acid change T1476M). Several LDs and haplotypes were found in the Caucasian individuals. In this Dutch population, the frequencies of 16 new SNPs and those of previously recognized SNPs were determined in genes coding for drug-metabolizing enzymes and drug transporters. Several LDs and haplotypes were also inferred. These data are important for further research to help explain the interindividual pharmacokinetic and pharmacodynamic variability in response to drug therapy.

Polymorphisms in the Estrogen Receptor β (ESR2) Gene Are Associated with Bone Mineral Density in Caucasian Men and Women

PubMed Central

Ichikawa, Shoji; Koller, Daniel L.; Peacock, Munro; Johnson, Michelle L.; Lai, Dongbing; Hui, Siu L.; Johnston, C. Conrad; Foroud, Tatiana M.; Econs, Michael J.

2007-01-01

Context A major determinant of osteoporotic fractures is peak bone mineral density (BMD), which is a highly heritable trait. Recently, we identified significant linkage for hip BMD in premenopausal sister pairs at chromosome 14q (LOD score = 3.5), where the estrogen receptor β gene (ESR2) is located. Objective The objective of the study was to determine whether ESR2 polymorphisms are associated with normal BMD variation. Design This was a population‐based genetic association study, using 11 single nucleotide polymorphisms (SNPs) distributed across the ESR2 gene. Setting The study was conducted at an academic research laboratory and medical center. Patients and Other Participants A total of 411 healthy men (aged 18–61 yr) and 1291 healthy premenopausal women (aged 20–50 yr) living in Indiana participated in the study. Intervention(s) There were no interventions. Main Outcome Measure(s) The main outcome measures were SNP genotype distributions and their association with BMD at the femoral neck and lumbar spine. Results Significant association of spine BMD was found with three SNPs in men and one SNP in women (P ≤ 0.05). The conditional linkage analysis using the ESR2 haplotypes showed that the ESR2 gene accounts for, at most, 18% of the original linkage. Conclusions ESR2 polymorphisms are significantly associated with bone mass in both men and women. However, the ESR2 gene is not entirely responsible for our original linkage, and an additional gene(s) in chromosome 14q contributes to the determination of BMD. PMID:16118344

Identification of Pyrus single nucleotide polymorphisms (SNPs) and evaluation for genetic mapping in European pear and interspecific Pyrus hybrids.

PubMed

Montanari, Sara; Saeed, Munazza; Knäbel, Mareike; Kim, YoonKyeong; Troggio, Michela; Malnoy, Mickael; Velasco, Riccardo; Fontana, Paolo; Won, KyungHo; Durel, Charles-Eric; Perchepied, Laure; Schaffer, Robert; Wiedow, Claudia; Bus, Vincent; Brewer, Lester; Gardiner, Susan E; Crowhurst, Ross N; Chagné, David

2013-01-01

We have used new generation sequencing (NGS) technologies to identify single nucleotide polymorphism (SNP) markers from three European pear (Pyrus communis L.) cultivars and subsequently developed a subset of 1096 pear SNPs into high throughput markers by combining them with the set of 7692 apple SNPs on the IRSC apple Infinium® II 8K array. We then evaluated this apple and pear Infinium® II 9K SNP array for large-scale genotyping in pear across several species, using both pear and apple SNPs. The segregating populations employed for array validation included a segregating population of European pear ('Old Home'×'Louise Bon Jersey') and four interspecific breeding families derived from Asian (P. pyrifolia Nakai and P. bretschneideri Rehd.) and European pear pedigrees. In total, we mapped 857 polymorphic pear markers to construct the first SNP-based genetic maps for pear, comprising 78% of the total pear SNPs included in the array. In addition, 1031 SNP markers derived from apple (13% of the total apple SNPs included in the array) were polymorphic and were mapped in one or more of the pear populations. These results are the first to demonstrate SNP transferability across the genera Malus and Pyrus. Our construction of high density SNP-based and gene-based genetic maps in pear represents an important step towards the identification of chromosomal regions associated with a range of horticultural characters, such as pest and disease resistance, orchard yield and fruit quality.

Neuropeptide Y gene-by-psychosocial stress interaction effect is associated with obesity in a Korean population.

PubMed

Kim, Hyun-Jin; Min, Kyoung-Bok; Min, Jin-Young

2016-07-01

Chronic psychosocial stress is a crucial risk factor in the development of many diseases including obesity. Neuropeptide Y (NPY), distributed throughout the peripheral and central nervous system, is believed to pay a role in the pathophysiologic relationship between stress and obesity. Although several animal studies have investigated the impact on obesity of interactions between NPY single nucleotide polymorphisms (SNPs) and stress, the same remains to be analyzed in humans. To identify NPY gene-by-stress interaction effects on human obesity, we analyzed the interaction between four NPY SNPs and stress with obesity-related traits, including visceral adipose tissue (VAT). A total of 1468 adult subjects were included for this analysis. In a SNP-only model without interaction with stress, no significant SNPs were found (pSNP>0.05). However, NPY SNPs-by-stress interaction effects were significantly linked to body mass index (BMI), waist circumference, and VAT (pint<0.05), even though a significant interaction effect for rs16135 on BMI was not identified. These significant interaction effects were also detected in interaction results for the binary traits of obesity. Among the obesity traits, mean changes of VAT by increased stress levels in homozygous risk allele carriers were the greatest (range of mean increases for four SNPs (min-max)=12.57cm(2)-29.86cm(2)). This study suggests that common polymorphisms for NPY were associated with human obesity by interacting with psychosocial stress, emphasizing the need for stress management in obesity prevention. Copyright © 2016 Elsevier Ltd. All rights reserved.

Sequence Polymorphisms and Structural Variations among Four Grapevine (Vitis vinifera L.) Cultivars Representing Sardinian Agriculture

PubMed Central

Mercenaro, Luca; Nieddu, Giovanni; Porceddu, Andrea; Pezzotti, Mario; Camiolo, Salvatore

2017-01-01

The genetic diversity among grapevine (Vitis vinifera L.) cultivars that underlies differences in agronomic performance and wine quality reflects the accumulation of single nucleotide polymorphisms (SNPs) and small indels as well as larger genomic variations. A combination of high throughput sequencing and mapping against the grapevine reference genome allows the creation of comprehensive sequence variation maps. We used next generation sequencing and bioinformatics to generate an inventory of SNPs and small indels in four widely cultivated Sardinian grape cultivars (Bovale sardo, Cannonau, Carignano and Vermentino). More than 3,200,000 SNPs were identified with high statistical confidence. Some of the SNPs caused the appearance of premature stop codons and thus identified putative pseudogenes. The analysis of SNP distribution along chromosomes led to the identification of large genomic regions with uninterrupted series of homozygous SNPs. We used a digital comparative genomic hybridization approach to identify 6526 genomic regions with significant differences in copy number among the four cultivars compared to the reference sequence, including 81 regions shared between all four cultivars and 4953 specific to single cultivars (representing 1.2 and 75.9% of total copy number variation, respectively). Reads mapping at a distance that was not compatible with the insert size were used to identify a dataset of putative large deletions with cultivar Cannonau revealing the highest number. The analysis of genes mapping to these regions provided a list of candidates that may explain some of the phenotypic differences among the Bovale sardo, Cannonau, Carignano and Vermentino cultivars. PMID:28775732

Bioinformatic analyses to select phenotype affecting polymorphisms in HTR2C gene.

PubMed

Piva, Francesco; Giulietti, Matteo; Baldelli, Luisa; Nardi, Bernardo; Bellantuono, Cesario; Armeni, Tatiana; Saccucci, Franca; Principato, Giovanni

2011-08-01

Single nucleotide polymorphisms (SNPs) in serotonin related genes influence mental disorders, responses to pharmacological and psychotherapeutic treatments. In planning association studies, researchers that want to investigate new SNPs have to select some among a large number of candidates. Our aim is to guide researchers in the selection of the most likely phenotype affecting polymorphisms. Here, we studied serotonin receptor 2C (HTR2C) SNPs because, till now, only relatively few of about 2000 are investigated. We used the most updated and assessed bioinformatic tools to predict which variations can give rise to biological effects among 2450 HTR2C SNPs. We suggest 48 SNPs that are worth considering in future association studies in the field of psychiatry, psychology and pharmacogenomics. Moreover, our analyses point out the biological level probably affected, such as transcription, splicing, miRNA regulation and protein structure, thus allowing to suggest future molecular investigations. Although few association studies are available in literature, their results are in agreement with our predictions, showing that our selection methods can help to guide future association studies. Copyright © 2011 John Wiley & Sons, Ltd.

Association of PTPN22 Single Nucleotide Polymorphisms with Celiac Disease.

PubMed

Aflatounian, Majid; Rezaei, Arezou; Sadr, Maryam; Saghazadeh, Amene; Elhamian, Nazanin; Sadeghi, Hengameh; Motevasselian, Fatemeh; Farahmand, Fatemeh; Fallahi, Gholamhossein; Motamed, Farzaneh; Najafi, Mehri; Rezaei, Nima

2017-06-01

Celiac disease is a chronic autoimmune disease in which gene-environment interactions cause the immune system to unfavorably react to naturally gluten-containing foods. PTPN22 plays a crucial role in regulating the function of various cells of the immune system, particularly T cells. Polymorphisms of the PTPN22 gene have been associated with many autoimmune diseases. The present genetic association study was conducted to investigate the possible associations between PTPNTT single nucleotide polymorphisms (SNPs) and celiac disease in an Iranian population. The study population consisted of 45 patients with celiac disease and 93 healthy controls. The study genotyped five SNPs of the PTPN22 gene: rs12760457, rs1310182, rs1217414, rs33996649, and rs2476601. Control and patient groups did not differ on the genotype distribution of four of five investigated SNPs in the PTPN22 gene, for example, rs12760457, rs2476601, rs1217414, and rs33996649. The only investigated PTPN22 variant, which could be associated with CD, was rs1310182. A significant increase in the carriage of the T allele of rs1310182 in CD patients was observed (OR (95% CI) = 11.42 (5.41, 24.1), p value < 0.0001). The TT genotype of this SNP was significantly associated with celiac disease. Our study suggests that the rs1310182 SNP of PTPN22 gene may be a predisposing factor of celiac disease in the Iranian population. Further studies are required to investigate the issue in other racial and ethnic subgroups.

Penetrance of Polygenic Obesity Susceptibility Loci across the Body Mass Index Distribution.

PubMed

Abadi, Arkan; Alyass, Akram; Robiou du Pont, Sebastien; Bolker, Ben; Singh, Pardeep; Mohan, Viswanathan; Diaz, Rafael; Engert, James C; Yusuf, Salim; Gerstein, Hertzel C; Anand, Sonia S; Meyre, David

2017-12-07

A growing number of single-nucleotide polymorphisms (SNPs) have been associated with body mass index (BMI) and obesity, but whether the effects of these obesity-susceptibility loci are uniform across the BMI distribution remains unclear. We studied the effects of 37 BMI-associated SNPs in 75,230 adults of European ancestry across BMI percentiles by using conditional quantile regression (CQR) and meta-regression (MR) models. The effects of nine SNPs (24%)-rs1421085 (FTO; p = 8.69 × 10 -15 ), rs6235 (PCSK1; p = 7.11 × 10 -6 ), rs7903146 (TCF7L2; p = 9.60 × 10 -6 ), rs11873305 (MC4R; p = 5.08 × 10 -5 ), rs12617233 (FANCL; p = 5.30 × 10 -5 ), rs11672660 (GIPR; p = 1.64 × 10 -4 ), rs997295 (MAP2K5; p = 3.25 × 10 -4 ), rs6499653 (FTO; p = 6.23 × 10 -4 ), and rs3824755 (NT5C2; p = 7.90 × 10 -4 )-increased significantly across the sample BMI distribution. We showed that such increases stemmed from unadjusted gene interactions that enhanced the effects of SNPs in persons with a high BMI. When 125 height-associated SNPs were analyzed for comparison, only one (<1%), rs6219 (IGF1, p = 1.80 × 10 -4 ), showed effects that varied significantly across height percentiles. Cumulative gene scores of these SNPs (GS-BMI and GS-height) showed that only GS-BMI had effects that increased significantly across the sample distribution (BMI: p = 7.03 × 10 -37 ; height: p = 0.499). Overall, these findings underscore the importance of gene-gene and gene-environment interactions in shaping the genetic architecture of BMI and advance a method for detecting such interactions by using only the sample outcome distribution. Copyright © 2017 American Society of Human Genetics. Published by Elsevier Inc. All rights reserved.

GSTO and AS3MT genetic polymorphisms and differences in urinary arsenic concentrations among residents in Bangladesh.

PubMed

Rodrigues, Ema G; Kile, Molly; Hoffman, Elaine; Quamruzzaman, Quazi; Rahman, Mahmuder; Mahiuddin, Golam; Hsueh, Yumei; Christiani, David C

2012-05-01

We determined whether single nucleotide polymorphisms (SNPs) in the glutathione S-transferase omega (GSTO) and arsenic(III)methyltransferase (AS3MT) genes were associated with concentrations of urinary arsenic metabolites among 900 individuals without skin lesions in Bangladesh. Four SNPs were assessed in these genes. A pathway analysis evaluated the association between urinary arsenic metabolites and SNPs. GSTO1 rs4925 homozygous wild type was significantly associated with higher monomethylarsonic acid (MMA) and dimethylarsinic acid urinary concentrations, whereas wild-type AS3MT rs11191439 had significantly lower levels of As(III) and MMA. Genetic polymorphisms GSTO and As3MT modify arsenic metabolism as evidenced by altered urinary arsenic excretion.

Genetic polymorphisms in TERT are associated with increased risk of esophageal cancer.

PubMed

Wu, Yifei; Yan, Mengdan; Li, Jing; Li, Jingjie; Chen, Zhengshuai; Chen, Peng; Li, Bin; Chen, Fulin; Jin, Tianbo; Chen, Chao

2017-02-07

Single nucleotide polymorphisms (SNPs) in TERT may be associated with susceptibility to esophageal cancer. In this study, we analyzed the association between TERT SNPs and risk of esophageal cancer in 386 esophageal cancer patients and 495 healthy subjects from the Xi'an area of China. Of the four SNPs examined, rs10069690 and rs2242652 were correlated with esophageal cancer risk. Additionally, after adjusting for age and gender, the "Trs10069690Ars2242652", "Trs10069690Grs2242652" haplotypes were associated with an increased risk of esophageal cancer, while the and "Crs10069690Grs2242652" haplotype was associated with a decreased risk of esophageal cancer. These findings suggest that TERT polymorphisms may contribute to the development of esophageal cancer.

Ranking and characterization of established BMI and lipid associated loci as candidates for gene-environment interactions

PubMed Central

Luan, Jian'an; Mihailov, Evelin; Metspalu, Andres; Forouhi, Nita G.; Magnusson, Patrik K. E.; Pedersen, Nancy L.; Hallmans, Göran; Chu, Audrey Y.; Justice, Anne E.; Graff, Mariaelisa; Rose, Lynda M.; Langenberg, Claudia; Cupples, L. Adrienne; Ridker, Paul M.; Ong, Ken K.; Loos, Ruth J. F.; Chasman, Daniel I.; Ingelsson, Erik; Kilpeläinen, Tuomas O.; Scott, Robert A.; Mägi, Reedik

2017-01-01

Phenotypic variance heterogeneity across genotypes at a single nucleotide polymorphism (SNP) may reflect underlying gene-environment (G×E) or gene-gene interactions. We modeled variance heterogeneity for blood lipids and BMI in up to 44,211 participants and investigated relationships between variance effects (Pv), G×E interaction effects (with smoking and physical activity), and marginal genetic effects (Pm). Correlations between Pv and Pm were stronger for SNPs with established marginal effects (Spearman’s ρ = 0.401 for triglycerides, and ρ = 0.236 for BMI) compared to all SNPs. When Pv and Pm were compared for all pruned SNPs, only BMI was statistically significant (Spearman’s ρ = 0.010). Overall, SNPs with established marginal effects were overrepresented in the nominally significant part of the Pv distribution (Pbinomial <0.05). SNPs from the top 1% of the Pm distribution for BMI had more significant Pv values (PMann–Whitney = 1.46×10−5), and the odds ratio of SNPs with nominally significant (<0.05) Pm and Pv was 1.33 (95% CI: 1.12, 1.57) for BMI. Moreover, BMI SNPs with nominally significant G×E interaction P-values (Pint<0.05) were enriched with nominally significant Pv values (Pbinomial = 8.63×10−9 and 8.52×10−7 for SNP × smoking and SNP × physical activity, respectively). We conclude that some loci with strong marginal effects may be good candidates for G×E, and variance-based prioritization can be used to identify them. PMID:28614350

Association of Single-Nucleotide Polymorphisms of the Tau Gene With Late-Onset Parkinson Disease

PubMed Central

Martin, Eden R.; Scott, William K.; Nance, Martha A.; Watts, Ray L.; Hubble, Jean P.; Koller, William C.; Lyons, Kelly; Pahwa, Rajesh; Stern, Matthew B.; Colcher, Amy; Hiner, Bradley C.; Jankovic, Joseph; Ondo, William G.; Allen, Fred H.; Goetz, Christopher G.; Small, Gary W.; Masterman, Donna; Mastaglia, Frank; Laing, Nigel G.; Stajich, Jeffrey M.; Ribble, Robert C.; Booze, Michael W.; Rogala, Allison; Hauser, Michael A.; Zhang, Fengyu; Gibson, Rachel A.; Middleton, Lefkos T.; Roses, Allen D.; Haines, Jonathan L.; Scott, Burton L.; Pericak-Vance, Margaret A.; Vance, Jeffery M.

2013-01-01

Context The human tau gene, which promotes assembly of neuronal microtubules, has been associated with several rare neurologic diseases that clinically include parkinsonian features. We recently observed linkage in idiopathic Parkinson disease (PD) to a region on chromosome 17q21 that contains the tau gene. These factors make tau a good candidate for investigation as a susceptibility gene for idiopathic PD, the most common form of the disease. Objective To investigate whether the tau gene is involved in idiopathic PD. Design, Setting, and Participants Among a sample of 1056 individuals from 235 families selected from 13 clinical centers in the United States and Australia and from a family ascertainment core center, we tested 5 single-nucleotide polymorphisms (SNPs) within the tau gene for association with PD, using family-based tests of association. Both affected (n = 426) and unaffected (n = 579) family members were included; 51 individuals had unclear PD status. Analyses were conducted to test individual SNPs and SNP haplotypes within the tau gene. Main Outcome Measure Family-based tests of association, calculated using asymptotic distributions. Results Analysis of association between the SNPs and PD yielded significant evidence of association for 3 of the 5 SNPs tested: SNP 3, P = .03; SNP 9i, P = .04; and SNP 11, P = .04. The 2 other SNPs did not show evidence of significant association (SNP 9ii, P = .11, and SNP 9iii, P = .87). Strong evidence of association was found with haplotype analysis, with a positive association with one haplotype (P = .009) and a negative association with another haplotype (P = .007). Substantial linkage disequilibrium (P<.001) was detected between 4 of the 5 SNPs (SNPs 3,9i, 9ii, and 11). Conclusions This integrated approach of genetic linkage and positional association analyses implicates tau as a susceptibility gene for idiopathic PD. PMID:11710889

Association of LMX1A genetic polymorphisms with susceptibility to congenital scoliosis in Chinese Han population.

PubMed

Wu, Nan; Yuan, Suomao; Liu, Jiaqi; Chen, Jun; Fei, Qi; Liu, Sen; Su, Xinlin; Wang, Shengru; Zhang, Jianguo; Li, Shugang; Wang, Yipeng; Qiu, Guixing; Wu, Zhihong

2014-10-01

A genetic association study of single nucleotide polymorphisms (SNPs) for the LMX1A gene with congenital scoliosis (CS) in the Chinese Han population. To determine whether LMX1A genetic polymorphisms are associated with susceptibility to CS. CS is a lateral curvature of the spine due to congenital vertebral defects, whose exact genetic cause has not been well established. The LMX1A gene was suggested as a potential human candidate gene for CS. However, no genetic study of LMX1A in CS has ever been reported. We genotyped 13 SNPs of the LMX1A gene in 154 patients with CS and 144 controls with matched sex and age. After conducting the Hardy-Weinberg equilibrium test, the data of 13 SNPs were analyzed by the allelic and genotypic association with logistic regression analysis. Furthermore, the genotype-phenotype association and haplotype association analysis were also performed. The 13 SNPs of the LMX1A gene met Hardy-Weinberg equilibrium in the controls, which was not in the cases. None of the allelic and genotypic frequencies of these SNPs showed significant difference between case and control groups (P > 0.05). However, the genotypic frequencies of rs1354510 and rs16841013 in the LMX1A gene were associated with CS predisposition in the unconditional logistic regression analysis (P = 0.02 and 0.018, respectively). Genotypic frequencies of 3 SNPs at rs6671290, rs1354510, and rs16841013 were found to exhibit significant differences between patients with CS with failure of formation and the healthy controls (P = 0.019, 0.007, and 0.006, respectively). Besides, in the model analysis by using unconditional logistic regression analysis, the optimized model for the 3 genotypic positive SNPs with failure of formation were rs6671290 (codominant; P = 0.025, Akaike information value = 316.6, Bayesian information criterion = 333.9), rs1354510 (overdominant; P = 0.0017, Akaike information value = 312.1, Bayesian information criterion = 325.9), and rsl6841013 (overdominant; P = 0.0016, Akaike information value = 311.1, Bayesian information criterion = 325), respectively. However, the haplotype distributions in the case group were not significantly different from those of the control group in the 3 haplotype blocks. To our knowledge, this is the first study to identify that the SNPs of the LMX1A gene might be associated with the susceptibility to CS and different clinical phenotypes of CS in the Chinese Han population. 4.

Genetic polymorphisms and skin aging: the identification of population genotypic groups holds potential for personalized treatments.

PubMed

Naval, Jordi; Alonso, Vicente; Herranz, Miquel Angel

2014-01-01

Skin changes are among the most visible signs of aging. Skin properties such as hydration, elasticity, and antioxidant capacity play a key role in the skin aging process. Skin aging is a complex process influenced by heritable and environmental factors. Recent studies on twins have revealed that up to 60% of the skin aging variation between individuals can be attributed to genetic factors, while the remaining 40% is due to non-genetic factors. Recent advances in genomics and bioinformatics approaches have led to the association of certain single nucleotide polymorphisms (SNPs) to skin properties. Our aim was to classify individuals based on an ensemble of multiple polymorphisms associated with certain properties of the skin for providing personalized skin care and anti-aging therapies. We identified the key proteins and SNPs associated with certain properties of the skin that contribute to skin aging. We selected a set of 13 SNPs in gene coding for these proteins which are potentially associated with skin aging. Finally, we classified a sample of 120 female volunteers into ten clusters exhibiting different skin properties according to their genotypic signature. This is the first study that describes the actual frequency of genetic polymorphisms and their distribution in clusters involved in skin aging in a Caucasian population. Individuals can be divided into genetic clusters defined by genotypic variables. These genotypic variables are linked with polymorphisms in one or more genes associated with certain properties of the skin that contribute to a person's perceived age. Therefore, by using this classification, it is possible to characterize human skin care and anti-aging needs on the basis of an individual's genetic signature, thus opening the door to personalized treatments addressed at specific populations. This is part of an ongoing effort towards personalized anti-aging therapies combining genetic signatures with environmental and life style evaluations.

Genetic polymorphisms and skin aging: the identification of population genotypic groups holds potential for personalized treatments

PubMed Central

Naval, Jordi; Alonso, Vicente; Herranz, Miquel Angel

2014-01-01

Introduction Skin changes are among the most visible signs of aging. Skin properties such as hydration, elasticity, and antioxidant capacity play a key role in the skin aging process. Skin aging is a complex process influenced by heritable and environmental factors. Recent studies on twins have revealed that up to 60% of the skin aging variation between individuals can be attributed to genetic factors, while the remaining 40% is due to non-genetic factors. Recent advances in genomics and bioinformatics approaches have led to the association of certain single nucleotide polymorphisms (SNPs) to skin properties. Our aim was to classify individuals based on an ensemble of multiple polymorphisms associated with certain properties of the skin for providing personalized skin care and anti-aging therapies. Methods and results We identified the key proteins and SNPs associated with certain properties of the skin that contribute to skin aging. We selected a set of 13 SNPs in gene coding for these proteins which are potentially associated with skin aging. Finally, we classified a sample of 120 female volunteers into ten clusters exhibiting different skin properties according to their genotypic signature. Conclusion This is the first study that describes the actual frequency of genetic polymorphisms and their distribution in clusters involved in skin aging in a Caucasian population. Individuals can be divided into genetic clusters defined by genotypic variables. These genotypic variables are linked with polymorphisms in one or more genes associated with certain properties of the skin that contribute to a person’s perceived age. Therefore, by using this classification, it is possible to characterize human skin care and anti-aging needs on the basis of an individual’s genetic signature, thus opening the door to personalized treatments addressed at specific populations. This is part of an ongoing effort towards personalized anti-aging therapies combining genetic signatures with environmental and life style evaluations. PMID:25061327

Functional single nucleotide polymorphisms of matrix metalloproteinase 7 and 12 genes in idiopathic recurrent spontaneous abortion.

PubMed

Barišić, Anita; Pereza, Nina; Hodžić, Alenka; Kapović, Miljenko; Peterlin, Borut; Ostojić, Saša

2017-03-01

The aim of this study was to investigate the potential association of matrix metalloproteinase 7 (MMP7) -181 A/G and MMP12 -82 A/G functional single nucleotide polymorphisms (SNP) with idiopathic recurrent spontaneous abortion (IRSA) in Slovenian reproductive couples. A case-control study was conducted on 149 couples with 3 or more consecutive idiopathic spontaneous pregnancy loses and 149 women and men with at least 2 live births and no history of pregnancy complications. Genotyping of MMP7 -181 A/G and MMP12 -82 A/G SNPs was performed using polymerase chain reaction and restriction fragment length polymorphism methods. There were no statistically significant differences in the distribution of MMP7 -181 A/G and MMP12 -82 A/G genotype, allele, or haplotype frequencies between IRSA patients and controls, as well as patients' primary and secondary IRSA. We also found no association of MMP7 -181 A/G and MMP12 -82 A/G genotypes, alleles, and haplotypes with IRSA. We found no evidence to support the association between IRSA and MMP7 -181 A/G and MMP12 -82 A/G SNPs in Slovenian reproductive couples.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Chen, Pei-Chun; Chen, Yen-Ching; Research Center for Gene, Environment, and Human Health, College of Public Health, National Taiwan University, Taiwan

Purpose: To identify germline polymorphisms to predict concurrent chemoradiation therapy (CCRT) response in esophageal cancer patients. Materials and Methods: A total of 139 esophageal cancer patients treated with CCRT (cisplatin-based chemotherapy combined with 40 Gy of irradiation) and subsequent esophagectomy were recruited at the National Taiwan University Hospital between 1997 and 2008. After excluding confounding factors (i.e., females and patients aged {>=}70 years), 116 patients were enrolled to identify single nucleotide polymorphisms (SNPs) associated with specific CCRT responses. Genotyping arrays and mass spectrometry were used sequentially to determine germline polymorphisms from blood samples. These polymorphisms remain stable throughout disease progression,more » unlike somatic mutations from tumor tissues. Two-stage design and additive genetic models were adopted in this study. Results: From the 26 SNPs identified in the first stage, 2 SNPs were found to be significantly associated with CCRT response in the second stage. Single nucleotide polymorphism rs16863886, located between SGPP2 and FARSB on chromosome 2q36.1, was significantly associated with a 3.93-fold increase in pathologic complete response to CCRT (95% confidence interval 1.62-10.30) under additive models. Single nucleotide polymorphism rs4954256, located in ZRANB3 on chromosome 2q21.3, was associated with a 3.93-fold increase in pathologic complete response to CCRT (95% confidence interval 1.57-10.87). The predictive accuracy for CCRT response was 71.59% with these two SNPs combined. Conclusions: This is the first study to identify germline polymorphisms with a high accuracy for predicting CCRT response in the treatment of esophageal cancer.« less

MAFsnp: A Multi-Sample Accurate and Flexible SNP Caller Using Next-Generation Sequencing Data

PubMed Central

Hu, Jiyuan; Li, Tengfei; Xiu, Zidi; Zhang, Hong

2015-01-01

Most existing statistical methods developed for calling single nucleotide polymorphisms (SNPs) using next-generation sequencing (NGS) data are based on Bayesian frameworks, and there does not exist any SNP caller that produces p-values for calling SNPs in a frequentist framework. To fill in this gap, we develop a new method MAFsnp, a Multiple-sample based Accurate and Flexible algorithm for calling SNPs with NGS data. MAFsnp is based on an estimated likelihood ratio test (eLRT) statistic. In practical situation, the involved parameter is very close to the boundary of the parametric space, so the standard large sample property is not suitable to evaluate the finite-sample distribution of the eLRT statistic. Observing that the distribution of the test statistic is a mixture of zero and a continuous part, we propose to model the test statistic with a novel two-parameter mixture distribution. Once the parameters in the mixture distribution are estimated, p-values can be easily calculated for detecting SNPs, and the multiple-testing corrected p-values can be used to control false discovery rate (FDR) at any pre-specified level. With simulated data, MAFsnp is shown to have much better control of FDR than the existing SNP callers. Through the application to two real datasets, MAFsnp is also shown to outperform the existing SNP callers in terms of calling accuracy. An R package “MAFsnp” implementing the new SNP caller is freely available at http://homepage.fudan.edu.cn/zhangh/softwares/. PMID:26309201

Genetic dissection of agronomically important traits in closely related temperate japonica rice cultivars

PubMed Central

Hori, Kiyosumi; Yamamoto, Toshio; Yano, Masahiro

2017-01-01

Many quantitative trait loci (QTLs) for agronomically important traits such as grain yield, disease resistance, and stress tolerance of rice (Oryza sativa L.) have been detected by using segregating populations derived from crosses between indica and japonica subspecies or with wild relatives. However, the QTLs involved in the control of natural variation in agronomic traits among closely related cultivars are still unclear. Decoding the whole genome sequences of Nipponbare and other temperate japonica rice cultivars has accelerated the collection of a huge number of single nucleotide polymorphisms (SNPs). These SNPs are good resource for developing polymorphic DNA markers and for detecting QTLs distributed across all rice chromosomes. The temperate japonica rice cultivar Koshihikari has remained the top cultivar for about 40 years since 1979 in Japan. Unraveling the genetic factors in Koshihikari will provide important insights into improving agronomic traits in temperate japonica rice cultivars. Here we describe recent progress in our studies as an example of genetic analysis in closely related cultivars. PMID:29398936

Candidate gene association analysis for milk yield, composition, urea nitrogen and somatic cell scores in Brown Swiss cows.

PubMed

Cecchinato, A; Ribeca, C; Chessa, S; Cipolat-Gotet, C; Maretto, F; Casellas, J; Bittante, G

2014-07-01

The aim of this study was to investigate 96 single-nucleotide polymorphisms (SNPs) from 54 candidate genes, and test the associations of the polymorphic SNPs with milk yield, composition, milk urea nitrogen (MUN) content and somatic cell score (SCS) in individual milk samples from Italian Brown Swiss cows. Milk and blood samples were collected from 1271 cows sampled once from 85 herds. Milk production, quality traits (i.e. protein, casein, fat and lactose percentages), MUN and SCS were measured for each milk sample. Genotyping was performed using a custom Illumina VeraCode GoldenGate approach. A Bayesian linear animal model that considered the effects of herd, days in milk, parity, SNP genotype and additive polygenic effect was used for the association analysis. Our results showed that 14 of the 51 polymorphic SNPs had relevant additive effects on at least one of the aforementioned traits. Polymorphisms in the glucocorticoid receptor DNA-binding factor 1 (GRLF1), prolactin receptor (PRLR) and chemokine ligand 2 (CCL2) were associated with milk yield; an SNP in the stearoyl-CoA desaturase (SCD-1) was related to fat content; SNPs in the caspase recruitment domain 15 protein (CARD15) and lipin 1 (LPIN1) affected the protein and casein contents; SNPs in growth hormone 1 (GH1), lactotransferrin (LTF) and SCD-1 were relevant for casein number; variants in beta casein (CSN2), GH1, GRLF1 and LTF affected lactose content; SNPs in beta-2 adrenergic receptor (ADRB2), serpin peptidase inhibitor (PI) and SCD-1 were associated with MUN; and SNPs in acetyl-CoA carboxylase alpha (ACACA) and signal transducer and activator of transcription 5A (STAT5A) were relevant in explaining the variation of SCS. Although further research is needed to validate these SNPs in other populations and breeds, the association between these markers and milk yield, composition, MUN and SCS could be exploited in gene-assisted selection programs for genetic improvement purposes.

Genetic Polymorphisms are Associated with Hair, Blood, and Urine Mercury Levels in the American Dental Association (ADA) Study Participants

PubMed Central

Parajuli, Rajendra Prasad; Goodrich, Jaclyn M.; Chou, Hwai-Nan; Gruninger, Stephen E.; Dolinoy, Dana C.; Franzblau, Alfred; Basu, Niladri

2015-01-01

Background/Aims Mercury (Hg) is a potent toxicant of concern to the general public. Recent studies suggest that several genes that mediate Hg metabolism are polymorphic. We hypothesize that single nucleotide polymorphisms (SNPs) in such genes may underline inter-individual differences in exposure biomarker concentrations. Methods Dental professionals were recruited during the American Dental Association (ADA) 2012 Annual Meeting. Samples of hair, blood, and urine were collected for quantifying Hg levels and genotyping (88 SNPs in classes relevant to Hg toxicokinetics including glutathione metabolism, selenoproteins, metallothioneins, and xenobiotic transporters). Questionnaires were administrated to obtain information on demographics and sources of Hg exposure (e.g., fish consumption and use of dental amalgam). Here, we report results for 380 participants with complete genotype and Hg biomarker datasets. ANOVA and linear regressions were used for statistical analysis. Results Mean (geometric) Hg levels in hair (hHg), blood (bHg), urine (uHg), and the average estimated Hg intake from fish were 0.62μg/g, 3.75μg/L, 1.32μg/L, and 0.12μg/kg body weight/day, respectively. Out of 88 SNPs successfully genotyped, Hg biomarker levels differed by genotype for 25 SNPs, one of which remained significant following Bonferroni correction in ANOVA. When the associations between sources of Hg exposure and SNPs were analyzed with respect to Hg biomarker concentrations, 38 SNPs had significant main effects and/or gene-Hg exposure source interactions. Twenty-five, 23, and four SNPs showed significant main effects and/or interactions for hHg, bHg, and uHg levels, respectively (p<0.05), and six SNPs (in GCLC, MT1M, MT4, ATP7B, and BDNF) remained significant following Bonferroni correction. Conclusion The findings suggest that polymorphisms in environmentally-responsive genes can influence Hg biomarker levels. Hence, consideration of such gene-environment factors may improve the ability to assess the health risks of Hg more precisely. PMID:26673400

The effects of single nucleotide polymorphisms (SNPs) of calpastatin (CAST) gene on meat tenderness of yak.

USDA-ARS?s Scientific Manuscript database

The association of single nucleotide polymorphisms (SNPs) of calpastatin (CAST) gene with shear force of 2.54 cm steaks from M. longissimus dorsi from Gannan yaks (Bos grunniens, n=181) was studied. Yaks were harvested at 2, 3, and 4 yr of age (n=51, 59, and 71, respectively), and samples of each ya...

CLC-2 single nucleotide polymorphisms (SNPs) as potential modifiers of cystic fibrosis disease severity

PubMed Central

Blaisdell, Carol J; Howard, Timothy D; Stern, Augustus; Bamford, Penelope; Bleecker, Eugene R; Stine, O Colin

2004-01-01

Background Cystic fibrosis (CF) lung disease manifest by impaired chloride secretion leads to eventual respiratory failure. Candidate genes that may modify CF lung disease severity include alternative chloride channels. The objectives of this study are to identify single nucleotide polymorphisms (SNPs) in the airway epithelial chloride channel, CLC-2, and correlate these polymorphisms with CF lung disease. Methods The CLC-2 promoter, intron 1 and exon 20 were examined for SNPs in adult CF dF508/dF508 homozygotes with mild and severe lung disease (forced expiratory volume at one second (FEV1) > 70% and < 40%). Results PCR amplification of genomic CLC-2 and sequence analysis revealed 1 polymorphism in the hClC -2 promoter, 4 in intron 1, and none in exon 20. Fisher's analysis within this data set, did not demonstrate a significant relationship between the severity of lung disease and SNPs in the CLC-2 gene. Conclusions CLC-2 is not a key modifier gene of CF lung phenotype. Further studies evaluating other phenotypes associated with CF may be useful in the future to assess the ability of CLC-2 to modify CF disease severity. PMID:15507145

Accumulation of slightly deleterious mutations in the mitochondrial genome: a hallmark of animal domestication.

PubMed

Hughes, Austin L

2013-02-15

The hypothesis that domestication leads to a relaxation of purifying selection on mitochondrial (mt) genomes was tested by comparative analysis of mt genes from dog, pig, chicken, and silkworm. The three vertebrate species showed mt genome phylogenies in which domestic and wild isolates were intermingled, whereas the domestic silkworm (Bombyx mori) formed a distinct cluster nested within its closest wild relative (Bombyx mandarina). In spite of these differences in phylogenetic pattern, significantly greater proportions of nonsynonymous SNPs than of synonymous SNPs were unique to the domestic populations of all four species. Likewise, in all four species, significantly greater proportions of RNA-encoding SNPs than of synonymous SNPs were unique to the domestic populations. Thus, domestic populations were characterized by an excess of unique polymorphisms in two categories generally subject to purifying selection: nonsynonymous sites and RNA-encoding sites. Many of these unique polymorphisms thus seem likely to be slightly deleterious; the latter hypothesis was supported by the generally lower gene diversities of polymorphisms unique to domestic populations in comparison to those of polymorphisms shared by domestic and wild populations. Copyright © 2012 Elsevier B.V. All rights reserved.

Association between long non-coding RNA polymorphisms and cancer risk: a meta-analysis.

PubMed

Huang, Xin; Zhang, Weiyue; Shao, Zengwu

2018-05-25

Several studies have suggested that long non-coding RNA (lncRNA) gene polymorphisms are associated with cancer risk. In the present study, we conducted a meta-analysis related to studies on the association between lncRNA single-nucleotide polymorphisms (SNPs) and the overall risk of cancer. A total 12 SNPs in five common lncRNA genes were finally included in the meta-analysis. In the lncRNA antisense noncoding RNA in the INK4 locus (ANRIL), the rs1333048 A/C, rs4977574 A/G, and rs10757278 A/G polymorphisms, but not rs1333045 C/T, were correlated with overall cancer risk. Our study also demonstrated that other SNPs were correlated with overall cancer risk, namely, metastasis-associated lung adenocarcinoma transcript 1 (MALAT1, rs619586 A/G), HOXA distal transcript antisense RNA (HOTTIP, rs1859168 A/C) and highly up-regulated in liver cancer (HULC, rs7763881 A/C). Moreover, four prostate cancer‑associated non‑coding RNA 1 (PRNCR1, rs16901946 G/A, rs13252298 G/A, rs1016343 T/C, and rs1456315 G/A) SNPs were in association with cancer risk. No association was found between the PRNCR1 (rs7007694 C/T) SNP and the risk of cancer. In conclusion, our results suggest that several studied lncRNA SNPs are associated with overall cancer risk. Therefore, they might be potential predictive biomarkers for the risk of cancer. More studies based on larger sample sizes and more lncRNA SNPs are warranted to confirm these findings. ©2018 The Author(s).

Single-nucleotide polymorphisms g.151435C>T and g.173057T>C in PRLR gene regulated by bta-miR-302a are associated with litter size in goats.

PubMed

An, Xiaopeng; Hou, Jinxing; Gao, Teyang; Lei, Yingnan; Li, Guang; Song, Yuxuan; Wang, Jiangang; Cao, Binyun

2015-06-01

Single-nucleotide polymorphisms (SNPs) located at microRNA-binding sites (miR-SNPs) can affect the expression of genes. This study aimed to identify the miR-SNPs associated with litter size. Guanzhong (n = 321) and Boer (n = 191) goat breeds were used to detect SNPs in the caprine prolactin receptor (PRLR) gene by DNA sequencing, primer-introduced restriction analysis-polymerase chain reaction, and polymerase chain reaction-restriction fragment length polymorphism. Three novel SNPs (g.151435C>T, g.151454A>G, and g.173057T>C) were identified in the caprine PRLR gene. Statistical results indicated that the g.151435C>T and g.173057T>C SNPs were significantly associated with litter size in Guanzhong and Boer goat breeds. Further analysis revealed that combinative genotype C6 (TTAACC) was better than the others for litter size in both goat breeds. Furthermore, the PRLR g.173057T>C polymorphism was predicted to regulate the binding activity of bta-miR-302a. Luciferase reporter gene assay confirmed that 173057C to T substitution disrupted the binding site for bta-miR-302a, resulting in the reduced levels of luciferase. Taken together, these findings suggested that bta-miR-302a can influence the expression of PRLR protein by binding with 3'untranslated region, resulting in that the g.173057T>C SNP had significant effects on litter size. Copyright © 2015 Elsevier Inc. All rights reserved.

Identification of Pyrus Single Nucleotide Polymorphisms (SNPs) and Evaluation for Genetic Mapping in European Pear and Interspecific Pyrus Hybrids

PubMed Central

Troggio, Michela; Malnoy, Mickael; Velasco, Riccardo; Fontana, Paolo; Won, KyungHo; Durel, Charles-Eric; Perchepied, Laure; Schaffer, Robert; Wiedow, Claudia; Bus, Vincent; Brewer, Lester; Gardiner, Susan E.; Crowhurst, Ross N.; Chagné, David

2013-01-01

We have used new generation sequencing (NGS) technologies to identify single nucleotide polymorphism (SNP) markers from three European pear (Pyrus communis L.) cultivars and subsequently developed a subset of 1096 pear SNPs into high throughput markers by combining them with the set of 7692 apple SNPs on the IRSC apple Infinium® II 8K array. We then evaluated this apple and pear Infinium® II 9K SNP array for large-scale genotyping in pear across several species, using both pear and apple SNPs. The segregating populations employed for array validation included a segregating population of European pear (‘Old Home’בLouise Bon Jersey’) and four interspecific breeding families derived from Asian (P. pyrifolia Nakai and P. bretschneideri Rehd.) and European pear pedigrees. In total, we mapped 857 polymorphic pear markers to construct the first SNP-based genetic maps for pear, comprising 78% of the total pear SNPs included in the array. In addition, 1031 SNP markers derived from apple (13% of the total apple SNPs included in the array) were polymorphic and were mapped in one or more of the pear populations. These results are the first to demonstrate SNP transferability across the genera Malus and Pyrus. Our construction of high density SNP-based and gene-based genetic maps in pear represents an important step towards the identification of chromosomal regions associated with a range of horticultural characters, such as pest and disease resistance, orchard yield and fruit quality. PMID:24155917

Pharmacogenetic association between GSTP1 genetic polymorphism and febrile neutropenia in Japanese patients with early breast cancer.

PubMed

Sugishita, Mihoko; Imai, Tsuneo; Kikumori, Toyone; Mitsuma, Ayako; Shimokata, Tomoya; Shibata, Takashi; Morita, Sachi; Inada-Inoue, Megumi; Sawaki, Masataka; Hasegawa, Yoshinori; Ando, Yuichi

2016-03-01

Genetic risk factors for febrile neutropenia (FN), the major adverse event of perioperative chemotherapy for early breast cancer, remain unclear. This study retrospectively explored pharmacogenetic associations of single nucleotide polymorphisms (SNPs) of the uridine glucuronosyltransferase 2B7 (UGT2B7, rs7668258), glutathione-S-transferase pi 1 (GSTP1, rs1695), and microcephalin 1 (MCPH1, rs2916733) genes with chemotherapy-related adverse events in 102 Japanese women who received epirubicin and cyclophosphamide as perioperative chemotherapy for early breast cancer. The allele frequencies for all of the SNPs were in concordance with the Hap-Map data of Japanese individuals. Among the 24 patients who had FN at least once during all courses of chemotherapy, 23 had the A/A genotype, and 1 had the A/G genotype of the GSTP1 polymorphism (rs1695, P = 0.001); 23 of the 70 patients with the A/A genotype had FN, as compared with only 1 of the 32 patients with the A/G and G/G genotypes. The genotype distributions of the UGT2B7 and MCPH1 polymorphisms did not differ between the patients who had FN or grade 3/4 neutropenia and those who did not. Among Japanese women who received epirubicin and cyclophosphamide as perioperative chemotherapy for early breast cancer, those with the A/A genotype of the GSTP1 polymorphism (rs1695) were more likely to have FN.

No association between catechol-O-methyltransferase polymorphisms and neurotic disorders among mainland Chinese university students.

PubMed

Kou, Changgui; Meng, Xiangfei; Xie, Bing; Shi, Jieping; Yu, Qiong; Yu, Yaqin; D'Arcy, Carl

2012-07-30

This study investigates the genetic association between catechol-O-methyltransferase (COMT) gene polymorphisms and neurotic disorders. Data were derived from a case-control association study of 255 undergraduates affected by neurotic disorders and 269 matched healthy undergraduate controls. The polymorphisms of eight tag single nucleotide polymorphisms (SNPs) on the COMT gene were tested using polymerase chain reaction (PCR)-based Ligase Detection Reaction (PCR-LDR). The eight tag SNPs on the COMT gene assessed were not associated with neurotic disorders. Our finding suggests that the COMT gene may not be a susceptibility gene for neurotic disorders. Copyright © 2012 Elsevier Ltd. All rights reserved.

Correlation between the development of calcium oxalate stones and polymorphisms in the fibronectin gene in the Uighur population of the Xinjiang region of China.

PubMed

Murat, M; Aekeper, A; Yuan, L Y; Alim, T; Du, G J; Abdusamat, A; Wu, G W; Aniwer, Y

2015-10-29

Here, we have investigated the correlation between calcium oxalate stone formation and Fn gene polymorphisms in urinary calculi patients among the Uighur population (Xinjiang region). In this case control study, genomic DNA extracted from the peripheral blood of 129 patients with calcium oxalate stones (patient group) and 94 normal people (control group) was used to genotype polymorphisms in the rs6725958, rs10202709, and rs35343655 sites of the Fn gene by polymerase chain reaction-restriction fragment length polymorphism. Subsequently, the association between different genotypes and susceptibility to calcium oxalate stone formation was compared among the patient and control groups. Single nucleotide polymorphisms (SNPs) were detected in the rs6725958, rs10202709, and rs35343655 sites of the Fn gene among the patient and control groups. The genotype distributions of the three loci complied with the Hardy-Weinberg equilibrium. The results of allele frequencies of the patient/control group for polymorphisms in the rs6725958 site of the Fn gene were C = 179 (69.92%)/119 (63.30%) and A = 77 (30.08%)/69 (36.70%), in the rs10202709 site were C = 245 (95.70%)/176 (93.63%) and T = 11 (4.30%)/12 (6.38%), and in the rs35343655 site of the Fn gene were A = 139 (54.30%)/87 (46.28%) and G = 117 (45.70%)/101 (53.72%). We observed no significant differences between the three SNPs and development of calcium oxalate stones. Polymorphisms in rs6725958, rs10202709, and rs35343655 of the Fn gene had no obvious effect on the susceptibility to the development of calcium oxalate stones in the Uighur population, residing in the Xinjiang region of China.

Potential relationship between single nucleotide polymorphisms used in forensic genetics and diseases or other traits in European population.

PubMed

Pombar-Gomez, Maria; Lopez-Lopez, Elixabet; Martin-Guerrero, Idoia; Garcia-Orad Carles, Africa; de Pancorbo, Marian M

2015-05-01

Single nucleotide polymorphisms (SNPs) are an interesting option to facilitate the analysis of highly degraded DNA by allowing the reduction of the size of the DNA amplicons. The SNPforID 52-plex panel is a clear example of the use of non-coding SNPs in forensic genetics. However, nonstop advances in studies of genetic polymorphisms are leading to the discovery of new associations between SNPs and diseases. The aim of this study was to perform a comprehensive review of the state of association between the 52 SNPs in the 52-plex panel and diseases or other traits related to their treatment, such as drug response characters. In order to achieve this goal, we have conducted a bioinformatic search for each SNP included in the panel and the SNPs in linkage disequilibrium (LD) with them in the European population (r (2)  > 0.8). A total of 424 SNPs (52 in the panel and 372 in LD) were investigated in PubMed, Scopus, and dbSNP databases. Our results show that three SNPs in the SNPforID 52-plex panel (rs2107612, rs1979255, rs1463729) have been associated with diseases such as hypertension or macular degeneration, as well as drug response. Similarly, three out of the 372 SNPs in LD (rs2107614, r (2)  = 0.859; rs765250, r (2)  = 0.858; rs11064560, r (2)  = 0,887) are also associated with various pathologies. In view of these results, we propose the need for a periodic review of the SNPs used in forensic genetics in order to keep their associations with diseases or related phenotypes updated and to evaluate their continuity in forensic panels for avoiding legal and ethical conflicts.

Significant SNPs have limited prediction ability for thyroid cancer

PubMed Central

Guo, Shicheng; Wang, Yu-Long; Li, Yi; Jin, Li; Xiong, Momiao; Ji, Qing-Hai; Wang, Jiucun

2014-01-01

Recently, five thyroid cancer significantly associated genetic variants (rs965513, rs944289, rs116909374, rs966423, and rs2439302) have been discovered and validated in two independent GWAS and numerous case–control studies, which were conducted in different populations. We genotyped the above five single nucleotide polymorphisms (SNPs) in Han Chinese populations and performed thyroid cancer-risk predictions with nine machine learning methods. We found that four SNPs were significantly associated with thyroid cancer in Han Chinese population, while no polymorphism was observed for rs116909374. Small familial relative risks (1.02–1.05) and limited power to predict thyroid cancer (AUCs: 0.54–0.60) indicate limited clinical potential. Four significant SNPs have limited prediction ability for thyroid cancer. PMID:24591304

Physiological Study on Association between Nicotinamide N-Methyltransferase Gene Polymorphisms and Hyperlipidemia

PubMed Central

Zhu, Xiao-Juan; Lin, Ya-Jun; Chen, Wei; Wang, Ya-Hui; Qiu, Li-Qiang; Cai, Can-Xin; Xiong, Qun; Chen, Fei; Chen, Li-Hui; Zhou, Qiong

2016-01-01

Nicotinamide N-methyltransferase (NNMT) catalyzes the methylation of nicotinamide. Our previous works indicate that NNMT is involved in the body mass index and energy metabolism, and recently the association between a SNP (rs694539) of NNMT and a variety of cardiovascular diseases was reported. At present, more than 200 NNMT single nucleotide polymorphisms (SNPs) have been identified in the databases of the human genome projects; however, the association between rs694539 variation and hyperlipidemia has not been reported yet, and whether there are any SNPs in NNMT significantly associated with hyperlipidemia is still unclear. In this paper, we selected 19 SNPs in NNMT as the tagSNPs using Haploview software (Haploview 4.2) first and then performed a case-control study to observe the association between these tagSNPs and hyperlipidemia and finally applied physiological approaches to explore the possible mechanisms through which the NNMT polymorphism induces hyperlipidemia. The results show that a SNP (rs1941404) in NNMT is significantly associated with hyperlipidemia, and the influence of rs1941404 variation on the resting energy expenditure may be the possible mechanism for rs1941404 variation to induce hyperlipidemia. PMID:27999813

Significant association of APOA5 and APOC3 gene polymorphisms with meat quality traits in Kele pigs.

PubMed

Hui, Y T; Yang, Y Q; Liu, R Y; Zhang, Y Y; Xiang, C J; Liu, Z Z; Ding, Y H; Zhang, Y L; Wang, B R

2013-09-13

Apolipoprotein A5 (APOA5) and C3 (APOC3) genes are involved in the PPAR lipid metabolism pathway and thus associated with elevated triglyceride levels. However, whether APOA5 and APOC3 genetic polymorphisms affect intramuscular fat deposition and other meat quality traits remains unknown in pigs. One hundred and seventy-one Kele pigs were sampled to investigate genetic variants in the APOA5 and APOC3 genes and their association with seven pork quality traits. We identified 5 single nucleotide polymorphisms (SNPs) in the promoter region of the APOA5 gene and 17 SNPs in the APOC3 gene. Linkage disequilibrium analysis revealed 5 complete linkage disequilibria among these 22 SNPs. We found that 10 SNPs were significantly correlated with meat quality traits, including the mutation A5/-769 in the APOA5 gene, which was significantly associated with cooked weight percentage, and 9 SNPs in the APOC3 gene that were significantly associated with drip loss rate, meat color value of longissimus dorsi muscle and shear force. Therefore, these SNP markers will be useful for marker-assisted selection for improved pork quality.

Efficient selection of tagging single-nucleotide polymorphisms in multiple populations.

PubMed

Howie, Bryan N; Carlson, Christopher S; Rieder, Mark J; Nickerson, Deborah A

2006-08-01

Common genetic polymorphism may explain a portion of the heritable risk for common diseases, so considerable effort has been devoted to finding and typing common single-nucleotide polymorphisms (SNPs) in the human genome. Many SNPs show correlated genotypes, or linkage disequilibrium (LD), suggesting that only a subset of all SNPs (known as tagging SNPs, or tagSNPs) need to be genotyped for disease association studies. Based on the genetic differences that exist among human populations, most tagSNP sets are defined in a single population and applied only in populations that are closely related. To improve the efficiency of multi-population analyses, we have developed an algorithm called MultiPop-TagSelect that finds a near-minimal union of population-specific tagSNP sets across an arbitrary number of populations. We present this approach as an extension of LD-select, a tagSNP selection method that uses a greedy algorithm to group SNPs into bins based on their pairwise association patterns, although the MultiPop-TagSelect algorithm could be used with any SNP tagging approach that allows choices between nearly equivalent SNPs. We evaluate the algorithm by considering tagSNP selection in candidate-gene resequencing data and lower density whole-chromosome data. Our analysis reveals that an exhaustive search is often intractable, while the developed algorithm can quickly and reliably find near-optimal solutions even for difficult tagSNP selection problems. Using populations of African, Asian, and European ancestry, we also show that an optimal multi-population set of tagSNPs can be substantially smaller (up to 44%) than a typical set obtained through independent or sequential selection.

Transcriptome characterization and polymorphism detection between subspecies of big sagebrush (Artemisia tridentata)

PubMed Central

2011-01-01

Background Big sagebrush (Artemisia tridentata) is one of the most widely distributed and ecologically important shrub species in western North America. This species serves as a critical habitat and food resource for many animals and invertebrates. Habitat loss due to a combination of disturbances followed by establishment of invasive plant species is a serious threat to big sagebrush ecosystem sustainability. Lack of genomic data has limited our understanding of the evolutionary history and ecological adaptation in this species. Here, we report on the sequencing of expressed sequence tags (ESTs) and detection of single nucleotide polymorphism (SNP) and simple sequence repeat (SSR) markers in subspecies of big sagebrush. Results cDNA of A. tridentata sspp. tridentata and vaseyana were normalized and sequenced using the 454 GS FLX Titanium pyrosequencing technology. Assembly of the reads resulted in 20,357 contig consensus sequences in ssp. tridentata and 20,250 contigs in ssp. vaseyana. A BLASTx search against the non-redundant (NR) protein database using 29,541 consensus sequences obtained from a combined assembly resulted in 21,436 sequences with significant blast alignments (≤ 1e-15). A total of 20,952 SNPs and 119 polymorphic SSRs were detected between the two subspecies. SNPs were validated through various methods including sequence capture. Validation of SNPs in different individuals uncovered a high level of nucleotide variation in EST sequences. EST sequences of a third, tetraploid subspecies (ssp. wyomingensis) obtained by Illumina sequencing were mapped to the consensus sequences of the combined 454 EST assembly. Approximately one-third of the SNPs between sspp. tridentata and vaseyana identified in the combined assembly were also polymorphic within the two geographically distant ssp. wyomingensis samples. Conclusion We have produced a large EST dataset for Artemisia tridentata, which contains a large sample of the big sagebrush leaf transcriptome. SNP mapping among the three subspecies suggest the origin of ssp. wyomingensis via mixed ancestry. A large number of SNP and SSR markers provide the foundation for future research to address questions in big sagebrush evolution, ecological genetics, and conservation using genomic approaches. PMID:21767398

Comparison of genetic variations of the SLCO1B1, SLCO1B3, and SLCO2B1 genes among five ethnic groups.

PubMed

Namgoong, Suhg; Cheong, Hyun Sub; Kim, Ji On; Kim, Lyoung Hyo; Na, Han Sung; Koh, In Song; Chung, Myeon Woo; Shin, Hyoung Doo

2015-11-01

Organic anion-transporting polypeptide (OATP; gene symbol, SLCO) transporters are generally involved in the uptake of multiple drugs and their metabolites at most epithelial barriers. The pattern of single-nucleotide polymorphisms (SNPs) in these transporters may be determinants of interindividual variability in drug disposition and response. The objective of this study was to define the distribution of SNPs of three SLCO genes, SLCO1B1, SLCO1B3, and SLCO2B1, in a Korean population and other ethnic groups. The study was screened using the Illumina GoldenGate assay for genomic DNA from 450 interethnic subjects, including 11 pharmacogenetic core variants and 76 HapMap tagging SNPs. The genotype distribution of the Korean population was similar to East Asian populations, but significantly different from African American and European American cohorts. These interethnic differences will be useful information for prospective studies, including genetic association and pharmacogenetic studies of drug metabolism by SLCO families. Copyright © 2015 Elsevier B.V. All rights reserved.

Association between PPAP2B gene polymorphisms and coronary heart disease susceptibility in Chinese Han males and females.

PubMed

Sun, Yu-Xiao; Gao, Chuan-Yu; Lu, Yang; Fu, Xin; Jia, Jun-Ge; Zhao, Yu-Jie; Li, Lian-Dong; Dui, Hong-Zhi; Zhang, Xing-Yu; Li, Zhi-Ying; Lei, Lei; Zhang, Wei-Feng; Yuan, Yi-Qiang

2017-02-21

Little is known about gender-related differences in the association between PPAP2B single nucleotide polymorphisms (SNPs) and coronary heart disease (CHD) in Chinese Han males and females. We therefore conducted a case-control study with 456 cases and 685 healthy controls divided into male and female subgroups. Five PPAP2B polymorphisms (SNPs) were selected and genotyped using Sequenom Mass-ARRAY technology. Odds ratios (OR) and 95% confidence intervals (CIs) were calculated using unconditional logistic regression adjusting for age and gender. Allelic model analysis revealed that for PPAP2B rs1759752, allele frequency distributions differed between cases and controls in the male subgroup (p = 0.015, OR: 1.401, 95%CI: 1.066-1.481). Genetic model analysis revealed that in the male subgroup, rs1759752 was associated with increased CHD risk in the dominant model (p = 0.035) and overdominant model (p = 0.045). In the female subgroup, rs12566304 was associated with a decreased CHD risk in the codominant model (p = 0.038) and overdominant model (p = 0.031). Additionally, the "GC" haplotypes of rs1759752 and rs1930760 were protective against CHD in males. These observations shed new light on gender-related differences in the association between PPAP2B gene polymorphisms and CHD susceptibility in the Chinese Han population.

Nucleotide polymorphisms in a pine ortholog of the Arabidopsis degrading enzyme cellulase KORRIGAN are associated with early growth performance in Pinus pinaster.

PubMed

Cabezas, José Antonio; González-Martínez, Santiago C; Collada, Carmen; Guevara, María Angeles; Boury, Christophe; de María, Nuria; Eveno, Emmanuelle; Aranda, Ismael; Garnier-Géré, Pauline H; Brach, Jean; Alía, Ricardo; Plomion, Christophe; Cervera, María Teresa

2015-09-01

We have carried out a candidate-gene-based association genetic study in Pinus pinaster Aiton and evaluated the predictive performance for genetic merit gain of the most significantly associated genes and single nucleotide polymorphisms (SNPs). We used a second generation 384-SNP array enriched with candidate genes for growth and wood properties to genotype mother trees collected in 20 natural populations covering most of the European distribution of the species. Phenotypic data for total height, polycyclism, root-collar diameter and biomass were obtained from a replicated provenance-progeny trial located in two sites with contrasting environments (Atlantic vs Mediterranean climate). General linear models identified strong associations between growth traits (total height and polycyclism) and four SNPs from the korrigan candidate gene, after multiple testing corrections using false discovery rate. The combined genomic breeding value predictions assessed for the four associated korrigan SNPs by ridge regression-best linear unbiased prediction (RR-BLUP) and cross-validation accounted for up to 8 and 15% of the phenotypic variance for height and polycyclic growth, respectively, and did not improve adding SNPs from other growth-related candidate genes. For root-collar diameter and total biomass, they accounted for 1.6 and 1.1% of the phenotypic variance, respectively, but increased to 15 and 4.1% when other SNPs from lp3.1, lp3.3 and cad were included in RR-BLUP models. These results point towards a desirable integration of candidate-gene studies as a means to pre-select relevant markers, and aid genomic selection in maritime pine breeding programs. © The Author 2015. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

Association of ERAP1, IL23R and PTGER4 Polymorphisms with Radiographic Severity of Ankylosing Spondylitis

PubMed Central

Ozen, Gulsen; Deniz, Rabia; Eren, Fatih; Erzik, Can; Unal, Ali Ugur; Yavuz, Sule; Aydin, Sibel Zehra; Inanc, Nevsun; Direskeneli, Haner; Atagunduz, Pamir

2017-01-01

Background: Radiographic severity of ankylosing spondylitis (AS) shows such great variance that some patients never develop syndesmophytes throughout the entire disease span, whereas some develop bamboo spine relatively early. Objective: To study the association between ERAP1, IL23R and PTGER4 single nucleotide polymorphisms (SNPs) and radiographic severity in AS patients. Methods: rs27044 and rs30187 (ERAP1), rs11209032 (IL23R) and rs10440635 (PTGER4) SNPs were genotyped in 235 AS patients fulfilling the modified New York criteria. Patients were classified as mild- and severe-AS according to modified Stoke AS spinal score (mSASSS). Mild-AS is defined as having mSASSS of “0” following at least 10 years of disease duration. Severe-AS is defined as having mSASSS of >20 (patients with mild vertebral changes (i.e. squaring or erosions) were omitted for clear stratification) regardless of disease duration. Results: The genotype distributions and allele frequencies of ERAP1 rs27044 and rs30187, IL23R rs11209032 and PTGER4 rs10440635 SNPs were similar in mild- (n=171, mSASSS=0, 55.6% HLA-B27 positive) and severe-AS patients (n=64, mSASSS=48.5±17.8, 73.4% HLA-B27 positive). After adjustment for clinical differences between groups (gender, disease duration, HLA-B27 and smoking status) by logistic regression analysis, none of the alleles in the investigated SNPs were found to be associated with radiographic severity of AS. Conclusion: In radiographically well-categorized AS patients, ERAP1 rs27044 and rs30187, IL23R rs11209032 and PTGER4 rs10440635 SNPs are not found to be associated with radiographic severity of AS. PMID:28400866

Association of ERAP1, IL23R and PTGER4 Polymorphisms with Radiographic Severity of Ankylosing Spondylitis.

PubMed

Ozen, Gulsen; Deniz, Rabia; Eren, Fatih; Erzik, Can; Unal, Ali Ugur; Yavuz, Sule; Aydin, Sibel Zehra; Inanc, Nevsun; Direskeneli, Haner; Atagunduz, Pamir

2017-01-01

Radiographic severity of ankylosing spondylitis (AS) shows such great variance that some patients never develop syndesmophytes throughout the entire disease span, whereas some develop bamboo spine relatively early. To study the association between ERAP1 , IL23R and PTGER4 single nucleotide polymorphisms (SNPs) and radiographic severity in AS patients. rs27044 and rs30187 ( ERAP1 ), rs11209032 ( IL23R ) and rs10440635 ( PTGER4 ) SNPs were genotyped in 235 AS patients fulfilling the modified New York criteria. Patients were classified as mild- and severe-AS according to modified Stoke AS spinal score (mSASSS). Mild-AS is defined as having mSASSS of "0" following at least 10 years of disease duration. Severe-AS is defined as having mSASSS of >20 (patients with mild vertebral changes ( i.e. squaring or erosions) were omitted for clear stratification) regardless of disease duration. The genotype distributions and allele frequencies of ERAP1 rs27044 and rs30187, IL23R rs11209032 and PTGER4 rs10440635 SNPs were similar in mild- (n=171, mSASSS=0, 55.6% HLA-B27 positive) and severe-AS patients (n=64, mSASSS=48.5±17.8, 73.4% HLA-B27 positive). After adjustment for clinical differences between groups (gender, disease duration, HLA-B27 and smoking status) by logistic regression analysis, none of the alleles in the investigated SNPs were found to be associated with radiographic severity of AS. In radiographically well-categorized AS patients, ERAP1 rs27044 and rs30187, IL23R rs11209032 and PTGER4 rs10440635 SNPs are not found to be associated with radiographic severity of AS.

Mining of haplotype-based expressed sequence tag single nucleotide polymorphisms in citrus

PubMed Central

2013-01-01

Background Single nucleotide polymorphisms (SNPs), the most abundant variations in a genome, have been widely used in various studies. Detection and characterization of citrus haplotype-based expressed sequence tag (EST) SNPs will greatly facilitate further utilization of these gene-based resources. Results In this paper, haplotype-based SNPs were mined out of publicly available citrus expressed sequence tags (ESTs) from different citrus cultivars (genotypes) individually and collectively for comparison. There were a total of 567,297 ESTs belonging to 27 cultivars in varying numbers and consequentially yielding different numbers of haplotype-based quality SNPs. Sweet orange (SO) had the most (213,830) ESTs, generating 11,182 quality SNPs in 3,327 out of 4,228 usable contigs. Summed from all the individually mining results, a total of 25,417 quality SNPs were discovered – 15,010 (59.1%) were transitions (AG and CT), 9,114 (35.9%) were transversions (AC, GT, CG, and AT), and 1,293 (5.0%) were insertion/deletions (indels). A vast majority of SNP-containing contigs consisted of only 2 haplotypes, as expected, but the percentages of 2 haplotype contigs varied widely in these citrus cultivars. BLAST of the 25,417 25-mer SNP oligos to the Clementine reference genome scaffolds revealed 2,947 SNPs had “no hits found”, 19,943 had 1 unique hit / alignment, 1,571 had one hit and 2+ alignments per hit, and 956 had 2+ hits and 1+ alignment per hit. Of the total 24,293 scaffold hits, 23,955 (98.6%) were on the main scaffolds 1 to 9, and only 338 were on 87 minor scaffolds. Most alignments had 100% (25/25) or 96% (24/25) nucleotide identities, accounting for 93% of all the alignments. Considering almost all the nucleotide discrepancies in the 24/25 alignments were at the SNP sites, it served well as in silico validation of these SNPs, in addition to and consistent with the rate (81%) validated by sequencing and SNaPshot assay. Conclusions High-quality EST-SNPs from different citrus genotypes were detected, and compared to estimate the heterozygosity of each genome. All the SNP oligo sequences were aligned with the Clementine citrus genome to determine their distribution and uniqueness and for in silico validation, in addition to SNaPshot and sequencing validation of selected SNPs. PMID:24175923

Screening for polymorphisms in the PXR gene in a Dutch population.

PubMed

Bosch, Tessa M; Deenen, Maarten; Pruntel, Roelof; Smits, Paul H M; Schellens, Jan H M; Beijnen, Jos H; Meijerman, Irma

2006-05-01

Cytochrome P450 3A4 (CYP3A4) is involved in the metabolism of over 50% of all drugs currently in use. However, CYP3A4 expression shows a large inter-individual variation that cannot only be explained by genetic polymorphisms identified in this gene. The pregnane X receptor (PXR) has been identified as a transcriptional regulator of CYP3A4. Single nucleotide polymorphisms (SNPs) in the PXR gene could influence PXR activity and thereby CYP3A4 expression. This study was therefore aimed at determining the frequencies of known SNPs and detecting yet unknown SNPs in the PXR gene in a Dutch population. Genomic DNA was isolated from blood samples obtained from 100 healthy volunteers and subjected to PCR amplification, followed by DNA sequencing. The population, of which the ethnicity was 93% Caucasian, consisted of 79 female individuals and 21 males. A total of 24 SNPs were found in the PXR gene, eight of which are previously unknown. The allelic frequencies found in this population varied from 0.5 to 73%. Most of the previously detected SNPs were located in introns. One new SNP, T8555G in exon 8, causes an amino acid change of C379G and is located in the Ligand Binding Domain of PXR. Several SNPs were detected in the PXR gene, one of which is located in the ligand binding domain (LBD). These SNPs may influence PXR-mediated CYP3A4 induction.

Vitamin D receptor polymorphisms in patients with cutaneous melanoma.

PubMed

Orlow, Irene; Roy, Pampa; Reiner, Anne S; Yoo, Sarah; Patel, Himali; Paine, Susan; Armstrong, Bruce K; Kricker, Anne; Marrett, Loraine D; Millikan, Robert C; Thomas, Nancy E; Gruber, Stephen B; Anton-Culver, Hoda; Rosso, Stefano; Gallagher, Richard P; Dwyer, Terence; Kanetsky, Peter A; Busam, Klaus; From, Lynn; Begg, Colin B; Berwick, Marianne

2012-01-15

The vitamin D receptor (VDR) gene has been associated with cancer risk, but only a few polymorphisms have been studied in relation to melanoma risk and the results have been inconsistent. We examined 38 VDR gene single nucleotide polymorphisms (SNPs) in a large international multicenter population-based case-control study of melanoma. Buccal DNAs were obtained from 1,207 people with incident multiple primary melanoma and 2,469 with incident single primary melanoma. SNPs with known or suspected impact on VDR activity, haplotype tagging SNPs with ≥ 10% minor allele frequency in Caucasians, and SNPs reported as significant in other association studies were examined. Logistic regression was used to calculate the relative risks conferred by the individual SNP. Eight of 38 SNPs in the promoter, coding, and 3' gene regions were individually significantly associated with multiple primary melanoma after adjusting for covariates. The estimated increase in risk for individuals who were homozygous for the minor allele ranged from 25 to 33% for six polymorphisms: rs10875712 (odds ratios [OR] 1.28; 95% confidence interval (CI), 1.01-1.62), rs4760674 (OR 1.33; 95% CI, 1.06-1.67), rs7139166 (OR 1.26; 95%CI, 1.02-1.56), rs4516035 (OR 1.25; 95%CI, 1.01-1.55), rs11168287 (OR 1.27; 95%CI, 1.03-1.57) and rs1544410 (OR 1.30; 95%CI, 1.04-1.63); for two polymorphisms, homozygous carriers had a decreased risk: rs7305032 (OR 0.81; 95%CI 0.65-1.02) and rs7965281 (OR, 0.78; 95%CI, 0.62-0.99). We recognize the potential false positive findings because of multiple comparisons; however, the eight significant SNPs in our study outnumbered the two significant tests expected to occur by chance. The VDR may play a role in melanomagenesis. Copyright © 2011 UICC.

Optimal Design of Low-Density SNP Arrays for Genomic Prediction: Algorithm and Applications.

PubMed

Wu, Xiao-Lin; Xu, Jiaqi; Feng, Guofei; Wiggans, George R; Taylor, Jeremy F; He, Jun; Qian, Changsong; Qiu, Jiansheng; Simpson, Barry; Walker, Jeremy; Bauck, Stewart

2016-01-01

Low-density (LD) single nucleotide polymorphism (SNP) arrays provide a cost-effective solution for genomic prediction and selection, but algorithms and computational tools are needed for the optimal design of LD SNP chips. A multiple-objective, local optimization (MOLO) algorithm was developed for design of optimal LD SNP chips that can be imputed accurately to medium-density (MD) or high-density (HD) SNP genotypes for genomic prediction. The objective function facilitates maximization of non-gap map length and system information for the SNP chip, and the latter is computed either as locus-averaged (LASE) or haplotype-averaged Shannon entropy (HASE) and adjusted for uniformity of the SNP distribution. HASE performed better than LASE with ≤1,000 SNPs, but required considerably more computing time. Nevertheless, the differences diminished when >5,000 SNPs were selected. Optimization was accomplished conditionally on the presence of SNPs that were obligated to each chromosome. The frame location of SNPs on a chip can be either uniform (evenly spaced) or non-uniform. For the latter design, a tunable empirical Beta distribution was used to guide location distribution of frame SNPs such that both ends of each chromosome were enriched with SNPs. The SNP distribution on each chromosome was finalized through the objective function that was locally and empirically maximized. This MOLO algorithm was capable of selecting a set of approximately evenly-spaced and highly-informative SNPs, which in turn led to increased imputation accuracy compared with selection solely of evenly-spaced SNPs. Imputation accuracy increased with LD chip size, and imputation error rate was extremely low for chips with ≥3,000 SNPs. Assuming that genotyping or imputation error occurs at random, imputation error rate can be viewed as the upper limit for genomic prediction error. Our results show that about 25% of imputation error rate was propagated to genomic prediction in an Angus population. The utility of this MOLO algorithm was also demonstrated in a real application, in which a 6K SNP panel was optimized conditional on 5,260 obligatory SNP selected based on SNP-trait association in U.S. Holstein animals. With this MOLO algorithm, both imputation error rate and genomic prediction error rate were minimal.

Optimal Design of Low-Density SNP Arrays for Genomic Prediction: Algorithm and Applications

PubMed Central

Wu, Xiao-Lin; Xu, Jiaqi; Feng, Guofei; Wiggans, George R.; Taylor, Jeremy F.; He, Jun; Qian, Changsong; Qiu, Jiansheng; Simpson, Barry; Walker, Jeremy; Bauck, Stewart

2016-01-01

Low-density (LD) single nucleotide polymorphism (SNP) arrays provide a cost-effective solution for genomic prediction and selection, but algorithms and computational tools are needed for the optimal design of LD SNP chips. A multiple-objective, local optimization (MOLO) algorithm was developed for design of optimal LD SNP chips that can be imputed accurately to medium-density (MD) or high-density (HD) SNP genotypes for genomic prediction. The objective function facilitates maximization of non-gap map length and system information for the SNP chip, and the latter is computed either as locus-averaged (LASE) or haplotype-averaged Shannon entropy (HASE) and adjusted for uniformity of the SNP distribution. HASE performed better than LASE with ≤1,000 SNPs, but required considerably more computing time. Nevertheless, the differences diminished when >5,000 SNPs were selected. Optimization was accomplished conditionally on the presence of SNPs that were obligated to each chromosome. The frame location of SNPs on a chip can be either uniform (evenly spaced) or non-uniform. For the latter design, a tunable empirical Beta distribution was used to guide location distribution of frame SNPs such that both ends of each chromosome were enriched with SNPs. The SNP distribution on each chromosome was finalized through the objective function that was locally and empirically maximized. This MOLO algorithm was capable of selecting a set of approximately evenly-spaced and highly-informative SNPs, which in turn led to increased imputation accuracy compared with selection solely of evenly-spaced SNPs. Imputation accuracy increased with LD chip size, and imputation error rate was extremely low for chips with ≥3,000 SNPs. Assuming that genotyping or imputation error occurs at random, imputation error rate can be viewed as the upper limit for genomic prediction error. Our results show that about 25% of imputation error rate was propagated to genomic prediction in an Angus population. The utility of this MOLO algorithm was also demonstrated in a real application, in which a 6K SNP panel was optimized conditional on 5,260 obligatory SNP selected based on SNP-trait association in U.S. Holstein animals. With this MOLO algorithm, both imputation error rate and genomic prediction error rate were minimal. PMID:27583971

Interleukin-2 and Interleukin-8 Gene Polymorphisms and Acquired Aplastic Anemia Risk in a Chinese Population.

PubMed

Zhang, Xuejie; Lin, Shengyun; Yang, Yan; Rong, Liucheng; He, Guangsheng; He, Hailong; Xue, Yao; Fang, Yongjun; Wang, Yaping

2017-01-01

Cytokines IL-2 and IL-8 both participate in immune regulation. However, the relationship between polymorphisms in these two cytokines and the risk of acquired aplastic anemia (acquired AA) has not been explored. We selected five SNPs including rs11575812, rs2069772 and rs2069762 of IL-2, rs2227306 and rs2227543 of IL-8. SNaPshot genotyping was used to test the genotypes of IL-2 and IL-8 polymorphisms in a population of 101 acquired AA patients and 165 healthy controls. The rs2069762 G allele appeared to be a protective mutation, but no significant differences were found in other four SNPs. We also found that rs2069762 had an impact on the transcriptional regulation. It could be assumed that the rs2069762 polymorphism might reduce the risk of acquired aplastic anemia, while the remaining four SNPs might not contribute to susceptibility to acquired AA in a Chinese population. © 2017 The Author(s)Published by S. Karger AG, Basel.

Catalog of MicroRNA Seed Polymorphisms in Vertebrates

PubMed Central

Calin, George Adrian; Horvat, Simon; Jiang, Zhihua; Dovc, Peter; Kunej, Tanja

2012-01-01

MicroRNAs (miRNAs) are a class of non-coding RNA that plays an important role in posttranscriptional regulation of mRNA. Evidence has shown that miRNA gene variability might interfere with its function resulting in phenotypic variation and disease susceptibility. A major role in miRNA target recognition is ascribed to complementarity with the miRNA seed region that can be affected by polymorphisms. In the present study, we developed an online tool for the detection of miRNA polymorphisms (miRNA SNiPer) in vertebrates (http://www.integratomics-time.com/miRNA-SNiPer) and generated a catalog of miRNA seed region polymorphisms (miR-seed-SNPs) consisting of 149 SNPs in six species. Although a majority of detected polymorphisms were due to point mutations, two consecutive nucleotide substitutions (double nucleotide polymorphisms, DNPs) were also identified in nine miRNAs. We determined that miR-SNPs are frequently located within the quantitative trait loci (QTL), chromosome fragile sites, and cancer susceptibility loci, indicating their potential role in the genetic control of various complex traits. To test this further, we performed an association analysis between the mmu-miR-717 seed SNP rs30372501, which is polymorphic in a large number of standard inbred strains, and all phenotypic traits in these strains deposited in the Mouse Phenome Database. Analysis showed a significant association between the mmu-miR-717 seed SNP and a diverse array of traits including behavior, blood-clinical chemistry, body weight size and growth, and immune system suggesting that seed SNPs can indeed have major pleiotropic effects. The bioinformatics analyses, data and tools developed in the present study can serve researchers as a starting point in testing more targeted hypotheses and designing experiments using optimal species or strains for further mechanistic studies. PMID:22303453

In Vitro vs In Silico Detected SNPs for the Development of a Genotyping Array: What Can We Learn from a Non-Model Species?

PubMed Central

Lepoittevin, Camille; Frigerio, Jean-Marc; Garnier-Géré, Pauline; Salin, Franck; Cervera, María-Teresa; Vornam, Barbara; Harvengt, Luc; Plomion, Christophe

2010-01-01

Background There is considerable interest in the high-throughput discovery and genotyping of single nucleotide polymorphisms (SNPs) to accelerate genetic mapping and enable association studies. This study provides an assessment of EST-derived and resequencing-derived SNP quality in maritime pine (Pinus pinaster Ait.), a conifer characterized by a huge genome size (∼23.8 Gb/C). Methodology/Principal Findings A 384-SNPs GoldenGate genotyping array was built from i/ 184 SNPs originally detected in a set of 40 re-sequenced candidate genes (in vitro SNPs), chosen on the basis of functionality scores, presence of neighboring polymorphisms, minor allele frequencies and linkage disequilibrium and ii/ 200 SNPs screened from ESTs (in silico SNPs) selected based on the number of ESTs used for SNP detection, the SNP minor allele frequency and the quality of SNP flanking sequences. The global success rate of the assay was 66.9%, and a conversion rate (considering only polymorphic SNPs) of 51% was achieved. In vitro SNPs showed significantly higher genotyping-success and conversion rates than in silico SNPs (+11.5% and +18.5%, respectively). The reproducibility was 100%, and the genotyping error rate very low (0.54%, dropping down to 0.06% when removing four SNPs showing elevated error rates). Conclusions/Significance This study demonstrates that ESTs provide a resource for SNP identification in non-model species, which do not require any additional bench work and little bio-informatics analysis. However, the time and cost benefits of in silico SNPs are counterbalanced by a lower conversion rate than in vitro SNPs. This drawback is acceptable for population-based experiments, but could be dramatic in experiments involving samples from narrow genetic backgrounds. In addition, we showed that both the visual inspection of genotyping clusters and the estimation of a per SNP error rate should help identify markers that are not suitable to the GoldenGate technology in species characterized by a large and complex genome. PMID:20543950

Association of gene polymorphisms in ABO blood group chromosomal regions and menstrual disorders

PubMed Central

SU, YONG; KONG, GUI-LIAN; SU, YA-LI; ZHOU, YAN; LV, LI-FANG; WANG, QIONG; HUANG, BAO-PING; ZHENG, RUI-ZHI; LI, QUAN-ZHONG; YUAN, HUI-JUAN; ZHAO, ZHI-GANG

2015-01-01

This study aimed to investigate whether single nucleotide polymorphisms (SNPs) located near the gene of the ABO blood group play an important role in the genetic aetiology of menstrual disorders (MDs). Polymerase chain reaction-ligase detection reaction technology was used to detect eight SNPs near the ABO gene location on the chromosomes in 250 cases of MD and 250 cases of normal menstruation. The differences in the distribution of each genotype, as well as the allele frequency in the normal and control groups, were analysed using Pearson's χ2 test to search for disease-associated loci. SHEsis software was used to analyse the linkage disequilibrium and haplotype frequencies and to inspect the correlation between haplotypes and the disease. Compared with the control group, the experimental group exhibited statistically significant differences in the genotype distribution frequencies of the rs657152 locus of the ABO blood group gene and the rs17250673 locus of the tumour necrosis factor cofactor 2 (TRAF2) gene, which is located downstream of the ABO gene. The allele distribution frequencies of rs657152 and rs495828 loci in the ABO blood group gene exhibited significant differences between the groups. Dominant and recessive genetic model analysis of each locus revealed that the experimental group exhibited statistically significant differences from the control group in the genotype distribution frequencies of rs657152 and rs495828 loci, respectively. These results indicate that the ABO blood group gene and TRAF2 gene may be a cause of MDs. PMID:26136981

Effect of polymorphisms in the CSN3 (κ-casein) gene on milk production traits in Chinese Holstein Cattle.

PubMed

Alim, M A; Dong, T; Xie, Y; Wu, X P; Zhang, Yi; Zhang, Shengli; Sun, D X

2014-11-01

This study was designed to evaluate significant associations between single nucleotide polymorphisms (SNPs) and milk composition and milk production traits in Chinese Holstein cows. Six SNPs were identified in the κ-casein gene using pooled DNA sequencing. The identified SNPs were genotyped by Matrix-assisted laser desorption/ionization time of flight mass spectrometry (MALDI-TOF MS) methods from 507 individuals. Out of six, we identified three non-synonymous SNPs (g.10888T>C, g.10924C>A and g.10944A>G) that changed in the protein product. SIFT (Sorting_Intolerant_From_Tolerant) prediction score (0.01) demonstrated that protein changed Isoleucine > Threonine (g.10888T>C) will affect the phenotypes. Significant associations between identified SNPs and three yield traits (milk, protein and fat) and two composition traits (fat and protein percentages) were found whereas it did not reach significance for fat percentage in haplotypes association. Importantly, the significant SNPs in our results showed a large proportion of the phenotypic variation of milk protein yield and concentration. Our results suggest that CSN3 is an important candidate gene that influences milk production traits, and identified polymorphisms and haplotypes could be used as a genetic marker in programs of marker-assisted selection for the genetic improvement of milk production traits in dairy cattle.

Contrasting Genomic Diversity in Two Closely Related Postharvest Pathogens: Penicillium digitatum and Penicillium expansum.

PubMed

Julca, Irene; Droby, Samir; Sela, Noa; Marcet-Houben, Marina; Gabaldón, Toni

2015-12-14

Penicillium digitatum and Penicillium expansum are two closely related fungal plant pathogens causing green and blue mold in harvested fruit, respectively. The two species differ in their host specificity, being P. digitatum restricted to citrus fruits and P. expansum able to infect a wide range of fruits after harvest. Although host-specific Penicillium species have been found to have a smaller gene content, it is so far unclear whether these different host specificities impact genome variation at the intraspecific level. Here we assessed genome variation across four P. digitatum and seven P. expansum isolates from geographically distant regions. Our results show very high similarity (average 0.06 SNPs [single nucleotide polymorphism] per kb) between globally distributed isolates of P. digitatum pointing to a recent expansion of a single lineage. This low level of genetic variation found in our samples contrasts with the higher genetic variability observed in the similarly distributed P. expansum isolates (2.44 SNPs per kb). Patterns of polymorphism in P. expansum indicate that recombination exists between genetically diverged strains. Consistent with the existence of sexual recombination and heterothallism, which was unknown for this species, we identified the two alternative mating types in different P. expansum isolates. Patterns of polymorphism in P. digitatum indicate a recent clonal population expansion of a single lineage that has reached worldwide distribution. We suggest that the contrasting patterns of genomic variation between the two species reflect underlying differences in population dynamics related with host specificities and related agricultural practices. It should be noted, however, that this results should be confirmed with a larger sampling of strains, as new strains may broaden the diversity so far found in P. digitatum. © The Author 2015. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

Direct sequencing and comprehensive screening of genetic polymorphisms on CYP2 family genes (CYP2A6, CYP2B6, CYP2C8, and CYP2E1) in five ethnic populations.

PubMed

Kim, Jeong-Hyun; Cheong, Hyun Sub; Park, Byung Lae; Kim, Lyoung Hyo; Shin, Hee Jung; Na, Han Sung; Chung, Myeon Woo; Shin, Hyoung Doo

2015-01-01

Recently, CYP2A6, CYP2B6, CYP2C8, and CYP2E1 have been reported to play a role in the metabolic effect of pharmacological and carcinogenic compounds. Moreover, genetic variations of drug metabolism genes have been implicated in the interindividual variation in drug disposition and pharmacological response. To define the distribution of single nucleotide polymorphisms (SNPs) in these four CYP2 family genes and to discover novel SNPs across ethnic groups, 288 DNAs composed of 48 African-Americans, 48 European-Americans, 48 Japanese, 48 Han Chinese, and 96 Koreans were resequenced. A total of 143 SNPs, 26 in CYP2A6, 45 in CYP2B6, 29 in CYP2C8, and 43 in CYP2E1, were identified, including 13 novel variants. Notably, two SNPs in the regulatory regions, a promoter SNP rs2054675 and a nonsynonymous rs3745274 (p.172Q>H) in CYP2B6, showed significantly different minor allele frequencies (MAFs) among ethnic groups (minimum P = 4.30 × 10(-12)). In addition, rs2031920 in the promoter region of CYP2E1 showed a wide range of MAF between different ethnic groups, and even among other various ethnic groups based on public reports. Among 13 newly discovered SNPs in this study, 5 SNPs were estimated to have potential functions in further in silico analyses. Some differences in genetic variations and haplotypes of CYP2A6, CYP2B6, CYP2C8, and CYP2E1 were observed among populations. Our findings could be useful in further researches, such as genetic associations with drug responses.

Association of Toll-like receptor 3 and Toll-like receptor 9 single-nucleotide polymorphisms with hepatitis C virus persistence among Egyptians.

PubMed

Hamdy, Shaimaa; Osman, Ahmed M; Zakaria, Zainab A; Galal, Iman; Sobhy, Maha; Hashem, Mohamed; Allam, Walaa R; Abdel-Samiee, Mohamed; Rewisha, Eman; Waked, Imam; Abdelwahab, Sayed F

2018-06-02

Toll-like receptors (TLRs) give the innate immune system a considerable specificity for a large range of pathogens. TLR3 detects dsRNA of viruses while TLR9 recognizes bacterial and viral unmethylated CpG motifs. This study examined whether there is a potential association between single-nucleotide polymorphisms (SNPs) in the TLR3.rs3775290 (c.1377C/T), TLR9.rs5743836 (-1237T→C) and TLR9.rs352140 (G2848A) genes and HCV infection among Egyptian patients and healthcare workers (HCWs). We enrolled 546 subjects (409 HCWs and 137 patients) divided into four groups: group 1 included 265 seronegative, aviremic subjects; group 2 included 25 seronegative, viremic subjects; group 3 included 87 subjects with spontaneously resolved HCV infection; and group 4 included 169 chronic HCV patients. All subjects were genotyped for TLR3.rs3775290, TLR9.rs5743836 and TLR9.rs352140 SNPs by polymerase chain reaction restriction fragment length polymorphism (PCR-RFLP) analysis. TLR3.rs3775290 "CC" genotype was associated with chronic HCV infection, where there was a significantly greater frequency of this genotype among chronic patients when compared to subjects with spontaneously resolved infection (63.9% vs. 51.9%; p = 0.033; OR = 1.639 and 95% CI = 0.94-2.84). However, this SNP did not correlate with the HCV RNA load among the chronic subjects (p > 0.05). There was no significant difference in TLR9.rs5743836 and TLR9.rs352140 genotype distribution between groups (p > 0.05). Lack of association between the three SNPs was found, as the three SNPs are located on two different chromosomes. In conclusion, the TLR3.rs3775290 "CC" genotype was associated with HCV chronicity, while the TLR9 gene may not play a major role in HCV infection.

Investigation of T-cell immunoglobulin- and mucin-domain-containing molecule-3 (TIM-3) polymorphisms in essential thrombocythaemia (ET).

PubMed

Han, Fuyan; Wang, Guanghai; Li, Yuantang; Tian, Wenjun; Dong, Zhenfang; Cheng, Shiqing; Liu, Yiqing; Qu, Teng; Wang, Xiaoying; Wang, Yong; Zhang, Bingchang; Ju, Ying

2017-07-01

T-cell immunoglobulin- and mucin-domain-containing molecule-3 (TIM-3) is preferentially expressed on terminally differentiated Th1 cells and inhibits their IFN-γ production. It has been reported that chronic inflammation may be an important driving force for myeloproliferative neoplasms (MPNs). Therefore, we hypothesized that as an important inflammation regulator, TIM-3 may be involved in essential thrombocythaemia (ET). The goal of this study was to investigate whether the -1516G > T, -574G > T and +4259T > G single-nucleotide polymorphisms (SNPs) within the TIM-3 gene contribute to the genetic susceptibility of individuals to ET. Genotyping of the TIM-3 -1516G > T, -574G > T and + 4259T > G SNPs was performed in 175 patients with ET and in 151 controls via a polymerase chain reaction-restriction fragment length polymorphism assay. We also investigated the relationships between the genotypes of each SNP and the risk factors of ET such as routine blood indexes, age and JAK2 V617F mutation. The genotype and allele frequencies of the -1516G > T SNP (p = 0.016 and 0.019, respectively), the -574G > T SNP (p = 0.035 and 0.038, respectively) and the +4259T > G SNP (p = 0.036 and 0.038, respectively) of the ET patients and the controls were significantly different. A haplotype analysis found that the GGT and TGT haplotypes had significantly different distributions between ET and controls (p = 0.041 and 0.041, respectively). However, no significant differences were detected between the genotypes of all SNPs and routine blood indexes, age and JAK2V617F mutation. The -1516G > T, -574G > T and +4259T > G SNPs within TIM-3 gene might play an important role as a genetic risk factor in the pathogenesis of ET.

Association of "ADAM10" and "CAMK2A" Polymorphisms with Conduct Disorder: Evidence from Family-Based Studies

ERIC Educational Resources Information Center

Jian, Xue-Qiu; Wang, Ke-Sheng; Wu, Tie-Jian; Hillhouse, Joel J.; Mullersman, Jerald E.

2011-01-01

Twin and family studies have shown that genetic factors play a role in the development of conduct disorder (CD). The purpose of this study was to identify genetic variants associated with CD using a family-based association study. We used 4,720 single nucleotide polymorphisms (SNPs) from the Illumina Panel and 11,120 SNPs from the Affymetrix 10K…

Leu72Met and Other Intronic Polymorphisms in the GHRL and GHSR Genes Are Not Associated with Type 2 Diabetes Mellitus, Insulin Resistance, or Serum Ghrelin Levels in a Saudi Population

PubMed Central

Joatar, Faris Elbahi; Al Qarni, Ali Ahmed; Ali, Muhalab E.; Al Masaud, Abdulaziz; Shire, Abdirashid M.; Das, Nagalla; Gumaa, Khalid

2017-01-01

Background Ghrelin (GHRL), a gastric peptide encoded by the GHRL gene, is known to be involved in energy homeostasis via its G protein receptor, encoded by the growth hormone secretagogue receptor (GHSR) gene. Some studies have shown associations between plasma GHRL levels and GHRL single-nucleotide polymorphisms (SNPs), namely the Leu72Met polymorphism (rs696217 TG), with type 2 diabetes mellitus (T2DM) and insulin resistance (IR), while others have not. The controversies in these associations raise the issue of ‘which SNPs in which populations.’ The aim of this study was to investigate whether SNPs in GHRL and/or GHSR genes were associated with T2DM, IR, or plasma GHRL levels among Arab Saudis. Methods Blood was collected from 208 Saudi subjects with (n=107) and without (n=101) T2DM. DNA samples from these subjects were analyzed by real-time polymerase chain reaction to genotype five intronic SNPs in the GHRL (rs696217 TG, rs27647 CT, rs2075356 CT, and rs4684677 AT) and GHSR (rs509030 GC) genes. In addition, plasma GHRL levels were measured by a radioimmunoassay. Results None of the SNPs were associated with T2DM, IR, or plasma GHRL levels. The frequencies of the alleles, genotypes, and haplotypes of the five SNPs were comparable between the T2DM patients and the non-diabetic subjects. A large number of the GHRL haplotypes indicates the molecular heterogeneity of the preproghrelin gene in this region. Conclusion Neither the Leu72Met polymorphism nor the other intronic GHRL and GHSR SNPs were associated with T2DM, IR, or GHRL levels. Further investigations should be carried out to explain the molecular basis of the association of the GHRL peptide with T2DM and IR. PMID:28956366

Leu72Met and Other Intronic Polymorphisms in the GHRL and GHSR Genes Are Not Associated with Type 2 Diabetes Mellitus, Insulin Resistance, or Serum Ghrelin Levels in a Saudi Population.

PubMed

Joatar, Faris Elbahi; Al Qarni, Ali Ahmed; Ali, Muhalab E; Al Masaud, Abdulaziz; Shire, Abdirashid M; Das, Nagalla; Gumaa, Khalid; Giha, Hayder A

2017-09-01

Ghrelin (GHRL), a gastric peptide encoded by the GHRL gene, is known to be involved in energy homeostasis via its G protein receptor, encoded by the growth hormone secretagogue receptor (GHSR) gene. Some studies have shown associations between plasma GHRL levels and GHRL single-nucleotide polymorphisms (SNPs), namely the Leu72Met polymorphism (rs696217 TG), with type 2 diabetes mellitus (T2DM) and insulin resistance (IR), while others have not. The controversies in these associations raise the issue of 'which SNPs in which populations.' The aim of this study was to investigate whether SNPs in GHRL and/or GHSR genes were associated with T2DM, IR, or plasma GHRL levels among Arab Saudis. Blood was collected from 208 Saudi subjects with (n=107) and without (n=101) T2DM. DNA samples from these subjects were analyzed by real-time polymerase chain reaction to genotype five intronic SNPs in the GHRL (rs696217 TG, rs27647 CT, rs2075356 CT, and rs4684677 AT) and GHSR (rs509030 GC) genes. In addition, plasma GHRL levels were measured by a radioimmunoassay. None of the SNPs were associated with T2DM, IR, or plasma GHRL levels. The frequencies of the alleles, genotypes, and haplotypes of the five SNPs were comparable between the T2DM patients and the non-diabetic subjects. A large number of the GHRL haplotypes indicates the molecular heterogeneity of the preproghrelin gene in this region. Neither the Leu72Met polymorphism nor the other intronic GHRL and GHSR SNPs were associated with T2DM, IR, or GHRL levels. Further investigations should be carried out to explain the molecular basis of the association of the GHRL peptide with T2DM and IR. Copyright © 2017 Korean Endocrine Society

Investigation of previously implicated genetic variants in chronic tic disorders: a transmission disequilibrium test approach.

PubMed

Abdulkadir, Mohamed; Londono, Douglas; Gordon, Derek; Fernandez, Thomas V; Brown, Lawrence W; Cheon, Keun-Ah; Coffey, Barbara J; Elzerman, Lonneke; Fremer, Carolin; Fründt, Odette; Garcia-Delgar, Blanca; Gilbert, Donald L; Grice, Dorothy E; Hedderly, Tammy; Heyman, Isobel; Hong, Hyun Ju; Huyser, Chaim; Ibanez-Gomez, Laura; Jakubovski, Ewgeni; Kim, Young Key; Kim, Young Shin; Koh, Yun-Joo; Kook, Sodahm; Kuperman, Samuel; Leventhal, Bennett; Ludolph, Andrea G; Madruga-Garrido, Marcos; Maras, Athanasios; Mir, Pablo; Morer, Astrid; Müller-Vahl, Kirsten; Münchau, Alexander; Murphy, Tara L; Plessen, Kerstin J; Roessner, Veit; Shin, Eun-Young; Song, Dong-Ho; Song, Jungeun; Tübing, Jennifer; van den Ban, Els; Visscher, Frank; Wanderer, Sina; Woods, Martin; Zinner, Samuel H; King, Robert A; Tischfield, Jay A; Heiman, Gary A; Hoekstra, Pieter J; Dietrich, Andrea

2018-04-01

Genetic studies in Tourette syndrome (TS) are characterized by scattered and poorly replicated findings. We aimed to replicate findings from candidate gene and genome-wide association studies (GWAS). Our cohort included 465 probands with chronic tic disorder (93% TS) and both parents from 412 families (some probands were siblings). We assessed 75 single nucleotide polymorphisms (SNPs) in 465 parent-child trios; 117 additional SNPs in 211 trios; and 4 additional SNPs in 254 trios. We performed SNP and gene-based transmission disequilibrium tests and compared nominally significant SNP results with those from a large independent case-control cohort. After quality control 71 SNPs were available in 371 trios; 112 SNPs in 179 trios; and 3 SNPs in 192 trios. 17 were candidate SNPs implicated in TS and 2 were implicated in obsessive-compulsive disorder (OCD) or autism spectrum disorder (ASD); 142 were tagging SNPs from eight monoamine neurotransmitter-related genes (including dopamine and serotonin); 10 were top SNPs from TS GWAS; and 13 top SNPs from attention-deficit/hyperactivity disorder, OCD, or ASD GWAS. None of the SNPs or genes reached significance after adjustment for multiple testing. We observed nominal significance for the candidate SNPs rs3744161 (TBCD) and rs4565946 (TPH2) and for five tagging SNPs; none of these showed significance in the independent cohort. Also, SLC1A1 in our gene-based analysis and two TS GWAS SNPs showed nominal significance, rs11603305 (intergenic) and rs621942 (PICALM). We found no convincing support for previously implicated genetic polymorphisms. Targeted re-sequencing should fully appreciate the relevance of candidate genes.

Screening of a Brassica napus bacterial artificial chromosome library using highly parallel single nucleotide polymorphism assays

PubMed Central

2013-01-01

Background Efficient screening of bacterial artificial chromosome (BAC) libraries with polymerase chain reaction (PCR)-based markers is feasible provided that a multidimensional pooling strategy is implemented. Single nucleotide polymorphisms (SNPs) can be screened in multiplexed format, therefore this marker type lends itself particularly well for medium- to high-throughput applications. Combining the power of multiplex-PCR assays with a multidimensional pooling system may prove to be especially challenging in a polyploid genome. In polyploid genomes two classes of SNPs need to be distinguished, polymorphisms between accessions (intragenomic SNPs) and those differentiating between homoeologous genomes (intergenomic SNPs). We have assessed whether the highly parallel Illumina GoldenGate® Genotyping Assay is suitable for the screening of a BAC library of the polyploid Brassica napus genome. Results A multidimensional screening platform was developed for a Brassica napus BAC library which is composed of almost 83,000 clones. Intragenomic and intergenomic SNPs were included in Illumina’s GoldenGate® Genotyping Assay and both SNP classes were used successfully for screening of the multidimensional BAC pools of the Brassica napus library. An optimized scoring method is proposed which is especially valuable for SNP calling of intergenomic SNPs. Validation of the genotyping results by independent methods revealed a success of approximately 80% for the multiplex PCR-based screening regardless of whether intra- or intergenomic SNPs were evaluated. Conclusions Illumina’s GoldenGate® Genotyping Assay can be efficiently used for screening of multidimensional Brassica napus BAC pools. SNP calling was specifically tailored for the evaluation of BAC pool screening data. The developed scoring method can be implemented independently of plant reference samples. It is demonstrated that intergenomic SNPs represent a powerful tool for BAC library screening of a polyploid genome. PMID:24010766

Population structure and genetic basis of the agronomic traits of upland cotton in China revealed by a genome-wide association study using high-density SNPs.

PubMed

Huang, Cong; Nie, Xinhui; Shen, Chao; You, Chunyuan; Li, Wu; Zhao, Wenxia; Zhang, Xianlong; Lin, Zhongxu

2017-11-01

Gossypium hirsutum L. represents the largest source of textile fibre, and China is one of the largest cotton-producing and cotton-consuming countries in the world. To investigate the genetic architecture of the agronomic traits of upland cotton in China, a diverse and nationwide population containing 503 G. hirsutum accessions was collected for a genome-wide association study (GWAS) on 16 agronomic traits. The accessions were planted in four places from 2012 to 2013 for phenotyping. The CottonSNP63K array and a published high-density map based on this array were used for genotyping. The 503 G. hirsutum accessions were divided into three subpopulations based on 11 975 quantified polymorphic single-nucleotide polymorphisms (SNPs). By comparing the genetic structure and phenotypic variation among three genetic subpopulations, seven geographic distributions and four breeding periods, we found that geographic distribution and breeding period were not the determinants of genetic structure. In addition, no obvious phenotypic differentiations were found among the three subpopulations, even though they had different genetic backgrounds. A total of 324 SNPs and 160 candidate quantitative trait loci (QTL) regions were identified as significantly associated with the 16 agronomic traits. A network was established for multieffects in QTLs and interassociations among traits. Thirty-eight associated regions had pleiotropic effects controlling more than one trait. One candidate gene, Gh_D08G2376, was speculated to control the lint percentage (LP). This GWAS is the first report using high-resolution SNPs in upland cotton in China to comprehensively investigate agronomic traits, and it provides a fundamental resource for cotton genetic research and breeding. © 2017 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.

LAMB1 polymorphism is associated with autism symptom severity in Korean autism spectrum disorder patients.

PubMed

Kim, Young Jong; Park, Jin Kyung; Kang, Won Sub; Kim, Su Kang; Park, Hae Jeong; Nam, Min; Kim, Jong Woo

2015-01-01

LAMB1 encodes laminin beta-1, which is expressed during early development of the human nervous system, and could be involved in the pathogenesis of neurodevelopmental disorders. In our study, we aimed to investigate whether single nucleotide polymorphisms (SNPs) in LAMB1 were associated with autism spectrum disorder (ASD) and with related clinical severities of ASD. Two coding SNPs (rs20556 and rs25659) and two intronic SNPs (rs2158836 and rs2237659) were compared between 180 patients with ASD and 147 healthy control subjects using direct sequencing. The Korean version of the Childhood Autism Rating Scale (K-CARS) was used to assess clinical severities. Multiple logistic regression models were employed to analyze genetic data, and associations with symptom severity were tested with the Kruskal-Wallis and the Mann-Whitney U tests. None of the four examined SNPs was associated with ASD risk. However, the GG genotype of rs2158836 was associated with more severe symptoms for the "object use" and "non-verbal communication" measures. The results of our study suggest the association between rs2158836 polymorphisms and symptom severity in ASD.

Genetic association between ghrelin polymorphisms and Alzheimer's disease in a Japanese population.

PubMed

Shibata, Nobuto; Ohnuma, Tohru; Kuerban, Bolati; Komatsu, Miwa; Arai, Heii

2011-01-01

Ghrelin has been reported to enter the hippocampus and to bind to the neurons of the hippocampal formation. This peptide also affects neuronal glucose uptake and decreases tau hyperphosphorylation. There is increasing evidence suggesting an association between ghrelin and Alzheimer's disease (AD) pathology. The aim of this study was to investigate whether single nucleotide polymorphisms (SNPs) of the ghrelin gene are associated with AD. The SNPs were genotyped using TaqMan technology and were analyzed using a case-control study design. Our case-control dataset consisted of 182 AD patients and 143 age-matched controls. Hardy-Weinberg equilibrium and linkage disequilibrium analyses suggest that the region in and around the gene is highly polymorphic. One SNP, rs4684677 (Leu90Gln), showed a marginal association with age of AD onset. We did not detect any association between the other SNPs of the ghrelin gene and AD. There have been few genetic studies on the relationship between circulating ghrelin and functional SNPs. Further multifactorial studies are needed to clarify the relationship between ghrelin and AD. Copyright © 2011 S. Karger AG, Basel.

Correlation between facial morphology and gene polymorphisms in the Uygur youth population.

PubMed

He, Huiyu; Mi, Xue; Zhang, Jiayu; Zhang, Qin; Yao, Yuan; Zhang, Xu; Xiao, Feng; Zhao, Chunping; Zheng, Shutao

2017-04-25

Human facial morphology varies considerably among individuals and can be influenced by gene polymorphisms. We explored the effects of single nucleotide polymorphisms (SNPs) on facial features in the Uygur youth population of the Kashi area in Xinjiang, China. Saliva samples were collected from 578 volunteers, and 10 SNPs previously associated with variations in facial physiognomy were genotyped. In parallel, 3D images of the subjects' faces were obtained using grating facial scanning technology. After delimitation of 15 salient landmarks, the correlation between SNPs and the distances between facial landmark pairs was assessed. Analysis of variance revealed that ENPP1 rs7754561 polymorphism was significantly associated with RAla-RLipCn and RLipCn-Sbn linear distances (p = 0.044 and p = 0.012, respectively) as well as RLipCn-Stm curve distance (p = 0.042). The GHR rs6180 polymorphism correlated with RLipCn-Stm linear distance (p = 0.04), while the GHR rs6184 polymorphism correlated with RLipCn-ULipP curve distance (p = 0.047). The FGFR1 rs4647905 polymorphism was associated with LLipCn-Nsn linear distance (p = 0.042). These results reveal that ENPP1 and FGFR1 influence lower anterior face height, the distance from the upper lip to the nasal floor, and lip shape. FGFR1 also influences the lower anterior face height, while GHR is associated with the length and width of the lip.

Common Polymorphisms in the PKP3-SIGIRR-TMEM16J Gene Region Are Associated With Susceptibility to Tuberculosis

PubMed Central

Randhawa, April K.; Chau, Tran T. H.; Bang, Nguyen D.; Yen, Nguyen T. B.; Farrar, Jeremy J.; Dunstan, Sarah J.; Hawn, Thomas R.

2012-01-01

(See the editorial commentary by Wilkinson, on pages 525–7.) Background. Tuberculosis has been associated with genetic variation in host immunity. We hypothesized that single-nucleotide polymorphisms (SNPs) in SIGIRR, a negative regulator of Toll-like receptor/IL-1R signaling, are associated with susceptibility to tuberculosis. Methods. We used a case-population study design in Vietnam with cases that had either tuberculous meningitis or pulmonary tuberculosis. We genotyped 6 SNPs in the SIGIRR gene region (including the adjacent genes PKP3 and TMEM16J) in a discovery cohort of 352 patients with tuberculosis and 382 controls. Significant associations were genotyped in a validation cohort (339 patients with tuberculosis, 376 controls). Results. Three SNPs (rs10902158, rs7105848, rs7111432) were associated with tuberculosis in discovery and validation cohorts. The polymorphisms were associated with both tuberculous meningitis and pulmonary tuberculosis and were strongest with a recessive genetic model (odds ratios, 1.5–1.6; P = .0006–.001). Coinheritance of these polymorphisms with previously identified risk alleles in Toll-like receptor 2 and TIRAP was associated with an additive risk of tuberculosis susceptibility. Conclusions. These results demonstrate a strong association of SNPs in the PKP3-SIGIRR-TMEM16J gene region and tuberculosis in discovery and validation cohorts. To our knowledge, these are the first associations of polymorphisms in this region with any disease. PMID:22223854

Impact of SNPs on Protein Phosphorylation Status in Rice (Oryza sativa L.).

PubMed

Lin, Shoukai; Chen, Lijuan; Tao, Huan; Huang, Jian; Xu, Chaoqun; Li, Lin; Ma, Shiwei; Tian, Tian; Liu, Wei; Xue, Lichun; Ai, Yufang; He, Huaqin

2016-11-11

Single nucleotide polymorphisms (SNPs) are widely used in functional genomics and genetics research work. The high-quality sequence of rice genome has provided a genome-wide SNP and proteome resource. However, the impact of SNPs on protein phosphorylation status in rice is not fully understood. In this paper, we firstly updated rice SNP resource based on the new rice genome Ver. 7.0, then systematically analyzed the potential impact of Non-synonymous SNPs (nsSNPs) on the protein phosphorylation status. There were 3,897,312 SNPs in Ver. 7.0 rice genome, among which 9.9% was nsSNPs. Whilst, a total 2,508,261 phosphorylated sites were predicted in rice proteome. Interestingly, we observed that 150,197 (39.1%) nsSNPs could influence protein phosphorylation status, among which 52.2% might induce changes of protein kinase (PK) types for adjacent phosphorylation sites. We constructed a database, SNP_rice, to deposit the updated rice SNP resource and phosSNPs information. It was freely available to academic researchers at http://bioinformatics.fafu.edu.cn. As a case study, we detected five nsSNPs that potentially influenced heterotrimeric G proteins phosphorylation status in rice, indicating that genetic polymorphisms showed impact on the signal transduction by influencing the phosphorylation status of heterotrimeric G proteins. The results in this work could be a useful resource for future experimental identification and provide interesting information for better rice breeding.

Mitochondrial pathogenic mutations are population-specific.

PubMed

Breen, Michael S; Kondrashov, Fyodor A

2010-12-31

Surveying deleterious variation in human populations is crucial for our understanding, diagnosis and potential treatment of human genetic pathologies. A number of recent genome-wide analyses focused on the prevalence of segregating deleterious alleles in the nuclear genome. However, such studies have not been conducted for the mitochondrial genome. We present a systematic survey of polymorphisms in the human mitochondrial genome, including those predicted to be deleterious and those that correspond to known pathogenic mutations. Analyzing 4458 completely sequenced mitochondrial genomes we characterize the genetic diversity of different types of single nucleotide polymorphisms (SNPs) in African (L haplotypes) and non-African (M and N haplotypes) populations. We find that the overall level of polymorphism is higher in the mitochondrial compared to the nuclear genome, although the mitochondrial genome appears to be under stronger selection as indicated by proportionally fewer nonsynonymous than synonymous substitutions. The African mitochondrial genomes show higher heterozygosity, a greater number of polymorphic sites and higher frequencies of polymorphisms for synonymous, benign and damaging polymorphism than non-African genomes. However, African genomes carry significantly fewer SNPs that have been previously characterized as pathogenic compared to non-African genomes. Finding SNPs classified as pathogenic to be the only category of polymorphisms that are more abundant in non-African genomes is best explained by a systematic ascertainment bias that favours the discovery of pathogenic polymorphisms segregating in non-African populations. This further suggests that, contrary to the common disease-common variant hypothesis, pathogenic mutations are largely population-specific and different SNPs may be associated with the same disease in different populations. Therefore, to obtain a comprehensive picture of the deleterious variability in the human population, as well as to improve the diagnostics of individuals carrying African mitochondrial haplotypes, it is necessary to survey different populations independently. This article was reviewed by Dr Mikhail Gelfand, Dr Vasily Ramensky (nominated by Dr Eugene Koonin) and Dr David Rand (nominated by Dr Laurence Hurst).

Distribution and linkage disequilibrium analysis of polymorphisms of GH1 gene in different populations of pigs associated with body size.

PubMed

Cheng, Yunyun; Liu, Songcai; Su, Dan; Lu, Chao; Zhang, Xin; Wu, Qingyan; Li, Siming; Fu, Haoyu; Yu, Hao; Hao, Linlin

2016-03-01

Growth hormone (GH) has been considered as a candidate gene for growth and body size in pigs. In this study, polymorphisms of the GH1 gene were evaluated for associations with body size traits in 190 pig individuals. Seventeen single-nucleotide polymorphisms (SNPs) were identified in GH1 gene of the large pig breeds and miniature pig breeds using direct sequencing and genotyped by allele-specific PCR approach. Notably, six (g.237A>G, g.283T>C, g.309A>G, g.318A>G, g.540A>G and g.544A>G) of them were significantly associated with body size, of which three loci (g.283T>C, g.309A>G, g.318A>G) located in the signal-peptide coding region of GH1 gene compose a CGG haplotype for large pigs and TAA haplotype for miniature pigs (P <0.001), two loci (g.540A>G and g.544A>G) located in the second intron of GH1 gene compose a GG haplotype for large pigs and AA haplotype for miniature pigs (P < 0.001). Our results demonstrate that these SNPs in GH1 gene are associated with the body size of pigs providing genetic basis for pig breeding with the improved economic benefits.

Association of glutathione S-transferase P1 (GSTP1) polymorphism with Tourette syndrome in Taiwanese patients.

PubMed

Shen, Che-Piao; Chou, I-Ching; Liu, Hsin-Ping; Lee, Cheng-Chun; Tsai, Yuhsin; Wu, Bor-Tsang; Hsu, Ban-Dar; Lin, Wei-Yong; Tsai, Fuu-Jen

2014-01-01

The etiology of Tourette syndrome (TS) is multifactorial. TS vulnerability may be associated with genetic and environmental factors. From the genetic point of view, TS is heterogeneous. Previous studies showed that some single-nucleotide polymorphisms (SNPs) of the glutathione-S-transferase P1 (GSTP1) gene can affect cellular proliferation and apoptotic activity and TS is a neurodevelopmental disorder. We guessed that there was a relationship between TS and genetic variants of the GSTP1 gene. Therefore, in this study, we aimed to test the hypothesis that GSTP1 SNPs were associated with TS. We performed a case-control study. One hundred twenty-one TS children and 105 normal children were included in the study. Polymerase chain reaction was used to identify the GSTP1 gene polymorphism at position rs6591256 (A/G, promoter polymorphism) in TS patients and normal children. The polymorphism at position rs6591256 in the GSTP1 gene revealed significant differences in the allele (p=0.0135) and genotype (p=0.0159) distributions between the TS patients and the control group. The A allele was present at a higher frequency than the G allele in the TS patients compared with the control group (odds ratio [OR]=1.91, 95% confidence interval [CI]: 1.14-3.21). The AA genotype was associated with susceptibility to TS with an OR of 2.38 for the AA versus AG genotype (95% CI: 1.29-4.41). These findings suggest that variants in the GSTP1 gene may play a role in susceptibility to TS.

Polymorphisms of the bovine DKK2 and their associations with body measurement traits and meat quality traits in Qinchuan cattle.

PubMed

Zhan, Xiaoli; Gao, Jianbin; Huangfu, Yifan; Fu, Changzhen; Zan, Linsen

2013-12-01

The objective of this research were to detect bovine Dickkopf 2 (DKK2) gene polymorphism and analyze their associations with body measurement traits (BMT) and meat quality traits (MQT) of animals. Blood samples were taken from a total of 541 Qinchuan cattle aged from 18 to 24 months. Polymerase chain reaction-single strand conformation polymorphism (PCR-SSCP) was employed to find out DKK2 single-polymorphism nucleotide (SNPs) and to explore their possible association with BMT and MQT. Sequence analysis of DKK2 gene revealed 2 SNPs (C29 T and A169C) in 5' untranslated region (5'UTR) of exon 1.C29T and A164T SNPs are both synonymous mutation, which showed 2 genotypes namely (CC, CT) and (AA and AC), respectively. Association analysis of polymorphism with body measurement and meat quality traits at the two locus showed that there were significant effects on CT, BL, RL, PBW, BFT, LMA, and IFC. These results suggest that the DKK2 gene might have potential effects on BMT and MQT in Qinchuan cattle population and could be used for marker-assisted selection.

Genetic contributions to the association between adult height and testicular germ cell tumors.

PubMed

Cook, Michael B; Chia, Victoria M; Berndt, Sonja I; Graubard, Barry I; Chanock, Stephen J; Rubertone, Mark V; Erickson, Ralph L; Hayes, Richard B; McGlynn, Katherine A

2011-06-01

Previously, we have shown that increasing adult height is associated with increased risk of testicular germ-cell tumor (TGCT). Recently, a number of single nucleotide polymorphisms (SNPs) have been found to be related to height. We examined whether these SNPs were associated with TGCT and whether they explained the relationship between height and TGCT. We genotyped 15 height-related SNPs in the US Servicemen's Testicular Tumor Environmental and Endocrine Determinants (STEED) case-control study. DNA was extracted from buccal cell samples and Taqman assays were used to type the selected SNPs. We used logistic regression models to estimate odds ratios (ORs) and 95% confidence intervals (95%CIs). There were 561 cases and 676 controls for analysis. Two SNPs were found to be associated with risk of TGCT, rs6060373 (CC vs TT, OR = 1.51, 95% CI: 1.06-2.15) and rs143384 (CC vs TT, OR = 1.53, 95% CI: 1.09-2.15). rs6060373 is an intronic polymorphism of ubiquinol-cytochrome c reductase complex chaperone (UQCC), and rs143384 is a 5'UTR polymorphism of growth differentiation factor 5 (GDF5). No individual SNP attenuated the association between height and TGCT. Adjustment for all SNPs previously associated with adult height reduced the associations between adult height and TGCT by ~8.5%, although the P-value indicated only weak evidence that this difference was important (P = 0.26). This novel analysis provides tentative evidence that SNPs which are associated with adult height may also share an association with risk of TGCT.

Possible association of VISA gene polymorphisms with susceptibility to systemic lupus erythematosus in Chinese population.

PubMed

Liu, Xiaowen; Jiao, Yulian; Wen, Xin; Wang, Laicheng; Ma, Chunyan; Gao, Xuejun; Chen, Zi-Jiang; Zhao, Yueran

2011-10-01

Virus-induced signaling adapter (VISA), an important adaptor protein linking both RIG-I and MDA-5 to downstream signaling events, may mediates the activation of NF kappaB and IRFs and the induction of type I IFN. As the evidence has showed that Toll-like receptors (TLRs), I-IFN and IFN-inducible genes contribute to the pathogenesis of systemic lupus erythematosus (SLE), the aim of the current study was to investigate the possible associations between the VISA gene and SLE. Four single nucleotide polymorphisms (SNPs), rs17857295, rs2326369, rs7262903, and rs7269320, in VISA gene were genotyped in 123 SLE patients and 95 healthy controls. Genotyping was performed using direct sequencing the purified PCR products. Associations were analyzed by using the chi-square test and Fisher's exact test. Haplotype analysis was performed using haploview and PHASE2.1. None of the four SNPs was found to be associated with SLE. The four-SNPs haplotype analysis showed different effect between cases and controls. While the SNPs, rs17857295 and rs2326369, were found to be associated with the renal nephritis and arthritis of SLE patient, respectively. The SNPs rs7269320 showed associations with different manifestations. Our data reveal that polymorphisms in the VISA gene may be related to disease susceptibility and manifestations of SLE.

Genetic Variation in FABP4 and Evaluation of Its Effects on Beef Cattle Fat Content.

PubMed

Goszczynski, Daniel E; Papaleo-Mazzucco, Juliana; Ripoli, María V; Villarreal, Edgardo L; Rogberg-Muñoz, Andrés; Mezzadra, Carlos A; Melucci, Lilia M; Giovambattista, Guillermo

2017-07-03

FABP4 is a protein primarily expressed in adipocytes and macrophages that plays a key role in fatty acid trafficking and lipid hydrolysis. FABP4 gene polymorphisms have been associated with meat quality traits in cattle, mostly in Asian breeds under feedlot conditions. The objectives of this work were to characterize FABP4 genetic variation in several worldwide cattle breeds and evaluate possible genotype effects on fat content in a pasture-fed crossbred (Angus-Hereford-Limousin) population. We re-sequenced 43 unrelated animals from nine cattle breeds (Angus, Brahman, Creole, Hereford, Holstein, Limousin, Nelore, Shorthorn, and Wagyu) and obtained 22 single nucleotide polymorphisms (SNPs) over 3,164 bp, including four novel polymorphisms. Haplotypes and linkage disequilibrium analyses showed a high variability. Five SNPs were selected to perform validation and association studies in our crossbred population. Four SNPs showed well-balanced allele frequencies (minor frequency > 0.159), and three showed no significant deviations from Hardy-Weinberg proportions. SNPs showed significant effects on backfat thickness and fatty acid composition (P < 0.05). The protein structure of one of the missense SNPs was analyzed to elucidate its possible effect on fat content in our studied population. Our results revealed a possible blockage of the fatty acid binding site by the missense mutation.

The Population Genomics of Repeated Evolution in the Blind Cavefish Astyanax mexicanus

PubMed Central

Bradic, Martina; Teotónio, Henrique; Borowsky, Richard L.

2013-01-01

Distinct populations of Astyanax mexicanus cavefish offer striking examples of repeatable convergence or parallelism in their independent evolutions from surface to cave phenotypes. However, the extent to which the repeatability of evolution occurred at the genetic level remains poorly understood. To address this, we first characterized the genetic diversity of 518 single-nucleotide polymorphisms (SNPs), obtained through RAD tag sequencing and distributed throughout the genome, in seven cave and three groups of surface populations. The cave populations represented two distinct lineages (old and new). Thirty-one SNPs were significantly differentiated between surface and old cave populations, two SNPs were differentiated between surface and new cave populations, and 44 SNPs were significantly differentiated in both old and new cave populations. In addition, we determined whether these SNPs map to the same locations of previously described quantitative trait loci (QTL) between surface and cave populations. A total of 25 differentiated SNPs co-map with several QTL, such as one containing a fibroblast growth factor gene (Fgf8) involved in eye development and lens size. Further, the identity of many SNPs that co-mapped with QTL was the same in independently derived cave populations. These conclusions were further confirmed by haplotype analyses of SNPs within QTL regions. Our findings indicate that the repeatability of evolution at the genetic level is substantial, suggesting that ancestral standing genetic variation significantly contributed to the population genetic variability used in adaptation to the cave environment. PMID:23927992

Polymorphisms in the Tlr4 and Tlr5 Gene Are Significantly Associated with Inflammatory Bowel Disease in German Shepherd Dogs

PubMed Central

Kathrani, Aarti; House, Arthur; Catchpole, Brian; Murphy, Angela; German, Alex; Werling, Dirk; Allenspach, Karin

2010-01-01

Inflammatory bowel disease (IBD) is considered to be the most common cause of vomiting and diarrhoea in dogs, and the German shepherd dog (GSD) is particularly susceptible. The exact aetiology of IBD is unknown, however associations have been identified between specific single-nucleotide polymorphisms (SNPs) in Toll-like receptors (TLRs) and human IBD. However, to date, no genetic studies have been undertaken in canine IBD. The aim of this study was to investigate whether polymorphisms in canine TLR 2, 4 and 5 genes are associated with IBD in GSDs. Mutational analysis of TLR2, TLR4 and TLR5 was performed in 10 unrelated GSDs with IBD. Four non-synonymous SNPs (T23C, G1039A, A1571T and G1807A) were identified in the TLR4 gene, and three non-synonymous SNPs (G22A, C100T and T1844C) were identified in the TLR5 gene. The non-synonymous SNPs identified in TLR4 and TLR5 were evaluated further in a case-control study using a SNaPSHOT multiplex reaction. Sequencing information from 55 unrelated GSDs with IBD were compared to a control group consisting of 61 unrelated GSDs. The G22A SNP in TLR5 was significantly associated with IBD in GSDs, whereas the remaining two SNPs were found to be significantly protective for IBD. Furthermore, the two SNPs in TLR4 (A1571T and G1807A) were in complete linkage disequilibrium, and were also significantly associated with IBD. The TLR5 risk haplotype (ACC) without the two associated TLR4 SNP alleles was significantly associated with IBD, however the presence of the two TLR4 SNP risk alleles without the TLR5 risk haplotype was not statistically associated with IBD. Our study suggests that the three TLR5 SNPs and two TLR4 SNPs; A1571T and G1807A could play a role in the pathogenesis of IBD in GSDs. Further studies are required to confirm the functional importance of these polymorphisms in the pathogenesis of this disease. PMID:21203467

Polymorphisms in the TLR4 and TLR5 gene are significantly associated with inflammatory bowel disease in German shepherd dogs.

PubMed

Kathrani, Aarti; House, Arthur; Catchpole, Brian; Murphy, Angela; German, Alex; Werling, Dirk; Allenspach, Karin

2010-12-23

Inflammatory bowel disease (IBD) is considered to be the most common cause of vomiting and diarrhoea in dogs, and the German shepherd dog (GSD) is particularly susceptible. The exact aetiology of IBD is unknown, however associations have been identified between specific single-nucleotide polymorphisms (SNPs) in Toll-like receptors (TLRs) and human IBD. However, to date, no genetic studies have been undertaken in canine IBD. The aim of this study was to investigate whether polymorphisms in canine TLR 2, 4 and 5 genes are associated with IBD in GSDs. Mutational analysis of TLR2, TLR4 and TLR5 was performed in 10 unrelated GSDs with IBD. Four non-synonymous SNPs (T23C, G1039A, A1571T and G1807A) were identified in the TLR4 gene, and three non-synonymous SNPs (G22A, C100T and T1844C) were identified in the TLR5 gene. The non-synonymous SNPs identified in TLR4 and TLR5 were evaluated further in a case-control study using a SNaPSHOT multiplex reaction. Sequencing information from 55 unrelated GSDs with IBD were compared to a control group consisting of 61 unrelated GSDs. The G22A SNP in TLR5 was significantly associated with IBD in GSDs, whereas the remaining two SNPs were found to be significantly protective for IBD. Furthermore, the two SNPs in TLR4 (A1571T and G1807A) were in complete linkage disequilibrium, and were also significantly associated with IBD. The TLR5 risk haplotype (ACC) without the two associated TLR4 SNP alleles was significantly associated with IBD, however the presence of the two TLR4 SNP risk alleles without the TLR5 risk haplotype was not statistically associated with IBD. Our study suggests that the three TLR5 SNPs and two TLR4 SNPs; A1571T and G1807A could play a role in the pathogenesis of IBD in GSDs. Further studies are required to confirm the functional importance of these polymorphisms in the pathogenesis of this disease.

Data on polymorphisms in CYP2A6 associated to risk and predispose to smoking related variables.

PubMed

López-Flores, Luis A; Pérez-Rubio, Gloria; Ramírez-Venegas, Alejandra; Ambrocio-Ortiz, Enrique; Sansores, Raúl H; Falfán-Valencia, Ramcés

2017-12-01

This article contains data on the single nucleotide polymorphisms (SNPs) rs1137115, rs1801272 and rs28399433 rs4105144 in CYP2A6 associated to smoking related variables in Mexican Mestizo smokers (Pérez-Rubio et al., 2017) [1]. These SNPs were selected due to previous associations with other populations. Mexican Mestizo smokers were classified according their smoking pattern. A genetic association test was performed.

Association of Cytokine Candidate Genes with Severity of Pain and Co-Occurring Symptoms in Breast Cancer Patients Receiving Chemotherapy

DTIC Science & Technology

2013-10-01

identify common genetic variations (i.e., single nucleotide polymorphisms [ SNPs ] and haplotypes) in cytokine genes, as well demographic, clinical, and...Center. The purpose of the proposed project is to identify common genetic variations (i.e., single nucleotide polymorphisms [ SNPs ] and haplotypes) in...research team continues to meet monthly to discuss progress with regards to recruitment, enrollment, and data collection. Training in Genetics In year

Single nucleotide polymorphisms associated with coronary heart disease predict incident ischemic stroke in the atherosclerosis risk in communities study.

PubMed

Morrison, Alanna C; Bare, Lance A; Luke, May M; Pankow, James S; Mosley, Thomas H; Devlin, James J; Willerson, James T; Boerwinkle, Eric

2008-01-01

Ischemic stroke and coronary heart disease (CHD) may share genetic factors contributing to a common etiology. This study investigates whether 51 single nucleotide polymorphisms (SNPs) associated with CHD in multiple antecedent studies are associated with incident ischemic stroke in the Atherosclerosis Risk in Communities (ARIC) study. From the multiethnic ARIC cohort of 14,215 individuals, 495 validated ischemic strokes were identified. Cox proportional hazards models, adjusted for age and gender, identified three SNPs in Whites and two SNPs in Blacks associated with incident stroke (p

Association of CYP1A1 and CYP1B1 polymorphisms with bone mineral density variations in postmenopausal Mexican-Mestizo women.

PubMed

Chávez, Bertha; Vilchis, Felipe; Rojano-Mejía, David; Coral Vázquez, Ramón Mauricio; Aguirre-García, María Del Carmen; Canto, Patricia

2017-08-01

Herein, we investigated potential associations between polymorphisms of genes related to estrogen metabolism and bone mineral density (BMD) in postmenopausal women. This was a cross-sectional study, in which two hundred and ninety postmenopausal Mexican-Mestizo women were studied. The BMD of the lumbar spine (LS), total hip (TH), and femoral neck (FN) was measured. The distribution of the genetic polymorphisms, including rs1799814 and rs1048943 at CYP1A1 as well as rs1056836 at CYP1B1, were analyzed by polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP), single-stranded conformational polymorphism (SSCP), and DNA sequencing. Deviations from Hardy-Weinberg equilibrium (HWE) were tested, and linkage disequilibrium (LD) was calculated by direct correlation (r 2 ). Moreover, haplotype analysis was performed. All polymorphisms were in HWE. The genotype and allele distributions of the three single nucleotide polymorphisms (SNPs) studied showed no significant differences. However, statistical significance was reached when constructing haplotypes. The CG haplotype in CYP1A1 was associated with variations in LS and FN BMD after adjustment for covariates (p = 0.021 and 0.045, respectively), but the association with TH BMD was not significant. These results suggested that the CG haplotype in CYP1A1 may play an important role in the mechanism of osteoporosis and may be useful as a genetic marker.

Interleukin-21 gene polymorphism rs2221903 is associated with disease activity in patients with rheumatoid arthritis.

PubMed

Malinowski, Damian; Paradowska-Gorycka, Agnieszka; Safranow, Krzysztof; Pawlik, Andrzej

2017-08-01

Interleukin-21 (IL-21) is a cytokine which plays a significant role in the pathogenesis and disease activity of rheumatoid arthritis (RA). Genetic polymorphisms in the IL-21 gene may alter the synthesis of IL-21. The aim of this study was to examine IL-21 and IL-21R polymorphisms in patients with RA. We examined 422 patients with RA and 338 healthy controls. Single nucleotide polymorphisms (SNPs) within the IL-21 (rs6822844 G>T, rs6840978 C>T, rs2221903 T>C) and IL-21R (rs2285452 G>A) genes were genotyped using TaqMan genotyping assays. There were no statistically significant differences in the distribution of studied genotypes and alleles between RA patients and the control group. To examine whether IL-21 polymorphisms affect disease activity in RA patients, we compared the distribution of IL-21 genotypes between patients with DAS28 ≤ 2.5 (patients with remission of disease symptoms) and patients with DAS28 > 2.5 (patients with active RA). Among patients with DAS28 > 2.5, increased prevalence of rs2221903 CT and CC genotypes was observed (OR = 1.54; 95% CI: 1.04-2.28; p = 0.035). The results of this study suggest that IL-21 and IL-21R gene polymorphisms are not risk loci for RA susceptibility, whereas the IL-21 rs2221903 polymorphism is associated with disease activity.

An abbreviated SNP panel for ancestry assignment of honeybees (Apis mellifera)

USDA-ARS?s Scientific Manuscript database

This paper examines whether an abbreviated panel of 37 single nucleotide polymorphisms (SNPs) has the same power as a larger and more expensive panel of 95 SNPs to assign ancestry of honeybees (Apis mellifera) to three ancestral lineages. We selected 37 SNPs from the original 95 SNP panel using alle...

Identification of SNPs associated with muscle yield and quality traits using allelic-imbalance analyses of pooled RNA-Seq samples in rainbow trout.

PubMed

Al-Tobasei, Rafet; Ali, Ali; Leeds, Timothy D; Liu, Sixin; Palti, Yniv; Kenney, Brett; Salem, Mohamed

2017-08-07

Coding/functional SNPs change the biological function of a gene and, therefore, could serve as "large-effect" genetic markers. In this study, we used two bioinformatics pipelines, GATK and SAMtools, for discovering coding/functional SNPs with allelic-imbalances associated with total body weight, muscle yield, muscle fat content, shear force, and whiteness. Phenotypic data were collected for approximately 500 fish, representing 98 families (5 fish/family), from a growth-selected line, and the muscle transcriptome was sequenced from 22 families with divergent phenotypes (4 low- versus 4 high-ranked families per trait). GATK detected 59,112 putative SNPs; of these SNPs, 4798 showed allelic imbalances (>2.0 as an amplification and <0.5 as loss of heterozygosity). SAMtools detected 87,066 putative SNPs; and of them, 4962 had allelic imbalances between the low- and high-ranked families. Only 1829 SNPs with allelic imbalances were common between the two datasets, indicating significant differences in algorithms. The two datasets contained 7930 non-redundant SNPs of which 4439 mapped to 1498 protein-coding genes (with 6.4% non-synonymous SNPs) and 684 mapped to 295 lncRNAs. Validation of a subset of 92 SNPs revealed 1) 86.7-93.8% success rate in calling polymorphic SNPs and 2) 95.4% consistent matching between DNA and cDNA genotypes indicating a high rate of identifying SNPs with allelic imbalances. In addition, 4.64% SNPs revealed random monoallelic expression. Genome distribution of the SNPs with allelic imbalances exhibited high density for all five traits in several chromosomes, especially chromosome 9, 20 and 28. Most of the SNP-harboring genes were assigned to important growth-related metabolic pathways. These results demonstrate utility of RNA-Seq in assessing phenotype-associated allelic imbalances in pooled RNA-Seq samples. The SNPs identified in this study were included in a new SNP-Chip design (available from Affymetrix) for genomic and genetic analyses in rainbow trout.

The Discovery of Single-Nucleotide Polymorphisms—and Inferences about Human Demographic History

PubMed Central

Wakeley, John; Nielsen, Rasmus; Liu-Cordero, Shau Neen; Ardlie, Kristin

2001-01-01

A method of historical inference that accounts for ascertainment bias is developed and applied to single-nucleotide polymorphism (SNP) data in humans. The data consist of 84 short fragments of the genome that were selected, from three recent SNP surveys, to contain at least two polymorphisms in their respective ascertainment samples and that were then fully resequenced in 47 globally distributed individuals. Ascertainment bias is the deviation, from what would be observed in a random sample, caused either by discovery of polymorphisms in small samples or by locus selection based on levels or patterns of polymorphism. The three SNP surveys from which the present data were derived differ both in their protocols for ascertainment and in the size of the samples used for discovery. We implemented a Monte Carlo maximum-likelihood method to fit a subdivided-population model that includes a possible change in effective size at some time in the past. Incorrectly assuming that ascertainment bias does not exist causes errors in inference, affecting both estimates of migration rates and historical changes in size. Migration rates are overestimated when ascertainment bias is ignored. However, the direction of error in inferences about changes in effective population size (whether the population is inferred to be shrinking or growing) depends on whether either the numbers of SNPs per fragment or the SNP-allele frequencies are analyzed. We use the abbreviation “SDL,” for “SNP-discovered locus,” in recognition of the genomic-discovery context of SNPs. When ascertainment bias is modeled fully, both the number of SNPs per SDL and their allele frequencies support a scenario of growth in effective size in the context of a subdivided population. If subdivision is ignored, however, the hypothesis of constant effective population size cannot be rejected. An important conclusion of this work is that, in demographic or other studies, SNP data are useful only to the extent that their ascertainment can be modeled. PMID:11704929

Dextromethorphan and debrisoquine metabolism and polymorphism of the gene for cytochrome P450 isozyme 2D50 in Thoroughbreds.

PubMed

Corado, Carley R; McKemie, Daniel S; Knych, Heather K

2016-09-01

OBJECTIVE To characterize polymorphisms of the gene for cytochrome P450 isozyme 2D50 (CYP2D50) and the disposition of 2 CYP2D50 probe drugs, dextromethorphan and debrisoquine, in horses. ANIMALS 23 healthy horses (22 Thoroughbreds and 1 Standardbred). PROCEDURES Single-nucleotide polymorphisms (SNPs) in CYP2D50 were identified. Disposition of dextromethorphan (2 mg/kg) and debrisoquine (0.2 mg/kg) were determined after oral (dextromethorphan) or nasogastric (debrisoquine) administration to the horses. Metabolic ratios of plasma dextromethorphan and total dextrorphan (dextrorphan plus dextrorphan-O-β-glucuronide) and 4-hydroxydebrisoquine concentrations were calculated on the basis of the area under the plasma concentration-versus-time curve extrapolated to infinity for the parent drug divided by that for the corresponding metabolite. Pharmacokinetic data were used to categorize horses into the phenotypic drug-metabolism categories poor, extensive, and ultrarapid. Disposition patterns were compared among categories, and relationships between SNPs and metabolism categories were explored. RESULTS Gene sequencing identified 51 SNPs, including 27 nonsynonymous SNPs. Debrisoquine was minimally detected after oral administration. Disposition of dextromethorphan varied markedly among horses. Metabolic ratios for dextromethorphan ranged from 0.03 to 0.46 (mean, 0.12). On the basis of these data, 1 horse was characterized as a poor metabolizer, 18 were characterized as extensive metabolizers, and 3 were characterized as ultrarapid metabolizers. CONCLUSIONS AND CLINICAL RELEVANCE Findings suggested that CYP2D50 is polymorphic and that the disposition of the probe drug varies markedly in horses. The polymorphisms may be related to rates of drug metabolism. Additional research involving more horses of various breeds is needed to fully explore the functional implication of polymorphisms in CYP2D50.

No association of dynamin binding protein (DNMBP) gene SNPs and Alzheimer's disease.

PubMed

Minster, Ryan L; DeKosky, Steven T; Kamboh, M Ilyas

2008-10-01

A recent scan of single nucleotide polymorphisms (SNPs) on chromosome 10q found significant association of six correlated SNPs with late-onset Alzheimer's disease (AD) among Japanese. We examined the SNP with the highest statistical significance (rs3740058) in a large Caucasian American case-control cohort and the remaining five SNPs in a smaller subset of cases and controls. We observed no association of statistical significance in either the total sample or the APOE*4 non-carriers for any of the SNPs.

CLUSTAG: hierarchical clustering and graph methods for selecting tag SNPs.

PubMed

Ao, S I; Yip, Kevin; Ng, Michael; Cheung, David; Fong, Pui-Yee; Melhado, Ian; Sham, Pak C

2005-04-15

Cluster and set-cover algorithms are developed to obtain a set of tag single nucleotide polymorphisms (SNPs) that can represent all the known SNPs in a chromosomal region, subject to the constraint that all SNPs must have a squared correlation R2>C with at least one tag SNP, where C is specified by the user. http://hkumath.hku.hk/web/link/CLUSTAG/CLUSTAG.html mng@maths.hku.hk.

Developing a new nonbinary SNP fluorescent multiplex detection system for forensic application in China.

PubMed

Liu, Yanfang; Liao, Huidan; Liu, Ying; Guo, Juanjuan; Sun, Yi; Fu, Xiaoliang; Xiao, Ding; Cai, Jifeng; Lan, Lingmei; Xie, Pingli; Zha, Lagabaiyila

2017-04-01

Nonbinary single-nucleotide polymorphisms (SNPs) are potential forensic genetic markers because their discrimination power is greater than that of normal binary SNPs, and that they can detect highly degraded samples. We previously developed a nonbinary SNP multiplex typing assay. In this study, we selected additional 20 nonbinary SNPs from the NCBI SNP database and verified them through pyrosequencing. These 20 nonbinary SNPs were analyzed using the fluorescent-labeled SNaPshot multiplex SNP typing method. The allele frequencies and genetic parameters of these 20 nonbinary SNPs were determined among 314 unrelated individuals from Han populations from China. The total power of discrimination was 0.9999999999994, and the cumulative probability of exclusion was 0.9986. Moreover, the result of the combination of this 20 nonbinary SNP assay with the 20 nonbinary SNP assay we previously developed demonstrated that the cumulative probability of exclusion of the 40 nonbinary SNPs was 0.999991 and that no significant linkage disequilibrium was observed in all 40 nonbinary SNPs. Thus, we concluded that this new system consisting of new 20 nonbinary SNPs could provide highly informative polymorphic data which would be further used in forensic application and would serve as a potentially valuable supplement to forensic DNA analysis. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Top single nucleotide polymorphisms affecting carbohydrate metabolism in metabolic syndrome: from the LIPGENE study.

PubMed

Delgado-Lista, Javier; Perez-Martinez, Pablo; Solivera, Juan; Garcia-Rios, Antonio; Perez-Caballero, A I; Lovegrove, Julie A; Drevon, Christian A; Defoort, Catherine; Blaak, Ellen E; Dembinska-Kieć, Aldona; Risérus, Ulf; Herruzo-Gomez, Ezequiel; Camargo, Antonio; Ordovas, Jose M; Roche, Helen; Lopez-Miranda, José

2014-02-01

Metabolic syndrome (MetS) is a high-prevalence condition characterized by altered energy metabolism, insulin resistance, and elevated cardiovascular risk. Although many individual single nucleotide polymorphisms (SNPs) have been linked to certain MetS features, there are few studies analyzing the influence of SNPs on carbohydrate metabolism in MetS. A total of 904 SNPs (tag SNPs and functional SNPs) were tested for influence on 8 fasting and dynamic markers of carbohydrate metabolism, by performance of an intravenous glucose tolerance test in 450 participants in the LIPGENE study. From 382 initial gene-phenotype associations between SNPs and any phenotypic variables, 61 (16% of the preselected variables) remained significant after bootstrapping. Top SNPs affecting glucose metabolism variables were as follows: fasting glucose, rs26125 (PPARGC1B); fasting insulin, rs4759277 (LRP1); C-peptide, rs4759277 (LRP1); homeostasis assessment of insulin resistance, rs4759277 (LRP1); quantitative insulin sensitivity check index, rs184003 (AGER); sensitivity index, rs7301876 (ABCC9), acute insulin response to glucose, rs290481 (TCF7L2); and disposition index, rs12691 (CEBPA). We describe here the top SNPs linked to phenotypic features in carbohydrate metabolism among approximately 1000 candidate gene variations in fasting and postprandial samples of 450 patients with MetS from the LIPGENE study.

Genetic analysis of prolactin gene in Pakistani cattle.

PubMed

Uddin, Raza Mohy; Babar, Masroor Ellahi; Nadeem, Asif; Hussain, Tanveer; Ahmad, Shakil; Munir, Sadia; Mehboob, Riffat; Ahmad, Fridoon Jawad

2013-10-01

Prolactin (PRL) is a polypeptide hormone, secreted mainly by the anterior pituitary gland. It is involved in many endocrine activities. The key functions of PRL are related to reproduction and lactation in mammals. To ascertain the presence of polymorphisms in the bovine PRL gene (bPRL), the bPRL gene was sequenced. Five mutations were identified in exonic region and eleven in associated intronic regions in 100 cattle from four Pakistani cattle breeds. Haplotype of predicted amino acid changes represent a common alteration at codon 222 from R-Arginine into K-Lysine in all four breeds. Significant statistical variations were observed in the distribution of single nucleotide polymorphism (SNP) in various cattle populations. However, on basis of present study, an association of these SNPs with milk performance traits in four Pakistani cow breeds cannot be truly replicated but at least can be effective DNA markers for some of the breeds studied. Linkage analysis between these SNPs on larger populations can be useful for the association with milk production traits. Furthermore, present study may be used for marker-assisted selection and management in cattle breeding program in local cattle breeds.

Cyclooxygenase-2 polymorphisms in Parkinson's disease.

PubMed

Håkansson, Anna; Bergman, Olle; Chrapkowska, Cecilia; Westberg, Lars; Belin, Andrea Carmine; Sydow, Olof; Johnels, Bo; Olson, Lars; Holmberg, Björn; Nissbrandt, Hans

2007-04-05

Accumulating evidence indicate that cyclooxygenase-2 (COX-2) is of pathophysiological importance for the neurodegeneration in Parkinson's disease (PD). For example, in a large epidemiological study, use of NSAIDs was associated with a lower risk of PD. Genetic variants of the COX-2 gene might therefore influence the risk of developing the disease. The genotype distribution of four common single nucleotide polymorphisms (SNPs) in the COX-2 gene (rs689466:A496G, rs20417:G926C, rs5277:G3050C, rs5275:C8473T) was analyzed in PD patients and control subjects in a Swedish population. No differences could be seen between the PD-patient and controls regarding the A496G, G926C, and G3050C SNPs, but the allele frequency of the C8473T SNP was found to differ when male patients were compared to controls (P = 0.007). In females no difference could be seen between PD-patients and controls. In conclusion, the results suggest a possible influence of the COX-2 C8473T SNP in PD, although it only seems to be of importance in men. (c) 2006 Wiley-Liss, Inc.

Automated detection system of single nucleotide polymorphisms using two kinds of functional magnetic nanoparticles

NASA Astrophysics Data System (ADS)

Liu, Hongna; Li, Song; Wang, Zhifei; Li, Zhiyang; Deng, Yan; Wang, Hua; Shi, Zhiyang; He, Nongyue

2008-11-01

Single nucleotide polymorphisms (SNPs) comprise the most abundant source of genetic variation in the human genome wide codominant SNPs identification. Therefore, large-scale codominant SNPs identification, especially for those associated with complex diseases, has induced the need for completely high-throughput and automated SNP genotyping method. Herein, we present an automated detection system of SNPs based on two kinds of functional magnetic nanoparticles (MNPs) and dual-color hybridization. The amido-modified MNPs (NH 2-MNPs) modified with APTES were used for DNA extraction from whole blood directly by electrostatic reaction, and followed by PCR, was successfully performed. Furthermore, biotinylated PCR products were captured on the streptavidin-coated MNPs (SA-MNPs) and interrogated by hybridization with a pair of dual-color probes to determine SNP, then the genotype of each sample can be simultaneously identified by scanning the microarray printed with the denatured fluorescent probes. This system provided a rapid, sensitive and highly versatile automated procedure that will greatly facilitate the analysis of different known SNPs in human genome.

Single-nucleotide polymorphisms (SNPs) of the IRF6 and TFAP2A in non-syndromic cleft lip with or without cleft palate (NSCLP) in a northern Chinese population

DOE Office of Scientific and Technical Information (OSTI.GOV)

Shi, Jinna, E-mail: kqkjk@yahoo.com.cn; Song, Tao; Jiao, Xiaohui

2011-07-15

Highlights: {yields} IRF6 rs642961 polymorphism is intensively associated with NSCLP. {yields} IRF6 rs2235371 polymorphism is not associated with NSCLP in the northern Chinese population. {yields} This investigation failed to yield any evidence for the involvement of TFAP2A polymorphisms in NSCLP in the northern Chinese population. -- Abstract: Non-syndromic cleft lip with or without cleft palate (NSCLP) is a common birth defect that is presumably caused by genetic factors alone or gene alterations in combination with environmental changes. A number of studies have shown an association between NSCLP and single-nucleotide polymorphisms (SNPs) in the interferon regulatory factor 6 (IRF6) gene inmore » several populations. The transcription factor AP-2a (TFAP2A), which is involved in regulating mid-face development and upper lip fusion, has also be considered a candidate gene contributing to the etiology of NSCLP. The potential importance of IRF6 and TFAP2A in the NSCLP is further highlighted by a study showing that the two molecules are in the same developmental pathway. To further assess the roles of the IRF6 and TFAP2A in NSCLP, we investigated two identified IRF6 SNPs (rs2235371, rs642961) and three TFAP2A tag SNPs (rs3798691, rs1675414, rs303050) selected from HapMap data in a northern Chinese population, a group with a high prevalence of NSCLP. These SNPs were examined for association with NSCLP in 175 patients and 160 healthy controls. We observed a significant correlation between IRF6 rs642961 and NSCLP, and a lack of association between IRF6 rs2235371 polymorphisms and NSCLP in this population. This investigation indicated that there is no association between the three SNPs in the TFAP2A and NSCLP, suggesting that TFAP2A may not be involved in the development of NSCLP in the northern Chinese population. Our study provides further evidence regarding the role of IRF6 variations in NSCLP development and finds no significant association between TFAP2A and NSCLP in this northern Chinese population.« less

Single nucleotide polymorphism analysis of Korean native chickens using next generation sequencing data.

PubMed

Seo, Dong-Won; Oh, Jae-Don; Jin, Shil; Song, Ki-Duk; Park, Hee-Bok; Heo, Kang-Nyeong; Shin, Younhee; Jung, Myunghee; Park, Junhyung; Jo, Cheorun; Lee, Hak-Kyo; Lee, Jun-Heon

2015-02-01

There are five native chicken lines in Korea, which are mainly classified by plumage colors (black, white, red, yellow, gray). These five lines are very important genetic resources in the Korean poultry industry. Based on a next generation sequencing technology, whole genome sequence and reference assemblies were performed using Gallus_gallus_4.0 (NCBI) with whole genome sequences from these lines to identify common and novel single nucleotide polymorphisms (SNPs). We obtained 36,660,731,136 ± 1,257,159,120 bp of raw sequence and average 26.6-fold of 25-29 billion reference assembly sequences representing 97.288 % coverage. Also, 4,006,068 ± 97,534 SNPs were observed from 29 autosomes and the Z chromosome and, of these, 752,309 SNPs are the common SNPs across lines. Among the identified SNPs, the number of novel- and known-location assigned SNPs was 1,047,951 ± 14,956 and 2,948,648 ± 81,414, respectively. The number of unassigned known SNPs was 1,181 ± 150 and unassigned novel SNPs was 8,238 ± 1,019. Synonymous SNPs, non-synonymous SNPs, and SNPs having character changes were 26,266 ± 1,456, 11,467 ± 604, 8,180 ± 458, respectively. Overall, 443,048 ± 26,389 SNPs in each bird were identified by comparing with dbSNP in NCBI. The presently obtained genome sequence and SNP information in Korean native chickens have wide applications for further genome studies such as genetic diversity studies to detect causative mutations for economic and disease related traits.

A Primary Assembly of a Bovine Haplotype Block Map Based on a 15,036-Single-Nucleotide Polymorphism Panel Genotyped in Holstein–Friesian Cattle

PubMed Central

Khatkar, Mehar S.; Zenger, Kyall R.; Hobbs, Matthew; Hawken, Rachel J.; Cavanagh, Julie A. L.; Barris, Wes; McClintock, Alexander E.; McClintock, Sara; Thomson, Peter C.; Tier, Bruce; Nicholas, Frank W.; Raadsma, Herman W.

2007-01-01

Analysis of data on 1000 Holstein–Friesian bulls genotyped for 15,036 single-nucleotide polymorphisms (SNPs) has enabled genomewide identification of haplotype blocks and tag SNPs. A final subset of 9195 SNPs in Hardy–Weinberg equilibrium and mapped on autosomes on the bovine sequence assembly (release Btau 3.1) was used in this study. The average intermarker spacing was 251.8 kb. The average minor allele frequency (MAF) was 0.29 (0.05–0.5). Following recent precedents in human HapMap studies, a haplotype block was defined where 95% of combinations of SNPs within a region are in very high linkage disequilibrium. A total of 727 haplotype blocks consisting of ≥3 SNPs were identified. The average block length was 69.7 ± 7.7 kb, which is ∼5–10 times larger than in humans. These blocks comprised a total of 2964 SNPs and covered 50,638 kb of the sequence map, which constitutes 2.18% of the length of all autosomes. A set of tag SNPs, which will be useful for further fine-mapping studies, has been identified. Overall, the results suggest that as many as 75,000–100,000 tag SNPs would be needed to track all important haplotype blocks in the bovine genome. This would require ∼250,000 SNPs in the discovery phase. PMID:17435229

PXR polymorphisms and their impact on pharmacokinetics/pharmacodynamics of repaglinide in healthy Chinese volunteers.

PubMed

Du, Qing-qing; Wang, Zhi-jun; He, Lin; Jiang, Xue-hua; Wang, Ling

2013-11-01

CYP3A4 is the main isoform of cytochrome P450 oxidases involved in the metabolism of approximately 60 % drugs, and its expression level is highly variable in human subjects. CYP3A4 is regulated by many transcription factors, among which the pregnane X receptor/steroid and xenobiotic receptor (PXR/SXR, NR1I2) have been identified as the most critical. Genetic polymorphisms (such as SNPs) in PXR may affect the expression level of CYP3A4. Although numerous SNPs have been identified in PXR and have appeared to affect PXR function, their impact on the expression of CYP3A4 in human subjects has not been well studied. Thus, a clinical study in healthy Chinese subjects was conducted to investigate the impact of PXR polymorphisms on repaglinide (an endogenous marker for CYP3A4 activity) pharmacokinetics used alone or in combination with a PXR inducer, flucloxacillin. Two SNPs, -298A>G and 11193T>C, were identified as the tag SNPs to represent the overall genetic polymorphic profile of PXR. To evaluate the potential functional change of these two SNPs, 24 healthy subjects were recruited in a pharmacokinetics/pharmacodynamics study of repaglinide with or without flucloxacillin. The pharmacokinetic parameters including AUC and T1/2 were significantly different among the PXR genotype groups. The SNPs of -298G/G and 11193C/C were found to be associated with a lower PXR activity resulting in reduction of CYP3A4 activity in vivo. After administration of flucloxacillin, a significant drug-drug interaction was observed. The clearance of repagnilide was significantly increased by concomitant flucloxacillin in a genotype dependent manner. The subjects with SNPs of -298G/G and 11193C/C appeared to be less sensitive to flucloxacillin. Our study results demonstrated for the first time the impact of genetic polymorphisms of PXR on the PK and PD of repaglinide, and showed that subjects with genotype of -298G/G and 11193C/C in PXR has a decreased elimination rate of 3A4/2C8. Furthermore, flucloxacillin was able to induce 3A4/2C8 expression mediated by PXR in a genotype dependent manner.

Transposon Insertions, Structural Variations, and SNPs Contribute to the Evolution of the Melon Genome.

PubMed

Sanseverino, Walter; Hénaff, Elizabeth; Vives, Cristina; Pinosio, Sara; Burgos-Paz, William; Morgante, Michele; Ramos-Onsins, Sebastián E; Garcia-Mas, Jordi; Casacuberta, Josep Maria

2015-10-01

The availability of extensive databases of crop genome sequences should allow analysis of crop variability at an unprecedented scale, which should have an important impact in plant breeding. However, up to now the analysis of genetic variability at the whole-genome scale has been mainly restricted to single nucleotide polymorphisms (SNPs). This is a strong limitation as structural variation (SV) and transposon insertion polymorphisms are frequent in plant species and have had an important mutational role in crop domestication and breeding. Here, we present the first comprehensive analysis of melon genetic diversity, which includes a detailed analysis of SNPs, SV, and transposon insertion polymorphisms. The variability found among seven melon varieties representing the species diversity and including wild accessions and highly breed lines, is relatively high due in part to the marked divergence of some lineages. The diversity is distributed nonuniformly across the genome, being lower at the extremes of the chromosomes and higher in the pericentromeric regions, which is compatible with the effect of purifying selection and recombination forces over functional regions. Additionally, this variability is greatly reduced among elite varieties, probably due to selection during breeding. We have found some chromosomal regions showing a high differentiation of the elite varieties versus the rest, which could be considered as strongly selected candidate regions. Our data also suggest that transposons and SV may be at the origin of an important fraction of the variability in melon, which highlights the importance of analyzing all types of genetic variability to understand crop genome evolution. © The Author 2015. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

Association of UCP1 -3826A/G and UCP3 -55C/T gene polymorphisms with obesity and its related traits among multi-ethnic Malaysians.

PubMed

Lee, Kah-Hui; Chai, Voon-Yun; Kanachamy, Sathia S; Say, Yee-How

2015-01-01

Our study investigated the association of UCP1 -3826A/G and UCP3 -55C/T single nucleotide polymorphisms (SNPs) with obesity and its related traits among multi-ethnic Malaysians. A total of 447 (225 males; 46 Malays, 339 ethnic Chinese, 62 ethnic Indians; 111 obese) participated. Demographic and anthropometric data were collected, and genotyping was performed by polymerase chain reaction-restriction fragment length polymorphism. The minor allele frequencies (MAFs) for UCP1 according to Malay/Chinese/Indian ethnicities were .61/.55/.52 and .32/.55/.38, respectively. UCP3 genotype and allele distribution was significantly associated with ethnicity and waist-to-hip ratio (WHR), but among non-obese and Chinese participants only, respectively, after stratified analysis. Chinese participants with T allele had significantly lesser risk to be centrally obese [odds ratio =.69 (CI =.48, 1.00; P=.04)], and also had significantly lower WHR compared to those with C allele. The UCP1 or UCP3 SNPs were not associated with obesity/BMI and total body fat (TBF), but combinatory genotype analysis revealed that those having the AA and CC genotype for the former and latter SNPs had significantly highest BMI and TBF compared to other genotype combinations. UCP3 -55C/T SNP was associated with central obesity among Malaysian participants of Chinese descent. Combinatory genotype analysis showed that BMI and TBF were significantly different among UCPI -3826A/G and UCP3 -55C/T genotype combinations, suggesting the existence of a gene interaction between UCP1 and UCP3 in influencing obesity and adiposity.

SIRT1 Gene Polymorphisms Affect the Protein Expression in Cardiovascular Diseases

PubMed Central

Kilic, Ulkan; Gok, Ozlem; Bacaksiz, Ahmet; Izmirli, Muzeyyen; Elibol-Can, Birsen; Uysal, Omer

2014-01-01

Cardiovascular disease (CVD), the leading cause of death worldwide, is related to gene-environment interactions due to epigenetic factors. SIRT1 protein and its downstream pathways are critical for both normal homeostasis and protection from CVD-induced defects. The aim of this study was to investigate the association between SIRT1 single nucleotide polymorphisms (SNPs) (rs7895833 A>G in the promoter region, rs7069102 C>G in intron 4 and rs2273773 C>T in exon 5 silent mutation) and SIRT1 and eNOS (endothelial nitric oxide synthase) protein expression as well as total antioxidant status (TAS), total oxidant status (TOS) and oxidative stress index (OSI) in CVD patients as compared to controls. The frequencies of mutant genotypes and alleles for rs7069102 and rs2273773 were significantly higher in patients with CVD compared to control group. The risk for CVD was increased by 2.4 times for rs7069102 and 1.9 times for rs2273773 in carriers of mutant allele compared with carriers of wild-type allele pointing the protective role of C allele for both SNPs against CVD. For rs7895833, there was no significant difference in genotype and allele distributions between groups. SIRT1 protein, TAS, TOS and OSI levels significantly increased in patients as compared to control group. In contrast, level of eNOS protein was considerably low in the CVD patients. An increase in the SIRT1 expression in the CVD patients carrying mutant genotype for rs7069102 and heterozygote genotype for all three SNPs was observed. This is the first study reporting an association between SIRT1 gene polymorphisms and the levels of SIRT1 and eNOS expressions as well as TAS, TOS and OSI. PMID:24587358

CARD15 Gene Polymorphisms Are Associated with Tuberculosis Susceptibility in Chinese Holstein Cows

PubMed Central

Liu, Tong; Tu, Wenji; Li, Wengui; Dong, Guodong; Xu, Cong; Qin, Bo; Liu, Kaihua; Yang, Jie; Chai, Jun; Shi, Xianwei; Zhang, Yifang

2015-01-01

Bovine tuberculosis (BTB) is a significant veterinary and financial problem in many parts of the world. Associations between specific host genes and susceptibility to mycobacterial infections, such as tuberculosis, have been reported in several species. The objective of this study was to identify and evaluate the relationship of single-nucleotide polymorphisms (SNPs) in the CARD15 gene with susceptibility to BTB in Chinese Holstein cows. DNA samples from 201 Chinese Holstein cows (103 cases and 98 controls) were collected from Kunming City, Yuxi City, and Dali City in China. SNPs in the CARD15 gene were assessed using polymerase chain reaction (PCR) and restriction fragment length polymorphism-polymerase chain reaction (RFLP-PCR). Case-control association testing and statistical analysis identified six SNPs associated with susceptibility to BTB in Chinese Holstein cows. The frequency of genotypes C/T, A/G, A/G, A/G, C/T, and A/G in E4 (-37), 208, 1644, 1648, 1799, and E10 (+107), respectively, was significantly higher in cases than in controls, and also the alleles C, A, A, G, T, and A, respectively, were associated with a greater relative risk in cases than in controls. The distribution of two haplotypes, TGGACA and CAGACA, was significantly different between cases and controls. Overall, this case-control study suggested that E4 (-37)(C/T), 208(A/G), 1644(A/G), 1648(A/G), 1799(C/T), and E10 (+107)(A/G) in the CARD15 gene were significantly associated with susceptibility to BTB in Chinese Holstein cows and that haplotypes TGGACA and CAGACA could be used as genetic markers in marker-assisted breeding programs for breeding cows with high resistance to BTB. PMID:26244859

Cannabinoid Receptor 1 Gene Polymorphisms and Marijuana Misuse Interactions On White Matter and Cognitive Deficits in Schizophrenia

PubMed Central

Ho, Beng-Choon; Wassink, Thomas H.; Ziebell, Steven; Andreasen, Nancy C.

2011-01-01

Marijuana exposure during the critical period of adolescent brain maturation may disrupt neuro-modulatory influences of endocannabinoids and increase schizophrenia susceptibility. Cannabinoid receptor 1 (CB1/CNR1) is the principal brain receptor mediating marijuana effects. No study to-date has systematically investigated the impact of CNR1 on quantitative phenotypic features in schizophrenia and inter-relationships with marijuana misuse. We genotyped 235 schizophrenia patients using 12 tag single nucleotide polymorphisms (tSNPs) that account for most of CB1 coding region genetic variability. Patients underwent a high-resolution anatomic brain magnetic resonance scan and cognitive assessment. Almost a quarter of the sample met DSM marijuana abuse (14%) or dependence (8%) criteria. Effects of CNR1 tSNPs and marijuana abuse/dependence on brain volumes and neurocognition were assessed using ANCOVA, including co-morbid alcohol/non-marijuana illicit drug misuse as covariates. Significant main effects of CNR1 tSNPs (rs7766029, rs12720071, and rs9450898) were found in white matter (WM) volumes. Patients with marijuana abuse/dependence had smaller fronto-temporal WM volumes than patients without heavy marijuana use. More interestingly, there were significant rs12720071 genotype-by-marijuana use interaction effects on WM volumes and neurocognitive impairment; suggestive of gene-environment interactions for conferring phenotypic abnormalities in schizophrenia. In this comprehensive evaluation of genetic variants distributed across the CB1 locus, CNR1 genetic polymorphisms were associated with WM brain volume variation among schizophrenia patients. Our findings suggest that heavy cannabis use in the context of specific CNR1 genotypes may contribute to greater WM volume deficits and cognitive impairment, which could in turn increase schizophrenia risk. PMID:21420833

Sequence polymorphism at the human apolipoprotein AII gene ( APOA2): unexpected deficit of variation in an African-American sample.

PubMed

Fullerton, Stephanie M; Clark, Andrew G; Weiss, Kenneth M; Taylor, Scott L; Stengård, Jari H; Salomaa, Veikko; Boerwinkle, Eric; Nickerson, Deborah A

2002-07-01

A 3.3-kb region, encompassing the APOA2 gene and 2 kb of 5' and 3' flanking DNA, was re-sequenced in a "core" sample of 24 individuals, sampled without regard to the health from each of three populations: African-Americans from Jackson (Miss., USA), Europeans from North Karelia (Finland), and non-Hispanic European-Americans from Rochester, (Minn., USA). Fifteen variable sites were identified (14 SNPs and one multi-allelic microsatellite, all silent), and these sites segregated as 18 sequence haplotypes (or nine, if SNPs only are considered). The haplotype distribution in the core African-American sample was unusual, with a deficit of particular haplotypes compared with those found in the other two samples, and a significantly (P<0.05) low level of nucleotide diversity relative to patterns of polymorphism and divergence at other human loci. Six of the 14 SNPs, whose variation captured the haplotype structure of the core data, were then genotyped by oligonucleotide ligation assay in an additional 2183 individuals from the same three populations (n=843, n=452, and n=888, respectively). All six sites varied in each of the larger "epidemiological" samples, and together, they defined 19 SNP haplotypes, seven with relative frequencies greater than 1% in the total sample; all of these common haplotypes had been identified earlier in the core re-sequencing survey. Here also, the African-American sample showed significantly lower SNP heterozygosity and haplotype diversity than the other two samples. The deficit of polymorphism is consistent with a population-specific non-neutral increase in the relative frequency of several haplotypes in Jackson.

Effect of BCHE single nucleotide polymorphisms on lipid metabolism markers in women.

PubMed

Oliveira, Jéssica de; Tureck, Luciane Viater; Santos, Willian Dos; Saliba, Louise Farah; Schenknecht, Caroline Schovanz; Scaraboto, Débora; Souza, Ricardo Lehtonen R; Furtado-Alle, Lupe

2017-01-01

Butyrylcholinesterase (BChE) activity and polymorphisms in its encoding gene had previously been associated with metabolic traits of obesity. This study investigated the association of three single nucleotide polymorphisms (SNPs) in the BCHE gene: -116G > A (rs1126680), 1615GA (rs1803274), 1914A < G (rs3495), with obesity and lipid metabolism markers, body mass index (BMI), total cholesterol (TC), low density lipoprotein cholesterol (LDL-C), high density lipoprotein cholesterol (HDL-C), triglyceride (TG) levels, and BChE enzymatic activity in obese (BMI≥30/n = 226) and non-obese women (BMI < 25/n = 81). BCHE SNPs genotyping was obtained by TaqMan allelic discrimination assay and by RFLP-PCR. Plasmatic BChE activity was measured using propionylthiocholine as substrate. Similar allele frequencies were found in obese and non-obese women for the three studied SNPs (p > 0.05). The dominant and recessive models were tested, and different effects were found. The -116A allele showed a dominant effect in BChE activity reduction in both non-obese and obese women (p = 0.045 and p < 0.001, respectively). The 1914A > G and 1615GA SNPs influenced the TG levels only in obese women. The 1914G and the 1615A alleles were associated with decreased plasma levels of TG. Thus, our results suggest that the obesity condition, characterized by loss of energy homeostasis, is modulated by BCHE polymorphisms.

Investigating the CFH Gene Polymorphisms as a Risk Factor for Age-related Macular Degeneration in an Iranian Population.

PubMed

Babanejad, Mojgan; Moein, Hamidreza; Akbari, Mohammad R; Badiei, Azadeh; Yaseri, Mehdi; Soheilian, Masoud; Najmabadi, Hossein

2016-06-01

Age-related macular degeneration (AMD) is a complex disorder which results in irreversible vision loss and progressive impairment of central vision. Disease susceptibility is influenced by multiple genetic and environmental factors. Single nucleotide polymorphisms (SNP) in the complement factor H gene are the most important genetic risk factors. We conducted a case-control study to investigate the association four SNPs (dbSNP ID: rs800292, rs1061170, rs2274700 and rs3753395) of CFH gene with AMD in the Iranian population. We recruited 100 AMD patients and 100 age- and sex-matched normal controls. Direct sequencing for three SNPs (rs800292, rs2274700 and rs3753395) and restriction fragment length polymorphism utilized for rs1061170. Allele and genotype frequencies of SNPs were calculated and tested for departure from Hardy-Weinberg equilibrium using the Chi-square test. An allelic and genotypic association was compared by logistic regression analysis using the SNPassoc. According to our results, the frequencies of risk allele for all SNPs (G, G, A, and C alleles of rs800292, rs2274700, rs3753395 and rs1061170, respectively) were significantly higher in AMD patients (p value < 0.001). AMD individuals who had at least one copy of the C allele of rs1061170 had an increased risk of disease compared with cases with the T allele. Other studied polymorphisms showed the same association. Our results suggest the contribution of all four predicted CFH polymorphisms in AMD susceptibility among the Iranian population. This association with CFH may lead to early detection and new strategies for prevention and treatment of AMD.

Sequence Analysis of APOA5 Among the Kuwaiti Population Identifies Association of rs2072560, rs2266788, and rs662799 With TG and VLDL Levels

PubMed Central

Jasim, Anfal A.; Al-Bustan, Suzanne A.; Al-Kandari, Wafa; Al-Serri, Ahmad; AlAskar, Huda

2018-01-01

Common variants of Apolipoprotein A5 (APOA5) have been associated with lipid levels yet very few studies have reported full sequence data from various ethnic groups. The purpose of this study was to analyse the full APOA5 gene sequence to identify variants in 100 healthy Kuwaitis of Arab ethnicities and assess their association with variation in lipid levels in a cohort of 733 samples. Sanger method was used in the direct sequencing of the full 3.7 Kb APOA5 and multiple sequence alignment was used to identify variants. The complete APOA5 sequence in Kuwaiti Arabs has been deposited in GenBank (KJ401315). A total of 20 reported single nucleotide polymorphisms (SNPs) were identified. Two novel SNPs were also identified: a synonymous 2197G>A polymorphism at genomic position 116661525 and a 3′ UTR 3222 C>T polymorphism at genomic position 116660500 based on human genome assembly GRCh37/hg:19. Five SNPs along with the two novel SNPs were selected for validation in the cohort. Association of those SNPs with lipid levels was tested and minor alleles of three SNPs (rs2072560, rs2266788, and rs662799) were found significantly associated with TG and VLDL levels. This is the first study to report the full APOA5 sequence and SNPs in an Arab ethnic group. Analysis of the variants identified and comparison to other populations suggests a distinctive genetic component in Arabs. The positive association observed for rs2072560 and rs2266788 with TG and VLDL levels confirms their role in lipid metabolism. PMID:29686695

Sequence Analysis of APOA5 Among the Kuwaiti Population Identifies Association of rs2072560, rs2266788, and rs662799 With TG and VLDL Levels.

PubMed

Jasim, Anfal A; Al-Bustan, Suzanne A; Al-Kandari, Wafa; Al-Serri, Ahmad; AlAskar, Huda

2018-01-01

Common variants of Apolipoprotein A5 ( APOA 5) have been associated with lipid levels yet very few studies have reported full sequence data from various ethnic groups. The purpose of this study was to analyse the full APOA5 gene sequence to identify variants in 100 healthy Kuwaitis of Arab ethnicities and assess their association with variation in lipid levels in a cohort of 733 samples. Sanger method was used in the direct sequencing of the full 3.7 Kb APOA5 and multiple sequence alignment was used to identify variants. The complete APOA5 sequence in Kuwaiti Arabs has been deposited in GenBank (KJ401315). A total of 20 reported single nucleotide polymorphisms (SNPs) were identified. Two novel SNPs were also identified: a synonymous 2197G>A polymorphism at genomic position 116661525 and a 3' UTR 3222 C>T polymorphism at genomic position 116660500 based on human genome assembly GRCh37/hg:19. Five SNPs along with the two novel SNPs were selected for validation in the cohort. Association of those SNPs with lipid levels was tested and minor alleles of three SNPs (rs2072560, rs2266788, and rs662799) were found significantly associated with TG and VLDL levels. This is the first study to report the full APOA5 sequence and SNPs in an Arab ethnic group. Analysis of the variants identified and comparison to other populations suggests a distinctive genetic component in Arabs. The positive association observed for rs2072560 and rs2266788 with TG and VLDL levels confirms their role in lipid metabolism.

Blood lead levels, iron metabolism gene polymorphisms and homocysteine: a gene-environment interaction study.

PubMed

Kim, Kyoung-Nam; Lee, Mee-Ri; Lim, Youn-Hee; Hong, Yun-Chul

2017-12-01

Homocysteine has been causally associated with various adverse health outcomes. Evidence supporting the relationship between lead and homocysteine levels has been accumulating, but most prior studies have not focused on the interaction with genetic polymorphisms. From a community-based prospective cohort, we analysed 386 participants (aged 41-71 years) with information regarding blood lead and plasma homocysteine levels. Blood lead levels were measured between 2001 and 2003, and plasma homocysteine levels were measured in 2007. Interactions of lead levels with 42 genotyped single-nucleotide polymorphisms (SNPs) in five genes ( TF , HFE , CBS , BHMT and MTR ) were assessed via a 2-degree of freedom (df) joint test and a 1-df interaction test. In secondary analyses using imputation, we further assessed 58 imputed SNPs in the TF and MTHFR genes. Blood lead concentrations were positively associated with plasma homocysteine levels (p=0.0276). Six SNPs in the TF and MTR genes were screened using the 2-df joint test, and among them, three SNPs in the TF gene showed interactions with lead with respect to homocysteine levels through the 1-df interaction test (p<0.0083). Seven SNPs in the MTHFR gene were associated with homocysteine levels at an α-level of 0.05, but the associations did not persist after Bonferroni correction. These SNPs did not show interactions with lead levels. Blood lead levels were positively associated with plasma homocysteine levels measured 4-6 years later, and three SNPs in the TF gene modified the association. © Article author(s) (or their employer(s) unless otherwise stated in the text of the article) 2017. All rights reserved. No commercial use is permitted unless otherwise expressly granted.

Interleukin gene polymorphisms and breast cancer: a case control study and systematic literature review

PubMed Central

Balasubramanian, SP; Azmy, IAF; Higham, SE; Wilson, AG; Cross, SS; Cox, A; Brown, NJ; Reed, MW

2006-01-01

Background Interleukins and cytokines play an important role in the pathogenesis of many solid cancers. Several single nucleotide polymorphisms (SNPs) identified in cytokine genes are thought to influence the expression or function of these proteins and many have been evaluated for their role in inflammatory disease and cancer predisposition. The aim of this study was to evaluate any role of specific SNPs in the interleukin genes IL1A, IL1B, IL1RN, IL4R, IL6 and IL10 in predisposition to breast cancer susceptibility and severity. Methods Candidate single nucleotide polymorphisms (SNPs) in key cytokine genes were genotyped in breast cancer patients and in appropriate healthy volunteers who were similar in age, race and sex. Genotyping was performed using a high throughput allelic discrimination method. Data on clinico-pathological details and survival were collected. A systematic review of Medline English literature was done to retrieve previous studies of these polymorphisms in breast cancer. Results None of the polymorphisms studied showed any overall predisposition to breast cancer susceptibility, severity or to time to death or occurrence of distant metastases. The results of the systematic review are summarised. Conclusion Polymorphisms within key interleukin genes (IL1A, IL1B, IL1RN, IL4R, IL6 and IL10 do not appear to play a significant overall role in breast cancer susceptibility or severity. PMID:16842617

Genetic polymorphism and prostate cancer aggressiveness: a case-only study of 1,536 GWAS and candidate SNPs in African-Americans and European-Americans.

PubMed

Bensen, Jeannette T; Xu, Zongli; Smith, Gary J; Mohler, James L; Fontham, Elizabeth T H; Taylor, Jack A

2013-01-01

Genome-wide association studies have established a number of replicated single nucleotide polymorphisms (SNPs) for susceptibility to prostate cancer (CaP), but it is unclear whether these susceptibility SNPs are also associated with disease aggressiveness. This study evaluates whether such replication SNPs or other candidate SNPs are associated with CaP aggressiveness in African-American (AA) and European-American (EA) men. A 1,536 SNP panel which included 34 genome-wide association study (GWAS) replication SNPs, 38 flanking SNPs, a set of ancestry informative markers, and SNPs in candidate genes and other areas was genotyped in 1,060 AA and 1,087 EA men with incident CaP from the North Carolina-Louisiana Prostate Cancer Project (PCaP). Tests for association were conducted using ordinal logistic regression with a log-additive genotype model and a 3-category CaP aggressiveness variable. Four GWAS replication SNPs (rs2660753, rs13254738, rs10090154, rs2735839) and seven flanking SNPs were associated with CaP aggressiveness (P < 0.05) in three genomic regions: One at 3p12 (EA), seven at 8q24 (5 AA, 2 EA), and three at 19q13 at the kallilkrein-related peptidase 3 (KLK3) locus (two AA, one AA and EA). The KLK3 SNPs also were associated with serum prostate-specific antigen (PSA) levels in AA (P < 0.001) but not in EA. A number of the other SNPs showed some evidence of association but none met study-wide significance levels after adjusting for multiple comparisons. Some replicated GWAS susceptibility SNPs may play a role in CaP aggressiveness. However, like susceptibility, these associations are not consistent between racial groups. Copyright © 2012 Wiley Periodicals, Inc.

Genetic polymorphism and prostate cancer aggressiveness: A case-only study of 1536 GWAS and candidate SNPs in African Americans and European Americans

PubMed Central

Bensen, Jeannette T.; Xu, Zongli; Smith, Gary J.; Mohler, James L.; Fontham, Elizabeth T.H.; Taylor, Jack A.

2012-01-01

BACKGROUND Genome-wide association studies have established a number of replicated single nucleotide polymorphisms (SNPs) for susceptibility to prostate cancer (CaP), but it is unclear whether these susceptibility SNPs are also associated with disease aggressiveness. This study evaluates whether such replication SNPs or other candidate SNPs are associated with CaP aggressiveness in African-American (AA) and European-American (EA) men. METHODS A 1,536 SNP panel which included 34 genome-wide association study (GWAS) replication SNPs, 38 flanking SNPs, a set of ancestry informative markers, and SNPs in candidate genes and other areas was genotyped in 1,060 AA and 1,087 EA men with incident CaP from the North Carolina-Louisiana Prostate Cancer Project (PCaP). Tests for association were conducted using ordinal logistic regression with a log-additive genotype model and a 3-category CaP aggressiveness variable. RESULTS 4 GWAS replication SNPs (rs2660753, rs13254738, rs10090154, rs2735839) and 7 flanking SNPs were associated with CaP aggressiveness (P<0.05) in 3 genomic regions: one at 3p12 (EA), 7 at 8q24 (5 AA, 2 EA), and 3 at 19q13 at the kallilkrein-related peptidase 3 (KLK3) locus (2 AA, 1 AA and EA). The KLK3 SNPs also were associated with serum prostate-specific antigen (PSA) levels in AA (p < 0.001) but not in EA. A number of the other SNPs showed some evidence of association but none met study-wide significance levels after adjusting for multiple comparisons. CONCLUSIONS Some replicated GWAS susceptibility SNPs may play a role in CaP aggressiveness. However, like susceptibility, these associations are not consistent between racial groups. PMID:22549899

Shared susceptibility loci at 2q33 region for lung and esophageal cancers in high-incidence areas of esophageal cancer in northern China

PubMed Central

Song, Xin; Hu, Shou Jia; Lv, Shuang; Cheng, Rang; Zhang, Tang Juan; Han, Xue Na; Ren, Jing Li; Qi, Yi Jun

2017-01-01

Background Cancers from lung and esophagus are the leading causes of cancer-related deaths in China and share many similarities in terms of histological type, risk factors and genetic variants. Recent genome-wide association studies (GWAS) in Chinese esophageal cancer patients have demonstrated six high-risk candidate single nucleotide polymorphisms (SNPs). Thus, the present study aimed to determine the risk of these SNPs predisposing to lung cancer in Chinese population. Methods A total of 1170 lung cancer patients and 1530 normal subjects were enrolled in this study from high-incidence areas for esophageal cancer in Henan, northern China. Five milliliters of blood were collected from all subjects for genotyping. Genotyping of 20 high-risk SNP loci identified from genome-wide association studies (GWAS) on esophageal, lung and gastric cancers was performed using TaqMan allelic discrimination assays. Polymorphisms were examined for deviation from Hardy-Weinberg equilibrium (HWE) using Х2 test. Bonferroni correction was performed to correct the statistical significance of 20 SNPs with the risk of lung cancer. The Pearson’s Х2 test was used to compare the distributions of gender, TNM stage, histopathological type, smoking and family history by lung susceptibility genotypes. Kaplan-Meier and Cox regression analyses were carried out to evaluate the associations between genetic variants and overall survival. Results Four of the 20 SNPs identified as high-risk SNPs in Chinese esophageal cancer showed increased risk for Chinese lung cancer, which included rs3769823 (OR = 1.26; 95% CI = 1.107–1.509; P = 0.02), rs10931936 (OR = 1.283; 95% CI = 1.100–1.495; P = 0.04), rs2244438 (OR = 1.294; 95% CI = 1.098–1.525; P = 0.04) and rs13016963 (OR = 1.268; 95% CI = 1.089–1.447; P = 0.04). All these SNPs were located at 2q33 region harboringgenes of CASP8, ALS2CR12 and TRAK2. However, none of these susceptibility SNPs was observed to be significantly associated with gender, TNM stage, histopathological type, smoking, family history and overall survival. Conclusions The present study identified four high-risk SNPs at 2q33 locus for Chinese lung cancer and demonstrated the shared susceptibility loci at 2q33 region for Chinese lung and esophageal cancers. PMID:28542283

Shared susceptibility loci at 2q33 region for lung and esophageal cancers in high-incidence areas of esophageal cancer in northern China.

PubMed

Zhao, Xue Ke; Mao, Yi Min; Meng, Hui; Song, Xin; Hu, Shou Jia; Lv, Shuang; Cheng, Rang; Zhang, Tang Juan; Han, Xue Na; Ren, Jing Li; Qi, Yi Jun; Wang, Li Dong

2017-01-01

Cancers from lung and esophagus are the leading causes of cancer-related deaths in China and share many similarities in terms of histological type, risk factors and genetic variants. Recent genome-wide association studies (GWAS) in Chinese esophageal cancer patients have demonstrated six high-risk candidate single nucleotide polymorphisms (SNPs). Thus, the present study aimed to determine the risk of these SNPs predisposing to lung cancer in Chinese population. A total of 1170 lung cancer patients and 1530 normal subjects were enrolled in this study from high-incidence areas for esophageal cancer in Henan, northern China. Five milliliters of blood were collected from all subjects for genotyping. Genotyping of 20 high-risk SNP loci identified from genome-wide association studies (GWAS) on esophageal, lung and gastric cancers was performed using TaqMan allelic discrimination assays. Polymorphisms were examined for deviation from Hardy-Weinberg equilibrium (HWE) using Х2 test. Bonferroni correction was performed to correct the statistical significance of 20 SNPs with the risk of lung cancer. The Pearson's Х2 test was used to compare the distributions of gender, TNM stage, histopathological type, smoking and family history by lung susceptibility genotypes. Kaplan-Meier and Cox regression analyses were carried out to evaluate the associations between genetic variants and overall survival. Four of the 20 SNPs identified as high-risk SNPs in Chinese esophageal cancer showed increased risk for Chinese lung cancer, which included rs3769823 (OR = 1.26; 95% CI = 1.107-1.509; P = 0.02), rs10931936 (OR = 1.283; 95% CI = 1.100-1.495; P = 0.04), rs2244438 (OR = 1.294; 95% CI = 1.098-1.525; P = 0.04) and rs13016963 (OR = 1.268; 95% CI = 1.089-1.447; P = 0.04). All these SNPs were located at 2q33 region harboringgenes of CASP8, ALS2CR12 and TRAK2. However, none of these susceptibility SNPs was observed to be significantly associated with gender, TNM stage, histopathological type, smoking, family history and overall survival. The present study identified four high-risk SNPs at 2q33 locus for Chinese lung cancer and demonstrated the shared susceptibility loci at 2q33 region for Chinese lung and esophageal cancers.

Mutation analysis of BRCA1/2 mutations with special reference to polymorphic SNPs in Indian breast cancer patients.

PubMed

Shah, Nidhi D; Shah, Parth S; Panchal, Yash Y; Katudia, Kalpesh H; Khatri, Nikunj B; Ray, Hari Shankar P; Bhatiya, Upti R; Shah, Sandip C; Shah, Bhavini S; Rao, Mandava V

2018-01-01

Germline mutations BRCA1 and BRCA2 contribute almost equally in the causation of breast cancer (BC). The type of mutations in the Indian population that cause this condition is largely unknown. In this cohort, 79 randomized BC patients were screened for various types of BRCA1 and BRCA2 mutations including frameshift, nonsense, missense, in-frame and splice site types. The purified extracted DNA of each referral patient was subjected to Sanger gene sequencing using Codon Code Analyzer and Mutation Surveyor and next-generation sequencing (NGS) methods with Ion torrent software, after appropriate care. The data revealed that 35 cases were positive for BRCA1 or BRCA2 (35/79: 44.3%). BRCA2 mutations were higher (52.4%) than BRCA1 mutations (47.6%). Five novel mutations detected in this study were p.pro163 frameshift, p.asn997 frameshift, p.ser148 frameshift and two splice site single-nucleotide polymorphisms (SNPs). Additionally, four nonsense and one in-frame deletion were identified, which all seemed to be pathogenic. Polymorphic SNPs contributed the highest percentage of mutations (72/82: 87.8%) and contributed to pathogenic, likely pathogenic, likely benign, benign and variant of unknown significance (VUS). Young age groups (20-60 years) had a high frequency of germline mutations (62/82;75.6%) in the Indian population. This study suggested that polymorphic SNPs contributed a high percentage of mutations along with five novel types. Younger age groups are prone to having BC with a higher mutational rate. Furthermore, the SNPs detected in exons 10, 11 and 16 of BRCA1 and BRCA2 were higher than those in other exons 2, 3 and 9 polymorphic sites in two germline genes. These may be contributory for BC although missense types are known to be susceptible for cancer depending on the type of amino acid replaced in the protein and associated with pathologic events. Accordingly, appropriate counseling and treatment may be suggested.

Polymorphisms in inflammation pathway genes and endometrial cancer risk

PubMed Central

Delahanty, Ryan J.; Xiang, Yong-Bing; Spurdle, Amanda; Beeghly-Fadiel, Alicia; Long, Jirong; Thompson, Deborah; Tomlinson, Ian; Yu, Herbert; Lambrechts, Diether; Dörk, Thilo; Goodman, Marc T.; Zheng, Ying; Salvesen, Helga B.; Bao, Ping-Ping; Amant, Frederic; Beckmann, Matthias W.; Coenegrachts, Lieve; Coosemans, An; Dubrowinskaja, Natalia; Dunning, Alison; Runnebaum, Ingo B.; Easton, Douglas; Ekici, Arif B.; Fasching, Peter A.; Halle, Mari K.; Hein, Alexander; Howarth, Kimberly; Gorman, Maggie; Kaydarova, Dylyara; Krakstad, Camilla; Lose, Felicity; Lu, Lingeng; Lurie, Galina; O’Mara, Tracy; Matsuno, Rayna K.; Pharoah, Paul; Risch, Harvey; Corssen, Madeleine; Trovik, Jone; Turmanov, Nurzhan; Wen, Wanqing; Lu, Wei; Cai, Qiuyin; Zheng, Wei; Shu, Xiao-Ou

2013-01-01

Background Experimental and epidemiological evidence have suggested that chronic inflammation may play a critical role in endometrial carcinogenesis. Methods To investigate this hypothesis, a two-stage study was carried out to evaluate single nucleotide polymorphisms (SNPs) in inflammatory pathway genes in association with endometrial cancer risk. In stage 1, 64 candidate pathway genes were identified and 4,542 directly genotyped or imputed SNPs were analyzed among 832 endometrial cancer cases and 2,049 controls, using data from the Shanghai Endometrial Cancer Genetics Study. Linkage disequilibrium of stage 1 SNPs significantly associated with endometrial cancer (P<0.05) indicated that the majority of associations could be linked to one of 24 distinct loci. One SNP from each of the 24 loci was then selected for follow-up genotyping. Of these, 21 SNPs were successfully designed and genotyped in stage 2, which consisted of ten additional studies including 6,604 endometrial cancer cases and 8,511 controls. Results Five of the 21 SNPs had significant allelic odds ratios and 95% confidence intervals as follows: FABP1, 0.92 (0.85-0.99); CXCL3, 1.16 (1.05-1.29); IL6, 1.08 (1.00-1.17); MSR1, 0.90 (0.82-0.98); and MMP9, 0.91 (0.87-0.97). Two of these polymorphisms were independently significant in the replication sample (rs352038 in CXCL3 and rs3918249 in MMP9). The association for the MMP9 polymorphism remained significant after Bonferroni correction and showed a significant association with endometrial cancer in both Asian- and European-ancestry samples. Conclusions These findings lend support to the hypothesis that genetic polymorphisms in genes involved in the inflammatory pathway may contribute to genetic susceptibility to endometrial cancer. Impact Statement This study adds to the growing evidence that inflammation plays an important role in endometrial carcinogenesis. PMID:23221126

SNPs in DNA repair or oxidative stress genes and late subcutaneous fibrosis in patients following single shot partial breast irradiation

PubMed Central

2012-01-01

Background The aim of this study was to evaluate the potential association between single nucleotide polymorphisms related response to radiotherapy injury, such as genes related to DNA repair or enzymes involved in anti-oxidative activities. The paper aims to identify marker genes able to predict an increased risk of late toxicity studying our group of patients who underwent a Single Shot 3D-CRT PBI (SSPBI) after BCS (breast conserving surgery). Methods A total of 57 breast cancer patients who underwent SSPBI were genotyped for SNPs (single nucleotide polymorphisms) in XRCC1, XRCC3, GST and RAD51 by Pyrosequencing technology. Univariate analysis (ORs and 95% CI) was performed to correlate SNPs with the risk of developing ≥ G2 fibrosis or fat necrosis. Results A higher significant risk of developing ≥ G2 fibrosis or fat necrosis in patients with: polymorphic variant GSTP1 (Ile105Val) (OR = 2.9; 95%CI, 0.88-10.14, p = 0.047). Conclusions The presence of some SNPs involved in DNA repair or response to oxidative stress seem to be able to predict late toxicity. Trial Registration ClinicalTrials.gov: NCT01316328 PMID:22272830

Transcriptome and Complexity-Reduced, DNA-Based Identification of Intraspecies Single-Nucleotide Polymorphisms in the Polyploid Gossypium hirsutum L.

PubMed Central

Zhu, Qian-Hao; Spriggs, Andrew; Taylor, Jennifer M.; Llewellyn, Danny; Wilson, Iain

2014-01-01

Varietal single nucleotide polymorphisms (SNPs) are the differences within one of the two subgenomes between different tetraploid cotton varieties and have not been practically used in cotton genetics and breeding because they are difficult to identify due to low genetic diversity and very high sequence identity between homeologous genes in cotton. We have used transcriptome and restriction site−associated DNA sequencing to identify varietal SNPs among 18 G. hirsutum varieties based on the rationale that varietal SNPs can be more confidently called when flanked by subgenome-specific SNPs. Using transcriptome data, we successfully identified 37,413 varietal SNPs and, of these, 22,121 did not have an additional varietal SNP within their 20-bp flanking regions so can be used in most SNP genotyping assays. From restriction site−associated DNA sequencing data, we identified an additional 3090 varietal SNPs between two of the varieties. Of the 1583 successful SNP assays achieved using different genotyping platforms, 1363 were verified. Many of the SNPs behaved as dominant markers because of coamplification from homeologous loci, but the number of SNPs acting as codominant markers increased when one or more subgenome-specific SNP(s) were incorporated in their assay primers, giving them greater utility for breeding applications. A G. hirsutum genetic map with 1244 SNP markers was constructed covering 5557.42 centiMorgan and used to map qualitative and quantitative traits. This collection of G. hirsutum varietal SNPs complements existing intra-specific SNPs and provides the cotton community with a valuable marker resource applicable to genetic analyses and breeding programs. PMID:25106949

Gene by Environment Investigation of Incident Lung Cancer Risk in African-Americans.

PubMed

David, Sean P; Wang, Ange; Kapphahn, Kristopher; Hedlin, Haley; Desai, Manisha; Henderson, Michael; Yang, Lingyao; Walsh, Kyle M; Schwartz, Ann G; Wiencke, John K; Spitz, Margaret R; Wenzlaff, Angela S; Wrensch, Margaret R; Eaton, Charles B; Furberg, Helena; Mark Brown, W; Goldstein, Benjamin A; Assimes, Themistocles; Tang, Hua; Kooperberg, Charles L; Quesenberry, Charles P; Tindle, Hilary; Patel, Manali I; Amos, Christopher I; Bergen, Andrew W; Swan, Gary E; Stefanick, Marcia L

2016-02-01

Genome-wide association studies have identified polymorphisms linked to both smoking exposure and risk of lung cancer. The degree to which lung cancer risk is driven by increased smoking, genetics, or gene-environment interactions is not well understood. We analyzed associations between 28 single nucleotide polymorphisms (SNPs) previously associated with smoking quantity and lung cancer in 7156 African-American females in the Women's Health Initiative (WHI), then analyzed main effects of top nominally significant SNPs and interactions between SNPs, cigarettes per day (CPD) and pack-years for lung cancer in an independent, multi-center case-control study of African-American females and males (1078 lung cancer cases and 822 controls). Nine nominally significant SNPs for CPD in WHI were associated with incident lung cancer (corrected p-values from 0.027 to 6.09 × 10(-5)). CPD was found to be a nominally significant effect modifier between SNP and lung cancer for six SNPs, including CHRNA5 rs2036527[A](betaSNP*CPD = - 0.017, p = 0.0061, corrected p = 0.054), which was associated with CPD in a previous genome-wide meta-analysis of African-Americans. These results suggest that chromosome 15q25.1 variants are robustly associated with CPD and lung cancer in African-Americans and that the allelic dose effect of these polymorphisms on lung cancer risk is most pronounced in lighter smokers.

Association of ACE and MDR1 Gene Polymorphisms with Steroid Resistance in Children with Idiopathic Nephrotic Syndrome.

PubMed

Dhandapani, Mohanapriya Chinambedu; Venkatesan, Vettriselvi; Rengaswamy, Nammalwar Bollam; Gowrishankar, Kalpana; Nageswaran, Prahlad; Perumal, Venkatachalam

2015-08-01

The purpose of the study was to investigate the distribution of insertion/deletion (I/D) polymorphisms of the angiotensin-converting enzyme (ACE) gene and three exonic polymorphisms of the multidrug resistance 1 (MDR1) gene (C3435T, C1236T, and G2677T) in children diagnosed with idiopathic nephrotic syndrome (INS). The study group consisted of 100 healthy controls and 150 INS patients, of which 50 were steroid resistant. Genomic DNA from blood samples was isolated from both of these groups and genotyping of the ACE and MDR1 genes was performed by polymerase chain reaction (PCR) using specific primers. There was no significant difference observed in the genotypic distribution and D allele frequency of the ACE gene. The two single-nucleotide polymorphisms (SNPs), C1236T and C3435T, of the MDR1 gene showed no significance, whereas the SNP G2677T/A was significantly associated with the genotypes GT and GA of the MDR1 gene, indicating it may be a potential marker to detect drug resistance. Screening these polymorphisms will pave the way to better understand the molecular mechanisms of the disease, which may be useful in developing targeted therapies for INS patients.

Association between mitochondrial DNA variations and schizophrenia in the northern Chinese Han population.

PubMed

Xu, Feng-Ling; Ding, Mei; Yao, Jun; Shi, Zhang-Sen; Wu, Xue; Zhang, Jing-Jing; Pang, Hao; Xing, Jia-Xin; Xuan, Jin-Feng; Wang, Bao-Jie

2017-01-01

To determine whether mitochondrial DNA (mtDNA) variations are associated with schizophrenia, 313 patients with schizophrenia and 326 unaffected participants of the northern Chinese Han population were included in a prospective study. Single-nucleotide polymorphisms (SNPs) including C5178A, A10398G, G13708A, and C13928G were analyzed by polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP). Hypervariable regions I and II (HVSI and HVSII) were analyzed by sequencing. The results showed that the 4 SNPs and 11 haplotypes, composed of the 4 SNPs, did not differ significantly between patient and control groups. No significant association between haplogroups and the risk of schizophrenia was ascertained after Bonferroni correction. Drawing a conclusion, there was no evidence of an association between mtDNA (the 4 SNPs and the control region) and schizophrenia in the northern Chinese Han population.

A genetic variation map for chicken with 2.8 million single nucleotide polymorphisms

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wong, G K; Hillier, L; Brandstrom, M

2005-02-20

We describe a genetic variation map for the chicken genome containing 2.8 million single nucleotide polymorphisms (SNPs), based on a comparison of the sequences of 3 domestic chickens (broiler, layer, Silkie) to their wild ancestor Red Jungle Fowl (RJF). Subsequent experiments indicate that at least 90% are true SNPs, and at least 70% are common SNPs that segregate in many domestic breeds. Mean nucleotide diversity is about 5 SNP/kb for almost every possible comparison between RJF and domestic lines, between two different domestic lines, and within domestic lines--contrary to the idea that domestic animals are highly inbred relative to theirmore » wild ancestors. In fact, most of the SNPs originated prior to domestication, and there is little to no evidence of selective sweeps for adaptive alleles on length scales of greater than 100 kb.« less

Single nucleotide polymorphisms of the bovine VEGF-B gene and their associations with growth traits in the Nanyang cattle breed.

PubMed

Pang, Y H; Lei, C Z; Zhang, C L; Lan, X Y; Shao, S M; Gao, X M; Chen, H

2012-01-01

PCR-SSCP and DNA sequencing methods were applied to reveal single nucleotide polymorphisms (SNPs) in the bovine VEGF-B gene in 675 samples belonging to three native Chinese cattle breeds. We found 3 SNPs and a duplication NC_007330.5: g. [782 A>G p. (Gly112 =) (;) 1000-1001dup CT (;) 1079 C>T (;) 2129 G>A p. (Arg184Gln)]. We also observed a statistically significant association of the polymorphism (1000-1001dup CT) in intron 3 of the VEGF-B gene with the body weight of the Nanyang cattle (p < 0.05). This polymorphisms of VEGF-B gene need to be verified among a larger cattle population before it can be identified as a marker for bovine body weight.

Vitamin D receptor polymorphisms in patients with cutaneous melanoma

PubMed Central

Orlow, Irene; Roy, Pampa; Reiner, Anne S.; Yoo, Sarah; Patel, Himali; Paine, Susan; Armstrong, Bruce K.; Kricker, Anne; Marrett, Loraine D.; Millikan, Robert C.; Thomas, Nancy E.; Gruber, Stephen B.; Anton-Culver, Hoda; Rosso, Stefano; Gallagher, Richard P.; Dwyer, Terence; Kanetsky, Peter A.; Busam, Klaus; From, Lynn; Begg, Colin B.; Berwick, Marianne

2011-01-01

The vitamin D receptor (VDR) gene has been associated with cancer risk, but only a few polymorphisms have been studied in relation to melanoma risk and the results have been inconsistent. We examined 38 VDR gene SNPs in a large international multi-center population-based case-control study of melanoma. Buccal DNAs were obtained from 1207 people with incident multiple primary melanoma and 2469 with incident single primary melanoma. SNPs with known or suspected impact on VDR activity, htSNPs with ≥10% MAF in Caucasians, and SNPs reported as significant in other association studies were examined. Logistic regression was used to calculate the relative risks conferred by the individual SNP. Eight of 38 SNPs in the promoter, coding, and 3’ gene regions were individually significantly associated with multiple primary melanoma after adjusting for covariates. The estimated increase in risk for individuals who were homozygous for the minor allele ranged from 25% to 33% for 6 polymorphisms: rs10875712 (OR 1.28; 95%CI, 1.01–1.62), rs4760674 (OR 1.33; 95% CI, 1.06–1.67), rs7139166 (OR 1.26; 95%CI, 1.02–1.56), rs4516035 (OR 1.25; 95%CI, 1.01–1.55), rs11168287 (OR 1.27; 95%CI, 1.03–1.57), rs1544410 (OR 1.30; 95%CI, 1.04–1.63); for 2 polymorphisms, homozygous carriers had a decreased risk: rs7305032 (OR 0.81; 95%CI 0.65–1.02), rs7965281 (OR, 0.78; 95%CI, 0.62–0.99). We recognize the potential false positive findings due to multiple comparisons; however the 8 significant SNPs in this study outnumbered the 2 significant tests expected to occur by chance. The vitamin D receptor may play a role in melanomagenesis. PMID:21365644

Genetic Polymorphisms in Host Antiviral Genes: Associations with Humoral and Cellular Immunity to Measles Vaccine

PubMed Central

Haralambieva, Iana H.; Ovsyannikova, Inna G.; Umlauf, Benjamin J.; Vierkant, Robert A.; Pankratz, V. Shane; Jacobson, Robert M.; Poland, Gregory A.

2014-01-01

Host antiviral genes are important regulators of antiviral immunity and plausible genetic determinants of immune response heterogeneity after vaccination. We genotyped and analyzed 307 common candidate tagSNPs from 12 antiviral genes in a cohort of 745 schoolchildren immunized with two doses of measles-mumps-rubella vaccine. Associations between SNPs/haplotypes and measles virus-specific immune outcomes were assessed using linear regression methodologies in Caucasians and African-Americans. Genetic variants within the DDX58/RIG-I gene, including a coding polymorphism (rs3205166/Val800Val), were associated as single-SNPs (p≤0.017; although these SNPs did not remain significant after correction for false discovery rate/FDR) and in haplotype-level analysis, with measles-specific antibody variations in Caucasians (haplotype allele p-value=0.021; haplotype global p-value=0.076). Four DDX58 polymorphisms, in high LD, demonstrated also associations (after correction for FDR) with variations in both measles-specific IFN-γ and IL-2 secretion in Caucasians (p≤0.001, q=0.193). Two intronic OAS1 polymorphisms, including the functional OAS1 SNP rs10774671 (p=0.003), demonstrated evidence of association with a significant allele-dose-related increase in neutralizing antibody levels in African-Americans. Genotype and haplotype-level associations demonstrated the role of ADAR genetic variants, including a non-synonymous SNP (rs2229857/Arg384Lys; p=0.01), in regulating measles virus-specific IFN-γ Elispot responses in Caucasians (haplotype global p-value=0.017). After correction FDR, 15 single-SNP associations (11 SNPs in Caucasians and 4 SNPs in African-Americans) still remained significant at the q-value<0.20. In conclusion, our findings strongly point to genetic variants/genes, involved in antiviral sensing and antiviral control, as critical determinants, differentially modulating the adaptive immune responses to live attenuated measles vaccine in Caucasians and African-Americans. PMID:21939710

Polymorphic genetic variation in immune system genes: a study of two populations of Espirito Santo, Brazil.

PubMed

Dettogni, Raquel Spinassé; Sá, Ricardo Tristão; Tovar, Thaís Tristão; Louro, Iúri Drumond

2013-08-01

Mapping single nucleotide polymorphisms (SNPs) in genes potentially involved in immune responses may help understand the pathophysiology of infectious diseases in specific geographical regions. In this context, we have aimed to analyze the frequency of immunogenetic markers, focusing on genes CD209 (SNP -336A/G), FCγRIIa (SNP -131H/R), TNF-α (SNP -308A/G) and VDR (SNP Taq I) in two populations of the Espirito Santo State (ES), Brazil: general and Pomeranian populations. Peripheral blood genomic DNA was extracted from one hundred healthy individuals of the general population and from 59 Pomeranians. Polymorphic variant identification was performed by polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP). SNP genotype frequencies were in Hardy-Weinberg Equilibrium. There was no statistically significant difference in allelic and genotypic distributions between the two populations studied. Statistically significant differences were observed for SNP genotype distribution in genes CD209, TNF-α and VDR when comparing the ES populations with other Brazilian populations. This is the first report of CD209, FcγRIIa, TNF-α and VDR allelic frequencies for the general and Pomeranian populations of ES.

Genotype imputation for African Americans using data from HapMap phase II versus 1000 genomes projects.

PubMed

Sung, Yun J; Gu, C Charles; Tiwari, Hemant K; Arnett, Donna K; Broeckel, Ulrich; Rao, Dabeeru C

2012-07-01

Genotype imputation provides imputation of untyped single nucleotide polymorphisms (SNPs) that are present on a reference panel such as those from the HapMap Project. It is popular for increasing statistical power and comparing results across studies using different platforms. Imputation for African American populations is challenging because their linkage disequilibrium blocks are shorter and also because no ideal reference panel is available due to admixture. In this paper, we evaluated three imputation strategies for African Americans. The intersection strategy used a combined panel consisting of SNPs polymorphic in both CEU and YRI. The union strategy used a panel consisting of SNPs polymorphic in either CEU or YRI. The merge strategy merged results from two separate imputations, one using CEU and the other using YRI. Because recent investigators are increasingly using the data from the 1000 Genomes (1KG) Project for genotype imputation, we evaluated both 1KG-based imputations and HapMap-based imputations. We used 23,707 SNPs from chromosomes 21 and 22 on Affymetrix SNP Array 6.0 genotyped for 1,075 HyperGEN African Americans. We found that 1KG-based imputations provided a substantially larger number of variants than HapMap-based imputations, about three times as many common variants and eight times as many rare and low-frequency variants. This higher yield is expected because the 1KG panel includes more SNPs. Accuracy rates using 1KG data were slightly lower than those using HapMap data before filtering, but slightly higher after filtering. The union strategy provided the highest imputation yield with next highest accuracy. The intersection strategy provided the lowest imputation yield but the highest accuracy. The merge strategy provided the lowest imputation accuracy. We observed that SNPs polymorphic only in CEU had much lower accuracy, reducing the accuracy of the union strategy. Our findings suggest that 1KG-based imputations can facilitate discovery of significant associations for SNPs across the whole MAF spectrum. Because the 1KG Project is still under way, we expect that later versions will provide better imputation performance. © 2012 Wiley Periodicals, Inc.

Development of a single nucleotide polymorphism barcode to genotype Plasmodium vivax infections.

PubMed

Baniecki, Mary Lynn; Faust, Aubrey L; Schaffner, Stephen F; Park, Daniel J; Galinsky, Kevin; Daniels, Rachel F; Hamilton, Elizabeth; Ferreira, Marcelo U; Karunaweera, Nadira D; Serre, David; Zimmerman, Peter A; Sá, Juliana M; Wellems, Thomas E; Musset, Lise; Legrand, Eric; Melnikov, Alexandre; Neafsey, Daniel E; Volkman, Sarah K; Wirth, Dyann F; Sabeti, Pardis C

2015-03-01

Plasmodium vivax, one of the five species of Plasmodium parasites that cause human malaria, is responsible for 25-40% of malaria cases worldwide. Malaria global elimination efforts will benefit from accurate and effective genotyping tools that will provide insight into the population genetics and diversity of this parasite. The recent sequencing of P. vivax isolates from South America, Africa, and Asia presents a new opportunity by uncovering thousands of novel single nucleotide polymorphisms (SNPs). Genotyping a selection of these SNPs provides a robust, low-cost method of identifying parasite infections through their unique genetic signature or barcode. Based on our experience in generating a SNP barcode for P. falciparum using High Resolution Melting (HRM), we have developed a similar tool for P. vivax. We selected globally polymorphic SNPs from available P. vivax genome sequence data that were located in putatively selectively neutral sites (i.e., intergenic, intronic, or 4-fold degenerate coding). From these candidate SNPs we defined a barcode consisting of 42 SNPs. We analyzed the performance of the 42-SNP barcode on 87 P. vivax clinical samples from parasite populations in South America (Brazil, French Guiana), Africa (Ethiopia) and Asia (Sri Lanka). We found that the P. vivax barcode is robust, as it requires only a small quantity of DNA (limit of detection 0.3 ng/μl) to yield reproducible genotype calls, and detects polymorphic genotypes with high sensitivity. The markers are informative across all clinical samples evaluated (average minor allele frequency > 0.1). Population genetic and statistical analyses show the barcode captures high degrees of population diversity and differentiates geographically distinct populations. Our 42-SNP barcode provides a robust, informative, and standardized genetic marker set that accurately identifies a genomic signature for P. vivax infections.

Development of a Single Nucleotide Polymorphism Barcode to Genotype Plasmodium vivax Infections

PubMed Central

Baniecki, Mary Lynn; Faust, Aubrey L.; Schaffner, Stephen F.; Park, Daniel J.; Galinsky, Kevin; Daniels, Rachel F.; Hamilton, Elizabeth; Ferreira, Marcelo U.; Karunaweera, Nadira D.; Serre, David; Zimmerman, Peter A.; Sá, Juliana M.; Wellems, Thomas E.; Musset, Lise; Legrand, Eric; Melnikov, Alexandre; Neafsey, Daniel E.; Volkman, Sarah K.; Wirth, Dyann F.; Sabeti, Pardis C.

2015-01-01

Plasmodium vivax, one of the five species of Plasmodium parasites that cause human malaria, is responsible for 25–40% of malaria cases worldwide. Malaria global elimination efforts will benefit from accurate and effective genotyping tools that will provide insight into the population genetics and diversity of this parasite. The recent sequencing of P. vivax isolates from South America, Africa, and Asia presents a new opportunity by uncovering thousands of novel single nucleotide polymorphisms (SNPs). Genotyping a selection of these SNPs provides a robust, low-cost method of identifying parasite infections through their unique genetic signature or barcode. Based on our experience in generating a SNP barcode for P. falciparum using High Resolution Melting (HRM), we have developed a similar tool for P. vivax. We selected globally polymorphic SNPs from available P. vivax genome sequence data that were located in putatively selectively neutral sites (i.e., intergenic, intronic, or 4-fold degenerate coding). From these candidate SNPs we defined a barcode consisting of 42 SNPs. We analyzed the performance of the 42-SNP barcode on 87 P. vivax clinical samples from parasite populations in South America (Brazil, French Guiana), Africa (Ethiopia) and Asia (Sri Lanka). We found that the P. vivax barcode is robust, as it requires only a small quantity of DNA (limit of detection 0.3 ng/μl) to yield reproducible genotype calls, and detects polymorphic genotypes with high sensitivity. The markers are informative across all clinical samples evaluated (average minor allele frequency > 0.1). Population genetic and statistical analyses show the barcode captures high degrees of population diversity and differentiates geographically distinct populations. Our 42-SNP barcode provides a robust, informative, and standardized genetic marker set that accurately identifies a genomic signature for P. vivax infections. PMID:25781890

Different effects of apolipoprotein A5 SNPs and haplotypes on triglyceride concentration in three ethnic origins.

PubMed

Ken-Dror, Gie; Goldbourt, Uri; Dankner, Rachel

2010-05-01

Several polymorphisms in the ApoA5 gene emerged as important candidate genes in triglyceride metabolism. The aim of this study was to determine the associations between ApoA5 polymorphisms, plasma triglyceride concentrations and the presence of cardiovascular disease (CVD) in three ethnic origins. Genotypes for 15 single nucleotide polymorphisms (SNPs) were determined in 659 older adults (mean age 71+/-7 years) who immigrated to Israel or whose ancestors originated from East Europe (Ashkenazi), North Africa, Asia (Sephardic) or Yemen (Yemenite). The minor alleles of the four common SNPs (rs662799, rs651821, rs2072560 and rs2266788) are associated with an increase of 27-38% in triglyceride concentration among Ashkenazi and Yemenite Jews compared with the major alleles, but not among those of Sephardic origin. Conversely, among the Sephardic group, the presence of the minor allele in SNP rs3135506 compared with the major allele was associated with an increase of 34% in triglyceride concentration. The four SNPs were in significant linkage disequilibrium (D'=0.96-0.99), resulting in three haplotypes H1, H2 and H3, representing 98-99% of the population. Haplotype H2 was significantly associated with triglyceride concentration among Ashkenazi and Yemenite but not among Sephardic Jews. Conversely, haplotype H3 was associated with triglyceride concentration in Sephardic but not in Ashkenazi and Yemenite Jews. Ashkenazi carriers of H2 haplotype had a CVD odds ratio of 2.19 (95% CI: 1.05-4.58) compared with H1 (the most frequent), after adjustment for all other risk factors. These results suggest that different SNPs in ApoA5 polymorphisms may be associated with triglyceride concentration and CVD in each of these ethnic origins.

Genetic polymorphisms within tumor necrosis factor gene promoter region: a role for susceptibility to ventilator-associated pneumonia.

PubMed

Kotsaki, Antigoni; Raftogiannis, Maria; Routsi, Christina; Baziaka, Fotini; Kotanidou, Anastasia; Antonopoulou, Anastasia; Orfanos, Stylianos E; Katsenos, Chrisostomos; Koutoukas, Pantelis; Plachouras, Diamantis; Mandragos, Konstantinos; Giamarellos-Bourboulis, Evangelos J

2012-08-01

Debatable findings exist among various studies regarding the impact of single nucleotide polymorphisms (SNPs) within the promoter region of the tumor necrosis factor (TNF) gene for susceptibility to infections. Their impact was investigated in a cohort of mechanically ventilated patients who developed ventilator-associated pneumonia (VAP). Two-hundred and thirteen mechanically ventilated patients who developed VAP were enrolled. Genomic DNA was extracted and SNPs at the -376, -308 and -238 position of the promoter region of the TNF gene were assessed by restriction fragment length polymorphisms. Monocytes were isolated from 47 patients when they developed sepsis and stimulated by bacterial endotoxin for the production of TNFα and of interleukin-6 (IL-6). Patients were divided into two groups; 166 patients bearing only wild-type alleles of all three studied polymorphisms; and 47 patients carrying at least one A allele of the three studied SNPs. Time between start of mechanical ventilation and advent of VAP was significantly shorter in the second group than in the first group (log-rank: 4.416, p: 0.041). When VAP supervened, disease severity did not differ between groups. Stimulation of TNFα and of IL-6 was much greater by monocytes for patients carrying A alleles. Carriage of at least one A allele of the three studied SNPs at the promoter region of the TNF-gene is associated with shorter time to development of VAP but it is not associated with disease severity. Findings may be related with a role of the studied SNPs in the production of pro-inflammatory cytokines. Copyright © 2012 Elsevier Ltd. All rights reserved.

Polymorphisms of the peroxisome proliferator-activated receptor-γ (rs1801282) and its coactivator-1 (rs8192673) are associated with obesity indexes in subjects with type 2 diabetes mellitus.

PubMed

Kruzliak, Peter; Haley, Andreana P; Starcevic, Jovana Nikolajevic; Gaspar, Ludovit; Petrovic, Daniel

2015-04-28

The aim of this study was to clarify whether common single nucleotide polymorphisms (SNPs) of the Peroxisome Proliferator-Activated Receptor-γ (PPAR-γ) gene (rs1801282) and the Peroxisome Proliferator-Activated Receptor-γ Coactivator-1 (PGC-1α) gene (rs8192673) are associated with obesity indexes (BMI, waist circumference) in subjects with type 2 diabetes mellitus (T2DM) in Caucasian population. The second aim was to find an association of both polymorphisms with T2DM. Two exonic SNPs of both genes rs1801282 of the PPAR-γ gene and rs8192673 of the PGC-1α gene) were genotyped in 881 unrelated Slovene subjects (Caucasians) with T2DM and in 348 subjects without T2DM (control subjects). Female homozygotes with the CC genotype of the rs8192673 had higher waist circumference in comparison with subjects with other genotypes. Homozygotes (females, males) with wild allele (Pro) of the rs1801282 (Pro12Ala polymorphism) had higher waist circumference in comparison with subjects with other genotypes. In the study, there were no differences in the distributions of the rs8192673 and the rs1801282 genotypes between patients with T2DM and controls. Linear regression analyses for both polymorphisms were performed and demonstrated an independent effect of the rs1801282 of the PPAR-γ on waist circumference in subjects with T2DM, whereas an independent effect on waist circumference was not demonstrated for the rs8192673 of the PGC-1α gene. In a large sample of the Caucasians the rs8192673 of the PGC-1α gene and the rs1801282 of the PPAR-γ gene were associated with waist circumference in subjects with T2DM.

Functional polymorphisms of circadian negative feedback regulation genes are associated with clinical outcome in hepatocellular carcinoma patients receiving radical resection.

PubMed

Zhang, Zhaohui; Ma, Fei; Zhou, Feng; Chen, Yibing; Wang, Xiaoyan; Zhang, Hongxin; Zhu, Yong; Bi, Jianwei; Zhang, Yiguan

2014-12-01

Previous studies have demonstrated that circadian negative feedback loop genes play an important role in the development and progression of many cancers. However, the associations between single-nucleotide polymorphisms (SNPs) in these genes and the clinical outcomes of hepatocellular carcinoma (HCC) after surgical resection have not been studied so far. Thirteen functional SNPs in circadian genes were genotyped using the Sequenom iPLEX genotyping system in a cohort of 489 Chinese HCC patients who received radical resection. Multivariate Cox proportional hazards model and Kaplan-Meier curve were used for the prognosis analysis. Cumulative effect analysis and survival tree analysis were used for the multiple SNPs analysis. Four individual SNPs, including rs3027178 in PER1, rs228669 and rs2640908 in PER3 and rs3809236 in CRY1, were significantly associated with overall survival (OS) of HCC patients, and three SNPs, including rs3027178 in PER1, rs228729 in PER3 and rs3809236 in CRY1, were significantly associated with recurrence-free survival (RFS). Moreover, we observed a cumulative effect of significant SNPs on OS and RFS (P for trend < 0.001 for both). Survival tree analysis indicated that wild genotype of rs228729 in PER3 was the primary risk factor contributing to HCC patients' RFS. Our study suggests that the polymorphisms in circadian negative feedback loop genes may serve as independent prognostic biomarkers in predicting clinical outcomes for HCC patients who received radical resection. Further studies with different ethnicities are needed to validate our findings and generalize its clinical utility.

Interleukin 18 receptor 1 gene polymorphisms are associated with asthma.

PubMed

Zhu, Guohua; Whyte, Moira K B; Vestbo, Jorgen; Carlsen, Karin; Carlsen, Kai-Håkon; Lenney, Warren; Silverman, Michael; Helms, Peter; Pillai, Sreekumar G

2008-09-01

The interleukin 18 receptor (IL18R1) gene is a strong candidate gene for asthma. It has been implicated in the pathophysiology of asthma and maps to an asthma susceptibility locus on chromosome 2q12. The possibility of association between polymorphisms in IL18R1 and asthma was examined by genotyping seven SNPs in 294, 342 and 100 families from Denmark, United Kingdom and Norway and conducting family-based association analyses for asthma, atopic asthma and bronchial hyper-reactivity (BHR) phenotypes. Three SNPs in IL18R1 were associated with asthma (0.01131 < or = P < or = 0.01377), five with atopic asthma (0.00066 < or = P < or = 0.00405) and two with BHR (0.01450 < or = P < or = 0.03203) in the Danish population; two SNPs were associated with atopic asthma (0.00397 < or = P < or = 0.01481) and four with BHR (0.00435 < or = P < or = 0.03544) in the UK population; four SNPs showed associations with asthma (0.00015 < or = P < or = 0.03062), two with atopic asthma (0.01269 < or = P < or = 0.04042) and three with BHR (0.00259 < or = P < or = 0.01401) in the Norwegian population; five SNPs showed associations with asthma (0.00005 < or = P < or = 0.03744), five with atopic asthma (0.00001 < or = P < or = 0.04491) and three with BHR (0.03568 < or = P < or = 0.04778) in the combined population. Three intronic SNPs (rs1420099, rs1362348 and rs1974675) showed replicated association for at least one asthma-related phenotype. These results demonstrate significant association between polymorphisms in IL18R1 and asthma.

Apolipoprotein A5 and apolipoprotein C3 single nucleotide polymorphisms are correlated with an increased risk of coronary heart disease: a case-control and meta-analysis study.

PubMed

Yang, Guang; Lei, Ming-Ming; Yu, Chun-Lei; Liu, Xiao-Xiao; An, Zhe; Song, Chun-Li

2015-09-19

Triglycerides (TGs) are proatherogenic lipoproteins involving the risk of coronary heart disease (CHD), while apolipoprotein A5 (APOA5) and apolipoprotein C3 (APOC3) are main lipoproteins composing TG-rich lipoproteins. In this study, we aim to explore the correlation of CHD with APOA5 -1131 T > C and APOC3 -455 T > C single nucleotide polymorphisms (SNPs). A sum of 210 CHD patients, hospitalized between Jan. 2013 and Mar. 2015 at China-Japan Union Hospital, Jilin University, were selected as our case group and 223 healthy individuals who had physical examination at same hospital at the same period were selected as control group. The frequency distribution of genotypes of APOA5 -1131 T > C and APOC3 -455 T > C SNPs were measured by polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP). The Stata 12.0 software was utilized for statistical analyses. There was no significant difference on age and sex between case and control group (P > 0.05). History of smoking, drinking, hypertension and diabetes mellitus, body mass index and levels of TG and fasting blood sugar in case group were shown to be higher than control group (P < 0.05), while levels of total cholesterol, high-density lipoprotein cholesterol and low-density lipoprotein cholesterol in case group were lower than control group (P < 0.05). Both CC and TC' + CC frequencies of APOA5 -1131 T > C and APOC3 -455 T > C in case group were higher compared to control group (both P < 0.05). Additionally, T allele frequencies of the two SNPs in case group were lower than control group, while C allele in case group has higher frequencies compared to control group (both P < 0.05). The results of meta-analysis under allele and dominant models showed that APOA5 -1131 T > C and APOC3 -455 T > C SNPs are likely to increase the risk of CHD (both P < 0.05). APOA5 -1131 T > C and APOC3 -455 T > C SNPs may play potent roles in the development and progression of CHD.

Canonical single nucleotide polymorphisms (SNPs) for high-resolution subtyping of Shiga-toxin producing Escherichia coli (STEC) O157:H7

USDA-ARS?s Scientific Manuscript database

The objective of this study was to develop a canonical SNP panel for subtyping of Shiga-toxin producing Escherichia coli (STEC). To this purpose, 906 putative SNPs were identified using resequencing tiling arrays. A subset of 391 SNPs was further screened using high-throughput TaqMan PCR against a d...

Characterization and analyses of multidrug resistance-associated protein 1 (MRP1/ABCC1) polymorphisms in Chinese population

PubMed Central

Yin, Ji-Ye; Huang, Qiong; Yang, Youyun; Zhang, Jian-Ting; Zhong, Mei-Zuo; Zhou, Hong-Hao; Liu, Zhao-Qian

2009-01-01

Multidrug resistance (MDR) is one of the major obstacles for successful cancer chemotherapy. Over-expression of ATP-binding cassette (ABC) transporters such as MRP1/ABCC1 has been suggested to cause MDR. In this study, we explored the distribution frequencies of four common single nucleotide polymorphisms (SNPs) of MRP1/ABCC1 in a mainland Chinese population and investigated whether these SNPs affect the expression and function of the MRP1/ABCC1. We found that the allelic frequencies of Cys43Ser (128G>C), Thr73Ile (218C>T), Arg723Gln (2168G>A) and Arg1058Gln (3173G>A) in mainland Chinese were 0.5%, 1.4%, 5.8% and 0.5%, respectively. These four SNPs were recreated by site-directed mutagenesis and tested for their effect on MRP1/ABCC1 expression and MDR function in HEK293 and CHO-K1 cells lines. We found that none of these mutations had any effect on MRP1/ABCC1 expression and trafficking, but that Arg723Gln mutation significantly reduced MRP1/ABCC1-mediated resistance to daunorubicin, doxorubicin, etoposide, vinblastine and vincristine. The Cys43Ser mutation did not affect all tested drugs resistance. On the other hand, the Thr73Ile mutation reduced resistance to methotrexate and etoposide while the Arg1058Gln mutation increased the response of two anthracycline drugs and etoposide in HEK293 and CHO-K1 cells as well as vinblastine and methotrexate in CHO-K1 cells. We conclude that the allelic frequency of the Arg723Gln mutation is relatively higher than other SNPs in mainland Chinese population and therefore this mutation significantly reduces MRP1/ABCC1 activity in MDR. PMID:19214144

Genetic Diversity and Population Structure of F3:6 Nebraska Winter Wheat Genotypes Using Genotyping-By-Sequencing.

PubMed

Eltaher, Shamseldeen; Sallam, Ahmed; Belamkar, Vikas; Emara, Hamdy A; Nower, Ahmed A; Salem, Khaled F M; Poland, Jesse; Baenziger, Peter S

2018-01-01

The availability of information on the genetic diversity and population structure in wheat ( Triticum aestivum L.) breeding lines will help wheat breeders to better use their genetic resources and manage genetic variation in their breeding program. The recent advances in sequencing technology provide the opportunity to identify tens or hundreds of thousands of single nucleotide polymorphism (SNPs) in large genome species (e.g., wheat). These SNPs can be utilized for understanding genetic diversity and performing genome wide association studies (GWAS) for complex traits. In this study, the genetic diversity and population structure were investigated in a set of 230 genotypes (F 3:6 ) derived from various crosses as a prerequisite for GWAS and genomic selection. Genotyping-by-sequencing provided 25,566 high-quality SNPs. The polymorphism information content (PIC) across chromosomes ranged from 0.09 to 0.37 with an average of 0.23. The distribution of SNPs markers on the 21 chromosomes ranged from 319 on chromosome 3D to 2,370 on chromosome 3B. The analysis of population structure revealed three subpopulations (G1, G2, and G3). Analysis of molecular variance identified 8% variance among and 92% within subpopulations. Of the three subpopulations, G2 had the highest level of genetic diversity based on three genetic diversity indices: Shannon's information index ( I ) = 0.494, diversity index ( h ) = 0.328 and unbiased diversity index (uh) = 0.331, while G3 had lowest level of genetic diversity ( I = 0.348, h = 0.226 and uh = 0.236). This high genetic diversity identified among the subpopulations can be used to develop new wheat cultivars.

Genetic Diversity and Population Structure of F3:6 Nebraska Winter Wheat Genotypes Using Genotyping-By-Sequencing

PubMed Central

Eltaher, Shamseldeen; Sallam, Ahmed; Belamkar, Vikas; Emara, Hamdy A.; Nower, Ahmed A.; Salem, Khaled F. M.; Poland, Jesse; Baenziger, Peter S.

2018-01-01

The availability of information on the genetic diversity and population structure in wheat (Triticum aestivum L.) breeding lines will help wheat breeders to better use their genetic resources and manage genetic variation in their breeding program. The recent advances in sequencing technology provide the opportunity to identify tens or hundreds of thousands of single nucleotide polymorphism (SNPs) in large genome species (e.g., wheat). These SNPs can be utilized for understanding genetic diversity and performing genome wide association studies (GWAS) for complex traits. In this study, the genetic diversity and population structure were investigated in a set of 230 genotypes (F3:6) derived from various crosses as a prerequisite for GWAS and genomic selection. Genotyping-by-sequencing provided 25,566 high-quality SNPs. The polymorphism information content (PIC) across chromosomes ranged from 0.09 to 0.37 with an average of 0.23. The distribution of SNPs markers on the 21 chromosomes ranged from 319 on chromosome 3D to 2,370 on chromosome 3B. The analysis of population structure revealed three subpopulations (G1, G2, and G3). Analysis of molecular variance identified 8% variance among and 92% within subpopulations. Of the three subpopulations, G2 had the highest level of genetic diversity based on three genetic diversity indices: Shannon’s information index (I) = 0.494, diversity index (h) = 0.328 and unbiased diversity index (uh) = 0.331, while G3 had lowest level of genetic diversity (I = 0.348, h = 0.226 and uh = 0.236). This high genetic diversity identified among the subpopulations can be used to develop new wheat cultivars. PMID:29593779

TPMT Genetic Variations in Populations of the Russian Federation

PubMed Central

Samochatova, Elena V; Chupova, Natalia V; Rudneva, Anastassia; Makarova, Olga; Nasedkina, Tatyana V; Fedorova, Olga E; Glotov, Andrei S; Kozhekbaeva, Zh.; Maiorova, Olga A; Roumyantsev, Alexander G; Krynetski, Eugene Y; Krynetskaia, Natalia F; Evans, William E; Ribeiro, Raul C

2009-01-01

Background Polymorphisms that reduce the activity of thiopurine S-methyltransferase (TPMT) cause adverse reactions to conventional doses of thiopurines, routinely used for antileukemic and immunosuppressive treatment. There are more than 20 variant alleles of TPMT that cause decreased enzymatic activity. We studied the most common variant alleles of TPMT and their frequency distribution in a large cohort of multiracial residents in the Russian Federation and compared their frequencies in children with and without malignancy to determine whether TPMT gene abnormality is associated with hematologic malignancy. Procedure The TPMT biochip was used to detect 6 TPMT single nucleotide polymorphisms (SNPs) corresponding to 7 TPMT-deficiency alleles (TPMT*2, TPMT*3A, TPMT*3B, TPMT*3C, TPMT*3D, TPMT*7, and TPMT*8). We analyzed allele frequencies in the whole cohort, the childhood cancer group, and the non-cancer group. We also characterized disease features and outcome according to the presence of TPMT SNPs in children with acute lymphoblastic leukemia (ALL). Results Fifty-five (5.5%) study participants overall had heterozygous TPMT genotypes (1 variant and 1 wild-type allele): TPMT*1/*3A (n=45; 4.5%), TPMT*1/*3C (n=8; 0.8%), and TPMT*1/*2 (n=2; 0.2%). TPMT SNPs were more frequent in children with hematologic malignancy than in other participants (7.5% vs. 4.0%, P = 0.02). We found no significant association between TPMT SNPs and ALL treatment outcome (median follow-up, 31.3 months). Conclusions TPMT*3A is the most prevalent variant allele in the Russian Federation. The estimated frequency of variant alleles in the study cohort (5.5%) was similar to that observed in the White populations in the U.S. and Eastern Europe. PMID:19034904

Genome-wide association study reveals a QTL and strong candidate genes for umbilical hernia in pigs on SSC14.

PubMed

Grindflek, Eli; Hansen, Marianne H S; Lien, Sigbjørn; van Son, Maren

2018-05-29

Umbilical hernia is one of the most prevalent congenital defect in pigs, causing economic losses and substantial animal welfare problems. Identification and implementation of genomic regions controlling umbilical hernia in breeding is of great interest to reduce incidences of hernia in commercial pig production. The aim of this study was to identify such regions and possibly identify causative variation affecting umbilical hernia in pigs. A case/control material consisting of 739 Norwegian Landrace pigs was collected and applied in a GWAS study with a genome-wide distributed panel of 60 K SNPs. Additionally candidate genes were sequenced to detect additional polymorphisms that were used for single SNP and haplotype association analyses in 453 of the pigs. The GWAS in this report detected a highly significant region affecting umbilical hernia around 50 Mb on SSC14 (P < 0.0001) explaining up to 8.6% of the phenotypic variance of the trait. The region is rather broad and includes 62 significant SNPs in high linkage disequilibrium with each other. Targeted sequencing of candidate genes within the region revealed polymorphisms within the Leukemia inhibitory factor (LIF) and Oncostatin M (OSM) that were significantly associated with umbilical hernia (P < 0.001). A highly significant QTL for umbilical hernia in Norwegian Landrace pigs was detected around 50 Mb on SSC14. Resequencing of candidate genes within the region revealed SNPs within LIF and OSM highly associated with the trait. However, because of extended LD within the region, studies in other populations and functional studies are needed to determine whether these variants are causal or not. Still without this knowledge, SNPs within the region can be used as genetic markers to reduce incidences of umbilical hernia in Norwegian Landrace pigs.

Genetic polymorphisms of pharmacogenomic VIP variants in the Yi population from China.

PubMed

Yan, Mengdan; Li, Dianzhen; Zhao, Guige; Li, Jing; Niu, Fanglin; Li, Bin; Chen, Peng; Jin, Tianbo

2018-03-30

Drug response and target therapeutic dosage are different among individuals. The variability is largely genetically determined. With the development of pharmacogenetics and pharmacogenomics, widespread research have provided us a wealth of information on drug-related genetic polymorphisms, and the very important pharmacogenetic (VIP) variants have been identified for the major populations around the world whereas less is known regarding minorities in China, including the Yi ethnic group. Our research aims to screen the potential genetic variants in Yi population on pharmacogenomics and provide a theoretical basis for future medication guidance. In the present study, 80 VIP variants (selected from the PharmGKB database) were genotyped in 100 unrelated and healthy Yi adults recruited for our research. Through statistical analysis, we made a comparison between the Yi and other 11 populations listed in the HapMap database for significant SNPs detection. Two specific SNPs were subsequently enrolled in an observation on global allele distribution with the frequencies downloaded from ALlele FREquency Database. Moreover, F-statistics (Fst), genetic structure and phylogenetic tree analyses were conducted for determination of genetic similarity between the 12 ethnic groups. Using the χ2 tests, rs1128503 (ABCB1), rs7294 (VKORC1), rs9934438 (VKORC1), rs1540339 (VDR) and rs689466 (PTGS2) were identified as the significantly different loci for further analysis. The global allele distribution revealed that the allele "A" of rs1540339 and rs9934438 were more frequent in Yi people, which was consistent with the most populations in East Asia. F-statistics (Fst), genetic structure and phylogenetic tree analyses demonstrated that the Yi and CHD shared a closest relationship on their genetic backgrounds. Additionally, Yi was considered similar to the Han people from Shaanxi province among the domestic ethnic populations in China. Our results demonstrated significant differences on several polymorphic SNPs and supplement the pharmacogenomic information for the Yi population, which could provide new strategies for optimizing clinical medication in accordance with the genetic determinants of drug toxicity and efficacy. Copyright © 2018 Elsevier B.V. All rights reserved.

Single nucleotide polymorphisms in native South American Atlantic coast populations of smooth shelled mussels: hybridization with invasive European Mytilus galloprovincialis.

PubMed

Zbawicka, Małgorzata; Trucco, María I; Wenne, Roman

2018-02-22

Throughout the world, harvesting of mussels Mytilus spp. is based on the exploitation of natural populations and aquaculture. Aquaculture activities include transfers of spat and live adult mussels between various geographic locations, which may result in large-scale changes in the world distribution of Mytilus taxa. Mytilus taxa are morphologically similar and difficult to distinguish. In spite of much research on taxonomy, evolution and geographic distribution, the native Mytilus taxa of the Southern Hemisphere are poorly understood. Recently, single nucleotide polymorphisms (SNPs) have been used to clarify the taxonomic status of populations of smooth shelled mussels from the Pacific coast of South America. In this paper, we used a set of SNPs to characterize, for the first time, populations of smooth shelled mussels Mytilus from the Atlantic coast of South America. Mytilus spp. samples were collected from eastern South America. Six reference samples from the Northern Hemisphere were used: Mytilus edulis from USA and Northern Ireland, Mytilus trossulus from Canada, and Mytilus galloprovincialis from Spain and Italy. Two other reference samples from the Southern Hemisphere were included: M. galloprovincialis from New Zealand and Mytilus chilensis from Chile. Fifty-five SNPs were successfully genotyped, of which 51 were polymorphic. Population genetic analyses using the STRUCTURE program revealed the clustering of eight populations from Argentina (Mytilus platensis) and the clustering of the sample from Ushuaia with M. chilensis from Chile. All individuals in the Puerto Madryn (Argentina) sample were identified as M. platensis × M. galloprovincialis F2 (88.89%) hybrids, except one that was classified as Mediterranean M. galloprovincialis. No F1 hybrids were observed. We demonstrate that M. platensis (or Mytilus edulis platensis) and M. chilensis are distinct native taxa in South America, which indicates that the evolutionary histories of Mytilus taxa along the Atlantic and Pacific coasts differ. M. platensis is endangered by hybridization with M. galloprovincialis that was introduced from Europe into the Puerto Madryn area in Argentina, presumably by accidental introduction via ship traffic. We confirm the occurrence of a native M. chilensis population in southern Argentina on the coast of Patagonia.

Empirical Distributions of F ST from Large-Scale Human Polymorphism Data

PubMed Central

Elhaik, Eran

2012-01-01

Studies of the apportionment of human genetic variation have long established that most human variation is within population groups and that the additional variation between population groups is small but greatest when comparing different continental populations. These studies often used Wright’s F ST that apportions the standardized variance in allele frequencies within and between population groups. Because local adaptations increase population differentiation, high-F ST may be found at closely linked loci under selection and used to identify genes undergoing directional or heterotic selection. We re-examined these processes using HapMap data. We analyzed 3 million SNPs on 602 samples from eight worldwide populations and a consensus subset of 1 million SNPs found in all populations. We identified four major features of the data: First, a hierarchically F ST analysis showed that only a paucity (12%) of the total genetic variation is distributed between continental populations and even a lesser genetic variation (1%) is found between intra-continental populations. Second, the global F ST distribution closely follows an exponential distribution. Third, although the overall F ST distribution is similarly shaped (inverse J), F ST distributions varies markedly by allele frequency when divided into non-overlapping groups by allele frequency range. Because the mean allele frequency is a crude indicator of allele age, these distributions mark the time-dependent change in genetic differentiation. Finally, the change in mean-F ST of these groups is linear in allele frequency. These results suggest that investigating the extremes of the F ST distribution for each allele frequency group is more efficient for detecting selection. Consequently, we demonstrate that such extreme SNPs are more clustered along the chromosomes than expected from linkage disequilibrium for each allele frequency group. These genomic regions are therefore likely candidates for natural selection. PMID:23185452

Empirical distributions of F(ST) from large-scale human polymorphism data.

PubMed

Elhaik, Eran

2012-01-01

Studies of the apportionment of human genetic variation have long established that most human variation is within population groups and that the additional variation between population groups is small but greatest when comparing different continental populations. These studies often used Wright's F(ST) that apportions the standardized variance in allele frequencies within and between population groups. Because local adaptations increase population differentiation, high-F(ST) may be found at closely linked loci under selection and used to identify genes undergoing directional or heterotic selection. We re-examined these processes using HapMap data. We analyzed 3 million SNPs on 602 samples from eight worldwide populations and a consensus subset of 1 million SNPs found in all populations. We identified four major features of the data: First, a hierarchically F(ST) analysis showed that only a paucity (12%) of the total genetic variation is distributed between continental populations and even a lesser genetic variation (1%) is found between intra-continental populations. Second, the global F(ST) distribution closely follows an exponential distribution. Third, although the overall F(ST) distribution is similarly shaped (inverse J), F(ST) distributions varies markedly by allele frequency when divided into non-overlapping groups by allele frequency range. Because the mean allele frequency is a crude indicator of allele age, these distributions mark the time-dependent change in genetic differentiation. Finally, the change in mean-F(ST) of these groups is linear in allele frequency. These results suggest that investigating the extremes of the F(ST) distribution for each allele frequency group is more efficient for detecting selection. Consequently, we demonstrate that such extreme SNPs are more clustered along the chromosomes than expected from linkage disequilibrium for each allele frequency group. These genomic regions are therefore likely candidates for natural selection.

Breast Cancer Risk From Modifiable and Nonmodifiable Risk Factors Among White Women in the United States

PubMed Central

Maas, Paige; Barrdahl, Myrto; Joshi, Amit D.; Auer, Paul L.; Gaudet, Mia M.; Milne, Roger L.; Schumacher, Fredrick R.; Anderson, William F.; Check, David; Chattopadhyay, Subham; Baglietto, Laura; Berg, Christine D.; Chanock, Stephen J.; Cox, David G.; Figueroa, Jonine D.; Gail, Mitchell H.; Graubard, Barry I.; Haiman, Christopher A.; Hankinson, Susan E.; Hoover, Robert N.; Isaacs, Claudine; Kolonel, Laurence N.; Le Marchand, Loic; Lee, I-Min; Lindström, Sara; Overvad, Kim; Romieu, Isabelle; Sanchez, Maria-Jose; Southey, Melissa C.; Stram, Daniel O.; Tumino, Rosario; VanderWeele, Tyler J.; Willett, Walter C.; Zhang, Shumin; Buring, Julie E.; Canzian, Federico; Gapstur, Susan M.; Henderson, Brian E.; Hunter, David J.; Giles, Graham G; Prentice, Ross L.; Ziegler, Regina G.; Kraft, Peter; Garcia-Closas, Montse; Chatterjee, Nilanjan

2017-01-01

IMPORTANCE An improved model for risk stratification can be useful for guiding public health strategies of breast cancer prevention. OBJECTIVE To evaluate combined risk stratification utility of common low penetrant single nucleotide polymorphisms (SNPs) and epidemiologic risk factors. DESIGN, SETTING, AND PARTICIPANTS Using a total of 17 171 cases and 19 862 controls sampled from the Breast and Prostate Cancer Cohort Consortium (BPC3) and 5879 women participating in the 2010 National Health Interview Survey, a model for predicting absolute risk of breast cancer was developed combining information on individual level data on epidemiologic risk factors and 24 genotyped SNPs from prospective cohort studies, published estimate of odds ratios for 68 additional SNPs, population incidence rate from the National Cancer Institute-Surveillance, Epidemiology, and End Results Program cancer registry and data on risk factor distribution from nationally representative health survey. The model is used to project the distribution of absolute risk for the population of white women in the United States after adjustment for competing cause of mortality. EXPOSURES Single nucleotide polymorphisms, family history, anthropometric factors, menstrual and/or reproductive factors, and lifestyle factors. MAIN OUTCOMES AND MEASURES Degree of stratification of absolute risk owing to nonmodifiable (SNPs, family history, height, and some components of menstrual and/or reproductive history) and modifiable factors (body mass index [BMI; calculated as weight in kilograms divided by height in meters squared], menopausal hormone therapy [MHT], alcohol, and smoking). RESULTS The average absolute risk for a 30-year-old white woman in the United States developing invasive breast cancer by age 80 years is 11.3%. A model that includes all risk factors provided a range of average absolute risk from 4.4% to 23.5% for women in the bottom and top deciles of the risk distribution, respectively. For women who were at the lowest and highest deciles of nonmodifiable risks, the 5th and 95th percentile range of the risk distribution associated with 4 modifiable factors was 2.9% to 5.0% and 15.5% to 25.0%, respectively. For women in the highest decile of risk owing to nonmodifiable factors, those who had low BMI, did not drink or smoke, and did not use MHT had risks comparable to an average woman in the general population. CONCLUSIONS AND RELEVANCE This model for absolute risk of breast cancer including SNPs can provide stratification for the population of white women in the United States. The model can also identify subsets of the population at an elevated risk that would benefit most from risk-reduction strategies based on altering modifiable factors. The effectiveness of this model for individual risk communication needs further investigation. PMID:27228256

Single nucleotide polymorphisms from Theobroma cacao expressed sequence tags associated with witches' broom disease in cacao.

PubMed

Lima, L S; Gramacho, K P; Carels, N; Novais, R; Gaiotto, F A; Lopes, U V; Gesteira, A S; Zaidan, H A; Cascardo, J C M; Pires, J L; Micheli, F

2009-07-14

In order to increase the efficiency of cacao tree resistance to witches' broom disease, which is caused by Moniliophthora perniciosa (Tricholomataceae), we looked for molecular markers that could help in the selection of resistant cacao genotypes. Among the different markers useful for developing marker-assisted selection, single nucleotide polymorphisms (SNPs) constitute the most common type of sequence difference between alleles and can be easily detected by in silico analysis from expressed sequence tag libraries. We report the first detection and analysis of SNPs from cacao-M. perniciosa interaction expressed sequence tags, using bioinformatics. Selection based on analysis of these SNPs should be useful for developing cacao varieties resistant to this devastating disease.

Nonassociation of homocysteine gene polymorphisms with treatment outcome in South Indian Tamil Rheumatoid Arthritis patients.

PubMed

Muralidharan, Niveditha; Gulati, Reena; Misra, Durga Prasanna; Negi, Vir S

2018-02-01

The aim of the study was to look for any association of MTR 2756A>G and MTRR 66A>G gene polymorphisms with clinical phenotype, methotrexate (MTX) treatment response, and MTX-induced adverse events in South Indian Tamil patients with rheumatoid arthritis (RA). A total of 335 patients with RA were investigated. MTR 2756A>G gene polymorphism was analyzed by PCR-RFLP, and MTRR 66A>G SNP was analyzed by TaqMan 5' nuclease assay. The allele frequencies were compared with HapMap groups. MTR 2756G allele was found to be associated with risk of developing RA. The allele frequencies of MTR 2756A>G and MTRR 66A>G SNPs in controls differed significantly when compared with HapMap groups. Neither of the SNPs influenced the MTX treatment outcome and adverse effects. Neither of the SNPs seems to be associated with MTX treatment outcome and adverse events in South Indian Tamil patients with RA.

A false single nucleotide polymorphism generated by gene duplication compromises meat traceability.

PubMed

Sanz, Arianne; Ordovás, Laura; Zaragoza, Pilar; Sanz, Albina; de Blas, Ignacio; Rodellar, Clementina

2012-07-01

Controlling meat traceability using SNPs is an effective method of ensuring food safety. We have analyzed several SNPs to create a panel for bovine genetic identification and traceability studies. One of these was the transversion g.329C>T (Genbank accession no. AJ496781) on the cytochrome P450 17A1 gene, which has been included in previously published panels. Using minisequencing reactions, we have tested 701 samples belonging to eight Spanish cattle breeds. Surprisingly, an excess of heterozygotes was detected, implying an extreme departure from Hardy-Weinberg equilibrium (P<0.001). By alignment analysis and sequencing, we detected that the g.329C>T SNP is a false positive polymorphism, which allows us to explain the inflated heterozygotic value. We recommend that this ambiguous SNP, as well as other polymorphisms located in this region, should not be used in identification, traceability or disease association studies. Annotation of these false SNPs should improve association studies and avoid misinterpretations. Copyright © 2012 Elsevier Ltd. All rights reserved.

Polymorphism of prion protein gene in Arctic fox (Vulpes lagopus).

PubMed

Wan, Jiayu; Bai, Xue; Liu, Wensen; Xu, Jing; Xu, Ming; Gao, Hongwei

2009-07-01

Prion diseases are fatal neurodegenerative disorders of humans and certain other mammals. Prion protein gene (Prnp) is associated with susceptibility and species barrier to prion diseases. No natural and experimental prion diseases have been documented to date in Arctic fox. In the present study, coding region of Prnp from 135 Arctic foxes were cloned and screened for polymorphisms. Our results indicated that the Arctic fox Prnp open reading frame (ORF) contains 771 nucleotides encoding 257 amino acids. Four single nucleotide polymorphisms (SNPs) (G312C, A337G, C541T, and A723G) were identified. SNPs G312C and A723G produced silent mutations, but SNPs A337G and C541T resulted in a M-V change at codon 113 and R-C at codon 181, respectively. The Arctic fox Prnp amino acid sequence was similar to that of the dog (XM 542906). In short, this study provides preliminary information about genotypes of Prnp in Arctic fox.

N-acetyltransferase single nucleotide polymorphisms: Emerging concepts serve as a paradigm for understanding complexities of personalized medicine

PubMed Central

Hein, David W.

2009-01-01

Arylamine N-acetyltransferase 1 (NAT1) and 2 (NAT2) exhibit single nucleotide polymorphisms (SNPs) in human populations that modify drug and carcinogen metabolism. This paper updates the identity, location, and functional effects of these SNPs and then follows with emerging concepts for understanding why pharmacogenetic findings may not be replicated consistently. Using this paradigm as an example, laboratory-based mechanistic analyses can reveal complexities such that genetic polymorphisms become biologically and medically relevant when confounding factors are more fully understood and considered. As medical care moves to a more personalized approach, the implications of these confounding factors will be important in understanding the complexities of personalized medicine. PMID:19379125

Interleukin-21 gene polymorphism rs2221903 is associated with disease activity in patients with rheumatoid arthritis

PubMed Central

Malinowski, Damian; Paradowska-Gorycka, Agnieszka; Safranow, Krzysztof

2017-01-01

Introduction Interleukin-21 (IL-21) is a cytokine which plays a significant role in the pathogenesis and disease activity of rheumatoid arthritis (RA). Genetic polymorphisms in the IL-21 gene may alter the synthesis of IL-21. The aim of this study was to examine IL-21 and IL-21R polymorphisms in patients with RA. Material and methods We examined 422 patients with RA and 338 healthy controls. Single nucleotide polymorphisms (SNPs) within the IL-21 (rs6822844 G>T, rs6840978 C>T, rs2221903 T>C) and IL-21R (rs2285452 G>A) genes were genotyped using TaqMan genotyping assays. Results There were no statistically significant differences in the distribution of studied genotypes and alleles between RA patients and the control group. To examine whether IL-21 polymorphisms affect disease activity in RA patients, we compared the distribution of IL-21 genotypes between patients with DAS28 ≤ 2.5 (patients with remission of disease symptoms) and patients with DAS28 > 2.5 (patients with active RA). Among patients with DAS28 > 2.5, increased prevalence of rs2221903 CT and CC genotypes was observed (OR = 1.54; 95% CI: 1.04–2.28; p = 0.035). Conclusions The results of this study suggest that IL-21 and IL-21R gene polymorphisms are not risk loci for RA susceptibility, whereas the IL-21 rs2221903 polymorphism is associated with disease activity. PMID:28883856

Polymorphisms in the vitamin D receptor and their associations with risk of schizophrenia and selected anthropometric measures.

PubMed

Handoko, H Y; Nancarrow, D J; Mowry, B J; McGrath, J J

2006-01-01

The association between vitamin D levels and skeletal growth has long been recognized. However, exposure to low levels of vitamin D during early life is also known to alter brain development, and is a candidate risk factor for schizophrenia. This study examines the association between four polymorphisms in the vitamin D receptor (VDR) and 1) risk of schizophrenia, and 2) three anthropometric variables (height, head size, and head shape). Four single-nucleotide polymorphisms (SNPs; rs10735810/FokI, rs1544410/BsmI, rs7975232/ApaI, and rs731236/TaqI) in the VDR gene were genotyped in 179 individuals with schizophrenia and 189 healthy controls. No significant associations were detected between any of the four VDR SNPs and risk of schizophrenia. Patients were slightly but significantly shorter compared to controls. Of the four SNPs, only rs10735810/FokI was associated with any of the anthropometric measures: the M4 isoform of this SNP was significantly associated with larger head size (P = 0.002). In light of the evidence demonstrating a role for vitamin D during brain development, the association between polymorphisms in VDR and brain development warrants closer scrutiny.

RAN/RANBP2 polymorphisms and neuroblastoma risk in Chinese children: a three-center case-control study.

PubMed

Wang, Juxiang; Zhuo, Zhenjian; Chen, Min; Zhu, Jinhong; Zhao, Jie; Zhang, Jiao; Chen, Shanshan; He, Jing; Zhou, Haixia

2018-04-28

The genetic etiology of sporadic neuroblastoma remains largely obscure. RAN and RANBP2 genes encode Ras-related nuclear protein and Ran-binding protein 2, respectively. These two proteins form Ran-RanBP2 complex that regulate various cellular activities including nuclear transport. Aberrant functions of the two proteins are implicated in carcinogenesis. Given the unknown role of RAN/RANBP2 single nucleotide polymorphisms (SNPs) in neuroblastoma risk, we performed a multi-center case-control study in Chinese children to assess the association of the RAN/RANBP2 SNPs with neuroblastoma risk. We analyzed three potentially functional SNPs in RAN gene (rs56109543 C>T, rs7132224 A>G, rs14035 C>T) and one in RANBP2 (rs2462788 C>T) in 429 cases and 884 controls. Odds ratios (ORs) and 95% confidence intervals (CIs) were used to access the association between these four polymorphisms and neuroblastoma risk. No single variant was found to statistically significantly associate with neuroblastoma risk. However, individuals with 3 protective genotypes were less likely to develop neuroblastoma, in comparison to non-carriers (adjusted OR=0.33; 95% CI=0.12-0.96; P =0.042), as well as those with 0-2 protective genotypes (adjusted OR=0.33; 95% CI=0.11-0.94; P =0.038). Stratified analysis revealed no significant association for any of the four polymorphisms. Further studies are warranted to validate the weak impact of RAN/RANBP2 SNPs on neuroblastoma risk.

Human leukocyte antigen class I region single-nucleotide polymorphisms are associated with leprosy susceptibility in Vietnam and India.

PubMed

Alter, Andrea; Huong, Nguyen Thu; Singh, Meenakshi; Orlova, Marianna; Van Thuc, Nguyen; Katoch, Kiran; Gao, Xiaojiang; Thai, Vu Hong; Ba, Nguyen Ngoc; Carrington, Mary; Abel, Laurent; Mehra, Narinder; Alcaïs, Alexandre; Schurr, Erwin

2011-05-01

Experimental evidence suggested the existence of unidentified leprosy susceptibility loci in the human leukocyte antigen (HLA) complex. To identify such genetic risk factors, a high-density association scan of a 1.9-mega-base (Mb) region in the HLA complex was performed. Among 682 single-nucleotide polymorphisms (SNPs), 59 were associated with leprosy (P <.01) in 198 Vietnamese single-case leprosy families. Genotyping of these SNPs in an independent sample of 292 Vietnamese single-case leprosy families replicated the association of 12 SNPs (P <.01). Multivariate analysis of these 12 SNPs showed that the association information could be captured by 2 intergenic HLA class I region SNPs (P = 9.4 × 10⁻⁹)-rs2394885 and rs2922997 (marginal multivariate P = 2.1 × 10⁻⁷ and P = .0016, respectively). SNP rs2394885 tagged the HLA-C*15:05 allele in the Vietnamese population. The identical associations were validated in a third sample of 364 patients with leprosy and 371 control subjects from North India. These results implicated class I alleles in leprosy pathogenesis.

Human Leukocyte Antigen Class I Region Single-Nucleotide Polymorphisms are Associated with Leprosy Susceptibility in Vietnam and India

PubMed Central

Alter, Andrea; Huong, Nguyen Thu; Singh, Meenakshi; Orlova, Marianna; Van Thuc, Nguyen; Katoch, Kiran; Gao, Xiaojiang; Thai, Vu Hong; Ba, Nguyen Ngoc; Carrington, Mary; Abel, Laurent; Mehra, Narinder; Alcaïs, Alexandre

2011-01-01

Experimental evidence suggested the existence of unidentified leprosy susceptibility loci in the human leukocyte antigen (HLA) complex. To identify such genetic risk factors, a high-density association scan of a 1.9-mega-base (Mb) region in the HLA complex was performed. Among 682 single-nucleotide polymorphisms (SNPs), 59 were associated with leprosy (P <.01) in 198 Vietnamese single-case leprosy families. Genotyping of these SNPs in an independent sample of 292 Vietnamese single-case leprosy families replicated the association of 12 SNPs (P <.01). Multivariate analysis of these 12 SNPs showed that the association information could be captured by 2 intergenic HLA class I region SNPs (P = 9.4 × 10−9)—rs2394885 and rs2922997 (marginal multivariate P = 2.1 × 10−7 and P = .0016, respectively). SNP rs2394885 tagged the HLA-C*15:05 allele in the Vietnamese population. The identical associations were validated in a third sample of 364 patients with leprosy and 371 control subjects from North India. These results implicated class I alleles in leprosy pathogenesis. PMID:21459816

Association of ITPA polymorphisms rs6051702/rs1127354 instead of rs7270101/rs1127354 as predictor of ribavirin-associated anemia in chronic hepatitis C treated patients.

PubMed

D'Avolio, Antonio; De Nicolò, Amedeo; Cusato, Jessica; Ciancio, Alessia; Boglione, Lucio; Strona, Silvia; Cariti, Giuseppe; Troshina, Giulia; Caviglia, Gian Paolo; Smedile, Antonina; Rizzetto, Mario; Di Perri, Giovanni

2013-10-01

Functional variants rs7270101 and rs1127354 of inosine triphosphatase (ITPA) were recently found to protect against ribavirin (RBV)-induced hemolytic anemia. However, no definitive data are yet available on the role of no functional rs6051702 polymorphism. Since a simultaneous evaluation of the three ITPA SNPs for hemolytic anemia has not yet been investigated, we aimed to understand the contribution of each SNPs and its potential clinical use to predict anemia in HCV treated patients. A retrospective analysis included 379 HCV treated patients. The ITPA variants rs6051702, rs7270101 and rs1127354 were genotyped and tested for association with achieving anemia at week 4. We also investigated, using multivariate logistic regression, the impact of each single and paired associated polymorphism on anemia onset. All SNPs were associated with Hb decrease. The carrier of at least one variant allele in the functional ITPA SNPs was associated with a lower decrement of Hb, as compared to patients without a variant allele. In multivariate logistic regression analyses the carrier of a variant allele in the rs6051702/rs1127354 association (OR=0.11, p=1.75×10(-5)) and Hb at baseline (OR=1.51, p=1.21×10(-4)) were independently associated with protection against clinically significant anemia at week 4. All ITPA polymorphisms considered were shown to be significantly associated with anemia onset. A multivariate regression model based on ITPA genetic polymorphisms was developed for predicting the risk of anemia. Considering the characterization of pre-therapy anemia predictors, rs6051702 SNP in association to rs1127354 is more informative in order to avoid this relevant adverse event. Copyright © 2013 Elsevier B.V. All rights reserved.

Medaka: a promising model animal for comparative population genomics

PubMed Central

Matsumoto, Yoshifumi; Oota, Hiroki; Asaoka, Yoichi; Nishina, Hiroshi; Watanabe, Koji; Bujnicki, Janusz M; Oda, Shoji; Kawamura, Shoji; Mitani, Hiroshi

2009-01-01

Background Within-species genome diversity has been best studied in humans. The international HapMap project has revealed a tremendous amount of single-nucleotide polymorphisms (SNPs) among humans, many of which show signals of positive selection during human evolution. In most of the cases, however, functional differences between the alleles remain experimentally unverified due to the inherent difficulty of human genetic studies. It would therefore be highly useful to have a vertebrate model with the following characteristics: (1) high within-species genetic diversity, (2) a variety of gene-manipulation protocols already developed, and (3) a completely sequenced genome. Medaka (Oryzias latipes) and its congeneric species, tiny fresh-water teleosts distributed broadly in East and Southeast Asia, meet these criteria. Findings Using Oryzias species from 27 local populations, we conducted a simple screening of nonsynonymous SNPs for 11 genes with apparent orthology between medaka and humans. We found medaka SNPs for which the same sites in human orthologs are known to be highly differentiated among the HapMap populations. Importantly, some of these SNPs show signals of positive selection. Conclusion These results indicate that medaka is a promising model system for comparative population genomics exploring the functional and adaptive significance of allelic differentiations. PMID:19426554

IL10A genotypic association with decreased IL-10 circulating levels in malaria infected individuals from endemic area of the Brazilian Amazon.

PubMed

Pereira, Virginia A; Sánchez-Arcila, Juan C; Teva, Antonio; Perce-da-Silva, Daiana S; Vasconcelos, Mariana P A; Lima, Cleoni A M; Aprígio, Cesarino J L; Rodrigues-da-Silva, Rodrigo N; Santos, Davi O; Banic, Dalma M; Bonecini-Almeida, Maria G; Lima-Júnior, Josué C; Oliveira-Ferreira, Joseli

2015-01-28

Cytokines play an important role in human immune responses to malaria and variation in their production may influence the course of infection and determine the outcome of the disease. The differential production of cytokines has been linked to single nucleotide polymorphisms in gene promoter regions, signal sequences, and gene introns. Although some polymorphisms play significant roles in susceptibility to malaria, gene polymorphism studies in Brazil are scarce. A population of 267 individuals from Brazilian Amazon exposed to malaria was genotyped for five single nucleotide polymorphisms (SNPs), IFNG + 874 T/A, IL10A-1082G/A, IL10A-592A/C, IL10A-819 T/C and NOS2A-954G/C. Specific DNA fragments were amplified by polymerase chain reaction, allowing the detection of the polymorphism genotypes. The polymorphisms IL10A-592A/C and IL10A-819 T/C were estimated by a single analysis due to the complete linkage disequilibrium between the two SNPs with D' = 0.99. Plasma was used to measure the levels of IFN-γ and IL-10 cytokines by Luminex and nitrogen radicals by Griess reaction. No differences were observed in genotype and allelic frequency of IFNG + 874 T/A and NOS2A-954G/C between positive and negative subjects for malaria infection. Interesting, the genotype NOS2A-954C/C was not identified in the study population. Significant differences were found in IL10A-592A/C and IL10A-819 T/C genotypes distribution, carriers of IL10A -592A/-819 T alleles (genotypes AA/TT + AC/TC) were more frequent among subjects with malaria than in negative subjects that presented a higher frequency of the variant C allele (p < 0.0001). The presence of the allele C was associated with low producer of IL-10 and low parasitaemia. In addition, the GTA haplotypes formed from combinations of investigated polymorphisms in IL10A were significantly associated with malaria (+) and the CCA haplotype with malaria (-) groups. The IL10A-1082G/A polymorphism showed high frequency of heterozygous AG genotype in the population, but it was not possible to infer any association of the polymorphism because their distribution was not in Hardy Weinberg equilibrium. This study shows that the IL10A-592A/C and IL10A-819 T/C polymorphisms were associated with malaria and decreased IL-10 levels and low parasite density suggesting that this polymorphism influence IL-10 levels and may influence in the susceptibility to clinical malaria.

Effect of UDP-Glucuronosyltransferase (UGT) 1A Polymorphism (rs8330 and rs10929303) on Glucuronidation Status of Acetaminophen

PubMed Central

Tahir, Imtiaz Mahmood; Iqbal, Tahira; Saleem, Sadaf; Perveen, Sofia; Farooqi, Aboubakker

2017-01-01

Interindividual variability in polymorphic uridine diphosphate-glucuronosyltransferase 1A1 (UGT1A1) ascribed to genetic diversity is associated with relative glucuronidation level among individuals. The present research was aimed to study the effect of 2 important single nucleotide polymorphisms (SNPs; rs8330 and rs10929303) of UGT1A1 gene on glucuronidation status of acetaminophen in healthy volunteers (n = 109). Among enrolled volunteers, 54.13% were male (n = 59) and 45.87% were female (n = 50). The in vivo activity of UGT1A1 was investigated by high-performance liquid chromatography-based analysis of glucuronidation status (ie, acetaminophen and acetaminophen glucuronide) in human volunteers after oral intake of a single dose (1000 mg) of acetaminophen. The TaqMan SNP genotyping assay was used for UGT1A1 genotyping. The wild-type genotype (C/C) was observed the most frequent one for both SNPs (rs8330 and rs10929303) and associated with fast glucuronidator phenotypes. The distribution of variant genotype (G/G) for SNP rs8330 was observed in 5% of male and 8% of the female population; however, for SNP rs10929303, the G/G genotype was found in 8% of both genders. A trimodal distribution (fast, intermediate, and slow) based on phenotypes was observed. Among the male participants, the glucuronidation phenotypes were observed as 7% slow, 37% intermediate, and 56% fast glucuronidators; however, these findings for the females were slightly different as 8%, 32%, and 60% respectively. The k-statistics revealed a compelling evidence for good concordance between phenotype and genotype with a k value of 1.00 for SNP rs8330 and 0.966 for SNP rs10929303 in our population. PMID:28932176

Genetic Variants in SDC3 Gene are Significantly Associated with Growth Traits in Two Chinese Beef Cattle Breeds.

PubMed

Huang, Yong-Zhen; Wang, Qin; Zhang, Chun-Lei; Fang, Xing-Tang; Song, En-Liang; Chen, Hong

2016-01-01

Identification of the genes and polymorphisms underlying quantitative traits, and understanding these genes and polymorphisms affect economic growth traits, are important for successful marker-assisted selection and more efficient management strategies in commercial cattle (Bos taurus) population. Syndecan-3 (SDC3), a member of the syndecan family of type I transmembrane heparan sulfate proteoglycans is a novel regulator of feeding behavior and body weight. The aim of this study is to examine the association of the SDC3 polymorphism with growth traits in Chinese Jiaxian and Qinchuan cattle breeds (). Four single nucleotide polymorphisms (SNPs: 1-4) were detected in 555 cows from three Chinese native cattle breeds by means of sequencing pooled DNA samples and polymerase chain reaction-single stranded conformational polymorphism (PCR-SSCP) methods. We found one SNP (g.28362A > G) in intron and three SNPs (g.30742T > G, g.30821C > T and 33418 A > G) in exons. The statistical analyses indicated that these SNPs of SDC3 gene were associated with bovine body height, body length, chest circumference, and circumference of cannon bone (P < 0.05). The mutant-type variant was superior for growth traits; the heterozygote was associated with higher growth traits compared to wild-type homozygote. Our result confirms the polymorphisms in the SDC3 gene are associated with growth traits that may be used for marker-assisted selection in beef cattle breeding programs.

Spatial distribution of single-nucleotide polymorphisms related to fungicide resistance and implications for sampling.

PubMed

Van der Heyden, H; Dutilleul, P; Brodeur, L; Carisse, O

2014-06-01

Spatial distribution of single-nucleotide polymorphisms (SNPs) related to fungicide resistance was studied for Botrytis cinerea populations in vineyards and for B. squamosa populations in onion fields. Heterogeneity in this distribution was characterized by performing geostatistical analyses based on semivariograms and through the fitting of discrete probability distributions. Two SNPs known to be responsible for boscalid resistance (H272R and H272Y), both located on the B subunit of the succinate dehydrogenase gene, and one SNP known to be responsible for dicarboximide resistance (I365S) were chosen for B. cinerea in grape. For B. squamosa in onion, one SNP responsible for dicarboximide resistance (I365S homologous) was chosen. One onion field was sampled in 2009 and another one was sampled in 2010 for B. squamosa, and two vineyards were sampled in 2011 for B. cinerea, for a total of four sampled sites. Cluster sampling was carried on a 10-by-10 grid, each of the 100 nodes being the center of a 10-by-10-m quadrat. In each quadrat, 10 samples were collected and analyzed by restriction fragment length polymorphism polymerase chain reaction (PCR) or allele specific PCR. Mean SNP incidence varied from 16 to 68%, with an overall mean incidence of 43%. In the geostatistical analyses, omnidirectional variograms showed spatial autocorrelation characterized by ranges of 21 to 1 m. Various levels of anisotropy were detected, however, with variograms computed in four directions (at 0°, 45°, 90°, and 135° from the within-row direction used as reference), indicating that spatial autocorrelation was prevalent or characterized by a longer range in one direction. For all eight data sets, the β-binomial distribution was found to fit the data better than the binomial distribution. This indicates local aggregation of fungicide resistance among sampling units, as supported by estimates of the parameter θ of the β-binomial distribution of 0.09 to 0.23 (overall median value = 0.20). On the basis of the observed spatial distribution patterns of SNP incidence, sampling curves were computed for different levels of reliability, emphasizing the importance of sample size for the detection of mutation incidence below the risk threshold for control failure.

Interaction between LRP5 and periostin gene polymorphisms on serum periostin levels and cortical bone microstructure.

PubMed

Pepe, J; Bonnet, N; Herrmann, F R; Biver, E; Rizzoli, R; Chevalley, T; Ferrari, S L

2018-02-01

We investigated the interaction between periostin SNPs and the SNPs of the genes assumed to modulate serum periostin levels and bone microstructure in a cohort of postmenopausal women. We identified an interaction between LRP5 SNP rs648438 and periostin SNP rs9547970 on serum periostin levels and on radial cortical porosity. The purpose of this study is to investigate the interaction between periostin gene polymorphisms (SNPs) and other genes potentially responsible for modulating serum periostin levels and bone microstructure in a cohort of postmenopausal women. In 648 postmenopausal women from the Geneva Retirees Cohort, we analyzed 6 periostin SNPs and another 149 SNPs in 14 genes, namely BMP2, CTNNB1, ESR1, ESR2, LRP5, LRP6, PTH, SPTBN1, SOST, TGFb1, TNFRSF11A, TNFSF11, TNFRSF11B and WNT16. Volumetric BMD and bone microstructure were measured by high-resolution peripheral quantitative computed tomography at the distal radius and tibia. Serum periostin levels were associated with radial cortical porosity, including after adjustment for age, BMI, and years since menopause (p = 0.036). Sixteen SNPs in the ESR1, LRP5, TNFRSF11A, SOST, SPTBN1, TNFRSF11B and TNFSF11 genes were associated with serum periostin levels (p range 0.03-0.001) whereas 26 SNPs in 9 genes were associated with cortical porosity at the radius and/or at the tibia. WNT 16 was the gene with the highest number of SNPs associated with both trabecular and cortical microstructure. The periostin SNP rs9547970 was also associated with cortical porosity (p = 0.04). In particular, SNPs in LRP5, ESR1 and near the TNFRSF11A gene were associated with both cortical porosity and serum periostin levels. Eventually, we identified an interaction between LRP5 SNP rs648438 and periostin SNP rs9547970 on serum periostin levels (interaction p = 0.01) and on radial cortical porosity (interaction p = 0.005). These results suggest that periostin expression is genetically modulated, particularly by polymorphisms in the Wnt pathway, and is thereby implicated in the genetic variation of bone microstructure.

Investigation into the association between P2RX7 gene polymorphisms and susceptibility to primary gout and hyperuricemia in a Chinese Han male population.

PubMed

Ying, Ying; Chen, Yong; Li, Zhen; Huang, Haiyan; Gong, Qiongyao

2017-04-01

The purpose of this study was to investigate the relationship between P2RX7 gene single nucleotide polymorphisms and primary gout and hyperuricemia in a Chinese Han male population. The genetic distributions of the single nucleotide polymorphisms (SNPs) rs2230911, rs208294, rs435309, rs28360447, rs1718119, rs28360457, and rs3751143 in P2RX7 were detected in 293 primary gout patients, 187 hyperuricemia patients and 269 controls using SNaPshot technology. Statistical analyses were implemented using SPSS version 20.0. The genetic distributions of each group were tested for Hardy-Weinberg equilibrium (HWE). T test, analysis of variance, rank sum test and Chi-square test were measured to assess differences in clinical data and polymorphisms among groups. Logistic regression was used to assess susceptibility to disease with odds ratios (ORs) and 95% confidence intervals (95% CIs). SHEsis software was used to calculate linkage disequilibrium blocks and haplotype association risk. P < .05 was regarded as statistically significant. Three SNPs (rs2230911, rs208294 and rs435309) did not deviate significantly from HWE (P > .05). In the comparison between primary gout and control, the frequencies of rs2230911 genotypes were significantly different (P = .002), and allele G was associated with a higher risk of primary gout than allele C [OR (95% CI) = 1.755 (1.278, 2.410), P < .001]. There was also a higher risk of primary gout in genotype (CG + GG) compared with genotype CC [OR (95% CI) = 1.876 (1.303, 2.701), P = .001]. However, no significant difference in allelic or genotypic frequency was observed between primary gout patients and hyperuricemia patients (P > .0167). Similarly, there were no obvious differences in the other two polymorphisms among the three groups (P > .05). Our results reveal that P2RX7 rs2230911 may be associated with primary gout risk in a Chinese Han male population and allele G may be a susceptibility factor for primary gout.

A nuclear phylogenetic analysis: SNPs, indels and SSRs deliver new insights into the relationships in the ‘true citrus fruit trees’ group (Citrinae, Rutaceae) and the origin of cultivated species

PubMed Central

Garcia-Lor, Andres; Curk, Franck; Snoussi-Trifa, Hager; Morillon, Raphael; Ancillo, Gema; Luro, François; Navarro, Luis; Ollitrault, Patrick

2013-01-01

Background and Aims Despite differences in morphology, the genera representing ‘true citrus fruit trees’ are sexually compatible, and their phylogenetic relationships remain unclear. Most of the important commercial ‘species’ of Citrus are believed to be of interspecific origin. By studying polymorphisms of 27 nuclear genes, the average molecular differentiation between species was estimated and some phylogenetic relationships between ‘true citrus fruit trees’ were clarified. Methods Sanger sequencing of PCR-amplified fragments from 18 genes involved in metabolite biosynthesis pathways and nine putative genes for salt tolerance was performed for 45 genotypes of Citrus and relatives of Citrus to mine single nucleotide polymorphisms (SNPs) and indel polymorphisms. Fifty nuclear simple sequence repeats (SSRs) were also analysed. Key Results A total of 16 238 kb of DNA was sequenced for each genotype, and 1097 single nucleotide polymorphisms (SNPs) and 50 indels were identified. These polymorphisms were more valuable than SSRs for inter-taxon differentiation. Nuclear phylogenetic analysis revealed that Citrus reticulata and Fortunella form a cluster that is differentiated from the clade that includes three other basic taxa of cultivated citrus (C. maxima, C. medica and C. micrantha). These results confirm the taxonomic subdivision between the subgenera Metacitrus and Archicitrus. A few genes displayed positive selection patterns within or between species, but most of them displayed neutral patterns. The phylogenetic inheritance patterns of the analysed genes were inferred for commercial Citrus spp. Conclusions Numerous molecular polymorphisms (SNPs and indels), which are potentially useful for the analysis of interspecific genetic structures, have been identified. The nuclear phylogenetic network for Citrus and its sexually compatible relatives was consistent with the geographical origins of these genera. The positive selection observed for a few genes will help further works to analyse the molecular basis of the variability of the associated traits. This study presents new insights into the origin of C. sinensis. PMID:23104641

A nuclear phylogenetic analysis: SNPs, indels and SSRs deliver new insights into the relationships in the 'true citrus fruit trees' group (Citrinae, Rutaceae) and the origin of cultivated species.

PubMed

Garcia-Lor, Andres; Curk, Franck; Snoussi-Trifa, Hager; Morillon, Raphael; Ancillo, Gema; Luro, François; Navarro, Luis; Ollitrault, Patrick

2013-01-01

Despite differences in morphology, the genera representing 'true citrus fruit trees' are sexually compatible, and their phylogenetic relationships remain unclear. Most of the important commercial 'species' of Citrus are believed to be of interspecific origin. By studying polymorphisms of 27 nuclear genes, the average molecular differentiation between species was estimated and some phylogenetic relationships between 'true citrus fruit trees' were clarified. Sanger sequencing of PCR-amplified fragments from 18 genes involved in metabolite biosynthesis pathways and nine putative genes for salt tolerance was performed for 45 genotypes of Citrus and relatives of Citrus to mine single nucleotide polymorphisms (SNPs) and indel polymorphisms. Fifty nuclear simple sequence repeats (SSRs) were also analysed. A total of 16 238 kb of DNA was sequenced for each genotype, and 1097 single nucleotide polymorphisms (SNPs) and 50 indels were identified. These polymorphisms were more valuable than SSRs for inter-taxon differentiation. Nuclear phylogenetic analysis revealed that Citrus reticulata and Fortunella form a cluster that is differentiated from the clade that includes three other basic taxa of cultivated citrus (C. maxima, C. medica and C. micrantha). These results confirm the taxonomic subdivision between the subgenera Metacitrus and Archicitrus. A few genes displayed positive selection patterns within or between species, but most of them displayed neutral patterns. The phylogenetic inheritance patterns of the analysed genes were inferred for commercial Citrus spp. Numerous molecular polymorphisms (SNPs and indels), which are potentially useful for the analysis of interspecific genetic structures, have been identified. The nuclear phylogenetic network for Citrus and its sexually compatible relatives was consistent with the geographical origins of these genera. The positive selection observed for a few genes will help further works to analyse the molecular basis of the variability of the associated traits. This study presents new insights into the origin of C. sinensis.

Pharmacogenetics of human 3'-phosphoadenosine 5'-phosphosulfate synthetase 1 (PAPSS1): gene resequencing, sequence variation, and functional genomics.

PubMed

Xu, Zhen-Hua; Thomae, Bianca A; Eckloff, Bruce W; Wieben, Eric D; Weinshilboum, Richard M

2003-06-01

3'-Phosphoadenosine 5'-phosphosulfate (PAPS) is the high-energy "sulfate donor" for reactions catalyzed by sulfotransferase (SULT) enzymes. The strict requirement of SULTs for PAPS suggests that PAPS synthesis might influence the rate of sulfate conjugation. In humans, PAPS is synthesized from ATP and SO(4)(2-) by two isoforms of PAPS synthetase (PAPSS): PAPSS1 and PAPSS2. As a step toward pharmacogenetic studies, we have resequenced the entire coding sequence of the human PAPSS1 gene, including exon-intron splice junctions, using DNA samples from 60 Caucasian-American and 58 African-American subjects. Twenty-one genetic polymorphisms were observed-1 insertion-deletion event and 20 single nucleotide polymorphisms (SNPs)-including two non-synonymous coding SNPs (cSNPs) that altered the following amino acids: Arg333Cys and Glu531Gln. Twelve pairs of these polymorphisms were tightly linked, and a total of twelve unequivocal haplotypes could be identified-two that were common to both ethnic groups and ten that were ethnic-specific. The Arg333Cys polymorphism, with an allele frequency of 2.5%, was observed only in DNA samples from Caucasian subjects. The Glu531Gln polymorphism was rare, with only a single copy of that allele in a DNA sample from an African-American subject. Transient expression in mammalian cells showed that neither of the non-synonymous cSNPs resulted in a change in the basal level of enzyme activity measured under optimal assay conditions. However, the Glu531Gln polymorphism altered the substrate kinetic properties of the enzyme. The Gln531 variant allozyme had a 5-fold higher K(m) value for SO(4)(2-) than did the wild-type allozyme and displayed monophasic kinetics for Na(2)SO(4). The wild-type allozyme (Glu531) showed biphasic kinetics for that substrate. These observations represent a step toward testing the hypothesis that genetic variation in PAPS synthesis catalyzed by PAPSS1 might alter in vivo sulfate conjugation.

Possible association of FAS and FASLG polymorphisms with the risk of idiopathic azoospermia in southeast Turkey.

PubMed

Balkan, Mahmut; Atar, Murat; Erdal, Mehmet Emin; Rustemoğlu, Aydin; Yildiz, Ismail; Gunesacar, Ramazan; Hatipoğlu, Namık Kemal; Bodakçi, Mehmet Nuri; Ay, Ozlem Izci; Çevik, Kenan

2014-06-01

To investigate the association of the genetic variants of FAS/FASLG cell death pathway genes in male infertility, we genotyped the FAS -670A/G, -1377G/A, and FASLG -124A/G single-nucleotide polymorphisms (SNPs) by real-time polymerase chain reaction in 108 infertile men with idiopathic azoospermia and in 125 proven fertile controls. The distribution of genotypes and alleles for SNPs at FAS -1377G/A and FASLG -124A/G loci were determined not to be statistically different between the case and control groups. However, the genotype frequencies of SNPs, FAS -670AA and FAS -670AG, were found to be significantly different between the case and control groups. Whereas the FAS -670AA genotype might be regarded as a higher predisposition for idiopathic azoospermia, FAS -670AG could be interpreted to mean that this genotype provides protection against idiopathic azoospermia. The study of combined genotype and haplotype frequencies has found statistically significant differences between case and control subjects for some combinations. The AA-GG binary genotype for the FAS670 and FAS1377 loci couple, in particular, may have a high degree of predisposition to idiopathic azoospermia. Our results suggest that FAS -670A/G SNP may be a genetic predisposing factor of idiopathic azoospermia among southeastern Anatolian men. Larger studies are needed to verify these findings. Furthermore, our data indicated a possible linkage between the FAS and FASLG genes and idiopathic azoospermia.

Effect of epidermal growth factor receptor gene polymorphisms on prognosis in glioma patients

PubMed Central

Li, Jingjie; Yan, Mengdan; Xie, Zhilan; Zhu, Yuanyuan; Chen, Chao; Jin, Tianbo

2016-01-01

Previous studies suggested that single nucleotide polymorphisms (SNPs) in epidermal growth factor receptor (EGFR) are associated with risk of glioma. However, the associations between these SNPs and glioma patient prognosis have not yet been fully investigated. Therefore, the present study was aimed to evaluate the effects of EGFR polymorphisms on the glioma patient prognosis. We retrospectively evaluated 269 glioma patients and investigated associations between EGFR SNPs and patient prognosis using Cox proportional hazard models and Kaplan-Meier curves. Univariate analysis revealed that age, gross-total resection and chemotherapy were associated with the prognosis of glioma patients (p < 0.05). In addition, four EGFR SNPs (rs11506105, rs3752651, rs1468727 and rs845552) correlated with overall survival (OS) (Log-rank p = 0.011, 0.020, 0.008, and 0.009, respectively) and progression-free survival PFS (Log-rank p = 0.026, 0.024, 0.019 and 0.009, respectively). Multivariate analysis indicated that the rs11506105 G/G genotype, the rs3752651 and rs1468727 C/C genotype and the rs845552 A/A genotype correlated inversely with OS and PFS. In addition, OS among patients with the rs730437 C/C genotype (p = 0.030) was significantly lower OS than among patients with A/A genotype. These data suggest that five EGFR SNPs (rs11506105, rs3752651, rs1468727, rs845552 and rs730437) correlated with glioma patient prognosis, and should be furthered validated in studies of ethnically diverse patients. PMID:27437777

A genotyping system capable of simultaneously analyzing >1000 single nucleotide polymorphisms in a haploid genome.

PubMed

Wang, Hui-Yun; Luo, Minjie; Tereshchenko, Irina V; Frikker, Danielle M; Cui, Xiangfeng; Li, James Y; Hu, Guohong; Chu, Yi; Azaro, Marco A; Lin, Yong; Shen, Li; Yang, Qifeng; Kambouris, Manousos E; Gao, Richeng; Shih, Weichung; Li, Honghua

2005-02-01

A high-throughput genotyping system for scoring single nucleotide polymorphisms (SNPs) has been developed. With this system, >1000 SNPs can be analyzed in a single assay, with a sensitivity that allows the use of single haploid cells as starting material. In the multiplex polymorphic sequence amplification step, instead of attaching universal sequences to the amplicons, primers that are unlikely to have nonspecific and productive interactions are used. Genotypes of SNPs are then determined by using the widely accessible microarray technology and the simple single-base extension assay. Three SNP panels, each consisting of >1000 SNPs, were incorporated into this system. The system was used to analyze 24 human genomic DNA samples. With 5 ng of human genomic DNA, the average detection rate was 98.22% when single probes were used, and 96.71% could be detected by dual probes in different directions. When single sperm cells were used, 91.88% of the SNPs were detectable, which is comparable to the level that was reached when very few genetic markers were used. By using a dual-probe assay, the average genotyping accuracy was 99.96% for 5 ng of human genomic DNA and 99.95% for single sperm. This system may be used to significantly facilitate large-scale genetic analysis even if the amount of DNA template is very limited or even highly degraded as that obtained from paraffin-embedded cancer specimens, and to make many unpractical research projects highly realistic and affordable.

Validation of PDE9A Gene Identified in GWAS Showing Strong Association with Milk Production Traits in Chinese Holstein.

PubMed

Yang, Shao-Hua; Bi, Xiao-Jun; Xie, Yan; Li, Cong; Zhang, Sheng-Li; Zhang, Qin; Sun, Dong-Xiao

2015-11-05

Phosphodiesterase9A (PDE9A) is a cyclic guanosine monophosphate (cGMP)-specific enzyme widely expressed among the tissues, which is important in activating cGMP-dependent signaling pathways. In our previous genome-wide association study, a single nucleotide polymorphism (SNP) (BTA-55340-no-rs(b)) located in the intron 14 of PDE9A, was found to be significantly associated with protein yield. In addition, we found that PDE9A was highly expressed in mammary gland by analyzing its mRNA expression in different tissues. The objectives of this study were to identify genetic polymorphisms of PDE9A and to determine the effects of these variants on milk production traits in dairy cattle. DNA sequencing identified 11 single nucleotide polymorphisms (SNPs) and six SNPs in 5' regulatory region were genotyped to test for the subsequent association analyses. After Bonferroni correction for multiple testing, all these identified SNPs were statistically significant for one or more milk production traits (p < 0.0001~0.0077). Interestingly, haplotype-based association analysis revealed similar effects on milk production traits (p < 0.01). In follow-up RNA expression analyses, two SNPs (c.-1376 G>A, c.-724 A>G) were involved in the regulation of gene expression. Consequently, our findings provide confirmatory evidences for associations of PDE9A variants with milk production traits and these identified SNPs may serve as genetic markers to accelerate Chinese Holstein breeding program.

Analysis of TLR2, TLR4, and TLR9 single nucleotide polymorphisms in children with bacterial meningitis and their healthy family members.

PubMed

Gowin, Ewelina; Świątek-Kościelna, Bogna; Kałużna, Ewelina; Nowak, Jerzy; Michalak, Michał; Wysocki, Jacek; Januszkiewicz-Lewandowska, Danuta

2017-07-01

The aim was to analyse TLR2 rs5743708, TLR2 rs4696480, TLR4 rs4986790, TLR9 rs5743836, and TLR9 rs352140 single nucleotide polymorphisms (SNPs) in children with pneumococcal and meningococcal meningitis and their family members. The study group consisted of 39 children with bacterial meningitis (25 with meningococcal meningitis and 14 with pneumococcal meningitis) and 49 family members. Laboratory test results and the course of the diseases were analyzed. Genomic DNA was extracted from 1.2ml of peripheral blood in order to analyze the five SNPs. Patients with pneumococcal and meningococcal meningitis showed a similar male/female ratio, mean age, and duration of symptoms. There were no statistically significant differences in biochemical markers between the two groups. All patients possessed at least one polymorphic variant of the analyzed SNPs. The most common SNP was TLR9 rs352140, detected in 89.7% of patients. No significant differences in SNP frequency were found between patients, family members, and the general population. The allele frequencies in the population studied are in accordance with the literature data. The study did not find an association between the analyzed SNPs and susceptibility to bacterial meningitis. The role of SNPs in genes coding toll-like receptors and the interactions between them in controlling inflammation in the central nervous system needs further evaluation. Copyright © 2017 The Author(s). Published by Elsevier Ltd.. All rights reserved.

Polymorphisms in the methylene tetrahydrofolate reductase and methionine synthase reductase genes and their correlation with unexplained recurrent spontaneous abortion susceptibility.

PubMed

Zhu, L

2015-07-28

We aimed to explore the correlation between unexplained recurrent spontaneous abortion and polymorphisms in the methylene tetrahydrofolate reductase (MTHFR) and methionine synthase reductase (MTRR) genes. A case control study was conducted in 118 patients with unexplained recurrent spontaneous abortion (abortion group) and 174 healthy women (control group). The genetic material was extracted from the oral mucosal epithelial cells obtained from all subjects. The samples were subjected to fluorescence quantitative PCR to detect the single nucleotide polymorphisms (SNPs) in the MTHFR (C677T and A1298C) and MTRR (A66G) gene loci. The distribution frequency (18/118, 15.3%) of the MTHFR 677TT genotype was significantly higher in the abortion group (χ2 = 11.006, P = 0.004) than in the control group (2/174, 1.1%); on the other hand, the distribution frequency of the MTHFR A1298C genotype did not significantly differ between the abortion and control groups (χ(2) = 0.441, P = 0.507). The distribution frequency of the MTRR A66G genotype was also significantly higher in the abortion group (14/118, 11.9%; χ(2) = 10.503, P = 0.005) than in the control group (8/174, 4.6%). The MTHFR C677T and MTRR A66G polymorphisms are significantly correlated with the occurrence of spontaneous abortion.

Capturing haplotypes in germplasm core collections

USDA-ARS?s Scientific Manuscript database

Genomewide data sets of single nucleotide polymorphisms (SNPs) offer great potential to improve ex situ conservation. Two factors impede their use for producing core collections. First, due to the large number of SNPs, the assembly of collections that maximize diversity may be intractable using ex...

Marker-assisted backcross approach for important agronomic traits of sorghum

USDA-ARS?s Scientific Manuscript database

Sequencing technologies are useful for identification of thousands of single nucleotide polymorphisms (SNPs) in a cost effective manner. QTL mapping, association mapping and Mutmap approaches provide opportunities for use of such SNPs to associate and identify genes that control important agronomic ...

Significant association between IL10-1082/-819 and TNF-308 haplotypes and the susceptibility to cervical carcinogenesis in women infected by Human papillomavirus.

PubMed

Chagas, Bárbara Simas; Lima, Rita de Cássia Pereira de; Paiva Júnior, Sérgio de Sá Leitão; Silva, Ruany Cristyne de Oliveira; Cordeiro, Marcelo Nazário; Silva Neto, Jacinto da Costa; Batista, Marcus Vinicius de Aragão; Silva, Anna Jéssica Duarte; Gurgel, Ana Pavla Almeida Diniz; Freitas, Antonio Carlos de

2018-06-20

Human papillomavirus (HPV) is responsible for high-grade cervical lesions and cervical cancer. The inflammation plays a key role in cervical cancer progression. In this context, studies propose an association between TNFα and IL10 SNPs and susceptibility to HPV infection. The present work aimed to investigate the possible association between IL10 and TNFα promoter polymorphisms and HPV infection in the cervical carcinogenesis risk in women from Brazil. A total of 654 samples was evaluated in this study. HPV detection was performed by PCR and HPV genotyping was performed by PCR and sequencing of positive MY09/11 PCR product. Genotyping of IL10 SNPs (rs1800871 and rs1800896) was performed by High Resolution Melt analysis. Genotyping of TNFα SNP (rs1800629) was performed by fluorogenic allele-specific probes. The distribution of TNF-308 (rs1800629) allelic (p = 0.03) and genotype (p = 0.03) frequencies and HPV-58 infection has showed a statistically significant difference between case and control groups for the assessed TNFα polymorphism. When it comes to TNFα (rs1800629) allelic and genotypic distribution and HPVs 18 and 31 infections, no statistically significant differences between case and control groups were observed for the studied TNFα polymorphism. The allelic and genotypic distribution of IL10-819 (rs1800871) and IL10-1082 (rs1800896) and HPV infection (HPVs 58, 18 and 31) has showed no statistically significant differences between case and control groups for the assessed IL10 polymorphisms. Furthermore, it was observed that haplotypes were associated with an increased cervical cancer risk in HPVs 16, 18 and 58-positive women. It was observed that women carrying the GTA and ATG haplotypes had 3.85 and 17.99-fold, respectively, increased cervical cancer susceptibility when infected by HPV-58. In women infected with HPV-16 and HPV-18, statistically significant results in women carrying the GTA and ATA haplotypes was observed. They had a 2.32 and 3.67-fold, respectively, increased cervical cancer susceptibility when infected by these two HPV types. The analysis of the haplotypes distribution in women infected with HPV-31 has showed no statistically significant results. Our study indicates that the association of genetic polymorphism in inflammation-related genes represents a risk to the susceptibility in the development of cervical cancer in women infected by HPVs 16, 18 and 58. Copyright © 2018. Published by Elsevier Ltd.

eQTL networks unveil enriched mRNA master integrators downstream of complex disease-associated SNPs.

PubMed

Li, Haiquan; Pouladi, Nima; Achour, Ikbel; Gardeux, Vincent; Li, Jianrong; Li, Qike; Zhang, Hao Helen; Martinez, Fernando D; 'Skip' Garcia, Joe G N; Lussier, Yves A

2015-12-01

The causal and interplay mechanisms of Single Nucleotide Polymorphisms (SNPs) associated with complex diseases (complex disease SNPs) investigated in genome-wide association studies (GWAS) at the transcriptional level (mRNA) are poorly understood despite recent advancements such as discoveries reported in the Encyclopedia of DNA Elements (ENCODE) and Genotype-Tissue Expression (GTex). Protein interaction network analyses have successfully improved our understanding of both single gene diseases (Mendelian diseases) and complex diseases. Whether the mRNAs downstream of complex disease genes are central or peripheral in the genetic information flow relating DNA to mRNA remains unclear and may be disease-specific. Using expression Quantitative Trait Loci (eQTL) that provide DNA to mRNA associations and network centrality metrics, we hypothesize that we can unveil the systems properties of information flow between SNPs and the transcriptomes of complex diseases. We compare different conditions such as naïve SNP assignments and stringent linkage disequilibrium (LD) free assignments for transcripts to remove confounders from LD. Additionally, we compare the results from eQTL networks between lymphoblastoid cell lines and liver tissue. Empirical permutation resampling (p<0.001) and theoretic Mann-Whitney U test (p<10(-30)) statistics indicate that mRNAs corresponding to complex disease SNPs via eQTL associations are likely to be regulated by a larger number of SNPs than expected. We name this novel property mRNA hubness in eQTL networks, and further term mRNAs with high hubness as master integrators. mRNA master integrators receive and coordinate the perturbation signals from large numbers of polymorphisms and respond to the personal genetic architecture integratively. This genetic signal integration contrasts with the mechanism underlying some Mendelian diseases, where a genetic polymorphism affecting a single protein hub produces a divergent signal that affects a large number of downstream proteins. Indeed, we verify that this property is independent of the hubness in protein networks for which these mRNAs are transcribed. Our findings provide novel insights into the pleiotropy of mRNAs targeted by complex disease polymorphisms and the architecture of the information flow between the genetic polymorphisms and transcriptomes of complex diseases. Copyright © 2015 The Authors. Published by Elsevier Inc. All rights reserved.

Using microarray analysis to evaluate genetic polymorphisms involved in the metabolism of environmental chemicals.

PubMed

Ban, Susumu; Kondo, Tomoko; Ishizuka, Mayumi; Sasaki, Seiko; Konishi, Kanae; Washino, Noriaki; Fujita, Syoichi; Kishi, Reiko

2007-05-01

The field of molecular biology currently faces the need for a comprehensive method of evaluating individual differences derived from genetic variation in the form of single nucleotide polymorphisms (SNPs). SNPs in human genes are generally considered to be very useful in determining inherited genetic disorders, susceptibility to certain diseases, and cancer predisposition. Quick and accurate discrimination of SNPs is the key characteristic of technology used in DNA diagnostics. For this study, we first developed a DNA microarray and then evaluated its efficacy by determining the detection ability and validity of this method. Using DNA obtained from 380 pregnant Japanese women, we examined 13 polymorphisms of 9 genes, which are associated with the metabolism of environmental chemical compounds found in high frequency among Japanese populations. The ability to detect CYP1A1 I462V, CYP1B1 L432V, GSTP1 I105V and AhR R554K gene polymorphisms was above 98%, and agreement rates when compared with real time PCR analysis methods (kappa values) showed high validity: 0.98 (0.96), 0.97 (0.93), 0.90 (0.81), 0.90 (0.91), respectively. While this DNA microarray analysis should prove important as a method for initial screening, it is still necessary that we find better methods for improving the detection of other gene polymorphisms not part of this study.

Genetic Diversity in the Prion Protein Gene (PRNP) of Domestic Cattle and Water Buffaloes in Vietnam, Indonesia and Thailand

PubMed Central

UCHIDA, Leo; HERIYANTO, Agus; THONGCHAI, Chalermchaikit; HANH, Tran Thi; HORIUCHI, Motohiro; ISHIHARA, Kanako; TAMURA, Yutaka; MURAMATSU, Yasukazu

2014-01-01

ABSTRACT There has been an accumulation of information on frequencies of insertion/deletion (indel) polymorphisms within the bovine prion protein gene (PRNP) and on the number of octapeptide repeats and single nucleotide polymorphisms (SNPs) in the coding region of bovine PRNP related to bovine spongiform encephalopathy (BSE) susceptibility. We investigated the frequencies of 23-bp indel polymorphism in the promoter region (23indel) and 12-bp indel polymorphism in intron 1 region (12indel), octapeptide repeat polymorphisms and SNPs in the bovine PRNP of cattle and water buffaloes in Vietnam, Indonesia and Thailand. The frequency of the deletion allele in the 23indel site was significantly low in cattle of Indonesia and Thailand and water buffaloes. The deletion allele frequency in the 12indel site was significantly low in all of the cattle and buffaloes categorized in each subgroup. In both indel sites, the deletion allele has been reported to be associated with susceptibility to classical BSE. In some Indonesian local cattle breeds, the frequency of the allele with 5 octapeptide repeats was significantly high despite the fact that the allele with 6 octapeptide repeats has been reported to be most frequent in many breeds of cattle. Four SNPs observed in Indonesian local cattle have not been reported for domestic cattle. This study provided information on PRNP of livestock in these Southeast Asian countries. PMID:24705506

The Geographic Distribution of Genetic Risk as Compared to Social Risk for Chronic Diseases in the United States.

PubMed

Rehkopf, David H; Domingue, Benjamin W; Cullen, Mark R

2016-01-01

There is an association between chronic disease and geography, and there is evidence that the environment plays a critical role in this relationship. Yet at the same time, there is known to be substantial geographic variation by ancestry across the United States. Resulting geographic genetic variation-that is, the extent to which single nucleotide polymorphisms (SNPs) related to chronic disease vary spatially-could thus drive some part of the association between geography and disease. We describe the variation in chronic disease genetic risk by state of birth by taking risk SNPs from genome-wide association study meta-analyses for coronary artery disease, diabetes, and ischemic stroke and creating polygenic risk scores. We compare the amount of variability across state of birth in these polygenic scores to the variability in parental education, own education, earnings, and wealth. Our primary finding is that the polygenic risk scores are only weakly differentially distributed across U.S. states. The magnitude of the differences in geographic distribution is very small in comparison to the distribution of social and economic factors and thus is not likely sufficient to have a meaningful effect on geographic disease differences by U.S. state.

Polymorphisms of the resistin gene and their association with obesity and resistin levels in Malaysian Malays.

PubMed

Apalasamy, Yamunah Devi; Rampal, Sanjay; Salim, Agus; Moy, Foong Ming; Su, Tin Tin; Majid, Hazreen Abdul; Bulgiba, Awang; Mohamed, Zahurin

2015-06-01

Single nucleotide polymorphisms (SNP) in the resistin gene (RETN) are linked to obesity and resistin levels in various populations. However, results have been inconsistent. This study aimed to investigate association between polymorphisms in the resistin gene with obesity in a homogenous Malaysian Malay population. This study is also aimed to determine association between resistin levels with certain SNPs and haplotypes of RETN. A total of 631 Malaysian Malay subjects were included in this study and genotyping was carried out using Sequenom MassARRAY. There was no significant difference found in both allelic and genotype frequencies of each of the RETN SNPs between the obese and non-obese groups after Bonferroni correction. RETN rs34861192 and rs3219175 SNPs were significantly associated with log-resistin levels. The GG genotype carriers are found to have higher levels of log-resistin compared to A allele carriers. The RETN haplotypes (CAG, CGA and GA) were significantly associated with resistin levels. However, the haplotypes of the RETN gene were not associated with obesity. Resistin levels were not correlated to metabolic parameters such as body weight, waist circumference, body mass index, and lipid parameters. RETN SNPs and haplotypes are of apparent functional importance in the regulation of resistin levels but are not correlated with obesity and related markers.

EPH Receptor B4 (EPHB4) Gene Polymorphisms and Risk of Intracranial Hemorrhage in Patients with Brain Arteriovenous Malformations

PubMed Central

Weinsheimer, Shantel; Kim, Helen; Pawlikowska, Ludmila; Chen, Yongmei; Lawton, Michael T.; Sidney, Stephen; Kwok, Pui-Yan; McCulloch, Charles E.; Young, William L.

2009-01-01

Background Brain arteriovenous malformations (BAVM) are a tangle of abnormal vessels directly shunting blood from the arterial to venous circulation and an important cause of intracranial hemorrhage (ICH). EphB4 is involved in arterial-venous determination during embryogenesis; altered signaling could lead to vascular instability resulting in ICH. We investigated the association of single-nucleotide polymorphisms (SNPs) and haplotypes in EPHB4 with risk of ICH at clinical presentation in BAVM patients. Methods and Results Eight haplotype-tagging SNPs spanning ∼29 kb were tested for association with ICH presentation in 146 Caucasian BAVM patients (phase I: 56 ICH, 90 non-ICH) using allelic, haplotypic, and principal components analysis. Associated SNPs were then genotyped in 102 additional cases (phase II: 37 ICH, 65 non-ICH) and data combined for multivariable logistic regression. Minor alleles of 2 SNPs were associated with reduced risk of ICH presentation (rs314313 C, P=0.005; rs314308 T, P=0.0004). Overall, haplotypes were also significantly associated with ICH presentation (χ2=17.24, 6 df, P=0.008); 2 haplotypes containing the rs314308 T allele (GCCTGGGT, P=0.003; GTCTGGGC, P=0.036) were associated with reduced risk. In principal components analysis, 2 components explained 91% of the variance, and complemented haplotype results by implicating 4 SNPs at the 5′ end, including rs314308 and rs314313. These 2 SNPs were replicated in the phase II cohort, and combined data resulted in greater significance (rs314313, P=0.0007; rs314308, P=0.00008). SNP association with ICH presentation persisted after adjusting for age, sex, BAVM size, and deep venous drainage. Conclusions EPHB4 polymorphisms are associated with risk of ICH presentation in BAVM patients, warranting further study. PMID:20031623

Polymorphisms in genes related to inflammation and obesity and colorectal adenoma risk.

PubMed

Huang, Brian Z; Tsilidis, Konstantinos K; Smith, Michael W; Hoffman-Bolton, Judith; Visvanathan, Kala; Platz, Elizabeth A; Joshu, Corinne E

2018-05-26

We previously investigated the association between single nucleotide polymorphisms (SNPs) in genes related to obesity and inflammation and colorectal cancer in the CLUE II cohort. However, the relationships between these SNPs and colorectal adenomas have not been well evaluated. In a nested case-control study of 135 incident adenoma cases and 269 matched controls in the CLUE II cohort (1989-2000), we genotyped 17 candidate SNPs in 12 genes (PPARG, TCF7L2, ADIPOQ, LEP, IL10, CRP, TLR4, IL6, IL1B, IL8, TNF, RNASEL) and 19 tagSNPs in three genes (IL10, CRP, and TLR4). Conditional logistic regression was used to calculate odds ratios (OR) for adenomas (overall and by size, histology, location, number). Polymorphisms in the inflammatory-related genes CRP, ADIPOQ, IL6, and TLR4 were observed to be associated with adenoma risk. At rs1205 in CRP, T (minor allele) carriers had a higher risk (OR 1.67, 95%CI 1.07-2.60; reference: CC) of adenomas overall and adenomas with aggressive characteristics. At rs1201299 in ADIPOQ, the AC genotype had a higher risk (OR 1.58, 95%CI 1.00-2.49) of adenomas, while the minor AA genotype had a borderline inverse association (OR 0.44, 95%CI 0.18-1.08; reference: CC). At rs1800797 in IL6, the AA genotype had a borderline inverse association (OR 0.53, 95%CI 0.27-1.05; reference: GG). Three TLR4 tagSNPs (rs10116253, rs1927911, rs7873784) were associated with adenomas among obese participants. None of these SNPs were associated with colorectal cancer in our prior study in CLUE II, possibly suggesting a different genetic etiology for early colorectal neoplasia. © 2018 Wiley Periodicals, Inc.

Genome-Wide SNP Discovery, Genotyping and Their Preliminary Applications for Population Genetic Inference in Spotted Sea Bass (Lateolabrax maculatus)

PubMed Central

Wang, Juan; Xue, Dong-Xiu; Zhang, Bai-Dong; Li, Yu-Long; Liu, Bing-Jian; Liu, Jin-Xian

2016-01-01

Next-generation sequencing and the collection of genome-wide single-nucleotide polymorphisms (SNPs) allow identifying fine-scale population genetic structure and genomic regions under selection. The spotted sea bass (Lateolabrax maculatus) is a non-model species of ecological and commercial importance and widely distributed in northwestern Pacific. A total of 22 648 SNPs was discovered across the genome of L. maculatus by paired-end sequencing of restriction-site associated DNA (RAD-PE) for 30 individuals from two populations. The nucleotide diversity (π) for each population was 0.0028±0.0001 in Dandong and 0.0018±0.0001 in Beihai, respectively. Shallow but significant genetic differentiation was detected between the two populations analyzed by using both the whole data set (FST = 0.0550, P < 0.001) and the putatively neutral SNPs (FST = 0.0347, P < 0.001). However, the two populations were highly differentiated based on the putatively adaptive SNPs (FST = 0.6929, P < 0.001). Moreover, a total of 356 SNPs representing 298 unique loci were detected as outliers putatively under divergent selection by FST-based outlier tests as implemented in BAYESCAN and LOSITAN. Functional annotation of the contigs containing putatively adaptive SNPs yielded hits for 22 of 55 (40%) significant BLASTX matches. Candidate genes for local selection constituted a wide array of functions, including binding, catalytic and metabolic activities, etc. The analyses with the SNPs developed in the present study highlighted the importance of genome-wide genetic variation for inference of population structure and local adaptation in L. maculatus. PMID:27336696

Genome-Wide SNP Discovery, Genotyping and Their Preliminary Applications for Population Genetic Inference in Spotted Sea Bass (Lateolabrax maculatus).

PubMed

Wang, Juan; Xue, Dong-Xiu; Zhang, Bai-Dong; Li, Yu-Long; Liu, Bing-Jian; Liu, Jin-Xian

2016-01-01

Next-generation sequencing and the collection of genome-wide single-nucleotide polymorphisms (SNPs) allow identifying fine-scale population genetic structure and genomic regions under selection. The spotted sea bass (Lateolabrax maculatus) is a non-model species of ecological and commercial importance and widely distributed in northwestern Pacific. A total of 22 648 SNPs was discovered across the genome of L. maculatus by paired-end sequencing of restriction-site associated DNA (RAD-PE) for 30 individuals from two populations. The nucleotide diversity (π) for each population was 0.0028±0.0001 in Dandong and 0.0018±0.0001 in Beihai, respectively. Shallow but significant genetic differentiation was detected between the two populations analyzed by using both the whole data set (FST = 0.0550, P < 0.001) and the putatively neutral SNPs (FST = 0.0347, P < 0.001). However, the two populations were highly differentiated based on the putatively adaptive SNPs (FST = 0.6929, P < 0.001). Moreover, a total of 356 SNPs representing 298 unique loci were detected as outliers putatively under divergent selection by FST-based outlier tests as implemented in BAYESCAN and LOSITAN. Functional annotation of the contigs containing putatively adaptive SNPs yielded hits for 22 of 55 (40%) significant BLASTX matches. Candidate genes for local selection constituted a wide array of functions, including binding, catalytic and metabolic activities, etc. The analyses with the SNPs developed in the present study highlighted the importance of genome-wide genetic variation for inference of population structure and local adaptation in L. maculatus.

Prospecting for pig single nucleotide polymorphisms in the human genome: have we struck gold?

PubMed

Grapes, L; Rudd, S; Fernando, R L; Megy, K; Rocha, D; Rothschild, M F

2006-06-01

Gene-to-gene variation in the frequency of single nucleotide polymorphisms (SNPs) has been observed in humans, mice, rats, primates and pigs, but a relationship across species in this variation has not been described. Here, the frequency of porcine coding SNPs (cSNPs) identified by in silico methods, and the frequency of murine cSNPs, were compared with the frequency of human cSNPs across homologous genes. From 150,000 porcine expressed sequence tag (EST) sequences, a total of 452 SNP-containing sequence clusters were found, totalling 1394 putative SNPs. All the clustered porcine EST annotations and SNP data have been made publicly available at http://sputnik.btk.fi/project?name=swine. Human and murine cSNPs were identified from dbSNP and were characterized as either validated or total number of cSNPs (validated plus non-validated) for comparison purposes. The correlation between in silico pig cSNP and validated human cSNP densities was found to be 0.77 (p < 0.00001) for a set of 25 homologous genes, while a correlation of 0.48 (p < 0.0005) was found for a primarily random sample of 50 homologous human and mouse genes. This is the first evidence of conserved gene-to-gene variability in cSNP frequency across species and indicates that site-directed screening of porcine genes that are homologous to cSNP-rich human genes may rapidly advance cSNP discovery in pigs.

Polymorphisms of endothelin 1 (G5665T and T-1370G) and endothelin receptor type A (C+70G and G-231A) in Graves' disease.

PubMed

Aydın, A Fatih; Develi-İş, Seval; Doğru-Abbasoğlu, Semra; Vural, Pervin; Ozderya, Ayşenur; Karadağ, Berrin; Uysal, Müjdat

2014-01-01

Endothelin 1 (EDN1) is a strong angiogenic and mitogenic factor, playing a key role in hypervascularization, thyroid follicle cell hyperplasia, and lymphocyte infiltration in the thyroid gland of patients with Graves' disease (GD). EDN1 induces angiogenesis and mitogenesis via endothelin receptor type A (EDNRA). This study examined the possible association of EDN1 (G5665T and T-1370G) and EDNRA (C+70G and G-231A) single nucleotide polymorphisms (SNPs) with the occurrence of GD, and evaluates the relationship between genotypes and clinical/laboratory manifestations of GD. We analyzed genotype and allele distributions of EDN1 and EDNRA polymorphisms in 165 patients with GD and 181 healthy controls by real-time PCR combined with melting curve analysis. No significant associations between GD and variant alleles of the studied polymorphisms were observed. However, the anti-thyroid peroxidase (anti-TPO) and anti-thyroglobulin (anti-TG) levels in EDN1 G5665T GG genotype were higher than those in T allele carriers (GT+TT) (p=0.001 and p=0.026, respectively). In addition, anti-TPO levels in EDN1 T-1370G wild-type homozygous patients were found to be higher than in mutant gene carrying patients (GT+GG) (p=0.006). The presence of EDNRA+70G allele was associated with 3.37-fold increased risk for development of ophthalmopathy in GD patients (p=0.009). Although there were no associations between EDN1 (G5665T and T-1370G) and EDNRA (C+70G and G-231A) SNPs and susceptibility to GD, EDN1 G5665T and T-1370G polymorphisms were related to alterations of autoantibody production and EDNRA C+70G polymorphism is related with increased risk for ophthalmopathy in GD patients. Copyright © 2013 Elsevier B.V. All rights reserved.

Single Nucleotide Polymorphisms in Cellular Drug Transporters Are Associated with Intolerance to Antiretroviral Therapy in Brazilian HIV-1 Positive Individuals.

PubMed

Arruda, Mônica Barcellos; Campagnari, Francine; de Almeida, Tailah Bernardo; Couto-Fernandez, José Carlos; Tanuri, Amilcar; Cardoso, Cynthia Chester

2016-01-01

Adverse reactions are the main cause of treatment discontinuation among HIV+ individuals. Genes related to drug absorption, distribution, metabolism and excretion (ADME) influence drug bioavailability and treatment response. We have investigated the association between single nucleotide polymorphisms (SNPs) in 29 ADME genes and intolerance to therapy in a case-control study including 764 individuals. Results showed that 15 SNPs were associated with intolerance to nucleoside and 11 to non-nucleoside reverse transcriptase inhibitors (NRTIs and NNRTIs), and 8 to protease inhibitors (PIs) containing regimens under alpha = 0.05. After Bonferroni adjustment, two associations remained statistically significant. SNP rs2712816, at SLCO2B1 was associated to intolerance to NRTIs (ORGA/AA = 2.37; p = 0.0001), while rs4148396, at ABCC2, conferred risk of intolerance to PIs containing regimens (ORCT/TT = 2.64; p = 0.00009). Accordingly, haplotypes carrying rs2712816A and rs4148396T alleles were also associated to risk of intolerance to NRTIs and PIs, respectively. Our data reinforce the role of drug transporters in response to HIV therapy and may contribute to a future development of personalized therapies.

Transcriptome-wide single nucleotide polymorphisms (SNPs) for abalone (Haliotis midae): validation and application using GoldenGate medium-throughput genotyping assays.

PubMed

Bester-Van Der Merwe, Aletta; Blaauw, Sonja; Du Plessis, Jana; Roodt-Wilding, Rouvay

2013-09-23

Haliotis midae is one of the most valuable commercial abalone species in the world, but is highly vulnerable, due to exploitation, habitat destruction and predation. In order to preserve wild and cultured stocks, genetic management and improvement of the species has become crucial. Fundamental to this is the availability and employment of molecular markers, such as microsatellites and single nucleotide (SNPs). Transcriptome sequences generated through sequencing-by-synthesis technology were utilized for the in vitro and in silico identification of 505 putative SNPs from a total of 316 selected contigs. A subset of 234 SNPs were further validated and characterized in wild and cultured abalone using two Illumina GoldenGate genotyping assays. Combined with VeraCode technology, this genotyping platform yielded a 65%-69% conversion rate (percentage polymorphic markers) with a global genotyping success rate of 76%-85% and provided a viable means for validating SNP markers in a non-model species. The utility of 31 of the validated SNPs in population structure analysis was confirmed, while a large number of SNPs (174) were shown to be informative and are, thus, good candidates for linkage map construction. The non-synonymous SNPs (50) located in coding regions of genes that showed similarities with known proteins will also be useful for genetic applications, such as the marker-assisted selection of genes of relevance to abalone aquaculture.

Functional and Structural Consequence of Rare Exonic Single Nucleotide Polymorphisms: One Story, Two Tales

PubMed Central

Gu, Wanjun; Gurguis, Christopher I.; Zhou, Jin J.; Zhu, Yihua; Ko, Eun-A.; Ko, Jae-Hong; Wang, Ting; Zhou, Tong

2015-01-01

Genetic variation arising from single nucleotide polymorphisms (SNPs) is ubiquitously found among human populations. While disease-causing variants are known in some cases, identifying functional or causative variants for most human diseases remains a challenging task. Rare SNPs, rather than common ones, are thought to be more important in the pathology of most human diseases. We propose that rare SNPs should be divided into two categories dependent on whether the minor alleles are derived or ancestral. Derived alleles are less likely to have been purified by evolutionary processes and may be more likely to induce deleterious effects. We therefore hypothesized that the rare SNPs with derived minor alleles would be more important for human diseases and predicted that these variants would have larger functional or structural consequences relative to the rare variants for which the minor alleles are ancestral. We systematically investigated the consequences of the exonic SNPs on protein function, mRNA structure, and translation. We found that the functional and structural consequences are more significant for the rare exonic variants for which the minor alleles are derived. However, this pattern is reversed when the minor alleles are ancestral. Thus, the rare exonic SNPs with derived minor alleles are more likely to be deleterious. Age estimation of rare SNPs confirms that these potentially deleterious SNPs are recently evolved in the human population. These results have important implications for understanding the function of genetic variations in human exonic regions and for prioritizing functional SNPs in genome-wide association studies of human diseases. PMID:26454016

Quantifying the utility of single nucleotide polymorphisms to guide colorectal cancer screening

PubMed Central

Jenkins, Mark A; Makalic, Enes; Dowty, James G; Schmidt, Daniel F; Dite, Gillian S; MacInnis, Robert J; Ait Ouakrim, Driss; Clendenning, Mark; Flander, Louisa B; Stanesby, Oliver K; Hopper, John L; Win, Aung K; Buchanan, Daniel D

2016-01-01

Aim: To determine whether single nucleotide polymorphisms (SNPs) can be used to identify people who should be screened for colorectal cancer. Methods: We simulated one million people with and without colorectal cancer based on published SNP allele frequencies and strengths of colorectal cancer association. We estimated 5-year risks of colorectal cancer by number of risk alleles. Results: We identified 45 SNPs with an average 1.14-fold increase colorectal cancer risk per allele (range: 1.05–1.53). The colorectal cancer risk for people in the highest quintile of risk alleles was 1.81-times that for the average person. Conclusion: We have quantified the extent to which known susceptibility SNPs can stratify the population into clinically useful colorectal cancer risk categories. PMID:26846999

Massively parallel sequencing of 124 SNPs included in the precision ID identity panel in three East Asian minority ethnicities.

PubMed

Liu, Jing; Wang, Zheng; He, Guanglin; Zhao, Xueying; Wang, Mengge; Luo, Tao; Li, Chengtao; Hou, Yiping

2018-07-01

Massively parallel sequencing (MPS) technologies can sequence many targeted regions of multiple samples simultaneously and are gaining great interest in the forensic community. The Precision ID Identity Panel contains 90 autosomal SNPs and 34 upper Y-Clade SNPs, which was designed with small amplicons and optimized for forensic degraded or challenging samples. Here, 184 unrelated individuals from three East Asian minority ethnicities (Tibetan, Uygur and Hui) were analyzed using the Precision ID Identity Panel and the Ion PGM System. The sequencing performance and corresponding forensic statistical parameters of this MPS-SNP panel were investigated. The inter-population relationships and substructures among three investigated populations and 30 worldwide populations were further investigated using PCA, MDS, cladogram and STRUCTURE. No significant deviation from Hardy-Weinberg equilibrium (HWE) and Linkage Disequilibrium (LD) tests was observed across all 90 autosomal SNPs. The combined matching probability (CMP) for Tibetan, Uygur and Hui were 2.5880 × 10 -33 , 1.7480 × 10 -35 and 4.6326 × 10 -34 respectively, and the combined power of exclusion (CPE) were 0.999999386152271, 0.999999607712827 and 0.999999696360182 respectively. For 34 Y-SNPs, only 16 haplogroups were obtained, but the haplogroup distributions differ among the three populations. Tibetans from the Sino-Tibetan population and Hui with multiple ethnicities with an admixture population have genetic affinity with East Asian populations, while Uygurs of a Eurasian admixture population have similar genetic components to the South Asian populations and are distributed between East Asian and European populations. The aforementioned results suggest that the Precision ID Identity Panel is informative and polymorphic in three investigated populations and could be used as an effective tool for human forensics. Copyright © 2018 Elsevier B.V. All rights reserved.

Ovine Reference Materials and Assays for Prion Genetic Testing

USDA-ARS?s Scientific Manuscript database

Codon variants implicated in scrapie susceptibility or disease progression include those at amino acid positions 112, 136, 141, 154, and 171. Nine single nucleotide polymorphisms (SNPs) determine which residues are encoded by the five implicated codons and accurately scoring these SNPs is essential...

Large-scale enrichment and discovery of gene-associated SNPs

USDA-ARS?s Scientific Manuscript database

With the recent advent of massively parallel pyrosequencing by 454 Life Sciences it has become feasible to cost-effectively identify numerous single nucleotide polymorphisms (SNPs) within the recombinogenic regions of the maize (Zea mays L.) genome. We developed a modified version of hypomethylated...

CGDSNPdb: a database resource for error-checked and imputed mouse SNPs.

PubMed

Hutchins, Lucie N; Ding, Yueming; Szatkiewicz, Jin P; Von Smith, Randy; Yang, Hyuna; de Villena, Fernando Pardo-Manuel; Churchill, Gary A; Graber, Joel H

2010-07-06

The Center for Genome Dynamics Single Nucleotide Polymorphism Database (CGDSNPdb) is an open-source value-added database with more than nine million mouse single nucleotide polymorphisms (SNPs), drawn from multiple sources, with genotypes assigned to multiple inbred strains of laboratory mice. All SNPs are checked for accuracy and annotated for properties specific to the SNP as well as those implied by changes to overlapping protein-coding genes. CGDSNPdb serves as the primary interface to two unique data sets, the 'imputed genotype resource' in which a Hidden Markov Model was used to assess local haplotypes and the most probable base assignment at several million genomic loci in tens of strains of mice, and the Affymetrix Mouse Diversity Genotyping Array, a high density microarray with over 600,000 SNPs and over 900,000 invariant genomic probes. CGDSNPdb is accessible online through either a web-based query tool or a MySQL public login. Database URL: http://cgd.jax.org/cgdsnpdb/

Genetic polymorphisms for estimating risk of atrial fibrillation: a literature-based meta-analysis

PubMed Central

Smith, J. Gustav; Almgren, Peter; Engström, Gunnar; Hedblad, Bo; Platonov, Pyotr G.; Newton-Cheh, Christopher; Melander, Olle

2013-01-01

Objectives Genome-wide association studies have recently identified genetic polymorphisms associated with common, etiologically complex diseases, for which direct-to-consumer genetic testing with provision of absolute genetic risk estimates is marketed by commercial companies. Polymorphisms associated with atrial fibrillation (AF) have shown relatively large risk estimates but the robustness of such estimates across populations and study designs has not been studied. Design A systematic literature review with meta-analysis and assessment of between-study heterogeneity was performed for single nucleotide polymorphisms (SNPs) in the six genetic regions associated with AF in genome-wide or candidate gene studies. Results Data from 18 samples of European ancestry (n=12,100 cases; 115,702 controls) were identified for the SNP on chromosome 4q25 (rs220733), 16 samples (n=12,694 cases; 132,602 controls) for the SNP on 16q22 (rs2106261) and 4 samples (n=5,272 cases; 59,725 controls) for the SNP in KCNH2 (rs1805123). Only the discovery studies were identified for SNPs on 1q21 and in GJA5 and IL6R, why no meta-analyses were performed for those SNPs. In overall random-effects meta-analyses, association with AF was observed for both SNPs from genome-wide studies on 4q25 (OR 1.67, 95% CI=1.50–1.86, p=2×10−21) and 16q22 (OR 1.21, 95% CI=1.13–1.29, p=1×10−8), but not the SNP in KCNH2 from candidate gene studies (p=0.15). There was substantial effect heterogeneity across case-control and cross-sectional studies for both polymorphisms (I2=0.50–0.78, p<0.05), but not across prospective cohort studies (I2=0.39, p=0.15). Both polymorphisms were robustly associated with AF for each study design individually (p<0.05). Conclusions In meta-analyses including up to 150,000 individuals, polymorphisms in two genetic regions were robustly associated with AF across all study designs but with substantial context-dependency of risk estimates. PMID:22690879

Association of DPP4 Gene Polymorphisms with Type 2 Diabetes Mellitus in Malaysian Subjects

PubMed Central

Ahmed, Radwan H.; Huri, Hasniza Zaman; Al-Hamodi, Zaid; Salem, Sameer D.; Al-absi, Boshra; Muniandy, Sekaran

2016-01-01

Background Genetic polymorphisms of the Dipeptidyl Peptidase 4 (DPP4) gene may play a role in the etiology of type 2 diabetes mellitus (T2DM). This study aimed to investigate the possible association of single nucleotide polymorphisms (SNPs) of the DPP4 gene in Malaysian subjects with T2DM and evaluated whether they had an effect on the serum levels of soluble dipeptidyl peptidase 4 (sDPP-IV). Method Ten DPP4 SNPs were genotyped by TaqMan genotyping assays in 314 subjects with T2DM and 235 controls. Of these, 71 metabolic syndrome (MetS) subjects were excluded from subsequent analysis. The odds ratios (ORs) and their 95% confidence interval (CIs) were calculated using multiple logistic regression for the association between the SNPs of DPP4 and T2DM. In addition, the serum levels of sDPP-IV were investigated to evaluate the association of the SNPs of DPP4 with the sDPP-IV levels. Results Dominant, recessive, and additive genetic models were employed to test the association of DPP4 polymorphisms with T2DM, after adjusting for age, race, gender and BMI. The rs12617656 was associated with T2DM in Malaysian subjects in the recessive genetic model (OR = 1.98, p = 0.006), dominant model (OR = 1.95, p = 0.008), and additive model (OR = 1.63, p = 0.001). This association was more pronounced among Malaysian Indians, recessive (OR = 3.21, p = 0.019), dominant OR = 3.72, p = 0.003) and additive model (OR = 2.29, p = 0.0009). The additive genetic model showed that DPP4 rs4664443 and rs7633162 polymorphisms were associated with T2DM (OR = 1.53, p = 0.039), and (OR = 1.42, p = 0.020), respectively. In addition, the rs4664443 G>A polymorphism was associated with increased sDPP-IV levels (p = 0.042) in T2DM subjects. Conclusions DPP4 polymorphisms were associated with T2DM in Malaysian subjects, and linked to variations in sDPP-IV levels. In addition, these associations were more pronounced among Malaysian Indian subjects. PMID:27111895

Association of DPP4 Gene Polymorphisms with Type 2 Diabetes Mellitus in Malaysian Subjects.

PubMed

Ahmed, Radwan H; Huri, Hasniza Zaman; Al-Hamodi, Zaid; Salem, Sameer D; Al-Absi, Boshra; Muniandy, Sekaran

2016-01-01

Genetic polymorphisms of the Dipeptidyl Peptidase 4 (DPP4) gene may play a role in the etiology of type 2 diabetes mellitus (T2DM). This study aimed to investigate the possible association of single nucleotide polymorphisms (SNPs) of the DPP4 gene in Malaysian subjects with T2DM and evaluated whether they had an effect on the serum levels of soluble dipeptidyl peptidase 4 (sDPP-IV). Ten DPP4 SNPs were genotyped by TaqMan genotyping assays in 314 subjects with T2DM and 235 controls. Of these, 71 metabolic syndrome (MetS) subjects were excluded from subsequent analysis. The odds ratios (ORs) and their 95% confidence interval (CIs) were calculated using multiple logistic regression for the association between the SNPs of DPP4 and T2DM. In addition, the serum levels of sDPP-IV were investigated to evaluate the association of the SNPs of DPP4 with the sDPP-IV levels. Dominant, recessive, and additive genetic models were employed to test the association of DPP4 polymorphisms with T2DM, after adjusting for age, race, gender and BMI. The rs12617656 was associated with T2DM in Malaysian subjects in the recessive genetic model (OR = 1.98, p = 0.006), dominant model (OR = 1.95, p = 0.008), and additive model (OR = 1.63, p = 0.001). This association was more pronounced among Malaysian Indians, recessive (OR = 3.21, p = 0.019), dominant OR = 3.72, p = 0.003) and additive model (OR = 2.29, p = 0.0009). The additive genetic model showed that DPP4 rs4664443 and rs7633162 polymorphisms were associated with T2DM (OR = 1.53, p = 0.039), and (OR = 1.42, p = 0.020), respectively. In addition, the rs4664443 G>A polymorphism was associated with increased sDPP-IV levels (p = 0.042) in T2DM subjects. DPP4 polymorphisms were associated with T2DM in Malaysian subjects, and linked to variations in sDPP-IV levels. In addition, these associations were more pronounced among Malaysian Indian subjects.

A systematic review and meta-analysis of MTHFR polymorphisms in methotrexate toxicity prediction in pediatric acute lymphoblastic leukemia.

PubMed

Lopez-Lopez, E; Martin-Guerrero, I; Ballesteros, J; Garcia-Orad, A

2013-12-01

Methotrexate (MTX) is an important component of therapy used to treat childhood acute lymphoblastic leukemia (ALL). Two single-nucleotide polymorphisms (SNPs) in the methylenetetrahydrofolate reductase (MTHFR) gene, C677T and A1298C, affect MTHFR activity. A large body of studies has investigated the potential role of MTHFR SNPs in MTX toxicity in pediatric ALL. However, the results are controversial. In this review and meta-analysis, we critically evaluate the relationship between the C677T and A1298C polymorphisms of MTHFR and MTX toxicity in pediatric ALL. The majority of published reports do not find associations between MTHFR polymorphisms and toxicity in pediatric ALL. When associations are reported, often the results are contradictory to each other. The meta-analysis confirms a lack of association. In conclusion, MTHFR, C677T and A1298C polymorphisms do not seem to be good markers of MTX-related toxicity in pediatric ALL.

In silico identification of genetic variants in glucocerebrosidase (GBA) gene involved in Gaucher's disease using multiple software tools.

PubMed

Manickam, Madhumathi; Ravanan, Palaniyandi; Singh, Pratibha; Talwar, Priti

2014-01-01

Gaucher's disease (GD) is an autosomal recessive disorder caused by the deficiency of glucocerebrosidase, a lysosomal enzyme that catalyses the hydrolysis of the glycolipid glucocerebroside to ceramide and glucose. Polymorphisms in GBA gene have been associated with the development of Gaucher disease. We hypothesize that prediction of SNPs using multiple state of the art software tools will help in increasing the confidence in identification of SNPs involved in GD. Enzyme replacement therapy is the only option for GD. Our goal is to use several state of art SNP algorithms to predict/address harmful SNPs using comparative studies. In this study seven different algorithms (SIFT, MutPred, nsSNP Analyzer, PANTHER, PMUT, PROVEAN, and SNPs&GO) were used to predict the harmful polymorphisms. Among the seven programs, SIFT found 47 nsSNPs as deleterious, MutPred found 46 nsSNPs as harmful. nsSNP Analyzer program found 43 out of 47 nsSNPs are disease causing SNPs whereas PANTHER found 32 out of 47 as highly deleterious, 22 out of 47 are classified as pathological mutations by PMUT, 44 out of 47 were predicted to be deleterious by PROVEAN server, all 47 shows the disease related mutations by SNPs&GO. Twenty two nsSNPs were commonly predicted by all the seven different algorithms. The common 22 targeted mutations are F251L, C342G, W312C, P415R, R463C, D127V, A309V, G46E, G202E, P391L, Y363C, Y205C, W378C, I402T, S366R, F397S, Y418C, P401L, G195E, W184R, R48W, and T43R.

Associations between incident ischemic stroke events and stroke and cardiovascular disease-related genome-wide association studies single nucleotide polymorphisms in the Population Architecture Using Genomics and Epidemiology study.

PubMed

Carty, Cara L; Buzková, Petra; Fornage, Myriam; Franceschini, Nora; Cole, Shelley; Heiss, Gerardo; Hindorff, Lucia A; Howard, Barbara V; Mann, Sue; Martin, Lisa W; Zhang, Ying; Matise, Tara C; Prentice, Ross; Reiner, Alexander P; Kooperberg, Charles

2012-04-01

Genome-wide association studies (GWAS) have identified loci associated with ischemic stroke (IS) and cardiovascular disease (CVD) in European-descent individuals, but their replication in different populations has been largely unexplored. Nine single nucleotide polymorphisms (SNPs) selected from GWAS and meta-analyses of stroke, and 86 SNPs previously associated with myocardial infarction and CVD risk factors, including blood lipids (high density lipoprotein [HDL], low density lipoprotein [LDL], and triglycerides), type 2 diabetes, and body mass index (BMI), were investigated for associations with incident IS in European Americans (EA) N=26 276, African-Americans (AA) N=8970, and American Indians (AI) N=3570 from the Population Architecture using Genomics and Epidemiology Study. Ancestry-specific fixed effects meta-analysis with inverse variance weighting was used to combine study-specific log hazard ratios from Cox proportional hazards models. Two of 9 stroke SNPs (rs783396 and rs1804689) were significantly associated with [corrected] IS hazard in AA; none were significant in this large EA cohort. Of 73 CVD risk factor SNPs tested in EA, 2 (HDL and triglycerides SNPs) were associated with IS. In AA, SNPs associated with LDL, HDL, and BMI were significantly associated with IS (3 of 86 SNPs tested). Out of 58 SNPs tested in AI, 1 LDL SNP was significantly associated with IS. Our analyses showing lack of replication in spite of reasonable power for many stroke SNPs and differing results by ancestry highlight the need to follow up on GWAS findings and conduct genetic association studies in diverse populations. We found modest IS associations with BMI and lipids SNPs, though these findings require confirmation.

Effect of statins on sirtuin 1 and endothelial nitric oxide synthase expression in young patients with a history of premature myocardial infarction.

PubMed

Yamaç, Aylin Hatice; Kılıç, Ülkan

2018-04-01

The present study was an investigation of the effect of statins on the expression of circulating sirtuin 1 (SIRT1) and endothelial nitric oxide synthase (eNOS) proteins, and on the distribution of single nucleotide polymorphisms (SNPs) of the SIRT1 gene in patients with a history of premature myocardial infarction (PMI). A total of 108 patients who had suffered from a premature ST-elevation myocardial infarction (STEMI) under the age of 45 years were enrolled in this study. While 79 patients had been taking statins since the index event, 29 patients had discontinued statin treatment after hospital discharge due to noncompliance or insufficient information about the importance of continuous statin therapy in post-MI patients. The control group consisted of 91 healthy patients without a previous cardiovascular event. The levels of SIRT1 and eNOS protein; oxidative stress markers, like total antioxidant status (TAS), total oxidant status (TOS), and the oxidative stress index (OSI); as well as the distribution of the SNPs rs7069102 and rs2273773 were measured and analyzed. A significant increase in the SIRT1 level (p<0.001) and a significant decrease in the eNOS level (p=0.001) was observed in all genotypes and alleles for both SNPs in patients who received statin therapy compared with the control group. Both SNPs were distributed in a similar frequency in the 2 MI groups, irrespective of statin treatment. Statins induce SIRT1 protein, which might have a cardioprotective role after PMI. In addition, the eNOS protein level was low in all of the MI patients, suggesting that impairment of eNOS expression is disease-specific without a causal link to SIRT1.

Single Nucleotide Polymorphisms of Stemness Genes Predicted to Regulate RNA Splicing, microRNA and Oncogenic Signaling are Associated with Prostate Cancer Survival.

PubMed

Freedman, Jennifer A; Wang, Yanru; Li, Xuechan; Liu, Hongliang; Moorman, Patricia G; George, Daniel J; Lee, Norman H; Hyslop, Terry; Wei, Qingyi; Patierno, Steven R

2018-05-03

Prostate cancer is a clinically and molecularly heterogeneous disease, with variation in outcomes only partially predicted by grade and stage. Additional tools to distinguish indolent from aggressive disease are needed. Phenotypic characteristics of stemness correlate with poor cancer prognosis. Given this correlation, we identified single nucleotide polymorphisms (SNPs) of stemness-related genes and examined their associations with prostate cancer survival. SNPs within stemness-related genes were analyzed for association with overall survival of prostate cancer in the Prostate, Lung, Colorectal and Ovarian Cancer Screening Trial. Significant SNPs predicted to be functional were selected for linkage disequilibrium analysis and combined and stratified analyses. Identified SNPs were evaluated for association with gene expression. SNPs of CD44 (rs9666607), ABCC1 (rs35605 and rs212091) and GDF15 (rs1058587) were associated with prostate cancer survival and predicted to be functional. A role for rs9666607 of CD44 and rs35605 of ABCC1 in RNA splicing regulation, rs212091 of ABCC1 in miRNA binding site activity and rs1058587 of GDF15 in causing an amino acid change was predicted. These SNPs represent potential novel prognostic markers for overall survival of prostate cancer and support a contribution of the stemness pathway to prostate cancer patient outcome.

Single nucleotide polymorphisms in long noncoding RNA, ANRIL, are not associated with severe periodontitis but with adverse cardiovascular events among patients with cardiovascular disease.

PubMed

Schulz, S; Seitter, L; Werdan, K; Hofmann, B; Schaller, H-G; Schlitt, A; Reichert, S

2018-05-06

Biological plausibility of an association between severe periodontitis and cardiovascular disease (CVD) has been proven. Genetic characteristics play an important role in both complex inflammatory diseases. Polymorphisms (single nucleotide polymorphisms [SNPs]) in the long noncoding RNA, antisense noncoding RNA in the INK4 locus (ANRIL), were shown to play a leading role in both diseases. The primary objectives of the study were to assess, among cardiovascular (CV angiographically proven ≥50% stenosis of a main coronary artery) patients, the impact of ANRIL SNPs rs133049 and rs3217992 on the severity of periodontitis and the previous history of coronary events, as well as on the occurrence of further adverse CV events. The prevalence of severe periodontitis was analyzed in 1002 CV patients. ANRIL SNPs rs133049 and rs3217992 were genotyped. The prognostic value of both ANRIL SNPs for combined CV endpoint (stroke/transient ischemic attack [TIA], myocardial infarction, death from a CV-related event, death from stroke) was evaluated after a 3-year follow-up period. Hazard ratios (HRs) were adjusted for established CV risk factors applying Cox regression. ANRIL SNPs rs133049 and rs3217992 were not associated with severe periodontitis or history of CVD in CV patients. In the Kaplan-Meier survival curve including the log rank-test (P = .036) and Cox regression (hazard ratio = 1.684, P = .009) the AA genotype of rs3217992 was shown to be an independent predictor for adverse CV events after 3 years of follow-up. SNPs in ANRIL are not risk modulators for severe periodontitis and history of CVD in CV patients. The AA genotype of ANRIL SNPs rs3217992 possesses prognostic power for further CV events within 3 years of follow-up. © 2018 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

G-231A and G+70C Polymorphisms of Endothelin Receptor Type-A Gene could Affect the Psoriasis Area and Severity Index Score and Endothelin 1 Levels.

PubMed

Okan, Gökhan; Yıldız, Zeynep; Gökdemir, Gonca; Yorulmaz, Eda; Vural, Pervin; Doğru-Abbasoğlu, Semra; Uysal, Müjdat

2015-01-01

The etiopathogenesis of psoriasis has not been clearly elucidated although the role of chronic inflammation, imbalance between pro- and anti-inflammatory cytokines, and many immunological events have been established. Endothelin 1 (EDN1) and endothelin receptor type-A (EDNRA) are implicated in the inflammatory process. The relationships between EDN1 and EDNRA polymorphisms with several diseases have been found. This study examined the possible association of EDN1 (G5665T and T-1370G) and EDNRA (G-231A and G + 70C) single nucleotide polymorphisms (SNPs) with the occurence of psoriasis, and evaluated the relationship between genotypes and clinical/laboratory manifestation of psoriasis. We analyzed genotype and allele distributions of the above-mentioned polymorphisms in 151 patients with psoriasis and 152 healthy controls by real-time PCR combined with melting curve analysis. We did not find significant differences in the genotype and allele distributions of EDN1 T-1370G, EDNRA G-231A, and EDNRA G+70C polymorphisms between patients with psoriasis and healthy controls. Psoriasis area and severity index (PASI) score of EDNRA -231 polymorphic A allele carrying subjects (AA and AA + AG) was higher than that of wild homozygotes (P = 0.044 and P = 0.027, respectively). In addition, EDN1 levels in EDNRA+70 polymorphic C allele carriers (CC + CG) were elevated when compared with GG genotype; however, the difference was at borderline significance (P = 0.05). Although there were no associations between studied polymorphisms and psoriasis susceptibility, the PASI score and EDN1 levels seem to be affected by EDNRA G-231A and G + 70C polymorphisms.

The role of climate and out-of-Africa migration in the frequencies of risk alleles for 21 human diseases.

PubMed

Blair, Lily M; Feldman, Marcus W

2015-07-14

Demography and environmental adaptation can affect the global distribution of genetic variants and possibly the distribution of disease. Population heterozygosity of single nucleotide polymorphisms has been shown to decrease strongly with distance from Africa and this has been attributed to the effect of serial founding events during the migration of humans out of Africa. Additionally, population allele frequencies have been shown to change due to environmental adaptation. Here, we investigate the relationship of Out-of-Africa migration and climatic variables to the distribution of risk alleles for 21 diseases. For each disease, we computed the regression of average heterozygosity and average allele frequency of the risk alleles with distance from Africa and 9 environmental variables. We compared these regressions to a null distribution created by regressing statistics for SNPs not associated with disease on distance from Africa and these environmental variables. Additionally, we used Bayenv 2.0 to assess the signal of environmental adaptation associated with individual risk SNPs. For those SNPs in HGDP and HapMap that are risk alleles for type 2 diabetes, we cannot reject that their distribution is as expected from Out-of-Africa migration. However, the allelic statistics for many other diseases correlate more closely with environmental variables than would be expected from the serial founder effect and show signals of environmental adaptation. We report strong environmental interactions with several autoimmune diseases, and note a particularly strong interaction between asthma and summer humidity. Additionally, we identified several risk genes with strong environmental associations. For most diseases, migration does not explain the distribution of risk alleles and the worldwide pattern of allele frequencies for some diseases may be better explained by environmental associations, which suggests that some selection has acted on these diseases.

Common breast cancer susceptibility alleles and the risk of breast cancer for BRCA1 and BRCA2 mutation carriers: implications for risk prediction.

PubMed

Antoniou, Antonis C; Beesley, Jonathan; McGuffog, Lesley; Sinilnikova, Olga M; Healey, Sue; Neuhausen, Susan L; Ding, Yuan Chun; Rebbeck, Timothy R; Weitzel, Jeffrey N; Lynch, Henry T; Isaacs, Claudine; Ganz, Patricia A; Tomlinson, Gail; Olopade, Olufunmilayo I; Couch, Fergus J; Wang, Xianshu; Lindor, Noralane M; Pankratz, Vernon S; Radice, Paolo; Manoukian, Siranoush; Peissel, Bernard; Zaffaroni, Daniela; Barile, Monica; Viel, Alessandra; Allavena, Anna; Dall'Olio, Valentina; Peterlongo, Paolo; Szabo, Csilla I; Zikan, Michal; Claes, Kathleen; Poppe, Bruce; Foretova, Lenka; Mai, Phuong L; Greene, Mark H; Rennert, Gad; Lejbkowicz, Flavio; Glendon, Gord; Ozcelik, Hilmi; Andrulis, Irene L; Thomassen, Mads; Gerdes, Anne-Marie; Sunde, Lone; Cruger, Dorthe; Birk Jensen, Uffe; Caligo, Maria; Friedman, Eitan; Kaufman, Bella; Laitman, Yael; Milgrom, Roni; Dubrovsky, Maya; Cohen, Shimrit; Borg, Ake; Jernström, Helena; Lindblom, Annika; Rantala, Johanna; Stenmark-Askmalm, Marie; Melin, Beatrice; Nathanson, Kate; Domchek, Susan; Jakubowska, Ania; Lubinski, Jan; Huzarski, Tomasz; Osorio, Ana; Lasa, Adriana; Durán, Mercedes; Tejada, Maria-Isabel; Godino, Javier; Benitez, Javier; Hamann, Ute; Kriege, Mieke; Hoogerbrugge, Nicoline; van der Luijt, Rob B; van Asperen, Christi J; Devilee, Peter; Meijers-Heijboer, E J; Blok, Marinus J; Aalfs, Cora M; Hogervorst, Frans; Rookus, Matti; Cook, Margaret; Oliver, Clare; Frost, Debra; Conroy, Don; Evans, D Gareth; Lalloo, Fiona; Pichert, Gabriella; Davidson, Rosemarie; Cole, Trevor; Cook, Jackie; Paterson, Joan; Hodgson, Shirley; Morrison, Patrick J; Porteous, Mary E; Walker, Lisa; Kennedy, M John; Dorkins, Huw; Peock, Susan; Godwin, Andrew K; Stoppa-Lyonnet, Dominique; de Pauw, Antoine; Mazoyer, Sylvie; Bonadona, Valérie; Lasset, Christine; Dreyfus, Hélène; Leroux, Dominique; Hardouin, Agnès; Berthet, Pascaline; Faivre, Laurence; Loustalot, Catherine; Noguchi, Tetsuro; Sobol, Hagay; Rouleau, Etienne; Nogues, Catherine; Frénay, Marc; Vénat-Bouvet, Laurence; Hopper, John L; Daly, Mary B; Terry, Mary B; John, Esther M; Buys, Saundra S; Yassin, Yosuf; Miron, Alexander; Goldgar, David; Singer, Christian F; Dressler, Anne Catharina; Gschwantler-Kaulich, Daphne; Pfeiler, Georg; Hansen, Thomas V O; Jønson, Lars; Agnarsson, Bjarni A; Kirchhoff, Tomas; Offit, Kenneth; Devlin, Vincent; Dutra-Clarke, Ana; Piedmonte, Marion; Rodriguez, Gustavo C; Wakeley, Katie; Boggess, John F; Basil, Jack; Schwartz, Peter E; Blank, Stephanie V; Toland, Amanda Ewart; Montagna, Marco; Casella, Cinzia; Imyanitov, Evgeny; Tihomirova, Laima; Blanco, Ignacio; Lazaro, Conxi; Ramus, Susan J; Sucheston, Lara; Karlan, Beth Y; Gross, Jenny; Schmutzler, Rita; Wappenschmidt, Barbara; Engel, Christoph; Meindl, Alfons; Lochmann, Magdalena; Arnold, Norbert; Heidemann, Simone; Varon-Mateeva, Raymonda; Niederacher, Dieter; Sutter, Christian; Deissler, Helmut; Gadzicki, Dorothea; Preisler-Adams, Sabine; Kast, Karin; Schönbuchner, Ines; Caldes, Trinidad; de la Hoya, Miguel; Aittomäki, Kristiina; Nevanlinna, Heli; Simard, Jacques; Spurdle, Amanda B; Holland, Helene; Chen, Xiaoqing; Platte, Radka; Chenevix-Trench, Georgia; Easton, Douglas F

2010-12-01

The known breast cancer susceptibility polymorphisms in FGFR2, TNRC9/TOX3, MAP3K1, LSP1, and 2q35 confer increased risks of breast cancer for BRCA1 or BRCA2 mutation carriers. We evaluated the associations of 3 additional single nucleotide polymorphisms (SNPs), rs4973768 in SLC4A7/NEK10, rs6504950 in STXBP4/COX11, and rs10941679 at 5p12, and reanalyzed the previous associations using additional carriers in a sample of 12,525 BRCA1 and 7,409 BRCA2 carriers. Additionally, we investigated potential interactions between SNPs and assessed the implications for risk prediction. The minor alleles of rs4973768 and rs10941679 were associated with increased breast cancer risk for BRCA2 carriers (per-allele HR = 1.10, 95% CI: 1.03-1.18, P = 0.006 and HR = 1.09, 95% CI: 1.01-1.19, P = 0.03, respectively). Neither SNP was associated with breast cancer risk for BRCA1 carriers, and rs6504950 was not associated with breast cancer for either BRCA1 or BRCA2 carriers. Of the 9 polymorphisms investigated, 7 were associated with breast cancer for BRCA2 carriers (FGFR2, TOX3, MAP3K1, LSP1, 2q35, SLC4A7, 5p12, P = 7 × 10(-11) - 0.03), but only TOX3 and 2q35 were associated with the risk for BRCA1 carriers (P = 0.0049, 0.03, respectively). All risk-associated polymorphisms appear to interact multiplicatively on breast cancer risk for mutation carriers. Based on the joint genotype distribution of the 7 risk-associated SNPs in BRCA2 mutation carriers, the 5% of BRCA2 carriers at highest risk (i.e., between 95th and 100th percentiles) were predicted to have a probability between 80% and 96% of developing breast cancer by age 80, compared with 42% to 50% for the 5% of carriers at lowest risk. Our findings indicated that these risk differences might be sufficient to influence the clinical management of mutation carriers.

Genome-wide single nucleotide polymorphisms (SNPs) for a model invasive ascidian Botryllus schlosseri.

PubMed

Gao, Yangchun; Li, Shiguo; Zhan, Aibin

2018-04-01

Invasive species cause huge damages to ecology, environment and economy globally. The comprehensive understanding of invasion mechanisms, particularly genetic bases of micro-evolutionary processes responsible for invasion success, is essential for reducing potential damages caused by invasive species. The golden star tunicate, Botryllus schlosseri, has become a model species in invasion biology, mainly owing to its high invasiveness nature and small well-sequenced genome. However, the genome-wide genetic markers have not been well developed in this highly invasive species, thus limiting the comprehensive understanding of genetic mechanisms of invasion success. Using restriction site-associated DNA (RAD) tag sequencing, here we developed a high-quality resource of 14,119 out of 158,821 SNPs for B. schlosseri. These SNPs were relatively evenly distributed at each chromosome. SNP annotations showed that the majority of SNPs (63.20%) were located at intergenic regions, and 21.51% and 14.58% were located at introns and exons, respectively. In addition, the potential use of the developed SNPs for population genomics studies was primarily assessed, such as the estimate of observed heterozygosity (H O ), expected heterozygosity (H E ), nucleotide diversity (π), Wright's inbreeding coefficient (F IS ) and effective population size (Ne). Our developed SNP resource would provide future studies the genome-wide genetic markers for genetic and genomic investigations, such as genetic bases of micro-evolutionary processes responsible for invasion success.

Associations Between Polymorphisms in the Glucocorticoid-Receptor Gene and Cardiovascular Risk Factors in a Chinese Population

PubMed Central

Yan, Yu-Xiang; Dong, Jing; Wu, Li-Juan; Shao, Shuang; Zhang, Jie; Zhang, Ling; Wang, Wei; He, Yan; Liu, You-Qin

2013-01-01

Background Glucocorticoid is an important regulator of energy homeostasis. Glucocorticoid receptor (GR) gene polymorphisms that contribute to variability in glucocorticoid sensitivity have been identified. We explored the associations of single-nucleotide polymorphisms (SNPs) of the GR gene with traditional cardiovascular risk factors in the Chinese Han population. Methods We recruited 762 consecutive adults who underwent a regular physical examination at Beijing Xuanwu Hospital. Blood pressure, glucose, lipid levels (total cholesterol, high-density lipoprotein cholesterol, low-density lipoprotein [LDL] cholesterol and triglycerides), body mass index (BMI), and waist-to-hip ratio were measured. Fourteen tag SNPs and 5 functional SNPs were selected and genotyped using the high-throughput Sequenom genotyping platform. Differences between genotypes/alleles for each SNP were adjusted for sex and age and tested using a general linear model procedure. Various models of inheritance, including additive, dominant, and recessive, were tested. Results Among the 19 SNPs examined, 5 markers were associated with cardiovascular risk factors. The rs41423247 GG genotype and the rs7701443 AA genotype were associated with higher BMI and systolic blood pressure (P < 0.0004), and the rs17209251 GG genotype was associated with higher systolic blood pressure (P < 0.0004). Lower systolic blood pressure, total cholesterol, and LDL cholesterol were observed among rs10052957 A allele carriers (P < 0.0004), and lower plasma glucose and LDL-cholesterol concentrations were observed among rs2963156 TT carriers (P < 0.0004). Conclusions Polymorphism of the GR gene was associated with cardiovascular risk factors and may contribute to susceptibility to cardiovascular disease. PMID:23892712

Lack of association of two chromosome 10q24 SNPs with Alzheimer’s disease

PubMed Central

Minster, Ryan L.; DeKosky, Steven T.; Kamboh, M. Ilyas

2006-01-01

Several groups have reported evidence of linkage on chromosome 10 to late-onset Alzheimer’s disease (LOAD). In a recent scan of single nucleotide polymorphisms (SNPs) on chromosome 10, significant associations between the rs498055 and rs4417206 SNPs and risk of LOAD were observed. We examined the association of these two SNPs with LOAD risk in a large Caucasian American cohort comprising about 2,000 cases and controls. Neither SNP revealed significant association with LOAD risk or age-at-onset. PMID:17000046

Association of μ-Calpain and Calpastatin Polymorphisms with Meat Tenderness in a Brahman–Angus Population

PubMed Central

Leal-Gutiérrez, Joel D.; Elzo, Mauricio A.; Johnson, Dwain D.; Scheffler, Tracy L.; Scheffler, Jason M.; Mateescu, Raluca G.

2018-01-01

Autogenous proteolytic enzymes of the calpain family are implicated in myofibrillar protein degradation. As a result, the μ-calpain gene and its specific inhibitor, calpastatin, have been repeatedly investigated for their association with meat quality traits in cattle; however, no functional mutation has been identified for these two genes. The objectives of this study were: (1) to assess breed composition effect on tenderness; (2) to perform a linkage disequilibrium (LD) analysis in μ-calpain and calpastatin genes as well as an association analyses with tenderness; and (3) to analyze putative functional SNPs inside the significant LD block for an effect on tenderness. Tenderness measurements and genotypes for 16 SNPs in μ-calpain gene and 28 SNPs in calpastatin gene from 673 steers were analyzed. A bioinformatic analysis identified “putative functional SNPs” inside the associated LD block – polymorphisms able to produce a physical and/or chemical change in the DNA, mRNA, or translated protein in silico. Breed composition had a significant (P < 0.0001) effect on tenderness where animals with more than 80% Angus composition had the most tender meat. One 11-kb LD-block and three LD-blocks of 37, 17, and 14 kb in length were identified in the μ-calpain and calpastatin genes, respectively. Out of these, the LD-block 3 in calpastatin, tagged by SNPs located at 7-98566391 and 7-98581038, had a significant effect on tenderness with the TG-CG diplotype being approximately 1 kg more tender than the toughest diplotype, TG-CG. A total of 768 SNPs in the LD-block 3 of calpastatin were included in the bioinformatic analysis, and 28 markers were selected as putative functional SNPs inside the LD-block 3 of calpastatin; however, none of them were polymorphic in this population. Out of 15 initial polymorphisms segregating inside the LD-block 3 of calpastatin in this population, markers ARSUSMARC116, Cast5, rs730723459, and rs210861835 were found to be significantly associated with tenderness. PMID:29520298

Genetic Association Study of KCNQ5 Polymorphisms with High Myopia.

PubMed

Liao, Xuan; Yap, Maurice K H; Leung, Kim Hung; Kao, Patrick Y P; Liu, Long Qian; Yip, Shea Ping

2017-01-01

Identification of genetic variations related to high myopia may advance our knowledge of the etiopathogenesis of refractive error. This study investigated the role of potassium channel gene (KCNQ5) polymorphisms in high myopia. We performed a case-control study of 1563 unrelated Han Chinese subjects (809 cases of high myopia and 754 emmetropic controls). Five tag single-nucleotide polymorphisms (SNPs) of KCNQ5 were genotyped, and association testing with high myopia was conducted using logistic regression analysis adjusted for sex and age to give P asym values, and multiple comparisons were corrected by permutation test to give P emp values. All five noncoding SNPs were associated with high myopia. The SNP rs7744813, previously shown to be associated with refractive error and myopia in two GWAS, showed an odds ratio of 0.75 (95% CI 0.63-0.90; P emp = 0.0058) for the minor allele. The top SNP rs9342979 showed an odds ratio of 0.75 (95% CI 0.64-0.89; P emp = 0.0045) for the minor allele. Both SNPs are located within enhancer histone marks and DNase-hypersensitive sites. Our data support the involvement of KCNQ5 gene polymorphisms in the genetic susceptibility to high myopia and further exploration of KCNQ5 as a risk factor for high myopia.

Genome-wide single-nucleotide polymorphism arrays demonstrate high fidelity of multiple displacement-based whole-genome amplification.

PubMed

Tzvetkov, Mladen V; Becker, Christian; Kulle, Bettina; Nürnberg, Peter; Brockmöller, Jürgen; Wojnowski, Leszek

2005-02-01

Whole-genome DNA amplification by multiple displacement (MD-WGA) is a promising tool to obtain sufficient DNA amounts from samples of limited quantity. Using Affymetrix' GeneChip Human Mapping 10K Arrays, we investigated the accuracy and allele amplification bias in DNA samples subjected to MD-WGA. We observed an excellent concordance (99.95%) between single-nucleotide polymorphisms (SNPs) called both in the nonamplified and the corresponding amplified DNA. This concordance was only 0.01% lower than the intra-assay reproducibility of the genotyping technique used. However, MD-WGA failed to amplify an estimated 7% of polymorphic loci. Due to the algorithm used to call genotypes, this was detected only for heterozygous loci. We achieved a 4.3-fold reduction of noncalled SNPs by combining the results from two independent MD-WGA reactions. This indicated that inter-reaction variations rather than specific chromosomal loci reduced the efficiency of MD-WGA. Consistently, we detected no regions of reduced amplification, with the exception of several SNPs located near chromosomal ends. Altogether, despite a substantial loss of polymorphic sites, MD-WGA appears to be the current method of choice to amplify genomic DNA for array-based SNP analyses. The number of nonamplified loci can be substantially reduced by amplifying each DNA sample in duplicate.

KIAA0319 gene polymorphisms are associated with developmental dyslexia in Chinese Uyghur children

PubMed Central

Zhao, Hua; Chen, Yun; Zhang, Bao-ping; Zuo, Peng-xiang

2016-01-01

The gene KIAA0319 has been reported to be associated with developmental dyslexia (DD) in previous studies, although the results have not always been consistent. However, few studies have been conducted in Uyghur populations. In the present study, we aimed to investigate the association of KIAA0319 polymorphisms and DD in individuals of Uyghurian descent. We used a custom-by-design 48-Plex SNPscan Kit to genotype 18 single-nucleotide polymorphisms (SNPs) of KIAA0319 in a group of 196 children with dyslexia and 196 controls of Uyghur descent aged 8–12 years. As a result, 7 SNPs (Pmin=0.001) of KIAA0319 had nominal significant differences between the cases and controls under specific genotypic models. The two SNPs rs6935076 (P=0.020 under dominant model; P=0.028 under additive model) and rs3756821 (P=0.021 under additive model) remained significantly associated with dyslexia after Bonferroni correction. Linkage disequilibrium analysis showed three blocks within KIAA0319, and only a 10-SNP haplotype in block 3 was present at significantly different frequencies in the dyslexic children and controls. This study indicated that genetic polymorphisms of KIAA0319 are associated with an increased risk of DD in the Uyghur population. PMID:27098879

Severity of eating disorder symptoms related to oxytocin receptor polymorphisms in anorexia nervosa.

PubMed

Acevedo, Summer F; Valencia, Celeste; Lutter, Michael; McAdams, Carrie J

2015-08-30

Oxytocin is a peptide hormone important for social behavior and differences in psychological traits have been associated with variants of the oxytocin receptor gene in healthy people. We examined whether single nucleotide polymorphisms (SNPs) of the oxytocin receptor gene (OXTR) correlated with clinical symptoms in women with anorexia nervosa, bulimia nervosa, and healthy comparison (HC) women. Subjects completed clinical assessments and provided DNA for analysis. Subjects were divided into four groups: HC, subjects currently with anorexia nervosa (AN-C), subjects with a history of anorexia nervosa but in long-term weight recovery (AN-WR), and subjects with bulimia nervosa (BN). Five SNPs of the oxytocin receptor were examined. Minor allele carriers showed greater severity in most of the psychiatric symptoms. Importantly, the combination of having had anorexia and carrying either of the A alleles for two SNPS in the OXTR gene (rs53576, rs2254298) was associated with increased severity specifically for ED symptoms including cognitions and behaviors associated both with eating and appearance. A review of psychosocial data related to the OXTR polymorphisms examined is included in the discussion. OXTR polymorphisms may be a useful intermediate endophenotype to consider in the treatment of patients with anorexia nervosa. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

Polymorphisms in the Wilms Tumor Gene Are Associated With Interindividual Variations in Rubella Virus-Specific Cellular Immunity After Measles-Mumps-Rubella II Vaccination.

PubMed

Voigt, Emily A; Haralambieva, Iana H; Larrabee, Beth L; Kennedy, Richard B; Ovsyannikova, Inna G; Schaid, Daniel J; Poland, Gregory A

2018-01-30

Rubella vaccination induces widely variable immune responses in vaccine recipients. While rubella vaccination is effective at inducing immunity to rubella infection in most subjects, up to 5% of individuals do not achieve or maintain long-term protective immunity. To expand upon our previous work identifying genetic polymorphisms that are associated with these interindividual differences in humoral immunity to rubella virus, we performed a genome-wide association study in a large cohort of 1843 subjects to discover single-nucleotide polymorphisms (SNPs) associated with rubella virus-specific cellular immune responses. We identified SNPs in the Wilms tumor protein gene (WT1) that were significantly associated (P < 5 × 10-8) with interindividual variations in rubella-specific interleukin 6 secretion from subjects' peripheral blood mononuclear cells postvaccination. No SNPs were found to be significantly associated with variations in rubella-specific interferon-γ secretion. Our findings demonstrate that genetic polymorphisms in the WT1 gene in subjects of European ancestry are associated with interindividual differences in rubella virus-specific cellular immunity after measles-mumps-rubella II vaccination. © The Author(s) 2017. Published by Oxford University Press for the Infectious Diseases Society of America. All rights reserved. For permissions, e-mail: journals.permissions@oup.com.

Association between Six CETP Polymorphisms and Metabolic Syndrome in Uyghur Adults from Xinjiang, China

PubMed Central

Hou, Huixian; Ma, Rulin; Guo, Heng; He, Jia; Hu, Yunhua; Mu, Lati; Yan, Yizhong; Ma, Jiaolong; Li, Shugang; Zhang, Jingyu; Ding, Yusong; Zhang, Mei; Niu, Qiang; Liu, Jiaming; Guo, Shuxia

2017-01-01

Objective: To explore the association between CETP gene polymorphisms and metabolic syndrome (MS), as well as the relationship between the CETP gene polymorphisms and each component of MS. Methods: A total of 571 individuals which were randomly selected from 5692 Uyghur adults were subdivided into two groups, including 280 patients with MS and 291 control subjects, using the group-matching method after matching for gender. We detected CETP polymorphisms (rs5882, rs1800775, rs3764261, rs12149545, rs711752, and rs708272) by using the Snapshot method. Results: (1) Significant differences were found involving the frequency distribution of genotypes and alleles of rs1800775, rs3764261, rs12149545, rs711752, and rs708272 between the control and MS groups (all p < 0.05). (2) rs1800775, rs3764261, rs12149545, rs711752, and rs708272 polymorphisms were significantly related to the risk of MS (all p < 0.05). (3) The rs1800775 polymorphism was associated with high fasting blood glucose levels and low high density lipoprotein cholesterol (HDL-C); rs3764261 and rs12149545 polymorphisms were associated with all components of MS except high blood pressure; rs711752 and rs708272 polymorphisms were associated with low HDL-C (all p < 0.05). (4) Complete linkage disequilibrium (LD) was identified for two pairs of single nucleotide polymorphisms (SNPs) (rs3764261 and rs12149545 (D’ = 1.000, r2 = 0.931), rs711752 and rs708272 (D’ = 1.000, r2 = 0.996)). (5) The A-G-G-G-C (p = 0.013, odds ratio [OR] = 0.622, 95% confidence interval [95% CI] = 0.427–0.906) and A-T-A-A-T (p < 0.001, OR = 0.519, 95% CI = 0.386–0.697) haplotypes were more frequent in the control group than in the case group. Conclusions: The rs1800775, rs3764261, rs12149545, rs711752, and rs708272 polymorphisms of CETP were associated with MS and its components among the Uyghur ethnic group. Complete LD was found between two pairs of SNPs (rs3764261 and rs12149545, rs711752, and rs708272). The A-G-G-G-C and A-T-A-A-T haplotypes might be protective factors for MS. PMID:28629169

Associations of Polymorphisms in the Apolipoprotein APOA1-C3-A5 Gene Cluster with Acute Coronary Syndrome

PubMed Central

Ding, Yan; Zhu, Ming An; Wang, Zhi Xiao; Zhu, Jing; Feng, Jing Bo; Li, Dong Sheng

2012-01-01

Background. Acute coronary syndromes (ACSs) are clinically cardiovascular events associated with dyslipidemia in common. Single nucleotide polymorphisms (SNPs) and haplotypes in the APOA1/C3/A5 gene cluster are associated with diabetes and familial combined hyperlipidaemia (FCH). Little is known about whether the polymorphisms in these genes affect lipid homeostasis in patients with ACSs. The present paper aimed to examine these associations with 4 SNPs in the APOA1 −75G > A, the APOC3 −455T > C, and APOA5 −1131T > C, c.553G > T variant to ACSs in Chinese Han. Methods. Chinese Han of 229 patients with ACSs and 254 unrelated controls were analyzed. Four SNPs in APOA1/C3/A5 cluster were genotyped and lipid was determined. Results. Our data show that minor allelic frequencies of APOC3 −455T > C, APOA5 −1131T > C, and c.553G > T polymorphisms in patients with ACSs were significantly higher than control group (P < 0.05). Furthermore, the 3 polymorphic sites were strongly of linkage disequilibrium, and minor alleles of 3 SNP sites had higher TG level than wild alleles (P < 0.05), APOC3 −455C and APOA5 c.553T allele carriers also had lower level of HDL-C. Conclusions. The minor alleles of APOC3 −455T > C, APOA5 −1131T > C, and c.553G > T polymorphisms are closely associated with ACSs. PMID:22675253

Discovery of single nucleotide polymorphisms in candidate genes associated with fertility and production traits in Holstein cattle

PubMed Central

2013-01-01

Background Identification of single nucleotide polymorphisms (SNPs) for specific genes involved in reproduction might improve reliability of genomic estimates for these low-heritability traits. Semen from 550 Holstein bulls of high (≥ 1.7; n = 288) or low (≤ −2; n = 262) daughter pregnancy rate (DPR) was genotyped for 434 candidate SNPs using the Sequenom MassARRAY® system. Three types of SNPs were evaluated: SNPs previously reported to be associated with reproductive traits or physically close to genetic markers for reproduction, SNPs in genes that are well known to be involved in reproductive processes, and SNPs in genes that are differentially expressed between physiological conditions in a variety of tissues associated in reproductive function. Eleven reproduction and production traits were analyzed. Results A total of 40 SNPs were associated (P < 0.05) with DPR. Among these were genes involved in the endocrine system, cell signaling, immune function and inhibition of apoptosis. A total of 10 genes were regulated by estradiol. In addition, 22 SNPs were associated with heifer conception rate, 33 with cow conception rate, 36 with productive life, 34 with net merit, 23 with milk yield, 19 with fat yield, 13 with fat percent, 19 with protein yield, 22 with protein percent, and 13 with somatic cell score. The allele substitution effect for SNPs associated with heifer conception rate, cow conception rate, productive life and net merit were in the same direction as for DPR. Allele substitution effects for several SNPs associated with production traits were in the opposite direction as DPR. Nonetheless, there were 29 SNPs associated with DPR that were not negatively associated with production traits. Conclusion SNPs in a total of 40 genes associated with DPR were identified as well as SNPs for other traits. It might be feasible to include these SNPs into genomic tests of reproduction and other traits. The genes associated with DPR are likely to be important for understanding the physiology of reproduction. Given the large number of SNPs associated with DPR that were not negatively associated with production traits, it should be possible to select for DPR without compromising production. PMID:23759029

Analysis of Over 10,000 Cases Finds No Association between Previously-Reported Candidate Polymorphisms and Ovarian Cancer Outcome

PubMed Central

White, Kristin L.; Vierkant, Robert A.; Fogarty, Zachary C.; Charbonneau, Bridget; Block, Matthew S.; Pharoah, Paul D.P.; Chenevix-Trench, Georgia; Rossing, Mary Anne; Cramer, Daniel W.; Pearce, C. Leigh; Schildkraut, Joellen M.; Menon, Usha; Kjaer, Susanne Kruger; Levine, Douglas A.; Gronwald, Jacek; Culver, Hoda Anton; Whittemore, Alice S.; Karlan, Beth Y.; Lambrechts, Diether; Wentzensen, Nicolas; Kupryjanczyk, Jolanta; Chang-Claude, Jenny; Bandera, Elisa V.; Hogdall, Estrid; Heitz, Florian; Kaye, Stanley B.; Fasching, Peter A.; Campbell, Ian; Goodman, Marc T.; Pejovic, Tanja; Bean, Yukie; Lurie, Galina; Eccles, Diana; Hein, Alexander; Beckmann, Matthias W.; Ekici, Arif B.; Paul, James; Brown, Robert; Flanagan, James; Harter, Philipp; du Bois, Andreas; Schwaab, Ira; Hogdall, Claus K.; Lundvall, Lene; Olson, Sara H.; Orlow, Irene; Paddock, Lisa E.; Rudolph, Anja; Eilber, Ursula; Dansonka-Mieszkowska, Agnieszka; Rzepecka, Iwona K.; Ziolkowska-Seta, Izabela; Brinton, Louise; Yang, Hannah; Garcia-Closas, Montserrat; Despierre, Evelyn; Lambrechts, Sandrina; Vergote, Ignace; Walsh, Christine; Lester, Jenny; Sieh, Weiva; McGuire, Valerie; Rothstein, Joseph H.; Ziogas, Argyrios; Lubiński, Jan; Cybulski, Cezary; Menkiszak, Janusz; Jensen, Allan; Gayther, Simon A.; Ramus, Susan J.; Gentry-Maharaj, Aleksandra; Berchuck, Andrew; Wu, Anna H.; Pike, Malcolm C.; Van Den Berg, David; Terry, Kathryn L.; Vitonis, Allison F.; Doherty, Jennifer A.; Johnatty, Sharon; deFazio, Anna; Song, Honglin; Tyrer, Jonathan; Sellers, Thomas A.; Phelan, Catherine M.; Kalli, Kimberly R.; Cunningham, Julie M.; Fridley, Brooke L.; Goode, Ellen L.

2013-01-01

Background Ovarian cancer is a leading cause of cancer-related death among women. In an effort to understand contributors to disease outcome, we evaluated single-nucleotide polymorphisms (SNPs) previously associated with ovarian cancer recurrence or survival, specifically in angiogenesis, inflammation, mitosis, and drug disposition genes. Methods Twenty-seven SNPs in VHL, HGF, IL18, PRKACB, ABCB1, CYP2C8, ERCC2, and ERCC1 previously associated with ovarian cancer outcome were genotyped in 10,084 invasive cases from 28 studies from the Ovarian Cancer Association Consortium with over 37,000 observed person-years and 4,478 deaths. Cox proportional hazards models were used to examine the association between candidate SNPs and ovarian cancer recurrence or survival with and without adjustment for key covariates. Results We observed no association between genotype and ovarian cancer recurrence or survival for any of the SNPs examined. Conclusions These results refute prior associations between these SNPs and ovarian cancer outcome and underscore the importance of maximally powered genetic association studies. Impact These variants should not be used in prognostic models. Alternate approaches to uncovering inherited prognostic factors, if they exist, are needed. PMID:23513043

Modulation of C-reactive protein and plasma omega-6 fatty acid levels by phospholipase A2 gene polymorphisms following a 6-week supplementation with fish oil.

PubMed

Tremblay, B L; Rudkowska, I; Couture, P; Lemieux, S; Julien, P; Vohl, M C

2015-12-01

This clinical trial investigated the impact of a six-week supplementation with fish oil and single nucleotide polymorphisms (SNPs) in PLA2G4A and PLA2G6 genes on total omega-6 fatty acid (n-6 FA) levels in plasma phospholipids (PL) and plasma C-reactive protein (CRP) levels in 191 subjects. Interaction effects between SNPs and supplementation modulated total n-6 FAs and CRP levels in both men and women. Associations between SNPs and total n-6 FA levels and between SNPs and CRP levels were identified in men, independently of supplementation. Supplementation decreased total n-6 FAs without affecting plasma CRP levels. Changes in CRP levels correlated positively with changes in total n-6 FAs in men (r=0.25 p=0.01), but not in women. In conclusion, total n-6 FA levels in plasma PL and plasma CRP levels are modulated by SNPs within PLA2G4A and PLA2G6 genes alone or in combination with fish oil supplementation. Copyright © 2015 Elsevier Ltd. All rights reserved.

Regionally clustered ABCC8 polymorphisms in a prospective cohort predict cerebral oedema and outcome in severe traumatic brain injury.

PubMed

Jha, Ruchira Menka; Koleck, Theresa A; Puccio, Ava M; Okonkwo, David O; Park, Seo-Young; Zusman, Benjamin E; Clark, Robert S B; Shutter, Lori A; Wallisch, Jessica S; Empey, Philip E; Kochanek, Patrick M; Conley, Yvette P

2018-04-19

ABCC8 encodes sulfonylurea receptor 1, a key regulatory protein of cerebral oedema in many neurological disorders including traumatic brain injury (TBI). Sulfonylurea-receptor-1 inhibition has been promising in ameliorating cerebral oedema in clinical trials. We evaluated whether ABCC8 tag single-nucleotide polymorphisms predicted oedema and outcome in TBI. DNA was extracted from 485 prospectively enrolled patients with severe TBI. 410 were analysed after quality control. ABCC8 tag single-nucleotide polymorphisms (SNPs) were identified (Hapmap, r 2 >0.8, minor-allele frequency >0.20) and sequenced (iPlex-Gold, MassArray). Outcomes included radiographic oedema, intracranial pressure (ICP) and 3-month Glasgow Outcome Scale (GOS) score. Proxy SNPs, spatial modelling, amino acid topology and functional predictions were determined using established software programs. Wild-type rs7105832 and rs2237982 alleles and genotypes were associated with lower average ICP (β=-2.91, p=0.001; β=-2.28, p=0.003) and decreased radiographic oedema (OR 0.42, p=0.012; OR 0.52, p=0.017). Wild-type rs2237982 also increased favourable 3-month GOS (OR 2.45, p=0.006); this was partially mediated by oedema (p=0.03). Different polymorphisms predicted 3-month outcome: variant rs11024286 increased (OR 1.84, p=0.006) and wild-type rs4148622 decreased (OR 0.40, p=0.01) the odds of favourable outcome. Significant tag and concordant proxy SNPs regionally span introns/exons 2-15 of the 39-exon gene. This study identifies four ABCC8 tag SNPs associated with cerebral oedema and/or outcome in TBI, tagging a region including 33 polymorphisms. In polymorphisms predictive of oedema, variant alleles/genotypes confer increased risk. Different variant polymorphisms were associated with favourable outcome, potentially suggesting distinct mechanisms. Significant polymorphisms spatially clustered flanking exons encoding the sulfonylurea receptor site and transmembrane domain 0/loop 0 (juxtaposing the channel pore/binding site). This, if validated, may help build a foundation for developing future strategies that may guide individualised care, treatment response, prognosis and patient selection for clinical trials. © Article author(s) (or their employer(s) unless otherwise stated in the text of the article) 2018. All rights reserved. No commercial use is permitted unless otherwise expressly granted.

Frequencies of the Arg16Gly, Gln27Glu and Thr164Ile Adrenoceptor β2 Polymorphisms among Omanis

PubMed Central

Al-Balushi, Khalid; Zadjali, Fahad; Al-Sinani, Sawsan; Al-Zadjali, Al-Muatasim; Bayoumi, Riad

2015-01-01

Objectives: This study aimed to assess the distribution of missense mutations in the adrenoceptor β2 (ADRB2) gene in an Omani cohort. Methods: This study was carried out between May 2014 and March 2015 at the Sultan Qaboos University, Muscat, Oman. Blood samples were taken from 316 unrelated Omani subjects. Genotyping for rs1042713 (c.46A>G, p.Arg16Gly), rs1042714 (c.79C>G, p.Gln27Glu) and rs1800888 (c.491C>T, p.Thr164Ile) polymorphisms was performed by real-time polymerase chain reaction using single nucleotide polymorphism (SNP) genotyping assays. The allelic frequencies of these polymorphisms were estimated on the basis of the observed numbers of specific alleles from the genotype data for male and female subjects. The genotype frequencies for each polymorphism were tested for deviation from the Hardy-Weinberg equilibrium. Results: Gly16 and Glu27 were the most frequent variants found among the cohort (63% and 75%, respectively). The Ile164 variant was not detected in the study population. There was a significant linkage disequilibrium between the rs1042713 and rs1042714 SNPs (r2 = 0.209; P ≤0.001). The most observed haplotypes were Gly16-Gln27 and Arg16-Gln27 (0.37 and 0.38, respectively). The frequency of Gly16-Glu27 was 0.25, comprising all Glu27 carriers. Conclusion: The allelic distribution of variants in this Omani cohort was similar to distributions reported among Caucasian populations. PMID:26629374

ESR1 and ESR2 polymorphisms in the BIG 1-98 trial comparing adjuvant letrozole versus tamoxifen or their sequence for early breast cancer.

PubMed

Leyland-Jones, Brian; Gray, Kathryn P; Abramovitz, Mark; Bouzyk, Mark; Young, Brandon; Long, Bradley; Kammler, Roswitha; Dell'Orto, Patrizia; Biasi, Maria Olivia; Thürlimann, Beat; Harvey, Vernon; Neven, Patrick; Arnould, Laurent; Maibach, Rudolf; Price, Karen N; Coates, Alan S; Goldhirsch, Aron; Gelber, Richard D; Pagani, Olivia; Viale, Giuseppe; Rae, James M; Regan, Meredith M

2015-12-01

Estrogen receptor 1 (ESR1) and ESR2 gene polymorphisms have been associated with endocrine-mediated physiological mechanisms, and inconsistently with breast cancer risk and outcomes, bone mineral density changes, and hot flushes/night sweats. DNA was isolated and genotyped for six ESR1 and two ESR2 single-nucleotide polymorphisms (SNPs) from tumor specimens from 3691 postmenopausal women with hormone receptor-positive breast cancer enrolled in the BIG 1-98 trial to receive tamoxifen and/or letrozole for 5 years. Associations with recurrence and adverse events (AEs) were assessed using Cox proportional hazards models. 3401 samples were successfully genotyped for five SNPs. ESR1 rs9340799(XbaI) (T>C) variants CC or TC were associated with reduced breast cancer risk (HR = 0.82,95% CI = 0.67-1.0), and ESR1 rs2077647 (T>C) variants CC or TC was associated with reduced distant recurrence risk (HR = 0.69, 95% CI = 0.53-0.90), both regardless of the treatments. No differential treatment effects (letrozole vs. tamoxifen) were observed for the association of outcome with any of the SNPs. Letrozole-treated patients with rs2077647 (T>C) variants CC and TC had a reduced risk of bone AE (HR = 0.75, 95% CI = 0.58-0.98, P interaction = 0.08), whereas patients with rs4986938 (G>A) genotype variants AA and AG had an increased risk of bone AE (HR = 1.37, 95% CI = 1.01-1.84, P interaction = 0.07). We observed that (1) rare ESR1 homozygous polymorphisms were associated with lower recurrence, and (2) ESR1 and ESR2 SNPs were associated with bone AEs in letrozole-treated patients. Genes that are involved in estrogen signaling and synthesis have the potential to affect both breast cancer recurrence and side effects, suggesting that individual treatment strategies can incorporate not only oncogenic drivers but also SNPs related to estrogen activity.

Mango (Mangifera indica L.) germplasm diversity based on single nucleotide polymorphisms derived from the transcriptome.

PubMed

Sherman, Amir; Rubinstein, Mor; Eshed, Ravit; Benita, Miri; Ish-Shalom, Mazal; Sharabi-Schwager, Michal; Rozen, Ada; Saada, David; Cohen, Yuval; Ophir, Ron

2015-11-14

Germplasm collections are an important source for plant breeding, especially in fruit trees which have a long duration of juvenile period. Thus, efforts have been made to study the diversity of fruit tree collections. Even though mango is an economically important crop, most of the studies on diversity in mango collections have been conducted with a small number of genetic markers. We describe a de novo transcriptome assembly from mango cultivar 'Keitt'. Variation discovery was performed using Illumina resequencing of 'Keitt' and 'Tommy Atkins' cultivars identified 332,016 single-nucleotide polymorphisms (SNPs) and 1903 simple-sequence repeats (SSRs). Most of the SSRs (70.1%) were of trinucleotide with the preponderance of motif (GGA/AAG)n and only 23.5% were di-nucleotide SSRs with the mostly of (AT/AT)n motif. Further investigation of the diversity in the Israeli mango collection was performed based on a subset of 293 SNPs. Those markers have divided the Israeli mango collection into two major groups: one group included mostly mango accessions from Southeast Asia (Malaysia, Thailand, Indonesia) and India and the other with mainly of Floridian and Israeli mango cultivars. The latter group was more polymorphic (FS=-0.1 on the average) and was more of an admixture than the former group. A slight population differentiation was detected (FST=0.03), suggesting that if the mango accessions of the western world apparently was originated from Southeast Asia, as has been previously suggested, the duration of cultivation was not long enough to develop a distinct genetic background. Whole-transcriptome reconstruction was used to significantly broaden the mango's genetic variation resources, i.e., SNPs and SSRs. The set of SNP markers described in this study is novel. A subset of SNPs was sampled to explore the Israeli mango collection and most of them were polymorphic in many mango accessions. Therefore, we believe that these SNPs will be valuable as they recapitulate and strengthen the history of mango diversity.

Association of Androgen Metabolism Gene Polymorphisms with Prostate Cancer Risk and Androgen Concentrations: Results from the Prostate Cancer Prevention Trial

PubMed Central

Price, Douglas K.; Chau, Cindy H.; Till, Cathee; Goodman, Phyllis J.; Leach, Robin J.; Johnson-Pais, Teresa L.; Hsing, Ann W.; Hoque, Ashraful; Parnes, Howard L.; Schenk, Jeannette M.; Tangen, Catherine M.; Thompson, Ian M.; Reichardt, Juergen K.V.; Figg, William D.

2016-01-01

Background Prostate cancer is highly influenced by androgens and genes. We investigated whether genetic polymorphisms along the androgen biosynthesis and metabolism pathways are associated with androgen concentrations or risk of prostate cancer or high-grade disease from finasteride treatment. Methods A nested case-control study from the Prostate Cancer Prevention Trial using cases drawn from men with biopsy-proven prostate cancer and biopsy-negative, frequency-matched controls was conducted to investigate the association of 51 single nucleotide polymorphisms (SNPs) in 12 genes of the androgen pathway with total, low-grade, and high-grade prostate cancer incidence and serum hormone concentrations. Results There were significant associations of genetic polymorphisms in SRD5A1 (rs3736316, rs3822430, rs1560149, rs248797, and rs472402) and SRD5A2 (rs2300700) with risk of high-grade prostate cancer in the placebo arm of the PCPT; two SNPs were significantly associated with increased risk (SRD5A1 rs472402 [OR, 1.70; 95% CI, 1.05-2.75, Ptrend=0.03]; SRD5A2 rs2300700 [OR, 1.94; 95% CI, 1.19-3.18, Ptrend=0.01]). Eleven SNPs in SRD5A1, SRD5A2, CYP1B1, and CYP3A4 were found to be associated with modifying mean serum androgen and sex hormone-binding globulin concentrations; two SNPs (SRD5A1 rs824811 and CYP1B1 rs10012, Ptrend<0.05) consistently and significantly altered all androgen concentrations. Several SNPs (rs3822430, rs2300700; CYP3A43 rs800672; CYP19 rs700519; Ptrend<0.05) were significantly associated with both circulating hormone levels and prostate cancer risk. Conclusion Germline genetic variations of androgen-related pathway genes are associated with serum androgen concentrations and risk of prostate cancer. Further studies to examine the functional consequence of novel causal variants are warranted. PMID:27164191

High resolution melting analysis is a more sensitive and effective alternative to gel-based platforms in analysis of SSR--an example in citrus.

PubMed

Distefano, Gaetano; Caruso, Marco; La Malfa, Stefano; Gentile, Alessandra; Wu, Shu-Biao

2012-01-01

High resolution melting curve analysis (HRM) has been used as an efficient, accurate and cost-effective tool to detect single nucleotide polymorphisms (SNPs) or insertions or deletions (INDELs). However, its efficiency, accuracy and applicability to discriminate microsatellite polymorphism have not been extensively assessed. The traditional protocols used for SSR genotyping include PCR amplification of the DNA fragment and the separation of the fragments on electrophoresis-based platform. However, post-PCR handling processes are laborious and costly. Furthermore, SNPs present in the sequences flanking repeat motif cannot be detected by polyacrylamide-gel-electrophoresis based methods. In the present study, we compared the discriminating power of HRM with the traditional electrophoresis-based methods and provided a panel of primers for HRM genotyping in Citrus. The results showed that sixteen SSR markers produced distinct polymorphic melting curves among the Citrus spp investigated through HRM analysis. Among those, 10 showed more genotypes by HRM analysis than capillary electrophoresis owing to the presence of SNPs in the amplicons. For the SSR markers without SNPs present in the flanking region, HRM also gave distinct melting curves which detected same genotypes as were shown in capillary electrophoresis (CE) analysis. Moreover, HRM analysis allowed the discrimination of most of the 15 citrus genotypes and the resulting genetic distance analysis clustered them into three main branches. In conclusion, it has been approved that HRM is not only an efficient and cost-effective alternative of electrophoresis-based method for SSR markers, but also a method to uncover more polymorphisms contributed by SNPs present in SSRs. It was therefore suggested that the panel of SSR markers could be used in a variety of applications in the citrus biodiversity and breeding programs using HRM analysis. Furthermore, we speculate that the HRM analysis can be employed to analyse SSR markers in a wide range of applications in all other species.

Genetic parameters and signatures of selection in two divergent laying hen lines selected for feather pecking behaviour.

PubMed

Grams, Vanessa; Wellmann, Robin; Preuß, Siegfried; Grashorn, Michael A; Kjaer, Jörgen B; Bessei, Werner; Bennewitz, Jörn

2015-09-30

Feather pecking (FP) in laying hens is a well-known and multi-factorial behaviour with a genetic background. In a selection experiment, two lines were developed for 11 generations for high (HFP) and low (LFP) feather pecking, respectively. Starting with the second generation of selection, there was a constant difference in mean number of FP bouts between both lines. We used the data from this experiment to perform a quantitative genetic analysis and to map selection signatures. Pedigree and phenotypic data were available for the last six generations of both lines. Univariate quantitative genetic analyses were conducted using mixed linear and generalized mixed linear models assuming a Poisson distribution. Selection signatures were mapped using 33,228 single nucleotide polymorphisms (SNPs) genotyped on 41 HFP and 34 LFP individuals of generation 11. For each SNP, we estimated Wright's fixation index (FST). We tested the null hypothesis that FST is driven purely by genetic drift against the alternative hypothesis that it is driven by genetic drift and selection. The mixed linear model failed to analyze the LFP data because of the large number of 0s in the observation vector. The Poisson model fitted the data well and revealed a small but continuous genetic trend in both lines. Most of the 17 genome-wide significant SNPs were located on chromosomes 3 and 4. Thirteen clusters with at least two significant SNPs within an interval of 3 Mb maximum were identified. Two clusters were mapped on chromosomes 3, 4, 8 and 19. Of the 17 genome-wide significant SNPs, 12 were located within the identified clusters. This indicates a non-random distribution of significant SNPs and points to the presence of selection sweeps. Data on FP should be analysed using generalised linear mixed models assuming a Poisson distribution, especially if the number of FP bouts is small and the distribution is heavily peaked at 0. The FST-based approach was suitable to map selection signatures that need to be confirmed by linkage or association mapping.

The genetic association study between polymorphisms in uncoupling protein 2 and uncoupling protein 3 and metabolic data in dogs.

PubMed

Udagawa, Chihiro; Tada, Naomi; Asano, Junzo; Ishioka, Katsumi; Ochiai, Kazuhiko; Bonkobara, Makoto; Tsuchida, Shuichi; Omi, Toshinori

2014-12-11

The uncoupling proteins (UCPs) in the mitochondrial inner membrane are members of the mitochondrial anion carrier protein family that play an important role in energy homeostasis. Genetic association studies have shown that human UCP2 and UCP3 variants (SNPs and indels) are associated with obesity, insulin resistance, type 2 diabetes mellitus, and metabolic syndrome. The aim of this study was to examine the genetic association between polymorphisms in UCP2 and UCP3 and metabolic data in dogs. We identified 10 SNPs (9 intronic and 1 exonic) and 4 indels (intronic) in UCP2, and 13 SNPs (11 intronic and 2 exonic) and one indel (exonic) in UCP3, by DNA sequence analysis of 11 different dog breeds (n=119). An association study between these UCP2 and UCP3 variants and the biochemical parameters of glucose, total cholesterol, lactate dehydrogenase and triglyceride in Labrador Retrievers (n=50) showed that none of the UCP2 polymorphisms were significantly associated with the levels of these parameters. However, four UCP3 SNPs (intron 1) were significantly associated with total cholesterol levels. In addition, the allele frequencies of two of the four SNPs associated with higher total cholesterol levels in a breed that is susceptible to hypercholesterolemia (Shetland Sheepdogs, n=30), compared with the control breed (Shiba, n=30). The results obtained from a limited number of individuals suggest that the UCP3 gene in dogs may be associated with total cholesterol levels. The examination of larger sample sizes and further analysis will lead to increased precision of these results.

Genome-wide analysis of intraspecific DNA polymorphism in 'Micro-Tom', a model cultivar of tomato (Solanum lycopersicum).

PubMed

Kobayashi, Masaaki; Nagasaki, Hideki; Garcia, Virginie; Just, Daniel; Bres, Cécile; Mauxion, Jean-Philippe; Le Paslier, Marie-Christine; Brunel, Dominique; Suda, Kunihiro; Minakuchi, Yohei; Toyoda, Atsushi; Fujiyama, Asao; Toyoshima, Hiromi; Suzuki, Takayuki; Igarashi, Kaori; Rothan, Christophe; Kaminuma, Eli; Nakamura, Yasukazu; Yano, Kentaro; Aoki, Koh

2014-02-01

Tomato (Solanum lycopersicum) is regarded as a model plant of the Solanaceae family. The genome sequencing of the tomato cultivar 'Heinz 1706' was recently completed. To accelerate the progress of tomato genomics studies, systematic bioresources, such as mutagenized lines and full-length cDNA libraries, have been established for the cultivar 'Micro-Tom'. However, these resources cannot be utilized to their full potential without the completion of the genome sequencing of 'Micro-Tom'. We undertook the genome sequencing of 'Micro-Tom' and here report the identification of single nucleotide polymorphisms (SNPs) and insertion/deletions (indels) between 'Micro-Tom' and 'Heinz 1706'. The analysis demonstrated the presence of 1.23 million SNPs and 0.19 million indels between the two cultivars. The density of SNPs and indels was high in chromosomes 2, 5 and 11, but was low in chromosomes 6, 8 and 10. Three known mutations of 'Micro-Tom' were localized on chromosomal regions where the density of SNPs and indels was low, which was consistent with the fact that these mutations were relatively new and introgressed into 'Micro-Tom' during the breeding of this cultivar. We also report SNP analysis for two 'Micro-Tom' varieties that have been maintained independently in Japan and France, both of which have served as standard lines for 'Micro-Tom' mutant collections. Approximately 28,000 SNPs were identified between these two 'Micro-Tom' lines. These results provide high-resolution DNA polymorphic information on 'Micro-Tom' and represent a valuable contribution to the 'Micro-Tom'-based genomics resources.

IL28B polymorphisms of both recipient and donor cooperate to influence IFN treatment response in HCV recurrence after liver transplantation, but IL28B SNPs of the recipient play a major role in IFN-induced blocking of HCV replication.

PubMed

Barbera, Floriana; Russelli, Giovanna; Pipitone, Loredana; Pietrosi, Giada; Corsale, Sveva; Vizzini, Giovanni; Gridelli, Bruno; Conaldi, Pier Giulio

2015-04-01

Single nucleotide polymorphisms (SNPs) of the IL28B locus are associated with a positive response to pegylated interferon-alpha and ribavirin (pegIFN-alpha/RBV) treatment of HCV-infected patients. This study evaluated the association between SNPs rs12980275, rs12979860 and rs8099917 and treatment outcome of HCV recurrent infection in HCV-positive patients who underwent liver transplant. We aimed to assess to what extent recipient and/or graft donor IL28B polymorphisms contribute to HCV clearance after transplantation influencing the response to the antiviral treatment. We found that the allele frequencies in donors were in agreement with the pattern expected in the European population. The frequency of favourable genotypes was significantly lower in recipients than in donors, reasonably because the recipients represented a group of patients affected by chronic Hepatitis C. Our study demonstrated that the positive outcome of the pegIFN-alpha/RBV treatment of HCV recurrence is associated with the co-presence of favourable genotypes of both donors and recipients. However, IL28B SNPs of the recipient seem to play a major role in this clinical setting. In particular, homozygosis of rs12979860 favourable genotype in recipients was associated with sustained virological response independently from the donor's genotype. Thus, identification of these SNPs may be useful to predict the response to IFN-based therapy of HCV recurrent infection in liver-transplanted patients.

A web-based genome browser for 'SNP-aware' assay design

USDA-ARS?s Scientific Manuscript database

Human and animal genomes contain an abundance of single nucleotide polymorphisms (SNPs) that are useful for genetic testing. However, the relatively large number of SNPs present in diverse populations can pose serious problems when designing assays. It is important to “mask” some SNP positions so ...

Population-Specific Patterns of Linkage Disequilibrium and SNP Variation in Spring and Winter Polyploid Wheat

USDA-ARS?s Scientific Manuscript database

Single nucleotide polymorphisms (SNPs) are ideally suited for the construction of high-resolution genetic maps, studying population evolutionary history and performing genome-wide association mapping experiments. Here we used a genome-wide set of 1536 SNPs to study linkage disequilibrium (LD) and po...

Ghrelin Gene Variants Influence on Metabolic Syndrome Components in Aged Spanish Population.

PubMed

Mora, Mireia; Adam, Victoria; Palomera, Elisabet; Blesa, Sebastian; Díaz, Gonzalo; Buquet, Xavier; Serra-Prat, Mateu; Martín-Escudero, Juan Carlos; Palanca, Ana; Chaves, Javier Felipe; Puig-Domingo, Manuel

2015-01-01

The role of genetic variations within the ghrelin gene on cardiometabolic profile and nutritional status is still not clear in humans, particularly in elderly people. We investigated six SNPs of the ghrelin gene and their relationship with metabolic syndrome (MS) components. 824 subjects (413 men/411 women, age 77.31±5.04) participating in the Mataró aging study (n = 310) and the Hortega study (n = 514) were analyzed. Anthropometric variables, ghrelin, lipids, glucose and blood pressure levels were measured, and distribution of SNPs -994CT (rs26312), -604GA (rs27647), -501AC (rs26802), R51Q (rs34911341), M72L (rs696217) and L90G (rs4684677) of the ghrelin gene evaluated. Genotypes were determined by multiplex PCR and SNaPshot minisequencing. MS (IDF criteria) was found in 54.9%. No association between any of the SNPs and levels of total fasting circulating ghrelin levels was found. C/A-A/A genotype of M72L was associated with increased risk of central obesity according to IDF criteria, while G/A-G/G genotypes of -604GA with reduced risk. A/A genotype of -501AC polymorphism was associated to decreased BMI. In relation to lipid profile, the same genotypes of -604GA were associated with increased total cholesterol and LDL-cholesterol and -501AC with reduced triglycerides. There were no associations with systolic or diastolic blood pressure levels or with hypertension, glucose levels or diabetes and ghrelin polymorphisms. However, G/G genotype of -604GA was associated with glucose >100 mg/dL. Haplotype analysis showed that only one haplotype is associated with increased risk of waist circumference and central obesity. The analysis of subjects by gender showed an important and different association of these polymorphisms regarding MS parameters. Ghrelin gene variants -604GA, -501AC and M72L are associated with certain components of MS, in particular to BMI and lipid profile in elderly Spanish subjects.

[Natural nucleotide polymorphism of the Srlk gene that determines salt stress tolerance in alfalfa (Medicago sativa L)].

PubMed

Vishnevskaia, M S; Pavlov, A V; Dziubenko, E A; Dziubenko, N I; Potokina, E K

2014-04-01

Based on legume genome syntheny, the nucleotide sequence of Srlk gene, key role of which in response to salt stress was demonstrated for the model species Medicago truncatula, was identified in the major forage and siderate crop alfalfa (Medicago sativa). In twelve alfalfa samples originating from regions with contrasting growing conditions, 19 SNPs were revealed in the Srlk gene. For two nonsynonymous SNPs, molecular markers were designed that could be further used to analyze the association between Srlk gene nucleotide polymorphism and the variability in salt stress tolerance among alfalfa cultivars.

Trichomonas vaginalis Metronidazole Resistance Is Associated with Single Nucleotide Polymorphisms in the Nitroreductase Genes ntr4Tv and ntr6Tv

PubMed Central

Paulish-Miller, Teresa E.; Augostini, Peter; Schuyler, Jessica A.; Smith, William L.; Mordechai, Eli; Adelson, Martin E.; Gygax, Scott E.; Secor, William E.

2014-01-01

Metronidazole resistance in the sexually transmitted parasite Trichomonas vaginalis is a problematic public health issue. We have identified single nucleotide polymorphisms (SNPs) in two nitroreductase genes (ntr4Tv and ntr6Tv) associated with resistance. These SNPs were associated with one of two distinct T. vaginalis populations identified by multilocus sequence typing, yet one SNP (ntr6Tv A238T), which results in a premature stop codon, was associated with resistance independent of population structure and may be of diagnostic value. PMID:24550324

Single nucleotide polymorphisms in common bean: their discovery and genotyping using a multiplex detection system

USDA-ARS?s Scientific Manuscript database

Single-nucleotide Polymorphism (SNP) markers are by far the most common form of DNA polymorphism in a genome. The objectives of this study were to discover SNPs in common bean comparing sequences from coding and non-coding regions obtained from Genbank and genomic DNA and to compare sequencing resu...

Design of a 9K illumina BeadChip for polar bears (Ursus maritimus) from RAD and transcriptome sequencing.

PubMed

Malenfant, René M; Coltman, David W; Davis, Corey S

2015-05-01

Single-nucleotide polymorphisms (SNPs) offer numerous advantages over anonymous markers such as microsatellites, including improved estimation of population parameters, finer-scale resolution of population structure and more precise genomic dissection of quantitative traits. However, many SNPs are needed to equal the resolution of a single microsatellite, and reliable large-scale genotyping of SNPs remains a challenge in nonmodel species. Here, we document the creation of a 9K Illumina Infinium BeadChip for polar bears (Ursus maritimus), which will be used to investigate: (i) the fine-scale population structure among Canadian polar bears and (ii) the genomic architecture of phenotypic traits in the Western Hudson Bay subpopulation. To this end, we used restriction-site associated DNA (RAD) sequencing from 38 bears across their circumpolar range, as well as blood/fat transcriptome sequencing of 10 individuals from Western Hudson Bay. Six-thousand RAD SNPs and 3000 transcriptomic SNPs were selected for the chip, based primarily on genomic spacing and gene function respectively. Of the 9000 SNPs ordered from Illumina, 8042 were successfully printed, and - after genotyping 1450 polar bears - 5441 of these SNPs were found to be well clustered and polymorphic. Using this array, we show rapid linkage disequilibrium decay among polar bears, we demonstrate that in a subsample of 78 individuals, our SNPs detect known genetic structure more clearly than 24 microsatellites genotyped for the same individuals and that these results are not driven by the SNP ascertainment scheme. Here, we present one of the first large-scale genotyping resources designed for a threatened species. © 2014 John Wiley & Sons Ltd.

Design of a High Density SNP Genotyping Assay in the Pig Using SNPs Identified and Characterized by Next Generation Sequencing Technology

PubMed Central

Ramos, Antonio M.; Crooijmans, Richard P. M. A.; Affara, Nabeel A.; Amaral, Andreia J.; Archibald, Alan L.; Beever, Jonathan E.; Bendixen, Christian; Churcher, Carol; Clark, Richard; Dehais, Patrick; Hansen, Mark S.; Hedegaard, Jakob; Hu, Zhi-Liang; Kerstens, Hindrik H.; Law, Andy S.; Megens, Hendrik-Jan; Milan, Denis; Nonneman, Danny J.; Rohrer, Gary A.; Rothschild, Max F.; Smith, Tim P. L.; Schnabel, Robert D.; Van Tassell, Curt P.; Taylor, Jeremy F.; Wiedmann, Ralph T.; Schook, Lawrence B.; Groenen, Martien A. M.

2009-01-01

Background The dissection of complex traits of economic importance to the pig industry requires the availability of a significant number of genetic markers, such as single nucleotide polymorphisms (SNPs). This study was conducted to discover several hundreds of thousands of porcine SNPs using next generation sequencing technologies and use these SNPs, as well as others from different public sources, to design a high-density SNP genotyping assay. Methodology/Principal Findings A total of 19 reduced representation libraries derived from four swine breeds (Duroc, Landrace, Large White, Pietrain) and a Wild Boar population and three restriction enzymes (AluI, HaeIII and MspI) were sequenced using Illumina's Genome Analyzer (GA). The SNP discovery effort resulted in the de novo identification of over 372K SNPs. More than 549K SNPs were used to design the Illumina Porcine 60K+SNP iSelect Beadchip, now commercially available as the PorcineSNP60. A total of 64,232 SNPs were included on the Beadchip. Results from genotyping the 158 individuals used for sequencing showed a high overall SNP call rate (97.5%). Of the 62,621 loci that could be reliably scored, 58,994 were polymorphic yielding a SNP conversion success rate of 94%. The average minor allele frequency (MAF) for all scorable SNPs was 0.274. Conclusions/Significance Overall, the results of this study indicate the utility of using next generation sequencing technologies to identify large numbers of reliable SNPs. In addition, the validation of the PorcineSNP60 Beadchip demonstrated that the assay is an excellent tool that will likely be used in a variety of future studies in pigs. PMID:19654876

Genetic polymorphisms to predict gains in maximal O2 uptake and knee peak torque after a high intensity training program in humans.

PubMed

Yoo, Jinho; Kim, Bo-Hyung; Kim, Soo-Hwan; Kim, Yangseok; Yim, Sung-Vin

2016-05-01

The study aimed to identify single nucleotide polymorphisms (SNPs) that significantly influenced the level of improvement of two kinds of training responses, including maximal O2 uptake (V'O2max) and knee peak torque of healthy adults participating in the high intensity training (HIT) program. The study also aimed to use these SNPs to develop prediction models for individual training responses. 79 Healthy volunteers participated in the HIT program. A genome-wide association study, based on 2,391,739 SNPs, was performed to identify SNPs that were significantly associated with gains in V'O2max and knee peak torque, following 9 weeks of the HIT program. To predict two training responses, two independent SNPs sets were determined using linear regression and iterative binary logistic regression analysis. False discovery rate analysis and permutation tests were performed to avoid false-positive findings. To predict gains in V'O2max, 7 SNPs were identified. These SNPs accounted for 26.0 % of the variance in the increment of V'O2max, and discriminated the subjects into three subgroups, non-responders, medium responders, and high responders, with prediction accuracy of 86.1 %. For the knee peak torque, 6 SNPs were identified, and accounted for 27.5 % of the variance in the increment of knee peak torque. The prediction accuracy discriminating the subjects into the three subgroups was estimated as 77.2 %. Novel SNPs found in this study could explain, and predict inter-individual variability in gains of V'O2max, and knee peak torque. Furthermore, with these genetic markers, a methodology suggested in this study provides a sound approach for the personalized training program.

Development and evaluation of high-density Axiom® CicerSNP Array for high-resolution genetic mapping and breeding applications in chickpea.

PubMed

Roorkiwal, Manish; Jain, Ankit; Kale, Sandip M; Doddamani, Dadakhalandar; Chitikineni, Annapurna; Thudi, Mahendar; Varshney, Rajeev K

2018-04-01

To accelerate genomics research and molecular breeding applications in chickpea, a high-throughput SNP genotyping platform 'Axiom ® CicerSNP Array' has been designed, developed and validated. Screening of whole-genome resequencing data from 429 chickpea lines identified 4.9 million SNPs, from which a subset of 70 463 high-quality nonredundant SNPs was selected using different stringent filter criteria. This was further narrowed down to 61 174 SNPs based on p-convert score ≥0.3, of which 50 590 SNPs could be tiled on array. Among these tiled SNPs, a total of 11 245 SNPs (22.23%) were from the coding regions of 3673 different genes. The developed Axiom ® CicerSNP Array was used for genotyping two recombinant inbred line populations, namely ICCRIL03 (ICC 4958 × ICC 1882) and ICCRIL04 (ICC 283 × ICC 8261). Genotyping data reflected high success and polymorphic rate, with 15 140 (29.93%; ICCRIL03) and 20 018 (39.57%; ICCRIL04) polymorphic SNPs. High-density genetic maps comprising 13 679 SNPs spanning 1033.67 cM and 7769 SNPs spanning 1076.35 cM were developed for ICCRIL03 and ICCRIL04 populations, respectively. QTL analysis using multilocation, multiseason phenotyping data on these RILs identified 70 (ICCRIL03) and 120 (ICCRIL04) main-effect QTLs on genetic map. Higher precision and potential of this array is expected to advance chickpea genetics and breeding applications. © 2017 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.

Cyclooxygenase 2 gene polymorphisms and chronic periodontitis in a North Indian population: a pilot study

PubMed Central

Daing, Anika; Singh, Sarvendra Vikram; Saimbi, Charanjeet Singh; Khan, Mohammad Akhlaq

2012-01-01

Purpose Cyclooxygenase (COX) enzyme catalyzes the production of prostaglandins, which are important mediators of tissue destruction in periodontitis. Single nucleotide polymorphisms of COX2 enzyme have been associated with increasing susceptibility to inflammatory diseases. The present study evaluates the association of two single nucleotide polymorphisms in COX2 gene (-1195G>A and 8473C>T) with chronic periodontitis in North Indians. Methods Both SNPs and their haplotypes were used to explore the associations between COX2 polymorphisms and chronic periodontitis in 56 patients and 60 controls. Genotyping was done by polymerase chain reaction followed by restriction fragment length polymorphism. Chi-square test and logistic regression analysis were performed for association analysis. Results By the individual genotype analysis, mutant genotypes (GA and AA) of COX2 -1195 showed more than a two fold risk (odds ratio [OR]>2) and COX2 8473 (TC and CC) showed a reduced risk for the disease, but the findings were not statistically significant. Haplotype analysis showed that the frequency of the haplotype AT was higher in the case group and a significant association was found for haplotype AT (OR, 1.79; 95% confidence interval, 1.03 to 3.11; P=0.0370) indicating an association between the AT haplotype of COX2 gene SNPs and chronic periodontitis. Conclusions Individual genotypes of both the SNPs were not associated while haplotype AT was found to be associated with chronic periodontitis in North Indians. PMID:23185695

Bovine GDF10 gene polymorphism analysis and its association with body measurement traits in Chinese indigenous cattle.

PubMed

Adoligbe, C; Zan, Linsen; Farougou, S; Wang, Hongbao; Ujjan, J A

2012-04-01

The objective of this research was to detect bovine GDF10 gene polymorphism and analyze its association with body measurement traits (BMT) of animals sampled from 6 different Chinese indigenous cattle populations. The populations included Xuelong (Xl), Luxi (Lx), Qinchuan (Qc), Jiaxian red (Jx), Xianang (Xn) and Nanyang (Ny). Blood samples were taken from a total of 417 female animals stratified into age categories of 12-36 months. Polymerase chain reaction-single strand conformation polymorphism (PCR-SSCP) was employed to find out GDF10 single polymorphism nucleotide (SNPs) and explore their possible association with BMT. Sequence analysis of GDF10 gene revealed 3 SNPs in total: 1 in exon1 (G142A) and 2 in exon3 (A11471G, and T12495C). G142A and T12495C SNPs are both synonymous mutation. They showed 2 genotypes namely respectively (GG, GA) and (PP and PB). A11471G SNP is a missense mutation leading to the change of Alanine to Threonine amino acid. It showed three genotypes namely AA, BB and AB. Analysis of association of polymorphism with body measurement traits at the three locus showed that there were significant effects on BMT in Qc, Jx and Ny cattle population. These results suggest that the GDF10 gene might have potential effects on body measurement traits in the above mentioned cattle populations and could be used for marker-assisted selection.

MMP1 bimodal expression and differential response to inflammatory mediators is linked to promoter polymorphisms

PubMed Central

2011-01-01

Background Identifying the functional importance of the millions of single nucleotide polymorphisms (SNPs) in the human genome is a difficult challenge. Therefore, a reverse strategy, which identifies functionally important SNPs by virtue of the bimodal abundance across the human population of the SNP-related mRNAs will be useful. Those mRNA transcripts that are expressed at two distinct abundances in proportion to SNP allele frequency may warrant further study. Matrix metalloproteinase 1 (MMP1) is important in both normal development and in numerous pathologies. Although much research has been conducted to investigate the expression of MMP1 in many different cell types and conditions, the regulation of its expression is still not fully understood. Results In this study, we used a novel but straightforward method based on agglomerative hierarchical clustering to identify bimodally expressed transcripts in human umbilical vein endothelial cell (HUVEC) microarray data from 15 individuals. We found that MMP1 mRNA abundance was bimodally distributed in un-treated HUVECs and showed a bimodal response to inflammatory mediator treatment. RT-PCR and MMP1 activity assays confirmed the bimodal regulation and DNA sequencing of 69 individuals identified an MMP1 gene promoter polymorphism that segregated precisely with the MMP1 bimodal expression. Chromatin immunoprecipation (ChIP) experiments indicated that the transcription factors (TFs) ETS1, ETS2 and GATA3, bind to the MMP1 promoter in the region of this polymorphism and may contribute to the bimodal expression. Conclusions We describe a simple method to identify putative bimodally expressed RNAs from transcriptome data that is effective yet easy for non-statisticans to understand and use. This method identified bimodal endothelial cell expression of MMP1, which appears to be biologically significant with implications for inflammatory disease. (271 Words) PMID:21244711

Risk of macular degeneration affected by polymorphisms in Matrix metalloproteinase-2: A case-control study in Chinese Han population.

PubMed

Cheng, Jie; Hao, Xiaolin; Zhang, Zhongchen

2017-11-01

The purpose of this study was to investigate the correlation of single nucleotide polymorphisms (SNPs) in Matrix metalloproteinase -2 (MMP-2) gene and the risk of age-related macular degeneration (AMD) in Chinese Han population.A total of 126 AMD patients and 141 healthy controls participated in this study. Genotypes of MMP-2 gene polymorphisms were identified by the polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP). χtest was used to detect the differences of genotypes and alleles frequencies between case and control groups. Relative risk of AMD was evaluated by odds ratios (ORs) with 95% confidence intervals (CIs).Distribution of variant allele carriers (computed tomography + TT genotypes) of MMP-2 gene rs243865 SNP was significantly different between case and control groups, and might act as protective factors for the onset of AMD (P = .044, OR = 0.583, 95% CI = 0.344-0.987). Nevertheless, the T allele might reduce the AMD risk (P = .030, OR = 0.611, 95% CI = 0.390-0.956). However, no significant association existed between rs243865 and AMD risk in the subgroup analysis based on age. GA + AA genotypes of rs243866 SNP may associate with a decreased risk of AMD in the age≤65 years subgroup (P = .028, OR = 0.399, 95% CI = 0.174-0.915).MMP-2 gene rs243865 and rs243866 SNPs associated with the risk of AMD. Further studies should be performed to confirm the results. Copyright © 2017 The Authors. Published by Wolters Kluwer Health, Inc. All rights reserved.

Genomic variation at the tips of the adaptive radiation of Darwin's finches.

PubMed

Chaves, Jaime A; Cooper, Elizabeth A; Hendry, Andrew P; Podos, Jeffrey; De León, Luis F; Raeymaekers, Joost A M; MacMillan, W Owen; Uy, J Albert C

2016-11-01

Adaptive radiation unfolds as selection acts on the genetic variation underlying functional traits. The nature of this variation can be revealed by studying the tips of an ongoing adaptive radiation. We studied genomic variation at the tips of the Darwin's finch radiation; specifically focusing on polymorphism within, and variation among, three sympatric species of the genus Geospiza. Using restriction site-associated DNA (RAD-seq), we characterized 32 569 single-nucleotide polymorphisms (SNPs), from which 11 outlier SNPs for beak and body size were uncovered by a genomewide association study (GWAS). Principal component analysis revealed that these 11 SNPs formed four statistically linked groups. Stepwise regression then revealed that the first PC score, which included 6 of the 11 top SNPs, explained over 80% of the variation in beak size, suggesting that selection on these traits influences multiple correlated loci. The two SNPs most strongly associated with beak size were near genes associated with beak morphology across deeper branches of the radiation: delta-like 1 homologue (DLK1) and high-mobility group AT-hook 2 (HMGA2). Our results suggest that (i) key adaptive traits are associated with a small fraction of the genome (11 of 32 569 SNPs), (ii) SNPs linked to the candidate genes are dispersed throughout the genome (on several chromosomes), and (iii) micro- and macro-evolutionary variation (roots and tips of the radiation) involve some shared and some unique genomic regions. © 2016 John Wiley & Sons Ltd.

Forensic genetic informativeness of an SNP panel consisting of 19 multi-allelic SNPs.

PubMed

Gao, Zehua; Chen, Xiaogang; Zhao, Yuancun; Zhao, Xiaohong; Zhang, Shu; Yang, Yiwen; Wang, Yufang; Zhang, Ji

2018-05-01

Current research focusing on forensic personal identification, phenotype inference and ancestry information on single-nucleotide polymorphisms (SNPs) has been widely reported. In the present study, we focused on tetra-allelic SNPs in the Chinese Han population. A total of 48 tetra-allelic SNPs were screened out from the Chinese Han population of the 1000 Genomes Database, including Chinese Han in Beijing (CHB) and Chinese Han South (CHS). Considering the forensic genetic requirement for the polymorphisms, only 11 tetra-allelic SNPs with a heterozygosity >0.06 were selected for further multiplex panel construction. In order to meet the demands of personal identification and parentage identification, an additional 8 tri-allelic SNPs were combined into the final multiplex panel. To ensure application in the degraded DNA analysis, all the PCR products were designed to be 87-188 bp. Employing multiple PCR reactions and SNaPshot minisequencing, 511 unrelated Chinese Han individuals from Sichuan were genotyped. The combined match probability (CMP), combined discrimination power (CDP), and cumulative probability of exclusion (CPE) of the panel were 6.07 × 10 -11 , 0.9999999999393 and 0.996764, respectively. Based on the population data retrieved from the 1000 Genomes Project, Fst values between Chinese Han in Sichuan (SCH) and all the populations included in the 1000 Genomes Project were calculated. The results indicated that two SNPs in this panel may contain ancestry information and may be used as markers of forensic biogeographical ancestry inference. Copyright © 2018 Elsevier B.V. All rights reserved.

HTRA1 promoter polymorphism predisposes Japanese to age-related macular degeneration.

PubMed

Yoshida, Tsunehiko; DeWan, Andrew; Zhang, Hong; Sakamoto, Ryosuke; Okamoto, Haru; Minami, Masayoshi; Obazawa, Minoru; Mizota, Atsushi; Tanaka, Minoru; Saito, Yoshihiro; Takagi, Ikue; Hoh, Josephine; Iwata, Takeshi

2007-04-04

To study the effect of candidate single nucleotide polymorphisms (SNPs) on chromosome 10q26, recently shown to be associated with wet age-related macular degeneration (AMD) in Chinese and Caucasian cohorts, in a Japanese cohort. Using genomic DNA isolated from peripheral blood of wet AMD cases and age-matched controls, we genotyped two SNPs, rs10490924, and rs11200638, on chromosome 10q26, 6.6 kb and 512 bp upstream of the HTRA1 gene, respectively, using temperature gradient capillary electrophoresis (TGCE) and direct sequencing. Association tests were performed for individual SNPs and jointly with SNP complement factor H (CFH) Y402H. The two SNPs, rs10490924 and rs11200638, are in complete linkage disequilibrium (D'=1). Previous sequence comparisons among seventeen species revealed that the genomic region containing rs11200638 was highly conserved while the region surrounding rs10490924 was not. The allelic association test for rs11200638 yielded a p-value <10(-11). SNP rs11200638 conferred disease risk in an autosomal recessive fashion: Odds ratio was 10.1 (95% CI 4.36, 23.06), adjusted for SNP CFH 402, for those carrying two copies of the risk allele, whereas indistinguishable from unity if carrying only one risk allele. The HTRA1 promoter polymorphism, rs11200638, is a strong candidate with a functional consequence that predisposes Japanese to develop neovascular AMD.

Fatal Methadone Toxicity: Potential Role of CYP3A4 Genetic Polymorphism

PubMed Central

Richards-Waugh, Lauren L.; Primerano, Donald A.; Dementieva, Yulia; Kraner, James C.; Rankin, Gary O.

2014-01-01

Methadone is difficult to administer as a therapeutic agent because of a wide range of interindividual pharmacokinetics, likely due to genetic variability of the CYP450 enzymes responsible for metabolism to its principal metabolite 2-ethylidene-1,5-dimethyl-3,3-diphenylpyrrolidine (EDDP). CYP3A4 is one of the primary CYP450 isoforms responsible for the metabolism of methadone to EDDP in humans. The purpose of this study was to evaluate the role of CYP3A4 genetic polymorphisms in accidental methadone fatalities. A study cohort consisting of 136 methadone-only and 92 combined methadone/benzodiazepine fatalities was selected from cases investigated at the West Virginia and Kentucky Offices of the Chief Medical Examiner. Seven single nucleotide polymorphisms (SNPs) were genotyped within the CYP3A4 gene. Observed allelic and genotypic frequencies were compared with expected frequencies obtained from The National Center for Biotechnology Information dbSNP database. SNPs rs2242480 and rs2740574 demonstrated an apparent enrichment within the methadone-only overdose fatalities compared with the control group and the general population. This enrichment was not apparent in the methadone/benzodiazepine cases for these two SNPs. Our findings indicate that there may be two or more SNPs on the CYP3A4 gene that cause or contribute to the methadone poor metabolizer phenotype. PMID:25217544

Association of galanin haplotypes with alcoholism and anxiety in two ethnically distinct populations

PubMed Central

Belfer, I; Hipp, H; McKnight, C; Evans, C; Buzas, B; Bollettino, A; Albaugh, B; Virkkunen, M; Yuan, Q; Max, MB; Goldman, D; Enoch, MA

2009-01-01

The neuropeptide galanin (GAL) is widely expressed in the central nervous system. Animal studies have implicated GAL in alcohol abuse and anxiety: chronic ethanol intake increases hypothalamic GAL mRNA; high levels of stress increase GAL release in the central amygdala. The coding sequence of the galanin gene, GAL, is highly conserved and a functional polymorphism has not yet been found. The aim of our study was, for the first time, to identify GAL haplotypes and investigate associations with alcoholism and anxiety. Seven single-nucleotide polymorphisms (SNPs) spanning GAL were genotyped in 65 controls from five populations: US and Finnish Caucasians, African Americans, Plains and Southwestern Indians. A single haplotype block with little evidence of historical recombination was observed for each population. Four tag SNPs were then genotyped in DSM-III-R lifetime alcoholics and nonalcoholics from two population isolates: 514 Finnish Caucasian men and 331 Plains Indian men and women. Tridimensional Personality Questionnaire harm avoidance (HA) scores, a dimensional measure of anxiety, were obtained. There was a haplotype association with alcoholism in both the Finnish (P=0.001) and Plains Indian (P=0.004) men. The SNPs were also significantly associated. Alcoholics were divided into high and low HA groups (≥ and < mean HA of population). In the Finns, haplotype (P < 0.0001) and diplotype (P < 0.0001) distributions differed between high HA alcoholics, low HA alcoholics and nonalcoholics. Our results from two independent populations suggest that GAL may contribute to vulnerability to alcoholism, perhaps mediated by dimensional anxiety. PMID:16314872

Single nucleotide polymorphism discovery via genotyping by sequencing to assess population genetic structure and recurrent polyploidization in Andropogon gerardii.

PubMed

McAllister, Christine A; Miller, Allison J

2016-07-01

Autopolyploidy, genome duplication within a single lineage, can result in multiple cytotypes within a species. Geographic distributions of cytotypes may reflect the evolutionary history of autopolyploid formation and subsequent population dynamics including stochastic (drift) and deterministic (differential selection among cytotypes) processes. Here, we used a population genomic approach to investigate whether autopolyploidy occurred once or multiple times in Andropogon gerardii, a widespread, North American grass with two predominant cytotypes. Genotyping by sequencing was used to identify single nucleotide polymorphisms (SNPs) in individuals collected from across the geographic range of A. gerardii. Two independent approaches to SNP calling were used: the reference-free UNEAK pipeline and a reference-guided approach based on the sequenced Sorghum bicolor genome. SNPs generated using these pipelines were analyzed independently with genetic distance and clustering. Analyses of the two SNP data sets showed very similar patterns of population-level clustering of A. gerardii individuals: a cluster of A. gerardii individuals from the southern Plains, a northern Plains cluster, and a western cluster. Groupings of individuals corresponded to geographic localities regardless of cytotype: 6x and 9x individuals from the same geographic area clustered together. SNPs generated using reference-guided and reference-free pipelines in A. gerardii yielded unique subsets of genomic data. Both data sets suggest that the 9x cytotype in A. gerardii likely evolved multiple times from 6x progenitors across the range of the species. Genomic approaches like GBS and diverse bioinformatics pipelines used here facilitate evolutionary analyses of complex systems with multiple ploidy levels. © 2016 Botanical Society of America.

Lack of genetic diversity across diverse immune genes in an endangered mammal, the Tasmanian devil (Sarcophilus harrisii).

PubMed

Morris, Katrina M; Wright, Belinda; Grueber, Catherine E; Hogg, Carolyn; Belov, Katherine

2015-08-01

The Tasmanian devil (Sarcophilus harrisii) is threatened with extinction due to the spread of devil facial tumour disease. Polymorphisms in immune genes can provide adaptive potential to resist diseases. Previous studies in diversity at immune loci in wild species have almost exclusively focused on genes of the major histocompatibility complex (MHC); however, these genes only account for a fraction of immune gene diversity. Devils lack diversity at functionally important immunity loci, including MHC and Toll-like receptor genes. Whether there are polymorphisms at devil immune genes outside these two families is unknown. Here, we identify polymorphisms in a wide range of key immune genes, and develop assays to type single nucleotide polymorphisms (SNPs) within a subset of these genes. A total of 167 immune genes were examined, including cytokines, chemokines and natural killer cell receptors. Using genome-level data from ten devils, SNPs within coding regions, introns and 10 kb flanking genes of interest were identified. We found low polymorphism across 167 immune genes examined bioinformatically using whole-genome data. From this data, we developed long amplicon assays to target nine genes. These amplicons were sequenced in 29-220 devils and found to contain 78 SNPs, including eight SNPS within exons. Despite the extreme paucity of genetic diversity within these genes, signatures of balancing selection were exhibited by one chemokine gene, suggesting that remaining diversity may hold adaptive potential. The low functional diversity may leave devils highly vulnerable to infectious disease, and therefore, monitoring and preserving remaining diversity will be critical for the long-term management of this species. Examining genetic variation in diverse immune genes should be a priority for threatened wildlife species. This study can act as a model for broad-scale immunogenetic diversity analysis in threatened species. © 2015 The Authors. Molecular Ecology Published by John Wiley & Sons Ltd.

Single-Nucleotide Polymorphisms of Genes Involved in Repair of Oxidative DNA Damage and the Risk of Recurrent Depressive Disorder.

PubMed

Czarny, Piotr; Kwiatkowski, Dominik; Toma, Monika; Gałecki, Piotr; Orzechowska, Agata; Bobińska, Kinga; Bielecka-Kowalska, Anna; Szemraj, Janusz; Berk, Michael; Anderson, George; Śliwiński, Tomasz

2016-11-20

BACKGROUND Depressive disorder, including recurrent type (rDD), is accompanied by increased oxidative stress and activation of inflammatory pathways, which may induce DNA damage. This thesis is supported by the presence of increased levels of DNA damage in depressed patients. Such DNA damage is repaired by the base excision repair (BER) pathway. BER efficiency may be influenced by polymorphisms in BER-related genes. Therefore, we genotyped nine single-nucleotide polymorphisms (SNPs) in six genes encoding BER proteins. MATERIAL AND METHODS Using TaqMan, we selected and genotyped the following SNPs: c.-441G>A (rs174538) of FEN1, c.2285T>C (rs1136410) of PARP1, c.580C>T (rs1799782) and c.1196A>G (rs25487) of XRCC1, c.*83A>C (rs4796030) and c.*50C>T (rs1052536) of LIG3, c.-7C>T (rs20579) of LIG1, and c.-468T>G (rs1760944) and c.444T>G (rs1130409) of APEX1 in 599 samples (288 rDD patients and 311 controls). RESULTS We found a strong correlation between rDD and both SNPs of LIG3, their haplotypes, as well as a weaker association with the c.-468T>G of APEXI which diminished after Nyholt correction. Polymorphisms of LIG3 were also associated with early onset versus late onset depression, whereas the c.-468T>G polymorphism showed the opposite association. CONCLUSIONS The SNPs of genes involved in the repair of oxidative DNA damage may modulate rDD risk. Since this is an exploratory study, the results should to be treated with caution and further work needs to be done to elucidate the exact involvement of DNA damage and repair mechanisms in the development of this disease.

Single-Nucleotide Polymorphisms of Genes Involved in Repair of Oxidative DNA Damage and the Risk of Recurrent Depressive Disorder

PubMed Central

Czarny, Piotr; Kwiatkowski, Dominik; Toma, Monika; Gałecki, Piotr; Orzechowska, Agata; Bobińska, Kinga; Bielecka-Kowalska, Anna; Szemraj, Janusz; Berk, Michael; Anderson, George; Śliwiński, Tomasz

2016-01-01

Background Depressive disorder, including recurrent type (rDD), is accompanied by increased oxidative stress and activation of inflammatory pathways, which may induce DNA damage. This thesis is supported by the presence of increased levels of DNA damage in depressed patients. Such DNA damage is repaired by the base excision repair (BER) pathway. BER efficiency may be influenced by polymorphisms in BER-related genes. Therefore, we genotyped nine single-nucleotide polymorphisms (SNPs) in six genes encoding BER proteins. Material/Methods Using TaqMan, we selected and genotyped the following SNPs: c.-441G>A (rs174538) of FEN1, c.2285T>C (rs1136410) of PARP1, c.580C>T (rs1799782) and c.1196A>G (rs25487) of XRCC1, c.*83A>C (rs4796030) and c.*50C>T (rs1052536) of LIG3, c.-7C>T (rs20579) of LIG1, and c.-468T>G (rs1760944) and c.444T>G (rs1130409) of APEX1 in 599 samples (288 rDD patients and 311 controls). Results We found a strong correlation between rDD and both SNPs of LIG3, their haplotypes, as well as a weaker association with the c.-468T>G of APEXI which diminished after Nyholt correction. Polymorphisms of LIG3 were also associated with early onset versus late onset depression, whereas the c.-468T>G polymorphism showed the opposite association. Conclusions The SNPs of genes involved in the repair of oxidative DNA damage may modulate rDD risk. Since this is an exploratory study, the results should to be treated with caution and further work needs to be done to elucidate the exact involvement of DNA damage and repair mechanisms in the development of this disease. PMID:27866211

HapMap-based study on the association between MPO and GSTP1 gene polymorphisms and lung cancer susceptibility in Chinese Han population

PubMed Central

Gu, Jun-dong; Hua, Feng; Mei, Chao-rong; Zheng, De-jie; Wang, Guo-fan; Zhou, Qing-hua

2014-01-01

Aim: Myeloperoxidase (MPO) and glutathione S-transferase pi 1 (GSTP1) are important carcinogen-metabolizing enzymes. The aim of this study was to investigate the association between the common polymorphisms of MPO and GSTP1 genes and lung cancer risk in Chinese Han population. Methods: A total of 266 subjects with lung cancer and 307 controls without personal history of the disease were recruited in this case control study. The tagSNPs approach was used to assess the common polymorphisms of MOP and GSTP1 genes and lung cancer risk according to the disequilibrium information from the HapMap project. The tagSNP rs7208693 was selected as the polymorphism site for MPO, while the haplotype-tagging SNPs rs1695, rs4891, rs762803 and rs749174 were selected as the polymorphism sites for GSTP1. The gene polymorphisms were confirmed using real-time PCR, cloning and sequencing. Results: The four GSTP1 haplotype-tagging SNPs rs1695, rs4891, rs762803 and rs749174, but not the MPO tagSNP rs7208693, exhibited an association with lung cancer susceptibility in smokers in the overall population and in the studied subgroups. When Phase 2 software was used to reconstruct the haplotype for GSTP1, the haplotype CACA (rs749174+rs1695 + rs762803+rs4891) exhibited an increased risk of lung cancer among smokers (adjust odds ratio 1.53; 95%CI 1.04–2.25, P=0.033). Furthermore, diplotype analyses demonstrated that the significant association between the risk haplotype and lung cancer. The risk haplotypes co-segregated with one or more biologically functional polymorphisms and corresponded to a recessive inheritance model. Conclusion: The common polymorphisms of the GSTP1 gene may be the candidates for SNP markers for lung cancer susceptibility in Chinese Han population. PMID:24786234

Discovery of Pod Shatter-Resistant Associated SNPs by Deep Sequencing of a Representative Library Followed by Bulk Segregant Analysis in Rapeseed

PubMed Central

Huang, Shunmou; Yang, Hongli; Zhan, Gaomiao; Wang, Xinfa; Liu, Guihua; Wang, Hanzhong

2012-01-01

Background Single nucleotide polymorphisms (SNPs) are an important class of genetic marker for target gene mapping. As of yet, there is no rapid and effective method to identify SNPs linked with agronomic traits in rapeseed and other crop species. Methodology/Principal Findings We demonstrate a novel method for identifying SNP markers in rapeseed by deep sequencing a representative library and performing bulk segregant analysis. With this method, SNPs associated with rapeseed pod shatter-resistance were discovered. Firstly, a reduced representation of the rapeseed genome was used. Genomic fragments ranging from 450–550 bp were prepared from the susceptible bulk (ten F2 plants with the silique shattering resistance index, SSRI <0.10) and the resistance bulk (ten F2 plants with SSRI >0.90), and also Solexa sequencing-produced 90 bp reads. Approximately 50 million of these sequence reads were assembled into contigs to a depth of 20-fold coverage. Secondly, 60,396 ‘simple SNPs’ were identified, and the statistical significance was evaluated using Fisher's exact test. There were 70 associated SNPs whose –log10 p value over 16 were selected to be further analyzed. The distribution of these SNPs appeared a tight cluster, which consisted of 14 associated SNPs within a 396 kb region on chromosome A09. Our evidence indicates that this region contains a major quantitative trait locus (QTL). Finally, two associated SNPs from this region were mapped on a major QTL region. Conclusions/Significance 70 associated SNPs were discovered and a major QTL for rapeseed pod shatter-resistance was found on chromosome A09 using our novel method. The associated SNP markers were used for mapping of the QTL, and may be useful for improving pod shatter-resistance in rapeseed through marker-assisted selection and map-based cloning. This approach will accelerate the discovery of major QTLs and the cloning of functional genes for important agronomic traits in rapeseed and other crop species. PMID:22529909

TLR9 Gene Region Polymorphisms and Susceptibility to Tuberculosis in Vietnam

PubMed Central

Graustein, AD; Horne, DJ; Arentz, M; Bang, ND; Chau, TTH; Thwaites, GE; Caws, M; Thuong, NTT; Dunstan, SJ; Hawn, TR

2015-01-01

Summary Humans exposed to Mycobacterium tuberculosis (Mtb) show variation in susceptibility to infection and differences in tuberculosis (TB) disease outcome. Toll-like receptor 9 (TLR9) is a pattern recognition receptor that mediates recognition of Mtb and modulates Mtb-specific T-cell responses. Using a case-population design, we evaluated whether single nucleotide polymorphisms (SNPs) in the TLR9 gene region are associated with susceptibility to pulmonary or meningeal TB as well as neurologic presentation and mortality in the meningeal TB group. In a discovery cohort (n = 352 cases, 382 controls), three SNPs were associated with TB (all forms, p<0.05) while three additional SNPs neared significance (0.05

Interactions between C-reactive protein genotypes with markers of nutritional status in relation to inflammation.

PubMed

Nienaber-Rousseau, Cornelie; Swanepoel, Bianca; Dolman, Robin C; Pieters, Marlien; Conradie, Karin R; Towers, G Wayne

2014-11-11

Inflammation, as indicated by C-reactive protein concentrations (CRP), is a risk factor for chronic diseases. Both genetic and environmental factors affect susceptibility to inflammation. As dietary interventions can influence inflammatory status, we hypothesized that dietary effects could be influenced by interactions with single nucleotide polymorphisms (SNPs) in the CRP gene. We determined 12 CRP SNPs, as well as various nutrition status markers in 2010 black South Africans and analyzed their effect on CRP. Interactions were observed for several genotypes with obesity in determining CRP. Lipid intake modulated the pro-inflammatory effects of some SNPs, i.e., an increase in both saturated fatty acid and monounsaturated fatty acid intake in those homozygous for the polymorphic allele at rs2808630 was associated with a larger increase in CRP. Those harboring the minor alleles at rs3093058 and rs3093062 presented with significantly higher CRP in the presence of increased triglyceride or cholesterol intake. When harboring the minor allele of these SNPs, a high omega-6 to -3 ratio was, however, found to be anti-inflammatory. Carbohydrate intake also modulated CRP SNPs, as HbA1C and fasting glucose levels interacted with some SNPs to influence the CRP. This investigation highlights the impact that nutritional status can have on reducing the inherent genetic susceptibility to a heightened systemic inflammatory state.

Study of five novel non-synonymous polymorphisms in human brain-expressed genes in a Colombian sample.

PubMed

Ojeda, Diego A; Forero, Diego A

2014-10-01

Non-synonymous single nucleotide polymorphisms (nsSNPs) in brain-expressed genes represent interesting candidates for genetic research in neuropsychiatric disorders. To study novel nsSNPs in brain-expressed genes in a sample of Colombian subjects. We applied an approach based on in silico mining of available genomic data to identify and select novel nsSNPs in brain-expressed genes. We developed novel genotyping assays, based in allele-specific PCR methods, for these nsSNPs and genotyped them in 171 Colombian subjects. Five common nsSNPs (rs6855837; p.Leu395Ile, rs2305160; p.Thr394Ala, rs10503929; p.Met289Thr, rs2270641; p.Thr4Pro and rs3822659; p.Ser735Ala) were studied, located in the CLOCK, NPAS2, NRG1, SLC18A1 and WWC1 genes. We reported allele and genotype frequencies in a sample of South American healthy subjects. There is previous experimental evidence, arising from genome-wide expression and association studies, for the involvement of these genes in several neuropsychiatric disorders and endophenotypes, such as schizophrenia, mood disorders or memory performance. Frequencies for these nsSNPSs in the Colombian samples varied in comparison to different HapMap populations. Future study of these nsSNPs in brain-expressed genes, a synaptogenomics approach, will be important for a better understanding of neuropsychiatric diseases and endophenotypes in different populations.

Identification of a single nucleotide polymorphism indicative of high risk in acute myocardial infarction

PubMed Central

Shalia, Kavita; Saranath, Dhananjaya; Rayar, Jaipreet; Shah, Vinod K.; Mashru, Manoj R.; Soneji, Surendra L.

2017-01-01

Background & objectives: Acute myocardial infarction (AMI) is a major health concern in India. The aim of the study was to identify single nucleotide polymorphisms (SNPs) associated with AMI in patients using dedicated chip and validating the identified SNPs on custom-designed chips using high-throughput microarray analysis. Methods: In pilot phase, 48 AMI patients and 48 healthy controls were screened for SNPs using human CVD55K BeadChip with 48,472 SNP probes on Illumina high-throughput microarray platform. The identified SNPs were validated by genotyping additional 160 patients and 179 controls using custom-made Illumina VeraCode GoldenGate Genotyping Assay. Analysis was carried out using PLINK software. Results: From the pilot phase, 98 SNPs present on 94 genes were identified with increased risk of AMI (odds ratio of 1.84-8.85, P=0.04861-0.003337). Five of these SNPs demonstrated association with AMI in the validation phase (P<0.05). Among these, one SNP rs9978223 on interferon gamma receptor 2 [IFNGR2, interferon (IFN)-gamma transducer 1] gene showed a significant association (P=0.00021) with AMI below Bonferroni corrected P value (P=0.00061). IFNGR2 is the second subunit of the receptor for IFN-gamma, an important cytokine in inflammatory reactions. Interpretation & conclusions: The study identified an SNP rs9978223 on IFNGR2 gene, associated with increased risk in AMI patient from India. PMID:29434065

Single nucleotide polymorphisms and haplotype frequencies of CYP3A5 in a Japanese population.

PubMed

Saeki, Mayumi; Saito, Yoshiro; Nakamura, Takahiro; Murayama, Norie; Kim, Su-Ryang; Ozawa, Shogo; Komamura, Kazuo; Ueno, Kazuyuki; Kamakura, Shiro; Nakajima, Toshiharu; Saito, Hirohisa; Kitamura, Yutaka; Kamatani, Naoyuki; Sawada, Jun-ichi

2003-06-01

In order to identify single nucleotide polymorphisms (SNPs) and haplotype frequencies of CYP3A5 in a Japanese population, we sequenced the proximal promoter region, all exons, and the surrounding intronic regions using genomic DNA from 187 Japanese subjects. Thirteen SNPs, including seven novel ones: 13108T>C, 16025A>G, 16903A>G, 16993C>G, 27448C>A, 29782A>G, and 31551T>C (A of the translational start codon of GenBank Accession # NG_000004.2 is numbered 1 according to the CYP Allele Nomenclature), were identified. The most common SNP was 6986A>G (key SNP for CYP3A5*3), with a 0.759 frequency. Two novel SNPs, 29782A>G (I456V) and 31551T>C (I488T), as well as 12952T>C (*5 marker) were found, but these alterations were always associated with the *3A marker SNPs, 6986A>G and 31611C>T. Using these 13 SNPs, haplotype analysis was performed and five novel *1 haplotypes (subtypes) (*1e to *1i) and six novel *3 haplotypes (subtypes) (*3d to *3i) were identified. Our findings suggest that CYP3A5*3 is the major defective allele and that other functional exonic SNPs are rare in the Japanese. Copyright 2003 Wiley-Liss, Inc.

Genomewide single nucleotide polymorphism discovery in Atlantic salmon (Salmo salar): validation in wild and farmed American and European populations.

PubMed

Yáñez, J M; Naswa, S; López, M E; Bassini, L; Correa, K; Gilbey, J; Bernatchez, L; Norris, A; Neira, R; Lhorente, J P; Schnable, P S; Newman, S; Mileham, A; Deeb, N; Di Genova, A; Maass, A

2016-07-01

A considerable number of single nucleotide polymorphisms (SNPs) are required to elucidate genotype-phenotype associations and determine the molecular basis of important traits. In this work, we carried out de novo SNP discovery accounting for both genome duplication and genetic variation from American and European salmon populations. A total of 9 736 473 nonredundant SNPs were identified across a set of 20 fish by whole-genome sequencing. After applying six bioinformatic filtering steps, 200 K SNPs were selected to develop an Affymetrix Axiom(®) myDesign Custom Array. This array was used to genotype 480 fish representing wild and farmed salmon from Europe, North America and Chile. A total of 159 099 (79.6%) SNPs were validated as high quality based on clustering properties. A total of 151 509 validated SNPs showed a unique position in the genome. When comparing these SNPs against 238 572 markers currently available in two other Atlantic salmon arrays, only 4.6% of the SNP overlapped with the panel developed in this study. This novel high-density SNP panel will be very useful for the dissection of economically and ecologically relevant traits, enhancing breeding programmes through genomic selection as well as supporting genetic studies in both wild and farmed populations of Atlantic salmon using high-resolution genomewide information. © 2016 John Wiley & Sons Ltd.

Impact of QTL minor allele frequency on genomic evaluation using real genotype data and simulated phenotypes in Japanese Black cattle.

PubMed

Uemoto, Yoshinobu; Sasaki, Shinji; Kojima, Takatoshi; Sugimoto, Yoshikazu; Watanabe, Toshio

2015-11-19

Genetic variance that is not captured by single nucleotide polymorphisms (SNPs) is due to imperfect linkage disequilibrium (LD) between SNPs and quantitative trait loci (QTLs), and the extent of LD between SNPs and QTLs depends on different minor allele frequencies (MAF) between them. To evaluate the impact of MAF of QTLs on genomic evaluation, we performed a simulation study using real cattle genotype data. In total, 1368 Japanese Black cattle and 592,034 SNPs (Illumina BovineHD BeadChip) were used. We simulated phenotypes using real genotypes under different scenarios, varying the MAF categories, QTL heritability, number of QTLs, and distribution of QTL effect. After generating true breeding values and phenotypes, QTL heritability was estimated and the prediction accuracy of genomic estimated breeding value (GEBV) was assessed under different SNP densities, prediction models, and population size by a reference-test validation design. The extent of LD between SNPs and QTLs in this population was higher in the QTLs with high MAF than in those with low MAF. The effect of MAF of QTLs depended on the genetic architecture, evaluation strategy, and population size in genomic evaluation. In genetic architecture, genomic evaluation was affected by the MAF of QTLs combined with the QTL heritability and the distribution of QTL effect. The number of QTL was not affected on genomic evaluation if the number of QTL was more than 50. In the evaluation strategy, we showed that different SNP densities and prediction models affect the heritability estimation and genomic prediction and that this depends on the MAF of QTLs. In addition, accurate QTL heritability and GEBV were obtained using denser SNP information and the prediction model accounted for the SNPs with low and high MAFs. In population size, a large sample size is needed to increase the accuracy of GEBV. The MAF of QTL had an impact on heritability estimation and prediction accuracy. Most genetic variance can be captured using denser SNPs and the prediction model accounted for MAF, but a large sample size is needed to increase the accuracy of GEBV under all QTL MAF categories.

Evolutionary selective pressure on three mitochondrial SNPs is consistent with their influence on metabolic efficiency in Pima Indians.

PubMed

Chamala, Srikar; Beckstead, Wesley A; Rowe, Mark J; McClellan, David A

2007-01-01

We investigated whether the effect of evolutionary selection on three recent Single Nucleotide Polymorphisms (SNPs) in the mitochondrial sub-haplogroups of Pima Indians is consistent with their effects on metabolic efficiency. The mitochondrial SNPs impact metabolic rate and respiratory quotient, and may be adaptations to caloric restriction in a desert habitat. Using TreeSAAP software, we examined evolutionary selection in 107 mammalian species at these SNPs, characterising the biochemical shifts produced by the amino acid substitutions. Our results suggest that two SNPs were affected by selection during mammalian evolution in a manner consistent with their effects on metabolic efficiency in Pima Indians.

The linkage disequilibrium pattern of the angiotensin converting enzyme gene in Arabic and Asian population groups.

PubMed

Kharrat, Najla; Abdelmouleh, Wafa; Abdelhedi, Rania; Alfadhli, Suad; Rebai, Ahmed

2012-01-01

DNA variations within the Angiotensin-Converting Enzyme (ACE) gene have been shown to be involved in the aetiology of several common diseases and the therapeutic response. This study reports a comparison of haplotype analysis of five SNPs in the ACE gene region using a sample of 100 healthy subjects derived from five different populations (Tunisian, Iranian, Kuwaiti, Bahraini and Indian). Strong linkage disequilibrium was found among all SNPs studied for all populations. Two SNPs (rs1800764 and rs4340) were identified as key SNPs for all populations. These SNPs will be valuable for future effective association studies of the ACE gene polymorphisms in Arab and Asian populations.

Association between UGT2B7 gene polymorphisms and fentanyl sensitivity in patients undergoing painful orthognathic surgery

PubMed Central

Muraoka, Wataru; Nishizawa, Daisuke; Fukuda, Kenichi; Kasai, Shinya; Hasegawa, Junko; Wajima, Koichi; Nakagawa, Taneaki

2016-01-01

Background Fentanyl is often used instead of morphine for the treatment of pain because it has fewer side effects. The metabolism of morphine by glucuronidation is known to be influenced by polymorphisms of the UGT2B7 gene. Some metabolic products of fentanyl are reportedly metabolized by glucuronate conjugation. The genes that are involved in the metabolic pathway of fentanyl may also influence fentanyl sensitivity. We analyzed associations between fentanyl sensitivity and polymorphisms of the UGT2B7 gene to clarify the hereditary determinants of individual differences in fentanyl sensitivity. Results This study examined whether single-nucleotide polymorphisms (SNPs) of the UGT2B7 gene affect cold pain sensitivity and the analgesic effects of fentanyl, evaluated by a standardized pain test and fentanyl requirements in healthy Japanese subjects who underwent uniform surgical procedures. The rs7439366 SNP of UGT2B7 is reportedly associated with the metabolism and analgesic effects of morphine. We found that this SNP is also associated with the analgesic effects of fentanyl in the cold pressor-induced pain test. It suggested that the C allele of the rs7439366 SNP may enhance analgesic efficacy. Two SNPs of UGT2B7, rs4587017 and rs1002849, were also found to be novel SNPs that may influence the analgesic effects of fentanyl in the cold pressor-induced pain test. Conclusions Fentanyl sensitivity for cold pressor-induced pain was associated with the rs7439366, rs4587017, and rs1002849 SNPs of the UGT2B7 gene. Our findings may provide valuable information for achieving satisfactory pain control and open to new avenues for personalized pain treatment. PMID:28256933

A cis-phase interaction study of genetic variants within the MAOA gene in major depressive disorder.

PubMed

Zhang, JieXu; Chen, YanBo; Zhang, KeRang; Yang, Hong; Sun, Yan; Fang, Yue; Shen, Yan; Xu, Qi

2010-11-01

The genetic basis of major depressive disorder (MDD) has been explored extensively, but the mode of transmission of the disease has yet to be established. To better understand the mechanism by which the monoamine oxidase A (MAOA) gene may play a role in developing MDD, the present work examined the cis-phase interaction between genetic variants within the MAOA gene for the pathogenesis of MDD. A variable number tandem repeat (VNTR) and 19 single nucleotide polymorphisms (SNPs) within the gene were genotyped in 512 unrelated patients with MDD and 567 unrelated control subjects among a Chinese population. Quantitative real-time polymerase chain reaction analysis was applied to test the effect of genetic variants on expression of the MAOA gene in MDD. Neither the VNTR polymorphism nor seven informative SNPs showed allelic association with MDD, but the cis-acting interactions between the VNTR polymorphism and four individual SNPs were strongly associated with MDD risk, of which the VNTR-rs1465107 combination showed the strongest association (p = .000011). Quantitative real-time polymerase chain reaction analysis showed that overall relative quantity of MAOA messenger RNA was significantly higher in patients with MDD than in control subjects (fold change = 5.28, p = 1.7 × 10⁻⁷) and that in the male subjects carrying the VNTR-L, rs1465107-A, rs6323-G, rs2072743-A, or rs1137070-T alleles, expression of MAOA messenger RNA was significantly higher in the patient group than in the control group. The cis-phase interaction between the VNTR polymorphism and functional SNPs may contribute to the etiology of MDD. Copyright © 2010 Society of Biological Psychiatry. Published by Elsevier Inc. All rights reserved.

Association between tumour necrosis-α gene polymorphisms and acne vulgaris in a Pakistani population.

PubMed

Aisha, N M; Haroon, J; Hussain, S; Tahir, C M; Ikramullah, M; Rahim, H; Kishwar, N; Younis, S; Hassan, M J; Javed, Q

2016-04-01

The cytokine tumour necrosis factor (TNF)-α is a well-studied potent candidate mediator that is systemically involved in a variety of inflammatory diseases. Several single nucleotide polymorphisms (SNPs) of the TNF-α gene have been studied with regard the pathogenesis of acne vulgaris, but the results have been inconclusive. This case-control study investigated the association of the TNF -308 G>A and -238 G>A SNPs with acne vulgaris in a high-risk Pakistani population. In total, 160 healthy controls and 140 patients with acne were enrolled in this study. Polymorphisms were determined by PCR and restriction fragment length polymorphism analysis. Our data showed that the TNF -308 G>A and TNF -238 G>A SNPs were present at a significantly higher rate in cases than in controls (P < 0.01 and P < 0.02; respectively). There was a significant difference between the G and A alleles from patients with acne and controls for -308 G>A (OR = 1.5, 95% CI = 1.07-2.19, P < 0.02) and -238 G>A (OR=1.6, 95% CI = 1.06-2.44, P = 0.02) genotype. Moreover, the severity of acne was significantly associated with TNF genotype (TNF -308 G>A: χ² = 34.6, P < 0.001; TNF -238 G>AL χ² = 12.9, P < 0.01). Our data suggest that the TNF -308 G>A and TNF -238 G>A SNPs may contribute to the pathogenesis of acne in the study population. Furthermore, patients with severe acne showed an increased frequency of mutant TNF genotypes at -308 and -238 compared with patients with less severe acne. © 2015 British Association of Dermatologists.

Association between polymorphisms in cancer-related genes and early onset of esophageal adenocarcinoma.

PubMed

Wu, I-Chen; Zhao, Yang; Zhai, Rihong; Liu, Geoffrey; Ter-Minassian, Monica; Asomaning, Kofi; Su, Li; Liu, Chen-Yu; Chen, Feng; Kulke, Matthew H; Heist, Rebecca S; Christiani, David C

2011-04-01

There is an increasing incidence of esophageal adenocarcinoma (EA) among younger people in the western populations. However, the association between genetic polymorphisms and the age of EA onset is unclear. In this study, 1330 functional/tagging single-nucleotide polymorphisms (SNPs) from 354 cancer-related genes were genotyped in 335 white EA patients. Twenty important SNPs that have the highest importance scores and lowest classification error rate were identified by the random forest algorithm to be associated with early onset of EA (age ≤ 55 years). Subsequent logistic regression analysis indicated that 10 SNPs (rs2070744 of NOS3, rs720321 of BCL2, rs17757541 of BCL2, rs11775256 of TNFRSF10A, rs1035142 of CASP8, rs2236302 of MMP14, rs4740363 of ABL1, rs696217 of GHRL, rs2445762 of CYP19A1, and rs11941492 of VEGFR2/KDR) were significantly associated with early onset of EA (≤55 vs >55 years, all P < .05 after adjusting for co-variates and false discovery rate). Among them, five SNPs in the NOS3, BCL2, TNFRSF10A, and CASP8 genes were known to be involved in apoptosis processes. In Kaplan-Meier analyses, rs2070744 of NOS3, rs720321 of BCL2, and rs1035142 of CASP8 were also significantly associated with early onset of EA. Moreover, there was a higher risk of developing EA at a younger age when one had more risk genotypes. In conclusion, polymorphisms in cancer-related genes, especially those in the apoptotic pathway, play an important role in the development of younger-aged EA in a dose-response manner.

Association analysis of vitamin D receptor gene polymorphisms and bone mineral density in postmenopausal Mexican-Mestizo women.

PubMed

González-Mercado, A; Sánchez-López, J Y; Regla-Nava, J A; Gámez-Nava, J I; González-López, L; Duran-Gonzalez, J; Celis, A; Perea-Díaz, F J; Salazar-Páramo, M; Ibarra, B

2013-07-30

We investigated associations between vitamin D receptor (VDR) gene polymorphisms, FokI T>C (rs2228570), BsmI G>A (rs1544410), ApaI G>T (rs7975232), and TaqI T>C (rs731236), with bone mineral density (BMD) in postmenopausal Mexican-Mestizo women. Three hundred and twenty postmenopausal women participated, who were classified according to World Health Organization criteria as non-osteoporotic (Non-OP; N = 88), osteopenic (Opn; N = 144), and osteoporotic (OP; N = 88). BMD measurements at the lumbar (L1-L4) spine and at the left and right femoral neck were obtained by dual-energy X-ray absorptiometry. Single nucleotide polymorphisms (SNPs) were genotyped using real-time polymerase chain reaction and TaqMan probes. Genotype and allelic frequencies of the 4 VDR SNPs were similar among the 3 groups. Polymorphic allele frequencies were as follows: FokI (C) 0.53, 0.49, 0.56; BsmI (A) 0.26, 0.22, 0.23; ApaI (T) 0.43, 0.39, 0.44; TaqI (C) 0.27, 0.22, 0.23 for the Non-OP, Opn, and OP groups, respectively. Although no associations were found between the SNPs and BMD, based on the putative function of the FokI SNP, we constructed, for the first time, the haplotype with the 4 VDR SNPs, and found that the CGGT haplotype differed between the Non- OP and OP groups (21.8 vs 31.8%, P < 0.05). The risk analysis for this haplotype was nearly significant under the dominant model (OR = 1.783, 95%CI = 0.98-3.25, P = 0.058). This result suggests a possible susceptibility effect of the C allele of the FokI SNP for the development of osteoporosis in postmenopausal Mexican-Mestizo women.

Vitamin D receptor polymorphisms and survival in patients with cutaneous melanoma: a population-based study.

PubMed

Orlow, Irene; Reiner, Anne S; Thomas, Nancy E; Roy, Pampa; Kanetsky, Peter A; Luo, Li; Paine, Susan; Armstrong, Bruce K; Kricker, Anne; Marrett, Loraine D; Rosso, Stefano; Zanetti, Roberto; Gruber, Stephen B; Anton-Culver, Hoda; Gallagher, Richard P; Dwyer, Terence; Busam, Klaus; Begg, Colin B; Berwick, Marianne

2016-01-01

Factors known to affect melanoma survival include age at presentation, sex and tumor characteristics. Polymorphisms also appear to modulate survival following diagnosis. Result from other studies suggest that vitamin D receptor (VDR) polymorphisms (SNPs) impact survival in patients with glioma, renal cell carcinoma, lung, breast, prostate and other cancers; however, a comprehensive study of VDR polymorphisms and melanoma-specific survival is lacking. We aimed to investigate whether VDR genetic variation influences survival in patients with cutaneous melanoma. The analysis involved 3566 incident single and multiple primary melanoma cases enrolled in the international population-based Genes, Environment, and Melanoma Study. Melanoma-specific survival outcomes were calculated for each of 38 VDR SNPs using a competing risk analysis after adjustment for covariates. There were 254 (7.1%) deaths due to melanoma during the median 7.6 years follow-up period. VDR SNPs rs7299460, rs3782905, rs2239182, rs12370156, rs2238140, rs7305032, rs1544410 (BsmI) and rs731236 (TaqI) each had a statistically significant (trend P values < 0.05) association with melanoma-specific survival in multivariate analysis. One functional SNP (rs2239182) remained significant after adjustment for multiple testing using the Monte Carlo method. None of the SNPs associated with survival were significantly associated with Breslow thickness, ulceration or mitosis. These results suggest that the VDR gene may influence survival from melanoma, although the mechanism by which VDR exerts its effect does not seem driven by tumor aggressiveness. Further investigations are needed to confirm our results and to understand the relationship between VDR and survival in the combined context of tumor and host characteristics. © The Author 2015. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

Vitamin D receptor polymorphisms and survival in patients with cutaneous melanoma: a population-based study

PubMed Central

Orlow, Irene; Reiner, Anne S.; Thomas, Nancy E.; Roy, Pampa; Kanetsky, Peter A.; Luo, Li; Paine, Susan; Armstrong, Bruce K.; Kricker, Anne; Marrett, Loraine D.; Rosso, Stefano; Zanetti, Roberto; Gruber, Stephen B.; Anton-Culver, Hoda; Gallagher, Richard P.; Dwyer, Terence; Busam, Klaus; Begg, Colin B.; Berwick, Marianne

2016-01-01

Factors known to affect melanoma survival include age at presentation, sex and tumor characteristics. Polymorphisms also appear to modulate survival following diagnosis. Result from other studies suggest that vitamin D receptor (VDR) polymorphisms (SNPs) impact survival in patients with glioma, renal cell carcinoma, lung, breast, prostate and other cancers; however, a comprehensive study of VDR polymorphisms and melanoma-specific survival is lacking. We aimed to investigate whether VDR genetic variation influences survival in patients with cutaneous melanoma. The analysis involved 3566 incident single and multiple primary melanoma cases enrolled in the international population-based Genes, Environment, and Melanoma Study. Melanoma-specific survival outcomes were calculated for each of 38 VDR SNPs using a competing risk analysis after adjustment for covariates. There were 254 (7.1%) deaths due to melanoma during the median 7.6 years follow-up period. VDR SNPs rs7299460, rs3782905, rs2239182, rs12370156, rs2238140, rs7305032, rs1544410 (BsmI) and rs731236 (TaqI) each had a statistically significant (trend P values < 0.05) association with melanoma-specific survival in multivariate analysis. One functional SNP (rs2239182) remained significant after adjustment for multiple testing using the Monte Carlo method. None of the SNPs associated with survival were significantly associated with Breslow thickness, ulceration or mitosis. These results suggest that the VDR gene may influence survival from melanoma, although the mechanism by which VDR exerts its effect does not seem driven by tumor aggressiveness. Further investigations are needed to confirm our results and to understand the relationship between VDR and survival in the combined context of tumor and host characteristics. PMID:26521212

ErbB polymorphisms: insights and implications for response to targeted cancer therapeutics.

PubMed

Alaoui-Jamali, Moulay A; Morand, Grégoire B; da Silva, Sabrina Daniela

2015-01-01

Advances in high-throughput genomic-scanning have expanded the repertory of genetic variations in DNA sequences encoding ErbB tyrosine kinase receptors in humans, including single nucleotide polymorphisms (SNPs), polymorphic repetitive elements, microsatellite variations, small-scale insertions and deletions. The ErbB family members: EGFR, ErbB2, ErbB3, and ErbB4 receptors are established as drivers of many aspects of tumor initiation and progression to metastasis. This knowledge has provided rationales for the development of an arsenal of anti-ErbB therapeutics, ranging from small molecule kinase inhibitors to monoclonal antibodies. Anti-ErbB agents are becoming the cornerstone therapeutics for the management of cancers that overexpress hyperactive variants of ErbB receptors, in particular ErbB2-positive breast cancer and non-small cell lung carcinomas. However, their clinical benefit has been limited to a subset of patients due to a wide heterogeneity in drug response despite the expression of the ErbB targets, attributed to intrinsic (primary) and to acquired (secondary) resistance. Somatic mutations in ErbB tyrosine kinase domains have been extensively investigated in preclinical and clinical setting as determinants for either high sensitivity or resistance to anti-ErbB therapeutics. In contrast, only scant information is available on the impact of SNPs, which are widespread in genes encoding ErbB receptors, on receptor structure and activity, and their predictive values for drug susceptibility. This review aims to briefly update polymorphic variations in genes encoding ErbB receptors based on recent advances in deep sequencing technologies, and to address challenging issues for a better understanding of the functional impact of single versus combined SNPs in ErbB genes to receptor topology, receptor-drug interaction, and drug susceptibility. The potential of exploiting SNPs in the era of stratified targeted therapeutics is discussed.

Genome-wide SNPs lead to strong signals of geographic structure and relatedness patterns in the major arbovirus vector, Aedes aegypti.

PubMed

Rašić, Gordana; Filipović, Igor; Weeks, Andrew R; Hoffmann, Ary A

2014-04-11

Genetic markers are widely used to understand the biology and population dynamics of disease vectors, but often markers are limited in the resolution they provide. In particular, the delineation of population structure, fine scale movement and patterns of relatedness are often obscured unless numerous markers are available. To address this issue in the major arbovirus vector, the yellow fever mosquito (Aedes aegypti), we used double digest Restriction-site Associated DNA (ddRAD) sequencing for the discovery of genome-wide single nucleotide polymorphisms (SNPs). We aimed to characterize the new SNP set and to test the resolution against previously described microsatellite markers in detecting broad and fine-scale genetic patterns in Ae. aegypti. We developed bioinformatics tools that support the customization of restriction enzyme-based protocols for SNP discovery. We showed that our approach for RAD library construction achieves unbiased genome representation that reflects true evolutionary processes. In Ae. aegypti samples from three continents we identified more than 18,000 putative SNPs. They were widely distributed across the three Ae. aegypti chromosomes, with 47.9% found in intergenic regions and 17.8% in exons of over 2,300 genes. Pattern of their imputed effects in ORFs and UTRs were consistent with those found in a recent transcriptome study. We demonstrated that individual mosquitoes from Indonesia, Australia, Vietnam and Brazil can be assigned with a very high degree of confidence to their region of origin using a large SNP panel. We also showed that familial relatedness of samples from a 0.4 km2 area could be confidently established with a subset of SNPs. Using a cost-effective customized RAD sequencing approach supported by our bioinformatics tools, we characterized over 18,000 SNPs in field samples of the dengue fever mosquito Ae. aegypti. The variants were annotated and positioned onto the three Ae. aegypti chromosomes. The new SNP set provided much greater resolution in detecting population structure and estimating fine-scale relatedness than a set of polymorphic microsatellites. RAD-based markers demonstrate great potential to advance our understanding of mosquito population processes, critical for implementing new control measures against this major disease vector.

Development and validation of a 20K single nucleotide polymorphism (SNP) whole genome genotyping array for apple (Malus × domestica Borkh).

PubMed

Bianco, Luca; Cestaro, Alessandro; Sargent, Daniel James; Banchi, Elisa; Derdak, Sophia; Di Guardo, Mario; Salvi, Silvio; Jansen, Johannes; Viola, Roberto; Gut, Ivo; Laurens, Francois; Chagné, David; Velasco, Riccardo; van de Weg, Eric; Troggio, Michela

2014-01-01

High-density SNP arrays for genome-wide assessment of allelic variation have made high resolution genetic characterization of crop germplasm feasible. A medium density array for apple, the IRSC 8K SNP array, has been successfully developed and used for screens of bi-parental populations. However, the number of robust and well-distributed markers contained on this array was not sufficient to perform genome-wide association analyses in wider germplasm sets, or Pedigree-Based Analysis at high precision, because of rapid decay of linkage disequilibrium. We describe the development of an Illumina Infinium array targeting 20K SNPs. The SNPs were predicted from re-sequencing data derived from the genomes of 13 Malus × domestica apple cultivars and one accession belonging to a crab apple species (M. micromalus). A pipeline for SNP selection was devised that avoided the pitfalls associated with the inclusion of paralogous sequence variants, supported the construction of robust multi-allelic SNP haploblocks and selected up to 11 entries within narrow genomic regions of ±5 kb, termed focal points (FPs). Broad genome coverage was attained by placing FPs at 1 cM intervals on a consensus genetic map, complementing them with FPs to enrich the ends of each of the chromosomes, and by bridging physical intervals greater than 400 Kbps. The selection also included ∼3.7K validated SNPs from the IRSC 8K array. The array has already been used in other studies where ∼15.8K SNP markers were mapped with an average of ∼6.8K SNPs per full-sib family. The newly developed array with its high density of polymorphic validated SNPs is expected to be of great utility for Pedigree-Based Analysis and Genomic Selection. It will also be a valuable tool to help dissect the genetic mechanisms controlling important fruit quality traits, and to aid the identification of marker-trait associations suitable for the application of Marker Assisted Selection in apple breeding programs.

Development and Validation of a 20K Single Nucleotide Polymorphism (SNP) Whole Genome Genotyping Array for Apple (Malus × domestica Borkh)

PubMed Central

Bianco, Luca; Cestaro, Alessandro; Sargent, Daniel James; Banchi, Elisa; Derdak, Sophia; Di Guardo, Mario; Salvi, Silvio; Jansen, Johannes; Viola, Roberto; Gut, Ivo; Laurens, Francois; Chagné, David; Velasco, Riccardo; van de Weg, Eric; Troggio, Michela

2014-01-01

High-density SNP arrays for genome-wide assessment of allelic variation have made high resolution genetic characterization of crop germplasm feasible. A medium density array for apple, the IRSC 8K SNP array, has been successfully developed and used for screens of bi-parental populations. However, the number of robust and well-distributed markers contained on this array was not sufficient to perform genome-wide association analyses in wider germplasm sets, or Pedigree-Based Analysis at high precision, because of rapid decay of linkage disequilibrium. We describe the development of an Illumina Infinium array targeting 20K SNPs. The SNPs were predicted from re-sequencing data derived from the genomes of 13 Malus × domestica apple cultivars and one accession belonging to a crab apple species (M. micromalus). A pipeline for SNP selection was devised that avoided the pitfalls associated with the inclusion of paralogous sequence variants, supported the construction of robust multi-allelic SNP haploblocks and selected up to 11 entries within narrow genomic regions of ±5 kb, termed focal points (FPs). Broad genome coverage was attained by placing FPs at 1 cM intervals on a consensus genetic map, complementing them with FPs to enrich the ends of each of the chromosomes, and by bridging physical intervals greater than 400 Kbps. The selection also included ∼3.7K validated SNPs from the IRSC 8K array. The array has already been used in other studies where ∼15.8K SNP markers were mapped with an average of ∼6.8K SNPs per full-sib family. The newly developed array with its high density of polymorphic validated SNPs is expected to be of great utility for Pedigree-Based Analysis and Genomic Selection. It will also be a valuable tool to help dissect the genetic mechanisms controlling important fruit quality traits, and to aid the identification of marker-trait associations suitable for the application of Marker Assisted Selection in apple breeding programs. PMID:25303088

The analysis of APOL1 genetic variation and haplotype diversity provided by 1000 Genomes project.

PubMed

Peng, Ting; Wang, Li; Li, Guisen

2017-08-11

The APOL1 gene variants has been shown to be associated with an increased risk of multiple kinds of diseases, particularly in African Americans, but not in Caucasians and Asians. In this study, we explored the single nucleotide polymorphism (SNP) and haplotype diversity of APOL1 gene in different races provided by 1000 Genomes project. Variants of APOL1 gene in 1000 Genome Project were obtained and SNPs located in the regulatory region or coding region were selected for genetic variation analysis. Total 2504 individuals from 26 populations were classified as four groups that included Africa, Europe, Asia and Admixed populations. Tag SNPs were selected to evaluate the haplotype diversities in the four populations by HaploStats software. APOL1 gene was surrounded by some of the most polymorphic genes in the human genome, variation of APOL1 gene was common, with up to 613 SNP (1000 Genome Project reported) and 99 of them (16.2%) with MAF ≥ 1%. There were 79 SNPs in the URR and 92 SNPs in 3'UTR. Total 12 SNPs in URR and 24 SNPs in 3'UTR were considered as common variants with MAF ≥ 1%. It is worth noting that URR-1 was presents lower frequencies in European populations, while other three haplotypes taken an opposite pattern; 3'UTR presents several high-frequency variation sites in a short segment, and the differences of its haplotypes among different population were significant (P < 0.01), UTR-1 and UTR-5 presented much higher frequency in African population, while UTR-2, UTR-3 and UTR-4 were much lower. APOL1 coding region showed that two SNP of G1 with higher frequency are actually pull down the haplotype H-1 frequency when considering all populations pooled together, and the diversity among the four populations be widen by the G1 two mutation (P 1  = 3.33E-4 vs P 2  = 3.61E-30). The distributions of APOL1 gene variants and haplotypes were significantly different among the different populations, in either regulatory or coding regions. It could provide clues for the future genetic study of APOL1 related diseases.

Mapping a Mutation in "Caenorhabditis elegans" Using a Polymerase Chain Reaction-Based Approach

ERIC Educational Resources Information Center

Myers, Edith M.

2014-01-01

Many single nucleotide polymorphisms (SNPs) have been identified within the "Caenorhabditis elegans" genome. SNPs present in the genomes of two isogenic "C. elegans" strains have been routinely used as a tool in forward genetics to map a mutation to a particular chromosome. This article describes a laboratory exercise in which…

Association between IL-10a SNPs and resistance to cyprinid herpesvirus-3 infection in common carp (Cyprinus carpio)

USDA-ARS?s Scientific Manuscript database

Analysis of gene polymorphisms and disease association is essential for assessing putative candidate genes affecting susceptibility or resistance to disease. In this paper, we report the results of an association analysis between SNPs in common carp innate immune response genes and resistance to Cy...

Single nucleotide polymorphisms in candidate genes related to daughter pregnancy rate in Holstein cows

USDA-ARS?s Scientific Manuscript database

ABSTRACT: Previously, a candidate gene approach identified 40 SNPs associated with daughter pregnancy rate (DPR) in dairy bulls. We evaluated 39 of these SNPs for relationship to DPR in a separate population of Holstein cows grouped on their predicted transmitting ability for DPR: <= -1 (n=1266) a...

SEAN: SNP prediction and display program utilizing EST sequence clusters.

PubMed

Huntley, Derek; Baldo, Angela; Johri, Saurabh; Sergot, Marek

2006-02-15

SEAN is an application that predicts single nucleotide polymorphisms (SNPs) using multiple sequence alignments produced from expressed sequence tag (EST) clusters. The algorithm uses rules of sequence identity and SNP abundance to determine the quality of the prediction. A Java viewer is provided to display the EST alignments and predicted SNPs.

Polymorphisms in the interferon-induced helicase (IFIH1) locus and susceptibility to Addison's disease.

PubMed

Zurawek, Magdalena; Fichna, Marta; Januszkiewicz, Danuta; Fichna, Piotr; Nowak, Jerzy

2013-02-01

The interferon-induced helicase C domain-containing protein 1 (IFIH1) gene encodes a sensor for double-stranded RNA that initiates antiviral activity against enteroviruses. Previous investigations have indicated a role for IFIH1 in autoimmunity, as common and rare polymorphisms in this gene have been associated with type 1 diabetes. We hypothesized that polymorphisms in the IFIH1 locus may play a role in the pathogenesis of autoimmune Addison's disease (AAD). We analysed the association of rs3747517, rs1990760, rs2111485 and rs13422767 single-nucleotide polymorphisms (SNPs) in the IFIH1 gene and intergenic region with AAD in a Polish cohort. The study comprised 120 patients with AAD and 689 healthy control individuals. Genotyping was performed using TaqMan genotyping assays. The major AA genotype of the coding SNP rs1990760 appeared significantly more frequently in AAD compared with healthy individuals (AG vs AA OR 0·62, 95%CI 0·40-0·95, P = 0·03). We also observed a significant difference in the distribution of the rs13422767 SNP alleles. The major G allele was more frequent in the AAD group (A vs G OR 0·65, 95%CI 0·43-0·98, P = 0·04). Both statistically significant differences, for rs1990760 and rs13422767 SNPs, did not survive the Bonferroni correction (P = 0·11 and P = 0·15, for AA genotype and G allele, respectively). Subsequently, a meta-analysis of 519 patients with AAD and 1362 controls from three different European populations was performed. Under a fixed-effect model, a pooled OR for A allele and AA genotype of rs1990760 did not display any significant increase among AAD (OR = 1·05, P = 0·56 and OR = 1·08, P = 0·50, respectively). The IFIH1 locus polymorphisms are unlikely to be associated with Addison's disease. © 2012 Blackwell Publishing Ltd.

Identification of the Q969R gain-of-function polymorphism in the gene encoding porcine NLRP3 and its distribution in pigs of Asian and European origin.

PubMed

Tohno, Masanori; Shinkai, Hiroki; Toki, Daisuke; Okumura, Naohiko; Tajima, Kiyoshi; Uenishi, Hirohide

2016-10-01

The nucleotide-binding domain, leucine-rich-containing family, pyrin-domain containing-3 (NLRP3) inflammasome comprises the major components caspase-1, apoptosis-associated speck-like protein containing a caspase recruitment domain (ASC), and NLRP3. NLRP3 plays important roles in maintaining immune homeostasis mediated by intestinal microorganisms and in the immunostimulatory properties of vaccine adjuvants used to induce an immune response. In the present study, we first cloned a complementary DNA (cDNA) encoding porcine ASC because its genomic sequence was not completely determined. The availability of the ASC cDNA enabled us to reconstitute porcine NLRP3 inflammasomes using an in vitro system that led to the identification of the immune functions of porcine NLRP3 and ASC based on the production of interleukin-1β (IL-1β). Further, we identified six synonymous and six nonsynonymous single-nucleotide polymorphisms (SNPs) in the coding sequence of NLRP3 of six breeds of pigs, including major commercial breeds. Among the nonsynonymous SNPs, the Q969R polymorphism is associated with an increased release of IL-1β compared with other porcine NLRP3 variants, indicating that this polymorphism represents a gain-of-function mutation. This allele was detected in 100 % of the analyzed Chinese Jinhua and Japanese wild boars, suggesting that the allele is maintained in the major commercial native European breeds Landrace, Large White, and Berkshire. These findings represent an important contribution to our knowledge of the diversity of NLRP3 nucleotide sequences among various pig populations. Moreover, efforts to exploit the gain of function induced by the Q969R polymorphism promise to improve pig breeding and husbandry by conferring enhanced resistance to pathogens as well as contributing to vaccine efficacy.

Polymorphisms in the FGF2 gene and risk of serous ovarian cancer: results from the Ovarian Cancer Association Consortium

PubMed Central

Johnatty, Sharon E.; Beesley, Jonathan; Chen, Xiaoqing; Spurdle, Amanda B.; deFazio, Anna; Webb, Penelope M; Goode, Ellen L.; Rider, David N.; Vierkant, Robert A.; Anderson, Stephanie; Wu, Anna H.; Pike, Malcolm; Van Den Berg, David; Moysich, Kirsten; Ness, Roberta; Doherty, Jennifer; Rossing, Mary-Anne; Pearce, Celeste Leigh; Chenevix-Trench, Georgia

2009-01-01

Fibroblast growth factor (FGF)-2 (basic) is a potent angiogenic molecule involved in tumour progression, and is one of several growth factors with a central role in ovarian carcinogenesis. We hypothesised that common single nucleotide polymorphisms (SNPs) in the FGF2 gene may alter angiogenic potential and thereby susceptibility to ovarian cancer. We analysed 25 FGF2 tgSNPs using five independent study populations from the United States and Australia. Analysis was restricted to non-Hispanic White women with serous ovarian carcinoma (1269 cases and 2829 controls). There were no statistically significant associations between any FGF2 SNPs and ovarian cancer risk. There were two nominally statistically significant associations between heterozygosity for two FGF2 SNPs (rs308379 and rs308447; p<0.05) and serous ovarian cancer risk in the combined dataset, but rare homozygous estimates did not achieve statistical significance, nor were they consistent with the log additive model of inheritance. Overall genetic variation in FGF2 does not appear to play a role in susceptibility to ovarian cancer. PMID:19456219

Association of CAT polymorphisms with catalase activity and exposure to environmental oxidative stimuli

PubMed Central

Nadif, Rachel; Mintz, Margaret; Jedlicka, Anne; Bertrand, Jean-Pierre; Kleeberger, Steven R.; Kauffmann, Francine

2005-01-01

We tested the hypotheses that catalase activity is modified by CAT single nucleotide polymorphisms (SNPs) (–262;–844), and by their interactions with oxidant exposures (coal dusts, smoking), lymphotoxin alpha (LTA, NcoI) and tumor necrosis factor (TNF, -308) in 196 miners. Erythrocyte catalase, superoxide dismutase, and glutathione peroxidase activities were measured. The CAT –262 SNP was related to lower catalase activity (104, 87 and 72 k/g hemoglobin for CC, CT and TT respectively, p<0.0001). Regardless of CAT SNPs, the LTA NcoI but not the TNF –308 SNP was associated with catalase activity (p=0.04 and p=0.8). CAT –262 T carriers were less frequent in highly exposed miners (OR=0.39 [0.20 – 0.78], p=0.007). In CAT –262 T carriers only, catalase activity decreased with high dust exposure (p=0.01). Haplotype analyses (combined CAT SNPs) confirm these results. Results show that CAT –262 and LTA NcoI SNPs, and interaction with coal dust exposure, influenced catalase activity. PMID:16298864

Integrating common and rare genetic variation in diverse human populations.

PubMed

Altshuler, David M; Gibbs, Richard A; Peltonen, Leena; Altshuler, David M; Gibbs, Richard A; Peltonen, Leena; Dermitzakis, Emmanouil; Schaffner, Stephen F; Yu, Fuli; Peltonen, Leena; Dermitzakis, Emmanouil; Bonnen, Penelope E; Altshuler, David M; Gibbs, Richard A; de Bakker, Paul I W; Deloukas, Panos; Gabriel, Stacey B; Gwilliam, Rhian; Hunt, Sarah; Inouye, Michael; Jia, Xiaoming; Palotie, Aarno; Parkin, Melissa; Whittaker, Pamela; Yu, Fuli; Chang, Kyle; Hawes, Alicia; Lewis, Lora R; Ren, Yanru; Wheeler, David; Gibbs, Richard A; Muzny, Donna Marie; Barnes, Chris; Darvishi, Katayoon; Hurles, Matthew; Korn, Joshua M; Kristiansson, Kati; Lee, Charles; McCarrol, Steven A; Nemesh, James; Dermitzakis, Emmanouil; Keinan, Alon; Montgomery, Stephen B; Pollack, Samuela; Price, Alkes L; Soranzo, Nicole; Bonnen, Penelope E; Gibbs, Richard A; Gonzaga-Jauregui, Claudia; Keinan, Alon; Price, Alkes L; Yu, Fuli; Anttila, Verneri; Brodeur, Wendy; Daly, Mark J; Leslie, Stephen; McVean, Gil; Moutsianas, Loukas; Nguyen, Huy; Schaffner, Stephen F; Zhang, Qingrun; Ghori, Mohammed J R; McGinnis, Ralph; McLaren, William; Pollack, Samuela; Price, Alkes L; Schaffner, Stephen F; Takeuchi, Fumihiko; Grossman, Sharon R; Shlyakhter, Ilya; Hostetter, Elizabeth B; Sabeti, Pardis C; Adebamowo, Clement A; Foster, Morris W; Gordon, Deborah R; Licinio, Julio; Manca, Maria Cristina; Marshall, Patricia A; Matsuda, Ichiro; Ngare, Duncan; Wang, Vivian Ota; Reddy, Deepa; Rotimi, Charles N; Royal, Charmaine D; Sharp, Richard R; Zeng, Changqing; Brooks, Lisa D; McEwen, Jean E

2010-09-02

Despite great progress in identifying genetic variants that influence human disease, most inherited risk remains unexplained. A more complete understanding requires genome-wide studies that fully examine less common alleles in populations with a wide range of ancestry. To inform the design and interpretation of such studies, we genotyped 1.6 million common single nucleotide polymorphisms (SNPs) in 1,184 reference individuals from 11 global populations, and sequenced ten 100-kilobase regions in 692 of these individuals. This integrated data set of common and rare alleles, called 'HapMap 3', includes both SNPs and copy number polymorphisms (CNPs). We characterized population-specific differences among low-frequency variants, measured the improvement in imputation accuracy afforded by the larger reference panel, especially in imputing SNPs with a minor allele frequency of

Promoter Polymorphisms in the Nitric Oxide Synthase 3 Gene Are Associated With Ischemic Stroke Susceptibility in Young Black Women

PubMed Central

Howard, Timothy D.; Giles, Wayne H.; Xu, Jianfeng; Wozniak, Marcella A.; Malarcher, Ann M.; Lange, Leslie A.; Macko, Richard F.; Basehore, Monica J.; Meyers, Deborah A.; Cole, John W.; Kittner, Steven J.

2006-01-01

Background and Purpose Endothelial nitric oxide exerts a variety of protective effects on endothelial cells and blood vessels, and therefore the nitric oxide synthase 3 gene (NOS3) is a logical candidate gene for stroke susceptibility. Methods We used the population-based Stroke Prevention in Young Women case-control study to assess the association of five NOS3 polymorphisms in 110 cases (46% black) with ischemic stroke and 206 controls (38% black), 15 to 44 years of age. Polymorphisms included 3 single nucleotide polymorphisms (SNPs) in the promoter region (−1468 T>A, −922 G>A, −786 T>C), 1 SNP in exon 7 (G894T), and 1 insertion/deletion polymorphism within intron 4. Results Significant associations with both the −922 G>A and −786 T>C SNPs with ischemic stroke were observed in the black, but not the white, population. This association was attributable to an increased prevalence of the −922 A allele (OR=3.0, 95% CI=1.3 to 6.8; P=0.005) and the −786 T allele (OR=2.9, 95% CI=1.3 to 6.4; P=0.005) in cases versus controls. These 2 SNPs were in strong linkage disequilibrium (D′=1.0), making it impossible to determine, within the confines of this genetic study, whether 1 or both of these polymorphisms are functionally related to NOS3 expression. Two sets of haplotypes were also identified, 1 of which may confer an increased susceptibility to stroke in blacks, whereas the other appears to be protective. Conclusion Promoter variants in NOS3 may be associated with ischemic stroke susceptibility among young black women. PMID:16100023

Promoter polymorphisms in the nitric oxide synthase 3 gene are associated with ischemic stroke susceptibility in young black women.

PubMed

Howard, Timothy D; Giles, Wayne H; Xu, Jianfeng; Wozniak, Marcella A; Malarcher, Ann M; Lange, Leslie A; Macko, Richard F; Basehore, Monica J; Meyers, Deborah A; Cole, John W; Kittner, Steven J

2005-09-01

Endothelial nitric oxide exerts a variety of protective effects on endothelial cells and blood vessels, and therefore the nitric oxide synthase 3 gene (NOS3) is a logical candidate gene for stroke susceptibility. We used the population-based Stroke Prevention in Young Women case-control study to assess the association of five NOS3 polymorphisms in 110 cases (46% black) with ischemic stroke and 206 controls (38% black), 15 to 44 years of age. Polymorphisms included 3 single nucleotide polymorphisms (SNPs) in the promoter region (-1468 T>A, -922 G>A, -786 T>C), 1 SNP in exon 7 (G894T), and 1 insertion/deletion polymorphism within intron 4. Significant associations with both the -922 G>A and -786 T>C SNPs with ischemic stroke were observed in the black, but not the white, population. This association was attributable to an increased prevalence of the -922 A allele (OR=3.0, 95% CI=1.3 to 6.8; P=0.005) and the -786 T allele (OR=2.9, 95% CI=1.3 to 6.4; P=0.005) in cases versus controls. These 2 SNPs were in strong linkage disequilibrium (D'=1.0), making it impossible to determine, within the confines of this genetic study, whether 1 or both of these polymorphisms are functionally related to NOS3 expression. Two sets of haplotypes were also identified, 1 of which may confer an increased susceptibility to stroke in blacks, whereas the other appears to be protective. Promoter variants in NOS3 may be associated with ischemic stroke susceptibility among young black women.

Distribution of Chlamydia trachomatis serotypes in clinical urogenital samples from north-eastern Croatia.

PubMed

Bošnjak, Zinka; Džijan, Snježana; Pavlinić, Dinko; Perić, Magdalena; Ružman, Nataša; Križan, Ivana Roksandić; Lauc, Gordan; Antolović-Požgain, Arlen; Burazin, Jelena; Vuković, Dubravka

2012-06-01

The purpose of this study was to determine prevalence of Chlamydia trachomatis (Ct) urogenital infection and its serotype distribution from clinical samples in north-eastern Croatia. During a 3-year period, 2,379 urogenital samples were analyzed by real-time polymerase chain reaction (A group), while 4,846 genital swabs were analyzed by direct fluorescent antibody test (B group). 132 Ct positive specimens were genotyped by omp1 gene sequencing. The prevalence rate of Ct was 3.2 % in A and 1 % in B group. The most prevalent chlamydial genotype was E (44 %), followed by F (33 %), K (11.5 %), G (8 %), J/UW (5.3 %), D-IC (4.4 %), D-B120 (1.8 %), and B/IU, J/IU, Ia/IU (0.9 % each) serotypes. Single-nucleotide polymorphisms (SNPs) of omp1 gene were detected in E, K, and G serotypes. Some of these SNPs (C/T at position 272 and G/A at position 813 in E strain; C/T at position 884 in D strain) might represent novel omp1 variants.

Recent genetic discoveries in osteoporosis, sarcopenia and obesity.

PubMed

Urano, Tomohiko; Inoue, Satoshi

2015-01-01

Osteoporosis is a skeletal disorder characterized by low bone mineral density (BMD) and an increased susceptibility to fractures. Evidence from genetic studies indicates that BMD, a complex quantitative trait with a normal distribution, is genetically controlled. Genome-wide association studies (GWAS) as well as studies using candidate gene approaches have identified single-nucleotide polymorphisms (SNPs) that are associated with BMD, osteoporosis and osteoporotic fractures. These SNPs have been mapped close to or within genes including those encoding WNT/β-catenin signaling proteins. Understanding the genetics of osteoporosis will help to identify novel candidates for diagnostic and therapeutic targets. Genetic factors are also important for the development of sarcopenia, which is characterized by a loss of lean body mass, and obesity, which is characterized by high fat mass. Hence, in this review, we discuss the genetic factors, identified by genetic studies, which regulate the body components related to osteoporosis, sarcopenia, and obesity.

Impact of single nucleotide polymorphisms of cytarabine metabolic genes on drug toxicity in childhood acute lymphoblastic leukemia.

PubMed

Gabor, Krisztina Mita; Schermann, Geza; Lautner-Csorba, Orsolya; Rarosi, Ferenc; Erdelyi, Daniel J; Endreffy, Emoke; Berek, Krisztina; Bartyik, Katalin; Bereczki, Csaba; Szalai, Csaba; Semsei, Agnes F

2015-04-01

Cytarabine (cytosine arabinoside, ara-C) is a chemotherapeutical agent used in the treatment of pediatric acute lymphoblastic leukemia (ALL). Adverse drug reactions, such as interpatient variability in sensitivity to ara-C, are considerable and may cause difficulties during chemotherapy. Single nucleotide polymorphisms (SNPs) can play a significant role in modifying nucleoside-drug pharmacokinetics and pharmacodynamics and thus the development of adverse effects. Our aim was to determine whether polymorphisms in genes encoding transporters and enzymes responsible for the metabolism of ara-C are associated with toxicity and clinical outcome in a patient population with childhood ALL. We studied 8 SNPs in the CDA, DCK, DCTD, SLC28A3, and SLC29A1 genes in 144 patients with childhood acute lymphoblastic leukemia treated according to ALLIC BFM 1990, 1995 and 2002 protocols. DCK rs12648166 and DCK rs4694362 SNPs were associated with hematologic toxicity (OR = 2.63, CI 95% = 1.37-5.04, P = 0.0036 and OR = 2.53, CI 95% = 1.34-4.80, P = 0.0044, respectively). Our results indicate that DCK polymorphisms might be important genetic risk factors for hematologic toxicity during ALL treatment with ara-C. Individualized chemotherapy based on genetic profiling may help to optimize ara-C dosing, leading to improvements in clinical outcome and reduced toxicity. © 2015 Wiley Periodicals, Inc.

ADAM33 polymorphisms are associated with asthma and a distinctive palm dermatoglyphic pattern

PubMed Central

XUE, WEILIN; HAN, WEI; ZHOU, ZHAO-SHAN

2013-01-01

A close correlation between asthma and palm dermatoglyphic patterns has been observed in previous studies, but the underlying genetic mechanisms have not been investigated. A disintegrin and metalloprotein-33 (ADAM33) polymorphisms are important in the development of asthma and other atopic diseases. To investigate the underlying mechanisms of the association between asthma and distinctive palm dermatoglyphic patterns, thirteen ADAM33 single-nucleotide polymorphisms (SNPs) were analyzed for the association between asthma and palm dermatoglyphic patterns in a population of 400 asthmatic patients and 200 healthy controls. Based on the results, five SNPs, rs44707 (codominant model, P=0.031; log-additive model, P=0.0084), rs2787094 (overdominant model, P=0.049), rs678881 (codominant model, P=0.028; overdominant model, P=0.0083), rs677044 (codominant model, P=0.013; log-additive model, P=0.0033) and rs512625 (dominant model, P=0.033), were associated with asthma in this population. Two SNPs, rs44707 (dominant model, P=0.042) and rs2787094 (codominant model, P=0.014; recessive model, P=0.0038), were observed in the asthma patients with the distinctive palm pattern. As rs44707 and rs2787094 are associated with asthma and a distinctive palm pattern, the data suggest that ADAM33 polymorphisms are correlated with asthma and may be the underlying genetic basis of the association between asthma and palm dermatoglyphic patterns. PMID:24141861

Association of twelve polymorphisms in three onco-lncRNA genes with hepatocellular cancer risk and prognosis: A case-control study

PubMed Central

Wang, Ben-Gang; Xu, Qian; Lv, Zhi; Fang, Xin-Xin; Ding, Han-Xi; Wen, Jing; Yuan, Yuan

2018-01-01

AIM To evaluate the association of 12 tag single nucleotide polymorphisms (tagSNPs) in three onco-long non-coding RNA (lncRNA) genes (HOTTIP, CCAT2, MALAT1) with the risk and prognosis of hepatocellular cancer (HCC). METHODS Twelve tagSNPs covering the three onco-lncRNAs were genotyped by the KASP method in a total of 1338 samples, including 521 HCC patients and frequency-matched 817 controls. The samples were obtained from an unrelated Chinese population at the First Hospital of China Medical University from 2012-2015. The expression quantitative trait loci (eQTL) analyses were conducted to explore further the potential function of the promising SNPs. RESULTS Three SNPs in HOTTIP, one promoter SNP in MALAT1, and one haplotype of HOTTIP were associated with HCC risk. The HOTTIP rs17501292, rs2067087, and rs17427960 SNPs were increased to 1.55-, 1.20-, and 1.18-fold HCC risk under allelic models (P = 0.012, 0.017 and 0.049, respectively). MALAT1 rs4102217 SNP was increased to a 1.32-fold HCC risk under dominant models (P = 0.028). In addition, the two-way interaction of HOTTIP rs17501292-MALAT1 rs619586 polymorphisms showed a decreased effect on HCC risk (Pinteraction = 0.028, OR = 0.30) and epistasis with each other. HOTTIP rs3807598 variant genotype showed significantly longer survival time in HBV negative subgroup (P = 0.049, HR = 0.12), and MALAT1 rs591291 showed significantly better prognosis in female and HBV negative subgroups (P = 0.022, HR = 0.37; P = 0.042, HR = 0.25, respectively). In the study, no significant effect was observed in eQTL analysis. CONCLUSION Specific lncRNA (HOTTIP and MALAT1) SNPs have potential to be biomarkers for HCC risk and prognosis. PMID:29930469

Cytochrome P450 2E1 gene polymorphisms/haplotypes and anti-tuberculosis drug-induced hepatitis in a Chinese cohort.

PubMed

Tang, Shaowen; Lv, Xiaozhen; Zhang, Yuan; Wu, Shanshan; Yang, Zhirong; Xia, Yinyin; Tu, Dehua; Deng, Peiyuan; Ma, Yu; Chen, Dafang; Zhan, Siyan

2013-01-01

The pathogenic mechanism of anti-tuberculosis (anti-TB) drug-induced hepatitis is associated with drug metabolizing enzymes. No tagging single-nucleotide polymorphisms (tSNPs) of cytochrome P450 2E1(CYP2E1) in the risk of anti-TB drug-induced hepatitis have been reported. The present study was aimed at exploring the role of tSNPs in CYP2E1 gene in a population-based anti-TB treatment cohort. A nested case-control study was designed. Each hepatitis case was 14 matched with controls by age, gender, treatment history, disease severity and drug dosage. The tSNPs were selected by using Haploview 4.2 based on the HapMap database of Han Chinese in Beijing, and detected by using TaqMan allelic discrimination technology. Eighty-nine anti-TB drug-induced hepatitis cases and 356 controls were included in this study. 6 tSNPs (rs2031920, rs2070672, rs915908, rs8192775, rs2515641, rs2515644) were genotyped and minor allele frequencies of these tSNPs were 21.9%, 23.0%, 19.1%, 23.6%, 20.8% and 44.4% in the cases and 20.9%, 22.7%, 18.9%, 23.2%, 18.2% and 43.2% in the controls, respectively. No significant difference was observed in genotypes or allele frequencies of the 6 tSNPs between case group and control group, and neither of haplotypes in block 1 nor in block 2 was significantly associated with the development of hepatitis. Based on the Chinese anti-TB treatment cohort, we did not find a statistically significant association between genetic polymorphisms of CYP2E1 and the risk of anti-TB drug-induced hepatitis. None of the haplotypes showed a significant association with the development of hepatitis in Chinese TB population.

The Influence of AHI1 Variants on the Diagnosis and Treatment Outcome in Schizophrenia

PubMed Central

Porcelli, Stefano; Pae, Chi-Un; Han, Changsu; Lee, Soo-Jung; Patkar, Ashwin A.; Masand, Prakash S.; Balzarro, Beatrice; Alberti, Siegfried; De Ronchi, Diana; Serretti, Alessandro

2015-01-01

The present study aimed to explore whether four single nucleotide polymorphisms (SNPs) within the AHI1 gene could be associated with schizophrenia (SCZ) and whether they could predict the clinical outcomes in SCZ patients treated with antipsychotics. Four hundred twenty-six (426) in-patients with SCZ and 345 controls were genotyped for four AHI1 SNPs (rs11154801, rs7750586, rs9647635 and rs9321501). Baseline and clinical measures for SCZ patients were assessed through the Positive and Negative Syndrome Scale (PANSS). Allelic and genotypic frequencies in SCZ subjects were compared with those of controls using the χ2 statistics. The repeated-measure ANOVA was used for the assessment of treatment outcomes measured by PANSS changes. The case-control analysis did not show any difference in the genotypic distribution of the SNPs, while in the allelic analysis, a weak association was found between the rs9647635 A allele and SCZ. Furthermore, in the haplotype analysis, three haplotypes resulted in being associated with SCZ. On the other hand, two SNPs (rs7750586 and rs9647635) were associated with clinical improvement of negative symptoms in the allelic analysis, although in the genotypic analysis, only trends of association were found for the same SNPs. Our findings suggest a possible influence of AHI1 variants on SCZ susceptibility and antipsychotic response, particularly concerning negative symptomatology. Subsequent well-designed studies would be mandatory to confirm our results due to the methodological shortcomings of the present study. PMID:25622261

Type 2 diabetes (T2D) associated polymorphisms regulate expression of adjacent transcripts in transformed lymphocytes, adipose, and muscle from Caucasian and African-American subjects.

PubMed

Sharma, Neeraj K; Langberg, Kurt A; Mondal, Ashis K; Elbein, Steven C; Das, Swapan K

2011-02-01

Genome-wide association scans (GWAS) have identified novel single nucleotide polymorphisms (SNPs) that increase T2D susceptibility and indicated the role of nearby genes in T2D pathogenesis. We hypothesized that T2D-associated SNPs act as cis-regulators of nearby genes in human tissues and that expression of these transcripts may correlate with metabolic traits, including insulin sensitivity (S(I)). Association of SNPs with the expression of their nearest transcripts was tested in adipose and muscle from 168 healthy individuals who spanned a broad range of S(I) and body mass index (BMI) and in transformed lymphocytes (TLs). We tested correlations between the expression of these transcripts in adipose and muscle with metabolic traits. Utilizing allelic expression imbalance (AEI) analysis we examined the presence of other cis-regulators for those transcripts in TLs. SNP rs9472138 was significantly (P = 0.037) associated with the expression of VEGFA in TLs while rs6698181 was detected as a cis-regulator for the PKN2 in muscle (P = 0.00027) and adipose (P = 0.018). Significant association was also observed for rs17036101 (P = 0.001) with expression of SYN2 in adipose of Caucasians. Among 19 GWAS-implicated transcripts, expression of VEGFA in adipose was correlated with BMI (r = -0.305) and S(I) (r = 0.230). Although only a minority of the T2D-associated SNPs were validated as cis-eQTLs for nearby transcripts, AEI analysis indicated presence of other cis-regulatory polymorphisms in 54% of these transcripts. Our study suggests that a small subset of GWAS-identified SNPs may increase T2D susceptibility by modulating expression of nearby transcripts in adipose or muscle.

SNP Assay Development for Linkage Map Construction, Anchoring Whole-Genome Sequence, and Other Genetic and Genomic Applications in Common Bean

DOE Office of Scientific and Technical Information (OSTI.GOV)

Song, Qijian; Jia, Gaofeng; Hyten, David L.

A total of 992,682 single-nucleotide polymorphisms (SNPs) was identified as ideal for Illumina Infinium II BeadChip design after sequencing a diverse set of 17 common bean (Phaseolus vulgaris L) varieties with the aid of next-generation sequencing technology. From these, two BeadChips each with >5000 SNPs were designed. The BARCBean6K_1 BeadChip was selected for the purpose of optimizing polymorphism among market classes and, when possible, SNPs were targeted to sequence scaffolds in the Phaseolus vulgaris 14× genome assembly with sequence lengths >10 kb. The BARCBean6K_2 BeadChip was designed with the objective of anchoring additional scaffolds and to facilitate orientation of largemore » scaffolds. Analysis of 267 F2 plants from a cross of varieties Stampede × Red Hawk with the two BeadChips resulted in linkage maps with a total of 7040 markers including 7015 SNPs. With the linkage map, a total of 432.3 Mb of sequence from 2766 scaffolds was anchored to create the Phaseolus vulgaris v1.0 assembly, which accounted for approximately 89% of the 487 Mb of available sequence scaffolds of the Phaseolus vulgaris v0.9 assembly. A core set of 6000 SNPs (BARCBean6K_3 BeadChip) with high genotyping quality and polymorphism was selected based on the genotyping of 365 dry bean and 134 snap bean accessions with the BARCBean6K_1 and BARCBean6K_2 BeadChips. The BARCBean6K_3 BeadChip is a useful tool for genetics and genomics research and it is widely used by breeders and geneticists in the United States and abroad.« less

SNP Assay Development for Linkage Map Construction, Anchoring Whole-Genome Sequence, and Other Genetic and Genomic Applications in Common Bean

DOE PAGES

Song, Qijian; Jia, Gaofeng; Hyten, David L.; ...

2015-08-28

A total of 992,682 single-nucleotide polymorphisms (SNPs) was identified as ideal for Illumina Infinium II BeadChip design after sequencing a diverse set of 17 common bean (Phaseolus vulgaris L) varieties with the aid of next-generation sequencing technology. From these, two BeadChips each with >5000 SNPs were designed. The BARCBean6K_1 BeadChip was selected for the purpose of optimizing polymorphism among market classes and, when possible, SNPs were targeted to sequence scaffolds in the Phaseolus vulgaris 14× genome assembly with sequence lengths >10 kb. The BARCBean6K_2 BeadChip was designed with the objective of anchoring additional scaffolds and to facilitate orientation of largemore » scaffolds. Analysis of 267 F2 plants from a cross of varieties Stampede × Red Hawk with the two BeadChips resulted in linkage maps with a total of 7040 markers including 7015 SNPs. With the linkage map, a total of 432.3 Mb of sequence from 2766 scaffolds was anchored to create the Phaseolus vulgaris v1.0 assembly, which accounted for approximately 89% of the 487 Mb of available sequence scaffolds of the Phaseolus vulgaris v0.9 assembly. A core set of 6000 SNPs (BARCBean6K_3 BeadChip) with high genotyping quality and polymorphism was selected based on the genotyping of 365 dry bean and 134 snap bean accessions with the BARCBean6K_1 and BARCBean6K_2 BeadChips. The BARCBean6K_3 BeadChip is a useful tool for genetics and genomics research and it is widely used by breeders and geneticists in the United States and abroad.« less

SNP Assay Development for Linkage Map Construction, Anchoring Whole-Genome Sequence, and Other Genetic and Genomic Applications in Common Bean.

PubMed

Song, Qijian; Jia, Gaofeng; Hyten, David L; Jenkins, Jerry; Hwang, Eun-Young; Schroeder, Steven G; Osorno, Juan M; Schmutz, Jeremy; Jackson, Scott A; McClean, Phillip E; Cregan, Perry B

2015-08-28

A total of 992,682 single-nucleotide polymorphisms (SNPs) was identified as ideal for Illumina Infinium II BeadChip design after sequencing a diverse set of 17 common bean (Phaseolus vulgaris L) varieties with the aid of next-generation sequencing technology. From these, two BeadChips each with >5000 SNPs were designed. The BARCBean6K_1 BeadChip was selected for the purpose of optimizing polymorphism among market classes and, when possible, SNPs were targeted to sequence scaffolds in the Phaseolus vulgaris 14× genome assembly with sequence lengths >10 kb. The BARCBean6K_2 BeadChip was designed with the objective of anchoring additional scaffolds and to facilitate orientation of large scaffolds. Analysis of 267 F2 plants from a cross of varieties Stampede × Red Hawk with the two BeadChips resulted in linkage maps with a total of 7040 markers including 7015 SNPs. With the linkage map, a total of 432.3 Mb of sequence from 2766 scaffolds was anchored to create the Phaseolus vulgaris v1.0 assembly, which accounted for approximately 89% of the 487 Mb of available sequence scaffolds of the Phaseolus vulgaris v0.9 assembly. A core set of 6000 SNPs (BARCBean6K_3 BeadChip) with high genotyping quality and polymorphism was selected based on the genotyping of 365 dry bean and 134 snap bean accessions with the BARCBean6K_1 and BARCBean6K_2 BeadChips. The BARCBean6K_3 BeadChip is a useful tool for genetics and genomics research and it is widely used by breeders and geneticists in the United States and abroad. Copyright © 2015 Song et al.

Identification and validation of single nucleotide polymorphisms in growth- and maturation-related candidate genes in sole (Solea solea L.).

PubMed

Diopere, Eveline; Hellemans, Bart; Volckaert, Filip A M; Maes, Gregory E

2013-03-01

Genomic methodologies applied in evolutionary and fisheries research have been of great benefit to understand the marine ecosystem and the management of natural resources. Although single nucleotide polymorphisms (SNPs) are attractive for the study of local adaptation, spatial stock management and traceability, and investigating the effects of fisheries-induced selection, they have rarely been exploited in non-model organisms. This is partly due to difficulties in finding and validating SNPs in species with limited or no genomic resources. Complementary to random genome-scan approaches, a targeted candidate gene approach has the potential to unveil pre-selected functional diversity and provides more in depth information on the action of selection at specific genes. For example genes can be under selective pressure due to climate change and sustained periods of heavy fishing pressure. In this study, we applied a candidate gene approach in sole (Solea solea L.), an important member of the demersal ecosystem. As consumption flatfish it is heavy exploited and has experienced associated life-history changes over the last 60years. To discover novel genetic polymorphisms in or around genes linked to important life history traits in sole, we screened a total of 76 candidate genes related to growth and maturation using a targeted resequencing approach. We identified in total 86 putative SNPs in 22 genes and validated 29 SNPs using a multiplex single-base extension genotyping assay. We found 22 informative SNPs, of which two represent non-synonymous mutations, potentially of functional relevance. These novel markers should be rapidly and broadly applicable in analyses of natural sole populations, as a measure of the evolutionary signature of overfishing and for initiatives on marker assisted selection. Copyright © 2012 Elsevier B.V. All rights reserved.

Single nucleotide polymorphism in the STAT5b gene is associated with body weight and reproductive traits of the Jinghai Yellow chicken.

PubMed

Zhao, X H; Wang, J Y; Zhang, G X; Wei, Y; Gu, Y P; Yu, Y B

2012-04-01

In our research, signal transducer and activator of transcription 5b (STAT5b) gene was studied as candidate gene associated with body weight and reproductive traits of Jinghai Yellow chicken. Single nucleotide polymorphisms (SNPs) of STAT5b gene were examined in both Jinghai Yellow chicken and three reference chicken populations including the Bian, Youxi and Arbor Acre chickens. Two SNPs (C-1591T and G-250A) were detected in the 5' flanking region of STAT5b gene. Association indicated that the C-1591T mutation is significantly associated with age at fist egg, The G-250A mutation is significantly related with hatch weight and body weight at 300 days. Additionally four STAT5b haplotypes (H1, CG; H2, TG; H3, AC and H4, TA) and their frequency distributions were estimated using the phase program. Diplotype H3H4 is dominant for 8, 16 week-age-weight and body weight at first egg. Thus STAT5b gene may be served as a potential genetic marker for growth and reproduction traits evaluation of the Jinghai Yellow chicken. This study will provide valuable information for the protection and breeding of Jinghai Yellow chicken.

Heme Oxygenase-1 and 2 Common Genetic Variants and Risk for Restless Legs Syndrome

PubMed Central

García-Martín, Elena; Jiménez-Jiménez, Félix Javier; Alonso-Navarro, Hortensia; Martínez, Carmen; Zurdo, Martín; Turpín-Fenoll, Laura; Millán-Pascual, Jorge; Adeva-Bartolomé, Teresa; Cubo, Esther; Navacerrada, Francisco; Rojo-Sebastián, Ana; Rubio, Lluisa; Ortega-Cubero, Sara; Pastor, Pau; Calleja, Marisol; Plaza-Nieto, José Francisco; Pilo-de-la-Fuente, Belén; Arroyo-Solera, Margarita; García-Albea, Esteban; Agúndez, José A.G.

2015-01-01

Abstract Several neurochemical, neuropathological, neuroimaging, and experimental data, suggest that iron deficiency plays an important role in the pathophysiology of restless legs syndrome (RLS). Heme-oxygenases (HMOX) are an important defensive mechanism against oxidative stress, mainly through the degradation of heme to biliverdin, free iron, and carbon monoxide. We analyzed whether HMOX1 and HMOX2 genes are related with the risk to develop RLS. We analyzed the distribution of genotypes and allelic frequencies of the HMOX1 rs2071746, HMOX1 rs2071747, HMOX2 rs2270363, and HMOX2 rs1051308 SNPs, as well as the presence of Copy number variations (CNVs) of these genes in 205 subjects RLS and 445 healthy controls. The frequencies of rs2071746TT genotype and rs2071746T allelic variant were significantly lower in RLS patients than that in controls, although the other 3 studied SNPs did not differ between RLS patients and controls. None of the studied polymorphisms influenced the disease onset, severity of RLS, family history of RLS, serum ferritin levels, or response to dopaminergic agonist, clonazepam or GABAergic drugs. The present study suggests a weak association between HMOX1 rs2071746 polymorphism and the risk to develop RLS in the Spanish population. PMID:26313808

Heme Oxygenase-1 and 2 Common Genetic Variants and Risk for Restless Legs Syndrome.

PubMed

García-Martín, Elena; Jiménez-Jiménez, Félix Javier; Alonso-Navarro, Hortensia; Martínez, Carmen; Zurdo, Martín; Turpín-Fenoll, Laura; Millán-Pascual, Jorge; Adeva-Bartolomé, Teresa; Cubo, Esther; Navacerrada, Francisco; Rojo-Sebastián, Ana; Rubio, Lluisa; Ortega-Cubero, Sara; Pastor, Pau; Calleja, Marisol; Plaza-Nieto, José Francisco; Pilo-de-la-Fuente, Belén; Arroyo-Solera, Margarita; García-Albea, Esteban; Agúndez, José A G

2015-08-01

Several neurochemical, neuropathological, neuroimaging, and experimental data, suggest that iron deficiency plays an important role in the pathophysiology of restless legs syndrome (RLS). Heme-oxygenases (HMOX) are an important defensive mechanism against oxidative stress, mainly through the degradation of heme to biliverdin, free iron, and carbon monoxide. We analyzed whether HMOX1 and HMOX2 genes are related with the risk to develop RLS.We analyzed the distribution of genotypes and allelic frequencies of the HMOX1 rs2071746, HMOX1 rs2071747, HMOX2 rs2270363, and HMOX2 rs1051308 SNPs, as well as the presence of Copy number variations (CNVs) of these genes in 205 subjects RLS and 445 healthy controls.The frequencies of rs2071746TT genotype and rs2071746T allelic variant were significantly lower in RLS patients than that in controls, although the other 3 studied SNPs did not differ between RLS patients and controls. None of the studied polymorphisms influenced the disease onset, severity of RLS, family history of RLS, serum ferritin levels, or response to dopaminergic agonist, clonazepam or GABAergic drugs.The present study suggests a weak association between HMOX1 rs2071746 polymorphism and the risk to develop RLS in the Spanish population.

A whole genome association study to detect additive and dominant single nucleotide polymorphisms for growth and carcass traits in Korean native cattle, Hanwoo.

PubMed

Li, Yi; Gao, Yuxuan; Kim, You-Sam; Iqbal, Asif; Kim, Jong-Joo

2017-01-01

A whole genome association study was conducted to identify single nucleotide polymorphisms (SNPs) with additive and dominant effects for growth and carcass traits in Korean native cattle, Hanwoo. The data set comprised 61 sires and their 486 Hanwoo steers that were born between spring of 2005 and fall of 2007. The steers were genotyped with the 35,968 SNPs that were embedded in the Illumina bovine SNP 50K beadchip and six growth and carcass quality traits were measured for the steers. A series of lack-of-fit tests between the models was applied to classify gene expression pattern as additive or dominant. A total of 18 (0), 15 (3), 12 (8), 15 (18), 11 (7), and 21 (1) SNPs were detected at the 5% chromosome (genome) - wise level for weaning weight (WWT), yearling weight (YWT), carcass weight (CWT), backfat thickness (BFT), longissimus dorsi muscle area (LMA) and marbling score, respectively. Among the significant 129 SNPs, 56 SNPs had additive effects, 20 SNPs dominance effects, and 53 SNPs both additive and dominance effects, suggesting that dominance inheritance mode be considered in genetic improvement for growth and carcass quality in Hanwoo. The significant SNPs were located at 33 quantitative trait locus (QTL) regions on 18 Bos Taurus chromosomes (i.e. BTA 3, 4, 5, 6, 7, 9, 11, 12, 13, 14, 16, 17, 18, 20, 23, 26, 28, and 29) were detected. There is strong evidence that BTA14 is the key chromosome affecting CWT. Also, BTA20 is the key chromosome for almost all traits measured (WWT, YWT, LMA). The application of various additive and dominance SNP models enabled better characterization of SNP inheritance mode for growth and carcass quality traits in Hanwoo, and many of the detected SNPs or QTL had dominance effects, suggesting that dominance be considered for the whole-genome SNPs data and implementation of successive molecular breeding schemes in Hanwoo.

What can time-frequency and phase coherence measures tell us about the genetic basis of P3 amplitude?

PubMed Central

McGue, Matt; Iacono, William G.

2017-01-01

In a recent comprehensive investigation, we largely failed to identify significant genetic markers associated with P3 amplitude or to corroborate previous associations between P3 and specific single nucleotide polymorphisms (SNPs) or genes. In the present study we extended this line of investigation to examine time-frequency (TF) activity and intertrial phase coherence (ITPC) in the P3 time window, both of which are associated with P3 amplitude. Previous genome-wide research has reported associations between P3-related theta and delta activity and individual genetic variants. A large, population-based sample of 4211 subjects, comprising male and female adolescent twins and their parents, was genotyped for 527,828 single nucleotide polymorphisms (SNPs), from which over six million SNPs were accurately imputed. Heritability estimates were greater for TF energy than ITPC, whether based on biometric models or the combined influence of all measured SNPs (derived from genome-wide complex trait analysis). The magnitude of overlap in the specific SNPs associated with delta energy and ITPC and P3 amplitude was significant. A genome-wide analysis of all SNPs, accompanied by an analysis of approximately 17,600 genes, indicated a region of chromosome 2 around TEKT4 that was significantly associated with theta ITPC. Analysis of candidate SNPs and genes previously reported to be associated with P3 or related phenotypes yielded one association surviving correction for multiple tests: between theta energy and CRHR1. However, we did not obtain significant associations for SNPs implicated in previous genome-wide studies of TF measures. Identifying specific genetic variants associated with P3 amplitude remains a challenge. PMID:27871913

Genetic Determinants of Enterovirus Infections: Polymorphisms in Type 1 Diabetes and Innate Immune Genes in the MIDIA Study.

PubMed

Witsø, Elisabet; Cinek, Ondrej; Tapia, German; Brorsson, Caroline A; Stene, Lars C; Gjessing, Håkon K; Rasmussen, Trond; Bergholdt, Regine; Pociot, Flemming M; Rønningen, Kjersti S

2015-12-01

Enteroviruses have been suggested as triggers of type 1 diabetes (T1D). We aimed to assess whether established T1D susceptibility single nucleotide polymorphisms (SNPs) and candidate SNPs in innate immune genes were associated with the frequency of enterovirus infection in otherwise healthy children. Fifty-six established T1D SNPs and 97 other candidate immunity SNPs were typed in 419 children carrying the T1D high-risk genotype, HLA-DR4-DQ8/DR3-DQ2 genotype, and 373 children without this genotype. Enteroviral RNA was detected using real-time polymerase chain reaction, with primers detecting essentially all enterovirus serotypes, in 7,393 longitudinal stool samples collected monthly (age range 3-36 months). The most significant association was with two T1D SNPs, rs12150079 (ZPBP2/ORMDL3/GSDMB region) (enterovirus frequency: AA 7.3%, AG 8.7%, GG 9.7%, RR = 0.86, overall p = 1.87E-02) and rs229541 (C1QTNF6/SSTR3/RAC2) (enterovirus frequency: CC 7.8%, CT 9.7%, TT 9.4%, RR = 1.13, overall p = 3.6E-02), followed by TLR8 (rs2407992) (p = 3.8E-02), TLR3 (1914926) (p = 4.9E-02), and two other T1D SNPs (IFIH1 rs3747517, p = 4.9E-02 and PTPN22, rs2476601, p = 5.3E-02). However, the quantile-quantile plot of p-values with confidence intervals for all 153 SNPs did not reveal clear evidence for rejection of the complete null hypothesis. Among a number of SNPs in candidate genes, we found no evidence for strong associations with enterovirus presence in stool samples from Norwegian children.

Genotyping of Single Nucleotide Polymorphisms in DNA Isolated from Serum Using Sequenom MassARRAY Technology.

PubMed

Clendenen, Tess V; Rendleman, Justin; Ge, Wenzhen; Koenig, Karen L; Wirgin, Isaac; Currie, Diane; Shore, Roy E; Kirchhoff, Tomas; Zeleniuch-Jacquotte, Anne

2015-01-01

Large epidemiologic studies have the potential to make valuable contributions to the assessment of gene-environment interactions because they prospectively collected detailed exposure data. Some of these studies, however, have only serum or plasma samples as a low quantity source of DNA. We examined whether DNA isolated from serum can be used to reliably and accurately genotype single nucleotide polymorphisms (SNPs) using Sequenom multiplex SNP genotyping technology. We genotyped 81 SNPs using samples from 158 participants in the NYU Women's Health Study. Each participant had DNA from serum and at least one paired DNA sample isolated from a high quality source of DNA, i.e. clots and/or cell precipitates, for comparison. We observed that 60 of the 81 SNPs (74%) had high call frequencies (≥95%) using DNA from serum, only slightly lower than the 85% of SNPs with high call frequencies in DNA from clots or cell precipitates. Of the 57 SNPs with high call frequencies for serum, clot, and cell precipitate DNA, 54 (95%) had highly concordant (>98%) genotype calls across all three sample types. High purity was not a critical factor to successful genotyping. Our results suggest that this multiplex SNP genotyping method can be used reliably on DNA from serum in large-scale epidemiologic studies.

Mining the transcriptomes of four commercially important shellfish species for single nucleotide polymorphisms within biomineralization genes.

PubMed

Vendrami, David L J; Shah, Abhijeet; Telesca, Luca; Hoffman, Joseph I

2016-06-01

Transcriptional profiling not only provides insights into patterns of gene expression, but also generates sequences that can be mined for molecular markers, which in turn can be used for population genetic studies. As part of a large-scale effort to better understand how commercially important European shellfish species may respond to ocean acidification, we therefore mined the transcriptomes of four species (the Pacific oyster Crassostrea gigas, the blue mussel Mytilus edulis, the great scallop Pecten maximus and the blunt gaper Mya truncata) for single nucleotide polymorphisms (SNPs). Illumina data for C. gigas, M. edulis and P. maximus and 454 data for M. truncata were interrogated using GATK and SWAP454 respectively to identify between 8267 and 47,159 high quality SNPs per species (total=121,053 SNPs residing within 34,716 different contigs). We then annotated the transcripts containing SNPs to reveal homology to diverse genes. Finally, as oceanic pH affects the ability of organisms to incorporate calcium carbonate, we honed in on genes implicated in the biomineralization process to identify a total of 1899 SNPs in 157 genes. These provide good candidates for biomarkers with which to study patterns of selection in natural or experimental populations. Copyright © 2016 Elsevier B.V. All rights reserved.

Polymorphisms, de novo lipogenesis, and plasma triglyceride response following fish oil supplementation

PubMed Central

Bouchard-Mercier, Annie; Rudkowska, Iwona; Lemieux, Simone; Couture, Patrick; Vohl, Marie-Claude

2013-01-01

Interindividual variability in the response of plasma triglyceride concentrations (TG) following fish oil consumption has been observed. Our objective was to examine the associations between single-nucleotide polymorphisms (SNPs) within genes encoding proteins involved in de novo lipogenesis and the relative change in plasma TG levels following a fish oil supplementation. Two hundred and eight participants were recruited in the greater Quebec City area. The participants completed a six-week fish oil supplementation (5 g fish oil/day: 1.9–2.2 g eicosapentaenoic acid and 1.1 g docosahexaenoic acid. SNPs within SREBF1, ACLY, and ACACA genes were genotyped using TAQMAN methodology. After correction for multiple comparison, only two SNPs, rs8071753 (ACLY) and rs1714987 (ACACA), were associated with the relative change in plasma TG concentrations (P = 0.004 and P = 0.005, respectively). These two SNPs explained 7.73% of the variance in plasma TG relative change following fish oil consumption. Genotype frequencies of rs8071753 according to the TG response groups (responders versus nonresponders) were different (P = 0.02). We conclude that the presence of certain SNPs within genes, such as ACLY and ACACA, encoding proteins involved in de novo lipogenesis seem to influence the plasma TG response following fish oil consumption. PMID:23886516

Polymorphisms, de novo lipogenesis, and plasma triglyceride response following fish oil supplementation.

PubMed

Bouchard-Mercier, Annie; Rudkowska, Iwona; Lemieux, Simone; Couture, Patrick; Vohl, Marie-Claude

2013-10-01

Interindividual variability in the response of plasma triglyceride concentrations (TG) following fish oil consumption has been observed. Our objective was to examine the associations between single-nucleotide polymorphisms (SNPs) within genes encoding proteins involved in de novo lipogenesis and the relative change in plasma TG levels following a fish oil supplementation. Two hundred and eight participants were recruited in the greater Quebec City area. The participants completed a six-week fish oil supplementation (5 g fish oil/day: 1.9-2.2 g eicosapentaenoic acid and 1.1 g docosahexaenoic acid. SNPs within SREBF1, ACLY, and ACACA genes were genotyped using TAQMAN methodology. After correction for multiple comparison, only two SNPs, rs8071753 (ACLY) and rs1714987 (ACACA), were associated with the relative change in plasma TG concentrations (P = 0.004 and P = 0.005, respectively). These two SNPs explained 7.73% of the variance in plasma TG relative change following fish oil consumption. Genotype frequencies of rs8071753 according to the TG response groups (responders versus nonresponders) were different (P = 0.02). We conclude that the presence of certain SNPs within genes, such as ACLY and ACACA, encoding proteins involved in de novo lipogenesis seem to influence the plasma TG response following fish oil consumption.

[The joint applications of DNA chips and single nucleotide polymorphisms in forensic science].

PubMed

Bai, Peng; Tian, Li; Zhou, Xue-ping

2005-05-01

DNA chip technology, being a new high-technology, shows its vigorous life and rapid growth. Single Nucleotide Polymorphisms (SNPs) is the most common diversity in the human genome. It provides suitable genetic markers which play a key role in disease linkage study, pharmacogenomics, forensic medicine, population evolution and immigration study. Their advantage such as being analyzed with DNA chips technology, is predicted to play an important role in the field of forensic medicine, especially in paternity test and individual identification. This report mainly reviews the characteristics of DNA chip and SNPs, and their joint applications in the practice of forensic medicine.

Single nucleotide polymorphisms in the bovine MHC region of Japanese Black cattle are associated with bovine leukemia virus proviral load.

PubMed

Takeshima, Shin-Nosuke; Sasaki, Shinji; Meripet, Polat; Sugimoto, Yoshikazu; Aida, Yoko

2017-04-04

Bovine leukemia virus (BLV) is the causative agent of enzootic bovine leukosis, a malignant B cell lymphoma that has spread worldwide and causes serious problems for the cattle industry. The BLV proviral load, which represents the BLV genome integrated into host genome, is a useful index for estimating disease progression and transmission risk. Here, we conducted a genome-wide association study to identify single nucleotide polymorphisms (SNPs) associated with BLV proviral load in Japanese Black cattle. The study examined 93 cattle with a high proviral load and 266 with a low proviral load. Three SNPs showed a significant association with proviral load. One SNP was detected in the CNTN3 gene on chromosome 22, and two (which were not in linkage disequilibrium) were detected in the bovine major histocompatibility complex region on chromosome 23. These results suggest that polymorphisms in the major histocompatibility complex region affect proviral load. This is the first report to detect SNPs associated with BLV proviral load in Japanese Black cattle using whole genome association study, and understanding host factors may provide important clues for controlling the spread of BLV in Japanese Black cattle.

The Associations between RNA Splicing Complex Gene SF3A1 Polymorphisms and Colorectal Cancer Risk in a Chinese Population.

PubMed

Chen, Xiaohua; Du, Hua; Liu, Binjian; Zou, Li; Chen, Wei; Yang, Yang; Zhu, Ying; Gong, Yajie; Tian, Jianbo; Li, Feng; Zhong, Shan

2015-01-01

Aberrant alternative splicing included alterations in components of the mRNA splicing machinery often occurred in colon cancer. However, the role of SF3A1, one key component of the mRNA splicing machinery, on colorectal cancer (CRC) risk was still not elucidated. We performed a hospital-based case-control study containing 801 CRC patients and 817 cancer-free controls to examine the association between SF3A1 polymorphisms and CRC risk in a Chinese population. Four candidate SNPs (rs10376, rs5753073, rs2839998 and rs2074733) were selected based on bioinformatics analysis and previous findings. The results showed no significant associations between these SNPs and CRC risk (P > 0.05). Besides, the stratified analysis based on the smoking and alcohol use status obtained no statistically significant results. Our study was the first one to investigate the association between SF3A1 polymorphisms and CRC risk. The results suggested these four SNPs in SF3A1 were not associated with CRC risk in a Chinese population, however, further more studies are needed to confirm our findings.

Association of ARID5B gene variants with acute lymphoblastic leukemia in Yemeni children.

PubMed

Al-Absi, Boshra; Noor, Suzita M; Saif-Ali, Riyadh; Salem, Sameer D; Ahmed, Radwan H; Razif, Muhammad Fm; Muniandy, Sekaran

2017-04-01

Studies have shown an association between ARID5B gene polymorphisms and childhood acute lymphoblastic leukemia. However, the association between ARID5B variants and acute lymphoblastic leukemia among the Arab population still needs to be studied. The aim of this study was to investigate the association between ARID5B variants with acute lymphoblastic leukemia in Yemeni children. A total of 14 ARID5B gene single nucleotide polymorphisms (SNPs) were genotyped in 289 Yemeni children, of whom 136 had acute lymphoblastic leukemia and 153 were controls, using the nanofluidic Dynamic Array (Fluidigm 192.24 Dynamic Array). Using logistic regression adjusted for age and gender, the risks of acute lymphoblastic leukemia were presented as odds ratios and 95% confidence intervals. We found that nine SNPs were associated with acute lymphoblastic leukemia under additive genetic models: rs7073837, rs10740055, rs7089424, rs10821936, rs4506592, rs10994982, rs7896246, rs10821938, and rs7923074. Furthermore, the recessive models revealed that six SNPs were risk factors for acute lymphoblastic leukemia: rs10740055, rs7089424, rs10994982, rs7896246, rs10821938, and rs7923074. The gender-specific impact of these SNPs under the recessive genetic model revealed that SNPs rs10740055, rs10994982, and rs6479779 in females, and rs10821938 and rs7923074 in males were significantly associated with acute lymphoblastic leukemia risk. Under the dominant model, SNPs rs7073837, rs10821936, rs7896246, and rs6479778 in males only showed striking association with acute lymphoblastic leukemia. The additive model revealed that SNPs with significant association with acute lymphoblastic leukemia were rs10821936 (both males and females); rs7073837, rs10740055, rs10994982, and rs4948487 (females only); and rs7089424, rs7896246, rs10821938, and rs7923074 (males only). In addition, the ARID5B haplotype block (CGAACACAA) showed a higher risk for acute lymphoblastic leukemia. The haplotype (CCCGACTGC) was associated with protection against acute lymphoblastic leukemia. In conclusion, our study has shown that ARID5B variants are associated with acute lymphoblastic leukemia in Yemeni children with several gender biases of ARID5B single nucleotide polymorphisms reported.

SNP-markers in Allium species to facilitate introgression breeding in onion.

PubMed

Scholten, Olga E; van Kaauwen, Martijn P W; Shahin, Arwa; Hendrickx, Patrick M; Keizer, L C Paul; Burger, Karin; van Heusden, Adriaan W; van der Linden, C Gerard; Vosman, Ben

2016-08-31

Within onion, Allium cepa L., the availability of disease resistance is limited. The identification of sources of resistance in related species, such as Allium roylei and Allium fistulosum, was a first step towards the improvement of onion cultivars by breeding. SNP markers linked to resistance and polymorphic between these related species and onion cultivars are a valuable tool to efficiently introgress disease resistance genes. In this paper we describe the identification and validation of SNP markers valuable for onion breeding. Transcriptome sequencing resulted in 192 million RNA seq reads from the interspecific F1 hybrid between A. roylei and A. fistulosum (RF) and nine onion cultivars. After assembly, reliable SNPs were discovered in about 36 % of the contigs. For genotyping of the interspecific three-way cross population, derived from a cross between an onion cultivar and the RF (CCxRF), 1100 SNPs that are polymorphic in RF and monomorphic in the onion cultivars (RF SNPs) were selected for the development of KASP assays. A molecular linkage map based on 667 RF-SNP markers was constructed for CCxRF. In addition, KASP assays were developed for 1600 onion-SNPs (SNPs polymorphic among onion cultivars). A second linkage map was constructed for an F2 of onion x A. roylei (F2(CxR)) that consisted of 182 onion-SNPs and 119 RF-SNPs, and 76 previously mapped markers. Markers co-segregating in both the F2(CxR) and the CCxRF population were used to assign the linkage groups of RF to onion chromosomes. To validate usefulness of these SNP markers, QTL mapping was applied in the CCxRF population that segregates for resistance to Botrytis squamosa and resulted in a QTL for resistance on chromosome 6 of A. roylei. Our research has more than doubled the publicly available marker sequences of expressed onion genes and two onion-related species. It resulted in a detailed genetic map for the interspecific CCxRF population. This is the first paper that reports the detection of a QTL for resistance to B. squamosa in A. roylei.

Single nucleotide polymorphism discovery in rainbow trout by deep sequencing of a reduced representation library.

PubMed

Sánchez, Cecilia Castaño; Smith, Timothy P L; Wiedmann, Ralph T; Vallejo, Roger L; Salem, Mohamed; Yao, Jianbo; Rexroad, Caird E

2009-11-25

To enhance capabilities for genomic analyses in rainbow trout, such as genomic selection, a large suite of polymorphic markers that are amenable to high-throughput genotyping protocols must be identified. Expressed Sequence Tags (ESTs) have been used for single nucleotide polymorphism (SNP) discovery in salmonids. In those strategies, the salmonid semi-tetraploid genomes often led to assemblies of paralogous sequences and therefore resulted in a high rate of false positive SNP identification. Sequencing genomic DNA using primers identified from ESTs proved to be an effective but time consuming methodology of SNP identification in rainbow trout, therefore not suitable for high throughput SNP discovery. In this study, we employed a high-throughput strategy that used pyrosequencing technology to generate data from a reduced representation library constructed with genomic DNA pooled from 96 unrelated rainbow trout that represent the National Center for Cool and Cold Water Aquaculture (NCCCWA) broodstock population. The reduced representation library consisted of 440 bp fragments resulting from complete digestion with the restriction enzyme HaeIII; sequencing produced 2,000,000 reads providing an average 6 fold coverage of the estimated 150,000 unique genomic restriction fragments (300,000 fragment ends). Three independent data analyses identified 22,022 to 47,128 putative SNPs on 13,140 to 24,627 independent contigs. A set of 384 putative SNPs, randomly selected from the sets produced by the three analyses were genotyped on individual fish to determine the validation rate of putative SNPs among analyses, distinguish apparent SNPs that actually represent paralogous loci in the tetraploid genome, examine Mendelian segregation, and place the validated SNPs on the rainbow trout linkage map. Approximately 48% (183) of the putative SNPs were validated; 167 markers were successfully incorporated into the rainbow trout linkage map. In addition, 2% of the sequences from the validated markers were associated with rainbow trout transcripts. The use of reduced representation libraries and pyrosequencing technology proved to be an effective strategy for the discovery of a high number of putative SNPs in rainbow trout; however, modifications to the technique to decrease the false discovery rate resulting from the evolutionary recent genome duplication would be desirable.

Identification of leptin gene polymorphisms associated with carcass traits and fatty acid composition in Japanese Black cattle.

PubMed

Kawaguchi, Fuki; Okura, Kazuki; Oyama, Kenji; Mannen, Hideyuki; Sasazaki, Shinji

2017-03-01

Previous studies have indicated that some leptin gene polymorphisms were associated with economically important traits in cattle breeds. However, polymorphisms in the leptin gene have not been reported thus far in Japanese Black cattle. Here, we aimed to identify the leptin gene polymorphisms which are associated with carcass traits and fatty acid composition in Japanese Black cattle. We sequenced the full-length coding sequence of leptin gene for eight Japanese Black cattle. Sequence comparison revealed eight single nucleotide polymorphisms (SNPs). Three of these were predicted to cause amino acid substitutions: Y7F, R25C and A80V. Then, we genotyped these SNPs in two populations (JB1 with 560 animals and JB2 with 450 animals) and investigated the effects on the traits. Y7F in JB1 and A80V in JB2 were excluded from statistical analysis because the minor allele frequencies were low (< 0.1). Association analysis revealed that Y7F had a significant effect on the dressed carcass weight in JB2; R25C had a significant effect on C18:0 and C14:1 in JB1 and JB2, respectively; and A80V had a significant effect on C16:0, C16:1, C18:1, monounsaturated fatty acid and saturated fatty acid in JB1. The results suggested that these SNPs could be used as an effective marker for the improvement of Japanese Black cattle. © 2016 Japanese Society of Animal Science.

GESPA: classifying nsSNPs to predict disease association.

PubMed

Khurana, Jay K; Reeder, Jay E; Shrimpton, Antony E; Thakar, Juilee

2015-07-25

Non-synonymous single nucleotide polymorphisms (nsSNPs) are the most common DNA sequence variation associated with disease in humans. Thus determining the clinical significance of each nsSNP is of great importance. Potential detrimental nsSNPs may be identified by genetic association studies or by functional analysis in the laboratory, both of which are expensive and time consuming. Existing computational methods lack accuracy and features to facilitate nsSNP classification for clinical use. We developed the GESPA (GEnomic Single nucleotide Polymorphism Analyzer) program to predict the pathogenicity and disease phenotype of nsSNPs. GESPA is a user-friendly software package for classifying disease association of nsSNPs. It allows flexibility in acceptable input formats and predicts the pathogenicity of a given nsSNP by assessing the conservation of amino acids in orthologs and paralogs and supplementing this information with data from medical literature. The development and testing of GESPA was performed using the humsavar, ClinVar and humvar datasets. Additionally, GESPA also predicts the disease phenotype associated with a nsSNP with high accuracy, a feature unavailable in existing software. GESPA's overall accuracy exceeds existing computational methods for predicting nsSNP pathogenicity. The usability of GESPA is enhanced by fast SQL-based cloud storage and retrieval of data. GESPA is a novel bioinformatics tool to determine the pathogenicity and phenotypes of nsSNPs. We anticipate that GESPA will become a useful clinical framework for predicting the disease association of nsSNPs. The program, executable jar file, source code, GPL 3.0 license, user guide, and test data with instructions are available at http://sourceforge.net/projects/gespa.

Association of androgen metabolism gene polymorphisms with prostate cancer risk and androgen concentrations: Results from the Prostate Cancer Prevention Trial.

PubMed

Price, Douglas K; Chau, Cindy H; Till, Cathee; Goodman, Phyllis J; Leach, Robin J; Johnson-Pais, Teresa L; Hsing, Ann W; Hoque, Ashraful; Parnes, Howard L; Schenk, Jeannette M; Tangen, Catherine M; Thompson, Ian M; Reichardt, Juergen K V; Figg, William D

2016-08-01

Prostate cancer is highly influenced by androgens and genes. The authors investigated whether genetic polymorphisms along the androgen biosynthesis and metabolism pathways are associated with androgen concentrations or with the risk of prostate cancer or high-grade disease from finasteride treatment. A nested case-control study from the Prostate Cancer Prevention Trial using data from men who had biopsy-proven prostate cancer (cases) and a group of biopsy-negative, frequency-matched controls was conducted to investigate the association of 51 single nucleotide polymorphisms (SNPs) in 12 genes of the androgen pathway with overall (total), low-grade, and high-grade prostate cancer incidence and serum hormone concentrations. There were significant associations of genetic polymorphisms in steroid 5α-reductase 1 (SRD5A1) (reference SNPs: rs3736316, rs3822430, rs1560149, rs248797, and rs472402) and SRD5A2 (rs2300700) with the risk of high-grade prostate cancer in the placebo arm of the Prostate Cancer Prevention Trial; 2 SNPs were significantly associated with an increased risk (SRD5A1 rs472402 [odds ratio, 1.70; 95% confidence interval, 1.05-2.75; Ptrend = .03] and SRD5A2 rs2300700 [odds ratio, 1.94; 95% confidence interval, 1.19-3.18; Ptrend = .01]). Eleven SNPs in SRD5A1, SRD5A2, cytochrome P450 family 1, subfamily B, polypeptide 1 (CYP1B1), and CYP3A4 were associated with modifying the mean concentrations of serum androgen and sex hormone-binding globulin; and 2 SNPs (SRD5A1 rs824811 and CYP1B1 rs10012; Ptrend < .05) consistently and significantly altered all androgen concentrations. Several SNPs (SRD5A1 rs3822430, SRD5A2 rs2300700, CYP3A43 rs800672, and CYP19 rs700519; Ptrend < .05) were significantly associated with both circulating hormone levels and prostate cancer risk. Germline genetic variations of androgen-related pathway genes are associated with serum androgen concentrations and the risk of prostate cancer. Further studies to examine the functional consequence of novel causal variants are warranted. Cancer 2016;122:2332-2340. © 2016 American Cancer Society. © 2016 American Cancer Society.

Polymorphic amplified typing sequences (PATS) and pulsed-field gel electrophoresis (PFGE) yield comparable results in the strain typing of a diverse set of bovine Escherichia coli O157 isolates

USDA-ARS?s Scientific Manuscript database

The PCR-based Escherichia coli O157 (O157) strain typing system, Polymorphic Amplified Typing Sequences (PATS), targets insertions-deletions (Indels) and single nucleotide polymorphisms (SNPs) at the XbaI and AvrII(BlnI) restriction enzyme sites, respectively, besides amplifying four known virulenc...

Single nucleotide polymorphisms/haplotypes associated with multiple rubella-specific immune response outcomes post-MMR immunization in healthy children.

PubMed

Ovsyannikova, Inna G; Salk, Hannah M; Larrabee, Beth R; Pankratz, V Shane; Poland, Gregory A

2015-10-01

The observed heterogeneity in rubella-specific immune response phenotypes post-MMR vaccination is thought to be explained, in part, by inter-individual genetic variation. In this study, single nucleotide polymorphisms (SNPs) and multiple haplotypes in several candidate genes were analyzed for associations with more than one rubella-specific immune response outcome, including secreted IFN-γ, secreted IL-6, and neutralizing antibody titers. Overall, we identified 23 SNPs in 10 different genes that were significantly associated with at least two rubella-specific immune responses. Of these SNPs, we detected eight in the PVRL3 gene, five in the PVRL1 gene, one in the TRIM22 gene, two in the IL10RB gene, two in the TLR4 gene, and five in other genes (PVR, ADAR, ZFP57, MX1, and BTN2A1/BTN3A3). The PVRL3 gene haplotype GACGGGGGCAGCAAAAAGAAGAGGAAAGAACAA was significantly associated with both higher IFN-γ secretion (t-statistic 4.43, p < 0.0001) and higher neutralizing antibody titers (t-statistic 3.14, p = 0.002). Our results suggest that there is evidence of multigenic associations among identified gene SNPs and that polymorphisms in these candidate genes contribute to the overall observed differences between individuals in response to live rubella virus vaccine. These results will aid our understanding of mechanisms behind rubella-specific immune response to MMR vaccine and influence the development of vaccines in the future.

Whole Genome Re-Sequencing and Characterization of Powdery Mildew Disease-Associated Allelic Variation in Melon.

PubMed

Natarajan, Sathishkumar; Kim, Hoy-Taek; Thamilarasan, Senthil Kumar; Veerappan, Karpagam; Park, Jong-In; Nou, Ill-Sup

2016-01-01

Powdery mildew is one of the most common fungal diseases in the world. This disease frequently affects melon (Cucumis melo L.) and other Cucurbitaceous family crops in both open field and greenhouse cultivation. One of the goals of genomics is to identify the polymorphic loci responsible for variation in phenotypic traits. In this study, powdery mildew disease assessment scores were calculated for four melon accessions, 'SCNU1154', 'Edisto47', 'MR-1', and 'PMR5'. To investigate the genetic variation of these accessions, whole genome re-sequencing using the Illumina HiSeq 2000 platform was performed. A total of 754,759,704 quality-filtered reads were generated, with an average of 82.64% coverage relative to the reference genome. Comparisons of the sequences for the melon accessions revealed around 7.4 million single nucleotide polymorphisms (SNPs), 1.9 million InDels, and 182,398 putative structural variations (SVs). Functional enrichment analysis of detected variations classified them into biological process, cellular component and molecular function categories. Further, a disease-associated QTL map was constructed for 390 SNPs and 45 InDels identified as related to defense-response genes. Among them 112 SNPs and 12 InDels were observed in powdery mildew responsive chromosomes. Accordingly, this whole genome re-sequencing study identified SNPs and InDels associated with defense genes that will serve as candidate polymorphisms in the search for sources of resistance against powdery mildew disease and could accelerate marker-assisted breeding in melon.

SNP identification in FBXO32 gene and their associations with growth traits in cattle.

PubMed

Wang, Ailan; Zhang, Ya; Li, Mijie; Lan, Xianyong; Wang, Juqiang; Chen, Hong

2013-02-15

The F-box protein 32 (FBXO32), also known as Atrogin-1, is one of the four subunits of the ubiquitin protein ligase complex. FBXO32 has been previously shown to be involved in regulation of initiation and development of muscle mass. In the present study, we investigated the polymorphism of FBXO32 gene in 1313 cattle from seven bovine breeds using DNA sequencing, polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) and PCR-based amplification-created restriction site (PCR-ACRS) methods. Four novel single nucleotide polymorphisms (SNPs) were identified within bovine FBXO32, and were deposited in the GenBank database. The association studies between these four SNPs and growth traits were performed in NanYang cattle. Notably, the SNPs ss411628932 and ss411628936 were shown to be significantly associated with body length of 24-month-old NanYang cattle. Based on the above four SNPs, 16 haplotypes were identified. The main haplotype was AATA, which occurred at a frequency of more than 40%. Additionally, phylogenetic analysis showed that geographical distance was essential to gene flow among seven cattle breeds. Indigenous bovine breeds displayed genetic difference in comparison to hybrid bovine breeds that have foreign origins. We herein describe for the first time a comprehensive study on the variability of bovine FBXO32 gene that is predictive of genetic potential for body length phenotype. Copyright © 2012 Elsevier B.V. All rights reserved.

Lack of association between SREBF-1c gene polymorphisms and risk of non-alcoholic fatty liver disease in a Chinese Han population.

PubMed

Peng, Xian-E; Chen, Feng-Lin; Liu, Wenjuan; Hu, ZhiJian; Lin, Xu

2016-08-30

The transcription factor sterol regulatory element-binding protein-1c (SREBP-1c) is a key regulator of lipogenesis and insulin sensitivity, and is associated with non-alcoholic fatty liver disease (NAFLD). Here, we assessed the impact of common single nucleotide polymorphisms (SNPs) in SREBF-1c on NAFLD susceptibility and associated metabolic phenotypes in a Han Chinese population. Four common SNPs (rs62064119, rs2297508, rs11868035 and rs13306741) in the SREBP-1c gene were selected and genotyped in 593 patients with NAFLD and 593 healthy controls. Unconditional logistic regression was performed to assess the risk of NAFLD by determining odds ratios and 95% confidence intervals (CIs). No significant differences in genotype and allele frequencies of these four SNPs were found between the NAFLD population and the controls (all P > 0.05). In addition, we did not find any association between the SREBF-1c SNPs and the clinical and biochemical parameters, such as body mass index, total cholesterol, high density lipoprotein-and low density lipoprotein-cholesterol or systolic and diastolic blood pressure, except that the rs2297508 C-allele or rs11868035 G-allele showed significant associations with lower triglyceride levels in control subjects (P < 0.01). Our findings suggested that the four polymorphisms in SREBF-1c gene are not associated with risk of NAFLD in the Chinese Han population.

Naked-eye fingerprinting of single nucleotide polymorphisms on psoriasis patients

NASA Astrophysics Data System (ADS)

Valentini, Paola; Marsella, Alessandra; Tarantino, Paolo; Mauro, Salvatore; Baglietto, Silvia; Congedo, Maurizio; Paolo Pompa, Pier

2016-05-01

We report a low-cost test, based on gold nanoparticles, for the colorimetric (naked-eye) fingerprinting of a panel of single nucleotide polymorphisms (SNPs), relevant for the personalized therapy of psoriasis. Such pharmacogenomic tests are not routinely performed on psoriasis patients, due to the high cost of standard technologies. We demonstrated high sensitivity and specificity of our colorimetric test by validating it on a cohort of 30 patients, through a double-blind comparison with two state-of-the-art instrumental techniques, namely reverse dot blotting and sequencing, finding 100% agreement. This test offers high parallelization capabilities and can be easily generalized to other SNPs of clinical relevance, finding broad utility in diagnostics and pharmacogenomics.We report a low-cost test, based on gold nanoparticles, for the colorimetric (naked-eye) fingerprinting of a panel of single nucleotide polymorphisms (SNPs), relevant for the personalized therapy of psoriasis. Such pharmacogenomic tests are not routinely performed on psoriasis patients, due to the high cost of standard technologies. We demonstrated high sensitivity and specificity of our colorimetric test by validating it on a cohort of 30 patients, through a double-blind comparison with two state-of-the-art instrumental techniques, namely reverse dot blotting and sequencing, finding 100% agreement. This test offers high parallelization capabilities and can be easily generalized to other SNPs of clinical relevance, finding broad utility in diagnostics and pharmacogenomics. Electronic supplementary information (ESI) available. See DOI: 10.1039/c6nr02200f

A genetic variant of miR-148a binding site in the SCRN1 3'-UTR is associated with susceptibility and prognosis of gastric cancer.

PubMed

Song, Peng; Zhu, Haixia; Zhang, Dong; Chu, Haiyan; Wu, Dongmei; Kang, Meiyun; Wang, Meilin; Gong, Weida; Zhou, Jianwei; Zhang, Zhengdong; Zhao, Qinghong

2014-11-17

Single nucleotide polymorphisms (SNPs) in the 3'-untranslated regions targeted by putative mircoRNA can change its binding strength, affecting the susceptibility and prognosis of cancer. We aimed to investigate the associations between SNPs within miR-148a binding sites and gastric cancer (GC) risk and prognosis. Using bioinformatics tools, we selected two SNPs (SCRN1 rs6976789 and PDYN rs2235749) located in miR-148a target sites. We genotyped the two SNPs in a case-control study comprising 753 GC patients and 949 cancer-free subjects. We found a significantly increased risk of GC associated with the SCRN1 rs6976789 C>T polymorphism [adjusted OR = 1.25, 95% confidence interval (CI) = 1.02-1.53; CT/TT vs. CC]. However, no significant association was found between the PDYN rs2235749 and GC risk in all genetic models. Furthermore, we evaluated whether SCRN1 rs6976789 affected the survival of GC patients. Results showed that individuals with SCRN1 rs6976789 TT genotype had poorer overall survival compared with those carried CC/CT genotypes in intestinal-type GC (adjusted HR = 2.47, 95% CI = 1.21-5.05). Luciferase report assay showed that the rs6976789 variant T allele influenced the binding ability of miR-148a. Our results suggested that the SCRN1 rs6976789 polymorphism may play an important role in the GC development and progression.

Polymorphisms in MicroRNA Genes And Genes Involving in NMDAR Signaling and Schizophrenia: A Case-Control Study in Chinese Han Population.

PubMed

Zhang, Yanxia; Fan, Mei; Wang, Qingzhong; He, Guang; Fu, Yingmei; Li, Huafang; Yu, Shunying

2015-08-10

Disturbances in glutamate signaling caused by disruption of N-methyl-D-aspartate-type glutamate receptor (NMDAR) have been implicated in schizophrenia. Findings suggested that miR-219, miR-132 and miR-107 could involve in NMDAR signaling by influencing the expression of pathway genes or the signaling transmission and single nucleotide polymorphisms (SNPs) within miRNA genes or miRNA target sites could result in their functional changes. Therefore, we hypothesized that SNPs in miRNAs and/or their target sites were associated with schizophrenia. 3 SNPs in hsa-pri-miR-219/132/107 and 6 SNPs in 3'UTRs of GRIN2A/2B/3A and CAMK2G were selected and genotyped in a case-control study of 1041 schizophrenia cases and 953 healthy controls in Chinese Han population. In the present study, GRIN2B rs890 showed significant associations with schizophrenia. Further functional analyses showed that the rs890 variant C allele led to significantly lower luciferase activity, compared with the A allele. MDR analysis showed that a 4-locus model including rs107822, rs2306327, rs890 and rs12342026 was the best model. These findings suggest that GRIN2B may be associated with schizophrenia and interaction effects of the polymorphisms in hsa-miR-219, CAKM2G, GRIN2B and GRIN3A may confer susceptibility to schizophrenia in the Chinese Han population.

RNA Expression and Post-Transcriptional Editing Analyses of Cucumber Plastids Reveals Genetic Differences Associated with Chilling Tolerance

USDA-ARS?s Scientific Manuscript database

Tolerance to chilling injury in cucumber (Cucumis sativus L.) is associated with three plastomic single nucleotide polymorphisms (ptSNPs) at bp positions 4,813, 56,561, and 126,349 that are co-inherited. An understanding of the genetic expression of these ptSNPs as a response to chilling is critical...

Development and evaluation of a high density genotyping 'Axiom_Arachis' array with 58K SNPs for accelerating genetics and breeding in groundnut

USDA-ARS?s Scientific Manuscript database

Single nucleotide polymorphisms (SNPs) are the most abundant DNA sequence variation in the genomes which can be used to associate genotypic variation to the phenotype. Therefore, availability of a high-density SNP array with uniform genome coverage can advance genetic studies and breeding applicatio...

Discovery of 20,000 RAD-SNPs and development of a 52-SNP array for monitoring river otters

Treesearch

Jeffrey B. Stetz; Seth Smith; Michael A. Sawaya; Alan B. Ramsey; Stephen J. Amish; Michael K. Schwartz; Gordon Luikart

2016-01-01

Many North American river otter (Lontra canadensis) populations are threatened or recovering but are difficult to study because they occur at low densities, it is difficult to visually identify individuals, and they inhabit aquatic environments that accelerate degradation of biological samples. Single nucleotide polymorphisms (SNPs) can improve our ability to...

Replication study of 15 recently published Loci for body fat distribution in the Japanese population.

PubMed

Hotta, Kikuko; Kitamoto, Aya; Kitamoto, Takuya; Mizusawa, Seiho; Teranishi, Hajime; So, Rina; Matsuo, Tomoaki; Nakata, Yoshio; Hyogo, Hideyuki; Ochi, Hidenori; Nakamura, Takahiro; Kamohara, Seika; Miyatake, Nobuyuki; Kotani, Kazuaki; Itoh, Naoto; Mineo, Ikuo; Wada, Jun; Yoneda, Masato; Nakajima, Atsushi; Funahashi, Tohru; Miyazaki, Shigeru; Tokunaga, Katsuto; Masuzaki, Hiroaki; Ueno, Takato; Chayama, Kazuaki; Hamaguchi, Kazuyuki; Yamada, Kentaro; Hanafusa, Toshiaki; Oikawa, Shinichi; Sakata, Toshiie; Tanaka, Kiyoji; Matsuzawa, Yuji; Nakao, Kazuwa; Sekine, Akihiro

2013-01-01

Visceral fat accumulation plays an integral role in morbidity and mortality rates by increasing the risk of developing metabolic disorders such as type 2 diabetes, dyslipidemia, and hypertension. New genetic loci associated with fat distribution, measured by waist-hip ratios and computed tomography (CT), have recently been identified by genome-wide association studies in European-descent populations. This study used CT to investigate whether single nucleotide polymorphisms (SNPs) that confer susceptibility to fat distribution are associated with visceral fat area (VFA) and subcutaneous fat area (SFA) in the Japanese population. We measured the VFAs and SFAs of 1424 obese Japanese subjects (BMI≥25 kg/m(2), 635 men and 789 women) that were genotyped at 15 SNPs, namely, TBX15 rs984222, DNM3 rs1011731, LYPLAL1 rs4846567, GRB14 rs10195252, NISCH rs6784615, ADAMTS9 rs6795735, CPEB4 rs6861681, LY86 rs1294421, VEGFA rs6905288, RSPO3 rs9491696, NFE2L3 rs1055144, ITPR2 rs718314, HOXC13 rs1443512, ZNRF3 rs4823006 and THNSL2 rs1659258. The G-allele of LYPLAL1 rs4846567 was borderline associated with an increased ratio of VFA to SFA (V/S ratio; p= 0.0020). LYPLAL1 rs4846567 had a stronger effect on the V/S ratio in women (p= 0.0078) than in men (p= 0.12); however, neither result was significant after Bonferroni correction for multiple comparisons. NISCH rs6784615 was nominally associated with increased VFA (p=0.040) and V/S ratio (p= 0.020). The other SNPs analyzed were not significantly associated with body mass index (BMI), VFA, or SFA. Our results suggest that LYPLAL1 rs4846567 and NISCH rs6784615 may influence fat distribution in the Japanese population.

Single nucleotide polymorphism discovery in bovine liver using RNA-seq technology.

PubMed

Pareek, Chandra Shekhar; Błaszczyk, Paweł; Dziuba, Piotr; Czarnik, Urszula; Fraser, Leyland; Sobiech, Przemysław; Pierzchała, Mariusz; Feng, Yaping; Kadarmideen, Haja N; Kumar, Dibyendu

2017-01-01

RNA-seq is a useful next-generation sequencing (NGS) technology that has been widely used to understand mammalian transcriptome architecture and function. In this study, a breed-specific RNA-seq experiment was utilized to detect putative single nucleotide polymorphisms (SNPs) in liver tissue of young bulls of the Polish Red, Polish Holstein-Friesian (HF) and Hereford breeds, and to understand the genomic variation in the three cattle breeds that may reflect differences in production traits. The RNA-seq experiment on bovine liver produced 107,114,4072 raw paired-end reads, with an average of approximately 60 million paired-end reads per library. Breed-wise, a total of 345.06, 290.04 and 436.03 million paired-end reads were obtained from the Polish Red, Polish HF, and Hereford breeds, respectively. Burrows-Wheeler Aligner (BWA) read alignments showed that 81.35%, 82.81% and 84.21% of the mapped sequencing reads were properly paired to the Polish Red, Polish HF, and Hereford breeds, respectively. This study identified 5,641,401 SNPs and insertion and deletion (indel) positions expressed in the bovine liver with an average of 313,411 SNPs and indel per young bull. Following the removal of the indel mutations, a total of 195,3804, 152,7120 and 205,3184 raw SNPs expressed in bovine liver were identified for the Polish Red, Polish HF, and Hereford breeds, respectively. Breed-wise, three highly reliable breed-specific SNP-databases (SNP-dbs) with 31,562, 24,945 and 28,194 SNP records were constructed for the Polish Red, Polish HF, and Hereford breeds, respectively. Using a combination of stringent parameters of a minimum depth of ≥10 mapping reads that support the polymorphic nucleotide base and 100% SNP ratio, 4,368, 3,780 and 3,800 SNP records were detected in the Polish Red, Polish HF, and Hereford breeds, respectively. The SNP detections using RNA-seq data were successfully validated by kompetitive allele-specific PCR (KASPTM) SNP genotyping assay. The comprehensive QTL/CG analysis of 110 QTL/CG with RNA-seq data identified 20 monomorphic SNP hit loci (CARTPT, GAD1, GDF5, GHRH, GHRL, GRB10, IGFBPL1, IGFL1, LEP, LHX4, MC4R, MSTN, NKAIN1, PLAG1, POU1F1, SDR16C5, SH2B2, TOX, UCP3 and WNT10B) in all three cattle breeds. However, six SNP loci (CCSER1, GHR, KCNIP4, MTSS1, EGFR and NSMCE2) were identified as highly polymorphic among the cattle breeds. This study identified breed-specific SNPs with greater SNP ratio and excellent mapping coverage, as well as monomorphic and highly polymorphic putative SNP loci within QTL/CGs of bovine liver tissue. A breed-specific SNP-db constructed for bovine liver yielded nearly six million SNPs. In addition, a KASPTM SNP genotyping assay, as a reliable cost-effective method, successfully validated the breed-specific putative SNPs originating from the RNA-seq experiments.

[Polymorphism of CD209 and TLR3 genes in populations of North Eurasia].

PubMed

Barkhash, A V; Babenko, V N; Voevoda, M I; Romaschenko, A G

2016-06-01

The DC-SIGN (dendritic cell-specific intercellular adhesion molecule (ICAM)-3-grabbing non-integrin) and TLR3 (toll-like receptor 3) proteins are key effectors of the innate immunity and particularly play an important role in the organism’s antiviral defense as pattern-recognition receptors. Previously, we demonstrated that certain genotypes and alleles of single nucleotide polymorphisms (SNPs) rs2287886 (G/A) in the promoter region of the CD209 gene (encoding DC-SIGN) and rs3775291 (G/A, Leu412Phe) in the exon 4 of the TLR3 gene are associated with human predisposition to tick-borne encephalitis in the Russian population. In the present work, the distribution of genotype and allele frequencies for these SNPs was studied in seven populations of North Eurasia, including Caucasians (Russians and Germans (from Altai region)), Central Asian Mongoloids (Altaians, Khakass, Tuvinians, and Shorians), and Arctic Mongoloids (Chukchi). It was found that the CD209 gene rs2287886 SNP A/A genotype and A allele, as well as the TLR3 gene rs3775291 SNP G/G genotype and G allele (the frequencies of which in our previous studies were increased in tick-borne encephalitis patients as compared with the population control (Russian citizens of Novosibirsk)), are preserved with a high frequency in Central Asian Mongoloids (who for a long time regularly came in contact with tick-borne encephalitis virus in places of their habitation). We suggested that predisposition to tick-borne encephalitis in Central Asian Mongoloid populations can be predetermined by a different set of genes and their polymorphisms than in the Russian population.

The absence of an association between Interleukin 1β gene polymorphisms and recurrent aphthous stomatitis (RAS).

PubMed

Ślebioda, Zuzanna; Kowalska, Anna; Rozmiarek, Marta; Krawiecka, Ewa; Szponar, Elżbieta; Dorocka-Bobkowska, Barbara

2017-12-01

Recurrent aphthous stomatitis (RAS) is a chronic, ulcerative disease with a probable polygenic mode of inheritance and complex etiology with a strong immunological background. The aim of the present study was to determine the possible association between two single nucleotide polymorphisms (SNPs) of the IL-1β gene: IL-1β-511 T>C (rs16944) and IL-1β+3954C>T (rs1143634) and RAS susceptibility in a moderately large group of patients. One hundred and four patients with minor, major and herpetiform RAS and 75 healthy volunteers were genotyped at IL-1β-511 T>C (rs16944) and IL-1β+3954C>T (rs1143634) using the PCR-RFLP approach. The results were statistically analysed with chi-square test and test of difference between two rates of structure, with p<0.05 assumed to be a statistically significance level (Statistica 10, StatSoft ® , Kraków, Poland). There were no statistically significant differences in the genotype distribution for the IL-1β C[+3954]T polymorphism between the RAS and control groups. The frequency of IL-1β*T[-511]/*T[-511] homozygotes among the patients was significantly higher when compared to our study control (p<0.0347). The results after stratification into carriers and non-carriers of C and T alleles did not clearly indicate which SNP may be considered a risk factor for RAS. The genetic association between the studied SNPs of the IL-1β gene and RAS remains controversial and requires further investigation. Copyright © 2017 Elsevier Ltd. All rights reserved.

[Association between platelet-activating factor acetylhydrolase gene polymorphisms and gastrointestinal bleeding in children with Henoch-Schönlein purpura].

PubMed

Wang, Bao-Xiang; Mei, Hong; Peng, Han-Ming; Gao, Yuan; Ding, Yan

2017-04-01

To study the association between the single nucleotide polymorphisms (SNPs) of the ninth exon Val279Phe of platelet-activating factor acetylhydrolase (PAF-AH) gene and gastrointestinal bleeding in children with Henoch-Schönlein purpura (HSP). A total 516 children with HSP were enrolled, among whom 182 had gastrointestinal bleeding and 334 had no gastrointestinal bleeding. PCR was used to investigate the distribution of genotypes and alleles in the SNPs of Val97Phe. The plasma PAF-AH activity was measured, as well as the levels of platelet-activating factor (PAF), granular membrane protein-140 (GMP-140), β-thromboglobulin (β-TG), and platelet factor 4 (PF4). The Val279Phe genotype and allele frequencies were in Hardy-Weinberg equilibrium, and the homozygous genotype TT and heterozygotes accounted for 0.97% and 6.05% respectively. The gastrointestinal bleeding group had a significantly higher allele frequency than the control group (5.22% vs 3.33%; P<0.01). The HSP patients with GG genotype in the gastrointestinal bleeding group had significantly higher levels of plasma PAF and GMP-140 than those in the non-gastrointestinal bleeding group (P<0.05), while the non-gastrointestinal bleeding group had a significantly higher PAF-AH activity than the gastrointestinal bleeding group (P<0.05). There were no significant differences in β-TG and PF4 between the two groups (P>0.05). Val279Phe gene polymorphisms in PAF-AH are associated with PAF-AH activity and PAF and GMP-140 levels and may be a risk factor for HSP with gastrointestinal bleeding.

Variant allele of CHEK2 is associated with a decreased risk of esophageal cancer lymph node metastasis in a Chinese population.

PubMed

Gu, Haiyong; Qiu, Wanshan; Wan, Ying; Ding, Guowen; Tang, Weifeng; Liu, Chao; Shi, Yijun; Chen, Yijang; Chen, Suocheng

2012-05-01

Growing evidence suggests that the checkpoint kinase 2 (CHEK2) signaling pathway occupies a central position in the signaling networks of DNA-damage signaling. Many functional and molecular epidemiological studies have evaluated the association between genetic variants of CHEK2 and various cancers. To evaluate the relationship between CHEK2 functional genetic variants and esophageal cancer risk and the risk of lymph node metastasis among a Chinese population. We genotyped CHEK2 rs738722, rs2236141 and rs2236142 single nucleotide polymorphisms (SNPs) using the matrix assisted laser desorption/ionization time-of-flight mass spectrometry assay in a case-controlled study, including 380 esophageal cancer cases and 380 healthy controls in a Chinese population. We found that none of the three polymorphisms achieved significant difference in their distributions between esophageal cancer cases and controls. Multiple logistic regression analyses revealed that esophageal cancer risk was not associated significantly with the variant genotypes of the three CHEK2 polymorphisms as compared with their wild-type genotypes. However, we found that functional variant rs738722 and rs2236142 in CHEK2 might contribute to susceptibility to lymph node metastasis. Our data did not support a significant association between CHEK2 SNPs and the risk of esophageal cancer. Functional variant CHEK2 rs738722 and rs2236142 might contribute to lymph node metastasis susceptibility. The CT allele of SNP rs738722 and the GC allele of SNP rs2236142 might be a protective factor of the risk for lymph node metastasis of esophageal cancer.

Genetic effects of PDGFRB and MARCH1 identified in GWAS revealing strong associations with semen production traits in Chinese Holstein bulls.

PubMed

Liu, Shuli; Yin, Hongwei; Li, Cong; Qin, Chunhua; Cai, Wentao; Cao, Mingyue; Zhang, Shengli

2017-07-03

Using a genome-wide association study strategy, our previous study discovered 19 significant single-nucleotide polymorphisms (SNPs) related to semen production traits in Chinese Holstein bulls. Among them, three SNPs were within or close to the phosphodiesterase 3A (PDE3A), membrane associated ring-CH-type finger 1 (MARCH1) and platelet derived growth factor receptor beta (PDGFRB) genes. The present study was designed with the objectives of identifying genetic polymorphism of the PDE3A, PDGFRB and MARCH1 genes and their effects on semen production traits in a Holstein bull population. A total of 20 SNPs were detected and genotyped in 730 bulls. Association analyses using de-regressed estimated breeding values of each semen production trait revealed four statistically significant SNPs for one or more semen production traits (P < 0.05): one SNP was located downstream of PDGFRB and three SNPs were located in the promoter of MARCH1. Interestingly, for MARCH1, haplotype-based analysis revealed significant associations of haplotypes with semen volume per ejaculate. Furthermore, high expression of the MARCH1 gene was observed in sperm cells. One SNP (rs43445726) in the regulatory region of MARCH1 had a significant effect on gene expression. Our study demonstrated the significant associations of genetic variants of the PDGFRB and MARCH1 genes with semen production traits. The identified SNPs may serve as genetic markers to optimize breeding programs for semen production traits in Holstein bull populations.

Nonsynonymous Polymorphism in Guanine Monophosphate Synthetase Is a Risk Factor for Unfavorable Thiopurine Metabolite Ratios in Patients With Inflammatory Bowel Disease.

PubMed

Roberts, Rebecca L; Wallace, Mary C; Seinen, Margien L; van Bodegraven, Adriaan A; Krishnaprasad, Krupa; Jones, Gregory T; van Rij, Andre M; Baird, Angela; Lawrance, Ian C; Prosser, Ruth; Bampton, Peter; Grafton, Rachel; Simms, Lisa A; Studd, Corrie; Bell, Sally J; Kennedy, Martin A; Halliwell, Jacob; Gearry, Richard B; Radford-Smith, Graham; Andrews, Jane M; McHugh, Patrick C; Barclay, Murray L

2018-05-16

Up to 20% of patients with inflammatory bowel disease (IBD) who are refractory to thiopurine therapy preferentially produce 6-methylmercaptopurine (6-MMP) at the expense of 6-thioguanine nucleotides (6-TGN), resulting in a high 6-MMP:6-TGN ratio (>20). The objective of this study was to evaluate whether genetic variability in guanine monophosphate synthetase (GMPS) contributes to preferential 6-MMP metabolizer phenotype. Exome sequencing was performed in a cohort of IBD patients with 6-MMP:6-TGN ratios of >100 to identify nonsynonymous single nucleotide polymorphisms (nsSNPs). In vitro assays were performed to measure GMPS activity associated with these nsSNPs. Frequency of the nsSNPs was measured in a cohort of 530 Caucasian IBD patients. Two nsSNPs in GMPS (rs747629729, rs61750370) were detected in 11 patients with very high 6-MMP:6-TGN ratios. The 2 nsSNPs were predicted to be damaging by in silico analysis. In vitro assays demonstrated that both nsSNPs resulted in a significant reduction in GMPS activity (P < 0.05). The SNP rs61750370 was significantly associated with 6-MMP:6-TGN ratios ≥100 (odds ratio, 5.64; 95% confidence interval, 1.01-25.12; P < 0.031) in a subset of 264 Caucasian IBD patients. The GMPS SNP rs61750370 may be a reliable risk factor for extreme 6MMP preferential metabolism.

The investigation of genetic polymorphisms in the carbonic anhydrase VI gene exon 2 and salivary parameters in type 2 diabetic patients and healthy adults.

PubMed

Koç Öztürk, Leyla; Ulucan, Korkut; Akyüz, Serap; Furuncuoğlu, Halit; Bayer, Hikmet; Yarat, Ayşen

2012-05-01

The aim of this study was to investigate carbonic anhydrase (CA) VI Exon 2 single nucleotide polymorphism (SNP) and its possible association with salivary parameters in type 2 diabetic patients compared to healthy adults. Caries status was measured by using the DMFT (number of decayed, missing, and filled teeth) index. Unstimulated whole saliva and blood samples were taken. SNPs of CA gene exon 2 were determined by PCR and DNA sequencing. Salivary CA activity and buffering capacity were determined by the method of Verpoorte and Ericson, respectively. Furthermore, salivary pH was measured with pH paper and salivary flow rate was calculated. Salivary buffering capacity and pH were significantly lower in diabetic patients than those of healthy subjects (P < 0.05). Salivary flow rate, CA activity and DMFT levels did not differ between groups (P > 0.05). Four SNPs were detected; their pubmed database number are rs2274327 (C/T), rs2274328 (A/C), rs2274329 (G/C) and rs2274330. While first three of those were responsible for amino acid changes, the last one was not. The frequencies of SNPs were not significant between groups (P > 0.05). Positive significant correlation was found between CA activity and the frequency of SNPs. There was no correlation between the SNPs frequencies and pH or buffering capacity. SNPs found in this study may be related to salivary CA activity in diabetics.

High-throughput SNP genotyping in the highly heterozygous genome of Eucalyptus: assay success, polymorphism and transferability across species

PubMed Central

2011-01-01

Background High-throughput SNP genotyping has become an essential requirement for molecular breeding and population genomics studies in plant species. Large scale SNP developments have been reported for several mainstream crops. A growing interest now exists to expand the speed and resolution of genetic analysis to outbred species with highly heterozygous genomes. When nucleotide diversity is high, a refined diagnosis of the target SNP sequence context is needed to convert queried SNPs into high-quality genotypes using the Golden Gate Genotyping Technology (GGGT). This issue becomes exacerbated when attempting to transfer SNPs across species, a scarcely explored topic in plants, and likely to become significant for population genomics and inter specific breeding applications in less domesticated and less funded plant genera. Results We have successfully developed the first set of 768 SNPs assayed by the GGGT for the highly heterozygous genome of Eucalyptus from a mixed Sanger/454 database with 1,164,695 ESTs and the preliminary 4.5X draft genome sequence for E. grandis. A systematic assessment of in silico SNP filtering requirements showed that stringent constraints on the SNP surrounding sequences have a significant impact on SNP genotyping performance and polymorphism. SNP assay success was high for the 288 SNPs selected with more rigorous in silico constraints; 93% of them provided high quality genotype calls and 71% of them were polymorphic in a diverse panel of 96 individuals of five different species. SNP reliability was high across nine Eucalyptus species belonging to three sections within subgenus Symphomyrtus and still satisfactory across species of two additional subgenera, although polymorphism declined as phylogenetic distance increased. Conclusions This study indicates that the GGGT performs well both within and across species of Eucalyptus notwithstanding its nucleotide diversity ≥2%. The development of a much larger array of informative SNPs across multiple Eucalyptus species is feasible, although strongly dependent on having a representative and sufficiently deep collection of sequences from many individuals of each target species. A higher density SNP platform will be instrumental to undertake genome-wide phylogenetic and population genomics studies and to implement molecular breeding by Genomic Selection in Eucalyptus. PMID:21492434

SNiPlay: a web-based tool for detection, management and analysis of SNPs. Application to grapevine diversity projects.

PubMed

Dereeper, Alexis; Nicolas, Stéphane; Le Cunff, Loïc; Bacilieri, Roberto; Doligez, Agnès; Peros, Jean-Pierre; Ruiz, Manuel; This, Patrice

2011-05-05

High-throughput re-sequencing, new genotyping technologies and the availability of reference genomes allow the extensive characterization of Single Nucleotide Polymorphisms (SNPs) and insertion/deletion events (indels) in many plant species. The rapidly increasing amount of re-sequencing and genotyping data generated by large-scale genetic diversity projects requires the development of integrated bioinformatics tools able to efficiently manage, analyze, and combine these genetic data with genome structure and external data. In this context, we developed SNiPlay, a flexible, user-friendly and integrative web-based tool dedicated to polymorphism discovery and analysis. It integrates:1) a pipeline, freely accessible through the internet, combining existing softwares with new tools to detect SNPs and to compute different types of statistical indices and graphical layouts for SNP data. From standard sequence alignments, genotyping data or Sanger sequencing traces given as input, SNiPlay detects SNPs and indels events and outputs submission files for the design of Illumina's SNP chips. Subsequently, it sends sequences and genotyping data into a series of modules in charge of various processes: physical mapping to a reference genome, annotation (genomic position, intron/exon location, synonymous/non-synonymous substitutions), SNP frequency determination in user-defined groups, haplotype reconstruction and network, linkage disequilibrium evaluation, and diversity analysis (Pi, Watterson's Theta, Tajima's D).Furthermore, the pipeline allows the use of external data (such as phenotype, geographic origin, taxa, stratification) to define groups and compare statistical indices.2) a database storing polymorphisms, genotyping data and grapevine sequences released by public and private projects. It allows the user to retrieve SNPs using various filters (such as genomic position, missing data, polymorphism type, allele frequency), to compare SNP patterns between populations, and to export genotyping data or sequences in various formats. Our experiments on grapevine genetic projects showed that SNiPlay allows geneticists to rapidly obtain advanced results in several key research areas of plant genetic diversity. Both the management and treatment of large amounts of SNP data are rendered considerably easier for end-users through automation and integration. Current developments are taking into account new advances in high-throughput technologies.SNiPlay is available at: http://sniplay.cirad.fr/.

Developing Single Nucleotide Polymorphism (SNP) markers from transcriptome sequences for the identification of longan (Dimocarpus longan) germplasm

USDA-ARS?s Scientific Manuscript database

Longan (Dimocarpus longan Lour.) is an important tropical fruit tree crop. Accurate varietal identification is essential for germplasm management and breeding. Using longan transcriptome sequences from public databases, we developed single nucleotide polymorphism (SNP) markers; validated 60 SNPs in...

Association of calcium sensing receptor polymorphisms at rs1801725 with circulating calcium in breast cancer patients.

PubMed

Wang, Li; Widatalla, Sarrah E; Whalen, Diva S; Ochieng, Josiah; Sakwe, Amos M

2017-08-02

Breast cancer (BC) patients with late-stage and/or rapidly growing tumors are prone to develop high serum calcium levels which have been shown to be associated with larger and aggressive breast tumors in post and premenopausal women respectively. Given the pivotal role of the calcium sensing receptor (CaSR) in calcium homeostasis, we evaluated whether polymorphisms of the CASR gene at rs1801725 and rs1801726 SNPs in exon 7, are associated with circulating calcium levels in African American and Caucasian control subjects and BC cases. In this retrospective case-control study, we assessed the mean circulating calcium levels, the distribution of two inactivating CaSR SNPs at rs1801725 and rs1801726 in 199 cases and 384 age-matched controls, and used multivariable regression analysis to determine whether these SNPs are associated with circulating calcium in control subjects and BC cases. We found that the mean circulating calcium levels in African American subjects were higher than those in Caucasian subjects (p < 0.001). As expected, the mean calcium levels were higher in BC cases compared to control subjects (p < 0.001), but the calcium levels in BC patients were independent of race. We also show that in BC cases and control subjects, the major alleles at rs1801725 (G/T, A986S) and at rs1801726 (C/G, Q1011E) were common among Caucasians and African Americans respectively. Compared to the wild type alleles, polymorphisms at the rs1801725 SNP were associated with higher calcium levels (p = 0.006) while those at rs1801726 were not. Using multivariable linear mixed-effects models and adjusting for age and race, we show that circulating calcium levels in BC cases were associated with tumor grade (p = 0.009), clinical stage (p = 0.003) and more importantly, with inactivating mutations of the CASR at the rs1801725 SNP (p = 0.038). These data suggest that decreased sensitivity of the CaSR to calcium due to inactivating polymorphisms at rs1801725, may predispose up to 20% of BC cases to high circulating calcium-associated larger and/or aggressive breast tumors.

Genome Wide Association Study and Follow-Up Analysis of Adiposity Traits in Hispanic-Americans: the IRAS Family Study

PubMed Central

Norris, Jill M.; Langefeld, Carl D.; Talbert, Matthew E.; Wing, Maria R.; Haritunians, Talin; Fingerlin, Tasha E.; Hanley, Anthony J. G.; Ziegler, Julie T.; Taylor, Kent D.; Haffner, Steven M.; Chen, Yii-Der I.; Bowden, Donald W.; Wagenknecht, Lynne E.

2010-01-01

We investigated candidate genomic regions associated with computed tomography (CT)-derived measures of adiposity in Hispanic from the IRAS Family Study. In 1190 Hispanic individuals from 92 families from the San Luis Valley, CO and San Antonio, TX, we measured CT-derived visceral adipose tissue (VAT); subcutaneous adipose tissue (SAT); and visceral: subcutaneous ratio (VSR). A genome-wide association study (GWAS) was completed using the Illumina HumanHap 300 BeadChip (~317K single nucleotide polymorphisms (SNPs)) in 229 individuals from the San Antonio site (Stage 1). Two hundred ninety-seven SNPs with evidence for association with VAT, SAT, or VSR, adjusting for age and sex (p<0.001), were genotyped in the remaining 961 Hispanic samples. The entire Hispanic cohort (n = 1190) was then tested for association, adjusting for age, sex, site of recruitment and admixture estimates (Stage 2). In Stage 3, additional SNPs were genotyped in four genic regions showing evidence of association in Stage 2. Several SNPs were associated in the GWAS (p<1×10−5) and were confirmed to be significantly associated in the entire Hispanic cohort (p<0.01), including: rs7543757 for VAT; rs4754373, and rs11212913 for SAT; and rs4541696, and rs4134351 for VSR. Numerous SNPs were associated with multiple adiposity phenotypes. Targeted analysis of four genes whose SNPs were significant in Stage 2 suggest candidate genes for influencing the distribution (RGS6) and amount of adiposity (NGEF). Several candidate loci, including RGS6 and NGEF, are associated with CT-derived adipose fat measures in Hispanic Americans in a three-stage genetic association study. PMID:19461586

Genome-wide association study and follow-up analysis of adiposity traits in Hispanic Americans: the IRAS Family Study.

PubMed

Norris, Jill M; Langefeld, Carl D; Talbert, Matthew E; Wing, Maria R; Haritunians, Talin; Fingerlin, Tasha E; Hanley, Anthony J G; Ziegler, Julie T; Taylor, Kent D; Haffner, Steven M; Chen, Yii-Der I; Bowden, Donald W; Wagenknecht, Lynne E

2009-10-01

We investigated candidate genomic regions associated with computed tomography (CT)-derived measures of adiposity in Hispanics from the Insulin Resistance Atherosclerosis Study Family Study (IRASFS). In 1,190 Hispanic individuals from 92 families 3 from the San Luis Valley, Colorado and San Antonio, Texas, we measured CT-derived visceral adipose tissue (VAT), subcutaneous adipose tissue (SAT), and visceral:subcutaneous ratio (VSR). A genome-wide association study (GWAS) was completed using the Illumina HumanHap 300 BeadChip (approximately 317K single-nucleotide polymorphisms (SNPs)) in 229 individuals from the San Antonio site (stage 1). In total, 297 SNPs with evidence for association with VAT, SAT, or VSR, adjusting for age and sex (P<0.001), were genotyped in the remaining 961 Hispanic samples. The entire Hispanic cohort (n=1,190) was then tested for association, adjusting for age, sex, site of recruitment, and admixture estimates (stage 2). In stage 3, additional SNPs were genotyped in four genic regions showing evidence of association in stage 2. Several SNPs were associated in the GWAS (P<1x10(-5)) and were confirmed to be significantly associated in the entire Hispanic cohort (P<0.01), including: rs7543757 for VAT, rs4754373 and rs11212913 for SAT, and rs4541696 and rs4134351 for VSR. Numerous SNPs were associated with multiple adiposity phenotypes. Targeted analysis of four genes whose SNPs were significant in stage 2 suggests candidate genes for influencing the distribution (RGS6) and amount of adiposity (NGEF). Several candidate loci, including RGS6 and NGEF, are associated with CT-derived adipose fat measures in Hispanic Americans in a three-stage genetic association study.

Complex Variation in Measures of General Intelligence and Cognitive Change

PubMed Central

Rowe, Suzanne J.; Rowlatt, Amy; Davies, Gail; Harris, Sarah E.; Porteous, David J.; Liewald, David C.; McNeill, Geraldine; Starr, John M.

2013-01-01

Combining information from multiple SNPs may capture a greater amount of genetic variation than from the sum of individual SNP effects and help identifying missing heritability. Regions may capture variation from multiple common variants of small effect, multiple rare variants or a combination of both. We describe regional heritability mapping of human cognition. Measures of crystallised (gc) and fluid intelligence (gf) in late adulthood (64–79 years) were available for 1806 individuals genotyped for 549,692 autosomal single nucleotide polymorphisms (SNPs). The same individuals were tested at age 11, enabling us the rare opportunity to measure cognitive change across most of their lifespan. 547,750 SNPs ranked by position are divided into 10, 908 overlapping regions of 101 SNPs to estimate the genetic variance each region explains, an approach that resembles classical linkage methods. We also estimate the genetic variation explained by individual autosomes and by SNPs within genes. Empirical significance thresholds are estimated separately for each trait from whole genome scans of 500 permutated data sets. The 5% significance threshold for the likelihood ratio test of a single region ranged from 17–17.5 for the three traits. This is the equivalent to nominal significance under the expectation of a chi-squared distribution (between 1df and 0) of P<1.44×10−5. These thresholds indicate that the distribution of the likelihood ratio test from this type of variance component analysis should be estimated empirically. Furthermore, we show that estimates of variation explained by these regions can be grossly overestimated. After applying permutation thresholds, a region for gf on chromosome 5 spanning the PRRC1 gene is significant at a genome-wide 10% empirical threshold. Analysis of gene methylation on the temporal cortex provides support for the association of PRRC1 and fluid intelligence (P = 0.004), and provides a prime candidate gene for high throughput sequencing of these uniquely informative cohorts. PMID:24349040

Comparison of Genetic Variants in Cancer-Related Genes between Chinese Hui and Han Populations

PubMed Central

Tian, Chaoyong; Chen, Zhiqiang; Ma, Xixian; Yang, Ming; Wang, Zhizhong; Dong, Ying; Yang, Ting; Yang, Wenjun

2015-01-01

Background The Chinese Hui population, as the second largest minority ethnic group in China, may have a different genetic background from Han people because of its unique demographic history. In this study, we aimed to identify genetic differences between Han and Hui Chinese from the Ningxia region of China by comparing eighteen single nucleotide polymorphisms in cancer-related genes. Methods DNA samples were collected from 99 Hui and 145 Han people from the Ningxia Hui Autonomous Region in China, and SNPs were detected using an improved multiplex ligase detection reaction method. Genotyping data from six 1000 Genomes Project population samples (99 Utah residents with northern and western European ancestry (CEU), 107 Toscani in Italy (TSI), 108 Yoruba in Ibadan (YRI), 61 of African ancestry in the southwestern US (ASW), 103 Han Chinese in Beijing (CHB), and 104 Japanese in Tokyo (JPT)) were also included in this study. Differences in the distribution of alleles among the populations were assessed using χ2 tests, and FST was used to measure the degree of population differentiation. Results We found that the genetic diversity of many SNPs in cancer-related genes in the Hui Chinese in Ningxia was different from that in the Han Chinese in Ningxia. For example, the allele frequencies of four SNPs (rs13361707, rs2274223, rs465498, and rs753955) showed different genetic distributions (p<0.05) between Chinese Ningxia Han and Chinese Ningxia Hui. Five SNPs (rs730506, rs13361707, rs2274223, rs465498 and rs753955) had different FST values (FST >0.000) between the Hui and Han populations. Conclusions These results suggest that some SNPs associated with cancer-related genes vary among different Chinese ethnic groups. We suggest that population differences should be carefully considered in evaluating cancer risk and prognosis as well as the efficacy of cancer therapy. PMID:26683024

Comparison of Genetic Variants in Cancer-Related Genes between Chinese Hui and Han Populations.

PubMed

Tian, Chaoyong; Chen, Zhiqiang; Ma, Xixian; Yang, Ming; Wang, Zhizhong; Dong, Ying; Yang, Ting; Yang, Wenjun

2015-01-01

The Chinese Hui population, as the second largest minority ethnic group in China, may have a different genetic background from Han people because of its unique demographic history. In this study, we aimed to identify genetic differences between Han and Hui Chinese from the Ningxia region of China by comparing eighteen single nucleotide polymorphisms in cancer-related genes. DNA samples were collected from 99 Hui and 145 Han people from the Ningxia Hui Autonomous Region in China, and SNPs were detected using an improved multiplex ligase detection reaction method. Genotyping data from six 1000 Genomes Project population samples (99 Utah residents with northern and western European ancestry (CEU), 107 Toscani in Italy (TSI), 108 Yoruba in Ibadan (YRI), 61 of African ancestry in the southwestern US (ASW), 103 Han Chinese in Beijing (CHB), and 104 Japanese in Tokyo (JPT)) were also included in this study. Differences in the distribution of alleles among the populations were assessed using χ2 tests, and FST was used to measure the degree of population differentiation. We found that the genetic diversity of many SNPs in cancer-related genes in the Hui Chinese in Ningxia was different from that in the Han Chinese in Ningxia. For example, the allele frequencies of four SNPs (rs13361707, rs2274223, rs465498, and rs753955) showed different genetic distributions (p<0.05) between Chinese Ningxia Han and Chinese Ningxia Hui. Five SNPs (rs730506, rs13361707, rs2274223, rs465498 and rs753955) had different FST values (FST>0.000) between the Hui and Han populations. These results suggest that some SNPs associated with cancer-related genes vary among different Chinese ethnic groups. We suggest that population differences should be carefully considered in evaluating cancer risk and prognosis as well as the efficacy of cancer therapy.

Selected single-nucleotide polymorphisms in FOXE1, SERPINA5, FTO, EVPL, TICAM1 and SCARB1 are associated with papillary and follicular thyroid cancer risk: replication study in a German population

PubMed Central

Sigurdson, Alice J.; Brenner, Alina V.; Roach, James A.; Goudeva, Lilia; Müller, Jörg A.; Nerlich, Kai; Reiners, Christoph; Schwab, Robert; Pfeiffer, Liliane; Waldenberger, Melanie; Braganza, Melissa; Xu, Li; Sturgis, Erich M.; Yeager, Meredith; Chanock, Stephen J.; Pfeiffer, Ruth M.; Abend, Michael; Port, Matthias

2016-01-01

Several single-nucleotide polymorphisms (SNPs) have been associated with papillary and follicular thyroid cancer (PTC and FTC, respectively) risk, but few have replicated. After analyzing 17525 tag SNPs in 1129 candidate genes, we found associations with PTC risk in SERPINA5, FTO, HEMGN (near FOXE1) and other genes. Here, we report results from a replication effort in a large independent PTC/FTC case–control study conducted in Germany. We evaluated the best tagging SNPs from our previous PTC study and additionally included SNPs in or near FOXE1 and NKX2-1 genes, known susceptibility loci for thyroid cancer. We genotyped 422 PTC and 130 FTC cases and 752 controls recruited from three German clinical centers. We used polytomous logistic regression to simultaneously estimate PTC and FTC associations for 79 SNPs based on log-additive models. We assessed effect modification by body mass index (BMI), gender and age for all SNPs, and selected SNP by SNP interactions. We confirmed associations with PTC and SNPs in FOXE1/HEMGN, SERPINA5 (rs2069974), FTO (rs8047395), EVPL (rs2071194), TICAM1 (rs8120) and SCARB1 (rs11057820) genes. We found associations with SNPs in FOXE1, SERPINA5, FTO, TICAM1 and HSPA6 and FTC. We found two significant interactions between FTO (rs8047395) and BMI (P = 0.0321) and between TICAM1 (rs8120) and FOXE1 (rs10984377) (P = 0.0006). Besides the known associations with FOXE1 SNPs, we confirmed additional PTC SNP associations reported previously. We also found several new associations with FTC risk and noteworthy interactions. We conclude that multiple variants and host factors might interact in complex ways to increase risk of PTC and FTC. PMID:27207655

Development and Evaluation of a Genome-Wide 6K SNP Array for Diploid Sweet Cherry and Tetraploid Sour Cherry

PubMed Central

Peace, Cameron; Bassil, Nahla; Main, Dorrie; Ficklin, Stephen; Rosyara, Umesh R.; Stegmeir, Travis; Sebolt, Audrey; Gilmore, Barbara; Lawley, Cindy; Mockler, Todd C.; Bryant, Douglas W.; Wilhelm, Larry; Iezzoni, Amy

2012-01-01

High-throughput genome scans are important tools for genetic studies and breeding applications. Here, a 6K SNP array for use with the Illumina Infinium® system was developed for diploid sweet cherry (Prunus avium) and allotetraploid sour cherry (P. cerasus). This effort was led by RosBREED, a community initiative to enable marker-assisted breeding for rosaceous crops. Next-generation sequencing in diverse breeding germplasm provided 25 billion basepairs (Gb) of cherry DNA sequence from which were identified genome-wide SNPs for sweet cherry and for the two sour cherry subgenomes derived from sweet cherry (avium subgenome) and P. fruticosa (fruticosa subgenome). Anchoring to the peach genome sequence, recently released by the International Peach Genome Initiative, predicted relative physical locations of the 1.9 million putative SNPs detected, preliminarily filtered to 368,943 SNPs. Further filtering was guided by results of a 144-SNP subset examined with the Illumina GoldenGate® assay on 160 accessions. A 6K Infinium® II array was designed with SNPs evenly spaced genetically across the sweet and sour cherry genomes. SNPs were developed for each sour cherry subgenome by using minor allele frequency in the sour cherry detection panel to enrich for subgenome-specific SNPs followed by targeting to either subgenome according to alleles observed in sweet cherry. The array was evaluated using panels of sweet (n = 269) and sour (n = 330) cherry breeding germplasm. Approximately one third of array SNPs were informative for each crop. A total of 1825 polymorphic SNPs were verified in sweet cherry, 13% of these originally developed for sour cherry. Allele dosage was resolved for 2058 polymorphic SNPs in sour cherry, one third of these being originally developed for sweet cherry. This publicly available genomics resource represents a significant advance in cherry genome-scanning capability that will accelerate marker-locus-trait association discovery, genome structure investigation, and genetic diversity assessment in this diploid-tetraploid crop group. PMID:23284615

Selected single-nucleotide polymorphisms in FOXE1, SERPINA5, FTO, EVPL, TICAM1 and SCARB1 are associated with papillary and follicular thyroid cancer risk: replication study in a German population.

PubMed

Sigurdson, Alice J; Brenner, Alina V; Roach, James A; Goudeva, Lilia; Müller, Jörg A; Nerlich, Kai; Reiners, Christoph; Schwab, Robert; Pfeiffer, Liliane; Waldenberger, Melanie; Braganza, Melissa; Xu, Li; Sturgis, Erich M; Yeager, Meredith; Chanock, Stephen J; Pfeiffer, Ruth M; Abend, Michael; Port, Matthias

2016-07-01

Several single-nucleotide polymorphisms (SNPs) have been associated with papillary and follicular thyroid cancer (PTC and FTC, respectively) risk, but few have replicated. After analyzing 17525 tag SNPs in 1129 candidate genes, we found associations with PTC risk in SERPINA5, FTO, HEMGN (near FOXE1) and other genes. Here, we report results from a replication effort in a large independent PTC/FTC case-control study conducted in Germany. We evaluated the best tagging SNPs from our previous PTC study and additionally included SNPs in or near FOXE1 and NKX2-1 genes, known susceptibility loci for thyroid cancer. We genotyped 422 PTC and 130 FTC cases and 752 controls recruited from three German clinical centers. We used polytomous logistic regression to simultaneously estimate PTC and FTC associations for 79 SNPs based on log-additive models. We assessed effect modification by body mass index (BMI), gender and age for all SNPs, and selected SNP by SNP interactions. We confirmed associations with PTC and SNPs in FOXE1/HEMGN, SERPINA5 (rs2069974), FTO (rs8047395), EVPL (rs2071194), TICAM1 (rs8120) and SCARB1 (rs11057820) genes. We found associations with SNPs in FOXE1, SERPINA5, FTO, TICAM1 and HSPA6 and FTC. We found two significant interactions between FTO (rs8047395) and BMI (P = 0.0321) and between TICAM1 (rs8120) and FOXE1 (rs10984377) (P = 0.0006). Besides the known associations with FOXE1 SNPs, we confirmed additional PTC SNP associations reported previously. We also found several new associations with FTC risk and noteworthy interactions. We conclude that multiple variants and host factors might interact in complex ways to increase risk of PTC and FTC. Published by Oxford University Press 2016.

A global perspective on hepatitis B‐related single nucleotide polymorphisms and evolution during human migration

PubMed Central

Jeng, Wen‐Juei; Lin, Chun‐Yen

2017-01-01

Genome‐wide association studies have indicated that human leukocyte antigen (HLA)‐DP and HLA‐DQ play roles in persistent hepatitis B virus (HBV) infection in Asia. To understand the evolution of HBV‐related single nucleotide polymorphisms (SNPs) and to correlate these SNPs with chronic HBV infection among different populations, we conducted a global perspective study on hepatitis‐related SNPs. We selected 12 HBV‐related SNPs on the HLA locus and two HBV and three hepatitis C virus immune‐related SNPs for analysis. Five nasopharyngeal carcinoma‐related SNPs served as controls. All SNP data worldwide from 26 populations were downloaded from 1,000 genomes. We found a dramatic difference in the allele frequency in most of the HBV‐ and HLA‐related SNPs in East Asia compared to the other continents. A sharp change in allele frequency in 8 of 12 SNPs was found between Bengali populations in Bangladesh and Chinese Dai populations in Xishuangbanna, China (P < 0.001); these areas represent the junction of South and East Asia. For the immune‐related SNPs, significant changes were found after leaving Africa. Most of these genes shifted from higher expression genotypes in Africa to lower expression genotypes in either Europe or South Asia (P < 0.001). During this two‐stage adaptation, immunity adjusted toward a weak immune response, which could have been a survival strategy during human migration to East Asia. The prevalence of chronic HBV infection in Africa is as high as in Asia; however, the HBV‐related SNP genotypes are not present in Africa, and so the genetic mechanism of chronic HBV infection in Africa needs further exploration. Conclusion: Two stages of genetic changes toward a weak immune response occurred when humans migrated out of Africa. These changes could be a survival strategy for avoiding cytokine storms and surviving in new environments. (Hepatology Communications 2017;1:1005–1013) PMID:29404438

Incorporating Single-nucleotide Polymorphisms Into the Lyman Model to Improve Prediction of Radiation Pneumonitis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Tucker, Susan L., E-mail: sltucker@mdanderson.org; Li Minghuan; Xu Ting

2013-01-01

Purpose: To determine whether single-nucleotide polymorphisms (SNPs) in genes associated with DNA repair, cell cycle, transforming growth factor-{beta}, tumor necrosis factor and receptor, folic acid metabolism, and angiogenesis can significantly improve the fit of the Lyman-Kutcher-Burman (LKB) normal-tissue complication probability (NTCP) model of radiation pneumonitis (RP) risk among patients with non-small cell lung cancer (NSCLC). Methods and Materials: Sixteen SNPs from 10 different genes (XRCC1, XRCC3, APEX1, MDM2, TGF{beta}, TNF{alpha}, TNFR, MTHFR, MTRR, and VEGF) were genotyped in 141 NSCLC patients treated with definitive radiation therapy, with or without chemotherapy. The LKB model was used to estimate the risk ofmore » severe (grade {>=}3) RP as a function of mean lung dose (MLD), with SNPs and patient smoking status incorporated into the model as dose-modifying factors. Multivariate analyses were performed by adding significant factors to the MLD model in a forward stepwise procedure, with significance assessed using the likelihood-ratio test. Bootstrap analyses were used to assess the reproducibility of results under variations in the data. Results: Five SNPs were selected for inclusion in the multivariate NTCP model based on MLD alone. SNPs associated with an increased risk of severe RP were in genes for TGF{beta}, VEGF, TNF{alpha}, XRCC1 and APEX1. With smoking status included in the multivariate model, the SNPs significantly associated with increased risk of RP were in genes for TGF{beta}, VEGF, and XRCC3. Bootstrap analyses selected a median of 4 SNPs per model fit, with the 6 genes listed above selected most often. Conclusions: This study provides evidence that SNPs can significantly improve the predictive ability of the Lyman MLD model. With a small number of SNPs, it was possible to distinguish cohorts with >50% risk vs <10% risk of RP when they were exposed to high MLDs.« less

Genetic polymorphisms related to efficacy and overuse of triptans in chronic migraine.

PubMed

Gentile, Giovanna; Borro, Marina; Lala, Noemi; Missori, Serena; Simmaco, Maurizio; Martelletti, Paolo

2010-10-01

Migraine is a common type of headache and its most severe attacks are usually treated with triptans, the efficacy of which is extremely variable. Several SNPs in genes involved in metabolism and target mechanisms of triptans have been described. To define an association between genetic profile and triptan response, we classified a migrainous population on the basis of triptan response and characterized it for polymorphisms in the genes coding for monoamine oxidase A, G protein β3 and the cytochrome CYP1A2. Analysis of the association between genotypic and allelic frequencies of the analyzed SNPs and the grade of response to triptan administration showed a significant correlation for MAOA uVNTR polymorphism. Further stratification of patients in abuser and non-abuser groups revealed a significant association with triptan overuse and, within the abusers, with drug response to the CYP1A2*1F variant.

Identification and validation of single nucleotide polymorphisms as tools to detect hybridization and population structure in freshwater stingrays.

PubMed

Cruz, Vanessa P; Vera, Manuel; Pardo, Belén G; Taggart, John; Martinez, Paulino; Oliveira, Claudio; Foresti, Fausto

2017-05-01

Single nucleotide polymorphism (SNP) markers were identified and validated for two stingrays species, Potamotrygon motoro and Potamotrygon falkneri, using double digest restriction-site associated DNA (ddRAD) reads using 454-Roche technology. A total of 226 774 reads (65.5 Mb) were obtained (mean read length 289 ± 183 bp) detecting a total of 5399 contigs (mean contig length: 396 ± 91 bp). Mining this data set, a panel of 143 in silico SNPs was selected. Eighty-two of these SNPs were successfully validated and 61 were polymorphic: 14 in P. falkneri, 21 in P. motoro, 3 in both species and 26 fixed for alternative variants in both species, thus being useful for population analyses and hybrid detection. © 2016 John Wiley & Sons Ltd.

The α‐synuclein gene in multiple system atrophy

PubMed Central

Ozawa, T; Healy, D G; Abou‐Sleiman, P M; Ahmadi, K R; Quinn, N; Lees, A J; Shaw, K; Wullner, U; Berciano, J; Moller, J C; Kamm, C; Burk, K; Josephs, K A; Barone, P; Tolosa, E; Goldstein, D B; Wenning, G; Geser, F; Holton, J L; Gasser, T; Revesz, T; Wood, N W

2006-01-01

Background The formation of α‐synuclein aggregates may be a critical event in the pathogenesis of multiple system atrophy (MSA). However, the role of this gene in the aetiology of MSA is unknown and untested. Method The linkage disequilibrium (LD) structure of the α‐synuclein gene was established and LD patterns were used to identify a set of tagging single nucleotide polymorphisms (SNPs) that represent 95% of the haplotype diversity across the entire gene. The effect of polymorphisms on the pathological expression of MSA in pathologically confirmed cases was also evaluated. Results and conclusion In 253 Gilman probable or definite MSA patients, 457 possible, probable, and definite MSA cases and 1472 controls, a frequency difference for the individual tagging SNPs or tag‐defined haplotypes was not detected. No effect was observed of polymorphisms on the pathological expression of MSA in pathologically confirmed cases. PMID:16543523

No Association between Oxytocin Receptor (OXTR) Gene Polymorphisms and Experimentally Elicited Social Preferences

PubMed Central

Apicella, Coren L.; Cesarini, David; Johannesson, Magnus; Dawes, Christopher T.; Lichtenstein, Paul; Wallace, Björn; Beauchamp, Jonathan; Westberg, Lars

2010-01-01

Background Oxytocin (OXT) has been implicated in a suite of complex social behaviors including observed choices in economic laboratory experiments. However, actual studies of associations between oxytocin receptor (OXTR) gene variants and experimentally elicited social preferences are rare. Methodology/Principal Findings We test hypotheses of associations between social preferences, as measured by behavior in two economic games, and 9 single nucleotide polymorphisms (SNPs) of the OXTR gene in a sample of Swedish twins (n = 684). Two standard economic games, the dictator game and the trust game, both involving real monetary consequences, were used to elicit such preferences. After correction for multiple hypothesis testing, we found no significant associations between any of the 9 single nucleotide polymorphisms (SNPs) and behavior in either of the games. Conclusion We were unable to replicate the most significant association reported in previous research between the amount donated in a dictator game and an OXTR genetic variant. PMID:20585395

No association between oxytocin receptor (OXTR) gene polymorphisms and experimentally elicited social preferences.

PubMed

Apicella, Coren L; Cesarini, David; Johannesson, Magnus; Dawes, Christopher T; Lichtenstein, Paul; Wallace, Björn; Beauchamp, Jonathan; Westberg, Lars

2010-06-16

Oxytocin (OXT) has been implicated in a suite of complex social behaviors including observed choices in economic laboratory experiments. However, actual studies of associations between oxytocin receptor (OXTR) gene variants and experimentally elicited social preferences are rare. We test hypotheses of associations between social preferences, as measured by behavior in two economic games, and 9 single nucleotide polymorphisms (SNPs) of the OXTR gene in a sample of Swedish twins (n = 684). Two standard economic games, the dictator game and the trust game, both involving real monetary consequences, were used to elicit such preferences. After correction for multiple hypothesis testing, we found no significant associations between any of the 9 single nucleotide polymorphisms (SNPs) and behavior in either of the games. We were unable to replicate the most significant association reported in previous research between the amount donated in a dictator game and an OXTR genetic variant.

Partitioned learning of deep Boltzmann machines for SNP data.

PubMed

Hess, Moritz; Lenz, Stefan; Blätte, Tamara J; Bullinger, Lars; Binder, Harald

2017-10-15

Learning the joint distributions of measurements, and in particular identification of an appropriate low-dimensional manifold, has been found to be a powerful ingredient of deep leaning approaches. Yet, such approaches have hardly been applied to single nucleotide polymorphism (SNP) data, probably due to the high number of features typically exceeding the number of studied individuals. After a brief overview of how deep Boltzmann machines (DBMs), a deep learning approach, can be adapted to SNP data in principle, we specifically present a way to alleviate the dimensionality problem by partitioned learning. We propose a sparse regression approach to coarsely screen the joint distribution of SNPs, followed by training several DBMs on SNP partitions that were identified by the screening. Aggregate features representing SNP patterns and the corresponding SNPs are extracted from the DBMs by a combination of statistical tests and sparse regression. In simulated case-control data, we show how this can uncover complex SNP patterns and augment results from univariate approaches, while maintaining type 1 error control. Time-to-event endpoints are considered in an application with acute myeloid leukemia patients, where SNP patterns are modeled after a pre-screening based on gene expression data. The proposed approach identified three SNPs that seem to jointly influence survival in a validation dataset. This indicates the added value of jointly investigating SNPs compared to standard univariate analyses and makes partitioned learning of DBMs an interesting complementary approach when analyzing SNP data. A Julia package is provided at 'http://github.com/binderh/BoltzmannMachines.jl'. binderh@imbi.uni-freiburg.de. Supplementary data are available at Bioinformatics online. © The Author (2017). Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com

HapMap filter 1.0: a tool to preprocess the HapMap genotypic data for association studies.

PubMed

Zhang, Wei; Duan, Shiwei; Dolan, M Eileen

2008-05-13

The International HapMap Project provides a resource of genotypic data on single nucleotide polymorphisms (SNPs), which can be used in various association studies to identify the genetic determinants for phenotypic variations. Prior to the association studies, the HapMap dataset should be preprocessed in order to reduce the computation time and control the multiple testing problem. The less informative SNPs including those with very low genotyping rate and SNPs with rare minor allele frequencies to some extent in one or more population are removed. Some research designs only use SNPs in a subset of HapMap cell lines. Although the HapMap website and other association software packages have provided some basic tools for optimizing these datasets, a fast and user-friendly program to generate the output for filtered genotypic data would be beneficial for association studies. Here, we present a flexible, straight-forward bioinformatics program that can be useful in preparing the HapMap genotypic data for association studies by specifying cell lines and two common filtering criteria: minor allele frequencies and genotyping rate. The software was developed for Microsoft Windows and written in C++. The Windows executable and source code in Microsoft Visual C++ are available at Google Code (http://hapmap-filter-v1.googlecode.com/) or upon request. Their distribution is subject to GNU General Public License v3.

Molecular complexity of successive bacterial epidemics deconvoluted by comparative pathogenomics.

PubMed

Beres, Stephen B; Carroll, Ronan K; Shea, Patrick R; Sitkiewicz, Izabela; Martinez-Gutierrez, Juan Carlos; Low, Donald E; McGeer, Allison; Willey, Barbara M; Green, Karen; Tyrrell, Gregory J; Goldman, Thomas D; Feldgarden, Michael; Birren, Bruce W; Fofanov, Yuriy; Boos, John; Wheaton, William D; Honisch, Christiane; Musser, James M

2010-03-02

Understanding the fine-structure molecular architecture of bacterial epidemics has been a long-sought goal of infectious disease research. We used short-read-length DNA sequencing coupled with mass spectroscopy analysis of SNPs to study the molecular pathogenomics of three successive epidemics of invasive infections involving 344 serotype M3 group A Streptococcus in Ontario, Canada. Sequencing the genome of 95 strains from the three epidemics, coupled with analysis of 280 biallelic SNPs in all 344 strains, revealed an unexpectedly complex population structure composed of a dynamic mixture of distinct clonally related complexes. We discovered that each epidemic is dominated by micro- and macrobursts of multiple emergent clones, some with distinct strain genotype-patient phenotype relationships. On average, strains were differentiated from one another by only 49 SNPs and 11 insertion-deletion events (indels) in the core genome. Ten percent of SNPs are strain specific; that is, each strain has a unique genome sequence. We identified nonrandom temporal-spatial patterns of strain distribution within and between the epidemic peaks. The extensive full-genome data permitted us to identify genes with significantly increased rates of nonsynonymous (amino acid-altering) nucleotide polymorphisms, thereby providing clues about selective forces operative in the host. Comparative expression microarray analysis revealed that closely related strains differentiated by seemingly modest genetic changes can have significantly divergent transcriptomes. We conclude that enhanced understanding of bacterial epidemics requires a deep-sequencing, geographically centric, comparative pathogenomics strategy.

Studying the genetic basis of speciation in high gene flow marine invertebrates

PubMed Central

2016-01-01

A growing number of genes responsible for reproductive incompatibilities between species (barrier loci) exhibit the signals of positive selection. However, the possibility that genes experiencing positive selection diverge early in speciation and commonly cause reproductive incompatibilities has not been systematically investigated on a genome-wide scale. Here, I outline a research program for studying the genetic basis of speciation in broadcast spawning marine invertebrates that uses a priori genome-wide information on a large, unbiased sample of genes tested for positive selection. A targeted sequence capture approach is proposed that scores single-nucleotide polymorphisms (SNPs) in widely separated species populations at an early stage of allopatric divergence. The targeted capture of both coding and non-coding sequences enables SNPs to be characterized at known locations across the genome and at genes with known selective or neutral histories. The neutral coding and non-coding SNPs provide robust background distributions for identifying FST-outliers within genes that can, in principle, identify specific mutations experiencing diversifying selection. If natural hybridization occurs between species, the neutral coding and non-coding SNPs can provide a neutral admixture model for genomic clines analyses aimed at finding genes exhibiting strong blocks to introgression. Strongylocentrotid sea urchins are used as a model system to outline the approach but it can be used for any group that has a complete reference genome available. PMID:29491951

Prevalence, Patterns, and Genetic Association Analysis of Modic Vertebral Endplate Changes.

PubMed

Kanna, Rishi Mugesh; Shanmuganathan, Rajasekaran; Rajagopalan, Veera Ranjani; Natesan, Senthil; Muthuraja, Raveendran; Cheung, Kenneth Man Chee; Chan, Danny; Kao, Patrick Yu Ping; Yee, Anita; Shetty, Ajoy Prasad

2017-08-01

A prospective genetic association study. The etiology of Modic changes (MCs) is unclear. Recently, the role of genetic factors in the etiology of MCs has been evaluated. However, studies with a larger patient subset are lacking, and candidate genes involved in other disc degeneration phenotypes have not been evaluated. We studied the prevalence of MCs and genetic association of 41 candidate genes in a large Indian cohort. MCs are vertebral endplate signal changes predominantly observed in the lumbar spine. A significant association between MCs and lumbar disc degeneration and nonspecific low back pain has been described, with the etiopathogenesis implicating various mechanical, infective, and biochemical factors. We studied 809 patients using 1.5-T magnetic resonance imaging to determine the prevalence, patterns, distribution, and type of lumbar MCs. Genetic association analysis of 71 single nucleotide polymorphisms (SNPs) of 41 candidate genes was performed based on the presence or absence of MCs. SNPs were genotyped using the Sequenome platform, and an association test was performed using PLINK software. The mean age of the study population (n=809) was 36.7±10.8 years. Based on the presence of MCs, the cohort was divided into 702 controls and 107 cases (prevalence, 13%). MCs were more commonly present in the lower (149/251, 59.4%) than in the upper (102/251, 40.6%) endplates. L4-5 endplates were the most commonly affected levels (30.7%). Type 2 MCs were the most commonly observed pattern (n=206, 82%). The rs2228570 SNP of VDR ( p =0.02) and rs17099008 SNP of MMP20 ( p =0.03) were significantly associated with MCs. Genetic polymorphisms of SNPs of VDR and MMP20 were significantly associated with MCs. Understanding the etiopathogenetic mechanisms of MCs is important for planning preventive and therapeutic strategies.

Different Contributions of CDKAL1, KIF21B, and LRRK2/MUC19 Polymorphisms to SAPHO Syndrome, Rheumatoid Arthritis, Ankylosing Spondylitis, and Seronegative Spondyloarthropathy.

PubMed

Li, Nan; Ma, Junfen; Li, Kai; Guo, Changlong; Ming, Liang

2017-02-01

Synovitis, acne, pustulosis, hyperostosis, and osteitis (SAPHO) syndrome, rheumatoid arthritis (RA), ankylosing spondylitis (AS), and seronegative spondyloarthropathy (SPA) are autoimmune diseases of unknown etiology, which share some clinical manifestations in common. Previous family-based investigations support genetic contributions to the susceptibility of these diseases. The current study evaluated whether three previously reported AS-associated single-nucleotide polymorphisms (SNPs), rs6908425 T>C in CDKAL1, rs11584383 T>C near KIF21B, and rs11175593 C>T near LRRK2/MUC19, have any genetic overlap across multiple autoimmune diseases including SAPHO syndrome, RA, AS, and SPA. Genomic DNA was obtained from 71 SAPHO, 125 RA, 67 AS, and 35 SPA Han Chinese patients, as well as 104 healthy controls. SNPs were genotyped by matrix-assisted laser desorption/ionization time-of-flight mass spectrometry. Genotype and allele frequencies were analyzed using chi-square test. rs6908425 T>C in CDKAL1 was significantly different between SAPHO cases and healthy controls (odds ratios = 2.056, 95% confidence intervals: 1.211-3.490; p = 0.007), but no SNPs were associated with the risk of developing RA, AS, or SPA (p > 0.05). Analysis of genotype distributions showed similar results. A significant difference was only found in the genotype frequency of rs6908425 in SAPHO cases (p = 0.004); no significant differences were detected among patients with RA, AS, and SPA (p > 0.05). Our results suggest that rs6908425 in CDKAL1 is associated with the risk of developing SAPHO in Han Chinese populations. People who carry the risk allele T of rs6908425 might be more prone to developing SAPHO syndrome.

Association of Inducible T Cell Costimulator Polymorphisms with Susceptibility and Outcome of Hepatitis B Virus Infection in a Chinese Han Population.

PubMed

Hu, J; Li, Q-L; Hou, S-H; Peng, H; Guo, J-J

2015-09-01

Inducible T cell costimulator (ICOS) functions to regulate cell-cell signalling, immune responses and cell proliferation. ICOS single nucleotide polymorphism (SNP) may affect protein expression and functions. This study investigated the association of ICOS SNPs with hepatitis B virus (HBV) infection and outcome in a Chinese population. A total of 1290 Chinese Han individuals were enrolled, including 63 asymptomatic HBV carriers, 220 chronic hepatitis B patients (CHB), 249 HBV-related liver cirrhosis patients (LC), 108 patients with HBV-related hepatocellular carcinoma (HCC), 338 patients with natural HBV clearance and 312 healthy subjects (as controls). DNA samples from these subjects were genotyped for four ICOS SNPs (rs11883722, rs10932029, rs1559931 and rs4675379) using TaqMan SNP Genotyping Assay and analysed. The data showed that genotype and allele frequencies of ICOS SNPs in cases and controls followed the Hardy-Weinberg distribution. The CC genotype of rs4675379 was higher in patients with HBV infection (including AC, CHB, LC and HCC) than in patients with HBV clearance (P = 0.006). Furthermore, the genotype 'GA' and the minor allele 'A' of rs1559931 were associated with a decreased HCC susceptibility (P < 0.001). Haplotype analysis data showed that 'GC' haplotype in block 2 (rs1559931 and rs4675379) had a lower frequency in patients than in HBV-cleared subjects (P = 0.034), although its overall frequency was only 1.6%. Our study found that ICOS rs1559931 SNP was associated with decreased HBV-related HCC risk in the studied Chinese Han population, except for patients with natural clearance of HBV. © 2015 The Foundation for the Scandinavian Journal of Immunology.

Geographic origin is not supported by the genetic variability found in a large living collection of Jatropha curcas with accessions from three continents.

PubMed

Maghuly, Fatemeh; Jankowicz-Cieslak, Joanna; Pabinger, Stephan; Till, Bradley J; Laimer, Margit

2015-04-01

Increasing economic interest in Jatropha curcas requires a major research focus on the genetic background and geographic origin of this non-edible biofuel crop. To determine the worldwide genetic structure of this species, amplified fragment length polymorphisms, inter simple sequence repeats, and novel single nucleotide polymorphisms (SNPs) were employed for a large collection of 907 J. curcas accessions and related species (RS) from three continents, 15 countries and 53 regions. PCoA, phenogram, and cophenetic analyses separated RS from two J. curcas groups. Accessions from Mexico, Bolivia, Paraguay, Kenya, and Ethiopia with unknown origins were found in both groups. In general, there was a considerable overlap between individuals from different regions and countries. The Bayesian approach using STRUCTURE demonstrated two groups with a low genetic variation. Analysis of molecular varience revealed significant variation among individuals within populations. SNPs found by in silico analyses of Δ12 fatty acid desaturase indicated possible changes in gene expression and thus in fatty acid profiles. SNP variation was higher in the curcin gene compared to genes involved in oil production. Novel SNPs allowed separating toxic, non-toxic, and Mexican accessions. The present study confirms that human activities had a major influence on the genetic diversity of J. curcas, not only because of domestication, but also because of biased selection. © 2015 The Authors. Biotechnology Journal published by Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim. This is an open access article under the terms of the Creative Commons Attribution License, which permits use, distribution and reproduction in any medium, provided the original work is properly cited.

A novel multiplex pyrosequencing assay for genotyping functionally relevant CTLA-4 polymorphisms: potential applications in autoimmunity and cancer.

PubMed

Banelli, Barbara; Morabito, Anna; Laurent, Stefania; Piccioli, Patrizia; Dozin, Beatrice; Ghio, Massimo; Ascierto, Paolo Antonio; Monteghirfo, Stefano; Marasco, Antonella; Ottaviano, Vincenzo; Queirolo, Paola; Romani, Massimo; Pistillo, Maria Pia

2014-08-01

CTLA-4 expression/function can be affected by single nucleotide polymorphisms (SNPs) of CTLA-4 gene, which have been widely associated with susceptibility or progression to autoimmune diseases and cancer development. In this study, we analyzed six CTLA-4 SNPs (-1661A>G, -1577G>A, -658C>T, -319C>T, +49A>G, CT60G>A) in 197 DNA samples from 43 B-lymphoblastoid cell lines (B-LCLs), 40 systemic sclerosis (SSc) patients, 14 pre-analyzed melanoma patients and 100 Italian healthy subjects. Genotyping of -1661A>G, -1577G>A, -658C>T and CT60G>A was performed by newly developed multiplex pyrosequencing (PSQ) assays, whereas -319C>T and +49A>G by T-ARMS PCR and direct sequencing. Genotype/allele frequency were analyzed using χ(2) or Fisher exact test. Our study provides the first multiplex PSQ method that allows simultaneous genotyping of two CTLA-4 SNP pairs (i.e. -1661A>G/-658C>T and -1577G>A/CT60G>A) by two multiplex PSQ reactions. Herein, we show the CTLA-4 genotype distribution in the B-LCLs providing the first and best characterized cell line panel typed for functionally relevant CTLA-4 SNPs. We also report the significant association of the -1661A/G genotype, -1661 & -319 AC-GT diplotype and -319 & CT60 TG haplotype with susceptibility to SSc without Hashimoto's thyroiditis occurrence. Furthermore, we confirmed previous genotyping data referred to melanoma patients and provided new genotyping data for Italian healthy subjects. Copyright © 2014 American Society for Histocompatibility and Immunogenetics. Published by Elsevier Inc. All rights reserved.

Association of the homeobox transcription factor gene ENGRAILED 2 with autistic disorder in Chinese children.

PubMed

Yang, Pinchen; Lung, For-Wey; Jong, Yuh-Jyh; Hsieh, Hsin-Yi; Liang, Chung-Ling; Juo, Suh-Hang Hank

2008-01-01

Autism is a neurodevelopmental disorder with a strong genetic component. Previous studies have mapped the disease to chromosome 7q, where the homeobox transcription factor ENGRAILED 2 (EN2) gene is located. EN2 is specifically involved in patterning the region that gives rise to the cerebellum. In the present work, we carried out a case-control study to determine whether 2 intronic single-nucleotide polymorphisms (SNPs) of EN2 are a susceptibility to autism in a Han Chinese population. We enrolled 184 cases of DSM-IV-TR diagnosed autistic disorder, 225 controls of unrelated healthy volunteers and 409 randomly selected controls from the community who lives in the adjacent geographical regions for this study. Two SNPs (rs1861972, rs1861973) at the EN2 gene that have been reported to be associated with autism underwent analysis among our studied cohorts. Both the UNPHASE and PHASE statistical programs were utilized for evaluating the association of EN2 SNPs with autism based on allelic and genotypic frequencies and haplotype compositions accompanied with the goodness-of-fit method of the chi(2) test. The gender difference was also investigated by using 2-side Fisher's exact test treated as a covariate in logistic regression analysis. Both the allelic and genotypic distributions of the 2 polymorphisms were concordant with Hardy-Weinberg equilibrium. Significant differences were found for cases versus community and overall controls. By using the UNPHASE and PHASE programs, the 2-marker haplotype A-C of EN2 was identified to have a protective effect for autism, indicating that the ethnic difference might confound the EN2 association with autism. Therefore, more EN2 gene association studies of Han Chinese populations are warranted to confirm this finding. 2008 S. Karger AG, Basel.

Development of 101 novel EST-derived single nucleotide polymorphism markers for Zhikong scallop ( Chlamys farreri)

NASA Astrophysics Data System (ADS)

Li, Jiqin; Bao, Zhenmin; Li, Ling; Wang, Xiaojian; Wang, Shi; Hu, Xiaoli

2013-09-01

Zhikong scallop ( Chlamys farreri) is an important maricultured species in China. Many researches on this species, such as population genetics and QTL fine-mapping, need a large number of molecular markers. In this study, based on the expressed sequence tags (EST), a total of 300 putative single nucleotide polymorphisms (SNPs) were selected and validated using high resolution melting (HRM) technology with unlabeled probe. Of them, 101 (33.7%) were found to be polymorphic in 48 individuals from 4 populations. Further evaluation with 48 individuals from Qingdao population showed that all the polymorphic loci had two alleles with the minor allele frequency ranged from 0.046 to 0.500. The observed and expected heterozygosities ranged from 0.000 to 0.925 and from 0.089 to 0.505, respectively. Fifteen loci deviated significantly from Hardy-Weinberg equilibrium and significant linkage disequilibrate was detected in one pair of markers. BLASTx gave significant hits for 72 of the 101 polymorphic SNP-containing ESTs. Thirty four polymorphic SNP loci were predicted to be non-synonymous substitutions as they caused either the change of codons (33 SNPs) or pretermination of translation (1 SNP). The markers developed can be used for the population studies and genetic improvement on Zhikong scallop.

[Identification of single nucleotide polymorphisms related to frailty].

PubMed

Inglés, Marta; Gimeno-Mallench, Lucia; Mas-Bargues, Cristina; Dromant, Mar; Cruz-Guerrero, Raquel; García-García, Francisco José; Rodríguez-Mañas, Leocadio; Gambini, Juan; Borrás, Consuelo; Viña, José

2018-04-07

The search for biomarkers that can lead to the early diagnosis and thus, early treatment of frailty, has become one of the main challenges facing the geriatric scientific community. The aim of the present study was to identify single nucleotide polymorphisms (SNPs) related to frailty. The study was conducted on 152 subjects from the Toledo Study for Healthy Aging (65 to 95 years of age), and classified as frail (n=78), and non-frail (n=74), according to Fried's criteria. After blood collection, DNA was isolated and amplified for the analysis of SNPs using Axiom TM Genotyping technology (Affymetrix). Statistical analyses were performed using the Plink program and library SNPassoc. The results of the study showed 15 SNPs with a P<.001. Those SNPs involved in processes related to frailty, such as energy metabolism, regulation of biological processes, cell motility and integrity, and cognition are highlighted. These results suggest that the genetic variations identified in frail individuals that are involved in biological processes related to frailty may be considered as biomarkers for the early detection of frailty. Copyright © 2018 SEGG. Publicado por Elsevier España, S.L.U. All rights reserved.

From Single Nucleotide Polymorphisms to Constant Immunosuppression: Mesenchymal Stem Cell Therapy for Autoimmune Diseases

PubMed Central

Galipeau, Jacques; Nooka, Ajay K.

2013-01-01

The regenerative abilities and the immunosuppressive properties of mesenchymal stromal cells (MSCs) make them potentially the ideal cellular product of choice for treatment of autoimmune and other immune mediated disorders. Although the usefulness of MSCs for therapeutic applications is in early phases, their potential clinical use remains of great interest. Current clinical evidence of use of MSCs from both autologous and allogeneic sources to treat autoimmune disorders confers conflicting clinical benefit outcomes. These varied results may possibly be due to MSC use across wide range of autoimmune disorders with clinical heterogeneity or due to variability of the cellular product. In the light of recent genome wide association studies (GWAS), linking predisposition of autoimmune diseases to single nucleotide polymorphisms (SNPs) in the susceptible genetic loci, the clinical relevance of MSCs possessing SNPs in the critical effector molecules of immunosuppression is largely undiscussed. It is of further interest in the allogeneic setting, where SNPs in the target pathway of MSC's intervention may also modulate clinical outcome. In the present review, we have discussed the known critical SNPs predisposing to disease susceptibility in various autoimmune diseases and their significance in the immunomodulatory properties of MSCs. PMID:24350294

Association study of IL10, IL1beta, and IL1RN and schizophrenia using tag SNPs from a comprehensive database: suggestive association with rs16944 at IL1beta.

PubMed

Shirts, Brian H; Wood, Joel; Yolken, Robert H; Nimgaonkar, Vishwajit L

2006-12-01

Genetic association studies of several candidate cytokine genes have been motivated by evidence of immune dysfunction among patients with schizophrenia. Intriguing but inconsistent associations have been reported with polymorphisms of three positional candidate genes, namely IL1beta, IL1RN, and IL10. We used comprehensive sequencing data from the Seattle SNPs database to select tag SNPs that represent all common polymorphisms in the Caucasian population at these loci. Associations with 28 tag SNPs were evaluated in 478 cases and 501 unscreened control individuals, while accounting for population sub-structure using the genomic control method. The samples were also stratified by gender, diagnostic category, and exposure to infectious agents. Significant association was not detected after correcting for multiple comparisons. However, meta-analysis of our data combined with previously published association studies of rs16944 (IL1beta -511) suggests that the C allele confers modest risk for schizophrenia among individuals reporting Caucasian ancestry, but not Asians (Caucasians, n=819 cases, 1292 controls; p=0.0013, OR=1.24, 95% CI 1.09, 1.41).

Impact of novel polymorphisms related to cytotoxicity of cytarabine in the induction treatment of acute myeloid leukemia.

PubMed

Megías-Vericat, Juan E; Montesinos, Pau; Herrero, María J; Moscardó, Federico; Bosó, Virginia; Martínez-Cuadrón, David; Poveda, José L; Sanz, Miguel Á; Aliño, Salvador F

2017-07-01

Several novel single nucleotide polymorphisms (SNPs) involved in cytarabine cytotoxicity and related to clinical outcomes have been reported recently in a series of 232 pediatric patients with acute myeloid leukemia (AML). We report the first adult AML cohort in which the influence of these SNPs in cytarabine efficacy and toxicity was analyzed. Six of polymorphisms with clinical significance in the previous study [rs12036333, rs10758713, rs9883101, rs6550826, IRX2: rs2897047, mutated in colorectal cancers (MCC): rs7729269] were analyzed in a cohort of 225 adult patients at initial diagnosis of AML treated with an induction scheme of idarubicin plus cytarabine. The variant alleles of rs12036333 and rs10758713 confirmed the previous associations with lower survival rates. The minor alleles of rs9883101 and rs6550826 were also related to lower survival, in concordance with higher cytarabine-induced cytotoxicity observed in pediatric patients. However, discordant findings between AML adult and pediatric population were observed with IRX2 rs2897047, showing higher survival in heterozygous genotype carriers. The heterozygous genotype of MCC rs7729269 was associated with higher cytarabine-induced toxicities (renal, hepatic, lung, skin toxicities), whereas lower time to thrombocytopenia recovery was associated with the MCC rs7729269 minor allele. This study confirms the influence in survival rates of these polymorphisms in an adult AML population. Novel associations between MCC SNPs and cytarabine toxicities were reported and should be validated in prospective studies involving larger groups of patients.

Association study of 21 circadian genes with bipolar I disorder, schizoaffective disorder, and schizophrenia

PubMed Central

Mansour, Hader A; Talkowski, Michael E; Wood, Joel; Chowdari, Kodavali V; McClain, Lora; Prasad, Konasale; Montrose, Debra; Fagiolini, Andrea; Friedman, Edward S; Allen, Michael H; Bowden, Charles L; Calabrese, Joseph; El-Mallakh, Rif S; Escamilla, Michael; Faraone, Stephen V; Fossey, Mark D; Gyulai, Laszlo; Loftis, Jennifer M; Hauser, Peter; Ketter, Terence A; Marangell, Lauren B; Miklowitz, David J; Nierenberg, Andrew A; Patel, Jayendra; Sachs, Gary S; Sklar, Pamela; Smoller, Jordan W; Laird, Nan; Keshavan, Matcheri; Thase, Michael E; Axelson, David; Birmaher, Boris; Lewis, David; Monk, Tim; Frank, Ellen; Kupfer, David J; Devlin, Bernie; Nimgaonkar, Vishwajit L

2012-01-01

Objective Published studies suggest associations between circadian gene polymorphisms and bipolar I disorder (BPI), as well as schizoaffective disorder (SZA) and schizophrenia (SZ). The results are plausible, based on prior studies of circadian abnormalities. As replications have not been attempted uniformly, we evaluated representative, common polymorphisms in all three disorders. Methods We assayed 276 publicly available ‘tag’ single nucleotide polymorphisms (SNPs) at 21 circadian genes among 523 patients with BPI, 527 patients with SZ/SZA, and 477 screened adult controls. Detected associations were evaluated in relation to two published genome-wide association studies (GWAS). Results Using gene-based tests, suggestive associations were noted between EGR3 and BPI (p = 0.017), and between NPAS2 and SZ/SZA (p = 0.034). Three SNPs were associated with both sets of disorders (NPAS2: rs13025524 and rs11123857; RORB: rs10491929; p < 0.05). None of the associations remained significant following corrections for multiple comparisons. Approximately 15% of the analyzed SNPs overlapped with an independent study that conducted GWAS for BPI; suggestive overlap between the GWAS analyses and ours was noted at ARNTL. Conclusions Several suggestive, novel associations were detected with circadian genes and BPI and SZ/SZA, but the present analyses do not support associations with common polymorphisms that confer risk with odds ratios greater than 1.5. Additional analyses using adequately powered samples are warranted to further evaluate these results. PMID:19839995

Genetic Diversity and Demographic History of Cajanus spp. Illustrated from Genome-Wide SNPs

PubMed Central

Saxena, Rachit K.; von Wettberg, Eric; Upadhyaya, Hari D.; Sanchez, Vanessa; Songok, Serah; Saxena, Kulbhushan; Kimurto, Paul; Varshney, Rajeev K.

2014-01-01

Understanding genetic structure of Cajanus spp. is essential for achieving genetic improvement by quantitative trait loci (QTL) mapping or association studies and use of selected markers through genomic assisted breeding and genomic selection. After developing a comprehensive set of 1,616 single nucleotide polymorphism (SNPs) and their conversion into cost effective KASPar assays for pigeonpea (Cajanus cajan), we studied levels of genetic variability both within and between diverse set of Cajanus lines including 56 breeding lines, 21 landraces and 107 accessions from 18 wild species. These results revealed a high frequency of polymorphic SNPs and relatively high level of cross-species transferability. Indeed, 75.8% of successful SNP assays revealed polymorphism, and more than 95% of these assays could be successfully transferred to related wild species. To show regional patterns of variation, we used STRUCTURE and Analysis of Molecular Variance (AMOVA) to partition variance among hierarchical sets of landraces and wild species at either the continental scale or within India. STRUCTURE separated most of the domesticated germplasm from wild ecotypes, and separates Australian and Asian wild species as has been found previously. Among Indian regions and states within regions, we found 36% of the variation between regions, and 64% within landraces or wilds within states. The highest level of polymorphism in wild relatives and landraces was found in Madhya Pradesh and Andhra Pradesh provinces of India representing the centre of origin and domestication of pigeonpea respectively. PMID:24533111

Single-nucleotide polymorphisms in Toll-like receptor (TLR)-2, TLR4 and heat shock protein 70 genes and susceptibility to scrub typhus.

PubMed

Janardhanan, Jeshina; Joseph Martin, Sherry; Astrup, Elisabeth; Veeramanikandan, R; Aukrust, Pål; Abraham, Ooriapadickal C; Varghese, George M

2013-11-01

Scrub typhus is a highly prevalent bacterial infection in India and South Asia that is caused by Orientia tsutsugamushi. The innate immune response to infections is modulated by Toll-like receptors (TLRs) and heat shock proteins (HSPs). This study was done to assess the prevalence and possible association of TLR and HSP polymorphisms in scrub typhus. TLR4 Asp299Gly, TLR4 Thr399Ile, TLR2 Arg753Gln and HSP70-2 A1267G are single-nucleotide polymorphisms (SNPs) that may modulate their activities, and these SNPs were assessed in 137 scrub typhus patients and 134 controls by PCR restriction fragment length polymorphism. We found that the two TLR4 mutations, TLR4 D299G and TLR4T399I, were present in 19.5% and 22% of the study population, respectively, and was in significant linkage disequilibrium with a D' of 0.8. The TLR2 mutation was found to be rare, whereas the HSP A>G mutation was very common (77.5%). Compared with the controls, the prevalence of heterozygous genotype of the TLR4D299G SNP, but not any of the other SNPs, was significantly higher among scrub typhus patients. Further studies using a larger sample size and more candidate genes may better enable in determining the role of these associations in susceptibility and severity of scrub typhus.

Investigation of -308G>A and -1031T>C polymorphisms in the TNFA promoter region in Polish peptic ulcer patients.

PubMed

Sałagacka, Aleksandra; Żebrowska, Marta; Jeleń, Agnieszka; Mirowski, Marek; Balcerczak, Ewa

2014-11-01

Tumor necrosis factor α (TNF-α) encoded by TNFA is a key mediator in inflammation, a precursor condition for peptic ulceration. Promoter polymorphisms of TNFA that influence its transcriptional activity and TNF-α production are known. TNFA-308G>A (rs1800629) and TNFA-1031T>C (rs1799964), which are responsible for increased TNFA transcription, could influence the risk of peptic ulceration. This study aimed to investigate these polymorphisms and to evaluate their association with peptic ulcer disease and Helicobacter pylori infection in the Polish population. Gastric mucosa specimens obtained from 177 Polish peptic ulcer patients were used to conduct rapid urease tests and to assess the investigated polymorphisms by polymerase chain reaction-restriction fragment length polymorphism. Genotyping data were compared with the results obtained from healthy individuals of Polish origin. There were no significant differences in genotype and allele frequency of the investigated polymorphisms between peptic ulcer patients and healthy individuals. No associations between the frequencies of particular genotypes and alleles for both single-nucleotide polymorphisms (SNPs) and the presence of H. pylori infection in peptic ulcer patients and in subgroups of men and women with peptic ulcer disease were found. The investigated SNPs are not risk factors for either peptic ulcer or H. pylori infection development in the Polish population. The results require verification in a larger cohort.

Blocks of limited haplotype diversity revealed by high-resolution scanning of human chromosome 21.

PubMed

Patil, N; Berno, A J; Hinds, D A; Barrett, W A; Doshi, J M; Hacker, C R; Kautzer, C R; Lee, D H; Marjoribanks, C; McDonough, D P; Nguyen, B T; Norris, M C; Sheehan, J B; Shen, N; Stern, D; Stokowski, R P; Thomas, D J; Trulson, M O; Vyas, K R; Frazer, K A; Fodor, S P; Cox, D R

2001-11-23

Global patterns of human DNA sequence variation (haplotypes) defined by common single nucleotide polymorphisms (SNPs) have important implications for identifying disease associations and human traits. We have used high-density oligonucleotide arrays, in combination with somatic cell genetics, to identify a large fraction of all common human chromosome 21 SNPs and to directly observe the haplotype structure defined by these SNPs. This structure reveals blocks of limited haplotype diversity in which more than 80% of a global human sample can typically be characterized by only three common haplotypes.

LS-SNP: large-scale annotation of coding non-synonymous SNPs based on multiple information sources.

PubMed

Karchin, Rachel; Diekhans, Mark; Kelly, Libusha; Thomas, Daryl J; Pieper, Ursula; Eswar, Narayanan; Haussler, David; Sali, Andrej

2005-06-15

The NCBI dbSNP database lists over 9 million single nucleotide polymorphisms (SNPs) in the human genome, but currently contains limited annotation information. SNPs that result in amino acid residue changes (nsSNPs) are of critical importance in variation between individuals, including disease and drug sensitivity. We have developed LS-SNP, a genomic scale software pipeline to annotate nsSNPs. LS-SNP comprehensively maps nsSNPs onto protein sequences, functional pathways and comparative protein structure models, and predicts positions where nsSNPs destabilize proteins, interfere with the formation of domain-domain interfaces, have an effect on protein-ligand binding or severely impact human health. It currently annotates 28,043 validated SNPs that produce amino acid residue substitutions in human proteins from the SwissProt/TrEMBL database. Annotations can be viewed via a web interface either in the context of a genomic region or by selecting sets of SNPs, genes, proteins or pathways. These results are useful for identifying candidate functional SNPs within a gene, haplotype or pathway and in probing molecular mechanisms responsible for functional impacts of nsSNPs. http://www.salilab.org/LS-SNP CONTACT: rachelk@salilab.org http://salilab.org/LS-SNP/supp-info.pdf.